WorldWideScience

Sample records for ribosomal rna sequence

  1. SINA: accurate high-throughput multiple sequence alignment of ribosomal RNA genes.

    Science.gov (United States)

    Pruesse, Elmar; Peplies, Jörg; Glöckner, Frank Oliver

    2012-07-15

    In the analysis of homologous sequences, computation of multiple sequence alignments (MSAs) has become a bottleneck. This is especially troublesome for marker genes like the ribosomal RNA (rRNA) where already millions of sequences are publicly available and individual studies can easily produce hundreds of thousands of new sequences. Methods have been developed to cope with such numbers, but further improvements are needed to meet accuracy requirements. In this study, we present the SILVA Incremental Aligner (SINA) used to align the rRNA gene databases provided by the SILVA ribosomal RNA project. SINA uses a combination of k-mer searching and partial order alignment (POA) to maintain very high alignment accuracy while satisfying high throughput performance demands. SINA was evaluated in comparison with the commonly used high throughput MSA programs PyNAST and mothur. The three BRAliBase III benchmark MSAs could be reproduced with 99.3, 97.6 and 96.1 accuracy. A larger benchmark MSA comprising 38 772 sequences could be reproduced with 98.9 and 99.3% accuracy using reference MSAs comprising 1000 and 5000 sequences. SINA was able to achieve higher accuracy than PyNAST and mothur in all performed benchmarks. Alignment of up to 500 sequences using the latest SILVA SSU/LSU Ref datasets as reference MSA is offered at http://www.arb-silva.de/aligner. This page also links to Linux binaries, user manual and tutorial. SINA is made available under a personal use license.

  2. High-Resolution Analysis of Coronavirus Gene Expression by RNA Sequencing and Ribosome Profiling.

    Science.gov (United States)

    Irigoyen, Nerea; Firth, Andrew E; Jones, Joshua D; Chung, Betty Y-W; Siddell, Stuart G; Brierley, Ian

    2016-02-01

    Members of the family Coronaviridae have the largest genomes of all RNA viruses, typically in the region of 30 kilobases. Several coronaviruses, such as Severe acute respiratory syndrome-related coronavirus (SARS-CoV) and Middle East respiratory syndrome-related coronavirus (MERS-CoV), are of medical importance, with high mortality rates and, in the case of SARS-CoV, significant pandemic potential. Other coronaviruses, such as Porcine epidemic diarrhea virus and Avian coronavirus, are important livestock pathogens. Ribosome profiling is a technique which exploits the capacity of the translating ribosome to protect around 30 nucleotides of mRNA from ribonuclease digestion. Ribosome-protected mRNA fragments are purified, subjected to deep sequencing and mapped back to the transcriptome to give a global "snap-shot" of translation. Parallel RNA sequencing allows normalization by transcript abundance. Here we apply ribosome profiling to cells infected with Murine coronavirus, mouse hepatitis virus, strain A59 (MHV-A59), a model coronavirus in the same genus as SARS-CoV and MERS-CoV. The data obtained allowed us to study the kinetics of virus transcription and translation with exquisite precision. We studied the timecourse of positive and negative-sense genomic and subgenomic viral RNA production and the relative translation efficiencies of the different virus ORFs. Virus mRNAs were not found to be translated more efficiently than host mRNAs; rather, virus translation dominates host translation at later time points due to high levels of virus transcripts. Triplet phasing of the profiling data allowed precise determination of translated reading frames and revealed several translated short open reading frames upstream of, or embedded within, known virus protein-coding regions. Ribosome pause sites were identified in the virus replicase polyprotein pp1a ORF and investigated experimentally. Contrary to expectations, ribosomes were not found to pause at the ribosomal

  3. High-Resolution Analysis of Coronavirus Gene Expression by RNA Sequencing and Ribosome Profiling.

    Directory of Open Access Journals (Sweden)

    Nerea Irigoyen

    2016-02-01

    Full Text Available Members of the family Coronaviridae have the largest genomes of all RNA viruses, typically in the region of 30 kilobases. Several coronaviruses, such as Severe acute respiratory syndrome-related coronavirus (SARS-CoV and Middle East respiratory syndrome-related coronavirus (MERS-CoV, are of medical importance, with high mortality rates and, in the case of SARS-CoV, significant pandemic potential. Other coronaviruses, such as Porcine epidemic diarrhea virus and Avian coronavirus, are important livestock pathogens. Ribosome profiling is a technique which exploits the capacity of the translating ribosome to protect around 30 nucleotides of mRNA from ribonuclease digestion. Ribosome-protected mRNA fragments are purified, subjected to deep sequencing and mapped back to the transcriptome to give a global "snap-shot" of translation. Parallel RNA sequencing allows normalization by transcript abundance. Here we apply ribosome profiling to cells infected with Murine coronavirus, mouse hepatitis virus, strain A59 (MHV-A59, a model coronavirus in the same genus as SARS-CoV and MERS-CoV. The data obtained allowed us to study the kinetics of virus transcription and translation with exquisite precision. We studied the timecourse of positive and negative-sense genomic and subgenomic viral RNA production and the relative translation efficiencies of the different virus ORFs. Virus mRNAs were not found to be translated more efficiently than host mRNAs; rather, virus translation dominates host translation at later time points due to high levels of virus transcripts. Triplet phasing of the profiling data allowed precise determination of translated reading frames and revealed several translated short open reading frames upstream of, or embedded within, known virus protein-coding regions. Ribosome pause sites were identified in the virus replicase polyprotein pp1a ORF and investigated experimentally. Contrary to expectations, ribosomes were not found to pause at the

  4. The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus.

    Science.gov (United States)

    Hori, H; Osawa, S; Murao, K; Ishikura, H

    1980-01-01

    The nucleotide sequence of ribosomal 5S RNA from Micrococcus lysodeikticus is pGUUACGGCGGCUAUAGCGUGGGGGAAACGCCCGGCCGUAUAUCGAACCCGGAAGCUAAGCCCCAUAGCGCCGAUGGUUACUGUAACCGGGAGGUUGUGGGAGAGUAGGUCGCCGCCGUGAOH. When compared to other 5S RNAs, the sequence homology is greatest with Thermus aquaticus, and these two 5S RNAs reveal several features intermediate between those of typical gram-positive bacteria and gram-negative bacteria. PMID:6780979

  5. Assessing the 5S ribosomal RNA heterogeneity in Arabidopsis thaliana using short RNA next generation sequencing data.

    Science.gov (United States)

    Szymanski, Maciej; Karlowski, Wojciech M

    2016-01-01

    In eukaryotes, ribosomal 5S rRNAs are products of multigene families organized within clusters of tandemly repeated units. Accumulation of genomic data obtained from a variety of organisms demonstrated that the potential 5S rRNA coding sequences show a large number of variants, often incompatible with folding into a correct secondary structure. Here, we present results of an analysis of a large set of short RNA sequences generated by the next generation sequencing techniques, to address the problem of heterogeneity of the 5S rRNA transcripts in Arabidopsis and identification of potentially functional rRNA-derived fragments.

  6. Sequence characterization of 5S ribosomal RNA from eight gram positive procaryotes

    Science.gov (United States)

    Woese, C. R.; Luehrsen, K. R.; Pribula, C. D.; Fox, G. E.

    1976-01-01

    Complete nucleotide sequences are presented for 5S rRNA from Bacillus subtilis, B. firmus, B. pasteurii, B. brevis, Lactobacillus brevis, and Streptococcus faecalis, and 5S rRNA oligonucleotide catalogs and partial sequence data are given for B. cereus and Sporosarcina ureae. These data demonstrate a striking consistency of 5S rRNA primary and secondary structure within a given bacterial grouping. An exception is B. brevis, in which the 5S rRNA sequence varies significantly from that of other bacilli in the tuned helix and the procaryotic loop. The localization of these variations suggests that B. brevis occupies an ecological niche that selects such changes. It is noted that this organism produces antibiotics which affect ribosome function.

  7. Highly divergent 16S rRNA sequences in ribosomal operons of Scytonema hyalinum (Cyanobacteria.

    Directory of Open Access Journals (Sweden)

    Jeffrey R Johansen

    Full Text Available A highly divergent 16S rRNA gene was found in one of the five ribosomal operons present in a species complex currently circumscribed as Scytonema hyalinum (Nostocales, Cyanobacteria using clone libraries. If 16S rRNA sequence macroheterogeneity among ribosomal operons due to insertions, deletions or truncation is excluded, the sequence heterogeneity observed in S. hyalinum was the highest observed in any prokaryotic species thus far (7.3-9.0%. The secondary structure of the 16S rRNA molecules encoded by the two divergent operons was nearly identical, indicating possible functionality. The 23S rRNA gene was examined for a few strains in this complex, and it was also found to be highly divergent from the gene in Type 2 operons (8.7%, and likewise had nearly identical secondary structure between the Type 1 and Type 2 operons. Furthermore, the 16S-23S ITS showed marked differences consistent between operons among numerous strains. Both operons have promoter sequences that satisfy consensus requirements for functional prokaryotic transcription initiation. Horizontal gene transfer from another unknown heterocytous cyanobacterium is considered the most likely explanation for the origin of this molecule, but does not explain the ultimate origin of this sequence, which is very divergent from all 16S rRNA sequences found thus far in cyanobacteria. The divergent sequence is highly conserved among numerous strains of S. hyalinum, suggesting adaptive advantage and selective constraint of the divergent sequence.

  8. rRNA:mRNA pairing alters the length and the symmetry of mRNA-protected fragments in ribosome profiling experiments

    OpenAIRE

    O?Connor, Patrick B. F.; Li, Gene-Wei; Weissman, Jonathan S.; Atkins, John F.; Baranov, Pavel V.

    2013-01-01

    Motivation: Ribosome profiling is a new technique that allows monitoring locations of translating ribosomes on mRNA at a whole transcriptome level. A recent ribosome profiling study demonstrated that internal Shine?Dalgarno (SD) sequences have a major global effect on translation rates in bacteria: ribosomes pause at SD sites in mRNA. Therefore, it is important to understand how SD sites effect mRNA movement through the ribosome and generation of ribosome footprints. Results: Here, we provide...

  9. Selection of mRNA 5'-untranslated region sequence with high translation efficiency through ribosome display

    International Nuclear Information System (INIS)

    Mie, Masayasu; Shimizu, Shun; Takahashi, Fumio; Kobatake, Eiry

    2008-01-01

    The 5'-untranslated region (5'-UTR) of mRNAs functions as a translation enhancer, promoting translation efficiency. Many in vitro translation systems exhibit a reduced efficiency in protein translation due to decreased translation initiation. The use of a 5'-UTR sequence with high translation efficiency greatly enhances protein production in these systems. In this study, we have developed an in vitro selection system that favors 5'-UTRs with high translation efficiency using a ribosome display technique. A 5'-UTR random library, comprised of 5'-UTRs tagged with a His-tag and Renilla luciferase (R-luc) fusion, were in vitro translated in rabbit reticulocytes. By limiting the translation period, only mRNAs with high translation efficiency were translated. During translation, mRNA, ribosome and translated R-luc with His-tag formed ternary complexes. They were collected with translated His-tag using Ni-particles. Extracted mRNA from ternary complex was amplified using RT-PCR and sequenced. Finally, 5'-UTR with high translation efficiency was obtained from random 5'-UTR library

  10. 5S rRNA and ribosome.

    Science.gov (United States)

    Gongadze, G M

    2011-12-01

    5S rRNA is an integral component of the ribosome of all living organisms. It is known that the ribosome without 5S rRNA is functionally inactive. However, the question about the specific role of this RNA in functioning of the translation apparatus is still open. This review presents a brief history of the discovery of 5S rRNA and studies of its origin and localization in the ribosome. The previously expressed hypotheses about the role of this RNA in the functioning of the ribosome are discussed considering the unique location of 5S rRNA in the ribosome and its intermolecular contacts. Based on analysis of the current data on ribosome structure and its functional complexes, the role of 5S rRNA as an intermediary between ribosome functional domains is discussed.

  11. 16S ribosomal RNA sequence analysis for determination of phylogenetic relationship among methylotrophs.

    Science.gov (United States)

    Tsuji, K; Tsien, H C; Hanson, R S; DePalma, S R; Scholtz, R; LaRoche, S

    1990-01-01

    16S ribosomal RNAs (rRNA) of 12 methylotrophic bacteria have been almost completely sequenced to establish their phylogenetic relationships. Methylotrophs that are physiologically related are phylogenetically diverse and are scattered among the purple eubacteria (class Proteobacteria). Group I methylotrophs can be classified in the beta- and the gamma-subdivisions and group II methylotrophs in the alpha-subdivision of the purple eubacteria, respectively. Pink-pigmented facultative and non-pigmented obligate group II methylotrophs form two distinctly separate branches within the alpha-subdivision. The secondary structures of the 16S rRNA sequences of 'Methylocystis parvus' strain OBBP, 'Methylosinus trichosporium' strain OB3b, 'Methylosporovibrio methanica' strain 81Z and Hyphomicrobium sp. strain DM2 are similar, and these non-pigmented obligate group II methylotrophs form one tight cluster in the alpha-subdivision. The pink-pigmented facultative methylotrophs, Methylobacterium extorquens strain AM1, Methylobacterium sp. strain DM4 and Methylobacterium organophilum strain XX form another cluster within the alpha-subdivision. Although similar in phenotypic characteristics, Methylobacterium organophilum strain XX and Methylobacterium extorquens strain AM1 are clearly distinguishable by their 16S rRNA sequences. The group I methylotrophs, Methylophilus methylotrophus strain AS1 and methylotrophic species DM11, which do not utilize methane, are similar in 16S rRNA sequence to bacteria in the beta-subdivision. The methane-utilizing, obligate group I methanotrophs, Methylococcus capsulatus strain BATH and Methylomonas methanica, are placed in the gamma-subdivision. The results demonstrate that it is possible to distinguish and classify the methylotrophic bacteria using 16S rRNA sequence analysis.

  12. Advantages and Limitations of Ribosomal RNA PCR and DNA Sequencing for Identification of Bacteria in Cardiac Valves of Danish Patients

    DEFF Research Database (Denmark)

    Kemp, Michael; Bangsborg, Jette; Kjerulf, Anne

    2013-01-01

    of direct molecular identification should also address weaknesses, their relevance in the given setting, and possible improvements. In this study cardiac valves from 56 Danish patients referred for surgery for infective endocarditis were analysed by microscopy and culture as well as by PCR targeting part...... of the bacterial 16S rRNA gene followed by DNA sequencing of the PCR product. PCR and DNA sequencing identified significant bacteria in 49 samples from 43 patients, including five out of 13 culture-negative cases. No rare, exotic, or intracellular bacteria were identified. There was a general agreement between...... bacterial identity obtained by ribosomal PCR and DNA sequencing from the valves and bacterial isolates from blood culture. However, DNA sequencing of the 16S rRNA gene did not discriminate well among non-haemolytic streptococci, especially within the Streptococcus mitis group. Ribosomal PCR with subsequent...

  13. Dwell-Time Distribution, Long Pausing and Arrest of Single-Ribosome Translation through the mRNA Duplex.

    Science.gov (United States)

    Xie, Ping

    2015-10-09

    Proteins in the cell are synthesized by a ribosome translating the genetic information encoded on the single-stranded messenger RNA (mRNA). It has been shown that the ribosome can also translate through the duplex region of the mRNA by unwinding the duplex. Here, based on our proposed model of the ribosome translation through the mRNA duplex we study theoretically the distribution of dwell times of the ribosome translation through the mRNA duplex under the effect of a pulling force externally applied to the ends of the mRNA to unzip the duplex. We provide quantitative explanations of the available single molecule experimental data on the distribution of dwell times with both short and long durations, on rescuing of the long paused ribosomes by raising the pulling force to unzip the duplex, on translational arrests induced by the mRNA duplex and Shine-Dalgarno(SD)-like sequence in the mRNA. The functional consequences of the pauses or arrests caused by the mRNA duplex and the SD sequence are discussed and compared with those obtained from other types of pausing, such as those induced by "hungry" codons or interactions of specific sequences in the nascent chain with the ribosomal exit tunnel.

  14. Ribosomal RNA gene sequences confirm that protistan endoparasite of larval cod Gadus morhua is Ichthyodinium sp

    DEFF Research Database (Denmark)

    Skovgaard, Alf; Meyer, Stefan; Overton, Julia Lynne

    2010-01-01

    An enigmatic protistan endoparasite found in eggs and larvae of cod Gadus morhua and turbot Psetta maxima was isolated from Baltic cod larvae, and DNA was extracted for sequencing of the parasite's small Subunit ribosomal RNA (SSU rRNA) gene. The endoparasite has previously been suggested...... to be related to Ichthyodinium chabelardi, a dinoflagellate-like protist that parasitizes yolk sacs of embryos and larvae of a variety of fish species. Comparison of a 1535 bp long fragment of the SSU rRNA gene of the cod endoparasite showed absolute identify with I. chabelardi, demonstrating that the 2...

  15. A ribosome without RNA

    Directory of Open Access Journals (Sweden)

    Harold S Bernhardt

    2015-11-01

    Full Text Available It was Francis Crick who first asked why the ribosome contains so much RNA, and discussed the implications of this for the direct flow of genetic information from DNA to protein. Remarkable advances in our understanding of the ribosome and protein synthesis, including the recent publication of two mammalian mitochondrial ribosome structures, have shed new light on this intriguing aspect of evolution in molecular biology. We examine here whether RNA is indispensable for coded protein synthesis, or whether an all-protein ‘ribosome’ (or ‘synthosome’ might be possible, with a protein enzyme catalyzing peptide synthesis, and release factor-like protein adaptors able to read a message composed of deoxyribonucleotides. We also compare the RNA world hypothesis with the alternative ‘proteins first’ hypothesis in terms of their different understandings of the evolution of the ribosome, and whether this might have been preceded by an ancestral form of nonribosomal peptide synthesis catalyzed by protein enzymes.

  16. Comparison of 16S ribosomal RNA gene sequence analysis and conventional culture in the environmental survey of a hospital

    OpenAIRE

    Manaka, Akihiro; Tokue, Yutaka; Murakami, Masami

    2017-01-01

    Background Nosocomial infection is one of the most common complications within health care facilities. Certain studies have reported outbreaks resulting from contaminated hospital environments. Although the identification of bacteria in the environment can readily be achieved using culturing methods, these methods detect live bacteria. Sequencing of the 16S ribosomal RNA (16S rRNA) gene is recognized to be effective for bacterial identification. In this study, we surveyed wards where drug-res...

  17. Analysis of Pteridium ribosomal RNA sequences by rapid direct sequencing.

    Science.gov (United States)

    Tan, M K

    1991-08-01

    A total of 864 bases from 5 regions interspersed in the 18S and 26S rRNA molecules from various clones of Pteridium covering the general geographical distribution of the genus was analysed using a rapid rRNA sequencing technique. No base difference has been detected amongst the three major lineages, two of which apparently separated before the breakup of the ancient supercontinent, Pangaea. These regions of the rRNA sequences have thus been conserved for at least 160 million years and are here compared with other eukaryotic, especially plant rRNAs.

  18. [Characterization of Black and Dichothrix Cyanobacteria Based on the 16S Ribosomal RNA Gene Sequence

    Science.gov (United States)

    Ortega, Maya

    2010-01-01

    My project focuses on characterizing different cyanobacteria in thrombolitic mats found on the island of Highborn Cay, Bahamas. Thrombolites are interesting ecosystems because of the ability of bacteria in these mats to remove carbon dioxide from the atmosphere and mineralize it as calcium carbonate. In the future they may be used as models to develop carbon sequestration technologies, which could be used as part of regenerative life systems in space. These thrombolitic communities are also significant because of their similarities to early communities of life on Earth. I targeted two cyanobacteria in my research, Dichothrix spp. and whatever black is, since they are believed to be important to carbon sequestration in these thrombolitic mats. The goal of my summer research project was to molecularly identify these two cyanobacteria. DNA was isolated from each organism through mat dissections and DNA extractions. I ran Polymerase Chain Reactions (PCR) to amplify the 16S ribosomal RNA (rRNA) gene in each cyanobacteria. This specific gene is found in almost all bacteria and is highly conserved, meaning any changes in the sequence are most likely due to evolution. As a result, the 16S rRNA gene can be used for bacterial identification of different species based on the sequence of their 16S rRNA gene. Since the exact sequence of the Dichothrix gene was unknown, I designed different primers that flanked the gene based on the known sequences from other taxonomically similar cyanobacteria. Once the 16S rRNA gene was amplified, I cloned the gene into specialized Escherichia coli cells and sent the gene products for sequencing. Once the sequence is obtained, it will be added to a genetic database for future reference to and classification of other Dichothrix sp.

  19. 5S ribosomal RNA database Y2K.

    Science.gov (United States)

    Szymanski, M; Barciszewska, M Z; Barciszewski, J; Erdmann, V A

    2000-01-01

    This paper presents the updated version (Y2K) of the database of ribosomal 5S ribonucleic acids (5S rRNA) and their genes (5S rDNA), http://rose.man/poznan.pl/5SData/index.html. This edition of the database contains 1985primary structures of 5S rRNA and 5S rDNA. They include 60 archaebacterial, 470 eubacterial, 63 plastid, nine mitochondrial and 1383 eukaryotic sequences. The nucleotide sequences of the 5S rRNAs or 5S rDNAs are divided according to the taxonomic position of the source organisms.

  20. Molecular phylogenetic studies on an unnamed bovine Babesia sp. based on small subunit ribosomal RNA gene sequences.

    Science.gov (United States)

    Luo, Jianxun; Yin, Hong; Liu, Zhijie; Yang, Dongying; Guan, Guiquan; Liu, Aihong; Ma, Miling; Dang, Shengzhi; Lu, Bingyi; Sun, Caiqin; Bai, Qi; Lu, Wenshun; Chen, Puyan

    2005-10-10

    The 18S small subunit ribosomal RNA (18S rRNA) gene of an unnamed Babesia species (designated B. U sp.) was sequenced and analyzed in an attempt to distinguish it from other Babesia species in China. The target DNA segment was amplified by polymerase chain reaction (PCR). The PCR product was ligated to the pGEM-T Easy vector for sequencing. It was found that the length of the 18S rRNA gene of all B. U sp. Kashi 1 and B. U sp. Kashi 2 was 1699 bp and 1689 bp. Two phylogenetic trees were, respectively, inferred based on 18S rRNA sequence of the Chinese bovine Babesia isolates and all of Babesia species available in GenBank. The first tree showed that B. U sp. was situated in the branch between B. major Yili and B. bovis Shannxian, and the second tree revealed that B. U sp. was confined to the same group as B. caballi. The percent identity of B. U sp. with other Chinese Babesia species was between 74.2 and 91.8, while the percent identity between two B. U sp. isolates was 99.7. These results demonstrated that this B. U sp. is different from other Babesia species, but that two B. U sp. isolates obtained with nymphal and adultal Hyalomma anatolicum anatolicum tick belong to the same species.

  1. Fluctuations in protein synthesis from a single RNA template: stochastic kinetics of ribosomes.

    Science.gov (United States)

    Garai, Ashok; Chowdhury, Debashish; Ramakrishnan, T V

    2009-01-01

    Proteins are polymerized by cyclic machines called ribosomes, which use their messenger RNA (mRNA) track also as the corresponding template, and the process is called translation. We explore, in depth and detail, the stochastic nature of the translation. We compute various distributions associated with the translation process; one of them--namely, the dwell time distribution--has been measured in recent single-ribosome experiments. The form of the distribution, which fits best with our simulation data, is consistent with that extracted from the experimental data. For our computations, we use a model that captures both the mechanochemistry of each individual ribosome and their steric interactions. We also demonstrate the effects of the sequence inhomogeneities of real genes on the fluctuations and noise in translation. Finally, inspired by recent advances in the experimental techniques of manipulating single ribosomes, we make theoretical predictions on the force-velocity relation for individual ribosomes. In principle, all our predictions can be tested by carrying out in vitro experiments.

  2. Ribosome dynamics and tRNA movement by time-resolved electron cryomicroscopy.

    Science.gov (United States)

    Fischer, Niels; Konevega, Andrey L; Wintermeyer, Wolfgang; Rodnina, Marina V; Stark, Holger

    2010-07-15

    The translocation step of protein synthesis entails large-scale rearrangements of the ribosome-transfer RNA (tRNA) complex. Here we have followed tRNA movement through the ribosome during translocation by time-resolved single-particle electron cryomicroscopy (cryo-EM). Unbiased computational sorting of cryo-EM images yielded 50 distinct three-dimensional reconstructions, showing the tRNAs in classical, hybrid and various novel intermediate states that provide trajectories and kinetic information about tRNA movement through the ribosome. The structures indicate how tRNA movement is coupled with global and local conformational changes of the ribosome, in particular of the head and body of the small ribosomal subunit, and show that dynamic interactions between tRNAs and ribosomal residues confine the path of the tRNAs through the ribosome. The temperature dependence of ribosome dynamics reveals a surprisingly flat energy landscape of conformational variations at physiological temperature. The ribosome functions as a Brownian machine that couples spontaneous conformational changes driven by thermal energy to directed movement.

  3. Novel mRNA-specific effects of ribosome drop-off on translation rate and polysome profile.

    Directory of Open Access Journals (Sweden)

    Pierre Bonnin

    2017-05-01

    Full Text Available The well established phenomenon of ribosome drop-off plays crucial roles in translational accuracy and nutrient starvation responses during protein translation. When cells are under stress conditions, such as amino acid starvation or aminoacyl-tRNA depletion due to a high level of recombinant protein expression, ribosome drop-off can substantially affect the efficiency of protein expression. Here we introduce a mathematical model that describes the effects of ribosome drop-off on the ribosome density along the mRNA and on the concomitant protein synthesis rate. Our results show that ribosome premature termination may lead to non-intuitive ribosome density profiles, such as a ribosome density which increases from the 5' to the 3' end. Importantly, the model predicts that the effects of ribosome drop-off on the translation rate are mRNA-specific, and we quantify their resilience to drop-off, showing that the mRNAs which present ribosome queues are much less affected by ribosome drop-off than those which do not. Moreover, among those mRNAs that do not present ribosome queues, resilience to drop-off correlates positively with the elongation rate, so that sequences using fast codons are expected to be less affected by ribosome drop-off. This result is consistent with a genome-wide analysis of S. cerevisiae, which reveals that under favourable growth conditions mRNAs coding for proteins involved in the translation machinery, known to be highly codon biased and using preferentially fast codons, are highly resilient to ribosome drop-off. Moreover, in physiological conditions, the translation rate of mRNAs coding for regulatory, stress-related proteins, is less resilient to ribosome drop-off. This model therefore allows analysis of variations in the translational efficiency of individual mRNAs by accounting for the full range of known ribosome behaviours, as well as explaining mRNA-specific variations in ribosome density emerging from ribosome profiling

  4. The role of upstream sequences in selecting the reading frame on tmRNA

    Directory of Open Access Journals (Sweden)

    Dewey Jonathan D

    2008-06-01

    Full Text Available Abstract Background tmRNA acts first as a tRNA and then as an mRNA to rescue stalled ribosomes in eubacteria. Two unanswered questions about tmRNA function remain: how does tmRNA, lacking an anticodon, bypass the decoding machinery and enter the ribosome? Secondly, how does the ribosome choose the proper codon to resume translation on tmRNA? According to the -1 triplet hypothesis, the answer to both questions lies in the unique properties of the three nucleotides upstream of the first tmRNA codon. These nucleotides assume an A-form conformation that mimics the codon-anticodon interaction, leading to recognition by the decoding center and choice of the reading frame. The -1 triplet hypothesis is important because it is the most credible model in which direct binding and recognition by the ribosome sets the reading frame on tmRNA. Results Conformational analysis predicts that 18 triplets cannot form the correct structure to function as the -1 triplet of tmRNA. We tested the tmRNA activity of all possible -1 triplet mutants using a genetic assay in Escherichia coli. While many mutants displayed reduced activity, our findings do not match the predictions of this model. Additional mutagenesis identified sequences further upstream that are required for tmRNA function. An immunoblot assay for translation of the tmRNA tag revealed that certain mutations in U85, A86, and the -1 triplet sequence result in improper selection of the first codon and translation in the wrong frame (-1 or +1 in vivo. Conclusion Our findings disprove the -1 triplet hypothesis. The -1 triplet is not required for accommodation of tmRNA into the ribosome, although it plays a minor role in frame selection. Our results strongly disfavor direct ribosomal recognition of the upstream sequence, instead supporting a model in which the binding of a separate ligand to A86 is primarily responsible for frame selection.

  5. Histone and ribosomal RNA repetitive gene clusters of the boll weevil are linked in a tandem array.

    Science.gov (United States)

    Roehrdanz, R; Heilmann, L; Senechal, P; Sears, S; Evenson, P

    2010-08-01

    Histones are the major protein component of chromatin structure. The histone family is made up of a quintet of proteins, four core histones (H2A, H2B, H3 & H4) and the linker histones (H1). Spacers are found between the coding regions. Among insects this quintet of genes is usually clustered and the clusters are tandemly repeated. Ribosomal DNA contains a cluster of the rRNA sequences 18S, 5.8S and 28S. The rRNA genes are separated by the spacers ITS1, ITS2 and IGS. This cluster is also tandemly repeated. We found that the ribosomal RNA repeat unit of at least two species of Anthonomine weevils, Anthonomus grandis and Anthonomus texanus (Coleoptera: Curculionidae), is interspersed with a block containing the histone gene quintet. The histone genes are situated between the rRNA 18S and 28S genes in what is known as the intergenic spacer region (IGS). The complete reiterated Anthonomus grandis histone-ribosomal sequence is 16,248 bp.

  6. The ribosome as a molecular machine: the mechanism of tRNA-mRNA movement in translocation.

    Science.gov (United States)

    Rodnina, Marina V; Wintermeyer, Wolfgang

    2011-04-01

    Translocation of tRNA and mRNA through the ribosome is one of the most dynamic events during protein synthesis. In the cell, translocation is catalysed by EF-G (elongation factor G) and driven by GTP hydrolysis. Major unresolved questions are: how the movement is induced and what the moving parts of the ribosome are. Recent progress in time-resolved cryoelectron microscopy revealed trajectories of tRNA movement through the ribosome. Driven by thermal fluctuations, the ribosome spontaneously samples a large number of conformational states. The spontaneous movement of tRNAs through the ribosome is loosely coupled to the motions within the ribosome. EF-G stabilizes conformational states prone to translocation and promotes a conformational rearrangement of the ribosome (unlocking) that accelerates the rate-limiting step of translocation: the movement of the tRNA anticodons on the small ribosomal subunit. EF-G acts as a Brownian ratchet providing directional bias for movement at the cost of GTP hydrolysis.

  7. Deciphering the role of the Gag-Pol ribosomal frameshift signal in HIV-1 RNA genome packaging.

    Science.gov (United States)

    Nikolaitchik, Olga A; Hu, Wei-Shau

    2014-04-01

    A key step of retroviral replication is packaging of the viral RNA genome during virus assembly. Specific packaging is mediated by interactions between the viral protein Gag and elements in the viral RNA genome. In HIV-1, similar to most retroviruses, the packaging signal is located within the 5' untranslated region and extends into the gag-coding region. A recent study reported that a region including the Gag-Pol ribosomal frameshift signal plays an important role in HIV-1 RNA packaging; deletions or mutations that affect the RNA structure of this signal lead to drastic decreases (10- to 50-fold) in viral RNA packaging and virus titer. We examined here the role of the ribosomal frameshift signal in HIV-1 RNA packaging by studying the RNA packaging and virus titer in the context of proviruses. Three mutants with altered ribosomal frameshift signal, either through direct deletion of the signal, mutation of the 6U slippery sequence, or alterations of the secondary structure were examined. We found that RNAs from all three mutants were packaged efficiently, and they generate titers similar to that of a virus containing the wild-type ribosomal frameshift signal. We conclude that although the ribosomal frameshift signal plays an important role in regulating the replication cycle, this RNA element is not directly involved in regulating RNA encapsidation. To generate infectious viruses, HIV-1 must package viral RNA genome during virus assembly. The specific HIV-1 genome packaging is mediated by interactions between the structural protein Gag and elements near the 5' end of the viral RNA known as packaging signal. In this study, we examined whether the Gag-Pol ribosomal frameshift signal is important for HIV-1 RNA packaging as recently reported. Our results demonstrated that when Gag/Gag-Pol is supplied in trans, none of the tested ribosomal frameshift signal mutants has defects in RNA packaging or virus titer. These studies provide important information on how HIV-1

  8. Import of desired nucleic acid sequences using addressing motif of mitochondrial ribosomal 5S-rRNA for fluorescent in vivo hybridization of mitochondrial DNA and RNA.

    Science.gov (United States)

    Zelenka, Jaroslav; Alán, Lukáš; Jabůrek, Martin; Ježek, Petr

    2014-04-01

    Based on the matrix-addressing sequence of mitochondrial ribosomal 5S-rRNA (termed MAM), which is naturally imported into mitochondria, we have constructed an import system for in vivo targeting of mitochondrial DNA (mtDNA) or mt-mRNA, in order to provide fluorescence hybridization of the desired sequences. Thus DNA oligonucleotides were constructed, containing the 5'-flanked T7 RNA polymerase promoter. After in vitro transcription and fluorescent labeling with Alexa Fluor(®) 488 or 647 dye, we obtained the fluorescent "L-ND5 probe" containing MAM and exemplar cargo, i.e., annealing sequence to a short portion of ND5 mRNA and to the light-strand mtDNA complementary to the heavy strand nd5 mt gene (5'-end 21 base pair sequence). For mitochondrial in vivo fluorescent hybridization, HepG2 cells were treated with dequalinium micelles, containing the fluorescent probes, bringing the probes proximally to the mitochondrial outer membrane and to the natural import system. A verification of import into the mitochondrial matrix of cultured HepG2 cells was provided by confocal microscopy colocalizations. Transfections using lipofectamine or probes without 5S-rRNA addressing MAM sequence or with MAM only were ineffective. Alternatively, the same DNA oligonucleotides with 5'-CACC overhang (substituting T7 promoter) were transcribed from the tetracycline-inducible pENTRH1/TO vector in human embryonic kidney T-REx®-293 cells, while mitochondrial matrix localization after import of the resulting unlabeled RNA was detected by PCR. The MAM-containing probe was then enriched by three-order of magnitude over the natural ND5 mRNA in the mitochondrial matrix. In conclusion, we present a proof-of-principle for mitochondrial in vivo hybridization and mitochondrial nucleic acid import.

  9. Interaction of tRNA with Eukaryotic Ribosome

    Directory of Open Access Journals (Sweden)

    Dmitri Graifer

    2015-03-01

    Full Text Available This paper is a review of currently available data concerning interactions of tRNAs with the eukaryotic ribosome at various stages of translation. These data include the results obtained by means of cryo-electron microscopy and X-ray crystallography applied to various model ribosomal complexes, site-directed cross-linking with the use of tRNA derivatives bearing chemically or photochemically reactive groups in the CCA-terminal fragment and chemical probing of 28S rRNA in the region of the peptidyl transferase center. Similarities and differences in the interactions of tRNAs with prokaryotic and eukaryotic ribosomes are discussed with concomitant consideration of the extent of resemblance between molecular mechanisms of translation in eukaryotes and bacteria.

  10. Fragmentation of the large subunit ribosomal RNA gene in oyster mitochondrial genomes

    Directory of Open Access Journals (Sweden)

    Milbury Coren A

    2010-09-01

    Full Text Available Abstract Background Discontinuous genes have been observed in bacteria, archaea, and eukaryotic nuclei, mitochondria and chloroplasts. Gene discontinuity occurs in multiple forms: the two most frequent forms result from introns that are spliced out of the RNA and the resulting exons are spliced together to form a single transcript, and fragmented gene transcripts that are not covalently attached post-transcriptionally. Within the past few years, fragmented ribosomal RNA (rRNA genes have been discovered in bilateral metazoan mitochondria, all within a group of related oysters. Results In this study, we have characterized this fragmentation with comparative analysis and experimentation. We present secondary structures, modeled using comparative sequence analysis of the discontinuous mitochondrial large subunit rRNA genes of the cupped oysters C. virginica, C. gigas, and C. hongkongensis. Comparative structure models for the large subunit rRNA in each of the three oyster species are generally similar to those for other bilateral metazoans. We also used RT-PCR and analyzed ESTs to determine if the two fragmented LSU rRNAs are spliced together. The two segments are transcribed separately, and not spliced together although they still form functional rRNAs and ribosomes. Conclusions Although many examples of discontinuous ribosomal genes have been documented in bacteria and archaea, as well as the nuclei, chloroplasts, and mitochondria of eukaryotes, oysters are some of the first characterized examples of fragmented bilateral animal mitochondrial rRNA genes. The secondary structures of the oyster LSU rRNA fragments have been predicted on the basis of previous comparative metazoan mitochondrial LSU rRNA structure models.

  11. Morpholino spin-labeling for base-pair sequencing of a 3'-terminal RNA stem by proton homonuclear Overhauser enhancements: yeast ribosomal 5S RNA

    International Nuclear Information System (INIS)

    Lee, K.M.; Marshall, A.G.

    1987-01-01

    Base-pair sequences for 5S and 5.8S RNAs are not readily extracted from proton homonuclear nuclear Overhauser enhancement (NOE) connectivity experiments alone, due to extensive peak overlap in the downfield (11-15 ppm) proton NMR spectrum. In this paper, we introduce a new method for base-pair proton peak assignment for ribosomal RNAs, based upon the distance-dependent broadening of the resonances of base-pair protons spatially proximal to a paramagnetic group. Introduction of a nitroxide spin-label covalently attached to the 3'-terminal ribose provides an unequivocal starting point for base-pair hydrogen-bond proton NMR assignment. Subsequent NOE connectivities then establish the base-pair sequence for the terminal stem of a 5S RNA. Periodate oxidation of yeast 5S RNA, followed by reaction with 4-amino-2,2,6,6-tetramethylpiperidinyl-1-oxy (TEMPO-NH2) and sodium borohydride reduction, produces yeast 5S RNA specifically labeled with a paramagnetic nitroxide group at the 3'-terminal ribose. Comparison of the 500-MHz 1H NMR spectra of native and 3'-terminal spin-labeled yeast 5S RNA serves to identify the terminal base pair (G1 . C120) and its adjacent base pair (G2 . U119) on the basis of their proximity to the 3'-terminal spin-label. From that starting point, we have then identified (G . C, A . U, or G . U) and sequenced eight of the nine base pairs in the terminal helix via primary and secondary NOE's

  12. [Molecular phylogeny of Turbellaria, based on data from comparing the nucleotide sequences of 18S ribosomal RNA genes].

    Science.gov (United States)

    Kuznedelov, K D; Timoshkin, O A

    1995-01-01

    Polymerase chain reaction and direct sequencing of the 5'-end region of the 18S ribosomal RNA gene were used to infer phylogenetic relationship among turbellarian flatworms from Lake Baikal. Representatives of 5 orders (Tricladida--10 spp., Lecithoepitheliata--5 spp., Prolecithophora--3 spp., Proseriata and Kalyptorhynchia one for each) were studied; nucleotide sequence of more than 340 nucleotides was determined for each species. Consensus sequence for each order having more than one representative species was determined. Distance matrix and maximum parsimony approaches were applied to infer phylogenies. Bootstrap procedure was used to estimate confidence limits, at the 100% level by bootstrapping, the group of three orders: Kalyptorhynchia, Proseriata and Lecithoepitheliata was found to be monophyletic. However, subsets inside the group had no significant support to be preferred or rejected. Our data do not support traditional systematics which joins two suborders Tricladida and Proseriata into the single order Seriata, and also do not support comparative anatomical data which show close relationship of Lecithoepitheliata and lower Prolecithophora.

  13. Clusters of basic amino acids contribute to RNA binding and nucleolar localization of ribosomal protein L22.

    Directory of Open Access Journals (Sweden)

    Jennifer L Houmani

    Full Text Available The ribosomal protein L22 is a component of the 60S eukaryotic ribosomal subunit. As an RNA-binding protein, it has been shown to interact with both cellular and viral RNAs including 28S rRNA and the Epstein-Barr virus encoded RNA, EBER-1. L22 is localized to the cell nucleus where it accumulates in nucleoli. Although previous studies demonstrated that a specific amino acid sequence is required for nucleolar localization, the RNA-binding domain has not been identified. Here, we investigated the hypothesis that the nucleolar accumulation of L22 is linked to its ability to bind RNA. To address this hypothesis, mutated L22 proteins were generated to assess the contribution of specific amino acids to RNA binding and protein localization. Using RNA-protein binding assays, we demonstrate that basic amino acids 80-93 are required for high affinity binding of 28S rRNA and EBER-1 by L22. Fluorescence localization studies using GFP-tagged mutated L22 proteins further reveal that basic amino acids 80-93 are critical for nucleolar accumulation and for incorporation into ribosomes. Our data support the growing consensus that the nucleolar accumulation of ribosomal proteins may not be mediated by a defined localization signal, but rather by specific interaction with established nucleolar components such as rRNA.

  14. Effect of primary and secondary radicals on chain breaks in ribosomal RNA in E. coli ribosomes

    International Nuclear Information System (INIS)

    Singh, H.; Bishop, J.

    1984-01-01

    It has been shown previously that, in dilute aerated solutions, ribosomes are inactivated by OH radicals and by secondary radicals produced from added alcohols (Singh and Vadasz 1983 a). In de-aerated solutions, both radicalH and e - sub(aq) also inactivate ribosomes (Singh and Vadasz 1983 b). The results of these studies and other on different systems (Adams et al. 1973, Aldrich and Cundall 1969, Dewey and Stein 1970, Masuda et al. 1971, Nabben et al. 1982, 1983, Samuni et al. 1980, Singh and Singh 1982) have shown that damage to biological systems occurs by diverse mechanisms. One of these mechanisms involves chain breaks in RNA (Pollard and Weller 1967). The purpose of this study was to determine which of the primary and secondary radicals cause chain breaks in ribosomal RNA (rRNA) within the ribosomes. (author)

  15. Spontaneous reverse movement of mRNA-bound tRNA through the ribosome.

    Science.gov (United States)

    Konevega, Andrey L; Fischer, Niels; Semenkov, Yuri P; Stark, Holger; Wintermeyer, Wolfgang; Rodnina, Marina V

    2007-04-01

    During the translocation step of protein synthesis, a complex of two transfer RNAs bound to messenger RNA (tRNA-mRNA) moves through the ribosome. The reaction is promoted by an elongation factor, called EF-G in bacteria, which, powered by GTP hydrolysis, induces an open, unlocked conformation of the ribosome that allows for spontaneous tRNA-mRNA movement. Here we show that, in the absence of EF-G, there is spontaneous backward movement, or retrotranslocation, of two tRNAs bound to mRNA. Retrotranslocation is driven by the gain in affinity when a cognate E-site tRNA moves into the P site, which compensates the affinity loss accompanying the movement of peptidyl-tRNA from the P to the A site. These results lend support to the diffusion model of tRNA movement during translocation. In the cell, tRNA movement is biased in the forward direction by EF-G, which acts as a Brownian ratchet and prevents backward movement.

  16. tmRNA-mediated trans-translation as the major ribosome rescue system in a bacterial cell

    Directory of Open Access Journals (Sweden)

    Hyouta eHimeno

    2014-04-01

    Full Text Available tmRNA (transfer messenger RNA; also known as 10Sa RNA or SsrA RNA is a small RNA molecule that is conserved among bacteria. It has structural and functional similarities to tRNA: it has an upper half of the tRNA-like structure, its 5’ end is processed by RNase P, it has typical tRNA-specific base modifications, it is aminoacylated with alanine, it binds to EF-Tu after aminoacylation and it enters the ribosome with EF-Tu and GTP. However, tmRNA lacks an anticodon, and instead it has a coding sequence for a short peptide called tag-peptide. An elaborate interplay of actions of tmRNA as both tRNA and mRNA with the help of a tmRNA-binding protein, SmpB, facilitates trans-translation, which produces a single polypeptide from two mRNA molecules. Initially alanyl-tmRNA in complex with EF-Tu and SmpB enters the vacant A-site of the stalled ribosome like aminoacyl-tRNA but without a codon-anticodon interaction, and subsequently truncated mRNA is replaced with the tag-encoding region of tmRNA. During these processes, not only tmRNA but also SmpB structurally and functionally mimics both tRNA and mRNA. Thus trans-translation rescues the stalled ribosome, thereby allowing recycling of the ribosome. Since the tag-peptide serves as a target of AAA+ proteases, the trans-translation products are preferentially degraded so that they do not accumulate in the cell. Although alternative rescue systems have recently been revealed, trans-translation is the only system that universally exists in bacteria. Furthermore, it is unique in that it employs a small RNA and that it prevents accumulation of nonfunctional proteins from truncated mRNA in the cell. It might play the major role in rescuing the stalled translation in the bacterial cell.

  17. The use of 125iodine-labeled RNA for detection of the RNA binding to ribosomes

    International Nuclear Information System (INIS)

    Mori, Tomohiko; Fukuda, Mitsuru

    1975-01-01

    The in vitro labeling of RNA with radioactive iodine is the efficient method to obtain the RNA with high specific activity. The present paper reports on the application of this technique to the production of iodine-labeled RNA for use in the experiment of binding RNA to ribosomes. Tobacco mosaic virus (TMV) RNA was used as natural mRNA, and E. coli S-30 preparation was used as a source of ribosomes. The TMV-RNA was prepared by bentonite-phenol extraction from TMV, and the method used for the iodation of RNA was based on the procedure described by Getz et al. The iodine-labeled RNA was incubated in a cell-free protein synthesizing system (S-30) prepared from E. coli K-12. After the incubation, the reaction mixture was layered onto sucrose gradient, centrifuged, and fractionated into 18 fractions. Optical density at 260 nm was measured, and radioactivity was counted, for each fraction. The binding of mRNA to ribosomes occurred even at 0 deg C, and the occurrence of the nonspecific binding was also shown. Consequently, the specific binding, i.e. the formation of the initiation complex being involved in amino acid incorporation, may be estimated by subtracting the radioactivity associated with monosomes in the presence of both rRNA and ATA from that in the presence of rRNA only. It was shown that the iodine-labeled RNA can be used for the studies of binding RNA to ribosomes. (Kako, I.)

  18. Thousands of primer-free, high-quality, full-length SSU rRNA sequences from all domains of life

    DEFF Research Database (Denmark)

    Karst, Soeren M; Dueholm, Morten S; McIlroy, Simon J

    2016-01-01

    Ribosomal RNA (rRNA) genes are the consensus marker for determination of microbial diversity on the planet, invaluable in studies of evolution and, for the past decade, high-throughput sequencing of variable regions of ribosomal RNA genes has become the backbone of most microbial ecology studies...... (SSU) rRNA genes and synthetic long read sequencing by molecular tagging, to generate primer-free, full-length SSU rRNA gene sequences from all domains of life, with a median raw error rate of 0.17%. We generated thousands of full-length SSU rRNA sequences from five well-studied ecosystems (soil, human...... gut, fresh water, anaerobic digestion, and activated sludge) and obtained sequences covering all domains of life and the majority of all described phyla. Interestingly, 30% of all bacterial operational taxonomic units were novel, compared to the SILVA database (less than 97% similarity...

  19. Sequencing of 16S rRNA gene for id ntification of Sta h lococcus ...

    African Journals Online (AJOL)

    Asdmin

    2014-01-15

    Jan 15, 2014 ... as the type strains of a species of genus Trichoderma based on phylogenetic tree analysis together with the 18S rRNA gene sequence search in Ribosomal Database Project, small subunit rRNA and large subunit rRNA databases. The sequence was deposited in GenBank with the accession numbers.

  20. Genome-wide mRNA processing in methanogenic archaea reveals post-transcriptional regulation of ribosomal protein synthesis.

    Science.gov (United States)

    Qi, Lei; Yue, Lei; Feng, Deqin; Qi, Fengxia; Li, Jie; Dong, Xiuzhu

    2017-07-07

    Unlike stable RNAs that require processing for maturation, prokaryotic cellular mRNAs generally follow an 'all-or-none' pattern. Herein, we used a 5΄ monophosphate transcript sequencing (5΄P-seq) that specifically captured the 5΄-end of processed transcripts and mapped the genome-wide RNA processing sites (PSSs) in a methanogenic archaeon. Following statistical analysis and stringent filtration, we identified 1429 PSSs, among which 23.5% and 5.4% were located in 5΄ untranslated region (uPSS) and intergenic region (iPSS), respectively. A predominant uridine downstream PSSs served as a processing signature. Remarkably, 5΄P-seq detected overrepresented uPSS and iPSS in the polycistronic operons encoding ribosomal proteins, and the majority upstream and proximal ribosome binding sites, suggesting a regulatory role of processing on translation initiation. The processed transcripts showed increased stability and translation efficiency. Particularly, processing within the tricistronic transcript of rplA-rplJ-rplL enhanced the translation of rplL, which can provide a driving force for the 1:4 stoichiometry of L10 to L12 in the ribosome. Growth-associated mRNA processing intensities were also correlated with the cellular ribosomal protein levels, thereby suggesting that mRNA processing is involved in tuning growth-dependent ribosome synthesis. In conclusion, our findings suggest that mRNA processing-mediated post-transcriptional regulation is a potential mechanism of ribosomal protein synthesis and stoichiometry. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  1. A review on architecture of the gag-pol ribosomal frameshifting RNA in human immunodeficiency virus: a variability survey of virus genotypes.

    Science.gov (United States)

    Qiao, Qi; Yan, Yanhua; Guo, Jinmei; Du, Shuqiang; Zhang, Jiangtao; Jia, Ruyue; Ren, Haimin; Qiao, Yuanbiao; Li, Qingshan

    2017-06-01

    Programmed '-1' ribosomal frameshifting is necessary for expressing the pol gene overlapped from a gag of human immunodeficiency virus. A viral RNA structure that requires base pairing across the overlapping sequence region suggests a mechanism of regulating ribosome and helicase traffic during expression. To get precise roles of an element around the frameshift site, a review on architecture of the frameshifting RNA is performed in combination of reported information with augments of a representative set of 19 viral samples. In spite of a different length for the viral RNAs, a canonical comparison on the element sequence allocation is performed for viewing variability associations between virus genotypes. Additionally, recent and historical insights recognized in frameshifting regulation are looked back as for indel and single nucleotide polymorphism of RNA. As specially noted, structural changes at a frameshift site, the spacer sequence, and a three-helix junction element, as well as two Watson-Crick base pairs near a bulge and a C-G pair close a loop, are the most vital strategies for the virus frameshifting regulations. All of structural changes, which are dependent upon specific sequence variations, facilitate an elucidation about the RNA element conformation-dependent mechanism for frameshifting. These facts on disrupting base pair interactions also allow solving the problem of competition between ribosome and helicase on a same RNA template, common to single-stranded RNA viruses. In a broad perspective, each new insight of frameshifting regulation in the competition systems introduced by the RNA element construct changes will offer a compelling target for antiviral therapy.

  2. The ribosome uses two active mechanisms to unwind messenger RNA during translation.

    Science.gov (United States)

    Qu, Xiaohui; Wen, Jin-Der; Lancaster, Laura; Noller, Harry F; Bustamante, Carlos; Tinoco, Ignacio

    2011-07-06

    The ribosome translates the genetic information encoded in messenger RNA into protein. Folded structures in the coding region of an mRNA represent a kinetic barrier that lowers the peptide elongation rate, as the ribosome must disrupt structures it encounters in the mRNA at its entry site to allow translocation to the next codon. Such structures are exploited by the cell to create diverse strategies for translation regulation, such as programmed frameshifting, the modulation of protein expression levels, ribosome localization and co-translational protein folding. Although strand separation activity is inherent to the ribosome, requiring no exogenous helicases, its mechanism is still unknown. Here, using a single-molecule optical tweezers assay on mRNA hairpins, we find that the translation rate of identical codons at the decoding centre is greatly influenced by the GC content of folded structures at the mRNA entry site. Furthermore, force applied to the ends of the hairpin to favour its unfolding significantly speeds translation. Quantitative analysis of the force dependence of its helicase activity reveals that the ribosome, unlike previously studied helicases, uses two distinct active mechanisms to unwind mRNA structure: it destabilizes the helical junction at the mRNA entry site by biasing its thermal fluctuations towards the open state, increasing the probability of the ribosome translocating unhindered; and it mechanically pulls apart the mRNA single strands of the closed junction during the conformational changes that accompany ribosome translocation. The second of these mechanisms ensures a minimal basal rate of translation in the cell; specialized, mechanically stable structures are required to stall the ribosome temporarily. Our results establish a quantitative mechanical basis for understanding the mechanism of regulation of the elongation rate of translation by structured mRNAs. ©2011 Macmillan Publishers Limited. All rights reserved

  3. Cis-regulatory RNA elements that regulate specialized ribosome activity.

    Science.gov (United States)

    Xue, Shifeng; Barna, Maria

    2015-01-01

    Recent evidence has shown that the ribosome itself can play a highly regulatory role in the specialized translation of specific subpools of mRNAs, in particular at the level of ribosomal proteins (RP). However, the mechanism(s) by which this selection takes place has remained poorly understood. In our recent study, we discovered a combination of unique RNA elements in the 5'UTRs of mRNAs that allows for such control by the ribosome. These mRNAs contain a Translation Inhibitory Element (TIE) that inhibits general cap-dependent translation, and an Internal Ribosome Entry Site (IRES) that relies on a specific RP for activation. The unique combination of an inhibitor of general translation and an activator of specialized translation is key to ribosome-mediated control of gene expression. Here we discuss how these RNA regulatory elements provide a new level of control to protein expression and their implications for gene expression, organismal development and evolution.

  4. ITSoneDB: a comprehensive collection of eukaryotic ribosomal RNA Internal Transcribed Spacer 1 (ITS1) sequences.

    Science.gov (United States)

    Santamaria, Monica; Fosso, Bruno; Licciulli, Flavio; Balech, Bachir; Larini, Ilaria; Grillo, Giorgio; De Caro, Giorgio; Liuni, Sabino; Pesole, Graziano

    2018-01-04

    A holistic understanding of environmental communities is the new challenge of metagenomics. Accordingly, the amplicon-based or metabarcoding approach, largely applied to investigate bacterial microbiomes, is moving to the eukaryotic world too. Indeed, the analysis of metabarcoding data may provide a comprehensive assessment of both bacterial and eukaryotic composition in a variety of environments, including human body. In this respect, whereas hypervariable regions of the 16S rRNA are the de facto standard barcode for bacteria, the Internal Transcribed Spacer 1 (ITS1) of ribosomal RNA gene cluster has shown a high potential in discriminating eukaryotes at deep taxonomic levels. As metabarcoding data analysis rely on the availability of a well-curated barcode reference resource, a comprehensive collection of ITS1 sequences supplied with robust taxonomies, is highly needed. To address this issue, we created ITSoneDB (available at http://itsonedb.cloud.ba.infn.it/) which in its current version hosts 985 240 ITS1 sequences spanning over 134 000 eukaryotic species. Each ITS1 is mapped on the NCBI reference taxonomy with its start and end positions precisely annotated. ITSoneDB has been developed in agreement to the FAIR guidelines by enabling the users to query and download its content through a simple web-interface and access relevant metadata by cross-linking to European Nucleotide Archive. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  5. Phylogenetic evidence for the acquisition of ribosomal RNA introns subsequent to the divergence of some of the major Tetrahymena groups

    DEFF Research Database (Denmark)

    Sogin, M L; Ingold, A; Karlok, M

    1986-01-01

    . In an attempt to evaluate the evolutionary origins of the intervening sequences, we have now determined complete small subunit ribosomal RNA gene sequences from 13 species of Tetrahymena and the absolute number of nucleotide differences between the sequences was used to construct a phylogenetic tree...

  6. Studies of the effects of ultraviolet radiation on the structural integrities of ribosomal RNA components of the Escherichia coli 50S ribosomal subunit

    International Nuclear Information System (INIS)

    Gorelic, L.; Parker, D.

    1978-01-01

    The effects of 254-nm radiation on the structural integrities of free and 50S ribosome-bound 5S and 23S ribosomal ribonucleic acids (rRNA) have been elucidated. Irradiation of aqueous solutions of Escherichia coli 50S ribosomes with 253.7-nm radiation results in the formation of single-strand breaks in double-stranded regions of the 23S rRNA component, but not in rRNA chain scission, and destabilization of the secondary structure of the 23S rRNA toward denaturation. The minimum doses of 253.7-nm radiation required for the first detection of the two effects are 7 x 10 19 quanta for the production of single-strand breaks in double-stranded regions of the 23S rRNA, and 19 quanta for destabilization of the 23S rRNA secondary structure. Free 23S rRNA is resistant toward photoinduced chain breakage at doses of 253.7-nm radiation up to at least 2.3 x 10 20 and is much less sensitive toward destabilization of secondary structure than ribosome-bound 23S rRNA. In contrast to the photosensitivity of 50S ribosome-bound 23S rRNA toward chain breakage, 50S ribosome-bound 5S rRNA is resistant toward chain breakage at doses of 253.7-nm radiation up to at least 2.3 x 10 20 quanta. Ribosome-bound 5S and 23S rRNA are also not photosensitive toward intermolecular 5S/23S rRNA cross-linkage

  7. Nuclear Export of Pre-Ribosomal Subunits Requires Dbp5, but Not as an RNA-Helicase as for mRNA Export.

    Science.gov (United States)

    Neumann, Bettina; Wu, Haijia; Hackmann, Alexandra; Krebber, Heike

    2016-01-01

    The DEAD-box RNA-helicase Dbp5/Rat8 is known for its function in nuclear mRNA export, where it displaces the export receptor Mex67 from the mRNA at the cytoplasmic side of the nuclear pore complex (NPC). Here we show that Dbp5 is also required for the nuclear export of both pre-ribosomal subunits. Yeast temperature-sensitive dbp5 mutants accumulate both ribosomal particles in their nuclei. Furthermore, Dbp5 genetically and physically interacts with known ribosomal transport factors such as Nmd3. Similar to mRNA export we show that also for ribosomal transport Dbp5 is required at the cytoplasmic side of the NPC. However, unlike its role in mRNA export, Dbp5 does not seem to undergo its ATPase cycle for this function, as ATPase-deficient dbp5 mutants that selectively inhibit mRNA export do not affect ribosomal transport. Furthermore, mutants of GLE1, the ATPase stimulating factor of Dbp5, show no major ribosomal export defects. Consequently, while Dbp5 uses its ATPase cycle to displace the export receptor Mex67 from the translocated mRNAs, Mex67 remains bound to ribosomal subunits upon transit to the cytoplasm, where it is detectable on translating ribosomes. Therefore, we propose a model, in which Dbp5 supports ribosomal transport by capturing ribosomal subunits upon their cytoplasmic appearance at the NPC, possibly by binding export factors such as Mex67. Thus, our findings reveal that although different ribonucleoparticles, mRNAs and pre-ribosomal subunits, use shared export factors, they utilize different transport mechanisms.

  8. Control of ribosome traffic by position-dependent choice of synonymous codons

    DEFF Research Database (Denmark)

    Mitarai, Namiko; Pedersen, Steen

    2013-01-01

    Messenger RNA (mRNA) encodes a sequence of amino acids by using codons. For most amino acids, there are multiple synonymous codons that can encode the amino acid. The translation speed can vary from one codon to another, thus there is room for changing the ribosome speed while keeping the amino...... acid sequence and hence the resulting protein. Recently, it has been noticed that the choice of the synonymous codon, via the resulting distribution of slow- and fast-translated codons, affects not only on the average speed of one ribosome translating the mRNA but also might have an effect on nearby...... ribosomes by affecting the appearance of 'traffic jams' where multiple ribosomes collide and form queues. To test this 'context effect' further, we here investigate the effect of the sequence of synonymous codons on the ribosome traffic by using a ribosome traffic model with codon-dependent rates, estimated...

  9. A Deconvolution Protocol for ChIP-Seq Reveals Analogous Enhancer Structures on the Mouse and Human Ribosomal RNA Genes

    Directory of Open Access Journals (Sweden)

    Jean-Clement Mars

    2018-01-01

    Full Text Available The combination of Chromatin Immunoprecipitation and Massively Parallel Sequencing, or ChIP-Seq, has greatly advanced our genome-wide understanding of chromatin and enhancer structures. However, its resolution at any given genetic locus is limited by several factors. In applying ChIP-Seq to the study of the ribosomal RNA genes, we found that a major limitation to resolution was imposed by the underlying variability in sequence coverage that very often dominates the protein–DNA interaction profiles. Here, we describe a simple numerical deconvolution approach that, in large part, corrects for this variability, and significantly improves both the resolution and quantitation of protein–DNA interaction maps deduced from ChIP-Seq data. This approach has allowed us to determine the in vivo organization of the RNA polymerase I preinitiation complexes that form at the promoters and enhancers of the mouse (Mus musculus and human (Homo sapiens ribosomal RNA genes, and to reveal a phased binding of the HMG-box factor UBF across the rDNA. The data identify and map a “Spacer Promoter” and associated stalled polymerase in the intergenic spacer of the human ribosomal RNA genes, and reveal a very similar enhancer structure to that found in rodents and lower vertebrates.

  10. Evaluation of two main RNA-seq approaches for gene quantification in clinical RNA sequencing: polyA+ selection versus rRNA depletion.

    Science.gov (United States)

    Zhao, Shanrong; Zhang, Ying; Gamini, Ramya; Zhang, Baohong; von Schack, David

    2018-03-19

    To allow efficient transcript/gene detection, highly abundant ribosomal RNAs (rRNA) are generally removed from total RNA either by positive polyA+ selection or by rRNA depletion (negative selection) before sequencing. Comparisons between the two methods have been carried out by various groups, but the assessments have relied largely on non-clinical samples. In this study, we evaluated these two RNA sequencing approaches using human blood and colon tissue samples. Our analyses showed that rRNA depletion captured more unique transcriptome features, whereas polyA+ selection outperformed rRNA depletion with higher exonic coverage and better accuracy of gene quantification. For blood- and colon-derived RNAs, we found that 220% and 50% more reads, respectively, would have to be sequenced to achieve the same level of exonic coverage in the rRNA depletion method compared with the polyA+ selection method. Therefore, in most cases we strongly recommend polyA+ selection over rRNA depletion for gene quantification in clinical RNA sequencing. Our evaluation revealed that a small number of lncRNAs and small RNAs made up a large fraction of the reads in the rRNA depletion RNA sequencing data. Thus, we recommend that these RNAs are specifically depleted to improve the sequencing depth of the remaining RNAs.

  11. Deep sequencing of cardiac microRNA-mRNA interactomes in clinical and experimental cardiomyopathy.

    Science.gov (United States)

    Matkovich, Scot J; Dorn, Gerald W

    2015-01-01

    MicroRNAs are a family of short (~21 nucleotide) noncoding RNAs that serve key roles in cellular growth and differentiation and the response of the heart to stress stimuli. As the sequence-specific recognition element of RNA-induced silencing complexes (RISCs), microRNAs bind mRNAs and prevent their translation via mechanisms that may include transcript degradation and/or prevention of ribosome binding. Short microRNA sequences and the ability of microRNAs to bind to mRNA sites having only partial/imperfect sequence complementarity complicate purely computational analyses of microRNA-mRNA interactomes. Furthermore, computational microRNA target prediction programs typically ignore biological context, and therefore the principal determinants of microRNA-mRNA binding: the presence and quantity of each. To address these deficiencies we describe an empirical method, developed via studies of stressed and failing hearts, to determine disease-induced changes in microRNAs, mRNAs, and the mRNAs targeted to the RISC, without cross-linking mRNAs to RISC proteins. Deep sequencing methods are used to determine RNA abundances, delivering unbiased, quantitative RNA data limited only by their annotation in the genome of interest. We describe the laboratory bench steps required to perform these experiments, experimental design strategies to achieve an appropriate number of sequencing reads per biological replicate, and computer-based processing tools and procedures to convert large raw sequencing data files into gene expression measures useful for differential expression analyses.

  12. Control of ribosome traffic by position-dependent choice of synonymous codons

    International Nuclear Information System (INIS)

    Mitarai, Namiko; Pedersen, Steen

    2013-01-01

    Messenger RNA (mRNA) encodes a sequence of amino acids by using codons. For most amino acids, there are multiple synonymous codons that can encode the amino acid. The translation speed can vary from one codon to another, thus there is room for changing the ribosome speed while keeping the amino acid sequence and hence the resulting protein. Recently, it has been noticed that the choice of the synonymous codon, via the resulting distribution of slow- and fast-translated codons, affects not only on the average speed of one ribosome translating the mRNA but also might have an effect on nearby ribosomes by affecting the appearance of ‘traffic jams’ where multiple ribosomes collide and form queues. To test this ‘context effect’ further, we here investigate the effect of the sequence of synonymous codons on the ribosome traffic by using a ribosome traffic model with codon-dependent rates, estimated from experiments. We compare the ribosome traffic on wild-type (WT) sequences and sequences where the synonymous codons were swapped randomly. By simulating translation of 87 genes, we demonstrate that the WT sequences, especially those with a high bias in codon usage, tend to have the ability to reduce ribosome collisions, hence optimizing the cellular investment in the translation apparatus. The magnitude of such reduction of the translation time might have a significant impact on the cellular growth rate and thereby have importance for the survival of the species. (paper)

  13. A new version of the RDP (Ribosomal Database Project)

    Science.gov (United States)

    Maidak, B. L.; Cole, J. R.; Parker, C. T. Jr; Garrity, G. M.; Larsen, N.; Li, B.; Lilburn, T. G.; McCaughey, M. J.; Olsen, G. J.; Overbeek, R.; hide

    1999-01-01

    The Ribosomal Database Project (RDP-II), previously described by Maidak et al. [ Nucleic Acids Res. (1997), 25, 109-111], is now hosted by the Center for Microbial Ecology at Michigan State University. RDP-II is a curated database that offers ribosomal RNA (rRNA) nucleotide sequence data in aligned and unaligned forms, analysis services, and associated computer programs. During the past two years, data alignments have been updated and now include >9700 small subunit rRNA sequences. The recent development of an ObjectStore database will provide more rapid updating of data, better data accuracy and increased user access. RDP-II includes phylogenetically ordered alignments of rRNA sequences, derived phylogenetic trees, rRNA secondary structure diagrams, and various software programs for handling, analyzing and displaying alignments and trees. The data are available via anonymous ftp (ftp.cme.msu. edu) and WWW (http://www.cme.msu.edu/RDP). The WWW server provides ribosomal probe checking, approximate phylogenetic placement of user-submitted sequences, screening for possible chimeric rRNA sequences, automated alignment, and a suggested placement of an unknown sequence on an existing phylogenetic tree. Additional utilities also exist at RDP-II, including distance matrix, T-RFLP, and a Java-based viewer of the phylogenetic trees that can be used to create subtrees.

  14. Evidence for rRNA 2'-O-methylation plasticity: Control of intrinsic translational capabilities of human ribosomes.

    Science.gov (United States)

    Erales, Jenny; Marchand, Virginie; Panthu, Baptiste; Gillot, Sandra; Belin, Stéphane; Ghayad, Sandra E; Garcia, Maxime; Laforêts, Florian; Marcel, Virginie; Baudin-Baillieu, Agnès; Bertin, Pierre; Couté, Yohann; Adrait, Annie; Meyer, Mélanie; Therizols, Gabriel; Yusupov, Marat; Namy, Olivier; Ohlmann, Théophile; Motorin, Yuri; Catez, Frédéric; Diaz, Jean-Jacques

    2017-12-05

    Ribosomal RNAs (rRNAs) are main effectors of messenger RNA (mRNA) decoding, peptide-bond formation, and ribosome dynamics during translation. Ribose 2'-O-methylation (2'-O-Me) is the most abundant rRNA chemical modification, and displays a complex pattern in rRNA. 2'-O-Me was shown to be essential for accurate and efficient protein synthesis in eukaryotic cells. However, whether rRNA 2'-O-Me is an adjustable feature of the human ribosome and a means of regulating ribosome function remains to be determined. Here we challenged rRNA 2'-O-Me globally by inhibiting the rRNA methyl-transferase fibrillarin in human cells. Using RiboMethSeq, a nonbiased quantitative mapping of 2'-O-Me, we identified a repertoire of 2'-O-Me sites subjected to variation and demonstrate that functional domains of ribosomes are targets of 2'-O-Me plasticity. Using the cricket paralysis virus internal ribosome entry site element, coupled to in vitro translation, we show that the intrinsic capability of ribosomes to translate mRNAs is modulated through a 2'-O-Me pattern and not by nonribosomal actors of the translational machinery. Our data establish rRNA 2'-O-Me plasticity as a mechanism providing functional specificity to human ribosomes.

  15. Plastid, nuclear and reverse transcriptase sequences in the mitochondrial genome of Oenothera: is genetic information transferred between organelles via RNA?

    Science.gov (United States)

    Schuster, W; Brennicke, A

    1987-01-01

    We describe an open reading frame (ORF) with high homology to reverse transcriptase in the mitochondrial genome of Oenothera. This ORF displays all the characteristics of an active plant mitochondrial gene with a possible ribosome binding site and 39% T in the third codon position. It is located between a sequence fragment from the plastid genome and one of nuclear origin downstream from the gene encoding subunit 5 of the NADH dehydrogenase. The nuclear derived sequence consists of 528 nucleotides from the small ribosomal RNA and contains an expansion segment unique to nuclear rRNAs. The plastid sequence contains part of the ribosomal protein S4 and the complete tRNA(Ser). The observation that only transcribed sequences have been found i more than one subcellular compartment in higher plants suggests that interorganellar transfer of genetic information may occur via RNA and subsequent local reverse transcription and genomic integration. PMID:14650433

  16. Cross-linking of streptomycin to the 16S ribosomal RNA of Escherichia coli

    International Nuclear Information System (INIS)

    Gravel, M.; Melancon, P.; Barkier-Gingras, L.

    1987-01-01

    [ 3 H]Dihydrostreptomycin was cross-linked to the 30S ribosomal subunit from Escherichia coli with the bifunctional reagent nitrogen mustard. The cross-linking primarily involved the 16S RNA. To localize the site of cross-linking of streptomycin to the 16S RNA, the authors hybridized RNA labeled with streptomycin to restriction fragments of the 16S RNA gene. Labeled RNA hybridized to DNA fragments corresponding to bases 892-917 and bases 1394-1415. These two segments of the ribosomal RNA must by juxtaposed in the ribosome, since there is a single binding site for streptomycin. This region has been implicated both in the decoding site and in the binding of initiation factor IF-3, indicating its functional importance

  17. The ribosome structure controls and directs mRNA entry, translocation and exit dynamics

    International Nuclear Information System (INIS)

    Kurkcuoglu, Ozge; Doruker, Pemra; Jernigan, Robert L; Sen, Taner Z; Kloczkowski, Andrzej

    2008-01-01

    The protein-synthesizing ribosome undergoes large motions to effect the translocation of tRNAs and mRNA; here, the domain motions of this system are explored with a coarse-grained elastic network model using normal mode analysis. Crystal structures are used to construct various model systems of the 70S complex with/without tRNA, elongation factor Tu and the ribosomal proteins. Computed motions reveal the well-known ratchet-like rotational motion of the large subunits, as well as the head rotation of the small subunit and the high flexibility of the L1 and L7/L12 stalks, even in the absence of ribosomal proteins. This result indicates that these experimentally observed motions during translocation are inherently controlled by the ribosomal shape and only partially dependent upon GTP hydrolysis. Normal mode analysis further reveals the mobility of A- and P-tRNAs to increase in the absence of the E-tRNA. In addition, the dynamics of the E-tRNA is affected by the absence of the ribosomal protein L1. The mRNA in the entrance tunnel interacts directly with helicase proteins S3 and S4, which constrain the mRNA in a clamp-like fashion, as well as with protein S5, which likely orients the mRNA to ensure correct translation. The ribosomal proteins S7, S11 and S18 may also be involved in assuring translation fidelity by constraining the mRNA at the exit site of the channel. The mRNA also interacts with the 16S 3' end forming the Shine–Dalgarno complex at the initiation step; the 3' end may act as a 'hook' to reel in the mRNA to facilitate its exit

  18. Genetic divergence of Asiatic Bdellocephala (Turbellaria, Tricladida, Paludicola) as revealed by partial 18S rRNA gene sequence comparisons.

    Science.gov (United States)

    Kuznedelov, K D; Timoshkin, O A; Goldman, E

    1997-01-01

    Polymerase chain reaction (PCR) and direct sequencing of small ribosomal RNA genes were used for analysis of genetic differences among Asiatic species of freshwater triclad genus Bdellocephala. Representatives of four species and four subspecies of this genus were used to establish homology between nucleotides in the 5'-end portion of small ribosomal RNA gene sequences. Within 552 nucleotide sites of aligned sequences compared, six variable base positions were discovered, dividing Bdellocephala into five different genotypes. Sequence data allow to distinguish two groups of these genotypes. One of them unites species from Kamchatka and Japan, another one unites Baikalian taxa. Agreement between available morphological, cytological and sequence data is discussed.

  19. Proto-ribosome: a theoretical approach based on RNA relics

    OpenAIRE

    Demongeot, Jacques

    2017-01-01

    We describe in this paper, based on already published articles, a contribution to the theory postulating the existence of a proto-ribosome, which could have appeared early at the origin of life and we discuss the interest of this notion in an evolutionary perspective, taking into account the existence of possible RNA relics of this proto-ribosome.

  20. rRNA maturation in yeast cells depleted of large ribosomal subunit proteins.

    Directory of Open Access Journals (Sweden)

    Gisela Pöll

    Full Text Available The structural constituents of the large eukaryotic ribosomal subunit are 3 ribosomal RNAs, namely the 25S, 5.8S and 5S rRNA and about 46 ribosomal proteins (r-proteins. They assemble and mature in a highly dynamic process that involves more than 150 proteins and 70 small RNAs. Ribosome biogenesis starts in the nucleolus, continues in the nucleoplasm and is completed after nucleo-cytoplasmic translocation of the subunits in the cytoplasm. In this work we created 26 yeast strains, each of which conditionally expresses one of the large ribosomal subunit (LSU proteins. In vivo depletion of the analysed LSU r-proteins was lethal and led to destabilisation and degradation of the LSU and/or its precursors. Detailed steady state and metabolic pulse labelling analyses of rRNA precursors in these mutant strains showed that LSU r-proteins can be grouped according to their requirement for efficient progression of different steps of large ribosomal subunit maturation. Comparative analyses of the observed phenotypes and the nature of r-protein-rRNA interactions as predicted by current atomic LSU structure models led us to discuss working hypotheses on i how individual r-proteins control the productive processing of the major 5' end of 5.8S rRNA precursors by exonucleases Rat1p and Xrn1p, and ii the nature of structural characteristics of nascent LSUs that are required for cytoplasmic accumulation of nascent subunits but are nonessential for most of the nuclear LSU pre-rRNA processing events.

  1. Structural basis for ribosome protein S1 interaction with RNA in trans-translation of Mycobacterium tuberculosis.

    Science.gov (United States)

    Fan, Yi; Dai, Yazhuang; Hou, Meijing; Wang, Huilin; Yao, Hongwei; Guo, Chenyun; Lin, Donghai; Liao, Xinli

    2017-05-27

    Ribosomal protein S1 (RpsA), the largest 30S protein in ribosome, plays a significant role in translation and trans-translation. In Mycobacterium tuberculosis, the C-terminus of RpsA is known as tuberculosis drug target of pyrazinoic acid, which inhibits the interaction between MtRpsA and tmRNA in trans-translation. However, the molecular mechanism underlying the interaction of MtRpsA with tmRNA remains unknown. We herein analyzed the interaction of the C-terminal domain of MtRpsA with three RNA fragments poly(A), sMLD and pre-sMLD. NMR titration analysis revealed that the RNA binding sites on MtRpsA CTD are mainly located in the β2, β3 and β5 strands and the adjacent L3 loop of the S1 domain. Fluorescence experiments determined the MtRpsA CTD binding to RNAs are in the micromolar affinity range. Sequence analysis also revealed conserved residues in the mapped RNA binding region. Residues L304, V305, G308, F310, H322, I323, R357 and I358 were verified to be the key residues influencing the interaction between MtRpsA CTD and pre-sMLD. Molecular docking further confirmed that the poly(A)-like sequence and sMLD of tmRNA are all involved in the protein-RNA interaction, through charged interaction and hydrogen bonds. The results will be beneficial for designing new anti-tuberculosis drugs. Copyright © 2017 Elsevier Inc. All rights reserved.

  2. Amplification and sequence analysis of partial bacterial 16S ribosomal RNA gene in gallbladder bile from patients with primary biliary cirrhosis.

    Science.gov (United States)

    Hiramatsu, K; Harada, K; Tsuneyama, K; Sasaki, M; Fujita, S; Hashimoto, T; Kaneko, S; Kobayashi, K; Nakanuma, Y

    2000-07-01

    The etiopathogenesis of bile duct lesion in primary biliary cirrhosis is unknown, though the participation of bacteria and/or their components and products is suspected. In this study, we tried to detect and identify bacteria in the bile of patients with primary biliary cirrhosis by polymerase chain reaction using universal bacterial primers of the 16S ribosomal RNA gene. Gallbladder bile samples from 15 patients with primary biliary cirrhosis, 5 with primary sclerosing cholangitis, 5 with hepatitis C virus-related liver cirrhosis, 11 with cholecystolithiasis, and from 12 normal adult gallbladders were used. In addition to the culture study, partial bacterial 16S ribosomal RNA gene was amplified by polymerase chain reaction (PCR) taking advantage of universal primers that can amplify the gene of almost all bacterial species, and the amplicons were cloned and sequenced. Sequence homology with specific bacterial species was analyzed by database research. Bacterial contamination at every step of the bile sampling, DNA extraction and PCR study was avoided. Furthermore, to confirm whether bacterial DNA is detectable in liver explants, the same analysis was performed using 10 liver explants of patients with primary biliary cirrhosis. In primary biliary cirrhosis, 75% (p<0.0001) of 100 clones were identified as so-called gram-positive cocci while these cocci were positive in only 5% in cholecystolithiasis (p<0.0001). In cholecystolithiasis gram-negative rods were predominant instead. One bacterial species detected in a normal adult was not related to those detected in primary biliary cirrhosis and cholecystolithiasis patients. No bacterial DNA was detected by PCR amplification in 10 liver explants of patients with primary biliary cirrhosis. The present results raise several possible roles of gram-positive bacteria in bile in the etiopathogenesis of primary biliary cirrhosis. However, these results could also reflect an epiphenomenon due to decreased bile flow in the

  3. The SmpB C-terminal tail helps tmRNA to recognize and enter stalled ribosomes

    Directory of Open Access Journals (Sweden)

    Mickey R. Miller

    2014-09-01

    Full Text Available In bacteria, transfer-messenger RNA (tmRNA and SmpB comprise the most common and effective system for rescuing stalled ribosomes. Ribosomes stall on mRNA transcripts lacking stop codons and are rescued as the defective mRNA is swapped for the tmRNA template in a process known as trans-translation. The tmRNA–SmpB complex is recruited to the ribosome independent of a codon–anticodon interaction. Given that the ribosome uses robust discriminatory mechanisms to select against non-cognate tRNAs during canonical decoding, it has been hard to explain how this can happen. Recent structural and biochemical studies show that SmpB licenses tmRNA entry through its interactions with the decoding center and mRNA channel. In particular, the C-terminal tail of SmpB promotes both EFTu activation and accommodation of tmRNA, the former through interactions with 16S rRNA nucleotide G530 and the latter through interactions with the mRNA channel downstream of the A site. Here we present a detailed model of the earliest steps in trans-translation, and in light of these mechanistic considerations, revisit the question of how tmRNA preferentially reacts with stalled, non-translating ribosomes.

  4. The nuclear 18S ribosomal RNA gene as a source of phylogenetic information in the genus Taenia.

    Science.gov (United States)

    Yan, Hongbin; Lou, Zhongzi; Li, Li; Ni, Xingwei; Guo, Aijiang; Li, Hongmin; Zheng, Yadong; Dyachenko, Viktor; Jia, Wanzhong

    2013-03-01

    Most species of the genus Taenia are of considerable medical and veterinary significance. In this study, complete nuclear 18S rRNA gene sequences were obtained from seven members of genus Taenia [Taenia multiceps, Taenia saginata, Taenia asiatica, Taenia solium, Taenia pisiformis, Taenia hydatigena, and Taenia taeniaeformis] and a phylogeny inferred using these sequences. Most of the variable sites fall within the variable regions, V1-V5. We show that sequences from the nuclear 18S ribosomal RNA gene have considerable promise as sources of phylogenetic information within the genus Taenia. Furthermore, given that almost all the variable sites lie within defined variable portions of that gene, it will be appropriate and economical to sequence only those regions for additional species of Taenia.

  5. Synthesis and methylation of ribosomal RNA in HeLa cells infected with the herpes virus pseudorabies virus

    International Nuclear Information System (INIS)

    Furlong, J.C.; Kyriakidis, S.; Stevely, W.S.

    1982-01-01

    The effects of infection with the herpes virus pseudorabies virus on the metabolism of HeLa cell ribosomal RNA were examined. There is a decline both in the synthesis of nucleolar 45S ribosomal precursor RNA and in its processing to mature cytoplasmic RNA. The methylated oligonucleotides in the ribosomal RNA species were studied. The methylation of cytoplasmic ribosomal RNA was essentially unchanged. However there was some undermethylation of the nucleolar precursor. If undermethylated RNA does not mature then this may partly explain the reduced processing in the infected cells. (Author)

  6. Myb-binding protein 1a (Mybbp1a) regulates levels and processing of pre-ribosomal RNA.

    Science.gov (United States)

    Hochstatter, Julia; Hölzel, Michael; Rohrmoser, Michaela; Schermelleh, Lothar; Leonhardt, Heinrich; Keough, Rebecca; Gonda, Thomas J; Imhof, Axel; Eick, Dirk; Längst, Gernot; Németh, Attila

    2012-07-13

    Ribosomal RNA gene transcription, co-transcriptional processing, and ribosome biogenesis are highly coordinated processes that are tightly regulated during cell growth. In this study we discovered that Mybbp1a is associated with both the RNA polymerase I complex and the ribosome biogenesis machinery. Using a reporter assay that uncouples transcription and RNA processing, we show that Mybbp1a represses rRNA gene transcription. In addition, overexpression of the protein reduces RNA polymerase I loading on endogenous rRNA genes as revealed by chromatin immunoprecipitation experiments. Accordingly, depletion of Mybbp1a results in an accumulation of the rRNA precursor in vivo but surprisingly also causes growth arrest of the cells. This effect can be explained by the observation that the modulation of Mybbp1a protein levels results in defects in pre-rRNA processing within the cell. Therefore, the protein may play a dual role in the rRNA metabolism, potentially linking and coordinating ribosomal DNA transcription and pre-rRNA processing to allow for the efficient synthesis of ribosomes.

  7. Ribosomal proteins S12 and S13 function as control elements for translocation of the mRNA:tRNA complex.

    Science.gov (United States)

    Cukras, Anthony R; Southworth, Daniel R; Brunelle, Julie L; Culver, Gloria M; Green, Rachel

    2003-08-01

    Translocation of the mRNA:tRNA complex through the ribosome is promoted by elongation factor G (EF-G) during the translation cycle. Previous studies established that modification of ribosomal proteins with thiol-specific reagents promotes this event in the absence of EF-G. Here we identify two small subunit interface proteins S12 and S13 that are essential for maintenance of a pretranslocation state. Omission of these proteins using in vitro reconstitution procedures yields ribosomal particles that translate in the absence of enzymatic factors. Conversely, replacement of cysteine residues in these two proteins yields ribosomal particles that are refractive to stimulation with thiol-modifying reagents. These data support a model where S12 and S13 function as control elements for the more ancient rRNA- and tRNA-driven movements of translocation.

  8. Translational regulation of ribosomal protein S15 drives characteristic patterns of protein-mRNA epistasis.

    Science.gov (United States)

    Mallik, Saurav; Basu, Sudipto; Hait, Suman; Kundu, Sudip

    2018-04-21

    Do coding and regulatory segments of a gene co-evolve with each-other? Seeking answers to this question, here we analyze the case of Escherichia coli ribosomal protein S15, that represses its own translation by specifically binding its messenger RNA (rpsO mRNA) and stabilizing a pseudoknot structure at the upstream untranslated region, thus trapping the ribosome into an incomplete translation initiation complex. In the absence of S15, ribosomal protein S1 recognizes rpsO and promotes translation by melting this very pseudoknot. We employ a robust statistical method to detect signatures of positive epistasis between residue site pairs and find that biophysical constraints of translational regulation (S15-rpsO and S1-rpsO recognition, S15-mediated rpsO structural rearrangement, and S1-mediated melting) are strong predictors of positive epistasis. Transforming the epistatic pairs into a network, we find that signatures of two different, but interconnected regulatory cascades are imprinted in the sequence-space and can be captured in terms of two dense network modules that are sparsely connected to each other. This network topology further reflects a general principle of how functionally coupled components of biological networks are interconnected. These results depict a model case, where translational regulation drives characteristic residue-level epistasis-not only between a protein and its own mRNA but also between a protein and the mRNA of an entirely different protein. © 2018 Wiley Periodicals, Inc.

  9. Translation initiation in bacterial polysomes through ribosome loading on a standby site on a highly translated mRNA

    Science.gov (United States)

    Andreeva, Irena

    2018-01-01

    During translation, consecutive ribosomes load on an mRNA and form a polysome. The first ribosome binds to a single-stranded mRNA region and moves toward the start codon, unwinding potential mRNA structures on the way. In contrast, the following ribosomes can dock at the start codon only when the first ribosome has vacated the initiation site. Here we show that loading of the second ribosome on a natural 38-nt-long 5′ untranslated region of lpp mRNA, which codes for the outer membrane lipoprotein from Escherichia coli, takes place before the leading ribosome has moved away from the start codon. The rapid formation of this standby complex depends on the presence of ribosomal proteins S1/S2 in the leading ribosome. The early recruitment of the second ribosome to the standby site before translation by the leading ribosome and the tight coupling between translation elongation by the first ribosome and the accommodation of the second ribosome can contribute to high translational efficiency of the lpp mRNA. PMID:29632209

  10. A ribosomal RNA gene intergenic spacer based PCR and DGGE fingerprinting method for the analysis of specific rhizobial communities in soil

    NARCIS (Netherlands)

    de Oliveira, VM; Manfio, GP; Coutinho, HLD; Keijzer-Wolters, AC; van Elsas, JD

    A direct molecular method for assessing the diversity of specific populations of rhizobia in soil, based on nested PCR amplification of 16S-23S ribosomal RNA gene (rDNA) intergenic spacer (IGS) sequences, was developed. Initial generic amplification of bacterial rDNA IGS sequences from soil DNA was

  11. A ribosomal RNA gene intergenic spacer based PCR and DGGE fingerprinting method for the analysis of specific rhizobial communities in soil

    NARCIS (Netherlands)

    Oliveira, de V.M.; Manfio, G.P.; Coutinho, H.L.D.; Keijzer-Wolters, A.C.; Elsas, van J.D.

    2006-01-01

    A direct molecular method for assessing the diversity of specific populations of rhizobia in soil, based on nested PCR amplification of 16S-23S ribosomal RNA gene (rDNA) intergenic spacer (IGS) sequences, was developed. Initial generic amplification of bacterial rDNA IGS sequences from soil DNA was

  12. Identification of a Recently Active Mammalian SINE Derived from Ribosomal RNA

    Science.gov (United States)

    Longo, Mark S.; Brown, Judy D.; Zhang, Chu; O’Neill, Michael J.; O’Neill, Rachel J.

    2015-01-01

    Complex eukaryotic genomes are riddled with repeated sequences whose derivation does not coincide with phylogenetic history and thus is often unknown. Among such sequences, the capacity for transcriptional activity coupled with the adaptive use of reverse transcription can lead to a diverse group of genomic elements across taxa, otherwise known as selfish elements or mobile elements. Short interspersed nuclear elements (SINEs) are nonautonomous mobile elements found in eukaryotic genomes, typically derived from cellular RNAs such as tRNAs, 7SL or 5S rRNA. Here, we identify and characterize a previously unknown SINE derived from the 3′-end of the large ribosomal subunit (LSU or 28S rDNA) and transcribed via RNA polymerase III. This new element, SINE28, is represented in low-copy numbers in the human reference genome assembly, wherein we have identified 27 discrete loci. Phylogenetic analysis indicates these elements have been transpositionally active within primate lineages as recently as 6 MYA while modern humans still carry transcriptionally active copies. Moreover, we have identified SINE28s in all currently available assembled mammalian genome sequences. Phylogenetic comparisons indicate that these elements are frequently rederived from the highly conserved LSU rRNA sequences in a lineage-specific manner. We propose that this element has not been previously recognized as a SINE given its high identity to the canonical LSU, and that SINE28 likely represents one of possibly many unidentified, active transposable elements within mammalian genomes. PMID:25637222

  13. 5S ribosomal ribonucleic acid sequences in Bacteroides and Fusobacterium: evolutionary relationships within these genera and among eubacteria in general

    Science.gov (United States)

    Van den Eynde, H.; De Baere, R.; Shah, H. N.; Gharbia, S. E.; Fox, G. E.; Michalik, J.; Van de Peer, Y.; De Wachter, R.

    1989-01-01

    The 5S ribosomal ribonucleic acid (rRNA) sequences were determined for Bacteroides fragilis, Bacteroides thetaiotaomicron, Bacteroides capillosus, Bacteroides veroralis, Porphyromonas gingivalis, Anaerorhabdus furcosus, Fusobacterium nucleatum, Fusobacterium mortiferum, and Fusobacterium varium. A dendrogram constructed by a clustering algorithm from these sequences, which were aligned with all other hitherto known eubacterial 5S rRNA sequences, showed differences as well as similarities with respect to results derived from 16S rRNA analyses. In the 5S rRNA dendrogram, Bacteroides clustered together with Cytophaga and Fusobacterium, as in 16S rRNA analyses. Intraphylum relationships deduced from 5S rRNAs suggested that Bacteroides is specifically related to Cytophaga rather than to Fusobacterium, as was suggested by 16S rRNA analyses. Previous taxonomic considerations concerning the genus Bacteroides, based on biochemical and physiological data, were confirmed by the 5S rRNA sequence analysis.

  14. A Listeria monocytogenes RNA helicase essential for growth and ribosomal maturation at low temperatures uses its C terminus for appropriate interaction with the ribosome.

    Science.gov (United States)

    Netterling, Sakura; Vaitkevicius, Karolis; Nord, Stefan; Johansson, Jörgen

    2012-08-01

    Listeria monocytogenes, a Gram-positive food-borne human pathogen, is able to grow at temperatures close to 0°C and is thus of great concern for the food industry. In this work, we investigated the physiological role of one DExD-box RNA helicase in Listeria monocytogenes. The RNA helicase Lmo1722 was required for optimal growth at low temperatures, whereas it was dispensable at 37°C. A Δlmo1722 strain was less motile due to downregulation of the major subunit of the flagellum, FlaA, caused by decreased flaA expression. By ribosomal fractionation experiments, it was observed that Lmo1722 was mainly associated with the 50S subunit of the ribosome. Absence of Lmo1722 decreased the fraction of 50S ribosomal subunits and mature 70S ribosomes and affected the processing of the 23S precursor rRNA. The ribosomal profile could be restored to wild-type levels in a Δlmo1722 strain expressing Lmo1722. Interestingly, the C-terminal part of Lmo1722 was redundant for low-temperature growth, motility, 23S rRNA processing, and appropriate ribosomal maturation. However, Lmo1722 lacking the C terminus showed a reduced affinity for the 50S and 70S fractions, suggesting that the C terminus is important for proper guidance of Lmo1722 to the 50S subunit. Taken together, our results show that the Listeria RNA helicase Lmo1722 is essential for growth at low temperatures, motility, and rRNA processing and is important for ribosomal maturation, being associated mainly with the 50S subunit of the ribosome.

  15. Production of RNA-protein cross links in γ irradiated E. Coli ribosomes

    International Nuclear Information System (INIS)

    Ekert, Bernard; Giocanti, Nicole

    1976-01-01

    γ irradiation in de-aerated conditions of E. coli MRE 600 ribosomes, labelled with 14 C uracil, leads to a decrease of extractibility of 14 C RNA by lithium chloride 4 M-urea 8 M. On the other hand, the radioactivity of the protein fraction increases with irradiation. These results strongly suggest that RNA-protein cross links are formed in irradiated ribosomes [fr

  16. Structural Studies of RNA Helicases Involved in Eukaryotic Pre-mRNA Splicing, Ribosome Biogenesis, and Translation Initiation

    DEFF Research Database (Denmark)

    He, Yangzi

    and ligates the neighbouring exons to generate mature mRNAs. Prp43 is an RNA helicase of the DEAH/RHA family. In yeast, once mRNAs are released, Prp43 catalyzes the disassembly of spliceosomes. The 18S, 5.8S and 25S rRNAs are transcribed as a single polycistronic transcript—the 35S pre......-rRNA. It is nucleolytically cleaved and chemically modified to generate mature rRNAs, which assemble with ribosomal proteins to form the ribosome. Prp43 is required for the processing of the 18S rRNA. Using X-ray crystallography, I determined a high resolution structure of Prp43 bound to ADP, the first structure of a DEAH....../RHA helicase. It defined the conserved structural features of all DEAH/RHA helicases, and unveiled a novel nucleotide binding site. Additionally a preliminary low resolution structure of a ternary complex comprising Prp43, a non-hydrolyzable ATP analogue, and a single-stranded RNA, was obtained. The ribosome...

  17. Simulating movement of tRNA through the ribosome during hybrid-state formation.

    Science.gov (United States)

    Whitford, Paul C; Sanbonmatsu, Karissa Y

    2013-09-28

    Biomolecular simulations provide a means for exploring the relationship between flexibility, energetics, structure, and function. With the availability of atomic models from X-ray crystallography and cryoelectron microscopy (cryo-EM), and rapid increases in computing capacity, it is now possible to apply molecular dynamics (MD) simulations to large biomolecular machines, and systematically partition the factors that contribute to function. A large biomolecular complex for which atomic models are available is the ribosome. In the cell, the ribosome reads messenger RNA (mRNA) in order to synthesize proteins. During this essential process, the ribosome undergoes a wide range of conformational rearrangements. One of the most poorly understood transitions is translocation: the process by which transfer RNA (tRNA) molecules move between binding sites inside of the ribosome. The first step of translocation is the adoption of a "hybrid" configuration by the tRNAs, which is accompanied by large-scale rotations in the ribosomal subunits. To illuminate the relationship between these rearrangements, we apply MD simulations using a multi-basin structure-based (SMOG) model, together with targeted molecular dynamics protocols. From 120 simulated transitions, we demonstrate the viability of a particular route during P/E hybrid-state formation, where there is asynchronous movement along rotation and tRNA coordinates. These simulations not only suggest an ordering of events, but they highlight atomic interactions that may influence the kinetics of hybrid-state formation. From these simulations, we also identify steric features (H74 and surrounding residues) encountered during the hybrid transition, and observe that flexibility of the single-stranded 3'-CCA tail is essential for it to reach the endpoint. Together, these simulations provide a set of structural and energetic signatures that suggest strategies for modulating the physical-chemical properties of protein synthesis by the

  18. cDNA, genomic sequence cloning and analysis of the ribosomal ...

    African Journals Online (AJOL)

    Ribosomal protein L37A (RPL37A) is a component of 60S large ribosomal subunit encoded by the RPL37A gene, which belongs to the family of ribosomal L37AE proteins, located in the cytoplasm. The complementary deoxyribonucleic acid (cDNA) and the genomic sequence of RPL37A were cloned successfully from giant ...

  19. sRNAnalyzer-a flexible and customizable small RNA sequencing data analysis pipeline.

    Science.gov (United States)

    Wu, Xiaogang; Kim, Taek-Kyun; Baxter, David; Scherler, Kelsey; Gordon, Aaron; Fong, Olivia; Etheridge, Alton; Galas, David J; Wang, Kai

    2017-12-01

    Although many tools have been developed to analyze small RNA sequencing (sRNA-Seq) data, it remains challenging to accurately analyze the small RNA population, mainly due to multiple sequence ID assignment caused by short read length. Additional issues in small RNA analysis include low consistency of microRNA (miRNA) measurement results across different platforms, miRNA mapping associated with miRNA sequence variation (isomiR) and RNA editing, and the origin of those unmapped reads after screening against all endogenous reference sequence databases. To address these issues, we built a comprehensive and customizable sRNA-Seq data analysis pipeline-sRNAnalyzer, which enables: (i) comprehensive miRNA profiling strategies to better handle isomiRs and summarization based on each nucleotide position to detect potential SNPs in miRNAs, (ii) different sequence mapping result assignment approaches to simulate results from microarray/qRT-PCR platforms and a local probabilistic model to assign mapping results to the most-likely IDs, (iii) comprehensive ribosomal RNA filtering for accurate mapping of exogenous RNAs and summarization based on taxonomy annotation. We evaluated our pipeline on both artificial samples (including synthetic miRNA and Escherichia coli cultures) and biological samples (human tissue and plasma). sRNAnalyzer is implemented in Perl and available at: http://srnanalyzer.systemsbiology.net/. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  20. sRNAnalyzer—a flexible and customizable small RNA sequencing data analysis pipeline

    Science.gov (United States)

    Kim, Taek-Kyun; Baxter, David; Scherler, Kelsey; Gordon, Aaron; Fong, Olivia; Etheridge, Alton; Galas, David J.

    2017-01-01

    Abstract Although many tools have been developed to analyze small RNA sequencing (sRNA-Seq) data, it remains challenging to accurately analyze the small RNA population, mainly due to multiple sequence ID assignment caused by short read length. Additional issues in small RNA analysis include low consistency of microRNA (miRNA) measurement results across different platforms, miRNA mapping associated with miRNA sequence variation (isomiR) and RNA editing, and the origin of those unmapped reads after screening against all endogenous reference sequence databases. To address these issues, we built a comprehensive and customizable sRNA-Seq data analysis pipeline—sRNAnalyzer, which enables: (i) comprehensive miRNA profiling strategies to better handle isomiRs and summarization based on each nucleotide position to detect potential SNPs in miRNAs, (ii) different sequence mapping result assignment approaches to simulate results from microarray/qRT-PCR platforms and a local probabilistic model to assign mapping results to the most-likely IDs, (iii) comprehensive ribosomal RNA filtering for accurate mapping of exogenous RNAs and summarization based on taxonomy annotation. We evaluated our pipeline on both artificial samples (including synthetic miRNA and Escherichia coli cultures) and biological samples (human tissue and plasma). sRNAnalyzer is implemented in Perl and available at: http://srnanalyzer.systemsbiology.net/. PMID:29069500

  1. Ribosomal RNA in the salivary gland of Sciara ocellaris during larval development

    International Nuclear Information System (INIS)

    Dessen, E.M.B.; Perondini, A.L.P.

    1979-01-01

    Ribosomal RNA in the salivary gland of Sciara ocellaris during larval development. The molecular weights of the precursor and of the 28S and 18S mature fractions of the ribosomal RNA estimated by poliacrilamid gel electrophoresis are 2.6 X 10 6 D, 1.4 X 10 6 D and 0.68 X 10 6 D, respectively. The in vivo processing of pre-rRNA is very fast since radioactivity could be detected in the mature fractions fifteen minutes after incorporation. The processing rate of salivary pre-rRNA increases after the stage of metamorphosis induction. The in vitro processing of the pre-rRNA is less rapid when compared to that in vivo, and no differences were found in RNAs [pt

  2. 5S Ribosomal RNA Is an Essential Component of a Nascent Ribosomal Precursor Complex that Regulates the Hdm2-p53 Checkpoint

    Directory of Open Access Journals (Sweden)

    Giulio Donati

    2013-07-01

    Full Text Available Recently, we demonstrated that RPL5 and RPL11 act in a mutually dependent manner to inhibit Hdm2 and stabilize p53 following impaired ribosome biogenesis. Given that RPL5 and RPL11 form a preribosomal complex with noncoding 5S ribosomal RNA (rRNA and the three have been implicated in the p53 response, we reasoned they may be part of an Hdm2-inhibitory complex. Here, we show that small interfering RNAs directed against 5S rRNA have no effect on total or nascent levels of the noncoding rRNA, though they prevent the reported Hdm4 inhibition of p53. To achieve efficient inhibition of 5S rRNA synthesis, we targeted TFIIIA, a specific RNA polymerase III cofactor, which, like depletion of either RPL5 or RPL11, did not induce p53. Instead, 5S rRNA acts in a dependent manner with RPL5 and RPL11 to inhibit Hdm2 and stabilize p53. Moreover, depletion of any one of the three components abolished the binding of the other two to Hdm2, explaining their common dependence. Finally, we demonstrate that the RPL5/RPL11/5S rRNA preribosomal complex is redirected from assembly into nascent 60S ribosomes to Hdm2 inhibition as a consequence of impaired ribosome biogenesis. Thus, the activation of the Hdm2-inhibitory complex is not a passive but a regulated event, whose potential role in tumor suppression has been recently noted.

  3. 5S ribosomal RNA is an essential component of a nascent ribosomal precursor complex that regulates the Hdm2-p53 checkpoint.

    Science.gov (United States)

    Donati, Giulio; Peddigari, Suresh; Mercer, Carol A; Thomas, George

    2013-07-11

    Recently, we demonstrated that RPL5 and RPL11 act in a mutually dependent manner to inhibit Hdm2 and stabilize p53 following impaired ribosome biogenesis. Given that RPL5 and RPL11 form a preribosomal complex with noncoding 5S ribosomal RNA (rRNA) and the three have been implicated in the p53 response, we reasoned they may be part of an Hdm2-inhibitory complex. Here, we show that small interfering RNAs directed against 5S rRNA have no effect on total or nascent levels of the noncoding rRNA, though they prevent the reported Hdm4 inhibition of p53. To achieve efficient inhibition of 5S rRNA synthesis, we targeted TFIIIA, a specific RNA polymerase III cofactor, which, like depletion of either RPL5 or RPL11, did not induce p53. Instead, 5S rRNA acts in a dependent manner with RPL5 and RPL11 to inhibit Hdm2 and stabilize p53. Moreover, depletion of any one of the three components abolished the binding of the other two to Hdm2, explaining their common dependence. Finally, we demonstrate that the RPL5/RPL11/5S rRNA preribosomal complex is redirected from assembly into nascent 60S ribosomes to Hdm2 inhibition as a consequence of impaired ribosome biogenesis. Thus, the activation of the Hdm2-inhibitory complex is not a passive but a regulated event, whose potential role in tumor suppression has been recently noted. Copyright © 2013 The Authors. Published by Elsevier Inc. All rights reserved.

  4. The Ribosomal RNA is a Useful Marker to Visualize Rhizobia Interacting with Legume Plants

    Science.gov (United States)

    Rinaudi, Luciana; Isola, Maria C.; Giordano, Walter

    2004-01-01

    Symbiosis between rhizobia and leguminous plants leads to the formation of nitrogen-fixing root nodules. In the present article, we recommend the use of the ribosomal RNA (rRNA) isolated from legume nodules in an experimental class with the purpose of introducing students to the structure of eukaryotic and prokaryotic ribosomes and of…

  5. Characterization of the regions from E. coli 16 S RNA covalently linked to ribosomal proteins S4 and S20 after ultraviolet irradiation

    International Nuclear Information System (INIS)

    Ehresmann, B.; Backendorf, C.; Ehresmann, C.; Ebel, J.P.

    1977-01-01

    The use of ultraviolet irradiation to form photochemical covalent bonds between the 16 S RNA and a ribosomal protein is a reliable method to check RNA regions which are interacting with the protein. This technique was successfully used to covalently link RNA or DNA and specific proteins in several cases. In the case of ribosome, it has been shown that the irradiation of 30 S and 50 S subunits using high doses of ultraviolet light allowed the covalent binding of almost all of the ribosomal proteins to the 16 S or 23 S RNAs. Using mild conditions, only proteins S7 and L4 could be covalently linked to the 16 S and 23 S RNAs, respectively, and the 16 S RNA region linked to protein S7 has now been characterized. The specificity of the photoreaction was demonstrated earlier and the tryptic peptides from proteins S4 and S7, photochemically linked to the 16 S RNA complexes, were identified. A report is presented on the sequences of the RNA regions which can be photochemically linked to proteins S4 and S7 after ultraviolet irradiation of the specific S4-16 S RNA and 20 S-16 S RNA complexes

  6. Hierarchical recruitment of ribosomal proteins and assembly factors remodels nucleolar pre-60S ribosomes.

    Science.gov (United States)

    Biedka, Stephanie; Micic, Jelena; Wilson, Daniel; Brown, Hailey; Diorio-Toth, Luke; Woolford, John L

    2018-04-24

    Ribosome biogenesis involves numerous preribosomal RNA (pre-rRNA) processing events to remove internal and external transcribed spacer sequences, ultimately yielding three mature rRNAs. Removal of the internal transcribed spacer 2 spacer RNA is the final step in large subunit pre-rRNA processing and begins with endonucleolytic cleavage at the C 2 site of 27SB pre-rRNA. C 2 cleavage requires the hierarchical recruitment of 11 ribosomal proteins and 14 ribosome assembly factors. However, the function of these proteins in C 2 cleavage remained unclear. In this study, we have performed a detailed analysis of the effects of depleting proteins required for C 2 cleavage and interpreted these results using cryo-electron microscopy structures of assembling 60S subunits. This work revealed that these proteins are required for remodeling of several neighborhoods, including two major functional centers of the 60S subunit, suggesting that these remodeling events form a checkpoint leading to C 2 cleavage. Interestingly, when C 2 cleavage is directly blocked by depleting or inactivating the C 2 endonuclease, assembly progresses through all other subsequent steps. © 2018 Biedka et al.

  7. Linking Maternal and Somatic 5S rRNA types with Different Sequence-Specific Non-LTR Retrotransposons

    NARCIS (Netherlands)

    Locati, M.D.; Pagano, J.F.B.; Ensink, W.A.; van Olst, M.; van Leeuwen, S.; Nehrdich, U.; Zhu, K.; Spaink, H.P.; Girard, G.; Rauwerda, H.; Jonker, M.J.; Dekker, R.J.; Breit, T.M.

    5S rRNA is a ribosomal core component, transcribed from many gene copies organized in genomic repeats. Some eukaryotic species have two 5S rRNA types defined by their predominant expression in oogenesis or adult tissue. Our next-generation sequencing study on zebrafish egg, embryo and adult tissue,

  8. A Sequence-Specific Interaction between the Saccharomyces cerevisiae rRNA Gene Repeats and a Locus Encoding an RNA Polymerase I Subunit Affects Ribosomal DNA Stability

    Science.gov (United States)

    Cahyani, Inswasti; Cridge, Andrew G.; Engelke, David R.; Ganley, Austen R. D.

    2014-01-01

    The spatial organization of eukaryotic genomes is linked to their functions. However, how individual features of the global spatial structure contribute to nuclear function remains largely unknown. We previously identified a high-frequency interchromosomal interaction within the Saccharomyces cerevisiae genome that occurs between the intergenic spacer of the ribosomal DNA (rDNA) repeats and the intergenic sequence between the locus encoding the second largest RNA polymerase I subunit and a lysine tRNA gene [i.e., RPA135-tK(CUU)P]. Here, we used quantitative chromosome conformation capture in combination with replacement mapping to identify a 75-bp sequence within the RPA135-tK(CUU)P intergenic region that is involved in the interaction. We demonstrate that the RPA135-IGS1 interaction is dependent on the rDNA copy number and the Msn2 protein. Surprisingly, we found that the interaction does not govern RPA135 transcription. Instead, replacement of a 605-bp region within the RPA135-tK(CUU)P intergenic region results in a reduction in the RPA135-IGS1 interaction level and fluctuations in rDNA copy number. We conclude that the chromosomal interaction that occurs between the RPA135-tK(CUU)P and rDNA IGS1 loci stabilizes rDNA repeat number and contributes to the maintenance of nucleolar stability. Our results provide evidence that the DNA loci involved in chromosomal interactions are composite elements, sections of which function in stabilizing the interaction or mediating a functional outcome. PMID:25421713

  9. Fluctuations between multiple EF-G-induced chimeric tRNA states during translocation on the ribosome

    Science.gov (United States)

    Adio, Sarah; Senyushkina, Tamara; Peske, Frank; Fischer, Niels; Wintermeyer, Wolfgang; Rodnina, Marina V.

    2015-06-01

    The coupled translocation of transfer RNA and messenger RNA through the ribosome entails large-scale structural rearrangements, including step-wise movements of the tRNAs. Recent structural work has visualized intermediates of translocation induced by elongation factor G (EF-G) with tRNAs trapped in chimeric states with respect to 30S and 50S ribosomal subunits. The functional role of the chimeric states is not known. Here we follow the formation of translocation intermediates by single-molecule fluorescence resonance energy transfer. Using EF-G mutants, a non-hydrolysable GTP analogue, and fusidic acid, we interfere with either translocation or EF-G release from the ribosome and identify several rapidly interconverting chimeric tRNA states on the reaction pathway. EF-G engagement prevents backward transitions early in translocation and increases the fraction of ribosomes that rapidly fluctuate between hybrid, chimeric and posttranslocation states. Thus, the engagement of EF-G alters the energetics of translocation towards a flat energy landscape, thereby promoting forward tRNA movement.

  10. Ribosomal proteins L11 and L10.(L12)4 and the antibiotic thiostrepton interact with overlapping regions of the 23 S rRNA backbone in the ribosomal GTPase centre

    DEFF Research Database (Denmark)

    Rosendahl, G; Douthwaite, S

    1993-01-01

    RNA, and to investigate how this interaction is influenced by other ribosomal components. Complexes were characterized in both naked 23 S rRNA and ribosomes from an E. coli L11-minus strain, before and after reconstitution with L11. The protein protects 17 riboses between positions 1058 and 1085 in the naked 23 S r......The Escherichia coli ribosomal protein (r-protein) L11 and its binding site on 23 S ribosomal RNA (rRNA) are associated with ribosomal hydrolysis of guanosine 5'-triphosphate (GTP). We have used hydroxyl radical footprinting to map the contacts between L11 and the backbone riboses in 23 S r......)4 and other proteins within the ribosome. The antibiotics thiostrepton and micrococcin inhibit the catalytic functions of this region by slotting in between the accessible loops and interacting with nucleotides there....

  11. International interlaboratory study comparing single organism 16S rRNA gene sequencing data: Beyond consensus sequence comparisons

    Science.gov (United States)

    Olson, Nathan D.; Lund, Steven P.; Zook, Justin M.; Rojas-Cornejo, Fabiola; Beck, Brian; Foy, Carole; Huggett, Jim; Whale, Alexandra S.; Sui, Zhiwei; Baoutina, Anna; Dobeson, Michael; Partis, Lina; Morrow, Jayne B.

    2015-01-01

    This study presents the results from an interlaboratory sequencing study for which we developed a novel high-resolution method for comparing data from different sequencing platforms for a multi-copy, paralogous gene. The combination of PCR amplification and 16S ribosomal RNA gene (16S rRNA) sequencing has revolutionized bacteriology by enabling rapid identification, frequently without the need for culture. To assess variability between laboratories in sequencing 16S rRNA, six laboratories sequenced the gene encoding the 16S rRNA from Escherichia coli O157:H7 strain EDL933 and Listeria monocytogenes serovar 4b strain NCTC11994. Participants performed sequencing methods and protocols available in their laboratories: Sanger sequencing, Roche 454 pyrosequencing®, or Ion Torrent PGM®. The sequencing data were evaluated on three levels: (1) identity of biologically conserved position, (2) ratio of 16S rRNA gene copies featuring identified variants, and (3) the collection of variant combinations in a set of 16S rRNA gene copies. The same set of biologically conserved positions was identified for each sequencing method. Analytical methods using Bayesian and maximum likelihood statistics were developed to estimate variant copy ratios, which describe the ratio of nucleotides at each identified biologically variable position, as well as the likely set of variant combinations present in 16S rRNA gene copies. Our results indicate that estimated variant copy ratios at biologically variable positions were only reproducible for high throughput sequencing methods. Furthermore, the likely variant combination set was only reproducible with increased sequencing depth and longer read lengths. We also demonstrate novel methods for evaluating variable positions when comparing multi-copy gene sequence data from multiple laboratories generated using multiple sequencing technologies. PMID:27077030

  12. International interlaboratory study comparing single organism 16S rRNA gene sequencing data: Beyond consensus sequence comparisons

    Directory of Open Access Journals (Sweden)

    Nathan D. Olson

    2015-03-01

    Full Text Available This study presents the results from an interlaboratory sequencing study for which we developed a novel high-resolution method for comparing data from different sequencing platforms for a multi-copy, paralogous gene. The combination of PCR amplification and 16S ribosomal RNA gene (16S rRNA sequencing has revolutionized bacteriology by enabling rapid identification, frequently without the need for culture. To assess variability between laboratories in sequencing 16S rRNA, six laboratories sequenced the gene encoding the 16S rRNA from Escherichia coli O157:H7 strain EDL933 and Listeria monocytogenes serovar 4b strain NCTC11994. Participants performed sequencing methods and protocols available in their laboratories: Sanger sequencing, Roche 454 pyrosequencing®, or Ion Torrent PGM®. The sequencing data were evaluated on three levels: (1 identity of biologically conserved position, (2 ratio of 16S rRNA gene copies featuring identified variants, and (3 the collection of variant combinations in a set of 16S rRNA gene copies. The same set of biologically conserved positions was identified for each sequencing method. Analytical methods using Bayesian and maximum likelihood statistics were developed to estimate variant copy ratios, which describe the ratio of nucleotides at each identified biologically variable position, as well as the likely set of variant combinations present in 16S rRNA gene copies. Our results indicate that estimated variant copy ratios at biologically variable positions were only reproducible for high throughput sequencing methods. Furthermore, the likely variant combination set was only reproducible with increased sequencing depth and longer read lengths. We also demonstrate novel methods for evaluating variable positions when comparing multi-copy gene sequence data from multiple laboratories generated using multiple sequencing technologies.

  13. Potential pitfalls of modelling ribosomal RNA data in phylogenetic tree reconstruction: evidence from case studies in the Metazoa.

    Science.gov (United States)

    Letsch, Harald O; Kjer, Karl M

    2011-05-27

    Failure to account for covariation patterns in helical regions of ribosomal RNA (rRNA) genes has the potential to misdirect the estimation of the phylogenetic signal of the data. Furthermore, the extremes of length variation among taxa, combined with regional substitution rate variation can mislead the alignment of rRNA sequences and thus distort subsequent tree reconstructions. However, recent developments in phylogenetic methodology now allow a comprehensive integration of secondary structures in alignment and tree reconstruction analyses based on rRNA sequences, which has been shown to correct some of these problems. Here, we explore the potentials of RNA substitution models and the interactions of specific model setups with the inherent pattern of covariation in rRNA stems and substitution rate variation among loop regions. We found an explicit impact of RNA substitution models on tree reconstruction analyses. The application of specific RNA models in tree reconstructions is hampered by interaction between the appropriate modelling of covarying sites in stem regions, and excessive homoplasy in some loop regions. RNA models often failed to recover reasonable trees when single-stranded regions are excessively homoplastic, because these regions contribute a greater proportion of the data when covarying sites are essentially downweighted. In this context, the RNA6A model outperformed all other models, including the more parametrized RNA7 and RNA16 models. Our results depict a trade-off between increased accuracy in estimation of interdependencies in helical regions with the risk of magnifying positions lacking phylogenetic signal. We can therefore conclude that caution is warranted when applying rRNA covariation models, and suggest that loop regions be independently screened for phylogenetic signal, and eliminated when they are indistinguishable from random noise. In addition to covariation and homoplasy, other factors, like non-stationarity of substitution rates

  14. Conservation of RNA sequence and cross-linking ability in ribosomes from a higher eukaryote: photochemical cross-linking of the anticodon of P site bound tRNA to the penultimate cytidine of the UACACACG sequence in Artemia salina 18S rRNA

    International Nuclear Information System (INIS)

    Ciesiolka, J.; Nurse, K.; Klein, J.; Ofengand, J.

    1985-01-01

    The complex of Artemia salina ribosomes and Escherichia coli acetylvalyl-tRNA could be cross-linked by irradiation with near-UV light. Cross-linking required the presence of the codon GUU, GUA being ineffective. The acetylvalyl group could be released from the cross-linked tRNA by treatment with puromycin, demonstrating that cross-linking had occurred at the P site. This was true both for pGUU- and also for poly(U2,G)-dependent cross-linking. All of the cross-linking was to the 18S rRNA of the small ribosomal subunit. Photolysis of the cross-link at 254 nm occurred with the same kinetics as that for the known cyclobutane dimer between this tRNA and Escherichia coli 16S rRNA. T1 RNase digestion of the cross-linked tRNA yielded an oligonucleotide larger in molecular weight than any from un-cross-linked rRNA or tRNA or from a prephotolyzed complex. Extended electrophoresis showed this material to consist of two oligomers of similar mobility, a faster one-third component and a slower two-thirds component. Each oligomer yielded two components on 254-nm photolysis. The slower band from each was the tRNA T1 oligomer CACCUCCCUVACAAGp, which includes the anticodon. The faster band was the rRNA 9-mer UACACACCGp and its derivative UACACACUG. Unexpectedly, the dephosphorylated and slower moving 9-mer was derived from the faster moving dimer. Deamination of the penultimate C to U is probably due to cyclobutane dimer formation and was evidence for that nucleotide being the site of cross-linking. Direct confirmation of the cross-linking site was obtained by Z-gel analysis

  15. MMB-GUI: a fast morphing method demonstrates a possible ribosomal tRNA translocation trajectory.

    Science.gov (United States)

    Tek, Alex; Korostelev, Andrei A; Flores, Samuel Coulbourn

    2016-01-08

    Easy-to-use macromolecular viewers, such as UCSF Chimera, are a standard tool in structural biology. They allow rendering and performing geometric operations on large complexes, such as viruses and ribosomes. Dynamical simulation codes enable modeling of conformational changes, but may require considerable time and many CPUs. There is an unmet demand from structural and molecular biologists for software in the middle ground, which would allow visualization combined with quick and interactive modeling of conformational changes, even of large complexes. This motivates MMB-GUI. MMB uses an internal-coordinate, multiscale approach, yielding as much as a 2000-fold speedup over conventional simulation methods. We use Chimera as an interactive graphical interface to control MMB. We show how this can be used for morphing of macromolecules that can be heterogeneous in biopolymer type, sequence, and chain count, accurately recapitulating structural intermediates. We use MMB-GUI to create a possible trajectory of EF-G mediated gate-passing translocation in the ribosome, with all-atom structures. This shows that the GUI makes modeling of large macromolecules accessible to a wide audience. The morph highlights similarities in tRNA conformational changes as tRNA translocates from A to P and from P to E sites and suggests that tRNA flexibility is critical for translocation completion. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  16. A comparative study of ribosomal proteins: linkage between amino acid distribution and ribosomal assembly

    International Nuclear Information System (INIS)

    Lott, Brittany Burton; Wang, Yongmei; Nakazato, Takuya

    2013-01-01

    Assembly of the ribosome from its protein and RNA constituents must occur quickly and efficiently in order to synthesize the proteins necessary for all cellular activity. Since the early 1960’s, certain characteristics of possible assembly pathways have been elucidated, yet the mechanisms that govern the precise recognition events remain unclear. We utilize a comparative analysis to investigate the amino acid composition of ribosomal proteins (r-proteins) with respect to their role in the assembly process. We compared small subunit (30S) r-protein sequences to those of other housekeeping proteins from 560 bacterial species and searched for correlations between r-protein amino acid content and factors such as assembly binding order, environmental growth temperature, protein size, and contact with ribosomal RNA (rRNA) in the 30S complex. We find r-proteins have a significantly high percent of positive residues, which are highly represented at rRNA contact sites. An inverse correlation between the percent of positive residues and r-protein size was identified and is mainly due to the content of Lysine residues, rather than Arginine. Nearly all r-proteins carry a net positive charge, but no statistical correlation between the net charge and the binding order was detected. Thermophilic (high-temperature) r-proteins contain increased Arginine, Isoleucine, and Tyrosine, and decreased Serine and Threonine compared to mesophilic (lower-temperature), reflecting a known distinction between thermophiles and mesophiles, possibly to account for protein thermostability. However, this difference in amino acid content does not extend to rRNA contact sites, as the proportions of thermophilic and mesophilic contact residues are not significantly different. Given the significantly higher level of positively charged residues in r-proteins and at contact sites, we conclude that ribosome assembly relies heavily on an electrostatic component of interaction. However, the binding order of

  17. Cisplatin Targeting of Bacterial Ribosomal RNA Hairpins

    Directory of Open Access Journals (Sweden)

    Gayani N. P. Dedduwa-Mudalige

    2015-09-01

    Full Text Available Cisplatin is a clinically important chemotherapeutic agent known to target purine bases in nucleic acids. In addition to major deoxyribonucleic acid (DNA intrastrand cross-links, cisplatin also forms stable adducts with many types of ribonucleic acid (RNA including siRNA, spliceosomal RNAs, tRNA, and rRNA. All of these RNAs play vital roles in the cell, such as catalysis of protein synthesis by rRNA, and therefore serve as potential drug targets. This work focused on platination of two highly conserved RNA hairpins from E. coli ribosomes, namely pseudouridine-modified helix 69 from 23S rRNA and the 790 loop of helix 24 from 16S rRNA. RNase T1 probing, MALDI mass spectrometry, and dimethyl sulfate mapping revealed platination at GpG sites. Chemical probing results also showed platination-induced RNA structural changes. These findings reveal solvent and structural accessibility of sites within bacterial RNA secondary structures that are functionally significant and therefore viable targets for cisplatin as well as other classes of small molecules. Identifying target preferences at the nucleotide level, as well as determining cisplatin-induced RNA conformational changes, is important for the design of more potent drug molecules. Furthermore, the knowledge gained through studies of RNA-targeting by cisplatin is applicable to a broad range of organisms from bacteria to human.

  18. Biological significance of 5S rRNA import into human mitochondria: role of ribosomal protein MRP-L18

    Science.gov (United States)

    Smirnov, Alexandre; Entelis, Nina; Martin, Robert P.; Tarassov, Ivan

    2011-01-01

    5S rRNA is an essential component of ribosomes of all living organisms, the only known exceptions being mitochondrial ribosomes of fungi, animals, and some protists. An intriguing situation distinguishes mammalian cells: Although the mitochondrial genome contains no 5S rRNA genes, abundant import of the nuclear DNA-encoded 5S rRNA into mitochondria was reported. Neither the detailed mechanism of this pathway nor its rationale was clarified to date. In this study, we describe an elegant molecular conveyor composed of a previously identified human 5S rRNA import factor, rhodanese, and mitochondrial ribosomal protein L18, thanks to which 5S rRNA molecules can be specifically withdrawn from the cytosolic pool and redirected to mitochondria, bypassing the classic nucleolar reimport pathway. Inside mitochondria, the cytosolic 5S rRNA is shown to be associated with mitochondrial ribosomes. PMID:21685364

  19. Partial nucleotide sequence analysis of 18S ribosomal RNA gene of the four genotypes of Trypanosoma congolense

    International Nuclear Information System (INIS)

    Osanya, A.; Majiwa, P.A.O.; Kinyanjui, P.W.

    2006-01-01

    Specific oligonucleotide primers based on conserved nucleotide sequences of 18s ribisomal RNA (18s rRNA) gene of Trypanosoma brucei, Leishmania donovani, Triponema aequale and Lagenidium gigantum have been designed and used in the ploymerase chain reaction (PCR) to amplify genomic DNA from four different clones each representing a different genotypic group of T. congolence. PCR products of approximately 1Kb were generated using as template DNA from each of the trypanosomes. The PCR products cross-hybridized with genomic DNA from T.brucei, T. simiae and the four genotypes of T.congolense implying significant sequence homology of 18S rRNA gene among trypanosomes. The nucleotide sequence of a segment of the PCR products were determined by direct sequencing to provide partial nucleotide sequence of the 18s rRNA gene in each T.congolense genotypic group. The sequences obtained together with those that have been published for T.brucei reveals that although most regions show inter and intra species nucleotide identity, there are several sites where deletions, insertions and base changes have occured in nucleotide sequence of of T.brucei and the four genotypes of T.congolense.(author)

  20. Detection of Aspergillus fumigatus pulmonary fungal infections in mice with 99mTc-labeled MORF oligomers targeting ribosomal RNA

    International Nuclear Information System (INIS)

    Wang Yuzhen; Chen Ling; Liu Xinrong; Cheng Dengfeng; Liu Guozheng; Liu Yuxia; Dou Shuping; Hnatowich, Donald J.; Rusckowski, Mary

    2013-01-01

    Purpose: Invasive aspergillosis is a major cause of infectious morbidity and mortality in immunocompromised patients. The fungus Aspergillus fumigatus (A. fumigatus) is the primary causative agent of invasive aspergillosis. However, A. fumigatus infections remain difficult to diagnose particularly in the early stages due to the lack of a rapid, sensitive and specific diagnostic approach. In this study, we investigated 99m Tc labeled MORF oligomers targeting fungal ribosomal RNA (rRNA) for the imaging detection of fungal infections. Procedures: Three phosphorodiamidate morpholino (MORF) oligomer (a DNA analogue) probes were designed: AGEN, complementary to a sequence of the fungal 28S ribosomal RNA (rRNA) of Aspergillus, as a genus-specific probe; AFUM, complementary to the 28S rRNA sequence of A. fumigatus, as a fungus species-specific probe; and cMORF, irrelevant to all fungal species, as a control probe. The probes were conjugated with Alexa Fluor 633 carboxylic acid succinimidyl ester (AF633) for fluorescence imaging or with NHS-mercaptoacetyl triglycine (NHS-MAG3) for nuclear imaging with 99m Tc and then evaluated in vitro and in vivo. Results: The specific binding of AGEN and AFUM to fungal total RNA was confirmed by dot blot hybridization while specific binding of AGEN and AFUM in fixed and live A. fumigatus was demonstrated by both fluorescent in situ hybridization (FISH) analysis and accumulation in live cells. SPECT imaging of BALB/c mice with pulmonary A. fumigatus infections and administered 99m Tc labeled AGEN and AFUM showed immediate and obvious accumulation in the infected lungs, while no significant accumulation of the control 99m Tc-cMORF in the infected lung was observed. Compared to non-infected mice, with sacrifice at 1 h, the accumulation of 99m Tc-AGEN and 99m Tc-AFUM in the lungs of mice infected with A. fumigatus was 2 and 2.7 fold higher respectively. Conclusions: In vivo targeting fungal ribosomal RNA with 99m Tc labeled MORF probes AGEN

  1. The origin of the 5S ribosomal RNA molecule could have been caused by a single inverse duplication: strong evidence from its sequences.

    Science.gov (United States)

    Branciamore, Sergio; Di Giulio, Massimo

    2012-04-01

    The secondary structure of the 5S ribosomal RNA (5S rRNA) molecule shows a high degree of symmetry. In order to explain the origin of this symmetry, it has been conjectured that one half of the 5S rRNA molecule was its precursor and that an indirect duplication of this precursor created the other half and thus the current symmetry of the molecule. Here, we have subjected to an empirical test both the indirect duplication model, analysing a total of 684 5S rRNA sequences for complementarity between the two halves of the 5S rRNA, and the direct duplication model analysing in this case the similarity between the two halves of this molecule. In intra- and inter-molecule and intra- and inter-domain comparisons, we find a high statistical support to the hypothesis of a complementarity relationship between the two halves of the 5S rRNA molecule, denying vice versa the hypothesis of similarity between these halves. Therefore, these observations corroborate the indirect duplication model at the expense of the direct duplication model, as reason of the origin of the 5S rRNA molecule. More generally, we discuss and favour the hypothesis that all RNAs and proteins, which present symmetry, did so through gene duplication and not by gradualistic accumulation of few monomers or segments of molecule into a gradualistic growth process. This would be the consequence of the very high propensity that nucleic acids have to be subjected to duplications.

  2. Distribution of protein and RNA in the 30S ribosomal subunit

    International Nuclear Information System (INIS)

    Ramakrishnan, V.

    1986-01-01

    In Escherichia coli, the small ribosomal subunit has a sedimentation coefficient of 30S, and consists of a 16S RNA molecule of 1541 nucleotides complexed with 21 proteins. Over the last few years, a controversy has emerged regarding the spatial distribution of RNA and protein in the 30S subunit. Contrast variation with neutron scattering was used to suggest that the RNA was located in a central core of the subunit and the proteins mainly in the periphery, with virtually no separation between the centers of mass of protein and RNA. However, these findings are incompatible with the results of efforts to locate individual ribosomal proteins by immune electron microscopy and triangulation with interprotein distance measurements. The conflict between these two views is resolved in this report of small-angle neutron scattering measurements on 30S subunits with and without protein S1, and on subunits reconstituted from deuterated 16S RNA and unlabeled proteins. The results show that (i) the proteins and RNA are intermingled, with neither component dominating at the core or the periphery, and (ii) the spatial distribution of protein and RNA is asymmetrical, with a separation between their centers of mass of about 25 angstroms

  3. Diversity of ribosomal 16S DNA- and RNA-based bacterial community in an office building drinking water system.

    Science.gov (United States)

    Inkinen, J; Jayaprakash, B; Santo Domingo, J W; Keinänen-Toivola, M M; Ryu, H; Pitkänen, T

    2016-06-01

    Next-generation sequencing of 16S ribosomal RNA genes (rDNA) and ribosomal RNA (rRNA) was used to characterize water and biofilm microbiome collected from a drinking water distribution system of an office building after its first year of operation. The total bacterial community (rDNA) and active bacterial members (rRNA) sequencing databases were generated by Illumina MiSeq PE250 platform. As estimated by Chao1 index, species richness in cold water system was lower (180-260) in biofilms (Sphingomonas spp., Methylobacterium spp., Limnohabitans spp., Rhizobiales order) than in waters (250-580), (also Methylotenera spp.) (P = 0·005, n = 20). Similarly species richness (Chao1) was slightly higher (210-580) in rDNA libraries compared to rRNA libraries (150-400; P = 0·054, n = 24). Active Mycobacterium spp. was found in cross-linked polyethylene (PEX), but not in corresponding copper pipeline biofilm. Nonpathogenic Legionella spp. was found in rDNA libraries but not in rRNA libraries. Microbial communities differed between water and biofilms, between cold and hot water systems, locations in the building and between water rRNA and rDNA libraries, as shown by clear clusters in principal component analysis (PcoA). By using the rRNA method, we found that not all bacterial community members were active (e.g. Legionella spp.), whereas other members showed increased activity in some locations; for example, Pseudomonas spp. in hot water circulations' biofilm and order Rhizobiales and Limnohabitans spp. in stagnated locations' water and biofilm. rRNA-based methods may be better than rDNA-based methods for evaluating human health implications as rRNA methods can be used to describe the active bacterial fraction. This study indicates that copper as a pipeline material might have an adverse impact on the occurrence of Mycobacterium spp. The activity of Legionella spp. maybe questionable when detected solely by using DNA-based methods. © 2016 The Society for Applied

  4. Organism-specific rRNA capture system for application in next-generation sequencing.

    Directory of Open Access Journals (Sweden)

    Sai-Kam Li

    Full Text Available RNA-sequencing is a powerful tool in studying RNomics. However, the highly abundance of ribosomal RNAs (rRNA and transfer RNA (tRNA have predominated in the sequencing reads, thereby hindering the study of lowly expressed genes. Therefore, rRNA depletion prior to sequencing is often performed in order to preserve the subtle alteration in gene expression especially those at relatively low expression levels. One of the commercially available methods is to use DNA or RNA probes to hybridize to the target RNAs. However, there is always a concern with the non-specific binding and unintended removal of messenger RNA (mRNA when the same set of probes is applied to different organisms. The degree of such unintended mRNA removal varies among organisms due to organism-specific genomic variation. We developed a computer-based method to design probes to deplete rRNA in an organism-specific manner. Based on the computation results, biotinylated-RNA-probes were produced by in vitro transcription and were used to perform rRNA depletion with subtractive hybridization. We demonstrated that the designed probes of 16S rRNAs and 23S rRNAs can efficiently remove rRNAs from Mycobacterium smegmatis. In comparison with a commercial subtractive hybridization-based rRNA removal kit, using organism-specific probes is better in preserving the RNA integrity and abundance. We believe the computer-based design approach can be used as a generic method in preparing RNA of any organisms for next-generation sequencing, particularly for the transcriptome analysis of microbes.

  5. Detailed analysis of RNA-protein interactions within the bacterial ribosomal protein L5/5S rRNA complex.

    Science.gov (United States)

    Perederina, Anna; Nevskaya, Natalia; Nikonov, Oleg; Nikulin, Alexei; Dumas, Philippe; Yao, Min; Tanaka, Isao; Garber, Maria; Gongadze, George; Nikonov, Stanislav

    2002-12-01

    The crystal structure of ribosomal protein L5 from Thermus thermophilus complexed with a 34-nt fragment comprising helix III and loop C of Escherichia coli 5S rRNA has been determined at 2.5 A resolution. The protein specifically interacts with the bulged nucleotides at the top of loop C of 5S rRNA. The rRNA and protein contact surfaces are strongly stabilized by intramolecular interactions. Charged and polar atoms forming the network of conserved intermolecular hydrogen bonds are located in two narrow planar parallel layers belonging to the protein and rRNA, respectively. The regions, including these atoms conserved in Bacteria and Archaea, can be considered an RNA-protein recognition module. Comparison of the T. thermophilus L5 structure in the RNA-bound form with the isolated Bacillus stearothermophilus L5 structure shows that the RNA-recognition module on the protein surface does not undergo significant changes upon RNA binding. In the crystal of the complex, the protein interacts with another RNA molecule in the asymmetric unit through the beta-sheet concave surface. This protein/RNA interface simulates the interaction of L5 with 23S rRNA observed in the Haloarcula marismortui 50S ribosomal subunit.

  6. The nucleotide sequence and organization of nuclear 5S rRNA genes in yellow lupine

    International Nuclear Information System (INIS)

    Nuc, K.; Nuc, P.; Pawelkiewicz, J.

    1993-01-01

    We have isolated a genomic clone containing 'Lupinus luteus' 5S ribosomal RNA genes by screening with 5S rDNA probe clones that were hybridized previously with the initiator methionine tRNA preparation (contaminated) with traces of rRNA or its degradation products). The clone isolated contains ten repeat units of 342 bp with 119 bp fragment showing 100% homology to the 5S rRNA from yellow lupine. Sequence analysis indicates only point heterogeneities among the flanking regions of the genes. (author). 6 refs, 3 figs

  7. Retrieval of a million high-quality, full-length microbial 16S and 18S rRNA gene sequences without primer bias

    DEFF Research Database (Denmark)

    Karst, Søren Michael; Dueholm, Morten Simonsen; McIlroy, Simon Jon

    2018-01-01

    Small subunit ribosomal RNA (SSU rRNA) genes, 16S in bacteria and 18S in eukaryotes, have been the standard phylogenetic markers used to characterize microbial diversity and evolution for decades. However, the reference databases of full-length SSU rRNA gene sequences are skewed to well-studied e...

  8. Defining the structural requirements for a helix in 23 S ribosomal RNA that confers erythromycin resistance

    DEFF Research Database (Denmark)

    Douthwaite, S; Powers, T; Lee, J Y

    1989-01-01

    The helix spanning nucleotides 1198 to 1247 (helix 1200-1250) in Escherichia coli 23 S ribosomal RNA (rRNA) is functionally important in protein synthesis, and deletions in this region confer erythromycin resistance. In order to define the structural requirements for resistance, we have dissected...... deletion mutants show a sensitive phenotype. Deletions that extend into the base-pairing between GCC1208 and GGU1240 result in non-functional 23 S RNAs, which consequently do not confer resistance. A number of phylogenetically conserved nucleotides have been shown to be non-essential for 23 S RNA function....... However, removal of either these or non-conserved nucleotides from helix 1200-1250 measurably reduces the efficiency of 23 S RNA in forming functional ribosomes. We have used chemical probing and a modified primer extension method to investigate erythromycin binding to wild-type and resistant ribosomes...

  9. Improved Ribosome-Footprint and mRNA Measurements Provide Insights into Dynamics and Regulation of Yeast Translation

    Science.gov (United States)

    2016-02-11

    unlimited. Improved Ribosome-Footprint and mRNA Measurements Provide Insights into Dynamics and Regulation of Yeast Translation The views, opinions and...into Dynamics and Regulation of Yeast Translation Report Title Ribosome-footprint profiling provides genome-wide snapshots of translation, but...tend to slow translation. With the improved mRNA measurements, the variation attributable to translational control in exponentially growing yeast was

  10. Expedited quantification of mutant ribosomal RNA by binary deoxyribozyme (BiDz) sensors.

    Science.gov (United States)

    Gerasimova, Yulia V; Yakovchuk, Petro; Dedkova, Larisa M; Hecht, Sidney M; Kolpashchikov, Dmitry M

    2015-10-01

    Mutations in ribosomal RNA (rRNA) have traditionally been detected by the primer extension assay, which is a tedious and multistage procedure. Here, we describe a simple and straightforward fluorescence assay based on binary deoxyribozyme (BiDz) sensors. The assay uses two short DNA oligonucleotides that hybridize specifically to adjacent fragments of rRNA, one of which contains a mutation site. This hybridization results in the formation of a deoxyribozyme catalytic core that produces the fluorescent signal and amplifies it due to multiple rounds of catalytic action. This assay enables us to expedite semi-quantification of mutant rRNA content in cell cultures starting from whole cells, which provides information useful for optimization of culture preparation prior to ribosome isolation. The method requires less than a microliter of a standard Escherichia coli cell culture and decreases analysis time from several days (for primer extension assay) to 1.5 h with hands-on time of ∼10 min. It is sensitive to single-nucleotide mutations. The new assay simplifies the preliminary analysis of RNA samples and cells in molecular biology and cloning experiments and is promising in other applications where fast detection/quantification of specific RNA is required. © 2015 Gerasimova et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  11. Molecular and phylogenetic characterizations of an Eimeria krijgsmanni Yakimoff & Gouseff, 1938 (Apicomplexa: Eimeriidae) mouse intestinal protozoan parasite by partial 18S ribosomal RNA gene sequence analysis.

    Science.gov (United States)

    Takeo, Toshinori; Tanaka, Tetsuya; Matsubayashi, Makoto; Maeda, Hiroki; Kusakisako, Kodai; Matsui, Toshihiro; Mochizuki, Masami; Matsuo, Tomohide

    2014-08-01

    Previously, we characterized an undocumented strain of Eimeria krijgsmanni by morphological and biological features. Here, we present a detailed molecular phylogenetic analysis of this organism. Namely, 18S ribosomal RNA gene (rDNA) sequences of E. krijgsmanni were analyzed to incorporate this species into a comprehensive Eimeria phylogeny. As a result, partial 18S rDNA sequence from E. krijgsmanni was successfully determined, and two different types, Type A and Type B, that differed by 1 base pair were identified. E. krijgsmanni was originally isolated from a single oocyst, and thus the result show that the two types might have allelic sequence heterogeneity in the 18S rDNA. Based on phylogenetic analyses, the two types of E. krijgsmanni 18S rDNA formed one of two clades among murine Eimeria spp.; these Eimeria clades reflected morphological similarity among the Eimeria spp. This is the third molecular phylogenetic characterization of a murine Eimeria spp. in addition to E. falciformis and E. papillata. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  12. The NBS1-Treacle complex controls ribosomal RNA transcription in response to DNA damage

    DEFF Research Database (Denmark)

    Larsen, Dorthe H; Hari, Flurina; Clapperton, Julie A

    2014-01-01

    Chromosome breakage elicits transient silencing of ribosomal RNA synthesis, but the mechanisms involved remained elusive. Here we discover an in trans signalling mechanism that triggers pan-nuclear silencing of rRNA transcription in response to DNA damage. This is associated with transient...... recruitment of the Nijmegen breakage syndrome protein 1 (NBS1), a central regulator of DNA damage responses, into the nucleoli. We further identify TCOF1 (also known as Treacle), a nucleolar factor implicated in ribosome biogenesis and mutated in Treacher Collins syndrome, as an interaction partner of NBS1...

  13. Revealing stable processing products from ribosome-associated small RNAs by deep-sequencing data analysis.

    Science.gov (United States)

    Zywicki, Marek; Bakowska-Zywicka, Kamilla; Polacek, Norbert

    2012-05-01

    The exploration of the non-protein-coding RNA (ncRNA) transcriptome is currently focused on profiling of microRNA expression and detection of novel ncRNA transcription units. However, recent studies suggest that RNA processing can be a multi-layer process leading to the generation of ncRNAs of diverse functions from a single primary transcript. Up to date no methodology has been presented to distinguish stable functional RNA species from rapidly degraded side products of nucleases. Thus the correct assessment of widespread RNA processing events is one of the major obstacles in transcriptome research. Here, we present a novel automated computational pipeline, named APART, providing a complete workflow for the reliable detection of RNA processing products from next-generation-sequencing data. The major features include efficient handling of non-unique reads, detection of novel stable ncRNA transcripts and processing products and annotation of known transcripts based on multiple sources of information. To disclose the potential of APART, we have analyzed a cDNA library derived from small ribosome-associated RNAs in Saccharomyces cerevisiae. By employing the APART pipeline, we were able to detect and confirm by independent experimental methods multiple novel stable RNA molecules differentially processed from well known ncRNAs, like rRNAs, tRNAs or snoRNAs, in a stress-dependent manner.

  14. (Brassicaceae) based on nuclear ribosomal ITS DNA sequences

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Genetics; Volume 93; Issue 2. Phylogeny and biogeography of Alyssum (Brassicaceae) based on nuclear ribosomal ITS DNA sequences. Yan Li Yan Kong Zhe Zhang Yanqiang Yin Bin Liu Guanghui Lv Xiyong Wang. Research Article Volume 93 Issue 2 August 2014 pp 313-323 ...

  15. The primary structure of L37--a rat ribosomal protein with a zinc finger-like motif.

    Science.gov (United States)

    Chan, Y L; Paz, V; Olvera, J; Wool, I G

    1993-04-30

    The amino acid sequence of the rat 60S ribosomal subunit protein L37 was deduced from the sequence of nucleotides in a recombinant cDNA. Ribosomal protein L37 has 96 amino acids, the NH2-terminal methionine is removed after translation of the mRNA, and has a molecular weight of 10,939. Ribosomal protein L37 has a single zinc finger-like motif of the C2-C2 type. Hybridization of the cDNA to digests of nuclear DNA suggests that there are 13 or 14 copies of the L37 gene. The mRNA for the protein is about 500 nucleotides in length. Rat L37 is related to Saccharomyces cerevisiae ribosomal protein YL35 and to Caenorhabditis elegans L37. We have identified in the data base a DNA sequence that encodes the chicken homolog of rat L37.

  16. Restriction fragment length polymorphism (RFLP) analysis of PCR products amplified from 18S ribosomal RNA gene of Trypanosoma congolense

    International Nuclear Information System (INIS)

    Osanyo, A.; Majiwa, P.W.

    2006-01-01

    Oligonucleotide primers were designed from the conserved nucleotide sequences of 18S ribosomal RNA (18S rRNA) gene of protozoans: Trypanosoma brucei, Leishmania donovani, Triponema aequale and Lagenidium gigantum. The primers were used in polymerace chain reaction (PCR) to generate PCR products of approximately 1 Kb using genomic DNA from T. brucei and the four genotypic groups of T. congolense as template. The five PCR products so produced were digested with several restriction enzymes and hybridized to a DNA probe made from T. brucei PCR product of the same 18S rRNA gene region. Most restriction enzyme digests revealed polymorphism with respect to the location of their recognition sites on the five PCR products. The restriction fragment length polymorphism (RFLP) pattern observed indicate that the 18S rRNA gene sequences of trypanosomes: T. brucei and the four genotypes of T.congolence group are heterogeneous. The results further demonstrate that the region that was amplified can be used in specific identification of trypanosomes species and subspecies.(author)

  17. Ribosomal RNA: a key to phylogeny

    Science.gov (United States)

    Olsen, G. J.; Woese, C. R.

    1993-01-01

    As molecular phylogeny increasingly shapes our understanding of organismal relationships, no molecule has been applied to more questions than have ribosomal RNAs. We review this role of the rRNAs and some of the insights that have been gained from them. We also offer some of the practical considerations in extracting the phylogenetic information from the sequences. Finally, we stress the importance of comparing results from multiple molecules, both as a method for testing the overall reliability of the organismal phylogeny and as a method for more broadly exploring the history of the genome.

  18. High-throughput sequencing of human plasma RNA by using thermostable group II intron reverse transcriptases

    Science.gov (United States)

    Qin, Yidan; Yao, Jun; Wu, Douglas C.; Nottingham, Ryan M.; Mohr, Sabine; Hunicke-Smith, Scott; Lambowitz, Alan M.

    2016-01-01

    Next-generation RNA-sequencing (RNA-seq) has revolutionized transcriptome profiling, gene expression analysis, and RNA-based diagnostics. Here, we developed a new RNA-seq method that exploits thermostable group II intron reverse transcriptases (TGIRTs) and used it to profile human plasma RNAs. TGIRTs have higher thermostability, processivity, and fidelity than conventional reverse transcriptases, plus a novel template-switching activity that can efficiently attach RNA-seq adapters to target RNA sequences without RNA ligation. The new TGIRT-seq method enabled construction of RNA-seq libraries from RNA in RNA in 1-mL plasma samples from a healthy individual revealed RNA fragments mapping to a diverse population of protein-coding gene and long ncRNAs, which are enriched in intron and antisense sequences, as well as nearly all known classes of small ncRNAs, some of which have never before been seen in plasma. Surprisingly, many of the small ncRNA species were present as full-length transcripts, suggesting that they are protected from plasma RNases in ribonucleoprotein (RNP) complexes and/or exosomes. This TGIRT-seq method is readily adaptable for profiling of whole-cell, exosomal, and miRNAs, and for related procedures, such as HITS-CLIP and ribosome profiling. PMID:26554030

  19. The CRM domain: an RNA binding module derived from an ancient ribosome-associated protein.

    Science.gov (United States)

    Barkan, Alice; Klipcan, Larik; Ostersetzer, Oren; Kawamura, Tetsuya; Asakura, Yukari; Watkins, Kenneth P

    2007-01-01

    The CRS1-YhbY domain (also called the CRM domain) is represented as a stand-alone protein in Archaea and Bacteria, and in a family of single- and multidomain proteins in plants. The function of this domain is unknown, but structural data and the presence of the domain in several proteins known to interact with RNA have led to the proposal that it binds RNA. Here we describe a phylogenetic analysis of the domain, its incorporation into diverse proteins in plants, and biochemical properties of a prokaryotic and eukaryotic representative of the domain family. We show that a bacterial member of the family, Escherichia coli YhbY, is associated with pre-50S ribosomal subunits, suggesting that YhbY functions in ribosome assembly. GFP fused to a single-domain CRM protein from maize localizes to the nucleolus, suggesting that an analogous activity may have been retained in plants. We show further that an isolated maize CRM domain has RNA binding activity in vitro, and that a small motif shared with KH RNA binding domains, a conserved "GxxG" loop, contributes to its RNA binding activity. These and other results suggest that the CRM domain evolved in the context of ribosome function prior to the divergence of Archaea and Bacteria, that this function has been maintained in extant prokaryotes, and that the domain was recruited to serve as an RNA binding module during the evolution of plant genomes.

  20. Reconstruction of phylogenetic relationships in dermatomycete genus Trichophyton Malmsten 1848 based on ribosomal internal transcribed spacer region, partial 28S rRNA and beta-tubulin genes sequences.

    Science.gov (United States)

    Pchelin, Ivan M; Zlatogursky, Vasily V; Rudneva, Mariya V; Chilina, Galina A; Rezaei-Matehkolaei, Ali; Lavnikevich, Dmitry M; Vasilyeva, Natalya V; Taraskina, Anastasia E

    2016-09-01

    Trichophyton spp. are important causative agents of superficial mycoses. The phylogeny of the genus and accurate strain identification, based on the ribosomal ITS region sequencing, are still under development. The present work is aimed at (i) inferring the genus phylogeny from partial ITS, LSU and BT2 sequences (ii) description of ribosomal ITS region polymorphism in 15 strains of Trichophyton interdigitale. We performed DNA sequence-based species identification and phylogenetic analysis on 48 strains belonging to the genus Trichophyton. Phylogenetic relationships were inferred by maximum likelihood and Bayesian methods on concatenated ITS, LSU and BT2 sequences. Ribosomal ITS region polymorphisms were assessed directly on the alignment. By phylogenetic reconstruction, we reveal major anthropophilic and zoophilic species clusters in the genus Trichophyton. We describe several sequences of the ITS region of T. interdigitale, which do not fit in the traditional polymorphism scheme and propose emendations in this scheme for discrimination between ITS sequence types in T. interdigitale. The new polymorphism scheme will allow inclusion of a wider spectrum of isolates while retaining its explanatory power. This scheme was also found to be partially congruent with NTS typing technique. © 2016 Blackwell Verlag GmbH.

  1. Sequence analysis and over-expression of ribosomal protein S28 ...

    African Journals Online (AJOL)

    RPS28 is a component of the 40S small ribosomal subunit encoded by RPS28 gene, which is specific to eukaryotes. The cDNA and the genomic sequence of RPS28 were cloned successfully from the Giant Panda using RT-PCR technology and Touchdown-PCR, respectively. Both sequences were analyzed preliminarily ...

  2. Amino acid sequences of ribosomal proteins S11 from Bacillus stearothermophilus and S19 from Halobacterium marismortui. Comparison of the ribosomal protein S11 family.

    Science.gov (United States)

    Kimura, M; Kimura, J; Hatakeyama, T

    1988-11-21

    The complete amino acid sequences of ribosomal proteins S11 from the Gram-positive eubacterium Bacillus stearothermophilus and of S19 from the archaebacterium Halobacterium marismortui have been determined. A search for homologous sequences of these proteins revealed that they belong to the ribosomal protein S11 family. Homologous proteins have previously been sequenced from Escherichia coli as well as from chloroplast, yeast and mammalian ribosomes. A pairwise comparison of the amino acid sequences showed that Bacillus protein S11 shares 68% identical residues with S11 from Escherichia coli and a slightly lower homology (52%) with the homologous chloroplast protein. The halophilic protein S19 is more related to the eukaryotic (45-49%) than to the eubacterial counterparts (35%).

  3. Cross-site comparison of ribosomal depletion kits for Illumina RNAseq library construction.

    Science.gov (United States)

    Herbert, Zachary T; Kershner, Jamie P; Butty, Vincent L; Thimmapuram, Jyothi; Choudhari, Sulbha; Alekseyev, Yuriy O; Fan, Jun; Podnar, Jessica W; Wilcox, Edward; Gipson, Jenny; Gillaspy, Allison; Jepsen, Kristen; BonDurant, Sandra Splinter; Morris, Krystalynne; Berkeley, Maura; LeClerc, Ashley; Simpson, Stephen D; Sommerville, Gary; Grimmett, Leslie; Adams, Marie; Levine, Stuart S

    2018-03-15

    Ribosomal RNA (rRNA) comprises at least 90% of total RNA extracted from mammalian tissue or cell line samples. Informative transcriptional profiling using massively parallel sequencing technologies requires either enrichment of mature poly-adenylated transcripts or targeted depletion of the rRNA fraction. The latter method is of particular interest because it is compatible with degraded samples such as those extracted from FFPE and also captures transcripts that are not poly-adenylated such as some non-coding RNAs. Here we provide a cross-site study that evaluates the performance of ribosomal RNA removal kits from Illumina, Takara/Clontech, Kapa Biosystems, Lexogen, New England Biolabs and Qiagen on intact and degraded RNA samples. We find that all of the kits are capable of performing significant ribosomal depletion, though there are differences in their ease of use. All kits were able to remove ribosomal RNA to below 20% with intact RNA and identify ~ 14,000 protein coding genes from the Universal Human Reference RNA sample at >1FPKM. Analysis of differentially detected genes between kits suggests that transcript length may be a key factor in library production efficiency. These results provide a roadmap for labs on the strengths of each of these methods and how best to utilize them.

  4. RNA-binding domain of the A protein component of the U1 small nuclear ribonucleoprotein analyzed by NMR spectroscopy is structurally similar to ribosomal proteins

    International Nuclear Information System (INIS)

    Hoffman, D.W.; Query, C.C.; Golden, B.L.; White, S.W.; Keene, J.D.

    1991-01-01

    An RNA recognition motif (RRM) of ∼80 amino acids constitutes the core of RNA-binding domains found in a large family of proteins involved in RNA processing. The U1 RNA-binding domain of the A protein component of the human U1 small nuclear ribonucleoprotein (RNP), which encompasses the RRM sequence, was analyzed by using NMR spectroscopy. The domain of the A protein is a highly stable monomer in solution consisting of four antiparallel β-strands and two α-helices. The highly conserved RNP1 and RNP2 consensus sequences, containing residues previously suggested to be involved in nucleic acid binding, are juxtaposed in adjacent β-strands. Conserved aromatic side chains that are critical for RNA binding are clustered on the surface to the molecule adjacent to a variable loop that influences recognition of specific RNA sequences. The secondary structure and topology of the RRM are similar to those of ribosomal proteins L12 and L30, suggesting a distant evolutionary relationship between these two types of RNA-associated proteins

  5. Structure based hypothesis of a mitochondrial ribosome rescue mechanism

    Directory of Open Access Journals (Sweden)

    Huynen Martijn A

    2012-05-01

    Full Text Available Abstract Background mtRF1 is a vertebrate mitochondrial protein with an unknown function that arose from a duplication of the mitochondrial release factor mtRF1a. To elucidate the function of mtRF1, we determined the positions that are conserved among mtRF1 sequences but that are different in their mtRF1a paralogs. We subsequently modeled the 3D structure of mtRF1a and mtRF1 bound to the ribosome, highlighting the structural implications of these differences to derive a hypothesis for the function of mtRF1. Results Our model predicts, in agreement with the experimental data, that the 3D structure of mtRF1a allows it to recognize the stop codons UAA and UAG in the A-site of the ribosome. In contrast, we show that mtRF1 likely can only bind the ribosome when the A-site is devoid of mRNA. Furthermore, while mtRF1a will adopt its catalytic conformation, in which it functions as a peptidyl-tRNA hydrolase in the ribosome, only upon binding of a stop codon in the A-site, mtRF1 appears specifically adapted to assume this extended, peptidyl-tRNA hydrolyzing conformation in the absence of mRNA in the A-site. Conclusions We predict that mtRF1 specifically recognizes ribosomes with an empty A-site and is able to function as a peptidyl-tRNA hydrolase in those situations. Stalled ribosomes with empty A-sites that still contain a tRNA bound to a peptide chain can result from the translation of truncated, stop-codon less mRNAs. We hypothesize that mtRF1 recycles such stalled ribosomes, performing a function that is analogous to that of tmRNA in bacteria. Reviewers This article was reviewed by Dr. Eugene Koonin, Prof. Knud H. Nierhaus (nominated by Dr. Sarah Teichmann and Dr. Shamil Sunyaev.

  6. 18S Ribosomal RNA Evaluation as Preanalytical Quality Control for Animal DNA

    Directory of Open Access Journals (Sweden)

    Cory Ann Leonard

    2016-01-01

    Full Text Available The 18S ribosomal RNA (rRNA gene is present in all eukaryotic cells. In this study, we evaluated the use of this gene to verify the presence of PCR-amplifiable host (animal DNA as an indicator of sufficient sample quality for quantitative real-time PCR (qPCR analysis. We compared (i samples from various animal species, tissues, and sample types, including swabs; (ii multiple DNA extraction methods; and (iii both fresh and formalin-fixed paraffin-embedded (FFPE samples. Results showed that 18S ribosomal RNA gene amplification was possible from all tissue samples evaluated, including avian, reptile, and FFPE samples and most swab samples. A single swine rectal swab, which showed sufficient DNA quantity and the demonstrated lack of PCR inhibitors, nonetheless was negative by 18S qPCR. Such a sample specifically illustrates the improvement of determination of sample integrity afforded by inclusion of 18S rRNA gene qPCR analysis in addition to spectrophotometric analysis and the use of internal controls for PCR inhibition. Other possible applications for the described 18S rRNA qPCR are preselection of optimal tissue specimens for studies or preliminary screening of archived samples prior to acceptance for biobanking projects.

  7. Effect of mutations in the A site of 16 S rRNA on aminoglycoside antibiotic-ribosome interaction

    DEFF Research Database (Denmark)

    Recht, M I; Douthwaite, S; Dahlquist, K D

    1999-01-01

    antibiotics, which also interact with this region of rRNA. Mutations of certain nucleotides in rRNA reduce aminoglycoside binding affinity, as previously demonstrated using a model RNA oligonucleotide system. Here, predictions from the oligonucleotide system were tested in the ribosome by mutation...... for the aminoglycoside paromomycin, whereas no discernible reduction in affinity was observed with 1406 mutant ribosomes. These data are consistent with prior NMR structural determination of aminoglycoside interaction with the decoding region, and further our understanding of how aminoglycoside resistance can...

  8. Role for cis-acting RNA sequences in the temperature-dependent expression of the multiadhesive lig proteins in Leptospira interrogans.

    Science.gov (United States)

    Matsunaga, James; Schlax, Paula J; Haake, David A

    2013-11-01

    The spirochete Leptospira interrogans causes a systemic infection that provokes a febrile illness. The putative lipoproteins LigA and LigB promote adhesion of Leptospira to host proteins, interfere with coagulation, and capture complement regulators. In this study, we demonstrate that the expression level of the LigA and LigB proteins was substantially higher when L. interrogans proliferated at 37°C instead of the standard culture temperature of 30°C. The RNA comprising the 175-nucleotide 5' untranslated region (UTR) and first six lig codons, whose sequence is identical in ligA and ligB, is predicted to fold into two distinct stem-loop structures separated by a single-stranded region. The ribosome-binding site is partially sequestered in double-stranded RNA within the second structure. Toeprint analysis revealed that in vitro formation of a 30S-tRNA(fMet)-mRNA ternary complex was inhibited unless a 5' deletion mutation disrupted the second stem-loop structure. To determine whether the lig sequence could mediate temperature-regulated gene expression in vivo, the 5' UTR and the first six codons were inserted between the Escherichia coli l-arabinose promoter and bgaB (β-galactosidase from Bacillus stearothermophilus) to create a translational fusion. The lig fragment successfully conferred thermoregulation upon the β-galactosidase reporter in E. coli. The second stem-loop structure was sufficient to confer thermoregulation on the reporter, while sequences further upstream in the 5' UTR slightly diminished expression at each temperature tested. Finally, the expression level of β-galactosidase was significantly higher when point mutations predicted to disrupt base pairs in the second structure were introduced into the stem. Compensatory mutations that maintained base pairing of the stem without restoring the wild-type sequence reinstated the inhibitory effect of the 5' UTR on expression. These results indicate that ligA and ligB expression is limited by double

  9. The functional half-life of an mRNA depends on the ribosome spacing in an early coding region

    DEFF Research Database (Denmark)

    Pedersen, Margit; Nissen, Søren; Mitarai, Namiko

    2011-01-01

    Bacterial mRNAs are translated by closely spaced ribosomes and degraded from the 5'-end, with half-lives of around 2 min at 37 °C in most cases. Ribosome-free or "naked" mRNA is known to be readily degraded, but the initial event that inactivates the mRNA functionally has not been fully described...

  10. An automated procedure for covariation-based detection of RNA structure

    International Nuclear Information System (INIS)

    Winker, S.; Overbeek, R.; Woese, C.R.; Olsen, G.J.; Pfluger, N.

    1989-12-01

    This paper summarizes our investigations into the computational detection of secondary and tertiary structure of ribosomal RNA. We have developed a new automated procedure that not only identifies potential bondings of secondary and tertiary structure, but also provides the covariation evidence that supports the proposed bondings, and any counter-evidence that can be detected in the known sequences. A small number of previously unknown bondings have been detected in individual RNA molecules (16S rRNA and 7S RNA) through the use of our automated procedure. Currently, we are systematically studying mitochondrial rRNA. Our goal is to detect tertiary structure within 16S rRNA and quaternary structure between 16S and 23S rRNA. Our ultimate hope is that automated covariation analysis will contribute significantly to a refined picture of ribosome structure. Our colleagues in biology have begun experiments to test certain hypotheses suggested by an examination of our program's output. These experiments involve sequencing key portions of the 23S ribosomal RNA for species in which the known 16S ribosomal RNA exhibits variation (from the dominant pattern) at the site of a proposed bonding. The hope is that the 23S ribosomal RNA of these species will exhibit corresponding complementary variation or generalized covariation. 24 refs

  11. An automated procedure for covariation-based detection of RNA structure

    Energy Technology Data Exchange (ETDEWEB)

    Winker, S.; Overbeek, R.; Woese, C.R.; Olsen, G.J.; Pfluger, N.

    1989-12-01

    This paper summarizes our investigations into the computational detection of secondary and tertiary structure of ribosomal RNA. We have developed a new automated procedure that not only identifies potential bondings of secondary and tertiary structure, but also provides the covariation evidence that supports the proposed bondings, and any counter-evidence that can be detected in the known sequences. A small number of previously unknown bondings have been detected in individual RNA molecules (16S rRNA and 7S RNA) through the use of our automated procedure. Currently, we are systematically studying mitochondrial rRNA. Our goal is to detect tertiary structure within 16S rRNA and quaternary structure between 16S and 23S rRNA. Our ultimate hope is that automated covariation analysis will contribute significantly to a refined picture of ribosome structure. Our colleagues in biology have begun experiments to test certain hypotheses suggested by an examination of our program's output. These experiments involve sequencing key portions of the 23S ribosomal RNA for species in which the known 16S ribosomal RNA exhibits variation (from the dominant pattern) at the site of a proposed bonding. The hope is that the 23S ribosomal RNA of these species will exhibit corresponding complementary variation or generalized covariation. 24 refs.

  12. Oxidative damage of 18S and 5S ribosomal RNA in digestive gland of mussels exposed to trace metals.

    Science.gov (United States)

    Kournoutou, Georgia G; Giannopoulou, Panagiota C; Sazakli, Eleni; Leotsinidis, Michel; Kalpaxis, Dimitrios L

    2017-11-01

    Numerous studies have shown the ability of trace metals to accumulate in marine organisms and cause oxidative stress that leads to perturbations in many important intracellular processes, including protein synthesis. This study is mainly focused on the exploration of structural changes, like base modifications, scissions, and conformational changes, caused in 18S and 5S ribosomal RNA (rRNA) isolated from the mussel Mytilus galloprovincialis exposed to 40μg/L Cu, 30μg/L Hg, or 100μg/L Cd, for 5 or 15days. 18S rRNA and 5S rRNA are components of the small and large ribosomal subunit, respectively, found in complex with ribosomal proteins, translation factors and other auxiliary components (metal ions, toxins etc). 18S rRNA plays crucial roles in all stages of protein synthesis, while 5S rRNA serves as a master signal transducer between several functional regions of 28S rRNA. Therefore, structural changes in these ribosomal constituents could affect the basic functions of ribosomes and hence the normal metabolism of cells. Especially, 18S rRNA along with ribosomal proteins forms the decoding centre that ensures the correct codon-anticodon pairing. As exemplified by ELISA, primer extension analysis and DMS footprinting analysis, each metal caused oxidative damage to rRNA, depending on the nature of metal ion and the duration of exposure. Interestingly, exposure of mussels to Cu or Hg caused structural alterations in 5S rRNA, localized in paired regions and within loops A, B, C, and E, leading to a continuous progressive loss of the 5S RNA structural integrity. In contrast, structural impairments of 5S rRNA in mussels exposed to Cd were accumulating for the initial 5days, and then progressively decreased to almost the normal level by day 15, probably due to the parallel elevation of metallothionein content that depletes the pools of free Cd. Regions of interest in 18S rRNA, such as the decoding centre, sites implicated in the binding of tRNAs (A- and P-sites) or

  13. Mutant forms of Escherichia coli protein L25 unable to bind to 5S rRNA are incorporated efficiently into the ribosome in vivo.

    Science.gov (United States)

    Anikaev, A Y; Korepanov, A P; Korobeinikova, A V; Kljashtorny, V G; Piendl, W; Nikonov, S V; Garber, M B; Gongadze, G M

    2014-08-01

    5S rRNA-binding ribosomal proteins of the L25 family are an evolutional acquisition of bacteria. Earlier we showed that (i) single replacements in the RNA-binding module of the protein of this family result in destabilization or complete impossibility to form a complex with 5S rRNA in vitro; (ii) ΔL25 ribosomes of Escherichia coli are less efficient in protein synthesis in vivo than the control ribosomes. In the present work, the efficiency of incorporation of the E. coli protein L25 with mutations in the 5S rRNA-binding region into the ribosome in vivo was studied. It was found that the mutations in L25 that abolish its ability to form the complex with free 5S rRNA do not prevent its correct and efficient incorporation into the ribosome. This is supported by the fact that even the presence of a very weakly retained mutant form of the protein in the ribosome has a positive effect on the activity of the translational machinery in vivo. All this suggests the existence of an alternative incorporation pathway for this protein into the ribosome, excluding the preliminary formation of the complex with 5S rRNA. At the same time, the stable L25-5S rRNA contact is important for the retention of the protein within the ribosome, and the conservative amino acid residues of the RNA-binding module play a key role in this.

  14. The pre-existing population of 5S rRNA effects p53 stabilization during ribosome biogenesis inhibition.

    Science.gov (United States)

    Onofrillo, Carmine; Galbiati, Alice; Montanaro, Lorenzo; Derenzini, Massimo

    2017-01-17

    Pre-ribosomal complex RPL5/RPL11/5S rRNA (5S RNP) is considered the central MDM2 inhibitory complex that control p53 stabilization during ribosome biogenesis inhibition. Despite its role is well defined, the dynamic of 5S RNP assembly still requires further characterization. In the present work, we report that MDM2 inhibition is dependent by a pre-existing population of 5S rRNA.

  15. Identification and characterization of rhizospheric microbial diversity by 16S ribosomal RNA gene sequencing

    Directory of Open Access Journals (Sweden)

    Muhammad Naveed

    2014-09-01

    Full Text Available In the present study, samples of rhizosphere and root nodules were collected from different areas of Pakistan to isolate plant growth promoting rhizobacteria. Identification of bacterial isolates was made by 16S rRNA gene sequence analysis and taxonomical confirmation on EzTaxon Server. The identified bacterial strains were belonged to 5 genera i.e. Ensifer, Bacillus, Pseudomona, Leclercia and Rhizobium. Phylogenetic analysis inferred from 16S rRNA gene sequences showed the evolutionary relationship of bacterial strains with the respective genera. Based on phylogenetic analysis, some candidate novel species were also identified. The bacterial strains were also characterized for morphological, physiological, biochemical tests and glucose dehydrogenase (gdh gene that involved in the phosphate solublization using cofactor pyrroloquinolone quinone (PQQ. Seven rhizoshperic and 3 root nodulating stains are positive for gdh gene. Furthermore, this study confirms a novel association between microbes and their hosts like field grown crops, leguminous and non-leguminous plants. It was concluded that a diverse group of bacterial population exist in the rhizosphere and root nodules that might be useful in evaluating the mechanisms behind plant microbial interactions and strains QAU-63 and QAU-68 have sequence similarity of 97 and 95% which might be declared as novel after further taxonomic characterization.

  16. How does a scanning ribosomal particle move along the 5'-untranslated region of eukaryotic mRNA? Brownian Ratchet model.

    Science.gov (United States)

    Spirin, Alexander S

    2009-11-17

    A model of the ATP-dependent unidirectional movement of the 43S ribosomal initiation complex (=40S ribosomal subunit + eIF1 + eIF1A + eIF2.GTP.Met-tRNA(i) + eIF3) during scanning of the 5'-untranslated region of eukaryotic mRNA is proposed. The model is based on the principles of molecular Brownian ratchet machines and explains several enigmatic data concerning the scanning complex. In this model, the one-dimensional diffusion of the ribosomal initiation complex along the mRNA chain is rectified into the net-unidirectional 5'-to-3' movement by the Feynman ratchet-and-pawl mechanism. The proposed mechanism is organized by the heterotrimeric protein eIF4F (=eIF4A + eIF4E + eIF4G), attached to the scanning ribosomal particle via eIF3, and the RNA-binding protein eIF4B that is postulated to play the role of the pawl. The energy for the useful work of the ratchet-and-pawl mechanism is supplied from ATP hydrolysis induced by the eIF4A subunit: ATP binding and its hydrolysis alternately change the affinities of eIF4A for eIF4B and for mRNA, resulting in the restriction of backward diffusional sliding of the 43S ribosomal complex along the mRNA chain, while stochastic movements ahead are allowed.

  17. Heavy ion effects on yeast: Inhibition of ribosomal RNA synthesis

    International Nuclear Information System (INIS)

    Weber, K.J.; Schneider, E.; Kiefer, J.; Kraft, G.

    1990-01-01

    Diploid wild-type yeast cells were exposed to beams of heavy ions covering a wide range of linear energy transfer (LET) (43-13,700 keV/microns). Synthesis of ribosomal RNA (rRNA) was assessed as a functional measure of damage produced by particle radiation. An exponential decrease of relative rRNA synthesis with particle fluence was demonstrated in all cases. The inactivation cross sections derived were found to increase with LET over the entire range of LET studied. The corresponding values for relative biological effectiveness were slightly less than unity. Maximum cross sections measured were close to 1 micron 2, implying that some larger structure within the yeast nucleus (e.g., the nucleolus) might represent the target for an impairment of synthetic activity by very heavy ions rather than the genes coding for rRNA. Where tested, an oxygen effect for rRNA synthesis could not be demonstrated

  18. Processing of the 17-S Escherichia coli precursor RNA in the 27-S pre-ribosomal particle

    Energy Technology Data Exchange (ETDEWEB)

    Hayes, F; Vasseur, M [Institut de Biologie Physico-Chimique, 75 - Paris (France)

    1976-01-01

    An RNase activity probably involved in the maturation of 16-S pre-ribosomal RNA in Escherichia coli has been partially purified from crude cell extracts. When 27-S ribosome precursor particles are incubated with this enzyme preparation in vitro, their 17-S RNA is converted to a product with the same electrophoretic mobility as mature 16-S rRNA. FingerprS rRNA. Generation of the normal 5'-P terminus seems to require a factor present in cell extracts since incubation of the 27-S precursor particle in an extract obtained after centrifugation at 30,000 x g causes conversion of the 17-S RNA to a 16-S species containing both termini of mature 16-S rRNS. Preliminary experiments suggest that correct maturation of the 5' end of the 17-S precursor RNA requires a system in which protein synthesis can take place.

  19. Paralogues of nuclear ribosomal genes conceal phylogenetic signals within the invasive Asian fish tapeworm lineage: evidence from next generation sequencing data

    Czech Academy of Sciences Publication Activity Database

    Brabec, Jan; Kuchta, Roman; Scholz, Tomáš; Littlewood, D. T. J.

    2016-01-01

    Roč. 46, č. 9 (2016), s. 555-562 ISSN 0020-7519 R&D Projects: GA MŠk(CZ) EE2.3.30.0032; GA ČR GA15-14198S Grant - others:GA MŠk(CZ) LM2010005 Institutional support: RVO:60077344 Keywords : Schyzocotyle acheilognathi * Asian fish tapeworm * Bothriocephalus acheilognathi * invasive parasite * mitochondrial genome * ribosomal RNA * illumina sequencing * phylogeny Subject RIV: EG - Zoology Impact factor: 3.730, year: 2016

  20. antaRNA: ant colony-based RNA sequence design.

    Science.gov (United States)

    Kleinkauf, Robert; Mann, Martin; Backofen, Rolf

    2015-10-01

    RNA sequence design is studied at least as long as the classical folding problem. Although for the latter the functional fold of an RNA molecule is to be found ,: inverse folding tries to identify RNA sequences that fold into a function-specific target structure. In combination with RNA-based biotechnology and synthetic biology ,: reliable RNA sequence design becomes a crucial step to generate novel biochemical components. In this article ,: the computational tool antaRNA is presented. It is capable of compiling RNA sequences for a given structure that comply in addition with an adjustable full range objective GC-content distribution ,: specific sequence constraints and additional fuzzy structure constraints. antaRNA applies ant colony optimization meta-heuristics and its superior performance is shown on a biological datasets. http://www.bioinf.uni-freiburg.de/Software/antaRNA CONTACT: backofen@informatik.uni-freiburg.de Supplementary data are available at Bioinformatics online. © The Author 2015. Published by Oxford University Press.

  1. A distinct group of hepacivirus/pestivirus-like internal ribosomal entry sites in members of diverse picornavirus genera: evidence for modular exchange of functional noncoding RNA elements by recombination.

    Science.gov (United States)

    Hellen, Christopher U T; de Breyne, Sylvain

    2007-06-01

    The 5' untranslated regions (UTRs) of the RNA genomes of Flaviviridae of the Hepacivirus and Pestivirus genera contain internal ribosomal entry sites (IRESs) that are unrelated to the two principal classes of IRESs of Picornaviridae. The mechanism of translation initiation on hepacivirus/pestivirus (HP) IRESs, which involves factor-independent binding to ribosomal 40S subunits, also differs fundamentally from initiation on these picornavirus IRESs. Ribosomal binding to HP IRESs requires conserved sequences that form a pseudoknot and the adjacent IIId and IIIe domains; analogous elements do not occur in the two principal groups of picornavirus IRESs. Here, comparative sequence analysis was used to identify a subset of picornaviruses from multiple genera that contain 5' UTR sequences with significant similarities to HP IRESs. They are avian encephalomyelitis virus, duck hepatitis virus 1, duck picornavirus, porcine teschovirus, porcine enterovirus 8, Seneca Valley virus, and simian picornavirus. Their 5' UTRs are predicted to form several structures, in some of which the peripheral elements differ from the corresponding HP IRES elements but in which the core pseudoknot, domain IIId, and domain IIIe elements are all closely related. These findings suggest that HP-like IRESs have been exchanged between unrelated virus families by recombination and support the hypothesis that RNA viruses consist of modular coding and noncoding elements that can exchange and evolve independently.

  2. The N-terminal sequence of ribosomal protein L10 from the archaebacterium Halobacterium marismortui and its relationship to eubacterial protein L6 and other ribosomal proteins.

    Science.gov (United States)

    Dijk, J; van den Broek, R; Nasiulas, G; Beck, A; Reinhardt, R; Wittmann-Liebold, B

    1987-08-01

    The amino-terminal sequence of ribosomal protein L10 from Halobacterium marismortui has been determined up to residue 54, using both a liquid- and a gas-phase sequenator. The two sequences are in good agreement. The protein is clearly homologous to protein HcuL10 from the related strain Halobacterium cutirubrum. Furthermore, a weaker but distinct homology to ribosomal protein L6 from Escherichia coli and Bacillus stearothermophilus can be detected. In addition to 7 identical amino acids in the first 36 residues in all four sequences a number of conservative replacements occurs, of mainly hydrophobic amino acids. In this common region the pattern of conserved amino acids suggests the presence of a beta-alpha fold as it occurs in ribosomal proteins L12 and L30. Furthermore, several potential cases of homology to other ribosomal components of the three ur-kingdoms have been found.

  3. Employment of Near Full-Length Ribosome Gene TA-Cloning and Primer-Blast to Detect Multiple Species in a Natural Complex Microbial Community Using Species-Specific Primers Designed with Their Genome Sequences.

    Science.gov (United States)

    Zhang, Huimin; He, Hongkui; Yu, Xiujuan; Xu, Zhaohui; Zhang, Zhizhou

    2016-11-01

    It remains an unsolved problem to quantify a natural microbial community by rapidly and conveniently measuring multiple species with functional significance. Most widely used high throughput next-generation sequencing methods can only generate information mainly for genus-level taxonomic identification and quantification, and detection of multiple species in a complex microbial community is still heavily dependent on approaches based on near full-length ribosome RNA gene or genome sequence information. In this study, we used near full-length rRNA gene library sequencing plus Primer-Blast to design species-specific primers based on whole microbial genome sequences. The primers were intended to be specific at the species level within relevant microbial communities, i.e., a defined genomics background. The primers were tested with samples collected from the Daqu (also called fermentation starters) and pit mud of a traditional Chinese liquor production plant. Sixteen pairs of primers were found to be suitable for identification of individual species. Among them, seven pairs were chosen to measure the abundance of microbial species through quantitative PCR. The combination of near full-length ribosome RNA gene library sequencing and Primer-Blast may represent a broadly useful protocol to quantify multiple species in complex microbial population samples with species-specific primers.

  4. Fluctuations and synchrony of RNA synthesis in nucleoli.

    Science.gov (United States)

    Pliss, Artem; Kuzmin, Andrey N; Kachynski, Aliaksandr V; Baev, Alexander; Berezney, Ronald; Prasad, Paras N

    2015-06-01

    Ribosomal RNA (rRNA) sequences are synthesized at exceptionally high rates and, together with ribosomal proteins (r-proteins), are utilized as building blocks for the assembly of pre-ribosomal particles. Although it is widely acknowledged that tight regulation and coordination of rRNA and r-protein production are fundamentally important for the maintenance of cellular homeostasis, still little is known about the real-time kinetics of the ribosome component synthesis in individual cells. In this communication we introduce a label-free MicroRaman spectrometric approach for monitoring rRNA synthesis in live cultured cells. Remarkably high and rapid fluctuations of rRNA production rates were revealed by this technique. Strikingly, the changes in the rRNA output were synchronous for ribosomal genes located in separate nucleoli of the same cell. Our findings call for the development of new concepts to elucidate the coordination of ribosomal components production. In this regard, numerical modeling further demonstrated that the production of rRNA and r-proteins can be coordinated, regardless of the fluctuations in rRNA synthesis. Overall, our quantitative data reveal a spectacular interplay of inherently stochastic rates of RNA synthesis and the coordination of gene expression.

  5. Evolution of blue-flowered species of genus Linum based on high-throughput sequencing of ribosomal RNA genes.

    Science.gov (United States)

    Bolsheva, Nadezhda L; Melnikova, Nataliya V; Kirov, Ilya V; Speranskaya, Anna S; Krinitsina, Anastasia A; Dmitriev, Alexey A; Belenikin, Maxim S; Krasnov, George S; Lakunina, Valentina A; Snezhkina, Anastasiya V; Rozhmina, Tatiana A; Samatadze, Tatiana E; Yurkevich, Olga Yu; Zoshchuk, Svyatoslav A; Amosova, Аlexandra V; Kudryavtseva, Anna V; Muravenko, Olga V

    2017-12-28

    The species relationships within the genus Linum have already been studied several times by means of different molecular and phylogenetic approaches. Nevertheless, a number of ambiguities in phylogeny of Linum still remain unresolved. In particular, the species relationships within the sections Stellerolinum and Dasylinum need further clarification. Also, the question of independence of the species of the section Adenolinum still remains unanswered. Moreover, the relationships of L. narbonense and other species of the section Linum require further clarification. Additionally, the origin of tetraploid species of the section Linum (2n = 30) including the cultivated species L. usitatissimum has not been explored. The present study examines the phylogeny of blue-flowered species of Linum by comparisons of 5S rRNA gene sequences as well as ITS1 and ITS2 sequences of 35S rRNA genes. High-throughput sequencing has been used for analysis of multicopy rRNA gene families. In addition to the molecular phylogenetic analysis, the number and chromosomal localization of 5S and 35S rDNA sites has been determined by FISH. Our findings confirm that L. stelleroides forms a basal branch from the clade of blue-flowered flaxes which is independent of the branch formed by species of the sect. Dasylinum. The current molecular phylogenetic approaches, the cytogenetic analysis as well as different genomic DNA fingerprinting methods applied previously did not discriminate certain species within the sect. Adenolinum. The allotetraploid cultivated species L. usitatissimum and its wild ancestor L. angustifolium (2n = 30) could originate either as the result of hybridization of two diploid species (2n = 16) related to the modern L. gandiflorum and L. decumbens, or hybridization of a diploid species (2n = 16) and a diploid ancestor of modern L. narbonense (2n = 14). High-throughput sequencing of multicopy rRNA gene families allowed us to make several adjustments to the

  6. Detailed analysis of RNA-protein interactions within the bacterial ribosomal protein L5/5S rRNA complex.

    OpenAIRE

    Perederina, Anna; Nevskaya, Natalia; Nikonov, Oleg; Nikulin, Alexei; Dumas, Philippe; Yao, Min; Tanaka, Isao; Garber, Maria; Gongadze, George; Nikonov, Stanislav

    2002-01-01

    The crystal structure of ribosomal protein L5 from Thermus thermophilus complexed with a 34-nt fragment comprising helix III and loop C of Escherichia coli 5S rRNA has been determined at 2.5 A resolution. The protein specifically interacts with the bulged nucleotides at the top of loop C of 5S rRNA. The rRNA and protein contact surfaces are strongly stabilized by intramolecular interactions. Charged and polar atoms forming the network of conserved intermolecular hydrogen bonds are located in ...

  7. Molecular characterization of 5S ribosomal RNA genes and transcripts in the protozoan parasite Leishmania major.

    Science.gov (United States)

    Moreno-Campos, Rodrigo; Florencio-Martínez, Luis E; Nepomuceno-Mejía, Tomás; Rojas-Sánchez, Saúl; Vélez-Ramírez, Daniel E; Padilla-Mejía, Norma E; Figueroa-Angulo, Elisa; Manning-Cela, Rebeca; Martínez-Calvillo, Santiago

    2016-12-01

    Eukaryotic 5S rRNA, synthesized by RNA polymerase III (Pol III), is an essential component of the large ribosomal subunit. Most organisms contain hundreds of 5S rRNA genes organized into tandem arrays. However, the genome of the protozoan parasite Leishmania major contains only 11 copies of the 5S rRNA gene, which are interspersed and associated with other Pol III-transcribed genes. Here we report that, in general, the number and order of the 5S rRNA genes is conserved between different species of Leishmania. While in most organisms 5S rRNA genes are normally associated with the nucleolus, combined fluorescent in situ hybridization and indirect immunofluorescence experiments showed that 5S rRNA genes are mainly located at the nuclear periphery in L. major. Similarly, the tandemly repeated 5S rRNA genes in Trypanosoma cruzi are dispersed throughout the nucleus. In contrast, 5S rRNA transcripts in L. major were localized within the nucleolus, and scattered throughout the cytoplasm, where mature ribosomes are located. Unlike other rRNA species, stable antisense RNA complementary to 5S rRNA is not detected in L. major.

  8. mRNA decapping enzyme from ribosomes of Saccharomyces cerevisiae

    International Nuclear Information System (INIS)

    Stevens, A.

    1980-01-01

    By use of [ 3 H]methyl-5'-capped [ 14 C]mRNA from yeast as a substrate, a decapping enzyme activity has been detected in enzyme fractions derived from a high salt wash of ribosomes of Saccharomyces cerevisiae. The product of the decapping reaction is [ 3 H]m 7 GDP. That the enzyme is not a non-specific pyrophosphatase is suggested by the finding that the diphosphate product, m 7 GpppA(G), and UDP-glucose are not hydrolyzed

  9. Accuracy of taxonomy prediction for 16S rRNA and fungal ITS sequences

    Directory of Open Access Journals (Sweden)

    Robert C. Edgar

    2018-04-01

    Full Text Available Prediction of taxonomy for marker gene sequences such as 16S ribosomal RNA (rRNA is a fundamental task in microbiology. Most experimentally observed sequences are diverged from reference sequences of authoritatively named organisms, creating a challenge for prediction methods. I assessed the accuracy of several algorithms using cross-validation by identity, a new benchmark strategy which explicitly models the variation in distances between query sequences and the closest entry in a reference database. When the accuracy of genus predictions was averaged over a representative range of identities with the reference database (100%, 99%, 97%, 95% and 90%, all tested methods had ≤50% accuracy on the currently-popular V4 region of 16S rRNA. Accuracy was found to fall rapidly with identity; for example, better methods were found to have V4 genus prediction accuracy of ∼100% at 100% identity but ∼50% at 97% identity. The relationship between identity and taxonomy was quantified as the probability that a rank is the lowest shared by a pair of sequences with a given pair-wise identity. With the V4 region, 95% identity was found to be a twilight zone where taxonomy is highly ambiguous because the probabilities that the lowest shared rank between pairs of sequences is genus, family, order or class are approximately equal.

  10. In situ DNA-RNA hybridization using in vitro 125I-labeled ribosomal RNA of higher plant

    International Nuclear Information System (INIS)

    Sato, Seiichi; Kikuchi, Tadatoshi; Ishida, M.R.; Tanaka, Ryuso.

    1975-01-01

    In situ hybridization using 125 I-labeled ribosomal RNA was applied to plant cells. Cytoplasmic 25 s rRNA, which was eluted from acrylamide gels after electrophoretic separation, was labeled in vitro with carrier-free 125 I and hybridized with the interphase nuclei in root tips of Vicia faba. In most of the preparations, the nucleoli were more heavily labeled than the other regions within nuclei, and several types of grain distribution were observed on the nucleoli. From these results, it was confirmed that in situ hybridization using 125 I-labeled rRNA can be used very effectively to detect the annealing sites of different molecular species of rRNA within the nuclei of plant cells, for which it is not as easy to obtain high specific radioactive rRNA in vivo as it is in the case of cultured animal cells. (auth.)

  11. A Distinct Group of Hepacivirus/Pestivirus-Like Internal Ribosomal Entry Sites in Members of Diverse Picornavirus Genera: Evidence for Modular Exchange of Functional Noncoding RNA Elements by Recombination▿ †

    Science.gov (United States)

    Hellen, Christopher U. T.; de Breyne, Sylvain

    2007-01-01

    The 5′ untranslated regions (UTRs) of the RNA genomes of Flaviviridae of the Hepacivirus and Pestivirus genera contain internal ribosomal entry sites (IRESs) that are unrelated to the two principal classes of IRESs of Picornaviridae. The mechanism of translation initiation on hepacivirus/pestivirus (HP) IRESs, which involves factor-independent binding to ribosomal 40S subunits, also differs fundamentally from initiation on these picornavirus IRESs. Ribosomal binding to HP IRESs requires conserved sequences that form a pseudoknot and the adjacent IIId and IIIe domains; analogous elements do not occur in the two principal groups of picornavirus IRESs. Here, comparative sequence analysis was used to identify a subset of picornaviruses from multiple genera that contain 5′ UTR sequences with significant similarities to HP IRESs. They are avian encephalomyelitis virus, duck hepatitis virus 1, duck picornavirus, porcine teschovirus, porcine enterovirus 8, Seneca Valley virus, and simian picornavirus. Their 5′ UTRs are predicted to form several structures, in some of which the peripheral elements differ from the corresponding HP IRES elements but in which the core pseudoknot, domain IIId, and domain IIIe elements are all closely related. These findings suggest that HP-like IRESs have been exchanged between unrelated virus families by recombination and support the hypothesis that RNA viruses consist of modular coding and noncoding elements that can exchange and evolve independently. PMID:17392358

  12. Endogenous ribosomal frameshift signals operate as mRNA destabilizing elements through at least two molecular pathways in yeast.

    Science.gov (United States)

    Belew, Ashton T; Advani, Vivek M; Dinman, Jonathan D

    2011-04-01

    Although first discovered in viruses, previous studies have identified operational -1 ribosomal frameshifting (-1 RF) signals in eukaryotic genomic sequences, and suggested a role in mRNA stability. Here, four yeast -1 RF signals are shown to promote significant mRNA destabilization through the nonsense mediated mRNA decay pathway (NMD), and genetic evidence is presented suggesting that they may also operate through the no-go decay pathway (NGD) as well. Yeast EST2 mRNA is highly unstable and contains up to five -1 RF signals. Ablation of the -1 RF signals or of NMD stabilizes this mRNA, and changes in -1 RF efficiency have opposing effects on the steady-state abundance of the EST2 mRNA. These results demonstrate that endogenous -1 RF signals function as mRNA destabilizing elements through at least two molecular pathways in yeast. Consistent with current evolutionary theory, phylogenetic analyses suggest that -1 RF signals are rapidly evolving cis-acting regulatory elements. Identification of high confidence -1 RF signals in ∼10% of genes in all eukaryotic genomes surveyed suggests that -1 RF is a broadly used post-transcriptional regulator of gene expression.

  13. Differentiation of Actinobacillus pleuropneumoniae strains by sequence analysis of 16S rDNA and ribosomal intergenic regions, and development of a species specific oligonucleotide for in situ detection

    DEFF Research Database (Denmark)

    Fussing, Vivian; Paster, Bruce J.; Dewhirst, Floyd E.

    1998-01-01

    . The larger RIS's were different between the 3 species tested. The sequence of the 16S ribosomal gene was determined for 8 serotypes of A. pleuropneumoniae. These sequences showed only minor base differences, indicating a close genetic relatedness of these serotypes within the species. An oligonucleotide DNA...... probe designed from the 16S rRNA gene sequence of A. pleuropneumoniae was specific for all strains of the target species and did not cross react with A. lignieresii, the closest known relative of A. pleuropneumoniae. This species-specific DNA probe labeled with fluorescein was used for in situ......The aims of this study were to characterize and determine intraspecies and interspecies relatedness of Actinobacillus pleuropneumoniae to Actinobacillus lignieresii and Actinobacillus suis by sequence analysis of the ribosomal operon and to find a species-specific area for in situ detection of A...

  14. Introducing W.A.T.E.R.S.: a workflow for the alignment, taxonomy, and ecology of ribosomal sequences.

    Science.gov (United States)

    Hartman, Amber L; Riddle, Sean; McPhillips, Timothy; Ludäscher, Bertram; Eisen, Jonathan A

    2010-06-12

    For more than two decades microbiologists have used a highly conserved microbial gene as a phylogenetic marker for bacteria and archaea. The small-subunit ribosomal RNA gene, also known as 16 S rRNA, is encoded by ribosomal DNA, 16 S rDNA, and has provided a powerful comparative tool to microbial ecologists. Over time, the microbial ecology field has matured from small-scale studies in a select number of environments to massive collections of sequence data that are paired with dozens of corresponding collection variables. As the complexity of data and tool sets have grown, the need for flexible automation and maintenance of the core processes of 16 S rDNA sequence analysis has increased correspondingly. We present WATERS, an integrated approach for 16 S rDNA analysis that bundles a suite of publicly available 16 S rDNA analysis software tools into a single software package. The "toolkit" includes sequence alignment, chimera removal, OTU determination, taxonomy assignment, phylogentic tree construction as well as a host of ecological analysis and visualization tools. WATERS employs a flexible, collection-oriented 'workflow' approach using the open-source Kepler system as a platform. By packaging available software tools into a single automated workflow, WATERS simplifies 16 S rDNA analyses, especially for those without specialized bioinformatics, programming expertise. In addition, WATERS, like some of the newer comprehensive rRNA analysis tools, allows researchers to minimize the time dedicated to carrying out tedious informatics steps and to focus their attention instead on the biological interpretation of the results. One advantage of WATERS over other comprehensive tools is that the use of the Kepler workflow system facilitates result interpretation and reproducibility via a data provenance sub-system. Furthermore, new "actors" can be added to the workflow as desired and we see WATERS as an initial seed for a sizeable and growing repository of interoperable

  15. cDNA, genomic sequence cloning and overexpression of ribosomal ...

    African Journals Online (AJOL)

    RPS16 of eukaryote is a component of the 40S small ribosomal subunit encoded by RPS16 gene and is also a homolog of prokaryotic RPS9. The cDNA and genomic sequence of RPS16 was cloned successfully for the first time from the Giant Panda (Ailuropoda melanoleuca) using reverse transcription-polymerase chain ...

  16. The rRNA evolution and procaryotic phylogeny

    Science.gov (United States)

    Fox, G. E.

    1986-01-01

    Studies of ribosomal RNA primary structure allow reconstruction of phylogenetic trees for prokaryotic organisms. Such studies reveal major dichotomy among the bacteria that separates them into eubacteria and archaebacteria. Both groupings are further segmented into several major divisions. The results obtained from 5S rRNA sequences are essentially the same as those obtained with the 16S rRNA data. In the case of Gram negative bacteria the ribosomal RNA sequencing results can also be directly compared with hybridization studies and cytochrome c sequencing studies. There is again excellent agreement among the several methods. It seems likely then that the overall picture of microbial phylogeny that is emerging from the RNA sequence studies is a good approximation of the true history of these organisms. The RNA data allow examination of the evolutionary process in a semi-quantitative way. The secondary structures of these RNAs are largely established. As a result it is possible to recognize examples of local structural evolution. Evolutionary pathways accounting for these events can be proposed and their probability can be assessed.

  17. GTPases and the origin of the ribosome

    Directory of Open Access Journals (Sweden)

    Smith Temple F

    2010-05-01

    Full Text Available Abstract Background This paper is an attempt to trace the evolution of the ribosome through the evolution of the universal P-loop GTPases that are involved with the ribosome in translation and with the attachment of the ribosome to the membrane. The GTPases involved in translation in Bacteria/Archaea are the elongation factors EFTu/EF1, the initiation factors IF2/aeIF5b + aeIF2, and the elongation factors EFG/EF2. All of these GTPases also contain the OB fold also found in the non GTPase IF1 involved in initiation. The GTPase involved in the signal recognition particle in most Bacteria and Archaea is SRP54. Results 1 The Elongation Factors of the Archaea based on structural considerations of the domains have the following evolutionary path: EF1→ aeIF2 → EF2. The evolution of the aeIF5b was a later event; 2 the Elongation Factors of the Bacteria based on the topological considerations of the GTPase domain have a similar evolutionary path: EFTu→ IF→2→EFG. These evolutionary sequences reflect the evolution of the LSU followed by the SSU to form the ribosome; 3 the OB-fold IF1 is a mimic of an ancient tRNA minihelix. Conclusion The evolution of translational GTPases of both the Archaea and Bacteria point to the evolution of the ribosome. The elongation factors, EFTu/EF1, began as a Ras-like GTPase bringing the activated minihelix tRNA to the Large Subunit Unit. The initiation factors and elongation factor would then have evolved from the EFTu/EF1 as the small subunit was added to the evolving ribosome. The SRP has an SRP54 GTPase and a specific RNA fold in its RNA component similar to the PTC. We consider the SRP to be a remnant of an ancient form of an LSU bound to a membrane. Reviewers This article was reviewed by George Fox, Leonid Mirny and Chris Sander.

  18. The Ribosomal Protein uL22 Modulates the Shape of the Protein Exit Tunnel

    DEFF Research Database (Denmark)

    Wekselman, Itai; Zimmerman, Ella; Davidovich, Chen

    2017-01-01

    Erythromycin is a clinically useful antibiotic that binds to an rRNA pocket in the ribosomal exit tunnel. Commonly, resistance to erythromycin is acquired by alterations of rRNA nucleotides that interact with the drug. Mutations in the β hairpin of ribosomal protein uL22, which is rather distal...... of the β hairpin of the mutated uL22 toward the interior of the exit tunnel, triggering a cascade of structural alterations of rRNA nucleotides that propagate to the erythromycin binding pocket. Our findings support recent studies showing that the interactions between uL22 and specific sequences within...

  19. Ribosomal synthesis of polylysine from individual lysyl-tRNA/sup Lys/ in the absence of a template

    International Nuclear Information System (INIS)

    Yusupova, G.Z.; Remme, Y.L.; Belitsina, N.B.; Spirin, A.S.

    1987-01-01

    Earlier studies showed that ribosomes of Escherichia coli, in the absence of a template, can synthesize oligolysine, using lysyl-tRNA as a substrate. The authors present results on the use of preparations of individual lysyl-tRNA/sup Lys/ and phenylalanyl-tRNA/sup Phe/ in a system of templateless peptide synthesis. For these studies, the authors used ribosomes of E. coli MRE 600, washed four times with 1 M NH 4 Cl with 10 MM MgCl 2 . The purified ribosomes were stored at -70 0 C in standard buffer, containing 20 mM Tris-HCl, 100 mM NH 4 Cl, 10 mM MgCl 2 , 0.1 mM ethylenediamine tetraacetate (EDTA), and 10% glycerin, pH/sub 37 0 C/7.6. A preparation of [ 14 C]lysyl-tRNA/sup Lys/ was produced by affinity chromatography on immobilized factor EF-T/sub u/ from Thermus thermophilus HB8. The elongation factor EF-T/sub u/ from T. thermophilus and immobilized on BrCN-activated Sepharose 4B. The initial preparation of total tRNA of E. coli, enzymatically acylated by [ 14 C]lysine (348 Ci/mole, Amersham), was produced as described earlier. The degree of aminoacylation was 52-59 pmoles [ 14 C]lysine per unit of A 260 of tRNA

  20. Mutations in ribosomal protein L3 and 23S ribosomal RNA at the peptidyl transferase centre are associated with reduced susceptibility to tiamulin in Brachyspira spp. isolates.

    Science.gov (United States)

    Pringle, Märit; Poehlsgaard, Jacob; Vester, Birte; Long, Katherine S

    2004-12-01

    The pleuromutilin antibiotic tiamulin binds to the ribosomal peptidyl transferase centre. Three groups of Brachyspira spp. isolates with reduced tiamulin susceptibility were analysed to define resistance mechanisms to the drug. Mutations were identified in genes encoding ribosomal protein L3 and 23S rRNA at positions proximal to the peptidyl transferase centre. In two groups of laboratory-selected mutants, mutations were found at nucleotide positions 2032, 2055, 2447, 2499, 2504 and 2572 of 23S rRNA (Escherichia coli numbering) and at amino acid positions 148 and 149 of ribosomal protein L3 (Brachyspira pilosicoli numbering). In a third group of clinical B. hyodysenteriae isolates, only a single mutation at amino acid 148 of ribosomal protein L3 was detected. Chemical footprinting experiments show a reduced binding of tiamulin to ribosomal subunits from mutants with decreased susceptibility to the drug. This reduction in drug binding is likely the resistance mechanism for these strains. Hence, the identified mutations located near the tiamulin binding site are predicted to be responsible for the resistance phenotype. The positions of the mutated residues relative to the bound drug advocate a model where the mutations affect tiamulin binding indirectly through perturbation of nucleotide U2504.

  1. Simultaneous Binding of Multiple EF-Tu Copies to Translating Ribosomes in Live Escherichia coli.

    Science.gov (United States)

    Mustafi, Mainak; Weisshaar, James C

    2018-01-16

    In bacteria, elongation factor Tu is a translational cofactor that forms ternary complexes with aminoacyl-tRNA (aa-tRNA) and GTP. Binding of a ternary complex to one of four flexible L7/L12 units on the ribosome tethers a charged tRNA in close proximity to the ribosomal A site. Two sequential tests for a match between the aa-tRNA anticodon and the current mRNA codon then follow. Because one elongation cycle can occur in as little as 50 ms and the vast majority of aa-tRNA copies are not cognate with the current mRNA codon, this testing must occur rapidly. We present a single-molecule localization and tracking study of fluorescently labeled EF-Tu in live Escherichia coli Imaging at 2 ms/frame distinguishes 60% slowly diffusing EF-Tu copies (assigned as transiently bound to translating ribosome) from 40% rapidly diffusing copies (assigned as a mixture of free ternary complexes and free EF-Tu). Combining these percentages with copy number estimates, we infer that the four L7/L12 sites are essentially saturated with ternary complexes in vivo. The results corroborate an earlier inference that all four sites can simultaneously tether ternary complexes near the A site, creating a high local concentration that may greatly enhance the rate of testing of aa-tRNAs. Our data and a combinatorial argument both suggest that the initial recognition test for a codon-anticodon match occurs in less than 1 to 2 ms per aa-tRNA copy. The results refute a recent study (A. Plochowietz, I. Farrell, Z. Smilansky, B. S. Cooperman, and A. N. Kapanidis, Nucleic Acids Res 45:926-937, 2016, https://doi.org/10.1093/nar/gkw787) of tRNA diffusion in E. coli that inferred that aa-tRNAs arrive at the ribosomal A site as bare monomers, not as ternary complexes. IMPORTANCE Ribosomes catalyze translation of the mRNA codon sequence into the corresponding sequence of amino acids within the nascent polypeptide chain. Polypeptide elongation can be as fast as 50 ms per added amino acid. Each amino acid

  2. The ribosome can prevent aggregation of partially folded protein intermediates: studies using the Escherichia coli ribosome.

    Directory of Open Access Journals (Sweden)

    Bani Kumar Pathak

    Full Text Available BACKGROUND: Molecular chaperones that support de novo folding of proteins under non stress condition are classified as chaperone 'foldases' that are distinct from chaperone' holdases' that provide high affinity binding platform for unfolded proteins and prevent their aggregation specifically under stress conditions. Ribosome, the cellular protein synthesis machine can act as a foldase chaperone that can bind unfolded proteins and release them in folding competent state. The peptidyl transferase center (PTC located in the domain V of the 23S rRNA of Escherichia coli ribosome (bDV RNA is the chaperoning center of the ribosome. It has been proposed that via specific interactions between the RNA and refolding proteins, the chaperone provides information for the correct folding of unfolded polypeptide chains. RESULTS: We demonstrate using Escherichia coli ribosome and variants of its domain V RNA that the ribosome can bind to partially folded intermediates of bovine carbonic anhydrase II (BCAII and lysozyme and suppress aggregation during their refolding. Using mutants of domain V RNA we demonstrate that the time for which the chaperone retains the bound protein is an important factor in determining its ability to suppress aggregation and/or support reactivation of protein. CONCLUSION: The ribosome can behave like a 'holdase' chaperone and has the ability to bind and hold back partially folded intermediate states of proteins from participating in the aggregation process. Since the ribosome is an essential organelle that is present in large numbers in all living cells, this ability of the ribosome provides an energetically inexpensive way to suppress cellular aggregation. Further, this ability of the ribosome might also be crucial in the context that the ribosome is one of the first chaperones to be encountered by a large nascent polypeptide chains that have a tendency to form partially folded intermediates immediately following their synthesis.

  3. Transcriptional activation of ribosomal RNA genes during compensatory renal hypertrophy

    International Nuclear Information System (INIS)

    Ouellette, A.J.; Moonka, R.; Zelenetz, A.; Malt, R.A.

    1986-01-01

    The overall rate of rDNA transcription increases by 50% during the first 24 hours of compensatory renal hypertrophy in the mouse. To study mechanisms of ribosome accumulation after uninephrectomy, transcription rates were measured in isolated kidneys by transcriptional runoff. 32 P-labeled nascent transcripts were hybridized to blots containing linearized, denatured cloned rDNA, and hybridization was quantitated autoradiographically and by direct counting. Overall transcriptional activity of rDNA was increased by 30% above control levels at 6 hrs after nephrectomy and by 50% at 12, 18, and 24 hrs after operation. Hybridizing RNA was insensitive to inhibiby alpha-amanitin, and no hybridization was detected to vector DNA. Thus, accelerated rDNA transcription is one regulatory element in the accretion of ribosomes in renal growth, and the regulatory event is an early event. Mechanisms of activation may include enhanced transcription of active genes or induction of inactive DNA

  4. Ribosomal protein L5 has a highly twisted concave surface and flexible arms responsible for rRNA binding.

    OpenAIRE

    Nakashima, T; Yao, M; Kawamura, S; Iwasaki, K; Kimura, M; Tanaka, I

    2001-01-01

    Ribosomal protein L5 is a 5S rRNA binding protein in the large subunit and plays an essential role in the promotion of a particular conformation of 5S rRNA. The crystal structure of the ribosomal protein L5 from Bacillus stearothermophilus has been determined at 1.8 A resolution. The molecule consists of a five-stranded antiparallel beta-sheet and four alpha-helices, which fold in a way that is topologically similar to the ribonucleoprotein (RNP) domain. The molecular shape and electrostatic ...

  5. Control of ribosome formation in rat heart

    International Nuclear Information System (INIS)

    Russo, L.A.

    1987-01-01

    Diabetes of 9 days duration produced a 17% diminution in the rate of total protein synthesis in rat hearts perfused as Langendorff preparations supplied with glucose, plasma levels of amino acids, and 400 μU/ml insulin. This reduction was attributable to a decrease in efficiency of protein synthesis and total RNA content. Total messenger RNA content decreased in diabetic hearts in proportion to the reduction in total RNA. Diabetes also resulted in diminished ribosome content as reflected by the induction in total RNA. Ribosome production was investigated by monitoring incorporation of [ 3 H]phenylalanine into the proteins of cytoplasmic ribosomes. Rates of ribosome formation in diabetic hearts were as fast as control rates in the presence of insulin, and were faster than control rates in the absence of the hormone. These results indicated that ribosome content fell in diabetic hearts despite unchanged or faster rates of ribosome formation

  6. Direct, rapid RNA sequence analysis

    International Nuclear Information System (INIS)

    Peattie, D.A.

    1987-01-01

    The original methods of RNA sequence analysis were based on enzymatic production and chromatographic separation of overlapping oligonucleotide fragments from within an RNA molecule followed by identification of the mononucleotides comprising the oligomer. Over the past decade the field of nucleic acid sequencing has changed dramatically, however, and RNA molecules now can be sequenced in a variety of more streamlined fashions. Most of the more recent advances in RNA sequencing have involved one-dimensional electrophoretic separation of 32 P-end-labeled oligoribonucleotides on polyacrylamide gels. In this chapter the author discusses two of these methods for determining the nucleotide sequences of RNA molecules rapidly: the chemical method and the enzymatic method. Both methods are direct and degradative, i.e., they rely on fragmatic and chemical approaches should be utilized. The single-strand-specific ribonucleases (A, T 1 , T 2 , and S 1 ) provide an efficient means to locate double-helical regions rapidly, and the chemical reactions provide a means to determine the RNA sequence within these regions. In addition, the chemical reactions allow one to assign interactions to specific atoms and to distinguish secondary interactions from tertiary ones. If the RNA molecule is small enough to be sequenced directly by the enzymatic or chemical method, the probing reactions can be done easily at the same time as sequencing reactions

  7. Molecular characterizations of somatic hybrids developed between Pleurotus florida and Lentinus squarrosulus through inter-simple sequence repeat markers and sequencing of ribosomal RNA-ITS gene.

    Science.gov (United States)

    Mallick, Pijush; Chattaraj, Shruti; Sikdar, Samir Ranjan

    2017-10-01

    The 12 pfls somatic hybrids and 2 parents of Pleurotus florida and Lentinus s quarrosulus were characterized by ISSR and sequencing of rRNA-ITS genes. Five ISSR primers were used and amplified a total of 54 reproducible fragments with 98.14% polymorphism among all the pfls hybrid populations and parental strains. UPGMA-based cluster exhibited a dendrogram with three major groups between the parents and pfls hybrids. Parent P . florida and L . squarrosulus showed different degrees of genetic distance with all the hybrid lines and they showed closeness to hybrid pfls 1m and pfls 1h , respectively. ITS1(F) and ITS4(R) amplified the rRNA-ITS gene with 611-867 bp sequence length. The nucleotide polymorphisms were found in the ITS1, ITS2 and 5.8S rRNA region with different number of bases. Based on rRNA-ITS sequence, UPGMA cluster exhibited three distinct groups between L. squarrosulus and pfls 1p , pfls 1m and pfls 1s , and pfls 1e and P. florida .

  8. Activation of ribosomal RNA genes in porcine embryos produced in vitro or by somatic cell nuclear transfer

    DEFF Research Database (Denmark)

    Bjerregaard, Bolette; Pedersen, Hanne Gervi; Jakobsen, Anne Sørig

    2007-01-01

    The onset of ribosomal RNA (rRNA) synthesis occurs during the second half of the third cell cycle, that is, at the four-cell stage, in porcine embryos developed in vivo. In the present study the onset of rRNA synthesis was investigated in porcine embryos produced in vitro (IVP) or by somatic cell...

  9. Ribosomal PCR and DNA sequencing for detection and identification of bacteria

    DEFF Research Database (Denmark)

    Jensen, Kristine Helander; Dargis, Rimtas; Christensen, Jens Jørgen

    2014-01-01

    -haemolytic streptococci, especially within the mitis group. The data show that ribosomal PCR with subsequent DNA sequencing of the PCR product is a most valuable supplement to culture for identifying bacterial agents of both acute and prolonged infections. However, some bacteria, including non-haemolytic streptococci...

  10. Eigenvectors determination of the ribosome dynamics model during mRNA translation using the Kleene Star algorithm

    Science.gov (United States)

    Ernawati; Carnia, E.; Supriatna, A. K.

    2018-03-01

    Eigenvalues and eigenvectors in max-plus algebra have the same important role as eigenvalues and eigenvectors in conventional algebra. In max-plus algebra, eigenvalues and eigenvectors are useful for knowing dynamics of the system such as in train system scheduling, scheduling production systems and scheduling learning activities in moving classes. In the translation of proteins in which the ribosome move uni-directionally along the mRNA strand to recruit the amino acids that make up the protein, eigenvalues and eigenvectors are used to calculate protein production rates and density of ribosomes on the mRNA. Based on this, it is important to examine the eigenvalues and eigenvectors in the process of protein translation. In this paper an eigenvector formula is given for a ribosome dynamics during mRNA translation by using the Kleene star algorithm in which the resulting eigenvector formula is simpler and easier to apply to the system than that introduced elsewhere. This paper also discusses the properties of the matrix {B}λ \\otimes n of model. Among the important properties, it always has the same elements in the first column for n = 1, 2,… if the eigenvalue is the time of initiation, λ = τin , and the column is the eigenvector of the model corresponding to λ.

  11. Ribosomal DNA sequence heterogeneity reflects intraspecies phylogenies and predicts genome structure in two contrasting yeast species.

    Science.gov (United States)

    West, Claire; James, Stephen A; Davey, Robert P; Dicks, Jo; Roberts, Ian N

    2014-07-01

    The ribosomal RNA encapsulates a wealth of evolutionary information, including genetic variation that can be used to discriminate between organisms at a wide range of taxonomic levels. For example, the prokaryotic 16S rDNA sequence is very widely used both in phylogenetic studies and as a marker in metagenomic surveys and the internal transcribed spacer region, frequently used in plant phylogenetics, is now recognized as a fungal DNA barcode. However, this widespread use does not escape criticism, principally due to issues such as difficulties in classification of paralogous versus orthologous rDNA units and intragenomic variation, both of which may be significant barriers to accurate phylogenetic inference. We recently analyzed data sets from the Saccharomyces Genome Resequencing Project, characterizing rDNA sequence variation within multiple strains of the baker's yeast Saccharomyces cerevisiae and its nearest wild relative Saccharomyces paradoxus in unprecedented detail. Notably, both species possess single locus rDNA systems. Here, we use these new variation datasets to assess whether a more detailed characterization of the rDNA locus can alleviate the second of these phylogenetic issues, sequence heterogeneity, while controlling for the first. We demonstrate that a strong phylogenetic signal exists within both datasets and illustrate how they can be used, with existing methodology, to estimate intraspecies phylogenies of yeast strains consistent with those derived from whole-genome approaches. We also describe the use of partial Single Nucleotide Polymorphisms, a type of sequence variation found only in repetitive genomic regions, in identifying key evolutionary features such as genome hybridization events and show their consistency with whole-genome Structure analyses. We conclude that our approach can transform rDNA sequence heterogeneity from a problem to a useful source of evolutionary information, enabling the estimation of highly accurate phylogenies of

  12. Post-transcriptional regulation of ribosome biogenesis in yeast

    Directory of Open Access Journals (Sweden)

    Isabelle C. Kos-Braun

    2017-05-01

    Full Text Available Most microorganisms are exposed to the constantly and often rapidly changing environment. As such they evolved mechanisms to balance their metabolism and energy expenditure with the resources available to them. When resources become scarce or conditions turn out to be unfavourable for growth, cells reduce their metabolism and energy usage to survive. One of the major energy consuming processes in the cell is ribosome biogenesis. Unsurprisingly, cells encountering adverse conditions immediately shut down production of new ribosomes. It is well established that nutrient depletion leads to a rapid repression of transcription of the genes encoding ribosomal proteins, ribosome biogenesis factors as well as ribosomal RNA (rRNA. However, if pre-rRNA processing and ribosome assembly are regulated post-transcriptionally remains largely unclear. We have recently uncovered that the yeast Saccharomyces cerevisiae rapidly switches between two alternative pre-rRNA processing pathways depending on the environmental conditions. Our findings reveal a new level of complexity in the regulation of ribosome biogenesis.

  13. Linking maternal and somatic 5S rRNA types with different sequence-specific non-LTR retrotransposons.

    Science.gov (United States)

    Locati, Mauro D; Pagano, Johanna F B; Ensink, Wim A; van Olst, Marina; van Leeuwen, Selina; Nehrdich, Ulrike; Zhu, Kongju; Spaink, Herman P; Girard, Geneviève; Rauwerda, Han; Jonker, Martijs J; Dekker, Rob J; Breit, Timo M

    2017-04-01

    5S rRNA is a ribosomal core component, transcribed from many gene copies organized in genomic repeats. Some eukaryotic species have two 5S rRNA types defined by their predominant expression in oogenesis or adult tissue. Our next-generation sequencing study on zebrafish egg, embryo, and adult tissue identified maternal-type 5S rRNA that is exclusively accumulated during oogenesis, replaced throughout the embryogenesis by a somatic-type, and thus virtually absent in adult somatic tissue. The maternal-type 5S rDNA contains several thousands of gene copies on chromosome 4 in tandem repeats with small intergenic regions, whereas the somatic-type is present in only 12 gene copies on chromosome 18 with large intergenic regions. The nine-nucleotide variation between the two 5S rRNA types likely affects TFIII binding and riboprotein L5 binding, probably leading to storage of maternal-type rRNA. Remarkably, these sequence differences are located exactly at the sequence-specific target site for genome integration by the 5S rRNA-specific Mutsu retrotransposon family. Thus, we could define maternal- and somatic-type MutsuDr subfamilies. Furthermore, we identified four additional maternal-type and two new somatic-type MutsuDr subfamilies, each with their own target sequence. This target-site specificity, frequently intact maternal-type retrotransposon elements, plus specific presence of Mutsu retrotransposon RNA and piRNA in egg and adult tissue, suggest an involvement of retrotransposons in achieving the differential copy number of the two types of 5S rDNA loci. © 2017 Locati et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  14. The Circadian Clock Modulates Global Daily Cycles of mRNA Ribosome Loading[OPEN

    Science.gov (United States)

    Missra, Anamika; Ernest, Ben; Jia, Qidong; Ke, Kenneth

    2015-01-01

    Circadian control of gene expression is well characterized at the transcriptional level, but little is known about diel or circadian control of translation. Genome-wide translation state profiling of mRNAs in Arabidopsis thaliana seedlings grown in long day was performed to estimate ribosome loading per mRNA. The experiments revealed extensive translational regulation of key biological processes. Notably, translation of mRNAs for ribosomal proteins and mitochondrial respiration peaked at night. Central clock mRNAs are among those subject to fluctuations in ribosome loading. There was no consistent phase relationship between peak translation states and peak transcript levels. The overlay of distinct transcriptional and translational cycles can be expected to alter the waveform of the protein synthesis rate. Plants that constitutively overexpress the clock gene CCA1 showed phase shifts in peak translation, with a 6-h delay from midnight to dawn or from noon to evening being particularly common. Moreover, cycles of ribosome loading that were detected under continuous light in the wild type collapsed in the CCA1 overexpressor. Finally, at the transcript level, the CCA1-ox strain adopted a global pattern of transcript abundance that was broadly correlated with the light-dark environment. Altogether, these data demonstrate that gene-specific diel cycles of ribosome loading are controlled in part by the circadian clock. PMID:26392078

  15. Ribosomal history reveals origins of modern protein synthesis.

    Directory of Open Access Journals (Sweden)

    Ajith Harish

    Full Text Available The origin and evolution of the ribosome is central to our understanding of the cellular world. Most hypotheses posit that the ribosome originated in the peptidyl transferase center of the large ribosomal subunit. However, these proposals do not link protein synthesis to RNA recognition and do not use a phylogenetic comparative framework to study ribosomal evolution. Here we infer evolution of the structural components of the ribosome. Phylogenetic methods widely used in morphometrics are applied directly to RNA structures of thousands of molecules and to a census of protein structures in hundreds of genomes. We find that components of the small subunit involved in ribosomal processivity evolved earlier than the catalytic peptidyl transferase center responsible for protein synthesis. Remarkably, subunit RNA and proteins coevolved, starting with interactions between the oldest proteins (S12 and S17 and the oldest substructure (the ribosomal ratchet in the small subunit and ending with the rise of a modern multi-subunit ribosome. Ancestral ribonucleoprotein components show similarities to in vitro evolved RNA replicase ribozymes and protein structures in extant replication machinery. Our study therefore provides important clues about the chicken-or-egg dilemma associated with the central dogma of molecular biology by showing that ribosomal history is driven by the gradual structural accretion of protein and RNA structures. Most importantly, results suggest that functionally important and conserved regions of the ribosome were recruited and could be relics of an ancient ribonucleoprotein world.

  16. Structure of the quaternary complex between SRP, SR, and translocon bound to the translating ribosome.

    Science.gov (United States)

    Jomaa, Ahmad; Fu, Yu-Hsien Hwang; Boehringer, Daniel; Leibundgut, Marc; Shan, Shu-Ou; Ban, Nenad

    2017-05-19

    During co-translational protein targeting, the signal recognition particle (SRP) binds to the translating ribosome displaying the signal sequence to deliver it to the SRP receptor (SR) on the membrane, where the signal peptide is transferred to the translocon. Using electron cryo-microscopy, we have determined the structure of a quaternary complex of the translating Escherichia coli ribosome, the SRP-SR in the 'activated' state and the translocon. Our structure, supported by biochemical experiments, reveals that the SRP RNA adopts a kinked and untwisted conformation to allow repositioning of the 'activated' SRP-SR complex on the ribosome. In addition, we observe the translocon positioned through interactions with the SR in the vicinity of the ribosome exit tunnel where the signal sequence is extending beyond its hydrophobic binding groove of the SRP M domain towards the translocon. Our study provides new insights into the mechanism of signal sequence transfer from the SRP to the translocon.

  17. Isolation and characterization of an RIP (ribosome-inactivating protein)-like protein from tobacco with dual enzymatic activity.

    Science.gov (United States)

    Sharma, Neelam; Park, Sang-Wook; Vepachedu, Ramarao; Barbieri, Luigi; Ciani, Marialibera; Stirpe, Fiorenzo; Savary, Brett J; Vivanco, Jorge M

    2004-01-01

    Ribosome-inactivating proteins (RIPs) are N-glycosidases that remove a specific adenine from the sarcin/ricin loop of the large rRNA, thus arresting protein synthesis at the translocation step. In the present study, a protein termed tobacco RIP (TRIP) was isolated from tobacco (Nicotiana tabacum) leaves and purified using ion exchange and gel filtration chromatography in combination with yeast ribosome depurination assays. TRIP has a molecular mass of 26 kD as evidenced by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and showed strong N-glycosidase activity as manifested by the depurination of yeast rRNA. Purified TRIP showed immunoreactivity with antibodies of RIPs from Mirabilis expansa. TRIP released fewer amounts of adenine residues from ribosomal (Artemia sp. and rat ribosomes) and non-ribosomal substrates (herring sperm DNA, rRNA, and tRNA) compared with other RIPs. TRIP inhibited translation in wheat (Triticum aestivum) germ more efficiently than in rabbit reticulocytes, showing an IC50 at 30 ng in the former system. Antimicrobial assays using highly purified TRIP (50 microg mL(-1)) conducted against various fungi and bacterial pathogens showed the strongest inhibitory activity against Trichoderma reesei and Pseudomonas solancearum. A 15-amino acid internal polypeptide sequence of TRIP was identical with the internal sequences of the iron-superoxide dismutase (Fe-SOD) from wild tobacco (Nicotiana plumbaginifolia), Arabidopsis, and potato (Solanum tuberosum). Purified TRIP showed SOD activity, and Escherichia coli Fe-SOD was observed to have RIP activity too. Thus, TRIP may be considered a dual activity enzyme showing RIP-like activity and Fe-SOD characteristics.

  18. Affinity labelling of ribosomes from the livers of different vertebrates by 2-nitro-4-azidobenzoyl-Phe-tRNA

    International Nuclear Information System (INIS)

    Stahl, J.; Boehm, H.; Voderberg, M.

    1981-01-01

    Ribosomal protein L 10 from the livers of trout, hen, and rat was found to be the main target for 2-nitro-4-azidobenzoyl-Phe-tRNA in affinity labelling experiments. Therefore, despite somewhat different electrophoretic mobilities, this protein seems to be involved in the organization of the peptidyl transferase centre in ribosomes of various vertebrates. (author)

  19. Evidence for ribosomal frameshifting and a novel overlapping gene in the genomes of insect-specific flaviviruses

    International Nuclear Information System (INIS)

    Firth, Andrew E.; Blitvich, Bradley J.; Wills, Norma M.; Miller, Cathy L.; Atkins, John F.

    2010-01-01

    Flaviviruses have a positive-sense, single-stranded RNA genome of ∼11 kb, encoding a large polyprotein that is cleaved to produce ∼10 mature proteins. Cell fusing agent virus, Kamiti River virus, Culex flavivirus and several recently discovered flaviviruses have no known vertebrate host and apparently infect only insects. We present compelling bioinformatic evidence for a 253-295 codon overlapping gene (designated fifo) conserved throughout these insect-specific flaviviruses and immunofluorescent detection of its product. Fifo overlaps the NS2A/NS2B coding sequence in the - 1/+ 2 reading frame and is most likely expressed as a trans-frame fusion protein via ribosomal frameshifting at a conserved GGAUUUY slippery heptanucleotide with 3'-adjacent RNA secondary structure (which stimulates efficient frameshifting in vitro). The discovery bears striking parallels to the recently discovered ribosomal frameshifting site in the NS2A coding sequence of the Japanese encephalitis serogroup of flaviviruses and suggests that programmed ribosomal frameshifting may be more widespread in flaviviruses than currently realized.

  20. A Sequence-Independent, Unstructured Internal Ribosome Entry Site Is Responsible for Internal Expression of the Coat Protein of Turnip Crinkle Virus.

    Science.gov (United States)

    May, Jared; Johnson, Philip; Saleem, Huma; Simon, Anne E

    2017-04-15

    To maximize the coding potential of viral genomes, internal ribosome entry sites (IRES) can be used to bypass the traditional requirement of a 5' cap and some/all of the associated translation initiation factors. Although viral IRES typically contain higher-order RNA structure, an unstructured sequence of about 84 nucleotides (nt) immediately upstream of the Turnip crinkle virus (TCV) coat protein (CP) open reading frame (ORF) has been found to promote internal expression of the CP from the genomic RNA (gRNA) both in vitro and in vivo An absence of extensive RNA structure was predicted using RNA folding algorithms and confirmed by selective 2'-hydroxyl acylation analyzed by primer extension (SHAPE) RNA structure probing. Analysis of the IRES region in vitro by use of both the TCV gRNA and reporter constructs did not reveal any sequence-specific elements but rather suggested that an overall lack of structure was an important feature for IRES activity. The CP IRES is A-rich, independent of orientation, and strongly conserved among viruses in the same genus. The IRES was dependent on eIF4G, but not eIF4E, for activity. Low levels of CP accumulated in vivo in the absence of detectable TCV subgenomic RNAs, strongly suggesting that the IRES was active in the gRNA in vivo Since the TCV CP also serves as the viral silencing suppressor, early translation of the CP from the viral gRNA is likely important for countering host defenses. Cellular mRNA IRES also lack extensive RNA structures or sequence conservation, suggesting that this viral IRES and cellular IRES may have similar strategies for internal translation initiation. IMPORTANCE Cap-independent translation is a common strategy among positive-sense, single-stranded RNA viruses for bypassing the host cell requirement of a 5' cap structure. Viral IRES, in general, contain extensive secondary structure that is critical for activity. In contrast, we demonstrate that a region of viral RNA devoid of extensive secondary

  1. Ribosomal protein S14 transcripts are edited in Oenothera mitochondria.

    Science.gov (United States)

    Schuster, W; Unseld, M; Wissinger, B; Brennicke, A

    1990-01-01

    The gene encoding ribosomal protein S14 (rps14) in Oenothera mitochondria is located upstream of the cytochrome b gene (cob). Sequence analysis of independently derived cDNA clones covering the entire rps14 coding region shows two nucleotides edited from the genomic DNA to the mRNA derived sequences by C to U modifications. A third editing event occurs four nucleotides upstream of the AUG initiation codon and improves a potential ribosome binding site. A CGG codon specifying arginine in a position conserved in evolution between chloroplasts and E. coli as a UGG tryptophan codon is not edited in any of the cDNAs analysed. An inverted repeat 3' of an unidentified open reading frame is located upstream of the rps14 gene. The inverted repeat sequence is highly conserved at analogous regions in other Oenothera mitochondrial loci. Images PMID:2326162

  2. Inhibition of ribosomal RNA synthesis in yeast by ionizing radiations

    Energy Technology Data Exchange (ETDEWEB)

    Weber, K; Kiefer, J [Giessen Univ. (Germany, F.R.). Strahlenzentrum

    1984-12-01

    Synthesis of ribosomal RNA(r-RNA) was measured for 1 h after exposure of Saccharomyces cerevisiae to ..gamma..-rays, X-rays or ..cap alpha.. particles. ..gamma..- or X-ray induced transcription inhibition was always found to decrease exponentially with dose. D/sub 0/ values of 2150 or 1950 Gy were determined in wild-type cells, corresponding to a mean energy of about 60 eV per r-RNA gene. The finding of differential sensitivities of the two high molecular-weight r-RNA species which are cotranscribed from r-DNA is compatible with the existence of a transcription terminating mechanism. Cells from a mutant strain (rad-9), radiation sensitive to colony forming ability, showed an approximately equal sensitivity for transcription inhibition compared to the wild-type (D/sub 0/ (2095) = 2400 Gy). Inactivation of r-RNA synthesis in cells exposed to ..cap alpha..-particles at room-temperature showed a decreased sensitivity with higher particle fluences ('resistant tail'). This phenomenon was drastically reduced if the temperature during irradiation was lowered to 4/sup 0/C and completely abolished when dried cells were used. An inactivation cross-section for ..cap alpha..-particle induced transcription inhibition of about 0.02 ..mu..m/sup 2/ can be derived from the experimental data.

  3. Differences in a ribosomal DNA sequence of Strongylus species allows identification of single eggs.

    Science.gov (United States)

    Campbell, A J; Gasser, R B; Chilton, N B

    1995-03-01

    In the current study, molecular techniques were evaluated for the species identification of individual strongyle eggs. Adult worms of Strongylus edentatus, S. equinus and S. vulgaris were collected at necropsy from horses from Australia and the U.S.A. Genomic DNA was isolated and a ribosomal transcribed spacer (ITS-2) amplified and sequenced using polymerase chain reaction (PCR) techniques. The length of the ITS-2 sequence of S. edentatus, S. equinus and S. vulgaris ranged between 217 and 235 nucleotides. Extensive sequence analysis demonstrated a low degree (0-0.9%) of intraspecific variation in the ITS-2 for the Strongylus species examined, whereas the levels of interspecific differences (13-29%) were significantly greater. Interspecific differences in the ITS-2 sequences allowed unequivocal species identification of single worms and eggs using PCR-linked restriction fragment length polymorphism. These results demonstrate the potential of the ribosomal spacers as genetic markers for species identification of single strongyle eggs from horse faeces.

  4. Thermus Thermophilus as a Model System for the Study of Ribosomal Antibiotic Resistance

    Science.gov (United States)

    Gregory, Steven T.

    2018-03-01

    Ribosomes are the intracellular ribonucleoprotein machines responsible for the translation of mRNA sequence into protein sequence. As an essential cell component, the ribosome is the target of numerous antibiotics that bind to critical functional sites to impair protein synthesis. Mutations causing resistance to antibiotics arise in antibiotic binding sites, and an understanding of the basis of resistance will be an essential component of efforts to develop new antibiotics by rational drug design. We have identified a number of antibiotic-resistance mutations in ribosomal genes of the thermophilic bacterium Thermus thermophilus. This species offers two primary advantages for examining the structural basis of antibiotic-resistance, in particular, its potential for genetic manipulation and the suitability of its ribosomes for analysis by X-ray crystallography. Mutations we have identified in this organism are in many instances identical to those found in other bacterial species, including important pathogens, a result of the extreme conservation of ribosome functional sites. Here I summarize the advantages of this organism as a model system to study antibiotic-resistance mechanisms at the molecular level.

  5. Complete mitochondrial genomes and nuclear ribosomal RNA operons of two species of Diplostomum (Platyhelminthes: Trematoda): a molecular resource for taxonomy and molecular epidemiology of important fish pathogens

    Czech Academy of Sciences Publication Activity Database

    Brabec, Jan; Kostadinova, Aneta; Scholz, Tomáš; Littlewood, D. T. J.

    2015-01-01

    Roč. 8, JUN 19 2015 (2015), s. 336 ISSN 1756-3305 R&D Projects: GA MŠk(CZ) EE2.3.30.0032; GA ČR(CZ) GA15-14198S Grant - others:GA MŠk(CZ) LM2010005 Institutional support: RVO:60077344 Keywords : Diplostomum (Platyhelminthes: Trematoda) * fish pathogens * mitochondrial genome * ribosomal RNA * illumina next-generation sequencing * phylogeny Subject RIV: EG - Zoology Impact factor: 3.234, year: 2015

  6. Identification and role of functionally important motifs in the 970 loop of Escherichia coli 16S ribosomal RNA.

    Science.gov (United States)

    Saraiya, Ashesh A; Lamichhane, Tek N; Chow, Christine S; SantaLucia, John; Cunningham, Philip R

    2008-02-22

    The 970 loop (helix 31) of Escherichia coli 16S ribosomal RNA contains two modified nucleotides, m(2)G966 and m(5)C967. Positions A964, A969, and C970 are conserved among the Bacteria, Archaea, and Eukarya. The nucleotides present at positions 965, 966, 967, 968, and 971, however, are only conserved and unique within each domain. All organisms contain a modified nucleoside at position 966, but the type of the modification is domain specific. Biochemical and structure studies have placed this loop near the P site and have shown it to be involved in the decoding process and in binding the antibiotic tetracycline. To identify the functional components of this ribosomal RNA hairpin, the eight nucleotides of the 970 loop of helix 31 were subjected to saturation mutagenesis and 107 unique functional mutants were isolated and analyzed. Nonrandom nucleotide distributions were observed at each mutated position among the functional isolates. Nucleotide identity at positions 966 and 969 significantly affects ribosome function. Ribosomes with single mutations of m(2)G966 or m(5)C967 produce more protein in vivo than do wild-type ribosomes. Overexpression of initiation factor 3 specifically restored wild-type levels of protein synthesis to the 966 and 967 mutants, suggesting that modification of these residues is important for initiation factor 3 binding and for the proper initiation of protein synthesis.

  7. Human ribosomal protein L37 has motifs predicting serine/threonine phosphorylation and a zinc-finger domain.

    Science.gov (United States)

    Barnard, G F; Staniunas, R J; Puder, M; Steele, G D; Chen, L B

    1994-08-02

    Ribosomal protein L37 mRNA is overexpressed in colon cancer. The nucleotide sequences of human L37 from several tumor and normal, colon and liver cDNA sources were determined to be identical. L37 mRNA was approximately 375 nucleotides long encoding 97 amino acids with M(r) = 11,070, pI = 12.6, multiple potential serine/threonine phosphorylation sites and a zinc-finger domain. The human sequence is compared to other species.

  8. Ribosomal frameshifting and transcriptional slippage: From genetic steganography and cryptography to adventitious use.

    Science.gov (United States)

    Atkins, John F; Loughran, Gary; Bhatt, Pramod R; Firth, Andrew E; Baranov, Pavel V

    2016-09-06

    Genetic decoding is not 'frozen' as was earlier thought, but dynamic. One facet of this is frameshifting that often results in synthesis of a C-terminal region encoded by a new frame. Ribosomal frameshifting is utilized for the synthesis of additional products, for regulatory purposes and for translational 'correction' of problem or 'savior' indels. Utilization for synthesis of additional products occurs prominently in the decoding of mobile chromosomal element and viral genomes. One class of regulatory frameshifting of stable chromosomal genes governs cellular polyamine levels from yeasts to humans. In many cases of productively utilized frameshifting, the proportion of ribosomes that frameshift at a shift-prone site is enhanced by specific nascent peptide or mRNA context features. Such mRNA signals, which can be 5' or 3' of the shift site or both, can act by pairing with ribosomal RNA or as stem loops or pseudoknots even with one component being 4 kb 3' from the shift site. Transcriptional realignment at slippage-prone sequences also generates productively utilized products encoded trans-frame with respect to the genomic sequence. This too can be enhanced by nucleic acid structure. Together with dynamic codon redefinition, frameshifting is one of the forms of recoding that enriches gene expression. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  9. Resistance to the peptidyl transferase inhibitor tiamulin caused by mutation of ribosomal protein l3.

    Science.gov (United States)

    Bøsling, Jacob; Poulsen, Susan M; Vester, Birte; Long, Katherine S

    2003-09-01

    The antibiotic tiamulin targets the 50S subunit of the bacterial ribosome and interacts at the peptidyl transferase center. Tiamulin-resistant Escherichia coli mutants were isolated in order to elucidate mechanisms of resistance to the drug. No mutations in the rRNA were selected as resistance determinants using a strain expressing only a plasmid-encoded rRNA operon. Selection in a strain with all seven chromosomal rRNA operons yielded a mutant with an A445G mutation in the gene coding for ribosomal protein L3, resulting in an Asn149Asp alteration. Complementation experiments and sequencing of transductants demonstrate that the mutation is responsible for the resistance phenotype. Chemical footprinting experiments show a reduced binding of tiamulin to mutant ribosomes. It is inferred that the L3 mutation, which points into the peptidyl transferase cleft, causes tiamulin resistance by alteration of the drug-binding site. This is the first report of a mechanism of resistance to tiamulin unveiled in molecular detail.

  10. Unique Trichomonas vaginalis gene sequences identified in multinational regions of Northwest China.

    Science.gov (United States)

    Liu, Jun; Feng, Meng; Wang, Xiaolan; Fu, Yongfeng; Ma, Cailing; Cheng, Xunjia

    2017-07-24

    Trichomonas vaginalis (T. vaginalis) is a flagellated protozoan parasite that infects humans worldwide. This study determined the sequence of the 18S ribosomal RNA gene of T. vaginalis infecting both females and males in Xinjiang, China. Samples from 73 females and 28 males were collected and confirmed for infection with T. vaginalis, a total of 110 sequences were identified when the T. vaginalis 18S ribosomal RNA gene was sequenced. These sequences were used to prepare a phylogenetic network. The rooted network comprised three large clades and several independent branches. Most of the Xinjiang sequences were in one group. Preliminary results suggest that Xinjiang T. vaginalis isolates might be genetically unique, as indicated by the sequence of their 18S ribosomal RNA gene. Low migration rate of local people in this province may contribute to a genetic conservativeness of T. vaginalis. The unique genetic feature of our isolates may suggest a different clinical presentation of trichomoniasis, including metronidazole susceptibility, T. vaginalis virus or Mycoplasma co-infection characteristics. The transmission and evolution of Xinjiang T. vaginalis is of interest and should be studied further. More attention should be given to T. vaginalis infection in both females and males in Xinjiang.

  11. Detection of Cryptosporidium species in feces or gastric contents from snakes and lizards as determined by polymerase chain reaction analysis and partial sequencing of the 18S ribosomal RNA gene.

    Science.gov (United States)

    Richter, Barbara; Nedorost, Nora; Maderner, Anton; Weissenböck, Herbert

    2011-05-01

    Cryptosporidiosis is a well-known gastrointestinal disease of snakes and lizards. In the current study, 672 samples (feces and/or gastric contents or regurgitated food items) of various snakes and lizards were examined for the presence of cryptosporidia by polymerase chain reaction (PCR) assay targeting a part of the 18S ribosomal RNA gene. A consecutive sequencing reaction was used to identify the cryptosporidian species present in PCR-positive samples. Cryptosporidium varanii (saurophilum) was detected in 17 out of 106 (16%) samples from corn snakes (Pantherophis guttatus) and in 32 out of 462 (7%) samples from leopard geckos (Eublepharis macularius). Cryptosporidium serpentis was found in 8 out of 462 (2%) leopard gecko samples, but in no other reptile. The Cryptosporidium sp. "lizard genotype" was present in 1 leopard gecko sample, and 1 sample from a corn snake showed a single nucleotide mismatch to this genotype. Pseudoparasitic cryptosporidian species were identified in 5 out of 174 (3%) ophidian samples, but not in lizards. Other sequences did not show complete similarity to previously published Cryptosporidium sequences. The results stress the importance for diagnostic methods to be specific for Cryptosporidium species especially in snakes and show a relatively high prevalence of C. varanii in leopard geckos and corn snakes. © 2011 The Author(s)

  12. Phylogenetic analysis of subgenus vigna species using nuclear ribosomal RNA ITS: evidence of hybridization among Vigna unguiculata subspecies.

    Science.gov (United States)

    Vijaykumar, Archana; Saini, Ajay; Jawali, Narendra

    2010-01-01

    Molecular phylogeny among species belonging to subgenus Vigna (genus Vigna) was inferred based on internal transcribed spacer (ITS) sequences of 18S-5.8S-26S ribosomal RNA gene unit. Analysis showed a total of 356 polymorphic sites of which approximately 80% were parsimony informative. Phylogenetic reconstruction by neighbor joining and maximum parsimony methods placed the 57 Vigna accessions (belonging to 15 species) into 5 major clades. Five species viz. Vigna heterophylla, Vigna pubigera, Vigna parkeri, Vigna laurentii, and Vigna gracilis whose position in the subgenus was previously not known were placed in the section Vigna. A single accession (Vigna unguiculata ssp. tenuis, NI 1637) harbored 2 intragenomic ITS variants, indicative of 2 different types of ribosomal DNA (rDNA) repeat units. ITS variant type-I was close to ITS from V. unguiculata ssp. pubescens, whereas type-II was close to V. unguiculata ssp. tenuis. Transcript analysis clearly demonstrates that in accession NI 1637, rDNA repeat units with only type-II ITS variants are transcriptionally active. Evidence from sequence analysis (of 5.8S, ITS1, and ITS2) and secondary structure analysis (of ITS1 and ITS2) indicates that the type-I ITS variant probably does not belong to the pseudogenic rDNA repeat units. The results from phylogenetic and transcript analysis suggest that the rDNA units with the type-I ITS may have introgressed as a result of hybridization (between ssp. tenuis and ssp. pubescens); however, it has been epigenetically silenced. The results also demonstrate differential evolution of ITS sequence among wild and cultivated forms of V. unguiculata.

  13. Automated insertion of sequences into a ribosomal RNA alignment: An application of computational linguistics in molecular biology

    Energy Technology Data Exchange (ETDEWEB)

    Taylor, Ronald C. [Case Western Reserve Univ., Cleveland, OH (United States)

    1991-11-01

    This thesis involved the construction of (1) a grammar that incorporates knowledge on base invariancy and secondary structure in a molecule and (2) a parser engine that uses the grammar to position bases into the structural subunits of the molecule. These concepts were combined with a novel pinning technique to form a tool that semi-automates insertion of a new species into the alignment for the 16S rRNA molecule (a component of the ribosome) maintained by Dr. Carl Woese`s group at the University of Illinois at Urbana. The tool was tested on species extracted from the alignment and on a group of entirely new species. The results were very encouraging, and the tool should be substantial aid to the curators of the 16S alignment. The construction of the grammar was itself automated, allowing application of the tool to alignments for other molecules. The logic programming language Prolog was used to construct all programs involved. The computational linguistics approach used here was found to be a useful way to attach the problem of insertion into an alignment.

  14. Automated insertion of sequences into a ribosomal RNA alignment: An application of computational linguistics in molecular biology

    Energy Technology Data Exchange (ETDEWEB)

    Taylor, R.C.

    1991-11-01

    This thesis involved the construction of (1) a grammar that incorporates knowledge on base invariancy and secondary structure in a molecule and (2) a parser engine that uses the grammar to position bases into the structural subunits of the molecule. These concepts were combined with a novel pinning technique to form a tool that semi-automates insertion of a new species into the alignment for the 16S rRNA molecule (a component of the ribosome) maintained by Dr. Carl Woese's group at the University of Illinois at Urbana. The tool was tested on species extracted from the alignment and on a group of entirely new species. The results were very encouraging, and the tool should be substantial aid to the curators of the 16S alignment. The construction of the grammar was itself automated, allowing application of the tool to alignments for other molecules. The logic programming language Prolog was used to construct all programs involved. The computational linguistics approach used here was found to be a useful way to attach the problem of insertion into an alignment.

  15. Selective inhibition of precursor incorporation into ribosomal RNA in gamma-irradiated Tetrahymena pyriformis

    International Nuclear Information System (INIS)

    Ernst, S.G.; Oleinick, N.L.; Rustad, R.C.; Greenblatt, R.M.

    1979-01-01

    Sublethal doses of γ radiation are known to inhibit total RNA synthesis in the ciliate protozoan Tetrahymena. To determine if the synthesis of a particular class of RNA is preferentially inhibited, pulse-labeled RNA was isolated from normal exponentially growing cells, irradiated cells, and cells in which total RNA synthesis had recovered to the pre-irradiation level. The RNAs were analyzed by SDS-polyacrylamide gel electrphoresis and oligo(dT)-cellulose column chromatography. Inhibition of RNA synthesis primarily involves ribosomal RNA. However, radiation does not cause a delay in the processing of precursor rRNA or a preferential loss of either of the mature rRNAs. Following irradiation, poly(A)-containing RNA [poly(A+)RNA] is synthesized at a rate up to three times greater than the control rate. The elevated poly(A+)RNA synthesis occurs during the period of depressed rRNA synthesis and even after rRNA synthesis has recovered to its pre-irradiation rate. While the sizes of the total cellular ribonucleoside triphosphate pools are depressed in the irradiated cells, these pools probably do not represent the actual compartments containing the precursors for RNA synthesis, and the observed changes cannot explain the modifications in macromolecular synthesis in irradiated Tetrahymena. (Auth.)

  16. Inhibition by Siomycin and Thiostrepton of Both Aminoacyl-tRNA and Factor G Binding to Ribosomes

    Science.gov (United States)

    Ll, Juan Modole; Cabrer, Bartolomé; Parmeggiani, Andrea; Azquez, David V

    1971-01-01

    Siomycin, a peptide antibiotic that interacts with the 50S ribosomal subunit and inhibits binding of factor G, is shown also to inhibit binding of aminoacyl-tRNA; however, it does not impair binding of fMet-tRNA and completion of the initiation complex. Moreover, unlike other inhibitors of aminoacyl-tRNA binding (tetracycline, sparsomycin, and streptogramin A), siomycin completely abolishes the GTPase activity associated with the binding of aminoacyl-tRNA catalyzed by factor Tu. A single-site interaction of siomycin appears to be responsible for its effect on both the binding of the aminoacyl-tRNA-Tu-GTP complex and that of factor G. PMID:4331558

  17. An approach to analyse the specific impact of rapamycin on mRNA-ribosome association

    Directory of Open Access Journals (Sweden)

    Jaquier-Gubler Pascale

    2008-08-01

    Full Text Available Abstract Background Recent work, using both cell culture model systems and tumour derived cell lines, suggests that the differential recruitment into polysomes of mRNA populations may be sufficient to initiate and maintain tumour formation. Consequently, a major effort is underway to use high density microarray profiles to establish molecular fingerprints for cells exposed to defined drug regimes. The aim of these pharmacogenomic approaches is to provide new information on how drugs can impact on the translational read-out within a defined cellular background. Methods We describe an approach that permits the analysis of de-novo mRNA-ribosome association in-vivo during short drug exposures. It combines hypertonic shock, polysome fractionation and high-throughput analysis to provide a molecular phenotype of translationally responsive transcripts. Compared to previous translational profiling studies, the procedure offers increased specificity due to the elimination of the drugs secondary effects (e.g. on the transcriptional read-out. For this pilot "proof-of-principle" assay we selected the drug rapamycin because of its extensively studied impact on translation initiation. Results High throughput analysis on both the light and heavy polysomal fractions has identified mRNAs whose re-recruitment onto free ribosomes responded to short exposure to the drug rapamycin. The results of the microarray have been confirmed using real-time RT-PCR. The selective down-regulation of TOP transcripts is also consistent with previous translational profiling studies using this drug. Conclusion The technical advance outlined in this manuscript offers the possibility of new insights into mRNA features that impact on translation initiation and provides a molecular fingerprint for transcript-ribosome association in any cell type and in the presence of a range of drugs of interest. Such molecular phenotypes defined pre-clinically may ultimately impact on the evaluation of

  18. Structure of a prehandover mammalian ribosomal SRP·SRP receptor targeting complex.

    Science.gov (United States)

    Kobayashi, Kan; Jomaa, Ahmad; Lee, Jae Ho; Chandrasekar, Sowmya; Boehringer, Daniel; Shan, Shu-Ou; Ban, Nenad

    2018-04-20

    Signal recognition particle (SRP) targets proteins to the endoplasmic reticulum (ER). SRP recognizes the ribosome synthesizing a signal sequence and delivers it to the SRP receptor (SR) on the ER membrane followed by the transfer of the signal sequence to the translocon. Here, we present the cryo-electron microscopy structure of the mammalian translating ribosome in complex with SRP and SR in a conformation preceding signal sequence handover. The structure visualizes all eukaryotic-specific SRP and SR proteins and reveals their roles in stabilizing this conformation by forming a large protein assembly at the distal site of SRP RNA. We provide biochemical evidence that the guanosine triphosphate hydrolysis of SRP·SR is delayed at this stage, possibly to provide a time window for signal sequence handover to the translocon. Copyright © 2018 The Authors, some rights reserved; exclusive licensee American Association for the Advancement of Science. No claim to original U.S. Government Works.

  19. Genetic characterization of human-pathogenic Cyclospora cayetanensis parasites from three endemic regions at the 18S ribosomal RNA locus.

    Science.gov (United States)

    Sulaiman, Irshad M; Ortega, Ynes; Simpson, Steven; Kerdahi, Khalil

    2014-03-01

    Cyclospora cayetanensis is an apicocomplexan parasite that infects the gastrointestinal tract and causes acute diarrheal disease in humans. In recent years, this human-pathogenic parasite has led to several foodborne outbreaks in the United States and Canada, mostly associated with imported produce. Understanding the biology and epidemiology of C. cayetanensis is difficult because little is known about its origin, possible zoonotic reservoirs, and genetic relationships with other coccidian parasites. Recently, we developed a 70kDa heat shock protein (HSP70) gene based nested PCR protocol for detection of C. cayetanensis parasite and sequenced the PCR products of 16 human isolates from Nepal, Mexico, and Peru. In this study, we have characterized the regions of 18S ribosomal RNA (rRNA) gene of 17 human C. cayetanensis isolates for molecular detection, and also to ascertain the genetic diversity of this parasite. The 18S rRNA primer sets were further tested by PCR amplification followed by nucleotide sequencing of the PCR amplified products of previously characterized C. cayetanensis isolates from three endemic regions at HSP70 locus. Although no genetic polymorphism was observed at the regions of HSP70 locus characterized in our previous study, the data analysis of this study revealed a minor genetic diversity at the 18S rRNA locus among the C. cayetanensis isolates. The 18S rRNA gene-based nested PCR protocol provides a useful genetic marker for the detection of C. cayetanensis parasite and confirms it as a genetically distinct species in genus Cyclospora. The results also supported lack of geographic segregation and existence of genetically homogeneous population for the C. cayetanensis parasites both at the HSP70 as well as at the18S rRNA loci. Published by Elsevier B.V.

  20. Naked mole-rat has increased translational fidelity compared with the mouse, as well as a unique 28S ribosomal RNA cleavage.

    Science.gov (United States)

    Azpurua, Jorge; Ke, Zhonghe; Chen, Iris X; Zhang, Quanwei; Ermolenko, Dmitri N; Zhang, Zhengdong D; Gorbunova, Vera; Seluanov, Andrei

    2013-10-22

    The naked mole-rat (Heterocephalus glaber) is a subterranean eusocial rodent with a markedly long lifespan and resistance to tumorigenesis. Multiple data implicate modulation of protein translation in longevity. Here we report that 28S ribosomal RNA (rRNA) of the naked mole-rat is processed into two smaller fragments of unequal size. The two breakpoints are located in the 28S rRNA divergent region 6 and excise a fragment of 263 nt. The excised fragment is unique to the naked mole-rat rRNA and does not show homology to other genomic regions. Because this hidden break site could alter ribosome structure, we investigated whether translation rate and amino acid incorporation fidelity were altered. We report that naked mole-rat fibroblasts have significantly increased translational fidelity despite having comparable translation rates with mouse fibroblasts. Although we cannot directly test whether the unique 28S rRNA structure contributes to the increased fidelity of translation, we speculate that it may change the folding or dynamics of the large ribosomal subunit, altering the rate of GTP hydrolysis and/or interaction of the large subunit with tRNA during accommodation, thus affecting the fidelity of protein synthesis. In summary, our results show that naked mole-rat cells produce fewer aberrant proteins, supporting the hypothesis that the more stable proteome of the naked mole-rat contributes to its longevity.

  1. Crystallization of ribosomes from Thermus thermophilus

    International Nuclear Information System (INIS)

    Karpova, E.A.; Serdyuk, I.N.; Tarkhovskii, Yu.S.; Orlova, E.V.; Borovyagin, V.L.

    1987-01-01

    An understanding of the molecular bases of the process of protein biosynthesis on the ribosome requires a knowledge of its structure with high three-dimensional resolution involving the method of x-ray crystallographic analysis. The authors report on the production of crystals of the 70S ribosomes from a new source - the highly thermophilic bacterium Thermus thermophilus. Ribosomes for crystallization were obtained from Th. thermophilus strain HB8 by two washings in buffer with high ionic strength. The ribosome preparation was investigated for homogeneity by the method of high-speed sedimentation in a buffer containing 15 mM MgCl 2 , 50 mM NH 4 Cl, and 10 MM Tris-HCl, pH 7.5. Analysis showed that the preparation if homogeneous. The same preparation was investigated for intactness of ribosomal RNA by the method of gel electrophoresis in 2.75% acrylamide 0.5% agarose gel in a buffer containing 30 mM Tris, 30 mM NaH 2 PO 4 , 10 mM EDTA, 1-2% SDS, and 6 M urea. Analysis showed that the preparation possesses intact 16S and 23S RNA. The latter did not degrade, at least in a week of exposure of the ribosomes in buffer solution at 5 0 C. The ribosome preparation had no appreciable RNase activity, which was verified by incubating 4.5 micrograms of ribosomes with 3 micrograms of 14 C-labeled 16S rRna (50 0 C, 90 min) in a buffer containing 10 mM MgCl 2 , 100 mM NH 4 Cl, and 10 mM Tris-HCl, pH/sub 20 0 / 7.5. The incubated nonhydrolyzed RNA was precipitated with 5% trichloroacetic acid and applied on a GF/C filter. The radioactivity was determined in a toluene scintillator on an LS-100C counter

  2. Complete nuclear ribosomal DNA sequence amplification and molecular analyses of Bangia (Bangiales, Rhodophyta) from China

    Science.gov (United States)

    Xu, Jiajie; Jiang, Bo; Chai, Sanming; He, Yuan; Zhu, Jianyi; Shen, Zonggen; Shen, Songdong

    2016-09-01

    Filamentous Bangia, which are distributed extensively throughout the world, have simple and similar morphological characteristics. Scientists can classify these organisms using molecular markers in combination with morphology. We successfully sequenced the complete nuclear ribosomal DNA, approximately 13 kb in length, from a marine Bangia population. We further analyzed the small subunit ribosomal DNA gene (nrSSU) and the internal transcribed spacer (ITS) sequence regions along with nine other marine, and two freshwater Bangia samples from China. Pairwise distances of the nrSSU and 5.8S ribosomal DNA gene sequences show the marine samples grouping together with low divergences (00.003; 0-0.006, respectively) from each other, but high divergences (0.123-0.126; 0.198, respectively) from freshwater samples. An exception is the marine sample collected from Weihai, which shows high divergence from both other marine samples (0.063-0.065; 0.129, respectively) and the freshwater samples (0.097; 0.120, respectively). A maximum likelihood phylogenetic tree based on a combined SSU-ITS dataset with maximum likelihood method shows the samples divided into three clades, with the two marine sample clades containing Bangia spp. from North America, Europe, Asia, and Australia; and one freshwater clade, containing Bangia atropurpurea from North America and China.

  3. High-resolution microscopy of active ribosomal genes and key members of the rRNA processing machinery inside nucleolus-like bodies of fully-grown mouse oocytes.

    Science.gov (United States)

    Shishova, Kseniya V; Khodarovich, Yuriy M; Lavrentyeva, Elena A; Zatsepina, Olga V

    2015-10-01

    Nucleolus-like bodies (NLBs) of fully-grown (germinal vesicle, GV) mammalian oocytes are traditionally considered as morphologically distinct entities, which, unlike normal nucleoli, contain transcribed ribosomal genes (rDNA) solely at their surface. In the current study, we for the first time showed that active ribosomal genes are present not only on the surface but also inside NLBs of the NSN-type oocytes. The "internal" rRNA synthesis was evidenced by cytoplasmic microinjections of BrUTP as precursor and by fluorescence in situ hybridization with a probe to the short-lived 5'ETS segment of the 47S pre-rRNA. We further showed that in the NLB mass of NSN-oocytes, distribution of active rDNA, RNA polymerase I (UBF) and rRNA processing (fibrillarin) protein factors, U3 snoRNA, pre-rRNAs and 18S/28S rRNAs is remarkably similar to that in somatic nucleoli capable to make pre-ribosomes. Overall, these observations support the occurrence of rDNA transcription, rRNA processing and pre-ribosome assembly in the NSN-type NLBs and so that their functional similarity to normal nucleoli. Unlike the NSN-type NLBs, the NLBs of more mature SN-oocytes do not contain transcribed rRNA genes, U3 snoRNA, pre-rRNAs, 18S and 28S rRNAs. These results favor the idea that in a process of transformation of NSN-oocytes to SN-oocytes, NLBs cease to produce pre-ribosomes and, moreover, lose their rRNAs. We also concluded that a denaturing fixative 70% ethanol used in the study to fix oocytes could be more appropriate for light microscopy analysis of nucleolar RNAs and proteins in mammalian fully-grown oocytes than a commonly used cross-linking aldehyde fixative, formalin. Copyright © 2015 Elsevier Inc. All rights reserved.

  4. In Profile: Models of Ribosome Biogenesis Defects and Regulation of Protein Synthesis

    NARCIS (Netherlands)

    Essers, P.B.M.

    2013-01-01

    Ribosomes are the mediators of protein synthesis in the cell and therefore crucial to proper cell function. In addition, ribosomes are highly abundant, with ribosomal RNA making up 80% of the RNA in the cell. A large amount of resources go into maintaining this pool of ribosomes, so ribosome

  5. Complete amino acid sequences of the ribosomal proteins L25, L29 and L31 from the archaebacterium Halobacterium marismortui.

    Science.gov (United States)

    Hatakeyama, T; Kimura, M

    1988-03-15

    Ribosomal proteins were extracted from 50S ribosomal subunits of the archaebacterium Halobacterium marismortui by decreasing the concentration of Mg2+ and K+, and the proteins were separated and purified by ion-exchange column chromatography on DEAE-cellulose. Ten proteins were purified to homogeneity and three of these proteins were subjected to sequence analysis. The complete amino acid sequences of the ribosomal proteins L25, L29 and L31 were established by analyses of the peptides obtained by enzymatic digestion with trypsin, Staphylococcus aureus protease, chymotrypsin and lysylendopeptidase. Proteins L25, L29 and L31 consist of 84, 115 and 95 amino acid residues with the molecular masses of 9472 Da, 12293 Da and 10418 Da respectively. A comparison of their sequences with those of other large-ribosomal-subunit proteins from other organisms revealed that protein L25 from H. marismortui is homologous to protein L23 from Escherichia coli (34.6%), Bacillus stearothermophilus (41.8%), and tobacco chloroplasts (16.3%) as well as to protein L25 from yeast (38.0%). Proteins L29 and L31 do not appear to be homologous to any other ribosomal proteins whose structures are so far known.

  6. Unique phylogenetic position of Diplomonadida based on the complete small subunit ribosomal RNA sequence of Giardia ardeae, G. muris, G. duodenalis and Hexamita sp.

    Science.gov (United States)

    van Keulen, H; Gutell, R R; Gates, M A; Campbell, S R; Erlandsen, S L; Jarroll, E L; Kulda, J; Meyer, E A

    1993-01-01

    Complete small-subunit rRNA (SSU-rRNA) coding region sequences were determined for two species of the intestinal parasite Giardia: G. ardeae and G. muris, both belonging to the order Diplomonadida, and a free-living member of this order, Hexamita sp. These sequences were compared to published SSU-rDNA sequences from a third member of the genus Giardia, G. duodenalis (often called G. intestinalis or G. lamblia) and various representative organisms from other taxa. Of the three Giardia sequences analyzed, the SSU-rRNA from G. muris is the smallest (1432 bases as compared to 1435 and 1453 for G. ardeae and G. duodenalis, respectively) and has the lowest G+C content (58.9%). The Hexamita SSU-rRNA is the largest in this group, containing 1550 bases. Because the sizes of the SSU-rRNA are prokaryotic rather than typically eukaryotic, the secondary structures of the SSU-rRNAs were constructed. These structures show a number of typically eukaryotic signature sequences. Sequence alignments based on constraints imposed by secondary structure were used for construction of a phylogenetic tree for these four taxa. The results show that of the four diplomonads represented, the Giardia species form a distinct group. The other diplomonad Hexamita and the microsporidium Vairimorpha necatrix appear to be distinct from Giardia.

  7. Promoter-wide hypermethylation of the ribosomal RNA gene promoter in the suicide brain.

    Directory of Open Access Journals (Sweden)

    Patrick O McGowan

    Full Text Available BACKGROUND: Alterations in gene expression in the suicide brain have been reported and for several genes DNA methylation as an epigenetic regulator is thought to play a role. rRNA genes, that encode ribosomal RNA, are the backbone of the protein synthesis machinery and levels of rRNA gene promoter methylation determine rRNA transcription. METHODOLOGY/PRINCIPAL FINDINGS: We test here by sodium bisulfite mapping of the rRNA promoter and quantitative real-time PCR of rRNA expression the hypothesis that epigenetic differences in critical loci in the brain are involved in the pathophysiology of suicide. Suicide subjects in this study were selected for a history of early childhood neglect/abuse, which is associated with decreased hippocampal volume and cognitive impairments. rRNA was significantly hypermethylated throughout the promoter and 5' regulatory region in the brain of suicide subjects, consistent with reduced rRNA expression in the hippocampus. This difference in rRNA methylation was not evident in the cerebellum and occurred in the absence of genome-wide changes in methylation, as assessed by nearest neighbor. CONCLUSIONS/SIGNIFICANCE: This is the first study to show aberrant regulation of the protein synthesis machinery in the suicide brain. The data implicate the epigenetic modulation of rRNA in the pathophysiology of suicide.

  8. Cell Death-Associated Ribosomal RNA Cleavage in Postmortem Tissues and Its Forensic Applications.

    Science.gov (United States)

    Kim, Ji Yeon; Kim, Yunmi; Cha, Hyo Kyeong; Lim, Hye Young; Kim, Hyungsub; Chung, Sooyoung; Hwang, Juck-Joon; Park, Seong Hwan; Son, Gi Hoon

    2017-06-30

    Estimation of postmortem interval (PMI) is a key issue in the field of forensic pathology. With the availability of quantitative analysis of RNA levels in postmortem tissues, several studies have assessed the postmortem degradation of constitutively expressed RNA species to estimate PMI. However, conventional RNA quantification as well as biochemical and physiological changes employed thus far have limitations related to standardization or normalization. The present study focuses on an interesting feature of the subdomains of certain RNA species, in which they are site-specifically cleaved during apoptotic cell death. We found that the D8 divergent domain of ribosomal RNA (rRNA) bearing cell death-related cleavage sites was rapidly removed during postmortem RNA degradation. In contrast to the fragile domain, the 5' terminal region of 28S rRNA was remarkably stable during the postmortem period. Importantly, the differences in the degradation rates between the two domains in mammalian 28S rRNA were highly proportional to increasing PMI with a significant linear correlation observed in mice as well as human autopsy tissues. In conclusion, we demonstrate that comparison of the degradation rates between domains of a single RNA species provides quantitative information on postmortem degradation states, which can be applied for the estimation of PMI.

  9. The effect of tRNA levels on decoding times of mRNA codons.

    Science.gov (United States)

    Dana, Alexandra; Tuller, Tamir

    2014-08-01

    The possible effect of transfer ribonucleic acid (tRNA) concentrations on codons decoding time is a fundamental biomedical research question; however, due to a large number of variables affecting this process and the non-direct relation between them, a conclusive answer to this question has eluded so far researchers in the field. In this study, we perform a novel analysis of the ribosome profiling data of four organisms which enables ranking the decoding times of different codons while filtering translational phenomena such as experimental biases, extreme ribosomal pauses and ribosome traffic jams. Based on this filtering, we show for the first time that there is a significant correlation between tRNA concentrations and the codons estimated decoding time both in prokaryotes and in eukaryotes in natural conditions (-0.38 to -0.66, all P values decoding times are not correlated with aminoacyl-tRNA levels. The reported results support the conjecture that translation efficiency is directly influenced by the tRNA levels in the cell. Thus, they should help to understand the evolution of synonymous aspects of coding sequences via the adaptation of their codons to the tRNA pool. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  10. The pleuromutilin drugs tiamulin and valnemulin bind to the RNA at the peptidyl transferase centre on the ribosome.

    Science.gov (United States)

    Poulsen, S M; Karlsson, M; Johansson, L B; Vester, B

    2001-09-01

    The pleuromutilin antibiotic derivatives, tiamulin and valnemulin, inhibit protein synthesis by binding to the 50S ribosomal subunit of bacteria. The action and binding site of tiamulin and valnemulin was further characterized on Escherichia coli ribosomes. It was revealed that these drugs are strong inhibitors of peptidyl transferase and interact with domain V of 23S RNA, giving clear chemical footprints at nucleotides A2058-9, U2506 and U2584-5. Most of these nucleotides are highly conserved phylogenetically and functionally important, and all of them are at or near the peptidyl transferase centre and have been associated with binding of several antibiotics. Competitive footprinting shows that tiamulin and valnemulin can bind concurrently with the macrolide erythromycin but compete with the macrolide carbomycin, which is a peptidyl transferase inhibitor. We infer from these and previous results that tiamulin and valnemulin interact with the rRNA in the peptidyl transferase slot on the ribosomes in which they prevent the correct positioning of the CCA-ends of tRNAs for peptide transfer.

  11. Characterization of anti-P monoclonal antibodies directed against the ribosomal protein-RNA complex antigen and produced using Murphy Roths large autoimmune-prone mice.

    Science.gov (United States)

    Sato, H; Onozuka, M; Hagiya, A; Hoshino, S; Narita, I; Uchiumi, T

    2015-02-01

    Autoantibodies, including anti-ribosomal P proteins (anti-P), are thought to be produced by an antigen-driven immune response in systemic lupus erythematosus (SLE). To test this hypothesis, we reconstituted the ribosomal antigenic complex in vitro using human P0, phosphorylated P1 and P2 and a 28S rRNA fragment covering the P0 binding site, and immunized Murphy Roths large (MRL)/lrp lupus mice with this complex without any added adjuvant to generate anti-P antibodies. Using hybridoma technology, we subsequently obtained 34 clones, each producing an anti-P monoclonal antibody (mAb) that recognized the conserved C-terminal tail sequence common to all three P proteins. We also obtained two P0-specific monoclonal antibodies, but no antibody specific to P1, P2 or rRNA fragment. Two types of mAbs were found among these anti-P antibodies: one type (e.g. 9D5) reacted more strongly with the phosphorylated P1 and P2 than that with their non-phosphorylated forms, whereas the other type (e.g. 4H11) reacted equally with both phosphorylated and non-phosphorylated forms of P1/P2. Both 9D5 and 4H11 inhibited the ribosome/eukaryotic elongation factor-2 (eEF-2)-coupled guanosine triphosphate (GTP)ase activity. However, preincubation with a synthetic peptide corresponding to the C-terminal sequence common to all three P proteins, but not the peptide that lacked the last three C-terminal amino acids, mostly prevented the mAb-induced inhibition of GTPase activity. Thus, at least two types of anti-P were produced preferentially following the immunization of MRL mice with the reconstituted antigenic complex. Presence of multiple copies of the C-termini, particularly that of the last three C-terminal amino acid residues, in the antigenic complex appears to contribute to the immunogenic stimulus. © 2014 British Society for Immunology.

  12. Characterization of anti-P monoclonal antibodies directed against the ribosomal protein–RNA complex antigen and produced using Murphy Roths large autoimmune-prone mice

    Science.gov (United States)

    Sato, H; Onozuka, M; Hagiya, A; Hoshino, S; Narita, I; Uchiumi, T

    2015-01-01

    Autoantibodies, including anti-ribosomal P proteins (anti-P), are thought to be produced by an antigen-driven immune response in systemic lupus erythematosus (SLE). To test this hypothesis, we reconstituted the ribosomal antigenic complex in vitro using human P0, phosphorylated P1 and P2 and a 28S rRNA fragment covering the P0 binding site, and immunized Murphy Roths large (MRL)/lrp lupus mice with this complex without any added adjuvant to generate anti-P antibodies. Using hybridoma technology, we subsequently obtained 34 clones, each producing an anti-P monoclonal antibody (mAb) that recognized the conserved C-terminal tail sequence common to all three P proteins. We also obtained two P0-specific monoclonal antibodies, but no antibody specific to P1, P2 or rRNA fragment. Two types of mAbs were found among these anti-P antibodies: one type (e.g. 9D5) reacted more strongly with the phosphorylated P1 and P2 than that with their non-phosphorylated forms, whereas the other type (e.g. 4H11) reacted equally with both phosphorylated and non-phosphorylated forms of P1/P2. Both 9D5 and 4H11 inhibited the ribosome/eukaryotic elongation factor-2 (eEF-2)-coupled guanosine triphosphate (GTP)ase activity. However, preincubation with a synthetic peptide corresponding to the C-terminal sequence common to all three P proteins, but not the peptide that lacked the last three C-terminal amino acids, mostly prevented the mAb-induced inhibition of GTPase activity. Thus, at least two types of anti-P were produced preferentially following the immunization of MRL mice with the reconstituted antigenic complex. Presence of multiple copies of the C-termini, particularly that of the last three C-terminal amino acid residues, in the antigenic complex appears to contribute to the immunogenic stimulus. PMID:25255895

  13. Miscoding-induced stalling of substrate translocation on the bacterial ribosome.

    Science.gov (United States)

    Alejo, Jose L; Blanchard, Scott C

    2017-10-10

    Directional transit of the ribosome along the messenger RNA (mRNA) template is a key determinant of the rate and processivity of protein synthesis. Imaging of the multistep translocation mechanism using single-molecule FRET has led to the hypothesis that substrate movements relative to the ribosome resolve through relatively long-lived late intermediates wherein peptidyl-tRNA enters the P site of the small ribosomal subunit via reversible, swivel-like motions of the small subunit head domain within the elongation factor G (GDP)-bound ribosome complex. Consistent with translocation being rate-limited by recognition and productive engagement of peptidyl-tRNA within the P site, we now show that base-pairing mismatches between the peptidyl-tRNA anticodon and the mRNA codon dramatically delay this rate-limiting, intramolecular process. This unexpected relationship between aminoacyl-tRNA decoding and translocation suggests that miscoding antibiotics may impact protein synthesis by impairing the recognition of peptidyl-tRNA in the small subunit P site during EF-G-catalyzed translocation. Strikingly, we show that elongation factor P (EF-P), traditionally known to alleviate ribosome stalling at polyproline motifs, can efficiently rescue translocation defects arising from miscoding. These findings help reveal the nature and origin of the rate-limiting steps in substrate translocation on the bacterial ribosome and indicate that EF-P can aid in resuming translation elongation stalled by miscoding errors.

  14. Affinity labelling in situ of the bL12 protein on E. coli 70S ribosomes by means of a tRNA dialdehyde derivative.

    Science.gov (United States)

    Hountondji, Codjo; Créchet, Jean-Bernard; Le Caër, Jean-Pierre; Lancelot, Véronique; Cognet, Jean A H; Baouz, Soria

    2017-12-01

    In this report, we have used periodate-oxidized tRNA (tRNAox) as an affinity laleling reagent to demonstrate that: (i) the bL12 protein contacts the CCA-arm of P-site bound tRNA on the Escherichia coli 70S ribosomes; (ii) the stoichiometry of labelling is one molecule of tRNAox bound to one polypeptide chain of endogenous bL12; (iii) cross-linking in situ of bL12 with tRNAox on the ribosomes provokes the loss of activity; (iv) intact tRNA protects bL12 in the 70S ribosomes against cross-linking with tRNAox; (v) both tRNAox and pyridoxal 5'-phosphate (PLP) compete for the same or for proximal cross-linking site(s) on bL12 inside the ribosome; (vi) the stoichiometry of cross-linking of PLP to the recombinant E. coli bL12 protein is one molecule of PLP covalently bound per polypeptide chain; (vii) the amino acid residue of recombinant bL12 cross-linked with PLP is Lys-65; (viii) Lys-65 of E. coli bL12 corresponds to Lys-53 of eL42 which was previously shown to cross-link with P-site bound tRNAox on human 80S ribosomes in situ; (ix) finally, E. coli bL12 and human eL42 proteins display significant primary structure similarities, which argues for evolutionary conservation of these two proteins located at the tRNA-CCA binding site on eubacterial and eukaryal ribosomes. © The Authors 2017. Published by Oxford University Press on behalf of the Japanese Biochemical Society. All rights reserved.

  15. Detection of Ribosomal DNA Sequence Polymorphisms in the Protist Plasmodiophora brassicae for the Identification of Geographical Isolates

    Directory of Open Access Journals (Sweden)

    Rawnak Laila

    2017-01-01

    Full Text Available Clubroot is a soil-borne disease caused by the protist Plasmodiophora brassicae (P. brassicae. It is one of the most economically important diseases of Brassica rapa and other cruciferous crops as it can cause remarkable yield reductions. Understanding P. brassicae genetics, and developing efficient molecular markers, is essential for effective detection of harmful races of this pathogen. Samples from 11 Korean field populations of P. brassicae (geographic isolates, collected from nine different locations in South Korea, were used in this study. Genomic DNA was extracted from the clubroot-infected samples to sequence the ribosomal DNA. Primers and probes for P. brassicae were designed using a ribosomal DNA gene sequence from a Japanese strain available in GenBank (accession number AB526843; isolate NGY. The nuclear ribosomal DNA (rDNA sequence of P. brassicae, comprising 6932 base pairs (bp, was cloned and sequenced and found to include the small subunits (SSUs and a large subunit (LSU, internal transcribed spacers (ITS1 and ITS2, and a 5.8s. Sequence variation was observed in both the SSU and LSU. Four markers showed useful differences in high-resolution melting analysis to identify nucleotide polymorphisms including single- nucleotide polymorphisms (SNPs, oligonucleotide polymorphisms, and insertions/deletions (InDels. A combination of three markers was able to distinguish the geographical isolates into two groups.

  16. Genetic variability of Echinococcus granulosus based on the mitochondrial 16S ribosomal RNA gene.

    Science.gov (United States)

    Wang, Ning; Wang, Jiahai; Hu, Dandan; Zhong, Xiuqin; Jiang, Zhongrong; Yang, Aiguo; Deng, Shijin; Guo, Li; Tsering, Dawa; Wang, Shuxian; Gu, Xiaobin; Peng, Xuerong; Yang, Guangyou

    2015-06-01

    Echinococcus granulosus is the etiological agent of cystic echinococcosis, a major zoonotic disease of both humans and animals. In this study, we assessed genetic variability and genetic structure of E. granulosus in the Tibet plateau, using the complete mitochondrial 16 S ribosomal RNA gene for the first time. We collected and sequenced 62 isolates of E. granulosus from 3 populations in the Tibet plateau. A BLAST analysis indicated that 61 isolates belonged to E. granulosus sensu stricto (genotypes G1-G3), while one isolate belonged to E. canadensis (genotype G6). We detected 16 haplotypes with a haplotype network revealing a star-like expansion, with the most common haplotype occupying the center of the network. Haplotype diversity and nucleotide diversity were low, while negative values were observed for Tajima's D and Fu's Fs. AMOVA results and Fst values revealed that the three geographic populations were not genetically differentiated. Our results suggest that a population bottleneck or population expansion has occurred in the past, and that this explains the low genetic variability of E. granulosus in the Tibet Plateau.

  17. Mapping posttranscriptional modifications in 5S ribosomal RNA by MALDI mass spectrometry

    DEFF Research Database (Denmark)

    Kirpekar, F; Douthwaite, S; Roepstorff, P

    2000-01-01

    RNases in parallel combined with further fragmentation by Post Source Decay (PSD). This approach allows fast and sensitive screening of a purified RNA for posttranscriptional modification, and has been applied on 5S rRNA from two thermophilic microorganisms, the bacterium Bacillus stearothermophilus...... that is clearly conserved with respect to both sequence and position in B. stearothermophilus and H. halobium and to some degree also in H. marismortui. However, no analogous modification was identified in the latter three organisms. We further find that the 5' end of H. halobium 5S rRNA is dephosphorylated......, in contrast to the other 5S rRNA species investigated. The method additionally gives an immediate indication of whether the expected RNA sequence is in agreement with the observed fragment masses. Discrepancies with two of the published 5S rRNA sequences were identified and are reported here....

  18. Ribosomal RNA and nucleolar proteins from the oocyte are to some degree used for embryonic nucleolar formation in cattle and pig

    DEFF Research Database (Denmark)

    Maddox-Hyttel, Poul; Svarcova, Olga; Laurincik, Josef

    2007-01-01

    The nucleolus is the site of ribosomal RNA (rRNA) and ribosome production. In the bovine primordial follicle oocyte, this organelle is inactive, but in the secondary follicle an active fibrillo-granular nucleolus develops and proteins involved in rDNA transcription (topoisomerase I, RNA polymerase...... I and upstream binding factor) and early (fibrillarin) or late rRNA processing (nucleolin and nucleophosmin) localize to it. At the end of the oocyte growth phase, the nucleolus is inactivated again and transforms into a solid remnant. The nucleolar remnant is dissolved when meiosis is resumed. Upon...... fertilization, structures resembling the nucleolar remnant, now referred to as nucleolus precursor bodies (NPBs), are established in the pronuclei. These entities are engaged in the re-establishment of fibrilo-granular nucleoli at the major activation of the embryonic genome. This nucleolar formation can...

  19. The pleuromutilin drugs tiamulin and valnemulin bind to the RNA at the peptidyl transferase centre on the ribosome

    DEFF Research Database (Denmark)

    Poulsen, S M; Karlsson, M; Johansson, L B

    2001-01-01

    The pleuromutilin antibiotic derivatives, tiamulin and valnemulin, inhibit protein synthesis by binding to the 50S ribosomal subunit of bacteria. The action and binding site of tiamulin and valnemulin was further characterized on Escherichia coli ribosomes. It was revealed that these drugs...... centre and have been associated with binding of several antibiotics. Competitive footprinting shows that tiamulin and valnemulin can bind concurrently with the macrolide erythromycin but compete with the macrolide carbomycin, which is a peptidyl transferase inhibitor. We infer from these and previous...... results that tiamulin and valnemulin interact with the rRNA in the peptidyl transferase slot on the ribosomes in which they prevent the correct positioning of the CCA-ends of tRNAs for peptide transfer....

  20. Validation of two ribosomal RNA removal methods for microbial metatranscriptomics

    Energy Technology Data Exchange (ETDEWEB)

    He, Shaomei; Wurtzel, Omri; Singh, Kanwar; Froula, Jeff L; Yilmaz, Suzan; Tringe, Susannah G; Wang, Zhong; Chen, Feng; Lindquist, Erika A; Sorek, Rotem; Hugenholtz, Philip

    2010-10-01

    The predominance of rRNAs in the transcriptome is a major technical challenge in sequence-based analysis of cDNAs from microbial isolates and communities. Several approaches have been applied to deplete rRNAs from (meta)transcriptomes, but no systematic investigation of potential biases introduced by any of these approaches has been reported. Here we validated the effectiveness and fidelity of the two most commonly used approaches, subtractive hybridization and exonuclease digestion, as well as combinations of these treatments, on two synthetic five-microorganism metatranscriptomes using massively parallel sequencing. We found that the effectiveness of rRNA removal was a function of community composition and RNA integrity for these treatments. Subtractive hybridization alone introduced the least bias in relative transcript abundance, whereas exonuclease and in particular combined treatments greatly compromised mRNA abundance fidelity. Illumina sequencing itself also can compromise quantitative data analysis by introducing a G+C bias between runs.

  1. Profiling of Ribose Methylations in RNA by High-Throughput Sequencing

    DEFF Research Database (Denmark)

    Birkedal, Ulf; Christensen-Dalsgaard, Mikkel; Krogh, Nicolai

    2015-01-01

    (RiboMeth-seq) and its application to yeast ribosomes, presently the best-studied eukaryotic model system. We demonstrate detection of the known as well as new modifications, reveal partial modifications and unexpected communication between modification events, and determine the order of modification...... at several sites during ribosome biogenesis. Surprisingly, the method also provides information on a subset of other modifications. Hence, RiboMeth-seq enables a detailed evaluation of the importance of RNA modifications in the cells most sophisticated molecular machine. RiboMeth-seq can be adapted to other...

  2. DSAP: deep-sequencing small RNA analysis pipeline.

    Science.gov (United States)

    Huang, Po-Jung; Liu, Yi-Chung; Lee, Chi-Ching; Lin, Wei-Chen; Gan, Richie Ruei-Chi; Lyu, Ping-Chiang; Tang, Petrus

    2010-07-01

    DSAP is an automated multiple-task web service designed to provide a total solution to analyzing deep-sequencing small RNA datasets generated by next-generation sequencing technology. DSAP uses a tab-delimited file as an input format, which holds the unique sequence reads (tags) and their corresponding number of copies generated by the Solexa sequencing platform. The input data will go through four analysis steps in DSAP: (i) cleanup: removal of adaptors and poly-A/T/C/G/N nucleotides; (ii) clustering: grouping of cleaned sequence tags into unique sequence clusters; (iii) non-coding RNA (ncRNA) matching: sequence homology mapping against a transcribed sequence library from the ncRNA database Rfam (http://rfam.sanger.ac.uk/); and (iv) known miRNA matching: detection of known miRNAs in miRBase (http://www.mirbase.org/) based on sequence homology. The expression levels corresponding to matched ncRNAs and miRNAs are summarized in multi-color clickable bar charts linked to external databases. DSAP is also capable of displaying miRNA expression levels from different jobs using a log(2)-scaled color matrix. Furthermore, a cross-species comparative function is also provided to show the distribution of identified miRNAs in different species as deposited in miRBase. DSAP is available at http://dsap.cgu.edu.tw.

  3. UPF201 Archaeal Specific Family Members Reveals Structural Similarity to RNA-Binding Proteins but Low Likelihood for RNA-Binding Function

    Energy Technology Data Exchange (ETDEWEB)

    Rao, K.N.; Swaminathan, S.; Burley, S. K.

    2008-12-11

    We have determined X-ray crystal structures of four members of an archaeal specific family of proteins of unknown function (UPF0201; Pfam classification: DUF54) to advance our understanding of the genetic repertoire of archaea. Despite low pairwise amino acid sequence identities (10-40%) and the absence of conserved sequence motifs, the three-dimensional structures of these proteins are remarkably similar to one another. Their common polypeptide chain fold, encompassing a five-stranded antiparallel {beta}-sheet and five {alpha}-helices, proved to be quite unexpectedly similar to that of the RRM-type RNA-binding domain of the ribosomal L5 protein, which is responsible for binding the 5S- rRNA. Structure-based sequence alignments enabled construction of a phylogenetic tree relating UPF0201 family members to L5 ribosomal proteins and other structurally similar RNA binding proteins, thereby expanding our understanding of the evolutionary purview of the RRM superfamily. Analyses of the surfaces of these newly determined UPF0201 structures suggest that they probably do not function as RNA binding proteins, and that this domain specific family of proteins has acquired a novel function in archaebacteria, which awaits experimental elucidation.

  4. Identification of tissue-embedded ascarid larvae by ribosomal DNA sequencing.

    Science.gov (United States)

    Ishiwata, Kenji; Shinohara, Akio; Yagi, Kinpei; Horii, Yoichiro; Tsuchiya, Kimiyuki; Nawa, Yukifumi

    2004-01-01

    Polymerase chain reaction (PCR) was applied to identify tissue-embedded ascarid nematode larvae. Two sequences of the internal transcribed spacer (ITS) regions of ribosomal DNA (rDNA), ITS1 and ITS2, of the ascarid parasites were amplified and compared with those of ascarid-nematodes registered in a DNA database (GenBank). The ITS sequences of the PCR products obtained from the ascarid parasite specimen in our laboratory were compatible with those of registered adult Ascaris and Toxocara parasites. PCR amplification of the ITS regions was sensitive enough to detect a single larva of Ascaris suum mixed with porcine liver tissue. Using this method, ascarid larvae embedded in the liver of a naturally infected turkey were identified as Toxocara canis. These results suggest that even a single larva embedded in tissues from patients with larva migrans could be identified by sequencing the ITS regions.

  5. In vitro degradation of ribosomes.

    Science.gov (United States)

    Mora, G; Rivas, A

    1976-12-01

    The cytoplasmic ribosomes from Euglena gracilis var. bacillaris are found to be of two types taking into consideration their stability "in vitro". In the group of unstable ribosomes the large subunit is degraded. The other group apparently does not suffer any degradation under the conditions described. However the RNAs extracted from both types of ribosomes are degraded during sucrose density gradients. The degradation of the largest RNA species has been reported previously, but no comment has been made about the stability of the ribosome itself.

  6. Cofactors in the RNA World

    Science.gov (United States)

    Ditzler, Mark A.

    2014-01-01

    RNA world theories figure prominently in many scenarios for the origin and early evolution of life. These theories posit that RNA molecules played a much larger role in ancient biology than they do now, acting both as the dominant biocatalysts and as the repository of genetic information. Many features of modern RNA biology are potential examples of molecular fossils from an RNA world, such as the pervasive involvement of nucleotides in coenzymes, the existence of natural aptamers that bind these coenzymes, the existence of natural ribozymes, a biosynthetic pathway in which deoxynucleotides are produced from ribonucleotides, and the central role of ribosomal RNA in protein synthesis in the peptidyl transferase center of the ribosome. Here, we uses both a top-down approach that evaluates RNA function in modern biology and a bottom-up approach that examines the capacities of RNA independent of modern biology. These complementary approaches exploit multiple in vitro evolution techniques coupled with high-throughput sequencing and bioinformatics analysis. Together these complementary approaches advance our understanding of the most primitive organisms, their early evolution, and their eventual transition to modern biochemistry.

  7. Cross-species functionality of pararetroviral elements driving ribosome shunting.

    Directory of Open Access Journals (Sweden)

    Mikhail M Pooggin

    Full Text Available BACKGROUND: Cauliflower mosaic virus (CaMV and Rice tungro bacilliform virus (RTBV belong to distinct genera of pararetroviruses infecting dicot and monocot plants, respectively. In both viruses, polycistronic translation of pregenomic (pg RNA is initiated by shunting ribosomes that bypass a large region of the pgRNA leader with several short (sORFs and a stable stem-loop structure. The shunt requires translation of a 5'-proximal sORF terminating near the stem. In CaMV, mutations knocking out this sORF nearly abolish shunting and virus viability. METHODOLOGY/PRINCIPAL FINDINGS: Here we show that two distant regions of the CaMV leader that form a minimal shunt configuration comprising the sORF, a bottom part of the stem, and a shunt landing sequence can be replaced by heterologous sequences that form a structurally similar configuration in RTBV without any dramatic effect on shunt-mediated translation and CaMV infectivity. The CaMV-RTBV chimeric leader sequence was largely stable over five viral passages in turnip plants: a few alterations that did eventually occur in the virus progenies are indicative of fine tuning of the chimeric sequence during adaptation to a new host. CONCLUSIONS/SIGNIFICANCE: Our findings demonstrate cross-species functionality of pararetroviral cis-elements driving ribosome shunting and evolutionary conservation of the shunt mechanism. We are grateful to Matthias Müller and Sandra Pauli for technical assistance. This work was initiated at Friedrich Miescher Institute (Basel, Switzerland. We thank Prof. Thomas Boller for hosting the group at the Institute of Botany.

  8. Single-Cell RNA-Sequencing Reveals a Continuous Spectrum of Differentiation in Hematopoietic Cells

    Directory of Open Access Journals (Sweden)

    Iain C. Macaulay

    2016-02-01

    Full Text Available The transcriptional programs that govern hematopoiesis have been investigated primarily by population-level analysis of hematopoietic stem and progenitor cells, which cannot reveal the continuous nature of the differentiation process. Here we applied single-cell RNA-sequencing to a population of hematopoietic cells in zebrafish as they undergo thrombocyte lineage commitment. By reconstructing their developmental chronology computationally, we were able to place each cell along a continuum from stem cell to mature cell, refining the traditional lineage tree. The progression of cells along this continuum is characterized by a highly coordinated transcriptional program, displaying simultaneous suppression of genes involved in cell proliferation and ribosomal biogenesis as the expression of lineage specific genes increases. Within this program, there is substantial heterogeneity in the expression of the key lineage regulators. Overall, the total number of genes expressed, as well as the total mRNA content of the cell, decreases as the cells undergo lineage commitment.

  9. Sequence of a cloned cDNA encoding human ribosomal protein S11

    Energy Technology Data Exchange (ETDEWEB)

    Lott, J B; Mackie, G A

    1988-02-11

    The authors have isolated a cloned cDNA that encodes human ribosomal protein (rp) S11 by screening a human fibroblast cDNA library with a labelled 204 bp DNA fragment encompassing residues 212-416 of pRS11, a rat rp Sll cDNA clone. The human rp S11 cloned cDNA consists of 15 residues of the 5' leader, the entire coding sequence and all 51 residues of the 3' untranslated region. The predicted amino acid sequence of 158 residues is identical to rat rpS11. The nucleotide sequence in the coding region differs, however, from that in rat in the first position in two codons and in the third position in 44 codons.

  10. Structure of Ribosomal Silencing Factor Bound to Mycobacterium tuberculosis Ribosome.

    Science.gov (United States)

    Li, Xiaojun; Sun, Qingan; Jiang, Cai; Yang, Kailu; Hung, Li-Wei; Zhang, Junjie; Sacchettini, James C

    2015-10-06

    The ribosomal silencing factor RsfS slows cell growth by inhibiting protein synthesis during periods of diminished nutrient availability. The crystal structure of Mycobacterium tuberculosis (Mtb) RsfS, together with the cryo-electron microscopy (EM) structure of the large subunit 50S of Mtb ribosome, reveals how inhibition of protein synthesis by RsfS occurs. RsfS binds to the 50S at L14, which, when occupied, blocks the association of the small subunit 30S. Although Mtb RsfS is a dimer in solution, only a single subunit binds to 50S. The overlap between the dimer interface and the L14 binding interface confirms that the RsfS dimer must first dissociate to a monomer in order to bind to L14. RsfS interacts primarily through electrostatic and hydrogen bonding to L14. The EM structure shows extended rRNA density that it is not found in the Escherichia coli ribosome, the most striking of these being the extended RNA helix of H54a. Copyright © 2015 Elsevier Ltd. All rights reserved.

  11. Ribosomal studies on the 70S ribosome of E.coli by means of neutron scattering

    International Nuclear Information System (INIS)

    Burkhardt, N.

    1997-01-01

    Ribosomes are ribonucleo-protein complexes, which catalyse proteinbiosynthesis in all living organisms. Currently, most of the structural models of the prokaryotic 70S ribosome rely on electron microscopy and describe mainly the outer shape of the particle. Neutron scattering can provide information on the internal structure of the ribosome. Parts of the structure can be contrasted for neutrons by means of an isotopic exchange of the naturally occurring hydrogen ( 1 H) for deuterium ( 2 H), allowing direct measurements in situ. Specifically deuterium-labeled ribosomes (E. coli) were prepared and analysed with neutron scattering. The biochemical methods were established and combined to a generally applicable preparation system. This allows labeling of all ribosomal components in any combination. A systematic analysis of the protein and RNA phases resulted in the development of a new model for the 70S ribosome. This model describes not only the outer shape of the particle, but displays also an experimentally determined internal protein-RNA distribution and the border of subunits for the first time (four-phase model; resolution: 50A). Models of the 70S ribosome from other studies were evaluated and ranked according to consistency with the measured scattering data. Applying a new neutron scattering technique of particular sensitivity, the proton-spin contrast-variation, single proteins could be measured and localized. The positions of the proteins S6 and S10 were determined, providing the first coordinates of protein mass centers within the 70S ribosome. (orig.) [de

  12. Engineered ribosomal RNA operon copy-number variants of E. coli reveal the evolutionary trade-offs shaping rRNA operon number

    Science.gov (United States)

    Gyorfy, Zsuzsanna; Draskovits, Gabor; Vernyik, Viktor; Blattner, Frederick F.; Gaal, Tamas; Posfai, Gyorgy

    2015-01-01

    Ribosomal RNA (rrn) operons, characteristically present in several copies in bacterial genomes (7 in E. coli), play a central role in cellular physiology. We investigated the factors determining the optimal number of rrn operons in E. coli by constructing isogenic variants with 5–10 operons. We found that the total RNA and protein content, as well as the size of the cells reflected the number of rrn operons. While growth parameters showed only minor differences, competition experiments revealed a clear pattern: 7–8 copies were optimal under conditions of fluctuating, occasionally rich nutrient influx and lower numbers were favored in stable, nutrient-limited environments. We found that the advantages of quick adjustment to nutrient availability, rapid growth and economic regulation of ribosome number all contribute to the selection of the optimal rrn operon number. Our results suggest that the wt rrn operon number of E. coli reflects the natural, ‘feast and famine’ life-style of the bacterium, however, different copy numbers might be beneficial under different environmental conditions. Understanding the impact of the copy number of rrn operons on the fitness of the cell is an important step towards the creation of functional and robust genomes, the ultimate goal of synthetic biology. PMID:25618851

  13. Sequence analysis of mitochondrial 16S ribosomal RNA gene ...

    Indian Academy of Sciences (India)

    Unknown

    For the understanding of their vectorial capacity, identification of disease carrying and refractory strains is essential. ... been widely used for phylogenetic studies and sequence differences in ... In order to fill up the internal gap, a new set.

  14. Placeholder factors in ribosome biogenesis: please, pave my way

    Directory of Open Access Journals (Sweden)

    Francisco J. Espinar-Marchena

    2017-04-01

    Full Text Available The synthesis of cytoplasmic eukaryotic ribosomes is an extraordinarily energy-demanding cellular activity that occurs progressively from the nucleolus to the cytoplasm. In the nucleolus, precursor rRNAs associate with a myriad of trans-acting factors and some ribosomal proteins to form pre-ribosomal particles. These factors include snoRNPs, nucleases, ATPases, GTPases, RNA helicases, and a vast list of proteins with no predicted enzymatic activity. Their coordinate activity orchestrates in a spatiotemporal manner the modification and processing of precursor rRNAs, the rearrangement reactions required for the formation of productive RNA folding intermediates, the ordered assembly of the ribosomal proteins, and the export of pre-ribosomal particles to the cytoplasm; thus, providing speed, directionality and accuracy to the overall process of formation of translation-competent ribosomes. Here, we review a particular class of trans-acting factors known as “placeholders”. Placeholder factors temporarily bind selected ribosomal sites until these have achieved a structural context that is appropriate for exchanging the placeholder with another site-specific binding factor. By this strategy, placeholders sterically prevent premature recruitment of subsequently binding factors, premature formation of structures, avoid possible folding traps, and act as molecular clocks that supervise the correct progression of pre-ribosomal particles into functional ribosomal subunits. We summarize the current understanding of those factors that delay the assembly of distinct ribosomal proteins or subsequently bind key sites in pre-ribosomal particles. We also discuss recurrent examples of RNA-protein and protein-protein mimicry between rRNAs and/or factors, which have clear functional implications for the ribosome biogenesis pathway.

  15. RNA-Pareto: interactive analysis of Pareto-optimal RNA sequence-structure alignments.

    Science.gov (United States)

    Schnattinger, Thomas; Schöning, Uwe; Marchfelder, Anita; Kestler, Hans A

    2013-12-01

    Incorporating secondary structure information into the alignment process improves the quality of RNA sequence alignments. Instead of using fixed weighting parameters, sequence and structure components can be treated as different objectives and optimized simultaneously. The result is not a single, but a Pareto-set of equally optimal solutions, which all represent different possible weighting parameters. We now provide the interactive graphical software tool RNA-Pareto, which allows a direct inspection of all feasible results to the pairwise RNA sequence-structure alignment problem and greatly facilitates the exploration of the optimal solution set.

  16. Mapping posttranscriptional modifications in 5S ribosomal RNA by MALDI mass spectrometry.

    Science.gov (United States)

    Kirpekar, F; Douthwaite, S; Roepstorff, P

    2000-02-01

    We present a method to screen RNA for posttranscriptional modifications based on Matrix Assisted Laser Desorption/Ionization mass spectrometry (MALDI-MS). After the RNA is digested to completion with a nucleotide-specific RNase, the fragments are analyzed by mass spectrometry. A comparison of the observed mass data with the data predicted from the gene sequence identifies fragments harboring modified nucleotides. Fragments larger than dinucleotides were valuable for the identification of posttranscriptional modifications. A more refined mapping of RNA modifications can be obtained by using two RNases in parallel combined with further fragmentation by Post Source Decay (PSD). This approach allows fast and sensitive screening of a purified RNA for posttranscriptional modification, and has been applied on 5S rRNA from two thermophilic microorganisms, the bacterium Bacillus stearothermophilus and the archaeon Sulfolobus acidocaldarius, as well as the halophile archaea Halobacterium halobium and Haloarcula marismortui. One S. acidocaldarius posttranscriptional modification was identified and was further characterized by PSD as a methylation of cytidine32. The modified C is located in a region that is clearly conserved with respect to both sequence and position in B. stearothermophilus and H. halobium and to some degree also in H. marismortui. However, no analogous modification was identified in the latter three organisms. We further find that the 5' end of H. halobium 5S rRNA is dephosphorylated, in contrast to the other 5S rRNA species investigated. The method additionally gives an immediate indication of whether the expected RNA sequence is in agreement with the observed fragment masses. Discrepancies with two of the published 5S rRNA sequences were identified and are reported here.

  17. The AAA-ATPase NVL2 is a component of pre-ribosomal particles that interacts with the DExD/H-box RNA helicase DOB1

    International Nuclear Information System (INIS)

    Nagahama, Masami; Yamazoe, Takeshi; Hara, Yoshimitsu; Tani, Katsuko; Tsuji, Akihiko; Tagaya, Mitsuo

    2006-01-01

    Nuclear VCP/p97-like protein 2 (NVL2) is a member of the chaperone-like AAA-ATPase family with two conserved ATP-binding modules. Our previous studies have shown that NVL2 is localized to the nucleolus by interacting with ribosomal protein L5 and may participate in ribosome synthesis, a process involving various non-ribosomal factors including chaperones and RNA helicases. Here, we show that NVL2 is associated with pre-ribosomal particles in the nucleus. Moreover, we used yeast two-hybrid and co-immunoprecipitation assays to identify an NVL2-interacting protein that could yield insights into NVL2 function in ribosome biogenesis. We found that NVL2 interacts with DOB1, a DExD/H-box RNA helicase, whose yeast homologue functions in a late stage of the 60S subunit synthesis. DOB1 can interact with a second ATP-binding module mutant of NVL2, which shows a dominant negative effect on ribosome synthesis. In contrast, it cannot interact with a first ATP-binding module mutant, which does not show the dominant negative effect. When the dominant negative mutant of NVL2 was overexpressed in cells, DOB1 appeared to remain associated with nuclear pre-ribosomal particles. Such accumulation was not observed upon overexpression of wild-type NVL2 or a nondominant-negative mutant. Taken together, our results suggest that NVL2 might regulate the association/dissociation reaction of DOB1 with pre-ribosomal particles by acting as a molecular chaperone

  18. 5SRNAdb: an information resource for 5S ribosomal RNAs.

    Science.gov (United States)

    Szymanski, Maciej; Zielezinski, Andrzej; Barciszewski, Jan; Erdmann, Volker A; Karlowski, Wojciech M

    2016-01-04

    Ribosomal 5S RNA (5S rRNA) is the ubiquitous RNA component found in the large subunit of ribosomes in all known organisms. Due to its small size, abundance and evolutionary conservation 5S rRNA for many years now is used as a model molecule in studies on RNA structure, RNA-protein interactions and molecular phylogeny. 5SRNAdb (http://combio.pl/5srnadb/) is the first database that provides a high quality reference set of ribosomal 5S RNAs (5S rRNA) across three domains of life. Here, we give an overview of new developments in the database and associated web tools since 2002, including updates to database content, curation processes and user web interfaces. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  19. Ribosomal studies on the 70S ribosome of E.coli by means of neutron scattering; Strukturuntersuchungen am 70S-Ribosom von E.coli unter Anwendung von Neutronenstreuung

    Energy Technology Data Exchange (ETDEWEB)

    Burkhardt, N. [GKSS-Forschungszentrum Geesthacht GmbH (Germany). Inst. fuer Werkstofforschung

    1997-12-31

    Ribosomes are ribonucleo-protein complexes, which catalyse proteinbiosynthesis in all living organisms. Currently, most of the structural models of the prokaryotic 70S ribosome rely on electron microscopy and describe mainly the outer shape of the particle. Neutron scattering can provide information on the internal structure of the ribosome. Parts of the structure can be contrasted for neutrons by means of an isotopic exchange of the naturally occurring hydrogen ({sup 1}H) for deuterium ({sup 2}H), allowing direct measurements in situ. Specifically deuterium-labeled ribosomes (E. coli) were prepared and analysed with neutron scattering. The biochemical methods were established and combined to a generally applicable preparation system. This allows labeling of all ribosomal components in any combination. A systematic analysis of the protein and RNA phases resulted in the development of a new model for the 70S ribosome. This model describes not only the outer shape of the particle, but displays also an experimentally determined internal protein-RNA distribution and the border of subunits for the first time (four-phase model; resolution: 50A). Models of the 70S ribosome from other studies were evaluated and ranked according to consistency with the measured scattering data. Applying a new neutron scattering technique of particular sensitivity, the proton-spin contrast-variation, single proteins could be measured and localized. The positions of the proteins S6 and S10 were determined, providing the first coordinates of protein mass centers within the 70S ribosome. (orig.) [Deutsch] Ribosomen sind Ribonukleinsaeure-Protein Komplexe, die in allen lebenden Organismen die Proteinbiosynthese katalysieren. Strukturmodelle fuer das prokaryontische 70S-Ribosom beruhen derzeit vorwiegend auf elektronenmikroskopischen Untersuchungen und beschreiben im wesentlichen die aeussere Oberflaeche des Partikels. Informationen ueber die innere Struktur des Ribosoms koennen Messungen mit

  20. Ribosomal studies on the 70S ribosome of E.coli by means of neutron scattering; Strukturuntersuchungen am 70S-Ribosom von E.coli unter Anwendung von Neutronenstreuung

    Energy Technology Data Exchange (ETDEWEB)

    Burkhardt, N [GKSS-Forschungszentrum Geesthacht GmbH (Germany). Inst. fuer Werkstofforschung

    1998-12-31

    Ribosomes are ribonucleo-protein complexes, which catalyse proteinbiosynthesis in all living organisms. Currently, most of the structural models of the prokaryotic 70S ribosome rely on electron microscopy and describe mainly the outer shape of the particle. Neutron scattering can provide information on the internal structure of the ribosome. Parts of the structure can be contrasted for neutrons by means of an isotopic exchange of the naturally occurring hydrogen ({sup 1}H) for deuterium ({sup 2}H), allowing direct measurements in situ. Specifically deuterium-labeled ribosomes (E. coli) were prepared and analysed with neutron scattering. The biochemical methods were established and combined to a generally applicable preparation system. This allows labeling of all ribosomal components in any combination. A systematic analysis of the protein and RNA phases resulted in the development of a new model for the 70S ribosome. This model describes not only the outer shape of the particle, but displays also an experimentally determined internal protein-RNA distribution and the border of subunits for the first time (four-phase model; resolution: 50A). Models of the 70S ribosome from other studies were evaluated and ranked according to consistency with the measured scattering data. Applying a new neutron scattering technique of particular sensitivity, the proton-spin contrast-variation, single proteins could be measured and localized. The positions of the proteins S6 and S10 were determined, providing the first coordinates of protein mass centers within the 70S ribosome. (orig.) [Deutsch] Ribosomen sind Ribonukleinsaeure-Protein Komplexe, die in allen lebenden Organismen die Proteinbiosynthese katalysieren. Strukturmodelle fuer das prokaryontische 70S-Ribosom beruhen derzeit vorwiegend auf elektronenmikroskopischen Untersuchungen und beschreiben im wesentlichen die aeussere Oberflaeche des Partikels. Informationen ueber die innere Struktur des Ribosoms koennen Messungen mit

  1. Studies on the catalytic rate constant of ribosomal peptidyltransferase.

    Science.gov (United States)

    Synetos, D; Coutsogeorgopoulos, C

    1987-02-20

    A detailed kinetic analysis of a model reaction for the ribosomal peptidyltransferase is described, using fMet-tRNA or Ac-Phe-tRNA as the peptidyl donor and puromycin as the acceptor. The initiation complex (fMet-tRNA X AUG X 70 S ribosome) or (Ac-Phe-tRNA X poly(U) X 70 S ribosome) (complex C) is isolated and then reacted with excess puromycin (S) to give fMet-puromycin or Ac-Phe-puromycin. This reaction (puromycin reaction) is first order at all concentrations of S tested. An important asset of this kinetic analysis is the fact that the relationship between the first order rate constant kobs and [S] shows hyperbolic saturation and that the value of kobs at saturating [S] is a measure of the catalytic rate constant (k cat) of peptidyltransferase in the puromycin reaction. With fMet-tRNA as the donor, this kcat of peptidyltransferase is 8.3 min-1 when the 0.5 M NH4Cl ribosomal wash is present, compared to 3.8 min-1 in its absence. The kcat of peptidyltransferase is 2.0 min-1 when Ac-Phe-tRNA replaces fMet-tRNA in the presence of the ribosomal wash and decreases to 0.8 min-1 in its absence. This kinetic procedure is the best method available for evaluating changes in the activity of peptidyltransferase in vitro. The results suggest that peptidyltransferase is subjected to activation by the binding of fMet-tRNA to the 70 S initiation complex.

  2. Sequence analysis of mitochondrial 16S ribosomal RNA gene

    Indian Academy of Sciences (India)

    Mosquitoes are vectors for the transmission of many human pathogens that include viruses, nematodes and protozoa. For the understanding of their vectorial capacity, identification of disease carrying and refractory strains is essential. Recently, molecular taxonomic techniques have been utilized for this purpose. Sequence ...

  3. Structural and functional implications in the eubacterial ribosome as revealed by protein-rRNA and antibiotic contact sites.

    Science.gov (United States)

    Wittmann-Liebold, B; Uhlein, M; Urlaub, H; Müller, E C; Otto, A; Bischof, O

    1995-01-01

    Contact sites between protein and rRNA in 30S and 50S ribosomal subunits of Escherichia coli and Bacillus stearothermophilus were investigated at the molecular level using UV and 2-iminothiolane as cross-linkers. Thirteen ribosomal proteins (S3, S4, S7, S14, S17, L2, L4, L6, L14, L27, L28, L29, and L36) from these organisms were cross-linked in direct contact with the RNAs, and the peptide stretches as well as amino acids involved were identified. Further, the binding sites of puromycin and spiramycin were established at the peptide level in several proteins that were found to constitute the antibiotic-binding sites. Peptide stretches of puromycin binding were identified from proteins S7, S14, S18, L18, AND L29; those of spiramycin attachment were derived from proteins S12, S14, L17, L18, L27, and L35. Comparison of the RNA-peptide contact sites with the peptides identified for antibiotic binding and with those altered in antibiotic-resistant mutants clearly showed identical peptide areas to be involved and, hence, demonstrated the functional importance of these peptides. Further evidence for a functional implication of ribosomal proteins in the translational process came from complementation experiments in which protein L2 from Halobacterium marismortui was incorporated into the E. coli ribosomes that were active. The incorporated protein was present in 50S subunits and 70S particles, in disomes, and in higher polysomes. These results clearly demonstrate the functional implication of protein L2 in protein biosynthesis. Incorporation studies with a mutant of HmaL2 with a replacement of histidine-229 by glycine completely abolished the functional activity of the ribosome. Accordingly, protein L2 with histidine-229 is a crucial element of the translational machinery.

  4. A computational investigation on the connection between dynamics properties of ribosomal proteins and ribosome assembly.

    Directory of Open Access Journals (Sweden)

    Brittany Burton

    Full Text Available Assembly of the ribosome from its protein and RNA constituents has been studied extensively over the past 50 years, and experimental evidence suggests that prokaryotic ribosomal proteins undergo conformational changes during assembly. However, to date, no studies have attempted to elucidate these conformational changes. The present work utilizes computational methods to analyze protein dynamics and to investigate the linkage between dynamics and binding of these proteins during the assembly of the ribosome. Ribosomal proteins are known to be positively charged and we find the percentage of positive residues in r-proteins to be about twice that of the average protein: Lys+Arg is 18.7% for E. coli and 21.2% for T. thermophilus. Also, positive residues constitute a large proportion of RNA contacting residues: 39% for E. coli and 46% for T. thermophilus. This affirms the known importance of charge-charge interactions in the assembly of the ribosome. We studied the dynamics of three primary proteins from E. coli and T. thermophilus 30S subunits that bind early in the assembly (S15, S17, and S20 with atomic molecular dynamic simulations, followed by a study of all r-proteins using elastic network models. Molecular dynamics simulations show that solvent-exposed proteins (S15 and S17 tend to adopt more stable solution conformations than an RNA-embedded protein (S20. We also find protein residues that contact the 16S rRNA are generally more mobile in comparison with the other residues. This is because there is a larger proportion of contacting residues located in flexible loop regions. By the use of elastic network models, which are computationally more efficient, we show that this trend holds for most of the 30S r-proteins.

  5. Crystallization of the two-domain N-terminal fragment of the archaeal ribosomal protein L10(P0) in complex with a specific fragment of 23S rRNA

    Science.gov (United States)

    Kravchenko, O. V.; Mitroshin, I. V.; Gabdulkhakov, A. G.; Nikonov, S. V.; Garber, M. B.

    2011-07-01

    Lateral L12-stalk (P1-stalk in Archaea, P1/P2-stalk in eukaryotes) is an obligatory morphological element of large ribosomal subunits in all organisms studied. This stalk is composed of the complex of ribosomal proteins L10(P0) and L12(P1) and interacts with 23S rRNA through the protein L10(P0). L12(P1)-stalk is involved in the formation of GTPase center of the ribosome and plays an important role in the ribosome interaction with translation factors. High mobility of this stalk puts obstacles in determination of its structure within the intact ribosome. Crystals of a two-domain N-terminal fragment of ribosomal protein L10(P0) from the archaeon Methanococcus jannaschii in complex with a specific fragment of rRNA from the same organism have been obtained. The crystals diffract X-rays at 3.2 Å resolution.

  6. Crystallization of the two-domain N-terminal fragment of the archaeal ribosomal protein L10(P0) in complex with a specific fragment of 23S rRNA

    Energy Technology Data Exchange (ETDEWEB)

    Kravchenko, O. V.; Mitroshin, I. V.; Gabdulkhakov, A. G.; Nikonov, S. V.; Garber, M. B., E-mail: garber@vega.protres.ru [Institute of Protein Research RAS (Russian Federation)

    2011-07-15

    Lateral L12-stalk (P1-stalk in Archaea, P1/P2-stalk in eukaryotes) is an obligatory morphological element of large ribosomal subunits in all organisms studied. This stalk is composed of the complex of ribosomal proteins L10(P0) and L12(P1) and interacts with 23S rRNA through the protein L10(P0). L12(P1)-stalk is involved in the formation of GTPase center of the ribosome and plays an important role in the ribosome interaction with translation factors. High mobility of this stalk puts obstacles in determination of its structure within the intact ribosome. Crystals of a two-domain N-terminal fragment of ribosomal protein L10(P0) from the archaeon Methanococcus jannaschii in complex with a specific fragment of rRNA from the same organism have been obtained. The crystals diffract X-rays at 3.2 Angstrom-Sign resolution.

  7. TaxCollector: Modifying Current 16S rRNA Databases for the Rapid Classification at Six Taxonomic Levels

    Directory of Open Access Journals (Sweden)

    Eric W. Triplett

    2010-07-01

    Full Text Available The high level of conservation of 16S ribosomal RNA gene (16S rRNA in all Prokaryotes makes this gene an ideal tool for the rapid identification and classification of these microorganisms. Databases such as the Ribosomal Database Project II (RDP-II and the Greengenes Project offer access to sets of ribosomal RNA sequence databases useful in identification of microbes in a culture-independent analysis of microbial communities. However, these databases do not contain all of the taxonomic levels attached to the published names of the bacterial and archaeal sequences. TaxCollector is a set of scripts developed in Python language that attaches taxonomic information to all 16S rRNA sequences in the RDP-II and Greengenes databases. These modified databases are referred to as TaxCollector databases, which when used in conjunction with BLAST allow for rapid classification of sequences from any environmental or clinical source at six different taxonomic levels, from domain to species. The TaxCollector database prepared from the RDP-II database is an important component of a new 16S rRNA pipeline called PANGEA. The usefulness of TaxCollector databases is demonstrated with two very different datasets obtained using samples from a clinical setting and an agricultural soil. The six TaxCollector scripts are freely available on http://taxcollector.sourceforge.net and on http://www.microgator.org.

  8. Virtual Ribosome - a comprehensive DNA translation tool with support for integration of sequence feature annotation

    DEFF Research Database (Denmark)

    Wernersson, Rasmus

    2006-01-01

    of alternative start codons. ( ii) Integration of sequences feature annotation - in particular, native support for working with files containing intron/ exon structure annotation. The software is available for both download and online use at http://www.cbs.dtu.dk/services/VirtualRibosome/....

  9. Simulation and analysis of single-ribosome translation

    International Nuclear Information System (INIS)

    Tinoco, Ignacio Jr; Wen, Jin-Der

    2009-01-01

    In the cell, proteins are synthesized by ribosomes in a multi-step process called translation. The ribosome translocates along the messenger RNA to read the codons that encode the amino acid sequence of a protein. Elongation factors, including EF-G and EF-Tu, are used to catalyze the process. Recently, we have shown that translation can be followed at the single-molecule level using optical tweezers; this technique allows us to study the kinetics of translation by measuring the lifetime the ribosome spends at each codon. Here, we analyze the data from single-molecule experiments and fit the data with simple kinetic models. We also simulate the translation kinetics based on a multi-step mechanism from ensemble kinetic measurements. The mean lifetimes from the simulation were consistent with our experimental single-molecule measurements. We found that the calculated lifetime distributions were fit in general by equations with up to five rate-determining steps. Two rate-determining steps were only obtained at low concentrations of elongation factors. These analyses can be used to design new single-molecule experiments to better understand the kinetics and mechanism of translation

  10. Reconstruction of ribosomal RNA genes from metagenomic data.

    Directory of Open Access Journals (Sweden)

    Lu Fan

    Full Text Available Direct sequencing of environmental DNA (metagenomics has a great potential for describing the 16S rRNA gene diversity of microbial communities. However current approaches using this 16S rRNA gene information to describe community diversity suffer from low taxonomic resolution or chimera problems. Here we describe a new strategy that involves stringent assembly and data filtering to reconstruct full-length 16S rRNA genes from metagenomicpyrosequencing data. Simulations showed that reconstructed 16S rRNA genes provided a true picture of the community diversity, had minimal rates of chimera formation and gave taxonomic resolution down to genus level. The strategy was furthermore compared to PCR-based methods to determine the microbial diversity in two marine sponges. This showed that about 30% of the abundant phylotypes reconstructed from metagenomic data failed to be amplified by PCR. Our approach is readily applicable to existing metagenomic datasets and is expected to lead to the discovery of new microbial phylotypes.

  11. Further characterization of ribosome binding to thylakoid membranes

    International Nuclear Information System (INIS)

    Hurewitz, J.; Jagendorf, A.T.

    1987-01-01

    Previous work indicated more polysomes bound to pea (Pisum sativum cv Progress No. 9) thylakoids in light than in the dark, in vivo. With isolated intact chloroplasts incubated in darkness, addition of MgATP had no effect but 24 to 74% more RNA was thylakoid-bound at pH 8.3 than at pH 7. Thus, the major effect of light on ribosome-binding in vivo may be due to higher stroma pH. In isolated pea chloroplasts, initiation inhibitors (pactamycin and kanamycin) decreased the extent of RNA binding, and elongation inhibitors (lincomycin and streptomycin) increased it. Thus, cycling of ribosomes is controlled by translation, initiation, and termination. Bound RNA accounted for 19 to 24% of the total chloroplast RNA and the incorporation of [ 3 H]leucine into thylakoids was proportional to the amount of this bound RNA. These data support the concept that stroma ribosomes are recruited into thylakoid polysomes, which are active in synthesizing thylakoid proteins

  12. Nuclear ribosomal internal transcribed spacer (ITS) region as a universal DNA barcode marker for Fungi.

    Science.gov (United States)

    Schoch, Conrad L; Seifert, Keith A; Huhndorf, Sabine; Robert, Vincent; Spouge, John L; Levesque, C André; Chen, Wen

    2012-04-17

    Six DNA regions were evaluated as potential DNA barcodes for Fungi, the second largest kingdom of eukaryotic life, by a multinational, multilaboratory consortium. The region of the mitochondrial cytochrome c oxidase subunit 1 used as the animal barcode was excluded as a potential marker, because it is difficult to amplify in fungi, often includes large introns, and can be insufficiently variable. Three subunits from the nuclear ribosomal RNA cistron were compared together with regions of three representative protein-coding genes (largest subunit of RNA polymerase II, second largest subunit of RNA polymerase II, and minichromosome maintenance protein). Although the protein-coding gene regions often had a higher percent of correct identification compared with ribosomal markers, low PCR amplification and sequencing success eliminated them as candidates for a universal fungal barcode. Among the regions of the ribosomal cistron, the internal transcribed spacer (ITS) region has the highest probability of successful identification for the broadest range of fungi, with the most clearly defined barcode gap between inter- and intraspecific variation. The nuclear ribosomal large subunit, a popular phylogenetic marker in certain groups, had superior species resolution in some taxonomic groups, such as the early diverging lineages and the ascomycete yeasts, but was otherwise slightly inferior to the ITS. The nuclear ribosomal small subunit has poor species-level resolution in fungi. ITS will be formally proposed for adoption as the primary fungal barcode marker to the Consortium for the Barcode of Life, with the possibility that supplementary barcodes may be developed for particular narrowly circumscribed taxonomic groups.

  13. Characterization of four species of Trichuris (Nematoda: Enoplida) by their second internal transcribed spacer ribosomal DNA sequence.

    Science.gov (United States)

    Oliveros, R; Cutillas, C; De Rojas, M; Arias, P

    2000-12-01

    Adult worms of Trichuris ovis and T. globulosa were collected from Ovis aries (sheep) and Capra hircus (goats). T. suis was isolated from Sus scrofa domestica (swine) and T. leporis was isolated from Lepus europaeus (rabbits) in Spain. Genomic DNA was isolated and a ribosomal internal transcribed spacer (ITS2) was amplified and sequenced using polymerase-chain-reaction (PCR) techniques. The ITS2 of T. ovis and T. globulosa was 407 nucleotides in length and had a GC content of about 62%. Furthermore, the ITS2 of T. suis and T. leporis was 534 and 418 nucleotides in length and had a GC content of about 64.8% and 62.4%, respectively. There was evidence of slight variation in the sequence within individuals of all species analyzed, indicating intraindividual variation in the sequence of different copies of the ribosomal DNA. Furthermore, low-level intraspecific variation was detected. Sequence analyses of ITS2 products of T. ovis and T. globulosa demonstrated no sequence difference between them. Nevertheless, differences were detected between the ITS2 sequences of T. suis, T. leporis, and T. ovis, indicating that Trichuris species can reliably be differentiated by their ITS2 sequences and PCR-linked restriction-fragment-length polymorphism (RFLP).

  14. Mitochondrial genome evolution in Alismatales: Size reduction and extensive loss of ribosomal protein genes

    DEFF Research Database (Denmark)

    Petersen, Gitte; Cuenca, Argelia; Zervas, Athanasios

    2017-01-01

    The order Alismatales is a hotspot for evolution of plant mitochondrial genomes characterized by remarkable differences in genome size, substitution rates, RNA editing, retrotranscription, gene loss and intron loss. Here we have sequenced the complete mitogenomes of Zostera marina and Stratiotes...... aloides, which together with previously sequenced mitogenomes from Butomus and Spirodela, provide new evolutionary evidence of genome size reduction, gene loss and transfer to the nucleus. The Zostera mitogenome includes a large portion of DNA transferred from the plastome, yet it is the smallest known...... mitogenome from a non-parasitic plant. Using a broad sample of the Alismatales, the evolutionary history of ribosomal protein gene loss is analyzed. In Zostera almost all ribosomal protein genes are lost from the mitogenome, but only some can be found in the nucleus....

  15. Ribosomal protein methyltransferases in the yeast Saccharomyces cerevisiae: Roles in ribosome biogenesis and translation.

    Science.gov (United States)

    Al-Hadid, Qais; White, Jonelle; Clarke, Steven

    2016-02-12

    A significant percentage of the methyltransferasome in Saccharomyces cerevisiae and higher eukaryotes is devoted to methylation of the translational machinery. Methylation of the RNA components of the translational machinery has been studied extensively and is important for structure stability, ribosome biogenesis, and translational fidelity. However, the functional effects of ribosomal protein methylation by their cognate methyltransferases are still largely unknown. Previous work has shown that the ribosomal protein Rpl3 methyltransferase, histidine protein methyltransferase 1 (Hpm1), is important for ribosome biogenesis and translation elongation fidelity. In this study, yeast strains deficient in each of the ten ribosomal protein methyltransferases in S. cerevisiae were examined for potential defects in ribosome biogenesis and translation. Like Hpm1-deficient cells, loss of four of the nine other ribosomal protein methyltransferases resulted in defects in ribosomal subunit synthesis. All of the mutant strains exhibited resistance to the ribosome inhibitors anisomycin and/or cycloheximide in plate assays, but not in liquid culture. Translational fidelity assays measuring stop codon readthrough, amino acid misincorporation, and programmed -1 ribosomal frameshifting, revealed that eight of the ten enzymes are important for translation elongation fidelity and the remaining two are necessary for translation termination efficiency. Altogether, these results demonstrate that ribosomal protein methyltransferases in S. cerevisiae play important roles in ribosome biogenesis and translation. Copyright © 2016 Elsevier Inc. All rights reserved.

  16. Metaxa: a software tool for automated detection and discrimination among ribosomal small subunit (12S/16S/18S) sequences of archaea, bacteria, eukaryotes, mitochondria, and chloroplasts in metagenomes and environmental sequencing datasets.

    Science.gov (United States)

    Bengtsson, Johan; Eriksson, K Martin; Hartmann, Martin; Wang, Zheng; Shenoy, Belle Damodara; Grelet, Gwen-Aëlle; Abarenkov, Kessy; Petri, Anna; Rosenblad, Magnus Alm; Nilsson, R Henrik

    2011-10-01

    The ribosomal small subunit (SSU) rRNA gene has emerged as an important genetic marker for taxonomic identification in environmental sequencing datasets. In addition to being present in the nucleus of eukaryotes and the core genome of prokaryotes, the gene is also found in the mitochondria of eukaryotes and in the chloroplasts of photosynthetic eukaryotes. These three sets of genes are conceptually paralogous and should in most situations not be aligned and analyzed jointly. To identify the origin of SSU sequences in complex sequence datasets has hitherto been a time-consuming and largely manual undertaking. However, the present study introduces Metaxa ( http://microbiology.se/software/metaxa/ ), an automated software tool to extract full-length and partial SSU sequences from larger sequence datasets and assign them to an archaeal, bacterial, nuclear eukaryote, mitochondrial, or chloroplast origin. Using data from reference databases and from full-length organelle and organism genomes, we show that Metaxa detects and scores SSU sequences for origin with very low proportions of false positives and negatives. We believe that this tool will be useful in microbial and evolutionary ecology as well as in metagenomics.

  17. Ribosomal protein L5 has a highly twisted concave surface and flexible arms responsible for rRNA binding.

    Science.gov (United States)

    Nakashima, T; Yao, M; Kawamura, S; Iwasaki, K; Kimura, M; Tanaka, I

    2001-05-01

    Ribosomal protein L5 is a 5S rRNA binding protein in the large subunit and plays an essential role in the promotion of a particular conformation of 5S rRNA. The crystal structure of the ribosomal protein L5 from Bacillus stearothermophilus has been determined at 1.8 A resolution. The molecule consists of a five-stranded antiparallel beta-sheet and four alpha-helices, which fold in a way that is topologically similar to the ribonucleoprotein (RNP) domain. The molecular shape and electrostatic representation suggest that the concave surface and loop regions are involved in 5S rRNA binding. To identify amino acid residues responsible for 5S rRNA binding, we made use of Ala-scanning mutagenesis of evolutionarily conserved amino acids occurring in the beta-strands and loop regions. The mutations of Asn37 at the beta1-strand and Gln63 at the loop between helix 2 and beta3-strand as well as that of Phe77 at the tip of the loop structure between the beta2- and beta3-strands caused a significant reduction in 5S rRNA binding. In addition, the mutations of Thr90 on the beta3-strand and Ile141 and Asp144 at the loop between beta4- and beta5-strands moderately reduced the 5S rRNA-binding affinity. Comparison of these results with the more recently analyzed structure of the 50S subunit from Haloarcula marismortui suggests that there are significant differences in the structure at N- and C-terminal regions and probably in the 5S rRNA binding.

  18. Cryo-EM Structure of the Archaeal 50S Ribosomal Subunit in Complex with Initiation Factor 6 and Implications for Ribosome Evolution

    Science.gov (United States)

    Greber, Basil J.; Boehringer, Daniel; Godinic-Mikulcic, Vlatka; Crnkovic, Ana; Ibba, Michael; Weygand-Durasevic, Ivana; Ban, Nenad

    2013-01-01

    Translation of mRNA into proteins by the ribosome is universally conserved in all cellular life. The composition and complexity of the translation machinery differ markedly between the three domains of life. Organisms from the domain Archaea show an intermediate level of complexity, sharing several additional components of the translation machinery with eukaryotes that are absent in bacteria. One of these translation factors is initiation factor 6 (IF6), which associates with the large ribosomal subunit. We have reconstructed the 50S ribosomal subunit from the archaeon Methanothermobacter thermautotrophicus in complex with archaeal IF6 at 6.6 Å resolution using cryo-electron microscopy (EM). The structure provides detailed architectural insights into the 50S ribosomal subunit from a methanogenic archaeon through identification of the rRNA expansion segments and ribosomal proteins that are shared between this archaeal ribosome and eukaryotic ribosomes but are mostly absent in bacteria and in some archaeal lineages. Furthermore, the structure reveals that, in spite of highly divergent evolutionary trajectories of the ribosomal particle and the acquisition of novel functions of IF6 in eukaryotes, the molecular binding of IF6 on the ribosome is conserved between eukaryotes and archaea. The structure also provides a snapshot of the reductive evolution of the archaeal ribosome and offers new insights into the evolution of the translation system in archaea. PMID:22306461

  19. Free-Energy Landscape of Reverse tRNA Translocation through the Ribosome Analyzed by Electron Microscopy Density Maps and Molecular Dynamics Simulations

    Science.gov (United States)

    Ishida, Hisashi; Matsumoto, Atsushi

    2014-01-01

    To understand the mechanism of reverse tRNA translocation in the ribosome, all-atom molecular dynamics simulations of the ribosome-tRNAs-mRNA-EFG complex were performed. The complex at the post-translocational state was directed towards the translocational and pre-translocational states by fitting the complex into cryo-EM density maps. Between a series of the fitting simulations, umbrella sampling simulations were performed to obtain the free-energy landscape. Multistep structural changes, such as a ratchet-like motion and rotation of the head of the small subunit were observed. The free-energy landscape showed that there were two main free-energy barriers: one between the post-translocational and intermediate states, and the other between the pre-translocational and intermediate states. The former corresponded to a clockwise rotation, which was coupled to the movement of P-tRNA over the P/E-gate made of G1338, A1339 and A790 in the small subunit. The latter corresponded to an anticlockwise rotation of the head, which was coupled to the location of the two tRNAs in the hybrid state. This indicates that the coupled motion of the head rotation and tRNA translocation plays an important role in opening and closing of the P/E-gate during the ratchet-like movement in the ribosome. Conformational change of EF-G was interpreted to be the result of the combination of the external motion by L12 around an axis passing near the sarcin-ricin loop, and internal hinge-bending motion. These motions contributed to the movement of domain IV of EF-G to maintain its interaction with A/P-tRNA. PMID:24999999

  20. Free-energy landscape of reverse tRNA translocation through the ribosome analyzed by electron microscopy density maps and molecular dynamics simulations.

    Directory of Open Access Journals (Sweden)

    Hisashi Ishida

    Full Text Available To understand the mechanism of reverse tRNA translocation in the ribosome, all-atom molecular dynamics simulations of the ribosome-tRNAs-mRNA-EFG complex were performed. The complex at the post-translocational state was directed towards the translocational and pre-translocational states by fitting the complex into cryo-EM density maps. Between a series of the fitting simulations, umbrella sampling simulations were performed to obtain the free-energy landscape. Multistep structural changes, such as a ratchet-like motion and rotation of the head of the small subunit were observed. The free-energy landscape showed that there were two main free-energy barriers: one between the post-translocational and intermediate states, and the other between the pre-translocational and intermediate states. The former corresponded to a clockwise rotation, which was coupled to the movement of P-tRNA over the P/E-gate made of G1338, A1339 and A790 in the small subunit. The latter corresponded to an anticlockwise rotation of the head, which was coupled to the location of the two tRNAs in the hybrid state. This indicates that the coupled motion of the head rotation and tRNA translocation plays an important role in opening and closing of the P/E-gate during the ratchet-like movement in the ribosome. Conformational change of EF-G was interpreted to be the result of the combination of the external motion by L12 around an axis passing near the sarcin-ricin loop, and internal hinge-bending motion. These motions contributed to the movement of domain IV of EF-G to maintain its interaction with A/P-tRNA.

  1. Multiperspective smFRET reveals rate-determining late intermediates of ribosomal translocation.

    Science.gov (United States)

    Wasserman, Michael R; Alejo, Jose L; Altman, Roger B; Blanchard, Scott C

    2016-04-01

    Directional translocation of the ribosome through the mRNA open reading frame is a critical determinant of translational fidelity. This process entails a complex interplay of large-scale conformational changes within the actively translating particle, which together coordinate the movement of tRNA and mRNA substrates with respect to the large and small ribosomal subunits. Using pre-steady state, single-molecule fluorescence resonance energy transfer imaging, we tracked the nature and timing of these conformational events within the Escherichia coli ribosome from five structural perspectives. Our investigations revealed direct evidence of structurally and kinetically distinct late intermediates during substrate movement, whose resolution determines the rate of translocation. These steps involve intramolecular events within the EF-G-GDP-bound ribosome, including exaggerated, reversible fluctuations of the small-subunit head domain, which ultimately facilitate peptidyl-tRNA's movement into its final post-translocation position.

  2. Diversity of Protease-Producing Bacillus spp. From Fresh Indonesian Tempeh Based on 16S rRNA Gene Sequence

    Directory of Open Access Journals (Sweden)

    Tati Barus

    2017-01-01

    Full Text Available Tempeh is a type of traditional fermented food in Indonesia. The fermentation can be performed by Rhizopus microsporus as a main microorganism. However, Bacillus spp. is found in abundance in tempeh production. Nevertheless, information regarding the diversity of Bacillus spp. in tempeh production has not been reported yet. Therefore, the aim of this investigation was to study the genetic diversity of Bacillus spp. in tempeh production based on the 16S ribosomal RNA sequence. In this study, about 22 of 24 fresh tempeh from Jakarta, Bogor, and Tangerang were used. A total of 52 protease-producing Bacillus spp. isolates were obtained. Based on 16S ribosomal RNA results, all 52 isolates were identified to be similar to B. pumilus, B. subtilis, B. megaterium, B. licheniformis, B. cereus, B. thuringiensis, B. amyloliquefaciens, Brevibacillus brevis, and Bacillus sp. All the identified isolates were divided into two large clusters: 1 a cluster of B. cereus, B. thuringiensis, Bacillus sp., and B. brevis and 2 a cluster of B. pumilus, B. subtilis, B. megaterium, B. licheniformis, and B. amyloliquefaciens. Information about the Bacillus spp. role in determining the quality of tempeh has not been reported and this is a preliminary study of Bacillus spp. from tempeh.

  3. The Unexplored Mechanisms and Regulatory Functions of Ribosomal Translocation

    Science.gov (United States)

    Alejo, Jose Luis

    In every cell, protein synthesis is carried out by the ribosome, a complex macromolecular RNA-protein assembly. Decades of structural and kinetic studies have increased our understanding of ribosome initiation, decoding, translocation and termination. Yet, the underlying mechanism of these fundamental processes has yet to be fully delineated. Hence, the molecular basis of regulation remains obscure. Here, single-molecule fluorescence methods are applied to decipher the mechanism and regulatory roles of the multi-step process of directional substrate translocation on the ribosome that accompanies every round of protein synthesis. In Chapter 1, single-molecule fluorescence resonance energy transfer (smFRET) is introduced as a tool for studying bacterial ribosome translocation. Chapter 2 details the experimental methods. In Chapter 3, the elongation factor G(EF-G)-catalyzed movement of substrates through the ribosome is examined from several perspectives or signals reporting on various degrees of freedom of ribosome dynamics. Two ribosomal states interconvert in the presence of EF-G(GDP), displaying novel head domain motions, until relocking takes place. In Chapter 4, in order to test if the mentioned fluctuations leading to relocking are correlated to the engagement of the P-site by the peptidyl-tRNA, the translocation of miscoded tRNAs is studied. Severe defects in the relocking stages of translocation reveal the correlation between this new stage of translocation and P-site tRNA engagement.

  4. Diversity of 23S rRNA genes within individual prokaryotic genomes.

    Directory of Open Access Journals (Sweden)

    Anna Pei

    Full Text Available BACKGROUND: The concept of ribosomal constraints on rRNA genes is deduced primarily based on the comparison of consensus rRNA sequences between closely related species, but recent advances in whole-genome sequencing allow evaluation of this concept within organisms with multiple rRNA operons. METHODOLOGY/PRINCIPAL FINDINGS: Using the 23S rRNA gene as an example, we analyzed the diversity among individual rRNA genes within a genome. Of 184 prokaryotic species containing multiple 23S rRNA genes, diversity was observed in 113 (61.4% genomes (mean 0.40%, range 0.01%-4.04%. Significant (1.17%-4.04% intragenomic variation was found in 8 species. In 5 of the 8 species, the diversity in the primary structure had only minimal effect on the secondary structure (stem versus loop transition. In the remaining 3 species, the diversity significantly altered local secondary structure, but the alteration appears minimized through complex rearrangement. Intervening sequences (IVS, ranging between 9 and 1471 nt in size, were found in 7 species. IVS in Deinococcus radiodurans and Nostoc sp. encode transposases. T. tengcongensis was the only species in which intragenomic diversity >3% was observed among 4 paralogous 23S rRNA genes. CONCLUSIONS/SIGNIFICANCE: These findings indicate tight ribosomal constraints on individual 23S rRNA genes within a genome. Although classification using primary 23S rRNA sequences could be erroneous, significant diversity among paralogous 23S rRNA genes was observed only once in the 184 species analyzed, indicating little overall impact on the mainstream of 23S rRNA gene-based prokaryotic taxonomy.

  5. Critical 23S rRNA interactions for macrolide-dependent ribosome stalling on the ErmCL nascent peptide chain.

    Science.gov (United States)

    Koch, Miriam; Willi, Jessica; Pradère, Ugo; Hall, Jonathan; Polacek, Norbert

    2017-06-20

    The nascent peptide exit tunnel has recently been identified as a functional region of ribosomes contributing to translation regulation and co-translational protein folding. Inducible expression of the erm resistance genes depends on ribosome stalling at specific codons of an upstream open reading frame in the presence of an exit tunnel-bound macrolide antibiotic. The molecular basis for this translation arrest is still not fully understood. Here, we used a nucleotide analog interference approach to unravel important functional groups on 23S rRNA residues in the ribosomal exit tunnel for ribosome stalling on the ErmC leader peptide. By replacing single nucleobase functional groups or even single atoms we were able to demonstrate the importance of A2062, A2503 and U2586 for drug-dependent ribosome stalling. Our data show that the universally conserved A2062 and A2503 are capable of forming a non-Watson-Crick base pair that is critical for sensing and transmitting the stalling signal from the exit tunnel back to the peptidyl transferase center of the ribosome. The nucleobases of A2062, A2503 as well as U2586 do not contribute significantly to the overall mechanism of protein biosynthesis, yet their elaborate role for co-translational monitoring of nascent peptide chains inside the exit tunnel can explain their evolutionary conservation. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  6. Yeast polypeptide exit tunnel ribosomal proteins L17, L35 and L37 are necessary to recruit late-assembling factors required for 27SB pre-rRNA processing.

    Science.gov (United States)

    Gamalinda, Michael; Jakovljevic, Jelena; Babiano, Reyes; Talkish, Jason; de la Cruz, Jesús; Woolford, John L

    2013-02-01

    Ribosome synthesis involves the coordinated folding and processing of pre-rRNAs with assembly of ribosomal proteins. In eukaryotes, these events are facilitated by trans-acting factors that propel ribosome maturation from the nucleolus to the cytoplasm. However, there is a gap in understanding how ribosomal proteins configure pre-ribosomes in vivo to enable processing to occur. Here, we have examined the role of adjacent yeast r-proteins L17, L35 and L37 in folding and processing of pre-rRNAs, and binding of other proteins within assembling ribosomes. These three essential ribosomal proteins, which surround the polypeptide exit tunnel, are required for 60S subunit formation as a consequence of their role in removal of the ITS2 spacer from 27SB pre-rRNA. L17-, L35- and L37-depleted cells exhibit turnover of aberrant pre-60S assembly intermediates. Although the structure of ITS2 does not appear to be grossly affected in their absence, these three ribosomal proteins are necessary for efficient recruitment of factors required for 27SB pre-rRNA processing, namely, Nsa2 and Nog2, which associate with pre-60S ribosomal particles containing 27SB pre-rRNAs. Altogether, these data support that L17, L35 and L37 are specifically required for a recruiting step immediately preceding removal of ITS2.

  7. Yeast eIF4B binds to the head of the 40S ribosomal subunit and promotes mRNA recruitment through its N-terminal and internal repeat domains.

    Science.gov (United States)

    Walker, Sarah E; Zhou, Fujun; Mitchell, Sarah F; Larson, Victoria S; Valasek, Leos; Hinnebusch, Alan G; Lorsch, Jon R

    2013-02-01

    Eukaryotic translation initiation factor (eIF)4B stimulates recruitment of mRNA to the 43S ribosomal pre-initiation complex (PIC). Yeast eIF4B (yeIF4B), shown previously to bind single-stranded (ss) RNA, consists of an N-terminal domain (NTD), predicted to be unstructured in solution; an RNA-recognition motif (RRM); an unusual domain comprised of seven imperfect repeats of 26 amino acids; and a C-terminal domain. Although the mechanism of yeIF4B action has remained obscure, most models have suggested central roles for its RRM and ssRNA-binding activity. We have dissected the functions of yeIF4B's domains and show that the RRM and its ssRNA-binding activity are dispensable in vitro and in vivo. Instead, our data indicate that the 7-repeats and NTD are the most critical domains, which mediate binding of yeIF4B to the head of the 40S ribosomal subunit via interaction with Rps20. This interaction induces structural changes in the ribosome's mRNA entry channel that could facilitate mRNA loading. We also show that yeIF4B strongly promotes productive interaction of eIF4A with the 43S•mRNA PIC in a manner required for efficient mRNA recruitment.

  8. Comparison of sequencing the D2 region of the large subunit ribosomal RNA gene (MicroSEQ®) versus the internal transcribed spacer (ITS) regions using two public databases for identification of common and uncommon clinically relevant fungal species.

    Science.gov (United States)

    Arbefeville, S; Harris, A; Ferrieri, P

    2017-09-01

    Fungal infections cause considerable morbidity and mortality in immunocompromised patients. Rapid and accurate identification of fungi is essential to guide accurately targeted antifungal therapy. With the advent of molecular methods, clinical laboratories can use new technologies to supplement traditional phenotypic identification of fungi. The aims of the study were to evaluate the sole commercially available MicroSEQ® D2 LSU rDNA Fungal Identification Kit compared to the in-house developed internal transcribed spacer (ITS) regions assay in identifying moulds, using two well-known online public databases to analyze sequenced data. 85 common and uncommon clinically relevant fungi isolated from clinical specimens were sequenced for the D2 region of the large subunit (LSU) of ribosomal RNA (rRNA) gene with the MicroSEQ® Kit and the ITS regions with the in house developed assay. The generated sequenced data were analyzed with the online GenBank and MycoBank public databases. The D2 region of the LSU rRNA gene identified 89.4% or 92.9% of the 85 isolates to the genus level and the full ITS region (f-ITS) 96.5% or 100%, using GenBank or MycoBank, respectively, when compared to the consensus ID. When comparing species-level designations to the consensus ID, D2 region of the LSU rRNA gene aligned with 44.7% (38/85) or 52.9% (45/85) of these isolates in GenBank or MycoBank, respectively. By comparison, f-ITS possessed greater specificity, followed by ITS1, then ITS2 regions using GenBank or MycoBank. Using GenBank or MycoBank, D2 region of the LSU rRNA gene outperformed phenotypic based ID at the genus level. Comparing rates of ID between D2 region of the LSU rRNA gene and the ITS regions in GenBank or MycoBank at the species level against the consensus ID, f-ITS and ITS2 exceeded performance of the D2 region of the LSU rRNA gene, but ITS1 had similar performance to the D2 region of the LSU rRNA gene using MycoBank. Our results indicated that the MicroSEQ® D2 LSU r

  9. Evidence for functional interaction between domains II and V of 23S ribosomal RNA from an erythromycin-resistant mutant

    DEFF Research Database (Denmark)

    Douthwaite, S; Prince, J B; Noller, H F

    1985-01-01

    A mutation affording low levels of erythromycin resistance has been obtained by in vitro hydroxylamine mutagenesis of a cloned ribosomal RNA operon from Escherichia coli. The site of the mutational event responsible for antibiotic resistance was localized to the gene region encoding domain II of ...

  10. Chimira: analysis of small RNA sequencing data and microRNA modifications.

    Science.gov (United States)

    Vitsios, Dimitrios M; Enright, Anton J

    2015-10-15

    Chimira is a web-based system for microRNA (miRNA) analysis from small RNA-Seq data. Sequences are automatically cleaned, trimmed, size selected and mapped directly to miRNA hairpin sequences. This generates count-based miRNA expression data for subsequent statistical analysis. Moreover, it is capable of identifying epi-transcriptomic modifications in the input sequences. Supported modification types include multiple types of 3'-modifications (e.g. uridylation, adenylation), 5'-modifications and also internal modifications or variation (ADAR editing or single nucleotide polymorphisms). Besides cleaning and mapping of input sequences to miRNAs, Chimira provides a simple and intuitive set of tools for the analysis and interpretation of the results (see also Supplementary Material). These allow the visual study of the differential expression between two specific samples or sets of samples, the identification of the most highly expressed miRNAs within sample pairs (or sets of samples) and also the projection of the modification profile for specific miRNAs across all samples. Other tools have already been published in the past for various types of small RNA-Seq analysis, such as UEA workbench, seqBuster, MAGI, OASIS and CAP-miRSeq, CPSS for modifications identification. A comprehensive comparison of Chimira with each of these tools is provided in the Supplementary Material. Chimira outperforms all of these tools in total execution speed and aims to facilitate simple, fast and reliable analysis of small RNA-Seq data allowing also, for the first time, identification of global microRNA modification profiles in a simple intuitive interface. Chimira has been developed as a web application and it is accessible here: http://www.ebi.ac.uk/research/enright/software/chimira. aje@ebi.ac.uk Supplementary data are available at Bioinformatics online. © The Author 2015. Published by Oxford University Press.

  11. Genetic diversity of Entamoeba: Novel ribosomal lineages from cockroaches.

    Directory of Open Access Journals (Sweden)

    Tetsuro Kawano

    Full Text Available Our current taxonomic perspective on Entamoeba is largely based on small-subunit ribosomal RNA genes (SSU rDNA from Entamoeba species identified in vertebrate hosts with minor exceptions such as E. moshkovskii from sewage water and E. marina from marine sediment. Other Entamoeba species have also been morphologically identified and described from non-vertebrate species such as insects; however, their genetic diversity remains unknown. In order to further disclose the diversity of the genus, we investigated Entamoeba spp. in the intestines of three cockroach species: Periplaneta americana, Blaptica dubia, and Gromphadorhina oblongonota. We obtained 134 Entamoeba SSU rDNA sequences from 186 cockroaches by direct nested PCR using the DNA extracts of intestines from cockroaches, followed by scrutinized BLASTn screening and phylogenetic analyses. All the sequences identified in this study were distinct from those reported from known Entamoeba species, and considered as novel Entamoeba ribosomal lineages. Furthermore, they were positioned at the base of the clade of known Entamoeba species and displayed remarkable degree of genetic diversity comprising nine major groups in the three cockroach species. This is the first report of the diversity of SSU rDNA sequences from Entamoeba in non-vertebrate host species, and should help to understand the genetic diversity of the genus Entamoeba.

  12. On the control of ribosomal protein biosynthesis in Escherichia coli

    International Nuclear Information System (INIS)

    Pichon, J.; Marvaldi, J.; Coeroli, C.; Cozzone, A.; Marchis-Mouren, G.

    1977-01-01

    The rate of individual ribosomal protein synthesis relative to total protein synthesis has been determined in Escherichia coli rel + and rel - cells, under valyl-tRNA deprivation. These strains have a temperature-sensitive valyl-tRNA synthetase. Starvation was obtained following transfer of the cells to non-permissive temperature. Ribosomal proteins were obtained by treatment of either total lysates of freeze-thawed lysozyme spheroplasts or ammonium sulphate precipitate of ribosomes, with acetic acid. Differential labelling of the ribosomal proteins was observed in both strains: proteins from the rel + strain appear more labelled than those from the rel - strain, the rate of labelling of individual proteins being about the same in both strains. Moreover ribosomal proteins were found as stable during starvation as total protein. It is thus concluded that in starving cells individual ribosomal proteins are not synthesized at equal rates. This indicates that the synthesis of ribosomal proteins is not only under the control of the rel gene

  13. Diverse Regulators of Human Ribosome Biogenesis Discovered by Changes in Nucleolar Number

    Directory of Open Access Journals (Sweden)

    Katherine I. Farley-Barnes

    2018-02-01

    Full Text Available Ribosome biogenesis is a highly regulated, essential cellular process. Although studies in yeast have established some of the biological principles of ribosome biogenesis, many of the intricacies of its regulation in higher eukaryotes remain unknown. To understand how ribosome biogenesis is globally integrated in human cells, we conducted a genome-wide siRNA screen for regulators of nucleolar number. We found 139 proteins whose depletion changed the number of nucleoli per nucleus from 2–3 to only 1 in human MCF10A cells. Follow-up analyses on 20 hits found many (90% to be essential for the nucleolar functions of rDNA transcription (7, pre-ribosomal RNA (pre-rRNA processing (16, and/or global protein synthesis (14. This genome-wide analysis exploits the relationship between nucleolar number and function to discover diverse cellular pathways that regulate the making of ribosomes and paves the way for further exploration of the links between ribosome biogenesis and human disease.

  14. Size, Shape, and Sequence-Dependent Immunogenicity of RNA Nanoparticles

    Directory of Open Access Journals (Sweden)

    Sijin Guo

    2017-12-01

    Full Text Available RNA molecules have emerged as promising therapeutics. Like all other drugs, the safety profile and immune response are important criteria for drug evaluation. However, the literature on RNA immunogenicity has been controversial. Here, we used the approach of RNA nanotechnology to demonstrate that the immune response of RNA nanoparticles is size, shape, and sequence dependent. RNA triangle, square, pentagon, and tetrahedron with same shape but different sizes, or same size but different shapes were used as models to investigate the immune response. The levels of pro-inflammatory cytokines induced by these RNA nanoarchitectures were assessed in macrophage-like cells and animals. It was found that RNA polygons without extension at the vertexes were immune inert. However, when single-stranded RNA with a specific sequence was extended from the vertexes of RNA polygons, strong immune responses were detected. These immunostimulations are sequence specific, because some other extended sequences induced little or no immune response. Additionally, larger-size RNA square induced stronger cytokine secretion. 3D RNA tetrahedron showed stronger immunostimulation than planar RNA triangle. These results suggest that the immunogenicity of RNA nanoparticles is tunable to produce either a minimal immune response that can serve as safe therapeutic vectors, or a strong immune response for cancer immunotherapy or vaccine adjuvants.

  15. Evolutionary dynamics of a conserved sequence motif in the ribosomal genes of the ciliate Paramecium.

    Science.gov (United States)

    Catania, Francesco; Lynch, Michael

    2010-05-04

    In protozoa, the identification of preserved motifs by comparative genomics is often impeded by difficulties to generate reliable alignments for non-coding sequences. Moreover, the evolutionary dynamics of regulatory elements in 3' untranslated regions (both in protozoa and metazoa) remains a virtually unexplored issue. By screening Paramecium tetraurelia's 3' untranslated regions for 8-mers that were previously found to be preserved in mammalian 3' UTRs, we detect and characterize a motif that is distinctly conserved in the ribosomal genes of this ciliate. The motif appears to be conserved across Paramecium aurelia species but is absent from the ribosomal genes of four additional non-Paramecium species surveyed, including another ciliate, Tetrahymena thermophila. Motif-free ribosomal genes retain fewer paralogs in the genome and appear to be lost more rapidly relative to motif-containing genes. Features associated with the discovered preserved motif are consistent with this 8-mer playing a role in post-transcriptional regulation. Our observations 1) shed light on the evolution of a putative regulatory motif across large phylogenetic distances; 2) are expected to facilitate the understanding of the modulation of ribosomal genes expression in Paramecium; and 3) reveal a largely unexplored--and presumably not restricted to Paramecium--association between the presence/absence of a DNA motif and the evolutionary fate of its host genes.

  16. Replication and meiotic transmission of yeast ribosomal RNA genes.

    Science.gov (United States)

    Brewer, B J; Zakian, V A; Fangman, W L

    1980-11-01

    The yeast Saccharomyces cerevisiae has approximately 120 genes for the ribosomal RNAs (rDNA) which are organized in tandem within chromosomal DNA. These multiple-copy genes are homogeneous in sequence but can undergo changes in copy number and topology. To determine if these changes reflect unusual features of rDNA metabolism, we have examined both the replication of rDNA in the mitotic cell cycle and the inheritance of rDNA during meiosis. The results indicate that rDNA behaves identically to chromosomal DNA: each rDNA unit is replicated once during the S phase of each cell cycle and each unit is conserved through meiosis. Therefore, the flexibility in copy number and topology of rDNA does not arise from the selective replication of units in each S phase nor by the selective inheritance of units in meiosis.

  17. Mitochondrial genome sequence of the potato powdery scab pathogen Spongospora subterranea.

    Science.gov (United States)

    Gutiérrez, Pablo; Bulman, Simon; Alzate, Juan; Ortíz, Mary Carmen; Marín, Mauricio

    2016-01-01

    Spongospora subterranea is a soil-borne obligate parasite responsible for potato powdery scab disease. S. subterranea is a member of the order Plasmodiophorida, a protist taxa that is related to Cercozoa and Foraminifera but the fine details of these relationships remain unresolved. Currently there is only one available complete mtDNA sequence of a cercozoan, Bigelowiella natans. In this work, the mitochondrial sequence of a S. subterranea isolate infecting an Andean variety of S. tuberosum ssp. andigena (Diacol-Capiro) is presented. The mtDNA codes for 16 proteins of the respiratory chain, 11 ribosomal proteins, 3 ribosomal RNAs, 24 tRNAs, a RNA processing RNaseP, a RNA-directed polymerase, and two proteins of unknown function. This is the first report of a mtDNA genome sequence from a plasmodiophorid and will be useful in clarifying the phylogenetic relationship of this group to other members in the supergroup Rhizaria once more mtDNA sequences are available.

  18. Inhibition of Hepatitis C Virus in Mice by a Small Interfering RNA Targeting a Highly Conserved Sequence in Viral IRES Pseudoknot.

    Directory of Open Access Journals (Sweden)

    Jae-Su Moon

    Full Text Available The hepatitis C virus (HCV internal ribosome entry site (IRES that directs cap-independent viral translation is a primary target for small interfering RNA (siRNA-based HCV antiviral therapy. However, identification of potent siRNAs against HCV IRES by bioinformatics-based siRNA design is a challenging task given the complexity of HCV IRES secondary and tertiary structures and association with multiple proteins, which can also dynamically change the structure of this cis-acting RNA element. In this work, we utilized siRNA tiling approach whereby siRNAs were tiled with overlapping sequences that were shifted by one or two nucleotides over the HCV IRES stem-loop structures III and IV spanning nucleotides (nts 277-343. Based on their antiviral activity, we mapped a druggable region (nts 313-343 where the targets of potent siRNAs were enriched. siIE22, which showed the greatest anti-HCV potency, targeted a highly conserved sequence across diverse HCV genotypes, locating within the IRES subdomain IIIf involved in pseudoknot formation. Stepwise target shifting toward the 5' or 3' direction by 1 or 2 nucleotides reduced the antiviral potency of siIE22, demonstrating the importance of siRNA accessibility to this highly structured and sequence-conserved region of HCV IRES for RNA interference. Nanoparticle-mediated systemic delivery of the stability-improved siIE22 derivative gs_PS1 siIE22, which contains a single phosphorothioate linkage on the guide strand, reduced the serum HCV genome titer by more than 4 log10 in a xenograft mouse model for HCV replication without generation of resistant variants. Our results provide a strategy for identifying potent siRNA species against a highly structured RNA target and offer a potential pan-HCV genotypic siRNA therapy that might be beneficial for patients resistant to current treatment regimens.

  19. Genome-wide polysomal analysis of a yeast strain with mutated ribosomal protein S9

    Directory of Open Access Journals (Sweden)

    Arava Yoav

    2007-08-01

    Full Text Available Abstract Background The yeast ribosomal protein S9 (S9 is located at the entrance tunnel of the mRNA into the ribosome. It is known to play a role in accurate decoding and its bacterial homolog (S4 has recently been shown to be involved in opening RNA duplexes. Here we examined the effects of changing the C terminus of S9, which is rich in acidic amino acids and extends out of the ribosome surface. Results We performed a genome-wide analysis to reveal effects at the transcription and translation levels of all yeast genes. While negligible relative changes were observed in steady-state mRNA levels, a significant number of mRNAs appeared to have altered ribosomal density. Notably, 40% of the genes having reliable signals changed their ribosomal association by more than one ribosome. Yet, no general correlations with physical or functional features of the mRNA were observed. Ribosome Density Mapping (RDM along four of the mRNAs with increased association revealed an increase in ribosomal density towards the end of the coding region for at least two of them. Read-through analysis did not reveal any increase in read-through of a premature stop codon by the mutant strain. Conclusion The ribosomal protein rpS9 appears to be involved in the translation of many mRNAs, since altering its C terminus led to a significant change in ribosomal association of many mRNAs. We did not find strong correlations between these changes and several physical features of the mRNA, yet future studies with advanced tools may allow such correlations to be determined. Importantly, our results indicate an accumulation of ribosomes towards the end of the coding regions of some mRNAs. This suggests an involvement of S9 in ribosomal dissociation during translation termination.

  20. The primary structures of ribosomal proteins S14 and S16 from the archaebacterium Halobacterium marismortui. Comparison with eubacterial and eukaryotic ribosomal proteins.

    Science.gov (United States)

    Kimura, J; Kimura, M

    1987-09-05

    The amino acid sequences of two ribosomal proteins, S14 and S16, from the archaebacterium Halobacterium marismortui have been determined. Sequence data were obtained by the manual and solid-phase sequencing of peptides derived from enzymatic digestions with trypsin, chymotrypsin, pepsin, and Staphylococcus aureus protease as well as by chemical cleavage with cyanogen bromide. Proteins S14 and S16 contain 109 and 126 amino acid residues and have Mr values of 11,964 and 13,515, respectively. Comparison of the sequences with those of ribosomal proteins from other organisms demonstrates that S14 has a significant homology with the rat liver ribosomal protein S11 (36% identity) as well as with the Escherichia coli ribosomal protein S17 (37%), and that S16 is related to the yeast ribosomal protein YS22 (40%) and proteins S8 from E. coli (28%) and Bacillus stearothermophilus (30%). A comparison of the amino acid residues in the homologous regions of halophilic and nonhalophilic ribosomal proteins reveals that halophilic proteins have more glutamic acids, asparatic acids, prolines, and alanines, and less lysines, arginines, and isoleucines than their nonhalophilic counterparts. These amino acid substitutions probably contribute to the structural stability of halophilic ribosomal proteins.

  1. Rfam: annotating families of non-coding RNA sequences.

    Science.gov (United States)

    Daub, Jennifer; Eberhardt, Ruth Y; Tate, John G; Burge, Sarah W

    2015-01-01

    The primary task of the Rfam database is to collate experimentally validated noncoding RNA (ncRNA) sequences from the published literature and facilitate the prediction and annotation of new homologues in novel nucleotide sequences. We group homologous ncRNA sequences into "families" and related families are further grouped into "clans." We collate and manually curate data cross-references for these families from other databases and external resources. Our Web site offers researchers a simple interface to Rfam and provides tools with which to annotate their own sequences using our covariance models (CMs), through our tools for searching, browsing, and downloading information on Rfam families. In this chapter, we will work through examples of annotating a query sequence, collating family information, and searching for data.

  2. miRBase: integrating microRNA annotation and deep-sequencing data.

    Science.gov (United States)

    Kozomara, Ana; Griffiths-Jones, Sam

    2011-01-01

    miRBase is the primary online repository for all microRNA sequences and annotation. The current release (miRBase 16) contains over 15,000 microRNA gene loci in over 140 species, and over 17,000 distinct mature microRNA sequences. Deep-sequencing technologies have delivered a sharp rise in the rate of novel microRNA discovery. We have mapped reads from short RNA deep-sequencing experiments to microRNAs in miRBase and developed web interfaces to view these mappings. The user can view all read data associated with a given microRNA annotation, filter reads by experiment and count, and search for microRNAs by tissue- and stage-specific expression. These data can be used as a proxy for relative expression levels of microRNA sequences, provide detailed evidence for microRNA annotations and alternative isoforms of mature microRNAs, and allow us to revisit previous annotations. miRBase is available online at: http://www.mirbase.org/.

  3. Size, Shape, and Sequence-Dependent Immunogenicity of RNA Nanoparticles.

    Science.gov (United States)

    Guo, Sijin; Li, Hui; Ma, Mengshi; Fu, Jian; Dong, Yizhou; Guo, Peixuan

    2017-12-15

    RNA molecules have emerged as promising therapeutics. Like all other drugs, the safety profile and immune response are important criteria for drug evaluation. However, the literature on RNA immunogenicity has been controversial. Here, we used the approach of RNA nanotechnology to demonstrate that the immune response of RNA nanoparticles is size, shape, and sequence dependent. RNA triangle, square, pentagon, and tetrahedron with same shape but different sizes, or same size but different shapes were used as models to investigate the immune response. The levels of pro-inflammatory cytokines induced by these RNA nanoarchitectures were assessed in macrophage-like cells and animals. It was found that RNA polygons without extension at the vertexes were immune inert. However, when single-stranded RNA with a specific sequence was extended from the vertexes of RNA polygons, strong immune responses were detected. These immunostimulations are sequence specific, because some other extended sequences induced little or no immune response. Additionally, larger-size RNA square induced stronger cytokine secretion. 3D RNA tetrahedron showed stronger immunostimulation than planar RNA triangle. These results suggest that the immunogenicity of RNA nanoparticles is tunable to produce either a minimal immune response that can serve as safe therapeutic vectors, or a strong immune response for cancer immunotherapy or vaccine adjuvants. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  4. A "bulged" double helix in a RNA-protein contact site

    DEFF Research Database (Denmark)

    Peattie, D A; Douthwaite, S; Garrett, R A

    1981-01-01

    as a singly bulged nucleotide extending the Fox and Woese central helix by two base pairs in the E. coli sequence (to positions 16-23/60-68) as well as in each of 61 (prokaryotic and eukaryotic) aligned 5S RNA sequences. In each case, the single bulged nucleotide is at the relative position of adenosine-66...... in the RNA sequences. The presence of this putative bulged nucleotide appears to have been conserved in 5S RNA sequences throughout evolution, and its identity varies with major phylogenetic divisions. This residue is likely involved in specific 5S RNA-protein recognition or interaction in prokaryotic...... and eukaryotic ribosomes. The uridine-65 to adenosine-66 internucleotide bond is protected from RNase A digestion in the complex, and carbethoxylation of E. coli adenosine-66 prior to L18 binding affects formation of a stable RNA-protein complex. Thus, we identify a region of E. coli 5S RNA protected...

  5. Selection of diethylstilbestrol-specific single-chain antibodies from a non-immunized mouse ribosome display library.

    Directory of Open Access Journals (Sweden)

    Yanan Sun

    Full Text Available Single chain variable fragments (scFvs against diethylstilbestrol (DES were selected from the splenocytes of non-immunized mice by ribosome display technology. A naive library was constructed and engineered to allow in vitro transcription and translation using an E. coli lysate system. Alternating selection in solution and immobilization in microtiter wells was used to pan mRNA-ribosome-antibody (ARM complexes. After seven rounds of ribosome display, the expression vector pTIG-TRX containing the selected specific scFv DNAs were transformed into Escherichia coli BL21 (DE3 for expression. Twenty-six positive clones were screened and five clones had high antibody affinity and specificity to DES as evidenced by indirect competitive ELISA. Sequence analysis showed that these five DES-specific scFvs had different amino acid sequences, but the CDRs were highly similar. Surface plasmon resonance (SPR analysis was used to determine binding kinetics of one clone (30-1. The measured K(D was 3.79 µM. These results indicate that ribosome display technology can be used to efficiently isolate hapten-specific antibody (Ab fragments from a naive library; this study provides a methodological framework for the development of novel immunoassays for multiple environmental pollutants with low molecular weight detection using recombinant antibodies.

  6. RNA sequence determinants of a coupled termination-reinitiation strategy for downstream open reading frame translation in Helminthosporium victoriae virus 190S and other victoriviruses (Family Totiviridae).

    Science.gov (United States)

    Li, Hua; Havens, Wendy M; Nibert, Max L; Ghabrial, Said A

    2011-07-01

    The genome-length, dicistronic mRNA of the double-stranded RNA fungal virus Helminthosporium victoriae virus 190S (genus Victorivirus, family Totiviridae) contains two long open reading frames (ORFs) that overlap in the tetranucleotide AUGA. Translation of the downstream ORF, which encodes the RNA-dependent RNA polymerase (RdRp), has been proposed to depend on ribosomal reinitiation following termination of the upstream ORF, which encodes the capsid protein. In the current study, we examined the RNA sequence determinants for RdRp translation in this virus and demonstrated that a coupled termination-reinitiation (stop-restart) strategy is indeed used. Signals for termination-reinitiation are found within a 32-nucleotide stretch of RNA immediately upstream of the AUGA motif, including a predicted pseudoknot structure. The close proximity in which this predicted structure is followed by the upstream ORF's stop codon appears to be especially important for promoting translation of the downstream ORF. The normal strong preferences for an AUG start codon and the canonical sequence context to favor translation initiation appear somewhat relaxed for the downstream ORF. Similar sequence motifs and predicted RNA structures in other victoriviruses suggest that they all share a related stop-restart strategy for RdRp translation. Members of the genus Victorivirus thus provide new and unique opportunities for exploring the molecular mechanisms of translational coupling, which remain only partly understood in this and other systems.

  7. Systematic relationships among Lutzomyia sand flies (Diptera: Psychodidae) of Peru and Colombia based on the analysis of 12S and 28S ribosomal DNA sequences.

    Science.gov (United States)

    Beati, Lorenza; Cáceres, Abraham G; Lee, Jamie A; Munstermann, Leonard E

    2004-02-01

    Lutzomyia spp. are New World phlebotomine sand flies, many of which are involved in the transmission of human diseases, such as leishmaniases and bartonellosis. The systematic classification of the approximately 400 species in the genus has been based on morphological characters, but the relationships within the genus are still very much in question. We have inferred phylogenies of 32 species of phlebotomine sand flies belonging to seven sub-genera and two species groups, by using fragments of the mitochondrial small subunit (12SrRNA) and of the nuclear large subunit (28SrRNA) ribosomal gene sequences. The subgenus Helcocyrtomyia and the Verrucarum species group, prominent representatives of the Peruvian sand fly fauna, were represented by 11 and 7 species, respectively. Although based on a limited number of taxa, the resulting phylogenies, based on 837 characters, provide an initial phylogenetic backbone for the progressive reconstruction of infrageneric relationships within Lutzomyia.

  8. Protein Structure and the Sequential Structure of mRNA

    DEFF Research Database (Denmark)

    Brunak, Søren; Engelbrecht, Jacob

    1996-01-01

    entries in the Brookhaven Protein Data Bank produced 719 protein chains with matching mRNA sequence, amino acid sequence, and secondary structure assignment, By neural network analysis, we found strong signals in mRNA sequence regions surrounding helices and sheets, These signals do not originate from......A direct comparison of experimentally determined protein structures and their corresponding protein coding mRNA sequences has been performed, We examine whether real world data support the hypothesis that clusters of rare codons correlate with the location of structural units in the resulting...... protein, The degeneracy of the genetic code allows for a biased selection of codons which may control the translational rate of the ribosome, and may thus in vivo have a catalyzing effect on the folding of the polypeptide chain, A complete search for GenBank nucleotide sequences coding for structural...

  9. The CCA-end of P-tRNA Contacts Both the Human RPL36AL and the A-site Bound Translation Termination Factor eRF1 at the Peptidyl Transferase Center of the Human 80S Ribosome.

    Science.gov (United States)

    Hountondji, Codjo; Bulygin, Konstantin; Créchet, Jean-Bernard; Woisard, Anne; Tuffery, Pierre; Nakayama, Jun-Ichi; Frolova, Ludmila; Nierhaus, Knud H; Karpova, Galina; Baouz, Soria

    2014-01-01

    We have demonstrated previously that the E-site specific protein RPL36AL present in human ribosomes can be crosslinked with the CCA-end of a P-tRNA in situ. Here we report the following: (i) We modeled RPL36AL into the structure of the archaeal ortholog RPL44E extracted from the known X-ray structure of the 50S subunit of Haloarcula marismortui. Superimposing the obtained RPL36AL structure with that of P/E tRNA observed in eukaryotic 80S ribosomes suggested that RPL36AL might in addition to its CCA neighbourhood interact with the inner site of the tRNA elbow similar to an interaction pattern known from tRNA•synthetase pairs. (ii) Accordingly, we detected that the isolated recombinant protein RPL36AL can form a tight binary complex with deacylated tRNA, and even tRNA fragments truncated at their CCA end showed a high affinity in the nanomolar range supporting a strong interaction outside the CCA end. (iii) We constructed programmed 80S complexes containing the termination factor eRF1 (stop codon UAA at the A-site) and a 2',3'-dialdehyde tRNA (tRNAox) analog at the P-site. Surprisingly, we observed a crosslinked ternary complex containing the tRNA, eRF1 and RPL36AL crosslinked both to the aldehyde groups of tRNAox at the 2'- and 3'-positions of the ultimate A. We also demonstrated that, upon binding to the ribosomal A-site, eRF1 induces an alternative conformation of the ribosome and/or the tRNA, leading to a novel crosslink of tRNAox to another large-subunit ribosomal protein (namely L37) rather than to RPL36AL, both ribosomal proteins being labeled in a mutually exclusive fashion. Since the human 80S ribosome in complex with P-site bound tRNAox and A-site bound eRF1 corresponds to the post-termination state of the ribosome, the results represent the first biochemical evidence for the positioning of the CCA-arm of the P-tRNA in close proximity to both RPL36AL and eRF1 at the end of the translation process.

  10. Ribosomal incorporation of backbone modified amino acids via an editing-deficient aminoacyl-tRNA synthetase.

    Science.gov (United States)

    Iqbal, Emil S; Dods, Kara K; Hartman, Matthew C T

    2018-02-14

    The ability to incorporate non-canonical amino acids (ncAA) using translation offers researchers the ability to extend the functionality of proteins and peptides for many applications including synthetic biology, biophysical and structural studies, and discovery of novel ligands. Here we describe the high promiscuity of an editing-deficient valine-tRNA synthetase (ValRS T222P). Using this enzyme, we demonstrate ribosomal translation of 11 ncAAs including those with novel side chains, α,α-disubstitutions, and cyclic β-amino acids.

  11. Biphasic character of ribosomal translocation and non-Michaelis-Menten kinetics of translation

    Science.gov (United States)

    Xie, Ping

    2014-12-01

    We study theoretically the kinetics of mRNA translocation in the wild-type (WT) Escherichia coli ribosome, which is composed of a small 30 S and large 50 S subunit, and the ribosomes with mutations to some intersubunit bridges such as B1a, B4, B7a, and B8. The theoretical results reproduce well the available in vitro experimental data on the biphasic kinetics of the forward mRNA translocation catalyzed by elongation factor G (EF-G) hydrolyzing GTP, which can be best fit by the sum of two exponentials, and the monophasic kinetics of the spontaneous reverse mRNA translocation in the absence of the elongation factor, which can be best fit by a single-exponential function, in both the WT and mutant ribosomes. We show that both the mutation-induced increase in the maximal rate of the slow phase for the forward mRNA translocation and that in the rate of the spontaneous reverse mRNA translocation result from a reduction in the intrinsic energy barrier to resist the rotational movements between the two subunits, giving the same degree of increase in the two rates. The mutation-induced increase in the maximal rate of the fast phase for the forward mRNA translocation results mainly from the increase in the rate of the ribosomal unlocking, a conformational change in the ribosome that widens the mRNA channel for the mRNA translocation to take place, which could be partly due to the effect of the mutation on the intrasubunit 30S head rotation. Moreover, we study the translation rate of the WT and mutant ribosomes. It is shown that the translation rate versus the concentration of EF-G-GTP does not follow the Michaelis-Menten (MM) kinetics, which is in sharp contrast to the general property of other enzymes that the rate of the enzymatic reaction versus the concentration of a substrate follows the MM kinetics. The physical origin of this non-MM kinetics for the ribosome is revealed.

  12. Integrated mRNA and microRNA transcriptome sequencing characterizes sequence variants and mRNA–microRNA regulatory network in nasopharyngeal carcinoma model systems

    Directory of Open Access Journals (Sweden)

    Carol Ying-Ying Szeto

    2014-01-01

    Full Text Available Nasopharyngeal carcinoma (NPC is a prevalent malignancy in Southeast Asia among the Chinese population. Aberrant regulation of transcripts has been implicated in many types of cancers including NPC. Herein, we characterized mRNA and miRNA transcriptomes by RNA sequencing (RNASeq of NPC model systems. Matched total mRNA and small RNA of undifferentiated Epstein–Barr virus (EBV-positive NPC xenograft X666 and its derived cell line C666, well-differentiated NPC cell line HK1, and the immortalized nasopharyngeal epithelial cell line NP460 were sequenced by Solexa technology. We found 2812 genes and 149 miRNAs (human and EBV to be differentially expressed in NP460, HK1, C666 and X666 with RNASeq; 533 miRNA–mRNA target pairs were inversely regulated in the three NPC cell lines compared to NP460. Integrated mRNA/miRNA expression profiling and pathway analysis show extracellular matrix organization, Beta-1 integrin cell surface interactions, and the PI3K/AKT, EGFR, ErbB, and Wnt pathways were potentially deregulated in NPC. Real-time quantitative PCR was performed on selected mRNA/miRNAs in order to validate their expression. Transcript sequence variants such as short insertions and deletions (INDEL, single nucleotide variant (SNV, and isomiRs were characterized in the NPC model systems. A novel TP53 transcript variant was identified in NP460, HK1, and C666. Detection of three previously reported novel EBV-encoded BART miRNAs and their isomiRs were also observed. Meta-analysis of a model system to a clinical system aids the choice of different cell lines in NPC studies. This comprehensive characterization of mRNA and miRNA transcriptomes in NPC cell lines and the xenograft provides insights on miRNA regulation of mRNA and valuable resources on transcript variation and regulation in NPC, which are potentially useful for mechanistic and preclinical studies.

  13. Ribosome evolution: Emergence of peptide synthesis machinery

    Indian Academy of Sciences (India)

    suggested the dynamic movement of ribosomal proteins. The L2 protein (a .... Such kinds of interactions are important in elucidating the evolution of RNA .... Tamura K 2009 Molecular handedness of life: significance of RNA aminoacylation.

  14. Integrative analysis of RNA, translation, and protein levels reveals distinct regulatory variation across humans.

    Science.gov (United States)

    Cenik, Can; Cenik, Elif Sarinay; Byeon, Gun W; Grubert, Fabian; Candille, Sophie I; Spacek, Damek; Alsallakh, Bilal; Tilgner, Hagen; Araya, Carlos L; Tang, Hua; Ricci, Emiliano; Snyder, Michael P

    2015-11-01

    Elucidating the consequences of genetic differences between humans is essential for understanding phenotypic diversity and personalized medicine. Although variation in RNA levels, transcription factor binding, and chromatin have been explored, little is known about global variation in translation and its genetic determinants. We used ribosome profiling, RNA sequencing, and mass spectrometry to perform an integrated analysis in lymphoblastoid cell lines from a diverse group of individuals. We find significant differences in RNA, translation, and protein levels suggesting diverse mechanisms of personalized gene expression control. Combined analysis of RNA expression and ribosome occupancy improves the identification of individual protein level differences. Finally, we identify genetic differences that specifically modulate ribosome occupancy--many of these differences lie close to start codons and upstream ORFs. Our results reveal a new level of gene expression variation among humans and indicate that genetic variants can cause changes in protein levels through effects on translation. © 2015 Cenik et al.; Published by Cold Spring Harbor Laboratory Press.

  15. Molecular evolution of the mitochondrial 12S rRNA in Ungulata (mammalia).

    Science.gov (United States)

    Douzery, E; Catzeflis, F M

    1995-11-01

    The complete 12S rRNA gene has been sequenced in 4 Ungulata (hoofed eutherians) and 1 marsupial and compared to 38 available mammalian sequences in order to investigate the molecular evolution of the mitochondrial small-subunit ribosomal RNA molecule. Ungulata were represented by one artiodactyl (the collared peccary, Tayassu tajacu, suborder Suiformes), two perissodactyls (the Grevy's zebra, Equus grevyi, suborder Hippomorpha; the white rhinoceros, Ceratotherium simum, suborder Ceratomorpha), and one hyracoid (the tree hyrax, Dendrohyrax dorsalis). The fifth species was a marsupial, the eastern gray kangaroo (Macropus giganteus). Several transition/transversion biases characterized the pattern of changes between mammalian 12S rRNA molecules. A bias toward transitions was found among 12S rRNA sequences of Ungulata, illustrating the general bias exhibited by ribosomal and protein-encoding genes of the mitochondrial genome. The derivation of a mammalian 12S rRNA secondary structure model from the comparison of 43 eutherian and marsupial sequences evidenced a pronounced bias against transversions in stems. Moreover, transversional compensatory changes were rare events within double-stranded regions of the ribosomal RNA. Evolutionary characteristics of the 12S rRNA were compared with those of the nuclear 18S and 28S rRNAs. From a phylogenetic point of view, transitions, transversions and indels in stems as well as transversional and indels events in loops gave congruent results for comparisons within orders. Some compensatory changes in double-stranded regions and some indels in single-stranded regions also constituted diagnostic events. The 12S rRNA molecule confirmed the monophyly of infraorder Pecora and order Cetacea and demonstrated the monophyly of the suborder Ruminantia was not supported and the branching pattern between Cetacea and the artiodacytyl suborders Ruminantia and Suiformes was not established. The monophyly of the order Perissodactyla was evidenced

  16. Deep-sequencing protocols influence the results obtained in small-RNA sequencing.

    Directory of Open Access Journals (Sweden)

    Joern Toedling

    Full Text Available Second-generation sequencing is a powerful method for identifying and quantifying small-RNA components of cells. However, little attention has been paid to the effects of the choice of sequencing platform and library preparation protocol on the results obtained. We present a thorough comparison of small-RNA sequencing libraries generated from the same embryonic stem cell lines, using different sequencing platforms, which represent the three major second-generation sequencing technologies, and protocols. We have analysed and compared the expression of microRNAs, as well as populations of small RNAs derived from repetitive elements. Despite the fact that different libraries display a good correlation between sequencing platforms, qualitative and quantitative variations in the results were found, depending on the protocol used. Thus, when comparing libraries from different biological samples, it is strongly recommended to use the same sequencing platform and protocol in order to ensure the biological relevance of the comparisons.

  17. Evolutionary dynamics of a conserved sequence motif in the ribosomal genes of the ciliate Paramecium

    Directory of Open Access Journals (Sweden)

    Lynch Michael

    2010-05-01

    Full Text Available Abstract Background In protozoa, the identification of preserved motifs by comparative genomics is often impeded by difficulties to generate reliable alignments for non-coding sequences. Moreover, the evolutionary dynamics of regulatory elements in 3' untranslated regions (both in protozoa and metazoa remains a virtually unexplored issue. Results By screening Paramecium tetraurelia's 3' untranslated regions for 8-mers that were previously found to be preserved in mammalian 3' UTRs, we detect and characterize a motif that is distinctly conserved in the ribosomal genes of this ciliate. The motif appears to be conserved across Paramecium aurelia species but is absent from the ribosomal genes of four additional non-Paramecium species surveyed, including another ciliate, Tetrahymena thermophila. Motif-free ribosomal genes retain fewer paralogs in the genome and appear to be lost more rapidly relative to motif-containing genes. Features associated with the discovered preserved motif are consistent with this 8-mer playing a role in post-transcriptional regulation. Conclusions Our observations 1 shed light on the evolution of a putative regulatory motif across large phylogenetic distances; 2 are expected to facilitate the understanding of the modulation of ribosomal genes expression in Paramecium; and 3 reveal a largely unexplored--and presumably not restricted to Paramecium--association between the presence/absence of a DNA motif and the evolutionary fate of its host genes.

  18. Integrating ribosomal promoter vectors that offer a choice of constitutive expression profiles in Leishmania donovani.

    Science.gov (United States)

    Soysa, Radika; Tran, Khoa D; Ullman, Buddy; Yates, Phillip A

    2015-12-01

    We have designed a novel series of integrating ribosomal RNA promoter vectors with five incrementally different constitutive expression profiles, covering a 250-fold range. Differential expression was achieved by placing different combinations of synthetic or leishmanial DNA sequences upstream and downstream of the transgene coding sequence in order to modulate pre-mRNA processing efficiency and mRNA stability, respectively. All of the vectors have extensive multiple cloning sites, and versions are available for producing N- or C- terminal GFP fusions at each of the possible relative expression levels. In addition, the modular configuration of the vectors allows drug resistance cassettes and other components to be readily exchanged. In toto, these vectors should be useful additions to the toolkit available for molecular and genetic studies of Leishmania donovani. Copyright © 2016 Elsevier B.V. All rights reserved.

  19. Probing the structure of ribosome assembly intermediates in vivo using DMS and hydroxyl radical footprinting.

    Science.gov (United States)

    Hulscher, Ryan M; Bohon, Jen; Rappé, Mollie C; Gupta, Sayan; D'Mello, Rhijuta; Sullivan, Michael; Ralston, Corie Y; Chance, Mark R; Woodson, Sarah A

    2016-07-01

    The assembly of the Escherichia coli ribosome has been widely studied and characterized in vitro. Despite this, ribosome biogenesis in living cells is only partly understood because assembly is coupled with transcription, modification and processing of the pre-ribosomal RNA. We present a method for footprinting and isolating pre-rRNA as it is synthesized in E. coli cells. Pre-rRNA synthesis is synchronized by starvation, followed by nutrient upshift. RNA synthesized during outgrowth is metabolically labeled to facilitate isolation of recent transcripts. Combining this technique with two in vivo RNA probing methods, hydroxyl radical and DMS footprinting, allows the structure of nascent RNA to be probed over time. Together, these can be used to determine changes in the structures of ribosome assembly intermediates as they fold in vivo. Copyright © 2016 Elsevier Inc. All rights reserved.

  20. Amino acid sequences of the ribosomal proteins HL30 and HmaL5 from the archaebacterium Halobacterium marismortui.

    Science.gov (United States)

    Hatakeyama, T; Hatakeyama, T

    1990-07-06

    The complete amino acid sequences of the ribosomal proteins HL30 and HmaL5 from the archaebacterium Halobacterium marismortui were determined. Protein HL30 was found to be acetylated at its N-terminal amino acid and shows homology to the eukaryotic ribosomal proteins YL34 from yeast and RL31 from rat. Protein HmaL5 was homologous to the protein L5 from Escherichia coli and Bacillus stearothermophilus as well as to YL16 from yeast. HmaL5 shows more similarities to its eukaryotic counterpart than to eubacterial ones.

  1. Direct crosslinking of the antitumor antibiotic sparsomycin, and its derivatives, to A2602 in the peptidyl transferase center of 23S-like rRNA within ribosome-tRNA complexes

    DEFF Research Database (Denmark)

    Porse, B T; Kirillov, S V; Awayez, M J

    1999-01-01

    of action was investigated by inducing a crosslink between sparsomycin and bacterial, archaeal, and eukaryotic ribosomes complexed with P-site-bound tRNA, on irradiating with low energy ultraviolet light (at 365 nm). The crosslink was localized exclusively to the universally conserved nucleotide A2602...

  2. Eukaryotic 5S rRNA biogenesis

    Science.gov (United States)

    Ciganda, Martin; Williams, Noreen

    2012-01-01

    The ribosome is a large complex containing both protein and RNA which must be assembled in a precise manner to allow proper functioning in the critical role of protein synthesis. 5S rRNA is the smallest of the RNA components of the ribosome, and although it has been studied for decades, we still do not have a clear understanding of its function within the complex ribosome machine. It is the only RNA species that binds ribosomal proteins prior to its assembly into the ribosome. Its transport into the nucleolus requires this interaction. Here we present an overview of some of the key findings concerning the structure and function of 5S rRNA and how its association with specific proteins impacts its localization and function. PMID:21957041

  3. Structural insights into methyltransferase KsgA function in 30S ribosomal subunit biogenesis.

    Science.gov (United States)

    Boehringer, Daniel; O'Farrell, Heather C; Rife, Jason P; Ban, Nenad

    2012-03-23

    The assembly of the ribosomal subunits is facilitated by ribosome biogenesis factors. The universally conserved methyltransferase KsgA modifies two adjacent adenosine residues in the 3'-terminal helix 45 of the 16 S ribosomal RNA (rRNA). KsgA recognizes its substrate adenosine residues only in the context of a near mature 30S subunit and is required for the efficient processing of the rRNA termini during ribosome biogenesis. Here, we present the cryo-EM structure of KsgA bound to a nonmethylated 30S ribosomal subunit. The structure reveals that KsgA binds to the 30S platform with the catalytic N-terminal domain interacting with substrate adenosine residues in helix 45 and the C-terminal domain making extensive contacts to helix 27 and helix 24. KsgA excludes the penultimate rRNA helix 44 from adopting its position in the mature 30S subunit, blocking the formation of the decoding site and subunit joining. We suggest that the activation of methyltransferase activity and subsequent dissociation of KsgA control conformational changes in helix 44 required for final rRNA processing and translation initiation.

  4. Structural Insights into Methyltransferase KsgA Function in 30S Ribosomal Subunit Biogenesis*

    Science.gov (United States)

    Boehringer, Daniel; O'Farrell, Heather C.; Rife, Jason P.; Ban, Nenad

    2012-01-01

    The assembly of the ribosomal subunits is facilitated by ribosome biogenesis factors. The universally conserved methyltransferase KsgA modifies two adjacent adenosine residues in the 3′-terminal helix 45 of the 16 S ribosomal RNA (rRNA). KsgA recognizes its substrate adenosine residues only in the context of a near mature 30S subunit and is required for the efficient processing of the rRNA termini during ribosome biogenesis. Here, we present the cryo-EM structure of KsgA bound to a nonmethylated 30S ribosomal subunit. The structure reveals that KsgA binds to the 30S platform with the catalytic N-terminal domain interacting with substrate adenosine residues in helix 45 and the C-terminal domain making extensive contacts to helix 27 and helix 24. KsgA excludes the penultimate rRNA helix 44 from adopting its position in the mature 30S subunit, blocking the formation of the decoding site and subunit joining. We suggest that the activation of methyltransferase activity and subsequent dissociation of KsgA control conformational changes in helix 44 required for final rRNA processing and translation initiation. PMID:22308031

  5. Using the Ribodeblur pipeline to recover A-sites from yeast ribosome profiling data.

    Science.gov (United States)

    Wang, Hao; Kingsford, Carl; McManus, C Joel

    2018-03-15

    Ribosome profiling has emerged as a powerful technique to study mRNA translation. Ribosome profiling has the potential to determine the relative quantities and locations of ribosomes on mRNA genome wide. Taking full advantage of this approach requires accurate measurement of ribosome locations. However, experimental inconsistencies often obscure the positional information encoded in ribosome profiling data. Here, we describe the Ribodeblur pipeline, a computational analysis tool that uses a maximum likelihood framework to infer ribosome positions from heterogeneous datasets. Ribodeblur is simple to install, and can be run on an average modern Mac or Linux-based laptop. We detail the process of applying the pipeline to high-coverage ribosome profiling data in yeast, and discuss important considerations for potential extension to other organisms. Copyright © 2018 Elsevier Inc. All rights reserved.

  6. Computational prediction of miRNA genes from small RNA sequencing data

    Directory of Open Access Journals (Sweden)

    Wenjing eKang

    2015-01-01

    Full Text Available Next-generation sequencing now for the first time allows researchers to gauge the depth and variation of entire transcriptomes. However, now as rare transcripts can be detected that are present in cells at single copies, more advanced computational tools are needed to accurately annotate and profile them. miRNAs are 22 nucleotide small RNAs (sRNAs that post-transcriptionally reduce the output of protein coding genes. They have established roles in numerous biological processes, including cancers and other diseases. During miRNA biogenesis, the sRNAs are sequentially cleaved from precursor molecules that have a characteristic hairpin RNA structure. The vast majority of new miRNA genes that are discovered are mined from small RNA sequencing (sRNA-seq, which can detect more than a billion RNAs in a single run. However, given that many of the detected RNAs are degradation products from all types of transcripts, the accurate identification of miRNAs remain a non-trivial computational problem. Here we review the tools available to predict animal miRNAs from sRNA sequencing data. We present tools for generalist and specialist use cases, including prediction from massively pooled data or in species without reference genome. We also present wet-lab methods used to validate predicted miRNAs, and approaches to computationally benchmark prediction accuracy. For each tool, we reference validation experiments and benchmarking efforts. Last, we discuss the future of the field.

  7. Ribosomes slide on lysine-encoding homopolymeric A stretches

    Science.gov (United States)

    Koutmou, Kristin S; Schuller, Anthony P; Brunelle, Julie L; Radhakrishnan, Aditya; Djuranovic, Sergej; Green, Rachel

    2015-01-01

    Protein output from synonymous codons is thought to be equivalent if appropriate tRNAs are sufficiently abundant. Here we show that mRNAs encoding iterated lysine codons, AAA or AAG, differentially impact protein synthesis: insertion of iterated AAA codons into an ORF diminishes protein expression more than insertion of synonymous AAG codons. Kinetic studies in E. coli reveal that differential protein production results from pausing on consecutive AAA-lysines followed by ribosome sliding on homopolymeric A sequence. Translation in a cell-free expression system demonstrates that diminished output from AAA-codon-containing reporters results from premature translation termination on out of frame stop codons following ribosome sliding. In eukaryotes, these premature termination events target the mRNAs for Nonsense-Mediated-Decay (NMD). The finding that ribosomes slide on homopolymeric A sequences explains bioinformatic analyses indicating that consecutive AAA codons are under-represented in gene-coding sequences. Ribosome ‘sliding’ represents an unexpected type of ribosome movement possible during translation. DOI: http://dx.doi.org/10.7554/eLife.05534.001 PMID:25695637

  8. Synthetic peptides and ribosomal proteins as substrate for 60S ribosomal protein kinase from yeast cells

    DEFF Research Database (Denmark)

    Grankowski, N; Gasior, E; Issinger, O G

    1993-01-01

    Kinetic studies on the 60S protein kinase were conducted with synthetic peptides and ribosomal proteins as substrate. Peptide RRREEESDDD proved to be the best synthetic substrate for this enzyme. The peptide has a sequence of amino acids which most closely resembles the structure of potential...... phosphorylation sites in natural substrates, i.e., acidic ribosomal proteins. The superiority of certain kinetic parameters for 60S kinase obtained with the native whole 80S ribosomes over those of the isolated fraction of acidic ribosomal proteins indicates that the affinity of 60S kinase to the specific protein...

  9. RNA sequencing: current and prospective uses in metabolic research.

    Science.gov (United States)

    Vikman, Petter; Fadista, Joao; Oskolkov, Nikolay

    2014-10-01

    Previous global RNA analysis was restricted to known transcripts in species with a defined transcriptome. Next generation sequencing has transformed transcriptomics by making it possible to analyse expressed genes with an exon level resolution from any tissue in any species without any a priori knowledge of which genes that are being expressed, splice patterns or their nucleotide sequence. In addition, RNA sequencing is a more sensitive technique compared with microarrays with a larger dynamic range, and it also allows for investigation of imprinting and allele-specific expression. This can be done for a cost that is able to compete with that of a microarray, making RNA sequencing a technique available to most researchers. Therefore RNA sequencing has recently become the state of the art with regards to large-scale RNA investigations and has to a large extent replaced microarrays. The only drawback is the large data amounts produced, which together with the complexity of the data can make a researcher spend far more time on analysis than performing the actual experiment. © 2014 Society for Endocrinology.

  10. Phylogeography, genetic variability and structure of Acanthamoeba metapopulations in Iran inferred by 18S ribosomal RNA sequences: A systematic review and meta-analysis.

    Science.gov (United States)

    Spotin, Adel; Moslemzadeh, Hamid Reza; Mahami-Oskouei, Mahmoud; Ahmadpour, Ehsan; Niyyati, Maryam; Hejazi, Seyed Hossein; Memari, Fatemeh; Noori, Jafar

    2017-09-01

    To verify phylogeography and genetic structure of Acanthamoeba populations among the Iranian clinical isolates and natural/artificial environments distributed in various regions of the country. We searched electronic databases including Medline, PubMed, Science Direct, Scopus and Google Scholar from 2005 to 2016. To explore the genetic variability of Acanthamoeba sp, 205 sequences were retrieved from keratitis patients, immunosuppressed cases and environmental sources as of various geographies of Iran. T4 genotype was the predominant strain in Iran, and the rare genotypes belonged to T2, T3, T5 (Acanthamoeba lenticulata), T6, T9, T11, T13 and T15 (Acanthamoeba jacobsi). A total of 47 unique haplotypes of T4 were identified. A parsimonious network of the sequence haplotypes demonstrated star-like feature containing haplogroups IR6 (34.1%) and IR7 (31.2%) as the most common haplotypes. In accordance with the analysis of molecular variance, the high value of haplotype diversity (0.612-0.848) of Acanthamoeba T4 represented genetic variability within populations. Neutrality indices of the 18S ribosomal RNA demonstrated negative values in all populations which represented a considerable divergence from neutrality. The majority of genetic diversity belonged to the infected contact lens and dust samples in immunodeficiency and ophthalmology wards, which indicated potential routes for exposure to a pathogenic Acanthamoeba sp. in at-risk individuals. A pairwise fixation index (F ST ) was from low to high values (0.02433-0.41892). The statistically F ST points out that T4 is genetically differentiated between north-west, north-south and central-south metapopulations, but not differentiated between west-central, west-south, central-south, and north-central isolates. An occurrence of IR6 and IR7 displays that possibly a gene flow of Acanthamoeba T4 occurred after the founder effect or bottleneck experience through ecological changes or host mobility. This is the first

  11. Ribosome-catalyzed formation of an abnormal peptide analogue

    International Nuclear Information System (INIS)

    Roesser, J.R.; Chorghade, M.S.; Hecht, S.M.

    1986-01-01

    The peptidyl-tRNA analogue N-(chloracetyl) phenylalanyl-tRNA/sup Phe/ was prepared by chemical aminoacylation and prebound to the P site of Escherichia coli ribosomes in response to poly(uridylic acid). Admixture of phenylalanyl-tRNA/sup Phe/ to the A site resulted in the formation of two dipeptides, one of which was found by displacement of chloride ion from the peptidyl-tRNA. This constitutes the first example of ribosome-mediated formation of a peptide of altered connectivity and suggests a need for revision of the current model of peptide bond formation. Also suggested by the present finding is the feasibility of utilizing tRNAs to prepare polypeptides of altered connectivity in an in vitro protein biosynthesizing system. [ 32 P]-oligo(rA), [ 3 H]- and [ 14 C] phenylalanines were used in the assay of the peptidye-tRNA analogue

  12. Phylogenetic relationships of true butterflies (Lepidoptera: Papilionoidea) inferred from COI, 16S rRNA and EF-1α sequences.

    Science.gov (United States)

    Kim, Man Il; Wan, Xinlong; Kim, Min Jee; Jeong, Heon Cheon; Ahn, Neung-Ho; Kim, Ki-Gyoung; Han, Yeon Soo; Kim, Iksoo

    2010-11-01

    The molecular phylogenetic relationships among true butterfly families (superfamily Papilionoidea) have been a matter of substantial controversy; this debate has led to several competing hypotheses. Two of the most compelling of those hypotheses involve the relationships of (Nymphalidae + Lycaenidae) + (Pieridae + Papilionidae) and (((Nymphalidae + Lycaenidae) + Pieridae) + Papilionidae). In this study, approximately 3,500 nucleotide sequences from cytochrome oxidase subunit I (COI), 16S ribosomal RNA (16S rRNA), and elongation factor-1 alpha (EF-1α) were sequenced from 83 species belonging to four true butterfly families, along with those of three outgroup species belonging to three lepidopteran superfamilies. These sequences were subjected to phylogenetic reconstruction via Bayesian Inference (BI), Maximum Likelihood (ML), and Maximum Parsimony (MP) algorithms. The monophyletic Pieridae and monophyletic Papilionidae evidenced good recovery in all analyses, but in some analyses, the monophylies of the Lycaenidae and Nymphalidae were hampered by the inclusion of single species of the lycaenid subfamily Miletinae and the nymphalid subfamily Danainae. Excluding those singletons, all phylogenetic analyses among the four true butterfly families clearly identified the Nymphalidae as the sister to the Lycaenidae and identified this group as a sister to the Pieridae, with the Papilionidae identified as the most basal linage to the true butterfly, thus supporting the hypothesis: (Papilionidae + (Pieridae + (Nymphalidae + Lycaenidae))).

  13. Protein-protein interactions within late pre-40S ribosomes.

    Directory of Open Access Journals (Sweden)

    Melody G Campbell

    2011-01-01

    Full Text Available Ribosome assembly in eukaryotic organisms requires more than 200 assembly factors to facilitate and coordinate rRNA transcription, processing, and folding with the binding of the ribosomal proteins. Many of these assembly factors bind and dissociate at defined times giving rise to discrete assembly intermediates, some of which have been partially characterized with regards to their protein and RNA composition. Here, we have analyzed the protein-protein interactions between the seven assembly factors bound to late cytoplasmic pre-40S ribosomes using recombinant proteins in binding assays. Our data show that these factors form two modules: one comprising Enp1 and the export adaptor Ltv1 near the beak structure, and the second comprising the kinase Rio2, the nuclease Nob1, and a regulatory RNA binding protein Dim2/Pno1 on the front of the head. The GTPase-like Tsr1 and the universally conserved methylase Dim1 are also peripherally connected to this second module. Additionally, in an effort to further define the locations for these essential proteins, we have analyzed the interactions between these assembly factors and six ribosomal proteins: Rps0, Rps3, Rps5, Rps14, Rps15 and Rps29. Together, these results and previous RNA-protein crosslinking data allow us to propose a model for the binding sites of these seven assembly factors. Furthermore, our data show that the essential kinase Rio2 is located at the center of the pre-ribosomal particle and interacts, directly or indirectly, with every other assembly factor, as well as three ribosomal proteins required for cytoplasmic 40S maturation. These data suggest that Rio2 could play a central role in regulating cytoplasmic maturation steps.

  14. Nucleotide sequence of a human tRNA gene heterocluster

    International Nuclear Information System (INIS)

    Chang, Y.N.; Pirtle, I.L.; Pirtle, R.M.

    1986-01-01

    Leucine tRNA from bovine liver was used as a hybridization probe to screen a human gene library harbored in Charon-4A of bacteriophage lambda. The human DNA inserts from plaque-pure clones were characterized by restriction endonuclease mapping and Southern hybridization techniques, using both [3'- 32 P]-labeled bovine liver leucine tRNA and total tRNA as hybridization probes. An 8-kb Hind III fragment of one of these γ-clones was subcloned into the Hind III site of pBR322. Subsequent fine restriction mapping and DNA sequence analysis of this plasmid DNA indicated the presence of four tRNA genes within the 8-kb DNA fragment. A leucine tRNA gene with an anticodon of AAG and a proline tRNA gene with an anticodon of AGG are in a 1.6-kb subfragment. A threonine tRNA gene with an anticodon of UGU and an as yet unidentified tRNA gene are located in a 1.1-kb subfragment. These two different subfragments are separated by 2.8 kb. The coding regions of the three sequenced genes contain characteristic internal split promoter sequences and do not have intervening sequences. The 3'-flanking region of these three genes have typical RNA polymerase III termination sites of at least four consecutive T residues

  15. Crystal Structure of the 23S rRNA Fragment Specific to r-Protein L1 and Designed Model of the Ribosomal L1 Stalk from Haloarcula marismortui

    Directory of Open Access Journals (Sweden)

    Azat Gabdulkhakov

    2017-02-01

    Full Text Available The crystal structure of the 92-nucleotide L1-specific fragment of 23S rRNA from Haloarcula marismortui (Hma has been determined at 3.3 Å resolution. Similar to the corresponding bacterial rRNA fragments, this structure contains joined helix 76-77 topped by an approximately globular structure formed by the residual part of the L1 stalk rRNA. The position of HmaL1 relative to the rRNA was found by its docking to the rRNA fragment using the L1-rRNA complex from Thermus thermophilus as a guide model. In spite of the anomalous negative charge of the halophilic archaeal protein, the conformation of the HmaL1-rRNA interface appeared to be very close to that observed in all known L1-rRNA complexes. The designed structure of the L1 stalk was incorporated into the H. marismortui 50S ribosomal subunit. Comparison of relative positions of L1 stalks in 50S subunits from H. marismortui and T. thermophilus made it possible to reveal the site of inflection of rRNA during the ribosome function.

  16. Biosynthesis of ribosomal RNA in nucleoli regulates pluripotency and differentiation ability of pluripotent stem cells.

    Science.gov (United States)

    Watanabe-Susaki, Kanako; Takada, Hitomi; Enomoto, Kei; Miwata, Kyoko; Ishimine, Hisako; Intoh, Atsushi; Ohtaka, Manami; Nakanishi, Mahito; Sugino, Hiromu; Asashima, Makoto; Kurisaki, Akira

    2014-12-01

    Pluripotent stem cells have been shown to have unique nuclear properties, for example, hyperdynamic chromatin and large, condensed nucleoli. However, the contribution of the latter unique nucleolar character to pluripotency has not been well understood. Here, we show that fibrillarin (FBL), a critical methyltransferase for ribosomal RNA (rRNA) processing in nucleoli, is one of the proteins highly expressed in pluripotent embryonic stem (ES) cells. Stable expression of FBL in ES cells prolonged the pluripotent state of mouse ES cells cultured in the absence of leukemia inhibitory factor (LIF). Analyses using deletion mutants and a point mutant revealed that the methyltransferase activity of FBL regulates stem cell pluripotency. Knockdown of this gene led to significant delays in rRNA processing, growth inhibition, and apoptosis in mouse ES cells. Interestingly, both partial knockdown of FBL and treatment with actinomycin D, an inhibitor of rRNA synthesis, induced the expression of differentiation markers in the presence of LIF and promoted stem cell differentiation into neuronal lineages. Moreover, we identified p53 signaling as the regulatory pathway for pluripotency and differentiation of ES cells. These results suggest that proper activity of rRNA production in nucleoli is a novel factor for the regulation of pluripotency and differentiation ability of ES cells. © 2014 AlphaMed Press.

  17. Novel extraction strategy of ribosomal RNA and genomic DNA from cheese for PCR-based investigations.

    Science.gov (United States)

    Bonaïti, Catherine; Parayre, Sandrine; Irlinger, Françoise

    2006-03-15

    Cheese microorganisms, such as bacteria and fungi, constitute a complex ecosystem that plays a central role in cheeses ripening. The molecular study of cheese microbial diversity and activity is essential but the extraction of high quality nucleic acid may be problematic: the cheese samples are characterised by a strong buffering capacity which negatively influenced the yield of the extracted rRNA. The objective of this study is to develop an effective method for the direct and simultaneous isolation of yeast and bacterial ribosomal RNA and genomic DNA from the same cheese samples. DNA isolation was based on a protocol used for nucleic acids isolation from anaerobic digestor, without preliminary washing step with the combined use of the action of chaotropic agent (acid guanidinium thiocyanate), detergents (SDS, N-lauroylsarcosine), chelating agent (EDTA) and a mechanical method (bead beating system). The DNA purification was carried out by two washing steps of phenol-chloroform. RNA was isolated successfully after the second acid extraction step by recovering it from the phenolic phase of the first acid extraction. The novel method yielded pure preparation of undegraded RNA accessible for reverse transcription-PCR. The extraction protocol of genomic DNA and rRNA was applicable to complex ecosystem of different cheese matrices.

  18. Novel Approach to Analyzing MFE of Noncoding RNA Sequences.

    Science.gov (United States)

    George, Tina P; Thomas, Tessamma

    2016-01-01

    Genomic studies have become noncoding RNA (ncRNA) centric after the study of different genomes provided enormous information on ncRNA over the past decades. The function of ncRNA is decided by its secondary structure, and across organisms, the secondary structure is more conserved than the sequence itself. In this study, the optimal secondary structure or the minimum free energy (MFE) structure of ncRNA was found based on the thermodynamic nearest neighbor model. MFE of over 2600 ncRNA sequences was analyzed in view of its signal properties. Mathematical models linking MFE to the signal properties were found for each of the four classes of ncRNA analyzed. MFE values computed with the proposed models were in concordance with those obtained with the standard web servers. A total of 95% of the sequences analyzed had deviation of MFE values within ±15% relative to those obtained from standard web servers.

  19. Sequence analysis of RNase MRP RNA reveals its origination from eukaryotic RNase P RNA

    Science.gov (United States)

    Zhu, Yanglong; Stribinskis, Vilius; Ramos, Kenneth S.; Li, Yong

    2006-01-01

    RNase MRP is a eukaryote-specific endoribonuclease that generates RNA primers for mitochondrial DNA replication and processes precursor rRNA. RNase P is a ubiquitous endoribonuclease that cleaves precursor tRNA transcripts to produce their mature 5′ termini. We found extensive sequence homology of catalytic domains and specificity domains between their RNA subunits in many organisms. In Candida glabrata, the internal loop of helix P3 is 100% conserved between MRP and P RNAs. The helix P8 of MRP RNA from microsporidia Encephalitozoon cuniculi is identical to that of P RNA. Sequence homology can be widely spread over the whole molecule of MRP RNA and P RNA, such as those from Dictyostelium discoideum. These conserved nucleotides between the MRP and P RNAs strongly support the hypothesis that the MRP RNA is derived from the P RNA molecule in early eukaryote evolution. PMID:16540690

  20. Binding site of ribosomal proteins on prokaryotic 5S ribonucleic acids: a study with ribonucleases

    DEFF Research Database (Denmark)

    Douthwaite, S; Christensen, A; Garrett, R A

    1982-01-01

    The binding sites of ribosomal proteins L18 and L25 on 5S RNA from Escherichia coli were probed with ribonucleases A, T1, and T2 and a double helix specific cobra venom endonuclease. The results for the protein-RNA complexes, which were compared with those for the free RNA [Douthwaite, S...... stearothermophilus 5S RNA. Several protein-induced changes in the RNA structures were identified; some are possibly allosteric in nature. The two prokaryotic 5S RNAs were also incubated with total 50S subunit proteins from E. coli and B. stearothermophilus ribosomes. Homologous and heterologous reconstitution....... stearothermophilus 5S RNA, which may have been due to a third ribosomal protein L5....

  1. Connecting the kinetics and energy landscape of tRNA translocation on the ribosome.

    Directory of Open Access Journals (Sweden)

    Paul C Whitford

    Full Text Available Functional rearrangements in biomolecular assemblies result from diffusion across an underlying energy landscape. While bulk kinetic measurements rely on discrete state-like approximations to the energy landscape, single-molecule methods can project the free energy onto specific coordinates. With measures of the diffusion, one may establish a quantitative bridge between state-like kinetic measurements and the continuous energy landscape. We used an all-atom molecular dynamics simulation of the 70S ribosome (2.1 million atoms; 1.3 microseconds to provide this bridge for specific conformational events associated with the process of tRNA translocation. Starting from a pre-translocation configuration, we identified sets of residues that collectively undergo rotary rearrangements implicated in ribosome function. Estimates of the diffusion coefficients along these collective coordinates for translocation were then used to interconvert between experimental rates and measures of the energy landscape. This analysis, in conjunction with previously reported experimental rates of translocation, provides an upper-bound estimate of the free-energy barriers associated with translocation. While this analysis was performed for a particular kinetic scheme of translocation, the quantitative framework is general and may be applied to energetic and kinetic descriptions that include any number of intermediates and transition states.

  2. Nicotiana small RNA sequences support a host genome origin of cucumber mosaic virus satellite RNA.

    Directory of Open Access Journals (Sweden)

    Kiran Zahid

    2015-01-01

    Full Text Available Satellite RNAs (satRNAs are small noncoding subviral RNA pathogens in plants that depend on helper viruses for replication and spread. Despite many decades of research, the origin of satRNAs remains unknown. In this study we show that a β-glucuronidase (GUS transgene fused with a Cucumber mosaic virus (CMV Y satellite RNA (Y-Sat sequence (35S-GUS:Sat was transcriptionally repressed in N. tabacum in comparison to a 35S-GUS transgene that did not contain the Y-Sat sequence. This repression was not due to DNA methylation at the 35S promoter, but was associated with specific DNA methylation at the Y-Sat sequence. Both northern blot hybridization and small RNA deep sequencing detected 24-nt siRNAs in wild-type Nicotiana plants with sequence homology to Y-Sat, suggesting that the N. tabacum genome contains Y-Sat-like sequences that give rise to 24-nt sRNAs capable of guiding RNA-directed DNA methylation (RdDM to the Y-Sat sequence in the 35S-GUS:Sat transgene. Consistent with this, Southern blot hybridization detected multiple DNA bands in Nicotiana plants that had sequence homology to Y-Sat, suggesting that Y-Sat-like sequences exist in the Nicotiana genome as repetitive DNA, a DNA feature associated with 24-nt sRNAs. Our results point to a host genome origin for CMV satRNAs, and suggest novel approach of using small RNA sequences for finding the origin of other satRNAs.

  3. sORFs.org: a repository of small ORFs identified by ribosome profiling.

    Science.gov (United States)

    Olexiouk, Volodimir; Crappé, Jeroen; Verbruggen, Steven; Verhegen, Kenneth; Martens, Lennart; Menschaert, Gerben

    2016-01-04

    With the advent of ribosome profiling, a next generation sequencing technique providing a "snap-shot'' of translated mRNA in a cell, many short open reading frames (sORFs) with ribosomal activity were identified. Follow-up studies revealed the existence of functional peptides, so-called micropeptides, translated from these 'sORFs', indicating a new class of bio-active peptides. Over the last few years, several micropeptides exhibiting important cellular functions were discovered. However, ribosome occupancy does not necessarily imply an actual function of the translated peptide, leading to the development of various tools assessing the coding potential of sORFs. Here, we introduce sORFs.org (http://www.sorfs.org), a novel database for sORFs identified using ribosome profiling. Starting from ribosome profiling, sORFs.org identifies sORFs, incorporates state-of-the-art tools and metrics and stores results in a public database. Two query interfaces are provided, a default one enabling quick lookup of sORFs and a BioMart interface providing advanced query and export possibilities. At present, sORFs.org harbors 263 354 sORFs that demonstrate ribosome occupancy, originating from three different cell lines: HCT116 (human), E14_mESC (mouse) and S2 (fruit fly). sORFs.org aims to provide an extensive sORFs database accessible to researchers with limited bioinformatics knowledge, thus enabling easy integration into personal projects. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  4. Differential Stoichiometry among Core Ribosomal Proteins

    Directory of Open Access Journals (Sweden)

    Nikolai Slavov

    2015-11-01

    Full Text Available Understanding the regulation and structure of ribosomes is essential to understanding protein synthesis and its dysregulation in disease. While ribosomes are believed to have a fixed stoichiometry among their core ribosomal proteins (RPs, some experiments suggest a more variable composition. Testing such variability requires direct and precise quantification of RPs. We used mass spectrometry to directly quantify RPs across monosomes and polysomes of mouse embryonic stem cells (ESC and budding yeast. Our data show that the stoichiometry among core RPs in wild-type yeast cells and ESC depends both on the growth conditions and on the number of ribosomes bound per mRNA. Furthermore, we find that the fitness of cells with a deleted RP-gene is inversely proportional to the enrichment of the corresponding RP in polysomes. Together, our findings support the existence of ribosomes with distinct protein composition and physiological function.

  5. Chromophore-assisted light inactivation of pKi-67 leads to inhibition of ribosomal RNA synthesis.

    Science.gov (United States)

    Rahmanzadeh, R; Hüttmann, G; Gerdes, J; Scholzen, T

    2007-06-01

    Expression of the nuclear Ki-67 protein (pKi-67) is strongly associated with cell proliferation. For this reason, antibodies against this protein are widely used as prognostic tools for the assessment of cell proliferation in biopsies from cancer patients. Despite this broad application in histopathology, functional evidence for the physiological role of pKi-67 is still missing. Recently, we proposed a function of pKi-67 in the early steps of ribosomal RNA (rRNA) synthesis. Here, we have examined the involvement of pKi-67 in this process by photochemical inhibition using chromophore-assisted light inactivation (CALI). Anti-pKi-67 antibodies were labelled with the fluorochrome fluorescein 5(6)-isothiocyanate and were irradiated after binding to their target protein. Performing CALI in vitro on cell lysates led to specific cross-linking of pKi-67. Moreover, the upstream binding factor (UBF) necessary for rRNA transcription was also partly subjected to cross-link formation, indicating a close spatial proximity of UBF and pKi-67. CALI in living cells, using micro-injected antibody, caused a striking relocalization of UBF from foci within the nucleoli to spots located at the nucleolar rim or within the nucleoplasm. pKi-67-CALI resulted in dramatic inhibition of RNA polymerase I-dependent nucleolar rRNA synthesis, whereas RNA polymerase II-dependent nucleoplasmic RNA synthesis remained almost unaltered. Our data presented here argue for a crucial role of pKi-67 in RNA polymerase I-dependent nucleolar rRNA synthesis.

  6. Eukaryotic ribosome display with in situ DNA recovery.

    Science.gov (United States)

    He, Mingyue; Edwards, Bryan M; Kastelic, Damjana; Taussig, Michael J

    2012-01-01

    Ribosome display is a cell-free display technology for in vitro selection and optimisation of proteins from large diversified libraries. It operates through the formation of stable protein-ribosome-mRNA (PRM) complexes and selection of ligand-binding proteins, followed by DNA recovery from the selected genetic information. Both prokaryotic and eukaryotic ribosome display systems have been developed. In this chapter, we describe the eukaryotic rabbit reticulocyte method in which a distinct in situ single-primer RT-PCR procedure is used to recover DNA from the selected PRM complexes without the need for prior disruption of the ribosome.

  7. Mutational analysis of S12 protein and implications for the accuracy of decoding by the ribosome.

    Science.gov (United States)

    Sharma, Divya; Cukras, Anthony R; Rogers, Elizabeth J; Southworth, Daniel R; Green, Rachel

    2007-12-07

    The fidelity of aminoacyl-tRNA selection by the ribosome depends on a conformational switch in the decoding center of the small ribosomal subunit induced by cognate but not by near-cognate aminoacyl-tRNA. The aminoglycosides paromomycin and streptomycin bind to the decoding center and induce related structural rearrangements that explain their observed effects on miscoding. Structural and biochemical studies have identified ribosomal protein S12 (as well as specific nucleotides in 16S ribosomal RNA) as a critical molecular contributor in distinguishing between cognate and near-cognate tRNA species as well as in promoting more global rearrangements in the small subunit, referred to as "closure." Here we use a mutational approach to define contributions made by two highly conserved loops in S12 to the process of tRNA selection. Most S12 variant ribosomes tested display increased levels of fidelity (a "restrictive" phenotype). Interestingly, several variants, K42A and R53A, were substantially resistant to the miscoding effects of paromomycin. Further characterization of the compromised paromomycin response identified a probable second, fidelity-modulating binding site for paromomycin in the 16S ribosomal RNA that facilitates closure of the small subunit and compensates for defects associated with the S12 mutations.

  8. Trapping the ribosome to control gene expression.

    Science.gov (United States)

    Boehringer, Daniel; Ban, Nenad

    2007-09-21

    Protein synthesis is often regulated by structured mRNAs that interact with ribosomes. In this issue of Cell, Marzi et al. (2007) provide insights into the autoregulation of protein S15 by visualizing the folded repressor mRNA on the ribosome stalled in the preinitiation state. These results have implications for our understanding of the mechanism of translation initiation in general.

  9. Ribosome profiling-guided depletion of an mRNA increases cell growth rate and protein secretion

    DEFF Research Database (Denmark)

    Beuchert Kallehauge, Thomas; Li, Shangzhong; Pedersen, Lasse Ebdrup

    2017-01-01

    Recombinant protein production coopts the host cell machinery to provide high protein yields of industrial enzymes or biotherapeutics. However, since protein translation is energetically expensive and tightly controlled, it is unclear if highly expressed recombinant genes are translated as effici......Recombinant protein production coopts the host cell machinery to provide high protein yields of industrial enzymes or biotherapeutics. However, since protein translation is energetically expensive and tightly controlled, it is unclear if highly expressed recombinant genes are translated...... as efficiently as host genes. Furthermore, it is unclear how the high expression impacts global translation. Here, we present the first genome-wide view of protein translation in an IgG-producing CHO cell line, measured with ribosome profiling. Through this we found that our recombinant mRNAs were translated...... as efficiently as the host cell transcriptome, and sequestered up to 15% of the total ribosome occupancy. During cell culture, changes in recombinant mRNA translation were consistent with changes in transcription, demonstrating that transcript levels influence specific productivity. Using this information, we...

  10. Initial bridges between two ribosomal subunits are formed within 9.4 milliseconds, as studied by time-resolved cryo-EM.

    Science.gov (United States)

    Shaikh, Tanvir R; Yassin, Aymen S; Lu, Zonghuan; Barnard, David; Meng, Xing; Lu, Toh-Ming; Wagenknecht, Terence; Agrawal, Rajendra K

    2014-07-08

    Association of the two ribosomal subunits during the process of translation initiation is a crucial step of protein synthesis. The two subunits (30S and 50S) of the bacterial 70S ribosome are held together by 12 dynamic bridges involving RNA-RNA, RNA-protein, and protein-protein interactions. The process of bridge formation, such as whether all these bridges are formed simultaneously or in a sequential order, is poorly understood. To understand such processes, we have developed and implemented a class of microfluidic devices that mix two components to completion within 0.4 ms and spray the mixture in the form of microdroplets onto an electron microscopy grid, yielding a minimum reaction time of 9.4 ms before cryofixation. Using these devices, we have obtained cryo-EM data corresponding to reaction times of 9.4 and 43 ms and have determined 3D structures of ribosomal subunit association intermediates. Molecular analyses of the cryo-EM maps reveal that eight intersubunit bridges (bridges B1a, B1b, B2a, B2b, B3, B7a, B7b, and B8) form within 9.4 ms, whereas the remaining four bridges (bridges B2c, B4, B5, and B6) take longer than 43 ms to form, suggesting that bridges are formed in a stepwise fashion. Our approach can be used to characterize sequences of various dynamic functional events on complex macromolecular assemblies such as ribosomes.

  11. HCV IRES domain IIb affects the configuration of coding RNA in the 40S subunit's decoding groove.

    Science.gov (United States)

    Filbin, Megan E; Kieft, Jeffrey S

    2011-07-01

    Hepatitis C virus (HCV) uses a structured internal ribosome entry site (IRES) RNA to recruit the translation machinery to the viral RNA and begin protein synthesis without the ribosomal scanning process required for canonical translation initiation. Different IRES structural domains are used in this process, which begins with direct binding of the 40S ribosomal subunit to the IRES RNA and involves specific manipulation of the translational machinery. We have found that upon initial 40S subunit binding, the stem-loop domain of the IRES that contains the start codon unwinds and adopts a stable configuration within the subunit's decoding groove. This configuration depends on the sequence and structure of a different stem-loop domain (domain IIb) located far from the start codon in sequence, but spatially proximal in the IRES•40S complex. Mutation of domain IIb results in misconfiguration of the HCV RNA in the decoding groove that includes changes in the placement of the AUG start codon, and a substantial decrease in the ability of the IRES to initiate translation. Our results show that two distal regions of the IRES are structurally communicating at the initial step of 40S subunit binding and suggest that this is an important step in driving protein synthesis.

  12. mESAdb: microRNA expression and sequence analysis database.

    Science.gov (United States)

    Kaya, Koray D; Karakülah, Gökhan; Yakicier, Cengiz M; Acar, Aybar C; Konu, Ozlen

    2011-01-01

    microRNA expression and sequence analysis database (http://konulab.fen.bilkent.edu.tr/mirna/) (mESAdb) is a regularly updated database for the multivariate analysis of sequences and expression of microRNAs from multiple taxa. mESAdb is modular and has a user interface implemented in PHP and JavaScript and coupled with statistical analysis and visualization packages written for the R language. The database primarily comprises mature microRNA sequences and their target data, along with selected human, mouse and zebrafish expression data sets. mESAdb analysis modules allow (i) mining of microRNA expression data sets for subsets of microRNAs selected manually or by motif; (ii) pair-wise multivariate analysis of expression data sets within and between taxa; and (iii) association of microRNA subsets with annotation databases, HUGE Navigator, KEGG and GO. The use of existing and customized R packages facilitates future addition of data sets and analysis tools. Furthermore, the ability to upload and analyze user-specified data sets makes mESAdb an interactive and expandable analysis tool for microRNA sequence and expression data.

  13. RISC RNA sequencing for context-specific identification of in vivo microRNA targets.

    Science.gov (United States)

    Matkovich, Scot J; Van Booven, Derek J; Eschenbacher, William H; Dorn, Gerald W

    2011-01-07

    MicroRNAs (miRs) are expanding our understanding of cardiac disease and have the potential to transform cardiovascular therapeutics. One miR can target hundreds of individual mRNAs, but existing methodologies are not sufficient to accurately and comprehensively identify these mRNA targets in vivo. To develop methods permitting identification of in vivo miR targets in an unbiased manner, using massively parallel sequencing of mouse cardiac transcriptomes in combination with sequencing of mRNA associated with mouse cardiac RNA-induced silencing complexes (RISCs). We optimized techniques for expression profiling small amounts of RNA without introducing amplification bias and applied this to anti-Argonaute 2 immunoprecipitated RISCs (RISC-Seq) from mouse hearts. By comparing RNA-sequencing results of cardiac RISC and transcriptome from the same individual hearts, we defined 1645 mRNAs consistently targeted to mouse cardiac RISCs. We used this approach in hearts overexpressing miRs from Myh6 promoter-driven precursors (programmed RISC-Seq) to identify 209 in vivo targets of miR-133a and 81 in vivo targets of miR-499. Consistent with the fact that miR-133a and miR-499 have widely differing "seed" sequences and belong to different miR families, only 6 targets were common to miR-133a- and miR-499-programmed hearts. RISC-sequencing is a highly sensitive method for general RISC profiling and individual miR target identification in biological context and is applicable to any tissue and any disease state.

  14. A ribosomal RNA gene intergenic spacer based PCR and DGGE fingerprinting method for the analysis of specific rhizobial communities in soil.

    Science.gov (United States)

    de Oliveira, Valéria Maia; Manfio, Gilson Paulo; da Costa Coutinho, Heitor Luiz; Keijzer-Wolters, Anneke Christina; van Elsas, Jan Dirk

    2006-03-01

    A direct molecular method for assessing the diversity of specific populations of rhizobia in soil, based on nested PCR amplification of 16S-23S ribosomal RNA gene (rDNA) intergenic spacer (IGS) sequences, was developed. Initial generic amplification of bacterial rDNA IGS sequences from soil DNA was followed by specific amplification of (1) sequences affiliated with Rhizobium leguminosarum "sensu lato" and (2) R. tropici. Using analysis of the amplified sequences in clone libraries obtained on the basis of soil DNA, this two-sided method was shown to be very specific for rhizobial subpopulations in soil. It was then further validated as a direct fingerprinting tool of the target rhizobia based on denaturing gradient gel electrophoresis (DGGE). The PCR-DGGE approach was applied to soils from fields in Brazil cultivated with common bean (Phaseolus vulgaris) under conventional or no-tillage practices. The community fingerprints obtained allowed the direct analysis of the respective rhizobial community structures in soil samples from the two contrasting agricultural practices. Data obtained with both primer sets revealed clustering of the community structures of the target rhizobial types along treatment. Moreover, the DGGE profiles obtained with the R. tropici primer set indicated that the abundance and diversity of these organisms were favoured under NT practices. These results suggest that the R. leguminosarum-as well as R. tropici-targeted IGS-based nested PCR and DGGE are useful tools for monitoring the effect of agricultural practices on these and related rhizobial subpopulations in soils.

  15. DNA Binding by the Ribosomal DNA Transcription Factor Rrn3 Is Essential for Ribosomal DNA Transcription*

    Science.gov (United States)

    Stepanchick, Ann; Zhi, Huijun; Cavanaugh, Alice H.; Rothblum, Katrina; Schneider, David A.; Rothblum, Lawrence I.

    2013-01-01

    The human homologue of yeast Rrn3 is an RNA polymerase I-associated transcription factor that is essential for ribosomal DNA (rDNA) transcription. The generally accepted model is that Rrn3 functions as a bridge between RNA polymerase I and the transcription factors bound to the committed template. In this model Rrn3 would mediate an interaction between the mammalian Rrn3-polymerase I complex and SL1, the rDNA transcription factor that binds to the core promoter element of the rDNA. In the course of studying the role of Rrn3 in recruitment, we found that Rrn3 was in fact a DNA-binding protein. Analysis of the sequence of Rrn3 identified a domain with sequence similarity to the DNA binding domain of heat shock transcription factor 2. Randomization, or deletion, of the amino acids in this region in Rrn3, amino acids 382–400, abrogated its ability to bind DNA, indicating that this domain was an important contributor to DNA binding by Rrn3. Control experiments demonstrated that these mutant Rrn3 constructs were capable of interacting with both rpa43 and SL1, two other activities demonstrated to be essential for Rrn3 function. However, neither of these Rrn3 mutants was capable of functioning in transcription in vitro. Moreover, although wild-type human Rrn3 complemented a yeast rrn3-ts mutant, the DNA-binding site mutant did not. These results demonstrate that DNA binding by Rrn3 is essential for transcription by RNA polymerase I. PMID:23393135

  16. DNA binding by the ribosomal DNA transcription factor rrn3 is essential for ribosomal DNA transcription.

    Science.gov (United States)

    Stepanchick, Ann; Zhi, Huijun; Cavanaugh, Alice H; Rothblum, Katrina; Schneider, David A; Rothblum, Lawrence I

    2013-03-29

    The human homologue of yeast Rrn3 is an RNA polymerase I-associated transcription factor that is essential for ribosomal DNA (rDNA) transcription. The generally accepted model is that Rrn3 functions as a bridge between RNA polymerase I and the transcription factors bound to the committed template. In this model Rrn3 would mediate an interaction between the mammalian Rrn3-polymerase I complex and SL1, the rDNA transcription factor that binds to the core promoter element of the rDNA. In the course of studying the role of Rrn3 in recruitment, we found that Rrn3 was in fact a DNA-binding protein. Analysis of the sequence of Rrn3 identified a domain with sequence similarity to the DNA binding domain of heat shock transcription factor 2. Randomization, or deletion, of the amino acids in this region in Rrn3, amino acids 382-400, abrogated its ability to bind DNA, indicating that this domain was an important contributor to DNA binding by Rrn3. Control experiments demonstrated that these mutant Rrn3 constructs were capable of interacting with both rpa43 and SL1, two other activities demonstrated to be essential for Rrn3 function. However, neither of these Rrn3 mutants was capable of functioning in transcription in vitro. Moreover, although wild-type human Rrn3 complemented a yeast rrn3-ts mutant, the DNA-binding site mutant did not. These results demonstrate that DNA binding by Rrn3 is essential for transcription by RNA polymerase I.

  17. Toxicity of ricin A chain is reduced in mammalian cells by inhibiting its interaction with the ribosome

    Energy Technology Data Exchange (ETDEWEB)

    Jetzt, Amanda E. [Department of Animal Sciences, Rutgers, The State University of New Jersey, New Brunswick, NJ 08901-8520 (United States); Li, Xiao-Ping; Tumer, Nilgun E. [Department of Plant Biology and Pathology, Rutgers, The State University of New Jersey, New Brunswick, NJ 08901-8520 (United States); Cohick, Wendie S., E-mail: cohick@aesop.rutgers.edu [Department of Animal Sciences, Rutgers, The State University of New Jersey, New Brunswick, NJ 08901-8520 (United States)

    2016-11-01

    Ricin is a potent ribotoxin that is considered a bioterror threat due to its ease of isolation and possibility of aerosolization. In yeast, mutation of arginine residues away from the active site results in a ricin toxin A chain (RTA) variant that is unable to bind the ribosome and exhibits reduced cytotoxicity. The goal of the present work was to determine if these residues contribute to ribosome binding and cytotoxicity of RTA in mammalian cells. The RTA mutant R193A/R235A did not interact with mammalian ribosomes, while a G212E variant with a point mutation near its active site bound ribosomes similarly to wild-type (WT) RTA. R193A/R235A retained full catalytic activity on naked RNA but had reduced activity on mammalian ribosomes. To determine the effect of this mutant in intact cells, pre R193A/R235A containing a signal sequence directing it to the endoplasmic reticulum and mature R193A/R235A that directly targeted cytosolic ribosomes were each expressed. Depurination and protein synthesis inhibition were reduced by both pre- and mature R193A/R235A relative to WT. Protein synthesis inhibition was reduced to a greater extent by R193A/R235A than by G212E. Pre R193A/R235A caused a greater reduction in caspase activation and loss of mitochondrial membrane potential than G212E relative to WT RTA. These findings indicate that an RTA variant with reduced ribosome binding is less toxic than a variant with less catalytic activity but normal ribosome binding activity. The toxin-ribosome interaction represents a novel target for the development of therapeutics to prevent or treat ricin intoxication. - Highlights: • Arginines 193 and 235 of RTA are critical for binding to the mammalian ribosome. • R193A/R235A has full catalytic activity on RNA but not on mammalian ribosomes. • R193A/R235A is less toxic than a mutant that targets the active site. • The toxin-ribosome interaction is a therapeutic target for ricin intoxication.

  18. Assembly constraints drive co-evolution among ribosomal constituents.

    Science.gov (United States)

    Mallik, Saurav; Akashi, Hiroshi; Kundu, Sudip

    2015-06-23

    Ribosome biogenesis, a central and essential cellular process, occurs through sequential association and mutual co-folding of protein-RNA constituents in a well-defined assembly pathway. Here, we construct a network of co-evolving nucleotide/amino acid residues within the ribosome and demonstrate that assembly constraints are strong predictors of co-evolutionary patterns. Predictors of co-evolution include a wide spectrum of structural reconstitution events, such as cooperativity phenomenon, protein-induced rRNA reconstitutions, molecular packing of different rRNA domains, protein-rRNA recognition, etc. A correlation between folding rate of small globular proteins and their topological features is known. We have introduced an analogous topological characteristic for co-evolutionary network of ribosome, which allows us to differentiate between rRNA regions subjected to rapid reconstitutions from those hindered by kinetic traps. Furthermore, co-evolutionary patterns provide a biological basis for deleterious mutation sites and further allow prediction of potential antibiotic targeting sites. Understanding assembly pathways of multicomponent macromolecules remains a key challenge in biophysics. Our study provides a 'proof of concept' that directly relates co-evolution to biophysical interactions during multicomponent assembly and suggests predictive power to identify candidates for critical functional interactions as well as for assembly-blocking antibiotic target sites. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  19. BioVLAB-MMIA-NGS: microRNA-mRNA integrated analysis using high-throughput sequencing data.

    Science.gov (United States)

    Chae, Heejoon; Rhee, Sungmin; Nephew, Kenneth P; Kim, Sun

    2015-01-15

    It is now well established that microRNAs (miRNAs) play a critical role in regulating gene expression in a sequence-specific manner, and genome-wide efforts are underway to predict known and novel miRNA targets. However, the integrated miRNA-mRNA analysis remains a major computational challenge, requiring powerful informatics systems and bioinformatics expertise. The objective of this study was to modify our widely recognized Web server for the integrated mRNA-miRNA analysis (MMIA) and its subsequent deployment on the Amazon cloud (BioVLAB-MMIA) to be compatible with high-throughput platforms, including next-generation sequencing (NGS) data (e.g. RNA-seq). We developed a new version called the BioVLAB-MMIA-NGS, deployed on both Amazon cloud and on a high-performance publicly available server called MAHA. By using NGS data and integrating various bioinformatics tools and databases, BioVLAB-MMIA-NGS offers several advantages. First, sequencing data is more accurate than array-based methods for determining miRNA expression levels. Second, potential novel miRNAs can be detected by using various computational methods for characterizing miRNAs. Third, because miRNA-mediated gene regulation is due to hybridization of an miRNA to its target mRNA, sequencing data can be used to identify many-to-many relationship between miRNAs and target genes with high accuracy. http://epigenomics.snu.ac.kr/biovlab_mmia_ngs/. © The Author 2014. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  20. The Conserved RNA Exonuclease Rexo5 Is Required for 3′ End Maturation of 28S rRNA, 5S rRNA, and snoRNAs

    Directory of Open Access Journals (Sweden)

    Stefanie Gerstberger

    2017-10-01

    Full Text Available Non-coding RNA biogenesis in higher eukaryotes has not been fully characterized. Here, we studied the Drosophila melanogaster Rexo5 (CG8368 protein, a metazoan-specific member of the DEDDh 3′-5′ single-stranded RNA exonucleases, by genetic, biochemical, and RNA-sequencing approaches. Rexo5 is required for small nucleolar RNA (snoRNA and rRNA biogenesis and is essential in D. melanogaster. Loss-of-function mutants accumulate improperly 3′ end-trimmed 28S rRNA, 5S rRNA, and snoRNA precursors in vivo. Rexo5 is ubiquitously expressed at low levels in somatic metazoan cells but extremely elevated in male and female germ cells. Loss of Rexo5 leads to increased nucleolar size, genomic instability, defective ribosome subunit export, and larval death. Loss of germline expression compromises gonadal growth and meiotic entry during germline development.

  1. Unexpected Diagnosis of Cerebral Toxoplasmosis by 16S and D2 Large-Subunit Ribosomal DNA PCR and Sequencing

    DEFF Research Database (Denmark)

    Kruse, Alexandra Yasmin Collin; Kvich, Lasse Andersson; Eickhardt-Dalbøge, Steffen Robert

    2015-01-01

    The protozoan parasite Toxoplasma gondii causes severe opportunistic infections. Here, we report an unexpected diagnosis of cerebral toxoplasmosis. T. gondii was diagnosed by 16S and D2 large-subunit (LSU) ribosomal DNA (rDNA) sequencing of a cerebral biopsy specimen and confirmed by T. gondii...

  2. An intergenic non-coding rRNA correlated with expression of the rRNA and frequency of an rRNA single nucleotide polymorphism in lung cancer cells.

    Directory of Open Access Journals (Sweden)

    Yih-Horng Shiao

    Full Text Available BACKGROUND: Ribosomal RNA (rRNA is a central regulator of cell growth and may control cancer development. A cis noncoding rRNA (nc-rRNA upstream from the 45S rRNA transcription start site has recently been implicated in control of rRNA transcription in mouse fibroblasts. We investigated whether a similar nc-rRNA might be expressed in human cancer epithelial cells, and related to any genomic characteristics. METHODOLOGY/PRINCIPAL FINDINGS: Using quantitative rRNA measurement, we demonstrated that a nc-rRNA is transcribed in human lung epithelial and lung cancer cells, starting from approximately -1000 nucleotides upstream of the rRNA transcription start site (+1 and extending at least to +203. This nc-rRNA was significantly more abundant in the majority of lung cancer cell lines, relative to a nontransformed lung epithelial cell line. Its abundance correlated negatively with total 45S rRNA in 12 of 13 cell lines (P = 0.014. During sequence analysis from -388 to +306, we observed diverse, frequent intercopy single nucleotide polymorphisms (SNPs in rRNA, with a frequency greater than predicted by chance at 12 sites. A SNP at +139 (U/C in the 5' leader sequence varied among the cell lines and correlated negatively with level of the nc-rRNA (P = 0.014. Modelling of the secondary structure of the rRNA 5'-leader sequence indicated a small increase in structural stability due to the +139 U/C SNP and a minor shift in local configuration occurrences. CONCLUSIONS/SIGNIFICANCE: The results demonstrate occurrence of a sense nc-rRNA in human lung epithelial and cancer cells, and imply a role in regulation of the rRNA gene, which may be affected by a +139 SNP in the 5' leader sequence of the primary rRNA transcript.

  3. Acrolein preferentially damages nucleolus eliciting ribosomal stress and apoptosis in human cancer cells.

    Science.gov (United States)

    Wang, Hsiang-Tsui; Chen, Tzu-Ying; Weng, Ching-Wen; Yang, Chun-Hsiang; Tang, Moon-Shong

    2016-12-06

    Acrolein (Acr) is a potent cytotoxic and DNA damaging agent which is ubiquitous in the environment and abundant in tobacco smoke. Acr is also an active cytotoxic metabolite of the anti-cancer drugs cyclophosphamide and ifosfamide. The mechanisms via which Acr exerts its anti-cancer activity and cytotoxicity are not clear. In this study, we found that Acr induces cytotoxicity and cell death in human cancer cells with different activities of p53. Acr preferentially binds nucleolar ribosomal DNA (rDNA) to form Acr-deoxyguanosine adducts, and induces oxidative damage to both rDNA and ribosomal RNA (rRNA). Acr triggers ribosomal stress responses, inhibits rRNA synthesis, reduces RNA polymerase I binding to the promoter of rRNA gene, disrupts nucleolar integrity, and impairs ribosome biogenesis and polysome formation. Acr causes an increase in MDM2 levels and phosphorylation of MDM2 in A549 and HeLa cells which are p53 active and p53 inactive, respectively. It enhances the binding of ribosomal protein RPL11 to MDM2 and reduces the binding of p53 and E2F-1 to MDM2 resulting in stabilization/activation of p53 in A549 cells and degradation of E2F-1 in A549 and HeLa cells. We propose that Acr induces ribosomal stress which leads to activation of MDM2 and RPL11-MDM2 binding, consequently, activates p53 and enhances E2F-1 degradation, and that taken together these two processes induce apoptosis and cell death.

  4. Expression of protein-coding genes embedded in ribosomal DNA

    DEFF Research Database (Denmark)

    Johansen, Steinar D; Haugen, Peik; Nielsen, Henrik

    2007-01-01

    Ribosomal DNA (rDNA) is a specialised chromosomal location that is dedicated to high-level transcription of ribosomal RNA genes. Interestingly, rDNAs are frequently interrupted by parasitic elements, some of which carry protein genes. These are non-LTR retrotransposons and group II introns that e...... in the nucleolus....

  5. Assessment of phylogenetic relationship of rare plant species collected from Saudi Arabia using internal transcribed spacer sequences of nuclear ribosomal DNA.

    Science.gov (United States)

    Al-Qurainy, F; Khan, S; Nadeem, M; Tarroum, M; Alaklabi, A

    2013-03-11

    The rare and endangered plants of any country are important genetic resources that often require urgent conservation measures. Assessment of phylogenetic relationships and evaluation of genetic diversity is very important prior to implementation of conservation strategies for saving rare and endangered plant species. We used internal transcribed spacer sequences of nuclear ribosomal DNA for the evaluation of sequence identity from the available taxa in the GenBank database by using the Basic Local Alignment Search Tool (BLAST). Two rare plant species viz, Heliotropium strigosum claded with H. pilosum (98% branch support) and Pancratium tortuosum claded with P. tenuifolium (61% branch support) clearly. However, some species, viz Scadoxus multiflorus, Commiphora myrrha and Senecio hadiensis showed close relationships with more than one species. We conclude that nuclear ribosomal internal transcribed spacer sequences are useful markers for phylogenetic study of these rare plant species in Saudi Arabia.

  6. Small subunit ribosomal metabarcoding reveals extraordinary trypanosomatid diversity in Brazilian bats.

    Directory of Open Access Journals (Sweden)

    Maria Augusta Dario

    2017-07-01

    Full Text Available Bats are a highly successful, globally dispersed order of mammals that occupy a wide array of ecological niches. They are also intensely parasitized and implicated in multiple viral, bacterial and parasitic zoonoses. Trypanosomes are thought to be especially abundant and diverse in bats. In this study, we used 18S ribosomal RNA metabarcoding to probe bat trypanosome diversity in unprecedented detail.Total DNA was extracted from the blood of 90 bat individuals (17 species captured along Atlantic Forest fragments of Espírito Santo state, southeast Brazil. 18S ribosomal RNA was amplified by standard and/or nested PCR, then deep sequenced to recover and identify Operational Taxonomic Units (OTUs for phylogenetic analysis. Blood samples from 34 bat individuals (13 species tested positive for infection by 18S rRNA amplification. Amplicon sequences clustered to 14 OTUs, of which five were identified as Trypanosoma cruzi I, T. cruzi III/V, Trypanosoma cruzi marinkellei, Trypanosoma rangeli, and Trypanosoma dionisii, and seven were identified as novel genotypes monophyletic to basal T. cruzi clade types of the New World. Another OTU was identified as a trypanosome like those found in reptiles. Surprisingly, the remaining OTU was identified as Bodo saltans-closest non-parasitic relative of the trypanosomatid order. While three blood samples featured just one OTU (T. dionisii, all others resolved as mixed infections of up to eight OTUs.This study demonstrates the utility of next-generation barcoding methods to screen parasite diversity in mammalian reservoir hosts. We exposed high rates of local bat parasitism by multiple trypanosome species, some known to cause fatal human disease, others non-pathogenic, novel or yet little understood. Our results highlight bats as a long-standing nexus among host-parasite interactions of multiple niches, sustained in part by opportunistic and incidental infections of consequence to evolutionary theory as much as to

  7. Effects of S-adenosylmethionine decarboxylase, polyamines, amino acids, and weak bases (amines and ammonia) on development and ribosomal RNA synthesis in Xenopus embryos.

    Science.gov (United States)

    Shiokawa, Koichiro; Aso, Mai; Kondo, Takeshi; Takai, Jun-Ichi; Yoshida, Junki; Mishina, Takamichi; Fuchimukai, Kota; Ogasawara, Tsukasa; Kariya, Taro; Tashiro, Kosuke; Igarashi, Kazuei

    2010-02-01

    We have been studying control mechanisms of gene expression in early embryogenesis in a South African clawed toad Xenopus laevis, especially during the period of midblastula transition (MBT), or the transition from the phase of active cell division (cleavage stage) to the phase of extensive morphogenesis (post-blastular stages). We first found that ribosomal RNA synthesis is initiated shortly after MBT in Xenopus embryos and those weak bases, such as amines and ammonium ion, selectively inhibit the initiation and subsequent activation of rRNA synthesis. We then found that rapidly labeled heterogeneous mRNA-like RNA is synthesized in embryos at pre-MBT stage. We then performed cloning and expression studies of several genes, such as those for activin receptors, follistatin and aldolases, and then reached the studies of S-adenosylmethionine decarboxylase (SAMDC), a key enzyme in polyamine metabolism. Here, we cloned a Xenopus SAMDC cDNA and performed experiments to overexpress the in vitro-synthesized SAMDC mRNA in Xenopus early embryos, and found that the maternally preset program of apoptosis occurs in cleavage stage embryos, which is executed when embryos reach the stage of MBT. In the present article, we first summarize results on SAMDC and the maternal program of apoptosis, and then describe our studies on small-molecular-weight substances like polyamines, amino acids, and amines in Xenopus embryos. Finally, we summarize our studies on weak bases, especially on ammonium ion, as the specific inhibitor of ribosomal RNA synthesis in Xenopus embryonic cells.

  8. 5S rRNA gene arrangements in protists: a case of nonadaptive evolution.

    Science.gov (United States)

    Drouin, Guy; Tsang, Corey

    2012-06-01

    Given their high copy number and high level of expression, one might expect that both the sequence and organization of eukaryotic ribosomal RNA genes would be conserved during evolution. Although the organization of 18S, 5.8S and 28S ribosomal RNA genes is indeed relatively well conserved, that of 5S rRNA genes is much more variable. Here, we review the different types of 5S rRNA gene arrangements which have been observed in protists. This includes linkages to the other ribosomal RNA genes as well as linkages to ubiquitin, splice-leader, snRNA and tRNA genes. Mapping these linkages to independently derived phylogenies shows that these diverse linkages have repeatedly been gained and lost during evolution. This argues against such linkages being the primitive condition not only in protists but also in other eukaryote species. Because the only characteristic the diverse genes with which 5S rRNA genes are found linked with is that they are tandemly repeated, these arrangements are unlikely to provide any selective advantage. Rather, the observed high variability in 5S rRNA genes arrangements is likely the result of the fact that 5S rRNA genes contain internal promoters, that these genes are often transposed by diverse recombination mechanisms and that these new gene arrangements are rapidly homogenized by unequal crossingovers and/or by gene conversions events in species with short generation times and frequent founder events.

  9. Reconstruction of ancestral RNA sequences under multiple structural constraints.

    Science.gov (United States)

    Tremblay-Savard, Olivier; Reinharz, Vladimir; Waldispühl, Jérôme

    2016-11-11

    Secondary structures form the scaffold of multiple sequence alignment of non-coding RNA (ncRNA) families. An accurate reconstruction of ancestral ncRNAs must use this structural signal. However, the inference of ancestors of a single ncRNA family with a single consensus structure may bias the results towards sequences with high affinity to this structure, which are far from the true ancestors. In this paper, we introduce achARNement, a maximum parsimony approach that, given two alignments of homologous ncRNA families with consensus secondary structures and a phylogenetic tree, simultaneously calculates ancestral RNA sequences for these two families. We test our methodology on simulated data sets, and show that achARNement outperforms classical maximum parsimony approaches in terms of accuracy, but also reduces by several orders of magnitude the number of candidate sequences. To conclude this study, we apply our algorithms on the Glm clan and the FinP-traJ clan from the Rfam database. Our results show that our methods reconstruct small sets of high-quality candidate ancestors with better agreement to the two target structures than with classical approaches. Our program is freely available at: http://csb.cs.mcgill.ca/acharnement .

  10. Deep Sequencing Insights in Therapeutic shRNA Processing and siRNA Target Cleavage Precision.

    Science.gov (United States)

    Denise, Hubert; Moschos, Sterghios A; Sidders, Benjamin; Burden, Frances; Perkins, Hannah; Carter, Nikki; Stroud, Tim; Kennedy, Michael; Fancy, Sally-Ann; Lapthorn, Cris; Lavender, Helen; Kinloch, Ross; Suhy, David; Corbau, Romu

    2014-02-04

    TT-034 (PF-05095808) is a recombinant adeno-associated virus serotype 8 (AAV8) agent expressing three short hairpin RNA (shRNA) pro-drugs that target the hepatitis C virus (HCV) RNA genome. The cytosolic enzyme Dicer cleaves each shRNA into multiple, potentially active small interfering RNA (siRNA) drugs. Using next-generation sequencing (NGS) to identify and characterize active shRNAs maturation products, we observed that each TT-034-encoded shRNA could be processed into as many as 95 separate siRNA strands. Few of these appeared active as determined by Sanger 5' RNA Ligase-Mediated Rapid Amplification of cDNA Ends (5-RACE) and through synthetic shRNA and siRNA analogue studies. Moreover, NGS scrutiny applied on 5-RACE products (RACE-seq) suggested that synthetic siRNAs could direct cleavage in not one, but up to five separate positions on targeted RNA, in a sequence-dependent manner. These data support an on-target mechanism of action for TT-034 without cytotoxicity and question the accepted precision of substrate processing by the key RNA interference (RNAi) enzymes Dicer and siRNA-induced silencing complex (siRISC).Molecular Therapy-Nucleic Acids (2014) 3, e145; doi:10.1038/mtna.2013.73; published online 4 February 2014.

  11. Chaperoning 5S RNA assembly.

    Science.gov (United States)

    Madru, Clément; Lebaron, Simon; Blaud, Magali; Delbos, Lila; Pipoli, Juliana; Pasmant, Eric; Réty, Stéphane; Leulliot, Nicolas

    2015-07-01

    In eukaryotes, three of the four ribosomal RNAs (rRNAs)—the 5.8S, 18S, and 25S/28S rRNAs—are processed from a single pre-rRNA transcript and assembled into ribosomes. The fourth rRNA, the 5S rRNA, is transcribed by RNA polymerase III and is assembled into the 5S ribonucleoprotein particle (RNP), containing ribosomal proteins Rpl5/uL18 and Rpl11/uL5, prior to its incorporation into preribosomes. In mammals, the 5S RNP is also a central regulator of the homeostasis of the tumor suppressor p53. The nucleolar localization of the 5S RNP and its assembly into preribosomes are performed by a specialized complex composed of Rpf2 and Rrs1 in yeast or Bxdc1 and hRrs1 in humans. Here we report the structural and functional characterization of the Rpf2-Rrs1 complex alone, in complex with the 5S RNA, and within pre-60S ribosomes. We show that the Rpf2-Rrs1 complex contains a specialized 5S RNA E-loop-binding module, contacts the Rpl5 protein, and also contacts the ribosome assembly factor Rsa4 and the 25S RNA. We propose that the Rpf2-Rrs1 complex establishes a network of interactions that guide the incorporation of the 5S RNP in preribosomes in the initial conformation prior to its rotation to form the central protuberance found in the mature large ribosomal subunit. © 2015 Madru et al.; Published by Cold Spring Harbor Laboratory Press.

  12. Absence of ribosomal DNA amplification in the meroistic (telotrophic) ovary of the large milkweed bug Oncopeltus fasciatus (Dallas) (Hemiptera: Lygaeidae)

    Science.gov (United States)

    1975-01-01

    In the typical meroistic insect ovary, the oocyte nucleus synthesizes little if any RNA. Nurse cells or trophocytes actively synthesize ribosomes which are transported to and accumulated by the oocyte. In the telotrophic ovary a morphological separation exists, the nurse cells being localized at the apical end of each ovariole and communicating with the ooocytes via nutritive cords. In order to determine whether the genes coding for ribosomal RNA (rRNA) are amplified in the telotrophic ovary of the milkweed bug Oncopeltus fasciatus, the percentages of the genome coding for ribosomal RNA in somatic cells, spermatogenic cells, ovarian follicles, and nurse cells were compared. The oocytes and most of the nurse cells of O. fasciatus are uninucleolate. DNA hybridizing with ribosomal RNA is localized in a satellite DNA, the density of which is 1.712 g/cm(-3). The density of main-band DNA is 1.694 g/cm(-3). The ribosomal DNA satellite accounts for approximately 0.2% of the DNA in somatic and gametogenic tissues of both males and females. RNA-DNA hybridization analysis demonstrates that approximately 0.03% of the DNA in somatic tissues, testis, ovarian follicles, and isolated nurse cells hybridizes with ribosomal RNA. The fact that the percentage of DNA hybridizing with rRNA is the same in somatic and in male and female gametogenic tissues indicates that amplification of ribosomal DNA does not occur in nurse cells and that if it occurs in oocytes, it represents less than a 50- fold increase in ribosomal DNA. An increase in total genome DNA accounted by polyploidization appears to provide for increasing the amount of ribosomal DNA in the nurse cells. PMID:1158969

  13. Defining the bacteroides ribosomal binding site.

    Science.gov (United States)

    Wegmann, Udo; Horn, Nikki; Carding, Simon R

    2013-03-01

    The human gastrointestinal tract, in particular the colon, hosts a vast number of commensal microorganisms. Representatives of the genus Bacteroides are among the most abundant bacterial species in the human colon. Bacteroidetes diverged from the common line of eubacterial descent before other eubacterial groups. As a result, they employ unique transcription initiation signals and, because of this uniqueness, they require specific genetic tools. Although some tools exist, they are not optimal for studying the roles and functions of these bacteria in the human gastrointestinal tract. Focusing on translation initiation signals in Bacteroides, we created a series of expression vectors allowing for different levels of protein expression in this genus, and we describe the use of pepI from Lactobacillus delbrueckii subsp. lactis as a novel reporter gene for Bacteroides. Furthermore, we report the identification of the 3' end of the 16S rRNA of Bacteroides ovatus and analyze in detail its ribosomal binding site, thus defining a core region necessary for efficient translation, which we have incorporated into the design of our expression vectors. Based on the sequence logo information from the 5' untranslated region of other Bacteroidales ribosomal protein genes, we conclude that our findings are relevant to all members of this order.

  14. Nascent peptide-mediated translation elongation arrest coupled with mRNA degradation in the CGS1 gene of Arabidopsis

    Science.gov (United States)

    Onouchi, Hitoshi; Nagami, Yoko; Haraguchi, Yuhi; Nakamoto, Mari; Nishimura, Yoshiko; Sakurai, Ryoko; Nagao, Nobuhiro; Kawasaki, Daisuke; Kadokura, Yoshitomo; Naito, Satoshi

    2005-01-01

    Expression of the Arabidopsis CGS1 gene that codes for cystathionine γ-synthase is feedback regulated at the step of mRNA stability in response to S-adenosyl-L-methionine (AdoMet). A short stretch of amino acid sequence, called the MTO1 region, encoded by the first exon of CGS1 itself is involved in this regulation. Here, we demonstrate, using a cell-free system, that AdoMet induces temporal translation elongation arrest at the Ser-94 codon located immediately downstream of the MTO1 region, by analyzing a translation intermediate and performing primer extension inhibition (toeprint) analysis. This translation arrest precedes the formation of a degradation intermediate of CGS1 mRNA, which has its 5′ end points near the 5′ edge of the stalled ribosome. The position of ribosome stalling also suggests that the MTO1 region in nascent peptide resides in the ribosomal exit tunnel when translation elongation is temporarily arrested. In addition to the MTO1 region amino acid sequence, downstream Trp-93 is also important for the AdoMet-induced translation arrest. This is the first example of nascent peptide-mediated translation elongation arrest coupled with mRNA degradation in eukaryotes. Furthermore, our data suggest that the ribosome stalls at the step of translocation rather than at the step of peptidyl transfer. PMID:16027170

  15. A unique enhancer boundary complex on the mouse ribosomal RNA genes persists after loss of Rrn3 or UBF and the inactivation of RNA polymerase I transcription.

    Science.gov (United States)

    Herdman, Chelsea; Mars, Jean-Clement; Stefanovsky, Victor Y; Tremblay, Michel G; Sabourin-Felix, Marianne; Lindsay, Helen; Robinson, Mark D; Moss, Tom

    2017-07-01

    Transcription of the several hundred of mouse and human Ribosomal RNA (rRNA) genes accounts for the majority of RNA synthesis in the cell nucleus and is the determinant of cytoplasmic ribosome abundance, a key factor in regulating gene expression. The rRNA genes, referred to globally as the rDNA, are clustered as direct repeats at the Nucleolar Organiser Regions, NORs, of several chromosomes, and in many cells the active repeats are transcribed at near saturation levels. The rDNA is also a hotspot of recombination and chromosome breakage, and hence understanding its control has broad importance. Despite the need for a high level of rDNA transcription, typically only a fraction of the rDNA is transcriptionally active, and some NORs are permanently silenced by CpG methylation. Various chromatin-remodelling complexes have been implicated in counteracting silencing to maintain rDNA activity. However, the chromatin structure of the active rDNA fraction is still far from clear. Here we have combined a high-resolution ChIP-Seq protocol with conditional inactivation of key basal factors to better understand what determines active rDNA chromatin. The data resolve questions concerning the interdependence of the basal transcription factors, show that preinitiation complex formation is driven by the architectural factor UBF (UBTF) independently of transcription, and that RPI termination and release corresponds with the site of TTF1 binding. They further reveal the existence of an asymmetric Enhancer Boundary Complex formed by CTCF and Cohesin and flanked upstream by phased nucleosomes and downstream by an arrested RNA Polymerase I complex. We find that the Enhancer Boundary Complex is the only site of active histone modification in the 45kbp rDNA repeat. Strikingly, it not only delimits each functional rRNA gene, but also is stably maintained after gene inactivation and the re-establishment of surrounding repressive chromatin. Our data define a poised state of rDNA chromatin

  16. A unique enhancer boundary complex on the mouse ribosomal RNA genes persists after loss of Rrn3 or UBF and the inactivation of RNA polymerase I transcription.

    Directory of Open Access Journals (Sweden)

    Chelsea Herdman

    2017-07-01

    Full Text Available Transcription of the several hundred of mouse and human Ribosomal RNA (rRNA genes accounts for the majority of RNA synthesis in the cell nucleus and is the determinant of cytoplasmic ribosome abundance, a key factor in regulating gene expression. The rRNA genes, referred to globally as the rDNA, are clustered as direct repeats at the Nucleolar Organiser Regions, NORs, of several chromosomes, and in many cells the active repeats are transcribed at near saturation levels. The rDNA is also a hotspot of recombination and chromosome breakage, and hence understanding its control has broad importance. Despite the need for a high level of rDNA transcription, typically only a fraction of the rDNA is transcriptionally active, and some NORs are permanently silenced by CpG methylation. Various chromatin-remodelling complexes have been implicated in counteracting silencing to maintain rDNA activity. However, the chromatin structure of the active rDNA fraction is still far from clear. Here we have combined a high-resolution ChIP-Seq protocol with conditional inactivation of key basal factors to better understand what determines active rDNA chromatin. The data resolve questions concerning the interdependence of the basal transcription factors, show that preinitiation complex formation is driven by the architectural factor UBF (UBTF independently of transcription, and that RPI termination and release corresponds with the site of TTF1 binding. They further reveal the existence of an asymmetric Enhancer Boundary Complex formed by CTCF and Cohesin and flanked upstream by phased nucleosomes and downstream by an arrested RNA Polymerase I complex. We find that the Enhancer Boundary Complex is the only site of active histone modification in the 45kbp rDNA repeat. Strikingly, it not only delimits each functional rRNA gene, but also is stably maintained after gene inactivation and the re-establishment of surrounding repressive chromatin. Our data define a poised state

  17. Reconstruction of ancestral RNA sequences under multiple structural constraints

    OpenAIRE

    Tremblay-Savard, Olivier; Reinharz, Vladimir; Waldisp?hl, J?r?me

    2016-01-01

    Background Secondary structures form the scaffold of multiple sequence alignment of non-coding RNA (ncRNA) families. An accurate reconstruction of ancestral ncRNAs must use this structural signal. However, the inference of ancestors of a single ncRNA family with a single consensus structure may bias the results towards sequences with high affinity to this structure, which are far from the true ancestors. Methods In this paper, we introduce achARNement, a maximum parsimony approach that, given...

  18. Diversification in insular plants: Inferring the phylogenetic relationship in Aeonium (Crassulaceae) using ITS sequences of nuclear ribosomal DNA

    DEFF Research Database (Denmark)

    Jorgensen, T.H.; Frydenberg, J.

    1999-01-01

    The ITS regions of nuclear ribosomal DNA were sequenced in 37 species of the genus Aeonium. A phylogeny obtained through the use of parsimony agrees to some extent with the sectional division of the genus and confirms the position of two newly described species. It also suggests the potential imp...

  19. Role of the ribosomal P-site elements of m²G966, m⁵C967, and the S9 C-terminal tail in maintenance of the reading frame during translational elongation in Escherichia coli.

    Science.gov (United States)

    Arora, Smriti; Bhamidimarri, Satya Prathyusha; Weber, Michael H W; Varshney, Umesh

    2013-08-01

    The ribosomal P-site hosts the peptidyl-tRNAs during translation elongation. Which P-site elements support these tRNA species to maintain codon-anticodon interactions has remained unclear. We investigated the effects of P-site features of methylations of G966, C967, and the conserved C-terminal tail sequence of Ser, Lys, and Arg (SKR) of the S9 ribosomal protein in maintenance of the translational reading frame of an mRNA. We generated Escherichia coli strains deleted for the SKR sequence in S9 ribosomal protein, RsmB (which methylates C967), and RsmD (which methylates G966) and used them to translate LacZ from its +1 and -1 out-of-frame constructs. We show that the S9 SKR tail prevents both the +1 and -1 frameshifts and plays a general role in holding the P-site tRNA/peptidyl-tRNA in place. In contrast, the G966 and C967 methylations did not make a direct contribution to the maintenance of the translational frame of an mRNA. However, deletion of rsmB in the S9Δ3 background caused significantly increased -1 frameshifting at 37°C. Interestingly, the effects of the deficiency of C967 methylation were annulled when the E. coli strain was grown at 30°C, supporting its context-dependent role.

  20. Mapping posttranscriptional modifications in 5S ribosomal RNA by MALDI mass spectrometry.

    OpenAIRE

    Kirpekar, F; Douthwaite, S; Roepstorff, P

    2000-01-01

    We present a method to screen RNA for posttranscriptional modifications based on Matrix Assisted Laser Desorption/Ionization mass spectrometry (MALDI-MS). After the RNA is digested to completion with a nucleotide-specific RNase, the fragments are analyzed by mass spectrometry. A comparison of the observed mass data with the data predicted from the gene sequence identifies fragments harboring modified nucleotides. Fragments larger than dinucleotides were valuable for the identification of post...

  1. Next-generation sequencing library preparation method for identification of RNA viruses on the Ion Torrent Sequencing Platform.

    Science.gov (United States)

    Chen, Guiqian; Qiu, Yuan; Zhuang, Qingye; Wang, Suchun; Wang, Tong; Chen, Jiming; Wang, Kaicheng

    2018-05-09

    Next generation sequencing (NGS) is a powerful tool for the characterization, discovery, and molecular identification of RNA viruses. There were multiple NGS library preparation methods published for strand-specific RNA-seq, but some methods are not suitable for identifying and characterizing RNA viruses. In this study, we report a NGS library preparation method to identify RNA viruses using the Ion Torrent PGM platform. The NGS sequencing adapters were directly inserted into the sequencing library through reverse transcription and polymerase chain reaction, without fragmentation and ligation of nucleic acids. The results show that this method is simple to perform, able to identify multiple species of RNA viruses in clinical samples.

  2. Emerging functions of ribosomal proteins in gene-specific transcription and translation

    International Nuclear Information System (INIS)

    Lindstroem, Mikael S.

    2009-01-01

    Ribosomal proteins have remained highly conserved during evolution presumably reflecting often critical functions in ribosome biogenesis or mature ribosome function. In addition, several ribosomal proteins possess distinct extra-ribosomal functions in apoptosis, DNA repair and transcription. An increasing number of ribosomal proteins have been shown to modulate the trans-activation function of important regulatory proteins such as NF-κB, p53, c-Myc and nuclear receptors. Furthermore, a subset of ribosomal proteins can bind directly to untranslated regions of mRNA resulting in transcript-specific translational control outside of the ribosome itself. Collectively, these findings suggest that ribosomal proteins may have a wider functional repertoire within the cell than previously thought. The future challenge is to identify and validate these novel functions in the background of an often essential primary function in ribosome biogenesis and cell growth.

  3. Sequence-structure relationships in RNA loops: establishing the basis for loop homology modeling.

    Science.gov (United States)

    Schudoma, Christian; May, Patrick; Nikiforova, Viktoria; Walther, Dirk

    2010-01-01

    The specific function of RNA molecules frequently resides in their seemingly unstructured loop regions. We performed a systematic analysis of RNA loops extracted from experimentally determined three-dimensional structures of RNA molecules. A comprehensive loop-structure data set was created and organized into distinct clusters based on structural and sequence similarity. We detected clear evidence of the hallmark of homology present in the sequence-structure relationships in loops. Loops differing by structures. Thus, our results support the application of homology modeling for RNA loop model building. We established a threshold that may guide the sequence divergence-based selection of template structures for RNA loop homology modeling. Of all possible sequences that are, under the assumption of isosteric relationships, theoretically compatible with actual sequences observed in RNA structures, only a small fraction is contained in the Rfam database of RNA sequences and classes implying that the actual RNA loop space may consist of a limited number of unique loop structures and conserved sequences. The loop-structure data sets are made available via an online database, RLooM. RLooM also offers functionalities for the modeling of RNA loop structures in support of RNA engineering and design efforts.

  4. Mutation of miRNA target sequences during human evolution

    DEFF Research Database (Denmark)

    Gardner, Paul P; Vinther, Jeppe

    2008-01-01

    It has long-been hypothesized that changes in non-protein-coding genes and the regulatory sequences controlling expression could undergo positive selection. Here we identify 402 putative microRNA (miRNA) target sequences that have been mutated specifically in the human lineage and show that genes...... containing such deletions are more highly expressed than their mouse orthologs. Our findings indicate that some miRNA target mutations are fixed by positive selection and might have been involved in the evolution of human-specific traits....

  5. Phylogenetic Analysis of Pasteuria penetrans by 16S rRNA Gene Cloning and Sequencing.

    Science.gov (United States)

    Anderson, J M; Preston, J F; Dickson, D W; Hewlett, T E; Williams, N H; Maruniak, J E

    1999-09-01

    Pasteuria penetrans is an endospore-forming bacterial parasite of Meloidogyne spp. This organism is among the most promising agents for the biological control of root-knot nematodes. In order to establish the phylogenetic position of this species relative to other endospore-forming bacteria, the 16S ribosomal genes from two isolates of P. penetrans, P-20, which preferentially infects M. arenaria race 1, and P-100, which preferentially infects M. incognita and M. javanica, were PCR-amplified from a purified endospore extraction. Universal primers for the 16S rRNA gene were used to amplify DNA which was cloned, and a nucleotide sequence was obtained for 92% of the gene (1,390 base pairs) encoding the 16S rDNA from each isolate. Comparison of both isolates showed identical sequences that were compared to 16S rDNA sequences of 30 other endospore-forming bacteria obtained from GenBank. Parsimony analyses indicated that P. penetrans is a species within a clade that includes Alicyclobacillus acidocaldarius, A. cycloheptanicus, Sulfobacillus sp., Bacillus tusciae, B. schlegelii, and P. ramosa. Its closest neighbor is P. ramosa, a parasite of Daphnia spp. (water fleas). This study provided a genomic basis for the relationship of species assigned to the genus Pasteuria, and for comparison of species that are parasites of different phytopathogenic nematodes.

  6. SimFuse: A Novel Fusion Simulator for RNA Sequencing (RNA-Seq Data

    Directory of Open Access Journals (Sweden)

    Yuxiang Tan

    2015-01-01

    Full Text Available The performance evaluation of fusion detection algorithms from high-throughput sequencing data crucially relies on the availability of data with known positive and negative cases of gene rearrangements. The use of simulated data circumvents some shortcomings of real data by generation of an unlimited number of true and false positive events, and the consequent robust estimation of accuracy measures, such as precision and recall. Although a few simulated fusion datasets from RNA Sequencing (RNA-Seq are available, they are of limited sample size. This makes it difficult to systematically evaluate the performance of RNA-Seq based fusion-detection algorithms. Here, we present SimFuse to address this problem. SimFuse utilizes real sequencing data as the fusions’ background to closely approximate the distribution of reads from a real sequencing library and uses a reference genome as the template from which to simulate fusions’ supporting reads. To assess the supporting read-specific performance, SimFuse generates multiple datasets with various numbers of fusion supporting reads. Compared to an extant simulated dataset, SimFuse gives users control over the supporting read features and the sample size of the simulated library, based on which the performance metrics needed for the validation and comparison of alternative fusion-detection algorithms can be rigorously estimated.

  7. Could a Proto-Ribosome Emerge Spontaneously in the Prebiotic World?

    Directory of Open Access Journals (Sweden)

    Ilana C. Agmon

    2016-12-01

    Full Text Available An indispensable prerequisite for establishing a scenario of life emerging by natural processes is the requirement that the first simple proto-molecules could have had a realistic probability of self-assembly from random molecular polymers in the prebiotic world. The vestige of the proto-ribosome, which is believed to be still embedded in the contemporary ribosome, is used to assess the feasibility of such spontaneous emergence. Three concentric structural elements of different magnitudes, having a dimeric nature derived from the symmetrical region of the ribosomal large subunit, were suggested to constitute the vestige of the proto-ribosome. It is assumed to have materialized spontaneously in the prebiotic world, catalyzing non-coded peptide bond formation and simple elongation. Probabilistic and energetic considerations are applied in order to evaluate the suitability of the three contenders for being the initial proto-ribosome. The analysis points to the simplest proto-ribosome, comprised of a dimer of tRNA-like molecules presently embedded in the core of the symmetrical region, as the only one having a realistic statistical likelihood of spontaneous emergence from random RNA chains. Hence it offers a feasible starting point for a continuous evolutionary path from the prebiotic matter, through natural processes, into the intricate modern translation system.

  8. Tetrahymena thermophila acidic ribosomal protein L37 contains an archaebacterial type of C-terminus

    DEFF Research Database (Denmark)

    Hansen, T S; Andreasen, P H; Dreisig, H

    1991-01-01

    We have cloned and characterized a Tetrahymena thermophila macronuclear gene (L37) encoding the acidic ribosomal protein (A-protein) L37. The gene contains a single intron located in the 3'-part of the coding region. Two major and three minor transcription start points (tsp) were mapped 39 to 63 ...... by protein sequencing. The T. thermophila L37 clearly belongs to the P1-type family of eukaryotic A-proteins, but the C-terminal region has the hallmarks of archaebacterial A-proteins.......We have cloned and characterized a Tetrahymena thermophila macronuclear gene (L37) encoding the acidic ribosomal protein (A-protein) L37. The gene contains a single intron located in the 3'-part of the coding region. Two major and three minor transcription start points (tsp) were mapped 39 to 63...... nucleotides upstream from the translational start codon. The uppermost tsp mapped to the first T in a putative T. thermophila RNA polymerase II initiator element, TATAA. The coding region of L37 predicts a protein of 109 amino acid (aa) residues. A substantial part of the deduced aa sequence was verified...

  9. Reconstruction of ancestral RNA sequences under multiple structural constraints

    Directory of Open Access Journals (Sweden)

    Olivier Tremblay-Savard

    2016-11-01

    Full Text Available Abstract Background Secondary structures form the scaffold of multiple sequence alignment of non-coding RNA (ncRNA families. An accurate reconstruction of ancestral ncRNAs must use this structural signal. However, the inference of ancestors of a single ncRNA family with a single consensus structure may bias the results towards sequences with high affinity to this structure, which are far from the true ancestors. Methods In this paper, we introduce achARNement, a maximum parsimony approach that, given two alignments of homologous ncRNA families with consensus secondary structures and a phylogenetic tree, simultaneously calculates ancestral RNA sequences for these two families. Results We test our methodology on simulated data sets, and show that achARNement outperforms classical maximum parsimony approaches in terms of accuracy, but also reduces by several orders of magnitude the number of candidate sequences. To conclude this study, we apply our algorithms on the Glm clan and the FinP-traJ clan from the Rfam database. Conclusions Our results show that our methods reconstruct small sets of high-quality candidate ancestors with better agreement to the two target structures than with classical approaches. Our program is freely available at: http://csb.cs.mcgill.ca/acharnement .

  10. Nuclear RNA sequencing of the mouse erythroid cell transcriptome.

    Directory of Open Access Journals (Sweden)

    Jennifer A Mitchell

    Full Text Available In addition to protein coding genes a substantial proportion of mammalian genomes are transcribed. However, most transcriptome studies investigate steady-state mRNA levels, ignoring a considerable fraction of the transcribed genome. In addition, steady-state mRNA levels are influenced by both transcriptional and posttranscriptional mechanisms, and thus do not provide a clear picture of transcriptional output. Here, using deep sequencing of nuclear RNAs (nucRNA-Seq in parallel with chromatin immunoprecipitation sequencing (ChIP-Seq of active RNA polymerase II, we compared the nuclear transcriptome of mouse anemic spleen erythroid cells with polymerase occupancy on a genome-wide scale. We demonstrate that unspliced transcripts quantified by nucRNA-seq correlate with primary transcript frequencies measured by RNA FISH, but differ from steady-state mRNA levels measured by poly(A-enriched RNA-seq. Highly expressed protein coding genes showed good correlation between RNAPII occupancy and transcriptional output; however, genome-wide we observed a poor correlation between transcriptional output and RNAPII association. This poor correlation is due to intergenic regions associated with RNAPII which correspond with transcription factor bound regulatory regions and a group of stable, nuclear-retained long non-coding transcripts. In conclusion, sequencing the nuclear transcriptome provides an opportunity to investigate the transcriptional landscape in a given cell type through quantification of unspliced primary transcripts and the identification of nuclear-retained long non-coding RNAs.

  11. 16S Ribosomal DNA Characterization of Nitrogen-Fixing Bacteria Isolated from Banana (Musa spp.) and Pineapple (Ananas comosus (L.) Merril)

    Science.gov (United States)

    Magalhães Cruz, Leonardo; Maltempi de Souza, Emanuel; Weber, Olmar Baler; Baldani, José Ivo; Döbereiner, Johanna; de Oliveira Pedrosa, Fábio

    2001-01-01

    Nitrogen-fixing bacteria isolated from banana (Musa spp.) and pineapple (Ananas comosus (L.) Merril) were characterized by amplified 16S ribosomal DNA restriction analysis and 16S rRNA sequence analysis. Herbaspirillum seropedicae, Herbaspirillum rubrisubalbicans, Burkholderia brasilensis, and Burkholderia tropicalis were identified. Eight other types were placed in close proximity to these genera and other alpha and beta Proteobacteria. PMID:11319127

  12. eRNA: a graphic user interface-based tool optimized for large data analysis from high-throughput RNA sequencing.

    Science.gov (United States)

    Yuan, Tiezheng; Huang, Xiaoyi; Dittmar, Rachel L; Du, Meijun; Kohli, Manish; Boardman, Lisa; Thibodeau, Stephen N; Wang, Liang

    2014-03-05

    RNA sequencing (RNA-seq) is emerging as a critical approach in biological research. However, its high-throughput advantage is significantly limited by the capacity of bioinformatics tools. The research community urgently needs user-friendly tools to efficiently analyze the complicated data generated by high throughput sequencers. We developed a standalone tool with graphic user interface (GUI)-based analytic modules, known as eRNA. The capacity of performing parallel processing and sample management facilitates large data analyses by maximizing hardware usage and freeing users from tediously handling sequencing data. The module miRNA identification" includes GUIs for raw data reading, adapter removal, sequence alignment, and read counting. The module "mRNA identification" includes GUIs for reference sequences, genome mapping, transcript assembling, and differential expression. The module "Target screening" provides expression profiling analyses and graphic visualization. The module "Self-testing" offers the directory setups, sample management, and a check for third-party package dependency. Integration of other GUIs including Bowtie, miRDeep2, and miRspring extend the program's functionality. eRNA focuses on the common tools required for the mapping and quantification analysis of miRNA-seq and mRNA-seq data. The software package provides an additional choice for scientists who require a user-friendly computing environment and high-throughput capacity for large data analysis. eRNA is available for free download at https://sourceforge.net/projects/erna/?source=directory.

  13. Roles of Transcriptional and Translational Control Mechanisms in Regulation of Ribosomal Protein Synthesis in Escherichia coli.

    Science.gov (United States)

    Burgos, Hector L; O'Connor, Kevin; Sanchez-Vazquez, Patricia; Gourse, Richard L

    2017-11-01

    Bacterial ribosome biogenesis is tightly regulated to match nutritional conditions and to prevent formation of defective ribosomal particles. In Escherichia coli , most ribosomal protein (r-protein) synthesis is coordinated with rRNA synthesis by a translational feedback mechanism: when r-proteins exceed rRNAs, specific r-proteins bind to their own mRNAs and inhibit expression of the operon. It was recently discovered that the second messenger nucleotide guanosine tetra and pentaphosphate (ppGpp), which directly regulates rRNA promoters, is also capable of regulating many r-protein promoters. To examine the relative contributions of the translational and transcriptional control mechanisms to the regulation of r-protein synthesis, we devised a reporter system that enabled us to genetically separate the cis -acting sequences responsible for the two mechanisms and to quantify their relative contributions to regulation under the same conditions. We show that the synthesis of r-proteins from the S20 and S10 operons is regulated by ppGpp following shifts in nutritional conditions, but most of the effect of ppGpp required the 5' region of the r-protein mRNA containing the target site for translational feedback regulation and not the promoter. These results suggest that most regulation of the S20 and S10 operons by ppGpp following nutritional shifts is indirect and occurs in response to changes in rRNA synthesis. In contrast, we found that the promoters for the S20 operon were regulated during outgrowth, likely in response to increasing nucleoside triphosphate (NTP) levels. Thus, r-protein synthesis is dynamic, with different mechanisms acting at different times. IMPORTANCE Bacterial cells have evolved complex and seemingly redundant strategies to regulate many high-energy-consuming processes. In E. coli , synthesis of ribosomal components is tightly regulated with respect to nutritional conditions by mechanisms that act at both the transcription and translation steps. In

  14. Chromatin structure of ribosomal RNA genes in dipterans and its relationship to the location of nucleolar organizers.

    Science.gov (United States)

    Madalena, Christiane Rodriguez Gutierrez; Díez, José Luís; Gorab, Eduardo

    2012-01-01

    Nucleoli, nuclear organelles in which ribosomal RNA is synthesized and processed, emerge from nucleolar organizers (NORs) located in distinct chromosomal regions. In polytene nuclei of dipterans, nucleoli of some species can be observed under light microscopy exhibiting distinctive morphology: Drosophila and chironomid species display well-formed nucleoli in contrast to the fragmented and dispersed nucleoli seen in sciarid flies. The available data show no apparent relationship between nucleolar morphology and location of NORs in Diptera. The regulation of rRNA transcription involves controlling both the transcription rate per gene as well as the proportion of rRNA genes adopting a proper chromatin structure for transcription, since active and inactive rRNA gene copies coexist in NORs. Transcription units organized in nucleosomes and those lacking canonical nucleosomes can be analyzed by the method termed psoralen gel retarding assay (PGRA), allowing inferences on the ratio of active to inactive rRNA gene copies. In this work, possible connections between chromosomal location of NORs and proportion of active rRNA genes were studied in Drosophila melanogaster, and in chironomid and sciarid species. The data suggested a link between location of NORs and proportion of active rRNA genes since the copy number showing nucleosomal organization predominates when NORs are located in the pericentric heterochromatin. The results presented in this work are in agreement with previous data on the chromatin structure of rRNA genes from distantly related eukaryotes, as assessed by the PGRA.

  15. Chromatin structure of ribosomal RNA genes in dipterans and its relationship to the location of nucleolar organizers.

    Directory of Open Access Journals (Sweden)

    Christiane Rodriguez Gutierrez Madalena

    Full Text Available Nucleoli, nuclear organelles in which ribosomal RNA is synthesized and processed, emerge from nucleolar organizers (NORs located in distinct chromosomal regions. In polytene nuclei of dipterans, nucleoli of some species can be observed under light microscopy exhibiting distinctive morphology: Drosophila and chironomid species display well-formed nucleoli in contrast to the fragmented and dispersed nucleoli seen in sciarid flies. The available data show no apparent relationship between nucleolar morphology and location of NORs in Diptera. The regulation of rRNA transcription involves controlling both the transcription rate per gene as well as the proportion of rRNA genes adopting a proper chromatin structure for transcription, since active and inactive rRNA gene copies coexist in NORs. Transcription units organized in nucleosomes and those lacking canonical nucleosomes can be analyzed by the method termed psoralen gel retarding assay (PGRA, allowing inferences on the ratio of active to inactive rRNA gene copies. In this work, possible connections between chromosomal location of NORs and proportion of active rRNA genes were studied in Drosophila melanogaster, and in chironomid and sciarid species. The data suggested a link between location of NORs and proportion of active rRNA genes since the copy number showing nucleosomal organization predominates when NORs are located in the pericentric heterochromatin. The results presented in this work are in agreement with previous data on the chromatin structure of rRNA genes from distantly related eukaryotes, as assessed by the PGRA.

  16. Deep sequencing of small RNAs identifies canonical and non-canonical miRNA and endogenous siRNAs in mammalian somatic tissues.

    Science.gov (United States)

    Castellano, Leandro; Stebbing, Justin

    2013-03-01

    MicroRNAs (miRNAs) are small RNA molecules that regulate gene expression. They are characterized by specific maturation processes defined by canonical and non-canonical biogenic pathways. Analysis of ∼0.5 billion sequences from mouse data sets derived from different tissues, developmental stages and cell types, partly characterized by either ablation or mutation of the main proteins belonging to miRNA processor complexes, reveals 66 high-confidence new genomic loci coding for miRNAs that could be processed in a canonical or non-canonical manner. A proportion of the newly discovered miRNAs comprises mirtrons, for which we define a new sub-class. Notably, some of these newly discovered miRNAs are generated from untranslated and open reading frames of coding genes, and we experimentally validate these. We also show that many annotated miRNAs do not present miRNA-like features, as they are neither processed by known processing complexes nor loaded on AGO2; this indicates that the current miRNA miRBase database list should be refined and re-defined. Accordingly, a group of them map on ribosomal RNA molecules, whereas others cannot undergo genuine miRNA biogenesis. Notably, a group of annotated miRNAs are Dgcr8 independent and DICER dependent endogenous small interfering RNAs that derive from a unique hairpin formed from a short interspersed nuclear element.

  17. A tale of two sequences: microRNA-target chimeric reads.

    Science.gov (United States)

    Broughton, James P; Pasquinelli, Amy E

    2016-04-04

    In animals, a functional interaction between a microRNA (miRNA) and its target RNA requires only partial base pairing. The limited number of base pair interactions required for miRNA targeting provides miRNAs with broad regulatory potential and also makes target prediction challenging. Computational approaches to target prediction have focused on identifying miRNA target sites based on known sequence features that are important for canonical targeting and may miss non-canonical targets. Current state-of-the-art experimental approaches, such as CLIP-seq (cross-linking immunoprecipitation with sequencing), PAR-CLIP (photoactivatable-ribonucleoside-enhanced CLIP), and iCLIP (individual-nucleotide resolution CLIP), require inference of which miRNA is bound at each site. Recently, the development of methods to ligate miRNAs to their target RNAs during the preparation of sequencing libraries has provided a new tool for the identification of miRNA target sites. The chimeric, or hybrid, miRNA-target reads that are produced by these methods unambiguously identify the miRNA bound at a specific target site. The information provided by these chimeric reads has revealed extensive non-canonical interactions between miRNAs and their target mRNAs, and identified many novel interactions between miRNAs and noncoding RNAs.

  18. Interaction of pleuromutilin derivatives with the ribosomal peptidyl transferase center

    DEFF Research Database (Denmark)

    Long, K. S.; Hansen, L. K.; Jakobsen, L.

    2006-01-01

    Tiamulin is a pleuromutilin antibiotic that is used in veterinary medicine. The recently published crystal structure of a tiamulin-50S ribosomal subunit complex provides detailed information about how this drug targets the peptidyl transferase center of the ribosome. To promote rational design...... mutant strain is resistant to tiamulin and pleuromutilin, but not valnemulin, implying that valnemulin is better able to withstand an altered rRNA binding surface around the mutilin core. This is likely due to additional interactions made between the valnemulin side chain extension and the rRNA binding...

  19. Cryo-EM structures of the 80S ribosomes from human parasites Trichomonas vaginalis and Toxoplasma gondii

    Institute of Scientific and Technical Information of China (English)

    Zhifei Li; Qiang Guo; Lvqin Zheng; Yongsheng Ji; Yi-Ting Xie; De-Hua Lai; Zhao-Rong Lun; Xun Suo; Ning Gao

    2017-01-01

    As an indispensable molecular machine universal in all living organisms,the ribosome has been selected by evolution to be the natural target of many antibiotics and small-molecule inhibitors.High-resolution structures of pathogen ribosomes are crucial for understanding the general and unique aspects of translation control in disease-causing microbes.With cryo-electron microscopy technique,we have determined structures of the cytosolic ribosomes from two human parasites,Trichomonas vaginalis and Toxoplasma gondii,at resolution of 3.2-3.4,(A).Although the ribosomal proteins from both pathogens are typical members of eukaryotic families,with a co-evolution pattern between certain species-specific insertions/extensions and neighboring ribosomal RNA (rRNA) expansion segments,the sizes of their rRNAs are sharply different.Very interestingly,rRNAs of T.vaginalis are in size comparable to prokaryotic counterparts,with nearly all the eukaryote-specific rRNA expansion segments missing.These structures facilitate the dissection of evolution path for ribosomal proteins and RNAs,and may aid in design of novel translation inhibitors.

  20. RStrucFam: a web server to associate structure and cognate RNA for RNA-binding proteins from sequence information.

    Science.gov (United States)

    Ghosh, Pritha; Mathew, Oommen K; Sowdhamini, Ramanathan

    2016-10-07

    RNA-binding proteins (RBPs) interact with their cognate RNA(s) to form large biomolecular assemblies. They are versatile in their functionality and are involved in a myriad of processes inside the cell. RBPs with similar structural features and common biological functions are grouped together into families and superfamilies. It will be useful to obtain an early understanding and association of RNA-binding property of sequences of gene products. Here, we report a web server, RStrucFam, to predict the structure, type of cognate RNA(s) and function(s) of proteins, where possible, from mere sequence information. The web server employs Hidden Markov Model scan (hmmscan) to enable association to a back-end database of structural and sequence families. The database (HMMRBP) comprises of 437 HMMs of RBP families of known structure that have been generated using structure-based sequence alignments and 746 sequence-centric RBP family HMMs. The input protein sequence is associated with structural or sequence domain families, if structure or sequence signatures exist. In case of association of the protein with a family of known structures, output features like, multiple structure-based sequence alignment (MSSA) of the query with all others members of that family is provided. Further, cognate RNA partner(s) for that protein, Gene Ontology (GO) annotations, if any and a homology model of the protein can be obtained. The users can also browse through the database for details pertaining to each family, protein or RNA and their related information based on keyword search or RNA motif search. RStrucFam is a web server that exploits structurally conserved features of RBPs, derived from known family members and imprinted in mathematical profiles, to predict putative RBPs from sequence information. Proteins that fail to associate with such structure-centric families are further queried against the sequence-centric RBP family HMMs in the HMMRBP database. Further, all other essential

  1. Defining reference sequences for Nocardia species by similarity and clustering analyses of 16S rRNA gene sequence data.

    Directory of Open Access Journals (Sweden)

    Manal Helal

    Full Text Available BACKGROUND: The intra- and inter-species genetic diversity of bacteria and the absence of 'reference', or the most representative, sequences of individual species present a significant challenge for sequence-based identification. The aims of this study were to determine the utility, and compare the performance of several clustering and classification algorithms to identify the species of 364 sequences of 16S rRNA gene with a defined species in GenBank, and 110 sequences of 16S rRNA gene with no defined species, all within the genus Nocardia. METHODS: A total of 364 16S rRNA gene sequences of Nocardia species were studied. In addition, 110 16S rRNA gene sequences assigned only to the Nocardia genus level at the time of submission to GenBank were used for machine learning classification experiments. Different clustering algorithms were compared with a novel algorithm or the linear mapping (LM of the distance matrix. Principal Components Analysis was used for the dimensionality reduction and visualization. RESULTS: The LM algorithm achieved the highest performance and classified the set of 364 16S rRNA sequences into 80 clusters, the majority of which (83.52% corresponded with the original species. The most representative 16S rRNA sequences for individual Nocardia species have been identified as 'centroids' in respective clusters from which the distances to all other sequences were minimized; 110 16S rRNA gene sequences with identifications recorded only at the genus level were classified using machine learning methods. Simple kNN machine learning demonstrated the highest performance and classified Nocardia species sequences with an accuracy of 92.7% and a mean frequency of 0.578. CONCLUSION: The identification of centroids of 16S rRNA gene sequence clusters using novel distance matrix clustering enables the identification of the most representative sequences for each individual species of Nocardia and allows the quantitation of inter- and intra

  2. Symportin 1 chaperones 5S RNP assembly during ribosome biogenesis by occupying an essential rRNA-binding site.

    Science.gov (United States)

    Calviño, Fabiola R; Kharde, Satyavati; Ori, Alessandro; Hendricks, Astrid; Wild, Klemens; Kressler, Dieter; Bange, Gert; Hurt, Ed; Beck, Martin; Sinning, Irmgard

    2015-04-07

    During 60S biogenesis, mature 5S RNP consisting of 5S RNA, RpL5 and RpL11, assembles into a pre-60S particle, where docking relies on RpL11 interacting with helix 84 (H84) of the 25S RNA. How 5S RNP is assembled for recruitment into the pre-60S is not known. Here we report the crystal structure of a ternary symportin Syo1-RpL5-N-RpL11 complex and provide biochemical and structural insights into 5S RNP assembly. Syo1 guards the 25S RNA-binding surface on RpL11 and competes with H84 for binding. Pull-down experiments show that H84 releases RpL11 from the ternary complex, but not in the presence of 5S RNA. Crosslinking mass spectrometry visualizes structural rearrangements on incorporation of 5S RNA into the Syo1-RpL5-RpL11 complex supporting the formation of a pre-5S RNP. Our data underline the dual role of Syo1 in ribosomal protein transport and as an assembly platform for 5S RNP.

  3. Full-length mRNA sequencing uncovers a widespread coupling between transcription initiation and mRNA processing.

    Science.gov (United States)

    Anvar, Seyed Yahya; Allard, Guy; Tseng, Elizabeth; Sheynkman, Gloria M; de Klerk, Eleonora; Vermaat, Martijn; Yin, Raymund H; Johansson, Hans E; Ariyurek, Yavuz; den Dunnen, Johan T; Turner, Stephen W; 't Hoen, Peter A C

    2018-03-29

    The multifaceted control of gene expression requires tight coordination of regulatory mechanisms at transcriptional and post-transcriptional level. Here, we studied the interdependence of transcription initiation, splicing and polyadenylation events on single mRNA molecules by full-length mRNA sequencing. In MCF-7 breast cancer cells, we find 2700 genes with interdependent alternative transcription initiation, splicing and polyadenylation events, both in proximal and distant parts of mRNA molecules, including examples of coupling between transcription start sites and polyadenylation sites. The analysis of three human primary tissues (brain, heart and liver) reveals similar patterns of interdependency between transcription initiation and mRNA processing events. We predict thousands of novel open reading frames from full-length mRNA sequences and obtained evidence for their translation by shotgun proteomics. The mapping database rescues 358 previously unassigned peptides and improves the assignment of others. By recognizing sample-specific amino-acid changes and novel splicing patterns, full-length mRNA sequencing improves proteogenomics analysis of MCF-7 cells. Our findings demonstrate that our understanding of transcriptome complexity is far from complete and provides a basis to reveal largely unresolved mechanisms that coordinate transcription initiation and mRNA processing.

  4. Sequencing and characterization of the complete mitochondrial genome of Japanese Swellshark (Cephalloscyllium umbratile)

    OpenAIRE

    Zhu, Ke-Cheng; Liang, Yin-Yin; Wu, Na; Guo, Hua-Yang; Zhang, Nan; Jiang, Shi-Gui; Zhang, Dian-Chang

    2017-01-01

    To further comprehend the genome features of Cephalloscyllium umbratile (Carcharhiniformes), an endangered species, the complete mitochondrial DNA (mtDNA) was firstly sequenced and annotated. The full-length mtDNA of C. umbratile was 16,697 bp and contained ribosomal RNA (rRNA) genes, 13 protein-coding genes (PCGs), 23 transfer RNA (tRNA) genes, and a major non-coding control region. Each PCG was initiated by an authoritative ATN codon, except for COX1 initiated by a GTG codon. Seven of 13 PC...

  5. "Transcriptomics": molecular diagnosis of inborn errors of metabolism via RNA-sequencing.

    Science.gov (United States)

    Kremer, Laura S; Wortmann, Saskia B; Prokisch, Holger

    2018-01-25

    Exome wide sequencing techniques have revolutionized molecular diagnostics in patients with suspected inborn errors of metabolism or neuromuscular disorders. However, the diagnostic yield of 25-60% still leaves a large fraction of individuals without a diagnosis. This indicates a causative role for non-exonic regulatory variants not covered by whole exome sequencing. Here we review how systematic RNA-sequencing analysis (RNA-seq, "transcriptomics") lead to a molecular diagnosis in 10-35% of patients in whom whole exome sequencing failed to do so. Importantly, RNA-sequencing based discoveries cannot only guide molecular diagnosis but might also unravel therapeutic intervention points such as antisense oligonucleotide treatment for splicing defects as recently reported for spinal muscular atrophy.

  6. Trans-kingdom mimicry underlies ribosome customization by a poxvirus kinase.

    Science.gov (United States)

    Jha, Sujata; Rollins, Madeline G; Fuchs, Gabriele; Procter, Dean J; Hall, Elizabeth A; Cozzolino, Kira; Sarnow, Peter; Savas, Jeffrey N; Walsh, Derek

    2017-06-29

    Ribosomes have the capacity to selectively control translation through changes in their composition that enable recognition of specific RNA elements. However, beyond differential subunit expression during development, evidence for regulated ribosome specification within individual cells has remained elusive. Here we report that a poxvirus kinase phosphorylates serine/threonine residues in the human small ribosomal subunit protein, receptor for activated C kinase (RACK1), that are not phosphorylated in uninfected cells or cells infected by other viruses. These modified residues cluster in an extended loop in RACK1, phosphorylation of which selects for translation of viral or reporter mRNAs with 5' untranslated regions that contain adenosine repeats, so-called polyA-leaders. Structural and phylogenetic analyses revealed that although RACK1 is highly conserved, this loop is variable and contains negatively charged amino acids in plants, in which these leaders act as translational enhancers. Phosphomimetics and inter-species chimaeras have shown that negative charge in the RACK1 loop dictates ribosome selectivity towards viral RNAs. By converting human RACK1 to a charged, plant-like state, poxviruses remodel host ribosomes so that adenosine repeats erroneously generated by slippage of the viral RNA polymerase confer a translational advantage. Our findings provide insight into ribosome customization through trans-kingdom mimicry and the mechanics of species-specific leader activity that underlie poxvirus polyA-leaders.

  7. Ribosome-induced changes in elongation factor Tu conformation control GTP hydrolysis

    DEFF Research Database (Denmark)

    Villa, Elizabeth; Sengupta, Jayati; Trabuco, Leonard G.

    2009-01-01

    In translation, elongation factor Tu (EF-Tu) molecules deliver aminoacyl-tRNAs to the mRNA-programmed ribosome. The GTPase activity of EF-Tu is triggered by ribosome-induced conformational changes of the factor that play a pivotal role in the selection of the cognate aminoacyl-tRNAs. We present a 6.......7-A cryo-electron microscopy map of the aminoacyl-tRNA x EF-Tu x GDP x kirromycin-bound Escherichia coli ribosome, together with an atomic model of the complex obtained through molecular dynamics flexible fitting. The model reveals the conformational changes in the conserved GTPase switch regions...... of EF-Tu that trigger hydrolysis of GTP, along with key interactions, including those between the sarcin-ricin loop and the P loop of EF-Tu, and between the effector loop of EF-Tu and a conserved region of the 16S rRNA. Our data suggest that GTP hydrolysis on EF-Tu is controlled through a hydrophobic...

  8. Re-inspection of small RNA sequence datasets reveals several novel human miRNA genes.

    Directory of Open Access Journals (Sweden)

    Thomas Birkballe Hansen

    Full Text Available BACKGROUND: miRNAs are key players in gene expression regulation. To fully understand the complex nature of cellular differentiation or initiation and progression of disease, it is important to assess the expression patterns of as many miRNAs as possible. Thereby, identifying novel miRNAs is an essential prerequisite to make possible a comprehensive and coherent understanding of cellular biology. METHODOLOGY/PRINCIPAL FINDINGS: Based on two extensive, but previously published, small RNA sequence datasets from human embryonic stem cells and human embroid bodies, respectively [1], we identified 112 novel miRNA-like structures and were able to validate miRNA processing in 12 out of 17 investigated cases. Several miRNA candidates were furthermore substantiated by including additional available small RNA datasets, thereby demonstrating the power of combining datasets to identify miRNAs that otherwise may be assigned as experimental noise. CONCLUSIONS/SIGNIFICANCE: Our analysis highlights that existing datasets are not yet exhaustedly studied and continuous re-analysis of the available data is important to uncover all features of small RNA sequencing.

  9. Small-angle X-ray titration study on the complex formation between 5-S RNA and the L18 protein of the Escherichia coli 50-S ribosome particle

    International Nuclear Information System (INIS)

    Oesterberg, R.; Garrett, A.

    1977-01-01

    The 5-S RNA (A) and the L 18 protein (B) from Escherichia coli ribosomes form one single AB complex in the concentration ranges supposed to prevail in vivo; at concentrations of L 18 higher than 40 mM there is some indication for a minor species, most probably an AB 2 species. This is indicated from the X-ray scattering titration data of the 5-S RNA/L 18 system recorded at 21 0 C in ribosomal reconstitution buffer. As a result of the 1 : 1 complex formation, there is a relatively small but defined increase in the radius of gyration from 3.61 to 3.85 nm. This result as well as the experimental scattering curve can be explained by models where it is assumed that the elongated L 18 model is quite far from the electron density centre and where protein L 18 interacts with one or both of the minor arms of the supposed Y-shaped 5-S RNA molecule. (orig.) [de

  10. A new sequence data set of SSU rRNA gene for Scleractinia and its phylogenetic and ecological applications

    KAUST Repository

    Arrigoni, Roberto; Vacherie, Benoî t; Benzoni, Francesca; Stefani, Fabrizio; Karsenti, Eric; Jaillon, Olivier; Not, Fabrice; Nunes, Flavia; Payri, Claude; Wincker, Patrick; Barbe, Valé rie

    2016-01-01

    Scleractinian corals (i.e. hard corals) play a fundamental role in building and maintaining coral reefs, one of the most diverse ecosystems on Earth. Nevertheless, their phylogenies remain largely unresolved and little is known about dispersal and survival of their planktonic larval phase. The small subunit ribosomal RNA (SSU rRNA) is a commonly used gene for DNA barcoding in several metazoans, and small variable regions of SSU rRNA are widely adopted as barcode marker to investigate marine plankton community structure worldwide. Here, we provide a large sequence data set of the complete SSU rRNA gene from 298 specimens, representing all known extant reef coral families and a total of 106 genera. The secondary structure was extremely conserved within the order with few exceptions due to insertions or deletions occurring in the variable regions. Remarkable differences in SSU rRNA length and base composition were detected between and within acroporids (Acropora, Montipora, Isopora and Alveopora) compared to other corals. The V4 and V9 regions seem to be promising barcode loci because variation at commonly used barcode primer binding sites was extremely low, while their levels of divergence allowed families and genera to be distinguished. A time-calibrated phylogeny of Scleractinia is provided, and mutation rate heterogeneity is demonstrated across main lineages. The use of this data set as a valuable reference for investigating aspects of ecology, biology, molecular taxonomy and evolution of scleractinian corals is discussed.

  11. A new sequence data set of SSU rRNA gene for Scleractinia and its phylogenetic and ecological applications

    KAUST Repository

    Arrigoni, Roberto

    2016-11-27

    Scleractinian corals (i.e. hard corals) play a fundamental role in building and maintaining coral reefs, one of the most diverse ecosystems on Earth. Nevertheless, their phylogenies remain largely unresolved and little is known about dispersal and survival of their planktonic larval phase. The small subunit ribosomal RNA (SSU rRNA) is a commonly used gene for DNA barcoding in several metazoans, and small variable regions of SSU rRNA are widely adopted as barcode marker to investigate marine plankton community structure worldwide. Here, we provide a large sequence data set of the complete SSU rRNA gene from 298 specimens, representing all known extant reef coral families and a total of 106 genera. The secondary structure was extremely conserved within the order with few exceptions due to insertions or deletions occurring in the variable regions. Remarkable differences in SSU rRNA length and base composition were detected between and within acroporids (Acropora, Montipora, Isopora and Alveopora) compared to other corals. The V4 and V9 regions seem to be promising barcode loci because variation at commonly used barcode primer binding sites was extremely low, while their levels of divergence allowed families and genera to be distinguished. A time-calibrated phylogeny of Scleractinia is provided, and mutation rate heterogeneity is demonstrated across main lineages. The use of this data set as a valuable reference for investigating aspects of ecology, biology, molecular taxonomy and evolution of scleractinian corals is discussed.

  12. High-throughput determination of RNA structure by proximity ligation.

    Science.gov (United States)

    Ramani, Vijay; Qiu, Ruolan; Shendure, Jay

    2015-09-01

    We present an unbiased method to globally resolve RNA structures through pairwise contact measurements between interacting regions. RNA proximity ligation (RPL) uses proximity ligation of native RNA followed by deep sequencing to yield chimeric reads with ligation junctions in the vicinity of structurally proximate bases. We apply RPL in both baker's yeast (Saccharomyces cerevisiae) and human cells and generate contact probability maps for ribosomal and other abundant RNAs, including yeast snoRNAs, the RNA subunit of the signal recognition particle and the yeast U2 spliceosomal RNA homolog. RPL measurements correlate with established secondary structures for these RNA molecules, including stem-loop structures and long-range pseudoknots. We anticipate that RPL will complement the current repertoire of computational and experimental approaches in enabling the high-throughput determination of secondary and tertiary RNA structures.

  13. MicroRNA sequence motifs reveal asymmetry between the stem arms

    DEFF Research Database (Denmark)

    Gorodkin, Jan; Havgaard, Jakob Hull; Ensterö, M.

    2006-01-01

    The processing of micro RNAs (miRNAs) from their stemloop precursor have revealed asymmetry in the processing of the mature and its star sequence. Furthermore, the miRNA processing system between organism differ. To assess this at the sequence level we have investigated mature miRNAs in their gen......The processing of micro RNAs (miRNAs) from their stemloop precursor have revealed asymmetry in the processing of the mature and its star sequence. Furthermore, the miRNA processing system between organism differ. To assess this at the sequence level we have investigated mature mi...

  14. Effect of single base changes and the absence of modified bases in 16S RNA on the reconstitution and function of Escherichia coli 30S ribosomes

    International Nuclear Information System (INIS)

    Denman, R.; Krzyzosiak, W.; Nurse, K.; Ofengand, J.

    1987-01-01

    The gene coding for E. coli 16S rRNA was placed in pUC19 under the control of the strong class III T7 promoter, phi 10, by ligation of the 1490 bp BclI/BstEII fragment of the rrnB operon with appropriate synthetic oligodeoxynucleotides. Such constructs allowed efficient in vitro synthesis of full-length transcripts (up to 900 mol RNA/mol template) free of modified bases. The synthetic RNA could be assembled into 30S subunits upon addition of E. coli 30S ribosomal proteins. The particles co-sedimented with authentic 30S particles and were electron microscopically indistinguishable from them. Upon addition of 50S subunits, codon-dependent P-site binding of tRNA and codon-dependent polypeptide synthesis were >80% of 30S reconstituted from natural 16S RNA and >50% of isolated 30S. UV-induced crosslinking of P-site bound AcVal-tRNA to residue C 1400 was preserved. Changing C 1400 to A had little effect on reconstitution, P-site binding, or polypeptide synthesis. However, the substitution of C 1499 by G markedly inhibited assembly. The effect on P-site binding and polypeptide synthesis is under study. These results show (1) none of the modified bases of 16S RNA are essential for protein synthesis, (2) substitution of A for C 1400 has little functional effect, and (3) position 1400 may be important for ribosome assembly

  15. gamma. radiation effect on the functional properties of the cotton ribosomes

    Energy Technology Data Exchange (ETDEWEB)

    Ibragimov, A P; Safarov, Sh

    1973-01-01

    A study is made of the action of radiation on the functional properties of ribosomes in irradiated organisms and on isolated ribosomes exposed to different doses. With increase in dose there occurs a reduction in the incorporation of labelled amino acids by the ribosomes released from irradiated sprouts and also during irradiation of isolated ribosomes. The study covered the functional activity of ribosomes irradiated at different doses with the use of synthetic poly-U and poly-A matrices synthesizing polyphenylalanine and polylysine, depending on the irradiation dose. The inhibition of the activity of the protein synthesis system at high doses is due to structural and functional changes in ribosomes and also to disturbance in the biosynthesis and functions of the messenger RNA.

  16. The mitochondrial gene encoding ribosomal protein S12 has been translocated to the nuclear genome in Oenothera.

    Science.gov (United States)

    Grohmann, L; Brennicke, A; Schuster, W

    1992-01-01

    The Oenothera mitochondrial genome contains only a gene fragment for ribosomal protein S12 (rps12), while other plants encode a functional gene in the mitochondrion. The complete Oenothera rps12 gene is located in the nucleus. The transit sequence necessary to target this protein to the mitochondrion is encoded by a 5'-extension of the open reading frame. Comparison of the amino acid sequence encoded by the nuclear gene with the polypeptides encoded by edited mitochondrial cDNA and genomic sequences of other plants suggests that gene transfer between mitochondrion and nucleus started from edited mitochondrial RNA molecules. Mechanisms and requirements of gene transfer and activation are discussed. Images PMID:1454526

  17. DNApi: A De Novo Adapter Prediction Algorithm for Small RNA Sequencing Data.

    Science.gov (United States)

    Tsuji, Junko; Weng, Zhiping

    2016-01-01

    With the rapid accumulation of publicly available small RNA sequencing datasets, third-party meta-analysis across many datasets is becoming increasingly powerful. Although removing the 3´ adapter is an essential step for small RNA sequencing analysis, the adapter sequence information is not always available in the metadata. The information can be also erroneous even when it is available. In this study, we developed DNApi, a lightweight Python software package that predicts the 3´ adapter sequence de novo and provides the user with cleansed small RNA sequences ready for down stream analysis. Tested on 539 publicly available small RNA libraries accompanied with 3´ adapter sequences in their metadata, DNApi shows near-perfect accuracy (98.5%) with fast runtime (~2.85 seconds per library) and efficient memory usage (~43 MB on average). In addition to 3´ adapter prediction, it is also important to classify whether the input small RNA libraries were already processed, i.e. the 3´ adapters were removed. DNApi perfectly judged that given another batch of datasets, 192 publicly available processed libraries were "ready-to-map" small RNA sequence. DNApi is compatible with Python 2 and 3, and is available at https://github.com/jnktsj/DNApi. The 731 small RNA libraries used for DNApi evaluation were from human tissues and were carefully and manually collected. This study also provides readers with the curated datasets that can be integrated into their studies.

  18. A dynamic ribosomal biogenesis response is not required for IGF-1-mediated hypertrophy of human primary myotubes.

    Science.gov (United States)

    Crossland, Hannah; Timmons, James A; Atherton, Philip J

    2017-12-01

    Increased ribosomal DNA transcription has been proposed to limit muscle protein synthesis, making ribosome biogenesis central to skeletal muscle hypertrophy. We examined the relationship between ribosomal RNA (rRNA) production and IGF-1-mediated myotube hypertrophy in vitro Primary skeletal myotubes were treated with IGF-1 (50 ng/ml) with or without 0.5 µM CX-5461 (CX), an inhibitor of RNA polymerase I. Myotube diameter, total protein, and RNA and DNA levels were measured along with markers of RNA polymerase I regulatory factors and regulators of protein synthesis. CX treatment reduced 45S pre-rRNA expression (-64 ± 5% vs. IGF-1; P IGF-1; P IGF-1-treated myotubes. IGF-1-mediated increases in myotube diameter (1.27 ± 0.09-fold, P IGF-1 treatment did not prevent early increases in AKT (+203 ± 39% vs. CX; P IGF-1, myotube diameter and protein accretion were sustained. Thus, while ribosome biogenesis represents a potential site for the regulation of skeletal muscle protein synthesis and muscle mass, it does not appear to be a prerequisite for IGF-1-induced myotube hypertrophy in vitro. -Crossland, H., Timmons, J. A., Atherton, P. J. A dynamic ribosomal biogenesis response is not required for IGF-1-mediated hypertrophy of human primary myotubes. © The Author(s).

  19. The importance of highly conserved nucleotides in the binding region of chloramphenicol at the peptidyl transfer centre of Escherichia coli 23S ribosomal RNA

    DEFF Research Database (Denmark)

    Vester, Birte; Garrett, Roger Antony

    1988-01-01

    in vivo on a plasmid-encoded rRNA (rrnB) operon and each one yielded dramatically altered phenotypes. Cells exhibiting A2060----C or A2450----C transversions were inviable and it was shown by inserting the mutated genes after a temperature-inducible promoter that the mutant RNAs were directly responsible...... into 50S subunits, but while the two lethal mutant RNAs were strongly selected against in 70S ribosomes, the plasmid-encoded A2503----C RNA was preferred over the chromosome-encoded RNA, contrary to current regulatory theories. The results establish the critical structural and functional importance...

  20. Gene expression profiling of non-polyadenylated RNA-seq across species

    Directory of Open Access Journals (Sweden)

    Xiao-Ou Zhang

    2014-12-01

    Full Text Available Transcriptomes are dynamic and unique, with each cell type/tissue, developmental stage and species expressing a different repertoire of RNA transcripts. Most mRNAs and well-characterized long noncoding RNAs are shaped with a 5′ cap and 3′ poly(A tail, thus conventional transcriptome analyses typically start with the enrichment of poly(A+ RNAs by oligo(dT selection, followed by deep sequencing approaches. However, accumulated lines of evidence suggest that many RNA transcripts are processed by alternative mechanisms without 3′ poly(A tails and, therefore, fail to be enriched by oligo(dT purification and are absent following deep sequencing analyses. We have described an enrichment strategy to purify non-polyadenylated (poly(A−/ribo− RNAs from human total RNAs by removal of both poly(A+ RNA transcripts and ribosomal RNAs, which led to the identification of many novel RNA transcripts with non-canonical 3′ ends in human. Here, we describe the application of non-polyadenylated RNA-sequencing in rhesus monkey and mouse cell lines/tissue, and further profile the transcription of non-polyadenylated RNAs across species, providing new resources for non-polyadenylated RNA identification and comparison across species.

  1. Multi-perspective smFRET reveals rate-determining late intermediates of ribosomal translocation

    Science.gov (United States)

    Wasserman, Michael R.; Alejo, Jose L.; Altman, Roger B.; Blanchard, Scott C.

    2016-01-01

    Directional translocation of the ribosome through the messenger RNA open reading frame is a critical determinant of translational fidelity. This process entails a complex interplay of large-scale conformational changes within the actively translating particle, which together coordinate the movement of transfer and messenger RNA substrates with respect to the large and small ribosomal subunits. Using pre-steady state, single-molecule fluorescence resonance energy transfer imaging, we have tracked the nature and timing of these conformational events within the Escherichia coli ribosome from five structural perspectives. Our investigations reveal direct evidence of structurally and kinetically distinct, late intermediates during substrate movement, whose resolution is rate-determining to the translocation mechanism. These steps involve intra-molecular events within the EFG(GDP)-bound ribosome, including exaggerated, reversible fluctuations of the small subunit head domain, which ultimately facilitate peptidyl-tRNA’s movement into its final post-translocation position. PMID:26926435

  2. Genotyping of Giardia lamblia isolates from humans in China and Korea using ribosomal DNA Sequences.

    Science.gov (United States)

    Yong, T S; Park, S J; Hwang, U W; Yang, H W; Lee, K W; Min, D Y; Rim, H J; Wang, Y; Zheng, F

    2000-08-01

    Genetic characterization of a total of 15 Giardia lamblia isolates, 8 from Anhui Province, China (all from purified cysts) and 7 from Seoul, Korea (2 from axenic cultures and 5 from purified cysts), was performed by polymerase chain reaction amplification and sequencing of a 295-bp region near the 5' end of the small subunit ribosomal DNA (eukaryotic 16S rDNA). Phylogenetic analyses were subsequently conducted using sequence data obtained in this study, as well as sequences published from other Giardia isolates. The maximum parsimony method revealed that G. lamblia isolates from humans in China and Korea are divided into 2 major lineages, assemblages A and B. All 7 Korean isolates were grouped into assemblage A, whereas 4 Chinese isolates were grouped into assemblage A and 4 into assemblage B. Two Giardia microti isolates and 2 dog-derived Giardia isolates also grouped into assemblage B, whereas Giardia ardeae and Giardia muris were unique.

  3. Hybridization-based reconstruction of small non-coding RNA transcripts from deep sequencing data.

    Science.gov (United States)

    Ragan, Chikako; Mowry, Bryan J; Bauer, Denis C

    2012-09-01

    Recent advances in RNA sequencing technology (RNA-Seq) enables comprehensive profiling of RNAs by producing millions of short sequence reads from size-fractionated RNA libraries. Although conventional tools for detecting and distinguishing non-coding RNAs (ncRNAs) from reference-genome data can be applied to sequence data, ncRNA detection can be improved by harnessing the full information content provided by this new technology. Here we present NorahDesk, the first unbiased and universally applicable method for small ncRNAs detection from RNA-Seq data. NorahDesk utilizes the coverage-distribution of small RNA sequence data as well as thermodynamic assessments of secondary structure to reliably predict and annotate ncRNA classes. Using publicly available mouse sequence data from brain, skeletal muscle, testis and ovary, we evaluated our method with an emphasis on the performance for microRNAs (miRNAs) and piwi-interacting small RNA (piRNA). We compared our method with Dario and mirDeep2 and found that NorahDesk produces longer transcripts with higher read coverage. This feature makes it the first method particularly suitable for the prediction of both known and novel piRNAs.

  4. The highly conserved codon following the slippery sequence supports -1 frameshift efficiency at the HIV-1 frameshift site.

    Directory of Open Access Journals (Sweden)

    Suneeth F Mathew

    Full Text Available HIV-1 utilises -1 programmed ribosomal frameshifting to translate structural and enzymatic domains in a defined proportion required for replication. A slippery sequence, U UUU UUA, and a stem-loop are well-defined RNA features modulating -1 frameshifting in HIV-1. The GGG glycine codon immediately following the slippery sequence (the 'intercodon' contributes structurally to the start of the stem-loop but has no defined role in current models of the frameshift mechanism, as slippage is inferred to occur before the intercodon has reached the ribosomal decoding site. This GGG codon is highly conserved in natural isolates of HIV. When the natural intercodon was replaced with a stop codon two different decoding molecules-eRF1 protein or a cognate suppressor tRNA-were able to access and decode the intercodon prior to -1 frameshifting. This implies significant slippage occurs when the intercodon is in the (perhaps distorted ribosomal A site. We accommodate the influence of the intercodon in a model of frame maintenance versus frameshifting in HIV-1.

  5. Nucleotide sequence and genetic organization of barley stripe mosaic virus RNA gamma.

    Science.gov (United States)

    Gustafson, G; Hunter, B; Hanau, R; Armour, S L; Jackson, A O

    1987-06-01

    The complete nucleotide sequences of RNA gamma from the Type and ND18 strains of barley stripe mosaic virus (BSMV) have been determined. The sequences are 3164 (Type) and 2791 (ND18) nucleotides in length. Both sequences contain a 5'-noncoding region (87 or 88 nucleotides) which is followed by a long open reading frame (ORF1). A 42-nucleotide intercistronic region separates ORF1 from a second, shorter open reading frame (ORF2) located near the 3'-end of the RNA. There is a high degree of homology between the Type and ND18 strains in the nucleotide sequence of ORF1. However, the Type strain contains a 366 nucleotide direct tandem repeat within ORF1 which is absent in the ND18 strain. Consequently, the predicted translation product of Type RNA gamma ORF1 (mol wt 87,312) is significantly larger than that of ND18 RNA gamma ORF1 (mol wt 74,011). The amino acid sequence of the ORF1 polypeptide contains homologies with putative RNA polymerases from other RNA viruses, suggesting that this protein may function in replication of the BSMV genome. The nucleotide sequence of RNA gamma ORF2 is nearly identical in the Type and ND18 strains. ORF2 codes for a polypeptide with a predicted molecular weight of 17,209 (Type) or 17,074 (ND18) which is known to be translated from a subgenomic (sg) RNA. The initiation point of this sgRNA has been mapped to a location 27 nucleotides upstream of the ORF2 initiation codon in the intercistronic region between ORF1 and ORF2. The sgRNA is not coterminal with the 3'-end of the genomic RNA, but instead contains heterogeneous poly(A) termini up to 150 nucleotides long (J. Stanley, R. Hanau, and A. O. Jackson, 1984, Virology 139, 375-383). In the genomic RNA gamma, ORF2 is followed by a short poly(A) tract and a 238-nucleotide tRNA-like structure.

  6. Origins of the plant chloroplasts and mitochondria based on comparisons of 5S ribosomal RNAs

    Science.gov (United States)

    Delihas, N.; Fox, G. E.

    1987-01-01

    In this paper, we provide macromolecular comparisons utilizing the 5S ribosomal RNA structure to suggest extant bacteria that are the likely descendants of chloroplast and mitochondria endosymbionts. The genetic stability and near universality of the 5S ribosomal gene allows for a useful means to study ancient evolutionary changes by macromolecular comparisons. The value in current and future ribosomal RNA comparisons is in fine tuning the assignment of ancestors to the organelles and in establishing extant species likely to be descendants of bacteria involved in presumed multiple endosymbiotic events.

  7. Study design requirements for RNA sequencing-based breast cancer diagnostics.

    Science.gov (United States)

    Mer, Arvind Singh; Klevebring, Daniel; Grönberg, Henrik; Rantalainen, Mattias

    2016-02-01

    Sequencing-based molecular characterization of tumors provides information required for individualized cancer treatment. There are well-defined molecular subtypes of breast cancer that provide improved prognostication compared to routine biomarkers. However, molecular subtyping is not yet implemented in routine breast cancer care. Clinical translation is dependent on subtype prediction models providing high sensitivity and specificity. In this study we evaluate sample size and RNA-sequencing read requirements for breast cancer subtyping to facilitate rational design of translational studies. We applied subsampling to ascertain the effect of training sample size and the number of RNA sequencing reads on classification accuracy of molecular subtype and routine biomarker prediction models (unsupervised and supervised). Subtype classification accuracy improved with increasing sample size up to N = 750 (accuracy = 0.93), although with a modest improvement beyond N = 350 (accuracy = 0.92). Prediction of routine biomarkers achieved accuracy of 0.94 (ER) and 0.92 (Her2) at N = 200. Subtype classification improved with RNA-sequencing library size up to 5 million reads. Development of molecular subtyping models for cancer diagnostics requires well-designed studies. Sample size and the number of RNA sequencing reads directly influence accuracy of molecular subtyping. Results in this study provide key information for rational design of translational studies aiming to bring sequencing-based diagnostics to the clinic.

  8. An image processing approach to computing distances between RNA secondary structures dot plots

    Directory of Open Access Journals (Sweden)

    Sapiro Guillermo

    2009-02-01

    Full Text Available Abstract Background Computing the distance between two RNA secondary structures can contribute in understanding the functional relationship between them. When used repeatedly, such a procedure may lead to finding a query RNA structure of interest in a database of structures. Several methods are available for computing distances between RNAs represented as strings or graphs, but none utilize the RNA representation with dot plots. Since dot plots are essentially digital images, there is a clear motivation to devise an algorithm for computing the distance between dot plots based on image processing methods. Results We have developed a new metric dubbed 'DoPloCompare', which compares two RNA structures. The method is based on comparing dot plot diagrams that represent the secondary structures. When analyzing two diagrams and motivated by image processing, the distance is based on a combination of histogram correlations and a geometrical distance measure. We introduce, describe, and illustrate the procedure by two applications that utilize this metric on RNA sequences. The first application is the RNA design problem, where the goal is to find the nucleotide sequence for a given secondary structure. Examples where our proposed distance measure outperforms others are given. The second application locates peculiar point mutations that induce significant structural alternations relative to the wild type predicted secondary structure. The approach reported in the past to solve this problem was tested on several RNA sequences with known secondary structures to affirm their prediction, as well as on a data set of ribosomal pieces. These pieces were computationally cut from a ribosome for which an experimentally derived secondary structure is available, and on each piece the prediction conveys similarity to the experimental result. Our newly proposed distance measure shows benefit in this problem as well when compared to standard methods used for assessing

  9. Mechanisms controlling mRNA processing and translation : decoding the regulatory layers defining gene expression through RNA sequencing

    NARCIS (Netherlands)

    Klerk, Eleonora de

    2015-01-01

    The work described in this thesis focuses on the mechanisms that give rise to alternative mRNAs and their alternative translation into proteins. Each of the described studies has been based on a specific set of high-throughput RNA sequencing technologies. An overview of the available RNA sequencing

  10. Systematic analysis and evolution of 5S ribosomal DNA in metazoans.

    Science.gov (United States)

    Vierna, J; Wehner, S; Höner zu Siederdissen, C; Martínez-Lage, A; Marz, M

    2013-11-01

    Several studies on 5S ribosomal DNA (5S rDNA) have been focused on a subset of the following features in mostly one organism: number of copies, pseudogenes, secondary structure, promoter and terminator characteristics, genomic arrangements, types of non-transcribed spacers and evolution. In this work, we systematically analyzed 5S rDNA sequence diversity in available metazoan genomes, and showed organism-specific and evolutionary-conserved features. Putatively functional sequences (12,766) from 97 organisms allowed us to identify general features of this multigene family in animals. Interestingly, we show that each mammal species has a highly conserved (housekeeping) 5S rRNA type and many variable ones. The genomic organization of 5S rDNA is still under debate. Here, we report the occurrence of several paralog 5S rRNA sequences in 58 of the examined species, and a flexible genome organization of 5S rDNA in animals. We found heterogeneous 5S rDNA clusters in several species, supporting the hypothesis of an exchange of 5S rDNA from one locus to another. A rather high degree of variation of upstream, internal and downstream putative regulatory regions appears to characterize metazoan 5S rDNA. We systematically studied the internal promoters and described three different types of termination signals, as well as variable distances between the coding region and the typical termination signal. Finally, we present a statistical method for detection of linkage among noncoding RNA (ncRNA) gene families. This method showed no evolutionary-conserved linkage among 5S rDNAs and any other ncRNA genes within Metazoa, even though we found 5S rDNA to be linked to various ncRNAs in several clades.

  11. Resistance to linezolid in Staphylococcus spp. clinical isolates associated with ribosomal binding site modifications: novel mutation in domain V of 23S rRNA.

    Science.gov (United States)

    Musumeci, Rosario; Calaresu, Enrico; Gerosa, Jolanda; Oggioni, Davide; Bramati, Simone; Morelli, Patrizia; Mura, Ida; Piana, Andrea; Are, Bianca Maria; Cocuzza, Clementina Elvezia

    2016-10-01

    Linezolid is the main representative of the oxazolidinones, introduced in 2000 in clinical practice to treat severe Gram-positive infections. This compound inhibits protein synthesis by binding to the peptidyl transferase centre of the 50S bacterial ribosomal subunit. The aim of this study was to characterize 12 clinical strains of linezolid-resistant Staphylococcus spp. isolated in Northern Italy. All isolates of Staphylococcus spp. studied showed a multi-antibiotic resistance phenotype. In particular, all isolates showed the presence of the mecA gene associated with SSCmec types IVa, V or I. Mutations in domain V of 23S rRNA were shown to be the most prevalent mechanism of linezolid resistance: among these a new C2551T mutation was found in S. aureus, whilst the G2576T mutation was shown to be the most prevalent overall. Moreover, three S. epidermidis isolates were shown to have linezolid resistance associated only with alterations in both L3 and L4 ribosomal proteins. No strain was shown to harbor the previously described cfr gene. These results have shown how the clinical use of linezolid in Northern Italy has resulted in the selection of multiple antibiotic-resistant clinical isolates of Staphylococcus spp., with linezolid resistance in these strains being associated with mutations in 23S rRNA or ribosomal proteins L3 and L4.

  12. High throughput 16S rRNA gene amplicon sequencing

    DEFF Research Database (Denmark)

    Nierychlo, Marta; Larsen, Poul; Jørgensen, Mads Koustrup

    S rRNA gene amplicon sequencing has been developed over the past few years and is now ready to use for more comprehensive studies related to plant operation and optimization thanks to short analysis time, low cost, high throughput, and high taxonomic resolution. In this study we show how 16S r......RNA gene amplicon sequencing can be used to reveal factors of importance for the operation of full-scale nutrient removal plants related to settling problems and floc properties. Using optimized DNA extraction protocols, indexed primers and our in-house Illumina platform, we prepared multiple samples...... be correlated to the presence of the species that are regarded as “strong” and “weak” floc formers. In conclusion, 16S rRNA gene amplicon sequencing provides a high throughput approach for a rapid and cheap community profiling of activated sludge that in combination with multivariate statistics can be used...

  13. Mitochondrial 16S ribosomal RNA gene for forensic identification of crocodile species.

    Science.gov (United States)

    Naga Jogayya, K; Meganathan, P R; Dubey, Bhawna; Haque, I

    2013-05-01

    All crocodilians are under various threats due to over exploitation and these species have been listed in Appendix I or II of CITES. Lack of molecular techniques for the forensic identification of confiscated samples makes it difficult to enforce the law. Therefore, we herein present a molecular method developed on the basis on 16S rRNA gene of mitochondrial DNA for identification of crocodile species. We have developed a set of 16S rRNA primers for PCR based identification of crocodilian species. These novel primers amplify partial 16S rRNA sequences of six crocodile species which can be later combined to obtain a larger region (1290 bp) of 16S rRNA gene. This 16S rRNA gene could be used as an effective tool for forensic authentication of crocodiles. The described primers hold great promise in forensic identification of crocodile species, which can aid in the effective enforcement of law and conservation of these species. Copyright © 2012 Elsevier Ltd and Faculty of Forensic and Legal Medicine. All rights reserved.

  14. IRESPred: Web Server for Prediction of Cellular and Viral Internal Ribosome Entry Site (IRES)

    Science.gov (United States)

    Kolekar, Pandurang; Pataskar, Abhijeet; Kulkarni-Kale, Urmila; Pal, Jayanta; Kulkarni, Abhijeet

    2016-01-01

    Cellular mRNAs are predominantly translated in a cap-dependent manner. However, some viral and a subset of cellular mRNAs initiate their translation in a cap-independent manner. This requires presence of a structured RNA element, known as, Internal Ribosome Entry Site (IRES) in their 5′ untranslated regions (UTRs). Experimental demonstration of IRES in UTR remains a challenging task. Computational prediction of IRES merely based on sequence and structure conservation is also difficult, particularly for cellular IRES. A web server, IRESPred is developed for prediction of both viral and cellular IRES using Support Vector Machine (SVM). The predictive model was built using 35 features that are based on sequence and structural properties of UTRs and the probabilities of interactions between UTR and small subunit ribosomal proteins (SSRPs). The model was found to have 75.51% accuracy, 75.75% sensitivity, 75.25% specificity, 75.75% precision and Matthews Correlation Coefficient (MCC) of 0.51 in blind testing. IRESPred was found to perform better than the only available viral IRES prediction server, VIPS. The IRESPred server is freely available at http://bioinfo.net.in/IRESPred/. PMID:27264539

  15. Defective replication initiation results in locus specific chromosome breakage and a ribosomal RNA deficiency in yeast.

    Directory of Open Access Journals (Sweden)

    Joseph C Sanchez

    2017-10-01

    Full Text Available A form of dwarfism known as Meier-Gorlin syndrome (MGS is caused by recessive mutations in one of six different genes (ORC1, ORC4, ORC6, CDC6, CDT1, and MCM5. These genes encode components of the pre-replication complex, which assembles at origins of replication prior to S phase. Also, variants in two additional replication initiation genes have joined the list of causative mutations for MGS (Geminin and CDC45. The identity of the causative MGS genetic variants strongly suggests that some aspect of replication is amiss in MGS patients; however, little evidence has been obtained regarding what aspect of chromosome replication is faulty. Since the site of one of the missense mutations in the human ORC4 alleles is conserved between humans and yeast, we sought to determine in what way this single amino acid change affects the process of chromosome replication, by introducing the comparable mutation into yeast (orc4Y232C. We find that yeast cells with the orc4Y232C allele have a prolonged S-phase, due to compromised replication initiation at the ribosomal DNA (rDNA locus located on chromosome XII. The inability to initiate replication at the rDNA locus results in chromosome breakage and a severely reduced rDNA copy number in the survivors, presumably helping to ensure complete replication of chromosome XII. Although reducing rDNA copy number may help ensure complete chromosome replication, orc4Y232C cells struggle to meet the high demand for ribosomal RNA synthesis. This finding provides additional evidence linking two essential cellular pathways-DNA replication and ribosome biogenesis.

  16. Defective replication initiation results in locus specific chromosome breakage and a ribosomal RNA deficiency in yeast.

    Science.gov (United States)

    Sanchez, Joseph C; Kwan, Elizabeth X; Pohl, Thomas J; Amemiya, Haley M; Raghuraman, M K; Brewer, Bonita J

    2017-10-01

    A form of dwarfism known as Meier-Gorlin syndrome (MGS) is caused by recessive mutations in one of six different genes (ORC1, ORC4, ORC6, CDC6, CDT1, and MCM5). These genes encode components of the pre-replication complex, which assembles at origins of replication prior to S phase. Also, variants in two additional replication initiation genes have joined the list of causative mutations for MGS (Geminin and CDC45). The identity of the causative MGS genetic variants strongly suggests that some aspect of replication is amiss in MGS patients; however, little evidence has been obtained regarding what aspect of chromosome replication is faulty. Since the site of one of the missense mutations in the human ORC4 alleles is conserved between humans and yeast, we sought to determine in what way this single amino acid change affects the process of chromosome replication, by introducing the comparable mutation into yeast (orc4Y232C). We find that yeast cells with the orc4Y232C allele have a prolonged S-phase, due to compromised replication initiation at the ribosomal DNA (rDNA) locus located on chromosome XII. The inability to initiate replication at the rDNA locus results in chromosome breakage and a severely reduced rDNA copy number in the survivors, presumably helping to ensure complete replication of chromosome XII. Although reducing rDNA copy number may help ensure complete chromosome replication, orc4Y232C cells struggle to meet the high demand for ribosomal RNA synthesis. This finding provides additional evidence linking two essential cellular pathways-DNA replication and ribosome biogenesis.

  17. Clinical identification of bacteria in human chronic wound infections: culturing vs. 16S ribosomal DNA sequencing

    Directory of Open Access Journals (Sweden)

    Rhoads Daniel D

    2012-11-01

    Full Text Available Abstract Background Chronic wounds affect millions of people and cost billions of dollars in the United States each year. These wounds harbor polymicrobial biofilm communities, which can be difficult to elucidate using culturing methods. Clinical molecular microbiological methods are increasingly being employed to investigate the microbiota of chronic infections, including wounds, as part of standard patient care. However, molecular testing is more sensitive than culturing, which results in markedly different results being reported to clinicians. This study compares the results of aerobic culturing and molecular testing (culture-free 16S ribosomal DNA sequencing, and it examines the relative abundance score that is generated by the molecular test and the usefulness of the relative abundance score in predicting the likelihood that the same organism would be detected by culture. Methods Parallel samples from 51 chronic wounds were studied using aerobic culturing and 16S DNA sequencing for the identification of bacteria. Results One hundred forty-five (145 unique genera were identified using molecular methods, and 68 of these genera were aerotolerant. Fourteen (14 unique genera were identified using aerobic culture methods. One-third (31/92 of the cultures were determined to be Staphylococcus aureus, Pseudomonas aeruginosa, and Enterococcus faecalis with higher relative abundance scores were more likely to be detected by culture as demonstrated with regression modeling. Conclusion Discordance between molecular and culture testing is often observed. However, culture-free 16S ribosomal DNA sequencing and its relative abundance score can provide clinicians with insight into which bacteria are most abundant in a sample and which are most likely to be detected by culture.

  18. Identification and Removal of Contaminant Sequences From Ribosomal Gene Databases: Lessons From the Census of Deep Life.

    Science.gov (United States)

    Sheik, Cody S; Reese, Brandi Kiel; Twing, Katrina I; Sylvan, Jason B; Grim, Sharon L; Schrenk, Matthew O; Sogin, Mitchell L; Colwell, Frederick S

    2018-01-01

    Earth's subsurface environment is one of the largest, yet least studied, biomes on Earth, and many questions remain regarding what microorganisms are indigenous to the subsurface. Through the activity of the Census of Deep Life (CoDL) and the Deep Carbon Observatory, an open access 16S ribosomal RNA gene sequence database from diverse subsurface environments has been compiled. However, due to low quantities of biomass in the deep subsurface, the potential for incorporation of contaminants from reagents used during sample collection, processing, and/or sequencing is high. Thus, to understand the ecology of subsurface microorganisms (i.e., the distribution, richness, or survival), it is necessary to minimize, identify, and remove contaminant sequences that will skew the relative abundances of all taxa in the sample. In this meta-analysis, we identify putative contaminants associated with the CoDL dataset, recommend best practices for removing contaminants from samples, and propose a series of best practices for subsurface microbiology sampling. The most abundant putative contaminant genera observed, independent of evenness across samples, were Propionibacterium , Aquabacterium , Ralstonia , and Acinetobacter . While the top five most frequently observed genera were Pseudomonas , Propionibacterium , Acinetobacter , Ralstonia , and Sphingomonas . The majority of the most frequently observed genera (high evenness) were associated with reagent or potential human contamination. Additionally, in DNA extraction blanks, we observed potential archaeal contaminants, including methanogens, which have not been discussed in previous contamination studies. Such contaminants would directly affect the interpretation of subsurface molecular studies, as methanogenesis is an important subsurface biogeochemical process. Utilizing previously identified contaminant genera, we found that ∼27% of the total dataset were identified as contaminant sequences that likely originate from DNA

  19. Phylogenetic relationships of Salmonella based on rRNA sequences

    DEFF Research Database (Denmark)

    Christensen, H.; Nordentoft, Steen; Olsen, J.E.

    1998-01-01

    separated by 16S rRNA analysis and found to be closely related to the Escherichia coli and Shigella complex by both 16S and 23S rRNA analyses. The diphasic serotypes S. enterica subspp. I and VI were separated from the monophasic serotypes subspp. IIIa and IV, including S. bongori, by 23S rRNA sequence...

  20. Is The Ribosome Targeted By Adaptive Mutations

    DEFF Research Database (Denmark)

    Jimenez Fernandez, Alicia; Molin, Søren; Johansen, Helle Krogh

    2015-01-01

    Introduction: RNA polymerase and ribosomes, composing the macromolecular synthesis machinery (MMSM), carry out the central processes of transcription and translation, but are usually seen as mechanical elements with no regulatory function. Extensive investigations of gene regulation and the high ...

  1. T box riboswitches in Actinobacteria: Translational regulation via novel tRNA interactions

    Science.gov (United States)

    Sherwood, Anna V.; Grundy, Frank J.; Henkin, Tina M.

    2015-01-01

    The T box riboswitch regulates many amino acid-related genes in Gram-positive bacteria. T box riboswitch-mediated gene regulation was shown previously to occur at the level of transcription attenuation via structural rearrangements in the 5′ untranslated (leader) region of the mRNA in response to binding of a specific uncharged tRNA. In this study, a novel group of isoleucyl-tRNA synthetase gene (ileS) T box leader sequences found in organisms of the phylum Actinobacteria was investigated. The Stem I domains of these RNAs lack several highly conserved elements that are essential for interaction with the tRNA ligand in other T box RNAs. Many of these RNAs were predicted to regulate gene expression at the level of translation initiation through tRNA-dependent stabilization of a helix that sequesters a sequence complementary to the Shine–Dalgarno (SD) sequence, thus freeing the SD sequence for ribosome binding and translation initiation. We demonstrated specific binding to the cognate tRNAIle and tRNAIle-dependent structural rearrangements consistent with regulation at the level of translation initiation, providing the first biochemical demonstration, to our knowledge, of translational regulation in a T box riboswitch. PMID:25583497

  2. Molecular interactions within the halophilic, thermophilic, and mesophilic prokaryotic ribosomal complexes: clues to environmental adaptation.

    Science.gov (United States)

    Mallik, Saurav; Kundu, Sudip

    2015-01-01

    Using the available crystal structures of 50S ribosomal subunits from three prokaryotic species: Escherichia coli (mesophilic), Thermus thermophilus (thermophilic), and Haloarcula marismortui (halophilic), we have analyzed different structural features of ribosomal RNAs (rRNAs), proteins, and of their interfaces. We have correlated these structural features with the environmental adaptation strategies of the corresponding species. While dense intra-rRNA packing is observed in thermophilic, loose intra-rRNA packing is observed in halophilic (both compared to mesophilic). Interestingly, protein-rRNA interfaces of both the extremophiles are densely packed compared to that of the mesophilic. The intersubunit bridge regions are almost devoid of cavities, probably ensuring the proper formation of each bridge (by not allowing any loosely packed region nearby). During rRNA binding, the ribosomal proteins experience some structural transitions. Here, we have analyzed the intrinsically disordered and ordered regions of the ribosomal proteins, which are subjected to such transitions. The intrinsically disordered and disorder-to-order transition sites of the thermophilic and mesophilic ribosomal proteins are simultaneously (i) highly conserved and (ii) slowly evolving compared to rest of the protein structure. Although high conservation is observed at such sites of halophilic ribosomal proteins, but slow rate of evolution is absent. Such differences between thermophilic, mesophilic, and halophilic can be explained from their environmental adaptation strategy. Interestingly, a universal biophysical principle evident by a linear relationship between the free energy of interface formation, interface area, and structural changes of r-proteins during assembly is always maintained, irrespective of the environmental conditions.

  3. Theoretical evaluation of transcriptional pausing effect on the attenuation in trp leader sequence

    OpenAIRE

    Suzuki, H.; Kunisawa, T.; Otsuka, J.

    1986-01-01

    The effect of transcriptional pausing on attenuation is investigated theoretically on the basis of the attenuation control mechanism presented by Oxender et al. (Oxender, D. L., G. Zurawski, and C. Yanofsky, 1979, Proc. Natl. Acad. Sci. USA. 76:5524-5528). An extended stochastic model including the RNA polymerase pausing in the leader region is developed to calculate the probability of relative position between the RNA polymerase transcribing the trp leader sequence and the ribosome translati...

  4. Sequence of the amino-terminal region of rat liver ribosomal proteins S4, S6, S8, L6, L7a, L18, L27, L30, L37, L37a, and L39.

    Science.gov (United States)

    Wittmann-Liebold, B; Geissler, A W; Lin, A; Wool, I G

    1979-01-01

    The sequence of the amino-terminal region of eleven rat liver ribosomal proteins--S4, S6, S8, L6, L7a, L18, L27, L30, L37a, and L39--was determined. The analysis confirmed the homogeneity of the proteins and suggests that they are unique, since no extensive common sequences were found. The N-terminal regions of the rat liver proteins were compared with amino acid sequences in Saccharomyces cerevisiae and in Escherichia coli ribosomal proteins. It seems likely that the proteins L37 from rat liver and Y55 from yeast ribosomes are homologous. It is possible that rat liver L7a or L37a or both are related to S cerevisiae Y44, although the similar sequences are at the amino-terminus of the rat liver proteins and in an internal region of Y44. A number of similarities in the sequences of rat liver and E coli ribosomal proteins have been found; however, it is not yet possible to say whether they connote a common ancestry.

  5. Expression and RNA Interference of Ribosomal Protein L5 Gene in Nilaparvata lugens (Hemiptera: Delphacidae).

    Science.gov (United States)

    Zhu, Jiajun; Hao, Peiying; Lu, Chaofeng; Ma, Yan; Feng, Yalin; Yu, Xiaoping

    2017-05-01

    The ribosomal proteins play important roles in the growth and development of organisms. This study aimed to explore the function of NlRPL5 (GenBank KX379234), a ribosomal protein L5 gene, in the brown planthopper Nilaparvata lugens. The open reading frame of NlRPL5 was cloned from N. lugens based on a previous transcriptome analysis. The results revealed that the open reading frame of NlRPL5 is of 900 bp, encoding 299 amino acid residues. The reverse transcription quantitative PCR results suggested that the expression of NlRPL5 gene was stronger in gravid females, but was relatively low in nymphs, males, and newly emerged females. The expression level of NlRPL5 in the ovary was about twofolds of that in the head, thorax, or fat body. RNAi of dsNlRPL5 resulted in a significant reduction of mRNA levels, ∼50% decrease in comparison with the dsGFP control at day 6. Treatment of dsNlRPL5 significantly restricted the ovarian development, and decreased the number of eggs laid on the rice (Oryza sativa) plants. This study provided a new clue for further study on the function and regulation mechanism of NlRPL5 in N. lugens. © The Author 2017. Published by Oxford University Press on behalf of the Entomological Society of America.

  6. Mycobacterial RNA isolation optimized for non-coding RNA: high fidelity isolation of 5S rRNA from Mycobacterium bovis BCG reveals novel post-transcriptional processing and a complete spectrum of modified ribonucleosides.

    Science.gov (United States)

    Hia, Fabian; Chionh, Yok Hian; Pang, Yan Ling Joy; DeMott, Michael S; McBee, Megan E; Dedon, Peter C

    2015-03-11

    A major challenge in the study of mycobacterial RNA biology is the lack of a comprehensive RNA isolation method that overcomes the unusual cell wall to faithfully yield the full spectrum of non-coding RNA (ncRNA) species. Here, we describe a simple and robust procedure optimized for the isolation of total ncRNA, including 5S, 16S and 23S ribosomal RNA (rRNA) and tRNA, from mycobacteria, using Mycobacterium bovis BCG to illustrate the method. Based on a combination of mechanical disruption and liquid and solid-phase technologies, the method produces all major species of ncRNA in high yield and with high integrity, enabling direct chemical and sequence analysis of the ncRNA species. The reproducibility of the method with BCG was evident in bioanalyzer electrophoretic analysis of isolated RNA, which revealed quantitatively significant differences in the ncRNA profiles of exponentially growing and non-replicating hypoxic bacilli. The method also overcame an historical inconsistency in 5S rRNA isolation, with direct sequencing revealing a novel post-transcriptional processing of 5S rRNA to its functional form and with chemical analysis revealing seven post-transcriptional ribonucleoside modifications in the 5S rRNA. This optimized RNA isolation procedure thus provides a means to more rigorously explore the biology of ncRNA species in mycobacteria. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  7. Complete mitochondrial genomes and nuclear ribosomal RNA operons of two species of Diplostomum (Platyhelminthes: Trematoda): a molecular resource for taxonomy and molecular epidemiology of important fish pathogens.

    Science.gov (United States)

    Brabec, Jan; Kostadinova, Aneta; Scholz, Tomáš; Littlewood, D Timothy J

    2015-06-19

    The genus Diplostomum (Platyhelminthes: Trematoda: Diplostomidae) is a diverse group of freshwater parasites with complex life-cycles and global distribution. The larval stages are important pathogens causing eye fluke disease implicated in substantial impacts on natural fish populations and losses in aquaculture. However, the problematic species delimitation and difficulties in the identification of larval stages hamper the assessment of the distributional and host ranges of Diplostomum spp. and their transmission ecology. Total genomic DNA was isolated from adult worms and shotgun sequenced using Illumina MiSeq technology. Mitochondrial (mt) genomes and nuclear ribosomal RNA (rRNA) operons were assembled using established bioinformatic tools and fully annotated. Mt protein-coding genes and nuclear rRNA genes were subjected to phylogenetic analysis by maximum likelihood and the resulting topologies compared. We characterised novel complete mt genomes and nuclear rRNA operons of two closely related species, Diplostomum spathaceum and D. pseudospathaceum. Comparative mt genome assessment revealed that the cox1 gene and its 'barcode' region used for molecular identification are the most conserved regions; instead, nad4 and nad5 genes were identified as most promising molecular diagnostic markers. Using the novel data, we provide the first genome wide estimation of the phylogenetic relationships of the order Diplostomida, one of the two fundamental lineages of the Digenea. Analyses of the mitogenomic data invariably recovered the Diplostomidae as a sister lineage of the order Plagiorchiida rather than as a basal lineage of the Diplostomida as inferred in rDNA phylogenies; this was concordant with the mt gene order of Diplostomum spp. exhibiting closer match to the conserved gene order of the Plagiorchiida. Complete sequences of the mt genome and rRNA operon of two species of Diplostomum provide a valuable resource for novel genetic markers for species delineation and

  8. Evidence for an RNA pseudoknot loop-helix interaction essential for efficient -1 ribosomal frameshifting.

    Science.gov (United States)

    Liphardt, J; Napthine, S; Kontos, H; Brierley, I

    1999-05-07

    RNA pseudoknots are structural elements that participate in a variety of biological processes. At -1 ribosomal frameshifting sites, several types of pseudoknot have been identified which differ in their organisation and functionality. The pseudoknot found in infectious bronchitis virus (IBV) is typical of those that possess a long stem 1 of 11-12 bp and a long loop 2 (30-164 nt). A second group of pseudoknots are distinguishable that contain stems of only 5 to 7 bp and shorter loops. The NMR structure of one such pseudoknot, that of mouse mammary tumor virus (MMTV), has revealed that it is kinked at the stem 1-stem 2 junction, and that this kinked conformation is essential for efficient frameshifting. We recently investigated the effect on frameshifting of modulating stem 1 length and stability in IBV-based pseudoknots, and found that a stem 1 with at least 11 bp was needed for efficient frameshifting. Here, we describe the sequence manipulations that are necessary to bypass the requirement for an 11 bp stem 1 and to convert a short non-functional IBV-derived pseudoknot into a highly efficient, kinked frameshifter pseudoknot. Simple insertion of an adenine residue at the stem 1-stem 2 junction (an essential feature of a kinked pseudoknot) was not sufficient to create a functional pseudoknot. An additional change was needed: efficient frameshifting was recovered only when the last nucleotide of loop 2 was changed from a G to an A. The requirement for an A at the end of loop 2 is consistent with a loop-helix contact similar to those described in other RNA tertiary structures. A mutational analysis of both partners of the proposed interaction, the loop 2 terminal adenine residue and two G.C pairs near the top of stem 1, revealed that the interaction was essential for efficient frameshifting. The specific requirement for a 3'-terminal A residue was lost when loop 2 was increased from 8 to 14 nt, suggesting that the loop-helix contact may be required only in those

  9. Sequence-specific RNA Photocleavage by Single-stranded DNA in Presence of Riboflavin

    Science.gov (United States)

    Zhao, Yongyun; Chen, Gangyi; Yuan, Yi; Li, Na; Dong, Juan; Huang, Xin; Cui, Xin; Tang, Zhuo

    2015-10-01

    Constant efforts have been made to develop new method to realize sequence-specific RNA degradation, which could cause inhibition of the expression of targeted gene. Herein, by using an unmodified short DNA oligonucleotide for sequence recognition and endogenic small molecue, vitamin B2 (riboflavin) as photosensitizer, we report a simple strategy to realize the sequence-specific photocleavage of targeted RNA. The DNA strand is complimentary to the target sequence to form DNA/RNA duplex containing a G•U wobble in the middle. The cleavage reaction goes through oxidative elimination mechanism at the nucleoside downstream of U of the G•U wobble in duplex to obtain unnatural RNA terminal, and the whole process is under tight control by using light as switch, which means the cleavage could be carried out according to specific spatial and temporal requirements. The biocompatibility of this method makes the DNA strand in combination with riboflavin a promising molecular tool for RNA manipulation.

  10. Ribosome. The complete structure of the 55S mammalian mitochondrial ribosome.

    Science.gov (United States)

    Greber, Basil J; Bieri, Philipp; Leibundgut, Marc; Leitner, Alexander; Aebersold, Ruedi; Boehringer, Daniel; Ban, Nenad

    2015-04-17

    Mammalian mitochondrial ribosomes (mitoribosomes) synthesize mitochondrially encoded membrane proteins that are critical for mitochondrial function. Here we present the complete atomic structure of the porcine 55S mitoribosome at 3.8 angstrom resolution by cryo-electron microscopy and chemical cross-linking/mass spectrometry. The structure of the 28S subunit in the complex was resolved at 3.6 angstrom resolution by focused alignment, which allowed building of a detailed atomic structure including all of its 15 mitoribosomal-specific proteins. The structure reveals the intersubunit contacts in the 55S mitoribosome, the molecular architecture of the mitoribosomal messenger RNA (mRNA) binding channel and its interaction with transfer RNAs, and provides insight into the highly specialized mechanism of mRNA recruitment to the 28S subunit. Furthermore, the structure contributes to a mechanistic understanding of aminoglycoside ototoxicity. Copyright © 2015, American Association for the Advancement of Science.

  11. HDP2: a ribosomal DNA (NTS-ETS) sequence as a target for species-specific molecular diagnosis of intestinal taeniasis in humans.

    Science.gov (United States)

    Flores, María D; Gonzalez, Luis M; Hurtado, Carolina; Motta, Yamileth Monje; Domínguez-Hidalgo, Cristina; Merino, Francisco Jesús; Perteguer, María J; Gárate, Teresa

    2018-02-27

    Taenia solium, T. asiatica and T. saginata tapeworms cause human taeniasis and are the origin of porcine and bovine cysticercosis. Furthermore, T. solium eggs can cause human cysticercosis, with neurocysticercosis being the most serious form of the disease. These helminth infections are neglected tropical diseases and are endemic in several countries in the Americas, Asia and Africa. As a result of globalization, migration in particular, the infections have been extending to non-endemic territories. Species-specific diagnosis of taeniasis is subject to drawbacks that could be resolved using molecular approaches. In the present study, conventional and real-time amplification protocols (cPCR and qPCR) based on the T. saginata HDP2 sequence were applied in the differential diagnosis of taeniasis (T. saginata, T. solium) in both fecal samples and proglottids expelled by patients. The HDP2 homolog in T. solium was cloned and characterized. Semi-nested cPCR and qPCR (Sn-HDP2 cPCR and Sn-HDP2 qPCR) amplified T. saginata and T. solium DNA, with an analytical sensitivity of 40 and 400 fg, respectively, and identically in both protocols. Eighteen taeniasis patients were diagnosed directly with T. saginata or T. solium, either from proglottids or fecal samples with/without eggs (detected using microscopy), based on the optimized Sn-HDP2 qPCR. After cloning, the T. solium HDP2 homolog sequence was confirmed to be a ribosomal sequence. The HDP2 fragment corresponded to a non-transcribed sequence/external transcribed repeat (NTS/ETS) of ribosomal DNA. Compared with the T. saginata HDP2 homolog, the T solium HDP2 sequence lacked the first 900 nt at the 5' end and showed nucleotide substitutions and small deletions. Sn-HDP2 cPCR and Sn-HDP2 qPCR were set up for the diagnosis of human taeniasis, using proglottids and fecal samples from affected patients. The new Sn-HDP2 qPCR protocol was the best option, as it directly differentiated T. saginata from T. solium. The diagnosis of

  12. Dinoflagellate phylogeny as inferred from heat shock protein 90 and ribosomal gene sequences.

    Directory of Open Access Journals (Sweden)

    Mona Hoppenrath

    2010-10-01

    Full Text Available Interrelationships among dinoflagellates in molecular phylogenies are largely unresolved, especially in the deepest branches. Ribosomal DNA (rDNA sequences provide phylogenetic signals only at the tips of the dinoflagellate tree. Two reasons for the poor resolution of deep dinoflagellate relationships using rDNA sequences are (1 most sites are relatively conserved and (2 there are different evolutionary rates among sites in different lineages. Therefore, alternative molecular markers are required to address the deeper phylogenetic relationships among dinoflagellates. Preliminary evidence indicates that the heat shock protein 90 gene (Hsp90 will provide an informative marker, mainly because this gene is relatively long and appears to have relatively uniform rates of evolution in different lineages.We more than doubled the previous dataset of Hsp90 sequences from dinoflagellates by generating additional sequences from 17 different species, representing seven different orders. In order to concatenate the Hsp90 data with rDNA sequences, we supplemented the Hsp90 sequences with three new SSU rDNA sequences and five new LSU rDNA sequences. The new Hsp90 sequences were generated, in part, from four additional heterotrophic dinoflagellates and the type species for six different genera. Molecular phylogenetic analyses resulted in a paraphyletic assemblage near the base of the dinoflagellate tree consisting of only athecate species. However, Noctiluca was never part of this assemblage and branched in a position that was nested within other lineages of dinokaryotes. The phylogenetic trees inferred from Hsp90 sequences were consistent with trees inferred from rDNA sequences in that the backbone of the dinoflagellate clade was largely unresolved.The sequence conservation in both Hsp90 and rDNA sequences and the poor resolution of the deepest nodes suggests that dinoflagellates reflect an explosive radiation in morphological diversity in their recent

  13. Architecture of the large subunit of the mammalian mitochondrial ribosome.

    Science.gov (United States)

    Greber, Basil J; Boehringer, Daniel; Leitner, Alexander; Bieri, Philipp; Voigts-Hoffmann, Felix; Erzberger, Jan P; Leibundgut, Marc; Aebersold, Ruedi; Ban, Nenad

    2014-01-23

    Mitochondrial ribosomes synthesize a number of highly hydrophobic proteins encoded on the genome of mitochondria, the organelles in eukaryotic cells that are responsible for energy conversion by oxidative phosphorylation. The ribosomes in mammalian mitochondria have undergone massive structural changes throughout their evolution, including ribosomal RNA shortening and acquisition of mitochondria-specific ribosomal proteins. Here we present the three-dimensional structure of the 39S large subunit of the porcine mitochondrial ribosome determined by cryo-electron microscopy at 4.9 Å resolution. The structure, combined with data from chemical crosslinking and mass spectrometry experiments, reveals the unique features of the 39S subunit at near-atomic resolution and provides detailed insight into the architecture of the polypeptide exit site. This region of the mitochondrial ribosome has been considerably remodelled compared to its bacterial counterpart, providing a specialized platform for the synthesis and membrane insertion of the highly hydrophobic protein components of the respiratory chain.

  14. Cleavage of rRNA ensures translational cessation in sperm at fertilization

    Science.gov (United States)

    Johnson, G.D.; Sendler, E.; Lalancette, C.; Hauser, R.; Diamond, M.P.; Krawetz, S.A.

    2011-01-01

    Intact ribosomal RNAs (rRNAs) comprise the majority of somatic transcripts, yet appear conspicuously absent in spermatozoa, perhaps reflecting cytoplasmic expulsion during spermatogenesis. To discern their fate, total RNA retained in mature spermatozoa from three fertile donors was characterized by Next Generation Sequencing. In all samples, >75% of total sequence reads aligned to rRNAs. The distribution of reads along the length of these transcripts exhibited a high degree of non-uniformity that was reiterated between donors. The coverage of sequencing reads was inversely correlated with guanine-cytosine (GC)-richness such that sequences greater than ∼70% GC were virtually absent in all sperm RNA samples. To confirm the loss of sequence, the relative abundance of specific regions of the 28S transcripts in sperm was established by 7-Deaza-2′-deoxy-guanosine-5′-triphosphate RT–PCR. The inability to amplify specific regions of the 28S sequence from sperm despite the abundant representation of this transcript in the sequencing libraries demonstrates that approximately three-quarters of RNA retained in the mature male gamete are products of rRNA fragmentation. Hence, cleavage (not expulsion of the RNA component of the translational machinery) is responsible for preventing spurious translation following spermiogenesis. These results highlight the potential importance of those transcripts, including many mRNAs, which evade fragmentation and remain intact when sperm are delivered at fertilization. Sequencing data are deposited in GEO as: GSE29160. PMID:21831882

  15. Cell cycle, differentiation and tissue-independent expression of ribosomal protein L37.

    Science.gov (United States)

    Su, S; Bird, R C

    1995-09-15

    A unique human cDNA (hG1.16) that encodes a mRNA of 450 nucleotides was isolated from a subtractive library derived from HeLa cells. The relative expression level of hG1.16 during different cell-cycle phases was determined by Northern-blot analysis of cells synchronized by double-thymidine block and serum deprivation/refeeding. hG1.16 was constitutively expressed during all phases of the cell cycle, including the quiescent phase when even most constitutively expressed genes experience some suppression of expression. The expression level of hG1.16 did not change during terminal differentiation of myoblasts to myotubes, during which cells become permanently post-mitotic. Examination of other tissues revealed that the relative expression level of hG1.16 was constitutive in all embryonic mouse tissues examined, including brain, eye, heart, kidney, liver, lung and skeletal muscle. This was unusual in that expression was not down-modulated during differentiation and did not vary appreciably between tissue types. Analysis by inter-species Northern-blot analysis revealed that hG1.16 was highly conserved among all vertebrates studied (from fish to humans but not in insects). DNA sequence analysis of hG1.16 revealed a high level of similarity to rat ribosomal protein L37, identifying hG1.16 as a new member of this multigene family. The deduced amino acid sequence of hG1.16 was identical to rat ribosomal protein L37 that contained 97 amino acids, many of which are highly positively charged (15 arginine and 14 lysine residues with a predicted M(r) of 11,065). hG1.16 protein has a single C2-C2 zinc-finger-like motif which is also present in rat ribosomal protein L37. Using primers designed from the sequence of hG1.16, unique bovine and rat cDNAs were also isolated by 5'-rapid-amplification of cDNA ends. DNA sequences of bovine and rat G1.16, clones were 92.8% and 92.2% similar to human G1.16 while the deduced amino acid sequences derived from bovine and rat cDNAs each differed

  16. Ribosomal and hematopoietic defects in induced pluripotent stem cells derived from Diamond Blackfan anemia patients.

    Science.gov (United States)

    Garçon, Loïc; Ge, Jingping; Manjunath, Shwetha H; Mills, Jason A; Apicella, Marisa; Parikh, Shefali; Sullivan, Lisa M; Podsakoff, Gregory M; Gadue, Paul; French, Deborah L; Mason, Philip J; Bessler, Monica; Weiss, Mitchell J

    2013-08-08

    Diamond Blackfan anemia (DBA) is a congenital disorder with erythroid (Ery) hypoplasia and tissue morphogenic abnormalities. Most DBA cases are caused by heterozygous null mutations in genes encoding ribosomal proteins. Understanding how haploinsufficiency of these ubiquitous proteins causes DBA is hampered by limited availability of tissues from affected patients. We generated induced pluripotent stem cells (iPSCs) from fibroblasts of DBA patients carrying mutations in RPS19 and RPL5. Compared with controls, DBA fibroblasts formed iPSCs inefficiently, although we obtained 1 stable clone from each fibroblast line. RPS19-mutated iPSCs exhibited defects in 40S (small) ribosomal subunit assembly and production of 18S ribosomal RNA (rRNA). Upon induced differentiation, the mutant clone exhibited globally impaired hematopoiesis, with the Ery lineage affected most profoundly. RPL5-mutated iPSCs exhibited defective 60S (large) ribosomal subunit assembly, accumulation of 12S pre-rRNA, and impaired erythropoiesis. In both mutant iPSC lines, genetic correction of ribosomal protein deficiency via complementary DNA transfer into the "safe harbor" AAVS1 locus alleviated abnormalities in ribosome biogenesis and hematopoiesis. Our studies show that pathological features of DBA are recapitulated by iPSCs, provide a renewable source of cells to model various tissue defects, and demonstrate proof of principle for genetic correction strategies in patient stem cells.

  17. Complete Genome Sequence of a Double-Stranded RNA Virus from Avocado

    OpenAIRE

    Villanueva, Francisco; Sabanadzovic, Sead; Valverde, Rodrigo A.; Navas-Castillo, Jesús

    2012-01-01

    A number of avocado (Persea americana) cultivars are known to contain high-molecular-weight double-stranded RNA (dsRNA) molecules for which a viral nature has been suggested, although sequence data are not available. Here we report the cloning and complete sequencing of a 13.5-kbp dsRNA virus isolated from avocado and show that it corresponds to the genome of a new species of the genus Endornavirus (family Endornaviridae), tentatively named Persea americana endornavirus (PaEV).

  18. A conserved chloramphenicol binding site at the entrance to the ribosomal peptide exit tunnel

    DEFF Research Database (Denmark)

    Long, Katherine S; Porse, Bo T

    2003-01-01

    , of E.coli 23S rRNA and G2084 (2058 in E.coli numbering) in domain V of H.halobium 23S rRNA. The modification sites overlap with a portion of the macrolide binding site and cluster at the entrance to the peptide exit tunnel. The data correlate with the recently reported chloramphenicol binding site...... on an archaeal ribosome and suggest that a similar binding site is present on the E.coli ribosome....

  19. On the Spatial Organization of mRNA, Plasmids, and Ribosomes in a Bacterial Host Overexpressing Membrane Proteins.

    Directory of Open Access Journals (Sweden)

    Lieke A van Gijtenbeek

    2016-12-01

    Full Text Available By using fluorescence imaging, we provide a time-resolved single-cell view on coupled defects in transcription, translation, and growth during expression of heterologous membrane proteins in Lactococcus lactis. Transcripts encoding poorly produced membrane proteins accumulate in mRNA-dense bodies at the cell poles, whereas transcripts of a well-expressed homologous membrane protein show membrane-proximal localization in a translation-dependent fashion. The presence of the aberrant polar mRNA foci correlates with cessation of cell division, which is restored once these bodies are cleared. In addition, activation of the heat-shock response and a loss of nucleoid-occluded ribosomes are observed. We show that the presence of a native-like N-terminal domain is key to SRP-dependent membrane localization and successful production of membrane proteins. The work presented gives new insights and detailed understanding of aberrant membrane protein biogenesis, which can be used for strategies to optimize membrane protein production.

  20. Nucleotide sequence and genetic organization of Hungarian grapevine chrome mosaic nepovirus RNA2.

    Science.gov (United States)

    Brault, V; Hibrand, L; Candresse, T; Le Gall, O; Dunez, J

    1989-10-11

    The complete nucleotide sequence of hungarian grapevine chrome mosaic nepovirus (GCMV) RNA2 has been determined. The RNA sequence is 4441 nucleotides in length, excluding the poly(A) tail. A polyprotein of 1324 amino acids with a calculated molecular weight of 146 kDa is encoded in a single long open reading frame extending from nucleotides 218 to 4190. This polyprotein is homologous with the protein encoded by the S strain of tomato black ring virus (TBRV) RNA2, the only other nepovirus sequenced so far. Direct sequencing of the viral coat protein and in vitro translation of transcripts derived from cDNA sequences demonstrate that, as for comoviruses, the coat protein is located at the carboxy terminus of the polyprotein. A model for the expression of GCMV RNA2 is presented.

  1. Mitochondrial 12S ribosomal RNA A1555G mutation associated with cardiomyopathy and hearing loss following high-dose chemotherapy and repeated aminoglycoside exposure

    DEFF Research Database (Denmark)

    Skou, Anne-Sofie; Tranebjærg, Lisbeth; Jensen, Tim

    2014-01-01

    A 19-month-old girl with the A1555G mitochondrial mutation in the 12S ribosomal RNA gene and acute myelogenous leukemia developed dilated cardiomyopathy and bilateral sensorineural hearing loss before undergoing allogeneic stem cell transplantation. She had received gentamicin during episodes of ...... of febrile neutropenia. Testing for the A1555G mutation is recommended in patients frequently treated with aminoglycosides....

  2. Highly divergent 16S rRNA sequences in ribosomal operons of Scytonema hyalinum (Cyanobacteria)

    Czech Academy of Sciences Publication Activity Database

    Johansen, J. R.; Mareš, Jan; Pietrasiak, N.; Bohunická, M.; Zima Jr., J.; Štenclová, Lenka; Hauer, T.

    2017-01-01

    Roč. 12, č. 10 (2017), č. článku e0186393. E-ISSN 1932-6203 Institutional support: RVO:60077344 Keywords : rRNA operon * heterogenita * Scytonema hyalinum Subject RIV: EF - Botanics OBOR OECD: Microbiology Impact factor: 2.806, year: 2016

  3. Plastid–Nuclear Interaction and Accelerated Coevolution in Plastid Ribosomal Genes in Geraniaceae

    Science.gov (United States)

    Weng, Mao-Lun; Ruhlman, Tracey A.; Jansen, Robert K.

    2016-01-01

    Plastids and mitochondria have many protein complexes that include subunits encoded by organelle and nuclear genomes. In animal cells, compensatory evolution between mitochondrial and nuclear-encoded subunits was identified and the high mitochondrial mutation rates were hypothesized to drive compensatory evolution in nuclear genomes. In plant cells, compensatory evolution between plastid and nucleus has rarely been investigated in a phylogenetic framework. To investigate plastid–nuclear coevolution, we focused on plastid ribosomal protein genes that are encoded by plastid and nuclear genomes from 27 Geraniales species. Substitution rates were compared for five sets of genes representing plastid- and nuclear-encoded ribosomal subunit proteins targeted to the cytosol or the plastid as well as nonribosomal protein controls. We found that nonsynonymous substitution rates (dN) and the ratios of nonsynonymous to synonymous substitution rates (ω) were accelerated in both plastid- (CpRP) and nuclear-encoded subunits (NuCpRP) of the plastid ribosome relative to control sequences. Our analyses revealed strong signals of cytonuclear coevolution between plastid- and nuclear-encoded subunits, in which nonsynonymous substitutions in CpRP and NuCpRP tend to occur along the same branches in the Geraniaceae phylogeny. This coevolution pattern cannot be explained by physical interaction between amino acid residues. The forces driving accelerated coevolution varied with cellular compartment of the sequence. Increased ω in CpRP was mainly due to intensified positive selection whereas increased ω in NuCpRP was caused by relaxed purifying selection. In addition, the many indels identified in plastid rRNA genes in Geraniaceae may have contributed to changes in plastid subunits. PMID:27190001

  4. Evolutionary conservation of nuclear and nucleolar targeting sequences in yeast ribosomal protein S6A

    International Nuclear Information System (INIS)

    Lipsius, Edgar; Walter, Korden; Leicher, Torsten; Phlippen, Wolfgang; Bisotti, Marc-Angelo; Kruppa, Joachim

    2005-01-01

    Over 1 billion years ago, the animal kingdom diverged from the fungi. Nevertheless, a high sequence homology of 62% exists between human ribosomal protein S6 and S6A of Saccharomyces cerevisiae. To investigate whether this similarity in primary structure is mirrored in corresponding functional protein domains, the nuclear and nucleolar targeting signals were delineated in yeast S6A and compared to the known human S6 signals. The complete sequence of S6A and cDNA fragments was fused to the 5'-end of the LacZ gene, the constructs were transiently expressed in COS cells, and the subcellular localization of the fusion proteins was detected by indirect immunofluorescence. One bipartite and two monopartite nuclear localization signals as well as two nucleolar binding domains were identified in yeast S6A, which are located at homologous regions in human S6 protein. Remarkably, the number, nature, and position of these targeting signals have been conserved, albeit their amino acid sequences have presumably undergone a process of co-evolution with their corresponding rRNAs

  5. TurboFold: Iterative probabilistic estimation of secondary structures for multiple RNA sequences

    Directory of Open Access Journals (Sweden)

    Sharma Gaurav

    2011-04-01

    Full Text Available Abstract Background The prediction of secondary structure, i.e. the set of canonical base pairs between nucleotides, is a first step in developing an understanding of the function of an RNA sequence. The most accurate computational methods predict conserved structures for a set of homologous RNA sequences. These methods usually suffer from high computational complexity. In this paper, TurboFold, a novel and efficient method for secondary structure prediction for multiple RNA sequences, is presented. Results TurboFold takes, as input, a set of homologous RNA sequences and outputs estimates of the base pairing probabilities for each sequence. The base pairing probabilities for a sequence are estimated by combining intrinsic information, derived from the sequence itself via the nearest neighbor thermodynamic model, with extrinsic information, derived from the other sequences in the input set. For a given sequence, the extrinsic information is computed by using pairwise-sequence-alignment-based probabilities for co-incidence with each of the other sequences, along with estimated base pairing probabilities, from the previous iteration, for the other sequences. The extrinsic information is introduced as free energy modifications for base pairing in a partition function computation based on the nearest neighbor thermodynamic model. This process yields updated estimates of base pairing probability. The updated base pairing probabilities in turn are used to recompute extrinsic information, resulting in the overall iterative estimation procedure that defines TurboFold. TurboFold is benchmarked on a number of ncRNA datasets and compared against alternative secondary structure prediction methods. The iterative procedure in TurboFold is shown to improve estimates of base pairing probability with each iteration, though only small gains are obtained beyond three iterations. Secondary structures composed of base pairs with estimated probabilities higher than a

  6. Complete Genome Sequence of a Double-Stranded RNA Virus from Avocado

    Science.gov (United States)

    Villanueva, Francisco; Sabanadzovic, Sead; Valverde, Rodrigo A.

    2012-01-01

    A number of avocado (Persea americana) cultivars are known to contain high-molecular-weight double-stranded RNA (dsRNA) molecules for which a viral nature has been suggested, although sequence data are not available. Here we report the cloning and complete sequencing of a 13.5-kbp dsRNA virus isolated from avocado and show that it corresponds to the genome of a new species of the genus Endornavirus (family Endornaviridae), tentatively named Persea americana endornavirus (PaEV). PMID:22205720

  7. The complete chloroplast genome sequence of Hibiscus syriacus.

    Science.gov (United States)

    Kwon, Hae-Yun; Kim, Joon-Hyeok; Kim, Sea-Hyun; Park, Ji-Min; Lee, Hyoshin

    2016-09-01

    The complete chloroplast genome sequence of Hibiscus syriacus L. is presented in this study. The genome is composed of 161 019 bp in length, with a typical circular structure containing a pair of inverted repeats of 25 745 bp of length separated by a large single-copy region and a small single-copy region of 89 698 bp and 19 831 bp of length, respectively. The overall GC content is 36.8%. One hundred and fourteen genes were annotated, including 81 protein-coding genes, 4 ribosomal RNA genes and 29 transfer RNA genes.

  8. RNA-ID, a Powerful Tool for Identifying and Characterizing Regulatory Sequences.

    Science.gov (United States)

    Brule, C E; Dean, K M; Grayhack, E J

    2016-01-01

    The identification and analysis of sequences that regulate gene expression is critical because regulated gene expression underlies biology. RNA-ID is an efficient and sensitive method to discover and investigate regulatory sequences in the yeast Saccharomyces cerevisiae, using fluorescence-based assays to detect green fluorescent protein (GFP) relative to a red fluorescent protein (RFP) control in individual cells. Putative regulatory sequences can be inserted either in-frame or upstream of a superfolder GFP fusion protein whose expression, like that of RFP, is driven by the bidirectional GAL1,10 promoter. In this chapter, we describe the methodology to identify and study cis-regulatory sequences in the RNA-ID system, explaining features and variations of the RNA-ID reporter, as well as some applications of this system. We describe in detail the methods to analyze a single regulatory sequence, from construction of a single GFP variant to assay of variants by flow cytometry, as well as modifications required to screen libraries of different strains simultaneously. We also describe subsequent analyses of regulatory sequences. © 2016 Elsevier Inc. All rights reserved.

  9. Genetic and epigenetic variation in 5S ribosomal RNA genes reveals genome dynamics in Arabidopsis thaliana.

    Science.gov (United States)

    Simon, Lauriane; Rabanal, Fernando A; Dubos, Tristan; Oliver, Cecilia; Lauber, Damien; Poulet, Axel; Vogt, Alexander; Mandlbauer, Ariane; Le Goff, Samuel; Sommer, Andreas; Duborjal, Hervé; Tatout, Christophe; Probst, Aline V

    2018-04-06

    Organized in tandem repeat arrays in most eukaryotes and transcribed by RNA polymerase III, expression of 5S rRNA genes is under epigenetic control. To unveil mechanisms of transcriptional regulation, we obtained here in depth sequence information on 5S rRNA genes from the Arabidopsis thaliana genome and identified differential enrichment in epigenetic marks between the three 5S rDNA loci situated on chromosomes 3, 4 and 5. We reveal the chromosome 5 locus as the major source of an atypical, long 5S rRNA transcript characteristic of an open chromatin structure. 5S rRNA genes from this locus translocated in the Landsberg erecta ecotype as shown by linkage mapping and chromosome-specific FISH analysis. These variations in 5S rDNA locus organization cause changes in the spatial arrangement of chromosomes in the nucleus. Furthermore, 5S rRNA gene arrangements are highly dynamic with alterations in chromosomal positions through translocations in certain mutants of the RNA-directed DNA methylation pathway and important copy number variations among ecotypes. Finally, variations in 5S rRNA gene sequence, chromatin organization and transcripts indicate differential usage of 5S rDNA loci in distinct ecotypes. We suggest that both the usage of existing and new 5S rDNA loci resulting from translocations may impact neighboring chromatin organization.

  10. Time of action of 4.5 S RNA in Escherichia coli translation

    DEFF Research Database (Denmark)

    Brown, S

    1989-01-01

    A new class of suppressor mutants helps to define the role of 4.5 S RNA in translation. The suppressors reduce the requirement for 4.5 S RNA by increasing the intracellular concentration of uncharged tRNA. Suppression probably occurs by prolonging the period in which translating ribosomes have...... translocated but not yet released the uncharged tRNA, indicating that this is the point at which 4.5 S RNA enters translation. The release of 4.5 S RNA from polysomes is affected by antibiotics that inhibit protein synthesis. The antibiotic-sensitivity of this release indicates that 4.5 S RNA exits...... the ribosome following translocation and prior to release of protein synthesis elongation factor G. These results indicate that 4.5 S RNA acts immediately after ribosomal translocation. A model is proposed in which 4.5 S RNA stabilizes the post-translocation state by replacing 23 S ribosomal RNA as a binding...

  11. The importance of ribosome production, and the 5S RNP-MDM2 pathway, in health and disease.

    Science.gov (United States)

    Pelava, Andria; Schneider, Claudia; Watkins, Nicholas J

    2016-08-15

    Ribosomes are abundant, large RNA-protein complexes that are the source of all protein synthesis in the cell. The production of ribosomes is an extremely energetically expensive cellular process that has long been linked to human health and disease. More recently, it has been shown that ribosome biogenesis is intimately linked to multiple cellular signalling pathways and that defects in ribosome production can lead to a wide variety of human diseases. Furthermore, changes in ribosome production in response to nutrient levels in the diet lead to metabolic re-programming of the liver. Reduced or abnormal ribosome production in response to cellular stress or mutations in genes encoding factors critical for ribosome biogenesis causes the activation of the tumour suppressor p53, which leads to re-programming of cellular transcription. The ribosomal assembly intermediate 5S RNP (ribonucleoprotein particle), containing RPL5, RPL11 and the 5S rRNA, accumulates when ribosome biogenesis is blocked. The excess 5S RNP binds to murine double minute 2 (MDM2), the main p53-suppressor in the cell, inhibiting its function and leading to p53 activation. Here, we discuss the involvement of ribosome biogenesis in the homoeostasis of p53 in the cell and in human health and disease. © 2016 The Author(s).

  12. The complete structure of the large subunit of the mammalian mitochondrial ribosome.

    Science.gov (United States)

    Greber, Basil J; Boehringer, Daniel; Leibundgut, Marc; Bieri, Philipp; Leitner, Alexander; Schmitz, Nikolaus; Aebersold, Ruedi; Ban, Nenad

    2014-11-13

    Mitochondrial ribosomes (mitoribosomes) are extensively modified ribosomes of bacterial descent specialized for the synthesis and insertion of membrane proteins that are critical for energy conversion and ATP production inside mitochondria. Mammalian mitoribosomes, which comprise 39S and 28S subunits, have diverged markedly from the bacterial ribosomes from which they are derived, rendering them unique compared to bacterial, eukaryotic cytosolic and fungal mitochondrial ribosomes. We have previously determined at 4.9 Å resolution the architecture of the porcine (Sus scrofa) 39S subunit, which is highly homologous to the human mitoribosomal large subunit. Here we present the complete atomic structure of the porcine 39S large mitoribosomal subunit determined in the context of a stalled translating mitoribosome at 3.4 Å resolution by cryo-electron microscopy and chemical crosslinking/mass spectrometry. The structure reveals the locations and the detailed folds of 50 mitoribosomal proteins, shows the highly conserved mitoribosomal peptidyl transferase active site in complex with its substrate transfer RNAs, and defines the path of the nascent chain in mammalian mitoribosomes along their idiosyncratic exit tunnel. Furthermore, we present evidence that a mitochondrial tRNA has become an integral component of the central protuberance of the 39S subunit where it architecturally substitutes for the absence of the 5S ribosomal RNA, a ubiquitous component of all cytoplasmic ribosomes.

  13. Quantitative miRNA expression analysis: comparing microarrays with next-generation sequencing

    DEFF Research Database (Denmark)

    Willenbrock, Hanni; Salomon, Jesper; Søkilde, Rolf

    2009-01-01

    Recently, next-generation sequencing has been introduced as a promising, new platform for assessing the copy number of transcripts, while the existing microarray technology is considered less reliable for absolute, quantitative expression measurements. Nonetheless, so far, results from the two...... technologies have only been compared based on biological data, leading to the conclusion that, although they are somewhat correlated, expression values differ significantly. Here, we use synthetic RNA samples, resembling human microRNA samples, to find that microarray expression measures actually correlate...... better with sample RNA content than expression measures obtained from sequencing data. In addition, microarrays appear highly sensitive and perform equivalently to next-generation sequencing in terms of reproducibility and relative ratio quantification....

  14. Quantitative analysis of ribosome–mRNA complexes at different translation stages

    Science.gov (United States)

    Shirokikh, Nikolay E.; Alkalaeva, Elena Z.; Vassilenko, Konstantin S.; Afonina, Zhanna A.; Alekhina, Olga M.; Kisselev, Lev L.; Spirin, Alexander S.

    2010-01-01

    Inhibition of primer extension by ribosome–mRNA complexes (toeprinting) is a proven and powerful technique for studying mechanisms of mRNA translation. Here we have assayed an advanced toeprinting approach that employs fluorescently labeled DNA primers, followed by capillary electrophoresis utilizing standard instruments for sequencing and fragment analysis. We demonstrate that this improved technique is not merely fast and cost-effective, but also brings the primer extension inhibition method up to the next level. The electrophoretic pattern of the primer extension reaction can be characterized with a precision unattainable by the common toeprint analysis utilizing radioactive isotopes. This method allows us to detect and quantify stable ribosomal complexes at all stages of translation, including initiation, elongation and termination, generated during the complete translation process in both the in vitro reconstituted translation system and the cell lysate. We also point out the unique advantages of this new methodology, including the ability to assay sites of the ribosomal complex assembly on several mRNA species in the same reaction mixture. PMID:19910372

  15. Expanding the Entamoeba Universe: New Hosts Yield Novel Ribosomal Lineages.

    Science.gov (United States)

    Jacob, Alison S; Busby, Eloise J; Levy, Abigail D; Komm, Natasha; Clark, C Graham

    2016-01-01

    Removing the requirement for cell culture has led to a substantial increase in the number of lineages of Entamoeba recognized as distinct. Surveying the range of potential host species for this parasite genus has barely been started and it is clear that additional sampling of the same host in different locations often identifies additional diversity. In this study, using small subunit ribosomal RNA gene sequencing, we identify four new lineages of Entamoeba, including the first report of Entamoeba from an elephant, and extend the host range of some previously described lineages. In addition, examination of microbiome data from a number of host animals suggests that substantial Entamoeba diversity remains to be uncovered. © 2015 The Author(s) Journal of Eukaryotic Microbiology © 2015 International Society of Protistologists.

  16. Characterisation of the human uterine microbiome in non-pregnant women through deep sequencing of the V1-2 region of the 16S rRNA gene

    Directory of Open Access Journals (Sweden)

    Hans Verstraelen

    2016-01-01

    Full Text Available Background. It is widely assumed that the uterine cavity in non-pregnant women is physiologically sterile, also as a premise to the long-held view that human infants develop in a sterile uterine environment, though likely reflecting under-appraisal of the extent of the human bacterial metacommunity. In an exploratory study, we aimed to investigate the putative presence of a uterine microbiome in a selected series of non-pregnant women through deep sequencing of the V1-2 hypervariable region of the 16S ribosomal RNA (rRNA gene.Methods. Nineteen women with various reproductive conditions, including subfertility, scheduled for hysteroscopy and not showing uterine anomalies were recruited. Subjects were highly diverse with regard to demographic and medical history and included nulliparous and parous women. Endometrial tissue and mucus harvesting was performed by use of a transcervical device designed to obtain endometrial biopsy, while avoiding cervicovaginal contamination. Bacteria were targeted by use of a barcoded Illumina MiSeq paired-end sequencing method targeting the 16S rRNA gene V1-2 region, yielding an average of 41,194 reads per sample after quality filtering. Taxonomic annotation was pursued by comparison with sequences available through the Ribosomal Database Project and the NCBI database.Results. Out of 183 unique 16S rRNA gene amplicon sequences, 15 phylotypes were present in all samples. In some 90% of the women included, community architecture was fairly similar inasmuch B. xylanisolvens, B. thetaiotaomicron, B. fragilis and an undetermined Pelomonas taxon constituted over one third of the endometrial bacterial community. On the singular phylotype level, six women showed predominance of L. crispatus or L. iners in the presence of the Bacteroides core. Two endometrial communities were highly dissimilar, largely lacking the Bacteroides core, one dominated by L. crispatus and another consisting of a highly diverse community, including

  17. Identification of Bacterial Small RNAs by RNA Sequencing

    DEFF Research Database (Denmark)

    Gómez Lozano, María; Marvig, Rasmus Lykke; Molin, Søren

    2014-01-01

    sequencing (RNA-seq) is described that involves the preparation and analysis of three different sequencing libraries. As a signifi cant number of unique sRNAs are identifi ed in each library, the libraries can be used either alone or in combination to increase the number of sRNAs identifi ed. The approach......Small regulatory RNAs (sRNAs) in bacteria are known to modulate gene expression and control a variety of processes including metabolic reactions, stress responses, and pathogenesis in response to environmental signals. A method to identify bacterial sRNAs on a genome-wide scale based on RNA...... may be applied to identify sRNAs in any bacterium under different growth and stress conditions....

  18. Schizosaccharomyces pombe Polysome Profile Analysis and RNA Purification.

    Science.gov (United States)

    Wolf, Dieter A; Bähler, Jürg; Wise, Jo Ann

    2017-04-03

    Polysome profile analysis is widely used by investigators studying the mechanism and regulation of translation. The method described here uses high-velocity centrifugation of whole cell extracts on linear sucrose gradients to separate 40S and 60S ribosomal subunits from 80S monosomes and polysomes. Cycloheximide is included in the lysis buffer to "freeze" polysomes by blocking translation. After centrifugation, the gradient is fractionated and RNA (and/or protein) is prepared from each fraction for subsequent analysis of individual species using northern or western blots. The entire RNA population in each fraction can be analyzed by hybridization to microarrays or by high-throughput RNA sequencing, and the proteins present can be identified by mass spectrometry analysis. © 2017 Cold Spring Harbor Laboratory Press.

  19. The secondary structure of large-subunit rRNA divergent domains, a marker for protist evolution

    DEFF Research Database (Denmark)

    Lenaers, G; Nielsen, Henrik; Engberg, J

    1988-01-01

    The secondary structure of the large-subunit ribosomal RNA (24-26S rRNA) has been studied with emphasis on comparative analysis of the folding patterns of the divergent domains in the available protist sequences, that is Prorocentrum micans (dinoflagellate), Saccharomyces carlsbergensis (yeast......), Tetrahymena thermophila (ciliate), Physarum polycephalum and Dictyostelium discoideum (slime moulds), Crithidia fasciculata and Giardia lamblia (parasitic flagellates). The folding for the D3, D7a and D10 divergent domains has been refined and a consensus model for the protist 24-26S rRNA structure...

  20. The chemical structure of DNA sequence signals for RNA transcription

    Science.gov (United States)

    George, D. G.; Dayhoff, M. O.

    1982-01-01

    The proposed recognition sites for RNA transcription for E. coli NRA polymerase, bacteriophage T7 RNA polymerase, and eukaryotic RNA polymerase Pol II are evaluated in the light of the requirements for efficient recognition. It is shown that although there is good experimental evidence that specific nucleic acid sequence patterns are involved in transcriptional regulation in bacteria and bacterial viruses, among the sequences now available, only in the case of the promoters recognized by bacteriophage T7 polymerase does it seem likely that the pattern is sufficient. It is concluded that the eukaryotic pattern that is investigated is not restrictive enough to serve as a recognition site.

  1. 3' terminal diversity of MRP RNA and other human noncoding RNAs revealed by deep sequencing.

    Science.gov (United States)

    Goldfarb, Katherine C; Cech, Thomas R

    2013-09-21

    Post-transcriptional 3' end processing is a key component of RNA regulation. The abundant and essential RNA subunit of RNase MRP has been proposed to function in three distinct cellular compartments and therefore may utilize this mode of regulation. Here we employ 3' RACE coupled with high-throughput sequencing to characterize the 3' terminal sequences of human MRP RNA and other noncoding RNAs that form RNP complexes. The 3' terminal sequence of MRP RNA from HEK293T cells has a distinctive distribution of genomically encoded termini (including an assortment of U residues) with a portion of these selectively tagged by oligo(A) tails. This profile contrasts with the relatively homogenous 3' terminus of an in vitro transcribed MRP RNA control and the differing 3' terminal profiles of U3 snoRNA, RNase P RNA, and telomerase RNA (hTR). 3' RACE coupled with deep sequencing provides a valuable framework for the functional characterization of 3' terminal sequences of noncoding RNAs.

  2. Accurate RNA consensus sequencing for high-fidelity detection of transcriptional mutagenesis-induced epimutations.

    Science.gov (United States)

    Reid-Bayliss, Kate S; Loeb, Lawrence A

    2017-08-29

    Transcriptional mutagenesis (TM) due to misincorporation during RNA transcription can result in mutant RNAs, or epimutations, that generate proteins with altered properties. TM has long been hypothesized to play a role in aging, cancer, and viral and bacterial evolution. However, inadequate methodologies have limited progress in elucidating a causal association. We present a high-throughput, highly accurate RNA sequencing method to measure epimutations with single-molecule sensitivity. Accurate RNA consensus sequencing (ARC-seq) uniquely combines RNA barcoding and generation of multiple cDNA copies per RNA molecule to eliminate errors introduced during cDNA synthesis, PCR, and sequencing. The stringency of ARC-seq can be scaled to accommodate the quality of input RNAs. We apply ARC-seq to directly assess transcriptome-wide epimutations resulting from RNA polymerase mutants and oxidative stress.

  3. Characterization of 16S rRNA Processing with Pre-30S Subunit Assembly Intermediates from E. coli.

    Science.gov (United States)

    Smith, Brian A; Gupta, Neha; Denny, Kevin; Culver, Gloria M

    2018-06-08

    Ribosomal RNA (rRNA) is a major component of ribosomes and is fundamental to the process of translation. In bacteria, 16S rRNA is a component of the small ribosomal subunit and plays a critical role in mRNA decoding. rRNA maturation entails the removal of intervening spacer sequences contained within the pre-rRNA transcript by nucleolytic enzymes. Enzymatic activities involved in maturation of the 5'-end of 16S rRNA have been identified, but those involved in 3'-end maturation of 16S rRNA are more enigmatic. Here, we investigate molecular details of 16S rRNA maturation using purified in vivo-formed small subunit (SSU) assembly intermediates (pre-SSUs) from wild-type Escherichia coli that contain precursor 16S rRNA (17S rRNA). Upon incubation of pre-SSUs with E. coli S100 cell extracts or purified enzymes implicated in 16S rRNA processing, the 17S rRNA is processed into additional intermediates and mature 16S rRNA. These results illustrate that exonucleases RNase R, RNase II, PNPase, and RNase PH can process the 3'-end of pre-SSUs in vitro. However, the endonuclease YbeY did not exhibit nucleolytic activity with pre-SSUs under these conditions. Furthermore, these data demonstrate that multiple pathways facilitate 16S rRNA maturation with pre-SSUs in vitro, with the dominant pathways entailing complete processing of the 5'-end of 17S rRNA prior to 3'-end maturation or partial processing of the 5'-end with concomitant processing of the 3'-end. These results reveal the multifaceted nature of SSU biogenesis and suggest that E. coli may be able to escape inactivation of any one enzyme by using an existing complementary pathway. Copyright © 2018 Elsevier Ltd. All rights reserved.

  4. Small molecule alteration of RNA sequence in cells and animals.

    Science.gov (United States)

    Guan, Lirui; Luo, Yiling; Ja, William W; Disney, Matthew D

    2017-10-18

    RNA regulation and maintenance are critical for proper cell function. Small molecules that specifically alter RNA sequence would be exceptionally useful as probes of RNA structure and function or as potential therapeutics. Here, we demonstrate a photochemical approach for altering the trinucleotide expanded repeat causative of myotonic muscular dystrophy type 1 (DM1), r(CUG) exp . The small molecule, 2H-4-Ru, binds to r(CUG) exp and converts guanosine residues to 8-oxo-7,8-dihydroguanosine upon photochemical irradiation. We demonstrate targeted modification upon irradiation in cell culture and in Drosophila larvae provided a diet containing 2H-4-Ru. Our results highlight a general chemical biology approach for altering RNA sequence in vivo by using small molecules and photochemistry. Furthermore, these studies show that addition of 8-oxo-G lesions into RNA 3' untranslated regions does not affect its steady state levels. Copyright © 2017 Elsevier Ltd. All rights reserved.

  5. Tetrahymena thermophila acidic ribosomal protein L37 contains an archaebacterial type of C-terminus.

    Science.gov (United States)

    Hansen, T S; Andreasen, P H; Dreisig, H; Højrup, P; Nielsen, H; Engberg, J; Kristiansen, K

    1991-09-15

    We have cloned and characterized a Tetrahymena thermophila macronuclear gene (L37) encoding the acidic ribosomal protein (A-protein) L37. The gene contains a single intron located in the 3'-part of the coding region. Two major and three minor transcription start points (tsp) were mapped 39 to 63 nucleotides upstream from the translational start codon. The uppermost tsp mapped to the first T in a putative T. thermophila RNA polymerase II initiator element, TATAA. The coding region of L37 predicts a protein of 109 amino acid (aa) residues. A substantial part of the deduced aa sequence was verified by protein sequencing. The T. thermophila L37 clearly belongs to the P1-type family of eukaryotic A-proteins, but the C-terminal region has the hallmarks of archaebacterial A-proteins.

  6. What makes ribosome-mediated transcriptional attenuation sensitive to amino acid limitation?

    Directory of Open Access Journals (Sweden)

    Johan Elf

    2005-06-01

    Full Text Available Ribosome-mediated transcriptional attenuation mechanisms are commonly used to control amino acid biosynthetic operons in bacteria. The mRNA leader of such an operon contains an open reading frame with "regulatory" codons, cognate to the amino acid that is synthesized by the enzymes encoded by the operon. When the amino acid is in short supply, translation of the regulatory codons is slow, which allows transcription to continue into the structural genes of the operon. When amino acid supply is in excess, translation of regulatory codons is rapid, which leads to termination of transcription. We use a discrete master equation approach to formulate a probabilistic model for the positioning of the RNA polymerase and the ribosome in the attenuator leader sequence. The model describes how the current rate of amino acid supply compared to the demand in protein synthesis (signal determines the expression of the amino acid biosynthetic operon (response. The focus of our analysis is on the sensitivity of operon expression to a change in the amino acid supply. We show that attenuation of transcription can be hyper-sensitive for two main reasons. The first is that its response depends on the outcome of a race between two multi-step mechanisms with synchronized starts: transcription of the leader of the operon, and translation of its regulatory codons. The relative change in the probability that transcription is aborted (attenuated can therefore be much larger than the relative change in the time it takes for the ribosome to read a regulatory codon. The second is that the general usage frequencies of codons of the type used in attenuation control are small. A small percentage decrease in the rate of supply of the controlled amino acid can therefore lead to a much larger percentage decrease in the rate of reading a regulatory codon. We show that high sensitivity further requires a particular choice of regulatory codon among several synonymous codons for the

  7. Including RNA secondary structures improves accuracy and robustness in reconstruction of phylogenetic trees.

    Science.gov (United States)

    Keller, Alexander; Förster, Frank; Müller, Tobias; Dandekar, Thomas; Schultz, Jörg; Wolf, Matthias

    2010-01-15

    In several studies, secondary structures of ribosomal genes have been used to improve the quality of phylogenetic reconstructions. An extensive evaluation of the benefits of secondary structure, however, is lacking. This is the first study to counter this deficiency. We inspected the accuracy and robustness of phylogenetics with individual secondary structures by simulation experiments for artificial tree topologies with up to 18 taxa and for divergency levels in the range of typical phylogenetic studies. We chose the internal transcribed spacer 2 of the ribosomal cistron as an exemplary marker region. Simulation integrated the coevolution process of sequences with secondary structures. Additionally, the phylogenetic power of marker size duplication was investigated and compared with sequence and sequence-structure reconstruction methods. The results clearly show that accuracy and robustness of Neighbor Joining trees are largely improved by structural information in contrast to sequence only data, whereas a doubled marker size only accounts for robustness. Individual secondary structures of ribosomal RNA sequences provide a valuable gain of information content that is useful for phylogenetics. Thus, the usage of ITS2 sequence together with secondary structure for taxonomic inferences is recommended. Other reconstruction methods as maximum likelihood, bayesian inference or maximum parsimony may equally profit from secondary structure inclusion. This article was reviewed by Shamil Sunyaev, Andrea Tanzer (nominated by Frank Eisenhaber) and Eugene V. Koonin. Reviewed by Shamil Sunyaev, Andrea Tanzer (nominated by Frank Eisenhaber) and Eugene V. Koonin. For the full reviews, please go to the Reviewers' comments section.

  8. Common 5S rRNA variants are likely to be accepted in many sequence contexts

    Science.gov (United States)

    Zhang, Zhengdong; D'Souza, Lisa M.; Lee, Youn-Hyung; Fox, George E.

    2003-01-01

    Over evolutionary time RNA sequences which are successfully fixed in a population are selected from among those that satisfy the structural and chemical requirements imposed by the function of the RNA. These sequences together comprise the structure space of the RNA. In principle, a comprehensive understanding of RNA structure and function would make it possible to enumerate which specific RNA sequences belong to a particular structure space and which do not. We are using bacterial 5S rRNA as a model system to attempt to identify principles that can be used to predict which sequences do or do not belong to the 5S rRNA structure space. One promising idea is the very intuitive notion that frequently seen sequence changes in an aligned data set of naturally occurring 5S rRNAs would be widely accepted in many other 5S rRNA sequence contexts. To test this hypothesis, we first developed well-defined operational definitions for a Vibrio region of the 5S rRNA structure space and what is meant by a highly variable position. Fourteen sequence variants (10 point changes and 4 base-pair changes) were identified in this way, which, by the hypothesis, would be expected to incorporate successfully in any of the known sequences in the Vibrio region. All 14 of these changes were constructed and separately introduced into the Vibrio proteolyticus 5S rRNA sequence where they are not normally found. Each variant was evaluated for its ability to function as a valid 5S rRNA in an E. coli cellular context. It was found that 93% (13/14) of the variants tested are likely valid 5S rRNAs in this context. In addition, seven variants were constructed that, although present in the Vibrio region, did not meet the stringent criteria for a highly variable position. In this case, 86% (6/7) are likely valid. As a control we also examined seven variants that are seldom or never seen in the Vibrio region of 5S rRNA sequence space. In this case only two of seven were found to be potentially valid. The

  9. RINT-1 interacts with MSP58 within nucleoli and plays a role in ribosomal gene transcription

    International Nuclear Information System (INIS)

    Yang, Chuan-Pin; Kuo, Yu-Liang; Lee, Yi-Chao; Lee, Kuen-Haur; Chiang, Chi-Wu; Wang, Ju-Ming; Hsu, Che-Chia

    2016-01-01

    The nucleolus is the cellular site of ribosomal (r)DNA transcription and ribosome biogenesis. The 58-kDa microspherule protein (MSP58) is a nucleolar protein involved in rDNA transcription and cell proliferation. However, regulation of MSP58-mediated rDNA transcription remains unknown. Using a yeast two-hybrid system with MSP58 as bait, we isolated complementary (c)DNA encoding Rad50-interacting protein 1 (RINT-1), as a MSP58-binding protein. RINT-1 was implicated in the cell cycle checkpoint, membrane trafficking, Golgi apparatus and centrosome dynamic integrity, and telomere length control. Both in vitro and in vivo interaction assays showed that MSP58 directly interacts with RINT-1. Interestingly, microscopic studies revealed the co-localization of MSP58, RINT-1, and the upstream binding factor (UBF), a rRNA transcription factor, in the nucleolus. We showed that ectopic expression of MSP58 or RINT-1 resulted in decreased rRNA expression and rDNA promoter activity, whereas knockdown of MSP58 or RINT-1 by siRNA exerted the opposite effect. Coexpression of MSP58 and RINT-1 robustly decreased rRNA synthesis compared to overexpression of either protein alone, whereas depletion of RINT-1 from MSP58-transfected cells enhanced rRNA synthesis. We also found that MSP58, RINT-1, and the UBF were associated with the rDNA promoter using a chromatin immunoprecipitation assay. Because aberrant ribosome biogenesis contributes to neoplastic transformation, our results revealed a novel protein complex involved in the regulation of rRNA gene expression, suggesting a role for MSP58 and RINT-1 in cancer development. - Highlights: • RINT-1 is a novel MSP58-interacting protein. • RINT-1 is a nucleolar protein that suppresses ribosomal RNA gene transcription. • RINT-1 and MSP58 cooperate to suppress ribosomal RNA gene transcription. • RINT-1, MSP58, and UBF form a complex on the rDNA promoter.

  10. Evaluating hypotheses of basal animal phylogeny using complete sequences of large and small subunit rRNA

    International Nuclear Information System (INIS)

    Medina, Monica; Collins, Allen G.; Silberman, Jeffrey; Sogin, Mitchell L.

    2001-01-01

    We studied the evolutionary relationships among basal metazoan lineages by using complete large subunit (LSU) and small subunit (SSU) ribosomal RNA sequences for 23 taxa. After identifying competing hypotheses, we performed maximum likelihood searches for trees conforming to each hypothesis. Kishino-Hasegawa tests were used to determine whether the data (LSU, SSU, and combined) reject any of the competing hypotheses. We also conducted unconstrained tree searches, compared the resulting topologies, and calculated bootstrap indices. Shimodaira-Hasegawa tests were applied to determine whether the data reject any of the topologies resulting from the constrained and unconstrained tree searches. LSU, SSU, and the combined data strongly contradict two assertions pertaining to sponge phylogeny. Hexactinellid sponges are not likely to be the basal lineage of amonophyletic Porifera or the sister group to all other animals. Instead, Hexactinellida and Demospongia form a well-supported clade of siliceous sponges, Silicea. It remains unclear, on the basis of these data alone, whether the calcarean sponges are more closely related to Silicea or to nonsponge animals. The SSU and combined data reject the hypothesis that Bilateria is more closely related to Ctenophora than it is to Cnidaria, whereas LSU data alone do not refute either hypothesis. LSU and SSU data agree in supporting the monophyly of Bilateria, Cnidaria, Ctenophora, and Metazoa. LSU sequence data reveal phylogenetic structure in a data set with limited taxon sampling. Continued accumulation of LSU sequences should increase our understanding of animal phylogeny

  11. Detection of protein-protein interactions by ribosome display and protein in situ immobilisation.

    Science.gov (United States)

    He, Mingyue; Liu, Hong; Turner, Martin; Taussig, Michael J

    2009-12-31

    We describe a method for identification of protein-protein interactions by combining two cell-free protein technologies, namely ribosome display and protein in situ immobilisation. The method requires only PCR fragments as the starting material, the target proteins being made through cell-free protein synthesis, either associated with their encoding mRNA as ribosome complexes or immobilised on a solid surface. The use of ribosome complexes allows identification of interacting protein partners from their attached coding mRNA. To demonstrate the procedures, we have employed the lymphocyte signalling proteins Vav1 and Grb2 and confirmed the interaction between Grb2 and the N-terminal SH3 domain of Vav1. The method has promise for library screening of pairwise protein interactions, down to the analytical level of individual domain or motif mapping.

  12. Chromosomal organization of the ribosomal RNA genes in the genus Chironomus (Diptera, Chironomidae

    Directory of Open Access Journals (Sweden)

    Larisa Gunderina

    2015-05-01

    Full Text Available Chromosomal localization of ribosomal RNA coding genes has been studied by using FISH (fluorescence in situ hybridization in 21 species from the genus Chironomus Meigen, 1803. Analysis of the data has shown intra- and interspecific variation in number and location of 5.8S rDNA hybridization sites in 17 species from the subgenus Chironomus and 4 species from the subgenus Camptochironomus Kieffer, 1914. In the majority of studied species the location of rDNA sites coincided with the sites where active NORs (nucleolus organizer regions were found. The number of hybridization sites in karyotypes of studied chironomids varied from 1 to 6. More than half of the species possessed only one NOR (12 out of 21. Two rDNA hybridization sites were found in karyotypes of five species, three – in two species, and five and six sites – in one species each. NORs were found in all chromosomal arms of species from the subgenus Chironomus with one of them always located on arm G. On the other hand, no hybridization sites were found on arm G in four studied species from the subgenus Camptochironomus. Two species from the subgenus Chironomus – Ch. balatonicus Devai, Wuelker & Scholl, 1983 and Ch. “annularius” sensu Strenzke, 1959 – showed intraspecific variability in the number of hybridization signals. Possible mechanisms of origin of variability in number and location of rRNA genes in the karyotypes of species from the genus Chironomus are discussed.

  13. Stability of the 'L12 stalk' in ribosomes from mesophilic and (hyper)thermophilic Archaea and Bacteria.

    Science.gov (United States)

    Shcherbakov, D; Dontsova, M; Tribus, M; Garber, M; Piendl, W

    2006-01-01

    The ribosomal stalk complex, consisting of one molecule of L10 and four or six molecules of L12, is attached to 23S rRNA via protein L10. This complex forms the so-called 'L12 stalk' on the 50S ribosomal subunit. Ribosomal protein L11 binds to the same region of 23S rRNA and is located at the base of the 'L12 stalk'. The 'L12 stalk' plays a key role in the interaction of the ribosome with translation factors. In this study stalk complexes from mesophilic and (hyper)thermophilic species of the archaeal genus Methanococcus and from the Archaeon Sulfolobus solfataricus, as well as from the Bacteria Escherichia coli, Geobacillus stearothermophilus and Thermus thermophilus, were overproduced in E.coli and purified under non-denaturing conditions. Using filter-binding assays the affinities of the archaeal and bacterial complexes to their specific 23S rRNA target site were analyzed at different pH, ionic strength and temperature. Affinities of both archaeal and bacterial complexes for 23S rRNA vary by more than two orders of magnitude, correlating very well with the growth temperatures of the organisms. A cooperative effect of binding to 23S rRNA of protein L11 and the L10/L12(4) complex from mesophilic and thermophilic Archaea was shown to be temperature-dependent.

  14. Molecular cloning and sequence of the B880 holochrome gene from Rhodospirillum rubrum

    International Nuclear Information System (INIS)

    Anon.

    1986-01-01

    Restriction fragments of genomic Rhodospirillum rubrum DNA were selected according to size by electrophoresis followed by hybridization with [ 32 P]mRNA encoding the two B880 holochrome polypeptides. The fragments were cloned into Escherchia coli C600 with plasmid pBR327 as a vector. The clones were selected by colony hybridization with 32 P-holochrome-mRNA and counter selected by hybridization with Rs. rubrum ribosomal RNA, a minor contaminant of the mRNA preparation. Chimeric plasmid pRR22 was shown to contain the B880 genes by hybrid selection of B880 holochrome-mRNA. A restriction map of its 2.2-kilobase insert and the sequence of a 430 base pair fragment thereof is reported. Genes α and β are nearly contiguous, indicating that they are transcribed as a single operon. The predicted amino acid sequences coincide with the sequences of the α and β polypeptides established in other laboratories, except for additional C-terminal tails of 10 and 13 amino acid residues, respectively

  15. Targeted CRISPR disruption reveals a role for RNase MRP RNA in human preribosomal RNA processing.

    Science.gov (United States)

    Goldfarb, Katherine C; Cech, Thomas R

    2017-01-01

    MRP RNA is an abundant, essential noncoding RNA whose functions have been proposed in yeast but are incompletely understood in humans. Mutations in the genomic locus for MRP RNA cause pleiotropic human diseases, including cartilage hair hypoplasia (CHH). Here we applied CRISPR-Cas9 genome editing to disrupt the endogenous human MRP RNA locus, thereby attaining what has eluded RNAi and RNase H experiments: elimination of MRP RNA in the majority of cells. The resulting accumulation of ribosomal RNA (rRNA) precursor-analyzed by RNA fluorescent in situ hybridization (FISH), Northern blots, and RNA sequencing-implicates MRP RNA in pre-rRNA processing. Amelioration of pre-rRNA imbalance is achieved through rescue of MRP RNA levels by ectopic expression. Furthermore, affinity-purified MRP ribonucleoprotein (RNP) from HeLa cells cleaves the human pre-rRNA in vitro at at least one site used in cells, while RNP isolated from cells with CRISPR-edited MRP loci loses this activity, and ectopic MRP RNA expression restores cleavage activity. Thus, a role for RNase MRP in human pre-rRNA processing is established. As demonstrated here, targeted CRISPR disruption is a valuable tool for functional studies of essential noncoding RNAs that are resistant to RNAi and RNase H-based degradation. © 2017 Goldfarb and Cech; Published by Cold Spring Harbor Laboratory Press.

  16. Finding the most significant common sequence and structure motifs in a set of RNA sequences

    DEFF Research Database (Denmark)

    Gorodkin, Jan; Heyer, L.J.; Stormo, G.D.

    1997-01-01

    We present a computational scheme to locally align a collection of RNA sequences using sequence and structure constraints, In addition, the method searches for the resulting alignments with the most significant common motifs, among all possible collections, The first part utilizes a simplified...

  17. Evaluating Methods for Isolating Total RNA and Predicting the Success of Sequencing Phylogenetically Diverse Plant Transcriptomes

    Science.gov (United States)

    Bruskiewich, Richard; Burris, Jason N.; Carrigan, Charlotte T.; Chase, Mark W.; Clarke, Neil D.; Covshoff, Sarah; dePamphilis, Claude W.; Edger, Patrick P.; Goh, Falicia; Graham, Sean; Greiner, Stephan; Hibberd, Julian M.; Jordon-Thaden, Ingrid; Kutchan, Toni M.; Leebens-Mack, James; Melkonian, Michael; Miles, Nicholas; Myburg, Henrietta; Patterson, Jordan; Pires, J. Chris; Ralph, Paula; Rolf, Megan; Sage, Rowan F.; Soltis, Douglas; Soltis, Pamela; Stevenson, Dennis; Stewart, C. Neal; Surek, Barbara; Thomsen, Christina J. M.; Villarreal, Juan Carlos; Wu, Xiaolei; Zhang, Yong; Deyholos, Michael K.; Wong, Gane Ka-Shu

    2012-01-01

    Next-generation sequencing plays a central role in the characterization and quantification of transcriptomes. Although numerous metrics are purported to quantify the quality of RNA, there have been no large-scale empirical evaluations of the major determinants of sequencing success. We used a combination of existing and newly developed methods to isolate total RNA from 1115 samples from 695 plant species in 324 families, which represents >900 million years of phylogenetic diversity from green algae through flowering plants, including many plants of economic importance. We then sequenced 629 of these samples on Illumina GAIIx and HiSeq platforms and performed a large comparative analysis to identify predictors of RNA quality and the diversity of putative genes (scaffolds) expressed within samples. Tissue types (e.g., leaf vs. flower) varied in RNA quality, sequencing depth and the number of scaffolds. Tissue age also influenced RNA quality but not the number of scaffolds ≥1000 bp. Overall, 36% of the variation in the number of scaffolds was explained by metrics of RNA integrity (RIN score), RNA purity (OD 260/230), sequencing platform (GAIIx vs HiSeq) and the amount of total RNA used for sequencing. However, our results show that the most commonly used measures of RNA quality (e.g., RIN) are weak predictors of the number of scaffolds because Illumina sequencing is robust to variation in RNA quality. These results provide novel insight into the methods that are most important in isolating high quality RNA for sequencing and assembling plant transcriptomes. The methods and recommendations provided here could increase the efficiency and decrease the cost of RNA sequencing for individual labs and genome centers. PMID:23185583

  18. Highly divergent 16S rRNA sequences in ribosomal operons of Scytonema hyalinum (Cyanobacteria)

    Czech Academy of Sciences Publication Activity Database

    Johansen, J. R.; Mareš, Jan; Pietrasiak, N.; Bohunická, Markéta; Zima, Jan; Štenclová, L.; Hauer, Tomáš

    2017-01-01

    Roč. 12, č. 10 (2017), č. článku e0186393. E-ISSN 1932-6203 R&D Projects: GA ČR(CZ) GA15-11912S Institutional support: RVO:67985939 Keywords : rRNA operon * heterogenita * Scytonema hyalinum Subject RIV: EF - Botanics OBOR OECD: Plant sciences, botany Impact factor: 2.806, year: 2016

  19. The Complete Structure of the Mycobacterium smegmatis 70S Ribosome

    Directory of Open Access Journals (Sweden)

    Jendrik Hentschel

    2017-07-01

    Full Text Available The ribosome carries out the synthesis of proteins in every living cell. It consequently represents a frontline target in anti-microbial therapy. Tuberculosis ranks among the leading causes of death worldwide, due in large part to the combination of difficult-to-treat latency and antibiotic resistance. Here, we present the 3.3-Å cryo-EM structure of the 70S ribosome of Mycobacterium smegmatis, a close relative to the human pathogen Mycobacterium tuberculosis. The structure reveals two additional ribosomal proteins and localizes them to the vicinity of drug-target sites in both the catalytic center and the decoding site of the ribosome. Furthermore, we visualized actinobacterium-specific rRNA and protein expansions that extensively remodel the ribosomal surface with implications for polysome organization. Our results provide a foundation for understanding the idiosyncrasies of mycobacterial translation and reveal atomic details of the structure that will facilitate the design of anti-tubercular therapeutics.

  20. The Complete Structure of the Mycobacterium smegmatis 70S Ribosome.

    Science.gov (United States)

    Hentschel, Jendrik; Burnside, Chloe; Mignot, Ingrid; Leibundgut, Marc; Boehringer, Daniel; Ban, Nenad

    2017-07-05

    The ribosome carries out the synthesis of proteins in every living cell. It consequently represents a frontline target in anti-microbial therapy. Tuberculosis ranks among the leading causes of death worldwide, due in large part to the combination of difficult-to-treat latency and antibiotic resistance. Here, we present the 3.3-Å cryo-EM structure of the 70S ribosome of Mycobacterium smegmatis, a close relative to the human pathogen Mycobacterium tuberculosis. The structure reveals two additional ribosomal proteins and localizes them to the vicinity of drug-target sites in both the catalytic center and the decoding site of the ribosome. Furthermore, we visualized actinobacterium-specific rRNA and protein expansions that extensively remodel the ribosomal surface with implications for polysome organization. Our results provide a foundation for understanding the idiosyncrasies of mycobacterial translation and reveal atomic details of the structure that will facilitate the design of anti-tubercular therapeutics. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

  1. A single mutation in the 15S rRNA gene confers nonsense suppressor activity and interacts with mRF1 the release factor in yeast mitochondria

    Directory of Open Access Journals (Sweden)

    Ali Gargouri

    2015-08-01

    Full Text Available We have determined the nucleotide sequence of the mim3-1 mitochondrial ribosomal suppressor, acting on ochre mitochondrial mutations and one frameshift mutation in Saccharomyces cerevisiae. The 15s rRNA suppressor gene contains a G633 to C transversion. Yeast mitochondrial G633 corresponds to G517 of the E.coli 15S rRNA, which is occupied by an invariant G in all known small rRNA sequences. Interestingly, this mutation has occurred at the same position as the known MSU1 mitochondrial suppressor which changes G633 to A. The suppressor mutation lies in a highly conserved region of the rRNA, known in E.coli as the 530-loop, interacting with the S4, S5 and S12 ribosomal proteins. We also show an interesting interaction between the mitochondrial mim3-1 and the nuclear nam3-1 suppressors, both of which have the same action spectrum on mitochondrial mutations: nam3-1 abolishes the suppressor effect when present with mim3-1 in the same haploid cell. We discuss these results in the light of the nature of Nam3, identified by [1] as the yeast mitochondrial translation release factor. A hypothetical mechanism of suppression by "ribosome shifting" is also discussed in view of the nature of mutations suppressed and not suppressed.

  2. The architecture of mammalian ribosomal protein promoters

    Directory of Open Access Journals (Sweden)

    Perry Robert P

    2005-02-01

    Full Text Available Abstract Background Mammalian ribosomes contain 79 different proteins encoded by widely scattered single copy genes. Coordinate expression of these genes at transcriptional and post-transcriptional levels is required to ensure a roughly equimolar accumulation of ribosomal proteins. To date, detailed studies of only a very few ribosomal protein (rp promoters have been made. To elucidate the general features of rp promoter architecture, I made a detailed sequence comparison of the promoter regions of the entire set of orthologous human and mouse rp genes. Results A striking evolutionarily conserved feature of most rp genes is the separation by an intron of the sequences involved in transcriptional and translational regulation from the sequences with protein encoding function. Another conserved feature is the polypyrimidine initiator, which conforms to the consensus (Y2C+1TY(T2(Y3. At least 60 % of the rp promoters contain a largely conserved TATA box or A/T-rich motif, which should theoretically have TBP-binding capability. A remarkably high proportion of the promoters contain conserved binding sites for transcription factors that were previously implicated in rp gene expression, namely upstream GABP and Sp1 sites and downstream YY1 sites. Over 80 % of human and mouse rp genes contain a transposable element residue within 900 bp of 5' flanking sequence; very little sequence identity between human and mouse orthologues was evident more than 200 bp upstream of the transcriptional start point. Conclusions This analysis has provided some valuable insights into the general architecture of mammalian rp promoters and has identified parameters that might coordinately regulate the transcriptional activity of certain subsets of rp genes.

  3. Nucleotide sequence of tomato ringspot virus RNA-2.

    Science.gov (United States)

    Rott, M E; Tremaine, J H; Rochon, D M

    1991-07-01

    The sequence of tomato ringspot virus (TomRSV) RNA-2 has been determined. It is 7273 nucleotides in length excluding the 3' poly(A) tail and contains a single long open reading frame (ORF) of 5646 nucleotides in the positive sense beginning at position 78 and terminating at position 5723. A second in-frame AUG at position 441 is in a more favourable context for initiation of translation and may act as a site for initiation of translation. The TomRSV RNA-2 3' noncoding region is 1550 nucleotides in length. The coat protein is located in the C-terminal region of the large polypeptide and shows significant but limited amino acid sequence similarity to the putative coat proteins of the nepoviruses tomato black ring (TBRV), Hungarian grapevine chrome mosaic (GCMV) and grapevine fanleaf (GFLV). Comparisons of the coding and non-coding regions of TomRSV RNA-2 and the RNA components of TBRV, GCMV, GFLV and the comovirus cowpea mosaic virus revealed significant similarity for over 300 amino acids between the coding region immediately to the N-terminal side of the putative coat proteins of TomRSV and GFLV; very little similarity could be detected among the non-coding regions of TomRSV and any of these viruses.

  4. The Structure of the RNA m5C Methyltransferase YebU from Escherichia coli Reveals a C-terminal RNA-recruiting PUA Domain

    DEFF Research Database (Denmark)

    Hallberg, B. Martin; Ericsson, Ulrika B.; Johnson, Kenneth A

    2006-01-01

    potential that differ from other RNA-MTase structures, suggesting that YebU interacts with its RNA target in a different manner. Docking of YebU onto the 30 S subunit indicates that the PUA and MTase domains make several contacts with 16 S rRNA as well as with the ribosomal protein S12. The ribosomal...... protein interactions would explain why the assembled 30 S subunit, and not naked 16 S rRNA, is the preferred substrate for YebU....... by X-ray crystallography, and we present a molecular model for how YebU specifically recognizes, binds and methylates its ribosomal substrate. The YebU protein has an N-terminal SAM-binding catalytic domain with structural similarity to the equivalent domains in several other m(5)C RNA MTases including...

  5. Intergenic and repeat transcription in human, chimpanzee and macaque brains measured by RNA-Seq.

    Directory of Open Access Journals (Sweden)

    Augix Guohua Xu

    Full Text Available Transcription is the first step connecting genetic information with an organism's phenotype. While expression of annotated genes in the human brain has been characterized extensively, our knowledge about the scope and the conservation of transcripts located outside of the known genes' boundaries is limited. Here, we use high-throughput transcriptome sequencing (RNA-Seq to characterize the total non-ribosomal transcriptome of human, chimpanzee, and rhesus macaque brain. In all species, only 20-28% of non-ribosomal transcripts correspond to annotated exons and 20-23% to introns. By contrast, transcripts originating within intronic and intergenic repetitive sequences constitute 40-48% of the total brain transcriptome. Notably, some repeat families show elevated transcription. In non-repetitive intergenic regions, we identify and characterize 1,093 distinct regions highly expressed in the human brain. These regions are conserved at the RNA expression level across primates studied and at the DNA sequence level across mammals. A large proportion of these transcripts (20% represents 3'UTR extensions of known genes and may play roles in alternative microRNA-directed regulation. Finally, we show that while transcriptome divergence between species increases with evolutionary time, intergenic transcripts show more expression differences among species and exons show less. Our results show that many yet uncharacterized evolutionary conserved transcripts exist in the human brain. Some of these transcripts may play roles in transcriptional regulation and contribute to evolution of human-specific phenotypic traits.

  6. CRM1 and its ribosome export adaptor NMD3 localize to the nucleolus and affect rRNA synthesis.

    Science.gov (United States)

    Bai, Baoyan; Moore, Henna M; Laiho, Marikki

    2013-01-01

    CRM1 is an export factor that together with its adaptor NMD3 transports numerous cargo molecules from the nucleus to cytoplasm through the nuclear pore. Previous studies have suggested that CRM1 and NMD3 are detected in the nucleolus. However, their localization with subnucleolar domains or participation in the activities of the nucleolus are unclear. We demonstrate here biochemically and using imaging analyses that CRM1 and NMD3 co-localize with nucleolar marker proteins in the nucleolus. In particular, their nucleolar localization is markedly increased by inhibition of RNA polymerase I (Pol I) transcription by actinomycin D or by silencing Pol I catalytic subunit, RPA194. We show that CRM1 nucleolar localization is dependent on its activity and the expression of NMD3, whereas NMD3 nucleolar localization is independent of CRM1. This suggests that NMD3 provides nucleolar tethering of CRM1. While inhibition of CRM1 by leptomycin B inhibited processing of 28S ribosomal (r) RNA, depletion of NMD3 did not, suggesting that their effects on 28S rRNA processing are distinct. Markedly, depletion of NMD3 and inhibition of CRM1 reduced the rate of pre-47S rRNA synthesis. However, their inactivation did not lead to nucleolar disintegration, a hallmark of Pol I transcription stress, suggesting that they do not directly regulate transcription. These results indicate that CRM1 and NMD3 have complex functions in pathways that couple rRNA synthetic and processing engines and that the rRNA synthesis rate may be adjusted according to proficiency in rRNA processing and export.

  7. CPSS: a computational platform for the analysis of small RNA deep sequencing data.

    Science.gov (United States)

    Zhang, Yuanwei; Xu, Bo; Yang, Yifan; Ban, Rongjun; Zhang, Huan; Jiang, Xiaohua; Cooke, Howard J; Xue, Yu; Shi, Qinghua

    2012-07-15

    Next generation sequencing (NGS) techniques have been widely used to document the small ribonucleic acids (RNAs) implicated in a variety of biological, physiological and pathological processes. An integrated computational tool is needed for handling and analysing the enormous datasets from small RNA deep sequencing approach. Herein, we present a novel web server, CPSS (a computational platform for the analysis of small RNA deep sequencing data), designed to completely annotate and functionally analyse microRNAs (miRNAs) from NGS data on one platform with a single data submission. Small RNA NGS data can be submitted to this server with analysis results being returned in two parts: (i) annotation analysis, which provides the most comprehensive analysis for small RNA transcriptome, including length distribution and genome mapping of sequencing reads, small RNA quantification, prediction of novel miRNAs, identification of differentially expressed miRNAs, piwi-interacting RNAs and other non-coding small RNAs between paired samples and detection of miRNA editing and modifications and (ii) functional analysis, including prediction of miRNA targeted genes by multiple tools, enrichment of gene ontology terms, signalling pathway involvement and protein-protein interaction analysis for the predicted genes. CPSS, a ready-to-use web server that integrates most functions of currently available bioinformatics tools, provides all the information wanted by the majority of users from small RNA deep sequencing datasets. CPSS is implemented in PHP/PERL+MySQL+R and can be freely accessed at http://mcg.ustc.edu.cn/db/cpss/index.html or http://mcg.ustc.edu.cn/sdap1/cpss/index.html.

  8. Deep sequencing of subseafloor eukaryotic rRNA reveals active Fungi across marine subsurface provinces.

    Directory of Open Access Journals (Sweden)

    William Orsi

    Full Text Available The deep marine subsurface is a vast habitat for microbial life where cells may live on geologic timescales. Because DNA in sediments may be preserved on long timescales, ribosomal RNA (rRNA is suggested to be a proxy for the active fraction of a microbial community in the subsurface. During an investigation of eukaryotic 18S rRNA by amplicon pyrosequencing, unique profiles of Fungi were found across a range of marine subsurface provinces including ridge flanks, continental margins, and abyssal plains. Subseafloor fungal populations exhibit statistically significant correlations with total organic carbon (TOC, nitrate, sulfide, and dissolved inorganic carbon (DIC. These correlations are supported by terminal restriction length polymorphism (TRFLP analyses of fungal rRNA. Geochemical correlations with fungal pyrosequencing and TRFLP data from this geographically broad sample set suggests environmental selection of active Fungi in the marine subsurface. Within the same dataset, ancient rRNA signatures were recovered from plants and diatoms in marine sediments ranging from 0.03 to 2.7 million years old, suggesting that rRNA from some eukaryotic taxa may be much more stable than previously considered in the marine subsurface.

  9. Unusual loop-sequence flexibility of the proximal RNA replication element in EMCV.

    Directory of Open Access Journals (Sweden)

    Jan Zoll

    Full Text Available Picornaviruses contain stable RNA structures at the 5' and 3' ends of the RNA genome, OriL and OriR involved in viral RNA replication. The OriL RNA element found at the 5' end of the enterovirus genome folds into a cloverleaf-like configuration. In vivo SELEX experiments revealed that functioning of the poliovirus cloverleaf depends on a specific structure in this RNA element. Little is known about the OriL of cardioviruses. Here, we investigated structural aspects and requirements of the apical loop of proximal stem-loop SL-A of mengovirus, a strain of EMCV. Using NMR spectroscopy, we showed that the mengovirus SL-A apical loop consists of an octaloop. In vivo SELEX experiments demonstrated that a large number of random sequences are tolerated in the apical octaloop that support virus replication. Mutants in which the SL-A loop size and the length of the upper part of the stem were varied showed that both stem-length and stability of the octaloop are important determinants for viral RNA replication and virus reproduction. Together, these data show that stem-loop A plays an important role in virus replication. The high degree of sequence flexibility and the lack of selective pressure on the octaloop argue against a role in sequence specific RNA-protein or RNA-RNA interactions in which octaloop nucleotides are involved.

  10. Multicolor microRNA FISH effectively differentiates tumor types

    Science.gov (United States)

    Renwick, Neil; Cekan, Pavol; Masry, Paul A.; McGeary, Sean E.; Miller, Jason B.; Hafner, Markus; Li, Zhen; Mihailovic, Aleksandra; Morozov, Pavel; Brown, Miguel; Gogakos, Tasos; Mobin, Mehrpouya B.; Snorrason, Einar L.; Feilotter, Harriet E.; Zhang, Xiao; Perlis, Clifford S.; Wu, Hong; Suárez-Fariñas, Mayte; Feng, Huichen; Shuda, Masahiro; Moore, Patrick S.; Tron, Victor A.; Chang, Yuan; Tuschl, Thomas

    2013-01-01

    MicroRNAs (miRNAs) are excellent tumor biomarkers because of their cell-type specificity and abundance. However, many miRNA detection methods, such as real-time PCR, obliterate valuable visuospatial information in tissue samples. To enable miRNA visualization in formalin-fixed paraffin-embedded (FFPE) tissues, we developed multicolor miRNA FISH. As a proof of concept, we used this method to differentiate two skin tumors, basal cell carcinoma (BCC) and Merkel cell carcinoma (MCC), with overlapping histologic features but distinct cellular origins. Using sequencing-based miRNA profiling and discriminant analysis, we identified the tumor-specific miRNAs miR-205 and miR-375 in BCC and MCC, respectively. We addressed three major shortcomings in miRNA FISH, identifying optimal conditions for miRNA fixation and ribosomal RNA (rRNA) retention using model compounds and high-pressure liquid chromatography (HPLC) analyses, enhancing signal amplification and detection by increasing probe-hapten linker lengths, and improving probe specificity using shortened probes with minimal rRNA sequence complementarity. We validated our method on 4 BCC and 12 MCC tumors. Amplified miR-205 and miR-375 signals were normalized against directly detectable reference rRNA signals. Tumors were classified using predefined cutoff values, and all were correctly identified in blinded analysis. Our study establishes a reliable miRNA FISH technique for parallel visualization of differentially expressed miRNAs in FFPE tumor tissues. PMID:23728175

  11. Plastid-Nuclear Interaction and Accelerated Coevolution in Plastid Ribosomal Genes in Geraniaceae.

    Science.gov (United States)

    Weng, Mao-Lun; Ruhlman, Tracey A; Jansen, Robert K

    2016-06-27

    Plastids and mitochondria have many protein complexes that include subunits encoded by organelle and nuclear genomes. In animal cells, compensatory evolution between mitochondrial and nuclear-encoded subunits was identified and the high mitochondrial mutation rates were hypothesized to drive compensatory evolution in nuclear genomes. In plant cells, compensatory evolution between plastid and nucleus has rarely been investigated in a phylogenetic framework. To investigate plastid-nuclear coevolution, we focused on plastid ribosomal protein genes that are encoded by plastid and nuclear genomes from 27 Geraniales species. Substitution rates were compared for five sets of genes representing plastid- and nuclear-encoded ribosomal subunit proteins targeted to the cytosol or the plastid as well as nonribosomal protein controls. We found that nonsynonymous substitution rates (dN) and the ratios of nonsynonymous to synonymous substitution rates (ω) were accelerated in both plastid- (CpRP) and nuclear-encoded subunits (NuCpRP) of the plastid ribosome relative to control sequences. Our analyses revealed strong signals of cytonuclear coevolution between plastid- and nuclear-encoded subunits, in which nonsynonymous substitutions in CpRP and NuCpRP tend to occur along the same branches in the Geraniaceae phylogeny. This coevolution pattern cannot be explained by physical interaction between amino acid residues. The forces driving accelerated coevolution varied with cellular compartment of the sequence. Increased ω in CpRP was mainly due to intensified positive selection whereas increased ω in NuCpRP was caused by relaxed purifying selection. In addition, the many indels identified in plastid rRNA genes in Geraniaceae may have contributed to changes in plastid subunits. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  12. Cryo-EM structure of Hepatitis C virus IRES bound to the human ribosome at 3.9-Å resolution.

    Science.gov (United States)

    Quade, Nick; Boehringer, Daniel; Leibundgut, Marc; van den Heuvel, Joop; Ban, Nenad

    2015-07-08

    Hepatitis C virus (HCV), a widespread human pathogen, is dependent on a highly structured 5'-untranslated region of its mRNA, referred to as internal ribosome entry site (IRES), for the translation of all of its proteins. The HCV IRES initiates translation by directly binding to the small ribosomal subunit (40S), circumventing the need for many eukaryotic translation initiation factors required for mRNA scanning. Here we present the cryo-EM structure of the human 40S ribosomal subunit in complex with the HCV IRES at 3.9 Å resolution, determined by focused refinement of an 80S ribosome-HCV IRES complex. The structure reveals the molecular details of the interactions between the IRES and the 40S, showing that expansion segment 7 (ES7) of the 18S rRNA acts as a central anchor point for the HCV IRES. The structural data rationalizes previous biochemical and genetic evidence regarding the initiation mechanism of the HCV and other related IRESs.

  13. Total RNA Sequencing Analysis of DCIS Progressing to Invasive Breast Cancer

    Science.gov (United States)

    2017-09-01

    AWARD NUMBER: W81XWH-14-1-0080 TITLE: Total RNA Sequencing Analysis of DCIS Progressing to Invasive Breast Cancer . PRINCIPAL INVESTIGATOR...TITLE AND SUBTITLE Total RNA Sequencing Analysis of DCIS Progressing to Invasive Breast Cancer . 5a. CONTRACT NUMBER 5b. GRANT NUMBER GRANT11489...institutional, NIH-funded study of genetic and epigenetic alterations of pre-invasive DCIS that did or did not progress to invasive breast cancer , with an

  14. Binding of Signal Recognition Particle Gives Ribosome/Nascent Chain Complexes a Competitive Advantage in Endoplasmic Reticulum Membrane Interaction

    Science.gov (United States)

    Neuhof, Andrea; Rolls, Melissa M.; Jungnickel, Berit; Kalies, Kai-Uwe; Rapoport, Tom A.

    1998-01-01

    Most secretory and membrane proteins are sorted by signal sequences to the endoplasmic reticulum (ER) membrane early during their synthesis. Targeting of the ribosome-nascent chain complex (RNC) involves the binding of the signal sequence to the signal recognition particle (SRP), followed by an interaction of ribosome-bound SRP with the SRP receptor. However, ribosomes can also independently bind to the ER translocation channel formed by the Sec61p complex. To explain the specificity of membrane targeting, it has therefore been proposed that nascent polypeptide-associated complex functions as a cytosolic inhibitor of signal sequence- and SRP-independent ribosome binding to the ER membrane. We report here that SRP-independent binding of RNCs to the ER membrane can occur in the presence of all cytosolic factors, including nascent polypeptide-associated complex. Nontranslating ribosomes competitively inhibit SRP-independent membrane binding of RNCs but have no effect when SRP is bound to the RNCs. The protective effect of SRP against ribosome competition depends on a functional signal sequence in the nascent chain and is also observed with reconstituted proteoliposomes containing only the Sec61p complex and the SRP receptor. We conclude that cytosolic factors do not prevent the membrane binding of ribosomes. Instead, specific ribosome targeting to the Sec61p complex is provided by the binding of SRP to RNCs, followed by an interaction with the SRP receptor, which gives RNC–SRP complexes a selective advantage in membrane targeting over nontranslating ribosomes. PMID:9436994

  15. Analysis of clustered point mutations in the human ribosomal RNA gene promoter by transient expression in vivo

    International Nuclear Information System (INIS)

    Jones, M.H.; Learned, R.M.; Tjian, R.

    1988-01-01

    The authors have mapped the cis regulatory elements required in vivo for initiation at the human rRNA promoter by RNA polymerase I. Transient expression in COS-7 cells was used to evaluate the transcription phenotype of clustered base substitution mutations in the human rRNA promoter. The promoter consists of two major elements: a large upstream region, composed of several domains, that lies between nucleotides -234 and -107 relative to the transcription initiation site and affects transcription up to 100-fold and a core element that lies between nucleotides -45 and +20 and affects transcription up to 1000-fold. The upstream regions is able to retain partial function when positioned within 100-160 nucleotides of the transcription initiation site, but it cannot stimulate transcription from distances of ≥ 600 nucleotides. In addition, they demonstrate, using mouse-human hybrid rRNA promoters, that the sequences responsible for human species-specific transcription in vivo appear to reside in both the core and upstream elements, and sequences from the mouse rRNA promoter cannot be substituted for them

  16. Complete sequence of RNA1 of grapevine Anatolian ringspot virus.

    Science.gov (United States)

    Digiaro, Michele; Nahdi, Sabrine; Elbeaino, Toufic

    2012-10-01

    The nucleotide sequence of RNA1 of grapevine Anatolian ringspot virus (GARSV), a nepovirus of subgroup B, was determined from cDNA clones. It is 7,288 nucleotides in length excluding the 3' terminal poly(A) tail and contains a large open reading frame (ORF), extending from nucleotides 272 to 7001, encoding a polypeptide of 2,243 amino acids with a predicted molecular mass of 250 kDa. The primary structure of the polyprotein, compared with that of other viral polyproteins, revealed the presence of all the characteristic domains of members of the order Picornavirales, i.e., the NTP-binding protein (1B(Hel)), the viral genome-linked protein (1C(VPg)), the proteinase (1D(Prot)), the RNA-dependent RNA polymerase (1E(Pol)), and of the protease cofactor (1A(Pro-cof)) shared by members of the subfamily Comovirinae within the family Secoviridae. The cleavage sites predicted within the polyprotein were found to be in agreement with those previously reported for nepoviruses of subgroup B, processing from 1A to 1E proteins of 67, 64, 3, 23 and 92 kDa, respectively. The RNA1-encoded polyprotein (p1) shared the highest amino acid sequence identity (66 %) with tomato black ring virus (TBRV) and beet ringspot virus (BRSV). The 5'- and 3'-noncoding regions (NCRs) of GARSV-RNA1 shared 89 % and 95 % nucleotide sequence identity respectively with the corresponding regions in RNA2. Phylogenetic analysis confirmed the close relationship of GARSV to members of subgroup B of the genus Nepovirus.

  17. High-Throughput Mapping of Single-Neuron Projections by Sequencing of Barcoded RNA.

    Science.gov (United States)

    Kebschull, Justus M; Garcia da Silva, Pedro; Reid, Ashlan P; Peikon, Ian D; Albeanu, Dinu F; Zador, Anthony M

    2016-09-07

    Neurons transmit information to distant brain regions via long-range axonal projections. In the mouse, area-to-area connections have only been systematically mapped using bulk labeling techniques, which obscure the diverse projections of intermingled single neurons. Here we describe MAPseq (Multiplexed Analysis of Projections by Sequencing), a technique that can map the projections of thousands or even millions of single neurons by labeling large sets of neurons with random RNA sequences ("barcodes"). Axons are filled with barcode mRNA, each putative projection area is dissected, and the barcode mRNA is extracted and sequenced. Applying MAPseq to the locus coeruleus (LC), we find that individual LC neurons have preferred cortical targets. By recasting neuroanatomy, which is traditionally viewed as a problem of microscopy, as a problem of sequencing, MAPseq harnesses advances in sequencing technology to permit high-throughput interrogation of brain circuits. Copyright © 2016 Elsevier Inc. All rights reserved.

  18. Ribosomal RNA Genes Contribute to the Formation of Pseudogenes and Junk DNA in the Human Genome.

    Science.gov (United States)

    Robicheau, Brent M; Susko, Edward; Harrigan, Amye M; Snyder, Marlene

    2017-02-01

    Approximately 35% of the human genome can be identified as sequence devoid of a selected-effect function, and not derived from transposable elements or repeated sequences. We provide evidence supporting a known origin for a fraction of this sequence. We show that: 1) highly degraded, but near full length, ribosomal DNA (rDNA) units, including both 45S and Intergenic Spacer (IGS), can be found at multiple sites in the human genome on chromosomes without rDNA arrays, 2) that these rDNA sequences have a propensity for being centromere proximal, and 3) that sequence at all human functional rDNA array ends is divergent from canonical rDNA to the point that it is pseudogenic. We also show that small sequence strings of rDNA (from 45S + IGS) can be found distributed throughout the genome and are identifiable as an "rDNA-like signal", representing 0.26% of the q-arm of HSA21 and ∼2% of the total sequence of other regions tested. The size of sequence strings found in the rDNA-like signal intergrade into the size of sequence strings that make up the full-length degrading rDNA units found scattered throughout the genome. We conclude that the displaced and degrading rDNA sequences are likely of a similar origin but represent different stages in their evolution towards random sequence. Collectively, our data suggests that over vast evolutionary time, rDNA arrays contribute to the production of junk DNA. The concept that the production of rDNA pseudogenes is a by-product of concerted evolution represents a previously under-appreciated process; we demonstrate here its importance. © The Author(s) 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  19. Biosynthesis of a hypermodified nucleotide in Saccharomyces carlsbergensis 17S and HeLa-cell 18S ribosomal ribonucleic acid.

    Science.gov (United States)

    Brand, R C; Klootwijk, J; Planta, R J; Maden, B E

    1978-01-01

    The biosynthesis of a hypermodified nucleotide, similar to or identical with 3-(3-amino-3-carboxypropyl)-1-methylpseudouridine monophosphate, present in Saccharomyces carlsbergensis 17S and HeLa-cell 18S rRNA, was investigated with respect to the sequence of reactions required for synthesis and their timing in ribosome maturation. In both yeast and HeLa cells methylation precedes attachment of the 3-amino-3-carboxypropyl group. In yeast the methylated precursor nucleotide was tentatively characterized as 1-methylpseudouridine. This precursor nucleotide was demonstrated in both 37S and most of the cytoplasmic 18S pre-rRNA (rRNA precursor) molecules. The synthesis of the hypermodified nucleotide is completed just before the final cleavage of 18S pre-rRNA to give 17S rRNA, so that the final addition of the 3-amino-3-carboxypropyl group is a cytoplasmic event. Comparable experiments with HeLa cells indicated that formation of 1-methylpseudouridine occurs at the level of 45S RNA and addition of the 3-amino-3-carboxypropyl group occurs in the cytoplasm on newly synthesized 18S RNA.

  20. The complete structure of the chloroplast 70S ribosome in complex with translation factor pY.

    Science.gov (United States)

    Bieri, Philipp; Leibundgut, Marc; Saurer, Martin; Boehringer, Daniel; Ban, Nenad

    2017-02-15

    Chloroplasts are cellular organelles of plants and algae that are responsible for energy conversion and carbon fixation by the photosynthetic reaction. As a consequence of their endosymbiotic origin, they still contain their own genome and the machinery for protein biosynthesis. Here, we present the atomic structure of the chloroplast 70S ribosome prepared from spinach leaves and resolved by cryo-EM at 3.4 Å resolution. The complete structure reveals the features of the 4.5S rRNA, which probably evolved by the fragmentation of the 23S rRNA, and all five plastid-specific ribosomal proteins. These proteins, required for proper assembly and function of the chloroplast translation machinery, bind and stabilize rRNA including regions that only exist in the chloroplast ribosome. Furthermore, the structure reveals plastid-specific extensions of ribosomal proteins that extensively remodel the mRNA entry and exit site on the small subunit as well as the polypeptide tunnel exit and the putative binding site of the signal recognition particle on the large subunit. The translation factor pY, involved in light- and temperature-dependent control of protein synthesis, is bound to the mRNA channel of the small subunit and interacts with 16S rRNA nucleotides at the A-site and P-site, where it protects the decoding centre and inhibits translation by preventing tRNA binding. The small subunit is locked by pY in a non-rotated state, in which the intersubunit bridges to the large subunit are stabilized. © 2016 The Authors. Published under the terms of the CC BY NC ND 4.0 license.