WorldWideScience

Sample records for ribosomes reveals spatial

  1. In vivo labelling of functional ribosomes reveals spatial regulation during starvation in Podospora anserina

    Directory of Open Access Journals (Sweden)

    Silar Philippe

    2000-11-01

    Full Text Available Abstract Background To date, in eukaryotes, ribosomal protein expression is known to be regulated at the transcriptional and/or translational levels. But other forms of regulation may be possible. Results Here, we report the successful tagging of functional ribosomal particles with a S7-GFP chimaeric protein, making it possible to observe in vivo ribosome dynamics in the filamentous fungus Podospora anserina. Microscopic observations revealed a novel kind of ribosomal protein regulation during the passage between cell growth and stationary phases, with a transient accumulation of ribosomal proteins and/or ribosome subunits in the nucleus, possibly the nucleolus, being observed at the beginning of stationary phase. Conclusion Nuclear sequestration can be another level of ribosomal protein regulation in eukaryotic cells.This may contribute to the regulation of cell growth and division.

  2. In vivo labelling of functional ribosomes reveals spatial regulation during starvation in Podospora anserina

    Science.gov (United States)

    Lalucque, Hervé; Silar, Philippe

    2000-01-01

    Background To date, in eukaryotes, ribosomal protein expression is known to be regulated at the transcriptional and/or translational levels. But other forms of regulation may be possible. Results Here, we report the successful tagging of functional ribosomal particles with a S7-GFP chimaeric protein, making it possible to observe in vivo ribosome dynamics in the filamentous fungus Podospora anserina. Microscopic observations revealed a novel kind of ribosomal protein regulation during the passage between cell growth and stationary phases, with a transient accumulation of ribosomal proteins and/or ribosome subunits in the nucleus, possibly the nucleolus, being observed at the beginning of stationary phase. Conclusion Nuclear sequestration can be another level of ribosomal protein regulation in eukaryotic cells.This may contribute to the regulation of cell growth and division. PMID:11112985

  3. Ribosomal history reveals origins of modern protein synthesis.

    Directory of Open Access Journals (Sweden)

    Ajith Harish

    Full Text Available The origin and evolution of the ribosome is central to our understanding of the cellular world. Most hypotheses posit that the ribosome originated in the peptidyl transferase center of the large ribosomal subunit. However, these proposals do not link protein synthesis to RNA recognition and do not use a phylogenetic comparative framework to study ribosomal evolution. Here we infer evolution of the structural components of the ribosome. Phylogenetic methods widely used in morphometrics are applied directly to RNA structures of thousands of molecules and to a census of protein structures in hundreds of genomes. We find that components of the small subunit involved in ribosomal processivity evolved earlier than the catalytic peptidyl transferase center responsible for protein synthesis. Remarkably, subunit RNA and proteins coevolved, starting with interactions between the oldest proteins (S12 and S17 and the oldest substructure (the ribosomal ratchet in the small subunit and ending with the rise of a modern multi-subunit ribosome. Ancestral ribonucleoprotein components show similarities to in vitro evolved RNA replicase ribozymes and protein structures in extant replication machinery. Our study therefore provides important clues about the chicken-or-egg dilemma associated with the central dogma of molecular biology by showing that ribosomal history is driven by the gradual structural accretion of protein and RNA structures. Most importantly, results suggest that functionally important and conserved regions of the ribosome were recruited and could be relics of an ancient ribonucleoprotein world.

  4. Multi-perspective smFRET reveals rate-determining late intermediates of ribosomal translocation

    Science.gov (United States)

    Wasserman, Michael R.; Alejo, Jose L.; Altman, Roger B.; Blanchard, Scott C.

    2016-01-01

    Directional translocation of the ribosome through the messenger RNA open reading frame is a critical determinant of translational fidelity. This process entails a complex interplay of large-scale conformational changes within the actively translating particle, which together coordinate the movement of transfer and messenger RNA substrates with respect to the large and small ribosomal subunits. Using pre-steady state, single-molecule fluorescence resonance energy transfer imaging, we have tracked the nature and timing of these conformational events within the Escherichia coli ribosome from five structural perspectives. Our investigations reveal direct evidence of structurally and kinetically distinct, late intermediates during substrate movement, whose resolution is rate-determining to the translocation mechanism. These steps involve intra-molecular events within the EFG(GDP)-bound ribosome, including exaggerated, reversible fluctuations of the small subunit head domain, which ultimately facilitate peptidyl-tRNA’s movement into its final post-translocation position. PMID:26926435

  5. Multiperspective smFRET reveals rate-determining late intermediates of ribosomal translocation.

    Science.gov (United States)

    Wasserman, Michael R; Alejo, Jose L; Altman, Roger B; Blanchard, Scott C

    2016-04-01

    Directional translocation of the ribosome through the mRNA open reading frame is a critical determinant of translational fidelity. This process entails a complex interplay of large-scale conformational changes within the actively translating particle, which together coordinate the movement of tRNA and mRNA substrates with respect to the large and small ribosomal subunits. Using pre-steady state, single-molecule fluorescence resonance energy transfer imaging, we tracked the nature and timing of these conformational events within the Escherichia coli ribosome from five structural perspectives. Our investigations revealed direct evidence of structurally and kinetically distinct late intermediates during substrate movement, whose resolution determines the rate of translocation. These steps involve intramolecular events within the EF-G-GDP-bound ribosome, including exaggerated, reversible fluctuations of the small-subunit head domain, which ultimately facilitate peptidyl-tRNA's movement into its final post-translocation position.

  6. Revealing −1 Programmed Ribosomal Frameshifting Mechanisms by Single-Molecule Techniques and Computational Methods

    Directory of Open Access Journals (Sweden)

    Kai-Chun Chang

    2012-01-01

    Full Text Available Programmed ribosomal frameshifting (PRF serves as an intrinsic translational regulation mechanism employed by some viruses to control the ratio between structural and enzymatic proteins. Most viral mRNAs which use PRF adapt an H-type pseudoknot to stimulate −1 PRF. The relationship between the thermodynamic stability and the frameshifting efficiency of pseudoknots has not been fully understood. Recently, single-molecule force spectroscopy has revealed that the frequency of −1 PRF correlates with the unwinding forces required for disrupting pseudoknots, and that some of the unwinding work dissipates irreversibly due to the torsional restraint of pseudoknots. Complementary to single-molecule techniques, computational modeling provides insights into global motions of the ribosome, whose structural transitions during frameshifting have not yet been elucidated in atomic detail. Taken together, recent advances in biophysical tools may help to develop antiviral therapies that target the ubiquitous −1 PRF mechanism among viruses.

  7. Understanding Biases in Ribosome Profiling Experiments Reveals Signatures of Translation Dynamics in Yeast.

    Directory of Open Access Journals (Sweden)

    Jeffrey A Hussmann

    2015-12-01

    Full Text Available Ribosome profiling produces snapshots of the locations of actively translating ribosomes on messenger RNAs. These snapshots can be used to make inferences about translation dynamics. Recent ribosome profiling studies in yeast, however, have reached contradictory conclusions regarding the average translation rate of each codon. Some experiments have used cycloheximide (CHX to stabilize ribosomes before measuring their positions, and these studies all counterintuitively report a weak negative correlation between the translation rate of a codon and the abundance of its cognate tRNA. In contrast, some experiments performed without CHX report strong positive correlations. To explain this contradiction, we identify unexpected patterns in ribosome density downstream of each type of codon in experiments that use CHX. These patterns are evidence that elongation continues to occur in the presence of CHX but with dramatically altered codon-specific elongation rates. The measured positions of ribosomes in these experiments therefore do not reflect the amounts of time ribosomes spend at each position in vivo. These results suggest that conclusions from experiments in yeast using CHX may need reexamination. In particular, we show that in all such experiments, codons decoded by less abundant tRNAs were in fact being translated more slowly before the addition of CHX disrupted these dynamics.

  8. Ribosome Profiling Reveals Pervasive Translation Outside of Annotated Protein-Coding Genes

    Directory of Open Access Journals (Sweden)

    Nicholas T. Ingolia

    2014-09-01

    Full Text Available Ribosome profiling suggests that ribosomes occupy many regions of the transcriptome thought to be noncoding, including 5′ UTRs and long noncoding RNAs (lncRNAs. Apparent ribosome footprints outside of protein-coding regions raise the possibility of artifacts unrelated to translation, particularly when they occupy multiple, overlapping open reading frames (ORFs. Here, we show hallmarks of translation in these footprints: copurification with the large ribosomal subunit, response to drugs targeting elongation, trinucleotide periodicity, and initiation at early AUGs. We develop a metric for distinguishing between 80S footprints and nonribosomal sources using footprint size distributions, which validates the vast majority of footprints outside of coding regions. We present evidence for polypeptide production beyond annotated genes, including the induction of immune responses following human cytomegalovirus (HCMV infection. Translation is pervasive on cytosolic transcripts outside of conserved reading frames, and direct detection of this expanded universe of translated products enables efforts at understanding how cells manage and exploit its consequences.

  9. A Deconvolution Protocol for ChIP-Seq Reveals Analogous Enhancer Structures on the Mouse and Human Ribosomal RNA Genes

    Directory of Open Access Journals (Sweden)

    Jean-Clement Mars

    2018-01-01

    Full Text Available The combination of Chromatin Immunoprecipitation and Massively Parallel Sequencing, or ChIP-Seq, has greatly advanced our genome-wide understanding of chromatin and enhancer structures. However, its resolution at any given genetic locus is limited by several factors. In applying ChIP-Seq to the study of the ribosomal RNA genes, we found that a major limitation to resolution was imposed by the underlying variability in sequence coverage that very often dominates the protein–DNA interaction profiles. Here, we describe a simple numerical deconvolution approach that, in large part, corrects for this variability, and significantly improves both the resolution and quantitation of protein–DNA interaction maps deduced from ChIP-Seq data. This approach has allowed us to determine the in vivo organization of the RNA polymerase I preinitiation complexes that form at the promoters and enhancers of the mouse (Mus musculus and human (Homo sapiens ribosomal RNA genes, and to reveal a phased binding of the HMG-box factor UBF across the rDNA. The data identify and map a “Spacer Promoter” and associated stalled polymerase in the intergenic spacer of the human ribosomal RNA genes, and reveal a very similar enhancer structure to that found in rodents and lower vertebrates.

  10. A Portrait of Ribosomal DNA Contacts with Hi-C Reveals 5S and 45S rDNA Anchoring Points in the Folded Human Genome.

    Science.gov (United States)

    Yu, Shoukai; Lemos, Bernardo

    2016-12-31

    Ribosomal RNAs (rRNAs) account for >60% of all RNAs in eukaryotic cells and are encoded in the ribosomal DNA (rDNA) arrays. The rRNAs are produced from two sets of loci: the 5S rDNA array resides exclusively on human chromosome 1, whereas the 45S rDNA array resides on the short arm of five human acrocentric chromosomes. The 45S rDNA gives origin to the nucleolus, the nuclear organelle that is the site of ribosome biogenesis. Intriguingly, 5S and 45S rDNA arrays exhibit correlated copy number variation in lymphoblastoid cells (LCLs). Here we examined the genomic architecture and repeat content of the 5S and 45S rDNA arrays in multiple human genome assemblies (including PacBio MHAP assembly) and ascertained contacts between the rDNA arrays and the rest of the genome using Hi-C datasets from two human cell lines (erythroleukemia K562 and lymphoblastoid cells). Our analyses revealed that 5S and 45S arrays each have thousands of contacts in the folded genome, with rDNA-associated regions and genes dispersed across all chromosomes. The rDNA contact map displayed conserved and disparate features between two cell lines, and pointed to specific chromosomes, genomic regions, and genes with evidence of spatial proximity to the rDNA arrays; the data also showed a lack of direct physical interaction between the 5S and 45S rDNA arrays. Finally, the analysis identified an intriguing organization in the 5S array with Alu and 5S elements adjacent to one another and organized in opposite orientation along the array. Portraits of genome folding centered on the ribosomal DNA array could help understand the emergence of concerted variation, the control of 5S and 45S expression, as well as provide insights into an organelle that contributes to the spatial localization of human chromosomes during interphase. © The Author(s) 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  11. Genetic and epigenetic variation in 5S ribosomal RNA genes reveals genome dynamics in Arabidopsis thaliana.

    Science.gov (United States)

    Simon, Lauriane; Rabanal, Fernando A; Dubos, Tristan; Oliver, Cecilia; Lauber, Damien; Poulet, Axel; Vogt, Alexander; Mandlbauer, Ariane; Le Goff, Samuel; Sommer, Andreas; Duborjal, Hervé; Tatout, Christophe; Probst, Aline V

    2018-04-06

    Organized in tandem repeat arrays in most eukaryotes and transcribed by RNA polymerase III, expression of 5S rRNA genes is under epigenetic control. To unveil mechanisms of transcriptional regulation, we obtained here in depth sequence information on 5S rRNA genes from the Arabidopsis thaliana genome and identified differential enrichment in epigenetic marks between the three 5S rDNA loci situated on chromosomes 3, 4 and 5. We reveal the chromosome 5 locus as the major source of an atypical, long 5S rRNA transcript characteristic of an open chromatin structure. 5S rRNA genes from this locus translocated in the Landsberg erecta ecotype as shown by linkage mapping and chromosome-specific FISH analysis. These variations in 5S rDNA locus organization cause changes in the spatial arrangement of chromosomes in the nucleus. Furthermore, 5S rRNA gene arrangements are highly dynamic with alterations in chromosomal positions through translocations in certain mutants of the RNA-directed DNA methylation pathway and important copy number variations among ecotypes. Finally, variations in 5S rRNA gene sequence, chromatin organization and transcripts indicate differential usage of 5S rDNA loci in distinct ecotypes. We suggest that both the usage of existing and new 5S rDNA loci resulting from translocations may impact neighboring chromatin organization.

  12. Small subunit ribosomal metabarcoding reveals extraordinary trypanosomatid diversity in Brazilian bats.

    Directory of Open Access Journals (Sweden)

    Maria Augusta Dario

    2017-07-01

    Full Text Available Bats are a highly successful, globally dispersed order of mammals that occupy a wide array of ecological niches. They are also intensely parasitized and implicated in multiple viral, bacterial and parasitic zoonoses. Trypanosomes are thought to be especially abundant and diverse in bats. In this study, we used 18S ribosomal RNA metabarcoding to probe bat trypanosome diversity in unprecedented detail.Total DNA was extracted from the blood of 90 bat individuals (17 species captured along Atlantic Forest fragments of Espírito Santo state, southeast Brazil. 18S ribosomal RNA was amplified by standard and/or nested PCR, then deep sequenced to recover and identify Operational Taxonomic Units (OTUs for phylogenetic analysis. Blood samples from 34 bat individuals (13 species tested positive for infection by 18S rRNA amplification. Amplicon sequences clustered to 14 OTUs, of which five were identified as Trypanosoma cruzi I, T. cruzi III/V, Trypanosoma cruzi marinkellei, Trypanosoma rangeli, and Trypanosoma dionisii, and seven were identified as novel genotypes monophyletic to basal T. cruzi clade types of the New World. Another OTU was identified as a trypanosome like those found in reptiles. Surprisingly, the remaining OTU was identified as Bodo saltans-closest non-parasitic relative of the trypanosomatid order. While three blood samples featured just one OTU (T. dionisii, all others resolved as mixed infections of up to eight OTUs.This study demonstrates the utility of next-generation barcoding methods to screen parasite diversity in mammalian reservoir hosts. We exposed high rates of local bat parasitism by multiple trypanosome species, some known to cause fatal human disease, others non-pathogenic, novel or yet little understood. Our results highlight bats as a long-standing nexus among host-parasite interactions of multiple niches, sustained in part by opportunistic and incidental infections of consequence to evolutionary theory as much as to

  13. Revealing stable processing products from ribosome-associated small RNAs by deep-sequencing data analysis.

    Science.gov (United States)

    Zywicki, Marek; Bakowska-Zywicka, Kamilla; Polacek, Norbert

    2012-05-01

    The exploration of the non-protein-coding RNA (ncRNA) transcriptome is currently focused on profiling of microRNA expression and detection of novel ncRNA transcription units. However, recent studies suggest that RNA processing can be a multi-layer process leading to the generation of ncRNAs of diverse functions from a single primary transcript. Up to date no methodology has been presented to distinguish stable functional RNA species from rapidly degraded side products of nucleases. Thus the correct assessment of widespread RNA processing events is one of the major obstacles in transcriptome research. Here, we present a novel automated computational pipeline, named APART, providing a complete workflow for the reliable detection of RNA processing products from next-generation-sequencing data. The major features include efficient handling of non-unique reads, detection of novel stable ncRNA transcripts and processing products and annotation of known transcripts based on multiple sources of information. To disclose the potential of APART, we have analyzed a cDNA library derived from small ribosome-associated RNAs in Saccharomyces cerevisiae. By employing the APART pipeline, we were able to detect and confirm by independent experimental methods multiple novel stable RNA molecules differentially processed from well known ncRNAs, like rRNAs, tRNAs or snoRNAs, in a stress-dependent manner.

  14. Dual binding mode of the nascent polypeptide-associated complex reveals a novel universal adapter site on the ribosome.

    Science.gov (United States)

    Pech, Markus; Spreter, Thomas; Beckmann, Roland; Beatrix, Birgitta

    2010-06-18

    Nascent polypeptide-associated complex (NAC) was identified in eukaryotes as the first cytosolic factor that contacts the nascent polypeptide chain emerging from the ribosome. NAC is present as a homodimer in archaea and as a highly conserved heterodimer in eukaryotes. Mutations in NAC cause severe embryonically lethal phenotypes in mice, Drosophila melanogaster, and Caenorhabditis elegans. In the yeast Saccharomyces cerevisiae NAC is quantitatively associated with ribosomes. Here we show that NAC contacts several ribosomal proteins. The N terminus of betaNAC, however, specifically contacts near the tunnel exit ribosomal protein Rpl31, which is unique to eukaryotes and archaea. Moreover, the first 23 amino acids of betaNAC are sufficient to direct an otherwise non-associated protein to the ribosome. In contrast, alphaNAC (Egd2p) contacts Rpl17, the direct neighbor of Rpl31 at the ribosomal tunnel exit site. Rpl31 was also recently identified as a contact site for the SRP receptor and the ribosome-associated complex. Furthermore, in Escherichia coli peptide deformylase (PDF) interacts with the corresponding surface area on the eubacterial ribosome. In addition to the previously identified universal adapter site represented by Rpl25/Rpl35, we therefore refer to Rpl31/Rpl17 as a novel universal docking site for ribosome-associated factors on the eukaryotic ribosome.

  15. Expression Profiling of Ribosome Biogenesis Factors Reveals Nucleolin as a Novel Potential Marker to Predict Outcome in AML Patients.

    Directory of Open Access Journals (Sweden)

    Virginie Marcel

    Full Text Available Acute myeloid leukemia (AML is a heterogeneous disease. Prognosis is mainly influenced by patient age at diagnosis and cytogenetic alterations, two of the main factors currently used in AML patient risk stratification. However, additional criteria are required to improve the current risk classification and better adapt patient care. In neoplastic cells, ribosome biogenesis is increased to sustain the high proliferation rate and ribosome composition is altered to modulate specific gene expression driving tumorigenesis. Here, we investigated the usage of ribosome biogenesis factors as clinical markers in adult patients with AML. We showed that nucleoli, the nucleus compartments where ribosome production takes place, are modified in AML by analyzing a panel of AML and healthy donor cells using immunofluorescence staining. Using four AML series, including the TCGA dataset, altogether representing a total of about 270 samples, we showed that not all factors involved in ribosome biogenesis have clinical values although ribosome biogenesis is increased in AML. Interestingly, we identified the regulator of ribosome production nucleolin (NCL as over-expressed in AML blasts. Moreover, we found in two series that high NCL mRNA expression level was associated with a poor overall survival, particular in elderly patients. Multivariate analyses taking into account age and cytogenetic risk indicated that NCL expression in blast cells is an independent marker of reduced survival. Our study identifies NCL as a potential novel prognostic factor in AML. Altogether, our results suggest that the ribosome biogenesis pathway may be of interest as clinical markers in AML.

  16. Genome-wide mRNA processing in methanogenic archaea reveals post-transcriptional regulation of ribosomal protein synthesis.

    Science.gov (United States)

    Qi, Lei; Yue, Lei; Feng, Deqin; Qi, Fengxia; Li, Jie; Dong, Xiuzhu

    2017-07-07

    Unlike stable RNAs that require processing for maturation, prokaryotic cellular mRNAs generally follow an 'all-or-none' pattern. Herein, we used a 5΄ monophosphate transcript sequencing (5΄P-seq) that specifically captured the 5΄-end of processed transcripts and mapped the genome-wide RNA processing sites (PSSs) in a methanogenic archaeon. Following statistical analysis and stringent filtration, we identified 1429 PSSs, among which 23.5% and 5.4% were located in 5΄ untranslated region (uPSS) and intergenic region (iPSS), respectively. A predominant uridine downstream PSSs served as a processing signature. Remarkably, 5΄P-seq detected overrepresented uPSS and iPSS in the polycistronic operons encoding ribosomal proteins, and the majority upstream and proximal ribosome binding sites, suggesting a regulatory role of processing on translation initiation. The processed transcripts showed increased stability and translation efficiency. Particularly, processing within the tricistronic transcript of rplA-rplJ-rplL enhanced the translation of rplL, which can provide a driving force for the 1:4 stoichiometry of L10 to L12 in the ribosome. Growth-associated mRNA processing intensities were also correlated with the cellular ribosomal protein levels, thereby suggesting that mRNA processing is involved in tuning growth-dependent ribosome synthesis. In conclusion, our findings suggest that mRNA processing-mediated post-transcriptional regulation is a potential mechanism of ribosomal protein synthesis and stoichiometry. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  17. Structural and functional implications in the eubacterial ribosome as revealed by protein-rRNA and antibiotic contact sites.

    Science.gov (United States)

    Wittmann-Liebold, B; Uhlein, M; Urlaub, H; Müller, E C; Otto, A; Bischof, O

    1995-01-01

    Contact sites between protein and rRNA in 30S and 50S ribosomal subunits of Escherichia coli and Bacillus stearothermophilus were investigated at the molecular level using UV and 2-iminothiolane as cross-linkers. Thirteen ribosomal proteins (S3, S4, S7, S14, S17, L2, L4, L6, L14, L27, L28, L29, and L36) from these organisms were cross-linked in direct contact with the RNAs, and the peptide stretches as well as amino acids involved were identified. Further, the binding sites of puromycin and spiramycin were established at the peptide level in several proteins that were found to constitute the antibiotic-binding sites. Peptide stretches of puromycin binding were identified from proteins S7, S14, S18, L18, AND L29; those of spiramycin attachment were derived from proteins S12, S14, L17, L18, L27, and L35. Comparison of the RNA-peptide contact sites with the peptides identified for antibiotic binding and with those altered in antibiotic-resistant mutants clearly showed identical peptide areas to be involved and, hence, demonstrated the functional importance of these peptides. Further evidence for a functional implication of ribosomal proteins in the translational process came from complementation experiments in which protein L2 from Halobacterium marismortui was incorporated into the E. coli ribosomes that were active. The incorporated protein was present in 50S subunits and 70S particles, in disomes, and in higher polysomes. These results clearly demonstrate the functional implication of protein L2 in protein biosynthesis. Incorporation studies with a mutant of HmaL2 with a replacement of histidine-229 by glycine completely abolished the functional activity of the ribosome. Accordingly, protein L2 with histidine-229 is a crucial element of the translational machinery.

  18. Spatial Congruity Effects Reveal Metaphorical Thinking, not Polarity Correspondence.

    Science.gov (United States)

    Dolscheid, Sarah; Casasanto, Daniel

    2015-01-01

    Spatial congruity effects have often been interpreted as evidence for metaphorical thinking, but an alternative account based on polarity correspondence (a.k.a. markedness) has challenged this view. Here we compared metaphor- and polarity-correspondence-based explanations for spatial congruity effects, using musical pitch as a testbed. In one experiment, English speakers classified high- and low-frequency pitches as "high" and "low," or as "front" and "back," to determine whether space-pitch congruity effects could be elicited by any marked spatial continuum. Although both pairs of terms describe bipolar spatial continuums, we found congruity effects only for high/low judgments, indicating that markedness is not sufficient to produce space-pitch congruity effects. A second experiment confirmed that there were no space-pitch congruity effects for another pair of terms that have clear markedness (big/small), but which do not denote spatial height. By contrast, this experiment showed congruity effects for words that cued an appropriate vertical spatial schema (tall/short), even though these words are not used conventionally in English to describe pitches, ruling out explanations for the observed pattern of results based on verbal polysemy. Together, results suggest that space-pitch congruity effects reveal metaphorical uses of spatial schemas, not polarity correspondence effects.

  19. Spatial congruity effects reveal metaphorical thinking, not polarity correspondence

    Directory of Open Access Journals (Sweden)

    Sarah eDolscheid

    2015-11-01

    Full Text Available Spatial congruity effects have often been interpreted as evidence for metaphorical thinking, but an alternative account based on polarity correspondence (a.k.a. markedness has challenged this view. Here we compared metaphor- and polarity-correspondence-based explanations for spatial congruity effects, using musical pitch as a testbed. In one experiment, English speakers classified high- and low-frequency pitches as high and low, or as front and back, to determine whether space-pitch congruity effects could be elicited by any marked spatial continuum. Although both pairs of terms describe bipolar spatial continuums, we found congruity effects only for high/low judgments, indicating that markedness is not sufficient to produce space-pitch congruity effects. A second experiment confirmed that there were no space-pitch congruity effects for another pair of terms that have clear markedness (big/small, but which do not denote spatial height. By contrast, this experiment showed congruity effects for words that cued an appropriate vertical spatial schema (tall/short, even though these words are not used conventionally in English to describe pitches, ruling out explanations for the observed pattern of results based on verbal polysemy. Together, results suggest that space-pitch congruity effects reveal metaphorical uses of spatial schemas, not polarity correspondence effects.

  20. Compact structure of ribosomal protein S4 in solution as revealed by small-angle X-ray scattering

    International Nuclear Information System (INIS)

    Serdyuk, I.N.; Sarkisyan, M.A.; Gogia, Z.V.

    1981-01-01

    The authors report the results of a small-angle X-ray scattering study of ribosomal protein preparations obtained by neutron scattering method. The theoretical resolution of the diffractometer (Kratky camera, the entrance slit 80 μm, the receiving slit 190 μm, the sample-detector distance 20.4 cm) was the same as the resolution of X-ray diffractometers, on which high rsub(g) values for ribosomal proteins were obtained. They used protein S4 adjusted to 20 mg/ml without any essential loss of solubility. The scattering indicatrix obtained in a wide range of angles has demonstrated that the X-ray rsub(g) obtained here coincides with the earlier obtained neutron rsub(g) and the outer part of the scattering curve is similar to that of slightly elongated compact bodies. They conclude that all discrepancies between their data on the study of ribosomal protein structure in solution and other data are not connected with the characteristics of the instruments used but only with the quality of the protein preparations. (Auth.)

  1. Engineered ribosomal RNA operon copy-number variants of E. coli reveal the evolutionary trade-offs shaping rRNA operon number

    Science.gov (United States)

    Gyorfy, Zsuzsanna; Draskovits, Gabor; Vernyik, Viktor; Blattner, Frederick F.; Gaal, Tamas; Posfai, Gyorgy

    2015-01-01

    Ribosomal RNA (rrn) operons, characteristically present in several copies in bacterial genomes (7 in E. coli), play a central role in cellular physiology. We investigated the factors determining the optimal number of rrn operons in E. coli by constructing isogenic variants with 5–10 operons. We found that the total RNA and protein content, as well as the size of the cells reflected the number of rrn operons. While growth parameters showed only minor differences, competition experiments revealed a clear pattern: 7–8 copies were optimal under conditions of fluctuating, occasionally rich nutrient influx and lower numbers were favored in stable, nutrient-limited environments. We found that the advantages of quick adjustment to nutrient availability, rapid growth and economic regulation of ribosome number all contribute to the selection of the optimal rrn operon number. Our results suggest that the wt rrn operon number of E. coli reflects the natural, ‘feast and famine’ life-style of the bacterium, however, different copy numbers might be beneficial under different environmental conditions. Understanding the impact of the copy number of rrn operons on the fitness of the cell is an important step towards the creation of functional and robust genomes, the ultimate goal of synthetic biology. PMID:25618851

  2. On the Spatial Organization of mRNA, Plasmids, and Ribosomes in a Bacterial Host Overexpressing Membrane Proteins.

    Directory of Open Access Journals (Sweden)

    Lieke A van Gijtenbeek

    2016-12-01

    Full Text Available By using fluorescence imaging, we provide a time-resolved single-cell view on coupled defects in transcription, translation, and growth during expression of heterologous membrane proteins in Lactococcus lactis. Transcripts encoding poorly produced membrane proteins accumulate in mRNA-dense bodies at the cell poles, whereas transcripts of a well-expressed homologous membrane protein show membrane-proximal localization in a translation-dependent fashion. The presence of the aberrant polar mRNA foci correlates with cessation of cell division, which is restored once these bodies are cleared. In addition, activation of the heat-shock response and a loss of nucleoid-occluded ribosomes are observed. We show that the presence of a native-like N-terminal domain is key to SRP-dependent membrane localization and successful production of membrane proteins. The work presented gives new insights and detailed understanding of aberrant membrane protein biogenesis, which can be used for strategies to optimize membrane protein production.

  3. Competing sound sources reveal spatial effects in cortical processing.

    Directory of Open Access Journals (Sweden)

    Ross K Maddox

    Full Text Available Why is spatial tuning in auditory cortex weak, even though location is important to object recognition in natural settings? This question continues to vex neuroscientists focused on linking physiological results to auditory perception. Here we show that the spatial locations of simultaneous, competing sound sources dramatically influence how well neural spike trains recorded from the zebra finch field L (an analog of mammalian primary auditory cortex encode source identity. We find that the location of a birdsong played in quiet has little effect on the fidelity of the neural encoding of the song. However, when the song is presented along with a masker, spatial effects are pronounced. For each spatial configuration, a subset of neurons encodes song identity more robustly than others. As a result, competing sources from different locations dominate responses of different neural subpopulations, helping to separate neural responses into independent representations. These results help elucidate how cortical processing exploits spatial information to provide a substrate for selective spatial auditory attention.

  4. Translational profiling of B cells infected with the Epstein-Barr virus reveals 5' leader ribosome recruitment through upstream open reading frames.

    Science.gov (United States)

    Bencun, Maja; Klinke, Olaf; Hotz-Wagenblatt, Agnes; Klaus, Severina; Tsai, Ming-Han; Poirey, Remy; Delecluse, Henri-Jacques

    2018-04-06

    The Epstein-Barr virus (EBV) genome encodes several hundred transcripts. We have used ribosome profiling to characterize viral translation in infected cells and map new translation initiation sites. We show here that EBV transcripts are translated with highly variable efficiency, owing to variable transcription and translation rates, variable ribosome recruitment to the leader region and coverage by monosomes versus polysomes. Some transcripts were hardly translated, others mainly carried monosomes, showed ribosome accumulation in leader regions and most likely represent non-coding RNAs. A similar process was visible for a subset of lytic genes including the key transactivators BZLF1 and BRLF1 in cells infected with weakly replicating EBV strains. This suggests that ribosome trapping, particularly in the leader region, represents a new checkpoint for the repression of lytic replication. We could identify 25 upstream open reading frames (uORFs) located upstream of coding transcripts that displayed 5' leader ribosome trapping, six of which were located in the leader region shared by many latent transcripts. These uORFs repressed viral translation and are likely to play an important role in the regulation of EBV translation.

  5. Revealing spatially heterogeneous relaxation in a model nanocomposite

    Energy Technology Data Exchange (ETDEWEB)

    Cheng, Shiwang; Bocharova, Vera [Chemical Sciences Division, Oak Ridge National Laboratory, Oak Ridge, Tennessee 37831 (United States); Mirigian, Stephen; Schweizer, Kenneth S. [Department of Materials Science and Chemistry, Frederick Seitz Materials Research Laboratory, University of Illinois, Urbana, Illinois 61801 (United States); Carrillo, Jan-Michael Y.; Sumpter, Bobby G. [Center for Nanophase Materials Sciences, Oak Ridge National Laboratory, Oak Ridge, Tennessee 37831 (United States); Computer Science and Mathematics Division, Oak Ridge National Laboratory, Oak Ridge, Tennessee 37831 (United States); Sokolov, Alexei P., E-mail: sokolov@utk.edu [Chemical Sciences Division, Oak Ridge National Laboratory, Oak Ridge, Tennessee 37831 (United States); Department of Chemistry, Department of Physics and Astronomy, University of Tennessee, Knoxville, Tennessee 37996 (United States)

    2015-11-21

    The detailed nature of spatially heterogeneous dynamics of glycerol-silica nanocomposites is unraveled by combining dielectric spectroscopy with atomistic simulation and statistical mechanical theory. Analysis of the spatial mobility gradient shows no “glassy” layer, but the α-relaxation time near the nanoparticle grows with cooling faster than the α-relaxation time in the bulk and is ∼20 times longer at low temperatures. The interfacial layer thickness increases from ∼1.8 nm at higher temperatures to ∼3.5 nm upon cooling to near bulk T{sub g}. A real space microscopic description of the mobility gradient is constructed by synergistically combining high temperature atomistic simulation with theory. Our analysis suggests that the interfacial slowing down arises mainly due to an increase of the local cage scale barrier for activated hopping induced by enhanced packing and densification near the nanoparticle surface. The theory is employed to predict how local surface densification can be manipulated to control layer dynamics and shear rigidity over a wide temperature range.

  6. Ribosomal protein methyltransferases in the yeast Saccharomyces cerevisiae: Roles in ribosome biogenesis and translation.

    Science.gov (United States)

    Al-Hadid, Qais; White, Jonelle; Clarke, Steven

    2016-02-12

    A significant percentage of the methyltransferasome in Saccharomyces cerevisiae and higher eukaryotes is devoted to methylation of the translational machinery. Methylation of the RNA components of the translational machinery has been studied extensively and is important for structure stability, ribosome biogenesis, and translational fidelity. However, the functional effects of ribosomal protein methylation by their cognate methyltransferases are still largely unknown. Previous work has shown that the ribosomal protein Rpl3 methyltransferase, histidine protein methyltransferase 1 (Hpm1), is important for ribosome biogenesis and translation elongation fidelity. In this study, yeast strains deficient in each of the ten ribosomal protein methyltransferases in S. cerevisiae were examined for potential defects in ribosome biogenesis and translation. Like Hpm1-deficient cells, loss of four of the nine other ribosomal protein methyltransferases resulted in defects in ribosomal subunit synthesis. All of the mutant strains exhibited resistance to the ribosome inhibitors anisomycin and/or cycloheximide in plate assays, but not in liquid culture. Translational fidelity assays measuring stop codon readthrough, amino acid misincorporation, and programmed -1 ribosomal frameshifting, revealed that eight of the ten enzymes are important for translation elongation fidelity and the remaining two are necessary for translation termination efficiency. Altogether, these results demonstrate that ribosomal protein methyltransferases in S. cerevisiae play important roles in ribosome biogenesis and translation. Copyright © 2016 Elsevier Inc. All rights reserved.

  7. Spatial interactions reveal inhibitory cortical networks in human amblyopia.

    Science.gov (United States)

    Wong, Erwin H; Levi, Dennis M; McGraw, Paul V

    2005-10-01

    Humans with amblyopia have a well-documented loss of sensitivity for first-order, or luminance defined, visual information. Recent studies show that they also display a specific loss of sensitivity for second-order, or contrast defined, visual information; a type of image structure encoded by neurons found predominantly in visual area A18/V2. In the present study, we investigate whether amblyopia disrupts the normal architecture of spatial interactions in V2 by determining the contrast detection threshold of a second-order target in the presence of second-order flanking stimuli. Adjacent flanks facilitated second-order detectability in normal observers. However, in marked contrast, they suppressed detection in each eye of the majority of amblyopic observers. Furthermore, strabismic observers with no loss of visual acuity show a similar pattern of detection suppression. We speculate that amblyopia results in predominantly inhibitory cortical interactions between second-order neurons.

  8. Neuron-Like Networks Between Ribosomal Proteins Within the Ribosome

    Science.gov (United States)

    Poirot, Olivier; Timsit, Youri

    2016-05-01

    From brain to the World Wide Web, information-processing networks share common scale invariant properties. Here, we reveal the existence of neural-like networks at a molecular scale within the ribosome. We show that with their extensions, ribosomal proteins form complex assortative interaction networks through which they communicate through tiny interfaces. The analysis of the crystal structures of 50S eubacterial particles reveals that most of these interfaces involve key phylogenetically conserved residues. The systematic observation of interactions between basic and aromatic amino acids at the interfaces and along the extension provides new structural insights that may contribute to decipher the molecular mechanisms of signal transmission within or between the ribosomal proteins. Similar to neurons interacting through “molecular synapses”, ribosomal proteins form a network that suggest an analogy with a simple molecular brain in which the “sensory-proteins” innervate the functional ribosomal sites, while the “inter-proteins” interconnect them into circuits suitable to process the information flow that circulates during protein synthesis. It is likely that these circuits have evolved to coordinate both the complex macromolecular motions and the binding of the multiple factors during translation. This opens new perspectives on nanoscale information transfer and processing.

  9. Revealing pancrustacean relationships: Phylogenetic analysis of ribosomal protein genes places Collembola (springtails in a monophyletic Hexapoda and reinforces the discrepancy between mitochondrial and nuclear DNA markers

    Directory of Open Access Journals (Sweden)

    Mariën J

    2008-03-01

    Full Text Available Abstract Background In recent years, several new hypotheses on phylogenetic relations among arthropods have been proposed on the basis of DNA sequences. One of the challenged hypotheses is the monophyly of hexapods. This discussion originated from analyses based on mitochondrial DNA datasets that, due to an unusual positioning of Collembola, suggested that the hexapod body plan evolved at least twice. Here, we re-evaluate the position of Collembola using ribosomal protein gene sequences. Results In total 48 ribosomal proteins were obtained for the collembolan Folsomia candida. These 48 sequences were aligned with sequence data on 35 other ecdysozoans. Each ribosomal protein gene was available for 25% to 86% of the taxa. However, the total sequence information was unequally distributed over the taxa and ranged between 4% and 100%. A concatenated dataset was constructed (5034 inferred amino acids in length, of which ~66% of the positions were filled. Phylogenetic tree reconstructions, using Maximum Likelihood, Maximum Parsimony, and Bayesian methods, resulted in a topology that supports monophyly of Hexapoda. Conclusion Although ribosomal proteins in general may not evolve independently, they once more appear highly valuable for phylogenetic reconstruction. Our analyses clearly suggest that Hexapoda is monophyletic. This underpins the inconsistency between nuclear and mitochondrial datasets when analyzing pancrustacean relationships. Caution is needed when applying mitochondrial markers in deep phylogeny.

  10. Revealing pancrustacean relationships: phylogenetic analysis of ribosomal protein genes places Collembola (springtails) in a monophyletic Hexapoda and reinforces the discrepancy between mitochondrial and nuclear DNA markers.

    Science.gov (United States)

    Timmermans, M J T N; Roelofs, D; Mariën, J; van Straalen, N M

    2008-03-12

    In recent years, several new hypotheses on phylogenetic relations among arthropods have been proposed on the basis of DNA sequences. One of the challenged hypotheses is the monophyly of hexapods. This discussion originated from analyses based on mitochondrial DNA datasets that, due to an unusual positioning of Collembola, suggested that the hexapod body plan evolved at least twice. Here, we re-evaluate the position of Collembola using ribosomal protein gene sequences. In total 48 ribosomal proteins were obtained for the collembolan Folsomia candida. These 48 sequences were aligned with sequence data on 35 other ecdysozoans. Each ribosomal protein gene was available for 25% to 86% of the taxa. However, the total sequence information was unequally distributed over the taxa and ranged between 4% and 100%. A concatenated dataset was constructed (5034 inferred amino acids in length), of which ~66% of the positions were filled. Phylogenetic tree reconstructions, using Maximum Likelihood, Maximum Parsimony, and Bayesian methods, resulted in a topology that supports monophyly of Hexapoda. Although ribosomal proteins in general may not evolve independently, they once more appear highly valuable for phylogenetic reconstruction. Our analyses clearly suggest that Hexapoda is monophyletic. This underpins the inconsistency between nuclear and mitochondrial datasets when analyzing pancrustacean relationships. Caution is needed when applying mitochondrial markers in deep phylogeny.

  11. Diffuse correlation tomography reveals spatial and temporal difference in blood flow changes among murine femoral grafts

    Science.gov (United States)

    Han, Songfeng; Proctor, Ashley R.; Benoit, Danielle S. W.; Choe, Regine

    2017-07-01

    Diffuse correlation tomography was utilized to noninvasively monitor 3D blood flow changes in three types of healing mouse femoral grafts. Results reveal the spatial and temporal difference among the groups.

  12. Tumor-adjacent tissue co-expression profile analysis reveals pro-oncogenic ribosomal gene signature for prognosis of resectable hepatocellular carcinoma.

    Science.gov (United States)

    Grinchuk, Oleg V; Yenamandra, Surya P; Iyer, Ramakrishnan; Singh, Malay; Lee, Hwee Kuan; Lim, Kiat Hon; Chow, Pierce Kah-Hoe; Kuznetsov, Vladamir A

    2018-01-01

    Currently, molecular markers are not used when determining the prognosis and treatment strategy for patients with hepatocellular carcinoma (HCC). In the present study, we proposed that the identification of common pro-oncogenic pathways in primary tumors (PT) and adjacent non-malignant tissues (AT) typically used to predict HCC patient risks may result in HCC biomarker discovery. We examined the genome-wide mRNA expression profiles of paired PT and AT samples from 321 HCC patients. The workflow integrated differentially expressed gene selection, gene ontology enrichment, computational classification, survival predictions, image analysis and experimental validation methods. We developed a 24-ribosomal gene-based HCC classifier (RGC), which is prognostically significant in both PT and AT. The RGC gene overexpression in PT was associated with a poor prognosis in the training (hazard ratio = 8.2, P = 9.4 × 10 -6 ) and cross-cohort validation (hazard ratio = 2.63, P = 0.004) datasets. The multivariate survival analysis demonstrated the significant and independent prognostic value of the RGC. The RGC displayed a significant prognostic value in AT of the training (hazard ratio = 5.0, P = 0.03) and cross-validation (hazard ratio = 1.9, P = 0.03) HCC groups, confirming the accuracy and robustness of the RGC. Our experimental and bioinformatics analyses suggested a key role for c-MYC in the pro-oncogenic pattern of ribosomal biogenesis co-regulation in PT and AT. Microarray, quantitative RT-PCR and quantitative immunohistochemical studies of the PT showed that DKK1 in PT is the perspective biomarker for poor HCC outcomes. The common co-transcriptional pattern of ribosome biogenesis genes in PT and AT from HCC patients suggests a new scalable prognostic system, as supported by the model of tumor-like metabolic redirection/assimilation in non-malignant AT. The RGC, comprising 24 ribosomal genes, is introduced as a robust and reproducible prognostic model for

  13. Patterns in the spatial distribution of Peruvian anchovy ( Engraulis ringens) revealed by spatially explicit fishing data

    Science.gov (United States)

    Bertrand, Sophie; Díaz, Erich; Lengaigne, Matthieu

    2008-10-01

    Peruvian anchovy ( Engraulis ringens) stock abundance is tightly driven by the high and unpredictable variability of the Humboldt Current Ecosystem. Management of the fishery therefore cannot rely on mid- or long-term management policy alone but needs to be adaptive at relatively short time scales. Regular acoustic surveys are performed on the stock at intervals of 2 to 4 times a year, but there is a need for more time continuous monitoring indicators to ensure that management can respond at suitable time scales. Existing literature suggests that spatially explicit data on the location of fishing activities could be used as a proxy for target stock distribution. Spatially explicit commercial fishing data could therefore guide adaptive management decisions at shorter time scales than is possible through scientific stock surveys. In this study we therefore aim to (1) estimate the position of fishing operations for the entire fleet of Peruvian anchovy purse-seiners using the Peruvian satellite vessel monitoring system (VMS), and (2) quantify the extent to which the distribution of purse-seine sets describes anchovy distribution. To estimate fishing set positions from vessel tracks derived from VMS data we developed a methodology based on artificial neural networks (ANN) trained on a sample of fishing trips with known fishing set positions (exact fishing positions are known for approximately 1.5% of the fleet from an at-sea observer program). The ANN correctly identified 83% of the real fishing sets and largely outperformed comparative linear models. This network is then used to forecast fishing operations for those trips where no observers were onboard. To quantify the extent to which fishing set distribution was correlated to stock distribution we compared three metrics describing features of the distributions (the mean distance to the coast, the total area of distribution, and a clustering index) for concomitant acoustic survey observations and fishing set positions

  14. New quantitative approaches reveal the spatial preference of nuclear compartments in mammalian fibroblasts.

    Science.gov (United States)

    Weston, David J; Russell, Richard A; Batty, Elizabeth; Jensen, Kirsten; Stephens, David A; Adams, Niall M; Freemont, Paul S

    2015-03-06

    The nuclei of higher eukaryotic cells display compartmentalization and certain nuclear compartments have been shown to follow a degree of spatial organization. To date, the study of nuclear organization has often involved simple quantitative procedures that struggle with both the irregularity of the nuclear boundary and the problem of handling replicate images. Such studies typically focus on inter-object distance, rather than spatial location within the nucleus. The concern of this paper is the spatial preference of nuclear compartments, for which we have developed statistical tools to quantitatively study and explore nuclear organization. These tools combine replicate images to generate 'aggregate maps' which represent the spatial preferences of nuclear compartments. We present two examples of different compartments in mammalian fibroblasts (WI-38 and MRC-5) that demonstrate new knowledge of spatial preference within the cell nucleus. Specifically, the spatial preference of RNA polymerase II is preserved across normal and immortalized cells, whereas PML nuclear bodies exhibit a change in spatial preference from avoiding the centre in normal cells to exhibiting a preference for the centre in immortalized cells. In addition, we show that SC35 splicing speckles are excluded from the nuclear boundary and localize throughout the nucleoplasm and in the interchromatin space in non-transformed WI-38 cells. This new methodology is thus able to reveal the effect of large-scale perturbation on spatial architecture and preferences that would not be obvious from single cell imaging.

  15. iTRAQ Protein Profile Differential Analysis of Dormant and Germinated Grassbur Twin Seeds Reveals that Ribosomal Synthesis and Carbohydrate Metabolism Promote Germination Possibly Through the PI3K Pathway.

    Science.gov (United States)

    Zhang, Guo-Liang; Zhu, Yue; Fu, Wei-Dong; Wang, Peng; Zhang, Rui-Hai; Zhang, Yan-Lei; Song, Zhen; Xia, Gui-Xian; Wu, Jia-He

    2016-06-01

    Grassbur is a destructive and invasive weed in pastures, and its burs can cause gastric damage to animals. The strong adaptability and reproductive potential of grassbur are partly due to a unique germination mechanism whereby twin seeds develop in a single bur: one seed germinates, but the other remains dormant. To investigate the molecular mechanism of seed germination in twin seeds, we used isobaric tags for relative and absolute quantitation (iTRAQ) to perform a dynamic proteomic analysis of germination and dormancy. A total of 1,984 proteins were identified, 161 of which were considered to be differentially accumulated. The differentially accumulated proteins comprised 102 up-regulated and 59 down-regulated proteins. These proteins were grouped into seven functional categories, ribosomal proteins being the predominant group. The authenticity and accuracy of the results were confirmed by enzyme-linked immunosorbent assay (ELISA) and quantitative real-time reverse transcription-PCR (qPCR). A dynamic proteomic analysis revealed that ribosome synthesis and carbohydrate metabolism affect seed germination possibly through the phosphoinositide 3-kinase (PI3K) pathway. As the PI3K pathway is generally activated by insulin, analyses of seeds treated with exogenous insulin by qPCR, ELISA and iTRAQ confirmed that the PI3K pathway can be activated, which suppresses dormancy and promotes germination in twin grassbur seeds. Together, these results show that the PI3K pathway may play roles in stimulating seed germination in grassbur by modulating ribosomal synthesis and carbohydrate metabolism. © The Author 2016. Published by Oxford University Press on behalf of Japanese Society of Plant Physiologists. All rights reserved. For permissions, please email: journals.permissions@oup.com.

  16. Choice experiments versus revealed choice models : a before-after study of consumer spatial shopping behavior

    NARCIS (Netherlands)

    Timmermans, H.J.P.; Borgers, A.W.J.; Waerden, van der P.J.H.J.

    1992-01-01

    The purpose of this article is to compare a set of multinomial logit models derived from revealed choice data and a decompositional choice model derived from experimental data in terms of predictive success in the context of consumer spatial shopping behavior. Data on consumer shopping choice

  17. Fourier decomposition of spatial localization errors reveals an idiotropic dominance of an internal model of gravity.

    Science.gov (United States)

    De Sá Teixeira, Nuno Alexandre

    2014-12-01

    Given its conspicuous nature, gravity has been acknowledged by several research lines as a prime factor in structuring the spatial perception of one's environment. One such line of enquiry has focused on errors in spatial localization aimed at the vanishing location of moving objects - it has been systematically reported that humans mislocalize spatial positions forward, in the direction of motion (representational momentum) and downward in the direction of gravity (representational gravity). Moreover, spatial localization errors were found to evolve dynamically with time in a pattern congruent with an anticipated trajectory (representational trajectory). The present study attempts to ascertain the degree to which vestibular information plays a role in these phenomena. Human observers performed a spatial localization task while tilted to varying degrees and referring to the vanishing locations of targets moving along several directions. A Fourier decomposition of the obtained spatial localization errors revealed that although spatial errors were increased "downward" mainly along the body's longitudinal axis (idiotropic dominance), the degree of misalignment between the latter and physical gravity modulated the time course of the localization responses. This pattern is surmised to reflect increased uncertainty about the internal model when faced with conflicting cues regarding the perceived "downward" direction.

  18. Exclusion of mRNPs and ribosomal particles from a thin zone beneath the nuclear envelope revealed upon inhibition of transport

    International Nuclear Information System (INIS)

    Kylberg, Karin; Bjoerk, Petra; Fomproix, Nathalie; Ivarsson, Birgitta; Wieslander, Lars; Daneholt, Bertil

    2010-01-01

    We have studied the nucleocytoplasmic transport of a specific messenger RNP (mRNP) particle, named Balbiani ring (BR) granule, and ribosomal RNP (rRNP) particles in the salivary glands of the dipteran Chironomus tentans. The passage of the RNPs through the nuclear pore complex (NPC) was inhibited with the nucleoporin-binding wheat germ agglutinin, and the effects were examined by electron microscopy. BR mRNPs bound to the nuclear basket increased in number, while BR mRNPs translocating through the central channel decreased, suggesting that the initiation of translocation proper had been inhibited. The rRNPs accumulated heavily in nucleoplasm, while no or very few rRNPs were recorded within nuclear baskets. Thus, the transport of rRNPs had been blocked prior to the entry into the baskets. Remarkably, the rRNPs had been excluded both from baskets and the space in between the baskets. We propose that normally basket fibrils move freely and repel RNPs from the exclusion zone unless the particles have affinity for and bind to nucleoporins within the baskets.

  19. Organization of Mitochondrial Gene Expression in Two Distinct Ribosome-Containing Assemblies

    Directory of Open Access Journals (Sweden)

    Kirsten Kehrein

    2015-02-01

    Full Text Available Mitochondria contain their own genetic system that provides subunits of the complexes driving oxidative phosphorylation. A quarter of the mitochondrial proteome participates in gene expression, but how all these factors are orchestrated and spatially organized is currently unknown. Here, we established a method to purify and analyze native and intact complexes of mitochondrial ribosomes. Quantitative mass spectrometry revealed extensive interactions of ribosomes with factors involved in all the steps of posttranscriptional gene expression. These interactions result in large expressosome-like assemblies that we termed mitochondrial organization of gene expression (MIOREX complexes. Superresolution microscopy revealed that most MIOREX complexes are evenly distributed throughout the mitochondrial network, whereas a subset is present as nucleoid-MIOREX complexes that unite the whole spectrum of organellar gene expression. Our work therefore provides a conceptual framework for the spatial organization of mitochondrial protein synthesis that likely developed to facilitate gene expression in the organelle.

  20. Crowding in Visual Working Memory Reveals Its Spatial Resolution and the Nature of Its Representations.

    Science.gov (United States)

    Tamber-Rosenau, Benjamin J; Fintzi, Anat R; Marois, René

    2015-09-01

    Spatial resolution fundamentally limits any image representation. Although this limit has been extensively investigated for perceptual representations by assessing how neighboring flankers degrade the perception of a peripheral target with visual crowding, the corresponding limit for representations held in visual working memory (VWM) is unknown. In the present study, we evoked crowding in VWM and directly compared resolution in VWM and perception. Remarkably, the spatial resolution of VWM proved to be no worse than that of perception. However, mixture modeling of errors caused by crowding revealed the qualitatively distinct nature of these representations. Perceptual crowding errors arose from both increased imprecision in target representations and substitution of flankers for targets. By contrast, VWM crowding errors arose exclusively from substitutions, which suggests that VWM transforms analog perceptual representations into discrete items. Thus, although perception and VWM share a common resolution limit, exceeding this limit reveals distinct mechanisms for perceiving images and holding them in mind. © The Author(s) 2015.

  1. Structure of Ribosomal Silencing Factor Bound to Mycobacterium tuberculosis Ribosome.

    Science.gov (United States)

    Li, Xiaojun; Sun, Qingan; Jiang, Cai; Yang, Kailu; Hung, Li-Wei; Zhang, Junjie; Sacchettini, James C

    2015-10-06

    The ribosomal silencing factor RsfS slows cell growth by inhibiting protein synthesis during periods of diminished nutrient availability. The crystal structure of Mycobacterium tuberculosis (Mtb) RsfS, together with the cryo-electron microscopy (EM) structure of the large subunit 50S of Mtb ribosome, reveals how inhibition of protein synthesis by RsfS occurs. RsfS binds to the 50S at L14, which, when occupied, blocks the association of the small subunit 30S. Although Mtb RsfS is a dimer in solution, only a single subunit binds to 50S. The overlap between the dimer interface and the L14 binding interface confirms that the RsfS dimer must first dissociate to a monomer in order to bind to L14. RsfS interacts primarily through electrostatic and hydrogen bonding to L14. The EM structure shows extended rRNA density that it is not found in the Escherichia coli ribosome, the most striking of these being the extended RNA helix of H54a. Copyright © 2015 Elsevier Ltd. All rights reserved.

  2. EEG source reconstruction reveals frontal-parietal dynamics of spatial conflict processing.

    Directory of Open Access Journals (Sweden)

    Michael X Cohen

    Full Text Available Cognitive control requires the suppression of distracting information in order to focus on task-relevant information. We applied EEG source reconstruction via time-frequency linear constrained minimum variance beamforming to help elucidate the neural mechanisms involved in spatial conflict processing. Human subjects performed a Simon task, in which conflict was induced by incongruence between spatial location and response hand. We found an early (∼200 ms post-stimulus conflict modulation in stimulus-contralateral parietal gamma (30-50 Hz, followed by a later alpha-band (8-12 Hz conflict modulation, suggesting an early detection of spatial conflict and inhibition of spatial location processing. Inter-regional connectivity analyses assessed via cross-frequency coupling of theta (4-8 Hz, alpha, and gamma power revealed conflict-induced shifts in cortical network interactions: Congruent trials (relative to incongruent trials had stronger coupling between frontal theta and stimulus-contrahemifield parietal alpha/gamma power, whereas incongruent trials had increased theta coupling between medial frontal and lateral frontal regions. These findings shed new light into the large-scale network dynamics of spatial conflict processing, and how those networks are shaped by oscillatory interactions.

  3. EEG source reconstruction reveals frontal-parietal dynamics of spatial conflict processing.

    Science.gov (United States)

    Cohen, Michael X; Ridderinkhof, K Richard

    2013-01-01

    Cognitive control requires the suppression of distracting information in order to focus on task-relevant information. We applied EEG source reconstruction via time-frequency linear constrained minimum variance beamforming to help elucidate the neural mechanisms involved in spatial conflict processing. Human subjects performed a Simon task, in which conflict was induced by incongruence between spatial location and response hand. We found an early (∼200 ms post-stimulus) conflict modulation in stimulus-contralateral parietal gamma (30-50 Hz), followed by a later alpha-band (8-12 Hz) conflict modulation, suggesting an early detection of spatial conflict and inhibition of spatial location processing. Inter-regional connectivity analyses assessed via cross-frequency coupling of theta (4-8 Hz), alpha, and gamma power revealed conflict-induced shifts in cortical network interactions: Congruent trials (relative to incongruent trials) had stronger coupling between frontal theta and stimulus-contrahemifield parietal alpha/gamma power, whereas incongruent trials had increased theta coupling between medial frontal and lateral frontal regions. These findings shed new light into the large-scale network dynamics of spatial conflict processing, and how those networks are shaped by oscillatory interactions.

  4. EEG Source Reconstruction Reveals Frontal-Parietal Dynamics of Spatial Conflict Processing

    Science.gov (United States)

    Cohen, Michael X; Ridderinkhof, K. Richard

    2013-01-01

    Cognitive control requires the suppression of distracting information in order to focus on task-relevant information. We applied EEG source reconstruction via time-frequency linear constrained minimum variance beamforming to help elucidate the neural mechanisms involved in spatial conflict processing. Human subjects performed a Simon task, in which conflict was induced by incongruence between spatial location and response hand. We found an early (∼200 ms post-stimulus) conflict modulation in stimulus-contralateral parietal gamma (30–50 Hz), followed by a later alpha-band (8–12 Hz) conflict modulation, suggesting an early detection of spatial conflict and inhibition of spatial location processing. Inter-regional connectivity analyses assessed via cross-frequency coupling of theta (4–8 Hz), alpha, and gamma power revealed conflict-induced shifts in cortical network interactions: Congruent trials (relative to incongruent trials) had stronger coupling between frontal theta and stimulus-contrahemifield parietal alpha/gamma power, whereas incongruent trials had increased theta coupling between medial frontal and lateral frontal regions. These findings shed new light into the large-scale network dynamics of spatial conflict processing, and how those networks are shaped by oscillatory interactions. PMID:23451201

  5. A ribosome without RNA

    Directory of Open Access Journals (Sweden)

    Harold S Bernhardt

    2015-11-01

    Full Text Available It was Francis Crick who first asked why the ribosome contains so much RNA, and discussed the implications of this for the direct flow of genetic information from DNA to protein. Remarkable advances in our understanding of the ribosome and protein synthesis, including the recent publication of two mammalian mitochondrial ribosome structures, have shed new light on this intriguing aspect of evolution in molecular biology. We examine here whether RNA is indispensable for coded protein synthesis, or whether an all-protein ‘ribosome’ (or ‘synthosome’ might be possible, with a protein enzyme catalyzing peptide synthesis, and release factor-like protein adaptors able to read a message composed of deoxyribonucleotides. We also compare the RNA world hypothesis with the alternative ‘proteins first’ hypothesis in terms of their different understandings of the evolution of the ribosome, and whether this might have been preceded by an ancestral form of nonribosomal peptide synthesis catalyzed by protein enzymes.

  6. Phylogeographic analysis reveals significant spatial genetic structure of Incarvillea sinensis as a product of mountain building

    Directory of Open Access Journals (Sweden)

    Chen Shaotian

    2012-04-01

    Full Text Available Abstract Background Incarvillea sinensis is widely distributed from Southwest China to Northeast China and in the Russian Far East. The distribution of this species was thought to be influenced by the uplift of the Qinghai-Tibet Plateau and Quaternary glaciation. To reveal the imprints of geological events on the spatial genetic structure of Incarvillea sinensis, we examined two cpDNA segments ( trnH- psbA and trnS- trnfM in 705 individuals from 47 localities. Results A total of 16 haplotypes was identified, and significant genetic differentiation was revealed (GST =0.843, NST = 0.975, P  Conclusions The results revealed that the uplift of the Qinghai-Tibet Plateau likely resulted in the significant divergence between the lineage in the eastern Qinghai-Tibet Plateau and the other one outside this area. The diverse niches in the eastern Qinghai-Tibet Plateau created a wide spectrum of habitats to accumulate and accommodate new mutations. The features of genetic diversity of populations outside the eastern Qinghai-Tibet Plateau seemed to reveal the imprints of extinction during the Glacial and the interglacial and postglacial recolonization. Our study is a typical case of the significance of the uplift of the Qinghai-Tibet Plateau and the Quaternary Glacial in spatial genetic structure of eastern Asian plants, and sheds new light on the evolution of biodiversity in the Qinghai-Tibet Plateau at the intraspecies level.

  7. Architecture of the large subunit of the mammalian mitochondrial ribosome.

    Science.gov (United States)

    Greber, Basil J; Boehringer, Daniel; Leitner, Alexander; Bieri, Philipp; Voigts-Hoffmann, Felix; Erzberger, Jan P; Leibundgut, Marc; Aebersold, Ruedi; Ban, Nenad

    2014-01-23

    Mitochondrial ribosomes synthesize a number of highly hydrophobic proteins encoded on the genome of mitochondria, the organelles in eukaryotic cells that are responsible for energy conversion by oxidative phosphorylation. The ribosomes in mammalian mitochondria have undergone massive structural changes throughout their evolution, including ribosomal RNA shortening and acquisition of mitochondria-specific ribosomal proteins. Here we present the three-dimensional structure of the 39S large subunit of the porcine mitochondrial ribosome determined by cryo-electron microscopy at 4.9 Å resolution. The structure, combined with data from chemical crosslinking and mass spectrometry experiments, reveals the unique features of the 39S subunit at near-atomic resolution and provides detailed insight into the architecture of the polypeptide exit site. This region of the mitochondrial ribosome has been considerably remodelled compared to its bacterial counterpart, providing a specialized platform for the synthesis and membrane insertion of the highly hydrophobic protein components of the respiratory chain.

  8. Structure in nascent carbon nanotubes revealed by spatially resolved Raman spectroscopy

    Energy Technology Data Exchange (ETDEWEB)

    Landois, Périne [CEA, IRAMIS, SPAM, Laboratoire Francis Perrin (CNRS URA 2453), 91191 Gif-sur-Yvette (France); Laboratoire de Physique des Solides, UMR CNRS 8502, Université Paris Sud 11, 91405 Orsay (France); Pinault, Mathieu [CEA, IRAMIS, SPAM, Laboratoire Francis Perrin (CNRS URA 2453), 91191 Gif-sur-Yvette (France); Huard, Mickaël [Laboratoire de Physique des Solides, UMR CNRS 8502, Université Paris Sud 11, 91405 Orsay (France); Reita, Valérie [Univ. Grenoble Alpes, Inst NEEL, F-38042 Grenoble (France); CNRS, Inst NEEL, F-38042 Grenoble (France); Rouzière, Stéphan; Launois, Pascale [Laboratoire de Physique des Solides, UMR CNRS 8502, Université Paris Sud 11, 91405 Orsay (France); Mayne-L' Hermite, Martine [CEA, IRAMIS, SPAM, Laboratoire Francis Perrin (CNRS URA 2453), 91191 Gif-sur-Yvette (France); Bendiab, Nedjma, E-mail: nedjma.bendiab@grenoble.cnrs.fr [Univ. Grenoble Alpes, Inst NEEL, F-38042 Grenoble (France); CNRS, Inst NEEL, F-38042 Grenoble (France)

    2014-10-01

    The understanding of carbon nanotube (CNT) growth is crucial for the control of their production. In particular, the identification of structural changes of carbon possibly occurring near the catalyst particle in the very early stages of their formation is of high interest. In this study, samples of nascent CNT obtained during nucleation step and samples of vertically aligned CNT obtained during growth step are analysed by combined spatially resolved Raman spectroscopy and X-ray diffraction measurements. Spatially resolved Raman spectroscopy reveals that iron-based phases and carbon phases are co-localized at the same position, and indicates that sp{sup 2} carbon nucleates preferentially on iron-based particles during this nucleation step. Depth scan Raman spectroscopy analysis, performed on nascent CNT, highlights that carbon structural organisation is significantly changing from defective graphene layers surrounding the iron-based particles at their base up to multi-walled nanotube structures in the upper part of iron-based particles. - Highlights: • Spatial co-localization of iron and carbon structures in nascent carbon nanotubes • Imaging local carbon structure changes along catalyst particles by Raman spectroscopy. • In nascent nanotubes, significant structural changes occur along catalyst particle.

  9. Spatial and Temporal Characteristics of Insulator Contaminations Revealed by Daily Observations of Equivalent Salt Deposit Density

    Directory of Open Access Journals (Sweden)

    Ling Ruan

    2015-01-01

    Full Text Available The accurate estimation of deposits adhering on insulators is of great significance to prevent pollution flashovers which cause huge costs worldwide. Researchers have developed sensors using different technologies to monitor insulator contamination on a fine time scale. However, there is lack of analysis of these data to reveal spatial and temporal characteristics of insulator contamination, and as a result the scheduling of periodical maintenance of power facilities is highly dependent on personal experience. Owing to the deployment of novel sensors, daily Equivalent Salt Deposit Density (ESDD observations of over two years were collected and analyzed for the first time. Results from 16 sites distributed in four regions of Hubei demonstrated that spatial heterogeneity can be seen at both the fine and coarse geographical scales, suggesting that current polluted area maps are necessary but are not sufficient conditions to guide the maintenance of power facilities. Both the local emission and the regional air pollution condition exert evident influences on deposit accumulation. A relationship between ESDD and PM10 was revealed by using regression analysis, proving that air pollution exerts influence on pollution accumulations on insulators. Moreover, the seasonality of ESDD was discovered for the first time by means of time series analysis, which could help engineers select appropriate times to clean the contamination. Besides, the trend component shows that the ESDD increases in a negative exponential fashion with the accumulation date (ESDD = a − b × exp(−time at a long time scale in real environments.

  10. Potential for tree rings to reveal spatial patterns of past drought variability across western Australia

    Science.gov (United States)

    O'Donnell, Alison J.; Cook, Edward R.; Palmer, Jonathan G.; Turney, Chris S. M.; Grierson, Pauline F.

    2018-02-01

    Proxy records have provided major insights into the variability of past climates over long timescales. However, for much of the Southern Hemisphere, the ability to identify spatial patterns of past climatic variability is constrained by the sparse distribution of proxy records. This is particularly true for mainland Australia, where relatively few proxy records are located. Here, we (1) assess the potential to use existing proxy records in the Australasian region—starting with the only two multi-century tree-ring proxies from mainland Australia—to reveal spatial patterns of past hydroclimatic variability across the western third of the continent, and (2) identify strategic locations to target for the development of new proxy records. We show that the two existing tree-ring records allow robust reconstructions of past hydroclimatic variability over spatially broad areas (i.e. > 3° × 3°) in inland north- and south-western Australia. Our results reveal synchronous periods of drought and wet conditions between the inland northern and southern regions of western Australia as well as a generally anti-phase relationship with hydroclimate in eastern Australia over the last two centuries. The inclusion of 174 tree-ring proxy records from Tasmania, New Zealand and Indonesia and a coral record from Queensland did not improve the reconstruction potential over western Australia. However, our findings suggest that the addition of relatively few new proxy records from key locations in western Australia that currently have low reconstruction skill will enable the development of a comprehensive drought atlas for the region, and provide a critical link to the drought atlases of monsoonal Asia and eastern Australia and New Zealand.

  11. Cortical and Subcortical Coordination of Visual Spatial Attention Revealed by Simultaneous EEG-fMRI Recording.

    Science.gov (United States)

    Green, Jessica J; Boehler, Carsten N; Roberts, Kenneth C; Chen, Ling-Chia; Krebs, Ruth M; Song, Allen W; Woldorff, Marty G

    2017-08-16

    produces spatially specific changes in visual cortex activity in anticipation of a stimulus. The mechanisms controlling these attention-related modulations of sensory cortex, however, are poorly understood. Here, we recorded these two complementary measures of brain activity simultaneously and examined their trial-to-trial covariations to gain insight into these attentional control mechanisms. This multi-methodological approach revealed the attention-related coordination of visual cortex modulation by the subcortical pulvinar nucleus of the thalamus while also disentangling the mechanisms underlying the attentional enhancement of relevant stimulus input and those underlying the concurrent suppression of irrelevant input. Copyright © 2017 the authors 0270-6474/17/377803-08$15.00/0.

  12. Ribosomal Antibiotics: Contemporary Challenges

    Directory of Open Access Journals (Sweden)

    Tamar Auerbach-Nevo

    2016-06-01

    Full Text Available Most ribosomal antibiotics obstruct distinct ribosomal functions. In selected cases, in addition to paralyzing vital ribosomal tasks, some ribosomal antibiotics are involved in cellular regulation. Owing to the global rapid increase in the appearance of multi-drug resistance in pathogenic bacterial strains, and to the extremely slow progress in developing new antibiotics worldwide, it seems that, in addition to the traditional attempts at improving current antibiotics and the intensive screening for additional natural compounds, this field should undergo substantial conceptual revision. Here, we highlight several contemporary issues, including challenging the common preference of broad-range antibiotics; the marginal attention to alterations in the microbiome population resulting from antibiotics usage, and the insufficient awareness of ecological and environmental aspects of antibiotics usage. We also highlight recent advances in the identification of species-specific structural motifs that may be exploited for the design and the creation of novel, environmental friendly, degradable, antibiotic types, with a better distinction between pathogens and useful bacterial species in the microbiome. Thus, these studies are leading towards the design of “pathogen-specific antibiotics,” in contrast to the current preference of broad range antibiotics, partially because it requires significant efforts in speeding up the discovery of the unique species motifs as well as the clinical pathogen identification.

  13. Expanding the ribosomal universe.

    Science.gov (United States)

    Dinman, Jonathan D; Kinzy, Terri Goss

    2009-12-09

    In this issue of Structure, Taylor et al. (2009) present the most complete model of an eukaryotic ribosome to date. This achievement represents a critical milestone along the path to structurally defining the unique aspects of the eukaryotic protein synthetic machinery.

  14. The Complete Structure of the Mycobacterium smegmatis 70S Ribosome

    Directory of Open Access Journals (Sweden)

    Jendrik Hentschel

    2017-07-01

    Full Text Available The ribosome carries out the synthesis of proteins in every living cell. It consequently represents a frontline target in anti-microbial therapy. Tuberculosis ranks among the leading causes of death worldwide, due in large part to the combination of difficult-to-treat latency and antibiotic resistance. Here, we present the 3.3-Å cryo-EM structure of the 70S ribosome of Mycobacterium smegmatis, a close relative to the human pathogen Mycobacterium tuberculosis. The structure reveals two additional ribosomal proteins and localizes them to the vicinity of drug-target sites in both the catalytic center and the decoding site of the ribosome. Furthermore, we visualized actinobacterium-specific rRNA and protein expansions that extensively remodel the ribosomal surface with implications for polysome organization. Our results provide a foundation for understanding the idiosyncrasies of mycobacterial translation and reveal atomic details of the structure that will facilitate the design of anti-tubercular therapeutics.

  15. Voronoi-based spatial analysis reveals selective interneuron changes in the cortex of FALS mice.

    Science.gov (United States)

    Minciacchi, Diego; Kassa, Roman M; Del Tongo, Claudia; Mariotti, Raffaella; Bentivoglio, Marina

    2009-01-01

    The neurodegenerative disease amyotrophic lateral sclerosis affects lower motoneurons and corticospinal cells. Mice expressing human mutant superoxide dismutase (SOD)1 provide widely investigated models of the familial form of disease, but information on cortical changes in these mice is still limited. We here analyzed the spatial organization of interneurons characterized by parvalbumin immunoreactivity in the motor, somatosensory, and visual cortical areas of SOD1(G93A) mice. Cell number and sociological spatial behavior were assessed by digital charts of cell location in cortical samples, cell counts, and generation of two-dimensional Voronoi diagrams. In end-stage SOD1-mutant mice, an increase of parvalbumin-containing cortical interneurons was found in the motor and somatosensory areas (about 35% and 20%, respectively) with respect to wild-type littermates. Changes in cell spatial distribution, as documented by Voronoi-derived coefficients of variation, indicated increased tendency of parvalbumin cells to aggregate into clusters in the same areas of the SOD1-mutant cortex. Counts and coefficients of variation of parvalbumin cells in the visual cortex gave instead similar results in SOD1-mutant and wild-type mice. Analyses of motor and somatosensory areas in presymptomatic SOD1-mutant mice provided findings very similar to those obtained at end-stage, indicating early changes of interneurons in these cortical areas during the pathology. Altogether the data reveal in the SOD1-mutant mouse cortex an altered architectonic pattern of interneurons, which selectively affects areas involved in motor control. The findings, which can be interpreted as pathogenic factors or early disease-related adaptations, point to changes in the cortical regulation and modulation of the motor circuit during motoneuron disease.

  16. Active sensing associated with spatial learning reveals memory-based attention in an electric fish.

    Science.gov (United States)

    Jun, James J; Longtin, André; Maler, Leonard

    2016-05-01

    Active sensing behaviors reveal what an animal is attending to and how it changes with learning. Gymnotus sp, a gymnotiform weakly electric fish, generates an electric organ discharge (EOD) as discrete pulses to actively sense its surroundings. We monitored freely behaving gymnotid fish in a large dark "maze" and extracted their trajectories and EOD pulse pattern and rate while they learned to find food with electrically detectable landmarks as cues. After training, they more rapidly found food using shorter, more stereotyped trajectories and spent more time near the food location. We observed three forms of active sensing: sustained high EOD rates per unit distance (sampling density), transient large increases in EOD rate (E-scans) and stereotyped scanning movements (B-scans) were initially strong at landmarks and food, but, after learning, intensified only at the food location. During probe (no food) trials, after learning, the fish's search area and intense active sampling was still centered on the missing food location, but now also increased near landmarks. We hypothesize that active sensing is a behavioral manifestation of attention and essential for spatial learning; the fish use spatial memory of landmarks and path integration to reach the expected food location and confine their attention to this region. Copyright © 2016 the American Physiological Society.

  17. Cryo-EM structure of the archaeal 50S ribosomal subunit in complex with initiation factor 6 and implications for ribosome evolution

    DEFF Research Database (Denmark)

    Greber, Basil J; Boehringer, Daniel; Godinic-Mikulcic, Vlatka

    2012-01-01

    additional components of the translation machinery with eukaryotes that are absent in bacteria. One of these translation factors is initiation factor 6 (IF6), which associates with the large ribosomal subunit. We have reconstructed the 50S ribosomal subunit from the archaeon Methanothermobacter...... between this archaeal ribosome and eukaryotic ribosomes but are mostly absent in bacteria and in some archaeal lineages. Furthermore, the structure reveals that, in spite of highly divergent evolutionary trajectories of the ribosomal particle and the acquisition of novel functions of IF6 in eukaryotes......, the molecular binding of IF6 on the ribosome is conserved between eukaryotes and archaea. The structure also provides a snapshot of the reductive evolution of the archaeal ribosome and offers new insights into the evolution of the translation system in archaea....

  18. Alpha-Band Activity Reveals Spontaneous Representations of Spatial Position in Visual Working Memory.

    Science.gov (United States)

    Foster, Joshua J; Bsales, Emma M; Jaffe, Russell J; Awh, Edward

    2017-10-23

    An emerging view suggests that spatial position is an integral component of working memory (WM), such that non-spatial features are bound to locations regardless of whether space is relevant [1, 2]. For instance, past work has shown that stimulus position is spontaneously remembered when non-spatial features are stored. Item recognition is enhanced when memoranda appear at the same location where they were encoded [3-5], and accessing non-spatial information elicits shifts of spatial attention to the original position of the stimulus [6, 7]. However, these findings do not establish that a persistent, active representation of stimulus position is maintained in WM because similar effects have also been documented following storage in long-term memory [8, 9]. Here we show that the spatial position of the memorandum is actively coded by persistent neural activity during a non-spatial WM task. We used a spatial encoding model in conjunction with electroencephalogram (EEG) measurements of oscillatory alpha-band (8-12 Hz) activity to track active representations of spatial position. The position of the stimulus varied trial to trial but was wholly irrelevant to the tasks. We nevertheless observed active neural representations of the original stimulus position that persisted throughout the retention interval. Further experiments established that these spatial representations are dependent on the volitional storage of non-spatial features rather than being a lingering effect of sensory energy or initial encoding demands. These findings provide strong evidence that online spatial representations are spontaneously maintained in WM-regardless of task relevance-during the storage of non-spatial features. Copyright © 2017 Elsevier Ltd. All rights reserved.

  19. Equating spatial summation in visual field testing reveals greater loss in optic nerve disease.

    Science.gov (United States)

    Kalloniatis, Michael; Khuu, Sieu K

    2016-07-01

    To test the hypothesis that visual field assessment in ocular disease measured with target stimuli within or close to complete spatial summation results in larger threshold elevation compared to when measured with the standard Goldmann III target size. The hypothesis predicts a greater loss will be identified in ocular disease. Additionally, we sought to develop a theoretical framework that would allow comparisons of thresholds with disease progression when using different Goldmann targets. The Humphrey Field Analyser (HFA) 30-2 grid was used in 13 patients with early/established optic nerve disease using the current Goldmann III target size or a combination of the three smallest stimuli (target size I, II and III). We used data from control subjects at each of the visual field locations for the different target sizes to establish the number of failed points (events) for the patients with optic nerve disease, as well as global indices for mean deviation (MD) and pattern standard deviation (PSD). The 30-2 visual field testing using alternate target size stimuli showed that all 13 patients displayed more defects (events) compared to the standard Goldmann III target size. The median increase for events was seven additional failed points: (range 1-26). The global indices also increased when the new testing approach was used (MD -3.47 to -6.25 dB and PSD 4.32 to 6.63 dB). Spatial summation mapping showed an increase in critical area (Ac) in disease and overall increase in thresholds when smaller target stimuli were used. When compared to the current Goldmann III paradigm, the use of alternate sized targets within the 30-2 testing protocol revealed a greater loss in patients with optic nerve disease for both event analysis and global indices (MD and PSD). We therefore provide evidence in a clinical setting that target size is important in visual field testing. © 2016 The Authors Ophthalmic & Physiological Optics © 2016 The College of Optometrists.

  20. In vitro degradation of ribosomes.

    Science.gov (United States)

    Mora, G; Rivas, A

    1976-12-01

    The cytoplasmic ribosomes from Euglena gracilis var. bacillaris are found to be of two types taking into consideration their stability "in vitro". In the group of unstable ribosomes the large subunit is degraded. The other group apparently does not suffer any degradation under the conditions described. However the RNAs extracted from both types of ribosomes are degraded during sucrose density gradients. The degradation of the largest RNA species has been reported previously, but no comment has been made about the stability of the ribosome itself.

  1. Quantitative protein localization signatures reveal an association between spatial and functional divergences of proteins.

    Science.gov (United States)

    Loo, Lit-Hsin; Laksameethanasan, Danai; Tung, Yi-Ling

    2014-03-01

    Protein subcellular localization is a major determinant of protein function. However, this important protein feature is often described in terms of discrete and qualitative categories of subcellular compartments, and therefore it has limited applications in quantitative protein function analyses. Here, we present Protein Localization Analysis and Search Tools (PLAST), an automated analysis framework for constructing and comparing quantitative signatures of protein subcellular localization patterns based on microscopy images. PLAST produces human-interpretable protein localization maps that quantitatively describe the similarities in the localization patterns of proteins and major subcellular compartments, without requiring manual assignment or supervised learning of these compartments. Using the budding yeast Saccharomyces cerevisiae as a model system, we show that PLAST is more accurate than existing, qualitative protein localization annotations in identifying known co-localized proteins. Furthermore, we demonstrate that PLAST can reveal protein localization-function relationships that are not obvious from these annotations. First, we identified proteins that have similar localization patterns and participate in closely-related biological processes, but do not necessarily form stable complexes with each other or localize at the same organelles. Second, we found an association between spatial and functional divergences of proteins during evolution. Surprisingly, as proteins with common ancestors evolve, they tend to develop more diverged subcellular localization patterns, but still occupy similar numbers of compartments. This suggests that divergence of protein localization might be more frequently due to the development of more specific localization patterns over ancestral compartments than the occupation of new compartments. PLAST enables systematic and quantitative analyses of protein localization-function relationships, and will be useful to elucidate protein

  2. Yeast ribosomal proteins

    International Nuclear Information System (INIS)

    Otaka, E.; Kobata, K.

    1978-01-01

    The cytoplasmic 80s ribosomal proteins from the cells of yeast Saccharomyces cerevisiae were analyzed by SDS two-dimensional polyacrylamide gel electrophoresis. Seventyfour proteins were identified and consecutively numbered from 1 to 74. Upon oxidation of the 80s proteins with performic acid, ten proteins (no. 15, 20, 35, 40, 44, 46, 49, 51, 54 and 55) were dislocated on the gel without change of the total number of protein spots. Five proteins (no. 8, 14, 16, 36 and 74) were phosphorylated in vivo as seen in 32 P-labelling experiments. The large and small subunits separated in low magnesium medium were analyzed by the above gel electrophoresis. At least forty-five and twenty-eight proteins were assumed to be in the large and small subunits, respectively. All proteins found in the 80s ribosomes, except for no. 3, were detected in either subunit without appearance of new spots. The acidic protein no. 3 seems to be lost during subunit dissociation. (orig.) [de

  3. Post-transcriptional regulation of ribosome biogenesis in yeast

    Directory of Open Access Journals (Sweden)

    Isabelle C. Kos-Braun

    2017-05-01

    Full Text Available Most microorganisms are exposed to the constantly and often rapidly changing environment. As such they evolved mechanisms to balance their metabolism and energy expenditure with the resources available to them. When resources become scarce or conditions turn out to be unfavourable for growth, cells reduce their metabolism and energy usage to survive. One of the major energy consuming processes in the cell is ribosome biogenesis. Unsurprisingly, cells encountering adverse conditions immediately shut down production of new ribosomes. It is well established that nutrient depletion leads to a rapid repression of transcription of the genes encoding ribosomal proteins, ribosome biogenesis factors as well as ribosomal RNA (rRNA. However, if pre-rRNA processing and ribosome assembly are regulated post-transcriptionally remains largely unclear. We have recently uncovered that the yeast Saccharomyces cerevisiae rapidly switches between two alternative pre-rRNA processing pathways depending on the environmental conditions. Our findings reveal a new level of complexity in the regulation of ribosome biogenesis.

  4. The Unexplored Mechanisms and Regulatory Functions of Ribosomal Translocation

    Science.gov (United States)

    Alejo, Jose Luis

    In every cell, protein synthesis is carried out by the ribosome, a complex macromolecular RNA-protein assembly. Decades of structural and kinetic studies have increased our understanding of ribosome initiation, decoding, translocation and termination. Yet, the underlying mechanism of these fundamental processes has yet to be fully delineated. Hence, the molecular basis of regulation remains obscure. Here, single-molecule fluorescence methods are applied to decipher the mechanism and regulatory roles of the multi-step process of directional substrate translocation on the ribosome that accompanies every round of protein synthesis. In Chapter 1, single-molecule fluorescence resonance energy transfer (smFRET) is introduced as a tool for studying bacterial ribosome translocation. Chapter 2 details the experimental methods. In Chapter 3, the elongation factor G(EF-G)-catalyzed movement of substrates through the ribosome is examined from several perspectives or signals reporting on various degrees of freedom of ribosome dynamics. Two ribosomal states interconvert in the presence of EF-G(GDP), displaying novel head domain motions, until relocking takes place. In Chapter 4, in order to test if the mentioned fluctuations leading to relocking are correlated to the engagement of the P-site by the peptidyl-tRNA, the translocation of miscoded tRNAs is studied. Severe defects in the relocking stages of translocation reveal the correlation between this new stage of translocation and P-site tRNA engagement.

  5. Multilayer networks reveal the spatial structure of seed-dispersal interactions across the Great Rift landscapes.

    Science.gov (United States)

    Timóteo, Sérgio; Correia, Marta; Rodríguez-Echeverría, Susana; Freitas, Helena; Heleno, Ruben

    2018-01-10

    Species interaction networks are traditionally explored as discrete entities with well-defined spatial borders, an oversimplification likely impairing their applicability. Using a multilayer network approach, explicitly accounting for inter-habitat connectivity, we investigate the spatial structure of seed-dispersal networks across the Gorongosa National Park, Mozambique. We show that the overall seed-dispersal network is composed by spatially explicit communities of dispersers spanning across habitats, functionally linking the landscape mosaic. Inter-habitat connectivity determines spatial structure, which cannot be accurately described with standard monolayer approaches either splitting or merging habitats. Multilayer modularity cannot be predicted by null models randomizing either interactions within each habitat or those linking habitats; however, as habitat connectivity increases, random processes become more important for overall structure. The importance of dispersers for the overall network structure is captured by multilayer versatility but not by standard metrics. Highly versatile species disperse many plant species across multiple habitats, being critical to landscape functional cohesion.

  6. EEG source reconstruction reveals frontal-parietal dynamics of spatial conflict processing

    OpenAIRE

    Cohen, M.X.; Ridderinkhof, K.R.

    2013-01-01

    Cognitive control requires the suppression of distracting information in order to focus on task-relevant information. We applied EEG source reconstruction via time-frequency linear constrained minimum variance beamforming to help elucidate the neural mechanisms involved in spatial conflict processing. Human subjects performed a Simon task, in which conflict was induced by incongruence between spatial location and response hand. We found an early (?200 ms post-stimulus) conflict modulation in ...

  7. Cryo-EM Structure of the Archaeal 50S Ribosomal Subunit in Complex with Initiation Factor 6 and Implications for Ribosome Evolution

    Science.gov (United States)

    Greber, Basil J.; Boehringer, Daniel; Godinic-Mikulcic, Vlatka; Crnkovic, Ana; Ibba, Michael; Weygand-Durasevic, Ivana; Ban, Nenad

    2013-01-01

    Translation of mRNA into proteins by the ribosome is universally conserved in all cellular life. The composition and complexity of the translation machinery differ markedly between the three domains of life. Organisms from the domain Archaea show an intermediate level of complexity, sharing several additional components of the translation machinery with eukaryotes that are absent in bacteria. One of these translation factors is initiation factor 6 (IF6), which associates with the large ribosomal subunit. We have reconstructed the 50S ribosomal subunit from the archaeon Methanothermobacter thermautotrophicus in complex with archaeal IF6 at 6.6 Å resolution using cryo-electron microscopy (EM). The structure provides detailed architectural insights into the 50S ribosomal subunit from a methanogenic archaeon through identification of the rRNA expansion segments and ribosomal proteins that are shared between this archaeal ribosome and eukaryotic ribosomes but are mostly absent in bacteria and in some archaeal lineages. Furthermore, the structure reveals that, in spite of highly divergent evolutionary trajectories of the ribosomal particle and the acquisition of novel functions of IF6 in eukaryotes, the molecular binding of IF6 on the ribosome is conserved between eukaryotes and archaea. The structure also provides a snapshot of the reductive evolution of the archaeal ribosome and offers new insights into the evolution of the translation system in archaea. PMID:22306461

  8. Large-area imaging reveals biologically driven non-random spatial patterns of corals at a remote reef

    Science.gov (United States)

    Edwards, Clinton B.; Eynaud, Yoan; Williams, Gareth J.; Pedersen, Nicole E.; Zgliczynski, Brian J.; Gleason, Arthur C. R.; Smith, Jennifer E.; Sandin, Stuart A.

    2017-12-01

    For sessile organisms such as reef-building corals, differences in the degree of dispersion of individuals across a landscape may result from important differences in life-history strategies or may reflect patterns of habitat availability. Descriptions of spatial patterns can thus be useful not only for the identification of key biological and physical mechanisms structuring an ecosystem, but also by providing the data necessary to generate and test ecological theory. Here, we used an in situ imaging technique to create large-area photomosaics of 16 plots at Palmyra Atoll, central Pacific, each covering 100 m2 of benthic habitat. We mapped the location of 44,008 coral colonies and identified each to the lowest taxonomic level possible. Using metrics of spatial dispersion, we tested for departures from spatial randomness. We also used targeted model fitting to explore candidate processes leading to differences in spatial patterns among taxa. Most taxa were clustered and the degree of clustering varied by taxon. A small number of taxa did not significantly depart from randomness and none revealed evidence of spatial uniformity. Importantly, taxa that readily fragment or tolerate stress through partial mortality were more clustered. With little exception, clustering patterns were consistent with models of fragmentation and dispersal limitation. In some taxa, dispersion was linearly related to abundance, suggesting density dependence of spatial patterning. The spatial patterns of stony corals are non-random and reflect fundamental life-history characteristics of the taxa, suggesting that the reef landscape may, in many cases, have important elements of spatial predictability.

  9. Revealing the regime of shallow coral reefs at patch scale by continuous spatial modeling

    Directory of Open Access Journals (Sweden)

    Antoine eCollin

    2014-11-01

    Full Text Available Reliably translating real-world spatial patterns of ecosystems is critical for understanding processes susceptible to reinforce resilience. However the great majority of studies in spatial ecology use thematic maps to describe habitats and species in a binary scheme. By discretizing the transitional areas and neglecting the gradual replacement across a given space, the thematic approach may suffer from substantial limitations when interpreting patterns created by many continuous variables. Here, local and regional spectral proxies were used to design and spatially map at very fine scale a continuous index dedicated to one of the most complex seascapes, the coral reefscape. Through a groundbreaking merge of bottom-up and top-down approach, we demonstrate that three to seven-habitat continuous indices can be modeled by nine, six, four and three spectral proxies, respectively, at 0.5 m spatial resolution using hand- and spaceborne measurements. We map the seven-habitat continuous index, spanning major Indo-Pacific coral reef habitats through the far red-green normalized difference ratio over the entire lagoon of a low (Tetiaroa atoll and a high volcanic (Moorea island in French Polynesia with 84% and 82% accuracy, respectively. Further examinations of the two resulting spatial models using a customized histoscape (density function of model values distributed on a concentric strip across the reef crest-coastline distance show that Tetiaroa exhibits a greater variety of coral reef habitats than Moorea. By designing such easy-to-implement, transferrable spectral proxies of coral reef regime, this study initiates a framework for spatial ecologists tackling coral reef biodiversity, responses to stresses, perturbations and shifts. We discuss the limitations and contributions of our findings towards the study of worldwide coral reef resilience following stochastic environmental change.

  10. EEG source reconstruction reveals frontal-parietal dynamics of spatial conflict processing

    NARCIS (Netherlands)

    Cohen, M.X.; Ridderinkhof, K.R.

    2013-01-01

    Cognitive control requires the suppression of distracting information in order to focus on task-relevant information. We applied EEG source reconstruction via time-frequency linear constrained minimum variance beamforming to help elucidate the neural mechanisms involved in spatial conflict

  11. A Bayesian multidimensional scaling procedure for the spatial analysis of revealed choice data

    NARCIS (Netherlands)

    DeSarbo, WS; Kim, Y; Fong, D

    1999-01-01

    We present a new Bayesian formulation of a vector multidimensional scaling procedure for the spatial analysis of binary choice data. The Gibbs sampler is gainfully employed to estimate the posterior distribution of the specified scalar products, bilinear model parameters. The computational procedure

  12. Participatory boat tracking reveals spatial fishing patterns in an Indonesian artisanal fishery

    DEFF Research Database (Denmark)

    Forero, Gabriela Navarrete; Miñarro, Sara; Mildenberger, Tobias

    2017-01-01

    for the coral reef ecosystem, contributing to its overall degradation. Estimations on the ecological impacts of different levels of fishing pressure, as well as fisheries stock assessments and marine resource management require precise information of the spatial distribution of fishing effort, which involves...

  13. Spatially Explicit Modeling Reveals Cephalopod Distributions Match Contrasting Trophic Pathways in the Western Mediterranean Sea.

    Directory of Open Access Journals (Sweden)

    Patricia Puerta

    Full Text Available Populations of the same species can experience different responses to the environment throughout their distributional range as a result of spatial and temporal heterogeneity in habitat conditions. This highlights the importance of understanding the processes governing species distribution at local scales. However, research on species distribution often averages environmental covariates across large geographic areas, missing variability in population-environment interactions within geographically distinct regions. We used spatially explicit models to identify interactions between species and environmental, including chlorophyll a (Chla and sea surface temperature (SST, and trophic (prey density conditions, along with processes governing the distribution of two cephalopods with contrasting life-histories (octopus and squid across the western Mediterranean Sea. This approach is relevant for cephalopods, since their population dynamics are especially sensitive to variations in habitat conditions and rarely stable in abundance and location. The regional distributions of the two cephalopod species matched two different trophic pathways present in the western Mediterranean Sea, associated with the Gulf of Lion upwelling and the Ebro river discharges respectively. The effects of the studied environmental and trophic conditions were spatially variant in both species, with usually stronger effects along their distributional boundaries. We identify areas where prey availability limited the abundance of cephalopod populations as well as contrasting effects of temperature in the warmest regions. Despite distributional patterns matching productive areas, a general negative effect of Chla on cephalopod densities suggests that competition pressure is common in the study area. Additionally, results highlight the importance of trophic interactions, beyond other common environmental factors, in shaping the distribution of cephalopod populations. Our study presents

  14. Revealing Spatial Variation and Correlation of Urban Travels from Big Trajectory Data

    Science.gov (United States)

    Li, X.; Tu, W.; Shen, S.; Yue, Y.; Luo, N.; Li, Q.

    2017-09-01

    With the development of information and communication technology, spatial-temporal data that contain rich human mobility information are growing rapidly. However, the consistency of multi-mode human travel behind multi-source spatial-temporal data is not clear. To this aim, we utilized a week of taxies' and buses' GPS trajectory data and smart card data in Shenzhen, China to extract city-wide travel information of taxi, bus and metro and tested the correlation of multi-mode travel characteristics. Both the global correlation and local correlation of typical travel indicator were examined. The results show that: (1) Significant differences exist in of urban multi-mode travels. The correlation between bus travels and taxi travels, metro travel and taxi travels are globally low but locally high. (2) There are spatial differences of the correlation relationship between bus, metro and taxi travel. These findings help us understanding urban travels deeply therefore facilitate both the transport policy making and human-space interaction research.

  15. REVEALING SPATIAL VARIATION AND CORRELATION OF URBAN TRAVELS FROM BIG TRAJECTORY DATA

    Directory of Open Access Journals (Sweden)

    X. Li

    2017-09-01

    Full Text Available With the development of information and communication technology, spatial-temporal data that contain rich human mobility information are growing rapidly. However, the consistency of multi-mode human travel behind multi-source spatial-temporal data is not clear. To this aim, we utilized a week of taxies’ and buses’ GPS trajectory data and smart card data in Shenzhen, China to extract city-wide travel information of taxi, bus and metro and tested the correlation of multi-mode travel characteristics. Both the global correlation and local correlation of typical travel indicator were examined. The results show that: (1 Significant differences exist in of urban multi-mode travels. The correlation between bus travels and taxi travels, metro travel and taxi travels are globally low but locally high. (2 There are spatial differences of the correlation relationship between bus, metro and taxi travel. These findings help us understanding urban travels deeply therefore facilitate both the transport policy making and human-space interaction research.

  16. Effects of Multimodal Load on Spatial Monitoring as Revealed by ERPs.

    Science.gov (United States)

    Bonato, Mario; Spironelli, Chiara; Lisi, Matteo; Priftis, Konstantinos; Zorzi, Marco

    2015-01-01

    While the role of selective attention in filtering out irrelevant information has been extensively studied, its characteristics and neural underpinnings when multiple environmental stimuli have to be processed in parallel are much less known. Building upon a dual-task paradigm that induced spatial awareness deficits for contralesional hemispace in right hemisphere-damaged patients, we investigated the electrophysiological correlates of multimodal load during spatial monitoring in healthy participants. The position of appearance of briefly presented, lateralized targets had to be reported either in isolation (single task) or together with a concurrent task, visual or auditory, which recruited additional attentional resources (dual-task). This top-down manipulation of attentional load, without any change of the sensory stimulation, modulated the amplitude of the first positive ERP response (P1) and shifted its neural generators, with a suppression of the signal in the early visual areas during both visual and auditory dual tasks. Furthermore, later N2 contralateral components elicited by left targets were particularly influenced by the concurrent visual task and were related to increased activation of the supramarginal gyrus. These results suggest that the right hemisphere is particularly affected by load manipulations, and confirm its crucial role in subtending automatic orienting of spatial attention and in monitoring both hemispaces.

  17. Effects of Multimodal Load on Spatial Monitoring as Revealed by ERPs.

    Directory of Open Access Journals (Sweden)

    Mario Bonato

    Full Text Available While the role of selective attention in filtering out irrelevant information has been extensively studied, its characteristics and neural underpinnings when multiple environmental stimuli have to be processed in parallel are much less known. Building upon a dual-task paradigm that induced spatial awareness deficits for contralesional hemispace in right hemisphere-damaged patients, we investigated the electrophysiological correlates of multimodal load during spatial monitoring in healthy participants. The position of appearance of briefly presented, lateralized targets had to be reported either in isolation (single task or together with a concurrent task, visual or auditory, which recruited additional attentional resources (dual-task. This top-down manipulation of attentional load, without any change of the sensory stimulation, modulated the amplitude of the first positive ERP response (P1 and shifted its neural generators, with a suppression of the signal in the early visual areas during both visual and auditory dual tasks. Furthermore, later N2 contralateral components elicited by left targets were particularly influenced by the concurrent visual task and were related to increased activation of the supramarginal gyrus. These results suggest that the right hemisphere is particularly affected by load manipulations, and confirm its crucial role in subtending automatic orienting of spatial attention and in monitoring both hemispaces.

  18. Spatial models reveal the microclimatic buffering capacity of old-growth forests.

    Science.gov (United States)

    Frey, Sarah J K; Hadley, Adam S; Johnson, Sherri L; Schulze, Mark; Jones, Julia A; Betts, Matthew G

    2016-04-01

    Climate change is predicted to cause widespread declines in biodiversity, but these predictions are derived from coarse-resolution climate models applied at global scales. Such models lack the capacity to incorporate microclimate variability, which is critical to biodiversity microrefugia. In forested montane regions, microclimate is thought to be influenced by combined effects of elevation, microtopography, and vegetation, but their relative effects at fine spatial scales are poorly known. We used boosted regression trees to model the spatial distribution of fine-scale, under-canopy air temperatures in mountainous terrain. Spatial models predicted observed independent test data well (r = 0.87). As expected, elevation strongly predicted temperatures, but vegetation and microtopography also exerted critical effects. Old-growth vegetation characteristics, measured using LiDAR (light detection and ranging), appeared to have an insulating effect; maximum spring monthly temperatures decreased by 2.5°C across the observed gradient in old-growth structure. These cooling effects across a gradient in forest structure are of similar magnitude to 50-year forecasts of the Intergovernmental Panel on Climate Change and therefore have the potential to mitigate climate warming at local scales. Management strategies to conserve old-growth characteristics and to curb current rates of primary forest loss could maintain microrefugia, enhancing biodiversity persistence in mountainous systems under climate warming.

  19. Eyetracking metrics reveal impaired spatial anticipation in behavioural variant frontotemporal dementia.

    Science.gov (United States)

    Primativo, Silvia; Clark, Camilla; Yong, Keir X X; Firth, Nicholas C; Nicholas, Jennifer; Alexander, Daniel; Warren, Jason D; Rohrer, Jonathan D; Crutch, Sebastian J

    2017-11-01

    Eyetracking technology has had limited application in the dementia field to date, with most studies attempting to discriminate syndrome subgroups on the basis of basic oculomotor functions rather than higher-order cognitive abilities. Eyetracking-based tasks may also offer opportunities to reduce or ameliorate problems associated with standard paper-and-pencil cognitive tests such as the complexity and linguistic demands of verbal test instructions, and the problems of tiredness and attention associated with lengthy tasks that generate few data points at a slow rate. In the present paper we adapted the Brixton spatial anticipation test to a computerized instruction-less version where oculomotor metrics, rather than overt verbal responses, were taken into account as indicators of high level cognitive functions. Twelve bvFTD (in whom spatial anticipation deficits were expected), six SD patients (in whom deficits were predicted to be less frequent) and 38 healthy controls were presented with a 10 × 7 matrix of white circles. During each trial (N = 24) a black dot moved across seven positions on the screen, following 12 different patterns. Participants' eye movements were recorded. Frequentist statistical analysis of standard eye movement metrics were complemented by a Bayesian machine learning (ML) approach in which raw eyetracking time series datasets were examined to explore the ability to discriminate diagnostic group performance not only on the overall performance but also on individual trials. The original pen and paper Brixton test identified a spatial anticipation deficit in 7/12 (58%) of bvFTD and in 2/6 (33%) of SD patients. The eyetracking frequentist approach reported the deficit in 11/12 (92%) of bvFTD and in none (0%) of the SD patients. The machine learning approach had the main advantage of identifying significant differences from controls in 24/24 individual trials for bvFTD patients and in only 12/24 for SD patients. Results indicate that the fine

  20. REVEAL II: Seasonality and spatial variability of particle and visibility conditions in the Fraser Valley

    DEFF Research Database (Denmark)

    Pryor, S.C.; Barthelmie, R.J.

    2000-01-01

    This paper presents data collected during a year-long field experiment (REVEAL II) in the Fraser Valley, British Columbia. The data are used to provide information regarding ambient visibility conditions and fine particle concentrations in the valley. Although average fine mass measured during RE...... taken at a number of sites during REVEAL II are used to evaluate a simple method for obtaining (classed) quantitative estimates of visual range from this medium without requiring access to specialized instrumentation. (C) 2000 Elsevier Science B.V. All rights reserved....

  1. Multistate models of bigheaded carps in the Illinois River reveal spatial dynamics of invasive species

    Science.gov (United States)

    Coulter, Alison A.; Brey, Marybeth; Lubejko, Matthew; Kallis, Jahn L.; Coulter, David P.; Glover, David C.; Whitledge, Gregory W.; Garvey, James E.

    2018-01-01

    Knowledge of the spatial distributions and dispersal characteristics of invasive species is necessary for managing the spread of highly mobile species, such as invasive bigheaded carps (Bighead Carp [Hypophthalmichthys nobilis] and Silver Carp [H. molitrix]). Management of invasive bigheaded carps in the Illinois River has focused on using human-made barriers and harvest to limit dispersal towards the Laurentian Great Lakes. Acoustic telemetry data were used to parameterize multistate models to examine the spatial dynamics of bigheaded carps in the Illinois River to (1) evaluate the effects of existing dams on movement, (2) identify how individuals distribute among pools, and (3) gauge the effects of reductions in movement towards the invasion front. Multistate models estimated that movement was generally less likely among upper river pools (Starved Rock, Marseilles, and Dresden Island) than the lower river (La Grange and Peoria) which matched the pattern of gated versus wicket style dams. Simulations using estimated movement probabilities indicated that Bighead Carp accumulate in La Grange Pool while Silver Carp accumulate in Alton Pool. Fewer Bighead Carp reached the upper river compared to Silver Carp during simulations. Reducing upstream movement probabilities (e.g., reduced propagule pressure) by ≥ 75% into any of the upper river pools could reduce upper river abundance with similar results regardless of location. Given bigheaded carp reproduction in the upper Illinois River is presently limited, reduced movement towards the invasion front coupled with removal of individuals reaching these areas could limit potential future dispersal towards the Great Lakes.

  2. Effective Connectivity Reveals Right-Hemisphere Dominance in Audiospatial Perception: Implications for Models of Spatial Neglect

    Science.gov (United States)

    Friston, Karl J.; Mattingley, Jason B.; Roepstorff, Andreas; Garrido, Marta I.

    2014-01-01

    Detecting the location of salient sounds in the environment rests on the brain's ability to use differences in sounds arriving at both ears. Functional neuroimaging studies in humans indicate that the left and right auditory hemispaces are coded asymmetrically, with a rightward attentional bias that reflects spatial attention in vision. Neuropsychological observations in patients with spatial neglect have led to the formulation of two competing models: the orientation bias and right-hemisphere dominance models. The orientation bias model posits a symmetrical mapping between one side of the sensorium and the contralateral hemisphere, with mutual inhibition of the ipsilateral hemisphere. The right-hemisphere dominance model introduces a functional asymmetry in the brain's coding of space: the left hemisphere represents the right side, whereas the right hemisphere represents both sides of the sensorium. We used Dynamic Causal Modeling of effective connectivity and Bayesian model comparison to adjudicate between these alternative network architectures, based on human electroencephalographic data acquired during an auditory location oddball paradigm. Our results support a hemispheric asymmetry in a frontoparietal network that conforms to the right-hemisphere dominance model. We show that, within this frontoparietal network, forward connectivity increases selectively in the hemisphere contralateral to the side of sensory stimulation. We interpret this finding in light of hierarchical predictive coding as a selective increase in attentional gain, which is mediated by feedforward connections that carry precision-weighted prediction errors during perceptual inference. This finding supports the disconnection hypothesis of unilateral neglect and has implications for theories of its etiology. PMID:24695717

  3. Participatory Boat Tracking Reveals Spatial Fishing Patterns in an Indonesian Artisanal Fishery

    Directory of Open Access Journals (Sweden)

    Gabriela Navarrete Forero

    2017-12-01

    Full Text Available The Spermonde Archipelago holds one of the largest artisanal fisheries in Indonesia, providing livelihoods for local communities and many other people involved in international trade networks of seafood. High demand and a lack of enforcement of existing fisheries regulations turn into high pressure for the coral reef ecosystem, contributing to its overall degradation. Estimations on the ecological impacts of different levels of fishing pressure, as well as fisheries stock assessments and marine resource management require precise information of the spatial distribution of fishing effort, which involves great uncertainty when only anecdotal information is considered. We explored the feasibility of applying participatory boat tracking to complement fisheries data during the NW monsoon season 2014–2015. We conducted interviews, measured catch landings, and distributed GPS data loggers among hook and line fishermen to identify fishing grounds by gear-dependent patterns of boat movement. Most of the fishing activities involved two gears (octopus bait and trolling line for live groupers and three fishing grounds. The mass of catch landings was dominated by Octopoda (CPUE = 10.1 kg boatday−1 while the most diverse group was the fish family Serranidae, with Plectropomus leopardus being the main target species. In conclusion, boat tracking combined with interviews and catch surveys has proven a useful tool to reduce uncertainty in information on spatial resource use, while allowing a high level of participation by fishermen.

  4. Continuous place avoidance task reveals differences in spatial navigation in male and female rats.

    Science.gov (United States)

    Cimadevilla, J M; Fenton, A A; Bures, J

    2000-01-01

    A new place navigation test was used to estimate the spatial orientation abilities of male and female rats. Animals had to avoid a room frame defined area on a rotating arena, entering of which was punished by mild footshock, i.e. rats had to avoid the same place in the room but different parts of the floor, which was rotated through the punished zone. Because of the rotation of the arena (one revolution per min), animals could not rely on intramaze cues and only extramaze landmarks could be used for accurate navigation. During 8 consecutive days rats were exposed to daily 40-min sessions, consisting of 20-min acquisition and 20-min extinction (shock discontinued). The position of the punished sector centered around one of the four mutually perpendicular azimuths was daily changed in a predetermined sequence. The results showed no male female differences during acquisition and better performance of males during extinction. The performance of females was not affected by estral cycle-related hormonal changes. The findings are discussed in the light of controversial results of research into sex differences in spatial abilities.

  5. Genome-wide polysomal analysis of a yeast strain with mutated ribosomal protein S9

    Directory of Open Access Journals (Sweden)

    Arava Yoav

    2007-08-01

    Full Text Available Abstract Background The yeast ribosomal protein S9 (S9 is located at the entrance tunnel of the mRNA into the ribosome. It is known to play a role in accurate decoding and its bacterial homolog (S4 has recently been shown to be involved in opening RNA duplexes. Here we examined the effects of changing the C terminus of S9, which is rich in acidic amino acids and extends out of the ribosome surface. Results We performed a genome-wide analysis to reveal effects at the transcription and translation levels of all yeast genes. While negligible relative changes were observed in steady-state mRNA levels, a significant number of mRNAs appeared to have altered ribosomal density. Notably, 40% of the genes having reliable signals changed their ribosomal association by more than one ribosome. Yet, no general correlations with physical or functional features of the mRNA were observed. Ribosome Density Mapping (RDM along four of the mRNAs with increased association revealed an increase in ribosomal density towards the end of the coding region for at least two of them. Read-through analysis did not reveal any increase in read-through of a premature stop codon by the mutant strain. Conclusion The ribosomal protein rpS9 appears to be involved in the translation of many mRNAs, since altering its C terminus led to a significant change in ribosomal association of many mRNAs. We did not find strong correlations between these changes and several physical features of the mRNA, yet future studies with advanced tools may allow such correlations to be determined. Importantly, our results indicate an accumulation of ribosomes towards the end of the coding regions of some mRNAs. This suggests an involvement of S9 in ribosomal dissociation during translation termination.

  6. Heterogeneous Ribosomes Preferentially Translate Distinct Subpools of mRNAs Genome-wide.

    Science.gov (United States)

    Shi, Zhen; Fujii, Kotaro; Kovary, Kyle M; Genuth, Naomi R; Röst, Hannes L; Teruel, Mary N; Barna, Maria

    2017-07-06

    Emerging studies have linked the ribosome to more selective control of gene regulation. However, an outstanding question is whether ribosome heterogeneity at the level of core ribosomal proteins (RPs) exists and enables ribosomes to preferentially translate specific mRNAs genome-wide. Here, we measured the absolute abundance of RPs in translating ribosomes and profiled transcripts that are enriched or depleted from select subsets of ribosomes within embryonic stem cells. We find that heterogeneity in RP composition endows ribosomes with differential selectivity for translating subpools of transcripts, including those controlling metabolism, cell cycle, and development. As an example, mRNAs enriched in binding to RPL10A/uL1-containing ribosomes are shown to require RPL10A/uL1 for their efficient translation. Within several of these transcripts, this level of regulation is mediated, at least in part, by internal ribosome entry sites. Together, these results reveal a critical functional link between ribosome heterogeneity and the post-transcriptional circuitry of gene expression. Copyright © 2017 Elsevier Inc. All rights reserved.

  7. Mapping organelle motion reveals a vesicular conveyor belt spatially replenishing secretory vesicles in stimulated chromaffin cells.

    Science.gov (United States)

    Maucort, Guillaume; Kasula, Ravikiran; Papadopulos, Andreas; Nieminen, Timo A; Rubinsztein-Dunlop, Halina; Meunier, Frederic A

    2014-01-01

    How neurosecretory cells spatially adjust their secretory vesicle pools to replenish those that have fused and released their hormonal content is currently unknown. Here we designed a novel set of image analyses to map the probability of tracked organelles undergoing a specific type of movement (free, caged or directed). We then applied our analysis to time-lapse z-stack confocal imaging of secretory vesicles from bovine Chromaffin cells to map the global changes in vesicle motion and directionality occurring upon secretagogue stimulation. We report a defined region abutting the cortical actin network that actively transports secretory vesicles and is dissipated by actin and microtubule depolymerizing drugs. The directionality of this "conveyor belt" towards the cell surface is activated by stimulation. Actin and microtubule networks therefore cooperatively probe the microenvironment to transport secretory vesicles to the periphery, providing a mechanism whereby cells globally adjust their vesicle pools in response to secretagogue stimulation.

  8. SPATIAL VARIATIONS OF PAH PROPERTIES IN M17SW REVEALED BY SPITZER /IRS SPECTRAL MAPPING

    Energy Technology Data Exchange (ETDEWEB)

    Yamagishi, M. [Institute of Space and Astronautical Science, Japan Aerospace Exploration Agency, Chuo-ku, Sagamihara 252-5210 (Japan); Kaneda, H.; Ishihara, D.; Oyabu, S.; Suzuki, T.; Nishimura, A.; Kohno, M. [Graduate School of Science, Nagoya University, Furo-cho, Chikusa-ku, Nagoya 464-8602 (Japan); Onaka, T.; Ohashi, S. [Graduate School of Science, The University of Tokyo, 7-3-1 Hongo, Bunkyo-ku, Tokyo 113-0033 (Japan); Nagayama, T.; Matsuo, M. [Graduate School of Science and Engineering, Kagoshima University, 1-21-35 Korimoto, Kagoshima 890-0065 (Japan); Umemoto, T.; Minamidani, T.; Fujita, S. [Nobeyama Radio Observatory, National Astronomical Observatory of Japan (NAOJ), National Institutes of Natural Sciences (NINS), 462-2, Nobeyama, Minamimaki, Minamisaku, Nagano 384-1305 (Japan); Tsuda, Y., E-mail: yamagish@ir.isas.jaxa.jp [Graduate School of Science and Engineering, Meisei University, 2-1-1 Hodokubo, Hino, Tokyo 191-0042 (Japan)

    2016-12-20

    We present Spitzer /IRS mid-infrared spectral maps of the Galactic star-forming region M17 as well as IRSF/SIRIUS Br γ and Nobeyama 45 m/FOREST {sup 13}CO ( J = 1–0) maps. The spectra show prominent features due to polycyclic aromatic hydrocarbons (PAHs) at wavelengths of 6.2, 7.7, 8.6, 11.3, 12.0, 12.7, 13.5, and 14.2  μ m. We find that the PAH emission features are bright in the region between the H ii region traced by Br γ and the molecular cloud traced by {sup 13}CO, supporting that the PAH emission originates mostly from photo-dissociation regions. Based on the spatially resolved Spitzer /IRS maps, we examine spatial variations of the PAH properties in detail. As a result, we find that the interband ratio of PAH 7.7  μ m/PAH 11.3  μ m varies locally near M17SW, but rather independently of the distance from the OB stars in M17, suggesting that the degree of PAH ionization is mainly controlled by local conditions rather than the global UV environments determined by the OB stars in M17. We also find that the interband ratios of the PAH 12.0  μ m, 12.7  μ m, 13.5  μ m, and 14.2  μ m features to the PAH 11.3  μ m feature are high near the M17 center, which suggests structural changes of PAHs through processing due to intense UV radiation, producing abundant edgy irregular PAHs near the M17 center.

  9. Spatially resolved metabolic analysis reveals a central role for transcriptional control in carbon allocation to wood.

    Science.gov (United States)

    Roach, Melissa; Arrivault, Stéphanie; Mahboubi, Amir; Krohn, Nicole; Sulpice, Ronan; Stitt, Mark; Niittylä, Totte

    2017-06-15

    The contribution of transcriptional and post-transcriptional regulation to modifying carbon allocation to developing wood of trees is not well defined. To clarify the role of transcriptional regulation, the enzyme activity patterns of eight central primary metabolism enzymes across phloem, cambium, and developing wood of aspen (Populus tremula L.) were compared with transcript levels obtained by RNA sequencing of sequential stem sections from the same trees. Enzymes were selected on the basis of their importance in sugar metabolism and in linking primary metabolism to lignin biosynthesis. Existing enzyme assays were adapted to allow measurements from ~1 mm3 sections of dissected stem tissue. These experiments provided high spatial resolution of enzyme activity changes across different stages of wood development, and identified the gene transcripts probably responsible for these changes. In most cases, there was a clear positive relationship between transcripts and enzyme activity. During secondary cell wall formation, the increases in transcript levels and enzyme activities also matched with increased levels of glucose, fructose, hexose phosphates, and UDP-glucose, emphasizing an important role for transcriptional regulation in carbon allocation to developing aspen wood. These observations corroborate the efforts to increase carbon allocation to wood by engineering gene regulatory networks. © The Author 2017. Published by Oxford University Press on behalf of the Society for Experimental Biology.

  10. The Complete Structure of the Mycobacterium smegmatis 70S Ribosome.

    Science.gov (United States)

    Hentschel, Jendrik; Burnside, Chloe; Mignot, Ingrid; Leibundgut, Marc; Boehringer, Daniel; Ban, Nenad

    2017-07-05

    The ribosome carries out the synthesis of proteins in every living cell. It consequently represents a frontline target in anti-microbial therapy. Tuberculosis ranks among the leading causes of death worldwide, due in large part to the combination of difficult-to-treat latency and antibiotic resistance. Here, we present the 3.3-Å cryo-EM structure of the 70S ribosome of Mycobacterium smegmatis, a close relative to the human pathogen Mycobacterium tuberculosis. The structure reveals two additional ribosomal proteins and localizes them to the vicinity of drug-target sites in both the catalytic center and the decoding site of the ribosome. Furthermore, we visualized actinobacterium-specific rRNA and protein expansions that extensively remodel the ribosomal surface with implications for polysome organization. Our results provide a foundation for understanding the idiosyncrasies of mycobacterial translation and reveal atomic details of the structure that will facilitate the design of anti-tubercular therapeutics. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

  11. Large behavioral variability of motile E. coli revealed in 3D spatial exploration

    Science.gov (United States)

    Figueroa-Morales, N.; Darnige, T.; Martinez, V.; Douarche, C.; Soto, R.; Lindner, A.; Clement, E.

    2017-11-01

    Bacterial motility determines the spatio-temporal structure of microbial communities, controls infection spreading and the microbiota organization in guts or in soils. Quantitative modeling of chemotaxis and statistical descriptions of active bacterial suspensions currently rely on the classical vision of a run-and-tumble strategy exploited by bacteria to explore their environment. Here we report a large behavioral variability of wild-type E. coli, revealed in their three-dimensional trajectories. We found a broad distribution of run times for individual cells, in stark contrast with the accepted vision of a single characteristic time. We relate our results to the slow fluctuations of a signaling protein which triggers the switching of the flagellar motor reversal responsible for tumbles. We demonstrate that such a large distribution of run times introduces measurement biases in most practical situations. These results reconcile a notorious conundrum between observations of run times and motor switching statistics. Our study implies that the statistical modeling of transport properties and of the chemotactic response of bacterial populations need to be profoundly revised to correctly account for the large variability of motility features.

  12. Hypoxic stress-induced changes in ribosomes of maize seedling roots

    International Nuclear Information System (INIS)

    Bailey-Serres, J.; Freeling, M.

    1990-01-01

    The hypoxic stress response of Zea mays L. seedling roots involves regulation of gene expression at transcriptional and posttranscriptional levels. We investigated the effect of hypoxia on the translational machinery of seedling roots. The levels of monoribosomes and ribosomal subunits increased dramatically within 1 hour of stress. Prolonged hypoxia resulted in continued accumulation of nontranslating ribosomes, as well as increased levels of small polyribosomes. The return of seedlings to normal aerobic conditions resulted in recovery of normal polyribosome levels. Comparison of ribosomal proteins from control and hypoxic roots revealed differences in quantity and electrophoretic mobility. In vivo labeling of roots with [ 35 S]methionine revealed variations in newly synthesized ribosomal proteins. In vivo labeling of roots with [ 32 P]orthophosphate revealed a major reduction in the phosphorylation of a 31 kilodalton ribosomal protein in hypoxic stressed roots. In vitro phosphorylation of ribosomal proteins by endogenous kinases was used to probe for differences in ribosome structure and composition. The patterns of in vitro kinased phosphoproteins of ribosomes from control and hypoxic roots were not identical. Variation in phosphoproteins of polyribosomes from control and hypoxic roots, as well as among polyribosomes from hypoxic roots were observed. These results indicate that modification of the translational machinery occurs in response to hypoxic stress

  13. Ribosome dynamics and tRNA movement by time-resolved electron cryomicroscopy.

    Science.gov (United States)

    Fischer, Niels; Konevega, Andrey L; Wintermeyer, Wolfgang; Rodnina, Marina V; Stark, Holger

    2010-07-15

    The translocation step of protein synthesis entails large-scale rearrangements of the ribosome-transfer RNA (tRNA) complex. Here we have followed tRNA movement through the ribosome during translocation by time-resolved single-particle electron cryomicroscopy (cryo-EM). Unbiased computational sorting of cryo-EM images yielded 50 distinct three-dimensional reconstructions, showing the tRNAs in classical, hybrid and various novel intermediate states that provide trajectories and kinetic information about tRNA movement through the ribosome. The structures indicate how tRNA movement is coupled with global and local conformational changes of the ribosome, in particular of the head and body of the small ribosomal subunit, and show that dynamic interactions between tRNAs and ribosomal residues confine the path of the tRNAs through the ribosome. The temperature dependence of ribosome dynamics reveals a surprisingly flat energy landscape of conformational variations at physiological temperature. The ribosome functions as a Brownian machine that couples spontaneous conformational changes driven by thermal energy to directed movement.

  14. Ribosomes slide on lysine-encoding homopolymeric A stretches

    Science.gov (United States)

    Koutmou, Kristin S; Schuller, Anthony P; Brunelle, Julie L; Radhakrishnan, Aditya; Djuranovic, Sergej; Green, Rachel

    2015-01-01

    Protein output from synonymous codons is thought to be equivalent if appropriate tRNAs are sufficiently abundant. Here we show that mRNAs encoding iterated lysine codons, AAA or AAG, differentially impact protein synthesis: insertion of iterated AAA codons into an ORF diminishes protein expression more than insertion of synonymous AAG codons. Kinetic studies in E. coli reveal that differential protein production results from pausing on consecutive AAA-lysines followed by ribosome sliding on homopolymeric A sequence. Translation in a cell-free expression system demonstrates that diminished output from AAA-codon-containing reporters results from premature translation termination on out of frame stop codons following ribosome sliding. In eukaryotes, these premature termination events target the mRNAs for Nonsense-Mediated-Decay (NMD). The finding that ribosomes slide on homopolymeric A sequences explains bioinformatic analyses indicating that consecutive AAA codons are under-represented in gene-coding sequences. Ribosome ‘sliding’ represents an unexpected type of ribosome movement possible during translation. DOI: http://dx.doi.org/10.7554/eLife.05534.001 PMID:25695637

  15. Hierarchical recruitment of ribosomal proteins and assembly factors remodels nucleolar pre-60S ribosomes.

    Science.gov (United States)

    Biedka, Stephanie; Micic, Jelena; Wilson, Daniel; Brown, Hailey; Diorio-Toth, Luke; Woolford, John L

    2018-04-24

    Ribosome biogenesis involves numerous preribosomal RNA (pre-rRNA) processing events to remove internal and external transcribed spacer sequences, ultimately yielding three mature rRNAs. Removal of the internal transcribed spacer 2 spacer RNA is the final step in large subunit pre-rRNA processing and begins with endonucleolytic cleavage at the C 2 site of 27SB pre-rRNA. C 2 cleavage requires the hierarchical recruitment of 11 ribosomal proteins and 14 ribosome assembly factors. However, the function of these proteins in C 2 cleavage remained unclear. In this study, we have performed a detailed analysis of the effects of depleting proteins required for C 2 cleavage and interpreted these results using cryo-electron microscopy structures of assembling 60S subunits. This work revealed that these proteins are required for remodeling of several neighborhoods, including two major functional centers of the 60S subunit, suggesting that these remodeling events form a checkpoint leading to C 2 cleavage. Interestingly, when C 2 cleavage is directly blocked by depleting or inactivating the C 2 endonuclease, assembly progresses through all other subsequent steps. © 2018 Biedka et al.

  16. Linking social and spatial networks to viral community phylogenetics reveals subtype-specific transmission dynamics in African lions.

    Science.gov (United States)

    Fountain-Jones, Nicholas M; Packer, Craig; Troyer, Jennifer L; VanderWaal, Kimberly; Robinson, Stacie; Jacquot, Maude; Craft, Meggan E

    2017-10-01

    Heterogeneity within pathogen species can have important consequences for how pathogens transmit across landscapes; however, discerning different transmission routes is challenging. Here, we apply both phylodynamic and phylogenetic community ecology techniques to examine the consequences of pathogen heterogeneity on transmission by assessing subtype-specific transmission pathways in a social carnivore. We use comprehensive social and spatial network data to examine transmission pathways for three subtypes of feline immunodeficiency virus (FIV Ple ) in African lions (Panthera leo) at multiple scales in the Serengeti National Park, Tanzania. We used FIV Ple molecular data to examine the role of social organization and lion density in shaping transmission pathways and tested to what extent vertical (i.e., father- and/or mother-offspring relationships) or horizontal (between unrelated individuals) transmission underpinned these patterns for each subtype. Using the same data, we constructed subtype-specific FIV Ple co-occurrence networks and assessed what combination of social networks, spatial networks or co-infection best structured the FIV Ple network. While social organization (i.e., pride) was an important component of FIV Ple transmission pathways at all scales, we find that FIV Ple subtypes exhibited different transmission pathways at within- and between-pride scales. A combination of social and spatial networks, coupled with consideration of subtype co-infection, was likely to be important for FIV Ple transmission for the two major subtypes, but the relative contribution of each factor was strongly subtype-specific. Our study provides evidence that pathogen heterogeneity is important in understanding pathogen transmission, which could have consequences for how endemic pathogens are managed. Furthermore, we demonstrate that community phylogenetic ecology coupled with phylodynamic techniques can reveal insights into the differential evolutionary pressures acting

  17. Indigenous knowledge and science unite to reveal spatial and temporal dimensions of distributional shift in wildlife of conservation concern.

    Directory of Open Access Journals (Sweden)

    Christina N Service

    Full Text Available Range shifts among wildlife can occur rapidly and impose cascading ecological, economic, and cultural consequences. However, occurrence data used to define distributional limits derived from scientific approaches are often outdated for wide ranging and elusive species, especially in remote environments. Accordingly, our aim was to amalgamate indigenous and western scientific evidence of grizzly bear (Ursus arctos horribilis records and detail a potential range shift on the central coast of British Columbia, Canada. In addition, we test the hypothesis that data from each method yield similar results, as well as illustrate the complementary nature of this coupled approach. Combining information from traditional and local ecological knowledge (TEK/LEK interviews with remote camera, genetic, and hunting data revealed that grizzly bears are now present on 10 islands outside their current management boundary. LEK interview data suggested this expansion has accelerated over the last 10 years. Both approaches provided complementary details and primarily affirmed one another: all islands with scientific evidence for occupation had consistent TEK/LEK evidence. Moreover, our complementary methods approach enabled a more spatially and temporally detailed account than either method would have afforded alone. In many cases, knowledge already held by local indigenous people could provide timely and inexpensive data about changing ecological processes. However, verifying the accuracy of scientific and experiential knowledge by pairing sources at the same spatial scale allows for increased confidence and detail. A similarly coupled approach may be useful across taxa in many regions.

  18. Collaborative activity between parietal and dorso-lateral prefrontal cortex in dynamic spatial working memory revealed by fMRI.

    Science.gov (United States)

    Diwadkar, V A; Carpenter, P A; Just, M A

    2000-07-01

    Functional MRI was used to determine how the constituents of the cortical network subserving dynamic spatial working memory respond to two types of increases in task complexity. Participants mentally maintained the most recent location of either one or three objects as the three objects moved discretely in either a two- or three-dimensional array. Cortical activation in the dorsolateral prefrontal (DLPFC) and the parietal cortex increased as a function of the number of object locations to be maintained and the dimensionality of the display. An analysis of the response characteristics of the individual voxels showed that a large proportion were activated only when both the variables imposed the higher level of demand. A smaller proportion were activated specifically in response to increases in task demand associated with each of the independent variables. A second experiment revealed the same effect of dimensionality in the parietal cortex when the movement of objects was signaled auditorily rather than visually, indicating that the additional representational demands induced by 3-D space are independent of input modality. The comodulation of activation in the prefrontal and parietal areas by the amount of computational demand suggests that the collaboration between areas is a basic feature underlying much of the functionality of spatial working memory. Copyright 2000 Academic Press.

  19. Catch and Release: A dense, longitudinal array of water quality sondes reveals spatial and temporal complexities in suspended sediment flux

    Science.gov (United States)

    Guilinger, J. J.; Crosby, B. T.

    2017-12-01

    Excessive suspended sediment in streams is one of the most common causes for industrial, ecological and recreational stream impairment in the US. Identifying the primary geomorphic or anthropogenic sources of sediment is a key step in the effective mitigation of impairment. This study seeks to identify sources of suspended sediment in an agriculturally impaired watershed, Marsh Creek, in southeast Idaho. We employ thirteen multi-parameter water quality sensors to simultaneously measure stage, turbidity, temperature and conductivity every 15 minutes over a full calendar year. Examined at both the event and annual scale, these data enable mass balance calculations for mainstem and tributary contributions. Revealed in this monitoring is an approximately eight-fold longitudinal increase in sediment flux over 74 km that is largely augmented by eroding mainstem banks in reaches with higher stream power in the lower 30 km, with less than 20% contributed from tributaries. Independent data confirming the bank source were acquired through cost-effective sediment fingerprinting using 15N and C:N signatures from potential soil endmembers. Additionally, Google Street View-type longitudinal imagery of banks was collected via a kayak survey to confirm the spatial extent and magnitude of bank erosion along Marsh Creek. These data converge on bank erosion as the primary source of fine sediment. Sediment load at various hierarchical temporal and spatial scales is impacted by in-stream storage and remobilization, especially over shorter timescales ranging from daily to seasonal periods. Once averaged over the annual scale, local, temporary in-channel storage is overcome and these data reveal source reaches that can be prioritized for restoration and mitigation projects.

  20. 5S rRNA and ribosome.

    Science.gov (United States)

    Gongadze, G M

    2011-12-01

    5S rRNA is an integral component of the ribosome of all living organisms. It is known that the ribosome without 5S rRNA is functionally inactive. However, the question about the specific role of this RNA in functioning of the translation apparatus is still open. This review presents a brief history of the discovery of 5S rRNA and studies of its origin and localization in the ribosome. The previously expressed hypotheses about the role of this RNA in the functioning of the ribosome are discussed considering the unique location of 5S rRNA in the ribosome and its intermolecular contacts. Based on analysis of the current data on ribosome structure and its functional complexes, the role of 5S rRNA as an intermediary between ribosome functional domains is discussed.

  1. Quantitative Imaging of Cholinergic Interneurons Reveals a Distinctive Spatial Organization and a Functional Gradient across the Mouse Striatum.

    Directory of Open Access Journals (Sweden)

    Miriam Matamales

    Full Text Available Information processing in the striatum requires the postsynaptic integration of glutamatergic and dopaminergic signals, which are then relayed to the output nuclei of the basal ganglia to influence behavior. Although cellularly homogeneous in appearance, the striatum contains several rare interneuron populations which tightly modulate striatal function. Of these, cholinergic interneurons (CINs have been recently shown to play a critical role in the control of reward-related learning; however how the striatal cholinergic network is functionally organized at the mesoscopic level and the way this organization influences striatal function remains poorly understood. Here, we systematically mapped and digitally reconstructed the entire ensemble of CINs in the mouse striatum and quantitatively assessed differences in densities, spatial arrangement and neuropil content across striatal functional territories. This approach demonstrated that the rostral portion of the striatum contained a higher concentration of CINs than the caudal striatum and that the cholinergic content in the core of the ventral striatum was significantly lower than in the rest of the regions. Additionally, statistical comparison of spatial point patterns in the striatal cholinergic ensemble revealed that only a minor portion of CINs (17% aggregated into cluster and that they were predominantly organized in a random fashion. Furthermore, we used a fluorescence reporter to estimate the activity of over two thousand CINs in naïve mice and found that there was a decreasing gradient of CIN overall function along the dorsomedial-to-ventrolateral axis, which appeared to be independent of their propensity to aggregate within the striatum. Altogether this work suggests that the regulation of striatal function by acetylcholine across the striatum is highly heterogeneous, and that signals originating in external afferent systems may be principally determining the function of CINs in the

  2. Ice Penetrating Radar Reveals Spatially Variable Features in Basal Channel under the Nansen Ice Shelf, Terra Nova Bay, Antarctica

    Science.gov (United States)

    Wray, P. L.; Dow, C. F.; Mueller, D.; Lee, W. S.; Lindzey, L.; Greenbaum, J. S.; Blankenship, D. D.

    2017-12-01

    The stability of Antarctic ice shelves is of great concern as their current thinning and future collapse will contribute to sea-level rise via the acceleration of grounded tributary glaciers into the ocean. The study of the sub-ice-shelf environment is essential for understanding ice-ocean interaction, where warming ocean temperatures have already begun to threaten the long-term viability of Antarctic ice shelves. Obtaining direct measurements of the sub-ice-shelf cavity remains challenging. Here, we demonstrate that ground-based geophysical methods can deliver high resolution monitoring and mapping of the spatial and temporal changes in features, melt rates, and ice mass transport of this environment. In November 2016, 84 km of ground-based, low frequency, Ice Penetrating Radar (IPR) surveys were completed on three sites over the Nansen Ice Shelf in Terra Nova Bay, Antarctica. The surveys examined an ocean-sourced basal channel incised into the bottom of the shelf, originally detected from a large surface depression. Results reveal high resolution features of a several kilometre-wide, 100 m high channel, with 40 m high sub-channels, zones of significant marine ice accumulation, and basal crevasses penetrating large fractions of the ice shelf thickness. Data from multiple airborne geophysical surveys were compared to the November 2016 IPR data to calculate mass change both spatially and temporally. Many of the smaller scale features we detected are not represented through hydrostatic equilibrium as calculated from ice thicknesses, due to bridging stresses, and as such can not be detected with satellite based remote sensing methods. Our in-field geophysical methods produced high-resolution information of these features, which underscores the need for similar surveys over vulnerable ice shelves to better understand ice-ocean processes.

  3. The primary structures of ribosomal proteins S14 and S16 from the archaebacterium Halobacterium marismortui. Comparison with eubacterial and eukaryotic ribosomal proteins.

    Science.gov (United States)

    Kimura, J; Kimura, M

    1987-09-05

    The amino acid sequences of two ribosomal proteins, S14 and S16, from the archaebacterium Halobacterium marismortui have been determined. Sequence data were obtained by the manual and solid-phase sequencing of peptides derived from enzymatic digestions with trypsin, chymotrypsin, pepsin, and Staphylococcus aureus protease as well as by chemical cleavage with cyanogen bromide. Proteins S14 and S16 contain 109 and 126 amino acid residues and have Mr values of 11,964 and 13,515, respectively. Comparison of the sequences with those of ribosomal proteins from other organisms demonstrates that S14 has a significant homology with the rat liver ribosomal protein S11 (36% identity) as well as with the Escherichia coli ribosomal protein S17 (37%), and that S16 is related to the yeast ribosomal protein YS22 (40%) and proteins S8 from E. coli (28%) and Bacillus stearothermophilus (30%). A comparison of the amino acid residues in the homologous regions of halophilic and nonhalophilic ribosomal proteins reveals that halophilic proteins have more glutamic acids, asparatic acids, prolines, and alanines, and less lysines, arginines, and isoleucines than their nonhalophilic counterparts. These amino acid substitutions probably contribute to the structural stability of halophilic ribosomal proteins.

  4. Linezolid-Dependent Function and Structure Adaptation of Ribosomes in a Staphylococcus epidermidis Strain Exhibiting Linezolid Dependence

    Science.gov (United States)

    Kokkori, Sofia; Apostolidi, Maria; Tsakris, Athanassios; Pournaras, Spyros

    2014-01-01

    Linezolid-dependent growth was recently reported in Staphylococcus epidermidis clinical strains carrying mutations associated with linezolid resistance. To investigate this unexpected behavior at the molecular level, we isolated active ribosomes from one of the linezolid-dependent strains and we compared them with ribosomes isolated from a wild-type strain. Both strains were grown in the absence and presence of linezolid. Detailed biochemical and structural analyses revealed essential differences in the function and structure of isolated ribosomes which were assembled in the presence of linezolid. The catalytic activity of peptidyltransferase was found to be significantly higher in the ribosomes derived from the linezolid-dependent strain. Interestingly, the same ribosomes exhibited an abnormal ribosomal subunit dissociation profile on a sucrose gradient in the absence of linezolid, but the profile was restored after treatment of the ribosomes with an excess of the antibiotic. Our study suggests that linezolid most likely modified the ribosomal assembly procedure, leading to a new functional ribosomal population active only in the presence of linezolid. Therefore, the higher growth rate of the partially linezolid-dependent strains could be attributed to the functional and structural adaptations of ribosomes to linezolid. PMID:24890589

  5. Spatial distribution of intra-molecular water and polymeric components in polyelectrolyte dendrimers revealed by small angle scattering investigations

    Science.gov (United States)

    Wu, Bin; Li, Xin; Do, Changwoo; Kim, Tae-Hwan; Shew, Chwen-Yang; Liu, Yun; Yang, Jun; Hong, Kunlun; Porcar, Lionel; Chen, Chun-Yu; Liu, Emily L.; Smith, Gregory S.; Herwig, Kenneth W.; Chen, Wei-Ren

    2011-10-01

    An experimental scheme using contrast variation small angle neutron scattering technique is developed to investigate the structural characteristics of amine-terminated poly(amidoamine) dendrimers solutions. Using this methodology, we present the dependence of both the intra-dendrimer water and the polymer distribution on molecular protonation, which can be precisely adjusted by tuning the pH of the solution. Assuming spherical symmetry of the spatial arrangement of the constituent components of dendrimer, and that the atomic ratio of hydrogen-to-deuterium for the solvent residing within the cavities of dendrimer is identical to that for the solvent outside the dendrimer, the intra-dendrimer water distribution along the radial direction is determined. Our result clearly reveals an outward relocation of the peripheral groups, as well as enhanced intra-dendrimer hydration, upon increasing the molecular protonation and, therefore, allows the determination of segmental backfolding in a quantitative manner. The connection between these charge-induced structural changes and our recently observed progressively active segmental dynamics is also discussed.

  6. Control of ribosome formation in rat heart

    International Nuclear Information System (INIS)

    Russo, L.A.

    1987-01-01

    Diabetes of 9 days duration produced a 17% diminution in the rate of total protein synthesis in rat hearts perfused as Langendorff preparations supplied with glucose, plasma levels of amino acids, and 400 μU/ml insulin. This reduction was attributable to a decrease in efficiency of protein synthesis and total RNA content. Total messenger RNA content decreased in diabetic hearts in proportion to the reduction in total RNA. Diabetes also resulted in diminished ribosome content as reflected by the induction in total RNA. Ribosome production was investigated by monitoring incorporation of [ 3 H]phenylalanine into the proteins of cytoplasmic ribosomes. Rates of ribosome formation in diabetic hearts were as fast as control rates in the presence of insulin, and were faster than control rates in the absence of the hormone. These results indicated that ribosome content fell in diabetic hearts despite unchanged or faster rates of ribosome formation

  7. Dynamic enzyme docking to the ribosome coordinates N-terminal processing with polypeptide folding.

    Science.gov (United States)

    Sandikci, Arzu; Gloge, Felix; Martinez, Michael; Mayer, Matthias P; Wade, Rebecca; Bukau, Bernd; Kramer, Günter

    2013-07-01

    Newly synthesized polypeptides undergo various cotranslational maturation steps, including N-terminal enzymatic processing, chaperone-assisted folding and membrane targeting, but the spatial and temporal coordination of these steps is unclear. We show that Escherichia coli methionine aminopeptidase (MAP) associates with ribosomes through a charged loop that is crucial for nascent-chain processing and cell viability. MAP competes with peptide deformylase (PDF), the first enzyme to act on nascent chains, for binding sites at the ribosomal tunnel exit. PDF has extremely fast association and dissociation kinetics, which allows it to frequently sample ribosomes and ensure the processing of nascent chains after their emergence. Premature recruitment of the chaperone trigger factor, or polypeptide folding, negatively affect processing efficiency. Thus, the fast ribosome association kinetics of PDF and MAP are crucial for the temporal separation of nascent-chain processing from later maturation events, including chaperone recruitment and folding.

  8. Salmon migration patterns revealed the temporal and spatial fluctuations of the radiocesium levels in terrestrial and ocean environments.

    Science.gov (United States)

    Arai, Takaomi

    2014-01-01

    The disabling of the Fukushima Daiichi Nuclear Power Plant (F1NPP) resulted in the release of radionuclides, including 134Cs and 137Cs, into the air and the ocean. The unpredicted nuclear accident is of global concern for human health and the ecosystem. Although investigations of radionuclides in environments were performed shortly after the accident started, the temporal and spatial impacts and fluctuations on the releasing radionuclides to natural environment remain unclear. I focused on salmon, which migrate from inland to the open ocean globally, to reveal the three-year (May 2011 to February 2014) fluctuations and accumulations of 134Cs and 137Cs from terrestrial to open ocean environments after the F1NPP accident. The 134Cs and 137Cs concentrations in six salmonids exhibited lower temporal variations for three years after the F1NPP accident, suggesting that these radionuclides are widely distributed and these radionuclides remain in the natural environment globally with less convergence. The accumulation patterns were significantly different among the different salmon species. Fluvial (freshwater residence) type salmons exhibited significantly higher accumulation in 134Cs (25.3-40.2 Bq kg(-1) in mean) and 137Cs (41.4-51.7 Bq kg(-1) in mean) than did the anadromous (sea-run) type salmons (0.64-8.03 Bq kg(-1) in mean 134Cs and 0.42-10.2 Bq kg(-1) in mean 137Cs) suggesting widespread contamination in terrestrial environments versus the coastal and open ocean environments. Salmonids are the most highly migratory animals and are characterised by their strong tendency to return home to their natal site for reproduction. Salmonids have a potential to be a good indicator as an effective monitoring animal.

  9. DNA replication stress restricts ribosomal DNA copy number

    Science.gov (United States)

    Salim, Devika; Bradford, William D.; Freeland, Amy; Cady, Gillian; Wang, Jianmin

    2017-01-01

    Ribosomal RNAs (rRNAs) in budding yeast are encoded by ~100–200 repeats of a 9.1kb sequence arranged in tandem on chromosome XII, the ribosomal DNA (rDNA) locus. Copy number of rDNA repeat units in eukaryotic cells is maintained far in excess of the requirement for ribosome biogenesis. Despite the importance of the repeats for both ribosomal and non-ribosomal functions, it is currently not known how “normal” copy number is determined or maintained. To identify essential genes involved in the maintenance of rDNA copy number, we developed a droplet digital PCR based assay to measure rDNA copy number in yeast and used it to screen a yeast conditional temperature-sensitive mutant collection of essential genes. Our screen revealed that low rDNA copy number is associated with compromised DNA replication. Further, subculturing yeast under two separate conditions of DNA replication stress selected for a contraction of the rDNA array independent of the replication fork blocking protein, Fob1. Interestingly, cells with a contracted array grew better than their counterparts with normal copy number under conditions of DNA replication stress. Our data indicate that DNA replication stresses select for a smaller rDNA array. We speculate that this liberates scarce replication factors for use by the rest of the genome, which in turn helps cells complete DNA replication and continue to propagate. Interestingly, tumors from mini chromosome maintenance 2 (MCM2)-deficient mice also show a loss of rDNA repeats. Our data suggest that a reduction in rDNA copy number may indicate a history of DNA replication stress, and that rDNA array size could serve as a diagnostic marker for replication stress. Taken together, these data begin to suggest the selective pressures that combine to yield a “normal” rDNA copy number. PMID:28915237

  10. DNA replication stress restricts ribosomal DNA copy number.

    Science.gov (United States)

    Salim, Devika; Bradford, William D; Freeland, Amy; Cady, Gillian; Wang, Jianmin; Pruitt, Steven C; Gerton, Jennifer L

    2017-09-01

    Ribosomal RNAs (rRNAs) in budding yeast are encoded by ~100-200 repeats of a 9.1kb sequence arranged in tandem on chromosome XII, the ribosomal DNA (rDNA) locus. Copy number of rDNA repeat units in eukaryotic cells is maintained far in excess of the requirement for ribosome biogenesis. Despite the importance of the repeats for both ribosomal and non-ribosomal functions, it is currently not known how "normal" copy number is determined or maintained. To identify essential genes involved in the maintenance of rDNA copy number, we developed a droplet digital PCR based assay to measure rDNA copy number in yeast and used it to screen a yeast conditional temperature-sensitive mutant collection of essential genes. Our screen revealed that low rDNA copy number is associated with compromised DNA replication. Further, subculturing yeast under two separate conditions of DNA replication stress selected for a contraction of the rDNA array independent of the replication fork blocking protein, Fob1. Interestingly, cells with a contracted array grew better than their counterparts with normal copy number under conditions of DNA replication stress. Our data indicate that DNA replication stresses select for a smaller rDNA array. We speculate that this liberates scarce replication factors for use by the rest of the genome, which in turn helps cells complete DNA replication and continue to propagate. Interestingly, tumors from mini chromosome maintenance 2 (MCM2)-deficient mice also show a loss of rDNA repeats. Our data suggest that a reduction in rDNA copy number may indicate a history of DNA replication stress, and that rDNA array size could serve as a diagnostic marker for replication stress. Taken together, these data begin to suggest the selective pressures that combine to yield a "normal" rDNA copy number.

  11. DNA replication stress restricts ribosomal DNA copy number.

    Directory of Open Access Journals (Sweden)

    Devika Salim

    2017-09-01

    Full Text Available Ribosomal RNAs (rRNAs in budding yeast are encoded by ~100-200 repeats of a 9.1kb sequence arranged in tandem on chromosome XII, the ribosomal DNA (rDNA locus. Copy number of rDNA repeat units in eukaryotic cells is maintained far in excess of the requirement for ribosome biogenesis. Despite the importance of the repeats for both ribosomal and non-ribosomal functions, it is currently not known how "normal" copy number is determined or maintained. To identify essential genes involved in the maintenance of rDNA copy number, we developed a droplet digital PCR based assay to measure rDNA copy number in yeast and used it to screen a yeast conditional temperature-sensitive mutant collection of essential genes. Our screen revealed that low rDNA copy number is associated with compromised DNA replication. Further, subculturing yeast under two separate conditions of DNA replication stress selected for a contraction of the rDNA array independent of the replication fork blocking protein, Fob1. Interestingly, cells with a contracted array grew better than their counterparts with normal copy number under conditions of DNA replication stress. Our data indicate that DNA replication stresses select for a smaller rDNA array. We speculate that this liberates scarce replication factors for use by the rest of the genome, which in turn helps cells complete DNA replication and continue to propagate. Interestingly, tumors from mini chromosome maintenance 2 (MCM2-deficient mice also show a loss of rDNA repeats. Our data suggest that a reduction in rDNA copy number may indicate a history of DNA replication stress, and that rDNA array size could serve as a diagnostic marker for replication stress. Taken together, these data begin to suggest the selective pressures that combine to yield a "normal" rDNA copy number.

  12. Trapping the ribosome to control gene expression.

    Science.gov (United States)

    Boehringer, Daniel; Ban, Nenad

    2007-09-21

    Protein synthesis is often regulated by structured mRNAs that interact with ribosomes. In this issue of Cell, Marzi et al. (2007) provide insights into the autoregulation of protein S15 by visualizing the folded repressor mRNA on the ribosome stalled in the preinitiation state. These results have implications for our understanding of the mechanism of translation initiation in general.

  13. Novel mRNA-specific effects of ribosome drop-off on translation rate and polysome profile.

    Directory of Open Access Journals (Sweden)

    Pierre Bonnin

    2017-05-01

    Full Text Available The well established phenomenon of ribosome drop-off plays crucial roles in translational accuracy and nutrient starvation responses during protein translation. When cells are under stress conditions, such as amino acid starvation or aminoacyl-tRNA depletion due to a high level of recombinant protein expression, ribosome drop-off can substantially affect the efficiency of protein expression. Here we introduce a mathematical model that describes the effects of ribosome drop-off on the ribosome density along the mRNA and on the concomitant protein synthesis rate. Our results show that ribosome premature termination may lead to non-intuitive ribosome density profiles, such as a ribosome density which increases from the 5' to the 3' end. Importantly, the model predicts that the effects of ribosome drop-off on the translation rate are mRNA-specific, and we quantify their resilience to drop-off, showing that the mRNAs which present ribosome queues are much less affected by ribosome drop-off than those which do not. Moreover, among those mRNAs that do not present ribosome queues, resilience to drop-off correlates positively with the elongation rate, so that sequences using fast codons are expected to be less affected by ribosome drop-off. This result is consistent with a genome-wide analysis of S. cerevisiae, which reveals that under favourable growth conditions mRNAs coding for proteins involved in the translation machinery, known to be highly codon biased and using preferentially fast codons, are highly resilient to ribosome drop-off. Moreover, in physiological conditions, the translation rate of mRNAs coding for regulatory, stress-related proteins, is less resilient to ribosome drop-off. This model therefore allows analysis of variations in the translational efficiency of individual mRNAs by accounting for the full range of known ribosome behaviours, as well as explaining mRNA-specific variations in ribosome density emerging from ribosome profiling

  14. Proteome distribution between nucleoplasm and nucleolus and its relation to ribosome biogenesis in Arabidopsis thaliana.

    Science.gov (United States)

    Palm, Denise; Simm, Stefan; Darm, Katrin; Weis, Benjamin L; Ruprecht, Maike; Schleiff, Enrico; Scharf, Christian

    2016-01-01

    Ribosome biogenesis is an essential process initiated in the nucleolus. In eukaryotes, multiple ribosome biogenesis factors (RBFs) can be found in the nucleolus, the nucleus and in the cytoplasm. They act in processing, folding and modification of the pre-ribosomal (r)RNAs, incorporation of ribosomal proteins (RPs), export of pre-ribosomal particles to the cytoplasm, and quality control mechanisms. Ribosome biogenesis is best established for Saccharomyces cerevisiae. Plant ortholog assignment to yeast RBFs revealed the absence of about 30% of the yeast RBFs in plants. In turn, few plant specific proteins have been identified by biochemical experiments to act in plant ribosome biogenesis. Nevertheless, a complete inventory of plant RBFs has not been established yet. We analyzed the proteome of the nucleus and nucleolus of Arabidopsis thaliana and the post-translational modifications of these proteins. We identified 1602 proteins in the nucleolar and 2544 proteins in the nuclear fraction with an overlap of 1429 proteins. For a randomly selected set of proteins identified by the proteomic approach we confirmed the localization inferred from the proteomics data by the localization of GFP fusion proteins. We assigned the identified proteins to various complexes and functions and found about 519 plant proteins that have a potential to act as a RBFs, but which have not been experimentally characterized yet. Last, we compared the distribution of RBFs and RPs in the various fractions with the distribution established for yeast.

  15. Differential Stoichiometry among Core Ribosomal Proteins

    Directory of Open Access Journals (Sweden)

    Nikolai Slavov

    2015-11-01

    Full Text Available Understanding the regulation and structure of ribosomes is essential to understanding protein synthesis and its dysregulation in disease. While ribosomes are believed to have a fixed stoichiometry among their core ribosomal proteins (RPs, some experiments suggest a more variable composition. Testing such variability requires direct and precise quantification of RPs. We used mass spectrometry to directly quantify RPs across monosomes and polysomes of mouse embryonic stem cells (ESC and budding yeast. Our data show that the stoichiometry among core RPs in wild-type yeast cells and ESC depends both on the growth conditions and on the number of ribosomes bound per mRNA. Furthermore, we find that the fitness of cells with a deleted RP-gene is inversely proportional to the enrichment of the corresponding RP in polysomes. Together, our findings support the existence of ribosomes with distinct protein composition and physiological function.

  16. Molecular Epidemiology and Phylogeny Reveal Complex Spatial Dynamics in Areas Where Canine Parvovirus Is Endemic ▿†

    Science.gov (United States)

    Clegg, S. R.; Coyne, K. P.; Parker, J.; Dawson, S.; Godsall, S. A.; Pinchbeck, G.; Cripps, P. J.; Gaskell, R. M.; Radford, A. D.

    2011-01-01

    Canine parvovirus type 2 (CPV-2) is a severe enteric pathogen of dogs, causing high mortality in unvaccinated dogs. After emerging, CPV-2 spread rapidly worldwide. However, there is now some evidence to suggest that international transmission appears to be more restricted. In order to investigate the transmission and evolution of CPV-2 both nationally and in relation to the global situation, we have used a long-range PCR to amplify and sequence the full VP2 gene of 150 canine parvoviruses obtained from a large cross-sectional sample of dogs presenting with severe diarrhea to veterinarians in the United Kingdom, over a 2-year period. Among these 150 strains, 50 different DNA sequence types (S) were identified, and apart from one case, all appeared unique to the United Kingdom. Phylogenetic analysis provided clear evidence for spatial clustering at the international level and for the first time also at the national level, with the geographical range of some sequence types appearing to be highly restricted within the United Kingdom. Evolution of the VP2 gene in this data set was associated with a lack of positive selection. In addition, the majority of predicted amino acid sequences were identical to those found elsewhere in the world, suggesting that CPV VP2 has evolved a highly fit conformation. Based on typing systems using key amino acid mutations, 43% of viruses were CPV-2a, and 57% CPV-2b, with no type 2 or 2c found. However, phylogenetic analysis suggested complex antigenic evolution of this virus, with both type 2a and 2b viruses appearing polyphyletic. As such, typing based on specific amino acid mutations may not reflect the true epidemiology of this virus. The geographical restriction that we observed both within the United Kingdom and between the United Kingdom and other countries, together with the lack of CPV-2c in this population, strongly suggests the spread of CPV within its population may be heterogeneously subject to limiting factors. This cross

  17. Pilot study of using UAV to reveal spatial patterns of indicator bacteria concentrations in ponds and reservoirs used for irrigation

    Science.gov (United States)

    Determination of indicator bacteria concentrations in irrigation water recently became mandatory for farmers. These concentrations are known to have large spatial variability in ponds and reservoirs. This variability is partially attributed to affinity of indicator bacteria to algae accumulations. W...

  18. Cisplatin Targeting of Bacterial Ribosomal RNA Hairpins

    Directory of Open Access Journals (Sweden)

    Gayani N. P. Dedduwa-Mudalige

    2015-09-01

    Full Text Available Cisplatin is a clinically important chemotherapeutic agent known to target purine bases in nucleic acids. In addition to major deoxyribonucleic acid (DNA intrastrand cross-links, cisplatin also forms stable adducts with many types of ribonucleic acid (RNA including siRNA, spliceosomal RNAs, tRNA, and rRNA. All of these RNAs play vital roles in the cell, such as catalysis of protein synthesis by rRNA, and therefore serve as potential drug targets. This work focused on platination of two highly conserved RNA hairpins from E. coli ribosomes, namely pseudouridine-modified helix 69 from 23S rRNA and the 790 loop of helix 24 from 16S rRNA. RNase T1 probing, MALDI mass spectrometry, and dimethyl sulfate mapping revealed platination at GpG sites. Chemical probing results also showed platination-induced RNA structural changes. These findings reveal solvent and structural accessibility of sites within bacterial RNA secondary structures that are functionally significant and therefore viable targets for cisplatin as well as other classes of small molecules. Identifying target preferences at the nucleotide level, as well as determining cisplatin-induced RNA conformational changes, is important for the design of more potent drug molecules. Furthermore, the knowledge gained through studies of RNA-targeting by cisplatin is applicable to a broad range of organisms from bacteria to human.

  19. A comparative analysis reveals weak relationships between ecological factors and beta diversity of stream insect metacommunities at two spatial levels

    OpenAIRE

    Gonroos, M; Jacobsen, D; Hamada, N; Gothe, E; Enclada, A; Dudgeon, D; Dangles, O; Cottenie, K; Callisto, M; Brand, C; Bonada, N; Angeler, DG; Al-Shami, SA; Altermatt, F; Bini, LM

    2015-01-01

    The hypotheses that beta diversity should increase with decreasing latitude and increase with spatial extent of a region have rarely been tested based on a comparative analysis of multiple datasets, and no such study has focused on stream insects. We first assessed how well variability in beta diversity of stream insect metacommunities is predicted by insect group, latitude, spatial extent, altitudinal range, and dataset properties across multiple drainage basins throughout the world. Second,...

  20. Spatial and temporal variability in the trans-Pacific migration of Pacific bluefin tuna (Thunnus orientalis) revealed by archival tags

    Science.gov (United States)

    Fujioka, Ko; Fukuda, Hiromu; Tei, Yaoki; Okamoto, Suguru; Kiyofuji, Hidetada; Furukawa, Seishiro; Takagi, Junichi; Estess, Ethan; Farwell, Charles J.; Fuller, Daniel W.; Suzuki, Nobuaki; Ohshimo, Seiji; Kitagawa, Takashi

    2018-03-01

    Archival electronic tags were internally implanted in 713 age-0 Pacific bluefin tuna (PBF) caught in their nursery waters off the southern coast of Japan and in the East China Sea over an extended study period (1995-2015) to clarify the spatial and temporal variability of their trans-Pacific migration. Two hundred twenty-five of these tagged tuna were recaptured by fisheries (31.6%), and we successfully retrieved tag data from 14 of 21 individuals recovered in the Eastern pacific. Furthermore, one archival tag recovered in the Western Pacific revealed that the individual had performed a trans-Pacific migration, so in total 21 tagged PBF were shown to have migrated to the Eastern Pacific (2.9% of the total tags released). We successfully downloaded data from 15 of these 21 archival tags, which revealed that some age-1 PBF migrate rapidly (123.9 ± 82.8 km day-1) and directly from waters offshore of Japan to the eastern Pacific (160.0°E to 130.0°W), a journey that takes an average of 2.5 months (ranging from 1.2 to 5.5 months) through relatively cool waters (14.7 ± 2.0 °C). All juvenile PBF began their trans-Pacific migration shortly after exposure to cooler water temperatures (physiological challenge for this age class. Three patterns were identified in the timing of the departure of juvenile PBF from the western Pacific: departing 12-14 months post-hatch (N = 7) in early summer (May-July), departing 17-19 months post-hatch (N = 7) in late autumn (October-December), and departing 21 months post-hatch (N = 1) in late winter (February). The PBF tagged along the southern coast of Japan (SCJ) arrived in the eastern Pacific earlier than those tagged in the East China Sea (ECS), most likely due to the shorter travel distance. Additionally, the PBF that began their trans-Pacific migration in the earlier period remained in an offshore foraging zone (the Kuroshio-Oyashio transition region) for shorter periods (2.8 months on average) and at lower latitudes (35.0

  1. Ribosomal trafficking is reduced in Schwann cells following induction of myelination

    Directory of Open Access Journals (Sweden)

    James M. Love

    2015-08-01

    Full Text Available Local synthesis of proteins within the Schwann cell periphery is extremely important for efficient process extension and myelination, when cells undergo dramatic changes in polarity and geometry. Still, it is unclear how ribosomal distributions are developed and maintained within Schwann cell projections to sustain local translation. In this multi-disciplinary study, we expressed a plasmid encoding a fluorescently labeled ribosomal subunit (L4-GFP in cultured primary rat Schwann cells. This enabled the generation of high-resolution, quantitative data on ribosomal distributions and trafficking dynamics within Schwann cells during early stages of myelination, induced by ascorbic acid treatment. Ribosomes were distributed throughout Schwann cell projections, with ~2-3 bright clusters along each projection. Clusters emerged within 1 day of culture and were maintained throughout early stages of myelination. Three days after induction of myelination, net ribosomal movement remained anterograde (directed away from the Schwann cell body, but ribosomal velocity decreased to about half the levels of the untreated group. Statistical and modeling analysis provided additional insight into key factors underlying ribosomal trafficking. Multiple regression analysis indicated that net transport at early time points was dependent on anterograde velocity, but shifted to dependence on anterograde duration at later time points. A simple, data-driven rate kinetics model suggested that the observed decrease in net ribosomal movement was primarily dictated by an increased conversion of anterograde particles to stationary particles, rather than changes in other directional parameters. These results reveal the strength of a combined experimental and theoretical approach in examining protein localization and transport, and provide evidence of an early establishment of ribosomal populations within Schwann cell projections with a reduction in trafficking following

  2. Increased fusiform area activation in schizophrenia during processing of spatial frequency-degraded faces, as revealed by fMRI.

    Science.gov (United States)

    Silverstein, S M; All, S D; Kasi, R; Berten, S; Essex, B; Lathrop, K L; Little, D M

    2010-07-01

    People with schizophrenia demonstrate perceptual organization impairments, and these are thought to contribute to their face processing difficulties. We examined the neural substrates of emotionally neutral face processing in schizophrenia by investigating neural activity under three stimulus conditions: faces characterized by the full spectrum of spatial frequencies, faces with low spatial frequency information removed [high spatial frequency (HSF) condition], and faces with high spatial frequency information removed [low spatial frequency (LSF) condition]. Face perception in the HSF condition is more reliant on local feature processing whereas perception in the LSF condition requires greater reliance on global form processing. Past studies of perceptual organization in schizophrenia indicate that patients perform relatively more poorly with degraded stimuli but also that, when global information is absent, patients may perform better than controls because of their relatively increased ability to initially process individual features. Therefore, we hypothesized that people with schizophrenia (n=14) would demonstrate greater face processing difficulties than controls (n=13) in the LSF condition, whereas they would demonstrate a smaller difference or superior performance in the HSF condition. In a gender-discrimination task, behavioral data indicated high levels of accuracy for both groups, with a trend toward an interaction involving higher patient performance in the HSF condition and poorer patient performance in the LSF condition. Patients demonstrated greater activity in the fusiform gyrus compared to controls in both degraded conditions. These data suggest that impairments in basic integration abilities may be compensated for by relatively increased activity in this region.

  3. A spatially resolved network spike in model neuronal cultures reveals nucleation centers, circular traveling waves and drifting spiral waves.

    Science.gov (United States)

    Paraskevov, A V; Zendrikov, D K

    2017-03-23

    We show that in model neuronal cultures, where the probability of interneuronal connection formation decreases exponentially with increasing distance between the neurons, there exists a small number of spatial nucleation centers of a network spike, from where the synchronous spiking activity starts propagating in the network typically in the form of circular traveling waves. The number of nucleation centers and their spatial locations are unique and unchanged for a given realization of neuronal network but are different for different networks. In contrast, if the probability of interneuronal connection formation is independent of the distance between neurons, then the nucleation centers do not arise and the synchronization of spiking activity during a network spike occurs spatially uniform throughout the network. Therefore one can conclude that spatial proximity of connections between neurons is important for the formation of nucleation centers. It is also shown that fluctuations of the spatial density of neurons at their random homogeneous distribution typical for the experiments in vitro do not determine the locations of the nucleation centers. The simulation results are qualitatively consistent with the experimental observations.

  4. Structure of the quaternary complex between SRP, SR, and translocon bound to the translating ribosome.

    Science.gov (United States)

    Jomaa, Ahmad; Fu, Yu-Hsien Hwang; Boehringer, Daniel; Leibundgut, Marc; Shan, Shu-Ou; Ban, Nenad

    2017-05-19

    During co-translational protein targeting, the signal recognition particle (SRP) binds to the translating ribosome displaying the signal sequence to deliver it to the SRP receptor (SR) on the membrane, where the signal peptide is transferred to the translocon. Using electron cryo-microscopy, we have determined the structure of a quaternary complex of the translating Escherichia coli ribosome, the SRP-SR in the 'activated' state and the translocon. Our structure, supported by biochemical experiments, reveals that the SRP RNA adopts a kinked and untwisted conformation to allow repositioning of the 'activated' SRP-SR complex on the ribosome. In addition, we observe the translocon positioned through interactions with the SR in the vicinity of the ribosome exit tunnel where the signal sequence is extending beyond its hydrophobic binding groove of the SRP M domain towards the translocon. Our study provides new insights into the mechanism of signal sequence transfer from the SRP to the translocon.

  5. Ribosome. The complete structure of the 55S mammalian mitochondrial ribosome.

    Science.gov (United States)

    Greber, Basil J; Bieri, Philipp; Leibundgut, Marc; Leitner, Alexander; Aebersold, Ruedi; Boehringer, Daniel; Ban, Nenad

    2015-04-17

    Mammalian mitochondrial ribosomes (mitoribosomes) synthesize mitochondrially encoded membrane proteins that are critical for mitochondrial function. Here we present the complete atomic structure of the porcine 55S mitoribosome at 3.8 angstrom resolution by cryo-electron microscopy and chemical cross-linking/mass spectrometry. The structure of the 28S subunit in the complex was resolved at 3.6 angstrom resolution by focused alignment, which allowed building of a detailed atomic structure including all of its 15 mitoribosomal-specific proteins. The structure reveals the intersubunit contacts in the 55S mitoribosome, the molecular architecture of the mitoribosomal messenger RNA (mRNA) binding channel and its interaction with transfer RNAs, and provides insight into the highly specialized mechanism of mRNA recruitment to the 28S subunit. Furthermore, the structure contributes to a mechanistic understanding of aminoglycoside ototoxicity. Copyright © 2015, American Association for the Advancement of Science.

  6. Spatially selective alpha oscillations reveal moment-by-moment trade-offs between working memory and attention

    NARCIS (Netherlands)

    van Moorselaar, Dirk; Foster, Joshua J.; Sutterer, David W.; Theeuwes, Jan; Olivers, Christian N.L.; Awh, Edward

    Current theories assume a functional role for covert attention in the maintenance of spatial information in working memory. Consistent with this view, both the locus of attention and positions stored in working memory can be decoded based on the topography of oscillatory alpha-band (8-12 Hz)

  7. Multimodal MRI reveals structural connectivity differences in 22q11 deletion syndrome related to impaired spatial working memory

    NARCIS (Netherlands)

    O'Hanlon, Erik; Howley, Sarah; Prasad, Sarah; McGrath, Jane; Leemans, Alexander; McDonald, Colm; Garavan, Hugh; Murphy, Kieran C

    2016-01-01

    INTRODUCTION: Impaired spatial working memory is a core cognitive deficit observed in people with 22q11 Deletion syndrome (22q11DS) and has been suggested as a candidate endophenotype for schizophrenia. However, to date, the neuroanatomical mechanisms describing its structural and functional

  8. Molecular dynamics simulation of ribosome jam

    KAUST Repository

    Matsumoto, Shigenori; Takagi, Fumiko; Shimada, Takashi; Ito, Nobuyasu

    2011-01-01

    We propose a coarse-grained molecular dynamics model of ribosome molecules to study the dependence of translation process on environmental parameters. We found the model exhibits traffic jam property, which is consistent with an ASEP model. We

  9. Ribosome evolution: Emergence of peptide synthesis machinery

    Indian Academy of Sciences (India)

    suggested the dynamic movement of ribosomal proteins. The L2 protein (a .... Such kinds of interactions are important in elucidating the evolution of RNA .... Tamura K 2009 Molecular handedness of life: significance of RNA aminoacylation.

  10. Is The Ribosome Targeted By Adaptive Mutations

    DEFF Research Database (Denmark)

    Jimenez Fernandez, Alicia; Molin, Søren; Johansen, Helle Krogh

    2015-01-01

    Introduction: RNA polymerase and ribosomes, composing the macromolecular synthesis machinery (MMSM), carry out the central processes of transcription and translation, but are usually seen as mechanical elements with no regulatory function. Extensive investigations of gene regulation and the high ...

  11. Synthetic peptides and ribosomal proteins as substrate for 60S ribosomal protein kinase from yeast cells

    DEFF Research Database (Denmark)

    Grankowski, N; Gasior, E; Issinger, O G

    1993-01-01

    Kinetic studies on the 60S protein kinase were conducted with synthetic peptides and ribosomal proteins as substrate. Peptide RRREEESDDD proved to be the best synthetic substrate for this enzyme. The peptide has a sequence of amino acids which most closely resembles the structure of potential...... phosphorylation sites in natural substrates, i.e., acidic ribosomal proteins. The superiority of certain kinetic parameters for 60S kinase obtained with the native whole 80S ribosomes over those of the isolated fraction of acidic ribosomal proteins indicates that the affinity of 60S kinase to the specific protein...

  12. Crystallization of ribosomes from Thermus thermophilus

    International Nuclear Information System (INIS)

    Karpova, E.A.; Serdyuk, I.N.; Tarkhovskii, Yu.S.; Orlova, E.V.; Borovyagin, V.L.

    1987-01-01

    An understanding of the molecular bases of the process of protein biosynthesis on the ribosome requires a knowledge of its structure with high three-dimensional resolution involving the method of x-ray crystallographic analysis. The authors report on the production of crystals of the 70S ribosomes from a new source - the highly thermophilic bacterium Thermus thermophilus. Ribosomes for crystallization were obtained from Th. thermophilus strain HB8 by two washings in buffer with high ionic strength. The ribosome preparation was investigated for homogeneity by the method of high-speed sedimentation in a buffer containing 15 mM MgCl 2 , 50 mM NH 4 Cl, and 10 MM Tris-HCl, pH 7.5. Analysis showed that the preparation if homogeneous. The same preparation was investigated for intactness of ribosomal RNA by the method of gel electrophoresis in 2.75% acrylamide 0.5% agarose gel in a buffer containing 30 mM Tris, 30 mM NaH 2 PO 4 , 10 mM EDTA, 1-2% SDS, and 6 M urea. Analysis showed that the preparation possesses intact 16S and 23S RNA. The latter did not degrade, at least in a week of exposure of the ribosomes in buffer solution at 5 0 C. The ribosome preparation had no appreciable RNase activity, which was verified by incubating 4.5 micrograms of ribosomes with 3 micrograms of 14 C-labeled 16S rRna (50 0 C, 90 min) in a buffer containing 10 mM MgCl 2 , 100 mM NH 4 Cl, and 10 mM Tris-HCl, pH/sub 20 0 / 7.5. The incubated nonhydrolyzed RNA was precipitated with 5% trichloroacetic acid and applied on a GF/C filter. The radioactivity was determined in a toluene scintillator on an LS-100C counter

  13. Seismogenic structure behaviour revealed by spatial clustering of seismicity in the Umbria-Marche Region (Central Italy

    Directory of Open Access Journals (Sweden)

    P. Tosi

    1998-06-01

    Full Text Available Time variations in the spatial distribution of earthquake epicentres are analyzed by application of the fractal correlation dimension method. The zone under investigation is located in Central Italy, bounded in longitude by 12.0 and 14.4 degrees east and in latitude by 42.0 and 43.6 degrees north. From 1st January 1978 to 5th October 1997, 2028 events with a magnitude above Ml= 2.5 constitute the database.Evolution of the spatial fractal dimension Ds permits the identification of seismic cycles that are connected to the occurrence of main earthquakes.In particular, it is possible to recognize a division within each cycle, between a period of random background seismicity and a spatial clustering of events where shocks of magnitude Ml ³occur. Moreover, the decrease in Ds prior to such events, evidences a structural relationship between foreshocks and the occurrence of a main shock, even if not in close territorial proximity.This feature indicates a new, more extensive definition of seismogenic structure which can includes several interconnected structures within a large area.

  14. Multiplex multivariate recurrence network from multi-channel signals for revealing oil-water spatial flow behavior.

    Science.gov (United States)

    Gao, Zhong-Ke; Dang, Wei-Dong; Yang, Yu-Xuan; Cai, Qing

    2017-03-01

    The exploration of the spatial dynamical flow behaviors of oil-water flows has attracted increasing interests on account of its challenging complexity and great significance. We first technically design a double-layer distributed-sector conductance sensor and systematically carry out oil-water flow experiments to capture the spatial flow information. Based on the well-established recurrence network theory, we develop a novel multiplex multivariate recurrence network (MMRN) to fully and comprehensively fuse our double-layer multi-channel signals. Then we derive the projection networks from the inferred MMRNs and exploit the average clustering coefficient and the spectral radius to quantitatively characterize the nonlinear recurrent behaviors related to the distinct flow patterns. We find that these two network measures are very sensitive to the change of flow states and the distributions of network measures enable to uncover the spatial dynamical flow behaviors underlying different oil-water flow patterns. Our method paves the way for efficiently analyzing multi-channel signals from multi-layer sensor measurement system.

  15. Similarities and differences between the brain networks underlying allocentric and egocentric spatial learning in rat revealed by cytochrome oxidase histochemistry.

    Science.gov (United States)

    Rubio, S; Begega, A; Méndez, M; Méndez-López, M; Arias, J L

    2012-10-25

    The involvement of different brain regions in place- and response-learning was examined using a water cross-maze. Rats were trained to find the goal from the initial arm by turning left at the choice point (egocentric strategy) or by using environmental cues (allocentric strategy). Although different strategies were required, the same maze and learning conditions were used. Using cytochrome oxidase histochemistry as a marker of cellular activity, the function of the 13 diverse cortical and subcortical regions was assessed in rats performing these two tasks. Our results show that allocentric learning depends on the recruitment of a large functional network, which includes the hippocampal CA3, dentate gyrus, medial mammillary nucleus and supramammillary nucleus. Along with the striatum, these last three structures are also related to egocentric spatial learning. The present study provides evidence for the contribution of these regions to spatial navigation and supports a possible functional interaction between the two memory systems, as their structural convergence may facilitate functional cooperation in the behaviours guided by more than one strategy. In summary, it can be argued that spatial learning is based on dynamic functional systems in which the interaction of brain regions is modulated by task requirements. Copyright © 2012 IBRO. Published by Elsevier Ltd. All rights reserved.

  16. Spatial and Species Variations in Bacterial Communities Associated with Corals from the Red Sea as Revealed by Pyrosequencing

    KAUST Repository

    Lee, O. O.; Yang, J.; Bougouffa, S.; Wang, Y.; Batang, Zenon B.; Tian, R.; Al-Suwailem, A.; Qian, P.-Y.

    2012-01-01

    -pyrosequencing technique to investigate the bacterial communities associated with three stony Scleractinea and two soft Octocorallia corals from three locations in the Red Sea. Our results revealed highly diverse bacterial communities in the Red Sea corals, with more than

  17. The ribosome as a molecular machine: the mechanism of tRNA-mRNA movement in translocation.

    Science.gov (United States)

    Rodnina, Marina V; Wintermeyer, Wolfgang

    2011-04-01

    Translocation of tRNA and mRNA through the ribosome is one of the most dynamic events during protein synthesis. In the cell, translocation is catalysed by EF-G (elongation factor G) and driven by GTP hydrolysis. Major unresolved questions are: how the movement is induced and what the moving parts of the ribosome are. Recent progress in time-resolved cryoelectron microscopy revealed trajectories of tRNA movement through the ribosome. Driven by thermal fluctuations, the ribosome spontaneously samples a large number of conformational states. The spontaneous movement of tRNAs through the ribosome is loosely coupled to the motions within the ribosome. EF-G stabilizes conformational states prone to translocation and promotes a conformational rearrangement of the ribosome (unlocking) that accelerates the rate-limiting step of translocation: the movement of the tRNA anticodons on the small ribosomal subunit. EF-G acts as a Brownian ratchet providing directional bias for movement at the cost of GTP hydrolysis.

  18. The complete structure of the large subunit of the mammalian mitochondrial ribosome.

    Science.gov (United States)

    Greber, Basil J; Boehringer, Daniel; Leibundgut, Marc; Bieri, Philipp; Leitner, Alexander; Schmitz, Nikolaus; Aebersold, Ruedi; Ban, Nenad

    2014-11-13

    Mitochondrial ribosomes (mitoribosomes) are extensively modified ribosomes of bacterial descent specialized for the synthesis and insertion of membrane proteins that are critical for energy conversion and ATP production inside mitochondria. Mammalian mitoribosomes, which comprise 39S and 28S subunits, have diverged markedly from the bacterial ribosomes from which they are derived, rendering them unique compared to bacterial, eukaryotic cytosolic and fungal mitochondrial ribosomes. We have previously determined at 4.9 Å resolution the architecture of the porcine (Sus scrofa) 39S subunit, which is highly homologous to the human mitoribosomal large subunit. Here we present the complete atomic structure of the porcine 39S large mitoribosomal subunit determined in the context of a stalled translating mitoribosome at 3.4 Å resolution by cryo-electron microscopy and chemical crosslinking/mass spectrometry. The structure reveals the locations and the detailed folds of 50 mitoribosomal proteins, shows the highly conserved mitoribosomal peptidyl transferase active site in complex with its substrate transfer RNAs, and defines the path of the nascent chain in mammalian mitoribosomes along their idiosyncratic exit tunnel. Furthermore, we present evidence that a mitochondrial tRNA has become an integral component of the central protuberance of the 39S subunit where it architecturally substitutes for the absence of the 5S ribosomal RNA, a ubiquitous component of all cytoplasmic ribosomes.

  19. Trans-kingdom mimicry underlies ribosome customization by a poxvirus kinase.

    Science.gov (United States)

    Jha, Sujata; Rollins, Madeline G; Fuchs, Gabriele; Procter, Dean J; Hall, Elizabeth A; Cozzolino, Kira; Sarnow, Peter; Savas, Jeffrey N; Walsh, Derek

    2017-06-29

    Ribosomes have the capacity to selectively control translation through changes in their composition that enable recognition of specific RNA elements. However, beyond differential subunit expression during development, evidence for regulated ribosome specification within individual cells has remained elusive. Here we report that a poxvirus kinase phosphorylates serine/threonine residues in the human small ribosomal subunit protein, receptor for activated C kinase (RACK1), that are not phosphorylated in uninfected cells or cells infected by other viruses. These modified residues cluster in an extended loop in RACK1, phosphorylation of which selects for translation of viral or reporter mRNAs with 5' untranslated regions that contain adenosine repeats, so-called polyA-leaders. Structural and phylogenetic analyses revealed that although RACK1 is highly conserved, this loop is variable and contains negatively charged amino acids in plants, in which these leaders act as translational enhancers. Phosphomimetics and inter-species chimaeras have shown that negative charge in the RACK1 loop dictates ribosome selectivity towards viral RNAs. By converting human RACK1 to a charged, plant-like state, poxviruses remodel host ribosomes so that adenosine repeats erroneously generated by slippage of the viral RNA polymerase confer a translational advantage. Our findings provide insight into ribosome customization through trans-kingdom mimicry and the mechanics of species-specific leader activity that underlie poxvirus polyA-leaders.

  20. Miscoding-induced stalling of substrate translocation on the bacterial ribosome.

    Science.gov (United States)

    Alejo, Jose L; Blanchard, Scott C

    2017-10-10

    Directional transit of the ribosome along the messenger RNA (mRNA) template is a key determinant of the rate and processivity of protein synthesis. Imaging of the multistep translocation mechanism using single-molecule FRET has led to the hypothesis that substrate movements relative to the ribosome resolve through relatively long-lived late intermediates wherein peptidyl-tRNA enters the P site of the small ribosomal subunit via reversible, swivel-like motions of the small subunit head domain within the elongation factor G (GDP)-bound ribosome complex. Consistent with translocation being rate-limited by recognition and productive engagement of peptidyl-tRNA within the P site, we now show that base-pairing mismatches between the peptidyl-tRNA anticodon and the mRNA codon dramatically delay this rate-limiting, intramolecular process. This unexpected relationship between aminoacyl-tRNA decoding and translocation suggests that miscoding antibiotics may impact protein synthesis by impairing the recognition of peptidyl-tRNA in the small subunit P site during EF-G-catalyzed translocation. Strikingly, we show that elongation factor P (EF-P), traditionally known to alleviate ribosome stalling at polyproline motifs, can efficiently rescue translocation defects arising from miscoding. These findings help reveal the nature and origin of the rate-limiting steps in substrate translocation on the bacterial ribosome and indicate that EF-P can aid in resuming translation elongation stalled by miscoding errors.

  1. The ribosome uses two active mechanisms to unwind messenger RNA during translation.

    Science.gov (United States)

    Qu, Xiaohui; Wen, Jin-Der; Lancaster, Laura; Noller, Harry F; Bustamante, Carlos; Tinoco, Ignacio

    2011-07-06

    The ribosome translates the genetic information encoded in messenger RNA into protein. Folded structures in the coding region of an mRNA represent a kinetic barrier that lowers the peptide elongation rate, as the ribosome must disrupt structures it encounters in the mRNA at its entry site to allow translocation to the next codon. Such structures are exploited by the cell to create diverse strategies for translation regulation, such as programmed frameshifting, the modulation of protein expression levels, ribosome localization and co-translational protein folding. Although strand separation activity is inherent to the ribosome, requiring no exogenous helicases, its mechanism is still unknown. Here, using a single-molecule optical tweezers assay on mRNA hairpins, we find that the translation rate of identical codons at the decoding centre is greatly influenced by the GC content of folded structures at the mRNA entry site. Furthermore, force applied to the ends of the hairpin to favour its unfolding significantly speeds translation. Quantitative analysis of the force dependence of its helicase activity reveals that the ribosome, unlike previously studied helicases, uses two distinct active mechanisms to unwind mRNA structure: it destabilizes the helical junction at the mRNA entry site by biasing its thermal fluctuations towards the open state, increasing the probability of the ribosome translocating unhindered; and it mechanically pulls apart the mRNA single strands of the closed junction during the conformational changes that accompany ribosome translocation. The second of these mechanisms ensures a minimal basal rate of translation in the cell; specialized, mechanically stable structures are required to stall the ribosome temporarily. Our results establish a quantitative mechanical basis for understanding the mechanism of regulation of the elongation rate of translation by structured mRNAs. ©2011 Macmillan Publishers Limited. All rights reserved

  2. Left neglected, but only in far space: Spatial biases in healthy participants revealed in a visually-guided grasping task

    Directory of Open Access Journals (Sweden)

    Natalie ede Bruin

    2014-01-01

    Full Text Available Hemispatial neglect is a common outcome of stroke that is characterised by the inability to orient towards, and attend to stimuli in contralesional space. It is established that hemispatial neglect has a perceptual component, however, the presence and severity of motor impairments is controversial. Establishing the nature of space use and spatial biases during visually-guided actions amongst healthy individuals is critical to understanding the presence of visuomotor deficits in patients with neglect. Accordingly, three experiments were conducted to investigate the effect of object spatial location on patterns of grasping. Experiment 1 required right-handed participants to reach and grasp for blocks in order to construct 3D models. The blocks were scattered on a tabletop divided into equal size quadrants: left near, left far, right near, and right far. Identical sets of building blocks were available in each quadrant. Space use was dynamic, with participants initially grasping blocks from right near space and tending to ‘neglect’ left far space until the final stages of the task. Experiment 2 repeated the protocol with left-handed participants. Remarkably, left-handed participants displayed a similar pattern of space use to right-handed participants. In Experiment 3 eye movements were examined to investigate whether ‘neglect’ for grasping in left far reachable space had its origins in attentional biases. It was found that patterns of eye movements mirrored patterns of reach-to-grasp movements. We conclude that there are spatial biases during visually-guided grasping, specifically, a tendency to neglect left far reachable space, and that this ‘neglect’ is attentional in origin. The results raise the possibility that visuomotor impairments reported among patients with right hemisphere lesions when working in contralesional space may result in part from this inherent tendency to ‘neglect’ left far space irrespective of the presence

  3. The Arabidopsis TOR Kinase Specifically Regulates the Expression of Nuclear Genes Coding for Plastidic Ribosomal Proteins and the Phosphorylation of the Cytosolic Ribosomal Protein S6.

    Science.gov (United States)

    Dobrenel, Thomas; Mancera-Martínez, Eder; Forzani, Céline; Azzopardi, Marianne; Davanture, Marlène; Moreau, Manon; Schepetilnikov, Mikhail; Chicher, Johana; Langella, Olivier; Zivy, Michel; Robaglia, Christophe; Ryabova, Lyubov A; Hanson, Johannes; Meyer, Christian

    2016-01-01

    Protein translation is an energy consuming process that has to be fine-tuned at both the cell and organism levels to match the availability of resources. The target of rapamycin kinase (TOR) is a key regulator of a large range of biological processes in response to environmental cues. In this study, we have investigated the effects of TOR inactivation on the expression and regulation of Arabidopsis ribosomal proteins at different levels of analysis, namely from transcriptomic to phosphoproteomic. TOR inactivation resulted in a coordinated down-regulation of the transcription and translation of nuclear-encoded mRNAs coding for plastidic ribosomal proteins, which could explain the chlorotic phenotype of the TOR silenced plants. We have identified in the 5' untranslated regions (UTRs) of this set of genes a conserved sequence related to the 5' terminal oligopyrimidine motif, which is known to confer translational regulation by the TOR kinase in other eukaryotes. Furthermore, the phosphoproteomic analysis of the ribosomal fraction following TOR inactivation revealed a lower phosphorylation of the conserved Ser240 residue in the C-terminal region of the 40S ribosomal protein S6 (RPS6). These results were confirmed by Western blot analysis using an antibody that specifically recognizes phosphorylated Ser240 in RPS6. Finally, this antibody was used to follow TOR activity in plants. Our results thus uncover a multi-level regulation of plant ribosomal genes and proteins by the TOR kinase.

  4. Amino acid sequences of ribosomal proteins S11 from Bacillus stearothermophilus and S19 from Halobacterium marismortui. Comparison of the ribosomal protein S11 family.

    Science.gov (United States)

    Kimura, M; Kimura, J; Hatakeyama, T

    1988-11-21

    The complete amino acid sequences of ribosomal proteins S11 from the Gram-positive eubacterium Bacillus stearothermophilus and of S19 from the archaebacterium Halobacterium marismortui have been determined. A search for homologous sequences of these proteins revealed that they belong to the ribosomal protein S11 family. Homologous proteins have previously been sequenced from Escherichia coli as well as from chloroplast, yeast and mammalian ribosomes. A pairwise comparison of the amino acid sequences showed that Bacillus protein S11 shares 68% identical residues with S11 from Escherichia coli and a slightly lower homology (52%) with the homologous chloroplast protein. The halophilic protein S19 is more related to the eukaryotic (45-49%) than to the eubacterial counterparts (35%).

  5. Excess of mutational jackpot events in expanding populations revealed by spatial Luria–Delbrück experiments

    Science.gov (United States)

    Fusco, Diana; Gralka, Matti; Kayser, Jona; Anderson, Alex; Hallatschek, Oskar

    2016-01-01

    The genetic diversity of growing cellular populations, such as biofilms, solid tumours or developing embryos, is thought to be dominated by rare, exceptionally large mutant clones. Yet, the emergence of these mutational jackpot events is only understood in well-mixed populations, where they stem from mutations that arise during the first few cell divisions. To study jackpot events in spatially structured populations, we track mutant clones in microbial populations using fluorescence microscopy and population sequencing. High-frequency mutations are found to be massively enriched in microbial colonies compared with well-shaken liquid cultures, as a result of late-occurring mutations surfing at the edge of range expansions. Thus, jackpot events can be generated not only when mutations arise early but also when they occur at favourable locations, which exacerbates their role in adaptation and disease. In particular, because spatial competition with the wild type keeps most mutant clones in a quiescent state, strong selection pressures that kill the wild type promote drug resistance. PMID:27694797

  6. Excess of mutational jackpot events in expanding populations revealed by spatial Luria-Delbrück experiments.

    Science.gov (United States)

    Fusco, Diana; Gralka, Matti; Kayser, Jona; Anderson, Alex; Hallatschek, Oskar

    2016-10-03

    The genetic diversity of growing cellular populations, such as biofilms, solid tumours or developing embryos, is thought to be dominated by rare, exceptionally large mutant clones. Yet, the emergence of these mutational jackpot events is only understood in well-mixed populations, where they stem from mutations that arise during the first few cell divisions. To study jackpot events in spatially structured populations, we track mutant clones in microbial populations using fluorescence microscopy and population sequencing. High-frequency mutations are found to be massively enriched in microbial colonies compared with well-shaken liquid cultures, as a result of late-occurring mutations surfing at the edge of range expansions. Thus, jackpot events can be generated not only when mutations arise early but also when they occur at favourable locations, which exacerbates their role in adaptation and disease. In particular, because spatial competition with the wild type keeps most mutant clones in a quiescent state, strong selection pressures that kill the wild type promote drug resistance.

  7. Spatial structure and nest demography reveal the influence of competition, parasitism and habitat quality on slavemaking ants and their hosts.

    Science.gov (United States)

    Scharf, Inon; Fischer-Blass, Birgit; Foitzik, Susanne

    2011-03-28

    Natural communities are structured by intra-guild competition, predation or parasitism and the abiotic environment. We studied the relative importance of these factors in two host-social parasite ecosystems in three ant communities in Europe (Bavaria) and North America (New York, West Virginia). We tested how these factors affect colony demography, life-history and the spatial pattern of colonies, using a large sample size of more than 1000 colonies. The strength of competition was measured by the distance to the nearest competitor. Distance to the closest social parasite colony was used as a measure of parasitism risk. Nest sites (i.e., sticks or acorns) are limited in these forest ecosystems and we therefore included nest site quality as an abiotic factor in the analysis. In contrast to previous studies based on local densities, we focus here on the positioning and spatial patterns and we use models to compare our predictions to random expectations. Colony demography was universally affected by the size of the nest site with larger and more productive colonies residing in larger nest sites of higher quality. Distance to the nearest competitor negatively influenced host demography and brood production in the Bavarian community, pointing to an important role of competition, while social parasitism was less influential in this community. The New York community was characterized by the highest habitat variability, and productive colonies were clustered in sites of higher quality. Colonies were clumped on finer spatial scales, when we considered only the nearest neighbors, but more regularly distributed on coarser scales. The analysis of spatial positioning within plots often produced different results compared to those based on colony densities. For example, while host and slavemaker densities are often positively correlated, slavemakers do not nest closer to potential host colonies than expected by random. The three communities are differently affected by biotic and

  8. Spatial structure and nest demography reveal the influence of competition, parasitism and habitat quality on slavemaking ants and their hosts

    Directory of Open Access Journals (Sweden)

    Fischer-Blass Birgit

    2011-03-01

    Full Text Available Abstract Background Natural communities are structured by intra-guild competition, predation or parasitism and the abiotic environment. We studied the relative importance of these factors in two host-social parasite ecosystems in three ant communities in Europe (Bavaria and North America (New York, West Virginia. We tested how these factors affect colony demography, life-history and the spatial pattern of colonies, using a large sample size of more than 1000 colonies. The strength of competition was measured by the distance to the nearest competitor. Distance to the closest social parasite colony was used as a measure of parasitism risk. Nest sites (i.e., sticks or acorns are limited in these forest ecosystems and we therefore included nest site quality as an abiotic factor in the analysis. In contrast to previous studies based on local densities, we focus here on the positioning and spatial patterns and we use models to compare our predictions to random expectations. Results Colony demography was universally affected by the size of the nest site with larger and more productive colonies residing in larger nest sites of higher quality. Distance to the nearest competitor negatively influenced host demography and brood production in the Bavarian community, pointing to an important role of competition, while social parasitism was less influential in this community. The New York community was characterized by the highest habitat variability, and productive colonies were clustered in sites of higher quality. Colonies were clumped on finer spatial scales, when we considered only the nearest neighbors, but more regularly distributed on coarser scales. The analysis of spatial positioning within plots often produced different results compared to those based on colony densities. For example, while host and slavemaker densities are often positively correlated, slavemakers do not nest closer to potential host colonies than expected by random. Conclusions The

  9. Spatial genetic analyses reveal cryptic population structure and migration patterns in a continuously harvested grey wolf (Canis lupus population in north-eastern Europe.

    Directory of Open Access Journals (Sweden)

    Maris Hindrikson

    Full Text Available Spatial genetics is a relatively new field in wildlife and conservation biology that is becoming an essential tool for unravelling the complexities of animal population processes, and for designing effective strategies for conservation and management. Conceptual and methodological developments in this field are therefore critical. Here we present two novel methodological approaches that further the analytical possibilities of STRUCTURE and DResD. Using these approaches we analyse structure and migrations in a grey wolf (Canislupus population in north-eastern Europe. We genotyped 16 microsatellite loci in 166 individuals sampled from the wolf population in Estonia and Latvia that has been under strong and continuous hunting pressure for decades. Our analysis demonstrated that this relatively small wolf population is represented by four genetic groups. We also used a novel methodological approach that uses linear interpolation to statistically test the spatial separation of genetic groups. The new method, which is capable of using program STRUCTURE output, can be applied widely in population genetics to reveal both core areas and areas of low significance for genetic groups. We also used a recently developed spatially explicit individual-based method DResD, and applied it for the first time to microsatellite data, revealing a migration corridor and barriers, and several contact zones.

  10. Ribosomal studies on the 70S ribosome of E.coli by means of neutron scattering

    International Nuclear Information System (INIS)

    Burkhardt, N.

    1997-01-01

    Ribosomes are ribonucleo-protein complexes, which catalyse proteinbiosynthesis in all living organisms. Currently, most of the structural models of the prokaryotic 70S ribosome rely on electron microscopy and describe mainly the outer shape of the particle. Neutron scattering can provide information on the internal structure of the ribosome. Parts of the structure can be contrasted for neutrons by means of an isotopic exchange of the naturally occurring hydrogen ( 1 H) for deuterium ( 2 H), allowing direct measurements in situ. Specifically deuterium-labeled ribosomes (E. coli) were prepared and analysed with neutron scattering. The biochemical methods were established and combined to a generally applicable preparation system. This allows labeling of all ribosomal components in any combination. A systematic analysis of the protein and RNA phases resulted in the development of a new model for the 70S ribosome. This model describes not only the outer shape of the particle, but displays also an experimentally determined internal protein-RNA distribution and the border of subunits for the first time (four-phase model; resolution: 50A). Models of the 70S ribosome from other studies were evaluated and ranked according to consistency with the measured scattering data. Applying a new neutron scattering technique of particular sensitivity, the proton-spin contrast-variation, single proteins could be measured and localized. The positions of the proteins S6 and S10 were determined, providing the first coordinates of protein mass centers within the 70S ribosome. (orig.) [de

  11. Identification of nucleolus-associated chromatin domains reveals the role of the nucleolus in the 3D organisation of the A. thaliana genome

    Science.gov (United States)

    Pontvianne, Frédéric; Carpentier, Marie-Christine; Durut, Nathalie; Pavlištová, Veronika; Jaške, Karin; Schořová, Šárka; Parrinello, Hugues; Rohmer, Marine; Pikaard, Craig S; Fojtová, Miloslava; Fajkus, Jiří; Saez-Vasquez, Julio

    2017-01-01

    The nucleolus is the site of ribosomal RNA (rRNA) gene transcription, rRNA processing and ribosome biogenesis. However, the nucleolus also plays additional roles in the cell. We isolated nucleoli by Fluorescence Activated Cell Sorting (FACS) and identified Nucleolus-Associated Chromatin Domains (NADs) by deep sequencing, comparing wild-type plants and null mutants for the nucleolar protein, NUCLEOLIN 1 (NUC1). NADs are primarily genomic regions with heterochromatic signatures and include transposable elements (TEs), sub-telomeric regions and mostly inactive protein-coding genes. However, NADs also include active ribosomal RNA genes, and the entire short arm of chromosome 4 adjacent to them. In nuc1 null mutants, which alter rRNA gene expression and overall nucleolar structure, NADs are altered, telomere association with the nucleolus is decreased and telomeres become shorter. Collectively, our studies reveal roles for NUC1 and the nucleolus in the spatial organization of chromosomes as well as telomere maintenance. PMID:27477271

  12. The 70S ribosome modulates the ATPase activity of Escherichia coli YchF.

    Science.gov (United States)

    Becker, Marion; Gzyl, Katherine E; Altamirano, Alvin M; Vuong, Anthony; Urban, Kirstin; Wieden, Hans-Joachim

    2012-10-01

    YchF is one of two universally conserved GTPases with unknown cellular function. As a first step toward elucidating YchF's cellular role, we performed a detailed biochemical characterization of the protein from Escherichia coli. Our data from fluorescence titrations not only confirmed the surprising finding that YchFE.coli binds adenine nucleotides more efficiently than guanine nucleotides, but also provides the first evidence suggesting that YchF assumes two distinct conformational states (ATP- and ADP-bound) consistent with the functional cycle of a typical GTPase. Based on an in vivo pull-down experiment using a His-tagged variant of YchF from E. coli (YchFE.coli), we were able to isolate a megadalton complex containing the 70S ribosome. Based on this finding, we report the successful reconstitution of a YchF•70S complex in vitro, revealing an affinity (KD) of the YchFE.coli•ADPNP complex for 70S ribosomes of 3 μM. The in vitro reconstitution data also suggests that the identity of the nucleotide-bound state of YchF (ADP or ATP) modulates its affinity for 70S ribosomes. A detailed Michaelis-Menten analysis of YchF's catalytic activity in the presence and the absence of the 70S ribosome and its subunits revealed for the first time that the 70S ribosome is able to stimulate YchF's ATPase activity (~10-fold), confirming the ribosome as part of the functional cycle of YchF. Our findings taken together with previously reported data for the human homolog of YchF (hOLA1) indicate a high level of evolutionary conservation in the enzymatic properties of YchF and suggest that the ribosome is the main functional partner of YchF not only in bacteria.

  13. Sex-biased natal dispersal and inbreeding avoidance in American black bears as revealed by spatial genetic analyses.

    Science.gov (United States)

    Costello, Cecily M; Creel, Scott R; Kalinowski, Steven T; Vu, Ninh V; Quigley, Howard B

    2008-11-01

    We tested the hypothesis that sex-biased natal dispersal reduces close inbreeding in American black bears, a solitary species that exhibits nearly complete male dispersal and female philopatry. Using microsatellite DNA and spatial data from reproductively mature bears (>or= 4 years old), we examined the spatial genetic structure of two distinct populations in New Mexico from 1993 to 2000. As predicted, relatedness (r) and the frequency of close relationships (parent-offspring or full siblings) decreased with distance among female dyads, but little change was observed among male or opposite-sex dyads. Neighbouring females were more closely related than neighbouring males. The potential for inbreeding was low. Most opposite-sex pairs that lived sufficiently close to facilitate mating were unrelated, and few were close relatives. We found no evidence that bears actively avoided inbreeding in their selection of mates from this nearby pool, as mean r and relationship frequencies did not differ between potential and actual mating pairs (determined by parentage analysis). These basic patterns were apparent in both study areas despite a nearly two-fold difference in density. However, the sex bias in dispersal was less pronounced in the lower-density area, based on proportions of bears with male and female relatives residing nearby. This result suggests that male bears may respond to reduced competition by decreasing their rate or distance of dispersal. Evidence supports the hypothesis that inbreeding avoidance is achieved by means of male-biased dispersal but also indicates that competition (for mates or resources) modifies dispersal patterns.

  14. The ribosome can prevent aggregation of partially folded protein intermediates: studies using the Escherichia coli ribosome.

    Directory of Open Access Journals (Sweden)

    Bani Kumar Pathak

    Full Text Available BACKGROUND: Molecular chaperones that support de novo folding of proteins under non stress condition are classified as chaperone 'foldases' that are distinct from chaperone' holdases' that provide high affinity binding platform for unfolded proteins and prevent their aggregation specifically under stress conditions. Ribosome, the cellular protein synthesis machine can act as a foldase chaperone that can bind unfolded proteins and release them in folding competent state. The peptidyl transferase center (PTC located in the domain V of the 23S rRNA of Escherichia coli ribosome (bDV RNA is the chaperoning center of the ribosome. It has been proposed that via specific interactions between the RNA and refolding proteins, the chaperone provides information for the correct folding of unfolded polypeptide chains. RESULTS: We demonstrate using Escherichia coli ribosome and variants of its domain V RNA that the ribosome can bind to partially folded intermediates of bovine carbonic anhydrase II (BCAII and lysozyme and suppress aggregation during their refolding. Using mutants of domain V RNA we demonstrate that the time for which the chaperone retains the bound protein is an important factor in determining its ability to suppress aggregation and/or support reactivation of protein. CONCLUSION: The ribosome can behave like a 'holdase' chaperone and has the ability to bind and hold back partially folded intermediate states of proteins from participating in the aggregation process. Since the ribosome is an essential organelle that is present in large numbers in all living cells, this ability of the ribosome provides an energetically inexpensive way to suppress cellular aggregation. Further, this ability of the ribosome might also be crucial in the context that the ribosome is one of the first chaperones to be encountered by a large nascent polypeptide chains that have a tendency to form partially folded intermediates immediately following their synthesis.

  15. Functional Dynamics within the Human Ribosome Regulate the Rate of Active Protein Synthesis.

    Science.gov (United States)

    Ferguson, Angelica; Wang, Leyi; Altman, Roger B; Terry, Daniel S; Juette, Manuel F; Burnett, Benjamin J; Alejo, Jose L; Dass, Randall A; Parks, Matthew M; Vincent, C Theresa; Blanchard, Scott C

    2015-11-05

    The regulation of protein synthesis contributes to gene expression in both normal physiology and disease, yet kinetic investigations of the human translation mechanism are currently lacking. Using single-molecule fluorescence imaging methods, we have quantified the nature and timing of structural processes in human ribosomes during single-turnover and processive translation reactions. These measurements reveal that functional complexes exhibit dynamic behaviors and thermodynamic stabilities distinct from those observed for bacterial systems. Structurally defined sub-states of pre- and post-translocation complexes were sensitive to specific inhibitors of the eukaryotic ribosome, demonstrating the utility of this platform to probe drug mechanism. The application of three-color single-molecule fluorescence resonance energy transfer (smFRET) methods further revealed a long-distance allosteric coupling between distal tRNA binding sites within ribosomes bearing three tRNAs, which contributed to the rate of processive translation. Copyright © 2015 Elsevier Inc. All rights reserved.

  16. Detection and Quantification of Ribosome Inhibition by Aminoglycoside Antibiotics in Living Bacteria Using an Orthogonal Ribosome-Controlled Fluorescent Reporter.

    Science.gov (United States)

    Huang, Shijie; Zhu, Xuechen; Melançon, Charles E

    2016-01-15

    The ribosome is the quintessential antibacterial drug target, with many structurally and mechanistically distinct classes of antibacterial agents acting by inhibiting ribosome function. Detecting and quantifying ribosome inhibition by small molecules and investigating their binding modes and mechanisms of action are critical to antibacterial drug discovery and development efforts. To develop a ribosome inhibition assay that is operationally simple, yet provides direct information on the drug target and the mechanism of action, we have developed engineered E. coli strains harboring an orthogonal ribosome-controlled green fluorescent protein (GFP) reporter that produce fluorescent signal when the orthogonal ribosome is inhibited. As a proof of concept, we demonstrate that these strains, when coexpressing homogeneous populations of aminoglycoside resistant ribosomes, act as sensitive and quantitative detectors of ribosome inhibition by a set of 12 structurally diverse aminoglycoside antibiotics. We suggest that this strategy can be extended to quantifying ribosome inhibition by other drug classes.

  17. Subacute onset leukodystrophy and visual-spatial disorders revealing phenylketonuria combined with homocysteinmia in adulthood: A case report.

    Science.gov (United States)

    Wang, Chunchen; Li, Jieying

    2018-02-01

    Phenylketonuria (PKU) is a metabolic disorder, which manifests a progressive irreversible neurological impairment during infancy and childhood. Hyperhomocysteinemia also showed that it might be involved in pathophysiology of many neuropsychiatric disorders. The late-onset clinical manifestations of these 2 diseases have not been reported elsewhere. We speculated that the late-onset PKU is caused by 2 kinds of metabolic dysfunction synergistically, especially a short period of irregular diet directly caused clinical symptoms. A 21-year old Asian male patient demonstrated subacute leukodystrophy and visual-spatial disorders of late onset in adulthood. Phenylketonuria combined with homocysteinmia, who presented with heterozygous mutations in gene encoding PAH p.G247R (c.739G>C) and p.Y204C (c.611A>G), along with homozygous mutation of gene encoding MTHFR c.677C>T. The patient was treated with cobalamine (500 μg/day), vitamin B6 (30 mg/day), folate (5 mg/day) and encouraged to follow a protein-restricted diet. Visual disorientation and cognitive function showed improvement. Head MR showed similar resolution with the original lesion. Serum homocysteine and folate analysis were normal with decreased phenylalanine level. This case suggests that neurological involvement of progressive nervous system dysfunction could be caused by more than one kind of inherited metabolic disturbances, and each one can induce or deteriorate the manifestations of another metabolic disorders.

  18. Energy dissipation mechanism revealed by spatially resolved Raman thermometry of graphene/hexagonal boron nitride heterostructure devices

    Science.gov (United States)

    Kim, Daehee; Kim, Hanul; Yun, Wan Soo; Watanabe, Kenji; Taniguchi, Takashi; Rho, Heesuk; Bae, Myung-Ho

    2018-04-01

    Understanding the energy transport by charge carriers and phonons in two-dimensional (2D) van der Waals heterostructures is essential for the development of future energy-efficient 2D nanoelectronics. Here, we performed in situ spatially resolved Raman thermometry on an electrically biased graphene channel and its hBN substrate to study the energy dissipation mechanism in graphene/hBN heterostructures. By comparing the temperature profile along the biased graphene channel with that along the hBN substrate, we found that the thermal boundary resistance between the graphene and hBN was in the range of (1-2) ~ × 10-7 m2 K W-1 from ~100 °C to the onset of graphene break-down at ~600 °C in air. Consideration of an electro-thermal transport model together with the Raman thermometry conducted in air showed that a doping effect occurred under a strong electric field played a crucial role in the energy dissipation of the graphene/hBN device up to T ~ 600 °C.

  19. Pan-Antarctic analysis aggregating spatial estimates of Adélie penguin abundance reveals robust dynamics despite stochastic noise.

    Science.gov (United States)

    Che-Castaldo, Christian; Jenouvrier, Stephanie; Youngflesh, Casey; Shoemaker, Kevin T; Humphries, Grant; McDowall, Philip; Landrum, Laura; Holland, Marika M; Li, Yun; Ji, Rubao; Lynch, Heather J

    2017-10-10

    Colonially-breeding seabirds have long served as indicator species for the health of the oceans on which they depend. Abundance and breeding data are repeatedly collected at fixed study sites in the hopes that changes in abundance and productivity may be useful for adaptive management of marine resources, but their suitability for this purpose is often unknown. To address this, we fit a Bayesian population dynamics model that includes process and observation error to all known Adélie penguin abundance data (1982-2015) in the Antarctic, covering >95% of their population globally. We find that process error exceeds observation error in this system, and that continent-wide "year effects" strongly influence population growth rates. Our findings have important implications for the use of Adélie penguins in Southern Ocean feedback management, and suggest that aggregating abundance across space provides the fastest reliable signal of true population change for species whose dynamics are driven by stochastic processes.Adélie penguins are a key Antarctic indicator species, but data patchiness has challenged efforts to link population dynamics to key drivers. Che-Castaldo et al. resolve this issue using a pan-Antarctic Bayesian model to infer missing data, and show that spatial aggregation leads to more robust inference regarding dynamics.

  20. Optogenetic and pharmacological suppression of spatial clusters of face neurons reveal their causal role in face gender discrimination.

    Science.gov (United States)

    Afraz, Arash; Boyden, Edward S; DiCarlo, James J

    2015-05-26

    Neurons that respond more to images of faces over nonface objects were identified in the inferior temporal (IT) cortex of primates three decades ago. Although it is hypothesized that perceptual discrimination between faces depends on the neural activity of IT subregions enriched with "face neurons," such a causal link has not been directly established. Here, using optogenetic and pharmacological methods, we reversibly suppressed the neural activity in small subregions of IT cortex of macaque monkeys performing a facial gender-discrimination task. Each type of intervention independently demonstrated that suppression of IT subregions enriched in face neurons induced a contralateral deficit in face gender-discrimination behavior. The same neural suppression of other IT subregions produced no detectable change in behavior. These results establish a causal link between the neural activity in IT face neuron subregions and face gender-discrimination behavior. Also, the demonstration that brief neural suppression of specific spatial subregions of IT induces behavioral effects opens the door for applying the technical advantages of optogenetics to a systematic attack on the causal relationship between IT cortex and high-level visual perception.

  1. Molecular markers reveal spatially segregated cryptic species in a critically endangered fish, the common skate (Dipturus batis).

    Science.gov (United States)

    Griffiths, Andrew M; Sims, David W; Cotterell, Stephen P; El Nagar, Aliya; Ellis, Jim R; Lynghammar, Arve; McHugh, Matthew; Neat, Francis C; Pade, Nicolas G; Queiroz, Nuno; Serra-Pereira, Bárbara; Rapp, Toby; Wearmouth, Victoria J; Genner, Martin J

    2010-05-22

    Many sharks and skates are particularly vulnerable to overfishing because of their large size, slow growth, late maturity and low fecundity. In Europe dramatic population declines have taken place in common skate (Dipturus batis L.), one of the largest demersal fish in regional shelf seas, leading to extirpations from substantial parts of its former range. Here we report the discovery of cryptic species in common skate collected from the northeast Atlantic continental shelf. Data from nuclear microsatellite markers indicated two clearly distinct clades and phylogenetic analysis of mitochondrial DNA sequences demonstrated monophyly of each one of them. Capture locations showed evidence of strong spatial segregation, with one taxon occurring mainly in waters off the southern British Isles and around Rockall, while the other was restricted to more northerly shelf waters. These apparently cryptic species showed overlapping substrate and depth preferences, but distributional limits were closely related to temperature gradients, potentially indicating thermal limits to their distributions. This discovery of hidden diversity within a large, critically endangered marine vertebrate demonstrates how marine biodiversity can be underestimated, even in such a relatively well-studied and heavily exploited region.

  2. Molecular markers reveal spatially segregated cryptic species in a critically endangered fish, the common skate (Dipturus batis)

    Science.gov (United States)

    Griffiths, Andrew M.; Sims, David W.; Cotterell, Stephen P.; El Nagar, Aliya; Ellis, Jim R.; Lynghammar, Arve; McHugh, Matthew; Neat, Francis C.; Pade, Nicolas G.; Queiroz, Nuno; Serra-Pereira, Bárbara; Rapp, Toby; Wearmouth, Victoria J.; Genner, Martin J.

    2010-01-01

    Many sharks and skates are particularly vulnerable to overfishing because of their large size, slow growth, late maturity and low fecundity. In Europe dramatic population declines have taken place in common skate (Dipturus batis L.), one of the largest demersal fish in regional shelf seas, leading to extirpations from substantial parts of its former range. Here we report the discovery of cryptic species in common skate collected from the northeast Atlantic continental shelf. Data from nuclear microsatellite markers indicated two clearly distinct clades and phylogenetic analysis of mitochondrial DNA sequences demonstrated monophyly of each one of them. Capture locations showed evidence of strong spatial segregation, with one taxon occurring mainly in waters off the southern British Isles and around Rockall, while the other was restricted to more northerly shelf waters. These apparently cryptic species showed overlapping substrate and depth preferences, but distributional limits were closely related to temperature gradients, potentially indicating thermal limits to their distributions. This discovery of hidden diversity within a large, critically endangered marine vertebrate demonstrates how marine biodiversity can be underestimated, even in such a relatively well-studied and heavily exploited region. PMID:20106849

  3. Analysis of biostimulated microbial communities from two field experiments reveals temporal and spatial differences in proteome profiles

    Energy Technology Data Exchange (ETDEWEB)

    Callister, S.J.; Wilkins, M.J.; Nicora, C.D.; Williams, K.H.; Banfield, J.F.; VerBerkmoes, N.C.; Hettich, R.L.; NGuessan, A.L.; Mouser, P.J.; Elifantz, H.; Smith, R.D.; Lovley, D.R.; Lipton, M.S.; Long, P.E.

    2010-07-15

    Stimulated by an acetate-amendment field experiment conducted in 2007, anaerobic microbial populations in the aquifer at the Rifle Integrated Field Research Challenge site in Colorado reduced mobile U(VI) to insoluble U(IV). During this experiment, planktonic biomass was sampled at various time points to quantitatively evaluate proteomes. In 2008, an acetate-amended field experiment was again conducted in a similar manner to the 2007 experiment. As there was no comprehensive metagenome sequence available for use in proteomics analysis, we systematically evaluated 12 different organism genome sequences to generate sets of aggregate genomes, or “pseudo-metagenomes”, for supplying relative quantitative peptide and protein identifications. Proteomics results support previous observations of the dominance of Geobacteraceae during biostimulation using acetate as sole electron donor, and revealed a shift from an early stage of iron reduction to a late stage of iron reduction. Additionally, a shift from iron reduction to sulfate reduction was indicated by changes in the contribution of proteome information contributed by different organism genome sequences within the aggregate set. In addition, the comparison of proteome measurements made between the 2007 field experiment and 2008 field experiment revealed differences in proteome profiles. These differences may be the result of alterations in abundance and population structure within the planktonic biomass samples collected for analysis.

  4. Microscopic View of Defect Evolution in Thermal Treated AlGaInAs Quantum Well Revealed by Spatially Resolved Cathodoluminescence

    Directory of Open Access Journals (Sweden)

    Yue Song

    2018-06-01

    Full Text Available An aluminum gallium indium arsenic (AlGaInAs material system is indispensable as the active layer of diode lasers emitting at 1310 or 1550 nm, which are used in optical fiber communications. However, the course of the high-temperature instability of a quantum well structure, which is closely related to the diffusion of indium atoms, is still not clear due to the system’s complexity. The diffusion process of indium atoms was simulated by thermal treatment, and the changes in the optical and structural properties of an AlGaInAs quantum well are investigated in this paper. Compressive strained Al0.07Ga0.22In0.71As quantum wells were treated at 170 °C with different heat durations. A significant decrement of photoluminescence decay time was observed on the quantum well of a sample that was annealed after 4 h. The microscopic cathodoluminescent (CL spectra of these quantum wells were measured by scanning electron microscope-cathodoluminescence (SEM-CL. The thermal treatment effect on quantum wells was characterized via CL emission peak wavelength and energy density distribution, which were obtained by spatially resolved cathodoluminescence. The defect area was clearly observed in the Al0.07Ga0.22In0.71As quantum wells layer after thermal treatment. CL emissions from the defect core have higher emission energy than those from the defect-free regions. The defect core distribution, which was associated with indium segregation gradient distribution, showed asymmetric character.

  5. Linezolid-Dependent Function and Structure Adaptation of Ribosomes in a Staphylococcus epidermidis Strain Exhibiting Linezolid Dependence

    OpenAIRE

    Kokkori, Sofia; Apostolidi, Maria; Tsakris, Athanassios; Pournaras, Spyros; Stathopoulos, Constantinos; Dinos, George

    2014-01-01

    Linezolid-dependent growth was recently reported in Staphylococcus epidermidis clinical strains carrying mutations associated with linezolid resistance. To investigate this unexpected behavior at the molecular level, we isolated active ribosomes from one of the linezolid-dependent strains and we compared them with ribosomes isolated from a wild-type strain. Both strains were grown in the absence and presence of linezolid. Detailed biochemical and structural analyses revealed essential differe...

  6. Comparative Metagenomics Reveal Phylum Level Temporal and Spatial Changes in Mycobiome of Belowground Parts of Crocus sativus.

    Directory of Open Access Journals (Sweden)

    Sheetal Ambardar

    cormosphere dormant = 0.05%. This is the first report on the fungal diversity associated with the root of Crocus sativus and first report on the fungi associated with corm of any plant with the temporal and spatial variation in the fungal community structure.

  7. The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus.

    Science.gov (United States)

    Hori, H; Osawa, S; Murao, K; Ishikura, H

    1980-01-01

    The nucleotide sequence of ribosomal 5S RNA from Micrococcus lysodeikticus is pGUUACGGCGGCUAUAGCGUGGGGGAAACGCCCGGCCGUAUAUCGAACCCGGAAGCUAAGCCCCAUAGCGCCGAUGGUUACUGUAACCGGGAGGUUGUGGGAGAGUAGGUCGCCGCCGUGAOH. When compared to other 5S RNAs, the sequence homology is greatest with Thermus aquaticus, and these two 5S RNAs reveal several features intermediate between those of typical gram-positive bacteria and gram-negative bacteria. PMID:6780979

  8. The nature of the Galactic Center source IRS 13 revealed by high spatial resolution in the infrared

    Science.gov (United States)

    Maillard, J. P.; Paumard, T.; Stolovy, S. R.; Rigaut, F.

    2004-08-01

    High spatial resolution observations in the 1 to 3.5 μm/ region of the Galactic Center source known historically as IRS 13 are presented. They include ground-based adaptive optics images in the H, Kp (2.12/0.4 μm) and L bands, HST-NICMOS data in filters between 1.1 and 2.2 μm, and integral field spectroscopic data from BEAR, an Imaging FTS, in the He I 2.06 μm/ and the Brγ line regions. Analysis of all these data provides a completely new picture of the main component, IRS 13E, which appears as a cluster of seven individual stars within a projected diameter of ˜0.5 arcsec (0.02 pc). The brightest sources, 13E1, 13E2, 13E3 which is detected as a binary, and 13E4, are all massive stars of different type. The star 13E1 is a luminous, blue object, with no detected emission line. 13E2 and 13E4 are two hot, high-mass emission line stars, 13E2 being at the WR stage and 13E4 a massive O-type star. In contrast, 13E3A and B are extremely red objects, proposed as other examples of dusty WR stars, like IRS 21 (Tanner et al. \\cite{tanner}). All these sources have a common westward proper motion (Ott et al. \\cite{ott2}) indicating they are bounded. Two other sources, detected after deconvolution of the AO images in the H and Kp bands, are also identified. One, that we call 13E5, is a red source similar to 13E3A and B, while the other one, 13E6, is probably a main sequence O star in front of the cluster. Considering this exceptional concentration of comoving massive hot stars, IRS 13E is proposed as the remaining core of a massive star cluster, which could harbor an intermediate-mass black hole (IMBH) (Portegies Zwart & McMillan \\cite{zwart2)} of ˜1300 M⊙. This detection plays in favor of a scenario, first suggested by Gerhard (\\cite{gerhard}), in which the helium stars and the other hot stars in the central parsec originate from the stripping of a massive cluster formed several tens of pc from the center. This cluster would have spiraled towards SgrA*, and IRS 13E

  9. Long-term urban carbon dioxide observations reveal spatial and temporal dynamics related to urban characteristics and growth.

    Science.gov (United States)

    Mitchell, Logan E; Lin, John C; Bowling, David R; Pataki, Diane E; Strong, Courtenay; Schauer, Andrew J; Bares, Ryan; Bush, Susan E; Stephens, Britton B; Mendoza, Daniel; Mallia, Derek; Holland, Lacey; Gurney, Kevin R; Ehleringer, James R

    2018-03-20

    Cities are concentrated areas of CO 2 emissions and have become the foci of policies for mitigation actions. However, atmospheric measurement networks suitable for evaluating urban emissions over time are scarce. Here we present a unique long-term (decadal) record of CO 2 mole fractions from five sites across Utah's metropolitan Salt Lake Valley. We examine "excess" CO 2 above background conditions resulting from local emissions and meteorological conditions. We ascribe CO 2 trends to changes in emissions, since we did not find long-term trends in atmospheric mixing proxies. Three contrasting CO 2 trends emerged across urban types: negative trends at a residential-industrial site, positive trends at a site surrounded by rapid suburban growth, and relatively constant CO 2 over time at multiple sites in the established, residential, and commercial urban core. Analysis of population within the atmospheric footprints of the different sites reveals approximately equal increases in population influencing the observed CO 2 , implying a nonlinear relationship with CO 2 emissions: Population growth in rural areas that experienced suburban development was associated with increasing emissions while population growth in the developed urban core was associated with stable emissions. Four state-of-the-art global-scale emission inventories also have a nonlinear relationship with population density across the city; however, in contrast to our observations, they all have nearly constant emissions over time. Our results indicate that decadal scale changes in urban CO 2 emissions are detectable through monitoring networks and constitute a valuable approach to evaluate emission inventories and studies of urban carbon cycles.

  10. Long-term urban carbon dioxide observations reveal spatial and temporal dynamics related to urban characteristics and growth

    Science.gov (United States)

    Mitchell, Logan E.; Lin, John C.; Bowling, David R.; Pataki, Diane E.; Strong, Courtenay; Schauer, Andrew J.; Bares, Ryan; Bush, Susan E.; Stephens, Britton B.; Mendoza, Daniel; Mallia, Derek; Holland, Lacey; Gurney, Kevin R.; Ehleringer, James R.

    2018-03-01

    Cities are concentrated areas of CO2 emissions and have become the foci of policies for mitigation actions. However, atmospheric measurement networks suitable for evaluating urban emissions over time are scarce. Here we present a unique long-term (decadal) record of CO2 mole fractions from five sites across Utah’s metropolitan Salt Lake Valley. We examine “excess” CO2 above background conditions resulting from local emissions and meteorological conditions. We ascribe CO2 trends to changes in emissions, since we did not find long-term trends in atmospheric mixing proxies. Three contrasting CO2 trends emerged across urban types: negative trends at a residential-industrial site, positive trends at a site surrounded by rapid suburban growth, and relatively constant CO2 over time at multiple sites in the established, residential, and commercial urban core. Analysis of population within the atmospheric footprints of the different sites reveals approximately equal increases in population influencing the observed CO2, implying a nonlinear relationship with CO2 emissions: Population growth in rural areas that experienced suburban development was associated with increasing emissions while population growth in the developed urban core was associated with stable emissions. Four state-of-the-art global-scale emission inventories also have a nonlinear relationship with population density across the city; however, in contrast to our observations, they all have nearly constant emissions over time. Our results indicate that decadal scale changes in urban CO2 emissions are detectable through monitoring networks and constitute a valuable approach to evaluate emission inventories and studies of urban carbon cycles.

  11. Spatial and Species Variations in Bacterial Communities Associated with Corals from the Red Sea as Revealed by Pyrosequencing

    KAUST Repository

    Lee, O. O.

    2012-08-03

    Microbial associations with corals are common and are most likely symbiotic, although their diversity and relationships with environmental factors and host species remain unclear. In this study, we adopted a 16S rRNA gene tag-pyrosequencing technique to investigate the bacterial communities associated with three stony Scleractinea and two soft Octocorallia corals from three locations in the Red Sea. Our results revealed highly diverse bacterial communities in the Red Sea corals, with more than 600 ribotypes detected and up to 1,000 species estimated from a single coral species. Altogether, 21 bacterial phyla were recovered from the corals, of which Gammaproteobacteria was the most dominant group, and Chloroflexi, Chlamydiae, and the candidate phylum WS3 were reported in corals for the first time. The associated bacterial communities varied greatly with location, where environmental conditions differed significantly. Corals from disturbed areas appeared to share more similar bacterial communities, but larger variations in community structures were observed between different coral species from pristine waters. Ordination methods identified salinity and depth as the most influential parameters affecting the abundance of Vibrio, Pseudoalteromonas, Serratia, Stenotrophomonas, Pseudomonas, and Achromobacter in the corals. On the other hand, bacteria such as Chloracidobacterium and Endozoicomonas were more sensitive to the coral species, suggesting that the host species type may be influential in the associated bacterial community, as well. The combined influences of the coral host and environmental factors on the associated microbial communities are discussed. This study represents the first comparative study using tag-pyrosequencing technology to investigate the bacterial communities in Red Sea corals.

  12. Nine-year spatial and temporal evolution of desert dust aerosols over South and East Asia as revealed by CALIOP

    Directory of Open Access Journals (Sweden)

    E. Proestakis

    2018-02-01

    Full Text Available We present a 3-D climatology of the desert dust distribution over South and East Asia derived using CALIPSO (Cloud-Aerosol Lidar and Infrared Pathfinder Satellite Observation data. To distinguish desert dust from total aerosol load we apply a methodology developed in the framework of EARLINET (European Aerosol Research Lidar Network. The method involves the use of the particle linear depolarization ratio and updated lidar ratio values suitable for Asian dust, applied to multiyear CALIPSO observations (January 2007–December 2015. The resulting dust product provides information on the horizontal and vertical distribution of dust aerosols over South and East Asia along with the seasonal transition of dust transport pathways. Persistent high D_AOD (dust aerosol optical depth values at 532 nm, of the order of 0.6, are present over the arid and semi-arid desert regions. Dust aerosol transport (range, height and intensity is subject to high seasonality, with the highest values observed during spring for northern China (Taklimakan and Gobi deserts and during summer over the Indian subcontinent (Thar Desert. Additionally, we decompose the CALIPSO AOD (aerosol optical depth into dust and non-dust aerosol components to reveal the non-dust AOD over the highly industrialized and densely populated regions of South and East Asia, where the non-dust aerosols yield AOD values of the order of 0.5. Furthermore, the CALIPSO-based short-term AOD and D_AOD time series and trends between January 2007 and December 2015 are calculated over South and East Asia and over selected subregions. Positive trends are observed over northwest and east China and the Indian subcontinent, whereas over southeast China trends are mostly negative. The calculated AOD trends agree well with the trends derived from Aqua MODIS (Moderate Resolution Imaging Spectroradiometer, although significant differences are observed over specific regions.

  13. Structural insights into methyltransferase KsgA function in 30S ribosomal subunit biogenesis.

    Science.gov (United States)

    Boehringer, Daniel; O'Farrell, Heather C; Rife, Jason P; Ban, Nenad

    2012-03-23

    The assembly of the ribosomal subunits is facilitated by ribosome biogenesis factors. The universally conserved methyltransferase KsgA modifies two adjacent adenosine residues in the 3'-terminal helix 45 of the 16 S ribosomal RNA (rRNA). KsgA recognizes its substrate adenosine residues only in the context of a near mature 30S subunit and is required for the efficient processing of the rRNA termini during ribosome biogenesis. Here, we present the cryo-EM structure of KsgA bound to a nonmethylated 30S ribosomal subunit. The structure reveals that KsgA binds to the 30S platform with the catalytic N-terminal domain interacting with substrate adenosine residues in helix 45 and the C-terminal domain making extensive contacts to helix 27 and helix 24. KsgA excludes the penultimate rRNA helix 44 from adopting its position in the mature 30S subunit, blocking the formation of the decoding site and subunit joining. We suggest that the activation of methyltransferase activity and subsequent dissociation of KsgA control conformational changes in helix 44 required for final rRNA processing and translation initiation.

  14. Structural Insights into Methyltransferase KsgA Function in 30S Ribosomal Subunit Biogenesis*

    Science.gov (United States)

    Boehringer, Daniel; O'Farrell, Heather C.; Rife, Jason P.; Ban, Nenad

    2012-01-01

    The assembly of the ribosomal subunits is facilitated by ribosome biogenesis factors. The universally conserved methyltransferase KsgA modifies two adjacent adenosine residues in the 3′-terminal helix 45 of the 16 S ribosomal RNA (rRNA). KsgA recognizes its substrate adenosine residues only in the context of a near mature 30S subunit and is required for the efficient processing of the rRNA termini during ribosome biogenesis. Here, we present the cryo-EM structure of KsgA bound to a nonmethylated 30S ribosomal subunit. The structure reveals that KsgA binds to the 30S platform with the catalytic N-terminal domain interacting with substrate adenosine residues in helix 45 and the C-terminal domain making extensive contacts to helix 27 and helix 24. KsgA excludes the penultimate rRNA helix 44 from adopting its position in the mature 30S subunit, blocking the formation of the decoding site and subunit joining. We suggest that the activation of methyltransferase activity and subsequent dissociation of KsgA control conformational changes in helix 44 required for final rRNA processing and translation initiation. PMID:22308031

  15. Insertion of the Biogenesis Factor Rei1 Probes the Ribosomal Tunnel during 60S Maturation.

    Science.gov (United States)

    Greber, Basil Johannes; Gerhardy, Stefan; Leitner, Alexander; Leibundgut, Marc; Salem, Michèle; Boehringer, Daniel; Leulliot, Nicolas; Aebersold, Ruedi; Panse, Vikram Govind; Ban, Nenad

    2016-01-14

    Eukaryotic ribosome biogenesis depends on several hundred assembly factors to produce functional 40S and 60S ribosomal subunits. The final phase of 60S subunit biogenesis is cytoplasmic maturation, which includes the proofreading of functional centers of the 60S subunit and the release of several ribosome biogenesis factors. We report the cryo-electron microscopy (cryo-EM) structure of the yeast 60S subunit in complex with the biogenesis factors Rei1, Arx1, and Alb1 at 3.4 Å resolution. In addition to the network of interactions formed by Alb1, the structure reveals a mechanism for ensuring the integrity of the ribosomal polypeptide exit tunnel. Arx1 probes the entire set of inner-ring proteins surrounding the tunnel exit, and the C terminus of Rei1 is deeply inserted into the ribosomal tunnel, where it forms specific contacts along almost its entire length. We provide genetic and biochemical evidence that failure to insert the C terminus of Rei1 precludes subsequent steps of 60S maturation. Copyright © 2016 Elsevier Inc. All rights reserved.

  16. The Circadian Clock Modulates Global Daily Cycles of mRNA Ribosome Loading[OPEN

    Science.gov (United States)

    Missra, Anamika; Ernest, Ben; Jia, Qidong; Ke, Kenneth

    2015-01-01

    Circadian control of gene expression is well characterized at the transcriptional level, but little is known about diel or circadian control of translation. Genome-wide translation state profiling of mRNAs in Arabidopsis thaliana seedlings grown in long day was performed to estimate ribosome loading per mRNA. The experiments revealed extensive translational regulation of key biological processes. Notably, translation of mRNAs for ribosomal proteins and mitochondrial respiration peaked at night. Central clock mRNAs are among those subject to fluctuations in ribosome loading. There was no consistent phase relationship between peak translation states and peak transcript levels. The overlay of distinct transcriptional and translational cycles can be expected to alter the waveform of the protein synthesis rate. Plants that constitutively overexpress the clock gene CCA1 showed phase shifts in peak translation, with a 6-h delay from midnight to dawn or from noon to evening being particularly common. Moreover, cycles of ribosome loading that were detected under continuous light in the wild type collapsed in the CCA1 overexpressor. Finally, at the transcript level, the CCA1-ox strain adopted a global pattern of transcript abundance that was broadly correlated with the light-dark environment. Altogether, these data demonstrate that gene-specific diel cycles of ribosome loading are controlled in part by the circadian clock. PMID:26392078

  17. Effect of primary and secondary radicals on chain breaks in ribosomal RNA in E. coli ribosomes

    International Nuclear Information System (INIS)

    Singh, H.; Bishop, J.

    1984-01-01

    It has been shown previously that, in dilute aerated solutions, ribosomes are inactivated by OH radicals and by secondary radicals produced from added alcohols (Singh and Vadasz 1983 a). In de-aerated solutions, both radicalH and e - sub(aq) also inactivate ribosomes (Singh and Vadasz 1983 b). The results of these studies and other on different systems (Adams et al. 1973, Aldrich and Cundall 1969, Dewey and Stein 1970, Masuda et al. 1971, Nabben et al. 1982, 1983, Samuni et al. 1980, Singh and Singh 1982) have shown that damage to biological systems occurs by diverse mechanisms. One of these mechanisms involves chain breaks in RNA (Pollard and Weller 1967). The purpose of this study was to determine which of the primary and secondary radicals cause chain breaks in ribosomal RNA (rRNA) within the ribosomes. (author)

  18. Primary structures of ribosomal proteins from the archaebacterium Halobacterium marismortui and the eubacterium Bacillus stearothermophilus.

    Science.gov (United States)

    Arndt, E; Scholzen, T; Krömer, W; Hatakeyama, T; Kimura, M

    1991-06-01

    Approximately 40 ribosomal proteins from each Halobacterium marismortui and Bacillus stearothermophilus have been sequenced either by direct protein sequence analysis or by DNA sequence analysis of the appropriate genes. The comparison of the amino acid sequences from the archaebacterium H marismortui with the available ribosomal proteins from the eubacterial and eukaryotic kingdoms revealed four different groups of proteins: 24 proteins are related to both eubacterial as well as eukaryotic proteins. Eleven proteins are exclusively related to eukaryotic counterparts. For three proteins only eubacterial relatives-and for another three proteins no counterpart-could be found. The similarities of the halobacterial ribosomal proteins are in general somewhat higher to their eukaryotic than to their eubacterial counterparts. The comparison of B stearothermophilus proteins with their E coli homologues showed that the proteins evolved at different rates. Some proteins are highly conserved with 64-76% identity, others are poorly conserved with only 25-34% identical amino acid residues.

  19. Structures of the E. coli translating ribosome with SRP and its receptor and with the translocon.

    Science.gov (United States)

    Jomaa, Ahmad; Boehringer, Daniel; Leibundgut, Marc; Ban, Nenad

    2016-01-25

    Co-translational protein targeting to membranes is a universally conserved process. Central steps include cargo recognition by the signal recognition particle and handover to the Sec translocon. Here we present snapshots of key co-translational-targeting complexes solved by cryo-electron microscopy at near-atomic resolution, establishing the molecular contacts between the Escherichia coli translating ribosome, the signal recognition particle and the translocon. Our results reveal the conformational changes that regulate the latching of the signal sequence, the release of the heterodimeric domains of the signal recognition particle and its receptor, and the handover of the signal sequence to the translocon. We also observe that the signal recognition particle and the translocon insert-specific structural elements into the ribosomal tunnel to remodel it, possibly to sense nascent chains. Our work provides structural evidence for a conformational state of the signal recognition particle and its receptor primed for translocon binding to the ribosome-nascent chain complex.

  20. Enhanced vector borne disease surveillance of California Culex mosquito populations reveals spatial and species-specific barriers of infection.

    Energy Technology Data Exchange (ETDEWEB)

    VanderNoot, Victoria A.; Curtis, Deanna Joy; Koh, Chung-Yan; Brodsky, Benjamin H; Lane, Todd

    2014-08-01

    terium and c am p y l o bacter bac t er i al spec i e s . W e utilized the s e mic r obial transcri p tomes pre s e nt in g e ogra p hical l y defined Cul e x po p ul a tions to defi n e spatial and m osqui t o specie s -spec i fic ba r r iers of i n fecti o n. T he v i r ome and microbi o me c o mpos i tion id e ntified in e ach mosqui t o p o ol pr o v i ded suf f icient resolut i on to dete r m i ne both the mosq u ito species and the g e o graphic regi o n in Californ i a w h e re t h e mosqui t o po o l orig i n ated. T his d a ta pr o v i des ins i ght in t o the compl e x i t y of microb i al spec i es cir c ulati n g in med i cal l y i mport a nt Culex mosqui t oes a nd t h eir potent i al im p act o n t he tran s missi o n of v ector-b o rne human / veter i na r y p a t hogens in C a liforn i a.

  1. The ribosome structure controls and directs mRNA entry, translocation and exit dynamics

    International Nuclear Information System (INIS)

    Kurkcuoglu, Ozge; Doruker, Pemra; Jernigan, Robert L; Sen, Taner Z; Kloczkowski, Andrzej

    2008-01-01

    The protein-synthesizing ribosome undergoes large motions to effect the translocation of tRNAs and mRNA; here, the domain motions of this system are explored with a coarse-grained elastic network model using normal mode analysis. Crystal structures are used to construct various model systems of the 70S complex with/without tRNA, elongation factor Tu and the ribosomal proteins. Computed motions reveal the well-known ratchet-like rotational motion of the large subunits, as well as the head rotation of the small subunit and the high flexibility of the L1 and L7/L12 stalks, even in the absence of ribosomal proteins. This result indicates that these experimentally observed motions during translocation are inherently controlled by the ribosomal shape and only partially dependent upon GTP hydrolysis. Normal mode analysis further reveals the mobility of A- and P-tRNAs to increase in the absence of the E-tRNA. In addition, the dynamics of the E-tRNA is affected by the absence of the ribosomal protein L1. The mRNA in the entrance tunnel interacts directly with helicase proteins S3 and S4, which constrain the mRNA in a clamp-like fashion, as well as with protein S5, which likely orients the mRNA to ensure correct translation. The ribosomal proteins S7, S11 and S18 may also be involved in assuring translation fidelity by constraining the mRNA at the exit site of the channel. The mRNA also interacts with the 16S 3' end forming the Shine–Dalgarno complex at the initiation step; the 3' end may act as a 'hook' to reel in the mRNA to facilitate its exit

  2. The primary structures of ribosomal proteins L16, L23 and L33 from the archaebacterium Halobacterium marismortui.

    Science.gov (United States)

    Hatakeyama, T; Hatakeyama, T; Kimura, M

    1988-11-21

    The complete amino acid sequences of ribosomal proteins L16, L23 and L33 from the archaebacterium Halobacterium marismortui were determined. The sequences were established by manual sequencing of peptides produced with several proteases as well as by cleavage with dilute HCl. Proteins L16, L23 and L33 consist of 119, 154 and 69 amino acid residues, and their molecular masses are 13,538, 16,812 and 7620 Da, respectively. The comparison of their sequences with those of ribosomal proteins from other organisms revealed that L23 and L33 are related to eubacterial ribosomal proteins from Escherichia coli and Bacillus stearothermophilus, while protein L16 was found to be homologous to a eukaryotic ribosomal protein from yeast. These results provide information about the special phylogenetic position of archaebacteria.

  3. A combined quantitative mass spectrometry and electron microscopy analysis of ribosomal 30S subunit assembly in E. coli.

    Science.gov (United States)

    Sashital, Dipali G; Greeman, Candacia A; Lyumkis, Dmitry; Potter, Clinton S; Carragher, Bridget; Williamson, James R

    2014-10-14

    Ribosome assembly is a complex process involving the folding and processing of ribosomal RNAs (rRNAs), concomitant binding of ribosomal proteins (r-proteins), and participation of numerous accessory cofactors. Here, we use a quantitative mass spectrometry/electron microscopy hybrid approach to determine the r-protein composition and conformation of 30S ribosome assembly intermediates in Escherichia coli. The relative timing of assembly of the 3' domain and the formation of the central pseudoknot (PK) structure depends on the presence of the assembly factor RimP. The central PK is unstable in the absence of RimP, resulting in the accumulation of intermediates in which the 3'-domain is unanchored and the 5'-domain is depleted for r-proteins S5 and S12 that contact the central PK. Our results reveal the importance of the cofactor RimP in central PK formation, and introduce a broadly applicable method for characterizing macromolecular assembly in cells.

  4. The ribosome biogenesis factor Nol11 is required for optimal rDNA transcription and craniofacial development in Xenopus.

    Directory of Open Access Journals (Sweden)

    John N Griffin

    2015-03-01

    Full Text Available The production of ribosomes is ubiquitous and fundamental to life. As such, it is surprising that defects in ribosome biogenesis underlie a growing number of symptomatically distinct inherited disorders, collectively called ribosomopathies. We previously determined that the nucleolar protein, NOL11, is essential for optimal pre-rRNA transcription and processing in human tissue culture cells. However, the role of NOL11 in the development of a multicellular organism remains unknown. Here, we reveal a critical function for NOL11 in vertebrate ribosome biogenesis and craniofacial development. Nol11 is strongly expressed in the developing cranial neural crest (CNC of both amphibians and mammals, and knockdown of Xenopus nol11 results in impaired pre-rRNA transcription and processing, increased apoptosis, and abnormal development of the craniofacial cartilages. Inhibition of p53 rescues this skeletal phenotype, but not the underlying ribosome biogenesis defect, demonstrating an evolutionarily conserved control mechanism through which ribosome-impaired craniofacial cells are removed. Excessive activation of this mechanism impairs craniofacial development. Together, our findings reveal a novel requirement for Nol11 in craniofacial development, present the first frog model of a ribosomopathy, and provide further insight into the clinically important relationship between specific ribosome biogenesis proteins and craniofacial cell survival.

  5. Features of spatial and functional segregation and integration of the primate connectome revealed by trade-off between wiring cost and efficiency.

    Science.gov (United States)

    Chen, Yuhan; Wang, Shengjun; Hilgetag, Claus C; Zhou, Changsong

    2017-09-01

    The primate connectome, possessing a characteristic global topology and specific regional connectivity profiles, is well organized to support both segregated and integrated brain function. However, the organization mechanisms shaping the characteristic connectivity and its relationship to functional requirements remain unclear. The primate brain connectome is shaped by metabolic economy as well as functional values. Here, we explored the influence of two competing factors and additional advanced functional requirements on the primate connectome employing an optimal trade-off model between neural wiring cost and the representative functional requirement of processing efficiency. Moreover, we compared this model with a generative model combining spatial distance and topological similarity, with the objective of statistically reproducing multiple topological features of the network. The primate connectome indeed displays a cost-efficiency trade-off and that up to 67% of the connections were recovered by optimal combination of the two basic factors of wiring economy and processing efficiency, clearly higher than the proportion of connections (56%) explained by the generative model. While not explicitly aimed for, the trade-off model captured several key topological features of the real connectome as the generative model, yet better explained the connectivity of most regions. The majority of the remaining 33% of connections unexplained by the best trade-off model were long-distance links, which are concentrated on few cortical areas, termed long-distance connectors (LDCs). The LDCs are mainly non-hubs, but form a densely connected group overlapping on spatially segregated functional modalities. LDCs are crucial for both functional segregation and integration across different scales. These organization features revealed by the optimization analysis provide evidence that the demands of advanced functional segregation and integration among spatially distributed regions may

  6. Features of spatial and functional segregation and integration of the primate connectome revealed by trade-off between wiring cost and efficiency.

    Directory of Open Access Journals (Sweden)

    Yuhan Chen

    2017-09-01

    Full Text Available The primate connectome, possessing a characteristic global topology and specific regional connectivity profiles, is well organized to support both segregated and integrated brain function. However, the organization mechanisms shaping the characteristic connectivity and its relationship to functional requirements remain unclear. The primate brain connectome is shaped by metabolic economy as well as functional values. Here, we explored the influence of two competing factors and additional advanced functional requirements on the primate connectome employing an optimal trade-off model between neural wiring cost and the representative functional requirement of processing efficiency. Moreover, we compared this model with a generative model combining spatial distance and topological similarity, with the objective of statistically reproducing multiple topological features of the network. The primate connectome indeed displays a cost-efficiency trade-off and that up to 67% of the connections were recovered by optimal combination of the two basic factors of wiring economy and processing efficiency, clearly higher than the proportion of connections (56% explained by the generative model. While not explicitly aimed for, the trade-off model captured several key topological features of the real connectome as the generative model, yet better explained the connectivity of most regions. The majority of the remaining 33% of connections unexplained by the best trade-off model were long-distance links, which are concentrated on few cortical areas, termed long-distance connectors (LDCs. The LDCs are mainly non-hubs, but form a densely connected group overlapping on spatially segregated functional modalities. LDCs are crucial for both functional segregation and integration across different scales. These organization features revealed by the optimization analysis provide evidence that the demands of advanced functional segregation and integration among spatially

  7. [Family of ribosomal proteins S1 contains unique conservative domain].

    Science.gov (United States)

    Deriusheva, E I; Machulin, A V; Selivanova, O M; Serdiuk, I N

    2010-01-01

    Different representatives of bacteria have different number of amino acid residues in the ribosomal proteins S1. This number varies from 111 (Spiroplasma kunkelii) to 863 a.a. (Treponema pallidum). Traditionally and for lack of this protein three-dimensional structure, its architecture is represented as repeating S1 domains. Number of these domains depends on the protein's length. Domain's quantity and its boundaries data are contained in the specialized databases, such as SMART, Pfam and PROSITE. However, for the same object these data may be very different. For search of domain's quantity and its boundaries, new approach, based on the analysis of dicted secondary structure (PsiPred), was used. This approach allowed us to reveal structural domains in amino acid sequences of S1 proteins and at that number varied from one to six. Alignment of S1 proteins, containing different domain's number, with the S1 RNAbinding domain of Escherichia coli PNPase elicited a fact that in family of ribosomal proteins SI one domain has maximal homology with S1 domain from PNPase. This conservative domain migrates along polypeptide chain and locates in proteins, containing different domain's number, according to specified pattern. In this domain as well in the S1 domain from PNPase, residues Phe-19, Phe-22, His-34, Asp-64 and Arg-68 are clustered on the surface and formed RNA binding site.

  8. GTPases and the origin of the ribosome

    Directory of Open Access Journals (Sweden)

    Smith Temple F

    2010-05-01

    Full Text Available Abstract Background This paper is an attempt to trace the evolution of the ribosome through the evolution of the universal P-loop GTPases that are involved with the ribosome in translation and with the attachment of the ribosome to the membrane. The GTPases involved in translation in Bacteria/Archaea are the elongation factors EFTu/EF1, the initiation factors IF2/aeIF5b + aeIF2, and the elongation factors EFG/EF2. All of these GTPases also contain the OB fold also found in the non GTPase IF1 involved in initiation. The GTPase involved in the signal recognition particle in most Bacteria and Archaea is SRP54. Results 1 The Elongation Factors of the Archaea based on structural considerations of the domains have the following evolutionary path: EF1→ aeIF2 → EF2. The evolution of the aeIF5b was a later event; 2 the Elongation Factors of the Bacteria based on the topological considerations of the GTPase domain have a similar evolutionary path: EFTu→ IF→2→EFG. These evolutionary sequences reflect the evolution of the LSU followed by the SSU to form the ribosome; 3 the OB-fold IF1 is a mimic of an ancient tRNA minihelix. Conclusion The evolution of translational GTPases of both the Archaea and Bacteria point to the evolution of the ribosome. The elongation factors, EFTu/EF1, began as a Ras-like GTPase bringing the activated minihelix tRNA to the Large Subunit Unit. The initiation factors and elongation factor would then have evolved from the EFTu/EF1 as the small subunit was added to the evolving ribosome. The SRP has an SRP54 GTPase and a specific RNA fold in its RNA component similar to the PTC. We consider the SRP to be a remnant of an ancient form of an LSU bound to a membrane. Reviewers This article was reviewed by George Fox, Leonid Mirny and Chris Sander.

  9. Alterations at the peptidyl transferase centre of the ribosome induced by the synergistic action of the streptogramins dalfopristin and quinupristin

    Directory of Open Access Journals (Sweden)

    Fucini Paola

    2004-04-01

    Full Text Available Abstract Background The bacterial ribosome is a primary target of several classes of antibiotics. Investigation of the structure of the ribosomal subunits in complex with different antibiotics can reveal the mode of inhibition of ribosomal protein synthesis. Analysis of the interactions between antibiotics and the ribosome permits investigation of the specific effect of modifications leading to antimicrobial resistances. Streptogramins are unique among the ribosome-targeting antibiotics because they consist of two components, streptogramins A and B, which act synergistically. Each compound alone exhibits a weak bacteriostatic activity, whereas the combination can act bactericidal. The streptogramins A display a prolonged activity that even persists after removal of the drug. However, the mode of activity of the streptogramins has not yet been fully elucidated, despite a plethora of biochemical and structural data. Results The investigation of the crystal structure of the 50S ribosomal subunit from Deinococcus radiodurans in complex with the clinically relevant streptogramins quinupristin and dalfopristin reveals their unique inhibitory mechanism. Quinupristin, a streptogramin B compound, binds in the ribosomal exit tunnel in a similar manner and position as the macrolides, suggesting a similar inhibitory mechanism, namely blockage of the ribosomal tunnel. Dalfopristin, the corresponding streptogramin A compound, binds close to quinupristin directly within the peptidyl transferase centre affecting both A- and P-site occupation by tRNA molecules. Conclusions The crystal structure indicates that the synergistic effect derives from direct interaction between both compounds and shared contacts with a single nucleotide, A2062. Upon binding of the streptogramins, the peptidyl transferase centre undergoes a significant conformational transition, which leads to a stable, non-productive orientation of the universally conserved U2585. Mutations of this r

  10. Nuclear Export of Pre-Ribosomal Subunits Requires Dbp5, but Not as an RNA-Helicase as for mRNA Export.

    Science.gov (United States)

    Neumann, Bettina; Wu, Haijia; Hackmann, Alexandra; Krebber, Heike

    2016-01-01

    The DEAD-box RNA-helicase Dbp5/Rat8 is known for its function in nuclear mRNA export, where it displaces the export receptor Mex67 from the mRNA at the cytoplasmic side of the nuclear pore complex (NPC). Here we show that Dbp5 is also required for the nuclear export of both pre-ribosomal subunits. Yeast temperature-sensitive dbp5 mutants accumulate both ribosomal particles in their nuclei. Furthermore, Dbp5 genetically and physically interacts with known ribosomal transport factors such as Nmd3. Similar to mRNA export we show that also for ribosomal transport Dbp5 is required at the cytoplasmic side of the NPC. However, unlike its role in mRNA export, Dbp5 does not seem to undergo its ATPase cycle for this function, as ATPase-deficient dbp5 mutants that selectively inhibit mRNA export do not affect ribosomal transport. Furthermore, mutants of GLE1, the ATPase stimulating factor of Dbp5, show no major ribosomal export defects. Consequently, while Dbp5 uses its ATPase cycle to displace the export receptor Mex67 from the translocated mRNAs, Mex67 remains bound to ribosomal subunits upon transit to the cytoplasm, where it is detectable on translating ribosomes. Therefore, we propose a model, in which Dbp5 supports ribosomal transport by capturing ribosomal subunits upon their cytoplasmic appearance at the NPC, possibly by binding export factors such as Mex67. Thus, our findings reveal that although different ribonucleoparticles, mRNAs and pre-ribosomal subunits, use shared export factors, they utilize different transport mechanisms.

  11. sORFs.org: a repository of small ORFs identified by ribosome profiling.

    Science.gov (United States)

    Olexiouk, Volodimir; Crappé, Jeroen; Verbruggen, Steven; Verhegen, Kenneth; Martens, Lennart; Menschaert, Gerben

    2016-01-04

    With the advent of ribosome profiling, a next generation sequencing technique providing a "snap-shot'' of translated mRNA in a cell, many short open reading frames (sORFs) with ribosomal activity were identified. Follow-up studies revealed the existence of functional peptides, so-called micropeptides, translated from these 'sORFs', indicating a new class of bio-active peptides. Over the last few years, several micropeptides exhibiting important cellular functions were discovered. However, ribosome occupancy does not necessarily imply an actual function of the translated peptide, leading to the development of various tools assessing the coding potential of sORFs. Here, we introduce sORFs.org (http://www.sorfs.org), a novel database for sORFs identified using ribosome profiling. Starting from ribosome profiling, sORFs.org identifies sORFs, incorporates state-of-the-art tools and metrics and stores results in a public database. Two query interfaces are provided, a default one enabling quick lookup of sORFs and a BioMart interface providing advanced query and export possibilities. At present, sORFs.org harbors 263 354 sORFs that demonstrate ribosome occupancy, originating from three different cell lines: HCT116 (human), E14_mESC (mouse) and S2 (fruit fly). sORFs.org aims to provide an extensive sORFs database accessible to researchers with limited bioinformatics knowledge, thus enabling easy integration into personal projects. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  12. Kinetic pathway of 40S ribosomal subunit recruitment to hepatitis C virus internal ribosome entry site.

    Science.gov (United States)

    Fuchs, Gabriele; Petrov, Alexey N; Marceau, Caleb D; Popov, Lauren M; Chen, Jin; O'Leary, Seán E; Wang, Richard; Carette, Jan E; Sarnow, Peter; Puglisi, Joseph D

    2015-01-13

    Translation initiation can occur by multiple pathways. To delineate these pathways by single-molecule methods, fluorescently labeled ribosomal subunits are required. Here, we labeled human 40S ribosomal subunits with a fluorescent SNAP-tag at ribosomal protein eS25 (RPS25). The resulting ribosomal subunits could be specifically labeled in living cells and in vitro. Using single-molecule Förster resonance energy transfer (FRET) between RPS25 and domain II of the hepatitis C virus (HCV) internal ribosome entry site (IRES), we measured the rates of 40S subunit arrival to the HCV IRES. Our data support a single-step model of HCV IRES recruitment to 40S subunits, irreversible on the initiation time scale. We furthermore demonstrated that after binding, the 40S:HCV IRES complex is conformationally dynamic, undergoing slow large-scale rearrangements. Addition of translation extracts suppresses these fluctuations, funneling the complex into a single conformation on the 80S assembly pathway. These findings show that 40S:HCV IRES complex formation is accompanied by dynamic conformational rearrangements that may be modulated by initiation factors.

  13. Suboptimal T-cell receptor signaling compromises protein translation, ribosome biogenesis, and proliferation of mouse CD8 T cells.

    Science.gov (United States)

    Tan, Thomas C J; Knight, John; Sbarrato, Thomas; Dudek, Kate; Willis, Anne E; Zamoyska, Rose

    2017-07-25

    Global transcriptomic and proteomic analyses of T cells have been rich sources of unbiased data for understanding T-cell activation. Lack of full concordance of these datasets has illustrated that important facets of T-cell activation are controlled at the level of translation. We undertook translatome analysis of CD8 T-cell activation, combining polysome profiling and microarray analysis. We revealed that altering T-cell receptor stimulation influenced recruitment of mRNAs to heavy polysomes and translation of subsets of genes. A major pathway that was compromised, when TCR signaling was suboptimal, was linked to ribosome biogenesis, a rate-limiting factor in both cell growth and proliferation. Defective TCR signaling affected transcription and processing of ribosomal RNA precursors, as well as the translation of specific ribosomal proteins and translation factors. Mechanistically, IL-2 production was compromised in weakly stimulated T cells, affecting the abundance of Myc protein, a known regulator of ribosome biogenesis. Consequently, weakly activated T cells showed impaired production of ribosomes and a failure to maintain proliferative capacity after stimulation. We demonstrate that primary T cells respond to various environmental cues by regulating ribosome biogenesis and mRNA translation at multiple levels to sustain proliferation and differentiation.

  14. Spatially complex distribution of dissolved manganese in a fjord as revealed by high-resolution in situ sensing using the autonomous underwater vehicle Autosub.

    Science.gov (United States)

    Statham, P J; Connelly, D P; German, C R; Brand, T; Overnell, J O; Bulukin, E; Millard, N; McPhail, S; Pebody, M; Perrett, J; Squire, M; Stevenson, P; Webb, A

    2005-12-15

    Loch Etive is a fjordic system on the west coast of Scotland. The deep waters of the upper basin are periodically isolated, and during these periods oxygen is lost through benthic respiration and concentrations of dissolved manganese increase. In April 2000 the autonomous underwater vehicle (AUV) Autosub was fitted with an in situ dissolved manganese analyzer and was used to study the spatial variability of this element together with oxygen, salinity, and temperature throughout the basin. Six along-loch transects were completed at either constant height above the seafloor or at constant depth below the surface. The ca. 4000 in situ 10-s-average dissolved Mn (Mnd) data points obtained provide a new quasi-synoptic and highly detailed view of the distribution of manganese in this fjordic environment not possible using conventional (water bottle) sampling. There is substantial variability in concentrations (600 nM) and distributions of Mnd. Surface waters are characteristically low in Mnd reflecting mixing of riverine and marine end-member waters, both of which are low in Mnd. The deeper waters are enriched in Mnd, and as the water column always contains some oxygen, this must reflect primarily benthic inputs of reduced dissolved Mn. However, this enrichment of Mnd is spatially very variable, presumably as a result of variability in release of Mn coupled with mixing of water in the loch and removal processes. This work demonstrates how AUVs coupled with chemical sensors can reveal substantial small-scale variability of distributions of chemical species in coastal environments that would not be resolved by conventional sampling approaches. Such information is essential if we are to improve our understanding of the nature and significance of the underlying processes leading to this variability.

  15. High-Resolution Analysis of Coronavirus Gene Expression by RNA Sequencing and Ribosome Profiling.

    Science.gov (United States)

    Irigoyen, Nerea; Firth, Andrew E; Jones, Joshua D; Chung, Betty Y-W; Siddell, Stuart G; Brierley, Ian

    2016-02-01

    Members of the family Coronaviridae have the largest genomes of all RNA viruses, typically in the region of 30 kilobases. Several coronaviruses, such as Severe acute respiratory syndrome-related coronavirus (SARS-CoV) and Middle East respiratory syndrome-related coronavirus (MERS-CoV), are of medical importance, with high mortality rates and, in the case of SARS-CoV, significant pandemic potential. Other coronaviruses, such as Porcine epidemic diarrhea virus and Avian coronavirus, are important livestock pathogens. Ribosome profiling is a technique which exploits the capacity of the translating ribosome to protect around 30 nucleotides of mRNA from ribonuclease digestion. Ribosome-protected mRNA fragments are purified, subjected to deep sequencing and mapped back to the transcriptome to give a global "snap-shot" of translation. Parallel RNA sequencing allows normalization by transcript abundance. Here we apply ribosome profiling to cells infected with Murine coronavirus, mouse hepatitis virus, strain A59 (MHV-A59), a model coronavirus in the same genus as SARS-CoV and MERS-CoV. The data obtained allowed us to study the kinetics of virus transcription and translation with exquisite precision. We studied the timecourse of positive and negative-sense genomic and subgenomic viral RNA production and the relative translation efficiencies of the different virus ORFs. Virus mRNAs were not found to be translated more efficiently than host mRNAs; rather, virus translation dominates host translation at later time points due to high levels of virus transcripts. Triplet phasing of the profiling data allowed precise determination of translated reading frames and revealed several translated short open reading frames upstream of, or embedded within, known virus protein-coding regions. Ribosome pause sites were identified in the virus replicase polyprotein pp1a ORF and investigated experimentally. Contrary to expectations, ribosomes were not found to pause at the ribosomal

  16. High-Resolution Analysis of Coronavirus Gene Expression by RNA Sequencing and Ribosome Profiling.

    Directory of Open Access Journals (Sweden)

    Nerea Irigoyen

    2016-02-01

    Full Text Available Members of the family Coronaviridae have the largest genomes of all RNA viruses, typically in the region of 30 kilobases. Several coronaviruses, such as Severe acute respiratory syndrome-related coronavirus (SARS-CoV and Middle East respiratory syndrome-related coronavirus (MERS-CoV, are of medical importance, with high mortality rates and, in the case of SARS-CoV, significant pandemic potential. Other coronaviruses, such as Porcine epidemic diarrhea virus and Avian coronavirus, are important livestock pathogens. Ribosome profiling is a technique which exploits the capacity of the translating ribosome to protect around 30 nucleotides of mRNA from ribonuclease digestion. Ribosome-protected mRNA fragments are purified, subjected to deep sequencing and mapped back to the transcriptome to give a global "snap-shot" of translation. Parallel RNA sequencing allows normalization by transcript abundance. Here we apply ribosome profiling to cells infected with Murine coronavirus, mouse hepatitis virus, strain A59 (MHV-A59, a model coronavirus in the same genus as SARS-CoV and MERS-CoV. The data obtained allowed us to study the kinetics of virus transcription and translation with exquisite precision. We studied the timecourse of positive and negative-sense genomic and subgenomic viral RNA production and the relative translation efficiencies of the different virus ORFs. Virus mRNAs were not found to be translated more efficiently than host mRNAs; rather, virus translation dominates host translation at later time points due to high levels of virus transcripts. Triplet phasing of the profiling data allowed precise determination of translated reading frames and revealed several translated short open reading frames upstream of, or embedded within, known virus protein-coding regions. Ribosome pause sites were identified in the virus replicase polyprotein pp1a ORF and investigated experimentally. Contrary to expectations, ribosomes were not found to pause at the

  17. Phosphorylation of acidic ribosomal proteins from rabbit reticulocytes by a ribosome-associated casein kinase

    DEFF Research Database (Denmark)

    Issinger, O G

    1977-01-01

    Two acidic proteins from 80-S ribosomes were isolated and purified to homogeneity. The purified acidic proteins could be phosphorylated by casein kinase using [gamma-32P]ATP and [gamma-32P]GTP as a phosphoryl donor. The proteins became phosphorylated in situ, too. Sodium dodecyl sulfate polyacryl......Two acidic proteins from 80-S ribosomes were isolated and purified to homogeneity. The purified acidic proteins could be phosphorylated by casein kinase using [gamma-32P]ATP and [gamma-32P]GTP as a phosphoryl donor. The proteins became phosphorylated in situ, too. Sodium dodecyl sulfate...

  18. Molecular Chemical Structure of Barley Proteins Revealed by Ultra-Spatially Resolved Synchrotron Light Sourced FTIR Microspectroscopy: Comparison of Barley Varieties

    International Nuclear Information System (INIS)

    Yu, P.

    2007-01-01

    Barley protein structure affects the barley quality, fermentation, and degradation behavior in both humans and animals among other factors such as protein matrix. Publications show various biological differences among barley varieties such as Valier and Harrington, which have significantly different degradation behaviors. The objectives of this study were to reveal the molecular structure of barley protein, comparing various varieties (Dolly, Valier, Harrington, LP955, AC Metcalfe, and Sisler), and quantify protein structure profiles using Gaussian and Lorentzian methods of multi-component peak modeling by using the ultra-spatially resolved synchrotron light sourced Fourier transform infrared microspectroscopy (SFTIRM). The items of the protein molecular structure revealed included protein structure α-helices, β-sheets, and others such as β-turns and random coils. The experiment was performed at the National Synchrotron Light Source in Brookhaven National Laboratory (BNL, US Department of Energy, NY). The results showed that with the SFTIRM, the molecular structure of barley protein could be revealed. Barley protein structures exhibited significant differences among the varieties in terms of proportion and ratio of model-fitted α-helices, β-sheets, and others. By using multi-component peaks modeling at protein amide I region of 1710-1576 cm -1 , the results show that barley protein consisted of approximately 18-34% of α-helices, 14-25% of β-sheets, and 44-69% others. AC Metcalfe, Sisler, and LP955 consisted of higher (P 0.05). The ratio of α-helices to others (0.3 to 1.0, P < 0.05) and that of β-sheets to others (0.2 to 0.8, P < 0.05) were different among the barley varieties. It needs to be pointed out that using a multi-peak modeling for protein structure analysis is only for making relative estimates and not exact determinations and only for the comparison purpose between varieties. The principal component analysis showed that protein amide I Fourier

  19. The ribosomal protein Rpl22 controls ribosome composition by directly repressing expression of its own paralog, Rpl22l1.

    Directory of Open Access Journals (Sweden)

    Monique N O'Leary

    Full Text Available Most yeast ribosomal protein genes are duplicated and their characterization has led to hypotheses regarding the existence of specialized ribosomes with different subunit composition or specifically-tailored functions. In yeast, ribosomal protein genes are generally duplicated and evidence has emerged that paralogs might have specific roles. Unlike yeast, most mammalian ribosomal proteins are thought to be encoded by a single gene copy, raising the possibility that heterogenous populations of ribosomes are unique to yeast. Here, we examine the roles of the mammalian Rpl22, finding that Rpl22(-/- mice have only subtle phenotypes with no significant translation defects. We find that in the Rpl22(-/- mouse there is a compensatory increase in Rpl22-like1 (Rpl22l1 expression and incorporation into ribosomes. Consistent with the hypothesis that either ribosomal protein can support translation, knockdown of Rpl22l1 impairs growth of cells lacking Rpl22. Mechanistically, Rpl22 regulates Rpl22l1 directly by binding to an internal hairpin structure and repressing its expression. We propose that ribosome specificity may exist in mammals, providing evidence that one ribosomal protein can influence composition of the ribosome by regulating its own paralog.

  20. Placeholder factors in ribosome biogenesis: please, pave my way

    Directory of Open Access Journals (Sweden)

    Francisco J. Espinar-Marchena

    2017-04-01

    Full Text Available The synthesis of cytoplasmic eukaryotic ribosomes is an extraordinarily energy-demanding cellular activity that occurs progressively from the nucleolus to the cytoplasm. In the nucleolus, precursor rRNAs associate with a myriad of trans-acting factors and some ribosomal proteins to form pre-ribosomal particles. These factors include snoRNPs, nucleases, ATPases, GTPases, RNA helicases, and a vast list of proteins with no predicted enzymatic activity. Their coordinate activity orchestrates in a spatiotemporal manner the modification and processing of precursor rRNAs, the rearrangement reactions required for the formation of productive RNA folding intermediates, the ordered assembly of the ribosomal proteins, and the export of pre-ribosomal particles to the cytoplasm; thus, providing speed, directionality and accuracy to the overall process of formation of translation-competent ribosomes. Here, we review a particular class of trans-acting factors known as “placeholders”. Placeholder factors temporarily bind selected ribosomal sites until these have achieved a structural context that is appropriate for exchanging the placeholder with another site-specific binding factor. By this strategy, placeholders sterically prevent premature recruitment of subsequently binding factors, premature formation of structures, avoid possible folding traps, and act as molecular clocks that supervise the correct progression of pre-ribosomal particles into functional ribosomal subunits. We summarize the current understanding of those factors that delay the assembly of distinct ribosomal proteins or subsequently bind key sites in pre-ribosomal particles. We also discuss recurrent examples of RNA-protein and protein-protein mimicry between rRNAs and/or factors, which have clear functional implications for the ribosome biogenesis pathway.

  1. The architecture of mammalian ribosomal protein promoters

    Directory of Open Access Journals (Sweden)

    Perry Robert P

    2005-02-01

    Full Text Available Abstract Background Mammalian ribosomes contain 79 different proteins encoded by widely scattered single copy genes. Coordinate expression of these genes at transcriptional and post-transcriptional levels is required to ensure a roughly equimolar accumulation of ribosomal proteins. To date, detailed studies of only a very few ribosomal protein (rp promoters have been made. To elucidate the general features of rp promoter architecture, I made a detailed sequence comparison of the promoter regions of the entire set of orthologous human and mouse rp genes. Results A striking evolutionarily conserved feature of most rp genes is the separation by an intron of the sequences involved in transcriptional and translational regulation from the sequences with protein encoding function. Another conserved feature is the polypyrimidine initiator, which conforms to the consensus (Y2C+1TY(T2(Y3. At least 60 % of the rp promoters contain a largely conserved TATA box or A/T-rich motif, which should theoretically have TBP-binding capability. A remarkably high proportion of the promoters contain conserved binding sites for transcription factors that were previously implicated in rp gene expression, namely upstream GABP and Sp1 sites and downstream YY1 sites. Over 80 % of human and mouse rp genes contain a transposable element residue within 900 bp of 5' flanking sequence; very little sequence identity between human and mouse orthologues was evident more than 200 bp upstream of the transcriptional start point. Conclusions This analysis has provided some valuable insights into the general architecture of mammalian rp promoters and has identified parameters that might coordinately regulate the transcriptional activity of certain subsets of rp genes.

  2. Evolutionary dynamics of a conserved sequence motif in the ribosomal genes of the ciliate Paramecium

    Directory of Open Access Journals (Sweden)

    Lynch Michael

    2010-05-01

    Full Text Available Abstract Background In protozoa, the identification of preserved motifs by comparative genomics is often impeded by difficulties to generate reliable alignments for non-coding sequences. Moreover, the evolutionary dynamics of regulatory elements in 3' untranslated regions (both in protozoa and metazoa remains a virtually unexplored issue. Results By screening Paramecium tetraurelia's 3' untranslated regions for 8-mers that were previously found to be preserved in mammalian 3' UTRs, we detect and characterize a motif that is distinctly conserved in the ribosomal genes of this ciliate. The motif appears to be conserved across Paramecium aurelia species but is absent from the ribosomal genes of four additional non-Paramecium species surveyed, including another ciliate, Tetrahymena thermophila. Motif-free ribosomal genes retain fewer paralogs in the genome and appear to be lost more rapidly relative to motif-containing genes. Features associated with the discovered preserved motif are consistent with this 8-mer playing a role in post-transcriptional regulation. Conclusions Our observations 1 shed light on the evolution of a putative regulatory motif across large phylogenetic distances; 2 are expected to facilitate the understanding of the modulation of ribosomal genes expression in Paramecium; and 3 reveal a largely unexplored--and presumably not restricted to Paramecium--association between the presence/absence of a DNA motif and the evolutionary fate of its host genes.

  3. Evolutionary dynamics of a conserved sequence motif in the ribosomal genes of the ciliate Paramecium.

    Science.gov (United States)

    Catania, Francesco; Lynch, Michael

    2010-05-04

    In protozoa, the identification of preserved motifs by comparative genomics is often impeded by difficulties to generate reliable alignments for non-coding sequences. Moreover, the evolutionary dynamics of regulatory elements in 3' untranslated regions (both in protozoa and metazoa) remains a virtually unexplored issue. By screening Paramecium tetraurelia's 3' untranslated regions for 8-mers that were previously found to be preserved in mammalian 3' UTRs, we detect and characterize a motif that is distinctly conserved in the ribosomal genes of this ciliate. The motif appears to be conserved across Paramecium aurelia species but is absent from the ribosomal genes of four additional non-Paramecium species surveyed, including another ciliate, Tetrahymena thermophila. Motif-free ribosomal genes retain fewer paralogs in the genome and appear to be lost more rapidly relative to motif-containing genes. Features associated with the discovered preserved motif are consistent with this 8-mer playing a role in post-transcriptional regulation. Our observations 1) shed light on the evolution of a putative regulatory motif across large phylogenetic distances; 2) are expected to facilitate the understanding of the modulation of ribosomal genes expression in Paramecium; and 3) reveal a largely unexplored--and presumably not restricted to Paramecium--association between the presence/absence of a DNA motif and the evolutionary fate of its host genes.

  4. Molecular dynamics simulation of ribosome jam

    KAUST Repository

    Matsumoto, Shigenori

    2011-09-01

    We propose a coarse-grained molecular dynamics model of ribosome molecules to study the dependence of translation process on environmental parameters. We found the model exhibits traffic jam property, which is consistent with an ASEP model. We estimated the influence of the temperature and concentration of molecules on the hopping probability used in the ASEP model. Our model can also treat environmental effects on the translation process that cannot be explained by such cellular automaton models. © 2010 Elsevier B.V. All rights reserved.

  5. Ribosomal RNA: a key to phylogeny

    Science.gov (United States)

    Olsen, G. J.; Woese, C. R.

    1993-01-01

    As molecular phylogeny increasingly shapes our understanding of organismal relationships, no molecule has been applied to more questions than have ribosomal RNAs. We review this role of the rRNAs and some of the insights that have been gained from them. We also offer some of the practical considerations in extracting the phylogenetic information from the sequences. Finally, we stress the importance of comparing results from multiple molecules, both as a method for testing the overall reliability of the organismal phylogeny and as a method for more broadly exploring the history of the genome.

  6. Eukaryotic ribosome display with in situ DNA recovery.

    Science.gov (United States)

    He, Mingyue; Edwards, Bryan M; Kastelic, Damjana; Taussig, Michael J

    2012-01-01

    Ribosome display is a cell-free display technology for in vitro selection and optimisation of proteins from large diversified libraries. It operates through the formation of stable protein-ribosome-mRNA (PRM) complexes and selection of ligand-binding proteins, followed by DNA recovery from the selected genetic information. Both prokaryotic and eukaryotic ribosome display systems have been developed. In this chapter, we describe the eukaryotic rabbit reticulocyte method in which a distinct in situ single-primer RT-PCR procedure is used to recover DNA from the selected PRM complexes without the need for prior disruption of the ribosome.

  7. In Profile: Models of Ribosome Biogenesis Defects and Regulation of Protein Synthesis

    NARCIS (Netherlands)

    Essers, P.B.M.

    2013-01-01

    Ribosomes are the mediators of protein synthesis in the cell and therefore crucial to proper cell function. In addition, ribosomes are highly abundant, with ribosomal RNA making up 80% of the RNA in the cell. A large amount of resources go into maintaining this pool of ribosomes, so ribosome

  8. A computational investigation on the connection between dynamics properties of ribosomal proteins and ribosome assembly.

    Directory of Open Access Journals (Sweden)

    Brittany Burton

    Full Text Available Assembly of the ribosome from its protein and RNA constituents has been studied extensively over the past 50 years, and experimental evidence suggests that prokaryotic ribosomal proteins undergo conformational changes during assembly. However, to date, no studies have attempted to elucidate these conformational changes. The present work utilizes computational methods to analyze protein dynamics and to investigate the linkage between dynamics and binding of these proteins during the assembly of the ribosome. Ribosomal proteins are known to be positively charged and we find the percentage of positive residues in r-proteins to be about twice that of the average protein: Lys+Arg is 18.7% for E. coli and 21.2% for T. thermophilus. Also, positive residues constitute a large proportion of RNA contacting residues: 39% for E. coli and 46% for T. thermophilus. This affirms the known importance of charge-charge interactions in the assembly of the ribosome. We studied the dynamics of three primary proteins from E. coli and T. thermophilus 30S subunits that bind early in the assembly (S15, S17, and S20 with atomic molecular dynamic simulations, followed by a study of all r-proteins using elastic network models. Molecular dynamics simulations show that solvent-exposed proteins (S15 and S17 tend to adopt more stable solution conformations than an RNA-embedded protein (S20. We also find protein residues that contact the 16S rRNA are generally more mobile in comparison with the other residues. This is because there is a larger proportion of contacting residues located in flexible loop regions. By the use of elastic network models, which are computationally more efficient, we show that this trend holds for most of the 30S r-proteins.

  9. Defining the bacteroides ribosomal binding site.

    Science.gov (United States)

    Wegmann, Udo; Horn, Nikki; Carding, Simon R

    2013-03-01

    The human gastrointestinal tract, in particular the colon, hosts a vast number of commensal microorganisms. Representatives of the genus Bacteroides are among the most abundant bacterial species in the human colon. Bacteroidetes diverged from the common line of eubacterial descent before other eubacterial groups. As a result, they employ unique transcription initiation signals and, because of this uniqueness, they require specific genetic tools. Although some tools exist, they are not optimal for studying the roles and functions of these bacteria in the human gastrointestinal tract. Focusing on translation initiation signals in Bacteroides, we created a series of expression vectors allowing for different levels of protein expression in this genus, and we describe the use of pepI from Lactobacillus delbrueckii subsp. lactis as a novel reporter gene for Bacteroides. Furthermore, we report the identification of the 3' end of the 16S rRNA of Bacteroides ovatus and analyze in detail its ribosomal binding site, thus defining a core region necessary for efficient translation, which we have incorporated into the design of our expression vectors. Based on the sequence logo information from the 5' untranslated region of other Bacteroidales ribosomal protein genes, we conclude that our findings are relevant to all members of this order.

  10. The Spatial Politics of Spatial Representation

    DEFF Research Database (Denmark)

    Olesen, Kristian; Richardson, Tim

    2011-01-01

    spatial planning in Denmark reveals how fuzzy spatial representations and relational spatial concepts are being used to depoliticise strategic spatial planning processes and to camouflage spatial politics. The paper concludes that, while relational geography might play an important role in building......This paper explores the interplay between the spatial politics of new governance landscapes and innovations in the use of spatial representations in planning. The central premise is that planning experiments with new relational approaches become enmeshed in spatial politics. The case of strategic...

  11. Biphasic character of ribosomal translocation and non-Michaelis-Menten kinetics of translation

    Science.gov (United States)

    Xie, Ping

    2014-12-01

    We study theoretically the kinetics of mRNA translocation in the wild-type (WT) Escherichia coli ribosome, which is composed of a small 30 S and large 50 S subunit, and the ribosomes with mutations to some intersubunit bridges such as B1a, B4, B7a, and B8. The theoretical results reproduce well the available in vitro experimental data on the biphasic kinetics of the forward mRNA translocation catalyzed by elongation factor G (EF-G) hydrolyzing GTP, which can be best fit by the sum of two exponentials, and the monophasic kinetics of the spontaneous reverse mRNA translocation in the absence of the elongation factor, which can be best fit by a single-exponential function, in both the WT and mutant ribosomes. We show that both the mutation-induced increase in the maximal rate of the slow phase for the forward mRNA translocation and that in the rate of the spontaneous reverse mRNA translocation result from a reduction in the intrinsic energy barrier to resist the rotational movements between the two subunits, giving the same degree of increase in the two rates. The mutation-induced increase in the maximal rate of the fast phase for the forward mRNA translocation results mainly from the increase in the rate of the ribosomal unlocking, a conformational change in the ribosome that widens the mRNA channel for the mRNA translocation to take place, which could be partly due to the effect of the mutation on the intrasubunit 30S head rotation. Moreover, we study the translation rate of the WT and mutant ribosomes. It is shown that the translation rate versus the concentration of EF-G-GTP does not follow the Michaelis-Menten (MM) kinetics, which is in sharp contrast to the general property of other enzymes that the rate of the enzymatic reaction versus the concentration of a substrate follows the MM kinetics. The physical origin of this non-MM kinetics for the ribosome is revealed.

  12. Mechanism of recycling of post-termination ribosomal complexes in ...

    Indian Academy of Sciences (India)

    Madhu

    all pathway of ribosome recycling in eubacteria with especial reference to the important role of the initiation factor ... [Seshadri A and Varshney U 2006 Mechanism of recycling of post-termination ribosomal complexes in eubacteria: a new role of initiation factor 3 .... RRF binding results in a remarkable conformational change.

  13. Expression of protein-coding genes embedded in ribosomal DNA

    DEFF Research Database (Denmark)

    Johansen, Steinar D; Haugen, Peik; Nielsen, Henrik

    2007-01-01

    Ribosomal DNA (rDNA) is a specialised chromosomal location that is dedicated to high-level transcription of ribosomal RNA genes. Interestingly, rDNAs are frequently interrupted by parasitic elements, some of which carry protein genes. These are non-LTR retrotransposons and group II introns that e...... in the nucleolus....

  14. Proto-ribosome: a theoretical approach based on RNA relics

    OpenAIRE

    Demongeot, Jacques

    2017-01-01

    We describe in this paper, based on already published articles, a contribution to the theory postulating the existence of a proto-ribosome, which could have appeared early at the origin of life and we discuss the interest of this notion in an evolutionary perspective, taking into account the existence of possible RNA relics of this proto-ribosome.

  15. Macrolide antibiotic interaction and resistance on the bacterial ribosome.

    Science.gov (United States)

    Poehlsgaard, Jacob; Douthwaite, Stephen

    2003-02-01

    Our understanding of the fine structure of many antibiotic target sites has reached a new level of enlightenment in the last couple of years due to the advent, by X-ray crystallography, of high-resolution structures of the bacterial ribosome. Many classes of clinically useful antibiotics bind to the ribosome to inhibit bacterial protein synthesis. Macrolide, lincosamide and streptogramin B (MLSB) antibiotics form one of the largest groups, and bind to the same site on the 50S ribosomal subunit. Here, we review the molecular details of the ribosomal MLSB site to put into perspective the main points from a wealth of biochemical and genetic data that have been collected over several decades. The information is now available to understand, at atomic resolution, how macrolide antibiotics interact with their ribosomal target, how the target is altered to confer resistance, and in which directions we need to look if we are to rationally design better drugs to overcome the extant resistance mechanisms.

  16. Cis-regulatory RNA elements that regulate specialized ribosome activity.

    Science.gov (United States)

    Xue, Shifeng; Barna, Maria

    2015-01-01

    Recent evidence has shown that the ribosome itself can play a highly regulatory role in the specialized translation of specific subpools of mRNAs, in particular at the level of ribosomal proteins (RP). However, the mechanism(s) by which this selection takes place has remained poorly understood. In our recent study, we discovered a combination of unique RNA elements in the 5'UTRs of mRNAs that allows for such control by the ribosome. These mRNAs contain a Translation Inhibitory Element (TIE) that inhibits general cap-dependent translation, and an Internal Ribosome Entry Site (IRES) that relies on a specific RP for activation. The unique combination of an inhibitor of general translation and an activator of specialized translation is key to ribosome-mediated control of gene expression. Here we discuss how these RNA regulatory elements provide a new level of control to protein expression and their implications for gene expression, organismal development and evolution.

  17. Control of Ribosome Synthesis in Escherichia coli

    DEFF Research Database (Denmark)

    Molin, Søren; Meyenburg, K. von; Måløe, O.

    1977-01-01

    The rate of ribosome synthesis and accumulation in Escherichia coli during the transition after an energy source shift-down was analyzed. The shift was imposed on cultures of stringent and relaxed strains growing in glucose minimal medium by the addition of the glucose analogue {alpha...... and to estimate the transcription time for the rRNA operon under different conditions. In steady states of growth with growth rates ranging from 0.75 to 2.3 doublings/h, as well as during the transition after a shift-down, the transcription time of the rRNA operon was constant. The rate of synthesis of r......RNA correlated during this transition – in contrast to the rate of accumulation (M. T. Hansen et al., J. Bacteriol. 122: 585-591, 1975) – with the ppGpp pool in the same way as has been observed during partial amino acid starvation....

  18. Complete amino acid sequences of the ribosomal proteins L25, L29 and L31 from the archaebacterium Halobacterium marismortui.

    Science.gov (United States)

    Hatakeyama, T; Kimura, M

    1988-03-15

    Ribosomal proteins were extracted from 50S ribosomal subunits of the archaebacterium Halobacterium marismortui by decreasing the concentration of Mg2+ and K+, and the proteins were separated and purified by ion-exchange column chromatography on DEAE-cellulose. Ten proteins were purified to homogeneity and three of these proteins were subjected to sequence analysis. The complete amino acid sequences of the ribosomal proteins L25, L29 and L31 were established by analyses of the peptides obtained by enzymatic digestion with trypsin, Staphylococcus aureus protease, chymotrypsin and lysylendopeptidase. Proteins L25, L29 and L31 consist of 84, 115 and 95 amino acid residues with the molecular masses of 9472 Da, 12293 Da and 10418 Da respectively. A comparison of their sequences with those of other large-ribosomal-subunit proteins from other organisms revealed that protein L25 from H. marismortui is homologous to protein L23 from Escherichia coli (34.6%), Bacillus stearothermophilus (41.8%), and tobacco chloroplasts (16.3%) as well as to protein L25 from yeast (38.0%). Proteins L29 and L31 do not appear to be homologous to any other ribosomal proteins whose structures are so far known.

  19. Myb-binding protein 1a (Mybbp1a) regulates levels and processing of pre-ribosomal RNA.

    Science.gov (United States)

    Hochstatter, Julia; Hölzel, Michael; Rohrmoser, Michaela; Schermelleh, Lothar; Leonhardt, Heinrich; Keough, Rebecca; Gonda, Thomas J; Imhof, Axel; Eick, Dirk; Längst, Gernot; Németh, Attila

    2012-07-13

    Ribosomal RNA gene transcription, co-transcriptional processing, and ribosome biogenesis are highly coordinated processes that are tightly regulated during cell growth. In this study we discovered that Mybbp1a is associated with both the RNA polymerase I complex and the ribosome biogenesis machinery. Using a reporter assay that uncouples transcription and RNA processing, we show that Mybbp1a represses rRNA gene transcription. In addition, overexpression of the protein reduces RNA polymerase I loading on endogenous rRNA genes as revealed by chromatin immunoprecipitation experiments. Accordingly, depletion of Mybbp1a results in an accumulation of the rRNA precursor in vivo but surprisingly also causes growth arrest of the cells. This effect can be explained by the observation that the modulation of Mybbp1a protein levels results in defects in pre-rRNA processing within the cell. Therefore, the protein may play a dual role in the rRNA metabolism, potentially linking and coordinating ribosomal DNA transcription and pre-rRNA processing to allow for the efficient synthesis of ribosomes.

  20. The pleuromutilin drugs tiamulin and valnemulin bind to the RNA at the peptidyl transferase centre on the ribosome

    DEFF Research Database (Denmark)

    Poulsen, S M; Karlsson, M; Johansson, L B

    2001-01-01

    The pleuromutilin antibiotic derivatives, tiamulin and valnemulin, inhibit protein synthesis by binding to the 50S ribosomal subunit of bacteria. The action and binding site of tiamulin and valnemulin was further characterized on Escherichia coli ribosomes. It was revealed that these drugs...... centre and have been associated with binding of several antibiotics. Competitive footprinting shows that tiamulin and valnemulin can bind concurrently with the macrolide erythromycin but compete with the macrolide carbomycin, which is a peptidyl transferase inhibitor. We infer from these and previous...... results that tiamulin and valnemulin interact with the rRNA in the peptidyl transferase slot on the ribosomes in which they prevent the correct positioning of the CCA-ends of tRNAs for peptide transfer....

  1. On the intracellular trafficking of mouse S5 ribosomal protein from cytoplasm to nucleoli.

    Science.gov (United States)

    Matragkou, Ch; Papachristou, H; Karetsou, Z; Papadopoulos, G; Papamarcaki, T; Vizirianakis, I S; Tsiftsoglou, A S; Choli-Papadopoulou, T

    2009-10-09

    The non-ribosomal functions of mammalian ribosomal proteins have recently attracted worldwide attention. The mouse ribosomal protein S5 (rpS5) derived from ribosomal material is an assembled non-phosphorylated protein. The free form of rpS5 protein, however, undergoes phosphorylation. In this study, we have (a) investigated the potential role of phosphorylation in rpS5 protein transport into the nucleus and then into nucleoli and (b) determined which of the domains of rpS5 are involved in this intracellular trafficking. In vitro PCR mutagenesis of mouse rpS5 cDNA, complemented by subsequent cloning and expression of rpS5 truncated recombinant forms, produced in fusion with green fluorescent protein, permitted the investigation of rpS5 intracellular trafficking in HeLa cells using confocal microscopy complemented by Western blot analysis. Our results indicate the following: (a) rpS5 protein enters the nucleus via the region 38-50 aa that forms a random coil as revealed by molecular dynamic simulation. (b) Immunoprecipitation of rpS5 with casein kinase II and immobilized metal affinity chromatography analysis complemented by in vitro kinase assay revealed that phosphorylation of rpS5 seems to be indispensable for its transport from nucleus to nucleoli; upon entering the nucleus, Thr-133 phosphorylation triggers Ser-24 phosphorylation by casein kinase II, thus promoting entrance of rpS5 into the nucleoli. Another important role of rpS5 N-terminal region is proposed to be the regulation of protein's cellular level. The repetitively co-appearance of a satellite C-terminal band below the entire rpS5 at the late stationary phase, and not at the early logarithmic phase, of cell growth suggests a specific degradation balancing probably the unassembled ribosomal protein molecules with those that are efficiently assembled to ribosomal subunits. Overall, these data provide new insights on the structural and functional domains within the rpS5 molecule that contribute to its

  2. Pioglitazone enhances mitochondrial biogenesis and ribosomal protein biosynthesis in skeletal muscle in polycystic ovary syndrome

    DEFF Research Database (Denmark)

    Skov, Vibe; Glintborg, Dorte; Knudsen, Steen

    2008-01-01

    indicate that pioglitazone therapy restores insulin sensitivity, in part, by a coordinated upregulation of genes involved in mitochondrial OXPHOS and ribosomal protein biosynthesis in muscle in PCOS. These transcriptional effects of pioglitazone may contribute to prevent the onset of type 2 diabetes...... by changes in the transcriptional profile of muscle favoring insulin sensitivity. Using Affymetrix microarrays, we examined the effect of pioglitazone (30 mg/day for 16 weeks) on gene expression in skeletal muscle of 10 obese women with PCOS metabolically characterized by a euglycemic-hyperinsulinemic clamp...... Annotator and Pathway Profiler (GenMAPP 2.1) and Gene Set Enrichment Analysis (GSEA 2.0.1) revealed a significant upregulation of genes representing mitochondrial oxidative phosphorylation (OXPHOS), ribosomal proteins, mRNA processing reactome, translation factors, and proteasome degradation in PCOS after...

  3. Structure of a prehandover mammalian ribosomal SRP·SRP receptor targeting complex.

    Science.gov (United States)

    Kobayashi, Kan; Jomaa, Ahmad; Lee, Jae Ho; Chandrasekar, Sowmya; Boehringer, Daniel; Shan, Shu-Ou; Ban, Nenad

    2018-04-20

    Signal recognition particle (SRP) targets proteins to the endoplasmic reticulum (ER). SRP recognizes the ribosome synthesizing a signal sequence and delivers it to the SRP receptor (SR) on the ER membrane followed by the transfer of the signal sequence to the translocon. Here, we present the cryo-electron microscopy structure of the mammalian translating ribosome in complex with SRP and SR in a conformation preceding signal sequence handover. The structure visualizes all eukaryotic-specific SRP and SR proteins and reveals their roles in stabilizing this conformation by forming a large protein assembly at the distal site of SRP RNA. We provide biochemical evidence that the guanosine triphosphate hydrolysis of SRP·SR is delayed at this stage, possibly to provide a time window for signal sequence handover to the translocon. Copyright © 2018 The Authors, some rights reserved; exclusive licensee American Association for the Advancement of Science. No claim to original U.S. Government Works.

  4. A comparative study of ribosomal proteins: linkage between amino acid distribution and ribosomal assembly

    International Nuclear Information System (INIS)

    Lott, Brittany Burton; Wang, Yongmei; Nakazato, Takuya

    2013-01-01

    Assembly of the ribosome from its protein and RNA constituents must occur quickly and efficiently in order to synthesize the proteins necessary for all cellular activity. Since the early 1960’s, certain characteristics of possible assembly pathways have been elucidated, yet the mechanisms that govern the precise recognition events remain unclear. We utilize a comparative analysis to investigate the amino acid composition of ribosomal proteins (r-proteins) with respect to their role in the assembly process. We compared small subunit (30S) r-protein sequences to those of other housekeeping proteins from 560 bacterial species and searched for correlations between r-protein amino acid content and factors such as assembly binding order, environmental growth temperature, protein size, and contact with ribosomal RNA (rRNA) in the 30S complex. We find r-proteins have a significantly high percent of positive residues, which are highly represented at rRNA contact sites. An inverse correlation between the percent of positive residues and r-protein size was identified and is mainly due to the content of Lysine residues, rather than Arginine. Nearly all r-proteins carry a net positive charge, but no statistical correlation between the net charge and the binding order was detected. Thermophilic (high-temperature) r-proteins contain increased Arginine, Isoleucine, and Tyrosine, and decreased Serine and Threonine compared to mesophilic (lower-temperature), reflecting a known distinction between thermophiles and mesophiles, possibly to account for protein thermostability. However, this difference in amino acid content does not extend to rRNA contact sites, as the proportions of thermophilic and mesophilic contact residues are not significantly different. Given the significantly higher level of positively charged residues in r-proteins and at contact sites, we conclude that ribosome assembly relies heavily on an electrostatic component of interaction. However, the binding order of

  5. On the control of ribosomal protein biosynthesis in Escherichia coli

    International Nuclear Information System (INIS)

    Pichon, J.; Marvaldi, J.; Coeroli, C.; Cozzone, A.; Marchis-Mouren, G.

    1977-01-01

    The rate of individual ribosomal protein synthesis relative to total protein synthesis has been determined in Escherichia coli rel + and rel - cells, under valyl-tRNA deprivation. These strains have a temperature-sensitive valyl-tRNA synthetase. Starvation was obtained following transfer of the cells to non-permissive temperature. Ribosomal proteins were obtained by treatment of either total lysates of freeze-thawed lysozyme spheroplasts or ammonium sulphate precipitate of ribosomes, with acetic acid. Differential labelling of the ribosomal proteins was observed in both strains: proteins from the rel + strain appear more labelled than those from the rel - strain, the rate of labelling of individual proteins being about the same in both strains. Moreover ribosomal proteins were found as stable during starvation as total protein. It is thus concluded that in starving cells individual ribosomal proteins are not synthesized at equal rates. This indicates that the synthesis of ribosomal proteins is not only under the control of the rel gene

  6. Characterisation of ribosomal proteins from HeLa and Krebs II mouse ascites tumor cells by different two-dimensional polyacrylamide gel electrophoresis techniques

    DEFF Research Database (Denmark)

    Issinger, O G; Beier, H

    1978-01-01

    Electrophoresis of ribosomal proteins according to Kaltschmidt and Wittmann, 1970a, b (pH 8.6/pH 4.5 urea system) yielded 29 proteins for the small subunits and 35 and 37 proteins for the large subunits of Krebs II ascites and HeLa ribosomes, respectively. Analysis of the proteins according...... to a modified technique by Mets and Bogorad (1974) (pH 4.5/pH 8.6 SDS system) revealed 28 and 29 proteins in the small subunits and 37 and 38 proteins in the large subunits of Krebs II ascites and HeLa ribosomes. The molecular weights of the individual proteins were determined by: 1. "three-dimensional" gel...... using the pH 4.5/pH 8.6 SDS system. The molecular weights Krebs II ascites and HeLa ribosomal proteins are compared with those obtained by other authors for different mammalian species....

  7. Genetic analysis reveals efficient sexual spore dispersal at a fine spatial scale in Armillaria ostoyae, the causal agent of root-rot disease in conifers.

    Science.gov (United States)

    Dutech, Cyril; Labbé, Frédéric; Capdevielle, Xavier; Lung-Escarmant, Brigitte

    Armillaria ostoyae (sometimes named Armillaria solidipes) is a fungal species causing root diseases in numerous coniferous forests of the northern hemisphere. The importance of sexual spores for the establishment of new disease centres remains unclear, particularly in the large maritime pine plantations of southwestern France. An analysis of the genetic diversity of a local fungal population distributed over 500 ha in this French forest showed genetic recombination between genotypes to be frequent, consistent with regular sexual reproduction within the population. The estimated spatial genetic structure displayed a significant pattern of isolation by distance, consistent with the dispersal of sexual spores mostly at the spatial scale studied. Using these genetic data, we inferred an effective density of reproductive individuals of 0.1-0.3 individuals/ha, and a second moment of parent-progeny dispersal distance of 130-800 m, compatible with the main models of fungal spore dispersal. These results contrast with those obtained for studies of A. ostoyae over larger spatial scales, suggesting that inferences about mean spore dispersal may be best performed at fine spatial scales (i.e. a few kilometres) for most fungal species. Copyright © 2017 British Mycological Society. Published by Elsevier Ltd. All rights reserved.

  8. Comparative analysis of spatial genetic structure in an ant-plant symbiosis reveals a tension zone and highlights speciation processes in tropical Africa

    NARCIS (Netherlands)

    Blatrix, Rumsaïs; Peccoud, Jean; Born, Céline; Piatscheck, Finn; Benoit, Laure; Sauve, Mathieu; Djiéto-Lordon, Champlain; Atteke, Christiane; Wieringa, Jan J.; Harris, David J.; Mckey, Doyle

    2017-01-01

    Aim: Pleistocene climatic oscillations induced range fluctuations in African rain forest organisms and may have shaped species diversification through allopatric speciation events. We compared the spatial genetic structure of two forest species that live in obligate symbiosis and thus must have

  9. Organization of Replication of Ribosomal DNA in Saccharomyces cerevisiae

    NARCIS (Netherlands)

    Linskens, Maarten H.K.; Huberman, Joel A.

    1988-01-01

    Using recently developed replicon mapping techniques, we have analyzed the replication of the ribosomal DNA in Saccharomyces cerevisiae. The results show that (i) the functional origin of replication colocalizes with an autonomously replicating sequence element previously mapped to the

  10. Ribosome-induced changes in elongation factor Tu conformation control GTP hydrolysis

    DEFF Research Database (Denmark)

    Villa, Elizabeth; Sengupta, Jayati; Trabuco, Leonard G.

    2009-01-01

    In translation, elongation factor Tu (EF-Tu) molecules deliver aminoacyl-tRNAs to the mRNA-programmed ribosome. The GTPase activity of EF-Tu is triggered by ribosome-induced conformational changes of the factor that play a pivotal role in the selection of the cognate aminoacyl-tRNAs. We present a 6.......7-A cryo-electron microscopy map of the aminoacyl-tRNA x EF-Tu x GDP x kirromycin-bound Escherichia coli ribosome, together with an atomic model of the complex obtained through molecular dynamics flexible fitting. The model reveals the conformational changes in the conserved GTPase switch regions...... of EF-Tu that trigger hydrolysis of GTP, along with key interactions, including those between the sarcin-ricin loop and the P loop of EF-Tu, and between the effector loop of EF-Tu and a conserved region of the 16S rRNA. Our data suggest that GTP hydrolysis on EF-Tu is controlled through a hydrophobic...

  11. Ribosome slowed by mutation to streptomycin resistance. [Escherichia coli

    Energy Technology Data Exchange (ETDEWEB)

    Galas, D J; Branscomb, E W

    1976-08-12

    The effect of mutation to streptomycin resistance on the speed of polypeptide elongation in Escherichia coli was investigated. Translation speed was determined by measuring the time required for the first newly synthesized ..beta..-galactosidase molecules to appear after induction of the lactose operon. The results showed that ribosome speed is not a fixed parameter inherent to the protein synthetic apparatus, but a variable determined by the kinetics of translation and ultimately by the structure of the ribosome. (HLW)

  12. Defective ribosome assembly in Shwachman-Diamond syndrome.

    Science.gov (United States)

    Wong, Chi C; Traynor, David; Basse, Nicolas; Kay, Robert R; Warren, Alan J

    2011-10-20

    Shwachman-Diamond syndrome (SDS), a recessive leukemia predisposition disorder characterized by bone marrow failure, exocrine pancreatic insufficiency, skeletal abnormalities and poor growth, is caused by mutations in the highly conserved SBDS gene. Here, we test the hypothesis that defective ribosome biogenesis underlies the pathogenesis of SDS. We create conditional mutants in the essential SBDS ortholog of the ancient eukaryote Dictyostelium discoideum using temperature-sensitive, self-splicing inteins, showing that mutant cells fail to grow at the restrictive temperature because ribosomal subunit joining is markedly impaired. Remarkably, wild type human SBDS complements the growth and ribosome assembly defects in mutant Dictyostelium cells, but disease-associated human SBDS variants are defective. SBDS directly interacts with the GTPase elongation factor-like 1 (EFL1) on nascent 60S subunits in vivo and together they catalyze eviction of the ribosome antiassociation factor eukaryotic initiation factor 6 (eIF6), a prerequisite for the translational activation of ribosomes. Importantly, lymphoblasts from SDS patients harbor a striking defect in ribosomal subunit joining whose magnitude is inversely proportional to the level of SBDS protein. These findings in Dictyostelium and SDS patient cells provide compelling support for the hypothesis that SDS is a ribosomopathy caused by corruption of an essential cytoplasmic step in 60S subunit maturation.

  13. Revealing the Driving Forces of Mid-Cities Urban Growth Patterns Using Spatial Modeling: a Case Study of Los Ángeles, Chile

    Directory of Open Access Journals (Sweden)

    Mauricio I. Aguayo

    2007-06-01

    Full Text Available City growth and changes in land-use patterns cause various important social and environmental impacts. To understand the spatial and temporal dynamics of these processes, the factors that drive urban development must be identified and analyzed, especially those factors that can be used to predict future changes and their potential environmental effects. Our objectives were to quantify the relationship between urban growth and its driving forces and to predict the spatial growth pattern based on historical land-use changes for the city of Los Ángeles in central Chile. This involved the analysis of images from 1978, 1992, and 1998 and characterization of the spatial pattern of land-use change; the construction of digital coverage in GIS; the selection of predictive variables through univariate analysis; the construction of logistic regression models using growth vs. nongrowth for 1978-1992 as the dependent variable; and the prediction of the probability of land-use change by applying the regression model to the 1992-1998 period. To investigate the influence of spatial scale, we constructed several sets of models that contained (1 only distance variables, e.g., distance to highways; (2 only scale-dependent density variables, e.g., density of urban area within a 600-m radius; (3 both distance and density variables; and (4 both distance and density variables at several spatial scales. The environmental variables were included in all models. The combination of distance and density variables at several scales is required to appropriately capture the multiscale urban growth process. The best models correctly predict ~90% of the observed land-use changes for 1992-1998. The distance to access roads, densities of the urban road system and urbanized area at various scales, and soil type were the strongest predictors of the growth pattern. Other variables were less important or not significant in explaining the urban growth process. Our approach, which

  14. Emerging functions of ribosomal proteins in gene-specific transcription and translation

    International Nuclear Information System (INIS)

    Lindstroem, Mikael S.

    2009-01-01

    Ribosomal proteins have remained highly conserved during evolution presumably reflecting often critical functions in ribosome biogenesis or mature ribosome function. In addition, several ribosomal proteins possess distinct extra-ribosomal functions in apoptosis, DNA repair and transcription. An increasing number of ribosomal proteins have been shown to modulate the trans-activation function of important regulatory proteins such as NF-κB, p53, c-Myc and nuclear receptors. Furthermore, a subset of ribosomal proteins can bind directly to untranslated regions of mRNA resulting in transcript-specific translational control outside of the ribosome itself. Collectively, these findings suggest that ribosomal proteins may have a wider functional repertoire within the cell than previously thought. The future challenge is to identify and validate these novel functions in the background of an often essential primary function in ribosome biogenesis and cell growth.

  15. Distribution of protein and RNA in the 30S ribosomal subunit

    International Nuclear Information System (INIS)

    Ramakrishnan, V.

    1986-01-01

    In Escherichia coli, the small ribosomal subunit has a sedimentation coefficient of 30S, and consists of a 16S RNA molecule of 1541 nucleotides complexed with 21 proteins. Over the last few years, a controversy has emerged regarding the spatial distribution of RNA and protein in the 30S subunit. Contrast variation with neutron scattering was used to suggest that the RNA was located in a central core of the subunit and the proteins mainly in the periphery, with virtually no separation between the centers of mass of protein and RNA. However, these findings are incompatible with the results of efforts to locate individual ribosomal proteins by immune electron microscopy and triangulation with interprotein distance measurements. The conflict between these two views is resolved in this report of small-angle neutron scattering measurements on 30S subunits with and without protein S1, and on subunits reconstituted from deuterated 16S RNA and unlabeled proteins. The results show that (i) the proteins and RNA are intermingled, with neither component dominating at the core or the periphery, and (ii) the spatial distribution of protein and RNA is asymmetrical, with a separation between their centers of mass of about 25 angstroms

  16. Organotypic culture of normal, dysplastic and squamous cell carcinoma-derived oral cell lines reveals loss of spatial regulation of CD44 and p75 NTR in malignancy.

    Science.gov (United States)

    Dalley, Andrew J; AbdulMajeed, Ahmad A; Upton, Zee; Farah, Camile S

    2013-01-01

    Oral squamous cell carcinomas (OSCC) often arise from dysplastic lesions. The role of cancer stem cells in tumour initiation is widely accepted, yet the potential existence of pre-cancerous stem cells in dysplastic tissue has received little attention. Cell lines from oral diseases ranging in severity from dysplasia to malignancy provide opportunity to investigate the involvement of stem cells in malignant progression from dysplasia. Stem cells are functionally defined by their ability to generate hierarchical tissue structures in consortium with spatial regulation. Organotypic cultures readily display tissue hierarchy in vitro; hence, in this study, we compared hierarchical expression of stem cell-associated markers in dermis-based organotypic cultures of oral epithelial cells from normal tissue (OKF6-TERT2), mild dysplasia (DOK), severe dysplasia (POE-9n) and OSCC (PE/CA P J15). Expression of CD44, p75(NTR), CD24 and ALDH was studied in monolayers by flow cytometry and in organotypic cultures by immunohistochemistry. Spatial regulation of CD44 and p75(NTR) was evident for organotypic cultures of normal (OKF6-TERT2) and dysplasia (DOK and POE-9n) but was lacking for OSCC (PE/CA PJ15)-derived cells. Spatial regulation of CD24 was not evident. All monolayer cultures exhibited CD44, p75(NTR), CD24 antigens and ALDH activity (ALDEFLUOR(®) assay), with a trend towards loss of population heterogeneity that mirrored disease severity. In monolayer, increased FOXA1 and decreased FOXA2 expression correlated with disease severity, but OCT3/4, Sox2 and NANOG did not. We conclude that dermis-based organotypic cultures give opportunity to investigate the mechanisms that underlie loss of spatial regulation of stem cell markers seen with OSCC-derived cells. © 2012 John Wiley & Sons A/S.

  17. The blind men meet the elephant at the dam: Alternative spatial and taxonomic components reveal different insights about how low-head dams impact fish biodiversity

    Science.gov (United States)

    Fencl, Jane S.; Mather, Martha E.; Smith, Joseph M.; Hitchman, Sean M.

    2017-01-01

    Dams are ubiquitous environmental impacts that threaten aquatic ecosystems. The ability to compare across research studies is essential to conserve the native biodiversity that is impacted by the millions of low‐head dams that currently fragment streams and rivers. Here, we identify a previously unaddressed obstacle that impedes this generalization. Specifically, divergent spatial and taxonomic approaches that result from different conceptualizations of the dam‐biodiversity problem can produce conflicting science‐based conclusions about the same dam impact. In this research, using the same dammed and undammed sites, we evaluated the scientific generality of different conceptualizations of the dam‐biodiversity problem. We compared two different but commonly used spatial approaches—(1) above dam–below dam vs. (2) undammed–dammed comparisons—and 11 different, commonly used taxonomic approaches (three assemblage summaries, eight guilds). Sites above the dam structure had less diverse fish assemblages than sites below dams, whereas sites below the dam structure were similar to undammed sites. Thus, spatial approach 1 detected a large dam effect and spatial approach 2 detected a small dam effect. Similarly, some taxonomic responses (species richness, diversity, abundance, and number of guilds) detected large dam effects; other responses detected small (riffle specialist guild) or no dam effects (pool generalists). In summary, our results showed that how the problem was framed altered scientific conclusions and created different dam realities. The metaphor of how individual blind men disagree about the structure of an elephant, based on examinations of different body parts, reinforces the need for a coordinated, holistic perspective on dam research. Although no single approach is adequate for all problems, identifying the form, consequences of, and relationships among different research conceptualizations will set the stage for future syntheses of dam

  18. RINT-1 interacts with MSP58 within nucleoli and plays a role in ribosomal gene transcription

    International Nuclear Information System (INIS)

    Yang, Chuan-Pin; Kuo, Yu-Liang; Lee, Yi-Chao; Lee, Kuen-Haur; Chiang, Chi-Wu; Wang, Ju-Ming; Hsu, Che-Chia

    2016-01-01

    The nucleolus is the cellular site of ribosomal (r)DNA transcription and ribosome biogenesis. The 58-kDa microspherule protein (MSP58) is a nucleolar protein involved in rDNA transcription and cell proliferation. However, regulation of MSP58-mediated rDNA transcription remains unknown. Using a yeast two-hybrid system with MSP58 as bait, we isolated complementary (c)DNA encoding Rad50-interacting protein 1 (RINT-1), as a MSP58-binding protein. RINT-1 was implicated in the cell cycle checkpoint, membrane trafficking, Golgi apparatus and centrosome dynamic integrity, and telomere length control. Both in vitro and in vivo interaction assays showed that MSP58 directly interacts with RINT-1. Interestingly, microscopic studies revealed the co-localization of MSP58, RINT-1, and the upstream binding factor (UBF), a rRNA transcription factor, in the nucleolus. We showed that ectopic expression of MSP58 or RINT-1 resulted in decreased rRNA expression and rDNA promoter activity, whereas knockdown of MSP58 or RINT-1 by siRNA exerted the opposite effect. Coexpression of MSP58 and RINT-1 robustly decreased rRNA synthesis compared to overexpression of either protein alone, whereas depletion of RINT-1 from MSP58-transfected cells enhanced rRNA synthesis. We also found that MSP58, RINT-1, and the UBF were associated with the rDNA promoter using a chromatin immunoprecipitation assay. Because aberrant ribosome biogenesis contributes to neoplastic transformation, our results revealed a novel protein complex involved in the regulation of rRNA gene expression, suggesting a role for MSP58 and RINT-1 in cancer development. - Highlights: • RINT-1 is a novel MSP58-interacting protein. • RINT-1 is a nucleolar protein that suppresses ribosomal RNA gene transcription. • RINT-1 and MSP58 cooperate to suppress ribosomal RNA gene transcription. • RINT-1, MSP58, and UBF form a complex on the rDNA promoter.

  19. Expanded spatial extent of the Medieval Climate Anomaly revealed in lake-sediment records across the boreal region in northwest Ontario.

    Science.gov (United States)

    Laird, Kathleen R; Haig, Heather A; Ma, Susan; Kingsbury, Melanie V; Brown, Thomas A; Lewis, C F Michael; Oglesby, Robert J; Cumming, Brian F

    2012-09-01

    Multi-decadal to centennial-scale shifts in effective moisture over the past two millennia are inferred from sedimentary records from six lakes spanning a ~250 km region in northwest Ontario. This is the first regional application of a technique developed to reconstruct drought from drainage lakes (open lakes with surface outlets). This regional network of proxy drought records is based on individual within-lake calibration models developed using diatom assemblages collected from surface sediments across a water-depth gradient. Analysis of diatom assemblages from sediment cores collected close to the near-shore ecological boundary between benthic and planktonic diatom taxa indicated this boundary shifted over time in all lakes. These shifts are largely dependent on climate-driven influences, and can provide a sensitive record of past drought. Our lake-sediment records indicate two periods of synchronous signals, suggesting a common large-scale climate forcing. The first is a period of prolonged aridity during the Medieval Climate Anomaly (MCA, c. 900-1400 CE). Documentation of aridity across this region expands the known spatial extent of the MCA megadrought into a region that historically has not experienced extreme droughts such as those in central and western north America. The second synchronous period is the recent signal of the past ~100 years, which indicates a change to higher effective moisture that may be related to anthropogenic forcing on climate. This approach has the potential to fill regional gaps, where many previous paleo-lake depth methods (based on deeper centrally located cores) were relatively insensitive. By filling regional gaps, a better understanding of past spatial patterns in drought can be used to assess the sensitivity and realism of climate model projections of future climate change. This type of data is especially important for validating high spatial resolution, regional climate models. © 2012 Blackwell Publishing Ltd.

  20. Effect of sodium fluoride on the amount of polyribosomes, single ribosomes and ribosomal subunits in a cellular slime mold, Dictyostelium discoideum

    Energy Technology Data Exchange (ETDEWEB)

    Sameshima, M; Ito, K; Iwabuchi, M

    1972-01-01

    In the slime mold, Dictyostelium discoideum, when the rate of protein synthesis was decreased by NaF, free 80-S ribosomes accumulated at the expense of polyribosomes, while 60-S and 40-S ribosomal subunits remained almost constant. The same level of ribosomal subunits was also maintained in cells after incubation with cycloheximide or at the stationary phase of growth.

  1. Role of alpha2C-adrenoceptor subtype in spatial working memory as revealed by mice with targeted disruption of the alpha2C-adrenoceptor gene.

    Science.gov (United States)

    Tanila, H; Mustonen, K; Sallinen, J; Scheinin, M; Riekkinen, P

    1999-02-01

    The role of the alpha2C-adrenoceptor subtype in mediating the beneficial effect of alpha2-adrenoceptor agonists on spatial working memory was studied in adult mice with targeted inactivation of the alpha2C-receptor gene (KO) and their wild-type controls (WT). A delayed alternation task was run in a T-maze with mixed delays varying from 20 s to 120 s. Dexmedetomidine, a specific but subtype nonselective alpha2-adrenoceptor agonist, dose-dependently decreased the total number of errors. The effect was strongest at the dose of 5 microg/kg (s.c.), and was observed similarly in KO and WT mice. KO mice performed inferior to WT mice due to a higher number of perseverative errors. Dexmedetomidine slowed initiation of the motor response in the start phase at lower doses in WT mice than in KO mice but no such difference was observed in the return phase of the task, suggesting involvement of alpha2C-adrenoceptors in the cognitive aspect of response preparation or in response sequence initiation. According to these findings, enhancement of spatial working memory is best achieved with alpha2-adrenoceptor agonists which have neither agonistic nor antagonistic effects at the alpha2C-adrenoceptor subtype.

  2. Cryo-EM structure of Hepatitis C virus IRES bound to the human ribosome at 3.9-Å resolution.

    Science.gov (United States)

    Quade, Nick; Boehringer, Daniel; Leibundgut, Marc; van den Heuvel, Joop; Ban, Nenad

    2015-07-08

    Hepatitis C virus (HCV), a widespread human pathogen, is dependent on a highly structured 5'-untranslated region of its mRNA, referred to as internal ribosome entry site (IRES), for the translation of all of its proteins. The HCV IRES initiates translation by directly binding to the small ribosomal subunit (40S), circumventing the need for many eukaryotic translation initiation factors required for mRNA scanning. Here we present the cryo-EM structure of the human 40S ribosomal subunit in complex with the HCV IRES at 3.9 Å resolution, determined by focused refinement of an 80S ribosome-HCV IRES complex. The structure reveals the molecular details of the interactions between the IRES and the 40S, showing that expansion segment 7 (ES7) of the 18S rRNA acts as a central anchor point for the HCV IRES. The structural data rationalizes previous biochemical and genetic evidence regarding the initiation mechanism of the HCV and other related IRESs.

  3. Clusters of basic amino acids contribute to RNA binding and nucleolar localization of ribosomal protein L22.

    Directory of Open Access Journals (Sweden)

    Jennifer L Houmani

    Full Text Available The ribosomal protein L22 is a component of the 60S eukaryotic ribosomal subunit. As an RNA-binding protein, it has been shown to interact with both cellular and viral RNAs including 28S rRNA and the Epstein-Barr virus encoded RNA, EBER-1. L22 is localized to the cell nucleus where it accumulates in nucleoli. Although previous studies demonstrated that a specific amino acid sequence is required for nucleolar localization, the RNA-binding domain has not been identified. Here, we investigated the hypothesis that the nucleolar accumulation of L22 is linked to its ability to bind RNA. To address this hypothesis, mutated L22 proteins were generated to assess the contribution of specific amino acids to RNA binding and protein localization. Using RNA-protein binding assays, we demonstrate that basic amino acids 80-93 are required for high affinity binding of 28S rRNA and EBER-1 by L22. Fluorescence localization studies using GFP-tagged mutated L22 proteins further reveal that basic amino acids 80-93 are critical for nucleolar accumulation and for incorporation into ribosomes. Our data support the growing consensus that the nucleolar accumulation of ribosomal proteins may not be mediated by a defined localization signal, but rather by specific interaction with established nucleolar components such as rRNA.

  4. The Phosphorylation of Ribosomal Protein in Lemna minor

    Science.gov (United States)

    Trewavas, A.

    1973-01-01

    Sterile cultures of Lemna minor have been labeled with 32P1, and the ribosomal proteins have been examined for radioactivity. In relatively short term labeling a radioactive protein was found which ran as a single component in both urea/acetic acid and sodium lauryl sulfate gel electrophoresis. Acid hydrolysis of the labeled protein permitted the isolation of serine phosphate. After labeling to equilibrium with 32P1, calculation indicated only 0.6 to 0.75 atom of this protein phosphorus per ribosome. The phosphorylated protein is found in both polysomes and “derived” monomers and appears to be located in the ribosomal small subunit. Its apparent molecular weight is 42,000. Addition of growth-inhibiting concentrations of abscisic acid does not alter the apparent degree of labeling of this protein in 5 hours, but after 24 hours of treatment the total protein phosphorus was reduced from 0.75 atom of phosphorus per ribosome to 0.36 atom of phosphorus per ribosome. PMID:16658405

  5. Phylogenetic Information Content of Copepoda Ribosomal DNA Repeat Units: ITS1 and ITS2 Impact

    Science.gov (United States)

    Zagoskin, Maxim V.; Lazareva, Valentina I.; Grishanin, Andrey K.; Mukha, Dmitry V.

    2014-01-01

    The utility of various regions of the ribosomal repeat unit for phylogenetic analysis was examined in 16 species representing four families, nine genera, and two orders of the subclass Copepoda (Crustacea). Fragments approximately 2000 bp in length containing the ribosomal DNA (rDNA) 18S and 28S gene fragments, the 5.8S gene, and the internal transcribed spacer regions I and II (ITS1 and ITS2) were amplified and analyzed. The DAMBE (Data Analysis in Molecular Biology and Evolution) software was used to analyze the saturation of nucleotide substitutions; this test revealed the suitability of both the 28S gene fragment and the ITS1/ITS2 rDNA regions for the reconstruction of phylogenetic trees. Distance (minimum evolution) and probabilistic (maximum likelihood, Bayesian) analyses of the data revealed that the 28S rDNA and the ITS1 and ITS2 regions are informative markers for inferring phylogenetic relationships among families of copepods and within the Cyclopidae family and associated genera. Split-graph analysis of concatenated ITS1/ITS2 rDNA regions of cyclopoid copepods suggested that the Mesocyclops, Thermocyclops, and Macrocyclops genera share complex evolutionary relationships. This study revealed that the ITS1 and ITS2 regions potentially represent different phylogenetic signals. PMID:25215300

  6. A spatially-supported forced-choice recognition test reveals children’s long-term memory for newly learned word forms

    Directory of Open Access Journals (Sweden)

    Katherine R. Gordon

    2014-03-01

    Full Text Available Children’s memories for the link between a newly trained word and its referent have been the focus of extensive past research. However, memory for the word form itself is rarely assessed among preschool-age children. When it is, children are typically asked to verbally recall the forms, and they generally perform at floor on such tests. To better measure children’s memory for word forms, we aimed to design a more sensitive test that required recognition rather than recall, provided spatial cues to off-set the phonological memory demands of the test, and allowed pointing rather than verbal responses. We taught 12 novel word-referent pairs via ostensive naming to sixteen 4-to-6-year-olds and measured their memory for the word forms after a week-long retention interval using the new spatially-supported form recognition test. We also measured their memory for the word-referent links and the generalization of the links to untrained referents with commonly used recognition tests. Children demonstrated memory for word forms at above chance levels; however, their memory for forms was poorer than their memory for trained or generalized word-referent links. When in error, children were no more likely to select a foil that was a close neighbor to the target form than a maximally different foil. Additionally, they more often selected correct forms that were among the first six than the last six to be trained. Overall, these findings suggest that children are able to remember word forms after a limited number of ostensive exposures and a long-term delay. However, word forms remain more difficult to learn than word-referent links and there is an upper limit on the number of forms that can be learned within a given period of time.

  7. Spatial genetic structure in Beta vulgaris subsp. maritima and Beta macrocarpa reveals the effect of contrasting mating system, influence of marine currents, and footprints of postglacial recolonization routes.

    Science.gov (United States)

    Leys, Marie; Petit, Eric J; El-Bahloul, Yasmina; Liso, Camille; Fournet, Sylvain; Arnaud, Jean-François

    2014-05-01

    Understanding the factors that contribute to population genetic divergence across a species' range is a long-standing goal in evolutionary biology and ecological genetics. We examined the relative importance of historical and ecological features in shaping the present-day spatial patterns of genetic structure in two related plant species, Beta vulgaris subsp. maritima and Beta macrocarpa. Using nuclear and mitochondrial markers, we surveyed 93 populations from Brittany (France) to Morocco - the southern limit of their species' range distribution. Whereas B. macrocarpa showed a genotypic structure and a high level of genetic differentiation indicative of selfing, the population genetic structure of B. vulgaris subsp. maritima was consistent with an outcrossing mating system. We further showed (1) a strong geographic clustering in coastal B. vulgaris subsp. maritima populations that highlighted the influence of marine currents in shaping different lineages and (2) a peculiar genetic structure of inland B. vulgaris subsp. maritima populations that could indicate the admixture of distinct evolutionary lineages and recent expansions associated with anthropogenic disturbances. Spatial patterns of nuclear diversity and differentiation also supported a stepwise recolonization of Europe from Atlantic-Mediterranean refugia after the last glacial period, with leading-edge expansions. However, cytoplasmic diversity was not impacted by postglacial recolonization: stochastic long-distance seed dispersal mediated by major oceanic currents may mitigate the common patterns of reduced cytoplasmic diversity observed for edge populations. Overall, the patterns we documented here challenge the general view of reduced genetic diversity at the edge of a species' range distribution and provide clues for understanding how life-history and major geographic features interact to shape the distribution of genetic diversity.

  8. Late-assembly of human ribosomal protein S20 in the cytoplasm is essential for the functioning of the small subunit ribosome

    International Nuclear Information System (INIS)

    Tai, Lin-Ru; Chou, Chang-Wei; Wu, Jing-Ying; Kirby, Ralph; Lin, Alan

    2013-01-01

    Using immuno-fluorescent probing and Western blotting analysis, we reveal the exclusive cytoplasm nature of the small subunit ribosomal protein S20. To illustrate the importance of the cellular compartmentation of S20 to the function of small subunit 40S, we created a nuclear resident S20 NLS mutant gene and examined polysome profile of cells that had been transfected with the S20 NLS gene. As a result, we observed the formation of recombinant 40S carried S20 NLS but this recombinant 40S was never found in the polysome, suggesting such a recombinant 40S was translation incompetent. Moreover, by the tactic of the energy depletion and restoration, we were able to restrain the nuclear-resided S20 NLS in the cytoplasm. Yet, along a progressive energy restoration, we observed the presence of recombinant 40S subunits carrying the S20 NLS in the polysome. This proves that S20 needs to be cytoplasmic in order to make a functional 40S subunit. Furthermore, it also implies that the assembly order of ribosomal protein in eukaryote is orderly regulated. - Highlights: • The step of S20 assembled on 40S is happened in the cytoplasm. • A small subunit assembled with a nuclear S20 NLS is translational incompetence. • Using energy depletion and recovery to manipulate the cellular compartment of S20 NLS . • Cytoplasm-retained S20 NLS is crucial for creating a functional small subunit

  9. Late-assembly of human ribosomal protein S20 in the cytoplasm is essential for the functioning of the small subunit ribosome

    Energy Technology Data Exchange (ETDEWEB)

    Tai, Lin-Ru [Institute of Genome Sciences, School of Life Sciences, National Yang-Ming University, Taipei, Taiwan, ROC (China); Chou, Chang-Wei [Department of Dentistry, School of Dentistry, National Yang-Ming University, Taipei, Taiwan, ROC (China); Wu, Jing-Ying; Kirby, Ralph [Institute of Genome Sciences, School of Life Sciences, National Yang-Ming University, Taipei, Taiwan, ROC (China); Lin, Alan, E-mail: alin@ym.edu.tw [Institute of Genome Sciences, School of Life Sciences, National Yang-Ming University, Taipei, Taiwan, ROC (China); Department of Dentistry, School of Dentistry, National Yang-Ming University, Taipei, Taiwan, ROC (China)

    2013-11-15

    Using immuno-fluorescent probing and Western blotting analysis, we reveal the exclusive cytoplasm nature of the small subunit ribosomal protein S20. To illustrate the importance of the cellular compartmentation of S20 to the function of small subunit 40S, we created a nuclear resident S20{sub NLS} mutant gene and examined polysome profile of cells that had been transfected with the S20{sub NLS} gene. As a result, we observed the formation of recombinant 40S carried S20{sub NLS} but this recombinant 40S was never found in the polysome, suggesting such a recombinant 40S was translation incompetent. Moreover, by the tactic of the energy depletion and restoration, we were able to restrain the nuclear-resided S20{sub NLS} in the cytoplasm. Yet, along a progressive energy restoration, we observed the presence of recombinant 40S subunits carrying the S20{sub NLS} in the polysome. This proves that S20 needs to be cytoplasmic in order to make a functional 40S subunit. Furthermore, it also implies that the assembly order of ribosomal protein in eukaryote is orderly regulated. - Highlights: • The step of S20 assembled on 40S is happened in the cytoplasm. • A small subunit assembled with a nuclear S20{sub NLS} is translational incompetence. • Using energy depletion and recovery to manipulate the cellular compartment of S20{sub NLS}. • Cytoplasm-retained S20{sub NLS} is crucial for creating a functional small subunit.

  10. RINT-1 interacts with MSP58 within nucleoli and plays a role in ribosomal gene transcription.

    Science.gov (United States)

    Yang, Chuan-Pin; Kuo, Yu-Liang; Lee, Yi-Chao; Lee, Kuen-Haur; Chiang, Chi-Wu; Wang, Ju-Ming; Hsu, Che-Chia; Chang, Wen-Chang; Lin, Ding-Yen

    2016-09-16

    The nucleolus is the cellular site of ribosomal (r)DNA transcription and ribosome biogenesis. The 58-kDa microspherule protein (MSP58) is a nucleolar protein involved in rDNA transcription and cell proliferation. However, regulation of MSP58-mediated rDNA transcription remains unknown. Using a yeast two-hybrid system with MSP58 as bait, we isolated complementary (c)DNA encoding Rad50-interacting protein 1 (RINT-1), as a MSP58-binding protein. RINT-1 was implicated in the cell cycle checkpoint, membrane trafficking, Golgi apparatus and centrosome dynamic integrity, and telomere length control. Both in vitro and in vivo interaction assays showed that MSP58 directly interacts with RINT-1. Interestingly, microscopic studies revealed the co-localization of MSP58, RINT-1, and the upstream binding factor (UBF), a rRNA transcription factor, in the nucleolus. We showed that ectopic expression of MSP58 or RINT-1 resulted in decreased rRNA expression and rDNA promoter activity, whereas knockdown of MSP58 or RINT-1 by siRNA exerted the opposite effect. Coexpression of MSP58 and RINT-1 robustly decreased rRNA synthesis compared to overexpression of either protein alone, whereas depletion of RINT-1 from MSP58-transfected cells enhanced rRNA synthesis. We also found that MSP58, RINT-1, and the UBF were associated with the rDNA promoter using a chromatin immunoprecipitation assay. Because aberrant ribosome biogenesis contributes to neoplastic transformation, our results revealed a novel protein complex involved in the regulation of rRNA gene expression, suggesting a role for MSP58 and RINT-1 in cancer development. Copyright © 2016 Elsevier Inc. All rights reserved.

  11. Label-Free Quantitation of Ribosomal Proteins from Bacillus subtilis for Antibiotic Research.

    Science.gov (United States)

    Schäkermann, Sina; Prochnow, Pascal; Bandow, Julia E

    2017-01-01

    Current research is focusing on ribosome heterogeneity as a response to changing environmental conditions and stresses, such as antibiotic stress. Altered stoichiometry and composition of ribosomal proteins as well as association of additional protein factors are mechanisms for shaping the protein expression profile or hibernating ribosomes. Here, we present a method for the isolation of ribosomes to analyze antibiotic-induced changes in the composition of ribosomes in Bacillus subtilis or other bacteria. Ribosomes and associated proteins are isolated by ultracentrifugation and proteins are identified and quantified using label-free mass spectrometry.

  12. Interaction of tRNA with Eukaryotic Ribosome

    Directory of Open Access Journals (Sweden)

    Dmitri Graifer

    2015-03-01

    Full Text Available This paper is a review of currently available data concerning interactions of tRNAs with the eukaryotic ribosome at various stages of translation. These data include the results obtained by means of cryo-electron microscopy and X-ray crystallography applied to various model ribosomal complexes, site-directed cross-linking with the use of tRNA derivatives bearing chemically or photochemically reactive groups in the CCA-terminal fragment and chemical probing of 28S rRNA in the region of the peptidyl transferase center. Similarities and differences in the interactions of tRNAs with prokaryotic and eukaryotic ribosomes are discussed with concomitant consideration of the extent of resemblance between molecular mechanisms of translation in eukaryotes and bacteria.

  13. 5SRNAdb: an information resource for 5S ribosomal RNAs.

    Science.gov (United States)

    Szymanski, Maciej; Zielezinski, Andrzej; Barciszewski, Jan; Erdmann, Volker A; Karlowski, Wojciech M

    2016-01-04

    Ribosomal 5S RNA (5S rRNA) is the ubiquitous RNA component found in the large subunit of ribosomes in all known organisms. Due to its small size, abundance and evolutionary conservation 5S rRNA for many years now is used as a model molecule in studies on RNA structure, RNA-protein interactions and molecular phylogeny. 5SRNAdb (http://combio.pl/5srnadb/) is the first database that provides a high quality reference set of ribosomal 5S RNAs (5S rRNA) across three domains of life. Here, we give an overview of new developments in the database and associated web tools since 2002, including updates to database content, curation processes and user web interfaces. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  14. Structural basis for precursor protein-directed ribosomal peptide macrocyclization

    Science.gov (United States)

    Li, Kunhua; Condurso, Heather L.; Li, Gengnan; Ding, Yousong; Bruner, Steven D.

    2016-01-01

    Macrocyclization is a common feature of natural product biosynthetic pathways including the diverse family of ribosomal peptides. Microviridins are architecturally complex cyanobacterial ribosomal peptides whose members target proteases with potent reversible inhibition. The product structure is constructed by three macrocyclizations catalyzed sequentially by two members of the ATP-grasp family, a unique strategy for ribosomal peptide macrocyclization. Here, we describe the detailed structural basis for the enzyme-catalyzed macrocyclizations in the microviridin J pathway of Microcystis aeruginosa. The macrocyclases, MdnC and MdnB, interact with a conserved α-helix of the precursor peptide using a novel precursor peptide recognition mechanism. The results provide insight into the unique protein/protein interactions key to the chemistry, suggest an origin of the natural combinatorial synthesis of microviridin peptides and provide a framework for future engineering efforts to generate designed compounds. PMID:27669417

  15. Structural basis for precursor protein-directed ribosomal peptide macrocyclization.

    Science.gov (United States)

    Li, Kunhua; Condurso, Heather L; Li, Gengnan; Ding, Yousong; Bruner, Steven D

    2016-11-01

    Macrocyclization is a common feature of natural product biosynthetic pathways including the diverse family of ribosomal peptides. Microviridins are architecturally complex cyanobacterial ribosomal peptides that target proteases with potent reversible inhibition. The product structure is constructed via three macrocyclizations catalyzed sequentially by two members of the ATP-grasp family, a unique strategy for ribosomal peptide macrocyclization. Here we describe in detail the structural basis for the enzyme-catalyzed macrocyclizations in the microviridin J pathway of Microcystis aeruginosa. The macrocyclases MdnC and MdnB interact with a conserved α-helix of the precursor peptide using a novel precursor-peptide recognition mechanism. The results provide insight into the unique protein-protein interactions that are key to the chemistry, suggest an origin for the natural combinatorial synthesis of microviridin peptides, and provide a framework for future engineering efforts to generate designed compounds.

  16. Protein-protein interactions within late pre-40S ribosomes.

    Directory of Open Access Journals (Sweden)

    Melody G Campbell

    2011-01-01

    Full Text Available Ribosome assembly in eukaryotic organisms requires more than 200 assembly factors to facilitate and coordinate rRNA transcription, processing, and folding with the binding of the ribosomal proteins. Many of these assembly factors bind and dissociate at defined times giving rise to discrete assembly intermediates, some of which have been partially characterized with regards to their protein and RNA composition. Here, we have analyzed the protein-protein interactions between the seven assembly factors bound to late cytoplasmic pre-40S ribosomes using recombinant proteins in binding assays. Our data show that these factors form two modules: one comprising Enp1 and the export adaptor Ltv1 near the beak structure, and the second comprising the kinase Rio2, the nuclease Nob1, and a regulatory RNA binding protein Dim2/Pno1 on the front of the head. The GTPase-like Tsr1 and the universally conserved methylase Dim1 are also peripherally connected to this second module. Additionally, in an effort to further define the locations for these essential proteins, we have analyzed the interactions between these assembly factors and six ribosomal proteins: Rps0, Rps3, Rps5, Rps14, Rps15 and Rps29. Together, these results and previous RNA-protein crosslinking data allow us to propose a model for the binding sites of these seven assembly factors. Furthermore, our data show that the essential kinase Rio2 is located at the center of the pre-ribosomal particle and interacts, directly or indirectly, with every other assembly factor, as well as three ribosomal proteins required for cytoplasmic 40S maturation. These data suggest that Rio2 could play a central role in regulating cytoplasmic maturation steps.

  17. A streamlined ribosome profiling protocol for the characterization of microorganisms

    DEFF Research Database (Denmark)

    Latif, Haythem; Szubin, Richard; Tan, Justin

    2015-01-01

    Ribosome profiling is a powerful tool for characterizing in vivo protein translation at the genome scale, with multiple applications ranging from detailed molecular mechanisms to systems-level predictive modeling. Though highly effective, this intricate technique has yet to become widely used...... in the microbial research community. Here we present a streamlined ribosome profiling protocol with reduced barriers to entry for microbial characterization studies. Our approach provides simplified alternatives during harvest, lysis, and recovery of monosomes and also eliminates several time-consuming steps...

  18. Interaction of pleuromutilin derivatives with the ribosomal peptidyl transferase center

    DEFF Research Database (Denmark)

    Long, K. S.; Hansen, L. K.; Jakobsen, L.

    2006-01-01

    Tiamulin is a pleuromutilin antibiotic that is used in veterinary medicine. The recently published crystal structure of a tiamulin-50S ribosomal subunit complex provides detailed information about how this drug targets the peptidyl transferase center of the ribosome. To promote rational design...... mutant strain is resistant to tiamulin and pleuromutilin, but not valnemulin, implying that valnemulin is better able to withstand an altered rRNA binding surface around the mutilin core. This is likely due to additional interactions made between the valnemulin side chain extension and the rRNA binding...

  19. Charge Segregation and Low Hydrophobicity Are Key Features of Ribosomal Proteins from Different Organisms*

    Science.gov (United States)

    Fedyukina, Daria V.; Jennaro, Theodore S.; Cavagnero, Silvia

    2014-01-01

    Ribosomes are large and highly charged macromolecular complexes consisting of RNA and proteins. Here, we address the electrostatic and nonpolar properties of ribosomal proteins that are important for ribosome assembly and interaction with other cellular components and may influence protein folding on the ribosome. We examined 50 S ribosomal subunits from 10 species and found a clear distinction between the net charge of ribosomal proteins from halophilic and non-halophilic organisms. We found that ∼67% ribosomal proteins from halophiles are negatively charged, whereas only up to ∼15% of ribosomal proteins from non-halophiles share this property. Conversely, hydrophobicity tends to be lower for ribosomal proteins from halophiles than for the corresponding proteins from non-halophiles. Importantly, the surface electrostatic potential of ribosomal proteins from all organisms, especially halophiles, has distinct positive and negative regions across all the examined species. Positively and negatively charged residues of ribosomal proteins tend to be clustered in buried and solvent-exposed regions, respectively. Hence, the majority of ribosomal proteins is characterized by a significant degree of intramolecular charge segregation, regardless of the organism of origin. This key property enables the ribosome to accommodate proteins within its complex scaffold regardless of their overall net charge. PMID:24398678

  20. Single-Nucleotide Polymorphisms Reveal Spatial Diversity Among Clones of Yersinia pestis During Plague Outbreaks in Colorado and the Western United States.

    Science.gov (United States)

    Lowell, Jennifer L; Antolin, Michael F; Andersen, Gary L; Hu, Ping; Stokowski, Renee P; Gage, Kenneth L

    2015-05-01

    In western North America, plague epizootics caused by Yersinia pestis appear to sweep across landscapes, primarily infecting and killing rodents, especially ground squirrels and prairie dogs. During these epizootics, the risk of Y. pestis transmission to humans is highest. While empirical models that include climatic conditions and densities of rodent hosts and fleas can predict when epizootics are triggered, bacterial transmission patterns across landscapes, and the scale at which Y. pestis is maintained in nature during inter-epizootic periods, are poorly defined. Elucidating the spatial extent of Y. pestis clones during epizootics can determine whether bacteria are propagated across landscapes or arise independently from local inter-epizootic maintenance reservoirs. We used DNA microarray technology to identify single-nucleotide polymorphisms (SNPs) in 34 Y. pestis isolates collected in the western United States from 1980 to 2006, 21 of which were collected during plague epizootics in Colorado. Phylogenetic comparisons were used to elucidate the hypothesized spread of Y. pestis between the mountainous Front Range and the eastern plains of northern Colorado during epizootics. Isolates collected from across the western United States were included for regional comparisons. By identifying SNPs that mark individual clones, our results strongly suggest that Y. pestis is maintained locally and that widespread epizootic activity is caused by multiple clones arising independently at small geographic scales. This is in contrast to propagation of individual clones being transported widely across landscapes. Regionally, our data are consistent with the notion that Y. pestis diversifies at relatively local scales following long-range translocation events. We recommend that surveillance and prediction by public health and wildlife management professionals focus more on models of local or regional weather patterns and ecological factors that may increase risk of widespread

  1. Spatial structure and climatic adaptation in African maize revealed by surveying SNP diversity in relation to global breeding and landrace panels.

    Directory of Open Access Journals (Sweden)

    Ola T Westengen

    Full Text Available BACKGROUND: Climate change threatens maize productivity in sub-Saharan Africa. To ensure food security, access to locally adapted genetic resources and varieties is an important adaptation measure. Most of the maize grown in Africa is a genetic mix of varieties introduced at different historic times following the birth of the trans-Atlantic economy, and knowledge about geographic structure and local adaptations is limited. METHODOLOGY: A panel of 48 accessions of maize representing various introduction routes and sources of historic and recent germplasm introductions in Africa was genotyped with the MaizeSNP50 array. Spatial genetic structure and genetic relationships in the African panel were analysed separately and in the context of a panel of 265 inbred lines representing global breeding material (based on 26,900 SNPs and a panel of 1127 landraces from the Americas (270 SNPs. Environmental association analysis was used to detect SNPs associated with three climatic variables based on the full 43,963 SNP dataset. CONCLUSIONS: The genetic structure is consistent between subsets of the data and the markers are well suited for resolving relationships and admixture among the accessions. The African accessions are structured in three clusters reflecting historical and current patterns of gene flow from the New World and within Africa. The Sahelian cluster reflects original introductions of Meso-American landraces via Europe and a modern introduction of temperate breeding material. The Western cluster reflects introduction of Coastal Brazilian landraces, as well as a Northeast-West spread of maize through Arabic trade routes across the continent. The Eastern cluster most strongly reflects gene flow from modern introduced tropical varieties. Controlling for population history in a linear model, we identify 79 SNPs associated with maximum temperature during the growing season. The associations located in genes of known importance for abiotic stress

  2. Elevated left and reduced right orbitomedial prefrontal fractional anisotropy in adults with bipolar disorder revealed by tract-based spatial statistics.

    Science.gov (United States)

    Versace, Amelia; Almeida, Jorge R C; Hassel, Stefanie; Walsh, Nicholas D; Novelli, Massimiliano; Klein, Crystal R; Kupfer, David J; Phillips, Mary L

    2008-09-01

    Diffusion tensor imaging (DTI) studies in adults with bipolar disorder (BD) indicate altered white matter (WM) in the orbitomedial prefrontal cortex (OMPFC), potentially underlying abnormal prefrontal corticolimbic connectivity and mood dysregulation in BD. To use tract-based spatial statistics (TBSS) to examine WM skeleton (ie, the most compact whole-brain WM) in subjects with BD vs healthy control subjects. Cross-sectional, case-control, whole-brain DTI using TBSS. University research institute. Fifty-six individuals, 31 having a DSM-IV diagnosis of BD type I (mean age, 35.9 years [age range, 24-52 years]) and 25 controls (mean age, 29.5 years [age range, 19-52 years]). Fractional anisotropy (FA) longitudinal and radial diffusivities in subjects with BD vs controls (covarying for age) and their relationships with clinical and demographic variables. Subjects with BD vs controls had significantly greater FA (t > 3.0, P left uncinate fasciculus (reduced radial diffusivity distally and increased longitudinal diffusivity centrally), left optic radiation (increased longitudinal diffusivity), and right anterothalamic radiation (no significant diffusivity change). Subjects with BD vs controls had significantly reduced FA (t > 3.0, P right uncinate fasciculus (greater radial diffusivity). Among subjects with BD, significant negative correlations (P right anterothalamic radiation, as well as between medication load and FA in the left optic radiation. Decreased FA (P left optic radiation and in the right anterothalamic radiation among subjects with BD taking vs those not taking mood stabilizers, as well as in the left optic radiation among depressed vs remitted subjects with BD. Subjects having BD with vs without lifetime alcohol or other drug abuse had significantly decreased FA in the left uncinate fasciculus. To our knowledge, this is the first study to use TBSS to examine WM in subjects with BD. Subjects with BD vs controls showed greater WM FA in the left OMPFC that

  3. The Interaction Pattern between a Homology Model of 40S Ribosomal S9 Protein of Rhizoctonia solani and 1-Hydroxyphenaize by Docking Study

    Directory of Open Access Journals (Sweden)

    Seema Dharni

    2014-01-01

    Full Text Available 1-Hydroxyphenazine (1-OH-PHZ, a natural product from Pseudomonas aeruginosa strain SD12, was earlier reported to have potent antifungal activity against Rhizoctonia solani. In the present work, the antifungal activity of 1-OH-PHZ on 40S ribosomal S9 protein was validated by molecular docking approach. 1-OH-PHZ showed interaction with two polar contacts with residues, Arg69 and Phe19, which inhibits the synthesis of fungal protein. Our study reveals that 1-OH-PHZ can be a potent inhibitor of 40S ribosomal S9 protein of R. solani that may be a promising approach for the management of fungal diseases.

  4. Seismic velocity structure and spatial distribution of reflection intensity off the Boso Peninsula, Central Japan, revealed by an ocean bottom seismographic experiment

    Science.gov (United States)

    Kono, Akihiro; Sato, Toshinori; Shinohara, Masanao; Mochizuki, Kimihiro; Yamada, Tomoaki; Uehira, Kenji; Shinbo, Takashi; Machida, Yuuya; Hino, Ryota; Azuma, Ryosuke

    2016-04-01

    Off the Boso Peninsula, central Japan, where the Sagami Trough is in the south and the Japan Trench is in the east, there is a triple junction where the Pacific plate (PAC), the Philippine Sea plate (PHS) and the Honshu island arc (HIA) meet each other. In this region, the PAC subducts beneath the PHS and the HIA, and the PHS subducts beneath the HIA. Due to the subduction of 2 oceanic plates, numerous seismic events took place in the past. In order to understand these events, it is important to image structure of these plates. Hence, many researchers attempted to reveal the substructure from natural earthquakes and seismic experiments. Because most of the seismometers are placed inland area and the regular seismicity off Boso is inactive, it is difficult to reveal the precise substructure off Boso area using only natural earthquakes. Although several marine seismic experiments using active sources were conducted, vast area remains unclear off Boso Peninsula. In order to improve the situation, a marine seismic experiment, using airgun as an active source, was conducted from 30th July to 4th of August, 2009. The survey line has 216 km length and 20 Ocean Bottom Seismometers (OBSs) were placed on it. We estimated 2-D P-wave velocity structure from the airgun data using the PMDM (Progressive Model Development Method; Sato and Kenett, 2000) and the FAST (First Arrival Seismic Tomography ; Zelt and Barton, 1998). Furthermore, we identified the probable reflection phases from the data and estimated the location of reflectors using Travel time mapping method (Fujie et al. 2006). We found some reflection phases from the data, and the reflectors are located near the region where P-wave velocity is 5.0 km/s. We interpret that the reflectors indicate the plate boundary between the PHS and the HIA. The variation of the intensity of reflection along the upper surface of PHS seems to be consistent with the result from previous reflection seismic experiment conducted by Kimura et

  5. Nuclear ribosomal DNA diversity of a cotton pest ( Rotylenchulus ...

    African Journals Online (AJOL)

    The reniform nematode (Rotylenchulus reniformis) has emerged as a major cotton pest in the United States. A recent analysis of over 20 amphimictic populations of this pest from the US and three other countries has shown no sequence variation at the nuclear ribosomal internal transcribed spacer (ITS) despite the region's ...

  6. The ribosome-associated complex antagonizes prion formation in yeast.

    Science.gov (United States)

    Amor, Alvaro J; Castanzo, Dominic T; Delany, Sean P; Selechnik, Daniel M; van Ooy, Alex; Cameron, Dale M

    2015-01-01

    The number of known fungal proteins capable of switching between alternative stable conformations is steadily increasing, suggesting that a prion-like mechanism may be broadly utilized as a means to propagate altered cellular states. To gain insight into the mechanisms by which cells regulate prion formation and toxicity we examined the role of the yeast ribosome-associated complex (RAC) in modulating both the formation of the [PSI(+)] prion - an alternative conformer of Sup35 protein - and the toxicity of aggregation-prone polypeptides. The Hsp40 RAC chaperone Zuo1 anchors the RAC to ribosomes and stimulates the ATPase activity of the Hsp70 chaperone Ssb. We found that cells lacking Zuo1 are sensitive to over-expression of some aggregation-prone proteins, including the Sup35 prion domain, suggesting that co-translational protein misfolding increases in Δzuo1 strains. Consistent with this finding, Δzuo1 cells exhibit higher frequencies of spontaneous and induced prion formation. Cells expressing mutant forms of Zuo1 lacking either a C-terminal charged region required for ribosome association, or the J-domain responsible for Ssb ATPase stimulation, exhibit similarly high frequencies of prion formation. Our findings are consistent with a role for the RAC in chaperoning nascent Sup35 to regulate folding of the N-terminal prion domain as it emerges from the ribosome.

  7. Ribosomal DNA internal transcribed spacer 1 and internal ...

    African Journals Online (AJOL)

    USER

    2010-07-26

    Jul 26, 2010 ... in some East Asian countries such as China, Korea and. *Corresponding author. E-mail: soonkwan@kangwon.ac.kr. Tel: +82 33 250 6476. Fax: +82 33 250 6470. Abbreviations: nrDNA, Nuclear ribosomal DNA; ITS, internal transcribed spacer; PCR, polymerase chain reaction; BLAST, basic local alignment ...

  8. cDNA, genomic sequence cloning and overexpression of ribosomal ...

    African Journals Online (AJOL)

    RPS16 of eukaryote is a component of the 40S small ribosomal subunit encoded by RPS16 gene and is also a homolog of prokaryotic RPS9. The cDNA and genomic sequence of RPS16 was cloned successfully for the first time from the Giant Panda (Ailuropoda melanoleuca) using reverse transcription-polymerase chain ...

  9. (Brassicaceae) based on nuclear ribosomal ITS DNA sequences

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Genetics; Volume 93; Issue 2. Phylogeny and biogeography of Alyssum (Brassicaceae) based on nuclear ribosomal ITS DNA sequences. Yan Li Yan Kong Zhe Zhang Yanqiang Yin Bin Liu Guanghui Lv Xiyong Wang. Research Article Volume 93 Issue 2 August 2014 pp 313-323 ...

  10. Expression of a ribosome inactivating protein (curcin 2) in Jatropha ...

    Indian Academy of Sciences (India)

    Unknown

    mechanisms employed by a number of higher-plant species involve defensive ... of RIPs in the same plant species. ..... Lam C J, Ryals J A, Ward E R and Dixon R A 1992 Emerging ... against insect pests and diseases of plants: ribosome in-.

  11. Protein folding on the ribosome studied using NMR spectroscopy

    Science.gov (United States)

    Waudby, Christopher A.; Launay, Hélène; Cabrita, Lisa D.; Christodoulou, John

    2013-01-01

    NMR spectroscopy is a powerful tool for the investigation of protein folding and misfolding, providing a characterization of molecular structure, dynamics and exchange processes, across a very wide range of timescales and with near atomic resolution. In recent years NMR methods have also been developed to study protein folding as it might occur within the cell, in a de novo manner, by observing the folding of nascent polypeptides in the process of emerging from the ribosome during synthesis. Despite the 2.3 MDa molecular weight of the bacterial 70S ribosome, many nascent polypeptides, and some ribosomal proteins, have sufficient local flexibility that sharp resonances may be observed in solution-state NMR spectra. In providing information on dynamic regions of the structure, NMR spectroscopy is therefore highly complementary to alternative methods such as X-ray crystallography and cryo-electron microscopy, which have successfully characterized the rigid core of the ribosome particle. However, the low working concentrations and limited sample stability associated with ribosome–nascent chain complexes means that such studies still present significant technical challenges to the NMR spectroscopist. This review will discuss the progress that has been made in this area, surveying all NMR studies that have been published to date, and with a particular focus on strategies for improving experimental sensitivity. PMID:24083462

  12. Architecture of the E.coli 70S ribosome

    DEFF Research Database (Denmark)

    Burkhardt, N.; Diedrich, G.; Nierhaus, K.H.

    1997-01-01

    The 70S ribosome from E.coli was analysed by neutron scattering focusing on the shape and the internal protein-RNA-distribution of the complex. Measurements on selectively deuterated 70S particles and free 30S and 50S subunits applying conventional contrast variation and proton-spin contrast...

  13. Structure based hypothesis of a mitochondrial ribosome rescue mechanism

    Directory of Open Access Journals (Sweden)

    Huynen Martijn A

    2012-05-01

    Full Text Available Abstract Background mtRF1 is a vertebrate mitochondrial protein with an unknown function that arose from a duplication of the mitochondrial release factor mtRF1a. To elucidate the function of mtRF1, we determined the positions that are conserved among mtRF1 sequences but that are different in their mtRF1a paralogs. We subsequently modeled the 3D structure of mtRF1a and mtRF1 bound to the ribosome, highlighting the structural implications of these differences to derive a hypothesis for the function of mtRF1. Results Our model predicts, in agreement with the experimental data, that the 3D structure of mtRF1a allows it to recognize the stop codons UAA and UAG in the A-site of the ribosome. In contrast, we show that mtRF1 likely can only bind the ribosome when the A-site is devoid of mRNA. Furthermore, while mtRF1a will adopt its catalytic conformation, in which it functions as a peptidyl-tRNA hydrolase in the ribosome, only upon binding of a stop codon in the A-site, mtRF1 appears specifically adapted to assume this extended, peptidyl-tRNA hydrolyzing conformation in the absence of mRNA in the A-site. Conclusions We predict that mtRF1 specifically recognizes ribosomes with an empty A-site and is able to function as a peptidyl-tRNA hydrolase in those situations. Stalled ribosomes with empty A-sites that still contain a tRNA bound to a peptide chain can result from the translation of truncated, stop-codon less mRNAs. We hypothesize that mtRF1 recycles such stalled ribosomes, performing a function that is analogous to that of tmRNA in bacteria. Reviewers This article was reviewed by Dr. Eugene Koonin, Prof. Knud H. Nierhaus (nominated by Dr. Sarah Teichmann and Dr. Shamil Sunyaev.

  14. Differential scanning calorimetry of whole Escherichia coli treated with the antimicrobial peptide MSI-78 indicate a multi-hit mechanism with ribosomes as a novel target

    Directory of Open Access Journals (Sweden)

    Alexander M. Brannan

    2015-12-01

    Full Text Available Differential Scanning Calorimetry (DSC of intact Escherichia coli (E. coli was used to identify non-lipidic targets of the antimicrobial peptide (AMP MSI-78. The DSC thermograms revealed that, in addition to its known lytic properties, MSI-78 also has a striking effect on ribosomes. MSI-78’s effect on DSC scans of bacteria was similar to that of kanamycin, an antibiotic drug known to target the 30S small ribosomal subunit. An in vitro transcription/translation assay helped confirm MSI-78’s targeting of ribosomes. The scrambled version of MSI-78 also affected the ribosome peak of the DSC scans, but required greater amounts of peptide to cause a similar effect to the unscrambled peptide. Furthermore, the effect of the scrambled peptide was not specific to the ribosomes; other regions of the DSC thermogram were also affected. These results suggest that MSI-78’s effects on E. coli are at least somewhat dependent on its particular structural features, rather than a sole function of its overall charge and hydrophobicity. When considered along with earlier work detailing MSI-78’s membrane lytic properties, it appears that MSI-78 operates via a multi-hit mechanism with multiple targets.

  15. Plastid-Nuclear Interaction and Accelerated Coevolution in Plastid Ribosomal Genes in Geraniaceae.

    Science.gov (United States)

    Weng, Mao-Lun; Ruhlman, Tracey A; Jansen, Robert K

    2016-06-27

    Plastids and mitochondria have many protein complexes that include subunits encoded by organelle and nuclear genomes. In animal cells, compensatory evolution between mitochondrial and nuclear-encoded subunits was identified and the high mitochondrial mutation rates were hypothesized to drive compensatory evolution in nuclear genomes. In plant cells, compensatory evolution between plastid and nucleus has rarely been investigated in a phylogenetic framework. To investigate plastid-nuclear coevolution, we focused on plastid ribosomal protein genes that are encoded by plastid and nuclear genomes from 27 Geraniales species. Substitution rates were compared for five sets of genes representing plastid- and nuclear-encoded ribosomal subunit proteins targeted to the cytosol or the plastid as well as nonribosomal protein controls. We found that nonsynonymous substitution rates (dN) and the ratios of nonsynonymous to synonymous substitution rates (ω) were accelerated in both plastid- (CpRP) and nuclear-encoded subunits (NuCpRP) of the plastid ribosome relative to control sequences. Our analyses revealed strong signals of cytonuclear coevolution between plastid- and nuclear-encoded subunits, in which nonsynonymous substitutions in CpRP and NuCpRP tend to occur along the same branches in the Geraniaceae phylogeny. This coevolution pattern cannot be explained by physical interaction between amino acid residues. The forces driving accelerated coevolution varied with cellular compartment of the sequence. Increased ω in CpRP was mainly due to intensified positive selection whereas increased ω in NuCpRP was caused by relaxed purifying selection. In addition, the many indels identified in plastid rRNA genes in Geraniaceae may have contributed to changes in plastid subunits. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  16. Plastid–Nuclear Interaction and Accelerated Coevolution in Plastid Ribosomal Genes in Geraniaceae

    Science.gov (United States)

    Weng, Mao-Lun; Ruhlman, Tracey A.; Jansen, Robert K.

    2016-01-01

    Plastids and mitochondria have many protein complexes that include subunits encoded by organelle and nuclear genomes. In animal cells, compensatory evolution between mitochondrial and nuclear-encoded subunits was identified and the high mitochondrial mutation rates were hypothesized to drive compensatory evolution in nuclear genomes. In plant cells, compensatory evolution between plastid and nucleus has rarely been investigated in a phylogenetic framework. To investigate plastid–nuclear coevolution, we focused on plastid ribosomal protein genes that are encoded by plastid and nuclear genomes from 27 Geraniales species. Substitution rates were compared for five sets of genes representing plastid- and nuclear-encoded ribosomal subunit proteins targeted to the cytosol or the plastid as well as nonribosomal protein controls. We found that nonsynonymous substitution rates (dN) and the ratios of nonsynonymous to synonymous substitution rates (ω) were accelerated in both plastid- (CpRP) and nuclear-encoded subunits (NuCpRP) of the plastid ribosome relative to control sequences. Our analyses revealed strong signals of cytonuclear coevolution between plastid- and nuclear-encoded subunits, in which nonsynonymous substitutions in CpRP and NuCpRP tend to occur along the same branches in the Geraniaceae phylogeny. This coevolution pattern cannot be explained by physical interaction between amino acid residues. The forces driving accelerated coevolution varied with cellular compartment of the sequence. Increased ω in CpRP was mainly due to intensified positive selection whereas increased ω in NuCpRP was caused by relaxed purifying selection. In addition, the many indels identified in plastid rRNA genes in Geraniaceae may have contributed to changes in plastid subunits. PMID:27190001

  17. Differential antibiotic sensitivity determined by the large ribosomal subunit in thermophilic archaea.

    OpenAIRE

    Ruggero, D; Londei, P

    1996-01-01

    Hybrid ribosomes obtained by mixing the ribosomal subunits of the extremely thermophilic archaea Sulfolobus solfataricus and Desulfurococcus mobilis were tested for their sensitivity to selected antibiotics. It is shown that structural differences in the large ribosomal subunits determine qualitatively and quantitatively the patterns of response to alpha-sarcin and paromomycin in these species.

  18. cDNA, genomic sequence cloning and analysis of the ribosomal ...

    African Journals Online (AJOL)

    Ribosomal protein L37A (RPL37A) is a component of 60S large ribosomal subunit encoded by the RPL37A gene, which belongs to the family of ribosomal L37AE proteins, located in the cytoplasm. The complementary deoxyribonucleic acid (cDNA) and the genomic sequence of RPL37A were cloned successfully from giant ...

  19. ABC-F Proteins Mediate Antibiotic Resistance through Ribosomal Protection.

    Science.gov (United States)

    Sharkey, Liam K R; Edwards, Thomas A; O'Neill, Alex J

    2016-03-22

    Members of the ABC-F subfamily of ATP-binding cassette proteins mediate resistance to a broad array of clinically important antibiotic classes that target the ribosome of Gram-positive pathogens. The mechanism by which these proteins act has been a subject of long-standing controversy, with two competing hypotheses each having gained considerable support: antibiotic efflux versus ribosomal protection. Here, we report on studies employing a combination of bacteriological and biochemical techniques to unravel the mechanism of resistance of these proteins, and provide several lines of evidence that together offer clear support to the ribosomal protection hypothesis. Of particular note, we show that addition of purified ABC-F proteins to anin vitrotranslation assay prompts dose-dependent rescue of translation, and demonstrate that such proteins are capable of displacing antibiotic from the ribosomein vitro To our knowledge, these experiments constitute the first direct evidence that ABC-F proteins mediate antibiotic resistance through ribosomal protection.IMPORTANCEAntimicrobial resistance ranks among the greatest threats currently facing human health. Elucidation of the mechanisms by which microorganisms resist the effect of antibiotics is central to understanding the biology of this phenomenon and has the potential to inform the development of new drugs capable of blocking or circumventing resistance. Members of the ABC-F family, which includelsa(A),msr(A),optr(A), andvga(A), collectively yield resistance to a broader range of clinically significant antibiotic classes than any other family of resistance determinants, although their mechanism of action has been controversial since their discovery 25 years ago. Here we present the first direct evidence that proteins of the ABC-F family act to protect the bacterial ribosome from antibiotic-mediated inhibition. Copyright © 2016 Sharkey et al.

  20. Studies on the catalytic rate constant of ribosomal peptidyltransferase.

    Science.gov (United States)

    Synetos, D; Coutsogeorgopoulos, C

    1987-02-20

    A detailed kinetic analysis of a model reaction for the ribosomal peptidyltransferase is described, using fMet-tRNA or Ac-Phe-tRNA as the peptidyl donor and puromycin as the acceptor. The initiation complex (fMet-tRNA X AUG X 70 S ribosome) or (Ac-Phe-tRNA X poly(U) X 70 S ribosome) (complex C) is isolated and then reacted with excess puromycin (S) to give fMet-puromycin or Ac-Phe-puromycin. This reaction (puromycin reaction) is first order at all concentrations of S tested. An important asset of this kinetic analysis is the fact that the relationship between the first order rate constant kobs and [S] shows hyperbolic saturation and that the value of kobs at saturating [S] is a measure of the catalytic rate constant (k cat) of peptidyltransferase in the puromycin reaction. With fMet-tRNA as the donor, this kcat of peptidyltransferase is 8.3 min-1 when the 0.5 M NH4Cl ribosomal wash is present, compared to 3.8 min-1 in its absence. The kcat of peptidyltransferase is 2.0 min-1 when Ac-Phe-tRNA replaces fMet-tRNA in the presence of the ribosomal wash and decreases to 0.8 min-1 in its absence. This kinetic procedure is the best method available for evaluating changes in the activity of peptidyltransferase in vitro. The results suggest that peptidyltransferase is subjected to activation by the binding of fMet-tRNA to the 70 S initiation complex.

  1. Is there a channel in the ribosome for nascent peptide. Labellimg of translating ribosomes with atomar tritium

    Energy Technology Data Exchange (ETDEWEB)

    Kolb, V A; Kammer, A A; Spirin, A S

    1987-01-01

    The method of tritium bombardment was applied to investigate exposure of growing peptide on the surface of ribsome E.coli. Distribution of radioactivity by fractions is presented. Tritium inclusion in all the aminoacid residues of heteropeptide testifies to its exposure on the surface of the ribosome.

  2. A comparison of structural and evolutionary attributes of Escherichia coli and Thermus thermophilus small ribosomal subunits: signatures of thermal adaptation.

    Directory of Open Access Journals (Sweden)

    Saurav Mallik

    Full Text Available Here we compare the structural and evolutionary attributes of Thermus thermophilus and Escherichia coli small ribosomal subunits (SSU. Our results indicate that with few exceptions, thermophilic 16S ribosomal RNA (16S rRNA is densely packed compared to that of mesophilic at most of the analogous spatial regions. In addition, we have located species-specific cavity clusters (SSCCs in both species. E. coli SSCCs are numerous and larger compared to T. thermophilus SSCCs, which again indicates densely packed thermophilic 16S rRNA. Thermophilic ribosomal proteins (r-proteins have longer disordered regions than their mesophilic homologs and they experience larger disorder-to-order transitions during SSU-assembly. This is reflected in the predicted higher conformational changes of thermophilic r-proteins compared to their mesophilic homologs during SSU-assembly. This high conformational change of thermophilic r-proteins may help them to associate with the 16S ribosomal RNA with high complementary interfaces, larger interface areas, and denser molecular contacts, compared to those of mesophilic. Thus, thermophilic protein-rRNA interfaces are tightly associated with 16S rRNA than their mesophilic homologs. Densely packed 16S rRNA interior and tight protein-rRNA binding of T. thermophilus (compared to those of E. coli are likely the signatures of its thermal adaptation. We have found a linear correlation between the free energy of protein-RNA interface formation, interface size, and square of conformational changes, which is followed in both prokaryotic and eukaryotic SSU. Disorder is associated with high protein-RNA interface polarity. We have found an evolutionary tendency to maintain high polarity (thereby disorder at protein-rRNA interfaces, than that at rest of the protein structures. However, some proteins exhibit exceptions to this general trend.

  3. The complete structure of the chloroplast 70S ribosome in complex with translation factor pY.

    Science.gov (United States)

    Bieri, Philipp; Leibundgut, Marc; Saurer, Martin; Boehringer, Daniel; Ban, Nenad

    2017-02-15

    Chloroplasts are cellular organelles of plants and algae that are responsible for energy conversion and carbon fixation by the photosynthetic reaction. As a consequence of their endosymbiotic origin, they still contain their own genome and the machinery for protein biosynthesis. Here, we present the atomic structure of the chloroplast 70S ribosome prepared from spinach leaves and resolved by cryo-EM at 3.4 Å resolution. The complete structure reveals the features of the 4.5S rRNA, which probably evolved by the fragmentation of the 23S rRNA, and all five plastid-specific ribosomal proteins. These proteins, required for proper assembly and function of the chloroplast translation machinery, bind and stabilize rRNA including regions that only exist in the chloroplast ribosome. Furthermore, the structure reveals plastid-specific extensions of ribosomal proteins that extensively remodel the mRNA entry and exit site on the small subunit as well as the polypeptide tunnel exit and the putative binding site of the signal recognition particle on the large subunit. The translation factor pY, involved in light- and temperature-dependent control of protein synthesis, is bound to the mRNA channel of the small subunit and interacts with 16S rRNA nucleotides at the A-site and P-site, where it protects the decoding centre and inhibits translation by preventing tRNA binding. The small subunit is locked by pY in a non-rotated state, in which the intersubunit bridges to the large subunit are stabilized. © 2016 The Authors. Published under the terms of the CC BY NC ND 4.0 license.

  4. DNA Binding by the Ribosomal DNA Transcription Factor Rrn3 Is Essential for Ribosomal DNA Transcription*

    Science.gov (United States)

    Stepanchick, Ann; Zhi, Huijun; Cavanaugh, Alice H.; Rothblum, Katrina; Schneider, David A.; Rothblum, Lawrence I.

    2013-01-01

    The human homologue of yeast Rrn3 is an RNA polymerase I-associated transcription factor that is essential for ribosomal DNA (rDNA) transcription. The generally accepted model is that Rrn3 functions as a bridge between RNA polymerase I and the transcription factors bound to the committed template. In this model Rrn3 would mediate an interaction between the mammalian Rrn3-polymerase I complex and SL1, the rDNA transcription factor that binds to the core promoter element of the rDNA. In the course of studying the role of Rrn3 in recruitment, we found that Rrn3 was in fact a DNA-binding protein. Analysis of the sequence of Rrn3 identified a domain with sequence similarity to the DNA binding domain of heat shock transcription factor 2. Randomization, or deletion, of the amino acids in this region in Rrn3, amino acids 382–400, abrogated its ability to bind DNA, indicating that this domain was an important contributor to DNA binding by Rrn3. Control experiments demonstrated that these mutant Rrn3 constructs were capable of interacting with both rpa43 and SL1, two other activities demonstrated to be essential for Rrn3 function. However, neither of these Rrn3 mutants was capable of functioning in transcription in vitro. Moreover, although wild-type human Rrn3 complemented a yeast rrn3-ts mutant, the DNA-binding site mutant did not. These results demonstrate that DNA binding by Rrn3 is essential for transcription by RNA polymerase I. PMID:23393135

  5. DNA binding by the ribosomal DNA transcription factor rrn3 is essential for ribosomal DNA transcription.

    Science.gov (United States)

    Stepanchick, Ann; Zhi, Huijun; Cavanaugh, Alice H; Rothblum, Katrina; Schneider, David A; Rothblum, Lawrence I

    2013-03-29

    The human homologue of yeast Rrn3 is an RNA polymerase I-associated transcription factor that is essential for ribosomal DNA (rDNA) transcription. The generally accepted model is that Rrn3 functions as a bridge between RNA polymerase I and the transcription factors bound to the committed template. In this model Rrn3 would mediate an interaction between the mammalian Rrn3-polymerase I complex and SL1, the rDNA transcription factor that binds to the core promoter element of the rDNA. In the course of studying the role of Rrn3 in recruitment, we found that Rrn3 was in fact a DNA-binding protein. Analysis of the sequence of Rrn3 identified a domain with sequence similarity to the DNA binding domain of heat shock transcription factor 2. Randomization, or deletion, of the amino acids in this region in Rrn3, amino acids 382-400, abrogated its ability to bind DNA, indicating that this domain was an important contributor to DNA binding by Rrn3. Control experiments demonstrated that these mutant Rrn3 constructs were capable of interacting with both rpa43 and SL1, two other activities demonstrated to be essential for Rrn3 function. However, neither of these Rrn3 mutants was capable of functioning in transcription in vitro. Moreover, although wild-type human Rrn3 complemented a yeast rrn3-ts mutant, the DNA-binding site mutant did not. These results demonstrate that DNA binding by Rrn3 is essential for transcription by RNA polymerase I.

  6. Photoaffinity labeling of rat liver ribosomes by N-(2-Nitro-4-azidobenzoyl)puromycin

    International Nuclear Information System (INIS)

    Boehm, H.; Stahl, J.; Bielka, H.

    1979-01-01

    N-(2-nitro-4-azidobenzoyl)-[ 3 H]puromycin (NAB-puromycin) was synthesized as a photoreactive derivative of puromycin in order to detect ribosomal proteins located near the peptidyltransferase centre of rat liver ribosomes. Irradiation of ribosome-NAB-puromycin complexes leads to covalent attachment of the affinity label to proteins of the large ribosomal subunit, in particular to proteins L28/29, and, to a somewhat lower extent, to proteins L4, L6, L10 and L24. The results are discussed in the light of earlier studies performed with other affinity labels that attacked the peptidyltransferase region of rat liver ribosomes. (author)

  7. Translation activity of chimeric ribosomes composed of Escherichia coli and Bacillus subtilis or Geobacillus stearothermophilus subunits

    Directory of Open Access Journals (Sweden)

    Sayaka Tsuji

    2017-07-01

    Full Text Available Ribosome composition, consisting of rRNA and ribosomal proteins, is highly conserved among a broad range of organisms. However, biochemical studies focusing on ribosomal subunit exchangeability between organisms remain limited. In this study, we show that chimeric ribosomes, composed of Escherichia coli and Bacillus subtilis or E. coli and Geobacillus stearothermophilus subunits, are active for β-galactosidase translation in a highly purified E. coli translation system. Activities of the chimeric ribosomes showed only a modest decrease when using E. coli 30 S subunits, indicating functional conservation of the 50 S subunit between these bacterial species.

  8. Unstable structure of ribosomal particles synthesized in. gamma. -irradiated Escherichia coli

    Energy Technology Data Exchange (ETDEWEB)

    Fujita, H; Morita, K [National Inst. of Radiological Sciences, Chiba (Japan)

    1975-06-01

    Stability of Escherichia coli ribosomes newly synthesized after ..gamma..-irradiation was compared with that of normal ribosomes. The ribosomal particles around 70-S synthesized in irradiated cells were more sensitive to digestion by pancreatic ribonuclease A. A larger number of the salt-unstable '50-S' precursor particles existed in the extract from irradiated cells than in the extract from unirradiated cells. These facts suggest that ribosomal particles, synthesized during an earlier stage in irradiated cells, maintain an incomplete structure even though they are not distinguishable from normal ribosomes by means of sucrose density-gradient centrifugation.

  9. Expression and RNA Interference of Ribosomal Protein L5 Gene in Nilaparvata lugens (Hemiptera: Delphacidae).

    Science.gov (United States)

    Zhu, Jiajun; Hao, Peiying; Lu, Chaofeng; Ma, Yan; Feng, Yalin; Yu, Xiaoping

    2017-05-01

    The ribosomal proteins play important roles in the growth and development of organisms. This study aimed to explore the function of NlRPL5 (GenBank KX379234), a ribosomal protein L5 gene, in the brown planthopper Nilaparvata lugens. The open reading frame of NlRPL5 was cloned from N. lugens based on a previous transcriptome analysis. The results revealed that the open reading frame of NlRPL5 is of 900 bp, encoding 299 amino acid residues. The reverse transcription quantitative PCR results suggested that the expression of NlRPL5 gene was stronger in gravid females, but was relatively low in nymphs, males, and newly emerged females. The expression level of NlRPL5 in the ovary was about twofolds of that in the head, thorax, or fat body. RNAi of dsNlRPL5 resulted in a significant reduction of mRNA levels, ∼50% decrease in comparison with the dsGFP control at day 6. Treatment of dsNlRPL5 significantly restricted the ovarian development, and decreased the number of eggs laid on the rice (Oryza sativa) plants. This study provided a new clue for further study on the function and regulation mechanism of NlRPL5 in N. lugens. © The Author 2017. Published by Oxford University Press on behalf of the Entomological Society of America.

  10. Structural Basis for Linezolid Binding Site Rearrangement in the Staphylococcus aureus Ribosome.

    Science.gov (United States)

    Belousoff, Matthew J; Eyal, Zohar; Radjainia, Mazdak; Ahmed, Tofayel; Bamert, Rebecca S; Matzov, Donna; Bashan, Anat; Zimmerman, Ella; Mishra, Satabdi; Cameron, David; Elmlund, Hans; Peleg, Anton Y; Bhushan, Shashi; Lithgow, Trevor; Yonath, Ada

    2017-05-09

    An unorthodox, surprising mechanism of resistance to the antibiotic linezolid was revealed by cryo-electron microscopy (cryo-EM) in the 70S ribosomes from a clinical isolate of Staphylococcus aureus This high-resolution structural information demonstrated that a single amino acid deletion in ribosomal protein uL3 confers linezolid resistance despite being located 24 Å away from the linezolid binding pocket in the peptidyl-transferase center. The mutation induces a cascade of allosteric structural rearrangements of the rRNA that ultimately results in the alteration of the antibiotic binding site. IMPORTANCE The growing burden on human health caused by various antibiotic resistance mutations now includes prevalent Staphylococcus aureus resistance to last-line antimicrobial drugs such as linezolid and daptomycin. Structure-informed drug modification represents a frontier with respect to designing advanced clinical therapies, but success in this strategy requires rapid, facile means to shed light on the structural basis for drug resistance (D. Brown, Nat Rev Drug Discov 14:821-832, 2015, https://doi.org/10.1038/nrd4675). Here, detailed structural information demonstrates that a common mechanism is at play in linezolid resistance and provides a step toward the redesign of oxazolidinone antibiotics, a strategy that could thwart known mechanisms of linezolid resistance. Copyright © 2017 Belousoff et al.

  11. Recognition of Ribosomal Protein L11 by the Protein Trimethyltransferase PrmA

    Energy Technology Data Exchange (ETDEWEB)

    Demirci,H.; Gregory, S.; Dahlberg, A.; Jogl, G.

    2007-01-01

    Bacterial ribosomal protein L11 is post-translationally trimethylated at multiple residues by a single methyltransferase, PrmA. Here, we describe four structures of PrmA from the extreme thermophile Thermus thermophilus. Two apo-PrmA structures at 1.59 and 2.3 {angstrom} resolution and a third with bound cofactor S-adenosyl-L-methionine at 1.75 {angstrom} each exhibit distinct relative positions of the substrate recognition and catalytic domains, revealing how PrmA can position the L11 substrate for multiple, consecutive side-chain methylation reactions. The fourth structure, the PrmA-L11 enzyme-substrate complex at 2.4 {angstrom} resolution, illustrates the highly specific interaction of the N-terminal domain with its substrate and places Lys39 in the PrmA active site. The presence of a unique flexible loop in the cofactor-binding site suggests how exchange of AdoMet with the reaction product S-adenosyl-L-homocysteine can occur without necessitating the dissociation of PrmA from L11. Finally, the mode of interaction of PrmA with L11 explains its observed preference for L11 as substrate before its assembly into the 50S ribosomal subunit.

  12. Using the Ribodeblur pipeline to recover A-sites from yeast ribosome profiling data.

    Science.gov (United States)

    Wang, Hao; Kingsford, Carl; McManus, C Joel

    2018-03-15

    Ribosome profiling has emerged as a powerful technique to study mRNA translation. Ribosome profiling has the potential to determine the relative quantities and locations of ribosomes on mRNA genome wide. Taking full advantage of this approach requires accurate measurement of ribosome locations. However, experimental inconsistencies often obscure the positional information encoded in ribosome profiling data. Here, we describe the Ribodeblur pipeline, a computational analysis tool that uses a maximum likelihood framework to infer ribosome positions from heterogeneous datasets. Ribodeblur is simple to install, and can be run on an average modern Mac or Linux-based laptop. We detail the process of applying the pipeline to high-coverage ribosome profiling data in yeast, and discuss important considerations for potential extension to other organisms. Copyright © 2018 Elsevier Inc. All rights reserved.

  13. Spatial variation of bacterial community composition near the Luzon ...

    African Journals Online (AJOL)

    Spatial variation of bacterial community composition near the Luzon strait assessed by polymerase chain reaction-denaturing gradient gel electrophoresis ... chain reaction (PCR)-amplified bacterial 16S ribosomal deoxyribonucleic acid (DNA) gene fragments and interpreted the results; its relationship with physical and ...

  14. Pactamycin binding site on archaebacterial and eukaryotic ribosomes

    International Nuclear Information System (INIS)

    Tejedor, F.; Amils, R.; Ballesta, J.P.G.

    1987-01-01

    The presence of a photoreactive acetophenone group in the protein synthesis inhibitor pactamycin and the possibility of obtaining active iodinated derivatives that retain full biological activity allow the antibiotic binding site on Saccharomyces cerevisiae and archaebacterium Sulfolobus solfataricus ribosomes to be photoaffinity labeled. Four major labeled proteins have been identified in the yeast ribosomes, i.e., YS10, YS18, YS21/24, and YS30, while proteins AL1a, AS10/L8, AS18/20, and AS21/22 appeared as radioactive spots in S. solfataricus. There seems to be a correlation between some of the proteins labeled in yeast and those previously reported in Escherichia coli indicating that the pactamycin binding sites of both species, which are in the small subunit close to the initiation factors and mRNA binding sites, must have similar characteristics

  15. Ribosome-catalyzed formation of an abnormal peptide analogue

    International Nuclear Information System (INIS)

    Roesser, J.R.; Chorghade, M.S.; Hecht, S.M.

    1986-01-01

    The peptidyl-tRNA analogue N-(chloracetyl) phenylalanyl-tRNA/sup Phe/ was prepared by chemical aminoacylation and prebound to the P site of Escherichia coli ribosomes in response to poly(uridylic acid). Admixture of phenylalanyl-tRNA/sup Phe/ to the A site resulted in the formation of two dipeptides, one of which was found by displacement of chloride ion from the peptidyl-tRNA. This constitutes the first example of ribosome-mediated formation of a peptide of altered connectivity and suggests a need for revision of the current model of peptide bond formation. Also suggested by the present finding is the feasibility of utilizing tRNAs to prepare polypeptides of altered connectivity in an in vitro protein biosynthesizing system. [ 32 P]-oligo(rA), [ 3 H]- and [ 14 C] phenylalanines were used in the assay of the peptidye-tRNA analogue

  16. Transcriptional activation of ribosomal RNA genes during compensatory renal hypertrophy

    International Nuclear Information System (INIS)

    Ouellette, A.J.; Moonka, R.; Zelenetz, A.; Malt, R.A.

    1986-01-01

    The overall rate of rDNA transcription increases by 50% during the first 24 hours of compensatory renal hypertrophy in the mouse. To study mechanisms of ribosome accumulation after uninephrectomy, transcription rates were measured in isolated kidneys by transcriptional runoff. 32 P-labeled nascent transcripts were hybridized to blots containing linearized, denatured cloned rDNA, and hybridization was quantitated autoradiographically and by direct counting. Overall transcriptional activity of rDNA was increased by 30% above control levels at 6 hrs after nephrectomy and by 50% at 12, 18, and 24 hrs after operation. Hybridizing RNA was insensitive to inhibiby alpha-amanitin, and no hybridization was detected to vector DNA. Thus, accelerated rDNA transcription is one regulatory element in the accretion of ribosomes in renal growth, and the regulatory event is an early event. Mechanisms of activation may include enhanced transcription of active genes or induction of inactive DNA

  17. Ribosomal protein S14 transcripts are edited in Oenothera mitochondria.

    Science.gov (United States)

    Schuster, W; Unseld, M; Wissinger, B; Brennicke, A

    1990-01-01

    The gene encoding ribosomal protein S14 (rps14) in Oenothera mitochondria is located upstream of the cytochrome b gene (cob). Sequence analysis of independently derived cDNA clones covering the entire rps14 coding region shows two nucleotides edited from the genomic DNA to the mRNA derived sequences by C to U modifications. A third editing event occurs four nucleotides upstream of the AUG initiation codon and improves a potential ribosome binding site. A CGG codon specifying arginine in a position conserved in evolution between chloroplasts and E. coli as a UGG tryptophan codon is not edited in any of the cDNAs analysed. An inverted repeat 3' of an unidentified open reading frame is located upstream of the rps14 gene. The inverted repeat sequence is highly conserved at analogous regions in other Oenothera mitochondrial loci. Images PMID:2326162

  18. The subcellular distribution of the human ribosomal "stalk" components: P1, P2 and P0 proteins

    DEFF Research Database (Denmark)

    Tchórzewski, Marek; Krokowski, Dawid; Rzeski, Wojciech

    2003-01-01

    The ribosomal "stalk" structure is a distinct lateral protuberance located on the large ribosomal subunit in prokaryotic, as well as in eukaryotic cells. In eukaryotes, this ribosomal structure is composed of the acidic ribosomal P proteins, forming two hetero-dimers (P1/P2) attached...

  19. Assembly constraints drive co-evolution among ribosomal constituents.

    Science.gov (United States)

    Mallik, Saurav; Akashi, Hiroshi; Kundu, Sudip

    2015-06-23

    Ribosome biogenesis, a central and essential cellular process, occurs through sequential association and mutual co-folding of protein-RNA constituents in a well-defined assembly pathway. Here, we construct a network of co-evolving nucleotide/amino acid residues within the ribosome and demonstrate that assembly constraints are strong predictors of co-evolutionary patterns. Predictors of co-evolution include a wide spectrum of structural reconstitution events, such as cooperativity phenomenon, protein-induced rRNA reconstitutions, molecular packing of different rRNA domains, protein-rRNA recognition, etc. A correlation between folding rate of small globular proteins and their topological features is known. We have introduced an analogous topological characteristic for co-evolutionary network of ribosome, which allows us to differentiate between rRNA regions subjected to rapid reconstitutions from those hindered by kinetic traps. Furthermore, co-evolutionary patterns provide a biological basis for deleterious mutation sites and further allow prediction of potential antibiotic targeting sites. Understanding assembly pathways of multicomponent macromolecules remains a key challenge in biophysics. Our study provides a 'proof of concept' that directly relates co-evolution to biophysical interactions during multicomponent assembly and suggests predictive power to identify candidates for critical functional interactions as well as for assembly-blocking antibiotic target sites. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  20. Photoaffinity labeling of the pactamycin binding site on eubacterial ribosomes

    International Nuclear Information System (INIS)

    Tejedor, F.; Amils, R.; Ballesta, J.P.

    1985-01-01

    Pactamycin, an inhibitor of the initial steps of protein synthesis, has an acetophenone group in its chemical structure that makes the drug a potentially photoreactive molecule. In addition, the presence of a phenolic residue makes it easily susceptible to radioactive labeling. Through iodination, one radioactive derivative of pactamycin has been obtained with biological activities similar to the unmodified drug when tested on in vivo and cell-free systems. With the use of [ 125 I]iodopactamycin, ribosomes of Escherichia coli have been photolabeled under conditions that preserve the activity of the particles and guarantee the specificity of the binding sites. Under these conditions, RNA is preferentially labeled when free, small ribosomal subunits are photolabeled, but proteins are the main target in the whole ribosome. This indicates that an important conformational change takes place in the binding site on association of the two subunits. The major labeled proteins are S2, S4, S18, S21, and L13. These proteins in the pactamycin binding site are probably related to the initiation step of protein synthesis

  1. Further characterization of ribosome binding to thylakoid membranes

    International Nuclear Information System (INIS)

    Hurewitz, J.; Jagendorf, A.T.

    1987-01-01

    Previous work indicated more polysomes bound to pea (Pisum sativum cv Progress No. 9) thylakoids in light than in the dark, in vivo. With isolated intact chloroplasts incubated in darkness, addition of MgATP had no effect but 24 to 74% more RNA was thylakoid-bound at pH 8.3 than at pH 7. Thus, the major effect of light on ribosome-binding in vivo may be due to higher stroma pH. In isolated pea chloroplasts, initiation inhibitors (pactamycin and kanamycin) decreased the extent of RNA binding, and elongation inhibitors (lincomycin and streptomycin) increased it. Thus, cycling of ribosomes is controlled by translation, initiation, and termination. Bound RNA accounted for 19 to 24% of the total chloroplast RNA and the incorporation of [ 3 H]leucine into thylakoids was proportional to the amount of this bound RNA. These data support the concept that stroma ribosomes are recruited into thylakoid polysomes, which are active in synthesizing thylakoid proteins

  2. Structure of Vibrio cholerae ribosome hibernation promoting factor

    International Nuclear Information System (INIS)

    De Bari, Heather; Berry, Edward A.

    2013-01-01

    The X-ray crystal structure of ribosome hibernation promoting factor from V. cholerae has been determined at 2.0 Å resolution. The crystal was phased by two-wavelength MAD using cocrystallized cobalt. The X-ray crystal structure of ribosome hibernation promoting factor (HPF) from Vibrio cholerae is presented at 2.0 Å resolution. The crystal was phased by two-wavelength MAD using cocrystallized cobalt. The asymmetric unit contained two molecules of HPF linked by four Co atoms. The metal-binding sites observed in the crystal are probably not related to biological function. The structure of HPF has a typical β–α–β–β–β–α fold consistent with previous structures of YfiA and HPF from Escherichia coli. Comparison of the new structure with that of HPF from E. coli bound to the Thermus thermophilus ribosome [Polikanov et al. (2012 ▶), Science, 336, 915–918] shows that no significant structural changes are induced in HPF by binding

  3. A new version of the RDP (Ribosomal Database Project)

    Science.gov (United States)

    Maidak, B. L.; Cole, J. R.; Parker, C. T. Jr; Garrity, G. M.; Larsen, N.; Li, B.; Lilburn, T. G.; McCaughey, M. J.; Olsen, G. J.; Overbeek, R.; hide

    1999-01-01

    The Ribosomal Database Project (RDP-II), previously described by Maidak et al. [ Nucleic Acids Res. (1997), 25, 109-111], is now hosted by the Center for Microbial Ecology at Michigan State University. RDP-II is a curated database that offers ribosomal RNA (rRNA) nucleotide sequence data in aligned and unaligned forms, analysis services, and associated computer programs. During the past two years, data alignments have been updated and now include >9700 small subunit rRNA sequences. The recent development of an ObjectStore database will provide more rapid updating of data, better data accuracy and increased user access. RDP-II includes phylogenetically ordered alignments of rRNA sequences, derived phylogenetic trees, rRNA secondary structure diagrams, and various software programs for handling, analyzing and displaying alignments and trees. The data are available via anonymous ftp (ftp.cme.msu. edu) and WWW (http://www.cme.msu.edu/RDP). The WWW server provides ribosomal probe checking, approximate phylogenetic placement of user-submitted sequences, screening for possible chimeric rRNA sequences, automated alignment, and a suggested placement of an unknown sequence on an existing phylogenetic tree. Additional utilities also exist at RDP-II, including distance matrix, T-RFLP, and a Java-based viewer of the phylogenetic trees that can be used to create subtrees.

  4. Simulation and analysis of single-ribosome translation

    International Nuclear Information System (INIS)

    Tinoco, Ignacio Jr; Wen, Jin-Der

    2009-01-01

    In the cell, proteins are synthesized by ribosomes in a multi-step process called translation. The ribosome translocates along the messenger RNA to read the codons that encode the amino acid sequence of a protein. Elongation factors, including EF-G and EF-Tu, are used to catalyze the process. Recently, we have shown that translation can be followed at the single-molecule level using optical tweezers; this technique allows us to study the kinetics of translation by measuring the lifetime the ribosome spends at each codon. Here, we analyze the data from single-molecule experiments and fit the data with simple kinetic models. We also simulate the translation kinetics based on a multi-step mechanism from ensemble kinetic measurements. The mean lifetimes from the simulation were consistent with our experimental single-molecule measurements. We found that the calculated lifetime distributions were fit in general by equations with up to five rate-determining steps. Two rate-determining steps were only obtained at low concentrations of elongation factors. These analyses can be used to design new single-molecule experiments to better understand the kinetics and mechanism of translation

  5. Structure of the hepatitis C virus IRES bound to the human 80S ribosome: remodeling of the HCV IRES.

    Science.gov (United States)

    Boehringer, Daniel; Thermann, Rolf; Ostareck-Lederer, Antje; Lewis, Joe D; Stark, Holger

    2005-11-01

    Initiation of translation of the hepatitis C virus (HCV) polyprotein is driven by an internal ribosome entry site (IRES) RNA that bypasses much of the eukaryotic translation initiation machinery. Here, single-particle electron cryomicroscopy has been used to study the mechanism of HCV IRES-mediated initiation. A HeLa in vitro translation system was used to assemble human IRES-80S ribosome complexes under near physiological conditions; these were stalled before elongation. Domain 2 of the HCV IRES is bound to the tRNA exit site, touching the L1 stalk of the 60S subunit, suggesting a mechanism for the removal of the HCV IRES in the progression to elongation. Domain 3 of the HCV IRES positions the initiation codon in the ribosomal mRNA binding cleft by binding helix 28 at the head of the 40S subunit. The comparison with the previously published binary 40S-HCV IRES complex reveals structural rearrangements in the two pseudoknot structures of the HCV IRES in translation initiation.

  6. Crystallization and preliminary crystallographic studies of L30e, a ribosomal protein from Methanocaldococcus jannaschii (MJ1044)

    International Nuclear Information System (INIS)

    Rangarajan, Sarani; Jeyakanthan, Jeyaraman; Mridula, Palappetty; Sakamoto, Keiko; Kitamura, Yoshiaki; Agari, Yoshihiro; Shinkai, Akeo; Ebihara, Akio; Kuramitsu, Seiki; Yokoyama, Shigeyuki; Sekar, Kanagaraj

    2008-01-01

    The ribosomal protein (L30e) from M. jannaschii was cloned from the gene MJ1044, expressed, purified and crystallized. The crystal belongs to the primitive tetragonal space group P4 3 and diffracted to 1.9 Å resolution. In view of the biological significance of understanding the ribosomal machinery of both prokaryotes and eukaryotes, the L30e ribosomal protein from Methanocaldococcus jannaschii was cloned, overexpressed, purified and crystallized using the microbatch-under-oil method with the crystallization conditions 40% PEG 400, 0.1 M MES pH 6.0 and 5% PEG 3000 at 291 K. A diffraction-quality crystal (0.20 × 0.20 × 0.35 mm) was obtained that belonged to the primitive tetragonal space group P4 3 , with unit-cell parameters a = 46.1, b = 46.1, c = 98.5 Å, and diffracted to a resolution of 1.9 Å. Preliminary calculations reveal that the asymmetric unit contains two monomers with a Matthews coefficient (V M ) of 2.16 Å 3 Da −1

  7. The pleuromutilin drugs tiamulin and valnemulin bind to the RNA at the peptidyl transferase centre on the ribosome.

    Science.gov (United States)

    Poulsen, S M; Karlsson, M; Johansson, L B; Vester, B

    2001-09-01

    The pleuromutilin antibiotic derivatives, tiamulin and valnemulin, inhibit protein synthesis by binding to the 50S ribosomal subunit of bacteria. The action and binding site of tiamulin and valnemulin was further characterized on Escherichia coli ribosomes. It was revealed that these drugs are strong inhibitors of peptidyl transferase and interact with domain V of 23S RNA, giving clear chemical footprints at nucleotides A2058-9, U2506 and U2584-5. Most of these nucleotides are highly conserved phylogenetically and functionally important, and all of them are at or near the peptidyl transferase centre and have been associated with binding of several antibiotics. Competitive footprinting shows that tiamulin and valnemulin can bind concurrently with the macrolide erythromycin but compete with the macrolide carbomycin, which is a peptidyl transferase inhibitor. We infer from these and previous results that tiamulin and valnemulin interact with the rRNA in the peptidyl transferase slot on the ribosomes in which they prevent the correct positioning of the CCA-ends of tRNAs for peptide transfer.

  8. Revealing Rembrandt

    Directory of Open Access Journals (Sweden)

    Andrew J Parker

    2014-04-01

    Full Text Available The power and significance of artwork in shaping human cognition is self-evident. The starting point for our empirical investigations is the view that the task of neuroscience is to integrate itself with other forms of knowledge, rather than to seek to supplant them. In our recent work, we examined a particular aspect of the appreciation of artwork using present-day functional magnetic resonance imaging (fMRI. Our results emphasised the continuity between viewing artwork and other human cognitive activities. We also showed that appreciation of a particular aspect of artwork, namely authenticity, depends upon the co-ordinated activity between the brain regions involved in multiple decision making and those responsible for processing visual information. The findings about brain function probably have no specific consequences for understanding how people respond to the art of Rembrandt in comparison with their response to other artworks. However, the use of images of Rembrandt’s portraits, his most intimate and personal works, clearly had a significant impact upon our viewers, even though they have been spatially confined to the interior of an MRI scanner at the time of viewing. Neuroscientific studies of humans viewing artwork have the capacity to reveal the diversity of human cognitive responses that may be induced by external advice or context as people view artwork in a variety of frameworks and settings.

  9. Comprehensive behavioral analysis of the Cdkl5 knockout mice revealed significant enhancement in anxiety- and fear-related behaviors and impairment in both acquisition and long-term retention of spatial reference memory.

    Science.gov (United States)

    Okuda, Kosuke; Takao, Keizo; Watanabe, Aya; Miyakawa, Tsuyoshi; Mizuguchi, Masashi; Tanaka, Teruyuki

    2018-01-01

    Mutations in the Cyclin-dependent kinase-like 5 (CDKL5) gene cause severe neurodevelopmental disorders. Recently we have generated Cdkl5 KO mice by targeting exon 2 on the C57BL/6N background, and demonstrated postsynaptic overaccumulation of GluN2B-containing N-methyl-D-aspartate (NMDA) receptors in the hippocampus. In the current study, we subjected the Cdkl5 KO mice to a battery of comprehensive behavioral tests, aiming to reveal the effects of loss of CDKL5 in a whole perspective of motor, emotional, social, and cognition/memory functions, and to identify its undetermined roles. The neurological screen, rotarod, hot plate, prepulse inhibition, light/dark transition, open field, elevated plus maze, Porsolt forced swim, tail suspension, one-chamber and three-chamber social interaction, 24-h home cage monitoring, contextual and cued fear conditioning, Barnes maze, and T-maze tests were applied on adult Cdkl5 -/Y and +/Y mice. Cdkl5 -/Y mice showed a mild alteration in the gait. Analyses of emotional behaviors revealed significantly enhanced anxiety-like behaviors of Cdkl5 -/Y mice. Depressive-like behaviors and social interaction of Cdkl5 -/Y mice were uniquely altered. The contextual and cued fear conditioning of Cdkl5 -/Y mice were comparable to control mice; however, Cdkl5 -/Y mice showed a significantly increased freezing time and a significantly decreased distance traveled during the pretone period in the altered context. Both acquisition and long-term retention of spatial reference memory were significantly impaired. The morphometric analysis of hippocampal CA1 pyramidal neurons revealed impaired dendritic arborization and immature spine development in Cdkl5 -/Y mice. These results indicate that CDKL5 plays significant roles in regulating emotional behaviors especially on anxiety- and fear-related responses, and in both acquisition and long-term retention of spatial reference memory, which suggests that focus and special attention should be paid to the

  10. Comprehensive behavioral analysis of the Cdkl5 knockout mice revealed significant enhancement in anxiety- and fear-related behaviors and impairment in both acquisition and long-term retention of spatial reference memory.

    Directory of Open Access Journals (Sweden)

    Kosuke Okuda

    Full Text Available Mutations in the Cyclin-dependent kinase-like 5 (CDKL5 gene cause severe neurodevelopmental disorders. Recently we have generated Cdkl5 KO mice by targeting exon 2 on the C57BL/6N background, and demonstrated postsynaptic overaccumulation of GluN2B-containing N-methyl-D-aspartate (NMDA receptors in the hippocampus. In the current study, we subjected the Cdkl5 KO mice to a battery of comprehensive behavioral tests, aiming to reveal the effects of loss of CDKL5 in a whole perspective of motor, emotional, social, and cognition/memory functions, and to identify its undetermined roles. The neurological screen, rotarod, hot plate, prepulse inhibition, light/dark transition, open field, elevated plus maze, Porsolt forced swim, tail suspension, one-chamber and three-chamber social interaction, 24-h home cage monitoring, contextual and cued fear conditioning, Barnes maze, and T-maze tests were applied on adult Cdkl5 -/Y and +/Y mice. Cdkl5 -/Y mice showed a mild alteration in the gait. Analyses of emotional behaviors revealed significantly enhanced anxiety-like behaviors of Cdkl5 -/Y mice. Depressive-like behaviors and social interaction of Cdkl5 -/Y mice were uniquely altered. The contextual and cued fear conditioning of Cdkl5 -/Y mice were comparable to control mice; however, Cdkl5 -/Y mice showed a significantly increased freezing time and a significantly decreased distance traveled during the pretone period in the altered context. Both acquisition and long-term retention of spatial reference memory were significantly impaired. The morphometric analysis of hippocampal CA1 pyramidal neurons revealed impaired dendritic arborization and immature spine development in Cdkl5 -/Y mice. These results indicate that CDKL5 plays significant roles in regulating emotional behaviors especially on anxiety- and fear-related responses, and in both acquisition and long-term retention of spatial reference memory, which suggests that focus and special attention should be

  11. Comprehensive behavioral analysis of the Cdkl5 knockout mice revealed significant enhancement in anxiety- and fear-related behaviors and impairment in both acquisition and long-term retention of spatial reference memory

    Science.gov (United States)

    Okuda, Kosuke; Takao, Keizo; Watanabe, Aya; Miyakawa, Tsuyoshi; Mizuguchi, Masashi

    2018-01-01

    Mutations in the Cyclin-dependent kinase-like 5 (CDKL5) gene cause severe neurodevelopmental disorders. Recently we have generated Cdkl5 KO mice by targeting exon 2 on the C57BL/6N background, and demonstrated postsynaptic overaccumulation of GluN2B-containing N-methyl-D-aspartate (NMDA) receptors in the hippocampus. In the current study, we subjected the Cdkl5 KO mice to a battery of comprehensive behavioral tests, aiming to reveal the effects of loss of CDKL5 in a whole perspective of motor, emotional, social, and cognition/memory functions, and to identify its undetermined roles. The neurological screen, rotarod, hot plate, prepulse inhibition, light/dark transition, open field, elevated plus maze, Porsolt forced swim, tail suspension, one-chamber and three-chamber social interaction, 24-h home cage monitoring, contextual and cued fear conditioning, Barnes maze, and T-maze tests were applied on adult Cdkl5 -/Y and +/Y mice. Cdkl5 -/Y mice showed a mild alteration in the gait. Analyses of emotional behaviors revealed significantly enhanced anxiety-like behaviors of Cdkl5 -/Y mice. Depressive-like behaviors and social interaction of Cdkl5 -/Y mice were uniquely altered. The contextual and cued fear conditioning of Cdkl5 -/Y mice were comparable to control mice; however, Cdkl5 -/Y mice showed a significantly increased freezing time and a significantly decreased distance traveled during the pretone period in the altered context. Both acquisition and long-term retention of spatial reference memory were significantly impaired. The morphometric analysis of hippocampal CA1 pyramidal neurons revealed impaired dendritic arborization and immature spine development in Cdkl5 -/Y mice. These results indicate that CDKL5 plays significant roles in regulating emotional behaviors especially on anxiety- and fear-related responses, and in both acquisition and long-term retention of spatial reference memory, which suggests that focus and special attention should be paid to the

  12. Ribosome profiling reveals features of normal and disease-associated mitochondrial translation

    NARCIS (Netherlands)

    Rooijers, K.; Loayza-Puch, F.; Nijtmans, L.G.J.; Agami, R.

    2013-01-01

    Mitochondria are essential cellular organelles for generation of energy and their dysfunction may cause diabetes, Parkinson's disease and multi-systemic failure marked by failure to thrive, gastrointestinal problems, lactic acidosis and early lethality. Disease-associated mitochondrial mutations

  13. Ribosome profiling reveals features of normal and disease-associated mitochondrial translation

    NARCIS (Netherlands)

    K. Rooijers (Koos); F. Loayza-Puch (Fabricio); L.G.J. Nijtmans (Leo); R. Agami (Reuven)

    2013-01-01

    textabstractMitochondria are essential cellular organelles for generation of energy and their dysfunction may cause diabetes, Parkinson's disease and multi-systemic failure marked by failure to thrive, gastrointestinal problems, lactic acidosis and early lethality. Disease-associated mitochondrial

  14. The Arabidopsis gene DIG6 encodes a large 60S subunit nuclear export GTPase 1 that is involved in ribosome biogenesis and affects multiple auxin-regulated development processes

    KAUST Repository

    Zhao, Huayan

    2015-08-13

    The circularly permuted GTPase large subunit GTPase 1 (LSG1) is involved in the maturation step of the 60S ribosome and is essential for cell viability in yeast. Here, an Arabidopsis mutant dig6 (drought inhibited growth of lateral roots) was isolated. The mutant exhibited multiple auxin-related phenotypes, which included reduced lateral root number, altered leaf veins, and shorter roots. Genetic mapping combined with next-generation DNA sequencing identified that the mutation occurred in AtLSG1-2. This gene was highly expressed in regions of auxin accumulation. Ribosome profiling revealed that a loss of function of AtLSG1-2 led to decreased levels of monosomes, further demonstrating its role in ribosome biogenesis. Quantitative proteomics showed that the expression of certain proteins involved in ribosome biogenesis was differentially regulated, indicating that ribosome biogenesis processes were impaired in the mutant. Further investigations showed that an AtLSG1-2 deficiency caused the alteration of auxin distribution, response, and transport in plants. It is concluded that AtLSG1-2 is integral to ribosome biogenesis, consequently affecting auxin homeostasis and plant development.

  15. The Arabidopsis gene DIG6 encodes a large 60S subunit nuclear export GTPase 1 that is involved in ribosome biogenesis and affects multiple auxin-regulated development processes

    KAUST Repository

    Zhao, Huayan; Lü , Shiyou; Li, Ruixi; Chen, Tao; Zhang, Huoming; Cui, Peng; Ding, Feng; Liu, Pei; Wang, Guangchao; Xia, Yiji; Running, Mark P.; Xiong, Liming

    2015-01-01

    The circularly permuted GTPase large subunit GTPase 1 (LSG1) is involved in the maturation step of the 60S ribosome and is essential for cell viability in yeast. Here, an Arabidopsis mutant dig6 (drought inhibited growth of lateral roots) was isolated. The mutant exhibited multiple auxin-related phenotypes, which included reduced lateral root number, altered leaf veins, and shorter roots. Genetic mapping combined with next-generation DNA sequencing identified that the mutation occurred in AtLSG1-2. This gene was highly expressed in regions of auxin accumulation. Ribosome profiling revealed that a loss of function of AtLSG1-2 led to decreased levels of monosomes, further demonstrating its role in ribosome biogenesis. Quantitative proteomics showed that the expression of certain proteins involved in ribosome biogenesis was differentially regulated, indicating that ribosome biogenesis processes were impaired in the mutant. Further investigations showed that an AtLSG1-2 deficiency caused the alteration of auxin distribution, response, and transport in plants. It is concluded that AtLSG1-2 is integral to ribosome biogenesis, consequently affecting auxin homeostasis and plant development.

  16. Cell cycle, differentiation and tissue-independent expression of ribosomal protein L37.

    Science.gov (United States)

    Su, S; Bird, R C

    1995-09-15

    A unique human cDNA (hG1.16) that encodes a mRNA of 450 nucleotides was isolated from a subtractive library derived from HeLa cells. The relative expression level of hG1.16 during different cell-cycle phases was determined by Northern-blot analysis of cells synchronized by double-thymidine block and serum deprivation/refeeding. hG1.16 was constitutively expressed during all phases of the cell cycle, including the quiescent phase when even most constitutively expressed genes experience some suppression of expression. The expression level of hG1.16 did not change during terminal differentiation of myoblasts to myotubes, during which cells become permanently post-mitotic. Examination of other tissues revealed that the relative expression level of hG1.16 was constitutive in all embryonic mouse tissues examined, including brain, eye, heart, kidney, liver, lung and skeletal muscle. This was unusual in that expression was not down-modulated during differentiation and did not vary appreciably between tissue types. Analysis by inter-species Northern-blot analysis revealed that hG1.16 was highly conserved among all vertebrates studied (from fish to humans but not in insects). DNA sequence analysis of hG1.16 revealed a high level of similarity to rat ribosomal protein L37, identifying hG1.16 as a new member of this multigene family. The deduced amino acid sequence of hG1.16 was identical to rat ribosomal protein L37 that contained 97 amino acids, many of which are highly positively charged (15 arginine and 14 lysine residues with a predicted M(r) of 11,065). hG1.16 protein has a single C2-C2 zinc-finger-like motif which is also present in rat ribosomal protein L37. Using primers designed from the sequence of hG1.16, unique bovine and rat cDNAs were also isolated by 5'-rapid-amplification of cDNA ends. DNA sequences of bovine and rat G1.16, clones were 92.8% and 92.2% similar to human G1.16 while the deduced amino acid sequences derived from bovine and rat cDNAs each differed

  17. Genotyping of Giardia lamblia isolates from humans in China and Korea using ribosomal DNA Sequences.

    Science.gov (United States)

    Yong, T S; Park, S J; Hwang, U W; Yang, H W; Lee, K W; Min, D Y; Rim, H J; Wang, Y; Zheng, F

    2000-08-01

    Genetic characterization of a total of 15 Giardia lamblia isolates, 8 from Anhui Province, China (all from purified cysts) and 7 from Seoul, Korea (2 from axenic cultures and 5 from purified cysts), was performed by polymerase chain reaction amplification and sequencing of a 295-bp region near the 5' end of the small subunit ribosomal DNA (eukaryotic 16S rDNA). Phylogenetic analyses were subsequently conducted using sequence data obtained in this study, as well as sequences published from other Giardia isolates. The maximum parsimony method revealed that G. lamblia isolates from humans in China and Korea are divided into 2 major lineages, assemblages A and B. All 7 Korean isolates were grouped into assemblage A, whereas 4 Chinese isolates were grouped into assemblage A and 4 into assemblage B. Two Giardia microti isolates and 2 dog-derived Giardia isolates also grouped into assemblage B, whereas Giardia ardeae and Giardia muris were unique.

  18. Involvement of ribosomal protein L6 in assembly of functional 50S ribosomal subunit in Escherichia coli cells

    International Nuclear Information System (INIS)

    Shigeno, Yuta; Uchiumi, Toshio; Nomura, Takaomi

    2016-01-01

    Ribosomal protein L6, an essential component of the large (50S) subunit, primarily binds to helix 97 of 23S rRNA and locates near the sarcin/ricin loop of helix 95 that directly interacts with GTPase translation factors. Although L6 is believed to play important roles in factor-dependent ribosomal function, crucial biochemical evidence for this hypothesis has not been obtained. We constructed and characterized an Escherichia coli mutant bearing a chromosomal L6 gene (rplF) disruption and carrying a plasmid with an arabinose-inducible L6 gene. Although this ΔL6 mutant grew more slowly than its wild-type parent, it proliferated in the presence of arabinose. Interestingly, cell growth in the absence of arabinose was biphasic. Early growth lasted only a few generations (LI-phase) and was followed by a suspension of growth for several hours (S-phase). This suspension was followed by a second growth phase (LII-phase). Cells harvested at both LI- and S-phases contained ribosomes with reduced factor-dependent GTPase activity and accumulated 50S subunit precursors (45S particles). The 45S particles completely lacked L6. Complete 50S subunits containing L6 were observed in all growth phases regardless of the L6-depleted condition, implying that the ΔL6 mutant escaped death because of a leaky expression of L6 from the complementing plasmid. We conclude that L6 is essential for the assembly of functional 50S subunits at the late stage. We thus established conditions for the isolation of L6-depleted 50S subunits, which are essential to study the role of L6 in translation. - Highlights: • We constructed an in vivo functional assay system for Escherichia coli ribosomal protein L6. • Growth of an E. coli ΔL6 mutant was biphasic when L6 levels were depleted. • The ΔL6 mutant accumulated 50S ribosomal subunit precursors that sedimented at 45S. • L6 is a key player in the late stage of E. coli 50S subunit assembly.

  19. Involvement of ribosomal protein L6 in assembly of functional 50S ribosomal subunit in Escherichia coli cells

    Energy Technology Data Exchange (ETDEWEB)

    Shigeno, Yuta [Division of Applied Biology, Faculty of Textile Science and Technology, Shinshu University, Ueda 386-8567 (Japan); Uchiumi, Toshio [Department of Biology, Faculty of Science, Niigata University, Niigata 950-2181 (Japan); Nomura, Takaomi, E-mail: nomurat@shinshu-u.ac.jp [Division of Applied Biology, Faculty of Textile Science and Technology, Shinshu University, Ueda 386-8567 (Japan)

    2016-04-22

    Ribosomal protein L6, an essential component of the large (50S) subunit, primarily binds to helix 97 of 23S rRNA and locates near the sarcin/ricin loop of helix 95 that directly interacts with GTPase translation factors. Although L6 is believed to play important roles in factor-dependent ribosomal function, crucial biochemical evidence for this hypothesis has not been obtained. We constructed and characterized an Escherichia coli mutant bearing a chromosomal L6 gene (rplF) disruption and carrying a plasmid with an arabinose-inducible L6 gene. Although this ΔL6 mutant grew more slowly than its wild-type parent, it proliferated in the presence of arabinose. Interestingly, cell growth in the absence of arabinose was biphasic. Early growth lasted only a few generations (LI-phase) and was followed by a suspension of growth for several hours (S-phase). This suspension was followed by a second growth phase (LII-phase). Cells harvested at both LI- and S-phases contained ribosomes with reduced factor-dependent GTPase activity and accumulated 50S subunit precursors (45S particles). The 45S particles completely lacked L6. Complete 50S subunits containing L6 were observed in all growth phases regardless of the L6-depleted condition, implying that the ΔL6 mutant escaped death because of a leaky expression of L6 from the complementing plasmid. We conclude that L6 is essential for the assembly of functional 50S subunits at the late stage. We thus established conditions for the isolation of L6-depleted 50S subunits, which are essential to study the role of L6 in translation. - Highlights: • We constructed an in vivo functional assay system for Escherichia coli ribosomal protein L6. • Growth of an E. coli ΔL6 mutant was biphasic when L6 levels were depleted. • The ΔL6 mutant accumulated 50S ribosomal subunit precursors that sedimented at 45S. • L6 is a key player in the late stage of E. coli 50S subunit assembly.

  20. gamma. radiation effect on the functional properties of the cotton ribosomes

    Energy Technology Data Exchange (ETDEWEB)

    Ibragimov, A P; Safarov, Sh

    1973-01-01

    A study is made of the action of radiation on the functional properties of ribosomes in irradiated organisms and on isolated ribosomes exposed to different doses. With increase in dose there occurs a reduction in the incorporation of labelled amino acids by the ribosomes released from irradiated sprouts and also during irradiation of isolated ribosomes. The study covered the functional activity of ribosomes irradiated at different doses with the use of synthetic poly-U and poly-A matrices synthesizing polyphenylalanine and polylysine, depending on the irradiation dose. The inhibition of the activity of the protein synthesis system at high doses is due to structural and functional changes in ribosomes and also to disturbance in the biosynthesis and functions of the messenger RNA.

  1. Computational resources for ribosome profiling: from database to Web server and software.

    Science.gov (United States)

    Wang, Hongwei; Wang, Yan; Xie, Zhi

    2017-08-14

    Ribosome profiling is emerging as a powerful technique that enables genome-wide investigation of in vivo translation at sub-codon resolution. The increasing application of ribosome profiling in recent years has achieved remarkable progress toward understanding the composition, regulation and mechanism of translation. This benefits from not only the awesome power of ribosome profiling but also an extensive range of computational resources available for ribosome profiling. At present, however, a comprehensive review on these resources is still lacking. Here, we survey the recent computational advances guided by ribosome profiling, with a focus on databases, Web servers and software tools for storing, visualizing and analyzing ribosome profiling data. This review is intended to provide experimental and computational biologists with a reference to make appropriate choices among existing resources for the question at hand. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  2. Senescent changes in the ribosomes of animal cells in vivo and in vitro

    Science.gov (United States)

    Miquel, J.; Johnson, J. E., Jr.

    1979-01-01

    The paper examines RNA-ribosomal changes observed in protozoa and fixed postmitotic cells, as well as the characteristics of intermitotic cells. Attention is given to a discussion of the implications of the reported ribosomal changes as to the senescent deterioration of protein synthesis and physiological functions. A survey of the literature suggests that, while the data on ribosomal change in dividing cells both in vivo and in vitro are inconclusive, there is strong histological and biochemical evidence in favor of some degree of quantitative ribosomal loss in fixed postmitotic cells. Since these decreases in ribosomes are demonstrated in differential cells from nematodes, insects and mammals, they may represent a universal manifestation of cytoplasmic senescence in certain types of fixed postmitotic animal cells. The observed variability in ribosomal loss for cells belonging to the same type suggests that this involution phenomenon is rather related to the wear and tear suffered by a particular cell.

  3. Control of ribosome traffic by position-dependent choice of synonymous codons

    DEFF Research Database (Denmark)

    Mitarai, Namiko; Pedersen, Steen

    2013-01-01

    Messenger RNA (mRNA) encodes a sequence of amino acids by using codons. For most amino acids, there are multiple synonymous codons that can encode the amino acid. The translation speed can vary from one codon to another, thus there is room for changing the ribosome speed while keeping the amino...... acid sequence and hence the resulting protein. Recently, it has been noticed that the choice of the synonymous codon, via the resulting distribution of slow- and fast-translated codons, affects not only on the average speed of one ribosome translating the mRNA but also might have an effect on nearby...... ribosomes by affecting the appearance of 'traffic jams' where multiple ribosomes collide and form queues. To test this 'context effect' further, we here investigate the effect of the sequence of synonymous codons on the ribosome traffic by using a ribosome traffic model with codon-dependent rates, estimated...

  4. New Partners in Regulation of Gene Expression: The Enhancer of Trithorax and Polycomb Corto Interacts with Methylated Ribosomal Protein L12 Via Its Chromodomain

    Science.gov (United States)

    Coléno-Costes, Anne; Jang, Suk Min; de Vanssay, Augustin; Rougeot, Julien; Bouceba, Tahar; Randsholt, Neel B.; Gibert, Jean-Michel; Le Crom, Stéphane; Mouchel-Vielh, Emmanuèle

    2012-01-01

    Chromodomains are found in many regulators of chromatin structure, and most of them recognize methylated lysines on histones. Here, we investigate the role of the Drosophila melanogaster protein Corto's chromodomain. The Enhancer of Trithorax and Polycomb Corto is involved in both silencing and activation of gene expression. Over-expression of the Corto chromodomain (CortoCD) in transgenic flies shows that it is a chromatin-targeting module, critical for Corto function. Unexpectedly, mass spectrometry analysis reveals that polypeptides pulled down by CortoCD from nuclear extracts correspond to ribosomal proteins. Furthermore, real-time interaction analyses demonstrate that CortoCD binds with high affinity RPL12 tri-methylated on lysine 3. Corto and RPL12 co-localize with active epigenetic marks on polytene chromosomes, suggesting that both are involved in fine-tuning transcription of genes in open chromatin. RNA–seq based transcriptomes of wing imaginal discs over-expressing either CortoCD or RPL12 reveal that both factors deregulate large sets of common genes, which are enriched in heat-response and ribosomal protein genes, suggesting that they could be implicated in dynamic coordination of ribosome biogenesis. Chromatin immunoprecipitation experiments show that Corto and RPL12 bind hsp70 and are similarly recruited on gene body after heat shock. Hence, Corto and RPL12 could be involved together in regulation of gene transcription. We discuss whether pseudo-ribosomal complexes composed of various ribosomal proteins might participate in regulation of gene expression in connection with chromatin regulators. PMID:23071455

  5. Human nucleolus organizers on nonhomologous chromosomes can share the same ribosomal gene variants.

    Science.gov (United States)

    Krystal, M; D'Eustachio, P; Ruddle, F H; Arnheim, N

    1981-01-01

    The distributions of three human ribosomal gene polymorphisms among individual chromosomes containing nucleolus organizers were analyzed by using mouse--human hybrid cells. Different nucleolus organizers can contain the same variant, suggesting the occurrence of genetic exchanges among ribosomal gene clusters on nonhomologous chromosomes. Such exchanges appear to occur less frequently in mice. This difference is discussed in terms of the nucleolar organization and chromosomal location of ribosomal gene clusters in humans and mice. Images PMID:6272316

  6. Initial bridges between two ribosomal subunits are formed within 9.4 milliseconds, as studied by time-resolved cryo-EM.

    Science.gov (United States)

    Shaikh, Tanvir R; Yassin, Aymen S; Lu, Zonghuan; Barnard, David; Meng, Xing; Lu, Toh-Ming; Wagenknecht, Terence; Agrawal, Rajendra K

    2014-07-08

    Association of the two ribosomal subunits during the process of translation initiation is a crucial step of protein synthesis. The two subunits (30S and 50S) of the bacterial 70S ribosome are held together by 12 dynamic bridges involving RNA-RNA, RNA-protein, and protein-protein interactions. The process of bridge formation, such as whether all these bridges are formed simultaneously or in a sequential order, is poorly understood. To understand such processes, we have developed and implemented a class of microfluidic devices that mix two components to completion within 0.4 ms and spray the mixture in the form of microdroplets onto an electron microscopy grid, yielding a minimum reaction time of 9.4 ms before cryofixation. Using these devices, we have obtained cryo-EM data corresponding to reaction times of 9.4 and 43 ms and have determined 3D structures of ribosomal subunit association intermediates. Molecular analyses of the cryo-EM maps reveal that eight intersubunit bridges (bridges B1a, B1b, B2a, B2b, B3, B7a, B7b, and B8) form within 9.4 ms, whereas the remaining four bridges (bridges B2c, B4, B5, and B6) take longer than 43 ms to form, suggesting that bridges are formed in a stepwise fashion. Our approach can be used to characterize sequences of various dynamic functional events on complex macromolecular assemblies such as ribosomes.

  7. Mutations in ribosomal proteins, RPL4 and RACK1, suppress the phenotype of a thermospermine-deficient mutant of Arabidopsis thaliana.

    Directory of Open Access Journals (Sweden)

    Jun-ichi Kakehi

    Full Text Available Thermospermine acts in negative regulation of xylem differentiation and its deficient mutant of Arabidopsis thaliana, acaulis5 (acl5, shows excessive xylem formation and severe dwarfism. Studies of two dominant suppressors of acl5, sac51-d and sac52-d, have revealed that SAC51 and SAC52 encode a transcription factor and a ribosomal protein L10 (RPL10, respectively, and these mutations enhance translation of the SAC51 mRNA, which contains conserved upstream open reading frames in the 5' leader. Here we report identification of SAC53 and SAC56 responsible for additional suppressors of acl5. sac53-d is a semi-dominant allele of the gene encoding a receptor for activated C kinase 1 (RACK1 homolog, a component of the 40S ribosomal subunit. sac56-d represents a semi-dominant allele of the gene for RPL4. We show that the GUS reporter activity driven by the CaMV 35S promoter plus the SAC51 5' leader is reduced in acl5 and restored by sac52-d, sac53-d, and sac56-d as well as thermospermine. Furthermore, the SAC51 mRNA, which may be a target of nonsense-mediated mRNA decay, was found to be stabilized in these ribosomal mutants and by thermospermine. These ribosomal proteins are suggested to act in the control of uORF-mediated translation repression of SAC51, which is derepressed by thermospermine.

  8. 20-Hydroxyecdysone stimulates nuclear accumulation of BmNep1, a nuclear ribosome biogenesis-related protein in the silkworm, Bombyx mori.

    Science.gov (United States)

    Ji, M-M; Liu, A-Q; Sima, Y-H; Xu, S-Q

    2016-10-01

    The pathway of communication between endocrine hormones and ribosome biogenesis critical for physiological adaptation is largely unknown. Nucleolar essential protein 1 (Nep1) is an essential gene for ribosome biogenesis and is functionally conserved in many in vertebrate and invertebrate species. In this study, we cloned Bombyx mori Nep1 (BmNep1) due to its high expression in silk glands of silkworms on day 3 of the fifth instar. We found that BmNep1 mRNA and protein levels were upregulated in silk glands during fourth-instar ecdysis and larval-pupal metamorphosis. By immunoprecipitation with the anti-BmNep1 antibody and liquid chromatography-tandem mass spectrometry analyses, it was shown that BmNep1 probably interacts with proteins related to ribosome structure formation. Immunohistochemistry, biochemical fractionation and immunocytochemistry revealed that BmNep1 is localized to the nuclei in Bombyx cells. Using BmN cells originally derived from ovaries, we demonstrated that 20-hydroxyecdysone (20E) induced BmNep1 expression and stimulated nuclear accumulation of BmNep1. Under physiological conditions, BmNep1 was also upregulated in ovaries during larval-pupal metamorphosis. Overall, our results indicate that the endocrine hormone 20E facilitates nuclear accumulation of BmNep1, which is involved in nuclear ribosome biogenesis in Bombyx. © 2016 The Royal Entomological Society.

  9. 5S ribosomal RNA database Y2K.

    Science.gov (United States)

    Szymanski, M; Barciszewska, M Z; Barciszewski, J; Erdmann, V A

    2000-01-01

    This paper presents the updated version (Y2K) of the database of ribosomal 5S ribonucleic acids (5S rRNA) and their genes (5S rDNA), http://rose.man/poznan.pl/5SData/index.html. This edition of the database contains 1985primary structures of 5S rRNA and 5S rDNA. They include 60 archaebacterial, 470 eubacterial, 63 plastid, nine mitochondrial and 1383 eukaryotic sequences. The nucleotide sequences of the 5S rRNAs or 5S rDNAs are divided according to the taxonomic position of the source organisms.

  10. mRNA decapping enzyme from ribosomes of Saccharomyces cerevisiae

    International Nuclear Information System (INIS)

    Stevens, A.

    1980-01-01

    By use of [ 3 H]methyl-5'-capped [ 14 C]mRNA from yeast as a substrate, a decapping enzyme activity has been detected in enzyme fractions derived from a high salt wash of ribosomes of Saccharomyces cerevisiae. The product of the decapping reaction is [ 3 H]m 7 GDP. That the enzyme is not a non-specific pyrophosphatase is suggested by the finding that the diphosphate product, m 7 GpppA(G), and UDP-glucose are not hydrolyzed

  11. Potential roles for ubiquitin and the proteasome during ribosome biogenesis

    Czech Academy of Sciences Publication Activity Database

    Stavreva, D. A.; Kawasaki, M.; Dundr, M.; Koberna, Karel; Müller, W. G.; Tsujimura-Takahashi, T.; Komatsu, W.; Hayano, T.; Isobe, T.; Raška, Ivan; Misteli, T.; Takahashi, N.; McNally, J. G.

    2006-01-01

    Roč. 26, č. 13 (2006), s. 5131-5145 ISSN 0270-7306 R&D Projects: GA MŠk(CZ) LC535; GA ČR(CZ) GA304/05/0374; GA ČR(CZ) GA304/04/0692 Grant - others:NIH(US) Intramural Research Program; Ministry of Education(JP) Pioneer Research grant Institutional research plan: CEZ:AV0Z50110509 Keywords : the role of the ubikvitin * proteasome system in ribosome biogenesis Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 6.773, year: 2006

  12. γ-irradiated ribosomes from Micrococcus radiodurans in a cell-free protein synthesizing system

    International Nuclear Information System (INIS)

    Suessmuth, R.; Widmann, A.

    1979-01-01

    γ-irradiation inactivation of isolated ribosomes of Micrococcus radiodurans was studied by examining poly U directed synthesis of polyphenylalanine. Ribosomes of M. radiodurans did not show significant γ-radiation sensitivity up to a dose of approx. 11.6 k Gy. Cells of M. radiodurans take up more magnesium than E. coli cells under the same conditions. The magnesium content of ribosomes of M. radiodurans was 18% higher than that of E.coli ribosomes. A possible relation between Mg 2+ -content and γ-resistance is discussed. (orig.) [de

  13. Ribosomes: Ribozymes that Survived Evolution Pressures but Is Paralyzed by Tiny Antibiotics

    Science.gov (United States)

    Yonath, Ada

    An impressive number of crystal structures of ribosomes, the universal cellular machines that translate the genetic code into proteins, emerged during the last decade. The determination of ribosome high resolution structure, which was widely considered formidable, led to novel insights into the ribosomal function, namely, fidelity, catalytic mechanism, and polymerize activities. They also led to suggestions concerning its origin and shed light on the action, selectivity and synergism of ribosomal antibiotics; illuminated mechanisms acquiring bacterial resistance and provided structural information for drug improvement and design. These studies required the pioneering and implementation of advanced technologies, which directly influenced the remarkable increase of the number of structures deposited in the Protein Data Bank.

  14. Expression of ribosomal genes in pea cotyledons at the initial stages of germination

    International Nuclear Information System (INIS)

    Gumilevskaya, N.A.; Chumikhina, L.V.; Akhmatova, A.T.; Kretovich, V.L.

    1986-01-01

    The time of appearance of newly synthesized rRNAs and ribosomal proteins (r-proteins) in the ribosomes of pea cotyledons (Pisum sativum L.) during germination was investigated. The ribosomal fraction was isolated and analyzed according to the method of germination of the embryo in the presence of labeled precursors or after pulse labeling of the embryos at different stages of germination. For the identification of newly synthesized rRNAs in the ribosomes we estimated the relative stability of labeled RNAs to the action of RNase, the sedimentation rate, the ability to be methylated in vivo in the presence of [ 14 C]CH 3 -methionine, and the localization in the subunits of dissociated ribosomes. The presence of newly synthesized r-proteins in the ribosomes was judged on the basis of the electrophoretic similarity in SDS-disc electrophoresis of labeled polypeptides of purified ribosome preparations and of genuine r-proteins, as well as according to the localization of labeled proteins in the subunits of the dissociated ribosomes. It was shown that the expression of the ribosomal genes in highly specialized cells of pea cotyledons that have completed their growth occurs at very early stages of germination

  15. The spatial biology of transcription and translation in rapidly growing Escherichia coli

    Directory of Open Access Journals (Sweden)

    Somenath eBakshi

    2015-07-01

    Full Text Available Single-molecule fluorescence provides high resolution spatial distributions of ribosomes and RNA polymerase (RNAP in live, rapidly growing E. coli. Ribosomes are more strongly segregated from the nucleoids (chromosomal DNA than previous widefield fluorescence studies suggested. While most transcription may be co-translational, the evidence indicates that most translation occurs on free mRNA copies that have diffused from the nucleoids to a ribosome-rich region. Analysis of time-resolved images of the nucleoid spatial distribution after treatment with the transcription-halting drug rifampicin and the translation-halting drug chloramphenicol shows that both drugs cause nucleoid contraction on the 0-3 min timescale. This is consistent with the transertion hypothesis. We suggest that the longer-term (20-30 min nucleoid expansion after Rif treatment arises from conversion of 70S-polysomes to 30S and 50S subunits, which readily penetrate the nucleoids. Monte Carlo simulations of a polymer bead model built to mimic the chromosomal DNA and ribosomes (either 70S-polysomes or 30S and 50S subunits explain spatial segregation or mixing of ribosomes and nucleoids in terms of excluded volume and entropic effects alone. A comprehensive model of the transcription-translation-transertion system incorporates this new information about the spatial organization of the E. coli cytoplasm. We propose that transertion, which radially expands the nucleoids, is essential for recycling of 30S and 50S subunits from ribosome-rich regions back into the nucleoids. There they initiate co-transcriptional translation, which is an important mechanism for maintaining RNAP forward progress and protecting the nascent mRNA chain. Segregation of 70S-polysomes from the nucleoid may facilitate rapid growth by shortening the search time for ribosomes to find free mRNA concentrated outside the nucleoid and the search time for RNAP concentrated within the nucleoid to find transcription

  16. Combined Effect of the Cfr Methyltransferase and Ribosomal Protein L3 Mutations on Resistance to Ribosome-Targeting Antibiotics.

    Science.gov (United States)

    Pakula, Kevin K; Hansen, Lykke H; Vester, Birte

    2017-09-01

    Several groups of antibiotics inhibit bacterial growth by binding to bacterial ribosomes. Mutations in ribosomal protein L3 have been associated with resistance to linezolid and tiamulin, which both bind at the peptidyl transferase center in the ribosome. Resistance to these and other antibiotics also occurs through methylation of 23S rRNA at position A2503 by the methyltransferase Cfr. The mutations in L3 and the cfr gene have been found together in clinical isolates, raising the question of whether they have a combined effect on antibiotic resistance or growth. We transformed a plasmid-borne cfr gene into a uL3-depleted Escherichia coli strain containing either wild-type L3 or L3 with one of seven mutations, G147R, Q148F, N149S, N149D, N149R, Q150L, or T151P, expressed from plasmid-carried rplC genes. The L3 mutations are well tolerated, with small to moderate growth rate decreases. The presence of Cfr has a very minor influence on the growth rate. The resistance of the transformants to linezolid, tiamulin, florfenicol, and Synercid (a combination of quinupristin and dalfopristin [Q-D]) was measured by MIC assays. The resistance from Cfr was, in all cases, stronger than the effects of the L3 mutations, but various effects were obtained with the combinations of Cfr and L3 mutations ranging from a synergistic to an antagonistic effect. Linezolid and tiamulin susceptibility varied greatly among the L3 mutations, while no significant effects on florfenicol and Q-D susceptibility were seen. This study underscores the complex interplay between various resistance mechanisms and cross-resistance, even from antibiotics with overlapping binding sites. Copyright © 2017 American Society for Microbiology.

  17. Ribosome-Inactivating Proteins from Plants: A Historical Overview

    Directory of Open Access Journals (Sweden)

    Andrea Bolognesi

    2016-11-01

    Full Text Available This review provides a historical overview of the research on plant ribosome-inactivating proteins (RIPs, starting from the first studies at the end of eighteenth century involving the purification of abrin and ricin, as well as the immunological experiments of Paul Erlich. Interest in these plant toxins was revived in 1970 by the observation of their anticancer activity, which has given rise to a large amount of research contributing to the development of various scientific fields. Biochemistry analyses succeeded in identifying the enzymatic activity of RIPs and allowed for a better understanding of the ribosomal machinery. Studies on RIP/cell interactions were able to detail the endocytosis and intracellular routing of ricin, thus increasing our knowledge of how cells handle exogenous proteins. The identification of new RIPs and the finding that most RIPs are single-chain polypeptides, together with their genetic sequencing, has aided in the development of new phylogenetic theories. Overall, the biological properties of these proteins, including their abortifacient, anticancer, antiviral and neurotoxic activities, suggest that RIPs could be utilized in agriculture and in many biomedical fields, including clinical drug development.

  18. Analysis of ribosomal protein gene structures: implications for intron evolution.

    Directory of Open Access Journals (Sweden)

    2006-03-01

    Full Text Available Many spliceosomal introns exist in the eukaryotic nuclear genome. Despite much research, the evolution of spliceosomal introns remains poorly understood. In this paper, we tried to gain insights into intron evolution from a novel perspective by comparing the gene structures of cytoplasmic ribosomal proteins (CRPs and mitochondrial ribosomal proteins (MRPs, which are held to be of archaeal and bacterial origin, respectively. We analyzed 25 homologous pairs of CRP and MRP genes that together had a total of 527 intron positions. We found that all 12 of the intron positions shared by CRP and MRP genes resulted from parallel intron gains and none could be considered to be "conserved," i.e., descendants of the same ancestor. This was supported further by the high frequency of proto-splice sites at these shared positions; proto-splice sites are proposed to be sites for intron insertion. Although we could not definitively disprove that spliceosomal introns were already present in the last universal common ancestor, our results lend more support to the idea that introns were gained late. At least, our results show that MRP genes were intronless at the time of endosymbiosis. The parallel intron gains between CRP and MRP genes accounted for 2.3% of total intron positions, which should provide a reliable estimate for future inferences of intron evolution.

  19. Interaction of Pleuromutilin Derivatives with the Ribosomal Peptidyl Transferase Center

    Science.gov (United States)

    Long, Katherine S.; Hansen, Lykke H.; Jakobsen, Lene; Vester, Birte

    2006-01-01

    Tiamulin is a pleuromutilin antibiotic that is used in veterinary medicine. The recently published crystal structure of a tiamulin-50S ribosomal subunit complex provides detailed information about how this drug targets the peptidyl transferase center of the ribosome. To promote rational design of pleuromutilin-based drugs, the binding of the antibiotic pleuromutilin and three semisynthetic derivatives with different side chain extensions has been investigated using chemical footprinting. The nucleotides A2058, A2059, G2505, and U2506 are affected in all of the footprints, suggesting that the drugs are similarly anchored in the binding pocket by the common tricyclic mutilin core. However, varying effects are observed at U2584 and U2585, indicating that the side chain extensions adopt distinct conformations within the cavity and thereby affect the rRNA conformation differently. An Escherichia coli L3 mutant strain is resistant to tiamulin and pleuromutilin, but not valnemulin, implying that valnemulin is better able to withstand an altered rRNA binding surface around the mutilin core. This is likely due to additional interactions made between the valnemulin side chain extension and the rRNA binding site. The data suggest that pleuromutilin drugs with enhanced antimicrobial activity may be obtained by maximizing the number of interactions between the side chain moiety and the peptidyl transferase cavity. PMID:16569865

  20. Genetic diversity of Entamoeba: Novel ribosomal lineages from cockroaches.

    Directory of Open Access Journals (Sweden)

    Tetsuro Kawano

    Full Text Available Our current taxonomic perspective on Entamoeba is largely based on small-subunit ribosomal RNA genes (SSU rDNA from Entamoeba species identified in vertebrate hosts with minor exceptions such as E. moshkovskii from sewage water and E. marina from marine sediment. Other Entamoeba species have also been morphologically identified and described from non-vertebrate species such as insects; however, their genetic diversity remains unknown. In order to further disclose the diversity of the genus, we investigated Entamoeba spp. in the intestines of three cockroach species: Periplaneta americana, Blaptica dubia, and Gromphadorhina oblongonota. We obtained 134 Entamoeba SSU rDNA sequences from 186 cockroaches by direct nested PCR using the DNA extracts of intestines from cockroaches, followed by scrutinized BLASTn screening and phylogenetic analyses. All the sequences identified in this study were distinct from those reported from known Entamoeba species, and considered as novel Entamoeba ribosomal lineages. Furthermore, they were positioned at the base of the clade of known Entamoeba species and displayed remarkable degree of genetic diversity comprising nine major groups in the three cockroach species. This is the first report of the diversity of SSU rDNA sequences from Entamoeba in non-vertebrate host species, and should help to understand the genetic diversity of the genus Entamoeba.

  1. The N-terminal sequence of ribosomal protein L10 from the archaebacterium Halobacterium marismortui and its relationship to eubacterial protein L6 and other ribosomal proteins.

    Science.gov (United States)

    Dijk, J; van den Broek, R; Nasiulas, G; Beck, A; Reinhardt, R; Wittmann-Liebold, B

    1987-08-01

    The amino-terminal sequence of ribosomal protein L10 from Halobacterium marismortui has been determined up to residue 54, using both a liquid- and a gas-phase sequenator. The two sequences are in good agreement. The protein is clearly homologous to protein HcuL10 from the related strain Halobacterium cutirubrum. Furthermore, a weaker but distinct homology to ribosomal protein L6 from Escherichia coli and Bacillus stearothermophilus can be detected. In addition to 7 identical amino acids in the first 36 residues in all four sequences a number of conservative replacements occurs, of mainly hydrophobic amino acids. In this common region the pattern of conserved amino acids suggests the presence of a beta-alpha fold as it occurs in ribosomal proteins L12 and L30. Furthermore, several potential cases of homology to other ribosomal components of the three ur-kingdoms have been found.

  2. A Listeria monocytogenes RNA helicase essential for growth and ribosomal maturation at low temperatures uses its C terminus for appropriate interaction with the ribosome.

    Science.gov (United States)

    Netterling, Sakura; Vaitkevicius, Karolis; Nord, Stefan; Johansson, Jörgen

    2012-08-01

    Listeria monocytogenes, a Gram-positive food-borne human pathogen, is able to grow at temperatures close to 0°C and is thus of great concern for the food industry. In this work, we investigated the physiological role of one DExD-box RNA helicase in Listeria monocytogenes. The RNA helicase Lmo1722 was required for optimal growth at low temperatures, whereas it was dispensable at 37°C. A Δlmo1722 strain was less motile due to downregulation of the major subunit of the flagellum, FlaA, caused by decreased flaA expression. By ribosomal fractionation experiments, it was observed that Lmo1722 was mainly associated with the 50S subunit of the ribosome. Absence of Lmo1722 decreased the fraction of 50S ribosomal subunits and mature 70S ribosomes and affected the processing of the 23S precursor rRNA. The ribosomal profile could be restored to wild-type levels in a Δlmo1722 strain expressing Lmo1722. Interestingly, the C-terminal part of Lmo1722 was redundant for low-temperature growth, motility, 23S rRNA processing, and appropriate ribosomal maturation. However, Lmo1722 lacking the C terminus showed a reduced affinity for the 50S and 70S fractions, suggesting that the C terminus is important for proper guidance of Lmo1722 to the 50S subunit. Taken together, our results show that the Listeria RNA helicase Lmo1722 is essential for growth at low temperatures, motility, and rRNA processing and is important for ribosomal maturation, being associated mainly with the 50S subunit of the ribosome.

  3. The activity of the acidic phosphoproteins from the 80 S rat liver ribosome.

    Science.gov (United States)

    MacConnell, W P; Kaplan, N O

    1982-05-25

    The selective removal of acidic phosphoproteins from the 80 S rat liver ribosome was accomplished by successive alcohol extractions at low salt concentration. The resulting core ribosomes lost over 90% of their translation activity and were unable to support the elongation factor 2 GTPase reaction. Both activities were partially restored when the dialyzed extracts were added back to the core ribosome. The binding of labeled adenosine diphosphoribosyl-elongation factor 2 to ribosomes was also affected by extraction and could be reconstituted, although not to the same extent as the GTPase activity associated with elongation factor 2 in the presence of the ribosome. The alcohol extracts of the 80 S ribosome contained mostly phosphoproteins P1 and P2 which could be dephosphorylated and rephosphorylated in solution by alkaline phosphatase and protein kinase, respectively. Dephosphorylation of the P1/P2 mixture in the extracts caused a decrease in the ability of these proteins to reactivate the polyphenylalanine synthesis activity of the core ribosome. However, treatment of the dephosphorylated proteins with the catalytic subunit of 3':5'-cAMP-dependent protein kinase in the presence of ATP reactivated the proteins when compared to the activity of the native extracts. Rabbit antisera raised against the alcohol-extracted proteins were capable of impairing both the polyphenylalanine synthesis reaction and the elongation factor 2-dependent GTPase reaction in the intact ribosomes.

  4. The Ribosomal RNA is a Useful Marker to Visualize Rhizobia Interacting with Legume Plants

    Science.gov (United States)

    Rinaudi, Luciana; Isola, Maria C.; Giordano, Walter

    2004-01-01

    Symbiosis between rhizobia and leguminous plants leads to the formation of nitrogen-fixing root nodules. In the present article, we recommend the use of the ribosomal RNA (rRNA) isolated from legume nodules in an experimental class with the purpose of introducing students to the structure of eukaryotic and prokaryotic ribosomes and of…

  5. Control of ribosome traffic by position-dependent choice of synonymous codons

    International Nuclear Information System (INIS)

    Mitarai, Namiko; Pedersen, Steen

    2013-01-01

    Messenger RNA (mRNA) encodes a sequence of amino acids by using codons. For most amino acids, there are multiple synonymous codons that can encode the amino acid. The translation speed can vary from one codon to another, thus there is room for changing the ribosome speed while keeping the amino acid sequence and hence the resulting protein. Recently, it has been noticed that the choice of the synonymous codon, via the resulting distribution of slow- and fast-translated codons, affects not only on the average speed of one ribosome translating the mRNA but also might have an effect on nearby ribosomes by affecting the appearance of ‘traffic jams’ where multiple ribosomes collide and form queues. To test this ‘context effect’ further, we here investigate the effect of the sequence of synonymous codons on the ribosome traffic by using a ribosome traffic model with codon-dependent rates, estimated from experiments. We compare the ribosome traffic on wild-type (WT) sequences and sequences where the synonymous codons were swapped randomly. By simulating translation of 87 genes, we demonstrate that the WT sequences, especially those with a high bias in codon usage, tend to have the ability to reduce ribosome collisions, hence optimizing the cellular investment in the translation apparatus. The magnitude of such reduction of the translation time might have a significant impact on the cellular growth rate and thereby have importance for the survival of the species. (paper)

  6. Plastid ribosome pausing is induced by multiple features and is linked to protein complex assembly

    DEFF Research Database (Denmark)

    Gawroński, Piotr; Jensen, Poul Erik; Karpinski, Stanislaw

    2018-01-01

    Many mRNAs contain pause sites that briefly interrupt the progress of translation. Specific features that induce ribosome pausing have been described; however, their individual contributions to pause-site formation, and the overall biological significance of ribosome pausing, remain largely uncle...

  7. Potential Natural Products for Alzheimer’s Disease: Targeted Search Using the Internal Ribosome Entry Site of Tau and Amyloid-β Precursor Protein

    Directory of Open Access Journals (Sweden)

    Yun-Chieh Tasi

    2015-04-01

    Full Text Available Overexpression of the amyloid precursor protein (APP and the hyperphosphorylation of the tau protein are vital in the understanding of the cause of Alzheimer’s disease (AD. As a consequence, regulation of the expression of both APP and tau proteins is one important approach in combating AD. The APP and tau proteins can be targeted at the levels of transcription, translation and protein structural integrity. This paper reports the utilization of a bi-cistronic vector containing either APP or tau internal ribosome entry site (IRES elements flanked by β-galactosidase gene (cap-dependent and secreted alkaline phosphatase (SEAP (cap-independent to discern the mechanism of action of memantine, an N-methyl-d-aspartate (NMDA receptor antagonist. Results indicate that memantine could reduce the activity of both the APP and tau IRES at a concentration of ~10 μM (monitored by SEAP activity without interfering with the cap-dependent translation as monitored by the β-galactosidase assay. Western blot analysis of the tau protein in neuroblastoma (N2A and rat hippocampal cells confirmed the halting of the expression of the tau proteins. We also employed this approach to identify a preparation named NB34, extracts of Boussingaultia baselloides (madeira-vine fermented with Lactobacillus spp., which can function similarly to memantine in both IRES of APP and Tau. The water maze test demonstrated that NB34 could improve the spatial memory of a high fat diet induced neurodegeneration in apolipoprotein E-knockout (ApoE−/− mice. These results revealed that the bi-cistronic vector provided a simple, and effective platform in screening and establishing the mechanistic action of potential compounds for the treatment and management of AD.

  8. Restless 5S: the re-arrangement(s) and evolution of the nuclear ribosomal DNA in land plants.

    Science.gov (United States)

    Wicke, Susann; Costa, Andrea; Muñoz, Jesùs; Quandt, Dietmar

    2011-11-01

    Among eukaryotes two types of nuclear ribosomal DNA (nrDNA) organization have been observed. Either all components, i.e. the small ribosomal subunit, 5.8S, large ribosomal subunit, and 5S occur tandemly arranged or the 5S rDNA forms a separate cluster of its own. Generalizations based on data derived from just a few model organisms have led to a superimposition of structural and evolutionary traits to the entire plant kingdom asserting that plants generally possess separate arrays. This study reveals that plant nrDNA organization into separate arrays is not a distinctive feature, but rather assignable almost solely to seed plants. We show that early diverging land plants and presumably streptophyte algae share a co-localization of all rRNA genes within one repeat unit. This raises the possibility that the state of rDNA gene co-localization had occurred in their common ancestor. Separate rDNA arrays were identified for all basal seed plants and water ferns, implying at least two independent 5S rDNA transposition events during land plant evolution. Screening for 5S derived Cassandra transposable elements which might have played a role during the transposition events, indicated that this retrotransposon is absent in early diverging vascular plants including early fern lineages. Thus, Cassandra can be rejected as a primary mechanism for 5S rDNA transposition in water ferns. However, the evolution of Cassandra and other eukaryotic 5S derived elements might have been a side effect of the 5S rDNA cluster formation. Structural analysis of the intergenic spacers of the ribosomal clusters revealed that transposition events partially affect spacer regions and suggests a slightly different transcription regulation of 5S rDNA in early land plants. 5S rDNA upstream regulatory elements are highly divergent or absent from the LSU-5S spacers of most early divergent land plant lineages. Several putative scenarios and mechanisms involved in the concerted relocation of hundreds of 5S

  9. Phosphorylation of ribosomal proteins induced by auxins in maize embryonic tissues

    International Nuclear Information System (INIS)

    Perez, L.; Aguilar, R.; Mendez, A.P.; de Jimenez, E.S.

    1990-01-01

    The effect of auxin on ribosomal protein phosphorylation of germinating maize (Zea mays) tissues was investigated. Two-dimensional gel electrophoresis and autoradiography of [ 32 P] ribosomal protein patterns for natural and synthetic auxin-treated tissues were performed. Both the rate of 32 P incorporation and the electrophoretic patterns were dependent on 32 P pulse length, suggesting that active protein phosphorylation-dephosphorylation occurred in small and large subunit proteins, in control as well as in auxin-treated tissues. The effect of ribosomal protein phosphorylation on in vitro translation was tested. Measurements of poly(U) translation rates as a function of ribosome concentration provided apparent K m values significantly different for auxin-treated and nontreated tissues. These findings suggest that auxin might exert some kind of translational control by regulating the phosphorylated status of ribosomal proteins

  10. rRNA:mRNA pairing alters the length and the symmetry of mRNA-protected fragments in ribosome profiling experiments

    OpenAIRE

    O?Connor, Patrick B. F.; Li, Gene-Wei; Weissman, Jonathan S.; Atkins, John F.; Baranov, Pavel V.

    2013-01-01

    Motivation: Ribosome profiling is a new technique that allows monitoring locations of translating ribosomes on mRNA at a whole transcriptome level. A recent ribosome profiling study demonstrated that internal Shine?Dalgarno (SD) sequences have a major global effect on translation rates in bacteria: ribosomes pause at SD sites in mRNA. Therefore, it is important to understand how SD sites effect mRNA movement through the ribosome and generation of ribosome footprints. Results: Here, we provide...

  11. Replication and meiotic transmission of yeast ribosomal RNA genes.

    Science.gov (United States)

    Brewer, B J; Zakian, V A; Fangman, W L

    1980-11-01

    The yeast Saccharomyces cerevisiae has approximately 120 genes for the ribosomal RNAs (rDNA) which are organized in tandem within chromosomal DNA. These multiple-copy genes are homogeneous in sequence but can undergo changes in copy number and topology. To determine if these changes reflect unusual features of rDNA metabolism, we have examined both the replication of rDNA in the mitotic cell cycle and the inheritance of rDNA during meiosis. The results indicate that rDNA behaves identically to chromosomal DNA: each rDNA unit is replicated once during the S phase of each cell cycle and each unit is conserved through meiosis. Therefore, the flexibility in copy number and topology of rDNA does not arise from the selective replication of units in each S phase nor by the selective inheritance of units in meiosis.

  12. Globular conformation of some ribosomal proteins in solution

    International Nuclear Information System (INIS)

    Serdyuk, I.N.; Spirin, A.S.

    1978-01-01

    The possibility that such RNA-binding proteins of the 30 S subparticle as S4, S7, S8 and S16 exist in the form of compact globules in solution has been explored experimentally. These proteins have been studied in D 2 O solution by neutron scattering to measure their radii of gyration. This type of radiation using D 2 O as a solvent provides the maximum 'contrast', that is the maximum difference between the scattering of the protein and the solvent. It allowed measurements to be made using protein at <= 1.5 mg/ml. The radii of gyration for the ribosomal proteins S4, S7, S8 and S16 were found to be relatively small corresponding to the radii of gyration of compact globular proteins of the same molecular weights. (Auth.)

  13. Heavy ion effects on yeast: Inhibition of ribosomal RNA synthesis

    International Nuclear Information System (INIS)

    Weber, K.J.; Schneider, E.; Kiefer, J.; Kraft, G.

    1990-01-01

    Diploid wild-type yeast cells were exposed to beams of heavy ions covering a wide range of linear energy transfer (LET) (43-13,700 keV/microns). Synthesis of ribosomal RNA (rRNA) was assessed as a functional measure of damage produced by particle radiation. An exponential decrease of relative rRNA synthesis with particle fluence was demonstrated in all cases. The inactivation cross sections derived were found to increase with LET over the entire range of LET studied. The corresponding values for relative biological effectiveness were slightly less than unity. Maximum cross sections measured were close to 1 micron 2, implying that some larger structure within the yeast nucleus (e.g., the nucleolus) might represent the target for an impairment of synthetic activity by very heavy ions rather than the genes coding for rRNA. Where tested, an oxygen effect for rRNA synthesis could not be demonstrated

  14. Expanding the Entamoeba Universe: New Hosts Yield Novel Ribosomal Lineages.

    Science.gov (United States)

    Jacob, Alison S; Busby, Eloise J; Levy, Abigail D; Komm, Natasha; Clark, C Graham

    2016-01-01

    Removing the requirement for cell culture has led to a substantial increase in the number of lineages of Entamoeba recognized as distinct. Surveying the range of potential host species for this parasite genus has barely been started and it is clear that additional sampling of the same host in different locations often identifies additional diversity. In this study, using small subunit ribosomal RNA gene sequencing, we identify four new lineages of Entamoeba, including the first report of Entamoeba from an elephant, and extend the host range of some previously described lineages. In addition, examination of microbiome data from a number of host animals suggests that substantial Entamoeba diversity remains to be uncovered. © 2015 The Author(s) Journal of Eukaryotic Microbiology © 2015 International Society of Protistologists.

  15. Cross-species functionality of pararetroviral elements driving ribosome shunting.

    Directory of Open Access Journals (Sweden)

    Mikhail M Pooggin

    Full Text Available BACKGROUND: Cauliflower mosaic virus (CaMV and Rice tungro bacilliform virus (RTBV belong to distinct genera of pararetroviruses infecting dicot and monocot plants, respectively. In both viruses, polycistronic translation of pregenomic (pg RNA is initiated by shunting ribosomes that bypass a large region of the pgRNA leader with several short (sORFs and a stable stem-loop structure. The shunt requires translation of a 5'-proximal sORF terminating near the stem. In CaMV, mutations knocking out this sORF nearly abolish shunting and virus viability. METHODOLOGY/PRINCIPAL FINDINGS: Here we show that two distant regions of the CaMV leader that form a minimal shunt configuration comprising the sORF, a bottom part of the stem, and a shunt landing sequence can be replaced by heterologous sequences that form a structurally similar configuration in RTBV without any dramatic effect on shunt-mediated translation and CaMV infectivity. The CaMV-RTBV chimeric leader sequence was largely stable over five viral passages in turnip plants: a few alterations that did eventually occur in the virus progenies are indicative of fine tuning of the chimeric sequence during adaptation to a new host. CONCLUSIONS/SIGNIFICANCE: Our findings demonstrate cross-species functionality of pararetroviral cis-elements driving ribosome shunting and evolutionary conservation of the shunt mechanism. We are grateful to Matthias Müller and Sandra Pauli for technical assistance. This work was initiated at Friedrich Miescher Institute (Basel, Switzerland. We thank Prof. Thomas Boller for hosting the group at the Institute of Botany.

  16. Ribosomal protein gene knockdown causes developmental defects in zebrafish.

    Directory of Open Access Journals (Sweden)

    Tamayo Uechi

    Full Text Available The ribosomal proteins (RPs form the majority of cellular proteins and are mandatory for cellular growth. RP genes have been linked, either directly or indirectly, to various diseases in humans. Mutations in RP genes are also associated with tissue-specific phenotypes, suggesting a possible role in organ development during early embryogenesis. However, it is not yet known how mutations in a particular RP gene result in specific cellular changes, or how RP genes might contribute to human diseases. The development of animal models with defects in RP genes will be essential for studying these questions. In this study, we knocked down 21 RP genes in zebrafish by using morpholino antisense oligos to inhibit their translation. Of these 21, knockdown of 19 RPs resulted in the development of morphants with obvious deformities. Although mutations in RP genes, like other housekeeping genes, would be expected to result in nonspecific developmental defects with widespread phenotypes, we found that knockdown of some RP genes resulted in phenotypes specific to each gene, with varying degrees of abnormality in the brain, body trunk, eyes, and ears at about 25 hours post fertilization. We focused further on the organogenesis of the brain. Each knocked-down gene that affected the morphogenesis of the brain produced a different pattern of abnormality. Among the 7 RP genes whose knockdown produced severe brain phenotypes, 3 human orthologs are located within chromosomal regions that have been linked to brain-associated diseases, suggesting a possible involvement of RP genes in brain or neurological diseases. The RP gene knockdown system developed in this study could be a powerful tool for studying the roles of ribosomes in human diseases.

  17. Genetic variability of Echinococcus granulosus based on the mitochondrial 16S ribosomal RNA gene.

    Science.gov (United States)

    Wang, Ning; Wang, Jiahai; Hu, Dandan; Zhong, Xiuqin; Jiang, Zhongrong; Yang, Aiguo; Deng, Shijin; Guo, Li; Tsering, Dawa; Wang, Shuxian; Gu, Xiaobin; Peng, Xuerong; Yang, Guangyou

    2015-06-01

    Echinococcus granulosus is the etiological agent of cystic echinococcosis, a major zoonotic disease of both humans and animals. In this study, we assessed genetic variability and genetic structure of E. granulosus in the Tibet plateau, using the complete mitochondrial 16 S ribosomal RNA gene for the first time. We collected and sequenced 62 isolates of E. granulosus from 3 populations in the Tibet plateau. A BLAST analysis indicated that 61 isolates belonged to E. granulosus sensu stricto (genotypes G1-G3), while one isolate belonged to E. canadensis (genotype G6). We detected 16 haplotypes with a haplotype network revealing a star-like expansion, with the most common haplotype occupying the center of the network. Haplotype diversity and nucleotide diversity were low, while negative values were observed for Tajima's D and Fu's Fs. AMOVA results and Fst values revealed that the three geographic populations were not genetically differentiated. Our results suggest that a population bottleneck or population expansion has occurred in the past, and that this explains the low genetic variability of E. granulosus in the Tibet Plateau.

  18. Structure of the Human Mitochondrial Ribosome Studied In Situ by Cryoelectron Tomography.

    Science.gov (United States)

    Englmeier, Robert; Pfeffer, Stefan; Förster, Friedrich

    2017-10-03

    Mitochondria maintain their own genome and its corresponding protein synthesis machine, the mitochondrial ribosome (mitoribosome). Mitoribosomes primarily synthesize highly hydrophobic proteins of the inner mitochondrial membrane. Recent studies revealed the complete structure of the isolated mammalian mitoribosome, but its mode of membrane association remained hypothetical. In this study, we used cryoelectron tomography to visualize human mitoribosomes in isolated mitochondria. The subtomogram average of the membrane-associated human mitoribosome reveals a single major contact site with the inner membrane, mediated by the mitochondria-specific protein mL45. A second rRNA-mediated contact site that is present in yeast is absent in humans, resulting in a more variable association of the human mitoribosome with the inner membrane. Despite extensive structural differences of mammalian and fungal mitoribosomal structure, the principal organization of peptide exit tunnel and the mL45 homolog remains invariant, presumably to align the mitoribosome with the membrane-embedded insertion machinery. Copyright © 2017 Elsevier Ltd. All rights reserved.

  19. Genetic interactions of MAF1 identify a role for Med20 in transcriptional repression of ribosomal protein genes.

    Directory of Open Access Journals (Sweden)

    Ian M Willis

    2008-07-01

    Full Text Available Transcriptional repression of ribosomal components and tRNAs is coordinately regulated in response to a wide variety of environmental stresses. Part of this response involves the convergence of different nutritional and stress signaling pathways on Maf1, a protein that is essential for repressing transcription by RNA polymerase (pol III in Saccharomyces cerevisiae. Here we identify the functions buffering yeast cells that are unable to down-regulate transcription by RNA pol III. MAF1 genetic interactions identified in screens of non-essential gene-deletions and conditionally expressed essential genes reveal a highly interconnected network of 64 genes involved in ribosome biogenesis, RNA pol II transcription, tRNA modification, ubiquitin-dependent proteolysis and other processes. A survey of non-essential MAF1 synthetic sick/lethal (SSL genes identified six gene-deletions that are defective in transcriptional repression of ribosomal protein (RP genes following rapamycin treatment. This subset of MAF1 SSL genes included MED20 which encodes a head module subunit of the RNA pol II Mediator complex. Genetic interactions between MAF1 and subunits in each structural module of Mediator were investigated to examine the functional relationship between these transcriptional regulators. Gene expression profiling identified a prominent and highly selective role for Med20 in the repression of RP gene transcription under multiple conditions. In addition, attenuated repression of RP genes by rapamycin was observed in a strain deleted for the Mediator tail module subunit Med16. The data suggest that Mediator and Maf1 function in parallel pathways to negatively regulate RP mRNA and tRNA synthesis.

  20. Translation initiation in bacterial polysomes through ribosome loading on a standby site on a highly translated mRNA

    Science.gov (United States)

    Andreeva, Irena

    2018-01-01

    During translation, consecutive ribosomes load on an mRNA and form a polysome. The first ribosome binds to a single-stranded mRNA region and moves toward the start codon, unwinding potential mRNA structures on the way. In contrast, the following ribosomes can dock at the start codon only when the first ribosome has vacated the initiation site. Here we show that loading of the second ribosome on a natural 38-nt-long 5′ untranslated region of lpp mRNA, which codes for the outer membrane lipoprotein from Escherichia coli, takes place before the leading ribosome has moved away from the start codon. The rapid formation of this standby complex depends on the presence of ribosomal proteins S1/S2 in the leading ribosome. The early recruitment of the second ribosome to the standby site before translation by the leading ribosome and the tight coupling between translation elongation by the first ribosome and the accommodation of the second ribosome can contribute to high translational efficiency of the lpp mRNA. PMID:29632209

  1. Insights into the Inhibition of the p90 Ribosomal S6 Kinase (RSK) by the Flavonol Glycoside SL0101 from the 1.5 Å Crystal Structure of the N-Terminal Domain of RSK2 with Bound Inhibitor

    Energy Technology Data Exchange (ETDEWEB)

    Utepbergenov, Darkhan; Derewenda, Urszula; Olekhnovich, Natalya; Szukalska, Gabriela; Banerjee, Budhaditya; Hilinski, Michael K.; Lannigan, Deborah A.; Stukenberg, P. Todd; Derewenda, Zygmunt S. (Lodz - Poland); (UV)

    2012-09-11

    The p90 ribosomal S6 family of kinases (RSK) are potential drug targets, due to their involvement in cancer and other pathologies. There are currently only two known selective inhibitors of RSK, but the basis for selectivity is not known. One of these inhibitors is a naturally occurring kaempferol-a-l-diacetylrhamnoside, SL0101. Here, we report the crystal structure of the complex of the N-terminal kinase domain of the RSK2 isoform with SL0101 at 1.5 {angstrom} resolution. The refined atomic model reveals unprecedented structural reorganization of the protein moiety, as compared to the nucleotide-bound form. The entire N-lobe, the hinge region, and the aD-helix undergo dramatic conformational changes resulting in a rearrangement of the nucleotide binding site with concomitant formation of a highly hydrophobic pocket spatially suited to accommodate SL0101. These unexpected results will be invaluable in further optimization of the SL0101 scaffold as a promising lead for a novel class of kinase inhibitors.

  2. Studies of the effects of ultraviolet radiation on the structural integrities of ribosomal RNA components of the Escherichia coli 50S ribosomal subunit

    International Nuclear Information System (INIS)

    Gorelic, L.; Parker, D.

    1978-01-01

    The effects of 254-nm radiation on the structural integrities of free and 50S ribosome-bound 5S and 23S ribosomal ribonucleic acids (rRNA) have been elucidated. Irradiation of aqueous solutions of Escherichia coli 50S ribosomes with 253.7-nm radiation results in the formation of single-strand breaks in double-stranded regions of the 23S rRNA component, but not in rRNA chain scission, and destabilization of the secondary structure of the 23S rRNA toward denaturation. The minimum doses of 253.7-nm radiation required for the first detection of the two effects are 7 x 10 19 quanta for the production of single-strand breaks in double-stranded regions of the 23S rRNA, and 19 quanta for destabilization of the 23S rRNA secondary structure. Free 23S rRNA is resistant toward photoinduced chain breakage at doses of 253.7-nm radiation up to at least 2.3 x 10 20 and is much less sensitive toward destabilization of secondary structure than ribosome-bound 23S rRNA. In contrast to the photosensitivity of 50S ribosome-bound 23S rRNA toward chain breakage, 50S ribosome-bound 5S rRNA is resistant toward chain breakage at doses of 253.7-nm radiation up to at least 2.3 x 10 20 quanta. Ribosome-bound 5S and 23S rRNA are also not photosensitive toward intermolecular 5S/23S rRNA cross-linkage

  3. The primary structure of rat liver ribosomal protein L37. Homology with yeast and bacterial ribosomal proteins.

    Science.gov (United States)

    Lin, A; McNally, J; Wool, I G

    1983-09-10

    The covalent structure of the rat liver 60 S ribosomal subunit protein L37 was determined. Twenty-four tryptic peptides were purified and the sequence of each was established; they accounted for all 111 residues of L37. The sequence of the first 30 residues of L37, obtained previously by automated Edman degradation of the intact protein, provided the alignment of the first 9 tryptic peptides. Three peptides (CN1, CN2, and CN3) were produced by cleavage of protein L37 with cyanogen bromide. The sequence of CN1 (65 residues) was established from the sequence of secondary peptides resulting from cleavage with trypsin and chymotrypsin. The sequence of CN1 in turn served to order tryptic peptides 1 through 14. The sequence of CN2 (15 residues) was determined entirely by a micromanual procedure and allowed the alignment of tryptic peptides 14 through 18. The sequence of the NH2-terminal 28 amino acids of CN3 (31 residues) was determined; in addition the complete sequences of the secondary tryptic and chymotryptic peptides were done. The sequence of CN3 provided the order of tryptic peptides 18 through 24. Thus the sequence of the three cyanogen bromide peptides also accounted for the 111 residues of protein L37. The carboxyl-terminal amino acids were identified after carboxypeptidase A treatment. There is a disulfide bridge between half-cystinyl residues at positions 40 and 69. Rat liver ribosomal protein L37 is homologous with yeast YP55 and with Escherichia coli L34. Moreover, there is a segment of 17 residues in rat L37 that occurs, albeit with modifications, in yeast YP55 and in E. coli S4, L20, and L34.

  4. Ribosomal studies on the 70S ribosome of E.coli by means of neutron scattering; Strukturuntersuchungen am 70S-Ribosom von E.coli unter Anwendung von Neutronenstreuung

    Energy Technology Data Exchange (ETDEWEB)

    Burkhardt, N. [GKSS-Forschungszentrum Geesthacht GmbH (Germany). Inst. fuer Werkstofforschung

    1997-12-31

    Ribosomes are ribonucleo-protein complexes, which catalyse proteinbiosynthesis in all living organisms. Currently, most of the structural models of the prokaryotic 70S ribosome rely on electron microscopy and describe mainly the outer shape of the particle. Neutron scattering can provide information on the internal structure of the ribosome. Parts of the structure can be contrasted for neutrons by means of an isotopic exchange of the naturally occurring hydrogen ({sup 1}H) for deuterium ({sup 2}H), allowing direct measurements in situ. Specifically deuterium-labeled ribosomes (E. coli) were prepared and analysed with neutron scattering. The biochemical methods were established and combined to a generally applicable preparation system. This allows labeling of all ribosomal components in any combination. A systematic analysis of the protein and RNA phases resulted in the development of a new model for the 70S ribosome. This model describes not only the outer shape of the particle, but displays also an experimentally determined internal protein-RNA distribution and the border of subunits for the first time (four-phase model; resolution: 50A). Models of the 70S ribosome from other studies were evaluated and ranked according to consistency with the measured scattering data. Applying a new neutron scattering technique of particular sensitivity, the proton-spin contrast-variation, single proteins could be measured and localized. The positions of the proteins S6 and S10 were determined, providing the first coordinates of protein mass centers within the 70S ribosome. (orig.) [Deutsch] Ribosomen sind Ribonukleinsaeure-Protein Komplexe, die in allen lebenden Organismen die Proteinbiosynthese katalysieren. Strukturmodelle fuer das prokaryontische 70S-Ribosom beruhen derzeit vorwiegend auf elektronenmikroskopischen Untersuchungen und beschreiben im wesentlichen die aeussere Oberflaeche des Partikels. Informationen ueber die innere Struktur des Ribosoms koennen Messungen mit

  5. Ribosomal studies on the 70S ribosome of E.coli by means of neutron scattering; Strukturuntersuchungen am 70S-Ribosom von E.coli unter Anwendung von Neutronenstreuung

    Energy Technology Data Exchange (ETDEWEB)

    Burkhardt, N [GKSS-Forschungszentrum Geesthacht GmbH (Germany). Inst. fuer Werkstofforschung

    1998-12-31

    Ribosomes are ribonucleo-protein complexes, which catalyse proteinbiosynthesis in all living organisms. Currently, most of the structural models of the prokaryotic 70S ribosome rely on electron microscopy and describe mainly the outer shape of the particle. Neutron scattering can provide information on the internal structure of the ribosome. Parts of the structure can be contrasted for neutrons by means of an isotopic exchange of the naturally occurring hydrogen ({sup 1}H) for deuterium ({sup 2}H), allowing direct measurements in situ. Specifically deuterium-labeled ribosomes (E. coli) were prepared and analysed with neutron scattering. The biochemical methods were established and combined to a generally applicable preparation system. This allows labeling of all ribosomal components in any combination. A systematic analysis of the protein and RNA phases resulted in the development of a new model for the 70S ribosome. This model describes not only the outer shape of the particle, but displays also an experimentally determined internal protein-RNA distribution and the border of subunits for the first time (four-phase model; resolution: 50A). Models of the 70S ribosome from other studies were evaluated and ranked according to consistency with the measured scattering data. Applying a new neutron scattering technique of particular sensitivity, the proton-spin contrast-variation, single proteins could be measured and localized. The positions of the proteins S6 and S10 were determined, providing the first coordinates of protein mass centers within the 70S ribosome. (orig.) [Deutsch] Ribosomen sind Ribonukleinsaeure-Protein Komplexe, die in allen lebenden Organismen die Proteinbiosynthese katalysieren. Strukturmodelle fuer das prokaryontische 70S-Ribosom beruhen derzeit vorwiegend auf elektronenmikroskopischen Untersuchungen und beschreiben im wesentlichen die aeussere Oberflaeche des Partikels. Informationen ueber die innere Struktur des Ribosoms koennen Messungen mit

  6. Ribosomal proteins as biomarkers for bacterial identification by mass spectrometry in the clinical microbiology laboratory.

    Science.gov (United States)

    Suarez, Stéphanie; Ferroni, Agnès; Lotz, Aurélie; Jolley, Keith A; Guérin, Philippe; Leto, Julie; Dauphin, Brunhilde; Jamet, Anne; Maiden, Martin C J; Nassif, Xavier; Armengaud, Jean

    2013-09-01

    Whole-cell matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS) is a rapid method for identification of microorganisms that is increasingly used in microbiology laboratories. This identification is based on the comparison of the tested isolate mass spectrum with reference databases. Using Neisseria meningitidis as a model organism, we showed that in one of the available databases, the Andromas database, 10 of the 13 species-specific biomarkers correspond to ribosomal proteins. Remarkably, one biomarker, ribosomal protein L32, was subject to inter-strain variability. The analysis of the ribosomal protein patterns of 100 isolates for which whole genome sequences were available, confirmed the presence of inter-strain variability in the molecular weight of 29 ribosomal proteins, thus establishing a correlation between the sequence type (ST) and/or clonal complex (CC) of each strain and its ribosomal protein pattern. Since the molecular weight of three of the variable ribosomal proteins (L30, L31 and L32) was included in the spectral window observed by MALDI-TOF MS in clinical microbiology, i.e., 3640-12000 m/z, we were able by analyzing the molecular weight of these three ribosomal proteins to classify each strain in one of six subgroups, each of these subgroups corresponding to specific STs and/or CCs. Their detection by MALDI-TOF allows therefore a quick typing of N. meningitidis isolates. © 2013 Elsevier B.V. All rights reserved.

  7. Ribosomal stress induces L11- and p53-dependent apoptosis in mouse pluripotent stem cells.

    Science.gov (United States)

    Morgado-Palacin, Lucia; Llanos, Susana; Serrano, Manuel

    2012-02-01

    Ribosome biogenesis is the most demanding energetic process in proliferating cells and it is emerging as a critical sensor of cellular homeostasis. Upon disturbance of ribosome biogenesis, specific free ribosomal proteins, most notably L11, bind and inhibit Mdm2, resulting in activation of the tumor suppressor p53. This pathway has been characterized in somatic and cancer cells, but its function in embryonic pluripotent cells has remained unexplored. Here, we show that treatment with low doses of Actinomycin D or depletion of ribosomal protein L37, two well-established inducers of ribosomal stress, activate p53 in an L11-dependent manner in mouse embryonic stem cells (ESCs) and in induced pluripotent stem cells (iPSCs). Activation of p53 results in transcriptional induction of p53 targets, including p21, Mdm2, Pidd, Puma, Noxa and Bax. Finally, ribosomal stress elicits L11- and p53-dependent apoptosis in ESCs/iPSCs. These results extend to pluripotent cells the functionality of the ribosomal stress pathway and we speculate that this could be a relevant cellular checkpoint during early embryogenesis.

  8. tmRNA-mediated trans-translation as the major ribosome rescue system in a bacterial cell

    Directory of Open Access Journals (Sweden)

    Hyouta eHimeno

    2014-04-01

    Full Text Available tmRNA (transfer messenger RNA; also known as 10Sa RNA or SsrA RNA is a small RNA molecule that is conserved among bacteria. It has structural and functional similarities to tRNA: it has an upper half of the tRNA-like structure, its 5’ end is processed by RNase P, it has typical tRNA-specific base modifications, it is aminoacylated with alanine, it binds to EF-Tu after aminoacylation and it enters the ribosome with EF-Tu and GTP. However, tmRNA lacks an anticodon, and instead it has a coding sequence for a short peptide called tag-peptide. An elaborate interplay of actions of tmRNA as both tRNA and mRNA with the help of a tmRNA-binding protein, SmpB, facilitates trans-translation, which produces a single polypeptide from two mRNA molecules. Initially alanyl-tmRNA in complex with EF-Tu and SmpB enters the vacant A-site of the stalled ribosome like aminoacyl-tRNA but without a codon-anticodon interaction, and subsequently truncated mRNA is replaced with the tag-encoding region of tmRNA. During these processes, not only tmRNA but also SmpB structurally and functionally mimics both tRNA and mRNA. Thus trans-translation rescues the stalled ribosome, thereby allowing recycling of the ribosome. Since the tag-peptide serves as a target of AAA+ proteases, the trans-translation products are preferentially degraded so that they do not accumulate in the cell. Although alternative rescue systems have recently been revealed, trans-translation is the only system that universally exists in bacteria. Furthermore, it is unique in that it employs a small RNA and that it prevents accumulation of nonfunctional proteins from truncated mRNA in the cell. It might play the major role in rescuing the stalled translation in the bacterial cell.

  9. A Numbers Game: Ribosome Densities, Bacterial Growth, and Antibiotic-Mediated Stasis and Death

    Directory of Open Access Journals (Sweden)

    Bruce R. Levin

    2017-02-01

    Full Text Available We postulate that the inhibition of growth and low rates of mortality of bacteria exposed to ribosome-binding antibiotics deemed bacteriostatic can be attributed almost uniquely to these drugs reducing the number of ribosomes contributing to protein synthesis, i.e., the number of effective ribosomes. We tested this hypothesis with Escherichia coli K-12 MG1655 and constructs that had been deleted for 1 to 6 of the 7 rRNA (rrn operons. In the absence of antibiotics, constructs with fewer rrn operons have lower maximum growth rates and longer lag phases than those with more ribosomal operons. In the presence of the ribosome-binding “bacteriostatic” antibiotics tetracycline, chloramphenicol, and azithromycin, E. coli strains with 1 and 2 rrn operons are killed at a substantially higher rate than those with more rrn operons. This increase in the susceptibility of E. coli with fewer rrn operons to killing by ribosome-targeting bacteriostatic antibiotics is not reflected in their greater sensitivity to killing by the bactericidal antibiotic ciprofloxacin, which does not target ribosomes, but also to killing by gentamicin, which does. Finally, when such strains are exposed to these ribosome-targeting bacteriostatic antibiotics, the time before these bacteria start to grow again when the drugs are removed, referred to as the post-antibiotic effect (PAE, is markedly greater for constructs with fewer rrn operons than for those with more rrn operons. We interpret the results of these other experiments reported here as support for the hypothesis that the reduction in the effective number of ribosomes due to binding to these structures provides a sufficient explanation for the action of bacteriostatic antibiotics that target these structures.

  10. Mutations in ribosomal protein L3 and 23S ribosomal RNA at the peptidyl transferase centre are associated with reduced susceptibility to tiamulin in Brachyspira spp. isolates.

    Science.gov (United States)

    Pringle, Märit; Poehlsgaard, Jacob; Vester, Birte; Long, Katherine S

    2004-12-01

    The pleuromutilin antibiotic tiamulin binds to the ribosomal peptidyl transferase centre. Three groups of Brachyspira spp. isolates with reduced tiamulin susceptibility were analysed to define resistance mechanisms to the drug. Mutations were identified in genes encoding ribosomal protein L3 and 23S rRNA at positions proximal to the peptidyl transferase centre. In two groups of laboratory-selected mutants, mutations were found at nucleotide positions 2032, 2055, 2447, 2499, 2504 and 2572 of 23S rRNA (Escherichia coli numbering) and at amino acid positions 148 and 149 of ribosomal protein L3 (Brachyspira pilosicoli numbering). In a third group of clinical B. hyodysenteriae isolates, only a single mutation at amino acid 148 of ribosomal protein L3 was detected. Chemical footprinting experiments show a reduced binding of tiamulin to ribosomal subunits from mutants with decreased susceptibility to the drug. This reduction in drug binding is likely the resistance mechanism for these strains. Hence, the identified mutations located near the tiamulin binding site are predicted to be responsible for the resistance phenotype. The positions of the mutated residues relative to the bound drug advocate a model where the mutations affect tiamulin binding indirectly through perturbation of nucleotide U2504.

  11. DNAJC21 Mutations Link a Cancer-Prone Bone Marrow Failure Syndrome to Corruption in 60S Ribosome Subunit Maturation.

    Science.gov (United States)

    Tummala, Hemanth; Walne, Amanda J; Williams, Mike; Bockett, Nicholas; Collopy, Laura; Cardoso, Shirleny; Ellison, Alicia; Wynn, Rob; Leblanc, Thierry; Fitzgibbon, Jude; Kelsell, David P; van Heel, David A; Payne, Elspeth; Plagnol, Vincent; Dokal, Inderjeet; Vulliamy, Tom

    2016-07-07

    A substantial number of individuals with bone marrow failure (BMF) present with one or more extra-hematopoietic abnormality. This suggests a constitutional or inherited basis, and yet many of them do not fit the diagnostic criteria of the known BMF syndromes. Through exome sequencing, we have now identified a subgroup of these individuals, defined by germline biallelic mutations in DNAJC21 (DNAJ homolog subfamily C member 21). They present with global BMF, and one individual developed a hematological cancer (acute myeloid leukemia) in childhood. We show that the encoded protein associates with rRNA and plays a highly conserved role in the maturation of the 60S ribosomal subunit. Lymphoblastoid cells obtained from an affected individual exhibit increased sensitivity to the transcriptional inhibitor actinomycin D and reduced amounts of rRNA. Characterization of mutations revealed impairment in interactions with cofactors (PA2G4, HSPA8, and ZNF622) involved in 60S maturation. DNAJC21 deficiency resulted in cytoplasmic accumulation of the 60S nuclear export factor PA2G4, aberrant ribosome profiles, and increased cell death. Collectively, these findings demonstrate that mutations in DNAJC21 cause a cancer-prone BMF syndrome due to corruption of early nuclear rRNA biogenesis and late cytoplasmic maturation of the 60S subunit. Copyright © 2016. Published by Elsevier Inc.

  12. Three-dimensional crystals of ribosomes and their subunits from eu- and archaebacteria.

    Science.gov (United States)

    Glotz, C; Müssig, J; Gewitz, H S; Makowski, I; Arad, T; Yonath, A; Wittmann, H G

    1987-11-01

    Ordered three-dimensional crystals of 70S ribosomes as well as of 30S and 50S ribosomal subunits from various bacteria (E. coli, Bacillus stearothermophilus, Thermus thermophilus and Halobacterium marismortui) have been grown by vapour diffusion in hanging drops using mono- and polyalcohols. A new compact crystal form of 50S subunits has been obtained, and it is suitable for crystallographic studies at medium resolution. In addition, from one crystal form large crystals could be grown in X-ray capillaries. In all cases the crystals were obtained from functionally active ribosomal particles, and the particles from dissolved crystals retained their integrity and biological activity.

  13. Origins of the plant chloroplasts and mitochondria based on comparisons of 5S ribosomal RNAs

    Science.gov (United States)

    Delihas, N.; Fox, G. E.

    1987-01-01

    In this paper, we provide macromolecular comparisons utilizing the 5S ribosomal RNA structure to suggest extant bacteria that are the likely descendants of chloroplast and mitochondria endosymbionts. The genetic stability and near universality of the 5S ribosomal gene allows for a useful means to study ancient evolutionary changes by macromolecular comparisons. The value in current and future ribosomal RNA comparisons is in fine tuning the assignment of ancestors to the organelles and in establishing extant species likely to be descendants of bacteria involved in presumed multiple endosymbiotic events.

  14. Purification and properties of a ribosomal casein kinase from rabbit reticulocytes

    DEFF Research Database (Denmark)

    Issinger, O G

    1977-01-01

    A casein kinase was isolated and purifed from rabbit reticulocytes. About 90% of the enzyme activity co-sedimented with the ribosomal fraction, whereas about 10% of the enzyme activity was found in the ribosome-free supernatant. Both casein kinases (the ribosome-bound enzyme as well as the free...... suggested that the casein kinase is a dimer composed of subunits of identical molecular weight. The enzyme utilizes GTP as well as ATP as a phosphoryl donor. It preferentially phosphorylates acidic proteins, in particular the model substrates casein and phosvitin. Casein kinase is cyclic AMP...

  15. Spatial Operations

    Directory of Open Access Journals (Sweden)

    Anda VELICANU

    2010-09-01

    Full Text Available This paper contains a brief description of the most important operations that can be performed on spatial data such as spatial queries, create, update, insert, delete operations, conversions, operations on the map or analysis on grid cells. Each operation has a graphical example and some of them have code examples in Oracle and PostgreSQL.

  16. Spatializing Time

    DEFF Research Database (Denmark)

    Thomsen, Bodil Marie Stavning

    2011-01-01

    The article analyses some of artist Søren Lose's photographic installations in which time, history and narration is reflected in the creation of allegoric, spatial relations.......The article analyses some of artist Søren Lose's photographic installations in which time, history and narration is reflected in the creation of allegoric, spatial relations....

  17. Spatial Computation

    Science.gov (United States)

    2003-12-01

    Computation and today’s microprocessors with the approach to operating system architecture, and the controversy between microkernels and monolithic kernels...Both Spatial Computation and microkernels break away a relatively monolithic architecture into in- dividual lightweight pieces, well specialized...for their particular functionality. Spatial Computation removes global signals and control, in the same way microkernels remove the global address

  18. Dietary ascorbic acid normalizes ribosomal efficiency for collagen production in skin of streptozotocin-induced diabetic rats

    International Nuclear Information System (INIS)

    Schneir, M.; Imberman, M.; Ramamurthy, N.; Golub, L.

    1987-01-01

    The objective of this study was to quantify the contribution of both ribosome amount and ribosomal efficiency to decreased collagen production in skin of diabetic rats and diabetic rats treated with dietary ascorbic acid. Male Sprague-Dawley rats were distributed equally into the following categories: non-diabetic controls; diabetics; ascorbic acid-treated diabetics. On day-20, all rats were injected with ( 3 H)proline and killed after 2 h. Absolute rate of collagen production, ribosome content, and ribosomal efficiency of collagen production were quantified. Also ribosomal efficiency was quantified for ribosomes in sucrose-gradient fractionated post-mitochondrial supernatants. The results indicate that decreased ribosomal efficiency was responsible for 70% of the decreased collagen production with 30% caused by decreased ribosome content, when measured for total skin or sucrose gradient-isolated ribosomes. At both levels of analysis, ascorbic acid treatment normalized ribosomal efficiency, indicating diabetes-mediated decreased ribosomal efficiency for collagen production is related to a co-translational event, such as procollagen underhydroxylation

  19. Karyotypic evolution of ribosomal sites in buffalo subspecies and their crossbreed

    Directory of Open Access Journals (Sweden)

    Tiago Marafiga Degrandi

    2014-06-01

    Full Text Available Domestic buffaloes are divided into two group based on cytogenetic characteristics and habitats: the "river buffaloes" with 2n = 50 and the "swamp buffaloes", 2n = 48. Nevertheless, their hybrids are viable, fertile and identified by a 2n = 49. In order to have a better characterization of these different cytotypes of buffaloes, and considering that NOR-bearing chromosomes are involved in the rearrangements responsible for the karyotypic differences, we applied silver staining (Ag-NOR and performed fluorescent in situ hybridization (FISH experiments using 18S rDNA as probe. Metaphases were obtained through blood lymphocyte culture of 21 individuals, including river, swamp and hybrid cytotypes. Ag-NOR staining revealed active NORs on six chromosome pairs (3p, 4p, 6, 21, 23, 24 in the river buffaloes, whereas the swamp buffaloes presented only five NOR-bearing pairs (4p, 6, 20, 22, 23. The F1 crossbreed had 11 chromosomes with active NORs, indicating expression of both parental chromosomes. FISH analysis confirmed the numerical divergence identified with Ag-NOR. This result is explained by the loss of the NOR located on chromosome 4p in the river buffalo, which is involved in the tandem fusion with chromosome 9 in this subspecies. A comparison with the ancestral cattle karyotype suggests that the NOR found on the 3p of the river buffalo may have originated from a duplication of ribosomal genes, resulting in the formation of new NOR sites in this subspecies.

  20. Chromosomal divergence and evolutionary inferences in Rhodniini based on the chromosomal location of ribosomal genes

    Directory of Open Access Journals (Sweden)

    Sebastian Pita

    2013-05-01

    Full Text Available In this study, we used fluorescence in situ hybridisation to determine the chromosomal location of 45S rDNA clusters in 10 species of the tribe Rhodniini (Hemiptera: Reduviidae: Triatominae. The results showed striking inter and intraspecific variability, with the location of the rDNA clusters restricted to sex chromosomes with two patterns: either on one (X chromosome or both sex chromosomes (X and Y chromosomes. This variation occurs within a genus that has an unchanging diploid chromosome number (2n = 22, including 20 autosomes and 2 sex chromosomes and a similar chromosome size and genomic DNA content, reflecting a genome dynamic not revealed by these chromosome traits. The rDNA variation in closely related species and the intraspecific polymorphism in Rhodnius ecuadoriensis suggested that the chromosomal position of rDNA clusters might be a useful marker to identify recently diverged species or populations. We discuss the ancestral position of ribosomal genes in the tribe Rhodniini and the possible mechanisms involved in the variation of the rDNA clusters, including the loss of rDNA loci on the Y chromosome, transposition and ectopic pairing. The last two processes involve chromosomal exchanges between both sex chromosomes, in contrast to the widely accepted idea that the achiasmatic sex chromosomes of Heteroptera do not interchange sequences.

  1. Biosynthesis of ribosomal RNA in nucleoli regulates pluripotency and differentiation ability of pluripotent stem cells.

    Science.gov (United States)

    Watanabe-Susaki, Kanako; Takada, Hitomi; Enomoto, Kei; Miwata, Kyoko; Ishimine, Hisako; Intoh, Atsushi; Ohtaka, Manami; Nakanishi, Mahito; Sugino, Hiromu; Asashima, Makoto; Kurisaki, Akira

    2014-12-01

    Pluripotent stem cells have been shown to have unique nuclear properties, for example, hyperdynamic chromatin and large, condensed nucleoli. However, the contribution of the latter unique nucleolar character to pluripotency has not been well understood. Here, we show that fibrillarin (FBL), a critical methyltransferase for ribosomal RNA (rRNA) processing in nucleoli, is one of the proteins highly expressed in pluripotent embryonic stem (ES) cells. Stable expression of FBL in ES cells prolonged the pluripotent state of mouse ES cells cultured in the absence of leukemia inhibitory factor (LIF). Analyses using deletion mutants and a point mutant revealed that the methyltransferase activity of FBL regulates stem cell pluripotency. Knockdown of this gene led to significant delays in rRNA processing, growth inhibition, and apoptosis in mouse ES cells. Interestingly, both partial knockdown of FBL and treatment with actinomycin D, an inhibitor of rRNA synthesis, induced the expression of differentiation markers in the presence of LIF and promoted stem cell differentiation into neuronal lineages. Moreover, we identified p53 signaling as the regulatory pathway for pluripotency and differentiation of ES cells. These results suggest that proper activity of rRNA production in nucleoli is a novel factor for the regulation of pluripotency and differentiation ability of ES cells. © 2014 AlphaMed Press.

  2. Molecular Characterization and Analysis of 16S Ribosomal DNA in Some Isolates of Demodex folicullorum.

    Science.gov (United States)

    Daneshparvar, Afrooz; Mowlavi, Gholamreza; Mirjalali, Hamed; Hajjaran, Homa; Mobedi, Iraj; Naddaf, Saeed Reza; Shidfar, Mohammadreza; Sadat Makki, Mahsa

    2017-01-01

    Demodicosis is one of the most prevalent skin diseases resulting from infestation by Demodex mites. This parasite usually inhabits in follicular infundibulum or sebaceous duct and transmits through close contact with an infested host. This study was carried from September 2014 to January 2016 at Tehran University of Medical Sciences, Tehran, Iran. DNA extraction and amplification of 16S ribosomal RNA was performed on four isolates, already obtained from four different patients and identified morphologically though clearing with 10% Potassium hydroxide (KOH) and microscopical examination. Amplified fragments from the isolates were compared with GeneBank database and phylogenetic analysis was carried out using MEGA6 software. A 390 bp fragment of 16S rDNA was obtained in all isolates and analysis of generated sequences showed high similarity with those submitted to GenBank, previously. Intra-species similarity and distance also showed 99.983% and 0.017, respectively, for the studied isolates. Multiple alignments of the isolates showed Single Nucleotide Polymorphisms (SNPs) in 16S rRNA fragment. Phylogenetic analysis revealed that all 4 isolates clustered with other D. folliculorum, recovered from GenBank database. Our accession numbers KF875587 and KF875589 showed more similarity together in comparison with two other studied isolates. Mitochondrial 16S rDNA is one of the most suitable molecular barcodes for identification D. folliculorum and this fragment can use for intra-species characterization of the most human-infected mites.

  3. Molecular Characterization and Analysis of 16S Ribosomal DNA in some Isolates of Demodex folliculorum

    Directory of Open Access Journals (Sweden)

    Afrooz DANESHPARVAR

    2017-06-01

    Full Text Available Background: Demodicosis is one of the most prevalent skin diseases resulting from infestation by Demodex mites. This parasite usually inhabits in follicular infundibulum or sebaceous duct transmitted through close contact with an infested host.Methods: This study was carried from September 2014 to January 2016 at Tehran University of Medical Sciences, Tehran, Iran. DNA extraction and amplification of 16S ribosomal RNA was performed on four isolates, obtained from four patients and identified morphologically through clearing with 10% Potassium hydroxide (KOH and microscopical examination. Amplified fragments from the isolates were compared with GenBank database and phylogenetic analysis was carried out using MEGA6 software.Results: A 390 bp fragment of 16S rDNA was obtained in all isolates and analysis of generated sequences showed high similarity with those submitted to GenBank, previously. Intra-species similarity and distance also showed 99.983% and 0.017, respectively, for the studied isolates. Multiple alignments of the isolates showed Single Nucleotide Polymorphisms (SNPs in 16S rRNA fragment. Phylogenetic analysis revealed that all 4 isolates clustered with other D. folliculorum, recovered from GenBank database. Our accession numbers KF875587 and KF875589 showed more similarity together in comparison with two other studied isolates. Conclusion: Mitochondrial 16S rDNA is one of the most suitable molecular barcodes for identification D. folliculorum and this fragment can use for intra-species characterization of the most human-infected mites.

  4. Hypervariability of ribosomal DNA at multiple chromosomal sites in lake trout (Salvelinus namaycush).

    Science.gov (United States)

    Zhuo, L; Reed, K M; Phillips, R B

    1995-06-01

    Variation in the intergenic spacer (IGS) of the ribosomal DNA (rDNA) of lake trout (Salvelinus namaycush) was examined. Digestion of genomic DNA with restriction enzymes showed that almost every individual had a unique combination of length variants with most of this variation occurring within rather than between populations. Sequence analysis of a 2.3 kilobase (kb) EcoRI-DraI fragment spanning the 3' end of the 28S coding region and approximately 1.8 kb of the IGS revealed two blocks of repetitive DNA. Putative transcriptional termination sites were found approximately 220 bases (b) downstream from the end of the 28S coding region. Comparison of the 2.3-kb fragments with two longer (3.1 kb) fragments showed that the major difference in length resulted from variation in the number of short (89 b) repeats located 3' to the putative terminator. Repeat units within a single nucleolus organizer region (NOR) appeared relatively homogeneous and genetic analysis found variants to be stably inherited. A comparison of the number of spacer-length variants with the number of NORs found that the number of length variants per individual was always less than the number of NORs. Examination of spacer variants in five populations showed that populations with more NORs had more spacer variants, indicating that variants are present at different rDNA sites on nonhomologous chromosomes.

  5. Ribosomal DNA variation in finger millet and wild species of Eleusine (Poaceae).

    Science.gov (United States)

    Hilu, K W; Johnson, J L

    1992-04-01

    Finger millet is an important cereal crop in the semi-arid regions of Africa and India. The crop belongs to the grass genus Eleusine, which includes nine annual and perennial species native to Africa except for the New World species E. tristachya. Ribosomal DNA (rDNA) variation in finger millet and related wild species was used to provide information on the origin of the genomes of this tetraploid crop and point out genetic relationships of the crop to other species in the genus. The restriction endonucleases used revealed a lack of variability in the rDNA spacer region in domesticated finger millet. All the rDNA variants of the crop were found in the proposed direct tetraploid ancestor, E. coracana subsp. africana. Wild and domesticated finger millet displayed the phenotypes found in diploid E. indica. Diploid Eleusine tristachya showed some similarity to the crop in some restriction sites. The remaining species were quite distinct in rDNA fragment patterns. The study supports the direct origin of finger millet from subspecies africana shows E. indica to be one of the genome donors of the crop, and demonstrates that none of the other species examined could have donated the second genome of the crop. The rDNA data raise the possibility that wild and domesticated finger millet could have originated as infraspecific polyploid hybrids from different varieties of E. indica.

  6. Inhibition of ribosomal RNA synthesis in yeast by ionizing radiations

    Energy Technology Data Exchange (ETDEWEB)

    Weber, K; Kiefer, J [Giessen Univ. (Germany, F.R.). Strahlenzentrum

    1984-12-01

    Synthesis of ribosomal RNA(r-RNA) was measured for 1 h after exposure of Saccharomyces cerevisiae to ..gamma..-rays, X-rays or ..cap alpha.. particles. ..gamma..- or X-ray induced transcription inhibition was always found to decrease exponentially with dose. D/sub 0/ values of 2150 or 1950 Gy were determined in wild-type cells, corresponding to a mean energy of about 60 eV per r-RNA gene. The finding of differential sensitivities of the two high molecular-weight r-RNA species which are cotranscribed from r-DNA is compatible with the existence of a transcription terminating mechanism. Cells from a mutant strain (rad-9), radiation sensitive to colony forming ability, showed an approximately equal sensitivity for transcription inhibition compared to the wild-type (D/sub 0/ (2095) = 2400 Gy). Inactivation of r-RNA synthesis in cells exposed to ..cap alpha..-particles at room-temperature showed a decreased sensitivity with higher particle fluences ('resistant tail'). This phenomenon was drastically reduced if the temperature during irradiation was lowered to 4/sup 0/C and completely abolished when dried cells were used. An inactivation cross-section for ..cap alpha..-particle induced transcription inhibition of about 0.02 ..mu..m/sup 2/ can be derived from the experimental data.

  7. Analysis of Ribosome Inactivating Protein (RIP): A Bioinformatics Approach

    Science.gov (United States)

    Jothi, G. Edward Gnana; Majilla, G. Sahaya Jose; Subhashini, D.; Deivasigamani, B.

    2012-10-01

    In spite of the medical advances in recent years, the world is in need of different sources to encounter certain health issues.Ribosome Inactivating Proteins (RIPs) were found to be one among them. In order to get easy access about RIPs, there is a need to analyse RIPs towards constructing a database on RIPs. Also, multiple sequence alignment was done towards screening for homologues of significant RIPs from rare sources against RIPs from easily available sources in terms of similarity. Protein sequences were retrieved from SWISS-PROT and are further analysed using pair wise and multiple sequence alignment.Analysis shows that, 151 RIPs have been characterized to date. Amongst them, there are 87 type I, 37 type II, 1 type III and 25 unknown RIPs. The sequence length information of various RIPs about the availability of full or partial sequence was also found. The multiple sequence alignment of 37 type I RIP using the online server Multalin, indicates the presence of 20 conserved residues. Pairwise alignment and multiple sequence alignment of certain selected RIPs in two groups namely Group I and Group II were carried out and the consensus level was found to be 98%, 98% and 90% respectively.

  8. Automated genome mining of ribosomal peptide natural products

    Energy Technology Data Exchange (ETDEWEB)

    Mohimani, Hosein; Kersten, Roland; Liu, Wei; Wang, Mingxun; Purvine, Samuel O.; Wu, Si; Brewer, Heather M.; Pasa-Tolic, Ljiljana; Bandeira, Nuno; Moore, Bradley S.; Pevzner, Pavel A.; Dorrestein, Pieter C.

    2014-07-31

    Ribosomally synthesized and posttranslationally modified peptides (RiPPs), especially from microbial sources, are a large group of bioactive natural products that are a promising source of new (bio)chemistry and bioactivity (1). In light of exponentially increasing microbial genome databases and improved mass spectrometry (MS)-based metabolomic platforms, there is a need for computational tools that connect natural product genotypes predicted from microbial genome sequences with their corresponding chemotypes from metabolomic datasets. Here, we introduce RiPPquest, a tandem mass spectrometry database search tool for identification of microbial RiPPs and apply it for lanthipeptide discovery. RiPPquest uses genomics to limit search space to the vicinity of RiPP biosynthetic genes and proteomics to analyze extensive peptide modifications and compute p-values of peptide-spectrum matches (PSMs). We highlight RiPPquest by connection of multiple RiPPs from extracts of Streptomyces to their gene clusters and by the discovery of a new class III lanthipeptide, informatipeptin, from Streptomyces viridochromogenes DSM 40736 as the first natural product to be identified in an automated fashion by genome mining. The presented tool is available at cy-clo.ucsd.edu.

  9. Ribosome reinitiation at leader peptides increases translation of bacterial proteins.

    Science.gov (United States)

    Korolev, Semen A; Zverkov, Oleg A; Seliverstov, Alexandr V; Lyubetsky, Vassily A

    2016-04-16

    Short leader genes usually do not encode stable proteins, although their importance in expression control of bacterial genomes is widely accepted. Such genes are often involved in the control of attenuation regulation. However, the abundance of leader genes suggests that their role in bacteria is not limited to regulation. Specifically, we hypothesize that leader genes increase the expression of protein-coding (structural) genes via ribosome reinitiation at the leader peptide in the case of a short distance between the stop codon of the leader gene and the start codon of the structural gene. For instance, in Actinobacteria, the frequency of leader genes at a distance of 10-11 bp is about 70 % higher than the mean frequency within the 1 to 65 bp range; and it gradually decreases as the range grows longer. A pronounced peak of this frequency-distance relationship is also observed in Proteobacteria, Bacteroidetes, Spirochaetales, Acidobacteria, the Deinococcus-Thermus group, and Planctomycetes. In contrast, this peak falls to the distance of 15-16 bp and is not very pronounced in Firmicutes; and no such peak is observed in cyanobacteria and tenericutes. Generally, this peak is typical for many bacteria. Some leader genes located close to a structural gene probably play a regulatory role as well.

  10. Generation of monoclonal antibodies for the assessment of protein purification by recombinant ribosomal coupling

    DEFF Research Database (Denmark)

    Kristensen, Janni; Sperling-Petersen, Hans Uffe; Mortensen, Kim Kusk

    2005-01-01

    We recently described a conceptually novel method for the purification of recombinant proteins with a propensity to form inclusion bodies in the cytoplasm of Escherichia coli. Recombinant proteins were covalently coupled to the E. coli ribosome by fusing them to ribosomal protein 23 (rpL23...... therefore purified rpL23-GFP-His, rpL23-His and GFP from E. coli recombinants using affinity, ion exchange and hydrophobic interaction chromatography. These proteins could be purified with yields of 150, 150 and 1500 microg per gram cellular wet weight, respectively. However, rpL23-GFP-His could only...... proteolytic cleavage sites. We conclude that the generated antibodies can be used to evaluate ribosomal coupling of recombinant target proteins as well as the efficiency of their separation from the ribosome....

  11. Remodeling of ribosomal genes in somatic cells by Xenopus egg extract

    DEFF Research Database (Denmark)

    Østrup, Olga; Hyttel, Poul; Klærke, Dan Arne

    2011-01-01

    Extracts from Xenopus eggs can reprogram gene expression in somatic nuclei, however little is known about the earliest processes associated with the switch in the transcriptional program. We show here that an early reprogramming event is the remodeling of ribosomal chromatin and gene expression....... This occurs within hours of extract treatment and is distinct from a stress response. Egg extract elicits remodeling of the nuclear envelope, chromatin and nucleolus. Nucleolar remodeling involves a rapid and stable decrease in ribosomal gene transcription, and promoter targeting of the nucleolar remodeling...... and elicits a stress-type nuclear response. Thus, an early event of Xenopus egg extract-mediated nuclear reprogramming is the remodeling of ribosomal genes involving nucleolar remodeling complex. Condition-specific and rapid silencing of ribosomal genes may serve as a sensitive marker for evaluation...

  12. Mitochondrial ribosomal protein S18-2 evokes chromosomal instability and transforms primary rat skin fibroblasts

    KAUST Repository

    Kashuba, Elena; Carbone, Ennio; Di Fabrizio, Enzo M.; Tirinato, Luca; Petruchek, Maria; Drummond, Catherine; Kovalevska, Larysa; Gurrapu, Sreeharsha; Mushtaq, Muhammad; Darekar, Suhas D.

    2015-01-01

    We have shown earlier that overexpression of the human mitochondrial ribosomal protein MRPS18-2 (S18-2) led to immortalization of primary rat embryonic fibroblasts. The derived cells expressed the embryonic stem cell markers, and cellular pathways

  13. Probing the structure of ribosome assembly intermediates in vivo using DMS and hydroxyl radical footprinting.

    Science.gov (United States)

    Hulscher, Ryan M; Bohon, Jen; Rappé, Mollie C; Gupta, Sayan; D'Mello, Rhijuta; Sullivan, Michael; Ralston, Corie Y; Chance, Mark R; Woodson, Sarah A

    2016-07-01

    The assembly of the Escherichia coli ribosome has been widely studied and characterized in vitro. Despite this, ribosome biogenesis in living cells is only partly understood because assembly is coupled with transcription, modification and processing of the pre-ribosomal RNA. We present a method for footprinting and isolating pre-rRNA as it is synthesized in E. coli cells. Pre-rRNA synthesis is synchronized by starvation, followed by nutrient upshift. RNA synthesized during outgrowth is metabolically labeled to facilitate isolation of recent transcripts. Combining this technique with two in vivo RNA probing methods, hydroxyl radical and DMS footprinting, allows the structure of nascent RNA to be probed over time. Together, these can be used to determine changes in the structures of ribosome assembly intermediates as they fold in vivo. Copyright © 2016 Elsevier Inc. All rights reserved.

  14. Ribosomal mutations promote the evolution of antibiotic resistance in a multidrug environment.

    Science.gov (United States)

    Gomez, James E; Kaufmann-Malaga, Benjamin B; Wivagg, Carl N; Kim, Peter B; Silvis, Melanie R; Renedo, Nikolai; Ioerger, Thomas R; Ahmad, Rushdy; Livny, Jonathan; Fishbein, Skye; Sacchettini, James C; Carr, Steven A; Hung, Deborah T

    2017-02-21

    Antibiotic resistance arising via chromosomal mutations is typically specific to a particular antibiotic or class of antibiotics. We have identified mutations in genes encoding ribosomal components in Mycobacterium smegmatis that confer resistance to several structurally and mechanistically unrelated classes of antibiotics and enhance survival following heat shock and membrane stress. These mutations affect ribosome assembly and cause large-scale transcriptomic and proteomic changes, including the downregulation of the catalase KatG, an activating enzyme required for isoniazid sensitivity, and upregulation of WhiB7, a transcription factor involved in innate antibiotic resistance. Importantly, while these ribosomal mutations have a fitness cost in antibiotic-free medium, in a multidrug environment they promote the evolution of high-level, target-based resistance. Further, suppressor mutations can then be easily acquired to restore wild-type growth. Thus, ribosomal mutations can serve as stepping-stones in an evolutionary path leading to the emergence of high-level, multidrug resistance.

  15. Karyotype characterization of Mugil incilis Hancock, 1830 (Mugiliformes: Mugilidae, including a description of an unusual co-localization of major and minor ribosomal genes in the family

    Directory of Open Access Journals (Sweden)

    Anne Kathrin Hett

    Full Text Available This study reports the description of the karyotype of Mugil incilis from Venezuela. The chromosome complement is composed of 48 acrocentric chromosomes, which uniformly decrease in size. Therefore, the homologues can not be clearly identified, with the exception of one of the largest chromosome pairs, classified as number 1, whose homologues may show a subcentromeric secondary constriction, and of chromosome pair number 24, which is considerably smaller than the others. C-banding showed heterochromatic blocks at the centromeric/pericentromeric regions of all chromosomes, which were more conspicuous on chromosomes 1, given the C-positive signals include the secondary constrictions. AgNO3 and fluorescent in situ hybridization (FISH with 45S rDNA demonstrated that the nucleolus organizer regions are indeed located on the secondary constrictions of chromosome pair number 1. FISH with 5S rDNA revealed that the minor ribosomal genes are located on this same chromosome pair, near the NORs, though signals are closer to the centromeres and of smaller size, compared to those of the major ribosomal gene clusters. This is the first description of co-localization of major and minor ribosomal genes in the family. Data are discussed from a cytotaxonomic and phylogenetic perspective.

  16. Kinase-Mediated Regulation of 40S Ribosome Assembly in Human Breast Cancer

    Science.gov (United States)

    2017-02-01

    and will assess if this resistance involves gain-of-function mutations in Ltv1, and if resistance can be overcome with drugs that direct...ribosome assembly factor Ltv1 in both yeast and TNBC cells, and that selective knockdown or silencing of CK1δ, or forced expression of Ltv1 mutant that...cannot be phosphorylated by CK1δ, blocks ribosome assembly in yeast and compromises the growth and survival of TNBC cells. Further, we have shown that

  17. A conserved chloramphenicol binding site at the entrance to the ribosomal peptide exit tunnel

    DEFF Research Database (Denmark)

    Long, Katherine S; Porse, Bo T

    2003-01-01

    , of E.coli 23S rRNA and G2084 (2058 in E.coli numbering) in domain V of H.halobium 23S rRNA. The modification sites overlap with a portion of the macrolide binding site and cluster at the entrance to the peptide exit tunnel. The data correlate with the recently reported chloramphenicol binding site...... on an archaeal ribosome and suggest that a similar binding site is present on the E.coli ribosome....

  18. Production of RNA-protein cross links in γ irradiated E. Coli ribosomes

    International Nuclear Information System (INIS)

    Ekert, Bernard; Giocanti, Nicole

    1976-01-01

    γ irradiation in de-aerated conditions of E. coli MRE 600 ribosomes, labelled with 14 C uracil, leads to a decrease of extractibility of 14 C RNA by lithium chloride 4 M-urea 8 M. On the other hand, the radioactivity of the protein fraction increases with irradiation. These results strongly suggest that RNA-protein cross links are formed in irradiated ribosomes [fr

  19. Morphogenetic and histogenetic roles of the temporal-spatial organization of cell proliferation in the vertebrate corticogenesis as revealed by inter-specific analyses of the optic tectum cortex development

    Directory of Open Access Journals (Sweden)

    Melina eRapacioli

    2016-03-01

    Full Text Available The central nervous system areas displaying the highest structural and functional complexity correspond to the so called cortices, i.e. concentric alternating neuronal and fibrous layers. Corticogenesis, i.e. the development of the cortical organization, depends on the temporal-spatial organization of several developmental events: (a the duration of the proliferative phase of the neuroepithelium, (b the relative duration of symmetric (expansive versus asymmetric (neuronogenic sub phases, (c the spatial organization of each kind of cell division, (e the time of determination and cell cycle exit and (f the time of onset of the postmitotic neuronal migration and (g the time of onset of the neuronal structural and functional differentiation. The first five events depend on molecular mechanisms that perform a fine tuning of the proliferative activity. Changes in any of them significantly influence the cortical size or volume (tangential expansion and radial thickness, morphology, architecture and also impact on neuritogenesis and synaptogenesis affecting the cortical wiring. This paper integrates information, obtained in several species, on the developmental roles of cell proliferation in the development of the optic tectum cortex, a multilayered associative area of the dorsal (alar midbrain. The present review (1 compiles relevant information on the temporal and spatial organization of cell proliferation in different species (fish, amphibians, birds and mammals, (2 revises the main molecular events involved in the isthmic organizer determination and localization, (3 describes how the patterning installed by isthmic organizer is translated into spatially organized neural stem cell proliferation (i.e. by means of growth factors, receptors, transcription factors, signaling pathways, etc. and (4 describes the morpho- and histogenetic effect of a spatially organized cell proliferation in the above mentioned species. A brief section on the optic tectum

  20. Evidence for alteration of the membrane-bound ribosomes in Micrococcus luteus cells exposed to lead

    Energy Technology Data Exchange (ETDEWEB)

    Barrow, W; Himmel, M; Squire, P G; Tornabene, T G

    1978-01-01

    Micrococcus luteus cells exposed to Pb(NO/sub 3/)/sub 2/ contained cytosol ribosomal particles and disaggregated membranal ribosomal particles as determined by ultracentrifugation and spectral studies. Approximately 60% of the membrane ribosome fraction from lead exposed cells had a sedimentation value of 8.4S. Cytosol ribosome from lead exposed cells as well as membranal and cytosol ribosomes from control cells were comparable by their contents of predominantly the 70S type with the 50S and 100S present in relatively small amounts. The lead content of the 8.4S components was more than 200 times higher than the components with higher sedimentation coefficients from lead exposed cells and approximately 650 times more than that of control cell ribosomes. The cells exposed to lead, however, showed no adverse effects from the lead in respect to their growth rates and cellular yields. These results indicate that lead is interacting only at specific sites of the membrane and is inducing events initiated only in strategic cellular regions. These data further substantiate that subtle changes do occur in lead exposed cells that show no obvious effects. It is assumed that these minor alterations are, in toto, biologically significant. 24 references, 2 figures, 1 table.

  1. The 5S RNP couples p53 homeostasis to ribosome biogenesis and nucleolar stress.

    Science.gov (United States)

    Sloan, Katherine E; Bohnsack, Markus T; Watkins, Nicholas J

    2013-10-17

    Several proto-oncogenes and tumor suppressors regulate the production of ribosomes. Ribosome biogenesis is a major consumer of cellular energy, and defects result in p53 activation via repression of mouse double minute 2 (MDM2) homolog by the ribosomal proteins RPL5 and RPL11. Here, we report that RPL5 and RPL11 regulate p53 from the context of a ribosomal subcomplex, the 5S ribonucleoprotein particle (RNP). We provide evidence that the third component of this complex, the 5S rRNA, is critical for p53 regulation. In addition, we show that the 5S RNP is essential for the activation of p53 by p14(ARF), a protein that is activated by oncogene overexpression. Our data show that the abundance of the 5S RNP, and therefore p53 levels, is determined by factors regulating 5S complex formation and ribosome integration, including the tumor suppressor PICT1. The 5S RNP therefore emerges as the critical coordinator of signaling pathways that couple cell proliferation with ribosome production. Copyright © 2013 The Authors. Published by Elsevier Inc. All rights reserved.

  2. Could a Proto-Ribosome Emerge Spontaneously in the Prebiotic World?

    Directory of Open Access Journals (Sweden)

    Ilana C. Agmon

    2016-12-01

    Full Text Available An indispensable prerequisite for establishing a scenario of life emerging by natural processes is the requirement that the first simple proto-molecules could have had a realistic probability of self-assembly from random molecular polymers in the prebiotic world. The vestige of the proto-ribosome, which is believed to be still embedded in the contemporary ribosome, is used to assess the feasibility of such spontaneous emergence. Three concentric structural elements of different magnitudes, having a dimeric nature derived from the symmetrical region of the ribosomal large subunit, were suggested to constitute the vestige of the proto-ribosome. It is assumed to have materialized spontaneously in the prebiotic world, catalyzing non-coded peptide bond formation and simple elongation. Probabilistic and energetic considerations are applied in order to evaluate the suitability of the three contenders for being the initial proto-ribosome. The analysis points to the simplest proto-ribosome, comprised of a dimer of tRNA-like molecules presently embedded in the core of the symmetrical region, as the only one having a realistic statistical likelihood of spontaneous emergence from random RNA chains. Hence it offers a feasible starting point for a continuous evolutionary path from the prebiotic matter, through natural processes, into the intricate modern translation system.

  3. Mutational analysis of S12 protein and implications for the accuracy of decoding by the ribosome.

    Science.gov (United States)

    Sharma, Divya; Cukras, Anthony R; Rogers, Elizabeth J; Southworth, Daniel R; Green, Rachel

    2007-12-07

    The fidelity of aminoacyl-tRNA selection by the ribosome depends on a conformational switch in the decoding center of the small ribosomal subunit induced by cognate but not by near-cognate aminoacyl-tRNA. The aminoglycosides paromomycin and streptomycin bind to the decoding center and induce related structural rearrangements that explain their observed effects on miscoding. Structural and biochemical studies have identified ribosomal protein S12 (as well as specific nucleotides in 16S ribosomal RNA) as a critical molecular contributor in distinguishing between cognate and near-cognate tRNA species as well as in promoting more global rearrangements in the small subunit, referred to as "closure." Here we use a mutational approach to define contributions made by two highly conserved loops in S12 to the process of tRNA selection. Most S12 variant ribosomes tested display increased levels of fidelity (a "restrictive" phenotype). Interestingly, several variants, K42A and R53A, were substantially resistant to the miscoding effects of paromomycin. Further characterization of the compromised paromomycin response identified a probable second, fidelity-modulating binding site for paromomycin in the 16S ribosomal RNA that facilitates closure of the small subunit and compensates for defects associated with the S12 mutations.

  4. Diverse Regulators of Human Ribosome Biogenesis Discovered by Changes in Nucleolar Number

    Directory of Open Access Journals (Sweden)

    Katherine I. Farley-Barnes

    2018-02-01

    Full Text Available Ribosome biogenesis is a highly regulated, essential cellular process. Although studies in yeast have established some of the biological principles of ribosome biogenesis, many of the intricacies of its regulation in higher eukaryotes remain unknown. To understand how ribosome biogenesis is globally integrated in human cells, we conducted a genome-wide siRNA screen for regulators of nucleolar number. We found 139 proteins whose depletion changed the number of nucleoli per nucleus from 2–3 to only 1 in human MCF10A cells. Follow-up analyses on 20 hits found many (90% to be essential for the nucleolar functions of rDNA transcription (7, pre-ribosomal RNA (pre-rRNA processing (16, and/or global protein synthesis (14. This genome-wide analysis exploits the relationship between nucleolar number and function to discover diverse cellular pathways that regulate the making of ribosomes and paves the way for further exploration of the links between ribosome biogenesis and human disease.

  5. Organization of proteins in mammalian mitochondrial ribosomes: accessibility to lactoperoxidase-catalyzed radioiodination

    International Nuclear Information System (INIS)

    Denslow, N.D.; O'Brien, T.W.

    1984-01-01

    To assess the relative exposure of individual ribosomal proteins (r-proteins) in the large and small subunits of the bovine mitochondrial ribosome, double label iodination technique was used. Regions of r-proteins exposed in purified ribosomal subunits were labeled with 131 I using the lactoperoxidase-catalyzed iodination system, and additional reactive groups available upon denaturing the r-proteins in urea were labeled with 125 I using the chloramine-T mediated reaction. The ratio of 131 I to 125 I incorporated into individual proteins under these conditions is representative of the degree of exposure for each of the proteins in the subunits. In this manner, the r-proteins have been grouped into 3 classes depending on their degree of exposure: high exposure, intermediate exposure, and essentially buried. While both subunits have a few proteins in the highly exposed group, and a large number of proteins in the intermediate exposure group, only the large ribosomal subunit has an appreciable number of proteins which appear essentially buried. The more buried proteins may serve mainly structural roles, perhaps acting as assembly proteins, since many from this group bind to ribosomal RNA. The more superficially disposed proteins may comprise binding sites for macromolecules that interact with ribosomes during protein synthesis, as well as stabilizing the association of the large and small subribosomal particles

  6. Ribosomal and hematopoietic defects in induced pluripotent stem cells derived from Diamond Blackfan anemia patients.

    Science.gov (United States)

    Garçon, Loïc; Ge, Jingping; Manjunath, Shwetha H; Mills, Jason A; Apicella, Marisa; Parikh, Shefali; Sullivan, Lisa M; Podsakoff, Gregory M; Gadue, Paul; French, Deborah L; Mason, Philip J; Bessler, Monica; Weiss, Mitchell J

    2013-08-08

    Diamond Blackfan anemia (DBA) is a congenital disorder with erythroid (Ery) hypoplasia and tissue morphogenic abnormalities. Most DBA cases are caused by heterozygous null mutations in genes encoding ribosomal proteins. Understanding how haploinsufficiency of these ubiquitous proteins causes DBA is hampered by limited availability of tissues from affected patients. We generated induced pluripotent stem cells (iPSCs) from fibroblasts of DBA patients carrying mutations in RPS19 and RPL5. Compared with controls, DBA fibroblasts formed iPSCs inefficiently, although we obtained 1 stable clone from each fibroblast line. RPS19-mutated iPSCs exhibited defects in 40S (small) ribosomal subunit assembly and production of 18S ribosomal RNA (rRNA). Upon induced differentiation, the mutant clone exhibited globally impaired hematopoiesis, with the Ery lineage affected most profoundly. RPL5-mutated iPSCs exhibited defective 60S (large) ribosomal subunit assembly, accumulation of 12S pre-rRNA, and impaired erythropoiesis. In both mutant iPSC lines, genetic correction of ribosomal protein deficiency via complementary DNA transfer into the "safe harbor" AAVS1 locus alleviated abnormalities in ribosome biogenesis and hematopoiesis. Our studies show that pathological features of DBA are recapitulated by iPSCs, provide a renewable source of cells to model various tissue defects, and demonstrate proof of principle for genetic correction strategies in patient stem cells.

  7. Spatial Theography

    OpenAIRE

    van Noppen, Jean Pierre

    1995-01-01

    Descriptive theology («theography») frequently resorts to metaphorical modes of meaning. Among these metaphors, the spatial language of localization and orientation plays an important role to delineate tentative insights into the relationship between the human and the divine. These spatial metaphors are presumably based on the universal human experience of interaction between the body and its environment. It is dangerous, however, to postulate universal agreement on meanings associated with s...

  8. The importance of ribosome production, and the 5S RNP-MDM2 pathway, in health and disease.

    Science.gov (United States)

    Pelava, Andria; Schneider, Claudia; Watkins, Nicholas J

    2016-08-15

    Ribosomes are abundant, large RNA-protein complexes that are the source of all protein synthesis in the cell. The production of ribosomes is an extremely energetically expensive cellular process that has long been linked to human health and disease. More recently, it has been shown that ribosome biogenesis is intimately linked to multiple cellular signalling pathways and that defects in ribosome production can lead to a wide variety of human diseases. Furthermore, changes in ribosome production in response to nutrient levels in the diet lead to metabolic re-programming of the liver. Reduced or abnormal ribosome production in response to cellular stress or mutations in genes encoding factors critical for ribosome biogenesis causes the activation of the tumour suppressor p53, which leads to re-programming of cellular transcription. The ribosomal assembly intermediate 5S RNP (ribonucleoprotein particle), containing RPL5, RPL11 and the 5S rRNA, accumulates when ribosome biogenesis is blocked. The excess 5S RNP binds to murine double minute 2 (MDM2), the main p53-suppressor in the cell, inhibiting its function and leading to p53 activation. Here, we discuss the involvement of ribosome biogenesis in the homoeostasis of p53 in the cell and in human health and disease. © 2016 The Author(s).

  9. Comparative analysis of chromosomal localization of ribosomal and telomeric DNA markers in three species of Pyrgomorphidae grasshoppers

    Directory of Open Access Journals (Sweden)

    Olesya G. Buleu

    2017-09-01

    Full Text Available The karyotypes of three species of Pyrgomorphidae grasshoppers were studied: Zonocerus elegans (Thunberg, 1815, Pyrgomorpha guentheri (Burr, 1899 and Atractomorpha lata (Mochulsky, 1866. Data on karyotypes of P. guentheri and Z. elegans are reported here for the first time. All species have karyotypes consisting of 19 acrocentric chromosomes in males and 20 acrocentric chromosomes in females (2n♂=19, NF=19; 2n♀=20, NF=20 and X0/XX sex determination system. A comparative analysis of the localization of C-heterochromatin, clusters of ribosomal DNA, and telomere repeats revealed inter-species diversity in these cytogenetic markers. These differences indicate that the karyotype divergence in the species studied is not associated with structural chromosome rearrangements, but with the evolution of repeated DNA sequences.

  10. Structural basis for ribosome protein S1 interaction with RNA in trans-translation of Mycobacterium tuberculosis.

    Science.gov (United States)

    Fan, Yi; Dai, Yazhuang; Hou, Meijing; Wang, Huilin; Yao, Hongwei; Guo, Chenyun; Lin, Donghai; Liao, Xinli

    2017-05-27

    Ribosomal protein S1 (RpsA), the largest 30S protein in ribosome, plays a significant role in translation and trans-translation. In Mycobacterium tuberculosis, the C-terminus of RpsA is known as tuberculosis drug target of pyrazinoic acid, which inhibits the interaction between MtRpsA and tmRNA in trans-translation. However, the molecular mechanism underlying the interaction of MtRpsA with tmRNA remains unknown. We herein analyzed the interaction of the C-terminal domain of MtRpsA with three RNA fragments poly(A), sMLD and pre-sMLD. NMR titration analysis revealed that the RNA binding sites on MtRpsA CTD are mainly located in the β2, β3 and β5 strands and the adjacent L3 loop of the S1 domain. Fluorescence experiments determined the MtRpsA CTD binding to RNAs are in the micromolar affinity range. Sequence analysis also revealed conserved residues in the mapped RNA binding region. Residues L304, V305, G308, F310, H322, I323, R357 and I358 were verified to be the key residues influencing the interaction between MtRpsA CTD and pre-sMLD. Molecular docking further confirmed that the poly(A)-like sequence and sMLD of tmRNA are all involved in the protein-RNA interaction, through charged interaction and hydrogen bonds. The results will be beneficial for designing new anti-tuberculosis drugs. Copyright © 2017 Elsevier Inc. All rights reserved.

  11. Mathematics revealed

    CERN Document Server

    Berman, Elizabeth

    1979-01-01

    Mathematics Revealed focuses on the principles, processes, operations, and exercises in mathematics.The book first offers information on whole numbers, fractions, and decimals and percents. Discussions focus on measuring length, percent, decimals, numbers as products, addition and subtraction of fractions, mixed numbers and ratios, division of fractions, addition, subtraction, multiplication, and division. The text then examines positive and negative numbers and powers and computation. Topics include division and averages, multiplication, ratios, and measurements, scientific notation and estim

  12. Ribosomal proteins L11 and L10.(L12)4 and the antibiotic thiostrepton interact with overlapping regions of the 23 S rRNA backbone in the ribosomal GTPase centre

    DEFF Research Database (Denmark)

    Rosendahl, G; Douthwaite, S

    1993-01-01

    RNA, and to investigate how this interaction is influenced by other ribosomal components. Complexes were characterized in both naked 23 S rRNA and ribosomes from an E. coli L11-minus strain, before and after reconstitution with L11. The protein protects 17 riboses between positions 1058 and 1085 in the naked 23 S r......The Escherichia coli ribosomal protein (r-protein) L11 and its binding site on 23 S ribosomal RNA (rRNA) are associated with ribosomal hydrolysis of guanosine 5'-triphosphate (GTP). We have used hydroxyl radical footprinting to map the contacts between L11 and the backbone riboses in 23 S r......)4 and other proteins within the ribosome. The antibiotics thiostrepton and micrococcin inhibit the catalytic functions of this region by slotting in between the accessible loops and interacting with nucleotides there....

  13. Ribosomal binding region for the antibiotic tiamulin: stoichiometry, subunit location, and affinity for various analogs.

    Science.gov (United States)

    Högenauer, G; Ruf, C

    1981-01-01

    Equilibrium dialysis experiments with a highly purified preparation of labeled tiamulin, a semisynthetic derivative of the antibiotic pleuromutilin, and Escherichia coli ribosomes allowed the determination of two binding sites for the drug. The binding reaction showed a cooperative effect. Of the two subunits, the 50S particle was able to bind the antibiotic in a 1:1 stoichiometry. Hence, the 50S subunit contributed predominantly to the binding energy which held the antibiotic to the ribosomes. The 30S subunit, showing no strong affinity for the drug, may be needed for the generation of the second binding site in the 70S particle. If depleted of ammonium ions, 70S ribosomes lost their binding capacity for the antibiotic. The attachment sites for tiamulin could be restored by heating the ribosomes to 40 degrees C in the presence of either ammonium ions or the antibiotic. Other pleuromutilin derivatives displaced labeled tiamulin from its ribosomal binding sites. By quantifying this competition, the relative affinity of various pleuromutilin derivatives for E. coli ribosomes was determined. The binding correlated with the minimal inhibitory concentrations of these compounds against E. coli. When compared with the minimal inhibitory concentrations of these compounds against E. coli. When compared with the minimal inhibitory concentrations against E. coli. When compared with the minimal inhibitory concentrations against Staphylococcus aureus, the correlation was less strict, but the same trend prevailed. These results suggest that the antibacterial activities of various pleuromutilin derivatives on a given test organism are mainly determined by the strength of binding to the ribosomes within the bacterial cell. PMID:6751216

  14. Spatial networks

    Science.gov (United States)

    Barthélemy, Marc

    2011-02-01

    Complex systems are very often organized under the form of networks where nodes and edges are embedded in space. Transportation and mobility networks, Internet, mobile phone networks, power grids, social and contact networks, and neural networks, are all examples where space is relevant and where topology alone does not contain all the information. Characterizing and understanding the structure and the evolution of spatial networks is thus crucial for many different fields, ranging from urbanism to epidemiology. An important consequence of space on networks is that there is a cost associated with the length of edges which in turn has dramatic effects on the topological structure of these networks. We will thoroughly explain the current state of our understanding of how the spatial constraints affect the structure and properties of these networks. We will review the most recent empirical observations and the most important models of spatial networks. We will also discuss various processes which take place on these spatial networks, such as phase transitions, random walks, synchronization, navigation, resilience, and disease spread.

  15. Spatial interpolation

    NARCIS (Netherlands)

    Stein, A.

    1991-01-01

    The theory and practical application of techniques of statistical interpolation are studied in this thesis, and new developments in multivariate spatial interpolation and the design of sampling plans are discussed. Several applications to studies in soil science are

  16. Binding of Signal Recognition Particle Gives Ribosome/Nascent Chain Complexes a Competitive Advantage in Endoplasmic Reticulum Membrane Interaction

    Science.gov (United States)

    Neuhof, Andrea; Rolls, Melissa M.; Jungnickel, Berit; Kalies, Kai-Uwe; Rapoport, Tom A.

    1998-01-01

    Most secretory and membrane proteins are sorted by signal sequences to the endoplasmic reticulum (ER) membrane early during their synthesis. Targeting of the ribosome-nascent chain complex (RNC) involves the binding of the signal sequence to the signal recognition particle (SRP), followed by an interaction of ribosome-bound SRP with the SRP receptor. However, ribosomes can also independently bind to the ER translocation channel formed by the Sec61p complex. To explain the specificity of membrane targeting, it has therefore been proposed that nascent polypeptide-associated complex functions as a cytosolic inhibitor of signal sequence- and SRP-independent ribosome binding to the ER membrane. We report here that SRP-independent binding of RNCs to the ER membrane can occur in the presence of all cytosolic factors, including nascent polypeptide-associated complex. Nontranslating ribosomes competitively inhibit SRP-independent membrane binding of RNCs but have no effect when SRP is bound to the RNCs. The protective effect of SRP against ribosome competition depends on a functional signal sequence in the nascent chain and is also observed with reconstituted proteoliposomes containing only the Sec61p complex and the SRP receptor. We conclude that cytosolic factors do not prevent the membrane binding of ribosomes. Instead, specific ribosome targeting to the Sec61p complex is provided by the binding of SRP to RNCs, followed by an interaction with the SRP receptor, which gives RNC–SRP complexes a selective advantage in membrane targeting over nontranslating ribosomes. PMID:9436994

  17. Synthesis and methylation of ribosomal RNA in HeLa cells infected with the herpes virus pseudorabies virus

    International Nuclear Information System (INIS)

    Furlong, J.C.; Kyriakidis, S.; Stevely, W.S.

    1982-01-01

    The effects of infection with the herpes virus pseudorabies virus on the metabolism of HeLa cell ribosomal RNA were examined. There is a decline both in the synthesis of nucleolar 45S ribosomal precursor RNA and in its processing to mature cytoplasmic RNA. The methylated oligonucleotides in the ribosomal RNA species were studied. The methylation of cytoplasmic ribosomal RNA was essentially unchanged. However there was some undermethylation of the nucleolar precursor. If undermethylated RNA does not mature then this may partly explain the reduced processing in the infected cells. (Author)

  18. Mice with a Mutation in the Mdm2 Gene That Interferes with MDM2/Ribosomal Protein Binding Develop a Defect in Erythropoiesis.

    Directory of Open Access Journals (Sweden)

    Takuya Kamio

    Full Text Available MDM2, an E3 ubiquitin ligase, is an important negative regulator of tumor suppressor p53. In turn the Mdm2 gene is a transcriptional target of p53, forming a negative feedback loop that is important in cell cycle control. It has recently become apparent that the ubiquitination of p53 by MDM2 can be inhibited when certain ribosomal proteins, including RPL5 and RPL11, bind to MDM2. This inhibition, and the resulting increase in p53 levels has been proposed to be responsible for the red cell aplasia seen in Diamond-Blackfan anemia (DBA and in 5q- myelodysplastic syndrome (MDS. DBA and 5q- MDS are associated with inherited (DBA or acquired (5q- MDS haploinsufficiency of ribosomal proteins. A mutation in Mdm2 causing a C305F amino acid substitution blocks the binding of ribosomal proteins. Mice harboring this mutation (Mdm2C305F, retain a normal p53 response to DNA damage, but lack the p53 response to perturbations in ribosome biogenesis. While studying the interaction between RP haploinsufficiency and the Mdm2C305F mutation we noticed that Mdm2C305F homozygous mice had altered hematopoiesis. These mice developed a mild macrocytic anemia with reticulocytosis. In the bone marrow (BM, these mice showed a significant decrease in Ter119hi cells compared to wild type (WT littermates, while no decrease in the number of mature erythroid cells (Ter119hiCD71low was found in the spleen, which showed compensated bone marrow hematopoiesis. In methylcellulose cultures, BFU-E colonies from the mutant mice were slightly reduced in number and there was a significant reduction in CFU-E colony numbers in mutant mice compared with WT controls (p < 0.01. This erythropoietic defect was abrogated by concomitant p53 deficiency (Trp53ko/ko. Further investigation revealed that in Mdm2C305F animals, there was a decrease in Lin-Sca-1+c-Kit+ (LSK cells, accompanied by significant decreases in multipotent progenitor (MPP cells (p < 0.01. Competitive BM repopulation experiments

  19. The Proximity of Ribosomal Protein Genes to oriC Enhances Vibrio cholerae Fitness in the Absence of Multifork Replication.

    Science.gov (United States)

    Soler-Bistué, Alfonso; Timmermans, Michaël; Mazel, Didier

    2017-02-28

    Recent works suggest that bacterial gene order links chromosome structure to cell homeostasis. Comparative genomics showed that, in fast-growing bacteria, ribosomal protein genes (RP) locate near the replication origin ( oriC ). We recently showed that Vibrio cholerae employs this positional bias as a growth optimization strategy: under fast-growth conditions, multifork replication increases RP dosage and expression. However, RP location may provide advantages in a dosage-independent manner: for example, the physical proximity of the many ribosomal components, in the context of a crowded cytoplasm, may favor ribosome biogenesis. To uncover putative dosage-independent effects, we studied isogenic V. cholerae derivatives in which the major RP locus, S10-spc-α (S10), was relocated to alternative genomic positions. When bacteria grew fast, bacterial fitness was reduced according to the S10 relative distance to oriC The growth of wild-type V. cholerae could not be improved by additional copies of the locus, suggesting a physiologically optimized genomic location. Slow growth is expected to uncouple RP position from dosage, since multifork replication does not occur. Under these conditions, we detected a fitness impairment when S10 was far from oriC Deep sequencing followed by marker frequency analysis in the absence of multifork replication revealed an up to 30% S10 dosage reduction associated with its relocation that closely correlated with fitness alterations. Hence, the impact of S10 location goes beyond a growth optimization strategy during feast periods. RP location may be important during the whole life cycle of this pathogen. IMPORTANCE The role of gene order within the bacterial chromosome is poorly understood. In fast growers, the location of genes linked with the expression of genetic information (i.e., transcription and translation) is biased toward oriC It was proposed that the location of these genes helps to maximize their expression by recruiting

  20. p53- and ERK7-dependent ribosome surveillance response regulates Drosophila insulin-like peptide secretion.

    Directory of Open Access Journals (Sweden)

    Kiran Hasygar

    2014-11-01

    Full Text Available Insulin-like signalling is a conserved mechanism that coordinates animal growth and metabolism with nutrient status. In Drosophila, insulin-producing median neurosecretory cells (IPCs regulate larval growth by secreting insulin-like peptides (dILPs in a diet-dependent manner. Previous studies have shown that nutrition affects dILP secretion through humoral signals derived from the fat body. Here we uncover a novel mechanism that operates cell autonomously in the IPCs to regulate dILP secretion. We observed that impairment of ribosome biogenesis specifically in the IPCs strongly inhibits dILP secretion, which consequently leads to reduced body size and a delay in larval development. This response is dependent on p53, a known surveillance factor for ribosome biogenesis. A downstream effector of this growth inhibitory response is an atypical MAP kinase ERK7 (ERK8/MAPK15, which is upregulated in the IPCs following impaired ribosome biogenesis as well as starvation. We show that ERK7 is sufficient and essential to inhibit dILP secretion upon impaired ribosome biogenesis, and it acts epistatically to p53. Moreover, we provide evidence that p53 and ERK7 contribute to the inhibition of dILP secretion upon starvation. Thus, we conclude that a cell autonomous ribosome surveillance response, which leads to upregulation of ERK7, inhibits dILP secretion to impede tissue growth under limiting dietary conditions.

  1. Fluctuations in protein synthesis from a single RNA template: stochastic kinetics of ribosomes.

    Science.gov (United States)

    Garai, Ashok; Chowdhury, Debashish; Ramakrishnan, T V

    2009-01-01

    Proteins are polymerized by cyclic machines called ribosomes, which use their messenger RNA (mRNA) track also as the corresponding template, and the process is called translation. We explore, in depth and detail, the stochastic nature of the translation. We compute various distributions associated with the translation process; one of them--namely, the dwell time distribution--has been measured in recent single-ribosome experiments. The form of the distribution, which fits best with our simulation data, is consistent with that extracted from the experimental data. For our computations, we use a model that captures both the mechanochemistry of each individual ribosome and their steric interactions. We also demonstrate the effects of the sequence inhomogeneities of real genes on the fluctuations and noise in translation. Finally, inspired by recent advances in the experimental techniques of manipulating single ribosomes, we make theoretical predictions on the force-velocity relation for individual ribosomes. In principle, all our predictions can be tested by carrying out in vitro experiments.

  2. Diamond Blackfan Anemia at the Crossroad between Ribosome Biogenesis and Heme Metabolism

    Directory of Open Access Journals (Sweden)

    Deborah Chiabrando

    2010-01-01

    Full Text Available Diamond-Blackfan anemia (DBA is a rare, pure red-cell aplasia that presents during infancy. Approximately 40% of cases are associated with other congenital defects, particularly malformations of the upper limb or craniofacial region. Mutations in the gene coding for the ribosomal protein RPS19 have been identified in 25% of patients with DBA, with resulting impairment of 18S rRNA processing and 40S ribosomal subunit formation. Moreover, mutations in other ribosomal protein coding genes account for about 25% of other DBA cases. Recently, the analysis of mice from which the gene coding for the heme exporter Feline Leukemia Virus subgroup C Receptor (FLVCR1 is deleted suggested that this gene may be involved in the pathogenesis of DBA. FLVCR1-null mice show a phenotype resembling that of DBA patients, including erythroid failure and malformations. Interestingly, some DBA patients have disease linkage to chromosome 1q31, where FLVCR1 is mapped. Moreover, it has been reported that cells from DBA patients express alternatively spliced isoforms of FLVCR1 which encode non-functional proteins. Herein, we review the known roles of RPS19 and FLVCR1 in ribosome function and heme metabolism respectively, and discuss how the deficiency of a ribosomal protein or of a heme exporter may result in the same phenotype.

  3. Structural and functional organization of ribosomal genes within the mammalian cell nucleolus.

    Science.gov (United States)

    Derenzini, Massimo; Pasquinelli, Gianandrea; O'Donohue, Marie-Françoise; Ploton, Dominique; Thiry, Marc

    2006-02-01

    Data on the in situ structural-functional organization of ribosomal genes in the mammalian cell nucleolus are reviewed here. Major findings on chromatin structure in situ come from investigations carried out using the Feulgen-like osmium ammine reaction as a highly specific electron-opaque DNA tracer. Intranucleolar chromatin shows three different levels of organization: compact clumps, fibers ranging from 11 to 30 nm, and loose agglomerates of extended DNA filaments. Both clumps and fibers of chromatin exhibit a nucleosomal organization that is lacking in the loose agglomerates of extended DNA filaments. In fact, these filaments constantly show a thickness of 2-3 nm, the same as a DNA double-helix molecule. The loose agglomerates of DNA filaments are located in the fibrillar centers, the interphase counterpart of metaphase NORs, therefore being constituted by ribosomal DNA. The extended, non-nucleosomal configuration of this rDNA has been shown to be independent of transcriptional activity and characterizes ribosome genes that are either transcribed or transcriptionally silent. Data reviewed are consistent with a model of control for ribosome gene activity that is not mediated by changes in chromatin structure. The presence of rDNA in mammalian cells always structurally ready for transcription might facilitate a more rapid adjustment of the ribosome production in response to the metabolic needs of the cell.

  4. The nuclear import of ribosomal proteins is regulated by mTOR

    Science.gov (United States)

    Kazyken, Dubek; Kaz, Yelimbek; Kiyan, Vladimir; Zhylkibayev, Assylbek A.; Chen, Chien-Hung; Agarwal, Nitin K.; Sarbassov, Dos D.

    2014-01-01

    Mechanistic target of rapamycin (mTOR) is a central component of the essential signaling pathway that regulates cell growth and proliferation by controlling anabolic processes in cells. mTOR exists in two distinct mTOR complexes known as mTORC1 and mTORC2 that reside mostly in cytoplasm. In our study, the biochemical characterization of mTOR led to discovery of its novel localization on nuclear envelope where it associates with a critical regulator of nuclear import Ran Binding Protein 2 (RanBP2). We show that association of mTOR with RanBP2 is dependent on the mTOR kinase activity that regulates the nuclear import of ribosomal proteins. The mTOR kinase inhibitors within thirty minutes caused a substantial decrease of ribosomal proteins in the nuclear but not cytoplasmic fraction. Detection of a nuclear accumulation of the GFP-tagged ribosomal protein rpL7a also indicated its dependence on the mTOR kinase activity. The nuclear abundance of ribosomal proteins was not affected by inhibition of mTOR Complex 1 (mTORC1) by rapamycin or deficiency of mTORC2, suggesting a distinctive role of the nuclear envelope mTOR complex in the nuclear import. Thus, we identified that mTOR in association with RanBP2 mediates the active nuclear import of ribosomal proteins. PMID:25294810

  5. Thermus Thermophilus as a Model System for the Study of Ribosomal Antibiotic Resistance

    Science.gov (United States)

    Gregory, Steven T.

    2018-03-01

    Ribosomes are the intracellular ribonucleoprotein machines responsible for the translation of mRNA sequence into protein sequence. As an essential cell component, the ribosome is the target of numerous antibiotics that bind to critical functional sites to impair protein synthesis. Mutations causing resistance to antibiotics arise in antibiotic binding sites, and an understanding of the basis of resistance will be an essential component of efforts to develop new antibiotics by rational drug design. We have identified a number of antibiotic-resistance mutations in ribosomal genes of the thermophilic bacterium Thermus thermophilus. This species offers two primary advantages for examining the structural basis of antibiotic-resistance, in particular, its potential for genetic manipulation and the suitability of its ribosomes for analysis by X-ray crystallography. Mutations we have identified in this organism are in many instances identical to those found in other bacterial species, including important pathogens, a result of the extreme conservation of ribosome functional sites. Here I summarize the advantages of this organism as a model system to study antibiotic-resistance mechanisms at the molecular level.

  6. RPL41, a Small Ribosomal Peptide Deregulated in Tumors, Is Essential for Mitosis and Centrosome Integrity

    Directory of Open Access Journals (Sweden)

    Shan Wang

    2010-03-01

    Full Text Available Ribosomal large subunit protein RPL41 is a basic (positively charged peptide consisting of only 25 amino acids. An antisense-based functional screening revealed that the down-regulation of RPL41 led to an anchorage-independent growth of NIH3T3 cells in soft agar plates. RPL41 depletion with gene-specific small interfering RNA also resulted in malignant transformation of NIH3T3 cells including increased tumor growth in mice. RPL41 deletion was detected in 59% of tumor cell lines by fluorescence in situ hybridization analyses and RPL41 down-regulation in 75% of primary breast cancers by real-time quantitative reverse transcription-polymerase chain reaction. These studies suggest a tumor suppression role for RPL41. By mass spectrometry, RPL41 was associated with several cytoskeleton components including tubulin β, γ, and myosin IIA, which was confirmed by Western blot analysis on both cellular lysis and individually in vitro-expressed proteins. RPL41 also bound directly to polymerized tubulins. Cells overexpressing a GFP-RPL41 were resistant to nocodazole-induced microtubule depolymerization. A synthetic RPL41 induced cellular α-tubulin acetylation and G2/M cell cycle arrest. These results indicate a stabilizing role of RPL41 on microtubule. Microtubule spindles are essential for chromosome segregation during mitosis. Cells with RPL41 knock-down showed abnormal spindles, frequent failure of cytokinesis, and formation of polynuclear cells. In interphase cells, RPL41-depleted cells had premature splitting of centrosome. Our results provide evidence that RPL41 is a microtubule-associated protein essential for functional spindles and for the integrity of centrosome and that the abnormal mitosis and disrupted centrosome associated with the RPL41 down-regulation may be related to malignant transformation.

  7. Characterization of the ovine ribosomal protein SA gene and its pseudogenes

    Directory of Open Access Journals (Sweden)

    Van Zeveren Alex

    2010-03-01

    Full Text Available Abstract Background The ribosomal protein SA (RPSA, previously named 37-kDa laminin receptor precursor/67-kDa laminin receptor (LRP/LR is a multifunctional protein that plays a role in a number of pathological processes, such as cancer and prion diseases. In all investigated species, RPSA is a member of a multicopy gene family consisting of one full length functional gene and several pseudogenes. Therefore, for studies on RPSA related pathways/pathologies, it is important to characterize the whole family and to address the possible function of the other RPSA family members. The present work aims at deciphering the RPSA family in sheep. Results In addition to the full length functional ovine RPSA gene, 11 other members of this multicopy gene family, all processed pseudogenes, were identified. Comparison between the RPSA transcript and these pseudogenes shows a large variety in sequence identities ranging from 99% to 74%. Only one of the 11 pseudogenes, i.e. RPSAP7, shares the same open reading frame (ORF of 295 amino acids with the RPSA gene, differing in only one amino acid. All members of the RPSA family were annotated by comparative mapping and fluorescence in situ hybridization (FISH localization. Transcription was investigated in the cerebrum, cerebellum, spleen, muscle, lymph node, duodenum and blood, and transcripts were detected for 6 of the 11 pseudogenes in some of these tissues. Conclusions In the present work we have characterized the ovine RPSA family. Our results have revealed the existence of 11 ovine RPSA pseudogenes and provide new data on their structure and sequence. Such information will facilitate molecular studies of the functional RPSA gene taking into account the existence of these pseudogenes in the design of experiments. It remains to be investigated if the transcribed members are functional as regulatory non-coding RNA or as functional proteins.

  8. Evolutional dynamics of 45S and 5S ribosomal DNA in ancient allohexaploid Atropa belladonna.

    Science.gov (United States)

    Volkov, Roman A; Panchuk, Irina I; Borisjuk, Nikolai V; Hosiawa-Baranska, Marta; Maluszynska, Jolanta; Hemleben, Vera

    2017-01-23

    Polyploid hybrids represent a rich natural resource to study molecular evolution of plant genes and genomes. Here, we applied a combination of karyological and molecular methods to investigate chromosomal structure, molecular organization and evolution of ribosomal DNA (rDNA) in nightshade, Atropa belladonna (fam. Solanaceae), one of the oldest known allohexaploids among flowering plants. Because of their abundance and specific molecular organization (evolutionarily conserved coding regions linked to variable intergenic spacers, IGS), 45S and 5S rDNA are widely used in plant taxonomic and evolutionary studies. Molecular cloning and nucleotide sequencing of A. belladonna 45S rDNA repeats revealed a general structure characteristic of other Solanaceae species, and a very high sequence similarity of two length variants, with the only difference in number of short IGS subrepeats. These results combined with the detection of three pairs of 45S rDNA loci on separate chromosomes, presumably inherited from both tetraploid and diploid ancestor species, example intensive sequence homogenization that led to substitution/elimination of rDNA repeats of one parent. Chromosome silver-staining revealed that only four out of six 45S rDNA sites are frequently transcriptionally active, demonstrating nucleolar dominance. For 5S rDNA, three size variants of repeats were detected, with the major class represented by repeats containing all functional IGS elements required for transcription, the intermediate size repeats containing partially deleted IGS sequences, and the short 5S repeats containing severe defects both in the IGS and coding sequences. While shorter variants demonstrate increased rate of based substitution, probably in their transition into pseudogenes, the functional 5S rDNA variants are nearly identical at the sequence level, pointing to their origin from a single parental species. Localization of the 5S rDNA genes on two chromosome pairs further supports uniparental

  9. A Sensitive and Specific PCR Based Method for Identification of Cryptosporidium Sp. Using New Primers from 18S Ribosomal RNA

    Directory of Open Access Journals (Sweden)

    M Heydarnezhadi

    2011-09-01

    Full Text Available Background: The main goal of the present study was to develop a new sensitive and specific PCR based method for Identification of Cryptosporidium sp. using novel primers from 18S ribosomal RNA. Cryptosporidi­osis in high-risk host groups particularly in neonates and immuno-compromised individuals may result in death. To the best of our knowledge this is the first study regarding develop a new PCR based method to diagnose the cryptosporidiosis in Iran.Methods: A total of 850 human fecal samples from patients clinically suspected to cryptosporidiosis and 100 healthy and diarrheic cattle stool specimens were collected. The simplified formol-ether concentration method was carried out for all samples. They were then examined microscopically by modified Ziehl-Neel­sen staining method. Total DNA was extracted by QIA amp DNA stool mini kit was carried out by using designed prim­ers.Results: Twenty nine cases of cryptosporidiosis infection in human and 30 samples from cattle microscopi­cally were posi­tive. The described primary and nested PCR method could detect all Cryptospori­dium positive samples from human and cattle. Regards to suspected negative samples in pri­mary PCR examination, the Nested PCR could ap­prove two more positive results. Furthermore, Nested PCR analysis was able to detect one more case which was nega­tive in both microscopically examination and primary PCR. Specificity of the test was 100%. Sensitivity of Nested PCR in comparison to our gold standard; microscopy after Ridley concentration modified ziehl-Neelsen, was 100 %.Conclusion: Our developed PCR based method by using new primers devised from 18S ribosomal RNA revealed the ability for identification of the Cryptosporidium species such as C. parvum and C. huminis with high specificity and sensitivity.

  10. Spatial distribution

    DEFF Research Database (Denmark)

    Borregaard, Michael Krabbe; Hendrichsen, Ditte Katrine; Nachman, Gøsta Støger

    2008-01-01

    , depending on the nature of intraspecific interactions between them: while the individuals of some species repel each other and partition the available area, others form groups of varying size, determined by the fitness of each group member. The spatial distribution pattern of individuals again strongly......Living organisms are distributed over the entire surface of the planet. The distribution of the individuals of each species is not random; on the contrary, they are strongly dependent on the biology and ecology of the species, and vary over different spatial scale. The structure of whole...... populations reflects the location and fragmentation pattern of the habitat types preferred by the species, and the complex dynamics of migration, colonization, and population growth taking place over the landscape. Within these, individuals are distributed among each other in regular or clumped patterns...

  11. Spatial Culture

    DEFF Research Database (Denmark)

    Reeh, Henrik

    2012-01-01

    Spatial Culture – A Humanities Perspective Abstract of introductory essay by Henrik Reeh Secured by alliances between socio-political development and cultural practices, a new field of humanistic studies in spatial culture has developed since the 1990s. To focus on links between urban culture...... and modern society is, however, an intellectual practice which has a much longer history. Already in the 1980s, the debate on the modern and the postmodern cited Paris and Los Angeles as spatio-cultural illustrations of these major philosophical concepts. Earlier, in the history of critical studies, the work...... Foucault considered a constitutive feature of 20th-century thinking and one that continues to occupy intellectual and cultural debates in the third millennium. A conceptual framework is, nevertheless, necessary, if the humanities are to adequa-tely address city and space – themes that have long been...

  12. Interplay of ribosomal DNA loci in nucleolar dominance: dominant NORs are up-regulated by chromatin dynamics in the wheat-rye system.

    Directory of Open Access Journals (Sweden)

    Manuela Silva

    Full Text Available BACKGROUND: Chromatin organizational and topological plasticity, and its functions in gene expression regulation, have been strongly revealed by the analysis of nucleolar dominance in hybrids and polyploids where one parental set of ribosomal RNA (rDNA genes that are clustered in nucleolar organizing regions (NORs, is rendered silent by epigenetic pathways and heterochromatization. However, information on the behaviour of dominant NORs is very sparse and needed for an integrative knowledge of differential gene transcription levels and chromatin specific domain interactions. METHODOLOGY/PRINCIPAL FINDINGS: Using molecular and cytological approaches in a wheat-rye addition line (wheat genome plus the rye nucleolar chromosome pair 1R, we investigated transcriptional activity and chromatin topology of the wheat dominant NORs in a nucleolar dominance situation. Herein we report dominant NORs up-regulation in the addition line through quantitative real-time PCR and silver-staining technique. Accompanying this modification in wheat rDNA trascription level, we also disclose that perinucleolar knobs of ribosomal chromatin are almost transcriptionally silent due to the residual detection of BrUTP incorporation in these domains, contrary to the marked labelling of intranucleolar condensed rDNA. Further, by comparative confocal analysis of nuclei probed to wheat and rye NORs, we found that in the wheat-rye addition line there is a significant decrease in the number of wheat-origin perinucleolar rDNA knobs, corresponding to a diminution of the rDNA heterochromatic fraction of the dominant (wheat NORs. CONCLUSIONS/SIGNIFICANCE: We demonstrate that inter-specific interactions leading to wheat-origin NOR dominance results not only on the silencing of rye origin NOR loci, but dominant NORs are also modified in their transcriptional activity and interphase organization. The results show a cross-talk between wheat and rye NORs, mediated by ribosomal chromatin

  13. Detection of protein-protein interactions by ribosome display and protein in situ immobilisation.

    Science.gov (United States)

    He, Mingyue; Liu, Hong; Turner, Martin; Taussig, Michael J

    2009-12-31

    We describe a method for identification of protein-protein interactions by combining two cell-free protein technologies, namely ribosome display and protein in situ immobilisation. The method requires only PCR fragments as the starting material, the target proteins being made through cell-free protein synthesis, either associated with their encoding mRNA as ribosome complexes or immobilised on a solid surface. The use of ribosome complexes allows identification of interacting protein partners from their attached coding mRNA. To demonstrate the procedures, we have employed the lymphocyte signalling proteins Vav1 and Grb2 and confirmed the interaction between Grb2 and the N-terminal SH3 domain of Vav1. The method has promise for library screening of pairwise protein interactions, down to the analytical level of individual domain or motif mapping.

  14. Binding site of ribosomal proteins on prokaryotic 5S ribonucleic acids: a study with ribonucleases

    DEFF Research Database (Denmark)

    Douthwaite, S; Christensen, A; Garrett, R A

    1982-01-01

    The binding sites of ribosomal proteins L18 and L25 on 5S RNA from Escherichia coli were probed with ribonucleases A, T1, and T2 and a double helix specific cobra venom endonuclease. The results for the protein-RNA complexes, which were compared with those for the free RNA [Douthwaite, S...... stearothermophilus 5S RNA. Several protein-induced changes in the RNA structures were identified; some are possibly allosteric in nature. The two prokaryotic 5S RNAs were also incubated with total 50S subunit proteins from E. coli and B. stearothermophilus ribosomes. Homologous and heterologous reconstitution....... stearothermophilus 5S RNA, which may have been due to a third ribosomal protein L5....

  15. Defining the structural requirements for a helix in 23 S ribosomal RNA that confers erythromycin resistance

    DEFF Research Database (Denmark)

    Douthwaite, S; Powers, T; Lee, J Y

    1989-01-01

    The helix spanning nucleotides 1198 to 1247 (helix 1200-1250) in Escherichia coli 23 S ribosomal RNA (rRNA) is functionally important in protein synthesis, and deletions in this region confer erythromycin resistance. In order to define the structural requirements for resistance, we have dissected...... deletion mutants show a sensitive phenotype. Deletions that extend into the base-pairing between GCC1208 and GGU1240 result in non-functional 23 S RNAs, which consequently do not confer resistance. A number of phylogenetically conserved nucleotides have been shown to be non-essential for 23 S RNA function....... However, removal of either these or non-conserved nucleotides from helix 1200-1250 measurably reduces the efficiency of 23 S RNA in forming functional ribosomes. We have used chemical probing and a modified primer extension method to investigate erythromycin binding to wild-type and resistant ribosomes...

  16. Cross-linking of streptomycin to the 16S ribosomal RNA of Escherichia coli

    International Nuclear Information System (INIS)

    Gravel, M.; Melancon, P.; Barkier-Gingras, L.

    1987-01-01

    [ 3 H]Dihydrostreptomycin was cross-linked to the 30S ribosomal subunit from Escherichia coli with the bifunctional reagent nitrogen mustard. The cross-linking primarily involved the 16S RNA. To localize the site of cross-linking of streptomycin to the 16S RNA, the authors hybridized RNA labeled with streptomycin to restriction fragments of the 16S RNA gene. Labeled RNA hybridized to DNA fragments corresponding to bases 892-917 and bases 1394-1415. These two segments of the ribosomal RNA must by juxtaposed in the ribosome, since there is a single binding site for streptomycin. This region has been implicated both in the decoding site and in the binding of initiation factor IF-3, indicating its functional importance

  17. Site-specific fluorescent labeling of nascent proteins on the translating ribosome.

    Science.gov (United States)

    Saraogi, Ishu; Zhang, Dawei; Chandrasekaran, Sandhya; Shan, Shu-ou

    2011-09-28

    As newly synthesized proteins emerge from the ribosome, they interact with a variety of cotranslational cellular machineries that facilitate their proper folding, maturation, and localization. These interactions are essential for proper function of the cell, and the ability to study these events is crucial to understanding cellular protein biogenesis. To this end, we have developed a highly efficient method to generate ribosome-nascent chain complexes (RNCs) site-specifically labeled with a fluorescent dye on the nascent polypeptide. The fluorescent RNC provides real-time, quantitative information on its cotranslational interaction with the signal recognition particle and will be a valuable tool in elucidating the role of the translating ribosome in numerous biochemical pathways.

  18. Sulfur restriction extends fission yeast chronological lifespan through Ecl1 family genes by downregulation of ribosome.

    Science.gov (United States)

    Ohtsuka, Hokuto; Takinami, Masahiro; Shimasaki, Takafumi; Hibi, Takahide; Murakami, Hiroshi; Aiba, Hirofumi

    2017-07-01

    Nutritional restrictions such as calorie restrictions are known to increase the lifespan of various organisms. Here, we found that a restriction of sulfur extended the chronological lifespan (CLS) of the fission yeast Schizosaccharomyces pombe. The restriction decreased cellular size, RNA content, and ribosomal proteins and increased sporulation rate. These responses depended on Ecl1 family genes, the overexpression of which results in the extension of CLS. We also showed that the Zip1 transcription factor results in the sulfur restriction-dependent expression of the ecl1 + gene. We demonstrated that a decrease in ribosomal activity results in the extension of CLS. Based on these observations, we propose that sulfur restriction extends CLS through Ecl1 family genes in a ribosomal activity-dependent manner. © 2017 John Wiley & Sons Ltd.

  19. Free and membrane-bound ribosomes and polysomes in hippocampal neurons during a learning experiment.

    Science.gov (United States)

    Wenzel, J; David, H; Pohle, W; Marx, I; Matthies, H

    1975-01-24

    The ribosomes of the CA1 and CA3 pyramidal cells of hipocampus were investigated by morphometric methods after the acquisition of a shock-motivated brightness discrimination in rats. A significant increase in the total number of ribosomes was observed in CA1 cells of trained animals and in CA3 cells of both active controls and trained rats. A significant increase in membrane-bound ribosomes was obtained in CA1 and CA3 cells after training only. The results confirm the suggestion of an increased protein synthesis in hippocampal neurons during and after the acquisition of a brightness discrimination, as we have concluded from out previous investigations on the incorporation of labeled amino acids under identical experimental conditions. The results lead to the assumption that the protein synthesis in some neuronal cells may probably differ not only quantitatively, but also qualitatively in trained and untrained animals.

  20. Resistance to Linezolid Caused by Modifications at Its Binding Site on the Ribosome

    DEFF Research Database (Denmark)

    Long, Katherine S.; Vester, Birte

    2012-01-01

    Linezolid is an oxazolidinone antibiotic in clinical use for the treatment of serious infections of resistant Gram-positive bacteria. It inhibits protein synthesis by binding to the peptidyl transferase center on the ribosome. Almost all known resistance mechanisms involve small alterations...... to the linezolid binding site, so this review will therefore focus on the various changes that can adversely affect drug binding and confer resistance. High-resolution structures of linezolid bound to the 50S ribosomal subunit show that it binds in a deep cleft that is surrounded by 23S rRNA nucleotides. Mutation...... of 23S rRNA has for some time been established as a linezolid resistance mechanism. Although ribosomal proteins L3 and L4 are located further away from the bound drug, mutations in specific regions of these proteins are increasingly being associated with linezolid resistance. However, very little...

  1. Molecular interactions within the halophilic, thermophilic, and mesophilic prokaryotic ribosomal complexes: clues to environmental adaptation.

    Science.gov (United States)

    Mallik, Saurav; Kundu, Sudip

    2015-01-01

    Using the available crystal structures of 50S ribosomal subunits from three prokaryotic species: Escherichia coli (mesophilic), Thermus thermophilus (thermophilic), and Haloarcula marismortui (halophilic), we have analyzed different structural features of ribosomal RNAs (rRNAs), proteins, and of their interfaces. We have correlated these structural features with the environmental adaptation strategies of the corresponding species. While dense intra-rRNA packing is observed in thermophilic, loose intra-rRNA packing is observed in halophilic (both compared to mesophilic). Interestingly, protein-rRNA interfaces of both the extremophiles are densely packed compared to that of the mesophilic. The intersubunit bridge regions are almost devoid of cavities, probably ensuring the proper formation of each bridge (by not allowing any loosely packed region nearby). During rRNA binding, the ribosomal proteins experience some structural transitions. Here, we have analyzed the intrinsically disordered and ordered regions of the ribosomal proteins, which are subjected to such transitions. The intrinsically disordered and disorder-to-order transition sites of the thermophilic and mesophilic ribosomal proteins are simultaneously (i) highly conserved and (ii) slowly evolving compared to rest of the protein structure. Although high conservation is observed at such sites of halophilic ribosomal proteins, but slow rate of evolution is absent. Such differences between thermophilic, mesophilic, and halophilic can be explained from their environmental adaptation strategy. Interestingly, a universal biophysical principle evident by a linear relationship between the free energy of interface formation, interface area, and structural changes of r-proteins during assembly is always maintained, irrespective of the environmental conditions.

  2. rRNA maturation in yeast cells depleted of large ribosomal subunit proteins.

    Directory of Open Access Journals (Sweden)

    Gisela Pöll

    Full Text Available The structural constituents of the large eukaryotic ribosomal subunit are 3 ribosomal RNAs, namely the 25S, 5.8S and 5S rRNA and about 46 ribosomal proteins (r-proteins. They assemble and mature in a highly dynamic process that involves more than 150 proteins and 70 small RNAs. Ribosome biogenesis starts in the nucleolus, continues in the nucleoplasm and is completed after nucleo-cytoplasmic translocation of the subunits in the cytoplasm. In this work we created 26 yeast strains, each of which conditionally expresses one of the large ribosomal subunit (LSU proteins. In vivo depletion of the analysed LSU r-proteins was lethal and led to destabilisation and degradation of the LSU and/or its precursors. Detailed steady state and metabolic pulse labelling analyses of rRNA precursors in these mutant strains showed that LSU r-proteins can be grouped according to their requirement for efficient progression of different steps of large ribosomal subunit maturation. Comparative analyses of the observed phenotypes and the nature of r-protein-rRNA interactions as predicted by current atomic LSU structure models led us to discuss working hypotheses on i how individual r-proteins control the productive processing of the major 5' end of 5.8S rRNA precursors by exonucleases Rat1p and Xrn1p, and ii the nature of structural characteristics of nascent LSUs that are required for cytoplasmic accumulation of nascent subunits but are nonessential for most of the nuclear LSU pre-rRNA processing events.

  3. Simulating movement of tRNA through the ribosome during hybrid-state formation.

    Science.gov (United States)

    Whitford, Paul C; Sanbonmatsu, Karissa Y

    2013-09-28

    Biomolecular simulations provide a means for exploring the relationship between flexibility, energetics, structure, and function. With the availability of atomic models from X-ray crystallography and cryoelectron microscopy (cryo-EM), and rapid increases in computing capacity, it is now possible to apply molecular dynamics (MD) simulations to large biomolecular machines, and systematically partition the factors that contribute to function. A large biomolecular complex for which atomic models are available is the ribosome. In the cell, the ribosome reads messenger RNA (mRNA) in order to synthesize proteins. During this essential process, the ribosome undergoes a wide range of conformational rearrangements. One of the most poorly understood transitions is translocation: the process by which transfer RNA (tRNA) molecules move between binding sites inside of the ribosome. The first step of translocation is the adoption of a "hybrid" configuration by the tRNAs, which is accompanied by large-scale rotations in the ribosomal subunits. To illuminate the relationship between these rearrangements, we apply MD simulations using a multi-basin structure-based (SMOG) model, together with targeted molecular dynamics protocols. From 120 simulated transitions, we demonstrate the viability of a particular route during P/E hybrid-state formation, where there is asynchronous movement along rotation and tRNA coordinates. These simulations not only suggest an ordering of events, but they highlight atomic interactions that may influence the kinetics of hybrid-state formation. From these simulations, we also identify steric features (H74 and surrounding residues) encountered during the hybrid transition, and observe that flexibility of the single-stranded 3'-CCA tail is essential for it to reach the endpoint. Together, these simulations provide a set of structural and energetic signatures that suggest strategies for modulating the physical-chemical properties of protein synthesis by the

  4. Acrolein preferentially damages nucleolus eliciting ribosomal stress and apoptosis in human cancer cells.

    Science.gov (United States)

    Wang, Hsiang-Tsui; Chen, Tzu-Ying; Weng, Ching-Wen; Yang, Chun-Hsiang; Tang, Moon-Shong

    2016-12-06

    Acrolein (Acr) is a potent cytotoxic and DNA damaging agent which is ubiquitous in the environment and abundant in tobacco smoke. Acr is also an active cytotoxic metabolite of the anti-cancer drugs cyclophosphamide and ifosfamide. The mechanisms via which Acr exerts its anti-cancer activity and cytotoxicity are not clear. In this study, we found that Acr induces cytotoxicity and cell death in human cancer cells with different activities of p53. Acr preferentially binds nucleolar ribosomal DNA (rDNA) to form Acr-deoxyguanosine adducts, and induces oxidative damage to both rDNA and ribosomal RNA (rRNA). Acr triggers ribosomal stress responses, inhibits rRNA synthesis, reduces RNA polymerase I binding to the promoter of rRNA gene, disrupts nucleolar integrity, and impairs ribosome biogenesis and polysome formation. Acr causes an increase in MDM2 levels and phosphorylation of MDM2 in A549 and HeLa cells which are p53 active and p53 inactive, respectively. It enhances the binding of ribosomal protein RPL11 to MDM2 and reduces the binding of p53 and E2F-1 to MDM2 resulting in stabilization/activation of p53 in A549 cells and degradation of E2F-1 in A549 and HeLa cells. We propose that Acr induces ribosomal stress which leads to activation of MDM2 and RPL11-MDM2 binding, consequently, activates p53 and enhances E2F-1 degradation, and that taken together these two processes induce apoptosis and cell death.

  5. Integrative analysis of RNA, translation, and protein levels reveals distinct regulatory variation across humans.

    Science.gov (United States)

    Cenik, Can; Cenik, Elif Sarinay; Byeon, Gun W; Grubert, Fabian; Candille, Sophie I; Spacek, Damek; Alsallakh, Bilal; Tilgner, Hagen; Araya, Carlos L; Tang, Hua; Ricci, Emiliano; Snyder, Michael P

    2015-11-01

    Elucidating the consequences of genetic differences between humans is essential for understanding phenotypic diversity and personalized medicine. Although variation in RNA levels, transcription factor binding, and chromatin have been explored, little is known about global variation in translation and its genetic determinants. We used ribosome profiling, RNA sequencing, and mass spectrometry to perform an integrated analysis in lymphoblastoid cell lines from a diverse group of individuals. We find significant differences in RNA, translation, and protein levels suggesting diverse mechanisms of personalized gene expression control. Combined analysis of RNA expression and ribosome occupancy improves the identification of individual protein level differences. Finally, we identify genetic differences that specifically modulate ribosome occupancy--many of these differences lie close to start codons and upstream ORFs. Our results reveal a new level of gene expression variation among humans and indicate that genetic variants can cause changes in protein levels through effects on translation. © 2015 Cenik et al.; Published by Cold Spring Harbor Laboratory Press.

  6. The ribosomal protein uL22 modulates the shape of the nascent protein exit tunnel

    DEFF Research Database (Denmark)

    Wekselman, I.; Zimmerman, E.; Davidovich, C.

    2017-01-01

    in the entrance of theribosomal exit tunnel and interferes with the progression of nas-cent chains. Commonly, resistance to erythromycin is acquiredby alterations of rRNA nucleotides that interact with the drug.Mutations in theb-hairpin of ribosomal protein uL22, which israther distal to the erythromycin binding...... to erythromycin binding pocket and increases its flexi-bility. Based on our results, we suggest a feasble mechanism thatexplains how nanscent proteins can be translated when ery-thromycin is bound to the ribosome. Furthermore, our findingssupport recent studies showing that the interactions betweenuL22...

  7. The Ribosomal Protein uL22 Modulates the Shape of the Protein Exit Tunnel

    DEFF Research Database (Denmark)

    Wekselman, Itai; Zimmerman, Ella; Davidovich, Chen

    2017-01-01

    Erythromycin is a clinically useful antibiotic that binds to an rRNA pocket in the ribosomal exit tunnel. Commonly, resistance to erythromycin is acquired by alterations of rRNA nucleotides that interact with the drug. Mutations in the β hairpin of ribosomal protein uL22, which is rather distal...... of the β hairpin of the mutated uL22 toward the interior of the exit tunnel, triggering a cascade of structural alterations of rRNA nucleotides that propagate to the erythromycin binding pocket. Our findings support recent studies showing that the interactions between uL22 and specific sequences within...

  8. Implementation of communication-mediating domains for non-ribosomal peptide production in Saccharomyces cerevisiae

    DEFF Research Database (Denmark)

    Siewers, Verena; San-Bento, Rita; Nielsen, Jens

    2010-01-01

    Saccharomyces cerevisiae has in several cases been proven to be a suitable host for the production of natural products and was recently exploited for the production of non-ribosomal peptides. Synthesis of non-ribosomal peptides (NRPs) is mediated by NRP synthetases (NRPSs), modular enzymes, which...... are often organized in enzyme complexes. In these complexes, partner NRPSs interact via communication-mediating domains (COM domains). In order to test whether functional interaction between separate NRPS modules is possible in yeast we constructed a yeast strain expressing two modules with compatible COM...

  9. Acidic ribosomal proteins and histone H3 from Leishmania present a high rate of divergence

    Directory of Open Access Journals (Sweden)

    Ysabel Montoya

    2000-08-01

    Full Text Available Another additional peculiarity in Leishmania will be discussed about of the amino acid divergence rate of three structural proteins: acidic ribosomal P1 and P2b proteins, and histone H3 by using multiple sequence alignment and dendrograms. These structural proteins present a high rate of divergence regarding to their homologous protein in Trypanosoma cruzi. At this regard, L. (V. peruviana P1 and T. cruzi P1 showed 57.4% of divergence rate. Likewise, L. (V. braziliensis histone H3 and acidic ribosomal P2 protein exhibited 31.8% and 41.7% respectively of rate of divergence in comparison with their homologous in T. cruzi.

  10. The NBS1-Treacle complex controls ribosomal RNA transcription in response to DNA damage

    DEFF Research Database (Denmark)

    Larsen, Dorthe H; Hari, Flurina; Clapperton, Julie A

    2014-01-01

    Chromosome breakage elicits transient silencing of ribosomal RNA synthesis, but the mechanisms involved remained elusive. Here we discover an in trans signalling mechanism that triggers pan-nuclear silencing of rRNA transcription in response to DNA damage. This is associated with transient...... recruitment of the Nijmegen breakage syndrome protein 1 (NBS1), a central regulator of DNA damage responses, into the nucleoli. We further identify TCOF1 (also known as Treacle), a nucleolar factor implicated in ribosome biogenesis and mutated in Treacher Collins syndrome, as an interaction partner of NBS1...

  11. 5S Ribosomal RNA Is an Essential Component of a Nascent Ribosomal Precursor Complex that Regulates the Hdm2-p53 Checkpoint

    Directory of Open Access Journals (Sweden)

    Giulio Donati

    2013-07-01

    Full Text Available Recently, we demonstrated that RPL5 and RPL11 act in a mutually dependent manner to inhibit Hdm2 and stabilize p53 following impaired ribosome biogenesis. Given that RPL5 and RPL11 form a preribosomal complex with noncoding 5S ribosomal RNA (rRNA and the three have been implicated in the p53 response, we reasoned they may be part of an Hdm2-inhibitory complex. Here, we show that small interfering RNAs directed against 5S rRNA have no effect on total or nascent levels of the noncoding rRNA, though they prevent the reported Hdm4 inhibition of p53. To achieve efficient inhibition of 5S rRNA synthesis, we targeted TFIIIA, a specific RNA polymerase III cofactor, which, like depletion of either RPL5 or RPL11, did not induce p53. Instead, 5S rRNA acts in a dependent manner with RPL5 and RPL11 to inhibit Hdm2 and stabilize p53. Moreover, depletion of any one of the three components abolished the binding of the other two to Hdm2, explaining their common dependence. Finally, we demonstrate that the RPL5/RPL11/5S rRNA preribosomal complex is redirected from assembly into nascent 60S ribosomes to Hdm2 inhibition as a consequence of impaired ribosome biogenesis. Thus, the activation of the Hdm2-inhibitory complex is not a passive but a regulated event, whose potential role in tumor suppression has been recently noted.

  12. 5S ribosomal RNA is an essential component of a nascent ribosomal precursor complex that regulates the Hdm2-p53 checkpoint.

    Science.gov (United States)

    Donati, Giulio; Peddigari, Suresh; Mercer, Carol A; Thomas, George

    2013-07-11

    Recently, we demonstrated that RPL5 and RPL11 act in a mutually dependent manner to inhibit Hdm2 and stabilize p53 following impaired ribosome biogenesis. Given that RPL5 and RPL11 form a preribosomal complex with noncoding 5S ribosomal RNA (rRNA) and the three have been implicated in the p53 response, we reasoned they may be part of an Hdm2-inhibitory complex. Here, we show that small interfering RNAs directed against 5S rRNA have no effect on total or nascent levels of the noncoding rRNA, though they prevent the reported Hdm4 inhibition of p53. To achieve efficient inhibition of 5S rRNA synthesis, we targeted TFIIIA, a specific RNA polymerase III cofactor, which, like depletion of either RPL5 or RPL11, did not induce p53. Instead, 5S rRNA acts in a dependent manner with RPL5 and RPL11 to inhibit Hdm2 and stabilize p53. Moreover, depletion of any one of the three components abolished the binding of the other two to Hdm2, explaining their common dependence. Finally, we demonstrate that the RPL5/RPL11/5S rRNA preribosomal complex is redirected from assembly into nascent 60S ribosomes to Hdm2 inhibition as a consequence of impaired ribosome biogenesis. Thus, the activation of the Hdm2-inhibitory complex is not a passive but a regulated event, whose potential role in tumor suppression has been recently noted. Copyright © 2013 The Authors. Published by Elsevier Inc. All rights reserved.

  13. Distinct roles for the IIId2 sub-domain in pestivirus and picornavirus internal ribosome entry sites

    DEFF Research Database (Denmark)

    Willcocks, Margaret M.; Zaini, Salmah; Chamond, Nathalie

    2017-01-01

    Viral internal ribosomes entry site (IRES) elements coordinate the recruitment of the host translation machinery to direct the initiation of viral protein synthesis. Within hepatitis C virus (HCV)-like IRES elements, the sub-domain IIId(1) is crucial for recruiting the 40S ribosomal subunit...

  14. Characterization of the domains of E. coli initiation factor IF2 responsible for recognition of the ribosome

    DEFF Research Database (Denmark)

    Manuel Palacios Moreno, Juan; Andersen, Lars Dyrskjøt; Egebjerg Kristensen, Janni

    1999-01-01

    We have studied the interactions between the ribosome and the domains of Escherichia coli translation initiation factor 2, using an in vitro ribosomal binding assay with wild-type forms, N- and C-terminal truncated forms of IF2 as well as isolated structural domains. A deletion mutant of the factor...

  15. Influence of hyperthermia on the phosphorylation of ribosomal protein S6 from human skin fibroblasts and meningioma cells

    DEFF Research Database (Denmark)

    Richter, W W; Zang, K D; Issinger, O G

    1983-01-01

    Skin fibroblasts and meningioma cells, derived from primary cultures of the same patients have been used to study the influence of hyperthermia on (i) cell morphology and (ii) phosphorylation pattern of ribosomal and ribosome-associated proteins. Incubation of tumour cells and fibroblasts up to 7...

  16. Affinity labelling of ribosomes from the livers of different vertebrates by 2-nitro-4-azidobenzoyl-Phe-tRNA

    International Nuclear Information System (INIS)

    Stahl, J.; Boehm, H.; Voderberg, M.

    1981-01-01

    Ribosomal protein L 10 from the livers of trout, hen, and rat was found to be the main target for 2-nitro-4-azidobenzoyl-Phe-tRNA in affinity labelling experiments. Therefore, despite somewhat different electrophoretic mobilities, this protein seems to be involved in the organization of the peptidyl transferase centre in ribosomes of various vertebrates. (author)

  17. The functional half-life of an mRNA depends on the ribosome spacing in an early coding region

    DEFF Research Database (Denmark)

    Pedersen, Margit; Nissen, Søren; Mitarai, Namiko

    2011-01-01

    Bacterial mRNAs are translated by closely spaced ribosomes and degraded from the 5'-end, with half-lives of around 2 min at 37 °C in most cases. Ribosome-free or "naked" mRNA is known to be readily degraded, but the initial event that inactivates the mRNA functionally has not been fully described...

  18. Characterization of the domains of E. coli initiation factor IF2 responsible for recognition of the ribosome

    DEFF Research Database (Denmark)

    Manuel Palacios Moreno, Juan; Andersen, Lars Dyrskjøt; Egebjerg Kristensen, Janni

    1999-01-01

    We have studied the interactions between the ribosome and the domains of Escherichia coli translation initiation factor 2, using an in vitro ribosomal binding assay with wild-type forms, N- and C-terminal truncated forms of IF2 as well as isolated structural domains. A deletion mutant of the fact...

  19. Evidence for rRNA 2'-O-methylation plasticity: Control of intrinsic translational capabilities of human ribosomes.

    Science.gov (United States)

    Erales, Jenny; Marchand, Virginie; Panthu, Baptiste; Gillot, Sandra; Belin, Stéphane; Ghayad, Sandra E; Garcia, Maxime; Laforêts, Florian; Marcel, Virginie; Baudin-Baillieu, Agnès; Bertin, Pierre; Couté, Yohann; Adrait, Annie; Meyer, Mélanie; Therizols, Gabriel; Yusupov, Marat; Namy, Olivier; Ohlmann, Théophile; Motorin, Yuri; Catez, Frédéric; Diaz, Jean-Jacques

    2017-12-05

    Ribosomal RNAs (rRNAs) are main effectors of messenger RNA (mRNA) decoding, peptide-bond formation, and ribosome dynamics during translation. Ribose 2'-O-methylation (2'-O-Me) is the most abundant rRNA chemical modification, and displays a complex pattern in rRNA. 2'-O-Me was shown to be essential for accurate and efficient protein synthesis in eukaryotic cells. However, whether rRNA 2'-O-Me is an adjustable feature of the human ribosome and a means of regulating ribosome function remains to be determined. Here we challenged rRNA 2'-O-Me globally by inhibiting the rRNA methyl-transferase fibrillarin in human cells. Using RiboMethSeq, a nonbiased quantitative mapping of 2'-O-Me, we identified a repertoire of 2'-O-Me sites subjected to variation and demonstrate that functional domains of ribosomes are targets of 2'-O-Me plasticity. Using the cricket paralysis virus internal ribosome entry site element, coupled to in vitro translation, we show that the intrinsic capability of ribosomes to translate mRNAs is modulated through a 2'-O-Me pattern and not by nonribosomal actors of the translational machinery. Our data establish rRNA 2'-O-Me plasticity as a mechanism providing functional specificity to human ribosomes.

  20. Ribosomal protein NtRPL17 interacts with kinesin-12 family protein NtKRP and functions in the regulation of embryo/seed size and radicle growth.

    Science.gov (United States)

    Tian, Shujuan; Wu, Jingjing; Liu, Yuan; Huang, Xiaorong; Li, Fen; Wang, Zhaodan; Sun, Meng-Xiang

    2017-11-28

    We previously reported that a novel motor protein belonging to the kinesin-12 family, NtKRP, displays critical roles in regulating embryo and seed size establishment. However, it remains unknown exactly how NtKRP contributes to this developmental process. Here, we report that a 60S ribosomal protein NtRPL17 directly interacts with NtKRP. The phenotypes of NtRPL17 RNAi lines show notable embryo and seed size reduction. Structural observations of the NtRPL17-silenced embryos/seeds reveal that the embryo size reduction is due to a decrease in cell number. In these embryos, cell division cycle progression is delayed at the G2/M transition. These phenotypes are similar to that in NtKRP-silenced embryos/seeds, indicating that NtKRP and NtRPL17 function as partners in the same regulatory pathway during seed development and specifically regulate cell cycle progression to control embryo/seed size. This work reveals that NtRPL17, as a widely distributed ribosomal protein, plays a critical role in seed development and provides a new clue in the regulation of seed size. Confirmation of the interaction between NtKRP and NtRPL17 and their co-function in the control of the cell cycle also suggests that the mechanism might be conserved in both plants and animals. © The Author 2017. Published by Oxford University Press on behalf of the Society for Experimental Biology.

  1. Evidence for an RNA pseudoknot loop-helix interaction essential for efficient -1 ribosomal frameshifting.

    Science.gov (United States)

    Liphardt, J; Napthine, S; Kontos, H; Brierley, I

    1999-05-07

    RNA pseudoknots are structural elements that participate in a variety of biological processes. At -1 ribosomal frameshifting sites, several types of pseudoknot have been identified which differ in their organisation and functionality. The pseudoknot found in infectious bronchitis virus (IBV) is typical of those that possess a long stem 1 of 11-12 bp and a long loop 2 (30-164 nt). A second group of pseudoknots are distinguishable that contain stems of only 5 to 7 bp and shorter loops. The NMR structure of one such pseudoknot, that of mouse mammary tumor virus (MMTV), has revealed that it is kinked at the stem 1-stem 2 junction, and that this kinked conformation is essential for efficient frameshifting. We recently investigated the effect on frameshifting of modulating stem 1 length and stability in IBV-based pseudoknots, and found that a stem 1 with at least 11 bp was needed for efficient frameshifting. Here, we describe the sequence manipulations that are necessary to bypass the requirement for an 11 bp stem 1 and to convert a short non-functional IBV-derived pseudoknot into a highly efficient, kinked frameshifter pseudoknot. Simple insertion of an adenine residue at the stem 1-stem 2 junction (an essential feature of a kinked pseudoknot) was not sufficient to create a functional pseudoknot. An additional change was needed: efficient frameshifting was recovered only when the last nucleotide of loop 2 was changed from a G to an A. The requirement for an A at the end of loop 2 is consistent with a loop-helix contact similar to those described in other RNA tertiary structures. A mutational analysis of both partners of the proposed interaction, the loop 2 terminal adenine residue and two G.C pairs near the top of stem 1, revealed that the interaction was essential for efficient frameshifting. The specific requirement for a 3'-terminal A residue was lost when loop 2 was increased from 8 to 14 nt, suggesting that the loop-helix contact may be required only in those

  2. Perceptual spatial differentiation of Ljubljana

    Directory of Open Access Journals (Sweden)

    Marko Krevs

    2004-12-01

    Full Text Available Geographical studies of human perception of places at local scale are usually aimed at bet-ter understanding of human spatial perception and knowledge about the places, and of using this knowledge in spatial decision-making or spatial behaviour. Our focus on the first part of these general research aims is presented based on a case study, revealing how residents of the Municipality of Ljubljana perceive and value neighbourhoods of “their” municipality at the beginning of the century1.

  3. Spatial filtring and thermocouple spatial filter

    International Nuclear Information System (INIS)

    Han Bing; Tong Yunxian

    1989-12-01

    The design and study on thermocouple spatial filter have been conducted for the flow measurement of integrated reactor coolant. The fundamental principle of spatial filtring, mathematical descriptions and analyses of thermocouple spatial filter are given

  4. Markerless Escherichia coli rrn Deletion Strains for Genetic Determination of Ribosomal Binding Sites

    DEFF Research Database (Denmark)

    Quan, Selwyn; Skovgaard, Ole; McLaughlin, Robert E

    2015-01-01

    Single-copy rrn strains facilitate genetic ribosomal studies in Escherichia coli. Consecutive markerless deletion of rrn operons resulted in slower growth upon inactivation of the fourth copy, which was reversed by supplying transfer RNA genes encoded in rrn operons in trans. Removal of the sixth...

  5. Transcription of ribosomal RNA genes is initiated in the third cell cycle of bovine embryos

    DEFF Research Database (Denmark)

    Jakobsen, Anne Sørig; Avery, Birthe; Dieleman, Steph J.

    2006-01-01

    Transcription from the embryos own ribosomal genes is initiated in most species at the same time as the maternal-embryonic transition. Recently data have indicated that a minor activation may take place during the third embryonic cell cycle in the bovine, one cell cycle before the major activation...

  6. Reaction of some macrolide antibiotics with the ribosome. Labeling of the binding site components

    International Nuclear Information System (INIS)

    Tejedor, F.; Ballesta, J.P.

    1986-01-01

    Radioactive carbomycin A, niddamycin, tylosin, and spiramycin, but not erythromycin, can be covalently bound to Escherichia coli ribosomes by incubation at 37 degrees C. The incorporation of radioactivity into the particles is inhibited by SH- and activated double bond containing compounds but not by amino groups, suggesting that the reactions may take place by addition to the double bond present in the reactive antibiotics. This thermic reaction must be different from the photoreaction described for some of these macrolides [Tejedor, F., and Ballesta, J. P. G. (1985) Biochemistry 24, 467-472] since tylosin, which is not photoincorporated, is thermically bound to ribosomes. Most of the radioactivity is incorporated into the ribosomal proteins. Two-dimensional gel electrophoresis of proteins labeled by carbomycin A, niddamycin, and tylosin indicates that about 40% of the radioactivity is bound to protein L27; the rest is distributed among several other proteins such as L8, L2, and S12, to differing extents depending on the drug used. These results indicate, in accordance with previous data, that protein L27 plays an important role in the macrolide binding site, confirming that these drugs bind near the peptidyl transferase center of the ribosome

  7. Genome-Scale Analysis of Translation Elongation with a Ribosome Flow Model

    Science.gov (United States)

    Meilijson, Isaac; Kupiec, Martin; Ruppin, Eytan

    2011-01-01

    We describe the first large scale analysis of gene translation that is based on a model that takes into account the physical and dynamical nature of this process. The Ribosomal Flow Model (RFM) predicts fundamental features of the translation process, including translation rates, protein abundance levels, ribosomal densities and the relation between all these variables, better than alternative (‘non-physical’) approaches. In addition, we show that the RFM can be used for accurate inference of various other quantities including genes' initiation rates and translation costs. These quantities could not be inferred by previous predictors. We find that increasing the number of available ribosomes (or equivalently the initiation rate) increases the genomic translation rate and the mean ribosome density only up to a certain point, beyond which both saturate. Strikingly, assuming that the translation system is tuned to work at the pre-saturation point maximizes the predictive power of the model with respect to experimental data. This result suggests that in all organisms that were analyzed (from bacteria to Human), the global initiation rate is optimized to attain the pre-saturation point. The fact that similar results were not observed for heterologous genes indicates that this feature is under selection. Remarkably, the gap between the performance of the RFM and alternative predictors is strikingly large in the case of heterologous genes, testifying to the model's promising biotechnological value in predicting the abundance of heterologous proteins before expressing them in the desired host. PMID:21909250

  8. The Potential of Targeting Ribosome Biogenesis in High-Grade Serous Ovarian Cancer

    Directory of Open Access Journals (Sweden)

    Shunfei Yan

    2017-01-01

    Full Text Available Overall survival for patients with ovarian cancer (OC has shown little improvement for decades meaning new therapeutic options are critical. OC comprises multiple histological subtypes, of which the most common and aggressive subtype is high-grade serous ovarian cancer (HGSOC. HGSOC is characterized by genomic structural variations with relatively few recurrent somatic mutations or dominantly acting oncogenes that can be targeted for the development of novel therapies. However, deregulation of pathways controlling homologous recombination (HR and ribosome biogenesis has been observed in a high proportion of HGSOC, raising the possibility that targeting these basic cellular processes may provide improved patient outcomes. The poly (ADP-ribose polymerase (PARP inhibitor olaparib has been approved to treat women with defects in HR due to germline BRCA mutations. Recent evidence demonstrated the efficacy of targeting ribosome biogenesis with the specific inhibitor of ribosomal RNA synthesis, CX-5461 in v-myc avian myelocytomatosis viral oncogene homolog (MYC-driven haematological and prostate cancers. CX-5461 has now progressed to a phase I clinical trial in patients with haematological malignancies and phase I/II trial in breast cancer. Here we review the currently available targeted therapies for HGSOC and discuss the potential of targeting ribosome biogenesis as a novel therapeutic approach against HGSOC.

  9. Cross-site comparison of ribosomal depletion kits for Illumina RNAseq library construction.

    Science.gov (United States)

    Herbert, Zachary T; Kershner, Jamie P; Butty, Vincent L; Thimmapuram, Jyothi; Choudhari, Sulbha; Alekseyev, Yuriy O; Fan, Jun; Podnar, Jessica W; Wilcox, Edward; Gipson, Jenny; Gillaspy, Allison; Jepsen, Kristen; BonDurant, Sandra Splinter; Morris, Krystalynne; Berkeley, Maura; LeClerc, Ashley; Simpson, Stephen D; Sommerville, Gary; Grimmett, Leslie; Adams, Marie; Levine, Stuart S

    2018-03-15

    Ribosomal RNA (rRNA) comprises at least 90% of total RNA extracted from mammalian tissue or cell line samples. Informative transcriptional profiling using massively parallel sequencing technologies requires either enrichment of mature poly-adenylated transcripts or targeted depletion of the rRNA fraction. The latter method is of particular interest because it is compatible with degraded samples such as those extracted from FFPE and also captures transcripts that are not poly-adenylated such as some non-coding RNAs. Here we provide a cross-site study that evaluates the performance of ribosomal RNA removal kits from Illumina, Takara/Clontech, Kapa Biosystems, Lexogen, New England Biolabs and Qiagen on intact and degraded RNA samples. We find that all of the kits are capable of performing significant ribosomal depletion, though there are differences in their ease of use. All kits were able to remove ribosomal RNA to below 20% with intact RNA and identify ~ 14,000 protein coding genes from the Universal Human Reference RNA sample at >1FPKM. Analysis of differentially detected genes between kits suggests that transcript length may be a key factor in library production efficiency. These results provide a roadmap for labs on the strengths of each of these methods and how best to utilize them.

  10. Sequence analysis and over-expression of ribosomal protein S28 ...

    African Journals Online (AJOL)

    RPS28 is a component of the 40S small ribosomal subunit encoded by RPS28 gene, which is specific to eukaryotes. The cDNA and the genomic sequence of RPS28 were cloned successfully from the Giant Panda using RT-PCR technology and Touchdown-PCR, respectively. Both sequences were analyzed preliminarily ...

  11. Computational discovery of specificity-conferring sites in non-ribosomal peptide synthetases

    DEFF Research Database (Denmark)

    Knudsen, Michael; Søndergaard, Dan Ariel; Tofting-Olesen, Claus

    2016-01-01

    Motivation: By using a class of large modular enzymes known as Non-Ribosomal Peptide Synthetases (NRPS), bacteria and fungi are capable of synthesizing a large variety of secondary metabolites, many of which are bioactive and have potential, pharmaceutical applications as e.g.~antibiotics. There ...

  12. Molecular mechanism and structure of Trigger Factor bound to the translating ribosome

    Science.gov (United States)

    Merz, Frieder; Boehringer, Daniel; Schaffitzel, Christiane; Preissler, Steffen; Hoffmann, Anja; Maier, Timm; Rutkowska, Anna; Lozza, Jasmin; Ban, Nenad; Bukau, Bernd; Deuerling, Elke

    2008-01-01

    Ribosome-associated chaperone Trigger Factor (TF) initiates folding of newly synthesized proteins in bacteria. Here, we pinpoint by site-specific crosslinking the sequence of molecular interactions of Escherichia coli TF and nascent chains during translation. Furthermore, we provide the first full-length structure of TF associated with ribosome–nascent chain complexes by using cryo-electron microscopy. In its active state, TF arches over the ribosomal exit tunnel accepting nascent chains in a protective void. The growing nascent chain initially follows a predefined path through the entire interior of TF in an unfolded conformation, and even after folding into a domain it remains accommodated inside the protective cavity of ribosome-bound TF. The adaptability to accept nascent chains of different length and folding states may explain how TF is able to assist co-translational folding of all kinds of nascent polypeptides during ongoing synthesis. Moreover, we suggest a model of how TF's chaperoning function can be coordinated with the co-translational processing and membrane targeting of nascent polypeptides by other ribosome-associated factors. PMID:18497744

  13. The use of 125iodine-labeled RNA for detection of the RNA binding to ribosomes

    International Nuclear Information System (INIS)

    Mori, Tomohiko; Fukuda, Mitsuru

    1975-01-01

    The in vitro labeling of RNA with radioactive iodine is the efficient method to obtain the RNA with high specific activity. The present paper reports on the application of this technique to the production of iodine-labeled RNA for use in the experiment of binding RNA to ribosomes. Tobacco mosaic virus (TMV) RNA was used as natural mRNA, and E. coli S-30 preparation was used as a source of ribosomes. The TMV-RNA was prepared by bentonite-phenol extraction from TMV, and the method used for the iodation of RNA was based on the procedure described by Getz et al. The iodine-labeled RNA was incubated in a cell-free protein synthesizing system (S-30) prepared from E. coli K-12. After the incubation, the reaction mixture was layered onto sucrose gradient, centrifuged, and fractionated into 18 fractions. Optical density at 260 nm was measured, and radioactivity was counted, for each fraction. The binding of mRNA to ribosomes occurred even at 0 deg C, and the occurrence of the nonspecific binding was also shown. Consequently, the specific binding, i.e. the formation of the initiation complex being involved in amino acid incorporation, may be estimated by subtracting the radioactivity associated with monosomes in the presence of both rRNA and ATA from that in the presence of rRNA only. It was shown that the iodine-labeled RNA can be used for the studies of binding RNA to ribosomes. (Kako, I.)

  14. Exploring ribosome composition and newly synthesized proteins through proteomics and potential biomedical applications

    Czech Academy of Sciences Publication Activity Database

    Šťastná, Miroslava; Gottlieb, R. A.; Van Eyk, J.E.

    2017-01-01

    Roč. 14, č. 6 (2017), s. 529-543 ISSN 1478-9450 Institutional support: RVO:68081715 Keywords : mass spectrometry * amino-acid labeling * translation * ribosomes * AHA Subject RIV: CB - Analytical Chemistry, Separation OBOR OECD: Analytical chemistry Impact factor: 3.849, year: 2016

  15. Virtual Ribosome - a comprehensive DNA translation tool with support for integration of sequence feature annotation

    DEFF Research Database (Denmark)

    Wernersson, Rasmus

    2006-01-01

    of alternative start codons. ( ii) Integration of sequences feature annotation - in particular, native support for working with files containing intron/ exon structure annotation. The software is available for both download and online use at http://www.cbs.dtu.dk/services/VirtualRibosome/....

  16. Selection of scFvs specific for the HepG2 cell line using ribosome ...

    Indian Academy of Sciences (India)

    Madhsudhan

    the important advantage of requiring no prior knowledge of ... were amplified separately by RT-PCR, and an anti-HepG2 VH/k chain ribosome display library was constructed ..... Engert A, Hudson P R and Power B E 2007 Selection of human.

  17. In silico modelling and analysis of ribosome kinetics and aa-tRNA competition

    NARCIS (Netherlands)

    Bošnački, D.; Pronk, T.E.; de Vink, E.P.

    2008-01-01

    We present a formal analysis of ribosome kinetics using probabilistic model checking and the tool Prism. We compute different parameters of the model, like probabilities of translation errors and average insertion times per codon. The model predicts strong correlation to the quotient of the

  18. YbxF, a protein associated with exponential-phase ribosomes in Bacillus subtilis

    Czech Academy of Sciences Publication Activity Database

    Sojka, Luděk; Fučík, Vladimír; Krásný, Libor; Barvík, I.; Jonák, Jiří

    2007-01-01

    Roč. 189, č. 13 (2007), s. 4809-4814 ISSN 0021-9193 R&D Projects: GA AV ČR IAA5052206 Institutional research plan: CEZ:AV0Z50520514 Keywords : ybxF * ymxC * ribosomes * Bacillus subtilis * GFP * growth phase Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 4.013, year: 2007

  19. Ribosomal PCR and DNA sequencing for detection and identification of bacteria

    DEFF Research Database (Denmark)

    Jensen, Kristine Helander; Dargis, Rimtas; Christensen, Jens Jørgen

    2014-01-01

    -haemolytic streptococci, especially within the mitis group. The data show that ribosomal PCR with subsequent DNA sequencing of the PCR product is a most valuable supplement to culture for identifying bacterial agents of both acute and prolonged infections. However, some bacteria, including non-haemolytic streptococci...

  20. Ribosome stalling regulates IRES-mediated translation in eukaryotes, a parallel to prokaryotic attenuation

    NARCIS (Netherlands)

    Fernandez, James; Yaman, Ibrahim; Huang, Charles; Liu, Haiyan; Lopez, Alex B.; Komar, Anton A.; Caprara, Mark G.; Merrick, William C.; Snider, Martin D.; Kaufman, Randal J.; Lamers, Wouter H.; Hatzoglou, Maria

    2005-01-01

    It was previously shown that the mRNA for the cat-1 Arg/Lys transporter is translated from an internal ribosome entry site (IRES) that is regulated by cellular stress. Amino acid starvation stimulated cat-1 translation via a mechanism that requires translation of an ORF in the mRNA leader and

  1. Development of Soft Tissue Sarcomas in Ribosomal Proteins L5 and S24 Heterozygous Mice

    Czech Academy of Sciences Publication Activity Database

    Kazerounian, S.; Ciarlini, P.D.S.C.; Yuan, D.; Ghazvinian, R.; Alberich-Jorda, Meritxell; Joshi, M.; Zhang, H.; Beggs, A.H.; Gazda, H.T.

    2016-01-01

    Roč. 7, č. 1 (2016), s. 32-36 ISSN 1837-9664 R&D Projects: GA MŠk LK21307 Institutional support: RVO:68378050 Keywords : Ribosomal proteins RPL5 and RPS24 * Diamond-Blackfan anemia * Soft tissue sarcoma Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.916, year: 2016

  2. Ribosome-inhibiting proteins from in vitro cultures of Phytolacca dodecandra

    DEFF Research Database (Denmark)

    Thomsen, S.; Hansen, Harald S.; Nyman, U.

    1991-01-01

    Phytolacca dodecandra (L'Herit) grown in cell cultures was investigated for content of ribosome-inhibiting proteins, which was evaluated hy measuring inhibition of protein synthesis in a cell-free rat liver extract. Calli initiated from leaf, cotyledon, radicle, and hypocotyl and suspension cells...

  3. Specific structural probing of plasmid-coded ribosomal RNAs from Escherichia coli

    DEFF Research Database (Denmark)

    Aagaard, C; Rosendahl, G; Dam, M

    1991-01-01

    The preferred method for construction and in vivo expression of mutagenised Escherichia coli ribosomal RNAs (rRNAs) is via high copy number plasmids. Transcription of wild-type rRNA from the seven chromosomal rrn operons in strains harbouring plasmid-coded mutant rRNAs leads to a heterogeneous...

  4. A rotational diffusion coefficient of the 70s ribosome determined by depolarized laser light scattering

    NARCIS (Netherlands)

    Bruining, J.; Fijnaut, H.M.

    We have obtained a rotational diffusion coefficient of the 70S ribosome isolated from Escherichia-coli (MRE-600), from the depolarized light scattering spectrum measured by photon correlation spectroscopy. The intensity correlation function of depolarized scattered light contains contributions due

  5. Ribosome-dependent ATPase interacts with conserved membrane protein in Escherichia coli to modulate protein synthesis and oxidative phosphorylation.

    Directory of Open Access Journals (Sweden)

    Mohan Babu

    Full Text Available Elongation factor RbbA is required for ATP-dependent deacyl-tRNA release presumably after each peptide bond formation; however, there is no information about the cellular role. Proteomic analysis in Escherichia coli revealed that RbbA reciprocally co-purified with a conserved inner membrane protein of unknown function, YhjD. Both proteins are also physically associated with the 30S ribosome and with members of the lipopolysaccharide transport machinery. Genome-wide genetic screens of rbbA and yhjD deletion mutants revealed aggravating genetic interactions with mutants deficient in the electron transport chain. Cells lacking both rbbA and yhjD exhibited reduced cell division, respiration and global protein synthesis as well as increased sensitivity to antibiotics targeting the ETC and the accuracy of protein synthesis. Our results suggest that RbbA appears to function together with YhjD as part of a regulatory network that impacts bacterial oxidative phosphorylation and translation efficiency.

  6. Identification of forensically important Chrysomya (Diptera: Calliphoridae) species using the second ribosomal internal transcribed spacer (ITS2).

    Science.gov (United States)

    Nelson, Leigh A; Wallman, James F; Dowton, Mark

    2008-05-20

    The identification of forensically important blowflies of the genus Chrysomya (Diptera: Calliphoridae) may be hampered by their close morphological similarities, especially as immatures. In contrast to most previous studies, the utility of a nuclear rather than mitochondrial genetic marker was investigated to solve this problem. The second internal transcribed spacer (ITS2) of ribosomal DNA (rDNA) was amplified and sequenced from all nine Chrysomya species known from Australia. Difficulties encountered with direct sequencing of ITS2 for Chrysomya flavifrons necessitated cloning prior to sequencing for this species, which revealed a low level (0-0.23%) of intraindividual variation. Five restriction enzymes (DraI, BsaXI, BciVI, AseI and HinfI) were identified that were able to differentiate most members of the genus by polymerase chain reaction (PCR) restriction fragment length polymorphism (PCR-RFLP). The PCR-RFLP analysis revealed characteristic restriction profiles for all species except the closely related species pairs Chrysomya latifrons+Chrysomya semimetallica and Chrysomya incisuralis+Chrysomya rufifacies. Ch. incisuralis and Ch. rufifacies were able to be separated using the size differences resulting from amplification of the entire ITS region. The lack of intraspecific ITS2 sequence variation among eight Ch. incisuralis specimens was verified by the identical restriction profiles generated from these specimens. A DNA-based approach, such as PCR-RFLP, has the capacity to be useful for the identification of forensic entomological evidence in cases where morphological characters are unreliable.

  7. Genetic diversity and molecular evolution of Naga King Chili inferred from internal transcribed spacer sequence of nuclear ribosomal DNA.

    Science.gov (United States)

    Kehie, Mechuselie; Kumaria, Suman; Devi, Khumuckcham Sangeeta; Tandon, Pramod

    2016-02-01

    Sequences of the Internal Transcribed Spacer (ITS1-5.8S-ITS2) of nuclear ribosomal DNAs were explored to study the genetic diversity and molecular evolution of Naga King Chili. Our study indicated the occurrence of nucleotide polymorphism and haplotypic diversity in the ITS regions. The present study demonstrated that the variability of ITS1 with respect to nucleotide diversity and sequence polymorphism exceeded that of ITS2. Sequence analysis of 5.8S gene revealed a much conserved region in all the accessions of Naga King Chili. However, strong phylogenetic information of this species is the distinct 13 bp deletion in the 5.8S gene which discriminated Naga King Chili from the rest of the Capsicum sp. Neutrality test results implied a neutral variation, and population seems to be evolving at drift-mutation equilibrium and free from directed selection pressure. Furthermore, mismatch analysis showed multimodal curve indicating a demographic equilibrium. Phylogenetic relationships revealed by Median Joining Network (MJN) analysis denoted a clear discrimination of Naga King Chili from its closest sister species (Capsicum chinense and Capsicum frutescens). The absence of star-like network of haplotypes suggested an ancient population expansion of this chili.

  8. Nuclear ribosomal internal transcribed spacer (ITS) region as a universal DNA barcode marker for Fungi.

    Science.gov (United States)

    Schoch, Conrad L; Seifert, Keith A; Huhndorf, Sabine; Robert, Vincent; Spouge, John L; Levesque, C André; Chen, Wen

    2012-04-17

    Six DNA regions were evaluated as potential DNA barcodes for Fungi, the second largest kingdom of eukaryotic life, by a multinational, multilaboratory consortium. The region of the mitochondrial cytochrome c oxidase subunit 1 used as the animal barcode was excluded as a potential marker, because it is difficult to amplify in fungi, often includes large introns, and can be insufficiently variable. Three subunits from the nuclear ribosomal RNA cistron were compared together with regions of three representative protein-coding genes (largest subunit of RNA polymerase II, second largest subunit of RNA polymerase II, and minichromosome maintenance protein). Although the protein-coding gene regions often had a higher percent of correct identification compared with ribosomal markers, low PCR amplification and sequencing success eliminated them as candidates for a universal fungal barcode. Among the regions of the ribosomal cistron, the internal transcribed spacer (ITS) region has the highest probability of successful identification for the broadest range of fungi, with the most clearly defined barcode gap between inter- and intraspecific variation. The nuclear ribosomal large subunit, a popular phylogenetic marker in certain groups, had superior species resolution in some taxonomic groups, such as the early diverging lineages and the ascomycete yeasts, but was otherwise slightly inferior to the ITS. The nuclear ribosomal small subunit has poor species-level resolution in fungi. ITS will be formally proposed for adoption as the primary fungal barcode marker to the Consortium for the Barcode of Life, with the possibility that supplementary barcodes may be developed for particular narrowly circumscribed taxonomic groups.

  9. Bactobolin resistance is conferred by mutations in the L2 ribosomal protein.

    Science.gov (United States)

    Chandler, Josephine R; Truong, Thao T; Silva, Patricia M; Seyedsayamdost, Mohammad R; Carr, Gavin; Radey, Matthew; Jacobs, Michael A; Sims, Elizabeth H; Clardy, Jon; Greenberg, E Peter

    2012-12-18

    Burkholderia thailandensis produces a family of polyketide-peptide molecules called bactobolins, some of which are potent antibiotics. We found that growth of B. thailandensis at 30°C versus that at 37°C resulted in increased production of bactobolins. We purified the three most abundant bactobolins and determined their activities against a battery of bacteria and mouse fibroblasts. Two of the three compounds showed strong activities against both bacteria and fibroblasts. The third analog was much less potent in both assays. These results suggested that the target of bactobolins might be conserved across bacteria and mammalian cells. To learn about the mechanism of bactobolin activity, we isolated four spontaneous bactobolin-resistant Bacillus subtilis mutants. We used genomic sequencing technology to show that each of the four resistant variants had mutations in rplB, which codes for the 50S ribosome-associated L2 protein. Ectopic expression of a mutant rplB gene in wild-type B. subtilis conferred bactobolin resistance. Finally, the L2 mutations did not confer resistance to other antibiotics known to interfere with ribosome function. Our data indicate that bactobolins target the L2 protein or a nearby site and that this is not the target of other antibiotics. We presume that the mammalian target of bactobolins involves the eukaryotic homolog of L2 (L8e). Currently available antibiotics target surprisingly few cellular functions, and there is a need to identify novel antibiotic targets. We have been interested in the Burkholderia thailandensis bactobolins, and we sought to learn about the target of bactobolin activity by mapping spontaneous resistance mutations in the bactobolin-sensitive Bacillus subtilis. Our results indicate that the bactobolin target is the 50S ribosome-associated L2 protein or a region of the ribosome affected by L2. Bactobolin-resistant mutants are not resistant to other known ribosome inhibitors. Our evidence indicates that bactobolins

  10. Remodeling of ribosomal genes in somatic cells by Xenopus egg extract

    Energy Technology Data Exchange (ETDEWEB)

    Ostrup, Olga, E-mail: osvarcova@gmail.com [Institute of Basic Animal and Veterinary Sciences, Faculty of Life Sciences, University of Copenhagen, Frederiksberg C (Denmark); Stem Cell Epigenetics Laboratory, Institute of Basic Medical Sciences, Faculty of Medicine, University of Oslo, Oslo (Norway); Norwegian Center for Stem Cell Research, Oslo (Norway); Hyttel, Poul; Klaerke, Dan A. [Institute of Basic Animal and Veterinary Sciences, Faculty of Life Sciences, University of Copenhagen, Frederiksberg C (Denmark); Collas, Philippe, E-mail: philc@medisin.uio.no [Stem Cell Epigenetics Laboratory, Institute of Basic Medical Sciences, Faculty of Medicine, University of Oslo, Oslo (Norway); Norwegian Center for Stem Cell Research, Oslo (Norway)

    2011-09-02

    Highlights: {yields} Xenopus egg extract remodels nuclei and alter cell growth characteristics. {yields} Ribosomal genes are reprogrammed within 6 h after extract exposure. {yields} rDNA reprogramming involves promoter targeting of SNF2H remodeling complex. {yields} Xenopus egg extract does not initiate stress-related response in somatic cells. {yields} Aza-cytidine elicits a stress-induced response in reprogrammed cells. -- Abstract: Extracts from Xenopus eggs can reprogram gene expression in somatic nuclei, however little is known about the earliest processes associated with the switch in the transcriptional program. We show here that an early reprogramming event is the remodeling of ribosomal chromatin and gene expression. This occurs within hours of extract treatment and is distinct from a stress response. Egg extract elicits remodeling of the nuclear envelope, chromatin and nucleolus. Nucleolar remodeling involves a rapid and stable decrease in ribosomal gene transcription, and promoter targeting of the nucleolar remodeling complex component SNF2H without affecting occupancy of the transcription factor UBF and the stress silencers SUV39H1 and SIRT1. During this process, nucleolar localization of UBF and SIRT1 is not altered. On contrary, azacytidine pre-treatment has an adverse effect on rDNA remodeling induced by extract and elicits a stress-type nuclear response. Thus, an early event of Xenopus egg extract-mediated nuclear reprogramming is the remodeling of ribosomal genes involving nucleolar remodeling complex. Condition-specific and rapid silencing of ribosomal genes may serve as a sensitive marker for evaluation of various reprogramming methods.

  11. Spatial regulation of a common precursor from two distinct genes generates metabolite diversity

    Energy Technology Data Exchange (ETDEWEB)

    Guo, Chun-Jun; Sun, Wei-Wen; Bruno, Kenneth S.; Oakley, Berl R.; Keller, Nancy P.; Wang, Clay C.

    2015-07-13

    In secondary metabolite biosynthesis, core synthetic genes such as polyketide synthase genes or non-ribosomal peptide synthase genes usually encode proteins that generate various backbone precursors. These precursors are modified by other tailoring enzymes to yield a large variety of different secondary metabolites. The number of core synthesis genes in a given species correlates, therefore, with the number of types of secondary metabolites the organism can produce. In our study, heterologous expression of all the A. terreus NRPS-like genes showed that two NRPS-like proteins, encoded by atmelA and apvA, release the same natural product, aspulvinone E. More interestingly, further experiments revealed that the aspulvinone E produced by two different genes accumulates in different fungal compartments. And this spatial control of aspulvinone E production is likely to be regulated by their own specific promoters. Comparative genomics indicates that atmelA and apvA might share a same ancestral gene and the gene apvA is inserted in a highly conserved region in Aspergillus species that contains genes coding for life-essential proteins. The study also identified one trans-prenyltransferase AbpB which is capable of prenylating two different substrates aspulvinones and butyrolactones. In total, our study shows the first example in which the locally distribution of the same natural product could lead to its incorporation into different SM pathways.

  12. Expansion of ribosomally produced natural products: a nitrile hydratase- and Nif11-related precursor family

    Directory of Open Access Journals (Sweden)

    Mitchell Douglas A

    2010-05-01

    Full Text Available Abstract Background A new family of natural products has been described in which cysteine, serine and threonine from ribosomally-produced peptides are converted to thiazoles, oxazoles and methyloxazoles, respectively. These metabolites and their biosynthetic gene clusters are now referred to as thiazole/oxazole-modified microcins (TOMM. As exemplified by microcin B17 and streptolysin S, TOMM precursors contain an N-terminal leader sequence and C-terminal core peptide. The leader sequence contains binding sites for the posttranslational modifying enzymes which subsequently act upon the core peptide. TOMM peptides are small and highly variable, frequently missed by gene-finders and occasionally situated far from the thiazole/oxazole forming genes. Thus, locating a substrate for a particular TOMM pathway can be a challenging endeavor. Results Examination of candidate TOMM precursors has revealed a subclass with an uncharacteristically long leader sequence closely related to the enzyme nitrile hydratase. Members of this nitrile hydratase leader peptide (NHLP family lack the metal-binding residues required for catalysis. Instead, NHLP sequences display the classic Gly-Gly cleavage motif and have C-terminal regions rich in heterocyclizable residues. The NHLP family exhibits a correlated species distribution and local clustering with an ABC transport system. This study also provides evidence that a separate family, annotated as Nif11 nitrogen-fixing proteins, can serve as natural product precursors (N11P, but not always of the TOMM variety. Indeed, a number of cyanobacterial genomes show extensive N11P paralogous expansion, such as Nostoc, Prochlorococcus and Cyanothece, which replace the TOMM cluster with lanthionine biosynthetic machinery. Conclusions This study has united numerous TOMM gene clusters with their cognate substrates. These results suggest that two large protein families, the nitrile hydratases and Nif11, have been retailored for

  13. Are ribosomal DNA clusters rearrangement hotspots? A case study in the genus Mus (Rodentia, Muridae

    Directory of Open Access Journals (Sweden)

    Douzery Emmanuel JP

    2011-05-01

    Full Text Available Abstract Background Recent advances in comparative genomics have considerably improved our knowledge of the evolution of mammalian karyotype architecture. One of the breakthroughs was the preferential localization of evolutionary breakpoints in regions enriched in repetitive sequences (segmental duplications, telomeres and centromeres. In this context, we investigated the contribution of ribosomal genes to genome reshuffling since they are generally located in pericentromeric or subtelomeric regions, and form repeat clusters on different chromosomes. The target model was the genus Mus which exhibits a high rate of karyotypic change, a large fraction of which involves centromeres. Results The chromosomal distribution of rDNA clusters was determined by in situ hybridization of mouse probes in 19 species. Using a molecular-based reference tree, the phylogenetic distribution of clusters within the genus was reconstructed, and the temporal association between rDNA clusters, breakpoints and centromeres was tested by maximum likelihood analyses. Our results highlighted the following features of rDNA cluster dynamics in the genus Mus: i rDNA clusters showed extensive diversity in number between species and an almost exclusive pericentromeric location, ii a strong association between rDNA sites and centromeres was retrieved which may be related to their shared constraint of concerted evolution, iii 24% of the observed breakpoints mapped near an rDNA cluster, and iv a substantial rate of rDNA cluster change (insertion, deletion also occurred in the absence of chromosomal rearrangements. Conclusions This study on the dynamics of rDNA clusters within the genus Mus has revealed a strong evolutionary relationship between rDNA clusters and centromeres. Both of these genomic structures coincide with breakpoints in the genus Mus, suggesting that the accumulation of a large number of repeats in the centromeric region may contribute to the high level of chromosome

  14. 16S/18S ribosomal DNA clone library analysis of rumen microbial diversity

    International Nuclear Information System (INIS)

    Wright, A.G.; Kiyoshi Tajima; Aminov, R.I.

    2005-01-01

    The rumen contains a complex ecosystem where billions of bacteria, archaea, protozoa and fungi reside. This diverse microbiota is well adapted to live in the rumen and play an important role in the digestion of feed and nutrient supply to the host in the form of microbial protein and volatile fatty acids. It is estimated that the rumen microbial population consists of about 10 6 protozoa/ml, 10 3 -10 7 fungi/ml, 10 10 bacteria/ml, and 10 9 methanogens/ml. To better understand the complex relationships in the rumen, it is necessary to gain an insight into the diversity of the rumen microbes and how the quantity and composition of rumen micro-organisms are altered by a number of different host factors such as age, genetics and diet. In the past, the diversity of micro-organisms from the digestive tracts of domesticated ruminants has been identified by classical microbiological techniques. However, given the fastidious growth requirements of rumen micro-organisms, it is reasonable to concede that the culture-dependent methods may select against some species, or taxonomic groups, leading researchers to underestimate the microbial diversity that is actually present in the rumen. In fact, it has been speculated that 90% of micro-organisms in nature have escaped traditional cultivation methods. Therefore, a major challenge in microbial ecology has been to assess the diversity and structure of natural microbial communities. The field of molecular biology has advanced with many innovative technological breakthroughs. The ability to extract and to isolate high-molecular weight DNA from rumen digesta, PCR amplify genes from specific microbial groups and obtain gene sequence data is now a routine event. The small subunit ribosomal RNA (SSU-rRNA) gene, called 16S in prokaryotes and 18S in eukaryotes, is the most widely used molecular marker to presumptively identify morphologically indistinguishable species, to infer their phylogenetic relationships, and to elucidate microbial

  15. Absence of ribosomal DNA amplification in the meroistic (telotrophic) ovary of the large milkweed bug Oncopeltus fasciatus (Dallas) (Hemiptera: Lygaeidae)

    Science.gov (United States)

    1975-01-01

    In the typical meroistic insect ovary, the oocyte nucleus synthesizes little if any RNA. Nurse cells or trophocytes actively synthesize ribosomes which are transported to and accumulated by the oocyte. In the telotrophic ovary a morphological separation exists, the nurse cells being localized at the apical end of each ovariole and communicating with the ooocytes via nutritive cords. In order to determine whether the genes coding for ribosomal RNA (rRNA) are amplified in the telotrophic ovary of the milkweed bug Oncopeltus fasciatus, the percentages of the genome coding for ribosomal RNA in somatic cells, spermatogenic cells, ovarian follicles, and nurse cells were compared. The oocytes and most of the nurse cells of O. fasciatus are uninucleolate. DNA hybridizing with ribosomal RNA is localized in a satellite DNA, the density of which is 1.712 g/cm(-3). The density of main-band DNA is 1.694 g/cm(-3). The ribosomal DNA satellite accounts for approximately 0.2% of the DNA in somatic and gametogenic tissues of both males and females. RNA-DNA hybridization analysis demonstrates that approximately 0.03% of the DNA in somatic tissues, testis, ovarian follicles, and isolated nurse cells hybridizes with ribosomal RNA. The fact that the percentage of DNA hybridizing with rRNA is the same in somatic and in male and female gametogenic tissues indicates that amplification of ribosomal DNA does not occur in nurse cells and that if it occurs in oocytes, it represents less than a 50- fold increase in ribosomal DNA. An increase in total genome DNA accounted by polyploidization appears to provide for increasing the amount of ribosomal DNA in the nurse cells. PMID:1158969

  16. Analysis of the protein-protein interactions between the human acidic ribosomal P-proteins: evaluation by the two hybrid system

    DEFF Research Database (Denmark)

    Tchórzewski, M; Boldyreff, B; Issinger, O

    2000-01-01

    The surface acidic ribosomal proteins (P-proteins), together with ribosomal core protein P0 form a multimeric lateral protuberance on the 60 S ribosomal subunit. This structure, also called stalk, is important for efficient translational activity of the ribosome. In order to shed more light...... forms the 60 S ribosomal stalk: P0-(P1/P2)(2). Additionally, mutual interactions among human and yeast P-proteins were analyzed. Heterodimer formation could be observed between human P2 and yeast P1 proteins....

  17. Toxicity of ricin A chain is reduced in mammalian cells by inhibiting its interaction with the ribosome

    Energy Technology Data Exchange (ETDEWEB)

    Jetzt, Amanda E. [Department of Animal Sciences, Rutgers, The State University of New Jersey, New Brunswick, NJ 08901-8520 (United States); Li, Xiao-Ping; Tumer, Nilgun E. [Department of Plant Biology and Pathology, Rutgers, The State University of New Jersey, New Brunswick, NJ 08901-8520 (United States); Cohick, Wendie S., E-mail: cohick@aesop.rutgers.edu [Department of Animal Sciences, Rutgers, The State University of New Jersey, New Brunswick, NJ 08901-8520 (United States)

    2016-11-01

    Ricin is a potent ribotoxin that is considered a bioterror threat due to its ease of isolation and possibility of aerosolization. In yeast, mutation of arginine residues away from the active site results in a ricin toxin A chain (RTA) variant that is unable to bind the ribosome and exhibits reduced cytotoxicity. The goal of the present work was to determine if these residues contribute to ribosome binding and cytotoxicity of RTA in mammalian cells. The RTA mutant R193A/R235A did not interact with mammalian ribosomes, while a G212E variant with a point mutation near its active site bound ribosomes similarly to wild-type (WT) RTA. R193A/R235A retained full catalytic activity on naked RNA but had reduced activity on mammalian ribosomes. To determine the effect of this mutant in intact cells, pre R193A/R235A containing a signal sequence directing it to the endoplasmic reticulum and mature R193A/R235A that directly targeted cytosolic ribosomes were each expressed. Depurination and protein synthesis inhibition were reduced by both pre- and mature R193A/R235A relative to WT. Protein synthesis inhibition was reduced to a greater extent by R193A/R235A than by G212E. Pre R193A/R235A caused a greater reduction in caspase activation and loss of mitochondrial membrane potential than G212E relative to WT RTA. These findings indicate that an RTA variant with reduced ribosome binding is less toxic than a variant with less catalytic activity but normal ribosome binding activity. The toxin-ribosome interaction represents a novel target for the development of therapeutics to prevent or treat ricin intoxication. - Highlights: • Arginines 193 and 235 of RTA are critical for binding to the mammalian ribosome. • R193A/R235A has full catalytic activity on RNA but not on mammalian ribosomes. • R193A/R235A is less toxic than a mutant that targets the active site. • The toxin-ribosome interaction is a therapeutic target for ricin intoxication.

  18. [Structural organization of 5S ribosomal DNA of Rosa rugosa].

    Science.gov (United States)

    Tynkevych, Iu O; Volkov, R A

    2014-01-01

    In order to clarify molecular organization of the genomic region encoding 5S rRNA in diploid species Rosa rugosa several 5S rDNA repeated units were cloned and sequenced. Analysis of the obtained sequences revealed that only one length variant of 5S rDNA repeated units, which contains intact promoter elements in the intergenic spacer region (IGS) and appears to be transcriptionally active is present in the genome. Additionally, a limited number of 5S rDNA pseudogenes lacking a portion of coding sequence and the complete IGS was detected. A high level of sequence similarity (from 93.7 to 97.5%) between the IGS of major 5S rDNA variants of East Asian R. rugosa and North American R. nitida was found indicating comparatively recent divergence of these species.

  19. Evaluation of Automated Ribosomal Intergenic Spacer Analysis for Bacterial Fingerprintin