WorldWideScience

Sample records for ribosomal rna sequence

  1. Depletion of Ribosomal RNA Sequences from Single-Cell RNA-Sequencing Library.

    Science.gov (United States)

    Fang, Nan; Akinci-Tolun, Rumeysa

    2016-07-01

    Recent advances in single-cell RNA sequencing technologies have revealed high heterogeneity of gene expression profiles in individual cells. However, most current single-cell RNA-seq methods use oligo-dT priming in the reverse transcription steps and detect only polyA-positive for more accuracy, since there are also polyA-positive non-coding RNAs transcripts, not other important RNA species, such as polyA-negative noncoding RNA. Reverse transcription using random oligos enables detection of not only the noncoding RNA species without polyA tails, but also ribosomal RNA (rRNA). rRNA comprises more than 90% of the total RNA and should be depleted from the RNA-seq library to ensure efficient usage of the sequencing capacity. Commonly used hybridization-based rRNA depletion methods can preserve noncoding RNA in the standard RNA-seq library. However, such rRNA depletion methods require high input amounts of total RNA and do not work at the single-cell level or with limited input DNA. This unit describes a novel procedure for RNA-seq library construction from single cells or a minimal amount of RNA. A thermostable duplex-specific nuclease is used in this method to effectively remove ribosomal RNA sequences following whole-transcriptome amplification and sequencing library construction. © 2016 by John Wiley & Sons, Inc.

  2. Nucleotide sequence of a crustacean 18S ribosomal RNA gene and secondary structure of eukaryotic small subunit ribosomal RNAs.

    Science.gov (United States)

    Nelles, L; Fang, B L; Volckaert, G; Vandenberghe, A; De Wachter, R

    1984-12-11

    The primary structure of the gene for 18 S rRNA of the crustacean Artemia salina was determined. The sequence has been aligned with 13 other small ribosomal subunit RNA sequences of eukaryotic, archaebacterial, eubacterial, chloroplastic and plant mitochondrial origin. Secondary structure models for these RNAs were derived on the basis of previously proposed models and additional comparative evidence found in the alignment. Although there is a general similarity in the secondary structure models for eukaryotes and prokaryotes, the evidence seems to indicate a different topology in a central area of the structures.

  3. Sequence of the 16S Ribosomal RNA from Halobacterium volcanii, an Archaebacterium.

    Science.gov (United States)

    Gupta, R; Lanter, J M; Woese, C R

    1983-08-12

    The sequence of the 16S ribosomal RNA (rRNA) from the archaebacterium Halobacterium volcanii has been determined by DNA sequencing methods. The archaebacterial rRNA is similar to its eubacterial counterpart in secondary structure. Although it is closer in sequence to the eubacterial 16S rRNA than to the eukaryotic 16S-like rRNA, the H. volcanii sequence also shows certain points of specific similarity to its eukaryotic counterpart. Since the H. volcanii sequence is closer to both the eubacterial and the eukaryotic sequences than these two are to one another, it follows that the archaebacterial sequence resembles their common ancestral sequence more closely than does either of the other two versions.

  4. Assessing the 5S ribosomal RNA heterogeneity in Arabidopsis thaliana using short RNA next generation sequencing data.

    Science.gov (United States)

    Szymanski, Maciej; Karlowski, Wojciech M

    2016-01-01

    In eukaryotes, ribosomal 5S rRNAs are products of multigene families organized within clusters of tandemly repeated units. Accumulation of genomic data obtained from a variety of organisms demonstrated that the potential 5S rRNA coding sequences show a large number of variants, often incompatible with folding into a correct secondary structure. Here, we present results of an analysis of a large set of short RNA sequences generated by the next generation sequencing techniques, to address the problem of heterogeneity of the 5S rRNA transcripts in Arabidopsis and identification of potentially functional rRNA-derived fragments.

  5. High-Resolution Analysis of Coronavirus Gene Expression by RNA Sequencing and Ribosome Profiling.

    Science.gov (United States)

    Irigoyen, Nerea; Firth, Andrew E; Jones, Joshua D; Chung, Betty Y-W; Siddell, Stuart G; Brierley, Ian

    2016-02-01

    Members of the family Coronaviridae have the largest genomes of all RNA viruses, typically in the region of 30 kilobases. Several coronaviruses, such as Severe acute respiratory syndrome-related coronavirus (SARS-CoV) and Middle East respiratory syndrome-related coronavirus (MERS-CoV), are of medical importance, with high mortality rates and, in the case of SARS-CoV, significant pandemic potential. Other coronaviruses, such as Porcine epidemic diarrhea virus and Avian coronavirus, are important livestock pathogens. Ribosome profiling is a technique which exploits the capacity of the translating ribosome to protect around 30 nucleotides of mRNA from ribonuclease digestion. Ribosome-protected mRNA fragments are purified, subjected to deep sequencing and mapped back to the transcriptome to give a global "snap-shot" of translation. Parallel RNA sequencing allows normalization by transcript abundance. Here we apply ribosome profiling to cells infected with Murine coronavirus, mouse hepatitis virus, strain A59 (MHV-A59), a model coronavirus in the same genus as SARS-CoV and MERS-CoV. The data obtained allowed us to study the kinetics of virus transcription and translation with exquisite precision. We studied the timecourse of positive and negative-sense genomic and subgenomic viral RNA production and the relative translation efficiencies of the different virus ORFs. Virus mRNAs were not found to be translated more efficiently than host mRNAs; rather, virus translation dominates host translation at later time points due to high levels of virus transcripts. Triplet phasing of the profiling data allowed precise determination of translated reading frames and revealed several translated short open reading frames upstream of, or embedded within, known virus protein-coding regions. Ribosome pause sites were identified in the virus replicase polyprotein pp1a ORF and investigated experimentally. Contrary to expectations, ribosomes were not found to pause at the ribosomal

  6. High-Resolution Analysis of Coronavirus Gene Expression by RNA Sequencing and Ribosome Profiling.

    Directory of Open Access Journals (Sweden)

    Nerea Irigoyen

    2016-02-01

    Full Text Available Members of the family Coronaviridae have the largest genomes of all RNA viruses, typically in the region of 30 kilobases. Several coronaviruses, such as Severe acute respiratory syndrome-related coronavirus (SARS-CoV and Middle East respiratory syndrome-related coronavirus (MERS-CoV, are of medical importance, with high mortality rates and, in the case of SARS-CoV, significant pandemic potential. Other coronaviruses, such as Porcine epidemic diarrhea virus and Avian coronavirus, are important livestock pathogens. Ribosome profiling is a technique which exploits the capacity of the translating ribosome to protect around 30 nucleotides of mRNA from ribonuclease digestion. Ribosome-protected mRNA fragments are purified, subjected to deep sequencing and mapped back to the transcriptome to give a global "snap-shot" of translation. Parallel RNA sequencing allows normalization by transcript abundance. Here we apply ribosome profiling to cells infected with Murine coronavirus, mouse hepatitis virus, strain A59 (MHV-A59, a model coronavirus in the same genus as SARS-CoV and MERS-CoV. The data obtained allowed us to study the kinetics of virus transcription and translation with exquisite precision. We studied the timecourse of positive and negative-sense genomic and subgenomic viral RNA production and the relative translation efficiencies of the different virus ORFs. Virus mRNAs were not found to be translated more efficiently than host mRNAs; rather, virus translation dominates host translation at later time points due to high levels of virus transcripts. Triplet phasing of the profiling data allowed precise determination of translated reading frames and revealed several translated short open reading frames upstream of, or embedded within, known virus protein-coding regions. Ribosome pause sites were identified in the virus replicase polyprotein pp1a ORF and investigated experimentally. Contrary to expectations, ribosomes were not found to pause at the

  7. Sequence characterization of 5S ribosomal RNA from eight gram positive procaryotes

    Science.gov (United States)

    Woese, C. R.; Luehrsen, K. R.; Pribula, C. D.; Fox, G. E.

    1976-01-01

    Complete nucleotide sequences are presented for 5S rRNA from Bacillus subtilis, B. firmus, B. pasteurii, B. brevis, Lactobacillus brevis, and Streptococcus faecalis, and 5S rRNA oligonucleotide catalogs and partial sequence data are given for B. cereus and Sporosarcina ureae. These data demonstrate a striking consistency of 5S rRNA primary and secondary structure within a given bacterial grouping. An exception is B. brevis, in which the 5S rRNA sequence varies significantly from that of other bacilli in the tuned helix and the procaryotic loop. The localization of these variations suggests that B. brevis occupies an ecological niche that selects such changes. It is noted that this organism produces antibiotics which affect ribosome function.

  8. Nucleotide sequence of an exceptionally long 5.8S ribosomal RNA from Crithidia fasciculata.

    Science.gov (United States)

    Schnare, M N; Gray, M W

    1982-01-01

    In Crithidia fasciculata, a trypanosomatid protozoan, the large ribosomal subunit contains five small RNA species (e, f, g, i, j) in addition to 5S rRNA [Gray, M.W. (1981) Mol. Cell. Biol. 1, 347-357]. The complete primary sequence of species i is shown here to be pAACGUGUmCGCGAUGGAUGACUUGGCUUCCUAUCUCGUUGA ... AGAmACGCAGUAAAGUGCGAUAAGUGGUApsiCAAUUGmCAGAAUCAUUCAAUUACCGAAUCUUUGAACGAAACGG ... CGCAUGGGAGAAGCUCUUUUGAGUCAUCCCCGUGCAUGCCAUAUUCUCCAmGUGUCGAA(C)OH. This sequence establishes that species i is a 5.8S rRNA, despite its exceptional length (171-172 nucleotides). The extra nucleotides in C. fasciculata 5.8S rRNA are located in a region whose primary sequence and length are highly variable among 5.8S rRNAs, but which is capable of forming a stable hairpin loop structure (the "G+C-rich hairpin"). The sequence of C. fasciculata 5.8S rRNA is no more closely related to that of another protozoan, Acanthamoeba castellanii, than it is to representative 5.8S rRNA sequences from the other eukaryotic kingdoms, emphasizing the deep phylogenetic divisions that seem to exist within the Kingdom Protista. Images PMID:7079176

  9. Dataset of the transcribed 45S ribosomal RNA sequence of the tree crop “yerba mate”

    Directory of Open Access Journals (Sweden)

    Patricia M. Aguilera

    2017-06-01

    Full Text Available This contribution contains data related to the research article entitled “The 18S-25S ribosomal RNA unit of yerba mate (Ilex paraguariensis A. St.-Hil.” (Aguilera et al., 2016 [1]. Through a bioinformatic approach involving NGS data, we provide information of the transcribed 45S ribosomal RNA (rRNA sequence of yerba mate, the first reference for the Ilex L. genus. This dataset (Supplementary file 1 comprises information regarding the assembly and annotation of this rRNA unit. The generated data is applicable for comparative analysis and evolutionary studies among Ilex and related taxa. The raw sequencing data used here is available at DDBJ/EMBL/GenBank (NCBI Resource Coordinators, 2016 [2] Sequence Read Archive (SRA under the accession SRP043293 and the consensus 45S ribosomal RNA sequence has been deposited there under the accession GFHV00000000.

  10. Sequence and secondary structure of the mitochondrial 16S ribosomal RNA gene of Ixodes scapularis.

    Science.gov (United States)

    Krakowetz, Chantel N; Chilton, Neil B

    2015-02-01

    The complete DNA sequences and secondary structure of the mitochondrial (mt) 16S ribosomal (r) RNA gene were determined for six Ixodes scapularis adults. There were 44 variable nucleotide positions in the 1252 bp sequence alignment. Most (95%) nucleotide alterations did not affect the integrity of the secondary structure of the gene because they either occurred at unpaired positions or represented compensatory changes that maintained the base pairing in helices. A large proportion (75%) of the intraspecific variation in DNA sequence occurred within Domains I, II and VI of the 16S gene. Therefore, several regions within this gene may be highly informative for studies of the population genetics and phylogeography of I. scapularis, a major vector of pathogens of humans and domestic animals in North America.

  11. [Characterization of Black and Dichothrix Cyanobacteria Based on the 16S Ribosomal RNA Gene Sequence

    Science.gov (United States)

    Ortega, Maya

    2010-01-01

    My project focuses on characterizing different cyanobacteria in thrombolitic mats found on the island of Highborn Cay, Bahamas. Thrombolites are interesting ecosystems because of the ability of bacteria in these mats to remove carbon dioxide from the atmosphere and mineralize it as calcium carbonate. In the future they may be used as models to develop carbon sequestration technologies, which could be used as part of regenerative life systems in space. These thrombolitic communities are also significant because of their similarities to early communities of life on Earth. I targeted two cyanobacteria in my research, Dichothrix spp. and whatever black is, since they are believed to be important to carbon sequestration in these thrombolitic mats. The goal of my summer research project was to molecularly identify these two cyanobacteria. DNA was isolated from each organism through mat dissections and DNA extractions. I ran Polymerase Chain Reactions (PCR) to amplify the 16S ribosomal RNA (rRNA) gene in each cyanobacteria. This specific gene is found in almost all bacteria and is highly conserved, meaning any changes in the sequence are most likely due to evolution. As a result, the 16S rRNA gene can be used for bacterial identification of different species based on the sequence of their 16S rRNA gene. Since the exact sequence of the Dichothrix gene was unknown, I designed different primers that flanked the gene based on the known sequences from other taxonomically similar cyanobacteria. Once the 16S rRNA gene was amplified, I cloned the gene into specialized Escherichia coli cells and sent the gene products for sequencing. Once the sequence is obtained, it will be added to a genetic database for future reference to and classification of other Dichothrix sp.

  12. The nucleotide sequence of 4.5S ribosomal RNA from tobacco chloroplasts.

    OpenAIRE

    Takaiwa, F; Sugiura, M

    1980-01-01

    The nucleotide sequence of tobacco chloroplast 4.5S ribosomal RNA has been determined to be: OHG-A-A-G-G-U-C-A-C-G-G-C-G-A-G-A-C-G-A-G-C-C-G-U-U-U-A-U-C-A-U-U-A-C-G-A-U-A-G-G-U-G-U-C-A-A-G-U-G-G-A-A-G-U-G-C-A-G-U-G-A-U-G-U-A-U-G-C-(G-A)-C-U-G-A-G-G-C-A-U-C-C-U-A-A-C-A-G-A-C-C-G-G-U-A-G-A-C-U-U-G-A-A-COH. The 4.5S RNA is 103 nucleotides long and its 5'-terminus is not phosphorylated.

  13. Different organisms associated with heartwater as shown by analysis of 16S ribosomal RNA gene sequences.

    Science.gov (United States)

    Allsopp, M; Visser, E S; du Plessis, J L; Vogel, S W; Allsopp, B A

    1997-08-01

    Cowdria ruminantium is a rickettsial parasite which causes heartwater, a economically important disease of domestic and wild ruminants in tropical and subtropical Africa and parts of the Caribbean. Because existing diagnostic methods are unreliable, we investigated the small-subunit ribosomal RNA (srRNA) gene from heartwater-infected material to characterise the organisms present and to develop specific oligonucleotide probes for polymerase chain reaction (PCR) based diagnosis. DNA was obtained from ticks and ruminants from heartwater-free and heartwater-endemic areas from Cowdria in tissue culture. PCR was carried out using primers designed to amplify only rickettsial srRNA genes, the target region being the highly variable V1 loop. Amplicons were cloned and sequenced; 51% were C. ruminantium sequences corresponding to four genotypes, two of which were identical to previously reported C. ruminantium sequences while the other two were new. The four different Cowdria genotypes can be correlated with different phenotypes. Tissue-culture samples yielded only Cowdria genotype sequences, but an extraordinary heterogeneity of 16S sequences was obtained from field samples. In addition to Cowdria genotypes we found sequences from previously unknown Ehrlichia spp., sequences showing homology to other Rickettsiales and a variety of Pseudomonadaceae. One Ehrlichia sequence was phylogenetically closely related to Ehrlichia platys (Group II Ehrlichia) and one to Ehrlichia canis (Group III Ehrlichia). This latter sequence was from an isolate (Germishuys) made from a naturally infected sheep which, from brain smear examination and pathology, appeared to be suffering from heartwater; nevertheless no Cowdria genotype sequences were found in this isolate. In addition no Cowdria sequences were obtained from uninfected ticks. Complete 16S rRNA gene sequences were determined for two C. ruminantium genotypes and for two previously uncharacterised heartwater-associated Ehrlichia spp

  14. Combined heat shock protein 90 and ribosomal RNA sequence phylogeny supports multiple replacements of dinoflagellate plastids.

    Science.gov (United States)

    Shalchian-Tabrizi, Kamran; Minge, Marianne A; Cavalier-Smith, Tom; Nedreklepp, Joachim M; Klaveness, Dag; Jakobsen, Kjetill S

    2006-01-01

    Dinoflagellates harbour diverse plastids obtained from several algal groups, including haptophytes, diatoms, cryptophytes, and prasinophytes. Their major plastid type with the accessory pigment peridinin is found in the vast majority of photosynthetic species. Some species of dinoflagellates have other aberrantly pigmented plastids. We sequenced the nuclear small subunit (SSU) ribosomal RNA (rRNA) gene of the "green" dinoflagellate Gymnodinium chlorophorum and show that it is sister to Lepidodinium viride, indicating that their common ancestor obtained the prasinophyte (or other green alga) plastid in one event. As the placement of dinoflagellate species that acquired green algal or haptophyte plastids is unclear from small and large subunit (LSU) rRNA trees, we tested the usefulness of the heat shock protein (Hsp) 90 gene for dinoflagellate phylogeny by sequencing it from four species with aberrant plastids (G. chlorophorum, Karlodinium micrum, Karenia brevis, and Karenia mikimotoi) plus Alexandrium tamarense, and constructing phylogenetic trees for Hsp90 and rRNAs, separately and together. Analyses of the Hsp90 and concatenated data suggest an ancestral origin of the peridinin-containing plastid, and two independent replacements of the peridinin plastid soon after the early radiation of the dinoflagellates. Thus, the Hsp90 gene seems to be a promising phylogenetic marker for dinoflagellate phylogeny.

  15. Small-subunit ribosomal RNA gene sequences of Phaeodarea challenge the monophyly of Haeckel's Radiolaria.

    Science.gov (United States)

    Polet, Stephane; Berney, Cédric; Fahrni, José; Pawlowski, Jan

    2004-03-01

    In his grand monograph of Radiolaria, Ernst Haeckel originally included Phaeodarea together with Acantharea and Polycystinea, all three taxa characterized by the presence of a central capsule and the possession of axopodia. Cytological and ultrastructural studies, however, questioned the monophyly of Radiolaria, suggesting an independent evolutionary origin of the three taxa, and the first molecular data on Acantharea and Polycystinea brought controversial results. To test further the monophyly of Radiolaria, we sequenced the complete small subunit ribosomal RNA gene of three phaeodarians and three polycystines. Our analyses reveal that phaeodarians clearly branch among the recently described phylum Cercozoa, separately from Acantharea and Polycystinea. This result enhances the morphological variability within the phylum Cercozoa, which already contains very heterogeneous groups of protists. Our study also confirms the common origin of Acantharea and Polycystinea, which form a sister-group to the Cercozoa, and allows a phylogenetic reinterpretation of the morphological features of the three radiolarian groups.

  16. [Ribosomal RNA Evolution

    Science.gov (United States)

    1997-01-01

    It is generally believed that an RNA World existed at an early stage in the history of life. During this early period, RNA molecules are seen to be potentially involved in both catalysis and the storage of genetic information. Translation presents several interrelated themes of inquiry for exobiology. First, it is essential, for understanding the very origin of life, how peptides and eventually proteins might have come to be made on the early Earth in a template directed manner. Second, it is necessary to understand how a machinery of similar complexity to that found in the ribosomes of modern organisms came to exist by the time of the last common ancestor (as detected by 16S rRNA sequence studies). Third, the ribosomal RNAs themselves likely had a very early origin and studies of their history may be very informative about the nature of the RNA World. Moreover, studies of these RNAs will contribute to a better understanding of the potential roles of RNA in early evolution.During the past year we have ave conducted a comparative study of four completely sequenced bacterial genoames. We have focused initially on conservation of gene order. The second component of the project continues to build on the model system for studying the validity of variant 5S rRNA sequences in the vicinity of the modern Vibrio proteolyticus 5S rRNA that we established earlier. This system has made it possible to conduct a detailed and extensive analysis of a local portion of the sequence space. These core methods have been used to construct numerous mutants during the last several years. Although it has been a secondary focus, this work has continued over the last year such that we now have in excess of 125 V. proteolyticus derived constructs which have been made and characterized. We have also continued high resolution NMR work on RNA oligomers originally initiated by G. Kenneth Smith who was funded by a NASA Graduate Student Researcher's Fellowship Award until May of 1996. Mr. Smith

  17. Terminal-sequence studies of high-molecular-weight ribonucleic acid. The 3'-termini of rabbit reticulocyte ribosomal RNA.

    Science.gov (United States)

    Hunt, J A

    1970-11-01

    Sequences of the polynucleotide chains of RNA found in the large and small ribosomal subunits of rabbit reticulocytes have been determined from the 3'-end by use of periodate oxidation and condensation with [(3)H]isoniazid and by stepwise degradation. By these methods the hexanucleotide sequences have been found as -pGpUpUpUpGpU for the 28S RNA and -pGpUpCpGpCpU for the 6S RNA of the large ribosomal subunit and the octanucleotide sequence -pGpApUpCpApUpUpA for the 18S rRNA of the small ribosomal subunit. These sequences are present in at least 70% of all the RNA molecules and are discussed in relation to the specific cleavage of rRNA from its precursors and the role of multiple cistrons for rRNA in the DNA of higher organisms. The feasibility of using the method for longer sequence determinations is discussed.

  18. 18S ribosomal RNA gene sequences of Cochliopodium (Himatismenida) and the phylogeny of Amoebozoa.

    Science.gov (United States)

    Kudryavtsev, Alexander; Bernhard, Detlef; Schlegel, Martin; Chao, Ema E Y; Cavalier-Smith, Thomas

    2005-08-01

    Cochliopodium is a very distinctive genus of discoid amoebae covered by a dorsal tectum of carbohydrate microscales. Its phylogenetic position is unclear, since although sharing many features with naked "gymnamoebae", the tectum sets it apart. We sequenced 18S ribosomal RNA genes from three Cochliopodium species (minus, spiniferum and Cochliopodium sp., a new species resembling C. minutum). Phylogenetic analysis shows Cochliopodium as robustly holophyletic and within Amoebozoa, in full accord with morphological data. Cochliopodium is always one of the basal branches within Amoebozoa but its precise position is unstable. In Bayesian analysis it is sister to holophyletic Glycostylida, but distance trees mostly place it between Dermamoeba and a possibly artifactual long-branch cluster including Thecamoeba. These positions are poorly supported and basal amoebozoan branching ill-resolved, making it unclear whether Discosea (Glycostylida, Himatismenida, Dermamoebida) is holophyletic; however, Thecamoeba seems not specifically related to Dermamoeba. We also sequenced the small-subunit rRNA gene of Vannella persistens, which constantly grouped with other Vannella species, and two Hartmannella strains. Our trees suggest that Vexilliferidae, Variosea and Hartmannella are polyphyletic, confirming the existence of two very distinct Hartmannella clades: that comprising H. cantabrigiensis and another divergent species is sister to Glaeseria, whilst Hartmannella vermiformis branches more deeply.

  19. Asaia bogorensis peritonitis identified by 16S ribosomal RNA sequence analysis in a patient receiving peritoneal dialysis.

    Science.gov (United States)

    Snyder, Richard W; Ruhe, Jorg; Kobrin, Sidney; Wasserstein, Alan; Doline, Christa; Nachamkin, Irving; Lipschutz, Joshua H

    2004-08-01

    Here the authors report a case of refractory peritonitis leading to multiple hospitalizations and the loss of peritoneal dialysis access in a patient on automated peritoneal dialysis, caused by Asaia bogorensis, a bacterium not previously described as a human pathogen. This organism was identified by sequence analysis of the 16S ribosomal RNA gene. Unusual microbial agents may cause peritonitis, and molecular microbiological techniques are important tools for identifying these agents.

  20. A study of ribonucleoproteins: The sequence of rabbit 18S ribosomal RNA and the identification of proteins associated with messenger RNA

    Energy Technology Data Exchange (ETDEWEB)

    Connaughton, J.F. Jr.

    1989-01-01

    This study considers the functional role of ribosomal RNA and messenger ribonucleoproteins in the translational regulation of gene expression. The primary structure of rabbit 18S ribosomal RNA was determined by nucleotide sequence analysis of the RNA directly. Rabbit 18S RNA was cleaved with either T{sub 1} ribonuclease or RNase H, using a Pst 1 DNA linker to generate a unique set of overlapping fragments spanning the entire molecule. Both intact and fragmented 18S RNA were end-labeled with {sup 32}P and base-specifically cleaved enzymatically and chemically. Nucleotide sequences were determined from long polyacrylamide sequencing gels run in formamide. To assess functional roles of RNA in gene expression, specific mRNA-protein interactions were also examined. Eukaryotic mRNA is associated with specific proteins that may be important in translational regulation and mRNA stability; mRNP complexes were reconstituted in a message-dependent, cell-free rabbit reticulocyte translation system, using unique mRNA species transcribed in vitro with SP6 polymerase. Transcripts of both rabbit and human {beta}-globin cDNA were labeled with {sup 32}P either throughout the molecule ore selectively at the 5{prime} and 3{prime} terminus.

  1. Neonatal Meningitis by Multidrug Resistant Elizabethkingia meningosepticum Identified by 16S Ribosomal RNA Gene Sequencing

    Directory of Open Access Journals (Sweden)

    V. V. Shailaja

    2014-01-01

    Full Text Available Clinical and microbiological profile of 9 neonates with meningitis by Elizabethkingia meningosepticum identified by 16S ribosomal gene sequencing was studied. All the clinical isolates were resistant to cephalosporins, aminoglycosides, trimethoprim-sulfamethoxazole, β-lactam combinations, carbapenems and only one isolate was susceptible to ciprofloxacin. All the isolates were susceptible to vancomycin. Six of nine neonates died even after using vancomycin, based on susceptibility results. E. meningosepticum meningitis in neonates results in high mortality rate. Though the organism is susceptible to vancomycin in vitro, its efficacy in vivo is questionable and it is difficult to determine the most appropriate antibiotic for treating E. meningosepticum meningitis in neonates.

  2. Nematode Diversity of Qingdao Coast Inferred from the 18S Ribosomal RNA Gene Sequence Analysis

    Institute of Scientific and Technical Information of China (English)

    SHEN Xiquan; YANG Guanpin; LIU Yongjian

    2007-01-01

    The 18S ribosomal DNA gene (18S rDNA) sequences (approximately 1300 bp in length) were amplified from the DNA extracted from the free-living marine nematodes collected from the inter-tidal sediment of Qingdao coast in bulk with nematode specific primers. The PCR products were cloned, re-amplified, digested with Rsa I and Hin6Ⅰ restriction endonucleases and separated in agarose gel. Among 17 restriction fragment length types, types 1, 2 and 6 covered 61.2%, 14.4% and 9.3% of the clones analyzed, respectively, while the remaining 14 only covered 21 clones, which accounted for 15.1% of the total. Twenty-four representative clones were sequenced and phylogenetically analyzed by referring to those currently available in RDP and GenBank databases. Although it was hard to assign these sequences to known species or genera due to the lack of the 18S rDNA sequence data of known marine free-living nematodes, the obtained sequences were assigned to the nematodes of Adenophorea. Among them, twelve sequences were close to Pontonema vulgare and Adoncholaimus sp., four to Daptonemaprocerus and two (identical) to Enoplus brevis. Our results showed that free-living marine nematode diversities could be determined by PCR retrieving and analysis of the 18S rDNA sequences and an 18S rDNA sequence could be assigned to a species or a genus only if the 18S rDNA sequences of the free-living marine nematodes were accumulated to some extent.

  3. Architecture of ribosomal RNA: Constraints on the sequence of tetra-loops

    Energy Technology Data Exchange (ETDEWEB)

    Woese, C.R. (Univ. of Illinois, Urbana (United States)); Winker, S. (Argonne National Lab., IL (United States)); Gutell, R.R. (Univ. of Illinois, Urbana (United States) Cangene Corp., Mississauga, Ontario (Canada))

    1990-11-01

    The four-base loops that cap many double-helical structures in rRNA (the so-called tetra-loops) exhibit highly invariant to highly variable sequences depending upon their location in the molecule. However, in the vast majority of these cases the sequence of a tetra-loop is independent of its location and conforms to one of three general motifs, GNRA, UNCG, and (more rarely) CUUG. For the most frequently varying of the 16S rRNA tetra-loops, that at position 83 (Escherichia coli numbering), the three sequences CUUG, UUCG, and GCAA account for almost all examples encountered, and each of them has independently arisen at least a dozen times. The closing base pair of tetra-loop hairpins reflects the loop sequence, tending to be C{center dot}G for CUUG loops.

  4. Sequence analysis of mitochondrial 16S ribosomal RNA gene fragment from seven mosquito species

    Indian Academy of Sciences (India)

    Yogesh S Shouche; Milind S Patole

    2000-12-01

    Mosquitoes are vectors for the transmission of many human pathogens that include viruses, nematodes and protozoa. For the understanding of their vectorial capacity, identification of disease carrying and refractory strains is essential. Recently, molecular taxonomic techniques have been utilized for this purpose. Sequence analysis of the mitochondrial 16S rRNA gene has been used for molecular taxonomy in many insects. In this paper, we have analysed a 450 bp hypervariable region of the mitochondrial 16S rRNA gene in three major genera of mosquitoes, Aedes, Anopheles and Culex. The sequence was found to be unusually A + T rich and in substitutions the rate of transversions was higher than the transition rate. A phylogenetic tree was constructed with these sequences. An interesting feature of the sequences was a stretch of Ts that distinguished between Aedes and Culex on the one hand, and Anopheles on the other. This is the first report of mitochondrial rRNA sequences from these medically important genera of mosquitoes.

  5. TAXONOMIC STATUS OF CAR BACILLUS BASED ON THE SMALL SUBUNIT RIBOSOMAL RNA SEQUENCES

    Institute of Scientific and Technical Information of China (English)

    魏强; TsujiM; TakahashiT; IshiharaC; ItohT

    1995-01-01

    In an attempt to identify the taxonomic relationship between CAR bacillus and other bacteria, the SSU rRNA gene sequences of two CAR bacillus strains, CBM and CBR isolated from mice and rats respectively were used in the present studies. The SSU rRNA gene sequences, approximately 1.5 kb in size amplified from genomic DNAs from both strains, were determined and 96. 8% homologies were found to exist be-tween them. Those sequences were aligned to most euhacteria with a computer search showing high homol-ogy with those of Flavobacter/Flexibacter species especially closed to Fx. sanai and Ft. ferrugineum. Phylogenetic analysts indicated that CAR bacillus belongs to a species close to Fx. sancti and Ft. ferrug-imum subdivision.

  6. Delimitation of the Thoracosphaeraceae (Dinophyceae), including the calcareous dinoflagellates, based on large amounts of ribosomal RNA sequence data.

    Science.gov (United States)

    Gottschling, Marc; Soehner, Sylvia; Zinssmeister, Carmen; John, Uwe; Plötner, Jörg; Schweikert, Michael; Aligizaki, Katerina; Elbrächter, Malte

    2012-01-01

    The phylogenetic relationships of the Dinophyceae (Alveolata) are not sufficiently resolved at present. The Thoracosphaeraceae (Peridiniales) are the only group of the Alveolata that include members with calcareous coccoid stages; this trait is considered apomorphic. Although the coccoid stage apparently is not calcareous, Bysmatrum has been assigned to the Thoracosphaeraceae based on thecal morphology. We tested the monophyly of the Thoracosphaeraceae using large sets of ribosomal RNA sequence data of the Alveolata including the Dinophyceae. Phylogenetic analyses were performed using Maximum Likelihood and Bayesian approaches. The Thoracosphaeraceae were monophyletic, but included also a number of non-calcareous dinophytes (such as Pentapharsodinium and Pfiesteria) and even parasites (such as Duboscquodinium and Tintinnophagus). Bysmatrum had an isolated and uncertain phylogenetic position outside the Thoracosphaeraceae. The phylogenetic relationships among calcareous dinophytes appear complex, and the assumption of the single origin of the potential to produce calcareous structures is challenged. The application of concatenated ribosomal RNA sequence data may prove promising for phylogenetic reconstructions of the Dinophyceae in future.

  7. New Hosts of Simplicimonas similis and Trichomitus batrachorum Identified by 18S Ribosomal RNA Gene Sequences

    Directory of Open Access Journals (Sweden)

    Kris Genelyn B. Dimasuay

    2013-01-01

    Full Text Available Trichomonads are obligate anaerobes generally found in the digestive and genitourinary tract of domestic animals. In this study, four trichomonad isolates were obtained from carabao, dog, and pig hosts using rectal swab. Genomic DNA was extracted using Chelex method and the 18S rRNA gene was successfully amplified through novel sets of primers and undergone DNA sequencing. Aligned isolate sequences together with retrieved 18S rRNA gene sequences of known trichomonads were utilized to generate phylogenetic trees using maximum likelihood and neighbor-joining analyses. Two isolates from carabao were identified as Simplicimonas similis while each isolate from dog and pig was identified as Pentatrichomonas hominis and Trichomitus batrachorum, respectively. This is the first report of S. similis in carabao and the identification of T. batrachorum in pig using 18S rRNA gene sequence analysis. The generated phylogenetic tree yielded three distinct groups mostly with relatively moderate to high bootstrap support and in agreement with the most recent classification. Pathogenic potential of the trichomonads in these hosts still needs further investigation.

  8. Identification and characterization of rhizospheric microbial diversity by 16S ribosomal RNA gene sequencing

    Directory of Open Access Journals (Sweden)

    Muhammad Naveed

    2014-09-01

    Full Text Available In the present study, samples of rhizosphere and root nodules were collected from different areas of Pakistan to isolate plant growth promoting rhizobacteria. Identification of bacterial isolates was made by 16S rRNA gene sequence analysis and taxonomical confirmation on EzTaxon Server. The identified bacterial strains were belonged to 5 genera i.e. Ensifer, Bacillus, Pseudomona, Leclercia and Rhizobium. Phylogenetic analysis inferred from 16S rRNA gene sequences showed the evolutionary relationship of bacterial strains with the respective genera. Based on phylogenetic analysis, some candidate novel species were also identified. The bacterial strains were also characterized for morphological, physiological, biochemical tests and glucose dehydrogenase (gdh gene that involved in the phosphate solublization using cofactor pyrroloquinolone quinone (PQQ. Seven rhizoshperic and 3 root nodulating stains are positive for gdh gene. Furthermore, this study confirms a novel association between microbes and their hosts like field grown crops, leguminous and non-leguminous plants. It was concluded that a diverse group of bacterial population exist in the rhizosphere and root nodules that might be useful in evaluating the mechanisms behind plant microbial interactions and strains QAU-63 and QAU-68 have sequence similarity of 97 and 95% which might be declared as novel after further taxonomic characterization.

  9. Identification and characterization of rhizospheric microbial diversity by 16S ribosomal RNA gene sequencing.

    Science.gov (United States)

    Naveed, Muhammad; Mubeen, Samavia; Khan, SamiUllah; Ahmed, Iftikhar; Khalid, Nauman; Suleria, Hafiz Ansar Rasul; Bano, Asghari; Mumtaz, Abdul Samad

    2014-01-01

    In the present study, samples of rhizosphere and root nodules were collected from different areas of Pakistan to isolate plant growth promoting rhizobacteria. Identification of bacterial isolates was made by 16S rRNA gene sequence analysis and taxonomical confirmation on EzTaxon Server. The identified bacterial strains were belonged to 5 genera i.e. Ensifer, Bacillus, Pseudomona, Leclercia and Rhizobium. Phylogenetic analysis inferred from 16S rRNA gene sequences showed the evolutionary relationship of bacterial strains with the respective genera. Based on phylogenetic analysis, some candidate novel species were also identified. The bacterial strains were also characterized for morphological, physiological, biochemical tests and glucose dehydrogenase (gdh) gene that involved in the phosphate solublization using cofactor pyrroloquinolone quinone (PQQ). Seven rhizoshperic and 3 root nodulating stains are positive for gdh gene. Furthermore, this study confirms a novel association between microbes and their hosts like field grown crops, leguminous and non-leguminous plants. It was concluded that a diverse group of bacterial population exist in the rhizosphere and root nodules that might be useful in evaluating the mechanisms behind plant microbial interactions and strains QAU-63 and QAU-68 have sequence similarity of 97 and 95% which might be declared as novel after further taxonomic characterization.

  10. Translation complex profile sequencing to study the in vivo dynamics of mRNA-ribosome interactions during translation initiation, elongation and termination.

    Science.gov (United States)

    Shirokikh, Nikolay E; Archer, Stuart K; Beilharz, Traude H; Powell, David; Preiss, Thomas

    2017-04-01

    Messenger RNA (mRNA) translation is a tightly controlled process that is integral to gene expression. It features intricate and dynamic interactions of the small and large subunits of the ribosome with mRNAs, aided by multiple auxiliary factors during distinct initiation, elongation and termination phases. The recently developed ribosome profiling method can generate transcriptome-wide surveys of translation and its regulation. Ribosome profiling records the footprints of fully assembled ribosomes along mRNAs and thus primarily interrogates the elongation phase of translation. Importantly, it does not monitor multiple substeps of initiation and termination that involve complexes between the small ribosomal subunit (SSU) and mRNA. Here we describe a related method, termed 'translation complex profile sequencing' (TCP-seq), that is uniquely capable of recording positions of any type of ribosome-mRNA complex transcriptome-wide. It uses fast covalent fixation of translation complexes in live cells, followed by RNase footprinting of translation intermediates and their separation into complexes involving either the full ribosome or the SSU. The footprints derived from each type of complex are then deep-sequenced separately, generating native distribution profiles during the elongation, as well as the initiation and termination stages of translation. We provide the full TCP-seq protocol for Saccharomyces cerevisiae liquid suspension culture, including a data analysis pipeline. The protocol takes ∼3 weeks to complete by a researcher who is well acquainted with standard molecular biology techniques and who has some experience in ultracentrifugation and the preparation of RNA sequencing (RNA-seq) libraries. Basic Bash and UNIX/Linux command skills are required to use the bioinformatics tools provided.

  11. Native Valve Endocarditis due to Corynebacterium striatum confirmed by 16S Ribosomal RNA Sequencing: A Case Report and Literature Review

    Science.gov (United States)

    2016-01-01

    Corynebacterium species are non-fermentous Gram-positive bacilli that are normal flora of human skin and mucous membranes and are commonly isolated in clinical specimens. Non-diphtheriae Corynebacterium are regarded as contaminants when found in blood culture. Currently, Corynebacterium striatum is considered one of the emerging nosocomial agents implicated in endocarditis and serious infections. We report a case of native-valve infective endocarditis caused by C. striatum, which was misidentified by automated identification system but identified accurately by 16S ribosomal RNA sequencing, in a 55-year-old male patient. The patient had two mobile vegetations on his mitral valve, both of which had high embolic risk. Through surgical valve replacement and an antibiotic regimen, the patient recovered completely. In unusual clinical scenarios, C. striatum should not be simply dismissed as a contaminant when isolated from clinical specimens. The possibility of C. striatum infection should be considered even in an immunocompetent patient, and we suggest a genotypic assay, such as 16S rRNA sequencing, to confirm species identity. PMID:27659439

  12. The phylogenetic position of Allocreadiidae (Trematoda: Digenea) from partial sequences of the 18S and 28S ribosomal RNA genes.

    Science.gov (United States)

    Choudhury, Anindo; Rosas Valdez, Rogelio; Johnson, Ryan C; Hoffmann, Brian; Pérez-Ponce de León, Gerardo

    2007-02-01

    Species of Allocreadiidae are an important component of the parasite fauna of freshwater vertebrates, particularly fishes, and yet their systematic relationships with other trematodes have not been clarified. Partial sequences of the 18S and 28S ribosomal RNA genes from 3 representative species of Allocreadiidae, i.e., Crepidostomum cooperi, Bunodera mediovitellata, and Polylekithum ictaluri, and from 79 other taxa representing 78 families of trematodes obtained from GenBank, were used in a phylogenetic analysis to address the relationships of Allocreadiidae with other plagiorchiiforms/plagiorchiidans. Maximum parsimony and Bayesian analyses of combined 18S and 28S rRNA gene sequence data place 2 of the allocreadiids, Crepidostomum cooperi and Bunodera mediovitellata, in a clade with species of Callodistomidae and Gorgoderidae, which, in turn is sister to a clade containing Polylekithum ictaluri and representatives of Encyclometridae, Dicrocoelidae, and Orchipedidae, a grouping supported by high bootstrap values. These results suggest that Polylekithum ictaluri is not an allocreadiid, a conclusion that is supported by reported differences between its cercaria and that of other allocreadiids. Although details of the life cycle of callodistomids, the sister taxon to Allocreadiidae, remain unknown, the relationship of Allocreadiidae and Gorgoderidae is consistent with their larval development in bivalve, rather than gastropod, molluscs, and with their host relationships (predominantly freshwater vertebrates). The results also indicate that, whereas Allocreadiidae is not a basal taxon, it is not included within the suborder Plagiorchiata. No support was found for a direct relationship between allocreadiids and opecoelids either.

  13. Import of desired nucleic acid sequences using addressing motif of mitochondrial ribosomal 5S-rRNA for fluorescent in vivo hybridization of mitochondrial DNA and RNA.

    Science.gov (United States)

    Zelenka, Jaroslav; Alán, Lukáš; Jabůrek, Martin; Ježek, Petr

    2014-04-01

    Based on the matrix-addressing sequence of mitochondrial ribosomal 5S-rRNA (termed MAM), which is naturally imported into mitochondria, we have constructed an import system for in vivo targeting of mitochondrial DNA (mtDNA) or mt-mRNA, in order to provide fluorescence hybridization of the desired sequences. Thus DNA oligonucleotides were constructed, containing the 5'-flanked T7 RNA polymerase promoter. After in vitro transcription and fluorescent labeling with Alexa Fluor(®) 488 or 647 dye, we obtained the fluorescent "L-ND5 probe" containing MAM and exemplar cargo, i.e., annealing sequence to a short portion of ND5 mRNA and to the light-strand mtDNA complementary to the heavy strand nd5 mt gene (5'-end 21 base pair sequence). For mitochondrial in vivo fluorescent hybridization, HepG2 cells were treated with dequalinium micelles, containing the fluorescent probes, bringing the probes proximally to the mitochondrial outer membrane and to the natural import system. A verification of import into the mitochondrial matrix of cultured HepG2 cells was provided by confocal microscopy colocalizations. Transfections using lipofectamine or probes without 5S-rRNA addressing MAM sequence or with MAM only were ineffective. Alternatively, the same DNA oligonucleotides with 5'-CACC overhang (substituting T7 promoter) were transcribed from the tetracycline-inducible pENTRH1/TO vector in human embryonic kidney T-REx®-293 cells, while mitochondrial matrix localization after import of the resulting unlabeled RNA was detected by PCR. The MAM-containing probe was then enriched by three-order of magnitude over the natural ND5 mRNA in the mitochondrial matrix. In conclusion, we present a proof-of-principle for mitochondrial in vivo hybridization and mitochondrial nucleic acid import.

  14. The sequence of the 5S ribosomal RNA of the crustacean Artemia salina

    OpenAIRE

    Diels, Ludo; De Baere, Raymond; Vandenberghe, Antoon; De Wachter, Rupert

    1981-01-01

    The primary structure of the 5 S rRNA isolated from the cryptobiotic cysts of the brine shrimp Artemia salina is pACCAACGGCCAUACCACGUUGAAAGUACCCAGUCUCGUCAGAUCCUGGAAGUCACACAACGUCGGGCCCGGUCAGUACUUGGAUGGGUGACCGCCUGGGAACACCGGGUGCUGUUGGCAU OH.

  15. Molecular phylogenetic inference of the woolly mammoth Mammuthus primigenius, based on complete sequences of mitochondrial cytochrome b and 12S ribosomal RNA genes.

    Science.gov (United States)

    Noro, M; Masuda, R; Dubrovo, I A; Yoshida, M C; Kato, M

    1998-03-01

    Complete sequences of cytochrome b (1,137 bases) and 12S ribosomal RNA (961 bases) genes in mitochondrial DNA were successfully determined from the woolly mammoth (Mammuthus primigenius), African elephant (Loxodonta africana), and Asian elephant (Elephas maximus). From these sequence data, phylogenetic relationships among three genera were examined. Molecular phylogenetic trees reconstructed by the neighbor-joining and the maximum parsimony methods provided an identical topology both for cytochrome b and 12S rRNA genes. These results support the "Mammuthus-Loxodonta" clade, which is contrary to some previous morphological reports that Mammuthus is more closely related to Elephas than to Loxodonta.

  16. Evaluation of sequence alignments and oligonucleotide probes with respect to three-dimensional structure of ribosomal RNA using ARB software package

    Directory of Open Access Journals (Sweden)

    Meier Harald

    2006-05-01

    Full Text Available Abstract Background Availability of high-resolution RNA crystal structures for the 30S and 50S ribosomal subunits and the subsequent validation of comparative secondary structure models have prompted the biologists to use three-dimensional structure of ribosomal RNA (rRNA for evaluating sequence alignments of rRNA genes. Furthermore, the secondary and tertiary structural features of rRNA are highly useful and successfully employed in designing rRNA targeted oligonucleotide probes intended for in situ hybridization experiments. RNA3D, a program to combine sequence alignment information with three-dimensional structure of rRNA was developed. Integration into ARB software package, which is used extensively by the scientific community for phylogenetic analysis and molecular probe designing, has substantially extended the functionality of ARB software suite with 3D environment. Results Three-dimensional structure of rRNA is visualized in OpenGL 3D environment with the abilities to change the display and overlay information onto the molecule, dynamically. Phylogenetic information derived from the multiple sequence alignments can be overlaid onto the molecule structure in a real time. Superimposition of both statistical and non-statistical sequence associated information onto the rRNA 3D structure can be done using customizable color scheme, which is also applied to a textual sequence alignment for reference. Oligonucleotide probes designed by ARB probe design tools can be mapped onto the 3D structure along with the probe accessibility models for evaluation with respect to secondary and tertiary structural conformations of rRNA. Conclusion Visualization of three-dimensional structure of rRNA in an intuitive display provides the biologists with the greater possibilities to carry out structure based phylogenetic analysis. Coupled with secondary structure models of rRNA, RNA3D program aids in validating the sequence alignments of rRNA genes and evaluating

  17. 5S rRNA and ribosome.

    Science.gov (United States)

    Gongadze, G M

    2011-12-01

    5S rRNA is an integral component of the ribosome of all living organisms. It is known that the ribosome without 5S rRNA is functionally inactive. However, the question about the specific role of this RNA in functioning of the translation apparatus is still open. This review presents a brief history of the discovery of 5S rRNA and studies of its origin and localization in the ribosome. The previously expressed hypotheses about the role of this RNA in the functioning of the ribosome are discussed considering the unique location of 5S rRNA in the ribosome and its intermolecular contacts. Based on analysis of the current data on ribosome structure and its functional complexes, the role of 5S rRNA as an intermediary between ribosome functional domains is discussed.

  18. The Comparative RNA Web (CRW Site: an online database of comparative sequence and structure information for ribosomal, intron, and other RNAs

    Directory of Open Access Journals (Sweden)

    Müller Kirsten M

    2002-01-01

    Full Text Available Abstract Background Comparative analysis of RNA sequences is the basis for the detailed and accurate predictions of RNA structure and the determination of phylogenetic relationships for organisms that span the entire phylogenetic tree. Underlying these accomplishments are very large, well-organized, and processed collections of RNA sequences. This data, starting with the sequences organized into a database management system and aligned to reveal their higher-order structure, and patterns of conservation and variation for organisms that span the phylogenetic tree, has been collected and analyzed. This type of information can be fundamental for and have an influence on the study of phylogenetic relationships, RNA structure, and the melding of these two fields. Results We have prepared a large web site that disseminates our comparative sequence and structure models and data. The four major types of comparative information and systems available for the three ribosomal RNAs (5S, 16S, and 23S rRNA, transfer RNA (tRNA, and two of the catalytic intron RNAs (group I and group II are: (1 Current Comparative Structure Models; (2 Nucleotide Frequency and Conservation Information; (3 Sequence and Structure Data; and (4 Data Access Systems. Conclusions This online RNA sequence and structure information, the result of extensive analysis, interpretation, data collection, and computer program and web development, is accessible at our Comparative RNA Web (CRW Site http://www.rna.icmb.utexas.edu. In the future, more data and information will be added to these existing categories, new categories will be developed, and additional RNAs will be studied and presented at the CRW Site.

  19. Higher order structure in ribosomal RNA.

    Science.gov (United States)

    Gutell, R R; Noller, H F; Woese, C R

    1986-05-01

    The only reliable general method currently available for determining precise higher order structure in the large ribosomal RNAs is comparative sequence analysis. The method is here applied to reveal 'tertiary' structure in the 16S-like rRNAs, i.e. structure more complex than simple double-helical, secondary structure. From a list of computer-generated potential higher order interactions within 16S rRNA one such interaction considered likely was selected for experimental test. The putative interaction involves a Watson-Crick one to one correspondence between positions 570 and 866 in the molecule (E. coli numbering). Using existing oligonucleotide catalog information several organisms were selected whose 16S rRNA sequences might test the proposed co-variation. In all of the (phylogenetically independent) cases selected, full sequence evidence confirms the predicted one to one (Watson-Crick) correspondence. An interaction between positions 570 and 866 is, therefore, considered proven phylogenetically.

  20. The European database on small subunit ribosomal RNA

    OpenAIRE

    Wuyts, Jan; Van de Peer, Yves; Winkelmans, Tina; De Wachter, Rupert

    2002-01-01

    The European database on SSU rRNA can be consulted via the World WideWeb at http://rrna.uia.ac.be/ssu/ and compiles all complete or nearly complete small subunit ribosomal RNA sequences. Sequences are provided in aligned format. The alignment takes into account the secondary structure information derived by comparative sequence analysis of thousands of sequences. Additional information such as literature references, taxonomy, secondary structure models and nucleotide variability maps, is also...

  1. Precursors of ribosomal RNA in yeast nucleus : Biosynthesis and relation to cytoplasmic ribosomal RNA

    NARCIS (Netherlands)

    Sillevis Smitt, W.W.; Vlak, J.M.; Schiphof, R.; Rozijn, Th.H.

    In vivo methylated precursors of ribosomal RNA in yeast have been characterized on acrylamide gels. The initial ribosomal precursor in the yeast nucleus is a 37S RNA component, which is processed to a nuclear 28S RNA. Both the 37S and the 28S RNA components are important constituents of the yeast

  2. Flow Cytometry-assisted Cloning of Specific Sequence Motifs fromComplex 16S ribosomal RNA Gene Libraries.

    Energy Technology Data Exchange (ETDEWEB)

    Nielsen, J.L.; Schramm, A.; Bernhard, A.E.; van den Engh, G.J.; Stahl, D.A.

    2004-07-21

    A flow cytometry method was developed for rapid screeningand recovery of cloned DNA containing common sequence motifs. Thisapproach, termed fluorescence-activated cell sorting-assisted cloning,was used to recover sequences affiliated with a unique lineage within theBacteroidetes not abundant in a clone library of environmental 16S rRNAgenes. Retrieval and sequence analysis of phylogenetically informativegenes has become a standard cultivation-independent technique toinvestigate microbial diversity in nature (7, 18). Genes encoding the 16SrRNA, because of the relative ease of their selective amplification, havebeen most frequently employed for general diversity surveys (16).Environmental studies have also focused on specific subpopulationsaffiliated with a phylogenetic group or identified by genes encodingspecific metabolic functions (e.g., ammonia oxidation, sulfaterespiration, and nitrate reduction) (8,15,20). However, specificpopulations may be of low abundance (1,23), or the genes encodingspecific metabolic functions may be insufficiently conserved to providepriming sites for general PCR amplification. Three general approacheshave been used to obtain 16S rRNA sequence information from low-abundancepopulations: screening hundreds to thousands of clones in a general 16SrRNA gene library (21), flow cytometric sorting of a subpopulation ofenvironmentally derived cells labeled by fluorescent in situhybridization (FISH) (27), or selective PCR amplification using primersspecific for the subpopulation (2,23). While the first approach is simplytime-consuming and tedious, the second has been restricted to fairlylarge and strongly fluorescent cells from aquatic samples (5, 27). Thethird approach often generates fragments of only a few hundred bases dueto the limited number of specific priming sites. Partial sequenceinformation often degrades analysis, obscuring or distorting thephylogenetic placement of the new sequences (11, 20). A more robustcharacterization of environ

  3. Automated insertion of sequences into a ribosomal RNA alignment: An application of computational linguistics in molecular biology

    Energy Technology Data Exchange (ETDEWEB)

    Taylor, R.C.

    1991-11-01

    This thesis involved the construction of (1) a grammar that incorporates knowledge on base invariancy and secondary structure in a molecule and (2) a parser engine that uses the grammar to position bases into the structural subunits of the molecule. These concepts were combined with a novel pinning technique to form a tool that semi-automates insertion of a new species into the alignment for the 16S rRNA molecule (a component of the ribosome) maintained by Dr. Carl Woese`s group at the University of Illinois at Urbana. The tool was tested on species extracted from the alignment and on a group of entirely new species. The results were very encouraging, and the tool should be substantial aid to the curators of the 16S alignment. The construction of the grammar was itself automated, allowing application of the tool to alignments for other molecules. The logic programming language Prolog was used to construct all programs involved. The computational linguistics approach used here was found to be a useful way to attach the problem of insertion into an alignment.

  4. Automated insertion of sequences into a ribosomal RNA alignment: An application of computational linguistics in molecular biology

    Energy Technology Data Exchange (ETDEWEB)

    Taylor, R.C.

    1991-11-01

    This thesis involved the construction of (1) a grammar that incorporates knowledge on base invariancy and secondary structure in a molecule and (2) a parser engine that uses the grammar to position bases into the structural subunits of the molecule. These concepts were combined with a novel pinning technique to form a tool that semi-automates insertion of a new species into the alignment for the 16S rRNA molecule (a component of the ribosome) maintained by Dr. Carl Woese's group at the University of Illinois at Urbana. The tool was tested on species extracted from the alignment and on a group of entirely new species. The results were very encouraging, and the tool should be substantial aid to the curators of the 16S alignment. The construction of the grammar was itself automated, allowing application of the tool to alignments for other molecules. The logic programming language Prolog was used to construct all programs involved. The computational linguistics approach used here was found to be a useful way to attach the problem of insertion into an alignment.

  5. Additional data for a new Theileria sp. from China based on the sequences of ribosomal RNA internal transcribed spacers.

    Science.gov (United States)

    Liu, Junlong; Guan, Guiquan; Liu, Zhijie; Liu, Aihong; Ma, Miling; Bai, Qi; Yin, Hong; Luo, Jianxun

    2013-02-01

    Theileria sinensis was recently isolated and named as an independent Theileria species that infects cattle in China. To date, this parasite has been described based on its morphology, transmission and molecular studies, indicating that it should be classified as a distinct species. To test the validity of this taxon, the two internal transcribed spacers (ITS1 and ITS2) and the 5.8S rRNA gene were cloned and sequenced from three T. sinensis isolates. The complete ITS sequences were compared with those of other Theileria sp. available in GenBank. Phylogenetic analyses based on sequence data for the complete ITS sequences indicate that T. sinensis lies in a distinct clade that is separate from that of T. buffeli/orientalis and T. annulata. Sequence comparisons indicate that different T. sinensis isolates possess unique sizes of ITS1 and ITS2 as well as species-specific nucleotide sequences. This analysis provides new molecular data to support the classification of T. sinensis as a distinct species from other known Theileria spp. based on ITS sequences.

  6. mRNA pseudoknot structures can act as ribosomal roadblocks

    DEFF Research Database (Denmark)

    Hansen, Jesper Tholstrup; Oddershede, Lene Broeng; Sørensen, Michael Askvad

    2012-01-01

    Several viruses utilize programmed ribosomal frameshifting mediated by mRNA pseudoknots in combination with a slippery sequence to produce a well defined stochiometric ratio of the upstream encoded to the downstream-encoded protein. A correlation between the mechanical strength of mRNA pseudoknot...

  7. Phylogenetic position of Dysteria derouxi (Ciliophora:Phyllopharyngea: Dysteriida) inferred from the small subunit ribosomal RNA gene sequence

    Institute of Scientific and Technical Information of China (English)

    2006-01-01

    The complete small subunit rRNA (SSrRNA) gene sequence of a marine ciliate, Dysteria derouxi Gong and Song, 2004, was determined to be of 1 708 nucleotides. The phylogenetic position of this species within the class Phyllopharyngea was deduced using distance matrix, maximum parsimony and maximum likelihood methods. Dysteria derouxi, together with other available ciliates of the class Phyllopharyngea, forms a monophyletic clade with strong bootstrap support in the distance matrix, maximum parsimony and likelihood tree construction methods, while the dysterids are, as a monophyletic group, phylogenetically close to the clade of chlamydodontids [values of 100% LS(least-squares), 100% NJ(neighbor-joining)]. In addition, the trees indicate that dysteriids may be a higher or specialized group within the class, which corresponds well to the morphology and infraciliature.

  8. Reconstitution of functional eukaryotic ribosomes from Dictyostelium discoideum ribosomal proteins and RNA.

    Science.gov (United States)

    Mangiarotti, G; Chiaberge, S

    1997-08-08

    40 and 60 S ribosomal subunits have been reconstituted in vitro from purified ribosomal RNA and ribosomal proteins of Dictyostelium discoideum. The functionality of the reconstituted ribosomes was demonstrated in in vitro mRNA-directed protein synthesis. The reassembly proceeded well with immature precursors of ribosomal RNA but poorly if at all with mature cytoplasmic RNA species. Reassembly also required a preparation of small nuclear RNA(s), acting as morphopoietic factor(s).

  9. The origin of the 5S ribosomal RNA molecule could have been caused by a single inverse duplication: strong evidence from its sequences.

    Science.gov (United States)

    Branciamore, Sergio; Di Giulio, Massimo

    2012-04-01

    The secondary structure of the 5S ribosomal RNA (5S rRNA) molecule shows a high degree of symmetry. In order to explain the origin of this symmetry, it has been conjectured that one half of the 5S rRNA molecule was its precursor and that an indirect duplication of this precursor created the other half and thus the current symmetry of the molecule. Here, we have subjected to an empirical test both the indirect duplication model, analysing a total of 684 5S rRNA sequences for complementarity between the two halves of the 5S rRNA, and the direct duplication model analysing in this case the similarity between the two halves of this molecule. In intra- and inter-molecule and intra- and inter-domain comparisons, we find a high statistical support to the hypothesis of a complementarity relationship between the two halves of the 5S rRNA molecule, denying vice versa the hypothesis of similarity between these halves. Therefore, these observations corroborate the indirect duplication model at the expense of the direct duplication model, as reason of the origin of the 5S rRNA molecule. More generally, we discuss and favour the hypothesis that all RNAs and proteins, which present symmetry, did so through gene duplication and not by gradualistic accumulation of few monomers or segments of molecule into a gradualistic growth process. This would be the consequence of the very high propensity that nucleic acids have to be subjected to duplications.

  10. The 28S-18S rDNA intergenic spacer from Crithidia fasciculata: repeated sequences, length heterogeneity, putative processing sites and potential interactions between U3 small nucleolar RNA and the ribosomal RNA precursor.

    Science.gov (United States)

    Schnare, M N; Collings, J C; Spencer, D F; Gray, M W

    2000-09-15

    In Crithidia fasciculata, the ribosomal RNA (rRNA) gene repeats range in size from approximately 11 to 12 kb. This length heterogeneity is localized to a region of the intergenic spacer (IGS) that contains tandemly repeated copies of a 19mer sequence. The IGS also contains four copies of an approximately 55 nt repeat that has an internal inverted repeat and is also present in the IGS of Leishmania species. We have mapped the C.fasciculata transcription initiation site as well as two other reverse transcriptase stop sites that may be analogous to the A0 and A' pre-rRNA processing sites within the 5' external transcribed spacer (ETS) of other eukaryotes. Features that could influence processing at these sites include two stretches of conserved primary sequence and three secondary structure elements present in the 5' ETS. We also characterized the C.fasciculata U3 snoRNA, which has the potential for base-pairing with pre-rRNA sequences. Finally, we demonstrate that biosynthesis of large subunit rRNA in both C. fasciculata and Trypanosoma brucei involves 3'-terminal addition of three A residues that are not present in the corresponding DNA sequences.

  11. Molecular and phylogenetic characterizations of an Eimeria krijgsmanni Yakimoff & Gouseff, 1938 (Apicomplexa: Eimeriidae) mouse intestinal protozoan parasite by partial 18S ribosomal RNA gene sequence analysis.

    Science.gov (United States)

    Takeo, Toshinori; Tanaka, Tetsuya; Matsubayashi, Makoto; Maeda, Hiroki; Kusakisako, Kodai; Matsui, Toshihiro; Mochizuki, Masami; Matsuo, Tomohide

    2014-08-01

    Previously, we characterized an undocumented strain of Eimeria krijgsmanni by morphological and biological features. Here, we present a detailed molecular phylogenetic analysis of this organism. Namely, 18S ribosomal RNA gene (rDNA) sequences of E. krijgsmanni were analyzed to incorporate this species into a comprehensive Eimeria phylogeny. As a result, partial 18S rDNA sequence from E. krijgsmanni was successfully determined, and two different types, Type A and Type B, that differed by 1 base pair were identified. E. krijgsmanni was originally isolated from a single oocyst, and thus the result show that the two types might have allelic sequence heterogeneity in the 18S rDNA. Based on phylogenetic analyses, the two types of E. krijgsmanni 18S rDNA formed one of two clades among murine Eimeria spp.; these Eimeria clades reflected morphological similarity among the Eimeria spp. This is the third molecular phylogenetic characterization of a murine Eimeria spp. in addition to E. falciformis and E. papillata.

  12. Ribosomal RNA pseudouridines and pseudouridine synthases.

    Science.gov (United States)

    Ofengand, James

    2002-03-01

    Pseudouridines are found in virtually all ribosomal RNAs but their function is unknown. There are four to eight times more pseudouridines in eukaryotes than in eubacteria. Mapping 19 Haloarcula marismortui pseudouridines on the three-dimensional 50S subunit does not show clustering. In bacteria, specific enzymes choose the site of pseudouridine formation. In eukaryotes, and probably also in archaea, selection and modification is done by a guide RNA-protein complex. No unique specific role for ribosomal pseudouridines has been identified. We propose that pseudouridine's function is as a molecular glue to stabilize required RNA conformations that would otherwise be too flexible.

  13. PHYLOGENETIC RELATIONSHIP OF ALEXANDRIUM MONILATUM (DINOPHYCAE)TO OTHER ALEXANDRIUM SPECIES BASED ON 18S RIBOSOMAL RNA GENE SEQUENCES

    Science.gov (United States)

    The phylogenetic relationship of Alexandrium monilatum to other Alexandrium spp. was explored using 18S rDNA sequences. Maximum likelihood phylogenetic analysis of the combined rDNA sequences established that A. monilatum paired with Alexandrium taylori and that the pair was the ...

  14. PHYLOGENETIC RELATIONSHIP OF ALEXANDRIUM MONILATUM (DINOPHYCEAE) TO OTHER ALEXANDRIUM SPECIES BASED ON 18S RIBOSOMAL RNA GENE SEQUENCES

    Science.gov (United States)

    The phylogenetic relationship of Alexandrium monilatum to other Alexandrium spp. was explored using 18S rDNA sequences. Maximum likelilhood phylogenetic analysis of the combined rDNA sequences established that A. monilatum paired with Alexandrium taylori and that the pair was the...

  15. Nucleotide sequences of chloroplast 5S ribosomal RNA from cell suspension cultures of the liverworts Marchantia polymorpha and Jungermannia subulata.

    OpenAIRE

    Yamano, Y; Ohyama, K; Komano, T

    1984-01-01

    The nucleotide sequences of chloroplast 5S rRNAs from cell suspension cultures of the liverworts Marchantia polymorpha and Jungermannia subulata were determined. Their nucleotide sequences, 119 nucleotides long, were highly homologous to each other (96% identity) and had high homology with those from chloroplast 5S rRNAs of two higher plants, tobacco (92% identity) and spinach (92-91% identity), but less homology (87-85% identity) with that from a lower plant, the fern Dryopteris acuminata.

  16. Monophyly of the ring-forming group in Diplopoda (Myriapoda, Arthropoda) based on SSU and LSU ribosomal RNA sequences

    Institute of Scientific and Technical Information of China (English)

    Peiyun Cong; Xuhua Xia; Qun Yang

    2009-01-01

    Two controversies exist in the phylogeny of the derived millipedes (Diplopoda). The first is whether millipedes with a fusion ring, including Polydesmida, Spirobolida, Spirostreptida and Julida, form a monophyletic group (the ring-forming group). The second concerns the phylogenetic relationship within the three orders of Juliformia, i.e. Julida, Spirostreptida and Spirobolida. To resolve these phylogenetic controversies, we sequenced 18S and 28S rDNA from six millipede orders and retrieved several homologous sequences from GenBank. Our results give robust support to the monophyly of the ring-forming group based on maximum parsimony methods, max-imum likelihood methods and Bayesian inference. The monophyly of the ring-forming group suggests that the fusion of segment sclerites might have occurred only once during millipede evolutionary history. We also established a sister-group relationship between Spirobol-ida and Spirostreptida within Jnliformia after eliminating a short-branch attraction phenomenon, which is consistent with that from the mitochondrial genome analysis.

  17. Cisplatin Targeting of Bacterial Ribosomal RNA Hairpins

    Directory of Open Access Journals (Sweden)

    Gayani N. P. Dedduwa-Mudalige

    2015-09-01

    Full Text Available Cisplatin is a clinically important chemotherapeutic agent known to target purine bases in nucleic acids. In addition to major deoxyribonucleic acid (DNA intrastrand cross-links, cisplatin also forms stable adducts with many types of ribonucleic acid (RNA including siRNA, spliceosomal RNAs, tRNA, and rRNA. All of these RNAs play vital roles in the cell, such as catalysis of protein synthesis by rRNA, and therefore serve as potential drug targets. This work focused on platination of two highly conserved RNA hairpins from E. coli ribosomes, namely pseudouridine-modified helix 69 from 23S rRNA and the 790 loop of helix 24 from 16S rRNA. RNase T1 probing, MALDI mass spectrometry, and dimethyl sulfate mapping revealed platination at GpG sites. Chemical probing results also showed platination-induced RNA structural changes. These findings reveal solvent and structural accessibility of sites within bacterial RNA secondary structures that are functionally significant and therefore viable targets for cisplatin as well as other classes of small molecules. Identifying target preferences at the nucleotide level, as well as determining cisplatin-induced RNA conformational changes, is important for the design of more potent drug molecules. Furthermore, the knowledge gained through studies of RNA-targeting by cisplatin is applicable to a broad range of organisms from bacteria to human.

  18. 16S ribosomal RNA pseudouridine synthase RsuA of Escherichia coli: deletion, mutation of the conserved Asp102 residue, and sequence comparison among all other pseudouridine synthases.

    Science.gov (United States)

    Conrad, J; Niu, L; Rudd, K; Lane, B G; Ofengand, J

    1999-06-01

    The gene for RsuA, the pseudouridine synthase that converts U516 to pseudouridine in 16S ribosomal RNA of Escherichia coli, has been deleted in strains MG1655 and BL21/DE3. Deletion of this gene resulted in the specific loss of pseudouridine516 in both cell lines, and replacement of the gene in trans on a plasmid restored the pseudouridine. Therefore, rsuA is the only gene in E. coli with the ability to produce a protein capable of forming pseudouridine516. There was no effect on the growth rate of rsuA- MG1655 either in rich or minimal medium at either 24, 37, or 42 degrees C. Plasmid rescue of the BL21/DE3 rsuA- strain using pET15b containing an rsuA gene with aspartate102 replaced by asparagine or threonine demonstrated that neither mutant was active in vivo. This result supports a role for this aspartate, located in a unique GRLD sequence in this gene, at the catalytic center of the synthase. Induction of wild-type and the two mutant synthases in strain BL21/DE3 from genes in pET15b yielded a strong overexpression of all three proteins in approximately equal amounts showing that the mutations did not affect production of the protein in vivo and thus that the lack of activity was not due to a failure to produce a gene product. Aspartate102 is found in a conserved motif present in many pseudouridine synthases. The conservation and distribution of this motif in nature was assessed.

  19. Reverse Translocation of tRNA in the Ribosome

    OpenAIRE

    2006-01-01

    A widely held view is that directional movement of tRNA in the ribosome is determined by an intrinsic mechanism and driven thermodynamically by transpeptidation. Here, we show that, in certain ribosomal complexes, the pretranslocation (PRE) state is thermodynamically favored over the posttranslocation (POST) state. Spontaneous and efficient conversion from the POST to PRE state is observed when EF-G is depleted from ribosomes in the POST state or when tRNA is added to the E site of ribosomes ...

  20. Dynamics of translation by single ribosomes through mRNA secondary structures

    OpenAIRE

    Chen, Chunlai; Zhang, Haibo; Broitman, Steven L.; Reiche, Michael; Farrell, Ian; Cooperman, Barry S.; Goldman, Yale E.

    2013-01-01

    During protein synthesis, the ribosome translates nucleotide triplets in single-stranded mRNA into polypeptide sequences. Strong downstream mRNA secondary (2°) structures, which must be unfolded for translation, can slow or even halt protein synthesis. Here we employ single molecule fluorescence resonance energy transfer to determine reaction rates for specific steps within the elongation cycle as the Escherichia coli ribosome encounters stem loop or pseudoknot mRNA 2° structures. Downstream ...

  1. Ribosomal RNA: a key to phylogeny

    Science.gov (United States)

    Olsen, G. J.; Woese, C. R.

    1993-01-01

    As molecular phylogeny increasingly shapes our understanding of organismal relationships, no molecule has been applied to more questions than have ribosomal RNAs. We review this role of the rRNAs and some of the insights that have been gained from them. We also offer some of the practical considerations in extracting the phylogenetic information from the sequences. Finally, we stress the importance of comparing results from multiple molecules, both as a method for testing the overall reliability of the organismal phylogeny and as a method for more broadly exploring the history of the genome.

  2. Ribosomal RNA: a key to phylogeny

    Science.gov (United States)

    Olsen, G. J.; Woese, C. R.

    1993-01-01

    As molecular phylogeny increasingly shapes our understanding of organismal relationships, no molecule has been applied to more questions than have ribosomal RNAs. We review this role of the rRNAs and some of the insights that have been gained from them. We also offer some of the practical considerations in extracting the phylogenetic information from the sequences. Finally, we stress the importance of comparing results from multiple molecules, both as a method for testing the overall reliability of the organismal phylogeny and as a method for more broadly exploring the history of the genome.

  3. Structural features of the tmRNA-ribosome interaction.

    Science.gov (United States)

    Bugaeva, Elizaveta Y; Surkov, Serhiy; Golovin, Andrey V; Ofverstedt, Lars-Göran; Skoglund, Ulf; Isaksson, Leif A; Bogdanov, Alexey A; Shpanchenko, Olga V; Dontsova, Olga A

    2009-12-01

    Trans-translation is a process which switches the synthesis of a polypeptide chain encoded by a nonstop messenger RNA to the mRNA-like domain of a transfer-messenger RNA (tmRNA). It is used in bacterial cells for rescuing the ribosomes arrested during translation of damaged mRNA and directing this mRNA and the product polypeptide for degradation. The molecular basis of this process is not well understood. Earlier, we developed an approach that allowed isolation of tmRNA-ribosomal complexes arrested at a desired step of tmRNA passage through the ribosome. We have here exploited it to examine the tmRNA structure using chemical probing and cryo-electron microscopy tomography. Computer modeling has been used to develop a model for spatial organization of the tmRNA inside the ribosome at different stages of trans-translation.

  4. tmRNA-SmpB: a journey to the centre of the bacterial ribosome.

    Science.gov (United States)

    Weis, Félix; Bron, Patrick; Giudice, Emmanuel; Rolland, Jean-Paul; Thomas, Daniel; Felden, Brice; Gillet, Reynald

    2010-11-17

    Ribosomes mediate protein synthesis by decoding the information carried by messenger RNAs (mRNAs) and catalysing peptide bond formation between amino acids. When bacterial ribosomes stall on incomplete messages, the trans-translation quality control mechanism is activated by the transfer-messenger RNA bound to small protein B (tmRNA-SmpB ribonucleoprotein complex). Trans-translation liberates the stalled ribosomes and triggers degradation of the incomplete proteins. Here, we present the cryo-electron microscopy structures of tmRNA-SmpB accommodated or translocated into stalled ribosomes. Two atomic models for each state are proposed. This study reveals how tmRNA-SmpB crosses the ribosome and how, as the problematic mRNA is ejected, the tmRNA resume codon is placed onto the ribosomal decoding site by new contacts between SmpB and the nucleotides upstream of the tag-encoding sequence. This provides a structural basis for the transit of the large tmRNA-SmpB complex through the ribosome and for the means by which the tmRNA internal frame is set for translation to resume.

  5. Mapping the interaction of SmpB with ribosomes by footprinting of ribosomal RNA

    Science.gov (United States)

    Ivanova, Natalia; Pavlov, Michael Y.; Bouakaz, Elli; Ehrenberg, Måns; Schiavone, Lovisa Holmberg

    2005-01-01

    In trans-translation transfer messenger RNA (tmRNA) and small protein B (SmpB) rescue ribosomes stalled on truncated or in other ways problematic mRNAs. SmpB promotes the binding of tmRNA to the ribosome but there is uncertainty about the number of participating SmpB molecules as well as their ribosomal location. Here, the interaction of SmpB with ribosomal subunits and ribosomes was studied by isolation of SmpB containing complexes followed by chemical modification of ribosomal RNA with dimethyl sulfate, kethoxal and hydroxyl radicals. The results show that SmpB binds 30S and 50S subunits with 1:1 molar ratios and the 70S ribosome with 2:1 molar ratio. SmpB-footprints are similar on subunits and the ribosome. In the 30S subunit, SmpB footprints nucleotides that are in the vicinity of the P-site facing the E-site, and in the 50S subunit SmpB footprints nucleotides that are located below the L7/L12 stalk in the 3D structure of the ribosome. Based on these results, we suggest a mechanism where two molecules of SmpB interact with tmRNA and the ribosome during trans-translation. The first SmpB molecule binds near the factor-binding site on the 50S subunit helping tmRNA accommodation on the ribosome, whereas the second SmpB molecule may functionally substitute for a missing anticodon stem–loop in tmRNA during later steps of trans-translation. PMID:15972795

  6. Structural and Functional Studies of Ribosome-inactivating Proteins and Ribosomal RNA

    Institute of Scientific and Technical Information of China (English)

    LIU Wangyi; ZHANG Jinsong; LIU Renshui; HE Wenjun; LING Jun

    2007-01-01

    @@ A plant's ribosome-inactivating proteins (RIPs) are a group of toxic proteins. Theoretically, they can be employed as a tool enzyme in the exploration of the structure and function of the ribosomal RNA; in practical application, they can be used as an insecticide in agriculture, for preparation of immuno-toxic protein to kill cancer cells or against viral infection in medicine.

  7. Counterselection of prokaryotic ribosomal RNA during reverse transcription using non-random hexameric oligonucleotides.

    Science.gov (United States)

    Gonzalez, J M; Robb, F T

    2007-12-01

    Ribosomal RNA (rRNA) is the major component in total RNA extracts, interfering with the synthesis of cDNA corresponding to messenger RNA (mRNA). In this study, we present a novel strategy for selectively discriminating against rRNA and favoring mRNA from prokaryotes during synthesis of cDNA by reverse transcriptase. Our technique is based on the fact that rRNA sequences, in many species, are G+C rich relative to the genome at large, and highly conserved among prokaryotes. The sequence TTTT is therefore rarely found in rRNA sequences. However, TTTT priming sites are found at a much higher frequency in protein-encoding gene sequences. We designed specific hexamers (HD/DHTTTT) to prime reverse transcription reactions resulting in a selective synthesis of cDNA corresponding to mRNA from prokaryotic total RNA extractions.

  8. Structural insights into the assembly of the 30S ribosomal subunit in vivo: functional role of S5 and location of the 17S rRNA precursor sequence.

    Science.gov (United States)

    Yang, Zhixiu; Guo, Qiang; Goto, Simon; Chen, Yuling; Li, Ningning; Yan, Kaige; Zhang, Yixiao; Muto, Akira; Deng, Haiteng; Himeno, Hyouta; Lei, Jianlin; Gao, Ning

    2014-05-01

    The in vivo assembly of ribosomal subunits is a highly complex process, with a tight coordination between protein assembly and rRNA maturation events, such as folding and processing of rRNA precursors, as well as modifications of selected bases. In the cell, a large number of factors are required to ensure the efficiency and fidelity of subunit production. Here we characterize the immature 30S subunits accumulated in a factor-null Escherichia coli strain (∆rsgA∆rbfA). The immature 30S subunits isolated with varying salt concentrations in the buffer system show interesting differences on both protein composition and structure. Specifically, intermediates derived under the two contrasting salt conditions (high and low) likely reflect two distinctive assembly stages, the relatively early and late stages of the 3' domain assembly, respectively. Detailed structural analysis demonstrates a mechanistic coupling between the maturation of the 5' end of the 17S rRNA and the assembly of the 30S head domain, and attributes a unique role of S5 in coordinating these two events. Furthermore, our structural results likely reveal the location of the unprocessed terminal sequences of the 17S rRNA, and suggest that the maturation events of the 17S rRNA could be employed as quality control mechanisms on subunit production and protein translation.

  9. Translation with frameshifting of ribosome along mRNA transcript

    CERN Document Server

    Li, Jingwei

    2015-01-01

    Translation is an important process for prokaryotic and eukaryotic cells to produce necessary proteins for cell growth. Numerious experiments have been performed to explore the translational properties. Diverse models have also been developed to determine the biochemical mechanism of translation. However, to simplify the majority of the existing models, the frameshifting of ribosome along the mRNA transcript is neglected, which actually occurs in real cells and has been extensively experimentally studied. The frameshifting of ribosome evidently influences the efficiency and speed of translation, considering that the peptide chains synthesized by shifted ribosomes will not fold into functional proteins and will degrade rapidly. In this study, a theoretical model is presented to describe the translational process based on the model for totally asymmetric simple exclusion process. In this model, the frameshifting of the ribosome along the mRNA transcript and the attachment/detachment of the ribosome to/from the ...

  10. Ribosomal DNA copy number loss and sequence variation in cancer.

    Science.gov (United States)

    Xu, Baoshan; Li, Hua; Perry, John M; Singh, Vijay Pratap; Unruh, Jay; Yu, Zulin; Zakari, Musinu; McDowell, William; Li, Linheng; Gerton, Jennifer L

    2017-06-01

    Ribosomal DNA is one of the most variable regions in the human genome with respect to copy number. Despite the importance of rDNA for cellular function, we know virtually nothing about what governs its copy number, stability, and sequence in the mammalian genome due to challenges associated with mapping and analysis. We applied computational and droplet digital PCR approaches to measure rDNA copy number in normal and cancer states in human and mouse genomes. We find that copy number and sequence can change in cancer genomes. Counterintuitively, human cancer genomes show a loss of copies, accompanied by global copy number co-variation. The sequence can also be more variable in the cancer genome. Cancer genomes with lower copies have mutational evidence of mTOR hyperactivity. The PTEN phosphatase is a tumor suppressor that is critical for genome stability and a negative regulator of the mTOR kinase pathway. Surprisingly, but consistent with the human cancer genomes, hematopoietic cancer stem cells from a Pten-/- mouse model for leukemia have lower rDNA copy number than normal tissue, despite increased proliferation, rRNA production, and protein synthesis. Loss of copies occurs early and is associated with hypersensitivity to DNA damage. Therefore, copy loss is a recurrent feature in cancers associated with mTOR activation. Ribosomal DNA copy number may be a simple and useful indicator of whether a cancer will be sensitive to DNA damaging treatments.

  11. The Expression of Antibiotic Resistance Methyltransferase Correlates with mRNA Stability Independently of Ribosome Stalling.

    Science.gov (United States)

    Dzyubak, Ekaterina; Yap, M N

    2016-12-01

    Members of the Erm methyltransferase family modify 23S rRNA of the bacterial ribosome and render cross-resistance to macrolides and multiple distantly related antibiotics. Previous studies have shown that the expression of erm is activated when a macrolide-bound ribosome stalls the translation of the leader peptide preceding the cotranscribed erm Ribosome stalling is thought to destabilize the inhibitory stem-loop mRNA structure and exposes the erm Shine-Dalgarno (SD) sequence for translational initiation. Paradoxically, mutations that abolish ribosome stalling are routinely found in hyper-resistant clinical isolates; however, the significance of the stalling-dead leader sequence is largely unknown. Here, we show that nonsense mutations in the Staphylococcus aureus ErmB leader peptide (ErmBL) lead to high basal and induced expression of downstream ErmB in the absence or presence of macrolide concomitantly with elevated ribosome methylation and resistance. The overexpression of ErmB is associated with the reduced turnover of the ermBL-ermB transcript, and the macrolide appears to mitigate mRNA cleavage at a site immediately downstream of the ermBL SD sequence. The stabilizing effect of antibiotics on mRNA is not limited to ermBL-ermB; cationic antibiotics representing a ribosome-stalling inducer and a noninducer increase the half-life of specific transcripts. These data unveil a new layer of ermB regulation and imply that ErmBL translation or ribosome stalling serves as a "tuner" to suppress aberrant production of ErmB because methylated ribosome may impose a fitness cost on the bacterium as a result of misregulated translation.

  12. Dynamics of translation by single ribosomes through mRNA secondary structures.

    Science.gov (United States)

    Chen, Chunlai; Zhang, Haibo; Broitman, Steven L; Reiche, Michael; Farrell, Ian; Cooperman, Barry S; Goldman, Yale E

    2013-05-01

    During protein synthesis, the ribosome translates nucleotide triplets in single-stranded mRNA into polypeptide sequences. Strong downstream mRNA secondary structures, which must be unfolded for translation, can slow or even halt protein synthesis. Here we used single-molecule fluorescence resonance energy transfer to determine reaction rates for specific steps within the elongation cycle as the Escherichia coli ribosome encounters stem-loop or pseudoknot mRNA secondary structures. Downstream stem-loops containing 100% GC base pairs decrease the rates of both tRNA translocation within the ribosome and deacylated tRNA dissociation from the ribosomal exit site (E site). Downstream stem-loops or pseudoknots containing both GC and AU pairs also decrease the rate of tRNA dissociation, but they have little effect on tRNA translocation rate. Thus, somewhat unexpectedly, unfolding of mRNA secondary structures is more closely coupled to E-site tRNA dissociation than to tRNA translocation.

  13. Evidence for several higher order structural elements in ribosomal RNA.

    Science.gov (United States)

    Woese, C R; Gutell, R R

    1989-05-01

    Comparative analysis of small subunit ribosomal RNA sequences suggests the existence of two new higher order interactions: (i) a double-helical structure involving positions 505-507 and 524-526 (Escherichia coli numbering) and (ii) an interaction between the region of position 130 and the helix located approximately between positions 180 and 195. In the first of these, one of the strands of the helix exists in the bulge loop, and the other strand exists in the terminal loop of a previously recognized compound helix involving positions 500-545. Therefore, the new structure formally represents a pseudoknot. In the second, the insertion/deletion of a nucleotide in the vicinity of position 130 correlates with the length of the helix in the 180-195 region, the latter having a 3-base-pair stalk when the base in question is deleted and a stalk of approximately 10 pairs when it is inserted.

  14. Phylogenetic analysis of ruminant Theileria spp. from China based on 28S ribosomal RNA gene.

    Science.gov (United States)

    Gou, Huitian; Guan, Guiquan; Ma, Miling; Liu, Aihong; Liu, Zhijie; Xu, Zongke; Ren, Qiaoyun; Li, Youquan; Yang, Jifei; Chen, Ze; Yin, Hong; Luo, Jianxun

    2013-10-01

    Species identification using DNA sequences is the basis for DNA taxonomy. In this study, we sequenced the ribosomal large-subunit RNA gene sequences (3,037-3,061 bp) in length of 13 Chinese Theileria stocks that were infective to cattle and sheep. The complete 28S rRNA gene is relatively difficult to amplify and its conserved region is not important for phylogenetic study. Therefore, we selected the D2-D3 region from the complete 28S rRNA sequences for phylogenetic analysis. Our analyses of 28S rRNA gene sequences showed that the 28S rRNA was useful as a phylogenetic marker for analyzing the relationships among Theileria spp. in ruminants. In addition, the D2-D3 region was a short segment that could be used instead of the whole 28S rRNA sequence during the phylogenetic analysis of Theileria, and it may be an ideal DNA barcode.

  15. Hierarchical RNA Processing Is Required for Mitochondrial Ribosome Assembly

    Directory of Open Access Journals (Sweden)

    Oliver Rackham

    2016-08-01

    Full Text Available The regulation of mitochondrial RNA processing and its importance for ribosome biogenesis and energy metabolism are not clear. We generated conditional knockout mice of the endoribonuclease component of the RNase P complex, MRPP3, and report that it is essential for life and that heart and skeletal-muscle-specific knockout leads to severe cardiomyopathy, indicating that its activity is non-redundant. Transcriptome-wide parallel analyses of RNA ends (PARE and RNA-seq enabled us to identify that in vivo 5′ tRNA cleavage precedes 3′ tRNA processing, and this is required for the correct biogenesis of the mitochondrial ribosomal subunits. We identify that mitoribosomal biogenesis proceeds co-transcriptionally because large mitoribosomal proteins can form a subcomplex on an unprocessed RNA containing the 16S rRNA. Taken together, our data show that RNA processing links transcription to translation via assembly of the mitoribosome.

  16. A Molecular Titration System Coordinates Ribosomal Protein Gene Transcription with Ribosomal RNA Synthesis.

    Science.gov (United States)

    Albert, Benjamin; Knight, Britta; Merwin, Jason; Martin, Victoria; Ottoz, Diana; Gloor, Yvonne; Bruzzone, Maria Jessica; Rudner, Adam; Shore, David

    2016-11-17

    Cell growth potential is determined by the rate of ribosome biogenesis, a complex process that requires massive and coordinated transcriptional output. In the yeast Saccharomyces cerevisiae, ribosome biogenesis is highly regulated at the transcriptional level. Although evidence for a system that coordinates ribosomal RNA (rRNA) and ribosomal protein gene (RPG) transcription has been described, the molecular mechanisms remain poorly understood. Here we show that an interaction between the RPG transcriptional activator Ifh1 and the rRNA processing factor Utp22 serves to coordinate RPG transcription with that of rRNA. We demonstrate that Ifh1 is rapidly released from RPG promoters by a Utp22-independent mechanism following growth inhibition, but that its long-term dissociation requires Utp22. We present evidence that RNA polymerase I activity inhibits the ability of Utp22 to titrate Ifh1 from RPG promoters and propose that a dynamic Ifh1-Utp22 interaction fine-tunes RPG expression to coordinate RPG and rRNA transcription. Copyright © 2016 Elsevier Inc. All rights reserved.

  17. Dwell-Time Distribution, Long Pausing and Arrest of Single-Ribosome Translation through the mRNA Duplex

    Directory of Open Access Journals (Sweden)

    Ping Xie

    2015-10-01

    Full Text Available Proteins in the cell are synthesized by a ribosome translating the genetic information encoded on the single-stranded messenger RNA (mRNA. It has been shown that the ribosome can also translate through the duplex region of the mRNA by unwinding the duplex. Here, based on our proposed model of the ribosome translation through the mRNA duplex we study theoretically the distribution of dwell times of the ribosome translation through the mRNA duplex under the effect of a pulling force externally applied to the ends of the mRNA to unzip the duplex. We provide quantitative explanations of the available single molecule experimental data on the distribution of dwell times with both short and long durations, on rescuing of the long paused ribosomes by raising the pulling force to unzip the duplex, on translational arrests induced by the mRNA duplex and Shine-Dalgarno(SD-like sequence in the mRNA. The functional consequences of the pauses or arrests caused by the mRNA duplex and the SD sequence are discussed and compared with those obtained from other types of pausing, such as those induced by “hungry” codons or interactions of specific sequences in the nascent chain with the ribosomal exit tunnel.

  18. Detection of Cryptosporidium species in feces or gastric contents from snakes and lizards as determined by polymerase chain reaction analysis and partial sequencing of the 18S ribosomal RNA gene.

    Science.gov (United States)

    Richter, Barbara; Nedorost, Nora; Maderner, Anton; Weissenböck, Herbert

    2011-05-01

    Cryptosporidiosis is a well-known gastrointestinal disease of snakes and lizards. In the current study, 672 samples (feces and/or gastric contents or regurgitated food items) of various snakes and lizards were examined for the presence of cryptosporidia by polymerase chain reaction (PCR) assay targeting a part of the 18S ribosomal RNA gene. A consecutive sequencing reaction was used to identify the cryptosporidian species present in PCR-positive samples. Cryptosporidium varanii (saurophilum) was detected in 17 out of 106 (16%) samples from corn snakes (Pantherophis guttatus) and in 32 out of 462 (7%) samples from leopard geckos (Eublepharis macularius). Cryptosporidium serpentis was found in 8 out of 462 (2%) leopard gecko samples, but in no other reptile. The Cryptosporidium sp. "lizard genotype" was present in 1 leopard gecko sample, and 1 sample from a corn snake showed a single nucleotide mismatch to this genotype. Pseudoparasitic cryptosporidian species were identified in 5 out of 174 (3%) ophidian samples, but not in lizards. Other sequences did not show complete similarity to previously published Cryptosporidium sequences. The results stress the importance for diagnostic methods to be specific for Cryptosporidium species especially in snakes and show a relatively high prevalence of C. varanii in leopard geckos and corn snakes.

  19. Ribosomal protein S7 from Escherichia coli uses the same determinants to bind 16S ribosomal RNA and its messenger RNA.

    Science.gov (United States)

    Robert, F; Brakier-Gingras, L

    2001-02-01

    Ribosomal protein S7 from Escherichia coli binds to the lower half of the 3' major domain of 16S rRNA and initiates its folding. It also binds to its own mRNA, the str mRNA, and represses its translation. Using filter binding assays, we show in this study that the same mutations that interfere with S7 binding to 16S rRNA also weaken its affinity for its mRNA. This suggests that the same protein regions are responsible for mRNA and rRNA binding affinities, and that S7 recognizes identical sequence elements within the two RNA targets, although they have dissimilar secondary structures. Overexpression of S7 is known to inhibit bacterial growth. This phenotypic growth defect was relieved in cells overexpressing S7 mutants that bind poorly the str mRNA, confirming that growth impairment is controlled by the binding of S7 to its mRNA. Interestingly, a mutant with a short deletion at the C-terminus of S7 was more detrimental to cell growth than wild-type S7. This suggests that the C-terminal portion of S7 plays an important role in ribosome function, which is perturbed by the deletion.

  20. Reverse translocation of tRNA in the ribosome.

    Science.gov (United States)

    Shoji, Shinichiro; Walker, Sarah E; Fredrick, Kurt

    2006-12-28

    A widely held view is that directional movement of tRNA in the ribosome is determined by an intrinsic mechanism and driven thermodynamically by transpeptidation. Here, we show that, in certain ribosomal complexes, the pretranslocation (PRE) state is thermodynamically favored over the posttranslocation (POST) state. Spontaneous and efficient conversion from the POST to PRE state is observed when EF-G is depleted from ribosomes in the POST state or when tRNA is added to the E site of ribosomes containing P-site tRNA. In the latter assay, the rate of tRNA movement is increased by streptomycin and neomycin, decreased by tetracycline, and not affected by the acylation state of the tRNA. In one case, we provide evidence that complex conversion occurs by reverse translocation (i.e., direct movement of the tRNAs from the E and P sites to the P and A sites, respectively). These findings have important implications for the energetics of translocation.

  1. Conservation of RNA sequence and cross-linking ability in ribosomes from a higher eukaryote: photochemical cross-linking of the anticodon of P site bound tRNA to the penultimate cytidine of the UACACACG sequence in Artemia salina 18S rRNA.

    Science.gov (United States)

    Ciesiolka, J; Nurse, K; Klein, J; Ofengand, J

    1985-06-18

    The complex of Artemia salina ribosomes and Escherichia coli acetylvalyl-tRNA could be cross-linked by irradiation with near-UV light. Cross-linking required the presence of the codon GUU, GUA being ineffective. The acetylvalyl group could be released from the cross-linked tRNA by treatment with puromycin, demonstrating that cross-linking had occurred at the P site. This was true both for pGUU- and also for poly(U2,G)-dependent cross-linking. All of the cross-linking was to the 18S rRNA of the small ribosomal subunit. Photolysis of the cross-link at 254 nm occurred with the same kinetics as that for the known cyclobutane dimer between this tRNA and Escherichia coli 16S rRNA. T1 RNase digestion of the cross-linked tRNA yielded an oligonucleotide larger in molecular weight than any from un-cross-linked rRNA or tRNA or from a prephotolyzed complex. Extended electrophoresis showed this material to consist of two oligomers of similar mobility, a faster one-third component and a slower two-thirds component. Each oligomer yielded two components on 254-nm photolysis. The slower band from each was the tRNA T1 oligomer CACCUCCCUVACAAGp, which includes the anticodon. The faster band was the rRNA 9-mer UACACACCGp and its derivative UACACACUG. Unexpectedly, the dephosphorylated and slower moving 9-mer was derived from the faster moving dimer. Deamination of the penultimate C to U is probably due to cyclobutane dimer formation and was evidence for that nucleotide being the site of cross-linking. Direct confirmation of the cross-linking site was obtained by "Z"-gel analysis [Ehresmann, C., & Ofengand, J. (1984) Biochemistry 23, 438-445].(ABSTRACT TRUNCATED AT 250 WORDS)

  2. Polyadenylation of ribosomal RNA in human cells

    OpenAIRE

    Slomovic, Shimyn; Laufer, David; Geiger, Dan; Schuster, Gadi

    2006-01-01

    The addition of poly(A)-tails to RNA is a process common to almost all organisms. In eukaryotes, stable poly(A)-tails, important for mRNA stability and translation initiation, are added to the 3′ ends of most nuclear-encoded mRNAs, but not to rRNAs. Contrarily, in prokaryotes and organelles, polyadenylation stimulates RNA degradation. Recently, polyadenylation of nuclear-encoded transcripts in yeast was reported to promote RNA degradation, demonstrating that polyadenylation can play a double-...

  3. RNA structures regulating ribosomal protein biosynthesis in bacilli.

    Science.gov (United States)

    Deiorio-Haggar, Kaila; Anthony, Jon; Meyer, Michelle M

    2013-07-01

    In Bacilli, there are three experimentally validated ribosomal-protein autogenous regulatory RNAs that are not shared with E. coli. Each of these RNAs forms a unique secondary structure that interacts with a ribosomal protein encoded by a downstream gene, namely S4, S15, and L20. Only one of these RNAs that interacts with L20 is currently found in the RNA Families Database. We created, or modified, existing structural alignments for these three RNAs and used them to perform homology searches. We have determined that each structure exhibits a narrow phylogenetic distribution, mostly relegated to the Firmicute class Bacilli. This work, in conjunction with other similar work, demonstrates that there are most likely many non-homologous RNA regulatory elements regulating ribosomal protein biosynthesis that still await discovery and characterization in other bacterial species.

  4. Interaction of tRNA with Eukaryotic Ribosome

    Directory of Open Access Journals (Sweden)

    Dmitri Graifer

    2015-03-01

    Full Text Available This paper is a review of currently available data concerning interactions of tRNAs with the eukaryotic ribosome at various stages of translation. These data include the results obtained by means of cryo-electron microscopy and X-ray crystallography applied to various model ribosomal complexes, site-directed cross-linking with the use of tRNA derivatives bearing chemically or photochemically reactive groups in the CCA-terminal fragment and chemical probing of 28S rRNA in the region of the peptidyl transferase center. Similarities and differences in the interactions of tRNAs with prokaryotic and eukaryotic ribosomes are discussed with concomitant consideration of the extent of resemblance between molecular mechanisms of translation in eukaryotes and bacteria.

  5. Effect of mutations in the A site of 16 S rRNA on aminoglycoside antibiotic-ribosome interaction

    DEFF Research Database (Denmark)

    Recht, M I; Douthwaite, S; Dahlquist, K D

    1999-01-01

    Decoding of genetic information occurs upon interaction of an mRNA codon-tRNA anticodon complex with the small subunit of the ribosome. The ribosomal decoding region is associated with highly conserved sequences near the 3' end of 16 S rRNA. The decoding process is perturbed by the aminoglycoside...... of universally conserved nucleotides at 1406 to 1408 and 1494 to 1495 in the decoding region of plasmid-encoded bacterial 16 S rRNA. Phenotypic changes range from the benign effect of U1406-->A or A1408-->G substitutions, to the highly deleterious 1406G and 1495 mutations that assemble into 30 S subunits...... but are defective in forming functional ribosomes. Changes in the local conformation of the decoding region caused by these mutations were identified by chemical probing of isolated 30 S subunits. Ribosomes containing 16 S rRNA with mutations at positions 1408, 1407+1494, or 1495 had reduced affinity...

  6. Complementarity between the mRNA 5' untranslated region and 18S ribosomal RNA can inhibit translation.

    Science.gov (United States)

    Verrier, S B; Jean-Jean, O

    2000-04-01

    In eubacteria, base pairing between the 3' end of 16S rRNA and the ribosome-binding site of mRNA is required for efficient initiation of translation. An interaction between the 18S rRNA and the mRNA was also proposed for translation initiation in eukaryotes. Here, we used an antisense RNA approach in vivo to identify the regions of 18S rRNA that might interact with the mRNA 5' untranslated region (5' UTR). Various fragments covering the entire mouse 18S rRNA gene were cloned 5' of a cat reporter gene in a eukaryotic vector, and translation products were analyzed after transient expression in human cells. For the largest part of 18S rRNA, we show that the insertion of complementary fragments in the mRNA 5' UTR do not impair translation of the downstream open reading frame (ORF). When translation inhibition is observed, reduction of the size of the complementary sequence to less than 200 nt alleviates the inhibitory effect. A single fragment complementary to the 18S rRNA 3' domain retains its inhibitory potential when reduced to 100 nt. Deletion analyses show that two distinct sequences of approximately 25 nt separated by a spacer sequence of 50 nt are required for the inhibitory effect. Sucrose gradient fractionation of polysomes reveals that mRNAs containing the inhibitory sequences accumulate in the fractions with 40S ribosomal subunits, suggesting that translation is blocked due to stalling of initiation complexes. Our results support an mRNA-rRNA base pairing to explain the translation inhibition observed and suggest that this region of 18S rRNA is properly located for interacting with mRNA.

  7. Comparison of sequencing the D2 region of the large subunit ribosomal RNA gene (MicroSEQ®) versus the internal transcribed spacer (ITS) regions using two public databases for identification of common and uncommon clinically relevant fungal species.

    Science.gov (United States)

    Arbefeville, S; Harris, A; Ferrieri, P

    2017-09-01

    Fungal infections cause considerable morbidity and mortality in immunocompromised patients. Rapid and accurate identification of fungi is essential to guide accurately targeted antifungal therapy. With the advent of molecular methods, clinical laboratories can use new technologies to supplement traditional phenotypic identification of fungi. The aims of the study were to evaluate the sole commercially available MicroSEQ® D2 LSU rDNA Fungal Identification Kit compared to the in-house developed internal transcribed spacer (ITS) regions assay in identifying moulds, using two well-known online public databases to analyze sequenced data. 85 common and uncommon clinically relevant fungi isolated from clinical specimens were sequenced for the D2 region of the large subunit (LSU) of ribosomal RNA (rRNA) gene with the MicroSEQ® Kit and the ITS regions with the in house developed assay. The generated sequenced data were analyzed with the online GenBank and MycoBank public databases. The D2 region of the LSU rRNA gene identified 89.4% or 92.9% of the 85 isolates to the genus level and the full ITS region (f-ITS) 96.5% or 100%, using GenBank or MycoBank, respectively, when compared to the consensus ID. When comparing species-level designations to the consensus ID, D2 region of the LSU rRNA gene aligned with 44.7% (38/85) or 52.9% (45/85) of these isolates in GenBank or MycoBank, respectively. By comparison, f-ITS possessed greater specificity, followed by ITS1, then ITS2 regions using GenBank or MycoBank. Using GenBank or MycoBank, D2 region of the LSU rRNA gene outperformed phenotypic based ID at the genus level. Comparing rates of ID between D2 region of the LSU rRNA gene and the ITS regions in GenBank or MycoBank at the species level against the consensus ID, f-ITS and ITS2 exceeded performance of the D2 region of the LSU rRNA gene, but ITS1 had similar performance to the D2 region of the LSU rRNA gene using MycoBank. Our results indicated that the MicroSEQ® D2 LSU r

  8. Experimental investigation of an RNA sequence space

    Science.gov (United States)

    Lee, Youn-Hyung; Dsouza, Lisa; Fox, George E.

    1993-12-01

    Modern rRNAs are the historic consequence of an ongoing evolutionary exploration of a sequence space. These extant sequences belong to a special subset of the sequence space that is comprised only of those primary sequences that can validly perform the biological function(s) required of the particular RNA. If it were possible to readily identify all such valid sequences, stochastic predictions could be made about the relative likelihood of various evolutionary pathways available to an RNA. Herein an experimental system which can assess whether a particular sequence is likely to have validity as a eubacterial 5S rRNA is described. A total of ten naturally occurring, and hence known to be valid, sequences and two point mutants of unknown validity were used to test the usefulness of the approach. Nine of the ten valid sequences tested positive whereas both mutants tested as clearly defective. The tenth valid sequence gave results that would be interpreted as reflecting a borderline status were the answer not known. These results demonstrate that it is possible to experimentally determine which sequences in local regions of the sequence space are potentially valid 5S rRNAs. This approach will allow direct study of the constraints governing RNA evolution and allow inquiry into how the last common ancestor of extant life apparently came to have very complex ribosomal RNAs that subsequently were very conserved.

  9. RNA polymerase and the ribosome: the close relationship.

    Science.gov (United States)

    McGary, Katelyn; Nudler, Evgeny

    2013-04-01

    In bacteria transcription and translation are linked in time and space. When coupled to RNA polymerase (RNAP), the translating ribosome ensures transcriptional processivity by preventing RNAP backtracking. Recent advances in the field have characterized important linker proteins that bridge the gap between transcription and translation: In particular, the NusE(S10):NusG complex and the NusG homolog, RfaH. The direct link between the moving ribosome and RNAP provides a basis for maintaining genomic integrity while enabling efficient transcription and timely translation of various genes within the bacterial cell. Copyright © 2013 Elsevier Ltd. All rights reserved.

  10. Comparative analyses among the Trichomonas vaginalis, Trichomonas tenax, and Tritrichomonas foetus 5S ribosomal RNA genes.

    Science.gov (United States)

    Torres-Machorro, Ana Lilia; Hernández, Roberto; Alderete, John F; López-Villaseñor, Imelda

    2009-04-01

    The 5S ribosomal RNA (5S rRNA) is an essential component of ribosomes. Throughout evolution, variation is found among 5S rRNA genes regarding their chromosomal localization, copy number, and intergenic regions. In this report, we describe and compare the gene sequences, motifs, genomic copy number, and chromosomal localization of the Trichomonas vaginalis, Trichomonas tenax, and Tritrichomonas foetus 5S rRNA genes. T. vaginalis and T. foetus have a single type of 5S rRNA-coding region, whereas two types were found in T. tenax. The sequence identities among the three organisms are between 94 and 97%. The intergenic regions are more divergent in sequence and size with characteristic species-specific motifs. The T. foetus 5S rRNA gene has larger and more complex intergenic regions, which contain either an ubiquitin gene or repeated sequences. The 5S rRNA genes were located in Trichomonads chromosomes by fluorescent in situ hybridization.

  11. PCR primers for metazoan mitochondrial 12S ribosomal DNA sequences.

    Directory of Open Access Journals (Sweden)

    Ryuji J Machida

    Full Text Available BACKGROUND: Assessment of the biodiversity of communities of small organisms is most readily done using PCR-based analysis of environmental samples consisting of mixtures of individuals. Known as metagenetics, this approach has transformed understanding of microbial communities and is beginning to be applied to metazoans as well. Unlike microbial studies, where analysis of the 16S ribosomal DNA sequence is standard, the best gene for metazoan metagenetics is less clear. In this study we designed a set of PCR primers for the mitochondrial 12S ribosomal DNA sequence based on 64 complete mitochondrial genomes and then tested their efficacy. METHODOLOGY/PRINCIPAL FINDINGS: A total of the 64 complete mitochondrial genome sequences representing all metazoan classes available in GenBank were downloaded using the NCBI Taxonomy Browser. Alignment of sequences was performed for the excised mitochondrial 12S ribosomal DNA sequences, and conserved regions were identified for all 64 mitochondrial genomes. These regions were used to design a primer pair that flanks a more variable region in the gene. Then all of the complete metazoan mitochondrial genomes available in NCBI's Organelle Genome Resources database were used to determine the percentage of taxa that would likely be amplified using these primers. Results suggest that these primers will amplify target sequences for many metazoans. CONCLUSIONS/SIGNIFICANCE: Newly designed 12S ribosomal DNA primers have considerable potential for metazoan metagenetic analysis because of their ability to amplify sequences from many metazoans.

  12. Probing the structure of 16 S ribosomal RNA from Bacillus brevis.

    Science.gov (United States)

    Kop, J; Kopylov, A M; Magrum, L; Siegel, R; Gupta, R; Woese, C R; Noller, H F

    1984-12-25

    A majority (approximately 89%) of the nucleotide sequence of Bacillus brevis 16 S rRNA has been determined by a combination of RNA sequencing methods. Several experimental approaches have been used to probe its structure, including (a) partial RNase digestion of 30 S ribosomal subunits, followed by two-dimensional native/denatured gel electrophoresis, in which base-paired fragments were directly identified; (b) identification of positions susceptible to cleavage by RNase A and RNase T1 in 30 S subunits; (c) sites of attack by cobra venom RNase on naked 16 S rRNA; and (d) nucleotides susceptible to attack by bisulfite in 16 S rRNA. These data are discussed with respect to a secondary structure model for B. brevis 16 S rRNA derived by comparative sequence analysis.

  13. Phylogenetic relationships of the marine Haplosclerida (Phylum Porifera employing ribosomal (28S rRNA and mitochondrial (cox1, nad1 gene sequence data.

    Directory of Open Access Journals (Sweden)

    Niamh E Redmond

    Full Text Available The systematics of the poriferan Order Haplosclerida (Class Demospongiae has been under scrutiny for a number of years without resolution. Molecular data suggests that the order needs revision at all taxonomic levels. Here, we provide a comprehensive view of the phylogenetic relationships of the marine Haplosclerida using many species from across the order, and three gene regions. Gene trees generated using 28S rRNA, nad1 and cox1 gene data, under maximum likelihood and Bayesian approaches, are highly congruent and suggest the presence of four clades. Clade A is comprised primarily of species of Haliclona and Callyspongia, and clade B is comprised of H. simulans and H. vansoesti (Family Chalinidae, Amphimedon queenslandica (Family Niphatidae and Tabulocalyx (Family Phloeodictyidae, Clade C is comprised primarily of members of the Families Petrosiidae and Niphatidae, while Clade D is comprised of Aka species. The polyphletic nature of the suborders, families and genera described in other studies is also found here.

  14. Phylogenetic relationships of the marine Haplosclerida (Phylum Porifera) employing ribosomal (28S rRNA) and mitochondrial (cox1, nad1) gene sequence data.

    Science.gov (United States)

    Redmond, Niamh E; Raleigh, Jean; van Soest, Rob W M; Kelly, Michelle; Travers, Simon A A; Bradshaw, Brian; Vartia, Salla; Stephens, Kelly M; McCormack, Grace P

    2011-01-01

    The systematics of the poriferan Order Haplosclerida (Class Demospongiae) has been under scrutiny for a number of years without resolution. Molecular data suggests that the order needs revision at all taxonomic levels. Here, we provide a comprehensive view of the phylogenetic relationships of the marine Haplosclerida using many species from across the order, and three gene regions. Gene trees generated using 28S rRNA, nad1 and cox1 gene data, under maximum likelihood and Bayesian approaches, are highly congruent and suggest the presence of four clades. Clade A is comprised primarily of species of Haliclona and Callyspongia, and clade B is comprised of H. simulans and H. vansoesti (Family Chalinidae), Amphimedon queenslandica (Family Niphatidae) and Tabulocalyx (Family Phloeodictyidae), Clade C is comprised primarily of members of the Families Petrosiidae and Niphatidae, while Clade D is comprised of Aka species. The polyphletic nature of the suborders, families and genera described in other studies is also found here.

  15. c-Myc co-ordinates mRNA cap methylation and ribosomal RNA production.

    Science.gov (United States)

    Dunn, Sianadh; Lombardi, Olivia; Cowling, Victoria H

    2017-02-01

    The mRNA cap is a structure added to RNA pol II transcripts in eukaryotes, which recruits factors involved in RNA processing, nuclear export and translation initiation. RNA guanine-7 methyltransferase (RNMT)-RNA-activating miniprotein (RAM), the mRNA cap methyltransferase complex, completes the basic functional mRNA cap structure, cap 0, by methylating the cap guanosine. Here, we report that RNMT-RAM co-ordinates mRNA processing with ribosome production. Suppression of RNMT-RAM reduces synthesis of the 45S ribosomal RNA (rRNA) precursor. RNMT-RAM is required for c-Myc expression, a major regulator of RNA pol I, which synthesises 45S rRNA. Constitutive expression of c-Myc restores rRNA synthesis when RNMT-RAM is suppressed, indicating that RNMT-RAM controls rRNA production predominantly by controlling c-Myc expression. We report that RNMT-RAM is recruited to the ribosomal DNA locus, which may contribute to rRNA synthesis in certain contexts. © 2017 The Author(s).

  16. The structure of a ribosomal protein S8/spc operon mRNA complex.

    Science.gov (United States)

    Merianos, Helen J; Wang, Jimin; Moore, Peter B

    2004-06-01

    In bacteria, translation of all the ribosomal protein cistrons in the spc operon mRNA is repressed by the binding of the product of one of them, S8, to an internal sequence at the 5' end of the L5 cistron. The way in which the first two genes of the spc operon are regulated, retroregulation, is mechanistically distinct from translational repression by S8 of the genes from L5 onward. A 2.8 A resolution crystal structure has been obtained of Escherichia coli S8 bound to this site. Despite sequence differences, the structure of this complex is almost identical to that of the S8/helix 21 complex seen in the small ribosomal subunit, consistent with the hypothesis that autogenous regulation of ribosomal protein synthesis results from conformational similarities between mRNAs and rRNAs. S8 binding must repress the translation of its own mRNA by inhibiting the formation of a ribosomal initiation complex at the start of the L5 cistron.

  17. RISSC: a novel database for ribosomal 16S-23S RNA genes spacer regions.

    Science.gov (United States)

    García-Martínez, J; Bescós, I; Rodríguez-Sala, J J; Rodríguez-Valera, F

    2001-01-01

    A novel database, under the acronym RISSC (Ribosomal Intergenic Spacer Sequence Collection), has been created. It compiles more than 1600 entries of edited DNA sequence data from the 16S-23S ribosomal spacers present in most prokaryotes and organelles (e.g. mitochondria and chloroplasts) and is accessible through the Internet (http://ulises.umh.es/RISSC), where systematic searches for specific words can be conducted, as well as BLAST-type sequence searches. Additionally, a characteristic feature of this region, the presence/absence and nature of tRNA genes within the spacer, is included in all the entries, even when not previously indicated in the original database. All these combined features could provide a useful documentation tool for studies on evolution, identification, typing and strain characterization, among others.

  18. Mechanisms for ribotoxin-induced ribosomal RNA cleavage

    Energy Technology Data Exchange (ETDEWEB)

    He, Kaiyu [Department of Microbiology and Molecular Genetics (United States); Center for Integrative Toxicology, Michigan State University, East Lansing, MI 48824 (United States); Zhou, Hui-Ren [Food Science and Human Nutrition (United States); Pestka, James J., E-mail: pestka@msu.edu [Department of Microbiology and Molecular Genetics (United States); Food Science and Human Nutrition (United States); Center for Integrative Toxicology, Michigan State University, East Lansing, MI 48824 (United States)

    2012-11-15

    The Type B trichothecene deoxynivalenol (DON), a ribotoxic mycotoxin known to contaminate cereal-based foods, induces ribosomal RNA (rRNA) cleavage in the macrophage via p38-directed activation of caspases. Here we employed the RAW 264.7 murine macrophage model to test the hypothesis that this rRNA cleavage pathway is similarly induced by other ribotoxins. Capillary electrophoresis confirmed that the antibiotic anisomycin (≥ 25 ng/ml), the macrocylic trichothecene satratoxin G (SG) (≥ 10 ng/ml) and ribosome-inactivating protein ricin (≥ 300 ng/ml) induced 18s and 28s rRNA fragmentation patterns identical to that observed for DON. Also, as found for DON, inhibition of p38, double-stranded RNA-activated kinase (PKR) and hematopoietic cell kinase (Hck) suppressed MAPK anisomycin-induced rRNA cleavage, while, in contrast, their inhibition did not affect SG- and ricin-induced rRNA fragmentation. The p53 inhibitor pifithrin-μ and pan caspase inhibitor Z-VAD-FMK suppressed rRNA cleavage induced by anisomycin, SG and ricin, indicating that these ribotoxins shared with DON a conserved downstream pathway. Activation of caspases 8, 9 and 3 concurrently with apoptosis further suggested that rRNA cleavage occurred in parallel with both extrinsic and intrinsic pathways of programmed cell death. When specific inhibitors of cathepsins L and B (lysosomal cysteine cathepsins active at cytosolic neutral pH) were tested, only the former impaired anisomycin-, SG-, ricin- and DON-induced rRNA cleavage. Taken together, the data suggest that (1) all four ribotoxins induced p53-dependent rRNA cleavage via activation of cathepsin L and caspase 3, and (2) activation of p53 by DON and anisomycin involved p38 whereas SG and ricin activated p53 by an alternative mechanism. Highlights: ► Deoxynivalenol (DON) anisomycin, satratoxin G (SG) and ricin are ribotoxins. ► Ribotoxins induce 18s and 28s rRNA cleavage in the RAW 264.7 macrophage model. ► Ribotoxins induce rRNA cleavage via

  19. Traffic of interacting ribosomes on mRNA during protein synthesis: effects of chemo-mechanics of individual ribosomes

    CERN Document Server

    Basu, A; Basu, Aakash; Chowdhury, Debashish

    2006-01-01

    Many {\\it ribosomes} simultaneously move on the same messenger RNA (mRNA), each synthesizing a protein. In contrast to the earlier models, here {\\it we develope a ``unified'' theoretical model} that not only incorporates the {\\it mutual exclusions} of the interacting ribosomes, but also describes explicitly the mechano-chemistry of each of these individual cyclic machines during protein synthesis. Using a combination of analytical and numerical techniques of non-equilibrium statistical mechanics, we analyze the rates of protein synthesis and the spatio-temporal oraganization of the ribosomes in this model. We also predict how these properties would change with the changes in the rates of the various chemo-mechanical processes in each ribosome. Finally, we illustrate the power of this model by making experimentally testable predictions on the rates of protein synthesis and the density profiles of the ribosomes on some mRNAs in {\\it E-coli}.

  20. Molecular Identification of Ptychodera flava (Hemichordata: Enteropneusta): Reconsideration in Light of Nucleotide Polymorphism in the 18S Ribosomal RNA Gene.

    Science.gov (United States)

    Urata, Makoto

    2015-06-01

    Seven nuclear and mitochondrial DNA markers were examined in 12 specimens of Ptychodera flava, a model acorn worm used in molecular biology, collected in Japan from three local populations with different modes of living. A comparison of intraspecific results did not show genetically isolated populations despite the species' enclave habitats and asexual reproduction. Moreover, both the nuclear 18S ribosomal RNA gene and mitochondrial 16S ribosomal RNA gene sequences were identical to those from Moorea in French Polynesia, nearly 10,000 kilometers away from Japan. I also provide the first definitive information regarding polymorphisms in 18S ribosomal RNA gene, the external transcribed spacer (ETS), internal transcribed spacers (ITS), and mitochondrial cytochrome c oxidase subunit 1 (mtCO1) sequence in hemichordates using newly designed primer sets, and I show both high larval vagility and certain criteria for the molecular identification of this species.

  1. Structure and Function of the Ribosomal Frameshifting Pseudoknot RNA from Beet Western Yellow Virus

    Energy Technology Data Exchange (ETDEWEB)

    Egli, M.; Sarkhel, S.; Minasov, G.; Rich, A.

    2010-03-05

    Many viruses reprogram ribosomes to produce two different proteins from two different reading frames. So-called -1 frameshifting often involves pairwise alignment of two adjacent tRNAs at a 'slippery' sequence in the ribosomal A and P sites such that an overlapping codon is shifted upstream by one base relative to the zero frame. In the majority of cases, an RNA pseudoknot located downstream stimulates this type of frameshift. Crystal structures of the frameshifting RNA pseudoknot from Beet Western Yellow Virus (BWYV) have provided a detailed picture of the tertiary interactions stabilizing this folding motif, including a minor-groove triplex and quadruple-base interactions. The structure determined at atomic resolution revealed the locations of several magnesium ions and provided insights into the role of structured water stabilizing the RNA. Systematic in vitro and in vivo mutational analyses based on the structural results revealed specific tertiary interactions and regions in the pseudoknot that drastically change frameshifting efficiency. Here, we summarize recent advances in our understanding of pseudoknot-mediated ribosomal frameshifting on the basis of the insights gained from structural and functional studies of the RNA pseudoknot from BWYV.

  2. Helix 69 of Escherichia coli 23S ribosomal RNA as a peptide nucleic acid target.

    Science.gov (United States)

    Kulik, Marta; Markowska-Zagrajek, Agnieszka; Wojciechowska, Monika; Grzela, Renata; Wituła, Tomasz; Trylska, Joanna

    2017-07-01

    A fragment of 23S ribosomal RNA (nucleotides 1906-1924 in E. coli), termed Helix 69, forms a hairpin that is essential for ribosome function. Helix 69 forms a conformationally flexible inter-subunit connection with helix 44 of 16S ribosomal RNA, and the nucleotide A1913 of Helix 69 influences decoding accuracy. Nucleotides U1911 and U1917 are post-transcriptionally modified with pseudouridines (Ψ) and U1915 with 3-methyl-Ψ. We investigated Helix 69 as a target for a complementary synthetic oligonucleotide - peptide nucleic acid (PNA). We determined thermodynamic properties of Helix 69 and its complexes with PNA and tested the performance of PNA targeted at Helix 69 in inhibiting translation in cell-free extracts and growth of E. coli cells. First, we examined the interactions of a PNA oligomer complementary to the G1907-A1919 fragment of Helix 69 with the sequences corresponding to human and bacterial species (with or without pseudouridine modifications). PNA invades the Helix 69 hairpin creating stable complexes and PNA binding to the pseudouridylated bacterial sequence is stronger than to Helix 69 without any modifications. Second, we confirmed the binding of PNA to 23S rRNA and 70S ribosomes. Third, we verified the efficiency of translation inhibition of these PNA oligomers in the cell-free translation/transcription E. coli system, which were in a similar range as tetracycline. Next, we confirmed that PNA conjugated to the (KFF)3K transporter peptide inhibited E. coli growth in micromolar concentrations. Overall, targeting Helix 69 with PNA or other sequence-specific oligomers could be a promising way to inhibit bacterial translation. Copyright © 2017 Elsevier B.V. and Société Française de Biochimie et Biologie Moléculaire (SFBBM). All rights reserved.

  3. Clusters of basic amino acids contribute to RNA binding and nucleolar localization of ribosomal protein L22.

    Directory of Open Access Journals (Sweden)

    Jennifer L Houmani

    Full Text Available The ribosomal protein L22 is a component of the 60S eukaryotic ribosomal subunit. As an RNA-binding protein, it has been shown to interact with both cellular and viral RNAs including 28S rRNA and the Epstein-Barr virus encoded RNA, EBER-1. L22 is localized to the cell nucleus where it accumulates in nucleoli. Although previous studies demonstrated that a specific amino acid sequence is required for nucleolar localization, the RNA-binding domain has not been identified. Here, we investigated the hypothesis that the nucleolar accumulation of L22 is linked to its ability to bind RNA. To address this hypothesis, mutated L22 proteins were generated to assess the contribution of specific amino acids to RNA binding and protein localization. Using RNA-protein binding assays, we demonstrate that basic amino acids 80-93 are required for high affinity binding of 28S rRNA and EBER-1 by L22. Fluorescence localization studies using GFP-tagged mutated L22 proteins further reveal that basic amino acids 80-93 are critical for nucleolar accumulation and for incorporation into ribosomes. Our data support the growing consensus that the nucleolar accumulation of ribosomal proteins may not be mediated by a defined localization signal, but rather by specific interaction with established nucleolar components such as rRNA.

  4. Fragmentation of the large subunit ribosomal RNA gene in oyster mitochondrial genomes

    Directory of Open Access Journals (Sweden)

    Milbury Coren A

    2010-09-01

    Full Text Available Abstract Background Discontinuous genes have been observed in bacteria, archaea, and eukaryotic nuclei, mitochondria and chloroplasts. Gene discontinuity occurs in multiple forms: the two most frequent forms result from introns that are spliced out of the RNA and the resulting exons are spliced together to form a single transcript, and fragmented gene transcripts that are not covalently attached post-transcriptionally. Within the past few years, fragmented ribosomal RNA (rRNA genes have been discovered in bilateral metazoan mitochondria, all within a group of related oysters. Results In this study, we have characterized this fragmentation with comparative analysis and experimentation. We present secondary structures, modeled using comparative sequence analysis of the discontinuous mitochondrial large subunit rRNA genes of the cupped oysters C. virginica, C. gigas, and C. hongkongensis. Comparative structure models for the large subunit rRNA in each of the three oyster species are generally similar to those for other bilateral metazoans. We also used RT-PCR and analyzed ESTs to determine if the two fragmented LSU rRNAs are spliced together. The two segments are transcribed separately, and not spliced together although they still form functional rRNAs and ribosomes. Conclusions Although many examples of discontinuous ribosomal genes have been documented in bacteria and archaea, as well as the nuclei, chloroplasts, and mitochondria of eukaryotes, oysters are some of the first characterized examples of fragmented bilateral animal mitochondrial rRNA genes. The secondary structures of the oyster LSU rRNA fragments have been predicted on the basis of previous comparative metazoan mitochondrial LSU rRNA structure models.

  5. Structures of the Bacterial Ribosome in Classical and Hybrid States of tRNA Binding

    Energy Technology Data Exchange (ETDEWEB)

    Dunkle, Jack A.; Wang, Leyi; Feldman, Michael B.; Pulk, Arto; Chen, Vincent B.; Kapral, Gary J.; Noeske, Jonas; Richardson, Jane S.; Blanchard, Scott C.; Cate, Jamie H. Doudna (Cornell); (UCB); (Duke)

    2011-09-06

    During protein synthesis, the ribosome controls the movement of tRNA and mRNA by means of large-scale structural rearrangements. We describe structures of the intact bacterial ribosome from Escherichia coli that reveal how the ribosome binds tRNA in two functionally distinct states, determined to a resolution of {approx}3.2 angstroms by means of x-ray crystallography. One state positions tRNA in the peptidyl-tRNA binding site. The second, a fully rotated state, is stabilized by ribosome recycling factor and binds tRNA in a highly bent conformation in a hybrid peptidyl/exit site. The structures help to explain how the ratchet-like motion of the two ribosomal subunits contributes to the mechanisms of translocation, termination, and ribosome recycling.

  6. Dinoflagellate 17S rRNA sequence inferred from the gene sequence: Evolutionary implications

    Science.gov (United States)

    Herzog, Michel; Maroteaux, Luc

    1986-01-01

    We present the complete sequence of the nuclear-encoded small-ribosomal-subunit RNA inferred from the cloned gene sequence of the dinoflagellate Prorocentrum micans. The dinoflagellate 17S rRNA sequence of 1798 nucleotides is contained in a family of 200 tandemly repeated genes per haploid genome. A tentative model of the secondary structure of P. micans 17S rRNA is presented. This sequence is compared with the small-ribosomal-subunit rRNA of Xenopus laevis (Animalia), Saccharomyces cerevisiae (Fungi), Zea mays (Planta), Dictyostelium discoideum (Protoctista), and Halobacterium volcanii (Monera). Although the secondary structure of the dinoflagellate 17S rRNA presents most of the eukaryotic characteristics, it contains sufficient archaeobacterial-like structural features to reinforce the view that dinoflagellates branch off very early from the eukaryotic lineage. PMID:16578795

  7. Patterns and regulation of ribosomal RNA transcription in Borrelia burgdorferi

    Directory of Open Access Journals (Sweden)

    Schwartz Ira

    2011-01-01

    Full Text Available Abstract Background Borrelia burgdorferi contains one 16S and two tandem sets of 23S-5S ribosomal (r RNA genes whose patterns of transcription and regulation are unknown but are likely to be critical for survival and persistence in its hosts. Results RT-PCR of B. burgdorferi N40 and B31 revealed three rRNA region transcripts: 16S rRNA-alanine transfer RNA (tRNAAla; tRNAIle; and both sets of 23S-5S rRNA. At 34°C, there were no differences in growth rate or in accumulation of total protein, DNA and RNA in B31 cultured in Barbour-Stoenner-Kelly (BSK-H whether rabbit serum was present or not. At 23°C, B31 grew more slowly in serum-containing BSK-H than at 34°C. DNA per cell was higher in cells in exponential as compared to stationary phase at either temperature; protein per cell was similar at both temperatures in both phases. Similar amounts of rRNA were produced in exponential phase at both temperatures, and rRNA was down-regulated in stationary phase at either temperature. Interestingly, a relBbu deletion mutant unable to generate (pppGpp did not down-regulate rRNA at transition to stationary phase in serum-containing BSK-H at 34°C, similar to the relaxed phenotype of E. coli relA mutants. Conclusions We conclude that rRNA transcription in B. burgdorferi is complex and regulated both by growth phase and by the stringent response but not by temperature-modulated growth rate.

  8. Molecular and cytological characterization of ribosomal RNA genes in Chenopodium quinoa and Chenopodium berlandieri.

    Science.gov (United States)

    Maughan, P J; Kolano, B A; Maluszynska, J; Coles, N D; Bonifacio, A; Rojas, J; Coleman, C E; Stevens, M R; Fairbanks, D J; Parkinson, S E; Jellen, E N

    2006-07-01

    The nucleolus organizer region (NOR) and 5S ribosomal RNA (rRNA) genes are valuable as chromosome landmarks and in evolutionary studies. The NOR intergenic spacers (IGS) and 5S rRNA nontranscribed spacers (NTS) were PCR-amplified and sequenced from 5 cultivars of the Andean grain crop quinoa (Chenopodium quinoa Willd., 2n = 4x = 36) and a related wild ancestor (C. berlandieri Moq. subsp. zschackei (Murr) A. Zobel, 2n = 4x = 36). Length heterogeneity observed in the IGS resulted from copy number difference in subrepeat elements, small re arrangements, and species-specific indels, though the general sequence composition of the 2 species was highly similar. Fifteen of the 41 sequence polymorphisms identified among the C. quinoa lines were synapomorphic and clearly differentiated the highland and lowland ecotypes. Analysis of the NTS sequences revealed 2 basic NTS sequence classes that likely originated from the 2 allopolyploid subgenomes of C. quinoa. Fluorescence in situ hybridization (FISH) analysis showed that C. quinoa possesses an interstitial and a terminal pair of 5S rRNA loci and only 1 pair of NOR, suggesting a reduction in the number of rRNA loci during the evolution of this species. C. berlandieri exhibited variation in both NOR and 5S rRNA loci without changes in ploidy.

  9. UtpA and UtpB chaperone nascent pre-ribosomal RNA and U3 snoRNA to initiate eukaryotic ribosome assembly

    Science.gov (United States)

    Hunziker, Mirjam; Barandun, Jonas; Petfalski, Elisabeth; Tan, Dongyan; Delan-Forino, Clémentine; Molloy, Kelly R.; Kim, Kelly H.; Dunn-Davies, Hywel; Shi, Yi; Chaker-Margot, Malik; Chait, Brian T.; Walz, Thomas; Tollervey, David; Klinge, Sebastian

    2016-06-01

    Early eukaryotic ribosome biogenesis involves large multi-protein complexes, which co-transcriptionally associate with pre-ribosomal RNA to form the small subunit processome. The precise mechanisms by which two of the largest multi-protein complexes--UtpA and UtpB--interact with nascent pre-ribosomal RNA are poorly understood. Here, we combined biochemical and structural biology approaches with ensembles of RNA-protein cross-linking data to elucidate the essential functions of both complexes. We show that UtpA contains a large composite RNA-binding site and captures the 5' end of pre-ribosomal RNA. UtpB forms an extended structure that binds early pre-ribosomal intermediates in close proximity to architectural sites such as an RNA duplex formed by the 5' ETS and U3 snoRNA as well as the 3' boundary of the 18S rRNA. Both complexes therefore act as vital RNA chaperones to initiate eukaryotic ribosome assembly.

  10. UtpA and UtpB chaperone nascent pre-ribosomal RNA and U3 snoRNA to initiate eukaryotic ribosome assembly.

    Science.gov (United States)

    Hunziker, Mirjam; Barandun, Jonas; Petfalski, Elisabeth; Tan, Dongyan; Delan-Forino, Clémentine; Molloy, Kelly R; Kim, Kelly H; Dunn-Davies, Hywel; Shi, Yi; Chaker-Margot, Malik; Chait, Brian T; Walz, Thomas; Tollervey, David; Klinge, Sebastian

    2016-06-29

    Early eukaryotic ribosome biogenesis involves large multi-protein complexes, which co-transcriptionally associate with pre-ribosomal RNA to form the small subunit processome. The precise mechanisms by which two of the largest multi-protein complexes-UtpA and UtpB-interact with nascent pre-ribosomal RNA are poorly understood. Here, we combined biochemical and structural biology approaches with ensembles of RNA-protein cross-linking data to elucidate the essential functions of both complexes. We show that UtpA contains a large composite RNA-binding site and captures the 5' end of pre-ribosomal RNA. UtpB forms an extended structure that binds early pre-ribosomal intermediates in close proximity to architectural sites such as an RNA duplex formed by the 5' ETS and U3 snoRNA as well as the 3' boundary of the 18S rRNA. Both complexes therefore act as vital RNA chaperones to initiate eukaryotic ribosome assembly.

  11. Cyclin-dependent kinase 9 links RNA polymerase II transcription to processing of ribosomal RNA.

    Science.gov (United States)

    Burger, Kaspar; Mühl, Bastian; Rohrmoser, Michaela; Coordes, Britta; Heidemann, Martin; Kellner, Markus; Gruber-Eber, Anita; Heissmeyer, Vigo; Strässer, Katja; Eick, Dirk

    2013-07-19

    Ribosome biogenesis is a process required for cellular growth and proliferation. Processing of ribosomal RNA (rRNA) is highly sensitive to flavopiridol, a specific inhibitor of cyclin-dependent kinase 9 (Cdk9). Cdk9 has been characterized as the catalytic subunit of the positive transcription elongation factor b (P-TEFb) of RNA polymerase II (RNAPII). Here we studied the connection between RNAPII transcription and rRNA processing. We show that inhibition of RNAPII activity by α-amanitin specifically blocks processing of rRNA. The block is characterized by accumulation of 3' extended unprocessed 47 S rRNAs and the entire inhibition of other 47 S rRNA-specific processing steps. The transcription rate of rRNA is moderately reduced after inhibition of Cdk9, suggesting that defective 3' processing of rRNA negatively feeds back on RNAPI transcription. Knockdown of Cdk9 caused a strong reduction of the levels of RNAPII-transcribed U8 small nucleolar RNA, which is essential for 3' rRNA processing in mammalian cells. Our data demonstrate a pivotal role of Cdk9 activity for coupling of RNAPII transcription with small nucleolar RNA production and rRNA processing.

  12. Structure and chromosomal localization of DNA sequences related to ribosomal subrepeats in Vicia faba.

    Science.gov (United States)

    Maggini, F; Cremonini, R; Zolfino, C; Tucci, G F; D'Ovidio, R; Delre, V; DePace, C; Scarascia Mugnozza, G T; Cionini, P G

    1991-05-01

    Subrepeating sequences of 325 bp found in the ribosomal intergenic spacer (IGS) of Vicia faba and responsible for variations in the length of the polycistronic units for rRNA were isolated and used as probes for in situ hybridization. Hybridization occurs at many regions of the metaphase chromosomes besides those bearing rRNA genes, namely chromosome ends and all the heterochromatic regions revealed by enhanced fluorescence after quinacrine staining. The DNA homologous to the 325 bp repeats that does not reside in the IGS was isolated, cloned and sequenced. It is composed of tandemly arranged 336 bp elements, each comprising two highly related 168 bp sequences. This structure is very similar to that of the IGS repeats and ca. 75% nucleotide sequence identity can be observed between these and the 168 bp doublets. The most obvious difference lies in the deletion, in the former, of a 14 bp segment from one of the two related sequences. It is hypothesized that the IGS repeats are derived from the 336 bp elements and have been transposed to ribosomal cistrons from other genome fractions. The possible relations between these sequences and others with similar structural features found in other species are discussed.

  13. 5S ribosomal ribonucleic acid sequences in Bacteroides and Fusobacterium: evolutionary relationships within these genera and among eubacteria in general

    Science.gov (United States)

    Van den Eynde, H.; De Baere, R.; Shah, H. N.; Gharbia, S. E.; Fox, G. E.; Michalik, J.; Van de Peer, Y.; De Wachter, R.

    1989-01-01

    The 5S ribosomal ribonucleic acid (rRNA) sequences were determined for Bacteroides fragilis, Bacteroides thetaiotaomicron, Bacteroides capillosus, Bacteroides veroralis, Porphyromonas gingivalis, Anaerorhabdus furcosus, Fusobacterium nucleatum, Fusobacterium mortiferum, and Fusobacterium varium. A dendrogram constructed by a clustering algorithm from these sequences, which were aligned with all other hitherto known eubacterial 5S rRNA sequences, showed differences as well as similarities with respect to results derived from 16S rRNA analyses. In the 5S rRNA dendrogram, Bacteroides clustered together with Cytophaga and Fusobacterium, as in 16S rRNA analyses. Intraphylum relationships deduced from 5S rRNAs suggested that Bacteroides is specifically related to Cytophaga rather than to Fusobacterium, as was suggested by 16S rRNA analyses. Previous taxonomic considerations concerning the genus Bacteroides, based on biochemical and physiological data, were confirmed by the 5S rRNA sequence analysis.

  14. Structural and functional analysis of Escherichia coli ribosomes containing small deletions around position 1760 in the 23S ribosomal RNA.

    Science.gov (United States)

    Zweib, C; Dahlberg, A E

    1984-09-25

    Three different small deletions were produced at a single Pvu 2 restriction site in E. coli 23S rDNA of plasmid pKK 3535 using exonuclease Bal 31. The deletions were located around position 1760 in 23S rRNA and were characterized by DNA sequencing as well as by direct fingerprinting and S1-mapping of the rRNA. Two of the mutant plasmids, Pvu 2-32 and Pvu 2-33, greatly reduced the growth rate of transformed cells while the third mutant, Pvu 2-14 grew as fast as cells containing the wild-type plasmid pKK 3535. All three mutant 23S rRNAs were incorporated into 50S-like particles and were even found in 70S ribosomes and polysomes in vivo. The conformation of mutant 23S rRNA in 50S subunits was probed with a double-strand specific RNase from cobra venom. These analyses revealed changes in the accessibility of cleavage sites near the deletions around position 1760 and in the area around position 800 in all three mutant rRNAs. We suggest, that an altered conformation of the rRNAs at the site of the deletion is responsible for the slow growth of cells containing mutant plasmids Pvu 2-32 and Pvu 2-33.

  15. Structure of ERA in complex with the 3′ end of 16S rRNA: Implications for ribosome biogenesis

    Energy Technology Data Exchange (ETDEWEB)

    Tu, Chao; Zhou, Xiaomei; Tropea, Joseph E.; Austin, Brian P.; Waugh, David S.; Court, Donald L.; Ji, Xinhua; (NCI)

    2009-10-09

    ERA, composed of an N-terminal GTPase domain followed by an RNA-binding KH domain, is essential for bacterial cell viability. It binds to 16S rRNA and the 30S ribosomal subunit. However, its RNA-binding site, the functional relationship between the two domains, and its role in ribosome biogenesis remain unclear. We have determined two crystal structures of ERA, a binary complex with GDP and a ternary complex with a GTP-analog and the {sub 1531}AUCACCUCCUUA{sub 1542} sequence at the 3' end of 16S rRNA. In the ternary complex, the first nine of the 12 nucleotides are recognized by the protein. We show that GTP binding is a prerequisite for RNA recognition by ERA and that RNA recognition stimulates its GTP-hydrolyzing activity. Based on these and other data, we propose a functional cycle of ERA, suggesting that the protein serves as a chaperone for processing and maturation of 16S rRNA and a checkpoint for assembly of the 30S ribosomal subunit. The AUCA sequence is highly conserved among bacteria, archaea, and eukaryotes, whereas the CCUCC, known as the anti-Shine-Dalgarno sequence, is conserved in noneukaryotes only. Therefore, these data suggest a common mechanism for a highly conserved ERA function in all three kingdoms of life by recognizing the AUCA, with a 'twist' for noneukaryotic ERA proteins by also recognizing the CCUCC.

  16. Natural variation in DNA methylation in ribosomal RNA genes of Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    Richards Eric J

    2008-09-01

    Full Text Available Abstract Background DNA methylation is an important biochemical mark that silences repetitive sequences, such as transposons, and reinforces epigenetic gene expression states. An important class of repetitive genes under epigenetic control in eukaryotic genomes encodes ribosomal RNA (rRNA transcripts. The ribosomal genes coding for the 45S rRNA precursor of the three largest eukaryotic ribosomal RNAs (18S, 5.8S, and 25–28S are found in nucleolus organizer regions (NORs, comprised of hundreds to thousands of repeats, only some of which are expressed in any given cell. An epigenetic switch, mediated by DNA methylation and histone modification, turns rRNA genes on and off. However, little is known about the mechanisms that specify and maintain the patterns of NOR DNA methylation. Results Here, we explored the extent of naturally-occurring variation in NOR DNA methylation among accessions of the flowering plant Arabidopsis thaliana. DNA methylation in coding regions of rRNA genes was positively correlated with copy number of 45S rRNA gene and DNA methylation in the intergenic spacer regions. We investigated the inheritance of NOR DNA methylation patterns in natural accessions with hypomethylated NORs in inter-strain crosses and defined three different categories of inheritance in F1 hybrids. In addition, subsequent analysis of F2 segregation for NOR DNA methylation patterns uncovered different patterns of inheritance. We also revealed that NOR DNA methylation in the Arabidopsis accession Bor-4 is influenced by the vim1-1 (variant in methylation 1-1 mutation, but the primary effect is specified by the NORs themselves. Conclusion Our results indicate that the NORs themselves are the most significant determinants of natural variation in NOR DNA methylation. However, the inheritance of NOR DNA methylation suggests the operation of a diverse set of mechanisms, including inheritance of parental methylation patterns, reconfiguration of parental NOR DNA

  17. Recognizing RNA structural motifs in HT-SELEX data for ribosomal protein S15.

    Science.gov (United States)

    Pei, Shermin; Slinger, Betty L; Meyer, Michelle M

    2017-06-06

    Proteins recognize many different aspects of RNA ranging from single stranded regions to discrete secondary or tertiary structures. High-throughput sequencing (HTS) of in vitro selected populations offers a large scale method to study RNA-proteins interactions. However, most existing analysis methods require that the binding motifs are enriched in the population relative to earlier rounds, and that motifs are found in a loop or single stranded region of the potential RNA secondary structure. Such methods do not generalize to all RNA-protein interaction as some RNA binding proteins specifically recognize more complex structures such as double stranded RNA. In this study, we use HT-SELEX derived populations to study the landscape of RNAs that interact with Geobacillus kaustophilus ribosomal protein S15. Our data show high sequence and structure diversity and proved intractable to existing methods. Conventional programs identified some sequence motifs, but these are found in less than 5-10% of the total sequence pool. Therefore, we developed a novel framework to analyze HT-SELEX data. Our process accounts for both sequence and structure components by abstracting the overall secondary structure into smaller substructures composed of a single base-pair stack, which allows us to leverage existing approaches already used in k-mer analysis to identify enriched motifs. By focusing on secondary structure motifs composed of specific two base-pair stacks, we identified significantly enriched or depleted structure motifs relative to earlier rounds. Discrete substructures are likely to be important to RNA-protein interactions, but they are difficult to elucidate. Substructures can help make highly diverse sequence data more tractable. The structure motifs provide limited accuracy in predicting enrichment suggesting that G. kaustophilus S15 can either recognize many different secondary structure motifs or some aspects of the interaction are not captured by the analysis. This

  18. tmRNA-SmpB: a journey to the centre of the bacterial ribosome.

    OpenAIRE

    Weis, Félix; Bron, Patrick; Giudice, Emmanuel; Rolland, Jean-Paul; Thomas, Daniel; Felden, Brice; Gillet, Reynald

    2010-01-01

    International audience; Ribosomes mediate protein synthesis by decoding the information carried by messenger RNAs (mRNAs) and catalysing peptide bond formation between amino acids. When bacterial ribosomes stall on incomplete messages, the trans-translation quality control mechanism is activated by the transfer-messenger RNA bound to small protein B (tmRNA-SmpB ribonucleoprotein complex). Trans-translation liberates the stalled ribosomes and triggers degradation of the incomplete proteins. He...

  19. The Ribosomal RNA is a Useful Marker to Visualize Rhizobia Interacting with Legume Plants

    Science.gov (United States)

    Rinaudi, Luciana; Isola, Maria C.; Giordano, Walter

    2004-01-01

    Symbiosis between rhizobia and leguminous plants leads to the formation of nitrogen-fixing root nodules. In the present article, we recommend the use of the ribosomal RNA (rRNA) isolated from legume nodules in an experimental class with the purpose of introducing students to the structure of eukaryotic and prokaryotic ribosomes and of…

  20. Mutation of the mitochondrial large ribosomal RNA can provide pentamidine resistance to Saccharomyces cerevisiae.

    Science.gov (United States)

    Örs, Ş Tomris; Akdoğan, Emel; Dunn, Cory D

    2014-09-01

    Pentamidine is used to treat several trypanosomal diseases, as well as opportunistic infection by pathogenic fungi. However, the relevant targets of this drug are unknown. We isolated dominant mutations providing pentamidine resistance to Saccharomyces cerevisiae, one of which was localized to mitochondrial DNA. Next-generation sequencing revealed alteration of a widely conserved base at the peptidyl transferase center of the mitochondrial 21S ribosomal RNA. Our results provide a potential rationale for the toxicity of this drug to patients, and we discuss whether blockade of mitochondrial translation is the mechanism by which pathogenic fungi or protists are killed by pentamidine.

  1. Validation of two ribosomal RNA removal methods for microbial metatranscriptomics

    Energy Technology Data Exchange (ETDEWEB)

    He, Shaomei; Wurtzel, Omri; Singh, Kanwar; Froula, Jeff L; Yilmaz, Suzan; Tringe, Susannah G; Wang, Zhong; Chen, Feng; Lindquist, Erika A; Sorek, Rotem; Hugenholtz, Philip

    2010-10-01

    The predominance of rRNAs in the transcriptome is a major technical challenge in sequence-based analysis of cDNAs from microbial isolates and communities. Several approaches have been applied to deplete rRNAs from (meta)transcriptomes, but no systematic investigation of potential biases introduced by any of these approaches has been reported. Here we validated the effectiveness and fidelity of the two most commonly used approaches, subtractive hybridization and exonuclease digestion, as well as combinations of these treatments, on two synthetic five-microorganism metatranscriptomes using massively parallel sequencing. We found that the effectiveness of rRNA removal was a function of community composition and RNA integrity for these treatments. Subtractive hybridization alone introduced the least bias in relative transcript abundance, whereas exonuclease and in particular combined treatments greatly compromised mRNA abundance fidelity. Illumina sequencing itself also can compromise quantitative data analysis by introducing a G+C bias between runs.

  2. Lateral transfer of eukaryotic ribosomal RNA genes: an emerging concern for molecular ecology of microbial eukaryotes.

    Science.gov (United States)

    Yabuki, Akinori; Toyofuku, Takashi; Takishita, Kiyotaka

    2014-07-01

    Ribosomal RNA (rRNA) genes are widely utilized in depicting organismal diversity and distribution in a wide range of environments. Although a few cases of lateral transfer of rRNA genes between closely related prokaryotes have been reported, it remains to be reported from eukaryotes. Here, we report the first case of lateral transfer of eukaryotic rRNA genes. Two distinct sequences of the 18S rRNA gene were detected from a clonal culture of the stramenopile, Ciliophrys infusionum. One was clearly derived from Ciliophrys, but the other gene originated from a perkinsid alveolate. Genome-walking analyses revealed that this alveolate-type rRNA gene is immediately adjacent to two protein-coding genes (ubc12 and usp39), and the origin of both genes was shown to be a stramenopile (that is, Ciliophrys) in our phylogenetic analyses. These findings indicate that the alveolate-type rRNA gene is encoded on the Ciliophrys genome and that eukaryotic rRNA genes can be transferred laterally.

  3. tmRNA-mediated trans-translation as the major ribosome rescue system in a bacterial cell

    Directory of Open Access Journals (Sweden)

    Hyouta eHimeno

    2014-04-01

    Full Text Available tmRNA (transfer messenger RNA; also known as 10Sa RNA or SsrA RNA is a small RNA molecule that is conserved among bacteria. It has structural and functional similarities to tRNA: it has an upper half of the tRNA-like structure, its 5’ end is processed by RNase P, it has typical tRNA-specific base modifications, it is aminoacylated with alanine, it binds to EF-Tu after aminoacylation and it enters the ribosome with EF-Tu and GTP. However, tmRNA lacks an anticodon, and instead it has a coding sequence for a short peptide called tag-peptide. An elaborate interplay of actions of tmRNA as both tRNA and mRNA with the help of a tmRNA-binding protein, SmpB, facilitates trans-translation, which produces a single polypeptide from two mRNA molecules. Initially alanyl-tmRNA in complex with EF-Tu and SmpB enters the vacant A-site of the stalled ribosome like aminoacyl-tRNA but without a codon-anticodon interaction, and subsequently truncated mRNA is replaced with the tag-encoding region of tmRNA. During these processes, not only tmRNA but also SmpB structurally and functionally mimics both tRNA and mRNA. Thus trans-translation rescues the stalled ribosome, thereby allowing recycling of the ribosome. Since the tag-peptide serves as a target of AAA+ proteases, the trans-translation products are preferentially degraded so that they do not accumulate in the cell. Although alternative rescue systems have recently been revealed, trans-translation is the only system that universally exists in bacteria. Furthermore, it is unique in that it employs a small RNA and that it prevents accumulation of nonfunctional proteins from truncated mRNA in the cell. It might play the major role in rescuing the stalled translation in the bacterial cell.

  4. Turnover of ribosomal RNA in mouse fibroblasts (3T3) in culture

    Energy Technology Data Exchange (ETDEWEB)

    Kolodny, G.M.

    1975-01-01

    Growing and confluent cultures of mouse fibroblasts were labeled with /sup 3/H-uridine and chased with an excess of nonradioactive uridine to investigate the turnover of ribosomal RNA. Growing cultures did not turn over their 18S and 28S ribosomal RNA; however, confluent cultures did show ribosomal RNA (rRNA) turnover. If the cells were labeled while growing and chased when confluent, 18S RNA displayed a two-component decay curve, while 28S RNA showed only single-component decay, similar in lifetime to the first component of the 18S RNA decay curve. If the cells were labeled while confluent, both the 18S and 28S RNA showed single-component decay curves with a lifetime possibly only slightly longer than the lifetime of the first component of the 18S RNA and the single component of the 28S RNA of the cultures labeled while growing.

  5. Profiling of Ribose Methylations in RNA by High-Throughput Sequencing

    DEFF Research Database (Denmark)

    Birkedal, Ulf; Christensen-Dalsgaard, Mikkel; Krogh, Nicolai;

    2015-01-01

    Ribose methylations are the most abundant chemical modifications of ribosomal RNA and are critical for ribosome assembly and fidelity of translation. Many aspects of ribose methylations have been difficult to study due to lack of efficient mapping methods. Here, we present a sequencing-based method...

  6. rRNA maturation as a "quality" control step in ribosomal subunit assembly in Dictyostelium discoideum.

    Science.gov (United States)

    Mangiarotti, G; Chiaberge, S; Bulfone, S

    1997-10-31

    In Dictyostelium discoideum, newly assembled ribosomal subunits enter polyribosomes while they still contain immature rRNA. rRNA maturation requires the engagement of the subunits in protein synthesis and leads to stabilization of their structure. Maturation of pre-17 S rRNA occurs only after the newly formed 40 S ribosomal particle has entered an 80 S ribosome and participated at least in the formation of one peptide bond or in one translocation event; maturation of pre-26 S rRNA requires the presence on the 80 S particle of a peptidyl-tRNA containing at least 6 amino acids. Newly assembled particles that cannot fulfill these requirements for structural reasons are disassembled into free immature rRNA and ribosomal proteins.

  7. Characterization of Dermanyssus gallinae (Acarina: Dermanissydae) by sequence analysis of the ribosomal internal transcribed spacer regions.

    Science.gov (United States)

    Potenza, L; Cafiero, M A; Camarda, A; La Salandra, G; Cucchiarini, L; Dachà, M

    2009-10-01

    In the present work mites previously identified as Dermanyssus gallinae De Geer (Acari, Mesostigmata) using morphological keys were investigated by molecular tools. The complete internal transcribed spacer 1 (ITS1), 5.8S ribosomal DNA, and ITS2 region of the ribosomal DNA from mites were amplified and sequenced to examine the level of sequence variations and to explore the feasibility of using this region in the identification of this mite. Conserved primers located at the 3'end of 18S and at the 5'start of 28S rRNA genes were used first, and amplified fragments were sequenced. Sequence analyses showed no variation in 5.8S and ITS2 region while slight intraspecific variations involving substitutions as well as deletions concentrated in the ITS1 region. Based on the sequence analyses a nested PCR of the ITS2 region followed by RFLP analyses has been set up in the attempt to provide a rapid molecular diagnostic tool of D. gallinae.

  8. MMB-GUI: a fast morphing method demonstrates a possible ribosomal tRNA translocation trajectory.

    Science.gov (United States)

    Tek, Alex; Korostelev, Andrei A; Flores, Samuel Coulbourn

    2016-01-08

    Easy-to-use macromolecular viewers, such as UCSF Chimera, are a standard tool in structural biology. They allow rendering and performing geometric operations on large complexes, such as viruses and ribosomes. Dynamical simulation codes enable modeling of conformational changes, but may require considerable time and many CPUs. There is an unmet demand from structural and molecular biologists for software in the middle ground, which would allow visualization combined with quick and interactive modeling of conformational changes, even of large complexes. This motivates MMB-GUI. MMB uses an internal-coordinate, multiscale approach, yielding as much as a 2000-fold speedup over conventional simulation methods. We use Chimera as an interactive graphical interface to control MMB. We show how this can be used for morphing of macromolecules that can be heterogeneous in biopolymer type, sequence, and chain count, accurately recapitulating structural intermediates. We use MMB-GUI to create a possible trajectory of EF-G mediated gate-passing translocation in the ribosome, with all-atom structures. This shows that the GUI makes modeling of large macromolecules accessible to a wide audience. The morph highlights similarities in tRNA conformational changes as tRNA translocates from A to P and from P to E sites and suggests that tRNA flexibility is critical for translocation completion.

  9. Identification of a Recently Active Mammalian SINE Derived from Ribosomal RNA

    Science.gov (United States)

    Longo, Mark S.; Brown, Judy D.; Zhang, Chu; O’Neill, Michael J.; O’Neill, Rachel J.

    2015-01-01

    Complex eukaryotic genomes are riddled with repeated sequences whose derivation does not coincide with phylogenetic history and thus is often unknown. Among such sequences, the capacity for transcriptional activity coupled with the adaptive use of reverse transcription can lead to a diverse group of genomic elements across taxa, otherwise known as selfish elements or mobile elements. Short interspersed nuclear elements (SINEs) are nonautonomous mobile elements found in eukaryotic genomes, typically derived from cellular RNAs such as tRNAs, 7SL or 5S rRNA. Here, we identify and characterize a previously unknown SINE derived from the 3′-end of the large ribosomal subunit (LSU or 28S rDNA) and transcribed via RNA polymerase III. This new element, SINE28, is represented in low-copy numbers in the human reference genome assembly, wherein we have identified 27 discrete loci. Phylogenetic analysis indicates these elements have been transpositionally active within primate lineages as recently as 6 MYA while modern humans still carry transcriptionally active copies. Moreover, we have identified SINE28s in all currently available assembled mammalian genome sequences. Phylogenetic comparisons indicate that these elements are frequently rederived from the highly conserved LSU rRNA sequences in a lineage-specific manner. We propose that this element has not been previously recognized as a SINE given its high identity to the canonical LSU, and that SINE28 likely represents one of possibly many unidentified, active transposable elements within mammalian genomes. PMID:25637222

  10. Characterization of recombinant bacteriophages containing mosquito ribosomal RNA genes

    Energy Technology Data Exchange (ETDEWEB)

    Park, Y.J.

    1988-01-01

    A family of nine recombinant bacteriophages containing rRNA genes from cultured cells of the mosquito, Aedes albopictus, has been isolated by screening two different genomic DNA libraries - Charon 30 and EMBL 3 using {sup 32}P-labeled 18S and 28S rRNA as probes. These nine recombinant bacteriophages were characterized by restriction mapping, Southern blotting, and S1 nuclease analysis. The 18S rRNA coding region contains an evolutionarily conserved EcoRI site near the 3{prime}-end, and measures 1800 bp. The 28S rRNA genes were divided into {alpha} and {beta} coding regions measuring 1750 bp and 2000 bp, respectively. The gap between these two regions measures about 340 bp. No insertion sequences were found in the rRNA coding regions. The entire rDNA repeat unit had a minimum length of 15.6 kb, including a nontranscribed spacer region. The non-transcribed spacer region of cloned A. albopictus rDNA contained a common series of seven PvuI sites within a 1250 bp region upstream of the 18S rRNA coding region, and a proportion of this region also showed heterogeneity both in the length and in the restriction sites.

  11. Specialized yeast ribosomes: a customized tool for selective mRNA translation.

    Directory of Open Access Journals (Sweden)

    Johann W Bauer

    Full Text Available Evidence is now accumulating that sub-populations of ribosomes - so-called specialized ribosomes - can favour the translation of subsets of mRNAs. Here we use a large collection of diploid yeast strains, each deficient in one or other copy of the set of ribosomal protein (RP genes, to generate eukaryotic cells carrying distinct populations of altered 'specialized' ribosomes. We show by comparative protein synthesis assays that different heterologous mRNA reporters based on luciferase are preferentially translated by distinct populations of specialized ribosomes. These mRNAs include reporters carrying premature termination codons (PTC thus allowing us to identify specialized ribosomes that alter the efficiency of translation termination leading to enhanced synthesis of the wild-type protein. This finding suggests that these strains can be used to identify novel therapeutic targets in the ribosome. To explore this further we examined the translation of the mRNA encoding the extracellular matrix protein laminin β3 (LAMB3 since a LAMB3-PTC mutant is implicated in the blistering skin disease Epidermolysis bullosa (EB. This screen identified specialized ribosomes with reduced levels of RP L35B as showing enhanced synthesis of full-length LAMB3 in cells expressing the LAMB3-PTC mutant. Importantly, the RP L35B sub-population of specialized ribosomes leave both translation of a reporter luciferase carrying a different PTC and bulk mRNA translation largely unaltered.

  12. Mutational robustness of 16S ribosomal RNA, shown by experimental horizontal gene transfer in Escherichia coli

    OpenAIRE

    Kitahara, Kei; Yasutake, Yoshiaki; Miyazaki, Kentaro

    2012-01-01

    The bacterial ribosome consists of three rRNA molecules and 57 proteins and plays a crucial role in translating mRNA-encoded information into proteins. Because of the ribosome’s structural and mechanistic complexity, it is believed that each ribosomal component coevolves to maintain its function. Unlike 5S rRNA, 16S and 23S rRNAs appear to lack mutational robustness, because they form the structural core of the ribosome. However, using Escherichia coli Δ7 (null mutant of operons) as a host, w...

  13. Choreography of molecular movements during ribosome progression along mRNA.

    Science.gov (United States)

    Belardinelli, Riccardo; Sharma, Heena; Caliskan, Neva; Cunha, Carlos E; Peske, Frank; Wintermeyer, Wolfgang; Rodnina, Marina V

    2016-04-01

    During translation elongation, ribosome translocation along an mRNA entails rotations of the ribosomal subunits, swiveling motions of the small subunit (SSU) head and stepwise movements of the tRNAs together with the mRNA. Here, we reconstructed the choreography of the collective motions of the Escherichia coli ribosome during translocation promoted by elongation factor EF-G, by recording the fluorescence signatures of nine different reporters placed on both ribosomal subunits, tRNA and mRNA. We captured an early forward swiveling of the SSU head taking place while the SSU body rotates in the opposite, clockwise direction. Backward swiveling of the SSU head starts upon tRNA translocation and continues until the post-translocation state is reached. This work places structures of translocation intermediates along a time axis and unravels principles of the motions of macromolecular machines.

  14. Translation by polysome: theory of ribosome profile on a single mRNA transcript

    CERN Document Server

    Sharma, Ajeet K

    2011-01-01

    The process of polymerizing a protein by a ribosome, using a messenger RNA (mRNA) as the corresponding template, is called {\\it translation}. Ribosome may be regarded as a molecular motor for which the mRNA template serves also as the track. Often several ribosomes may translate the same (mRNA) simultaneously. The ribosomes bound simultaneously to a single mRNA transcript are the members of a polyribosome (or, simply, {\\it polysome}). Experimentally measured {\\it polysome profile} gives the distribution of polysome {\\it sizes}. Recently a breakthrough in determining the instantaneous {\\it positions} of the ribosomes on a given mRNA track has been achieved and the technique is called {\\it ribosome profiling} \\cite{ingolia10,guo10}. Motivated by the success of these techniques, we have studied the spatio-temporal organization of ribosomes by extending a theoretical model that we have reported elsewhere \\cite{sharma11}. This extended version of our model incorporates not only (i) mechano-chemical cycle of indivi...

  15. The human Shwachman-Diamond syndrome protein, SBDS, associates with ribosomal RNA.

    Science.gov (United States)

    Ganapathi, Karthik A; Austin, Karyn M; Lee, Chung-Sheng; Dias, Anusha; Malsch, Maggie M; Reed, Robin; Shimamura, Akiko

    2007-09-01

    Shwachman-Diamond syndrome (SDS) is an autosomal recessive disorder characterized by bone marrow failure, exocrine pancreatic dysfunction, and leukemia predisposition. Mutations in the SBDS gene are identified in most patients with SDS. SBDS encodes a highly conserved protein of unknown function. Data from SBDS orthologs suggest that SBDS may play a role in ribosome biogenesis or RNA processing. Human SBDS is enriched in the nucleolus, the major cellular site of ribosome biogenesis. Here we report that SBDS nucleolar localization is dependent on active rRNA transcription. Cells from patients with SDS or Diamond-Blackfan anemia are hypersensitive to low doses of actinomycin D, an inhibitor of rRNA transcription. The addition of wild-type SBDS complements the actinomycin D hypersensitivity of SDS patient cells. SBDS migrates together with the 60S large ribosomal subunit in sucrose gradients and coprecipitates with 28S ribosomal RNA (rRNA). Loss of SBDS is not associated with a discrete block in rRNA maturation or with decreased levels of the 60S ribosomal subunit. SBDS forms a protein complex with nucleophosmin, a multifunctional protein implicated in ribosome biogenesis and leukemogenesis. Our studies support the addition of SDS to the growing list of human bone marrow failure syndromes involving the ribosome.

  16. Routine forensic use of the mitochondrial 12S ribosomal RNA gene for species identification.

    Science.gov (United States)

    Melton, Terry; Holland, Charity

    2007-11-01

    Since July 2004, Mitotyping Technologies has been amplifying and sequencing a approximately 150 base pair fragment of mitochondrial DNA (mtDNA) that codes for 12S ribosomal RNA, to identify the species origin of nonhuman casework samples. The approximately 100 base pair sequence product is searched at http://www.ncbi.nlm.nih.gov/BLAST and the species match is reported. The use of this assay has halved the number of samples for which no mtDNA results are obtained and is especially useful on hairs and degraded samples. The availability of species determination may aid forensic investigators in opening or closing off lines of inquiry where a highly probative but challenging sample has been collected.

  17. Mapping of the RNA recognition site of Escherichia coli ribosomal protein S7.

    Science.gov (United States)

    Robert, F; Gagnon, M; Sans, D; Michnick, S; Brakier-Gingras, L

    2000-11-01

    Bacterial ribosomal protein S7 initiates the folding of the 3' major domain of 16S ribosomal RNA by binding to its lower half. The X-ray structure of protein S7 from thermophilic bacteria was recently solved and found to be a modular structure, consisting of an alpha-helical domain with a beta-ribbon extension. To gain further insights into its interaction with rRNA, we cloned the S7 gene from Escherichia coli K12 into a pET expression vector and introduced 4 deletions and 12 amino acid substitutions in the protein sequence. The binding of each mutant to the lower half of the 3' major domain of 16S rRNA was assessed by filtration on nitrocellulose membranes. Deletion of the N-terminal 17 residues or deletion of the B hairpins (residues 72-89) severely decreased S7 affinity for the rRNA. Truncation of the C-terminal portion (residues 138-178), which includes part of the terminal alpha-helix, significantly affected S7 binding, whereas a shorter truncation (residues 148-178) only marginally influenced its binding. Severe effects were also observed with several strategic point mutations located throughout the protein, including Q8A and F17G in the N-terminal region, and K35Q, G54S, K113Q, and M115G in loops connecting the alpha-helices. Our results are consistent with the occurrence of several sites of contact between S7 and the 16S rRNA, in line with its role in the folding of the 3' major domain.

  18. Modeling of ribosome dynamics on a ds-mRNA under an external load

    Science.gov (United States)

    Shakiba, Bahareh; Dayeri, Maryam; Mohammad-Rafiee, Farshid

    2016-07-01

    Protein molecules in cells are synthesized by macromolecular machines called ribosomes. According to the recent experimental data, we reduce the complexity of the ribosome and propose a model to express its activity in six main states. Using our model, we study the translation rate in different biological relevant situations in the presence of external force and the translation through the RNA double stranded region in the absence or presence of the external force. In the present study, we give a quantitative theory for translation rate and show that the ribosome behaves more like a Brownian Ratchet motor. Our findings could shed some light on understanding behaviors of the ribosome in biological conditions.

  19. Modeling of Ribosome Dynamics on a ds-mRNA under an External Load

    CERN Document Server

    Shakiba, Bahareh; Mohammad-Rafiee, Farshid

    2016-01-01

    Protein molecules in cells are synthesized by macromolecular machines called ribosomes. According to recent experimental data, we reduce the complexity of the ribosome and propose a model to express its activity in six main states. Using our model, we study the translation rate in different biological relevant situations in the presence of external force, and translation through the RNA double stranded region in the absence or presence of the external force. In the present study, we give a quantitative theory for translation rate and show that the ribosome behaves more like a Brownian Ratchet motor. Our findings could shed some light on understanding behaviors of the ribosome in biological conditions.

  20. A ribosomal RNA gene intergenic spacer based PCR and DGGE fingerprinting method for the analysis of specific rhizobial communities in soil

    NARCIS (Netherlands)

    de Oliveira, VM; Manfio, GP; Coutinho, HLD; Keijzer-Wolters, AC; van Elsas, JD

    2006-01-01

    A direct molecular method for assessing the diversity of specific populations of rhizobia in soil, based on nested PCR amplification of 16S-23S ribosomal RNA gene (rDNA) intergenic spacer (IGS) sequences, was developed. Initial generic amplification of bacterial rDNA IGS sequences from soil DNA was

  1. Molecular phylogeny of silk-producing insects based on 16S ribosomal RNA and cytochrome oxidase subunit I genes

    Indian Academy of Sciences (India)

    B. Mahendran; S. K. Ghosh; S. C. Kundu

    2006-04-01

    We have examined the molecular-phylogenetic relationships between nonmulberry and mulberry silkwormspecies that belong to the families Saturniidae, Bombycidae and Lasiocampidae using 16S ribosomal RNA (16S rRNA) and cytochrome oxidase subunit I (coxI) gene sequences. Aligned nucleotide sequences of 16S rRNA and coxI from 14 silk-producing species were used for construction of phylogenetic trees by maximum likelihood and maximum parsimony methods. The tree topology on the basis of 16S rRNA supports monophyly for members of Saturniidae and Bombycidae. Weighted parsimony analysis weighted towards transversions relative to transitions (ts, tv4) for coxI resulted in more robust bootstrap support over unweighted parsimony and favours the 16S rRNA tree topology. Combined analysis reflected clear biogeographic pattern, and agrees with morphological and cytological data.

  2. Molecular identification of sibling species of Sclerodermus (Hymenoptera: Bethylidae that parasitize buprestid and cerambycid beetles by using partial sequences of mitochondrial DNA cytochrome oxidase subunit 1 and 28S ribosomal RNA gene.

    Directory of Open Access Journals (Sweden)

    Yuan Jiang

    Full Text Available The species belonging to Sclerodermus (Hymenoptera: Bethylidae are currently the most important insect natural enemies of wood borer pests, mainly buprestid and cerambycid beetles, in China. However, some sibling species of this genus are very difficult to distinguish because of their similar morphological features. To address this issue, we conducted phylogenetic and genetic analyses of cytochrome oxidase subunit I (COI and 28S RNA gene sequences from eight species of Sclerodermus reared from different wood borer pests. The eight sibling species were as follows: S. guani Xiao et Wu, S. sichuanensis Xiao, S. pupariae Yang et Yao, and Sclerodermus spp. (Nos. 1-5. A 594-bp fragment of COI and 750-bp fragment of 28S were subsequently sequenced. For COI, the G-C content was found to be low in all the species, averaging to about 30.0%. Sequence divergences (Kimura-2-parameter distances between congeneric species averaged to 4.5%, and intraspecific divergences averaged to about 0.09%. Further, the maximum sequence divergences between congeneric species and Sclerodermus sp. (No. 5 averaged to about 16.5%. All 136 samples analyzed were included in six reciprocally monophyletic clades in the COI neighbor-joining (NJ tree. The NJ tree inferred from the 28S rRNA sequence yielded almost identical results, but the samples from S. guani, S. sichuanensis, S. pupariae, and Sclerodermus spp. (Nos. 1-4 clustered together and only Sclerodermus sp. (No. 5 clustered separately. Our findings indicate that the standard barcode region of COI can be efficiently used to distinguish morphologically similar Sclerodermus species. Further, we speculate that Sclerodermus sp. (No. 5 might be a new species of Sclerodermus.

  3. What do we know about ribosomal RNA methylation in Escherichia coli?

    Science.gov (United States)

    Sergeeva, O V; Bogdanov, A A; Sergiev, P V

    2015-10-01

    A ribosome is a ribonucleoprotein that performs the synthesis of proteins. Ribosomal RNA of all organisms includes a number of modified nucleotides, such as base or ribose methylated and pseudouridines. Methylated nucleotides are highly conserved in bacteria and some even universally. In this review we discuss available data on a set of modification sites in the most studied bacteria, Escherichia coli. While most rRNA modification enzymes are known for this organism, the function of the modified nucleotides is rarely identified.

  4. Ribosome collisions and Translation efficiency: Optimization by codon usage and mRNA destabilization

    DEFF Research Database (Denmark)

    Mitarai, Namiko; Sneppen, Kim; Pedersen, Steen

    2008-01-01

    Individual mRNAs are translated by multiple ribosomes that initiate translation with an interval of a few seconds. The ribosome speed is codon dependent, and ribosome queuing has been suggested to explain specific data for translation of some mRNAs in vivo. By modeling the stochastic translation...... process as a traffic problem, we here analyze conditions and consequences of collisions and queuing. The model allowed us to determine the on-rate (0.8 to 1.1 initiations/s) and the time (1 s) the preceding ribosome occludes initiation for Escherichia coli lacZ mRNA in vivo. We find that ribosome...... collisions and queues are inevitable consequences of a stochastic translation mechanism that reduce the translation efficiency substantially on natural mRNAs. The cells minimize collisions by having its mRNAs being unstable and by a highly selected codon usage in the start of the mRNA. The cost of m...

  5. A quantitative SMRT cell sequencing method for ribosomal amplicons.

    Science.gov (United States)

    Jones, Bethan M; Kustka, Adam B

    2017-04-01

    Advances in sequencing technologies continue to provide unprecedented opportunities to characterize microbial communities. For example, the Pacific Biosciences Single Molecule Real-Time (SMRT) platform has emerged as a unique approach harnessing DNA polymerase activity to sequence template molecules, enabling long reads at low costs. With the aim to simultaneously classify and enumerate in situ microbial populations, we developed a quantitative SMRT (qSMRT) approach that involves the addition of exogenous standards to quantify ribosomal amplicons derived from environmental samples. The V7-9 regions of 18S SSU rDNA were targeted and quantified from protistan community samples collected in the Ross Sea during the Austral summer of 2011. We used three standards of different length and optimized conditions to obtain accurate quantitative retrieval across the range of expected amplicon sizes, a necessary criterion for analyzing taxonomically diverse 18S rDNA molecules from natural environments. The ability to concurrently identify and quantify microorganisms in their natural environment makes qSMRT a powerful, rapid and cost-effective approach for defining ecosystem diversity and function.

  6. Ribosomal RNA gene diversity, effective population size, and evolutionary longevity in asexual glomeromycota.

    Science.gov (United States)

    Vankuren, Nicholas W; den Bakker, Henk C; Morton, Joseph B; Pawlowska, Teresa E

    2013-01-01

    Arbuscular mycorrhizal fungi (phylum Glomeromycota) are among the oldest and most successful symbionts of land plants. With no evidence of sexual reproduction, their evolutionary success is inconsistent with the prediction that asexual taxa are vulnerable to extinction due to accumulation of deleterious mutations. To explore why Glomeromycota defy this prediction, we studied ribosomal RNA (rRNA) gene evolution in the Claroideoglomus lineage and estimated effective population size, N(e) , in C. etunicatum. We found that rRNA genes of these fungi exhibit unusual and complex patterns of molecular evolution. In C. etunicatum, these patterns can be collectively explained by an unexpectedly large N(e) combined with imperfect genome-wide and population-level rRNA gene repeat homogenization. The mutations accumulated in rRNA gene sequences indicate that natural selection is effective at purging deleterious mutations in the Claroideoglomus lineage, which is also consistent with the large N(e) of C. etunicatum. We propose that in the near absence of recombination, asexual reproduction involving massively multinucleate spores typical for Glomeromycota is responsible for the improved efficacy of selection relative to drift. We postulate that large effective population sizes contribute to the evolutionary longevity of Glomeromycota.

  7. The putative RNA helicase HELZ promotes cell proliferation, translation initiation and ribosomal protein S6 phosphorylation.

    Directory of Open Access Journals (Sweden)

    Philippe A Hasgall

    Full Text Available The hypoxia-inducible transcription factor (HIF is a key component of the cellular adaptation mechanisms to hypoxic conditions. HIFα subunits are degraded by prolyl-4-hydroxylase domain (PHD enzyme-dependent prolyl-4-hydroxylation of LxxLAP motifs that confer oxygen-dependent proteolytic degradation. Interestingly, only three non-HIFα proteins contain two conserved LxxLAP motifs, including the putative RNA helicase with a zinc finger domain HELZ. However, HELZ proteolytic regulation was found to be oxygen-independent, supporting the notion that a LxxLAP sequence motif alone is not sufficient for oxygen-dependent protein destruction. Since biochemical pathways involving RNA often require RNA helicases to modulate RNA structure and activity, we used luciferase reporter gene constructs and metabolic labeling to demonstrate that HELZ overexpression activates global protein translation whereas RNA-interference mediated HELZ suppression had the opposite effect. Although HELZ interacted with the poly(A-binding protein (PABP via its PAM2 motif, PABP was dispensable for HELZ function in protein translation. Importantly, downregulation of HELZ reduced translational initiation, resulting in the disassembly of polysomes, in a reduction of cell proliferation and hypophosphorylation of ribosomal protein S6.

  8. Reconstruction of ribosomal RNA genes from metagenomic data.

    Directory of Open Access Journals (Sweden)

    Lu Fan

    Full Text Available Direct sequencing of environmental DNA (metagenomics has a great potential for describing the 16S rRNA gene diversity of microbial communities. However current approaches using this 16S rRNA gene information to describe community diversity suffer from low taxonomic resolution or chimera problems. Here we describe a new strategy that involves stringent assembly and data filtering to reconstruct full-length 16S rRNA genes from metagenomicpyrosequencing data. Simulations showed that reconstructed 16S rRNA genes provided a true picture of the community diversity, had minimal rates of chimera formation and gave taxonomic resolution down to genus level. The strategy was furthermore compared to PCR-based methods to determine the microbial diversity in two marine sponges. This showed that about 30% of the abundant phylotypes reconstructed from metagenomic data failed to be amplified by PCR. Our approach is readily applicable to existing metagenomic datasets and is expected to lead to the discovery of new microbial phylotypes.

  9. A Long Noncoding RNA on the Ribosome Is Required for Lifespan Extension

    NARCIS (Netherlands)

    Essers, Paul B.; Nonnekens, Julie; Goos, Yvonne J.; Betist, Marco C.|info:eu-repo/dai/nl/304073202; Viester, Marjon D.; Mossink, Britt; Lansu, Nico; Korswagen, Hendrik C.; Jelier, Rob; Brenkman, Arjan B.; MacInnes, Alyson W.|info:eu-repo/dai/nl/338681388

    2015-01-01

    The biogenesis of ribosomes and their coordination of protein translation consume an enormous amount of cellular energy. As such, it has been established that the inhibition of either process can extend eukaryotic lifespan. Here, we used next-generation sequencing to compare ribosome-associated RNAs

  10. Binding of 16S rRNA to chloroplast 30S ribosomal proteins blotted on nitrocellulose

    OpenAIRE

    Rozier, Claude; Mache, Régis

    1984-01-01

    Protein-RNA associations were studied by a method using proteins blotted on a nitrocellulose sheet. This method was assayed with Escherichia Coli 30S ribosomal components. In stringent conditions (300 mM NaCl or 20° C) only 9 E. coli ribosomal proteins strongly bound to the 16S rRNA: S4, S5, S7, S9, S12, S13, S14, S19, S20. 8 of these proteins have been previously found to bind independently to the 16S rRNA. The same method was applied to determine protein-RNA interactions in spinach chloropl...

  11. Ribosomal DNA sequence heterogeneity reflects intraspecies phylogenies and predicts genome structure in two contrasting yeast species.

    Science.gov (United States)

    West, Claire; James, Stephen A; Davey, Robert P; Dicks, Jo; Roberts, Ian N

    2014-07-01

    The ribosomal RNA encapsulates a wealth of evolutionary information, including genetic variation that can be used to discriminate between organisms at a wide range of taxonomic levels. For example, the prokaryotic 16S rDNA sequence is very widely used both in phylogenetic studies and as a marker in metagenomic surveys and the internal transcribed spacer region, frequently used in plant phylogenetics, is now recognized as a fungal DNA barcode. However, this widespread use does not escape criticism, principally due to issues such as difficulties in classification of paralogous versus orthologous rDNA units and intragenomic variation, both of which may be significant barriers to accurate phylogenetic inference. We recently analyzed data sets from the Saccharomyces Genome Resequencing Project, characterizing rDNA sequence variation within multiple strains of the baker's yeast Saccharomyces cerevisiae and its nearest wild relative Saccharomyces paradoxus in unprecedented detail. Notably, both species possess single locus rDNA systems. Here, we use these new variation datasets to assess whether a more detailed characterization of the rDNA locus can alleviate the second of these phylogenetic issues, sequence heterogeneity, while controlling for the first. We demonstrate that a strong phylogenetic signal exists within both datasets and illustrate how they can be used, with existing methodology, to estimate intraspecies phylogenies of yeast strains consistent with those derived from whole-genome approaches. We also describe the use of partial Single Nucleotide Polymorphisms, a type of sequence variation found only in repetitive genomic regions, in identifying key evolutionary features such as genome hybridization events and show their consistency with whole-genome Structure analyses. We conclude that our approach can transform rDNA sequence heterogeneity from a problem to a useful source of evolutionary information, enabling the estimation of highly accurate phylogenies of

  12. Covalent crosslinking of tRNA1Val to 16S RNA at the ribosomal P site: identification of crosslinked residues.

    Science.gov (United States)

    Prince, J B; Taylor, B H; Thurlow, D L; Ofengand, J; Zimmermann, R A

    1982-09-01

    N-Acetylvalyl-tRNA1Val (AcVal-tRNA1Val) was bound to the P site of uniformly 32P-labeled 70S ribosomes from Escherichia coli and crosslinked to 16S RNA in the 30S ribosomal subunit by irradiation with light of 300-400 nm. To identify the crosslinked nucleotide in 16S RNA. AcVal-tRNA1Val-16S [32P]RNA was digested completely with RNase T1 and the band containing the covalently attached oligonucleotides from tRNA and rRNA was isolated by polyacrylamide gel electrophoresis. The crosslinked oligonucleotide, and the 32P-labeled rRNA moiety released from it by photoreversal of the crosslink at 254 nm, were then analyzed by secondary hydrolysis with pancreatic RNase A and RNase U2. The oligonucleotide derived from 16S RNA was found to be the evolutionarily conserved sequence, U-A-C-A-C-A-C-C-G1401, and the nucleotide crosslinked to tRNA1Val, C1400. The identity of the covalently attached residue in the tRNA was established by using AcVal-tRNA1Val-16S RNA prepared from unlabeled ribosomes. This complex was digested to completion with RNase T1 and the resulting RNA fragments were labeled at the 3' end with [5'-32P]pCp. The crosslinked T1 oligonucleotide isolated from the mixture yielded one major end-labeled component upon photoreversal. Chemical sequence analysis demonstrated that this product was derived from the anticodon-containing pentadecanucleotide of tRNA1Val, C-A-C-C-U-C-C-C-U-cmo5U-A-C-m6A-A-G39(cmo5U, 5-carboxymethoxyuridine). A similar study of the crosslinked oligonucleotide revealed that the residue covalently bound to 16S was cmo5U34, the 5' or wobble base of the anticodon. The adduct is believed to result from formation of a cyclobutane dimer between cmo5U34 of tRNA1Val and C1400 of the 16S RNA.

  13. 微孢子虫核糖体小亚单位RNA(ssUrRNA)基因%Small Subunit Ribosomal RNA Genes of Microsporidia

    Institute of Scientific and Technical Information of China (English)

    王见杨; 黄可威; 毛西成; 赵 昀; 陆长德

    2001-01-01

    微孢子虫是广泛分布于自然界的细胞内原虫类寄生物。它们可寄生于整个生物界。微孢子虫是真核生物,但其核糖体及核糖体RNA(rRNA)为原核生物型。为探讨9种家蚕病原性微孢子虫的种属地位及亲缘关系,对已广泛用于生物进化分类的核糖体小亚单位RNA(asurRNA)基因进行了研究。由微孢子虫ssurRNA基因序列同源性分析所构建的系统进化发育树及Southam杂交分析表明,这9种微孢子虫同为Nosema属,为同属不同种。%Microsporidia are ubiquitous intracellular parasitic protozoa infecting all types of animals. Their ribosomes and rRNAs are of prokaryotic size. In order to better understand their phylogenetic relationship and identify the uncertain species, the sequences of the small subunit ribosomal RNA (ssurRNA, 16 S rRNA) genesof nine microsporidia infectious to the silkworm, Bombyx mori, were determined. The results of phylogenetic trees and Southern blotting suggest all the nine strains of icrosporidia are various species of the genus Nosema.

  14. Slip of grip of a molecular motor on a crowded track: Modeling shift of reading frame of ribosome on RNA template

    Science.gov (United States)

    Mishra, Bhavya; Schütz, Gunter M.; Chowdhury, Debashish

    2016-06-01

    We develop a stochastic model for the programmed frameshift of ribosomes synthesizing a protein while moving along a mRNA template. Normally the reading frame of a ribosome decodes successive triplets of nucleotides on the mRNA in a step-by-step manner. We focus on the programmed shift of the ribosomal reading frame, forward or backward, by only one nucleotide which results in a fusion protein; it occurs when a ribosome temporarily loses its grip to its mRNA track. Special “slippery” sequences of nucleotides and also downstream secondary structures of the mRNA strand are believed to play key roles in programmed frameshift. Here we explore the role of an hitherto neglected parameter in regulating -1 programmed frameshift. Specifically, we demonstrate that the frameshift frequency can be strongly regulated also by the density of the ribosomes, all of which are engaged in simultaneous translation of the same mRNA, at and around the slippery sequence. Monte Carlo simulations support the analytical predictions obtained from a mean-field analysis of the stochastic dynamics.

  15. Slip of grip of a molecular motor on a crowded track: Modeling shift of reading frame of ribosome on RNA template

    CERN Document Server

    Mishra, Bhavya; Chowdhury, Debashish

    2016-01-01

    We develop a stochastic model for the programmed frameshift of ribosomes synthesizing a protein while moving along a mRNA template. Normally the reading frame of a ribosome decodes successive triplets of nucleotides on the mRNA in a step-by-step manner. We focus on the programmed shift of the ribosomal reading frame, forward or backward, by only one nucleotide which results in a fusion protein; it occurs when a ribosome temporarily loses its grip to its mRNA track. Special "slippery" sequences of nucleotides and also downstream secondary structures of the mRNA strand are believed to play key roles in programmed frameshift. Here we explore the role of an hitherto neglected parameter in regulating -1 programmed frameshift. Specifically, we demonstrate that the frameshift frequency can be strongly regulated also by the density of the ribosomes, all of which are engaged in simultaneous translation of the same mRNA, at and around the slippery sequence. Monte Carlo simulations support the analytical predictions obt...

  16. Binding of 16S rRNA to chloroplast 30S ribosomal proteins blotted on nitrocellulose.

    Science.gov (United States)

    Rozier, C; Mache, R

    1984-10-11

    Protein-RNA associations were studied by a method using proteins blotted on a nitrocellulose sheet. This method was assayed with Escherichia Coli 30S ribosomal components. In stringent conditions (300 mM NaCl or 20 degrees C) only 9 E. coli ribosomal proteins strongly bound to the 16S rRNA: S4, S5, S7, S9, S12, S13, S14, S19, S20. 8 of these proteins have been previously found to bind independently to the 16S rRNA. The same method was applied to determine protein-RNA interactions in spinach chloroplast 30S ribosomal subunits. A set of only 7 proteins was bound to chloroplast rRNA in stringent conditions: chloroplast S6, S10, S11, S14, S15, S17 and S22. They also bound to E. coli 16S rRNA. This set includes 4 chloroplast-synthesized proteins: S6, S11, S15 and S22. The core particles obtained after treatment by LiCl of chloroplast 30S ribosomal subunit contained 3 proteins (S6, S10 and S14) which are included in the set of 7 binding proteins. This set of proteins probably play a part in the early steps of the assembly of the chloroplast 30S ribosomal subunit.

  17. The nuclear 18S ribosomal RNA gene as a source of phylogenetic information in the genus Taenia.

    Science.gov (United States)

    Yan, Hongbin; Lou, Zhongzi; Li, Li; Ni, Xingwei; Guo, Aijiang; Li, Hongmin; Zheng, Yadong; Dyachenko, Viktor; Jia, Wanzhong

    2013-03-01

    Most species of the genus Taenia are of considerable medical and veterinary significance. In this study, complete nuclear 18S rRNA gene sequences were obtained from seven members of genus Taenia [Taenia multiceps, Taenia saginata, Taenia asiatica, Taenia solium, Taenia pisiformis, Taenia hydatigena, and Taenia taeniaeformis] and a phylogeny inferred using these sequences. Most of the variable sites fall within the variable regions, V1-V5. We show that sequences from the nuclear 18S ribosomal RNA gene have considerable promise as sources of phylogenetic information within the genus Taenia. Furthermore, given that almost all the variable sites lie within defined variable portions of that gene, it will be appropriate and economical to sequence only those regions for additional species of Taenia.

  18. The ribosomal RNA transcription unit of Entamoeba invadens: accumulation of unprocessed pre-rRNA and a long non coding RNA during encystation.

    Science.gov (United States)

    Ojha, Sandeep; Singh, Nishant; Bhattacharya, Alok; Bhattacharya, Sudha

    2013-01-01

    The ribosomal RNA genes in Entamoeba spp. are located on extrachromosomal circular molecules. Unlike model organisms where rRNA transcription stops during growth stress, Entamoeba histolytica continues transcription; but unprocessed pre-rRNA accumulates during stress, along with a novel class of circular transcripts from the 5'-external transcribed spacer (ETS). To determine the fate of rRNA transcription during stage conversion between trophozoite to cyst we analyzed Entamoeba invadens, a model system for differentiation studies in Entamoeba. We characterized the complete rDNA transcription unit by mapping the ends of pre-rRNA and mature rRNAs. The 3' end of mature 28S rRNA was located 321 nt downstream of the end predicted by sequence homology with E. histolytica. The major processing sites were mapped in external and internal transcribed spacers. The promoter located within 146 nt upstream of 5' ETS was used to transcribe the pre-rRNA. On the other hand, a second promoter located at the 3' end of 28S rDNA was used to transcribe almost the entire intergenic spacer into a long non coding (nc) RNA (>10 kb). Interestingly we found that the levels of pre-rRNA and long ncRNA, measured by northern hybridization, decreased initially in cells shifted to encystation medium, after which they began to increase and reached high levels by 72 h when mature cysts were formed. Unlike E. histolytica, no circular transcripts were found in E. invadens. E. histolytica and E. invadens express fundamentally different ncRNAs from the rDNA locus, which may reflect their adaptation to different hosts (human and reptiles, respectively). This is the first description of rDNA organization and transcription in E. invadens, and provides the framework for further studies on regulation of rRNA synthesis during cyst formation.

  19. The NBS1-Treacle complex controls ribosomal RNA transcription in response to DNA damage

    DEFF Research Database (Denmark)

    Larsen, Dorthe H; Hari, Flurina; Clapperton, Julie A

    2014-01-01

    Chromosome breakage elicits transient silencing of ribosomal RNA synthesis, but the mechanisms involved remained elusive. Here we discover an in trans signalling mechanism that triggers pan-nuclear silencing of rRNA transcription in response to DNA damage. This is associated with transient...

  20. Probing dimensionality beyond the linear sequence of mRNA.

    Science.gov (United States)

    Del Campo, Cristian; Ignatova, Zoya

    2016-05-01

    mRNA is a nexus entity between DNA and translating ribosomes. Recent developments in deep sequencing technologies coupled with structural probing have revealed new insights beyond the classic role of mRNA and place it more centrally as a direct effector of a variety of processes, including translation, cellular localization, and mRNA degradation. Here, we highlight emerging approaches to probe mRNA secondary structure on a global transcriptome-wide level and compare their potential and resolution. Combined approaches deliver a richer and more complex picture. While our understanding on the effect of secondary structure for various cellular processes is quite advanced, the next challenge is to unravel more complex mRNA architectures and tertiary interactions.

  1. Classification of methanogenic bacteria by 16S ribosomal RNA characterization

    Energy Technology Data Exchange (ETDEWEB)

    Fox, G.E.; Magrum, L.J.; Balch, W.E.; Wolfe, R.S.; Woese, C.R.

    1977-10-01

    The 16S ribosomal RNAs from 10 species of methanogenic bacteria have been characterized in terms of the oligonucleotides produced by T/sub 1/ RNase digestion. Comparative analysis of these data reveals the methanogens to constitute a distinct phylogenetic group containing two major divisions. These organisms appear to be only distantly related to typical bacteria.

  2. Interaction of the antibiotics clindamycin and lincomycin with Escherichia coli 23S ribosomal RNA

    DEFF Research Database (Denmark)

    Douthwaite, S

    1992-01-01

    Interaction of the antibiotics clindamycin and lincomycin with Escherichia coli ribosomes has been compared by chemical footprinting. The protection afforded by both drugs is limited to the peptidyl transferase loop of 23S rRNA. Under conditions of stoichiometric binding at 1 mM drug concentration...... of the two drugs for the ribosome, estimated by footprinting, is approximately the same, giving Kdiss values of 5 microM for lincomycin and 8 microM for clindamycin. The results show that in vitro the drugs are equally potent in blocking their ribosomal target site. Their inhibitory effects on peptide bond...

  3. Basonuclin regulates a subset of ribosomal RNA genes in HaCaT cells.

    Directory of Open Access Journals (Sweden)

    Shengliang Zhang

    Full Text Available Basonuclin (Bnc1, a cell-type-specific ribosomal RNA (rRNA gene regulator, is expressed mainly in keratinocytes of stratified epithelium and gametogenic cells of testis and ovary. Previously, basonuclin was shown in vitro to interact with rRNA gene (rDNA promoter at three highly conserved sites. Basonuclin's high affinity binding site overlaps with the binding site of a dedicated and ubiquitous Pol I transcription regulator, UBF, suggesting that their binding might interfere with each other if they bind to the same promoter. Knocking-down basonuclin in mouse oocytes eliminated approximately one quarter of RNA polymerase I (Pol I transcription foci, without affecting the BrU incorporation of the remaining ones, suggesting that basonuclin might regulate a subset of rDNA. Here we show, via chromatin immunoprecipitation (ChIP, that basonuclin is associated with rDNA promoters in HaCaT cells, a spontaneously established human keratinocyte line. Immunoprecipitation data suggest that basonuclin is in a complex that also contains the subunits of Pol I (RPA194, RPA116, but not UBF. Knocking-down basonuclin in HaCaT cells partially impairs the association of RPA194 to rDNA promoter, but not that of UBF. Basonuclin-deficiency also reduces the amount of 47S pre-rRNA, but this effect can be seen only after cell-proliferation related rRNA synthesis has subsided at a higher cell density. DNA sequence of basonuclin-bound rDNA promoters shows single nucleotide polymorphisms (SNPs that differ from those associated with UBF-bound promoters, suggesting that basonuclin and UBF interact with different subsets of promoters. In conclusion, our results demonstrate basonuclin's functional association with rDNA promoters and its interaction with Pol I in vivo. Our data also suggest that basonuclin-Pol I complex transcribes a subset of rDNA.

  4. Extraction of ribosomal RNA and genomic DNA from soil for studying the diversity of the indigenous bacterial community

    NARCIS (Netherlands)

    Duarte, G.F.; Rosado, A.S.; Keijzer-Wolters, A.C.; Elsas, van J.D.

    1998-01-01

    A method for the indirect (cell extraction followed by nucleic acid extraction) isolation of bacterial ribosomal RNA (rRNA) and genomic DNA from soil was developed. The protocol allowed for the rapid parallel extraction of genomic DNA as well as small and large ribosomal subunit RNA from four soils

  5. Extraction of ribosomal RNA and genomic DNA from soil for studying the diversity of the indigenous bacterial community

    NARCIS (Netherlands)

    Duarte, G.F.; Rosado, A.S.; Keijzer-Wolters, A.C.; Elsas, van J.D.

    1998-01-01

    A method for the indirect (cell extraction followed by nucleic acid extraction) isolation of bacterial ribosomal RNA (rRNA) and genomic DNA from soil was developed. The protocol allowed for the rapid parallel extraction of genomic DNA as well as small and large ribosomal subunit RNA from four soils

  6. RNAome sequencing delineates the complete RNA landscape

    NARCIS (Netherlands)

    K.W.J. Derks (Kasper); J. Pothof (Joris)

    2015-01-01

    textabstractStandard RNA expression profiling methods rely on enrichment steps for specific RNA classes, thereby not detecting all RNA species. For example, small and large RNAs from the same sample cannot be sequenced in a single sequence run. We designed RNAome sequencing, which is a strand-specif

  7. Unusual structure of ribosomal DNA in the copepod Tigriopus californicus: intergenic spacer sequences lack internal subrepeats.

    Science.gov (United States)

    Burton, R S; Metz, E C; Flowers, J M; Willett, C S

    2005-01-03

    Eukaryotic nuclear ribosomal DNA (rDNA) is typically arranged as a series of tandem repeats coding for 18S, 5.8S, and 28S ribosomal RNAs. Transcription of rDNA repeats is initiated in the intergenic spacer (IGS) region upstream of the 18S gene. The IGS region itself typically consists of a set of subrepeats that function as transcriptional enhancers. Two important evolutionary forces have been proposed to act on the IGS region: first, selection may favor changes in the number of subrepeats that adaptively adjust rates of rDNA transcription, and second, coevolution of IGS sequence with RNA polymerase I transcription factors may lead to species specificity of the rDNA transcription machinery. To investigate the potential role of these forces on population differentiation and hybrid breakdown in the intertidal copepod Tigriopus californicus, we have characterized the rDNA of five T. californicus populations from the Pacific Coast of North America and one sample of T. brevicornicus from Scotland. Major findings are as follows: (1) the structural genes for 18S and 28S are highly conserved across T. californicus populations, in contrast to other nuclear and mitochondrial DNA (mtDNA) genes previously studied in these populations. (2) There is extensive differentiation among populations in the IGS region; in the extreme, no homology is observed across the IGS sequences (>2 kb) from the two Tigriopus species. (3) None of the Tigriopus IGS sequences have the subrepeat structure common to other eukaryotic IGS regions. (4) Segregation of rDNA in laboratory crosses indicates that rDNA is located on at least two separate chromosomes in T. californicus. These data suggest that although IGS length polymorphism does not appear to play the adaptive role hypothesized in some other eukaryotic systems, sequence divergence in the rDNA promoter region within the IGS could lead to population specificity of transcription in hybrids.

  8. Tsukamurella tyrosinosolvens intravascular catheter infection identified using 16S ribosomal DNA sequencing.

    Science.gov (United States)

    Sheridan, Elizabeth A S; Warwick, Simon; Chan, Anthony; Dall'Antonia, Martino; Koliou, Maria; Sefton, Armine

    2003-03-01

    Cultures of blood from a hemodialysis line repeatedly yielded a gram-positive rod. The organism was identified as Tsukamurella tyrosinosolvens by 16S ribosomal DNA sequencing, and the patient was treated successfully by removal of the line.

  9. Flipping of the ribosomal A-site adenines provides a basis for tRNA selection

    Science.gov (United States)

    Zeng, Xiancheng; Chugh, Jeetender; Casiano-Negroni, Anette; Al-Hashimi, Hashim M.; Brooks, Charles L.

    2014-01-01

    Ribosomes control the missense error rate of ~10−4 during translation though quantitative contributions of individual mechanistic steps of the conformational changes yet to be fully determined. Biochemical and biophysical studies led to a qualitative tRNA selection model in which ribosomal A-site residues A1492 and A1493 (A1492/3) flip out in response to cognate tRNA binding, promoting the subsequent reactions, but not in the case of near cognate or non-cognate tRNA. However, this model was recently questioned by X-ray structures revealing conformations of extrahelical A1492/3 and domain closure of the decoding center in both cognate and near-cognate tRNA bound ribosome complexes, suggesting that the non-specific flipping of A1492/3 has no active role in tRNA selection. We explore this question by carrying out molecular dynamics (MD) simulations, aided with fluorescence and NMR experiments, to probe the free energy cost of extrahelical flipping of 1492/3 and the strain energy associated with domain conformational change. Our rigorous calculations demonstrate that the A1492/3 flipping is indeed a specific response to the binding of cognate tRNA, contributing 3 kcal/mol to the specificity of tRNA selection. Furthermore, the different A-minor interactions in cognate and near-cognate complexes propagate into the conformational strain and contribute another 4 kcal/mol in domain closure. The recent structure of ribosome with features of extrahelical A1492/3 and closed domain in near-cognate complex is reconciled by possible tautomerization of the wobble base pair in mRNA-tRNA. These results quantitatively rationalize other independent experimental observations and explain the ribosomal discrimination mechanism of selecting cognate versus near-cognate tRNA. PMID:24813122

  10. A ribonucleoprotein fragment of the 30 S ribosome of E. coli containing two contiguous domains of the 16 S RNA.

    Science.gov (United States)

    Spitnik-Elson, P; Elson, D; Avital, S; Abramowitz, R

    1982-08-11

    Ribonucleoprotein fragments of the 30 S ribosome of E. coli have been prepared by limited ribonuclease digestion and mild heating of the ribosome in a constant ionic environment. One such fragment has been described previously. A second electrophoretically homogeneous fragment has now been isolated and its RNA and protein moieties have been characterized. It contains the 5' half of the 16 S RNA, encompassing domains I and II except for the extreme 5' terminus and several small gaps. Seven proteins are present: S4, S5, S6, S8, S12, S15 and S20. The RNA binding sites of five of these proteins are known, and all are RNA sequences that are present in the fragment. Published neutron scattering and immuno-electron microscopic data indicate that six of the proteins are clustered together in a cross sectional slice through the center of the subunit. After deproteinization, the RNA moiety gives two bands in gel electrophoresis, one containing domains I and II and the other, essentially only domain II. The former, although larger, migrates faster in gel electrophoresis, indicating that RNA domains I and II interact with each other in such a way as to become more compact than domain II by itself.

  11. Direct Activation of Ribosome-Associated Double-Stranded RNA-Dependent Protein Kinase (PKR by Deoxynivalenol, Anisomycin and Ricin: A New Model for Ribotoxic Stress Response Induction

    Directory of Open Access Journals (Sweden)

    Hui-Ren Zhou

    2014-12-01

    Full Text Available Double-stranded RNA (dsRNA-activated protein kinase (PKR is a critical upstream mediator of the ribotoxic stress response (RSR to the trichothecene deoxynivalenol (DON and other translational inhibitors. Here, we employed HeLa cell lysates to: (1 characterize PKR’s interactions with the ribosome and ribosomal RNA (rRNA; (2 demonstrate cell-free activation of ribosomal-associated PKR and (3 integrate these findings in a unified model for RSR. Robust PKR-dependent RSR was initially confirmed in intact cells. PKR basally associated with 40S, 60S, 80S and polysome fractions at molar ratios of 7, 2, 23 and 3, respectively. Treatment of ATP-containing HeLa lysates with DON or the ribotoxins anisomycin and ricin concentration-dependently elicited phosphorylation of PKR and its substrate eIF2α. These phosphorylations could be blocked by PKR inhibitors. rRNA immunoprecipitation (RNA-IP of HeLa lysates with PKR-specific antibody and sequencing revealed that in the presence of DON or not, the kinase associated with numerous discrete sites on both the 18S and 28S rRNA molecules, a number of which contained double-stranded hairpins. These findings are consistent with a sentinel model whereby multiple PKR molecules basally associate with the ribosome positioning them to respond to ribotoxin-induced alterations in rRNA structure by dimerizing, autoactivating and, ultimately, evoking RSR.

  12. Direct activation of ribosome-associated double-stranded RNA-dependent protein kinase (PKR) by deoxynivalenol, anisomycin and ricin: a new model for ribotoxic stress response induction.

    Science.gov (United States)

    Zhou, Hui-Ren; He, Kaiyu; Landgraf, Jeff; Pan, Xiao; Pestka, James J

    2014-12-16

    Double-stranded RNA (dsRNA)-activated protein kinase (PKR) is a critical upstream mediator of the ribotoxic stress response (RSR) to the trichothecene deoxynivalenol (DON) and other translational inhibitors. Here, we employed HeLa cell lysates to: (1) characterize PKR's interactions with the ribosome and ribosomal RNA (rRNA); (2) demonstrate cell-free activation of ribosomal-associated PKR and (3) integrate these findings in a unified model for RSR. Robust PKR-dependent RSR was initially confirmed in intact cells. PKR basally associated with 40S, 60S, 80S and polysome fractions at molar ratios of 7, 2, 23 and 3, respectively. Treatment of ATP-containing HeLa lysates with DON or the ribotoxins anisomycin and ricin concentration-dependently elicited phosphorylation of PKR and its substrate eIF2α. These phosphorylations could be blocked by PKR inhibitors. rRNA immunoprecipitation (RNA-IP) of HeLa lysates with PKR-specific antibody and sequencing revealed that in the presence of DON or not, the kinase associated with numerous discrete sites on both the 18S and 28S rRNA molecules, a number of which contained double-stranded hairpins. These findings are consistent with a sentinel model whereby multiple PKR molecules basally associate with the ribosome positioning them to respond to ribotoxin-induced alterations in rRNA structure by dimerizing, autoactivating and, ultimately, evoking RSR.

  13. Seasonal succession leads to habitat-dependent differentiation in ribosomal RNA:DNA ratios among freshwater lake bacteria

    Directory of Open Access Journals (Sweden)

    Vincent J Denef

    2016-04-01

    Full Text Available Relative abundance profiles of bacterial populations measured by sequencing DNA or RNA of marker genes can widely differ. These differences, made apparent when calculating ribosomal RNA:DNA ratios, have been interpreted as variable activities of bacterial populations. However, inconsistent correlations between ribosomal RNA:DNA ratios and metabolic activity or growth rates have led to a more conservative interpretation of this metric as the cellular protein synthesis potential (PSP. Little is known, particularly in freshwater systems, about how PSP varies for specific taxa across temporal and spatial environmental gradients and how conserved PSP is across bacterial phylogeny. Here, we generated 16S rRNA gene sequencing data using simultaneously extracted DNA and RNA from fractionated (free-living and particulate water samples taken seasonally along a eutrophic freshwater estuary to oligotrophic pelagic transect in Lake Michigan. In contrast to previous reports, we observed frequent clustering of DNA and RNA data from the same sample. Analysis of the overlap in taxa detected at the RNA and DNA level indicated that microbial dormancy may be more common in the estuary, the particulate fraction, and during the stratified period. Across spatiotemporal gradients, PSP was often conserved at the phylum and class levels. PSPs for specific taxa were more similar across habitats in spring than in summer and fall. This was most notable for PSPs of the same taxa when located in the free-living or particulate fractions, but also when contrasting surface to deep, and estuary to Lake Michigan communities. Our results show that community composition assessed by RNA and DNA measurements are more similar than previously assumed in freshwater systems. However, the similarity between RNA and DNA measurements and taxa-specific PSPs that drive community-level similarities are conditional on spatiotemporal factors.

  14. Characterisation of RNA fragments obtained by mild nuclease digestion of 30-S ribosomal subunits from Escherichia coli.

    Science.gov (United States)

    Rinke, J; Ross, A; Brimacombe, R

    1977-06-01

    When Escherichia coli 30-S ribosomal subunits are hydrolysed under mild conditions, two ribonucleoprotein fragments of unequal size are produced. Knowledge of the RNA sequences contained in these hydrolysis products was required for the experiments described in the preceding paper, and the RNA sub-fragments have therefore been examined by oligonucleotide analysis. Two well-defined small fragments of free RNA, produced concomitantly with the ribonucleoprotein fragments, were also analysed. The larger ribonucleoprotein fragment, containing predominantly proteins S4, S5, S8, S15, S16 (17) and S20, contains a complex mixture of RNA sub-fragments varying from about 100 to 800 nucleotides in length. All these fragments arose from the 5'-terminal 900 nucleotides of 16-S RNA, corresponding to the well-known 12-S fragment. No long-range interactions could be detected within this RNA region in these experiments. The RNA from the smaller ribonucleoprotein fragment (containing proteins S7, S9 S10, S14 and S19) has been described in detail previously, and consists of about 450 nucleotides near the 3' end of the 16-S RNA, but lacking the 3'-terminal 150 nucleotides. The two small free RNA fragments (above) partly account for these missing 150 nucleotides; both fragments arose from section A of the 16-S RNA, but section J (the 3'-terminal 50 nucleotides) was not found. This result suggests that the 3' region of 16-S RNA is not involved in stable interactions with protein.

  15. Assembly factors Rpf2 and Rrs1 recruit 5S rRNA and ribosomal proteins rpL5 and rpL11 into nascent ribosomes.

    Science.gov (United States)

    Zhang, Jingyu; Harnpicharnchai, Piyanun; Jakovljevic, Jelena; Tang, Lan; Guo, Yurong; Oeffinger, Marlene; Rout, Michael P; Hiley, Shawna L; Hughes, Timothy; Woolford, John L

    2007-10-15

    More than 170 proteins are necessary for assembly of ribosomes in eukaryotes. However, cofactors that function with each of these proteins, substrates on which they act, and the precise functions of assembly factors--e.g., recruiting other molecules into preribosomes or triggering structural rearrangements of pre-rRNPs--remain mostly unknown. Here we investigated the recruitment of two ribosomal proteins and 5S ribosomal RNA (rRNA) into nascent ribosomes. We identified a ribonucleoprotein neighborhood in preribosomes that contains two yeast ribosome assembly factors, Rpf2 and Rrs1, two ribosomal proteins, rpL5 and rpL11, and 5S rRNA. Interactions between each of these four proteins have been confirmed by binding assays in vitro. These molecules assemble into 90S preribosomal particles containing 35S rRNA precursor (pre-rRNA). Rpf2 and Rrs1 are required for recruiting rpL5, rpL11, and 5S rRNA into preribosomes. In the absence of association of these molecules with pre-rRNPs, processing of 27SB pre-rRNA is blocked. Consequently, the abortive 66S pre-rRNPs are prematurely released from the nucleolus to the nucleoplasm, and cannot be exported to the cytoplasm.

  16. Deciphering the RNA landscape by RNAome sequencing

    NARCIS (Netherlands)

    K.W.J. Derks (Kasper); B. Misovic (Branislav); M.C.G.N. van den hout (Mirjam); C. Kockx (Christel); C.P. Gomez (Cesar Payan); R.W.W. Brouwer (Rutger); H. Vrieling (Harry); J.H.J. Hoeijmakers (Jan); W.F.J. van IJcken (Wilfred); J. Pothof (Joris)

    2015-01-01

    textabstractCurrent RNA expression profiling methods rely on enrichment steps for specific RNA classes, thereby not detecting all RNA species in an unperturbed manner. We report strand-specific RNAome sequencing that determines expression of small and large RNAs from rRNA-depleted total RNA in a

  17. Deciphering the RNA landscape by RNAome sequencing

    NARCIS (Netherlands)

    K.W.J. Derks (Kasper); B. Misovic (Branislav); M.C.G.N. van den hout (Mirjam); C. Kockx (Christel); C.P. Gomez (Cesar Payan); R.W.W. Brouwer (Rutger); H. Vrieling (Harry); J.H.J. Hoeijmakers (Jan); W.F.J. van IJcken (Wilfred); J. Pothof (Joris)

    2015-01-01

    textabstractCurrent RNA expression profiling methods rely on enrichment steps for specific RNA classes, thereby not detecting all RNA species in an unperturbed manner. We report strand-specific RNAome sequencing that determines expression of small and large RNAs from rRNA-depleted total RNA in a sin

  18. A detailed view of a ribosomal active site: the structure of the L11-RNA complex.

    Science.gov (United States)

    Wimberly, B T; Guymon, R; McCutcheon, J P; White, S W; Ramakrishnan, V

    1999-05-14

    We report the crystal structure of a 58 nucleotide fragment of 23S ribosomal RNA bound to ribosomal protein L11. This highly conserved ribonucleoprotein domain is the target for the thiostrepton family of antibiotics that disrupt elongation factor function. The highly compact RNA has both familiar and novel structural motifs. While the C-terminal domain of L11 binds RNA tightly, the N-terminal domain makes only limited contacts with RNA and is proposed to function as a switch that reversibly associates with an adjacent region of RNA. The sites of mutations conferring resistance to thiostrepton and micrococcin line a narrow cleft between the RNA and the N-terminal domain. These antibiotics are proposed to bind in this cleft, locking the putative switch and interfering with the function of elongation factors.

  19. Elucidation of pathways of ribosomal RNA degradation: an essential role for RNase E

    Science.gov (United States)

    Sulthana, Shaheen; Basturea, Georgeta N.; Deutscher, Murray P.

    2016-01-01

    Although normally stable in growing cells, ribosomal RNAs are degraded under conditions of stress, such as starvation, and in response to misassembled or otherwise defective ribosomes in a process termed RNA quality control. Previously, our laboratory found that large fragments of 16S and 23S rRNA accumulate in strains lacking the processive exoribonucleases RNase II, RNase R, and PNPase, implicating these enzymes in the later steps of rRNA breakdown. Here, we define the pathways of rRNA degradation in the quality control process and during starvation, and show that the essential endoribonuclease, RNase E, is required to make the initial cleavages in both degradative processes. We also present evidence that explains why the exoribonuclease, RNase PH, is required to initiate the degradation of rRNA during starvation. The data presented here provide the first detailed description of rRNA degradation in bacterial cells. PMID:27298395

  20. Ribosomal RNA and protein transcripts persist in the cysts of Entamoeba invadens.

    Science.gov (United States)

    Ojha, Sandeep; Ahamad, Jamaluddin; Bhattacharya, Alok; Bhattacharya, Sudha

    2014-06-01

    In most organisms rDNA transcription ceases under conditions of growth stress. However, we have earlier shown that pre-rRNA accumulates during encystation in Entamoeba invadens. We labeled newly-synthesized rRNA during encystation, with [methyl-(3)H] methionine in the presence of chitinase to enable uptake of isotope. Incorporation rate reduced after 24h, and then increased to reach levels comparable with normal cells. The label was rapidly chased to the ribosomal pellet in dividing cells, while at late stages of encystation the ratio of counts going to the pellet dropped 3-fold. The transcript levels of selected ribosomal protein genes also went down initially but went up again at later stages of encystation. This suggested that rRNA and ribosomal protein transcription may be coordinately regulated. Our data shows that encysting E. invadens cells accumulate transcripts of both the RNA and protein components of the ribosome, which may ensure rapid synthesis of new ribosomes when growth resumes.

  1. Basic Mechanisms in RNA Polymerase I Transcription of the Ribosomal RNA Genes

    Science.gov (United States)

    Goodfellow, Sarah J.; Zomerdijk, Joost C. B. M.

    2013-01-01

    RNA Polymerase (Pol) I produces ribosomal (r)RNA, an essential component of the cellular protein synthetic machinery that drives cell growth, underlying many fundamental cellular processes. Extensive research into the mechanisms governing transcription by Pol I has revealed an intricate set of control mechanisms impinging upon rRNA production. Pol I-specific transcription factors guide Pol I to the rDNA promoter and contribute to multiple rounds of transcription initiation, promoter escape, elongation and termination. In addition, many accessory factors are now known to assist at each stage of this transcription cycle, some of which allow the integration of transcriptional activity with metabolic demands. The organisation and accessibility of rDNA chromatin also impinge upon Pol I output, and complex mechanisms ensure the appropriate maintenance of the epigenetic state of the nucleolar genome and its effective transcription by Pol I. The following review presents our current understanding of the components of the Pol I transcription machinery, their functions and regulation by associated factors, and the mechanisms operating to ensure the proper transcription of rDNA chromatin. The importance of such stringent control is demonstrated by the fact that deregulated Pol I transcription is a feature of cancer and other disorders characterised by abnormal translational capacity. PMID:23150253

  2. Comment on "Length-dependent translation of messenger RNA by ribosomes"

    CERN Document Server

    Zhang, Yunxin

    2011-01-01

    In recent paper [Phys. Rev. E {\\bf 83}, 042903 (2011)], a simple model for the translation of messenger RNA by ribosomes is provided, and the expression of translational ratio of protein is given. In this comments, varied methods to get this ratio are addressed. Depending on a different method, we find that, roughly speaking, this translational ratio decays exponentially with mRNA length in prokaryotic cell, and reciprocally with mRNA length in eukaryotic cells.

  3. Ribosomal proteins L11 and L10.(L12)4 and the antibiotic thiostrepton interact with overlapping regions of the 23 S rRNA backbone in the ribosomal GTPase centre

    DEFF Research Database (Denmark)

    Rosendahl, G; Douthwaite, S

    1993-01-01

    The Escherichia coli ribosomal protein (r-protein) L11 and its binding site on 23 S ribosomal RNA (rRNA) are associated with ribosomal hydrolysis of guanosine 5'-triphosphate (GTP). We have used hydroxyl radical footprinting to map the contacts between L11 and the backbone riboses in 23 S rRNA, a...

  4. [Affinity modification of Escherichia coli ribosomes with photoactivated analogs of mRNA].

    Science.gov (United States)

    Gimautdinova, O I; Zenkova, M A; Karpova, G G; Podust, L M

    1984-01-01

    Oligoribonucleotide derivatives containing the photoactivated arylazidogroup at 5'-end of the oligonucleotide fragment [2-(N-2,4-dinitro-5-azidophenyl) aminoethyl] phosphamides of the oligoribonucleotides, azido-NH (CH2)2NHpN (pN) n-1, were prepared. It was demonstrated that azido-NH(CH2)2NHpA(pA)4 and azido-NH (CH2)2NHpU (pU)3 stimulate the binding of the codonspecific aminoacyl-tRNA with ribosome. After irradiation of the ternary complex ribosome-azido-NH (CH2)2NHpU (pU) n-1 X tRNA with UV-light (lambda greater than 350 nm) covalent binding of the reagent to ribosome occurs. Up to 10% of the reagent, bound in the ternary complex with ribosome, is cross-linked with the ribosomal proteins of 30S and 50S subunits. The ribosomal RNA are not modified by azido-NH (CH2)2NHpU (pU) n-1. The proteins of 30S and 50S subunits, modified with azido-NH (CH2)2NHpU (pU) n-1 with n = 4,7 and 8, were identified. It is shown that proteins of 30S subunits S3, S4, S9, S11, S12, S14, S17, S19, S20 undergo modification. The proteins of 50S subunits L2, L13, L16, L27, L32, L33 are modified. The set of the modified proteins essentially depends on the length of the oligonucleotide part of the reagent and on occupancy of ribosome A-site by a molecule of tRNA.

  5. Ribosomal protein L16 binds to the 3'-end of transfer RNA.

    Science.gov (United States)

    Maimets, T; Remme, J; Villems, R

    1984-01-23

    Escherichia coli 50 S ribosomal subunits were reconstituted with and without protein L16 present. The latter particles, although active in puromycin reaction, were unable to use CACCA-Phe as an acceptor substrate. We also found that L16 interacts directly with this oligonucleotide and, in the complex with tRNA, protects its 3'-end from pancreatic ribonuclease digestion. We suggest that the role of L16 is in the fixation of the aminoacyl stem of tRNA to the ribosome at its A-site.

  6. Ribosomal RNA in Alzheimer disease is oxidized by bound redox-active iron.

    Science.gov (United States)

    Honda, Kazuhiro; Smith, Mark A; Zhu, Xiongwei; Baus, Diane; Merrick, William C; Tartakoff, Alan M; Hattier, Thomas; Harris, Peggy L; Siedlak, Sandra L; Fujioka, Hisashi; Liu, Quan; Moreira, Paula I; Miller, Frank P; Nunomura, Akihiko; Shimohama, Shun; Perry, George

    2005-06-03

    Oxidative modification of cytoplasmic RNA in vulnerable neurons is an important, well documented feature of the pathophysiology of Alzheimer disease. Here we report that RNA-bound iron plays a pivotal role for RNA oxidation in vulnerable neurons in Alzheimer disease brain. The cytoplasm of hippocampal neurons showed significantly higher redox activity and iron(II) staining than age-matched controls. Notably, both were susceptible to RNase, suggesting a physical association of iron(II) with RNA. Ultrastructural analysis further suggested an endoplasmic reticulum association. Both rRNA and mRNA showed twice the iron binding as tRNA. rRNA, extremely abundant in neurons, was considered to provide the greatest number of iron binding sites among cytoplasmic RNA species. Interestingly, the difference of iron binding capacity disappeared after denaturation of RNA, suggesting that the higher order structure may contribute to the greater iron binding of rRNA. Reflecting the difference of iron binding capacity, oxidation of rRNA by the Fenton reaction formed 13 times more 8-hydroxyguanosine than tRNA. Consistent with in situ findings, ribosomes purified from Alzheimer hippocampus contained significantly higher levels of RNase-sensitive iron(II) and redox activity than control. Furthermore, only Alzheimer rRNA contains 8-hydroxyguanosine in reverse transcriptase-PCR. Addressing the biological significance of ribosome oxidation by redox-active iron, in vitro translation with oxidized ribosomes from rabbit reticulocyte showed a significant reduction of protein synthesis. In conclusion these results suggest that rRNA provides a binding site for redox-active iron and serves as a redox center within the cytoplasm of vulnerable neurons in Alzheimer disease in advance of the appearance of morphological change indicating neurodegeneration.

  7. rRNA maturation in yeast cells depleted of large ribosomal subunit proteins.

    Directory of Open Access Journals (Sweden)

    Gisela Pöll

    Full Text Available The structural constituents of the large eukaryotic ribosomal subunit are 3 ribosomal RNAs, namely the 25S, 5.8S and 5S rRNA and about 46 ribosomal proteins (r-proteins. They assemble and mature in a highly dynamic process that involves more than 150 proteins and 70 small RNAs. Ribosome biogenesis starts in the nucleolus, continues in the nucleoplasm and is completed after nucleo-cytoplasmic translocation of the subunits in the cytoplasm. In this work we created 26 yeast strains, each of which conditionally expresses one of the large ribosomal subunit (LSU proteins. In vivo depletion of the analysed LSU r-proteins was lethal and led to destabilisation and degradation of the LSU and/or its precursors. Detailed steady state and metabolic pulse labelling analyses of rRNA precursors in these mutant strains showed that LSU r-proteins can be grouped according to their requirement for efficient progression of different steps of large ribosomal subunit maturation. Comparative analyses of the observed phenotypes and the nature of r-protein-rRNA interactions as predicted by current atomic LSU structure models led us to discuss working hypotheses on i how individual r-proteins control the productive processing of the major 5' end of 5.8S rRNA precursors by exonucleases Rat1p and Xrn1p, and ii the nature of structural characteristics of nascent LSUs that are required for cytoplasmic accumulation of nascent subunits but are nonessential for most of the nuclear LSU pre-rRNA processing events.

  8. Impact of P-Site tRNA and antibiotics on ribosome mediated protein folding: studies using the Escherichia coli ribosome.

    Directory of Open Access Journals (Sweden)

    Surojit Mondal

    Full Text Available BACKGROUND: The ribosome, which acts as a platform for mRNA encoded polypeptide synthesis, is also capable of assisting in folding of polypeptide chains. The peptidyl transferase center (PTC that catalyzes peptide bond formation resides in the domain V of the 23S rRNA of the bacterial ribosome. Proper positioning of the 3' -CCA ends of the A- and P-site tRNAs via specific interactions with the nucleotides of the PTC are crucial for peptidyl transferase activity. This RNA domain is also the center for ribosomal chaperoning activity. The unfolded polypeptide chains interact with the specific nucleotides of the PTC and are released in a folding competent form. In vitro transcribed RNA corresponding to this domain (bDV RNA also displays chaperoning activity. RESULTS: The present study explores the effects of tRNAs, antibiotics that are A- and P-site PTC substrate analogs (puromycin and blasticidin and macrolide antibiotics (erythromycin and josamycin on the chaperoning ability of the E. coli ribosome and bDV RNA. Our studies using mRNA programmed ribosomes show that a tRNA positioned at the P-site effectively inhibits the ribosome's chaperoning function. We also show that the antibiotic blasticidin (that mimics the interaction between 3'-CCA end of P/P-site tRNA with the PTC is more effective in inhibiting ribosome and bDV RNA chaperoning ability than either puromycin or the macrolide antibiotics. Mutational studies of the bDV RNA could identify the nucleotides U2585 and G2252 (both of which interact with P-site tRNA to be important for its chaperoning ability. CONCLUSION: Both protein synthesis and their proper folding are crucial for maintenance of a functional cellular proteome. The PTC of the ribosome is attributed with both these abilities. The silencing of the chaperoning ability of the ribosome in the presence of P-site bound tRNA might be a way to segregate these two important functions.

  9. Computational and Experimental Characterization of Ribosomal DNA and RNA G-Quadruplexes

    Science.gov (United States)

    Cho, Samuel

    DNA G-quadruplexes in human telomeres and gene promoters are being extensively studied for their role in controlling the growth of cancer cells. Recent studies strongly suggest that guanine (G)-rich genes encoding pre-ribosomal RNA (pre-rRNA) are a potential anticancer target through the inhibition of RNA polymerase I (Pol I) in ribosome biogenesis. However, the structures of ribosomal G-quadruplexes at atomic resolution are unknown, and very little biophysical characterization has been performed on them to date. Here, we have modeled two putative rDNA G-quadruplex structures, NUC 19P and NUC 23P, which we observe via circular dichroism (CD) spectroscopy to adopt a predominantly parallel topology, and their counterpart rRNA. To validate and refine the putative ribosomal G-quadruplex structures, we performed all-atom molecular dynamics (MD) simulations using the CHARMM36 force field in the presence and absence of stabilizing K + or Na + ions. We optimized the CHARMM36 force field K + parameters to be more consistent with quantum mechanical calculations (and the polarizable Drude model force field) so that the K + ion is predominantly in the G-quadruplex channel. Our MD simulations show that the rDNA G-quadruplex have more well-defined, predominantly parallel-topology structures than rRNA and NUC 19P is more structured than NUC 23P, which features extended loops. Our study demonstrates that they are both potential targets for the design of novel chemotherapeutics.

  10. Molecular characterization of 5S ribosomal RNA genes and transcripts in the protozoan parasite Leishmania major.

    Science.gov (United States)

    Moreno-Campos, Rodrigo; Florencio-Martínez, Luis E; Nepomuceno-Mejía, Tomás; Rojas-Sánchez, Saúl; Vélez-Ramírez, Daniel E; Padilla-Mejía, Norma E; Figueroa-Angulo, Elisa; Manning-Cela, Rebeca; Martínez-Calvillo, Santiago

    2016-12-01

    Eukaryotic 5S rRNA, synthesized by RNA polymerase III (Pol III), is an essential component of the large ribosomal subunit. Most organisms contain hundreds of 5S rRNA genes organized into tandem arrays. However, the genome of the protozoan parasite Leishmania major contains only 11 copies of the 5S rRNA gene, which are interspersed and associated with other Pol III-transcribed genes. Here we report that, in general, the number and order of the 5S rRNA genes is conserved between different species of Leishmania. While in most organisms 5S rRNA genes are normally associated with the nucleolus, combined fluorescent in situ hybridization and indirect immunofluorescence experiments showed that 5S rRNA genes are mainly located at the nuclear periphery in L. major. Similarly, the tandemly repeated 5S rRNA genes in Trypanosoma cruzi are dispersed throughout the nucleus. In contrast, 5S rRNA transcripts in L. major were localized within the nucleolus, and scattered throughout the cytoplasm, where mature ribosomes are located. Unlike other rRNA species, stable antisense RNA complementary to 5S rRNA is not detected in L. major.

  11. RNA-RNA interaction prediction based on multiple sequence alignments

    CERN Document Server

    Li, Andrew X; Qin, Jing; Reidys, Christian M

    2010-01-01

    Recently, $O(N^6)$ time and $O(N^4)$ space dynamic programming algorithms have become available that compute the partition function of RNA-RNA interaction complexes for pairs of RNA sequences. These algorithms and the biological requirement of more reliable interactions motivate to utilize the additional information contained in multiple sequence alignments and to generalize the above framework to the partition function and base pairing probabilities for multiple sequence alignments.

  12. Locus-specific ribosomal RNA gene silencing in nucleolar dominance.

    Directory of Open Access Journals (Sweden)

    Michelle S Lewis

    Full Text Available The silencing of one parental set of rRNA genes in a genetic hybrid is an epigenetic phenomenon known as nucleolar dominance. We showed previously that silencing is restricted to the nucleolus organizer regions (NORs, the loci where rRNA genes are tandemly arrayed, and does not spread to or from neighboring protein-coding genes. One hypothesis is that nucleolar dominance is the net result of hundreds of silencing events acting one rRNA gene at a time. A prediction of this hypothesis is that rRNA gene silencing should occur independent of chromosomal location. An alternative hypothesis is that the regulatory unit in nucleolar dominance is the NOR, rather than each individual rRNA gene, in which case NOR localization may be essential for rRNA gene silencing. To test these alternative hypotheses, we examined the fates of rRNA transgenes integrated at ectopic locations. The transgenes were accurately transcribed in all independent transgenic Arabidopsis thaliana lines tested, indicating that NOR localization is not required for rRNA gene expression. Upon crossing the transgenic A. thaliana lines as ovule parents with A. lyrata to form F1 hybrids, a new system for the study of nucleolar dominance, the endogenous rRNA genes located within the A. thaliana NORs are silenced. However, rRNA transgenes escaped silencing in multiple independent hybrids. Collectively, our data suggest that rRNA gene activation can occur in a gene-autonomous fashion, independent of chromosomal location, whereas rRNA gene silencing in nucleolar dominance is locus-dependent.

  13. Identification of the methyltransferase targeting C2499 in Deinococcus radiodurans 23S ribosomal RNA

    DEFF Research Database (Denmark)

    Nielsen, Julie Mundus; Flyvbjerg, Karen Freund; Kirpekar, Finn

    2016-01-01

    The bacterium Deinococcus radiodurans-like all other organisms-introduces nucleotide modifications into its ribosomal RNA. We have previously found that the bacterium contains a Carbon-5 methylation on cytidine 2499 of its 23S ribosomal RNA, which is so far the only modified version of cytidine 2...

  14. Targeted RNA Sequencing Assay to Characterize Gene Expression and Genomic Alterations

    Science.gov (United States)

    Martin, Dorrelyn P.; Miya, Jharna; Reeser, Julie W.; Roychowdhury, Sameek

    2017-01-01

    RNA sequencing (RNAseq) is a versatile method that can be utilized to detect and characterize gene expression, mutations, gene fusions, and noncoding RNAs. Standard RNAseq requires 30 – 100 million sequencing reads and can include multiple RNA products such as mRNA and noncoding RNAs. We demonstrate how targeted RNAseq (capture) permits a focused study on selected RNA products using a desktop sequencer. RNAseq capture can characterize unannotated, low, or transiently expressed transcripts that may otherwise be missed using traditional RNAseq methods. Here we describe the extraction of RNA from cell lines, ribosomal RNA depletion, cDNA synthesis, preparation of barcoded libraries, hybridization and capture of targeted transcripts and multiplex sequencing on a desktop sequencer. We also outline the computational analysis pipeline, which includes quality control assessment, alignment, fusion detection, gene expression quantification and identification of single nucleotide variants. This assay allows for targeted transcript sequencing to characterize gene expression, gene fusions, and mutations. PMID:27585245

  15. Can we estimate bacterial growth rates from ribosomal RNA content?

    Energy Technology Data Exchange (ETDEWEB)

    Kemp, P.F.

    1995-12-31

    Several studies have demonstrated a strong relationship between the quantity of RNA in bacterial cells and their growth rate under laboratory conditions. It may be possible to use this relationship to provide information on the activity of natural bacterial communities, and in particular on growth rate. However, if this approach is to provide reliably interpretable information, the relationship between RNA content and growth rate must be well-understood. In particular, a requisite of such applications is that the relationship must be universal among bacteria, or alternately that the relationship can be determined and measured for specific bacterial taxa. The RNA-growth rate relationship has not been used to evaluate bacterial growth in field studies, although RNA content has been measured in single cells and in bulk extracts of field samples taken from coastal environments. These measurements have been treated as probable indicators of bacterial activity, but have not yet been interpreted as estimators of growth rate. The primary obstacle to such interpretations is a lack of information on biological and environmental factors that affect the RNA-growth rate relationship. In this paper, the available data on the RNA-growth rate relationship in bacteria will be reviewed, including hypotheses regarding the regulation of RNA synthesis and degradation as a function of growth rate and environmental factors; i.e. the basic mechanisms for maintaining RNA content in proportion to growth rate. An assessment of the published laboratory and field data, the current status of this research area, and some of the remaining questions will be presented.

  16. The RDP (Ribosomal Database Project).

    Science.gov (United States)

    Maidak, B L; Olsen, G J; Larsen, N; Overbeek, R; McCaughey, M J; Woese, C R

    1997-01-01

    The Ribosomal Database Project (RDP) is a curated database that offers ribosome-related data, analysis services and associated computer programs. The offerings include phylogenetically ordered alignments of ribosomal RNA (rRNA) sequences, derived phylogenetic trees, rRNA secondary structure diagrams, and various software for handling, analyzing and displaying alignments and trees. The data are available via anonymous FTP (rdp.life.uiuc.edu), electronic mail (server@rdp.life.uiuc.edu), gopher (rdpgopher.life.uiuc.edu) and WWW (http://rdpwww.life.uiuc.edu/ ). The electronic mail and WWW servers provide ribosomal probe checking, approximate phylogenetic placement of user-submitted sequences, screening for possible chimeric rRNA sequences, automated alignment, and a suggested placement of an unknown sequence on an existing phylogenetic tree.

  17. The CRM domain: an RNA binding module derived from an ancient ribosome-associated protein.

    Science.gov (United States)

    Barkan, Alice; Klipcan, Larik; Ostersetzer, Oren; Kawamura, Tetsuya; Asakura, Yukari; Watkins, Kenneth P

    2007-01-01

    The CRS1-YhbY domain (also called the CRM domain) is represented as a stand-alone protein in Archaea and Bacteria, and in a family of single- and multidomain proteins in plants. The function of this domain is unknown, but structural data and the presence of the domain in several proteins known to interact with RNA have led to the proposal that it binds RNA. Here we describe a phylogenetic analysis of the domain, its incorporation into diverse proteins in plants, and biochemical properties of a prokaryotic and eukaryotic representative of the domain family. We show that a bacterial member of the family, Escherichia coli YhbY, is associated with pre-50S ribosomal subunits, suggesting that YhbY functions in ribosome assembly. GFP fused to a single-domain CRM protein from maize localizes to the nucleolus, suggesting that an analogous activity may have been retained in plants. We show further that an isolated maize CRM domain has RNA binding activity in vitro, and that a small motif shared with KH RNA binding domains, a conserved "GxxG" loop, contributes to its RNA binding activity. These and other results suggest that the CRM domain evolved in the context of ribosome function prior to the divergence of Archaea and Bacteria, that this function has been maintained in extant prokaryotes, and that the domain was recruited to serve as an RNA binding module during the evolution of plant genomes.

  18. Preparation of Biologically Active Arabidopsis Ribosomes and Comparison with Yeast Ribosomes for Binding to a tRNA-Mimic that Enhances Translation of Plant Plus-Strand RNA Viruses

    Directory of Open Access Journals (Sweden)

    Vera Aleksey Stupina

    2013-07-01

    Full Text Available Isolation of biologically active cell components from multicellular eukaryotic organisms often poses difficult challenges such as low yields and inability to retain the integrity and functionality of the purified compound. We previously identified a cap-independent translation enhancer (3’CITE in the 3’UTR of Turnip crinkle virus (TCV that structurally mimics a tRNA and binds to yeast 80S ribosomes and 60S subunits in the P-site. Yeast ribosomes were used for these studies due to the lack of methods for isolation of plant ribosomes with high yields and integrity. To carry out studies with more natural components, a simple and efficient procedure has been developed for the isolation of large quantities of high quality ribosomes and ribosomal subunits from Arabidopsis thaliana protoplasts prepared from seed-derived callus tissue. Attempts to isolate high quality ribosomes from wheat germ, bean sprouts and evacuolated protoplasts were unsuccessful. Addition of purified Arabidopsis 80S plant ribosomes to ribosome-depleted wheat germ lysates resulted in a greater than 1200-fold enhancement in in vitro translation of a luciferase reporter construct. The TCV 3’CITE bound to ribosomes with a 3 to 7-fold higher efficiency when using plant 80S ribosomes compared with yeast ribosomes, indicating that this viral translational enhancer is adapted to interact more efficiently with host plant ribosomes.

  19. Comparisons of Ribosomal Protein Gene Promoters Indicate Superiority of Heterologous Regulatory Sequences for Expressing Transgenes in Phytophthora infestans.

    Science.gov (United States)

    Poidevin, Laetitia; Andreeva, Kalina; Khachatoorian, Careen; Judelson, Howard S

    2015-01-01

    Molecular genetics approaches in Phytophthora research can be hampered by the limited number of known constitutive promoters for expressing transgenes and the instability of transgene activity. We have therefore characterized genes encoding the cytoplasmic ribosomal proteins of Phytophthora and studied their suitability for expressing transgenes in P. infestans. Phytophthora spp. encode a standard complement of 79 cytoplasmic ribosomal proteins. Several genes are duplicated, and two appear to be pseudogenes. Half of the genes are expressed at similar levels during all stages of asexual development, and we discovered that the majority share a novel promoter motif named the PhRiboBox. This sequence is enriched in genes associated with transcription, translation, and DNA replication, including tRNA and rRNA biogenesis. Promoters from the three P. infestans genes encoding ribosomal proteins S9, L10, and L23 and their orthologs from P. capsici were tested for their ability to drive transgenes in stable transformants of P. infestans. Five of the six promoters yielded strong expression of a GUS reporter, but the stability of expression was higher using the P. capsici promoters. With the RPS9 and RPL10 promoters of P. infestans, about half of transformants stopped making GUS over two years of culture, while their P. capsici orthologs conferred stable expression. Since cross-talk between native and transgene loci may trigger gene silencing, we encourage the use of heterologous promoters in transformation studies.

  20. Changes in the conformation of 5S rRNA cause alterations in principal functions of the ribosomal nanomachine.

    Science.gov (United States)

    Kouvela, Ekaterini C; Gerbanas, George V; Xaplanteri, Maria A; Petropoulos, Alexandros D; Dinos, George P; Kalpaxis, Dimitrios L

    2007-01-01

    5S rRNA is an integral component of the large ribosomal subunit in virtually all living organisms. Polyamine binding to 5S rRNA was investigated by cross-linking of N1-azidobenzamidino (ABA)-spermine to naked 5S rRNA or 50S ribosomal subunits and whole ribosomes from Escherichia coli cells. ABA-spermine cross-linking sites were kinetically measured and their positions in 5S rRNA were localized by primer extension analysis. Helices III and V, and loops A, C, D and E in naked 5S rRNA were found to be preferred polyamine binding sites. When 50S ribosomal subunits or poly(U)-programmed 70S ribosomes bearing tRNA(Phe) at the E-site and AcPhe-tRNA at the P-site were targeted, the susceptibility of 5S rRNA to ABA-spermine was greatly reduced. Regardless of 5S rRNA assembly status, binding of spermine induced significant changes in the 5S rRNA conformation; loop A adopted an apparent 'loosening' of its structure, while loops C, D, E and helices III and V achieved a more compact folding. Poly(U)-programmed 70S ribosomes possessing 5S rRNA cross-linked with spermine were more efficient than control ribosomes in tRNA binding, peptidyl transferase activity and translocation. Our results support the notion that 5S rRNA serves as a signal transducer between regions of 23S rRNA responsible for principal ribosomal functions.

  1. Structural Studies of RNA Helicases Involved in Eukaryotic Pre-mRNA Splicing, Ribosome Biogenesis, and Translation Initiation

    DEFF Research Database (Denmark)

    He, Yangzi

    -rRNA. It is nucleolytically cleaved and chemically modified to generate mature rRNAs, which assemble with ribosomal proteins to form the ribosome. Prp43 is required for the processing of the 18S rRNA. Using X-ray crystallography, I determined a high resolution structure of Prp43 bound to ADP, the first structure of a DEAH....../RHA helicase. It defined the conserved structural features of all DEAH/RHA helicases, and unveiled a novel nucleotide binding site. Additionally a preliminary low resolution structure of a ternary complex comprising Prp43, a non-hydrolyzable ATP analogue, and a single-stranded RNA, was obtained. The ribosome...... translates the genetic message encoded in mRNAs to synthesize proteins. Initiation of translation requires localization and recognition of the start codon at the P-site of the 40S small ribosomal subunit. On most eukaryotic mRNAs, the start codon is identified by a scanning mechanism, whereby a small subunit...

  2. Autocatalytic cyclization of an excised intervening sequence RNA is a cleavage-ligation reaction.

    Science.gov (United States)

    Zaug, A J; Grabowski, P J; Cech, T R

    The intervening sequence (IVS) of the Tetrahymena ribosomal RNA precursor is excised as a linear RNA molecule which subsequently cyclizes itself in a protein-independent reaction. Cyclization involves cleavage of the linear IVS RNA 15 nucleotides from its 5' end and formation of a phosphodiester bond between the new 5' phosphate and the original 3'-hydroxyl terminus of the IVS. This recombination mechanism is analogous to that by which splicing of the precursor RNA is achieved. The circular molecules appear to have no direct function in RNA splicing, and we propose the cyclization serves to prevent unwanted RNA from driving the splicing reactions backwards.

  3. An evolutionary conserved pattern of 18S rRNA sequence complementarity to mRNA 5' UTRs and its implications for eukaryotic gene translation regulation.

    Science.gov (United States)

    Pánek, Josef; Kolár, Michal; Vohradský, Jirí; Shivaya Valásek, Leos

    2013-09-01

    There are several key mechanisms regulating eukaryotic gene expression at the level of protein synthesis. Interestingly, the least explored mechanisms of translational control are those that involve the translating ribosome per se, mediated for example via predicted interactions between the ribosomal RNAs (rRNAs) and mRNAs. Here, we took advantage of robustly growing large-scale data sets of mRNA sequences for numerous organisms, solved ribosomal structures and computational power to computationally explore the mRNA-rRNA complementarity that is statistically significant across the species. Our predictions reveal highly specific sequence complementarity of 18S rRNA sequences with mRNA 5' untranslated regions (UTRs) forming a well-defined 3D pattern on the rRNA sequence of the 40S subunit. Broader evolutionary conservation of this pattern may imply that 5' UTRs of eukaryotic mRNAs, which have already emerged from the mRNA-binding channel, may contact several complementary spots on 18S rRNA situated near the exit of the mRNA binding channel and on the middle-to-lower body of the solvent-exposed 40S ribosome including its left foot. We discuss physiological significance of this structurally conserved pattern and, in the context of previously published experimental results, propose that it modulates scanning of the 40S subunit through 5' UTRs of mRNAs.

  4. CED-4 is an mRNA-binding protein that delivers ced-3 mRNA to ribosomes.

    Science.gov (United States)

    Wang, Miao-xing; Itoh, Masanori; Li, Shimo; Hida, Yoko; Ohta, Kazunori; Hayakawa, Miki; Nishida, Emika; Ueda, Masashi; Islam, Saiful; Tana; Nakagawa, Toshiyuki

    2016-01-29

    Cell death abnormal (ced)-3 and ced-4 genes regulate apoptosis to maintain tissue homeostasis in Caenorhabditis elegans. Apoptosome formation and CED-4 translocation drive CED-3 activation. However, the precise role of CED-4 translocation is not yet fully understood. In this study, using a combination of immunoprecipitation and reverse transcription-polymerase chain reaction methods in cells and a glutathione-S-transferase pull down assay in a cell-free system, we show that CED-4 binds ced-3 mRNA. In the presence of ced-3 mRNA, CED-4 protein is enriched in the microsomal fraction and interacts with ribosomal protein L10a in mammalian cells, increasing the levels of CED-3. These results suggest that CED-4 forms a complex with ced-3 mRNA and delivers it to ribosomes for translation.

  5. Sequence, overproduction and purification of Vibrio proteolyticus ribosomal protein L18 for in vitro and in vivo studies

    Science.gov (United States)

    Setterquist, R. A.; Smith, G. K.; Oakley, T. H.; Lee, Y. H.; Fox, G. E.

    1996-01-01

    A strategy suggested by comparative genomic studies was used to amplify the entire Vibrio proteolyticus (Vp) gene for ribosomal protein L18. Vp L18 and its flanking regions were sequenced and compared with the deduced amino acid (aa) sequences of other known L18 proteins. A 26-aa residue segment at the carboxy terminus contains many strongly conserved residues and may be critical for the L18 interaction with 5S rRNA. This approach should allow rapid characterization of L18 from large numbers of bacteria. Both Vp L18 and Escherichia coli (Ec) L18 were overproduced and purified using a T7 expression vector which fuses an N-terminal peptide segment (His-tag) containing 6 histidine residues to the recombinant protein. The purified fusion proteins, Vp His::L18 and Ec His::L18, were both found to bind to either the Vp 5S or Ec 5S rRNAs in vitro. Vp His::L18 protein was also shown to incorporate into Ec ribosomes in vivo. This His-tag strategy likely will have general applicability for the study of ribosomal proteins in vitro and in vivo.

  6. Sequence, overproduction and purification of Vibrio proteolyticus ribosomal protein L18 for in vitro and in vivo studies

    Science.gov (United States)

    Setterquist, R. A.; Smith, G. K.; Oakley, T. H.; Lee, Y. H.; Fox, G. E.

    1996-01-01

    A strategy suggested by comparative genomic studies was used to amplify the entire Vibrio proteolyticus (Vp) gene for ribosomal protein L18. Vp L18 and its flanking regions were sequenced and compared with the deduced amino acid (aa) sequences of other known L18 proteins. A 26-aa residue segment at the carboxy terminus contains many strongly conserved residues and may be critical for the L18 interaction with 5S rRNA. This approach should allow rapid characterization of L18 from large numbers of bacteria. Both Vp L18 and Escherichia coli (Ec) L18 were overproduced and purified using a T7 expression vector which fuses an N-terminal peptide segment (His-tag) containing 6 histidine residues to the recombinant protein. The purified fusion proteins, Vp His::L18 and Ec His::L18, were both found to bind to either the Vp 5S or Ec 5S rRNAs in vitro. Vp His::L18 protein was also shown to incorporate into Ec ribosomes in vivo. This His-tag strategy likely will have general applicability for the study of ribosomal proteins in vitro and in vivo.

  7. Chromosomal localization of the major ribosomal RNA genes in scallop Chlamys farreri

    Institute of Scientific and Technical Information of China (English)

    HUANG Xiaoting; BAO Zhenmin; BI Ke; HU Jingjie; ZHANG Can; ZHANG Quanqi; HU Xiaoli

    2006-01-01

    The chromosomes of Chlamys farreri were analyzed by means of silver staining and fluorescence in situ hybridization ( FISH ) with 18S-28S rDNA probe. Probe was made by PCR amplification of a DNA fragment containing internal transcribed spacers ITS1 between 18S and 5.8S ribosomal RNA gene, ITS2 between 5.8S and 28S ribosomal RNA gene and 5.8S rRNA gene, and labeled by PCR incorporation of bio-16-dUTP. FISH signals were located on the short arm of subtelocentric chromosome 10. After silverstaining, nucleolus organizer regions (NORs) could be observed on the telomere of the short arm of chromosome 10. However,one metaphase spread displayed an additional silver spot on the short arm of subtelocentric chromosome 12.

  8. Biological significance of 5S rRNA import into human mitochondria: role of ribosomal protein MRP-L18.

    Science.gov (United States)

    Smirnov, Alexandre; Entelis, Nina; Martin, Robert P; Tarassov, Ivan

    2011-06-15

    5S rRNA is an essential component of ribosomes of all living organisms, the only known exceptions being mitochondrial ribosomes of fungi, animals, and some protists. An intriguing situation distinguishes mammalian cells: Although the mitochondrial genome contains no 5S rRNA genes, abundant import of the nuclear DNA-encoded 5S rRNA into mitochondria was reported. Neither the detailed mechanism of this pathway nor its rationale was clarified to date. In this study, we describe an elegant molecular conveyor composed of a previously identified human 5S rRNA import factor, rhodanese, and mitochondrial ribosomal protein L18, thanks to which 5S rRNA molecules can be specifically withdrawn from the cytosolic pool and redirected to mitochondria, bypassing the classic nucleolar reimport pathway. Inside mitochondria, the cytosolic 5S rRNA is shown to be associated with mitochondrial ribosomes.

  9. Targets and intracellular signaling mechanisms for deoxynivalenol-induced ribosomal RNA cleavage.

    Science.gov (United States)

    He, Kaiyu; Zhou, Hui-Ren; Pestka, James J

    2012-06-01

    The trichothecene mycotoxin deoxynivalenol (DON), a known translational inhibitor, induces ribosomal RNA (rRNA) cleavage. Here, we characterized this process relative to (1) specific 18S and 28S ribosomal RNA cleavage sites and (2) identity of specific upstream signaling elements in this pathway. Capillary electrophoresis indicated that DON at concentrations as low as 200 ng/ml evoked selective rRNA cleavage after 6 h and that 1000 ng/ml caused cleavage within 2 h. Northern blot analysis revealed that DON exposure induced six rRNA cleavage fragments from 28S rRNA and five fragments from 18S rRNA. When selective kinase inhibitors were used to identify potential upstream signals, RNA-activated protein kinase (PKR), hematopoietic cell kinase (Hck), and p38 were found to be required for rRNA cleavage, whereas c-Jun N-terminal kinase and extracellular signal-regulated kinase were not. Furthermore, rRNA fragmentation was suppressed by the p53 inhibitors pifithrin-α and pifithrin-μ as well as the pan caspase inhibitor Z-VAD-FMK. Concurrent apoptosis was confirmed by acridine orange/ethidium bromide staining and flow cytometry. DON activated caspases 3, 8, and 9, thus suggesting the possible coinvolvement of both extrinsic and intrinsic apoptotic pathways in rRNA cleavage. Satratoxin G (SG), anisomycin, and ricin also induced specific rRNA cleavage profiles identical to those of DON, suggesting that ribotoxins might share a conserved rRNA cleavage mechanism. Taken together, DON-induced rRNA cleavage is likely to be closely linked to apoptosis activation and appears to involve the sequential activation of PKR/Hck →p38→p53→caspase 8/9→caspase 3.

  10. Combined large and small subunit ribosomal RNA phylogenies support a basal position of the acoelomorph flatworms.

    Science.gov (United States)

    Telford, Maximilian J; Lockyer, Anne E; Cartwright-Finch, Chloë; Littlewood, D Timothy J

    2003-05-22

    The phylogenetic position of the phylum Platyhelminthes has been re-evaluated in the past decade by analysis of diverse molecular datasets. The consensus is that the Rhabditophora + Catenulida, which includes most of the flatworm taxa, are not primitively simple basal bilaterians but are related to coelomate phyla such as molluscs. The status of two other groups of acoelomate worms, Acoela and Nemertodermatida, is less clear. Although many characteristics unite these two groups, initial molecular phylogenetic studies placed the Nemertodermatida within the Rhabditophora, but placed the Acoela at the base of the Bilateria, distant from other flatworms. This contradiction resulted in scepticism about the basal position of acoels and led to calls for further data. We have sequenced large subunit ribosomal RNA genes from 13 rhabditophorans + catenulids, three acoels and one nemertodermatid, tripling the available data. Our analyses strongly support a basal position of both acoels and nemertodermatids. Alternative hypotheses are significantly less well supported by the data. We conclude that the Nemertodermatida and Acoela are basal bilaterians and, owing to their unique body plan and embryogenesis, should be recognized as a separate phylum, the Acoelomorpha.

  11. Genetic variability of Echinococcus granulosus based on the mitochondrial 16S ribosomal RNA gene.

    Science.gov (United States)

    Wang, Ning; Wang, Jiahai; Hu, Dandan; Zhong, Xiuqin; Jiang, Zhongrong; Yang, Aiguo; Deng, Shijin; Guo, Li; Tsering, Dawa; Wang, Shuxian; Gu, Xiaobin; Peng, Xuerong; Yang, Guangyou

    2015-06-01

    Echinococcus granulosus is the etiological agent of cystic echinococcosis, a major zoonotic disease of both humans and animals. In this study, we assessed genetic variability and genetic structure of E. granulosus in the Tibet plateau, using the complete mitochondrial 16 S ribosomal RNA gene for the first time. We collected and sequenced 62 isolates of E. granulosus from 3 populations in the Tibet plateau. A BLAST analysis indicated that 61 isolates belonged to E. granulosus sensu stricto (genotypes G1-G3), while one isolate belonged to E. canadensis (genotype G6). We detected 16 haplotypes with a haplotype network revealing a star-like expansion, with the most common haplotype occupying the center of the network. Haplotype diversity and nucleotide diversity were low, while negative values were observed for Tajima's D and Fu's Fs. AMOVA results and Fst values revealed that the three geographic populations were not genetically differentiated. Our results suggest that a population bottleneck or population expansion has occurred in the past, and that this explains the low genetic variability of E. granulosus in the Tibet Plateau.

  12. Network of tRNA Gene Sequences

    Institute of Scientific and Technical Information of China (English)

    WEI Fang-ping; LI Sheng; MA Hong-ru

    2008-01-01

    A network of 3719 tRNA gene sequences was constructed using simplest alignment. Its topology, degree distribution and clustering coefficient were studied. The behaviors of the network shift from fluctuated distribution to scale-free distribution when the similarity degree of the tRNA gene sequences increases. The tRNA gene sequences with the same anticodon identity are more self-organized than those with different anticodon identities and form local clusters in the network. Some vertices of the local cluster have a high connection with other local clusters, and the probable reason was given. Moreover, a network constructed by the same number of random tRNA sequences was used to make comparisons. The relationships between the properties of the tRNA similarity network and the characters of tRNA evolutionary history were discussed.

  13. 云南保山和普洱地区带绦虫线粒体DNA基因编码核糖体RNA小亚基基因序列分析%Analysis of the mitochondrial DNA-gene encoding ribosomal RNA small subunit gene sequence of Taenia cestode from Baoshan and Puer areas in Yunnan Province

    Institute of Scientific and Technical Information of China (English)

    刘爱波; 杨毅梅

    2011-01-01

    Objective To identify Taenia cestodes specimens collected from Baoshan and Puer regions of Yunnan Province by analyzing mitochondrial DNA gene encoding ribosomal RNA small subunit (mtDNA-12S rRNA) gene sequence. Methods The adult Taenia cestode samples were collected from Baoshan and Puer regions of Yunnan Province. The genomic DNA was extracted and mtDNA-12S rRAN gene was amplified by polymerase chain reaction (PCR), then sequenced.Combined with the known mtDNA-12S rRNA gene sequence of Taenia solium, Taenia saginata,Taenia asiatica in GenBank, homology tree and phylogenetic tree were constructed by DNA MAN software. Results Taenia cestode homology tree and phylogenetic tree showed that gene sequences of BS1, BS2, BS4 and BS5 were most close to YZ with identity of 99% and those of BS3, BS6, BST,PE1 and PE2 were most close to ND with identity of 99%. Conclusions Taenia saginata and Taenia asiatica can be found in Baoshan area, while Taenia saginata can be found in Puer area. The gene sequence of mtDNA-12S rRNA can be used for clarifying the three types of Taenia cestode.%目的 利用线粒体DNA基因编码核糖体RNA小亚基(mtDNA-12S rRNA)基因序列分析对采自云南保山、普洱地区的带绦虫标本进行鉴定.方法 选取保山(7条,BS1-BS7)、普洱(2条,PE1~PE2)带绦虫成虫节片,抽提基因组DNA,PCR扩增mtDNA-12S rRNA基因序列,并测序;结合GenBank中已知的猪带绦虫(ZD)、牛带绦虫(ND)、亚洲带绦虫(YZ)mtDNA-12S rRNA基因序列,经DNA MAN软件处理后构建同源树状图与系统发育树状图.结果 带绦虫同源树与系统发育树状图显示,BS1、BS2、BS4、BS5与YZ的同源性最近(99%).BS3、BS6、BS7、PE1、PE2与ND的同源性最近(99%).结论 云南保山存在牛带绦虫与亚洲带绦虫,普洱存在牛带绦虫,mtDNA-12S rRNA基因序列可用于三种带绦虫的分类研究.

  14. Regulation of ribosomal rna synthesis in escherichia coli

    OpenAIRE

    Oostra, Bernard Anne

    1981-01-01

    Bacterien kunnen met verschillende snelheden groeien. De groeisnelheid hangt af van het milieu waarin de bakterien zich bevinden. De expressie van genen wordt aangepast aan de groeiomstandigheden. Omdat op een bepaald moment slechts een beperkt deel van de genen tot expressie komt, moet er sprake zijn van regulering. Daarbij is het ook van belang te weten dat prokaryoten één enzym hebben, het RNA polymerase, dat zorgt voor de transcriptie van alle genen. ... Samenvatting

  15. The Circadian Clock Modulates Global Daily Cycles of mRNA Ribosome Loading[OPEN

    Science.gov (United States)

    Missra, Anamika; Ernest, Ben; Jia, Qidong; Ke, Kenneth

    2015-01-01

    Circadian control of gene expression is well characterized at the transcriptional level, but little is known about diel or circadian control of translation. Genome-wide translation state profiling of mRNAs in Arabidopsis thaliana seedlings grown in long day was performed to estimate ribosome loading per mRNA. The experiments revealed extensive translational regulation of key biological processes. Notably, translation of mRNAs for ribosomal proteins and mitochondrial respiration peaked at night. Central clock mRNAs are among those subject to fluctuations in ribosome loading. There was no consistent phase relationship between peak translation states and peak transcript levels. The overlay of distinct transcriptional and translational cycles can be expected to alter the waveform of the protein synthesis rate. Plants that constitutively overexpress the clock gene CCA1 showed phase shifts in peak translation, with a 6-h delay from midnight to dawn or from noon to evening being particularly common. Moreover, cycles of ribosome loading that were detected under continuous light in the wild type collapsed in the CCA1 overexpressor. Finally, at the transcript level, the CCA1-ox strain adopted a global pattern of transcript abundance that was broadly correlated with the light-dark environment. Altogether, these data demonstrate that gene-specific diel cycles of ribosome loading are controlled in part by the circadian clock. PMID:26392078

  16. The Circadian Clock Modulates Global Daily Cycles of mRNA Ribosome Loading.

    Science.gov (United States)

    Missra, Anamika; Ernest, Ben; Lohoff, Tim; Jia, Qidong; Satterlee, James; Ke, Kenneth; von Arnim, Albrecht G

    2015-09-01

    Circadian control of gene expression is well characterized at the transcriptional level, but little is known about diel or circadian control of translation. Genome-wide translation state profiling of mRNAs in Arabidopsis thaliana seedlings grown in long day was performed to estimate ribosome loading per mRNA. The experiments revealed extensive translational regulation of key biological processes. Notably, translation of mRNAs for ribosomal proteins and mitochondrial respiration peaked at night. Central clock mRNAs are among those subject to fluctuations in ribosome loading. There was no consistent phase relationship between peak translation states and peak transcript levels. The overlay of distinct transcriptional and translational cycles can be expected to alter the waveform of the protein synthesis rate. Plants that constitutively overexpress the clock gene CCA1 showed phase shifts in peak translation, with a 6-h delay from midnight to dawn or from noon to evening being particularly common. Moreover, cycles of ribosome loading that were detected under continuous light in the wild type collapsed in the CCA1 overexpressor. Finally, at the transcript level, the CCA1-ox strain adopted a global pattern of transcript abundance that was broadly correlated with the light-dark environment. Altogether, these data demonstrate that gene-specific diel cycles of ribosome loading are controlled in part by the circadian clock.

  17. The pleuromutilin drugs tiamulin and valnemulin bind to the RNA at the peptidyl transferase centre on the ribosome

    DEFF Research Database (Denmark)

    Poulsen, S M; Karlsson, M; Johansson, L B

    2001-01-01

    The pleuromutilin antibiotic derivatives, tiamulin and valnemulin, inhibit protein synthesis by binding to the 50S ribosomal subunit of bacteria. The action and binding site of tiamulin and valnemulin was further characterized on Escherichia coli ribosomes. It was revealed that these drugs...... results that tiamulin and valnemulin interact with the rRNA in the peptidyl transferase slot on the ribosomes in which they prevent the correct positioning of the CCA-ends of tRNAs for peptide transfer....

  18. The Ribosomal Database Project (RDP).

    Science.gov (United States)

    Maidak, B L; Olsen, G J; Larsen, N; Overbeek, R; McCaughey, M J; Woese, C R

    1996-01-01

    The Ribosomal Database Project (RDP) is a curated database that offers ribosome-related data, analysis services and associated computer programs. The offerings include phylogenetically ordered alignments of ribosomal RNA (rRNA) sequences, derived phylogenetic trees, rRNA secondary structure diagrams and various software for handling, analyzing and displaying alignments and trees. The data are available via anonymous ftp (rdp.life.uiuc.edu), electronic mail (server@rdp.life.uiuc.edu), gopher (rdpgopher.life.uiuc.edu) and World Wide Web (WWW)(http://rdpwww.life.uiuc.edu/). The electronic mail and WWW servers provide ribosomal probe checking, screening for possible chimeric rRNA sequences, automated alignment and approximate phylogenetic placement of user-submitted sequences on an existing phylogenetic tree.

  19. Recognition of Cognate Transfer RNA by the 30S Ribosomal Subunit

    Energy Technology Data Exchange (ETDEWEB)

    Ogle, James M.; Brodersen, Ditlev E.; Clemons, William M.; Tarry, Michael J.; Carter, Andrew P.; Ramakrishnan, V. (MRC Laboratory of Molecular Biology)

    2009-10-07

    Crystal structures of the 30S ribosomal subunit in complex with messenger RNA and cognate transfer RNA in the A site, both in the presence and absence of the antibiotic paromomycin, have been solved at between 3.1 and 3.3 angstroms resolution. Cognate transfer RNA (tRNA) binding induces global domain movements of the 30S subunit and changes in the conformation of the universally conserved and essential bases A1492, A1493, and G530 of 16S RNA. These bases interact intimately with the minor groove of the first two base pairs between the codon and anticodon, thus sensing Watson-Crick base-pairing geometry and discriminating against near-cognate tRNA. The third, or 'wobble,' position of the codon is free to accommodate certain noncanonical base pairs. By partially inducing these structural changes, paromomycin facilitates binding of near-cognate tRNAs.

  20. Ultraviolet damage and nucleosome folding of the 5S ribosomal RNA gene.

    Energy Technology Data Exchange (ETDEWEB)

    Liu, X (Washington State University); Mann, David B.(ASSOC WESTERN UNIVERSITY); Suquet, C (Washington State University); Springer, David L.(BATTELLE (PACIFIC NW LAB)); Smerdon, Michael J.(VISITORS)

    2000-01-25

    The Xenopus borealis somatic 5S ribosomal RNA gene was used as a model system to determine the mutual effects of nucleosome folding and formation of ultraviolet (UV) photoproducts (primarily cis-syn cyclobutane pyrimidine dimers, or CPDs) in chromatin. We analyzed the preferred rotational and translational settings of 5S rDNA on the histone octamer surface after induction of up to 0.8 CPD/nucleosome core (2.5 kJ/m(2) UV dose). DNase I and hydroxyl radical footprints indicate that UV damage at these levels does not affect the average rotational setting of the 5S rDNA molecules. Moreover, a combination of nuclease trimming and restriction enzyme digestion indicates the preferred translational positions of the histone octamer are not affected by this level of UV damage. We also did not observe differences in the UV damage patterns of irradiated 5S rDNA before or after nucleosome formation, indicating there is little difference in the inhibition of nucleosome folding by specific CPD sites in the 5S rRNA gene. Conversely, nucleosome folding significantly restricts CPD formation at all sites in the three helical turns of the nontranscribed strand located in the dyad axis region of the nucleosome, where DNA is bound exclusively by the histone H3-H4 tetramer. Finally, modulation of the CPD distribution in a 14 nt long pyrimidine tract correlates with its rotational setting on the histone surface, when the strong sequence bias for CPD formation in this tract is minimized by normalization. These results help establish the mutual roles of histone binding and UV photoproducts on their formation in chromatin.

  1. DksA Guards Elongating RNA Polymerase Against Ribosome-Stalling-Induced Arrest

    Science.gov (United States)

    Zhang, Yan; Mooney, Rachel A.; Grass, Jeffrey A.; Sivaramakrishnan, Priya; Herman, Christophe; Landick, Robert; Wang, Jue D.

    2014-01-01

    Summary In bacteria, translation-transcription coupling inhibits RNA polymerase (RNAP) stalling. We present evidence suggesting that, upon amino acid starvation, inactive ribosomes promote rather than inhibit RNAP stalling. We developed an algorithm to evaluate genome-wide polymerase progression independently of local noise, and used it to reveal that the transcription factor DksA inhibits promoter-proximal pausing and increases RNAP elongation when uncoupled from translation by depletion of charged tRNAs. DksA has minimal effect on RNAP elongation in vitro and on untranslated RNAs in vivo. In these cases, transcripts can form RNA structures that prevent backtracking. Thus, the effect of DksA on transcript elongation may occur primarily upon ribosome slowing/stalling or at promoter-proximal locations that limit the potential for RNA structure. We propose that inactive ribosomes prevent formation of backtrack-blocking mRNA structures and that, in this circumstance, DksA acts as a transcription elongation factor in vivo. PMID:24606919

  2. Expanded versions of the 16S and 23S ribosomal RNA mutation databases (16SMDBexp and 23SMDBexp)

    OpenAIRE

    Triman, K L; Peister, A; Goel, R A

    1998-01-01

    Expanded versions of the Ribosomal RNA Mutation Databases provide lists of mutated positions in 16S and 16S-like ribosomal RNA (16SMDBexp) and 23S and 23S-like ribosomal RNA (23SMDBexp) and the identity of each alteration. Alterations from organisms other than Escherichia coli are reported at positions according to the E.coli numbering system. Information provided for each mutation includes: (i) a brief description of the phenotype(s) associated with each mutation, (ii) whether a mutant pheno...

  3. Codon-Anticodon Recognition in the Bacillus subtilis glyQS T Box Riboswitch: RNA-DEPENDENT CODON SELECTION OUTSIDE THE RIBOSOME.

    Science.gov (United States)

    Caserta, Enrico; Liu, Liang-Chun; Grundy, Frank J; Henkin, Tina M

    2015-09-18

    Many amino acid-related genes in Gram-positive bacteria are regulated by the T box riboswitch. The leader RNA of genes in the T box family controls the expression of downstream genes by monitoring the aminoacylation status of the cognate tRNA. Previous studies identified a three-nucleotide codon, termed the "Specifier Sequence," in the riboswitch that corresponds to the amino acid identity of the downstream genes. Pairing of the Specifier Sequence with the anticodon of the cognate tRNA is the primary determinant of specific tRNA recognition. This interaction mimics codon-anticodon pairing in translation but occurs in the absence of the ribosome. The goal of the current study was to determine the effect of a full range of mismatches for comparison with codon recognition in translation. Mutations were individually introduced into the Specifier Sequence of the glyQS leader RNA and tRNA(Gly) anticodon to test the effect of all possible pairing combinations on tRNA binding affinity and antitermination efficiency. The functional role of the conserved purine 3' of the Specifier Sequence was also verifiedin this study. We found that substitutions at the Specifier Sequence resulted in reduced binding, the magnitude of which correlates well with the predicted stability of the RNA-RNA pairing. However, the tolerance for specific mismatches in antitermination was generally different from that during decoding, which reveals a unique tRNA recognition pattern in the T box antitermination system.

  4. Phylogenetic relationships in the mushroom genus Coprinus and dark-spored allies based on sequence data from the nuclear gene coding for the large ribosomal subunit RNA: divergent domains, outgroups, and monophyly.

    Science.gov (United States)

    Hopple, J S; Vilgalys, R

    1999-10-01

    Phylogenetic relationships were investigated in the mushroom genus Coprinus based on sequence data from the nuclear encoded large-subunit rDNA gene. Forty-seven species of Coprinus and 19 additional species from the families Coprinaceae, Strophariaceae, Bolbitiaceae, Agaricaceae, Podaxaceae, and Montagneaceae were studied. A total of 1360 sites was sequenced across seven divergent domains and intervening sequences. A total of 302 phylogenetically informative characters was found. Ninety-eight percent of the average divergence between taxa was located within the divergent domains, with domains D2 and D8 being most divergent and domains D7 and D10 the least divergent. An empirical test of phylogenetic signal among divergent domains also showed that domains D2 and D3 had the lowest levels of homoplasy. Two equally most parsimonious trees were resolved using Wagner parsimony. A character-state weighted analysis produced 12 equally most parsimonious trees similar to those generated by Wagner parsimony. Phylogenetic analyses employing topological constraints suggest that none of the major taxonomic systems proposed for subgeneric classification is able to completely reflect phylogenetic relationships in Coprinus. A strict consensus integration of the two Wagner trees demonstrates the problematic nature of choosing outgroups within dark-spored mushrooms. The genus Coprinus is found to be polyphyletic and is separated into three distinct clades. Most Coprinus taxa belong to the first two clades, which together form a larger monophyletic group with Lacrymaria and Psathyrella in basal positions. A third clade contains members of Coprinus section Comati as well as the genus Leucocoprinus, Podaxis pistillaris, Montagnea arenaria, and Agaricus pocillator. This third clade is separated from the other species of Coprinus by members of the families Strophariaceae and Bolbitiaceae and the genus Panaeolus.

  5. Kinetoplastid Specific RNA-Protein Interactions in Trypanosoma cruzi Ribosome Biogenesis.

    Directory of Open Access Journals (Sweden)

    Khan Umaer

    Full Text Available RNA binding proteins (RBP play essential roles in the highly conserved and coordinated process of ribosome biogenesis. Our laboratory has previously characterized two essential and abundant RBPs, P34 and P37, in Trypanosoma brucei which are required for several critical steps in ribosome biogenesis. The genes for these proteins have only been identified in kinetoplastid organisms but not in the host genome. We have identified a homolog of the TbP34 and TbP37 in a T. cruzi strain (termed TcP37/NRBD. Although the N-terminal APK-rich domain and RNA recognition motifs are conserved, the C-terminal region which contains putative nuclear and nucleolar localization signals in TbP34 and TbP37 is almost entirely missing from TcP37/NRBD. We have shown that TcP37/NRBD is expressed in T. cruzi epimastigotes at the level of mature mRNA and protein. Despite the loss of the C-terminal domain, TcP37/NRBD is present in the nucleus, including the nucleolus, and the cytoplasm. TcP37/NRBD interacts directly with Tc 5S rRNA, but does not associate with polyadenylated RNA. TcP37/NRBD also associates in vivo and in vitro with large ribosomal protein TcL5 and, unlike the case of T. brucei, this association is strongly enhanced by the presence of 5S rRNA, suggesting that the loss of the C-terminal domain of TcP37/NRBD may alter the interactions within the complex. These results indicate that the unique preribosomal complex comprised of L5, 5S rRNA, and the trypanosome-specific TcP37/NRBD or TbP34 and TbP37 is functionally conserved in trypanosomes despite the differences in the C-termini of the trypanosome-specific protein components.

  6. Kinetoplastid Specific RNA-Protein Interactions in Trypanosoma cruzi Ribosome Biogenesis.

    Science.gov (United States)

    Umaer, Khan; Williams, Noreen

    2015-01-01

    RNA binding proteins (RBP) play essential roles in the highly conserved and coordinated process of ribosome biogenesis. Our laboratory has previously characterized two essential and abundant RBPs, P34 and P37, in Trypanosoma brucei which are required for several critical steps in ribosome biogenesis. The genes for these proteins have only been identified in kinetoplastid organisms but not in the host genome. We have identified a homolog of the TbP34 and TbP37 in a T. cruzi strain (termed TcP37/NRBD). Although the N-terminal APK-rich domain and RNA recognition motifs are conserved, the C-terminal region which contains putative nuclear and nucleolar localization signals in TbP34 and TbP37 is almost entirely missing from TcP37/NRBD. We have shown that TcP37/NRBD is expressed in T. cruzi epimastigotes at the level of mature mRNA and protein. Despite the loss of the C-terminal domain, TcP37/NRBD is present in the nucleus, including the nucleolus, and the cytoplasm. TcP37/NRBD interacts directly with Tc 5S rRNA, but does not associate with polyadenylated RNA. TcP37/NRBD also associates in vivo and in vitro with large ribosomal protein TcL5 and, unlike the case of T. brucei, this association is strongly enhanced by the presence of 5S rRNA, suggesting that the loss of the C-terminal domain of TcP37/NRBD may alter the interactions within the complex. These results indicate that the unique preribosomal complex comprised of L5, 5S rRNA, and the trypanosome-specific TcP37/NRBD or TbP34 and TbP37 is functionally conserved in trypanosomes despite the differences in the C-termini of the trypanosome-specific protein components.

  7. Kinetoplastid Specific RNA-Protein Interactions in Trypanosoma cruzi Ribosome Biogenesis

    Science.gov (United States)

    Umaer, Khan; Williams, Noreen

    2015-01-01

    RNA binding proteins (RBP) play essential roles in the highly conserved and coordinated process of ribosome biogenesis. Our laboratory has previously characterized two essential and abundant RBPs, P34 and P37, in Trypanosoma brucei which are required for several critical steps in ribosome biogenesis. The genes for these proteins have only been identified in kinetoplastid organisms but not in the host genome. We have identified a homolog of the TbP34 and TbP37 in a T. cruzi strain (termed TcP37/NRBD). Although the N-terminal APK-rich domain and RNA recognition motifs are conserved, the C-terminal region which contains putative nuclear and nucleolar localization signals in TbP34 and TbP37 is almost entirely missing from TcP37/NRBD. We have shown that TcP37/NRBD is expressed in T. cruzi epimastigotes at the level of mature mRNA and protein. Despite the loss of the C-terminal domain, TcP37/NRBD is present in the nucleus, including the nucleolus, and the cytoplasm. TcP37/NRBD interacts directly with Tc 5S rRNA, but does not associate with polyadenylated RNA. TcP37/NRBD also associates in vivo and in vitro with large ribosomal protein TcL5 and, unlike the case of T. brucei, this association is strongly enhanced by the presence of 5S rRNA, suggesting that the loss of the C-terminal domain of TcP37/NRBD may alter the interactions within the complex. These results indicate that the unique preribosomal complex comprised of L5, 5S rRNA, and the trypanosome-specific TcP37/NRBD or TbP34 and TbP37 is functionally conserved in trypanosomes despite the differences in the C-termini of the trypanosome-specific protein components. PMID:26121669

  8. Minor groove RNA triplex in the crystal structure of a ribosomal frameshifting viral pseudoknot

    Science.gov (United States)

    Su, L.; Chen, L.; Egli, M.; Berger, J. M.; Rich, A.

    1999-01-01

    Many viruses regulate translation of polycistronic mRNA using a -1 ribosomal frameshift induced by an RNA pseudoknot. A pseudoknot has two stems that form a quasi-continuous helix and two connecting loops. A 1.6 A crystal structure of the beet western yellow virus (BWYV) pseudoknot reveals rotation and a bend at the junction of the two stems. A loop base is inserted in the major groove of one stem with quadruple-base interactions. The second loop forms a new minor-groove triplex motif with the other stem, involving 2'-OH and triple-base interactions, as well as sodium ion coordination. Overall, the number of hydrogen bonds stabilizing the tertiary interactions exceeds the number involved in Watson-Crick base pairs. This structure will aid mechanistic analyses of ribosomal frameshifting.

  9. Intra-genomic ribosomal RNA polymorphism and morphological variation in Elphidium macellum suggests inter-specific hybridization in foraminifera.

    Directory of Open Access Journals (Sweden)

    Loïc Pillet

    Full Text Available Elphidium macellum is a benthic foraminifer commonly found in the Patagonian fjords. To test whether its highly variable morphotypes are ecophenotypes or different genotypes, we analysed 70 sequences of the SSU rRNA gene from 25 specimens. Unexpectedly, we identified 11 distinct ribotypes, with up to 5 ribotypes co-occurring within the same specimen. The ribotypes differ by varying blocks of sequence located at the end of stem-loop motifs in the three expansion segments specific to foraminifera. These changes, distinct from typical SNPs and indels, directly affect the structure of the expansion segments. Their mosaic distribution suggests that ribotypes originated by recombination of two or more clusters of ribosomal genes. We propose that this expansion segment polymorphism (ESP could originate from hybridization of morphologically different populations of Patagonian Elphidium. We speculate that the complex geological history of Patagonia enhanced divergence of coastal foraminiferal species and contributed to increasing genetic and morphological variation.

  10. Ribosomal PCR and DNA sequencing for detection and identification of bacteria

    DEFF Research Database (Denmark)

    Jensen, Kristine Helander; Dargis, Rimtas; Christensen, Jens Jørgen

    2014-01-01

    -haemolytic streptococci, especially within the mitis group. The data show that ribosomal PCR with subsequent DNA sequencing of the PCR product is a most valuable supplement to culture for identifying bacterial agents of both acute and prolonged infections. However, some bacteria, including non-haemolytic streptococci...

  11. Nucleotide sequence of Zygosaccharomyces bailii virus Z: Evidence for +1 programmed ribosomal frameshifting and for assignment to family Amalgaviridae.

    Science.gov (United States)

    Depierreux, Delphine; Vong, Minh; Nibert, Max L

    2016-06-02

    Zygosaccharomyces bailii virus Z (ZbV-Z) is a monosegmented dsRNA virus that infects the yeast Zygosaccharomyces bailii and remains unclassified to date despite its discovery >20years ago. The previously reported nucleotide sequence of ZbV-Z (GenBank AF224490) encompasses two nonoverlapping long ORFs: upstream ORF1 encoding the putative coat protein and downstream ORF2 encoding the RNA-dependent RNA polymerase (RdRp). The lack of overlap between these ORFs raises the question of how the downstream ORF is translated. After examining the previous sequence of ZbV-Z, we predicted that it contains at least one sequencing error to explain the nonoverlapping ORFs, and hence we redetermined the nucleotide sequence of ZbV-Z, derived from the same isolate of Z. bailii as previously studied, to address this prediction. The key finding from our new sequence, which includes several insertions, deletions, and substitutions relative to the previous one, is that ORF2 in fact overlaps ORF1 in the +1 frame. Moreover, a proposed sequence motif for +1 programmed ribosomal frameshifting, previously noted in influenza A viruses, plant amalgaviruses, and others, is also present in the newly identified ORF1-ORF2 overlap region of ZbV-Z. Phylogenetic analyses provided evidence that ZbV-Z represents a distinct taxon most closely related to plant amalgaviruses (genus Amalgavirus, family Amalgaviridae). We conclude that ZbV-Z is the prototype of a new species, which we propose to assign as type species of a new genus of monosegmented dsRNA mycoviruses in family Amalgaviridae. Comparisons involving other unclassified mycoviruses with RdRps apparently related to those of plant amalgaviruses, and having either mono- or bisegmented dsRNA genomes, are also discussed.

  12. Molecular signatures of ribosomal evolution.

    Science.gov (United States)

    Roberts, Elijah; Sethi, Anurag; Montoya, Jonathan; Woese, Carl R; Luthey-Schulten, Zaida

    2008-09-16

    Ribosomal signatures, idiosyncrasies in the ribosomal RNA (rRNA) and/or proteins, are characteristic of the individual domains of life. As such, insight into the early evolution of the domains can be gained from a comparative analysis of their respective signatures in the translational apparatus. In this work, we identify signatures in both the sequence and structure of the rRNA and analyze their contributions to the universal phylogenetic tree using both sequence- and structure-based methods. Domain-specific ribosomal proteins can be considered signatures in their own right. Although it is commonly assumed that they developed after the universal ribosomal proteins, we present evidence that at least one may have been present before the divergence of the organismal lineages. We find correlations between the rRNA signatures and signatures in the ribosomal proteins showing that the rRNA signatures coevolved with both domain-specific and universal ribosomal proteins. Finally, we show that the genomic organization of the universal ribosomal components contains these signatures as well. From these studies, we propose the ribosomal signatures are remnants of an evolutionary-phase transition that occurred as the cell lineages began to coalesce and so should be reflected in corresponding signatures throughout the fabric of the cell and its genome.

  13. Phylogenetic analysis of freshwater mussel corbicula regularis by 18s rRNA gene sequencing

    Directory of Open Access Journals (Sweden)

    Magare V N

    2015-04-01

    Full Text Available Corbicula regularis is a freshwater mussel found in the Indian sub-continent. In the present study, phylogenetic characterization of this important bivalve was attempted using 18S ribosomal RNA gene markers. Genomic DNA was extracted and 18S rRNA gene was amplified by universal primers. The amplification product was sequenced and compared with the nucleotide databases available online to evaluate phylogenetic relationship of the animal under study. Results indicated that 18S rRNA gene sequences of C. regularis showed high degree of similarity to another freshwater mussel, C. fluminea. This work constitutes the first ever sequence deposition of the C. regularis in the nucleotide databases highlighting the usefulness of 18S ribosomal gene markers for phylogenetic analysis.

  14. cDNA, genomic sequence cloning and overexpression of ribosomal ...

    African Journals Online (AJOL)

    PRECIOUS

    2009-11-02

    Nov 2, 2009 ... structure analysis revealed that the molecular weight of the putative RPS20 protein is ... II phosphorylation sites in the RPS20 protein of the Giant Panda. ... basic machinery of protein synthesis and regulation, but ... transcribed with the small nucleolar RNA gene U54, .... Reverse transcription polymerase.

  15. 25S ribosomal RNA homologies of basidiomycetous yeasts: taxonomic and phylogenetic implications

    Science.gov (United States)

    Baharaeen, S.; Vishniac, H. S.

    1984-01-01

    Genera, families, and possibly orders of basidiomycetous yeasts can be defined by 25S rRNA homology and correlated phenotypic characters. The teleomorphic genera Filobasidium, Leucosporidium, and Rhodosporidium have greater than 96 relative binding percent (rb%) intrageneric 25S rRNA homology and significant intergeneric separation from each other and from Filobasidiella. The anamorphic genus Cryptococcus can be defined by morphology (monopolar budding), colony color, and greater than 75 rb% intrageneric homology; Vanrija is heterogeneous. Agaricostilbum (Phragmobasidiomycetes, Auriculariales), Hansenula (Ascomycotera, Endomycota), Tremella (Phragmobasidiomycetes, Tremellales), and Ustilago (Ustomycota, Ustilaginales) appear equally unrelated to the Cryptococcus, Filobasidiella, and Rhodosporidium spp. used as probes. The Filobasidiaceae and Sporidiaceae, Filobasidiales and Sporidiales, form coherent homology groups which appear to have undergone convergent 25S rRNA evolution, since their relatedness is much greater than that indicated by 5S rRNA homology. Ribosomal RNA homologies do not appear to measure evolutionary distance.

  16. antaRNA: ant colony-based RNA sequence design

    National Research Council Canada - National Science Library

    Kleinkauf, Robert; Mann, Martin; Backofen, Rolf

    2015-01-01

    ... ,: specific sequence constraints and additional fuzzy structure constraints. antaRNA applies ant colony optimization meta-heuristics and its superior performance is shown on a biological datasets. http://www.bioinf.uni-freiburg.de/Software/antaRNA CONTACT: backofen@informatik.uni-freiburg.de Supplementary data are available at Bioinformatics online.

  17. Detection of bacterial 16S ribosomal RNA genes for forensic identification of vaginal fluid.

    Science.gov (United States)

    Akutsu, Tomoko; Motani, Hisako; Watanabe, Ken; Iwase, Hirotaro; Sakurada, Koichi

    2012-05-01

    To preliminarily evaluate the applicability of bacterial DNA as a marker for the forensic identification of vaginal fluid, we developed and performed PCR-based detection of 16S ribosomal RNA genes of Lactobacillus spp. dominating the vagina and of bacterial vaginosis-related bacteria from DNA extracted from body fluids and stains. As a result, 16S ribosomal RNA genes of Lactobacillus crispatus, Lactobacillus jensenii and Atopobium vaginae were specifically detected in vaginal fluid and female urine samples. Bacterial genes detected in female urine might have originated from contaminated vaginal fluid. In addition, those of Lactobacillus iners, Lactobacillus gasseri and Gardnerella vaginalis were also detected in non-vaginal body fluids such as semen. Because bacterial genes were successfully amplified in DNA samples extracted by using the general procedure for animal tissues without any optional treatments, DNA samples prepared for the identification of vaginal fluid can also be used for personal identification. In conclusion, 16S ribosomal RNA genes of L. crispatus, L. jensenii and A. vaginae could be effective markers for forensic identification of vaginal fluid.

  18. Detection of Enterobacter sakazakii in neonatal sepsis by PCR on 16S ribosomal RNA

    Directory of Open Access Journals (Sweden)

    Khadijeh Ahmadi

    2014-08-01

    Full Text Available Background: Enterobacter sakazakii is a gram negative, facultative anaerobic, straight rod-shaped bacterium that belongs to the family Enterobacteriaceae. It is also considered an emerging opportunistic pathogen, responsible of cases of neonatal infections including sepsis, meningitis, necrotizing enterocolitis ad bacteremia. The goal of this study was detection of Enterobacter salazakii in neonates with sepsis by PCR on 16S ribosomal RNA gene. Material and Methods: This cross-sectional study was conducted on 405 blood specimens that were taken from hospitalized neonates suspected to sepsis in Ahvaz Abuzar Hospital in 2011. From each neonate 0.5 ml blood sample was taken and placed in CBC tubes containing EDTA at -200C for polymerase chain reaction. For detection of Enterobacter sakazakii, PCR was performed on DNA for amplification of 16S ribosomal RNA gene. Results: In all 405 neonates blood samples’ PCR reactions for Enterobacter sakazakii 16S ribosomal RNA gene were negative. Blood cultures were positive for Streptococcus agalactiae in 8 (1.4 % patients. Conclusion: Because Enterobacter sakazakii is an opportunistic pathogen with high pathogenicity power, more investigation on high risk groups is required. For detection of infection caused by this organism using of different diagnostic methods with high specificity and sensitivity is necessary.

  19. A Genome-Wide Analysis of RNA Pseudoknots That Stimulate Efficient −1 Ribosomal Frameshifting or Readthrough in Animal Viruses

    Directory of Open Access Journals (Sweden)

    Xiaolan Huang

    2013-01-01

    Full Text Available Programmed −1 ribosomal frameshifting (PRF and stop codon readthrough are two translational recoding mechanisms utilized by some RNA viruses to express their structural and enzymatic proteins at a defined ratio. Efficient recoding usually requires an RNA pseudoknot located several nucleotides downstream from the recoding site. To assess the strategic importance of the recoding pseudoknots, we have carried out a large scale genome-wide analysis in which we used an in-house developed program to detect all possible H-type pseudoknots within the genomic mRNAs of 81 animal viruses. Pseudoknots are detected downstream from ~85% of the recoding sites, including many previously unknown pseudoknots. ~78% of the recoding pseudoknots are the most stable pseudoknot within the viral genomes. However, they are not as strong as some designed pseudoknots that exhibit roadblocking effect on the translating ribosome. Strong roadblocking pseudoknots are not detected within the viral genomes. These results indicate that the decoding pseudoknots have evolved to possess optimal stability for efficient recoding. We also found that the sequence at the gag-pol frameshift junction of HIV1 harbors potential elaborated pseudoknots encompassing the frameshift site. A novel mechanism is proposed for possible involvement of the elaborated pseudoknots in the HIV1 PRF event.

  20. Virtual Ribosome - a comprehensive DNA translation tool with support for integration of sequence feature annotation

    DEFF Research Database (Denmark)

    Wernersson, Rasmus

    2006-01-01

    Virtual Ribosome is a DNA translation tool with two areas of focus. ( i) Providing a strong translation tool in its own right, with an integrated ORF finder, full support for the IUPAC degenerate DNA alphabet and all translation tables defined by the NCBI taxonomy group, including the use...... of alternative start codons. ( ii) Integration of sequences feature annotation - in particular, native support for working with files containing intron/ exon structure annotation. The software is available for both download and online use at http://www.cbs.dtu.dk/services/VirtualRibosome/....

  1. Routine ribosomal PCR and DNA sequencing for detection and identification of bacteria

    DEFF Research Database (Denmark)

    Kemp, Michael; Jensen, Kristine H; Dargis, Rimtas

    2010-01-01

    Detection and identification of bacteria by PCR and DNA sequencing from clinical sample material has been introduced as a diagnostic routine analysis during the last 5-10 years. Assays analyzing ribosomal genes have been found to be particularly useful. The technique has identified unusual bacteria...... as well as well-known bacteria in unusual infectious foci. Thereby, it has proven its value both in diagnosing infections in individual patients and as a tool to establish the pathogenic potential of bacteria not previously associated with disease. To be of clinical relevance, results from ribosomal PCR...

  2. Identification of Novel RNA-Protein Contact in Complex of Ribosomal Protein S7 and 3'-Terminal Fragment of 16S rRNA in E. coli.

    Science.gov (United States)

    Golovin, A V; Khayrullina, G A; Kraal, B; Kopylov, Capital A Cyrillic М

    2012-10-01

    For prokaryotes in vitro, 16S rRNA and 20 ribosomal proteins are capable of hierarchical self- assembly yielding a 30S ribosomal subunit. The self-assembly is initiated by interactions between 16S rRNA and three key ribosomal proteins: S4, S8, and S7. These proteins also have a regulatory function in the translation of their polycistronic operons recognizing a specific region of mRNA. Therefore, studying the RNA-protein interactions within binary complexes is obligatory for understanding ribosome biogenesis. The non-conventional RNA-protein contact within the binary complex of recombinant ribosomal protein S7 and its 16S rRNA binding site (236 nucleotides) was identified. UV-induced RNA-protein cross-links revealed that S7 cross-links to nucleotide U1321 of 16S rRNA. The careful consideration of the published RNA- protein cross-links for protein S7 within the 30S subunit and their correlation with the X-ray data for the 30S subunit have been performed. The RNA - protein cross-link within the binary complex identified in this study is not the same as the previously found cross-links for a subunit both in a solution, and in acrystal. The structure of the binary RNA-protein complex formed at the initial steps of self-assembly of the small subunit appears to be rearranged during the formation of the final structure of the subunit.

  3. An RNA Element That Facilitates Programmed Ribosomal Readthrough in Turnip Crinkle Virus Adopts Multiple Conformations.

    Science.gov (United States)

    Kuhlmann, Micki M; Chattopadhyay, Maitreyi; Stupina, Vera A; Gao, Feng; Simon, Anne E

    2016-10-01

    Ribosome recoding is used by RNA viruses for translational readthrough or frameshifting past termination codons for the synthesis of extension products. Recoding sites, along with downstream recoding stimulatory elements (RSEs), have long been studied in reporter constructs, because these fragments alone mediate customary levels of recoding and are thus assumed to contain complete instructions for establishment of the proper ratio of termination to recoding. RSEs from the Tombusviridae and Luteoviridae are thought to be exceptions, since they contain a long-distance RNA-RNA connection with the 3' end. This interaction has been suggested to substitute for pseudoknots, thought to be missing in tombusvirid RSEs. We provide evidence that the phylogenetically conserved RSE of the carmovirus Turnip crinkle virus (TCV) adopts an alternative, smaller structure that extends an upstream conserved hairpin and that this alternative structure is the predominant form of the RSE within nascent viral RNA in plant cells and when RNA is synthesized in vitro The TCV RSE also contains an internal pseudoknot along with the long-distance interaction, and the pseudoknot is not compatible with the phylogenetically conserved structure. Conserved residues just past the recoding site are important for recoding, and these residues are also conserved in the RSEs of gammaretroviruses. Our data demonstrate the dynamic nature of the TCV RSE and suggest that studies using reporter constructs may not be effectively recapitulating RSE-mediated recoding within viral genomes. Ribosome recoding is used by RNA viruses to enable ribosomes to extend translation past termination codons for the synthesis of longer products. Recoding sites and a downstream recoding stimulatory element (RSE) mediate expected levels of recoding when excised and placed in reporter constructs and thus are assumed to contain complete instructions for the establishment of the proper ratio of termination to recoding. We provide

  4. Linking Maternal and Somatic 5S rRNA types with Different Sequence-Specific Non-LTR Retrotransposons

    NARCIS (Netherlands)

    Locati, M.D.; Pagano, J.F.B.; Ensink, W.A.; van Olst, M.; van Leeuwen, S.; Nehrdich, U.; Zhu, K.; Spaink, H.P.; Girard, G.; Rauwerda, H.; Jonker, M.J.; Dekker, R.J.; Breit, T.M.

    5S rRNA is a ribosomal core component, transcribed from many gene copies organized in genomic repeats. Some eukaryotic species have two 5S rRNA types defined by their predominant expression in oogenesis or adult tissue. Our next-generation sequencing study on zebrafish egg, embryo and adult tissue,

  5. The nucleotide sequence of chloroplast 4.5S rRNA from a fern, Dryopteris acuminata.

    OpenAIRE

    Takaiwa, F.; Kusuda, M; SUGIURA, M.

    1982-01-01

    The 4.5S rRNA was isolated from the chloroplast ribosomes from Dryopteris acuminata. The complete nucleotide sequence was determined to be: OHUAAGGUCACGGCAAGACGAGCCGUUUAUCACCACGAUAGGUGCUAAGUGGAGGUGCAGUAAUGUAUGCAGCUGAGGC AUCCUAAUAGACCGAGAGGUUUGAACOH. The 4.5S rRNA is composed of 103 nucleotides and shows strong homology with those from flowering plants.

  6. The pre-existing population of 5S rRNA effects p53 stabilization during ribosome biogenesis inhibition.

    Science.gov (United States)

    Onofrillo, Carmine; Galbiati, Alice; Montanaro, Lorenzo; Derenzini, Massimo

    2017-01-17

    Pre-ribosomal complex RPL5/RPL11/5S rRNA (5S RNP) is considered the central MDM2 inhibitory complex that control p53 stabilization during ribosome biogenesis inhibition. Despite its role is well defined, the dynamic of 5S RNP assembly still requires further characterization. In the present work, we report that MDM2 inhibition is dependent by a pre-existing population of 5S rRNA.

  7. RNA tertiary interactions in the large ribosomal subunit: The A-minor motif

    Energy Technology Data Exchange (ETDEWEB)

    Nissen, Poul; Ippolito, Joseph A.; Ban, Nenad; Moore, Peter B.; Steitz, Thomas A. (Yale University); (Yale University); (Yale Unversity)

    2009-10-07

    Analysis of the 2.4-{angstrom} resolution crystal structure of the large ribosomal subunit from Haloarcula marismortui reveals the existence of an abundant and ubiquitous structural motif that stabilizes RNA tertiary and quaternary structures. This motif is termed the A-minor motif, because it involves the insertion of the smooth, minor groove edges of adenines into the minor groove of neighboring helices, preferentially at C-G base pairs, where they form hydrogen bonds with one or both of the 2' OHs of those pairs. A-minor motifs stabilize contacts between RNA helices, interactions between loops and helices, and the conformations of junctions and tight turns. The interactions between the 3' terminal adenine of tRNAs bound in either the A site or the P site with 23S rRNA are examples of functionally significant A-minor interactions. The A-minor motif is by far the most abundant tertiary structure interaction in the large ribosomal subunit; 186 adenines in 23S and 5S rRNA participate, 68 of which are conserved. It may prove to be the universally most important long-range interaction in large RNA structures.

  8. Efficient hammerhead ribozyme and antisense RNA targeting in a slow ribosome Escherichia coli mutant.

    Science.gov (United States)

    Chen, H; Ferbeyre, G; Cedergren, R

    1997-05-01

    We have evaluated inhibition of the plasmid-born chloramphenicol acetyl transferase gene (CAT) by the hammerhead ribozyme and antisense RNA in Escherichia coli where the translation and transcription rates have been modified. Whereas neither antisense nor the hammerhead had an inhibitory effect on CAT activity in wild-type E. coli, both reduced the level of the messenger RNA and the activity of the CAT gene by almost 60% in a slow ribosome mutant. Streptomycin, which increases the speed of translation in this mutant strain, restored full CAT activity. The level of CAT activity expressed from a T7 RNA polymerase promoter was not affected by the presence of either antisense RNA or the hammerhead ribozyme. When the target gene was expressed from a chromosomal locus in wild-type E. coli, both antisense RNA and the hammerhead ribozyme showed some inhibitory activity, but the level of inhibition was significantly increased in the slow ribosome strain. This bacterial system offers a unique entry to the study of cellular factors which mediate the activity of ribozymes in vivo.

  9. 18S Ribosomal RNA Evaluation as Preanalytical Quality Control for Animal DNA

    Directory of Open Access Journals (Sweden)

    Cory Ann Leonard

    2016-01-01

    Full Text Available The 18S ribosomal RNA (rRNA gene is present in all eukaryotic cells. In this study, we evaluated the use of this gene to verify the presence of PCR-amplifiable host (animal DNA as an indicator of sufficient sample quality for quantitative real-time PCR (qPCR analysis. We compared (i samples from various animal species, tissues, and sample types, including swabs; (ii multiple DNA extraction methods; and (iii both fresh and formalin-fixed paraffin-embedded (FFPE samples. Results showed that 18S ribosomal RNA gene amplification was possible from all tissue samples evaluated, including avian, reptile, and FFPE samples and most swab samples. A single swine rectal swab, which showed sufficient DNA quantity and the demonstrated lack of PCR inhibitors, nonetheless was negative by 18S qPCR. Such a sample specifically illustrates the improvement of determination of sample integrity afforded by inclusion of 18S rRNA gene qPCR analysis in addition to spectrophotometric analysis and the use of internal controls for PCR inhibition. Other possible applications for the described 18S rRNA qPCR are preselection of optimal tissue specimens for studies or preliminary screening of archived samples prior to acceptance for biobanking projects.

  10. Close sequence identity between ribosomal DNA episomes of the non-pathogenic Entamoeba dispar and pathogenic Entamoeba histolytica

    Indian Academy of Sciences (India)

    Jaishree Paul; Alok Bhattacharya; Sudha Bhattacharya

    2002-11-01

    Entamoeba dispar and Entamoeba histolytica are now recognized as two distinct species – the former being nonpathogenic to humans. We had earlier studied the organization of ribosomal RNA genes in E. histolytica. Here we report the analysis of ribosomal RNA genes in E. dispar. The rRNA genes of E. dispar, like their counterpart in E. histolytica are located on a circular rDNA molecule. From restriction map analysis, the size of E. dispar rDNA circle was estimated to be 24.4 kb. The size was also confirmed by linearizing the circle with BsaHI, and by limited DNAseI digestion. The restriction map of the E. dispar rDNA circle showed close similarity to EhR1, the rDNA circle of E. histolytica strain HM-1:IMSS which has two rDNA units per circle. The various families of short tandem repeats found in the upstream and downstream intergenic spacers (IGS) of EhR1 were also present in E. dispar. Partial sequencing of the cloned fragments of E. dispar rDNA and comparison with EhR1 revealed only 2.6% to 3.8% sequence divergence in the IGS. The region Tr and the adjoining PvuI repeats in the IGS of EhR1, which are missing in those E. histolytica strains that have one rDNA unit per circle, were present in the E. dispar rDNA circle. Such close similarity in the overall organization and sequence of the IGS of rDNAs of two different species is uncommon. In fact the spacer sequences were only slightly more divergent than the 18S rRNA gene sequence which differs by 1.6% in the two species. The most divergent sequence between E. histolytica and E. dispar was the internal transcribed spacer, ITS2. Therefore, it was concluded that probes derived from the ITS1 and ITS2 sequences would be more reliable and reproducible than probes from the IGS regions used earlier for identifying these species.

  11. 5S Ribosomal RNA Is an Essential Component of a Nascent Ribosomal Precursor Complex that Regulates the Hdm2-p53 Checkpoint

    Directory of Open Access Journals (Sweden)

    Giulio Donati

    2013-07-01

    Full Text Available Recently, we demonstrated that RPL5 and RPL11 act in a mutually dependent manner to inhibit Hdm2 and stabilize p53 following impaired ribosome biogenesis. Given that RPL5 and RPL11 form a preribosomal complex with noncoding 5S ribosomal RNA (rRNA and the three have been implicated in the p53 response, we reasoned they may be part of an Hdm2-inhibitory complex. Here, we show that small interfering RNAs directed against 5S rRNA have no effect on total or nascent levels of the noncoding rRNA, though they prevent the reported Hdm4 inhibition of p53. To achieve efficient inhibition of 5S rRNA synthesis, we targeted TFIIIA, a specific RNA polymerase III cofactor, which, like depletion of either RPL5 or RPL11, did not induce p53. Instead, 5S rRNA acts in a dependent manner with RPL5 and RPL11 to inhibit Hdm2 and stabilize p53. Moreover, depletion of any one of the three components abolished the binding of the other two to Hdm2, explaining their common dependence. Finally, we demonstrate that the RPL5/RPL11/5S rRNA preribosomal complex is redirected from assembly into nascent 60S ribosomes to Hdm2 inhibition as a consequence of impaired ribosome biogenesis. Thus, the activation of the Hdm2-inhibitory complex is not a passive but a regulated event, whose potential role in tumor suppression has been recently noted.

  12. 5S ribosomal RNA is an essential component of a nascent ribosomal precursor complex that regulates the Hdm2-p53 checkpoint.

    Science.gov (United States)

    Donati, Giulio; Peddigari, Suresh; Mercer, Carol A; Thomas, George

    2013-07-11

    Recently, we demonstrated that RPL5 and RPL11 act in a mutually dependent manner to inhibit Hdm2 and stabilize p53 following impaired ribosome biogenesis. Given that RPL5 and RPL11 form a preribosomal complex with noncoding 5S ribosomal RNA (rRNA) and the three have been implicated in the p53 response, we reasoned they may be part of an Hdm2-inhibitory complex. Here, we show that small interfering RNAs directed against 5S rRNA have no effect on total or nascent levels of the noncoding rRNA, though they prevent the reported Hdm4 inhibition of p53. To achieve efficient inhibition of 5S rRNA synthesis, we targeted TFIIIA, a specific RNA polymerase III cofactor, which, like depletion of either RPL5 or RPL11, did not induce p53. Instead, 5S rRNA acts in a dependent manner with RPL5 and RPL11 to inhibit Hdm2 and stabilize p53. Moreover, depletion of any one of the three components abolished the binding of the other two to Hdm2, explaining their common dependence. Finally, we demonstrate that the RPL5/RPL11/5S rRNA preribosomal complex is redirected from assembly into nascent 60S ribosomes to Hdm2 inhibition as a consequence of impaired ribosome biogenesis. Thus, the activation of the Hdm2-inhibitory complex is not a passive but a regulated event, whose potential role in tumor suppression has been recently noted. Copyright © 2013 The Authors. Published by Elsevier Inc. All rights reserved.

  13. Functional ribosome biogenesis is a prerequisite for p53 destabilization: impact of chemotherapy on nucleolar functions and RNA metabolism.

    Science.gov (United States)

    Burger, Kaspar; Eick, Dirk

    2013-09-01

    The production and processing of ribosomal RNA is a complex and well-coordinated nucleolar process for ribosome biogenesis. Progress in understanding nucleolar structure and function has lead to the unexpected discovery of the nucleolus as a highly sensitive sensor of cellular stress and an important regulator of the tumor suppressor p53. Inhibition of ribosomal RNA metabolism has been shown to activate a signaling pathway for p53 induction. This review elucidates the potential of classical and recently developed chemotherapeutic drugs to stabilize p53 by inhibiting nucleolar functions.

  14. A growth-dependent transcription initiation factor (TIF-IA) interacting with RNA polymerase I regulates mouse ribosomal RNA synthesis.

    Science.gov (United States)

    Schnapp, A; Pfleiderer, C; Rosenbauer, H; Grummt, I

    1990-09-01

    Control of mouse ribosomal RNA synthesis in response to extracellular signals is mediated by TIF-IA, a regulatory factor whose amount or activity correlates with cell proliferation. Factor TIF-IA interacts with RNA polymerase I (pol I), thus converting it into a transcriptionally active holoenzyme, which is able to initiate specifically at the rDNA promoter in the presence of the other auxiliary transcription initiation factors, designated TIF-IB, TIF-IC and UBF. With regard to several criteria, the growth-dependent factor TIF-IA behaves like a bacterial sigma factor: (i) it associates physically with pol I, (ii) it is required for initiation of transcription, (iii) it is present in limiting amounts and (iv) under certain salt conditions, it is chromatographically separable from the polymerase. In addition, evidence is presented that dephosphorylation of pol I abolishes in vitro transcription initiation from the ribosomal gene promoter without significantly affecting the polymerizing activity of the enzyme at nonspecific templates. The involvement of both a regulatory factor and post-translational modification of the transcribing enzyme provides an efficient and versatile mechanism of rDNA transcription regulation which enables the cell to adapt ribosome synthesis rapidly to a variety of extracellular signals.

  15. Decrease in Ribosomal RNA in Candida albicans Induced by Serum Exposure.

    Science.gov (United States)

    Fleischmann, Jacob; Rocha, Miguel A

    2015-01-01

    Candida albicans is an important polymorphic human pathogen. It can switch from a unicellular yeast form to germinating hypha, which may play a role in making it the successful pathogen it is. This hyphal transformation can be triggered by various extracellular stimuli, the most potent one being serum from any source. We have previously reported that Candida albicans transiently polyadenylates portions of both the large and small subunits of ribosomal RNA, shortly after serum exposure. Northern blots at the same time suggested that serum might induce a decrease in total ribosomal RNA. We have carried out a number of experiments to carefully assess this possibility and now report that serum significantly reduces ribosomal RNA in Candida albicans. Fluorometric measurements, Northern blotting and quantitative RT-PCR, have all confirmed this decrease. Timed experiments show that serum induces this decrease rapidly, as it was seen in as early as five minutes. Cell mass is not decreased as total cellular protein content remains the same and metabolic activity does not appear to slow, as assessed by XTT assay, and by the observation that cells form hyphal structures robustly. Another hyphal inducer, N-acetylglucosamine, also caused RNA decrease, but to a lesser extent. We also observed it in non-germinating yeast, such as Candida glabrata. The reason for this decrease is unknown and overall our data suggests that decrease in rRNA does not play a causal role in hyphal transformation. Rapid and significant decrease in a molecule so central to the yeast's biology is of some importance, and further studies, such as its effect on protein metabolism, will be required to better understand its purpose.

  16. The primordial sequence, ribosomes, and the genetic code.

    Science.gov (United States)

    Fox, S. W.; Yuki, A.; Waehneldt, T. V.; Lacey, J. C., Jr.

    1971-01-01

    Experimental investigation of the key question of the origin of life concerning the chronological order in the primordial sequence of nucleic acid, protein, and cell. It is pointed out that, when viewed against the background of experiments on the selective reaction of basic homopolyamine acids with mononucleotides (Lacey and Pruitt, 1969; Woese, 1968), the experiments made help to establish a basis for understanding how information originally flowed from proteins to nucleic acids.

  17. Complementary roles of initiation factor 1 and ribosome recycling factor in 70S ribosome splitting

    Science.gov (United States)

    Pavlov, Michael Y; Antoun, Ayman; Lovmar, Martin; Ehrenberg, Måns

    2008-01-01

    We demonstrate that ribosomes containing a messenger RNA (mRNA) with a strong Shine–Dalgarno sequence are rapidly split into subunits by initiation factors 1 (IF1) and 3 (IF3), but slowly split by ribosome recycling factor (RRF) and elongation factor G (EF-G). Post-termination-like (PTL) ribosomes containing mRNA and a P-site-bound deacylated transfer RNA (tRNA) are split very rapidly by RRF and EF-G, but extremely slowly by IF1 and IF3. Vacant ribosomes are split by RRF/EF-G much more slowly than PTL ribosomes and by IF1/IF3 much more slowly than mRNA-containing ribosomes. These observations reveal complementary splitting of different ribosomal complexes by IF1/IF3 and RRF/EF-G, and suggest the existence of two major pathways for ribosome splitting into subunits in the living cell. We show that the identity of the deacylated tRNA in the PTL ribosome strongly affects the rate by which it is split by RRF/EF-G and that IF3 is involved in the mechanism of ribosome splitting by IF1/IF3 but not by RRF/EF-G. With support from our experimental data, we discuss the principally different mechanisms of ribosome splitting by IF1/IF3 and by RRF/EF-G. PMID:18497739

  18. The major transcripts of the kinetoplast Trypanosoma brucei are very small ribosomal RNA's.

    NARCIS (Netherlands)

    I.C. Eperon; J.W.G. Janssen; J.H.J. Hoeijmakers (Jan); P. Borst (Piet)

    1983-01-01

    textabstractThe nucleotide sequence has been determined of a 2.2 kb segment of kinetoplast DNA, which encodes the major mitochondrial transcripts (12S and 9S) of Trypanosoma brucei. The sequence shows that the 12S RNA is a large subunit rRNA, although sufficiently unusual for resistance to chloramph

  19. Insights into the phylogenetic positions of photosynthetic bacteria obtained from 5S rRNA and 16S rRNA sequence data

    Science.gov (United States)

    Fox, G. E.

    1985-01-01

    Comparisons of complete 16S ribosomal ribonucleic acid (rRNA) sequences established that the secondary structure of these molecules is highly conserved. Earlier work with 5S rRNA secondary structure revealed that when structural conservation exists the alignment of sequences is straightforward. The constancy of structure implies minimal functional change. Under these conditions a uniform evolutionary rate can be expected so that conditions are favorable for phylogenetic tree construction.

  20. Global shape mimicry of tRNA within a viral internal ribosome entry site mediates translational reading frame selection.

    Science.gov (United States)

    Au, Hilda H; Cornilescu, Gabriel; Mouzakis, Kathryn D; Ren, Qian; Burke, Jordan E; Lee, Seonghoon; Butcher, Samuel E; Jan, Eric

    2015-11-24

    The dicistrovirus intergenic region internal ribosome entry site (IRES) adopts a triple-pseudoknotted RNA structure and occupies the core ribosomal E, P, and A sites to directly recruit the ribosome and initiate translation at a non-AUG codon. A subset of dicistrovirus IRESs directs translation in the 0 and +1 frames to produce the viral structural proteins and a +1 overlapping open reading frame called ORFx, respectively. Here we show that specific mutations of two unpaired adenosines located at the core of the three-helical junction of the honey bee dicistrovirus Israeli acute paralysis virus (IAPV) IRES PKI domain can uncouple 0 and +1 frame translation, suggesting that the structure adopts distinct conformations that contribute to 0 or +1 frame translation. Using a reconstituted translation system, we show that ribosomes assembled on mutant IRESs that direct exclusive 0 or +1 frame translation lack reading frame fidelity. Finally, a nuclear magnetic resonance/small-angle X-ray scattering hybrid approach reveals that the PKI domain of the IAPV IRES adopts an RNA structure that resembles a complete tRNA. The tRNA shape-mimicry enables the viral IRES to gain access to the ribosome tRNA-binding sites and form intermolecular contacts with the ribosome that are necessary for initiating IRES translation in a specific reading frame.

  1. 采用rDNA测序的方法鉴定1株祖菲无绿藻碳水化合物变种%Identification of a strain Prototheca zopfii var. hydrocarbonea by analyzing the sequence of ribosome RNA gene

    Institute of Scientific and Technical Information of China (English)

    刘素玲; 冉玉平; 何晓丹; 张东兴; 代亚玲

    2007-01-01

    A strain of Prototheca species isolated from a case of meningitis was identified by routine morphologic and biochemical methods as well as amplification of the related genes, in which the 28S large-subunit (LSU) region of ribosomal RNA (rRNA) gene and intergenic space (ITS) were amplified with universal fungal primers. The small-subunit (SSU) rRNA gene was amplified with eukaryote-specific primers and Prototheca genus-specific primers. Then, compared the sequences with the ones posted on BLAST (www. ncbi. nlm. nih. gov/BLAST). The organism choice giving the closest match, up to 99%, was considered the most likely correct identification. It was found that this strain of fungus grew well at 25 ℃ or 37 ℃. Smooth,moist colonies with white color were observed on Sabouraud Dextrose Agar (SDA) and Potato Dextrose Agar (PDA). Microscopically, globular or ovoid cells, a number of round, ovoid shaped endospores could be observed. No hypha, ascus or blastic conidia was found upon cultivation on SDA. Based on the morphological characteristics, this isolate could be identified as Prototheca species. The identity with Prototheca wickerhamii was 2.9 % as demonstrated by the API 20C AUX system. Sequence analysis showed that the ITS gene was proved to be a complex structural region which was not suitable for the identification of Prototheca species, but the LSU and SSU rDNA regions showed 94% and 99.9% sequence identities with Prototheca zopfii var. hydrocarbonea (P. zopfii var. hydrocarbonea) respectively, indicating that the SSU rRNA gene sequence might be more reliable on than the LSU rRNA gene sequence for identification of Prototheca species.%目的 鉴定1株由脑膜炎患者分离的无绿藻菌株.方法 常规的形态学、生化方法及扩增相关基因序列进行菌种鉴定.选用真菌通用引物扩增核糖RNA(rRNA)28S大亚基(LSU)、核糖体内转录间区(ITS)DNA;真核细胞特异性引物及无绿藻种属特异性引物扩增核糖体18S小亚基(SSU

  2. Identification of Trichosporon spp. Strains by Sequencing D1/D2 Region and Sub-typing by Sequencing Ribosomal Intergenic Spacer Region of Ribosomal DNA

    Institute of Scientific and Technical Information of China (English)

    Jingsi ZENG; Cristina Maria de Souza Motta; Kazutaka Fukushima; Kayoko Takizawa; Oliane Maria Correia Magalhes; Rejane Pereira Neves; Kazuko Nishimura

    2009-01-01

    To re-identify and further group 25 isolates of Trichosporon spp. identified morphologically previously, sequences of D1/D2 region of large subunit (LSU) of ribosomal DNA (rDNA) of 25 tested strains for identification and those of ribosomal intergenic space 1 (IGS1) region of 11 strains for sub-grouping were detected. The identifications of tested strains were changed except 6 strains. According to the alignment of the IGS1 region, 6 T. asahii isolates tested fell into 4 groups and 5 T. faecale isolates into 3 groups. Polymorphism of 2 T.japonicum isolates was found in 10 positions. With the alignments obtained in this research compared with the relative GenBank entries, it was found that T. asahii, T.faecale and T.japonicum species were divided into 7, 3 and 2 subtypes respectively. Morphological and biophysical methods are not sufficient for Trichosporon spp. identification. Sequencing becomes neces-sary for Trichosporon diagnosis. There is obvious diversity within a species.

  3. Phylogeny of the Zygomycota based on nuclear ribosomal sequence data.

    Science.gov (United States)

    White, Merlin M; James, Timothy Y; O'Donnell, Kerry; Cafaro, Matías J; Tanabe, Yuuhiko; Sugiyama, Junta

    2006-01-01

    The Zygomycota is an ecologically heterogenous assemblage of nonzoosporic fungi comprising two classes, Zygomycetes and Trichomycetes. Phylogenetic analyses have suggested that the phylum is polyphyletic; two of four orders of Trichomycetes are related to the Mesomycetozoa (protists) that diverged near the fungal/animal split. Current circumscription of the Zygomycota includes only orders with representatives that produce zygospores. We present a molecular-based phylogeny including recognized representatives of the Zygomycetes and Trichomycetes with a combined dataset for nuclear rRNA 18S (SSU), 5.8S and 28S (LSU) genes. Tree reconstruction by Bayesian analyses suggests the Zygomycota is paraphyletic. Although 12 clades were identified only some of these correspond to the nine orders of Zygomycota currently recognized. A large superordinal clade, comprising the Dimargaritales, Harpellales, Kickxellales and Zoopagales, grouping together many symbiotic fungi, also is identified in part by a unique septal structure. Although Harpellales and Kickxellales are not monophyletic, these lineages are distinct from the Mucorales, Endogonales and Mortierellales, which appear more closely related to the Ascomycota + Basidiomycota + Glomeromycota. The final major group, the insect-associated Entomophthorales, appears to be polyphyletic. In the present analyses Basidiobolus and Neozygites group within Zygomycota but not with the Entomophthorales. Clades are discussed with special reference to traditional classifications, mapping morphological characters and ecology, where possible, as a snapshot of our current phylogenetic perspective of the Zygomycota.

  4. Transcription of ribosomal RNA genes is initiated in the third cell cycle of bovine embryos

    DEFF Research Database (Denmark)

    Jakobsen, Anne Sørig; Avery, Birthe; Dieleman, Steph J.

    2006-01-01

    of the embryonic genome. In the present study, ribosomal RNA (rRNA) transcription was investigated by visualization of the rRNA by fluorescent in situ hybridization, and subsequent visualization of the argyrophilic nucleolar proteins by silver staining. A total of 145 in vivo developed and 200 in vitro produced...... bovine embryos were investigated to allow comparison of transcription initiation. Signs of active transcription of rRNA were observed in the third cell cycle in 29% of the in vitro produced embryos (n=35) and in 58% of the in vivo developed embryos (n=11). Signs of active transcription of rRNA were...... not apparent in the early phase of the fourth cell cycle but restarted later on. All embryos in the fifth or later cell cycles were all transcribing rRNA. The signs of rRNA synthesis during the third and fourth embryonic cell cycles could be blocked by actinomycin D, which is a strong inhibitor of RNA...

  5. Structures of human SRP72 complexes provide insights into SRP RNA remodeling and ribosome interaction

    Science.gov (United States)

    Becker, Matthias M. M.; Lapouge, Karine; Segnitz, Bernd; Wild, Klemens; Sinning, Irmgard

    2017-01-01

    Co-translational protein targeting and membrane protein insertion is a fundamental process and depends on the signal recognition particle (SRP). In mammals, SRP is composed of the SRP RNA crucial for SRP assembly and function and six proteins. The two largest proteins SRP68 and SRP72 form a heterodimer and bind to a regulatory site of the SRP RNA. Despite their essential roles in the SRP pathway, structural information has been available only for the SRP68 RNA-binding domain (RBD). Here we present the crystal structures of the SRP68 protein-binding domain (PBD) in complex with SRP72-PBD and of the SRP72-RBD bound to the SRP S domain (SRP RNA, SRP19 and SRP68) detailing all interactions of SRP72 within SRP. The SRP72-PBD is a tetratricopeptide repeat, which binds an extended linear motif of SRP68 with high affinity. The SRP72-RBD is a flexible peptide crawling along the 5e- and 5f-loops of SRP RNA. A conserved tryptophan inserts into the 5e-loop forming a novel type of RNA kink-turn stabilized by a potassium ion, which we define as K+-turn. In addition, SRP72-RBD remodels the 5f-loop involved in ribosome binding and visualizes SRP RNA plasticity. Docking of the S domain structure into cryo-electron microscopy density maps reveals multiple contact sites between SRP68/72 and the ribosome, and explains the role of SRP72 in the SRP pathway. PMID:27899666

  6. Polynucleotide phosphorylase hinders mRNA degradation upon ribosomal protein S1 overexpression in Escherichia coli.

    Science.gov (United States)

    Briani, Federica; Curti, Serena; Rossi, Francesca; Carzaniga, Thomas; Mauri, Pierluigi; Dehò, Gianni

    2008-11-01

    The exoribonuclease polynucleotide phosphorylase (PNPase, encoded by pnp) is a major player in bacterial RNA decay. In Escherichia coli, PNPase expression is post-transcriptionally regulated at the level of mRNA stability. The primary transcript is very efficiently processed by the endonuclease RNase III at a specific site and the processed pnp mRNA is rapidly degraded in a PNPase-dependent manner. While investigating the PNPase autoregulation mechanism we found, by UV-cross-linking experiments, that the ribosomal protein S1 in crude extracts binds to the pnp-mRNA leader region. We assayed the potential role of S1 protein in pnp gene regulation by modulating S1 expression from depletion to overexpression. We found that S1 depletion led to a sharp decrease of the amount of pnp and other tested mRNAs, as detected by Northern blotting, whereas S1 overexpression caused a strong stabilization of pnp and the other transcripts. Surprisingly, mRNA stabilization depended on PNPase, as it was not observed in a pnp deletion strain. PNPase-dependent stabilization, however, was not detected by chemical decay assay of bulk mRNA. Overall, our data suggest that PNPase exonucleolytic activity may be modulated by the translation potential of the target mRNAs and that, upon ribosomal protein S1 overexpression, PNPase protects from degradation a set of full-length mRNAs. It thus appears that a single mRNA species may be differentially targeted to either decay or PNPase-dependent stabilization, thus preventing its depletion in conditions of fast turnover.

  7. Highly purified spermatozoal RNA obtained by a novel method indicates an unusual 28S/18S rRNA ratio and suggests impaired ribosome assembly.

    Science.gov (United States)

    Cappallo-Obermann, Heike; Schulze, Wolfgang; Jastrow, Holger; Baukloh, Vera; Spiess, Andrej-Nikolai

    2011-11-01

    Human spermatozoal RNA features special characteristics such as a significantly reduced quantity within spermatozoa compared with somatic cells is described as being devoid of ribosomal RNAs and is difficult to isolate due to a massive excess of genomic DNA in the lysates. Using a novel two-round column-based protocol for human ejaculates delivering highly purified spermatozoal RNA, we uncovered a heterogeneous, but specific banding pattern in microelectrophoresis with 28S ribosomal RNA being indicative for the amount of round cell contamination. Ejaculates with different round cell quantities and density-purified spermatozoa revealed that 18S rRNA but not 28S rRNA is inherent to a pure spermatozoal fraction. Transmission electron microscopy showed monoribosomes and polyribosomes in spermatozoal cytoplasm, while immunohistochemical results suggest the presence of proteins from small and large ribosomal subunits in retained spermatozoal cytoplasm irrespective of 28S rRNA absence.

  8. PCR primers for metazoan nuclear 18S and 28S ribosomal DNA sequences.

    Directory of Open Access Journals (Sweden)

    Ryuji J Machida

    Full Text Available BACKGROUND: Metagenetic analyses, which amplify and sequence target marker DNA regions from environmental samples, are increasingly employed to assess the biodiversity of communities of small organisms. Using this approach, our understanding of microbial diversity has expanded greatly. In contrast, only a few studies using this approach to characterize metazoan diversity have been reported, despite the fact that many metazoan species are small and difficult to identify or are undescribed. One of the reasons for this discrepancy is the availability of universal primers for the target taxa. In microbial studies, analysis of the 16S ribosomal DNA is standard. In contrast, the best gene for metazoan metagenetics is less clear. In the present study, we have designed primers that amplify the nuclear 18S and 28S ribosomal DNA sequences of most metazoan species with the goal of providing effective approaches for metagenetic analyses of metazoan diversity in environmental samples, with a particular emphasis on marine biodiversity. METHODOLOGY/PRINCIPAL FINDINGS: Conserved regions suitable for designing PCR primers were identified using 14,503 and 1,072 metazoan sequences of the nuclear 18S and 28S rDNA regions, respectively. The sequence similarity of both these newly designed and the previously reported primers to the target regions of these primers were compared for each phylum to determine the expected amplification efficacy. The nucleotide diversity of the flanking regions of the primers was also estimated for genera or higher taxonomic groups of 11 phyla to determine the variable regions within the genes. CONCLUSIONS/SIGNIFICANCE: The identified nuclear ribosomal DNA primers (five primer pairs for 18S and eleven for 28S and the results of the nucleotide diversity analyses provide options for primer combinations for metazoan metagenetic analyses. Additionally, advantages and disadvantages of not only the 18S and 28S ribosomal DNA, but also other

  9. Streptomycin binds to the decoding center of 16 S ribosomal RNA.

    Science.gov (United States)

    Spickler, C; Brunelle, M N; Brakier-Gingras, L

    1997-10-31

    Streptomycin, an error-inducing aminoglycoside antibiotic, binds to a single site on the small ribosomal subunit of bacteria, but this site has not yet been defined precisely. Here, we demonstrate that streptomycin binds to E. coli 16 S rRNA in the absence of ribosomal proteins, and protects a set of bases in the decoding region against dimethyl sulfate attack. The binding studies were performed in a high ionic strength buffer containing 20 mM Mg2+. The pattern of protection in the decoding region was similar to that observed when streptomycin binds to the 30 S subunit. However, streptomycin also protects the 915 region of 16 S rRNA within the 30 S subunit, whereas it did not protect the 915 region of the naked 16 S rRNA. The interaction of streptomycin with 16 S rRNA was further defined by using two fragments that correspond to the 3' minor domain of 16 S rRNA and to the decoding analog, a portion of this domain encompassing the decoding center. In the presence of streptomycin, the pattern of protection against dimethyl sulfate attack for the two fragments was similar to that seen with the full-length 16 S rRNA. This indicates that the 3' minor domain as well as the decoding analog contain the recognition signals for the binding of streptomycin. However, streptomycin could not bind to the decoding analog in the absence of Mg2+. This contrasts with neomycin, another error-inducing aminoglycoside antibiotic, that binds to the decoding analog in the absence of Mg2+, but not at 20 mM Mg2+. Our results suggest that both neomycin and streptomycin interact with the decoding center, but recognize alternative conformations of this region.

  10. Mapping posttranscriptional modifications in 5S ribosomal RNA by MALDI mass spectrometry

    DEFF Research Database (Denmark)

    Kirpekar, F; Douthwaite, S; Roepstorff, P

    2000-01-01

    RNases in parallel combined with further fragmentation by Post Source Decay (PSD). This approach allows fast and sensitive screening of a purified RNA for posttranscriptional modification, and has been applied on 5S rRNA from two thermophilic microorganisms, the bacterium Bacillus stearothermophilus...... that is clearly conserved with respect to both sequence and position in B. stearothermophilus and H. halobium and to some degree also in H. marismortui. However, no analogous modification was identified in the latter three organisms. We further find that the 5' end of H. halobium 5S rRNA is dephosphorylated......, in contrast to the other 5S rRNA species investigated. The method additionally gives an immediate indication of whether the expected RNA sequence is in agreement with the observed fragment masses. Discrepancies with two of the published 5S rRNA sequences were identified and are reported here....

  11. Alternative applications for distinct RNA sequencing strategies

    Science.gov (United States)

    Han, Leng; Vickers, Kasey C.; Samuels, David C.

    2015-01-01

    Recent advances in RNA library preparation methods, platform accessibility and cost efficiency have allowed high-throughput RNA sequencing (RNAseq) to replace conventional hybridization microarray platforms as the method of choice for mRNA profiling and transcriptome analyses. RNAseq is a powerful technique to profile both long and short RNA expression, and the depth of information gained from distinct RNAseq methods is striking and facilitates discovery. In addition to expression analysis, distinct RNAseq approaches also allow investigators the ability to assess transcriptional elongation, DNA variance and exogenous RNA content. Here we review the current state of the art in transcriptome sequencing and address epigenetic regulation, quantification of transcription activation, RNAseq output and a diverse set of applications for RNAseq data. We detail how RNAseq can be used to identify allele-specific expression, single-nucleotide polymorphisms and somatic mutations and discuss the benefits and limitations of using RNAseq to monitor DNA characteristics. Moreover, we highlight the power of combining RNA- and DNAseq methods for genomic analysis. In summary, RNAseq provides the opportunity to gain greater insight into transcriptional regulation and output than simply miRNA and mRNA profiling. PMID:25246237

  12. An approach to analyse the specific impact of rapamycin on mRNA-ribosome association

    Directory of Open Access Journals (Sweden)

    Jaquier-Gubler Pascale

    2008-08-01

    Full Text Available Abstract Background Recent work, using both cell culture model systems and tumour derived cell lines, suggests that the differential recruitment into polysomes of mRNA populations may be sufficient to initiate and maintain tumour formation. Consequently, a major effort is underway to use high density microarray profiles to establish molecular fingerprints for cells exposed to defined drug regimes. The aim of these pharmacogenomic approaches is to provide new information on how drugs can impact on the translational read-out within a defined cellular background. Methods We describe an approach that permits the analysis of de-novo mRNA-ribosome association in-vivo during short drug exposures. It combines hypertonic shock, polysome fractionation and high-throughput analysis to provide a molecular phenotype of translationally responsive transcripts. Compared to previous translational profiling studies, the procedure offers increased specificity due to the elimination of the drugs secondary effects (e.g. on the transcriptional read-out. For this pilot "proof-of-principle" assay we selected the drug rapamycin because of its extensively studied impact on translation initiation. Results High throughput analysis on both the light and heavy polysomal fractions has identified mRNAs whose re-recruitment onto free ribosomes responded to short exposure to the drug rapamycin. The results of the microarray have been confirmed using real-time RT-PCR. The selective down-regulation of TOP transcripts is also consistent with previous translational profiling studies using this drug. Conclusion The technical advance outlined in this manuscript offers the possibility of new insights into mRNA features that impact on translation initiation and provides a molecular fingerprint for transcript-ribosome association in any cell type and in the presence of a range of drugs of interest. Such molecular phenotypes defined pre-clinically may ultimately impact on the evaluation of

  13. Complete nuclear ribosomal DNA sequence amplification and molecular analyses of Bangia (Bangiales, Rhodophyta) from China

    Science.gov (United States)

    Xu, Jiajie; Jiang, Bo; Chai, Sanming; He, Yuan; Zhu, Jianyi; Shen, Zonggen; Shen, Songdong

    2016-09-01

    Filamentous Bangia, which are distributed extensively throughout the world, have simple and similar morphological characteristics. Scientists can classify these organisms using molecular markers in combination with morphology. We successfully sequenced the complete nuclear ribosomal DNA, approximately 13 kb in length, from a marine Bangia population. We further analyzed the small subunit ribosomal DNA gene (nrSSU) and the internal transcribed spacer (ITS) sequence regions along with nine other marine, and two freshwater Bangia samples from China. Pairwise distances of the nrSSU and 5.8S ribosomal DNA gene sequences show the marine samples grouping together with low divergences (00.003; 0-0.006, respectively) from each other, but high divergences (0.123-0.126; 0.198, respectively) from freshwater samples. An exception is the marine sample collected from Weihai, which shows high divergence from both other marine samples (0.063-0.065; 0.129, respectively) and the freshwater samples (0.097; 0.120, respectively). A maximum likelihood phylogenetic tree based on a combined SSU-ITS dataset with maximum likelihood method shows the samples divided into three clades, with the two marine sample clades containing Bangia spp. from North America, Europe, Asia, and Australia; and one freshwater clade, containing Bangia atropurpurea from North America and China.

  14. International interlaboratory study comparing single organism 16S rRNA gene sequencing data: Beyond consensus sequence comparisons.

    Science.gov (United States)

    Olson, Nathan D; Lund, Steven P; Zook, Justin M; Rojas-Cornejo, Fabiola; Beck, Brian; Foy, Carole; Huggett, Jim; Whale, Alexandra S; Sui, Zhiwei; Baoutina, Anna; Dobeson, Michael; Partis, Lina; Morrow, Jayne B

    2015-03-01

    This study presents the results from an interlaboratory sequencing study for which we developed a novel high-resolution method for comparing data from different sequencing platforms for a multi-copy, paralogous gene. The combination of PCR amplification and 16S ribosomal RNA gene (16S rRNA) sequencing has revolutionized bacteriology by enabling rapid identification, frequently without the need for culture. To assess variability between laboratories in sequencing 16S rRNA, six laboratories sequenced the gene encoding the 16S rRNA from Escherichia coli O157:H7 strain EDL933 and Listeria monocytogenes serovar 4b strain NCTC11994. Participants performed sequencing methods and protocols available in their laboratories: Sanger sequencing, Roche 454 pyrosequencing(®), or Ion Torrent PGM(®). The sequencing data were evaluated on three levels: (1) identity of biologically conserved position, (2) ratio of 16S rRNA gene copies featuring identified variants, and (3) the collection of variant combinations in a set of 16S rRNA gene copies. The same set of biologically conserved positions was identified for each sequencing method. Analytical methods using Bayesian and maximum likelihood statistics were developed to estimate variant copy ratios, which describe the ratio of nucleotides at each identified biologically variable position, as well as the likely set of variant combinations present in 16S rRNA gene copies. Our results indicate that estimated variant copy ratios at biologically variable positions were only reproducible for high throughput sequencing methods. Furthermore, the likely variant combination set was only reproducible with increased sequencing depth and longer read lengths. We also demonstrate novel methods for evaluating variable positions when comparing multi-copy gene sequence data from multiple laboratories generated using multiple sequencing technologies.

  15. Evolutionary dynamics of a conserved sequence motif in the ribosomal genes of the ciliate Paramecium

    Directory of Open Access Journals (Sweden)

    Lynch Michael

    2010-05-01

    Full Text Available Abstract Background In protozoa, the identification of preserved motifs by comparative genomics is often impeded by difficulties to generate reliable alignments for non-coding sequences. Moreover, the evolutionary dynamics of regulatory elements in 3' untranslated regions (both in protozoa and metazoa remains a virtually unexplored issue. Results By screening Paramecium tetraurelia's 3' untranslated regions for 8-mers that were previously found to be preserved in mammalian 3' UTRs, we detect and characterize a motif that is distinctly conserved in the ribosomal genes of this ciliate. The motif appears to be conserved across Paramecium aurelia species but is absent from the ribosomal genes of four additional non-Paramecium species surveyed, including another ciliate, Tetrahymena thermophila. Motif-free ribosomal genes retain fewer paralogs in the genome and appear to be lost more rapidly relative to motif-containing genes. Features associated with the discovered preserved motif are consistent with this 8-mer playing a role in post-transcriptional regulation. Conclusions Our observations 1 shed light on the evolution of a putative regulatory motif across large phylogenetic distances; 2 are expected to facilitate the understanding of the modulation of ribosomal genes expression in Paramecium; and 3 reveal a largely unexplored--and presumably not restricted to Paramecium--association between the presence/absence of a DNA motif and the evolutionary fate of its host genes.

  16. Nucleotide sequence of the SrRNA gene and phylogenetic analysis of Trichomonas tenax.

    Science.gov (United States)

    Fukura, K; Yamamoto, A; Hashimoto, T; Goto, N

    1996-01-01

    The small subunit ribosomal RNA (SrRNA) gene of Trichomonas tenax ATCC30207 was amplified by PCR and the 1.55-kb product was cloned into plasmid vector pUC18. Four clones were isolated and sequenced. The insert DNAs were 1,552 bp long and their G+C contents were 48.1%; three of them had exactly the same DNA sequences and one had only one nucleotide change. A representative SrRNA sequence was analyzed and a phylogenetic tree was estimated by the neighbor-joining (NJ) method. Among the protists examined, T. tenax was placed as the closest relative of Tritrichomonas foetus, as expected from the traditional taxonomy. The total homology between the two SrRNA sequences was 89.2%.

  17. Antibiotic resistance evolved via inactivation of a ribosomal RNA methylating enzyme

    Science.gov (United States)

    Stojković, Vanja; Noda-Garcia, Lianet; Tawfik, Dan S.; Fujimori, Danica Galonić

    2016-01-01

    Modifications of the bacterial ribosome regulate the function of the ribosome and modulate its susceptibility to antibiotics. By modifying a highly conserved adenosine A2503 in 23S rRNA, methylating enzyme Cfr confers resistance to a range of ribosome-targeting antibiotics. The same adenosine is also methylated by RlmN, an enzyme widely distributed among bacteria. While RlmN modifies C2, Cfr modifies the C8 position of A2503. Shared nucleotide substrate and phylogenetic relationship between RlmN and Cfr prompted us to investigate evolutionary origin of antibiotic resistance in this enzyme family. Using directed evolution of RlmN under antibiotic selection, we obtained RlmN variants that mediate low-level resistance. Surprisingly, these variants confer resistance not through the Cfr-like C8 methylation, but via inhibition of the endogenous RlmN C2 methylation of A2503. Detection of RlmN inactivating mutations in clinical resistance isolates suggests that the mechanism used by the in vitro evolved variants is also relevant in a clinical setting. Additionally, as indicated by a phylogenetic analysis, it appears that Cfr did not diverge from the RlmN family but from another distinct family of predicted radical SAM methylating enzymes whose function remains unknown. PMID:27496281

  18. Nonstop mRNA Decay: a Special Attribute of Trans-Translation Mediated Ribosome Rescue

    Directory of Open Access Journals (Sweden)

    Krithika eVenkataraman

    2014-03-01

    Full Text Available Decoding of aberrant mRNAs leads to unproductive ribosome stalling and sequestration of components of the translation machinery. Bacteria have evolved three seemingly independent pathways to resolve stalled translation complexes. The trans-translation process, orchestrated by the hybrid transfer-messenger RNA (tmRNA and its essential protein co-factor, SmpB, is the principal translation quality control system for rescuing unproductively stalled ribosomes. Two specialized alternative rescue pathways, coordinated by ArfA and ArfB, have been recently discovered. The SmpB-tmRNA mediated trans-translation pathway, in addition to re-mobilizing stalled translation complexes, co-translationally appends a degradation tag to the associated nascent polypeptides, marking them for proteolysis by various cellular proteases. Another unique feature of trans-translation, not shared by the alternative rescue pathways, is the facility to recruit RNase R for targeted degradation of nonstop mRNAs, thus preventing further futile cycles of translation. The distinct C-terminal lysine-rich (K-rich domain of RNase R is essential for its recruitment to stalled ribosomes. To gain new insights into the structure and function of RNase R, we investigated its global architecture, the spatial arrangement of its distinct domains, and the identities of key functional residues in its unique K-rich domain. Small-angle X-ray scattering (SAXS models of RNase R reveal a tri-lobed structure with flexible N- and C-terminal domains, and suggest intimate contacts between the K-rich domain and the catalytic core of the enzyme. Alanine-scanning mutagenesis of the K-rich domain, in the region spanning residues 735 and 750, has uncovered the precise amino acid determinants required for the productive engagement of RNase R on tmRNA-rescued ribosomes. Theses analyses demonstrate that alanine substitution of conserved residues E740 and K741 result in profound defects, not only in the recruitment

  19. Structural arrangement of tRNA binding sites on Escherichia coli ribosomes, as revealed from data on affinity labelling with photoactivatable tRNA derivatives.

    Science.gov (United States)

    Graifer, D M; Babkina, G T; Matasova, N B; Vladimirov, S N; Karpova, G G; Vlassov, V V

    1989-07-01

    A systematic study of protein environment of tRNA in ribosomes in model complexes representing different translation steps was carried out using the affinity labelling of the ribosomes with tRNA derivatives bearing aryl azide groups scattered statistically over tRNA guanine residues. Analysis of the proteins crosslinked to tRNA derivatives showed that the location of the derivatives in the aminoacyl (A) site led to the labelling of the proteins S5 and S7 in all complexes studied, whereas the labelling of the proteins S2, S8, S9, S11, S14, S16, S17, S18, S19, S21 as well as L9, L11, L14, L15, L21, L23, L24, L29 depended on the state of tRNA in A site. Similarly, the location of tRNA derivatives in the peptidyl (P) site resulted in the labelling of the proteins L27, S11, S13 and S19 in all states, whereas the labelling of the proteins S5, S7, S9, S12, S14, S20, S21 as well as L2, L13, L14, L17, L24, L27, L31, L32, L33 depended on the type of complex. The derivatives of tRNA(fMet) were found to crosslink to S1, S3, S5, S7, S9, S14 and L1, L2, L7/L12, L27. Based on the data obtained, a general principle of the dynamic functioning of ribosomes has been proposed: (i) the formation of each type of ribosomal complex is accompanied by changes in mutual arrangement of proteins - 'conformational adjustment' of the ribosome - and (ii) a ribosome can dynamically change its internal structure at each step of initiation and elongation; on the 70 S ribosome there are no rigidly fixed structures forming tRNA-binding sites (primarily A and P sites).

  20. Equally parsimonious pathways through an RNA sequence space are not equally likely

    Science.gov (United States)

    Lee, Y. H.; DSouza, L. M.; Fox, G. E.

    1997-01-01

    An experimental system for determining the potential ability of sequences resembling 5S ribosomal RNA (rRNA) to perform as functional 5S rRNAs in vivo in the Escherichia coli cellular environment was devised previously. Presumably, the only 5S rRNA sequences that would have been fixed by ancestral populations are ones that were functionally valid, and hence the actual historical paths taken through RNA sequence space during 5S rRNA evolution would have most likely utilized valid sequences. Herein, we examine the potential validity of all sequence intermediates along alternative equally parsimonious trajectories through RNA sequence space which connect two pairs of sequences that had previously been shown to behave as valid 5S rRNAs in E. coli. The first trajectory requires a total of four changes. The 14 sequence intermediates provide 24 apparently equally parsimonious paths by which the transition could occur. The second trajectory involves three changes, six intermediate sequences, and six potentially equally parsimonious paths. In total, only eight of the 20 sequence intermediates were found to be clearly invalid. As a consequence of the position of these invalid intermediates in the sequence space, seven of the 30 possible paths consisted of exclusively valid sequences. In several cases, the apparent validity/invalidity of the intermediate sequences could not be anticipated on the basis of current knowledge of the 5S rRNA structure. This suggests that the interdependencies in RNA sequence space may be more complex than currently appreciated. If ancestral sequences predicted by parsimony are to be regarded as actual historical sequences, then the present results would suggest that they should also satisfy a validity requirement and that, in at least limited cases, this conjecture can be tested experimentally.

  1. Prevalent ciliate symbiosis on copepods: high genetic diversity and wide distribution detected using small subunit ribosomal RNA gene.

    Science.gov (United States)

    Guo, Zhiling; Liu, Sheng; Hu, Simin; Li, Tao; Huang, Yousong; Liu, Guangxing; Zhang, Huan; Lin, Senjie

    2012-01-01

    Toward understanding the genetic diversity and distribution of copepod-associated symbiotic ciliates and the evolutionary relationships with their hosts in the marine environment, we developed a small subunit ribosomal RNA gene (18S rDNA)-based molecular method and investigated the genetic diversity and genotype distribution of the symbiotic ciliates on copepods. Of the 10 copepod species representing six families collected from six locations of Pacific and Atlantic Oceans, 9 were found to harbor ciliate symbionts. Phylogenetic analysis of the 391 ciliate 18S rDNA sequences obtained revealed seven groups (ribogroups), six (containing 99% of all the sequences) belonging to subclass Apostomatida, the other clustered with peritrich ciliate Vorticella gracilis. Among the Apostomatida groups, Group III were essentially identical to Vampyrophrya pelagica, and the other five groups represented the undocumented ciliates that were close to Vampyrophrya/Gymnodinioides/Hyalophysa. Group VI ciliates were found in all copepod species but one (Calanus sinicus), and were most abundant among all ciliate sequences obtained, indicating that they are the dominant symbiotic ciliates universally associated with copepods. In contrast, some ciliate sequences were found only in some of the copepods examined, suggesting the host selectivity and geographic differentiation of ciliates, which requires further verification by more extensive sampling. Our results reveal the wide occurrence and high genetic diversity of symbiotic ciliates on marine copepods and highlight the need to systematically investigate the host- and geography-based genetic differentiation and ecological roles of these ciliates globally.

  2. Prevalent ciliate symbiosis on copepods: high genetic diversity and wide distribution detected using small subunit ribosomal RNA gene.

    Directory of Open Access Journals (Sweden)

    Zhiling Guo

    Full Text Available Toward understanding the genetic diversity and distribution of copepod-associated symbiotic ciliates and the evolutionary relationships with their hosts in the marine environment, we developed a small subunit ribosomal RNA gene (18S rDNA-based molecular method and investigated the genetic diversity and genotype distribution of the symbiotic ciliates on copepods. Of the 10 copepod species representing six families collected from six locations of Pacific and Atlantic Oceans, 9 were found to harbor ciliate symbionts. Phylogenetic analysis of the 391 ciliate 18S rDNA sequences obtained revealed seven groups (ribogroups, six (containing 99% of all the sequences belonging to subclass Apostomatida, the other clustered with peritrich ciliate Vorticella gracilis. Among the Apostomatida groups, Group III were essentially identical to Vampyrophrya pelagica, and the other five groups represented the undocumented ciliates that were close to Vampyrophrya/Gymnodinioides/Hyalophysa. Group VI ciliates were found in all copepod species but one (Calanus sinicus, and were most abundant among all ciliate sequences obtained, indicating that they are the dominant symbiotic ciliates universally associated with copepods. In contrast, some ciliate sequences were found only in some of the copepods examined, suggesting the host selectivity and geographic differentiation of ciliates, which requires further verification by more extensive sampling. Our results reveal the wide occurrence and high genetic diversity of symbiotic ciliates on marine copepods and highlight the need to systematically investigate the host- and geography-based genetic differentiation and ecological roles of these ciliates globally.

  3. 5S ribosomal RNA genes in six species of Mediterranean grey mullets: genomic organization and phylogenetic inference.

    Science.gov (United States)

    Gornung, Ekaterina; Colangelo, Paolo; Annesi, Flavia

    2007-09-01

    This paper describes a study of the 5S ribosomal RNA genes (5S rDNA) in a group of 6 species belonging to 4 genera of Mugilidae. In these 6 species, the relatively short 5S rDNA repeat units, generated by PCR and ranging in size from 219 to 257 bp, show a high level of intragenomic homogeneity of both coding and spacer regions (NTS-I). Phylogenetic reconstructions based on this data set highlight the greater phylogenetic and genetic diversity of Mugil cephalus and Oedalechilus labeo compared with the genera Liza and Chelon. Comparative sequence analysis revealed significant conservation of the short 5S rDNA repeat units across Chelon and Liza. Moreover, a second size class of 5S rDNA repeat units, ranging from roughly 800 to 1100 bp, was produced in the Liza and Chelon samples. Only short 5S rDNA repeat units were found in M. cephalus and O. labeo. The sequences of the long 5S rDNA repeat units, obtained in Chelon labrosus and Liza ramada, differ owing to the presence of 2 large insertion/deletions (indels) in the spacers (NTS-II) and show considerable sequence identity with NTS-I spacers. Interspecific sequence variation of NTS-II spacers, excluding the indels, is low. Southern-blot hybridization patterns suggest an intermixed arrangement of short and long repeat units within a single chromosome locus.

  4. Phylogenetic analysis of subgenus vigna species using nuclear ribosomal RNA ITS: evidence of hybridization among Vigna unguiculata subspecies.

    Science.gov (United States)

    Vijaykumar, Archana; Saini, Ajay; Jawali, Narendra

    2010-01-01

    Molecular phylogeny among species belonging to subgenus Vigna (genus Vigna) was inferred based on internal transcribed spacer (ITS) sequences of 18S-5.8S-26S ribosomal RNA gene unit. Analysis showed a total of 356 polymorphic sites of which approximately 80% were parsimony informative. Phylogenetic reconstruction by neighbor joining and maximum parsimony methods placed the 57 Vigna accessions (belonging to 15 species) into 5 major clades. Five species viz. Vigna heterophylla, Vigna pubigera, Vigna parkeri, Vigna laurentii, and Vigna gracilis whose position in the subgenus was previously not known were placed in the section Vigna. A single accession (Vigna unguiculata ssp. tenuis, NI 1637) harbored 2 intragenomic ITS variants, indicative of 2 different types of ribosomal DNA (rDNA) repeat units. ITS variant type-I was close to ITS from V. unguiculata ssp. pubescens, whereas type-II was close to V. unguiculata ssp. tenuis. Transcript analysis clearly demonstrates that in accession NI 1637, rDNA repeat units with only type-II ITS variants are transcriptionally active. Evidence from sequence analysis (of 5.8S, ITS1, and ITS2) and secondary structure analysis (of ITS1 and ITS2) indicates that the type-I ITS variant probably does not belong to the pseudogenic rDNA repeat units. The results from phylogenetic and transcript analysis suggest that the rDNA units with the type-I ITS may have introgressed as a result of hybridization (between ssp. tenuis and ssp. pubescens); however, it has been epigenetically silenced. The results also demonstrate differential evolution of ITS sequence among wild and cultivated forms of V. unguiculata.

  5. Diversifying microRNA sequence and function.

    Science.gov (United States)

    Ameres, Stefan L; Zamore, Phillip D

    2013-08-01

    MicroRNAs (miRNAs) regulate the expression of most genes in animals, but we are only now beginning to understand how they are generated, assembled into functional complexes and destroyed. Various mechanisms have now been identified that regulate miRNA stability and that diversify miRNA sequences to create distinct isoforms. The production of different isoforms of individual miRNAs in specific cells and tissues may have broader implications for miRNA-mediated gene expression control. Rigorously testing the many discrepant models for how miRNAs function using quantitative biochemical measurements made in vivo and in vitro remains a major challenge for the future.

  6. Studies on the control of ribosomal RNA synthesis in HeLa cells.

    Science.gov (United States)

    Chesterton, C J; Coupar, B E; Butterworth, P H; Green, M H

    1975-09-01

    In many eucaryotic systems protein synthesis is coupled to ribosomal RNA synthesis such that shut-down of the former causes inhibition of the latter. We have investigated this stringency phenomenon in HeLa cells. The protein synthesis inhibitors cycloheximide and puromycin cause inactivation of both processes but valine starvation totally inhibits only the processing of 45-S RNA. DNA-dependent RNA polymerases from A, B and C (or I, II and III respectively) were extracted, separated partially by DEAE-cellulose chromatography and their activity levels determined. These do not decrease significantly during inhibition of protein synthesis. To find out whether or not form A is bound to its template under these conditions, proteins were removed from chromatin with the detergent sarkosyl. This does not affect bound RNA polymerase. Inhibition of protein synthesis caused up to 50% reduction in endogenous alpha-amanitin-insensitive chromatin-RNA-synthesising activity. This reduced level of activity was not affected by sarkosyl treatment. Levels in normal cells were stimulated. This result indicates that the form A RNA polymerase is not bound to its template when protein synthesis is inhibited.

  7. Effects of ethidium bromide on the production of ribosomal RNA in cultured mouse cells.

    Science.gov (United States)

    Lange, M; May, P

    1979-06-25

    A treatment of primary mouse kidney cell cultures with 5 microM Ethidium Bromide (Eth Br) reduces the transcription of nuclear-coded genes and especially of ribosomal RNA genes. This effect was consistently observed when comparing drug-treated and control cells for (i), the incorporation of 3H uridine into total nuclear and B RNA polymerases as determined in isolated nuclei. It became more pronounced with exposure time; however, after removal of the drug, there was a progressive recovery of RNA synthesis culminating in the complete reversal of the drug effect. That this effect is probably not due only to the suppression of mitochondrial protein synthesis by the drug, is shown by a comparative study of the effects of chloramphenicol treatment. In addition, in the cytoplasm Eth Br depresses the labeling of 28 S rRNA more than that of 18 S whereas no abnormal accumulation of 28 S rRNA is observed in the nucleus. It is suggested that Eth Br may affect either the stability of the 28 S rRNA or its rate of formation from the 32 S precursor.

  8. Enhanced methods for unbiased deep sequencing of Lassa and Ebola RNA viruses from clinical and biological samples.

    Science.gov (United States)

    Matranga, Christian B; Andersen, Kristian G; Winnicki, Sarah; Busby, Michele; Gladden, Adrianne D; Tewhey, Ryan; Stremlau, Matthew; Berlin, Aaron; Gire, Stephen K; England, Eleina; Moses, Lina M; Mikkelsen, Tarjei S; Odia, Ikponmwonsa; Ehiane, Philomena E; Folarin, Onikepe; Goba, Augustine; Kahn, S Humarr; Grant, Donald S; Honko, Anna; Hensley, Lisa; Happi, Christian; Garry, Robert F; Malboeuf, Christine M; Birren, Bruce W; Gnirke, Andreas; Levin, Joshua Z; Sabeti, Pardis C

    2014-01-01

    We have developed a robust RNA sequencing method for generating complete de novo assemblies with intra-host variant calls of Lassa and Ebola virus genomes in clinical and biological samples. Our method uses targeted RNase H-based digestion to remove contaminating poly(rA) carrier and ribosomal RNA. This depletion step improves both the quality of data and quantity of informative reads in unbiased total RNA sequencing libraries. We have also developed a hybrid-selection protocol to further enrich the viral content of sequencing libraries. These protocols have enabled rapid deep sequencing of both Lassa and Ebola virus and are broadly applicable to other viral genomics studies.

  9. The functional half-life of an mRNA depends on the ribosome spacing in an early coding region

    DEFF Research Database (Denmark)

    Pedersen, Margit; Nissen, Søren; Mitarai, Namiko

    2011-01-01

    supported the model. We thus suggest that translation-rate-mediated differences in the spacing between ribosomes in this early coding region is a parameter that determines the mRNAs functional half-life. We present a model that is in accordance with many earlier observations and that allows a prediction...... codons. When comparing the ribosome spacing at various segments of the mRNA to its functional half-life, we found a clear correlation between the functional mRNA half-life and the ribosome spacing in the mRNA region approximately between codon 20 and codon 45. From this finding, we predicted that inserts......Bacterial mRNAs are translated by closely spaced ribosomes and degraded from the 5'-end, with half-lives of around 2 min at 37 °C in most cases. Ribosome-free or "naked" mRNA is known to be readily degraded, but the initial event that inactivates the mRNA functionally has not been fully described...

  10. Predicted class-I aminoacyl tRNA synthetase-like proteins in non-ribosomal peptide synthesis

    Directory of Open Access Journals (Sweden)

    Iyer Lakshminarayan M

    2010-08-01

    Full Text Available Abstract Background Recent studies point to a great diversity of non-ribosomal peptide synthesis systems with major roles in amino acid and co-factor biosynthesis, secondary metabolism, and post-translational modifications of proteins by peptide tags. The least studied of these systems are those utilizing tRNAs or aminoacyl-tRNA synthetases (AAtRS in non-ribosomal peptide ligation. Results Here we describe novel examples of AAtRS related proteins that are likely to be involved in the synthesis of widely distributed peptide-derived metabolites. Using sensitive sequence profile methods we show that the cyclodipeptide synthases (CDPSs are members of the HUP class of Rossmannoid domains and are likely to be highly derived versions of the class-I AAtRS catalytic domains. We also identify the first eukaryotic CDPSs in fungi and in animals; they might be involved in immune response in the latter organisms. We also identify a paralogous version of the methionyl-tRNA synthetase, which is widespread in bacteria, and present evidence using contextual information that it might function independently of protein synthesis as a peptide ligase in the formation of a peptide- derived secondary metabolite. This metabolite is likely to be heavily modified through multiple reactions catalyzed by a metal-binding cupin domain and a lysine N6 monooxygenase that are strictly associated with this paralogous methionyl-tRNA synthetase (MtRS. We further identify an analogous system wherein the MtRS has been replaced by more typical peptide ligases with the ATP-grasp or modular condensation-domains. Conclusions The prevalence of these predicted biosynthetic pathways in phylogenetically distant, pathogenic or symbiotic bacteria suggests that metabolites synthesized by them might participate in interactions with the host. More generally, these findings point to a complete spectrum of recruitment of AAtRS to various non-ribosomal biosynthetic pathways, ranging from the

  11. R3D-2-MSA: the RNA 3D structure-to-multiple sequence alignment server.

    Science.gov (United States)

    Cannone, Jamie J; Sweeney, Blake A; Petrov, Anton I; Gutell, Robin R; Zirbel, Craig L; Leontis, Neocles

    2015-07-01

    The RNA 3D Structure-to-Multiple Sequence Alignment Server (R3D-2-MSA) is a new web service that seamlessly links RNA three-dimensional (3D) structures to high-quality RNA multiple sequence alignments (MSAs) from diverse biological sources. In this first release, R3D-2-MSA provides manual and programmatic access to curated, representative ribosomal RNA sequence alignments from bacterial, archaeal, eukaryal and organellar ribosomes, using nucleotide numbers from representative atomic-resolution 3D structures. A web-based front end is available for manual entry and an Application Program Interface for programmatic access. Users can specify up to five ranges of nucleotides and 50 nucleotide positions per range. The R3D-2-MSA server maps these ranges to the appropriate columns of the corresponding MSA and returns the contents of the columns, either for display in a web browser or in JSON format for subsequent programmatic use. The browser output page provides a 3D interactive display of the query, a full list of sequence variants with taxonomic information and a statistical summary of distinct sequence variants found. The output can be filtered and sorted in the browser. Previous user queries can be viewed at any time by resubmitting the output URL, which encodes the search and re-generates the results. The service is freely available with no login requirement at http://rna.bgsu.edu/r3d-2-msa.

  12. Synergistic Internal Ribosome Entry Site/MicroRNA-Based Approach for Flavivirus Attenuation and Live Vaccine Development

    Directory of Open Access Journals (Sweden)

    Konstantin A. Tsetsarkin

    2017-04-01

    Full Text Available The recent emergence of Zika virus underscores the need for new strategies for a rapid development of safe flavivirus vaccines. Using another flavivirus (Langat virus [LGTV] that belongs to the group of tick-borne flaviviruses as a model, we describe a dual strategy for virus attenuation which synergistically accesses the specificity of microRNA (miRNA genome targeting and the effectiveness of internal ribosome entry site (IRES insertion. To increase the stability and immunogenicity of bicistronic LGTVs, we developed a novel approach in which the capsid (C protein gene was relocated into the 3′ noncoding region (NCR and expressed under translational control from an IRES. Engineered bicistronic LGTVs carrying multiple target sequences for brain-specific miRNAs were stable in Vero cells and induced adaptive immunity in mice. Importantly, miRNA-targeted bicistronic LGTVs were not pathogenic for either newborn mice after intracranial inoculation or adult immunocompromised mice (SCID or type I interferon receptor knockout after intraperitoneal injection. Moreover, bicistronic LGTVs were restricted for replication in tick-derived cells, suggesting an interruption of viral transmission in nature by arthropod vectors. This approach is suitable for reliable attenuation of many flaviviruses and may enable development of live attenuated flavivirus vaccines.

  13. [Study of the photoaffinity modification of Escherichia coli ribosomes near the donor tRNA-binding center].

    Science.gov (United States)

    Bausk, E V; Graĭfer, D M; Karpova, G G

    1985-01-01

    Affinity labelling of E. coli ribosomes near the donor tRNA-binding (P) site was studied with the use of photoreactive derivatives of tRNAPhe bearing arylazidogroups on N7 atoms of guanine residues (azido-tRNA). UV-irradiation of complexes 70S ribosome.poly(U).azido- tRNA(P-site) and 70S ribosome.poly(U).azido-tRNA(P-site).Phe- tRNAPhe(A-site) resulted in covalent attachment of azido-tRNA to ribosomes, both subunits being labelled. In both cases modification extent of 30S subunit was two-fold than that of the 50S one. It was shown that when the A-site was free the azido-tRNA located in P-site labelled proteins S9, S11, S12, S13, S21 and L14, L27, L31. Azido-tRNA located in P-site when the A-site was occupied with Phe-tRNAPhe labelled proteins S11, S12, S13, S14, S19, L32/L33 and possibly L23, L25. From the comparison of the sets of proteins labelled when A-site was free or occupied a conclusion was drawn that aminoacyl-tRNA located in ribosomal A-site affects the arrangement of deacylated tRNA in P-site. Data obtained allow to propose that proteins S5, S19, S20 and L24, L33 interact with guanine residues important for the tRNA tertiary structure formation.

  14. Oxidative damage of 18S and 5S ribosomal RNA in digestive gland of mussels exposed to trace metals.

    Science.gov (United States)

    Kournoutou, Georgia G; Giannopoulou, Panagiota C; Sazakli, Eleni; Leotsinidis, Michel; Kalpaxis, Dimitrios L

    2017-09-06

    Numerous studies have shown the ability of trace metals to accumulate in marine organisms and cause oxidative stress that leads to perturbations in many important intracellular processes, including protein synthesis. This study is mainly focused on the exploration of structural changes, like base modifications, scissions, and conformational changes, caused in 18S and 5S ribosomal RNA (rRNA) isolated from the mussel Mytilus galloprovincialis exposed to 40μg/L Cu, 30μg/L Hg, or 100μg/L Cd, for 5 or 15days. 18S rRNA and 5S rRNA are components of the small and large ribosomal subunit, respectively, found in complex with ribosomal proteins, translation factors and other auxiliary components (metal ions, toxins etc). 18S rRNA plays crucial roles in all stages of protein synthesis, while 5S rRNA serves as a master signal transducer between several functional regions of 28S rRNA. Therefore, structural changes in these ribosomal constituents could affect the basic functions of ribosomes and hence the normal metabolism of cells. Especially, 18S rRNA along with ribosomal proteins forms the decoding centre that ensures the correct codon-anticodon pairing. As exemplified by ELISA, primer extension analysis and DMS footprinting analysis, each metal caused oxidative damage to rRNA, depending on the nature of metal ion and the duration of exposure. Interestingly, exposure of mussels to Cu or Hg caused structural alterations in 5S rRNA, localized in paired regions and within loops A, B, C, and E, leading to a continuous progressive loss of the 5S RNA structural integrity. In contrast, structural impairments of 5S rRNA in mussels exposed to Cd were accumulating for the initial 5days, and then progressively decreased to almost the normal level by day 15, probably due to the parallel elevation of metallothionein content that depletes the pools of free Cd. Regions of interest in 18S rRNA, such as the decoding centre, sites implicated in the binding of tRNAs (A- and P-sites) or

  15. Sequence selective recognition of double-stranded RNA using triple helix-forming peptide nucleic acids.

    Science.gov (United States)

    Zengeya, Thomas; Gupta, Pankaj; Rozners, Eriks

    2014-01-01

    Noncoding RNAs are attractive targets for molecular recognition because of the central role they play in gene expression. Since most noncoding RNAs are in a double-helical conformation, recognition of such structures is a formidable problem. Herein, we describe a method for sequence-selective recognition of biologically relevant double-helical RNA (illustrated on ribosomal A-site RNA) using peptide nucleic acids (PNA) that form a triple helix in the major grove of RNA under physiologically relevant conditions. Protocols for PNA preparation and binding studies using isothermal titration calorimetry are described in detail.

  16. Cell-Type-Specific mRNA Purification by Translating Ribosome Affinity Purification (TRAP)

    Science.gov (United States)

    Heiman, Myriam; Kulicke, Ruth; Fenster, Robert J.; Greengard, Paul; Heintz, Nathaniel

    2014-01-01

    Cellular diversity and architectural complexity create barriers to understanding the function of the mammalian central nervous system (CNS) at a molecular level. To address this problem, we recently developed a methodology that provides the ability to profile the entire translated mRNA complement of any genetically defined cell population. This methodology, which we termed translating ribosome affinity purification, or TRAP, combines cell-type-specific transgene expression with affinity purification of translating ribosomes. TRAP can be used to study the cell-type-specific mRNA profiles of any genetically defined cell type, and has been successfully used to date in organisms ranging from D. melanogaster to mice and human cultured cells. Unlike other methodologies that rely upon micro-dissection, cell panning, or cell sorting, the TRAP methodology bypasses the need for tissue fixation or single-cell suspensions (and potential artifacts these treatments introduce), and reports on mRNAs in the entire cell body. This protocol provides a step-by-step guide to implementing the TRAP methodology, which takes two days to complete once all materials are in hand. PMID:24810037

  17. Compilation of tRNA sequences.

    Science.gov (United States)

    Sprinzl, M; Grueter, F; Spelzhaus, A; Gauss, D H

    1980-01-11

    This compilation presents in a small space the tRNA sequences so far published. The numbering of tRNAPhe from yeast is used following the rules proposed by the participants of the Cold Spring Harbor Meeting on tRNA 1978 (1,2;Fig. 1). This numbering allows comparisons with the three dimensional structure of tRNAPhe. The secondary structure of tRNAs is indicated by specific underlining. In the primary structure a nucleoside followed by a nucleoside in brackets or a modification in brackets denotes that both types of nucleosides can occupy this position. Part of a sequence in brackets designates a piece of sequence not unambiguosly analyzed. Rare nucleosides are named according to the IUPACIUB rules (for complicated rare nucleosides and their identification see Table 1); those with lengthy names are given with the prefix x and specified in the footnotes. Footnotes are numbered according to the coordinates of the corresponding nucleoside and are indicated in the sequence by an asterisk. The references are restricted to the citation of the latest publication in those cases where several papers deal with one sequence. For additional information the reader is referred either to the original literature or to other tRNA sequence compilations (3-7). Mutant tRNAs are dealt with in a compilation by J. Celis (8). The compilers would welcome any information by the readers regarding missing material or erroneous presentation. On the basis of this numbering system computer printed compilations of tRNA sequences in a linear form and in cloverleaf form are in preparation.

  18. Probabilistic error correction for RNA sequencing.

    Science.gov (United States)

    Le, Hai-Son; Schulz, Marcel H; McCauley, Brenna M; Hinman, Veronica F; Bar-Joseph, Ziv

    2013-05-01

    Sequencing of RNAs (RNA-Seq) has revolutionized the field of transcriptomics, but the reads obtained often contain errors. Read error correction can have a large impact on our ability to accurately assemble transcripts. This is especially true for de novo transcriptome analysis, where a reference genome is not available. Current read error correction methods, developed for DNA sequence data, cannot handle the overlapping effects of non-uniform abundance, polymorphisms and alternative splicing. Here we present SEquencing Error CorrEction in Rna-seq data (SEECER), a hidden Markov Model (HMM)-based method, which is the first to successfully address these problems. SEECER efficiently learns hundreds of thousands of HMMs and uses these to correct sequencing errors. Using human RNA-Seq data, we show that SEECER greatly improves on previous methods in terms of quality of read alignment to the genome and assembly accuracy. To illustrate the usefulness of SEECER for de novo transcriptome studies, we generated new RNA-Seq data to study the development of the sea cucumber Parastichopus parvimensis. Our corrected assembled transcripts shed new light on two important stages in sea cucumber development. Comparison of the assembled transcripts to known transcripts in other species has also revealed novel transcripts that are unique to sea cucumber, some of which we have experimentally validated. Supporting website: http://sb.cs.cmu.edu/seecer/.

  19. The conserved endoribonuclease YbeY is required for chloroplast ribosomal RNA processing in Arabidopsis.

    Science.gov (United States)

    Liu, Jinwen; Zhou, Wenbin; Liu, Guifeng; Yang, Chuanping; Sun, Yi; Wu, Wenjuan; Cao, Shenquan; Wang, Chong; Hai, Guanghui; Wang, Zhifeng; Bock, Ralph; Huang, Jirong; Cheng, Yuxiang

    2015-05-01

    Maturation of chloroplast ribosomal RNAs (rRNAs) comprises several endoribonucleolytic and exoribonucleolytic processing steps. However, little is known about the specific enzymes involved and the cleavage steps they catalyze. Here, we report the functional characterization of the single Arabidopsis (Arabidopsis thaliana) gene encoding a putative YbeY endoribonuclease. AtYbeY null mutants are seedling lethal, indicating that AtYbeY function is essential for plant growth. Knockdown plants display slow growth and show pale-green leaves. Physiological and ultrastructural analyses of atybeY mutants revealed impaired photosynthesis and defective chloroplast development. Fluorescent microcopy analysis showed that, when fused with the green fluorescence protein, AtYbeY is localized in chloroplasts. Immunoblot and RNA gel-blot assays revealed that the levels of chloroplast-encoded subunits of photosynthetic complexes are reduced in atybeY mutants, but the corresponding transcripts accumulate normally. In addition, atybeY mutants display defective maturation of both the 5' and 3' ends of 16S, 23S, and 4.5S rRNAs as well as decreased accumulation of mature transcripts from the transfer RNA genes contained in the chloroplast rRNA operon. Consequently, mutant plants show a severe deficiency in ribosome biogenesis, which, in turn, results in impaired plastid translational activity. Furthermore, biochemical assays show that recombinant AtYbeY is able to cleave chloroplast rRNAs as well as messenger RNAs and transfer RNAs in vitro. Taken together, our findings indicate that AtYbeY is a chloroplast-localized endoribonuclease that is required for chloroplast rRNA processing and thus for normal growth and development.

  20. [Study of the mRNA-binding region of ribosomes at different steps of translation. II. Affinity modification of Escherichia coli ribosomes by benzylidene derivative of AUGU6 in the 70S initiation complex].

    Science.gov (United States)

    Babkina, G T; Karpova, G G; Matasova, N B; Berzin', V M; Gren, E Ia

    1985-01-01

    2',3'-O-(4-[N-(2-chloroethyl)-N-methylamino]) benzylidene derivative of AUGU6 was used for identification of the proteins in the region of the mRNA-binding centre of E. coli ribosomes. This derivative alkylated ribosomes (preferentially 30S ribosomal) with high efficiency within the 70S initiation complex. In both 30S and 50S ribosomal subunits proteins and rRNA were modified. Specificity of the alkylation of ribosomal proteins and rRNA with the reagent was proved by the inhibitory action of AUGU6. Using the method of two-dimensional electrophoresis in polyacrylamide gel the proteins S4, S12, S13, S14, S15, S18, S19 and S20/L26 which are labelled by the analog of mRNA were identified.

  1. Requirement for a conserved, tertiary interaction in the core of 23S ribosomal RNA

    DEFF Research Database (Denmark)

    Aagaard, C; Douthwaite, S

    1994-01-01

    A putative base-pairing interaction that determines the folding of the central region of 23S rRNA has been investigated by mutagenesis. Each of the possible base substitutions has been made at the phylogenetically covariant positions adenine-1262 (A1262) and U2017 in Escherichia coli 23S rRNA....... Every substitution that disrupts the potential for Watson-Crick base pairing between these positions reduces or abolishes the participation of 23S rRNA in protein synthesis. All mutant 23S rRNAs are assembled into 50S subunits, but the mutant subunits are less able to stably interact with 30S subunits...... to form translationally active ribosomes. The function of 23S rRNA is largely reestablished by introduction of an alternative G1262.C2017 or U1262.A2017 pair, although neither of these supports polysome formation quite as effectively as the wild-type pair. A 23S rRNA with a C1262.G2017 pair...

  2. Label- and amplification-free electrochemical detection of bacterial ribosomal RNA.

    Science.gov (United States)

    Henihan, Grace; Schulze, Holger; Corrigan, Damion K; Giraud, Gerard; Terry, Jonathan G; Hardie, Alison; Campbell, Colin J; Walton, Anthony J; Crain, Jason; Pethig, Ronald; Templeton, Kate E; Mount, Andrew R; Bachmann, Till T

    2016-07-15

    Current approaches to molecular diagnostics rely heavily on PCR amplification and optical detection methods which have restrictions when applied to point of care (POC) applications. Herein we describe the development of a label-free and amplification-free method of pathogen detection applied to Escherichia coli which overcomes the bottleneck of complex sample preparation and has the potential to be implemented as a rapid, cost effective test suitable for point of care use. Ribosomal RNA is naturally amplified in bacterial cells, which makes it a promising target for sensitive detection without the necessity for prior in vitro amplification. Using fluorescent microarray methods with rRNA targets from a range of pathogens, an optimal probe was selected from a pool of probe candidates identified in silico. The specificity of probes was investigated on DNA microarray using fluorescently labeled 16S rRNA target. The probe yielding highest specificity performance was evaluated in terms of sensitivity and a LOD of 20 pM was achieved on fluorescent glass microarray. This probe was transferred to an EIS end point format and specificity which correlated to microarray data was demonstrated. Excellent sensitivity was facilitated by the use of uncharged PNA probes and large 16S rRNA target and investigations resulted in an LOD of 50 pM. An alternative kinetic EIS assay format was demonstrated with which rRNA could be detected in a species specific manner within 10-40min at room temperature without wash steps.

  3. Novel extraction strategy of ribosomal RNA and genomic DNA from cheese for PCR-based investigations.

    Science.gov (United States)

    Bonaïti, Catherine; Parayre, Sandrine; Irlinger, Françoise

    2006-03-15

    Cheese microorganisms, such as bacteria and fungi, constitute a complex ecosystem that plays a central role in cheeses ripening. The molecular study of cheese microbial diversity and activity is essential but the extraction of high quality nucleic acid may be problematic: the cheese samples are characterised by a strong buffering capacity which negatively influenced the yield of the extracted rRNA. The objective of this study is to develop an effective method for the direct and simultaneous isolation of yeast and bacterial ribosomal RNA and genomic DNA from the same cheese samples. DNA isolation was based on a protocol used for nucleic acids isolation from anaerobic digestor, without preliminary washing step with the combined use of the action of chaotropic agent (acid guanidinium thiocyanate), detergents (SDS, N-lauroylsarcosine), chelating agent (EDTA) and a mechanical method (bead beating system). The DNA purification was carried out by two washing steps of phenol-chloroform. RNA was isolated successfully after the second acid extraction step by recovering it from the phenolic phase of the first acid extraction. The novel method yielded pure preparation of undegraded RNA accessible for reverse transcription-PCR. The extraction protocol of genomic DNA and rRNA was applicable to complex ecosystem of different cheese matrices.

  4. The bacterial toxin RelE induces specific mRNA cleavage in the A site of the eukaryote ribosome

    Science.gov (United States)

    Andreev, Dmitri; Hauryliuk, Vasili; Terenin, Ilya; Dmitriev, Sergey; Ehrenberg, Måns; Shatsky, Ivan

    2008-01-01

    RelE/RelB is a well-characterized toxin–anti-toxin pair involved in nutritional stress responses in Bacteria and Archae. RelE lacks any eukaryote homolog, but we demonstrate here that it efficiently and specifically cleaves mRNA in the A site of the eukaryote ribosome. The cleavage mechanism is similar to that in bacteria, showing the feasibility of A-site cleavage of mRNA for regulatory purposes also in eukaryotes. RelE cleavage in the A-site codon of a stalled eukaryote ribosome is precise and easily monitored, making “RelE printing” a useful complement to toeprinting to determine the exact mRNA location on the eukaryote ribosome and to probe the occupancy of its A site. PMID:18083838

  5. Macrolides and lincomycin susceptibility of Mycoplasma hyorhinis and variable mutation of domain II and V in 23S ribosomal RNA.

    Science.gov (United States)

    Kobayashi, Hideki; Nakajima, Hiromi; Shimizu, Yuka; Eguchi, Masashi; Hata, Eiji; Yamamoto, Koshi

    2005-08-01

    A total of 151 strains of Mycoplasma hyorhinis isolated from porcine lung lesions (weaned pigs, n=71, and finishers, n=80) were investigated for their in vitro susceptibility to 10 antimicrobial agents. Thirty-one strains (28 from weaned pigs and 3 from finishers) showed resistance to 16-membered macrolide antibiotics and lincomycin. The prevalence of the 16-membered macrolide-resistant M. hyorhinis strain in weaned pigs from Japanese herds has approximately quadrupled in the past 10 years. Several of the 31 strains were examined for mutations in the 23S ribosomal RNA (rRNA). All field strains tested showed a transition of A to G at position 2059 of 23S rRNA-rendered Escherichia coli. On the other hand, individual tylosin- and lincomycin-resistant mutants of M. hyorhinis were selected in vitro from the susceptible type strain BTS7 by 3 to 9 serial passages in subinhibitory concentrations of each antibiotic. The 23S rRNA sequences of both tylosin and lincomycin-resistant mutants were compared with that of the radical BTS7 strain. The BTS7 mutant strain selected by tylosin showed the same transition as the field-isolated strains of A2059G. However, the transition selected in lincomycin showed mutations in domains II and V of 23S rRNA, G2597U, C2611U in domain V, and the addition of an adenine at the pentameric adenine loop in domain II. The strain selected by lincomycin showed an additional point mutation of A2062G selected by tylosin.

  6. Removal of ribosomal subunits (and rRNA) from cytoplasmic extracts before solubilization with SDS and deproteinization.

    Science.gov (United States)

    Rio, Donald C; Ares, Manuel; Hannon, Gregory J; Nilsen, Timothy W

    2010-06-01

    More than 95% of total RNA is composed of ribosomal RNAs (rRNAs) (28S, 18S, 5.8S, and 5S). Here, we present a method that is effective in removing rRNA before extraction and purification of total RNA. If you choose to prepare cytoplasmic RNA and wish to analyze any RNA other than rRNA, it is desirable to eliminate the rRNAs by taking advantage of the fact that the ribosomal subunits are very large (40S and 60S). Few, if any, other cellular RNAs are present in such large macromolecular complexes. The vast majority of rRNAs can be removed by sedimentation. Of course, steps must be taken to avoid co-sedimentation of desired RNAs. Co-sedimentation can be greatly reduced by first dissociating ribosomes into their respective subunits by EDTA treatment. The subunits are then "cleaned" by treatment with high salt and nonionic detergent. Ribosomal subunits remain intact under these conditions and can be sedimented free of other RNAs. Subsequently, the remaining RNAs (messenger RNAs [mRNAs] and all other RNAs) can be purified and analyzed by a variety of methods.

  7. The structure of a single unit of ribosomal RNA gene (rDNA) including intergenic subrepeats in the Australian bulldog ant Myrmecia croslandi (Hymenoptera: Formicidae).

    Science.gov (United States)

    Ohnishi, Hitoshi; Yamamoto, Masa-Toshi

    2004-02-01

    A complete single unit of a ribosomal RNA gene (rDNA) of M. croslandi was sequenced. The ends of the 18S, 5.8S and 28S rRNA genes were determined by using the sequences of D. melanogaster rDNAs as references. Each of the tandemly repeated rDNA units consists of coding and non-coding regions whose arrangement is the same as that of D. melanogaster rDNA. The intergenic spacer (IGS) contains, as in other species, a region with subrepeats, of which the sequences are different from those previously reported in other insect species. The length of IGSs was estimated to be 7-12 kb by genomic Southern hybridization, showing that an rDNA repeating unit of M. croslandi is 14-19 kb-long. The sequences of the coding regions are highly conserved, whereas IGS and ITS (internal transcribed spacer) sequences are not. We obtained clones with insertions of various sizes of R2 elements, the target sequence of which was found in the 28S rRNA coding region. A short segment in the IGS that follows the 3' end of the 28S rRNA gene was predicted to form a secondary structure with long stems.

  8. An intron within the 16S ribosomal RNA gene of the archaeon Pyrobaculum aerophilum

    Science.gov (United States)

    Burggraf, S.; Larsen, N.; Woese, C. R.; Stetter, K. O.

    1993-01-01

    The 16S rRNA genes of Pyrobaculum aerophilum and Pyrobaculum islandicum were amplified by the polymerase chain reaction, and the resulting products were sequenced directly. The two organisms are closely related by this measure (over 98% similar). However, they differ in that the (lone) 16S rRNA gene of Pyrobaculum aerophilum contains a 713-bp intron not seen in the corresponding gene of Pyrobaculum islandicum. To our knowledge, this is the only intron so far reported in the small subunit rRNA gene of a prokaryote. Upon excision the intron is circularized. A secondary structure model of the intron-containing rRNA suggests a splicing mechanism of the same type as that invoked for the tRNA introns of the Archaea and Eucarya and 23S rRNAs of the Archaea. The intron contains an open reading frame whose protein translation shows no certain homology with any known protein sequence.

  9. An intron within the 16S ribosomal RNA gene of the archaeon Pyrobaculum aerophilum

    Science.gov (United States)

    Burggraf, S.; Larsen, N.; Woese, C. R.; Stetter, K. O.

    1993-01-01

    The 16S rRNA genes of Pyrobaculum aerophilum and Pyrobaculum islandicum were amplified by the polymerase chain reaction, and the resulting products were sequenced directly. The two organisms are closely related by this measure (over 98% similar). However, they differ in that the (lone) 16S rRNA gene of Pyrobaculum aerophilum contains a 713-bp intron not seen in the corresponding gene of Pyrobaculum islandicum. To our knowledge, this is the only intron so far reported in the small subunit rRNA gene of a prokaryote. Upon excision the intron is circularized. A secondary structure model of the intron-containing rRNA suggests a splicing mechanism of the same type as that invoked for the tRNA introns of the Archaea and Eucarya and 23S rRNAs of the Archaea. The intron contains an open reading frame whose protein translation shows no certain homology with any known protein sequence.

  10. Insects' RNA Profiling Reveals Absence of "Hidden Break" in 28S Ribosomal RNA Molecule of Onion Thrips, Thrips tabaci.

    Science.gov (United States)

    Macharia, Rosaline Wanjiru; Ombura, Fidelis Levi; Aroko, Erick Onyango

    2015-01-01

    With an exception of aphids, insects' 28S rRNA is thought to harbor a "hidden break" which cleaves under denaturing conditions to comigrate with 18S rRNA band to exhibit a degraded appearance on native agarose gels. The degraded appearance confounds determination of RNA integrity in laboratories that rely on gel electrophoresis. To provide guidelines for RNA profiles, RNA from five major insect orders, namely, Diptera, Hemiptera, Thysanoptera, Hymenoptera, and Lepidoptera, was compared under denaturing and nondenaturing conditions. This study confirmed that although present in most of insect's RNA, the "hidden break" is absent in the 28S rRNA of onion thrips, Thrips tabaci. On the other hand, presence of "hidden break" was depicted in whiteflies' 28S rRNA despite their evolutionary grouping under same order with aphids. Divergence of 28S rRNA sequences confirms variation of both size and composition of gap region among insect species. However, phylogeny reconstruction does not support speciation as a possible source of the hidden break in insect's 28S rRNA. In conclusion, we show that RNA from a given insect order does not conform to a particular banding profile and therefore this approach cannot be reliably used to characterize newly discovered species.

  11. Partial methylation at Am100 in 18S rRNA of baker's yeast reveals ribosome heterogeneity on the level of eukaryotic rRNA modification.

    Directory of Open Access Journals (Sweden)

    Markus Buchhaupt

    Full Text Available Ribosome heterogeneity is of increasing biological significance and several examples have been described for multicellular and single cells organisms. In here we show for the first time a variation in ribose methylation within the 18S rRNA of Saccharomyces cerevisiae. Using RNA-cleaving DNAzymes, we could specifically demonstrate that a significant amount of S. cerevisiae ribosomes are not methylated at 2'-O-ribose of A100 residue in the 18S rRNA. Furthermore, using LC-UV-MS/MS of a respective 18S rRNA fragment, we could not only corroborate the partial methylation at A100, but could also quantify the methylated versus non-methylated A100 residue. Here, we exhibit that only 68% of A100 in the 18S rRNA of S.cerevisiae are methylated at 2'-O ribose sugar. Polysomes also contain a similar heterogeneity for methylated Am100, which shows that 40S ribosome subunits with and without Am100 participate in translation. Introduction of a multicopy plasmid containing the corresponding methylation guide snoRNA gene SNR51 led to an increased A100 methylation, suggesting the cellular snR51 level to limit the extent of this modification. Partial rRNA modification demonstrates a new level of ribosome heterogeneity in eukaryotic cells that might have substantial impact on regulation and fine-tuning of the translation process.

  12. Partial methylation at Am100 in 18S rRNA of baker's yeast reveals ribosome heterogeneity on the level of eukaryotic rRNA modification.

    Science.gov (United States)

    Buchhaupt, Markus; Sharma, Sunny; Kellner, Stefanie; Oswald, Stefanie; Paetzold, Melanie; Peifer, Christian; Watzinger, Peter; Schrader, Jens; Helm, Mark; Entian, Karl-Dieter

    2014-01-01

    Ribosome heterogeneity is of increasing biological significance and several examples have been described for multicellular and single cells organisms. In here we show for the first time a variation in ribose methylation within the 18S rRNA of Saccharomyces cerevisiae. Using RNA-cleaving DNAzymes, we could specifically demonstrate that a significant amount of S. cerevisiae ribosomes are not methylated at 2'-O-ribose of A100 residue in the 18S rRNA. Furthermore, using LC-UV-MS/MS of a respective 18S rRNA fragment, we could not only corroborate the partial methylation at A100, but could also quantify the methylated versus non-methylated A100 residue. Here, we exhibit that only 68% of A100 in the 18S rRNA of S.cerevisiae are methylated at 2'-O ribose sugar. Polysomes also contain a similar heterogeneity for methylated Am100, which shows that 40S ribosome subunits with and without Am100 participate in translation. Introduction of a multicopy plasmid containing the corresponding methylation guide snoRNA gene SNR51 led to an increased A100 methylation, suggesting the cellular snR51 level to limit the extent of this modification. Partial rRNA modification demonstrates a new level of ribosome heterogeneity in eukaryotic cells that might have substantial impact on regulation and fine-tuning of the translation process.

  13. Thousands of primer-free, high-quality, full-length SSU rRNA sequences from all domains of life

    DEFF Research Database (Denmark)

    Karst, Soeren M; Dueholm, Morten S; McIlroy, Simon J

    2016-01-01

    Ribosomal RNA (rRNA) genes are the consensus marker for determination of microbial diversity on the planet, invaluable in studies of evolution and, for the past decade, high-throughput sequencing of variable regions of ribosomal RNA genes has become the backbone of most microbial ecology studies...... (SSU) rRNA genes and synthetic long read sequencing by molecular tagging, to generate primer-free, full-length SSU rRNA gene sequences from all domains of life, with a median raw error rate of 0.17%. We generated thousands of full-length SSU rRNA sequences from five well-studied ecosystems (soil, human...... gut, fresh water, anaerobic digestion, and activated sludge) and obtained sequences covering all domains of life and the majority of all described phyla. Interestingly, 30% of all bacterial operational taxonomic units were novel, compared to the SILVA database (less than 97% similarity...

  14. Massive-scale RNA-Seq analysis of non ribosomal transcriptome in human trisomy 21.

    Directory of Open Access Journals (Sweden)

    Valerio Costa

    Full Text Available Hybridization- and tag-based technologies have been successfully used in Down syndrome to identify genes involved in various aspects of the pathogenesis. However, these technologies suffer from several limits and drawbacks and, to date, information about rare, even though relevant, RNA species such as long and small non-coding RNAs, is completely missing. Indeed, none of published works has still described the whole transcriptional landscape of Down syndrome. Although the recent advances in high-throughput RNA sequencing have revealed the complexity of transcriptomes, most of them rely on polyA enrichment protocols, able to detect only a small fraction of total RNA content. On the opposite end, massive-scale RNA sequencing on rRNA-depleted samples allows the survey of the complete set of coding and non-coding RNA species, now emerging as novel contributors to pathogenic mechanisms. Hence, in this work we analysed for the first time the complete transcriptome of human trisomic endothelial progenitor cells to an unprecedented level of resolution and sensitivity by RNA-sequencing. Our analysis allowed us to detect differential expression of even low expressed genes crucial for the pathogenesis, to disclose novel regions of active transcription outside yet annotated loci, and to investigate a plethora of non-polyadenylated long as well as short non coding RNAs. Novel splice isoforms for a large subset of crucial genes, and novel extended untranslated regions for known genes--possibly novel miRNA targets or regulatory sites for gene transcription--were also identified in this study. Coupling the rRNA depletion of samples, followed by high-throughput RNA-sequencing, to the easy availability of these cells renders this approach very feasible for transcriptome studies, offering the possibility of investigating in-depth blood-related pathological features of Down syndrome, as well as other genetic disorders.

  15. Characterization of the tRNA and ribosome-dependent pppGpp-synthesis by recombinant stringent factor from Escherichia coli.

    Science.gov (United States)

    Knutsson Jenvert, Rose-Marie; Holmberg Schiavone, Lovisa

    2005-02-01

    Stringent factor is a ribosome-dependent ATP:GTP pyrophosphoryl transferase that synthesizes (p)ppGpp upon nutrient deprivation. It is activated by unacylated tRNA in the ribosomal amino-acyl site (A-site) but it is unclear how activation occurs. A His-tagged stringent factor was isolated by affinity-chromatography and precipitation. This procedure yielded a protein of high purity that displayed (a) a low endogenous pyrophosphoryl transferase activity that was inhibited by the antibiotic tetracycline; (b) a low ribosome-dependent activity that was inhibited by the A-site specific antibiotics thiostrepton, micrococcin, tetracycline and viomycin; (c) a tRNA- and ribosome-dependent activity amounting to 4500 pmol pppGpp per pmol stringent factor per minute. Footprinting analysis showed that stringent factor interacted with ribosomes that contained tRNAs bound in classical states. Maximal activity was seen when the ribosomal A-site was presaturated with unacylated tRNA. Less tRNA was required to reach maximal activity when stringent factor and unacylated tRNA were added simultaneously to ribosomes, suggesting that stringent factor formed a complex with tRNA in solution that had higher affinity for the ribosomal A-site. However, tRNA-saturation curves, performed at two different ribosome/stringent factor ratios and filter-binding assays, did not support this hypothesis.

  16. Model of EF4-induced ribosomal state transitions and mRNA translocation

    Science.gov (United States)

    Xie, Ping

    2014-08-01

    EF4, a highly conserved protein present in bacteria, mitochondria and chloroplasts, can bind to both the posttranslocation and pretranslocation ribosomal complexes. When binding to the posttranslocation state, it catalyzes backward translocation to a pretranslocation state. When binding to the pretranslocation state, it catalyzes transition to another pretranslocation state that is similar and possibly identical to that resulting from the posttranslocation state bound by EF4, and competes with EF-G to regulate the elongation cycle. However, the molecular mechanism on how EF4 induces state transitions and mRNA translocation remains unclear. Here, we present both the model for state transitions induced by EF4 binding to the posttranslocation state and that by EF4 binding to the pretranslocation state, based on which we study the kinetics of EF4-induced state transitions and mRNA translocation, giving quantitative explanations of the available experimental data. Moreover, we present some predicted results on state transitions and mRNA translocation induced by EF4 binding to the pretranslocation state complexed with the mRNA containing a duplex region.

  17. Nearly identical 16S rRNA sequences recovered from lakes in North America and Europe indicate the existence of clades of globally distributed freshwater bacteria

    NARCIS (Netherlands)

    Zwart, G.; Hiorns, W.D.; Methe, B.A.; Agterveld, M.P. van; Huismans, R.; Nold, S.C.; Zehr, J.P.; Laanbroek, H.J.

    1998-01-01

    We compared bacterial 16S ribosomal RNA gene sequences recovered from Lake Loosdrecht, the Netherlands, to reported sequences from lakes in Alaska and New York State. In each of the three lake systems, which differ in pH and trophic state, some sequence types were found without related

  18. Profiling of 2'-O-Me in human rRNA reveals a subset of fractionally modified positions and provides evidence for ribosome heterogeneity

    DEFF Research Database (Denmark)

    Krogh, Nicolai; Jansson, Martin D; Häfner, Sophia J

    2016-01-01

    Ribose methylation is one of the two most abundant modifications in human ribosomal RNA and is believed to be important for ribosome biogenesis, mRNA selectivity and translational fidelity. We have applied RiboMeth-seq to rRNA from HeLa cells for ribosome-wide, quantitative mapping of 2'-O-Me sites...... and obtained a comprehensive set of 106 sites, including two novel sites, and with plausible box C/D guide RNAs assigned to all but three sites. We find approximately two-thirds of the sites to be fully methylated and the remainder to be fractionally modified in support of ribosome heterogeneity at the level...

  19. RACK1 is a ribosome scaffold protein for β-actin mRNA/ZBP1 complex.

    Directory of Open Access Journals (Sweden)

    Marcello Ceci

    Full Text Available In neurons, specific mRNAs are transported in a translationally repressed manner along dendrites or axons by transport ribonucleic-protein complexes called RNA granules. ZBP1 is one RNA binding protein present in transport RNPs, where it transports and represses the translation of cotransported mRNAs, including β-actin mRNA. The release of β-actin mRNA from ZBP1 and its subsequent translation depends on the phosphorylation of ZBP1 by Src kinase, but little is known about how this process is regulated. Here we demonstrate that the ribosomal-associated protein RACK1, another substrate of Src, binds the β-actin mRNA/ZBP1 complex on ribosomes and contributes to the release of β-actin mRNA from ZBP1 and to its translation. We identify the Src binding and phosphorylation site Y246 on RACK1 as the critical site for the binding to the β-actin mRNA/ZBP1 complex. Based on these results we propose RACK1 as a ribosomal scaffold protein for specific mRNA-RBP complexes to tightly regulate the translation of specific mRNAs.

  20. Chromosomal localization of ribosomal DNA sequences in an apple rootstock using a digoxygenin detection system

    Institute of Scientific and Technical Information of China (English)

    ZHUJIMEI; SEGARDINER

    1995-01-01

    A 6kb rDNA probe comprising the 18S coding plus spacer sequences has been hybridized to the metaphase chromosomes of apple rootstock cultivar MM106 demonstrating the localization of ribosomal gene arrays in the vicinity of the telomeric regions of the short arms of chromosomes 6 and 14.The in situ results using digoxygenin labelling coupled to an alkaline phosphatase immunoassay were confirmed by silver staining for NORs and nucleoli.This study demonstrates the feasibility of molecular cytogenetic analysis of very small chromosomes(1.0-2.7μm) of apple.

  1. Identification of Chinese populations of Bemisia tabaci (Gennadius) by analyzing ribosomal ITS1 sequence

    Institute of Scientific and Technical Information of China (English)

    2003-01-01

    Spreading of Bemisia tabaci B biotype has had a large impact on the production of vegetables, ornamental and fiber crops in many countries of the world since the 1990s. This study analyzes the ribosomal ITS1 sequence (~520 bp) to distinguish genetic difference of B. tabaci from representative different geographical populations in China. Phylogenetic analysis shows that populations of B.tabaci from Beijing and Shandong Province are of biotype B, and populations of B.tabaci from sweet potato in Fujian Province and pumpkin in Guangxi, China, belong to two different non-B biotypes and have a geographical origin of Asia.

  2. The effect of aminoacyl- or peptidyl-tRNA at the A-site on the arrangement of deacylated tRNA at the ribosomal P-site.

    Science.gov (United States)

    Babkina, G T; Bausk, E V; Graifer, D M; Karpova, G G; Matasova, N B

    1984-05-21

    Photoreactive derivatives of E. coli tRNAPhe bearing arylazido groups on guanine residues (azido-tRNA) were used for affinity labelling of E. coli ribosomes in the region of the P-site when the A-site was either free or occupied by aminoacyl- or peptidyl-tRNA. Corresponding complexes of azido-tRNA with ribosomes and poly(U) were obtained both nonenzymatically and with the use of elongation factors. UV-irradiation of the complexes resulted in labelling of ribosomal proteins (preferentially of 30 S subunit). Proteins S9 and S21 were labelled only when the A-site was free; S14 - only when it was occupied; S11, S13, S19 - in both cases; S5, S7, S12, S20 - in some states.

  3. Mitochondrial large ribosomal subunit sequences are homogeneous within isolates of Glomus (arbuscular mycorrhizal fungi, Glomeromycota).

    Science.gov (United States)

    Raab, Philipp A; Brennwald, Annemarie; Redecker, Dirk

    2005-12-01

    Partial sequences of the mtLSU rDNA were obtained from the arbuscular mycorrhizal (AM) fungi Glomus proliferum (isolate DAOM 226389) and G. intraradices (isolates JJ291 and BEG75). The exon sequences of the two species showed regions of strong divergence. There was no evidence of intra-isolate sequence heterogeneity as it is found in variable regions of nuclear ribosomal genes of Glomeromycota. In G. intraradices JJ291, two introns were found in the partial LSU sequence. One of the introns contained an ORF for a putative site-specific homing endonuclease of the LAGLIDADG family. In G. intraradices BEG75, one of the introns was missing and the other had a DNA sequence distinct from JJ291. G. proliferum had no introns in the region sequenced. A PCR primer was designed to amplify the fragment of the mtLSU of a different, distinguishable G. intraradices genotype from colonized roots of a field sample. These mitochondrial gene sequences are the first reported from the phylum Glomeromycota. Our findings indicate that the intra-individual sequence heterogeneity of the Glomeromycota may be a peculiar feature of the nuclear genes. Therefore, mtLSU and its introns have the potential to be highly sensitive genetic markers for these fungi in the future.

  4. Connecting the kinetics and energy landscape of tRNA translocation on the ribosome.

    Science.gov (United States)

    Whitford, Paul C; Blanchard, Scott C; Cate, Jamie H D; Sanbonmatsu, Karissa Y

    2013-01-01

    Functional rearrangements in biomolecular assemblies result from diffusion across an underlying energy landscape. While bulk kinetic measurements rely on discrete state-like approximations to the energy landscape, single-molecule methods can project the free energy onto specific coordinates. With measures of the diffusion, one may establish a quantitative bridge between state-like kinetic measurements and the continuous energy landscape. We used an all-atom molecular dynamics simulation of the 70S ribosome (2.1 million atoms; 1.3 microseconds) to provide this bridge for specific conformational events associated with the process of tRNA translocation. Starting from a pre-translocation configuration, we identified sets of residues that collectively undergo rotary rearrangements implicated in ribosome function. Estimates of the diffusion coefficients along these collective coordinates for translocation were then used to interconvert between experimental rates and measures of the energy landscape. This analysis, in conjunction with previously reported experimental rates of translocation, provides an upper-bound estimate of the free-energy barriers associated with translocation. While this analysis was performed for a particular kinetic scheme of translocation, the quantitative framework is general and may be applied to energetic and kinetic descriptions that include any number of intermediates and transition states.

  5. The structure of Aquifex aeolicus ribosomal protein S8 reveals a unique subdomain that contributes to an extremely tight association with 16S rRNA.

    Science.gov (United States)

    Menichelli, Elena; Edgcomb, Stephen P; Recht, Michael I; Williamson, James R

    2012-01-20

    The assembly of ribonucleoprotein complexes occurs under a broad range of conditions, but the principles that promote assembly and allow function at high temperature are poorly understood. The ribosomal protein S8 from Aquifex aeolicus (AS8) is unique in that there is a 41-residue insertion in the consensus S8 sequence. In addition, AS8 exhibits an unusually high affinity for the 16S ribosomal RNA, characterized by a picomolar dissociation constant that is approximately 26,000-fold tighter than the equivalent interaction from Escherichia coli. Deletion analysis demonstrated that binding to the minimal site on helix 21 occurred at the same nanomolar affinity found for other bacterial species. The additional affinity required the presence of a three-helix junction between helices 20, 21, and 22. The crystal structure of AS8 was solved, revealing the helix-loop-helix geometry of the unique AS8 insertion region, while the core of the molecule is conserved with known S8 structures. The AS8 structure was modeled onto the structure of the 30S ribosomal subunit from E. coli, suggesting the possibility that the unique subdomain provides additional backbone and side-chain contacts between the protein and an unpaired base within the three-way junction of helices 20, 21, and 22. Point mutations in the protein insertion subdomain resulted in a significantly reduced RNA binding affinity with respect to wild-type AS8. These results indicate that the AS8-specific subdomain provides additional interactions with the three-way junction that contribute to the extremely tight binding to ribosomal RNA.

  6. Genetic characterization of clinical acanthamoeba isolates from Japan using nuclear and mitochondrial small subunit ribosomal RNA.

    Science.gov (United States)

    Rahman, Md Moshiur; Yagita, Kenji; Kobayashi, Akira; Oikawa, Yosaburo; Hussein, Amjad I A; Matsumura, Takahiro; Tokoro, Masaharu

    2013-08-01

    Because of an increased number of Acanthamoeba keratitis (AK) along with associated disease burdens, medical professionals have become more aware of this pathogen in recent years. In this study, by analyzing both the nuclear 18S small subunit ribosomal RNA (18S rRNA) and mitochondrial 16S rRNA gene loci, 27 clinical Acanthamoeba strains that caused AK in Japan were classified into 3 genotypes, T3 (3 strains), T4 (23 strains), and T5 (one strain). Most haplotypes were identical to the reference haplotypes reported from all over the world, and thus no specificity of the haplotype distribution in Japan was found. The T4 sub-genotype analysis using the 16S rRNA gene locus also revealed a clear sub-conformation within the T4 cluster, and lead to the recognition of a new sub-genotype T4i, in addition to the previously reported sub-genotypes T4a-T4h. Furthermore, 9 out of 23 strains in the T4 genotype were identified to a specific haplotype (AF479533), which seems to be a causal haplotype of AK. While heterozygous nuclear haplotypes were observed from 2 strains, the mitochondrial haplotypes were homozygous as T4 genotype in the both strains, and suggested a possibility of nuclear hybridization (mating reproduction) between different strains in Acanthamoeba. The nuclear 18S rRNA gene and mitochondrial 16S rRNA gene loci of Acanthamoeba spp. possess different unique characteristics usable for the genotyping analyses, and those specific features could contribute to the establishment of molecular taxonomy for the species complex of Acanthamoeba.

  7. Multicenter quality assessment of 16S ribosomal DNA-sequencing for microbiome analyses reveals high inter-center variability.

    Science.gov (United States)

    Hiergeist, Andreas; Reischl, Udo; Gessner, Andrè

    2016-08-01

    The composition of human as well as animal microbiota has increasingly gained in interest since metabolites and structural components of endogenous microorganisms fundamentally influence all aspects of host physiology. Since many of the bacteria are still unculturable, molecular techniques such as high-throughput sequencing have dramatically increased our knowledge of microbial communities. The majority of microbiome studies published thus far are based on bacterial 16S ribosomal RNA (rRNA) gene sequencing, so that they can, at least in principle, be compared to determine the role of the microbiome composition for host metabolism and physiology, developmental processes, as well as different diseases. However, differences in DNA preparation and purification, 16S rDNA PCR amplification, sequencing procedures and platforms, as well as bioinformatic analysis and quality control measures may strongly affect the microbiome composition results obtained in different laboratories. To systematically evaluate the comparability of results and identify the most influential methodological factors affecting these differences, identical human stool sample replicates spiked with quantified marker bacteria, and their subsequent DNA sequences were analyzed by nine different centers in an external quality assessment (EQA). While high intra-center reproducibility was observed in repetitive tests, significant inter-center differences of reported microbiota composition were obtained. All steps of the complex analysis workflow significantly influenced microbiome profiles, but the magnitude of variation caused by PCR primers for 16S rDNA amplification was clearly the largest. In order to advance microbiome research to a more standardized and routine medical diagnostic procedure, it is essential to establish uniform standard operating procedures throughout laboratories and to initiate regular proficiency testing.

  8. Effect of thiostrepton and 3'-terminal fragments of aminoacyl-tRNA on EF-Tu and ribosome-dependent GTP hydrolysis.

    Science.gov (United States)

    Bhuta, P; Chládek, S

    1982-08-30

    The effect of the antibiotics thiostrepton and micrococcin on EF-Tu-catalyzed (ribosome-dependent) GTP hydrolysis in the presence of A-Phe, C-A-Phe, or C-C-A-Phe (related to the sequence of the 3'-terminus of aminoacyl-tRNA)(System I) or by methanol ('uncoupled GTPase', System II) was investigated. In System I, thiostrepton increases the binding affinities of the effectors to the EF-Tu.GTP.70 S ribosome complex, as well as the extent of the GTP hydrolysis, while the KmGTP is virtually unchanged. Similarly, in the uncoupled system (System II) and in the absence of effectors, thiostrepton significantly increases VmaxGTP, whereas KmGTP remains unaffected. Micrococcin is without any effect in both systems. The 'uncoupled GTPase' (in System II) is also strongly inhibited by C-A-Phe. The results indicate the crucial role of the EF-Tu site which binds the aminoacylated C-C-A terminus of aminoacyl-tRNA in promoting GTP hydrolysis. It follows that the binding of the model effectors (such as C-C-A-Phe) to that site is favorably influenced by the interaction of thiostrepton with the 50 S ribosomal subunit, whereas thiostrepton, per se, does not influence the affinity of EF-Tu for GTP.

  9. Mutant forms of Escherichia coli protein L25 unable to bind to 5S rRNA are incorporated efficiently into the ribosome in vivo.

    Science.gov (United States)

    Anikaev, A Y; Korepanov, A P; Korobeinikova, A V; Kljashtorny, V G; Piendl, W; Nikonov, S V; Garber, M B; Gongadze, G M

    2014-08-01

    5S rRNA-binding ribosomal proteins of the L25 family are an evolutional acquisition of bacteria. Earlier we showed that (i) single replacements in the RNA-binding module of the protein of this family result in destabilization or complete impossibility to form a complex with 5S rRNA in vitro; (ii) ΔL25 ribosomes of Escherichia coli are less efficient in protein synthesis in vivo than the control ribosomes. In the present work, the efficiency of incorporation of the E. coli protein L25 with mutations in the 5S rRNA-binding region into the ribosome in vivo was studied. It was found that the mutations in L25 that abolish its ability to form the complex with free 5S rRNA do not prevent its correct and efficient incorporation into the ribosome. This is supported by the fact that even the presence of a very weakly retained mutant form of the protein in the ribosome has a positive effect on the activity of the translational machinery in vivo. All this suggests the existence of an alternative incorporation pathway for this protein into the ribosome, excluding the preliminary formation of the complex with 5S rRNA. At the same time, the stable L25-5S rRNA contact is important for the retention of the protein within the ribosome, and the conservative amino acid residues of the RNA-binding module play a key role in this.

  10. Organism-specific rRNA capture system for application in next-generation sequencing.

    Directory of Open Access Journals (Sweden)

    Sai-Kam Li

    Full Text Available RNA-sequencing is a powerful tool in studying RNomics. However, the highly abundance of ribosomal RNAs (rRNA and transfer RNA (tRNA have predominated in the sequencing reads, thereby hindering the study of lowly expressed genes. Therefore, rRNA depletion prior to sequencing is often performed in order to preserve the subtle alteration in gene expression especially those at relatively low expression levels. One of the commercially available methods is to use DNA or RNA probes to hybridize to the target RNAs. However, there is always a concern with the non-specific binding and unintended removal of messenger RNA (mRNA when the same set of probes is applied to different organisms. The degree of such unintended mRNA removal varies among organisms due to organism-specific genomic variation. We developed a computer-based method to design probes to deplete rRNA in an organism-specific manner. Based on the computation results, biotinylated-RNA-probes were produced by in vitro transcription and were used to perform rRNA depletion with subtractive hybridization. We demonstrated that the designed probes of 16S rRNAs and 23S rRNAs can efficiently remove rRNAs from Mycobacterium smegmatis. In comparison with a commercial subtractive hybridization-based rRNA removal kit, using organism-specific probes is better in preserving the RNA integrity and abundance. We believe the computer-based design approach can be used as a generic method in preparing RNA of any organisms for next-generation sequencing, particularly for the transcriptome analysis of microbes.

  11. Ribosome-associated GTPases: the role of RNA for GTPase activation.

    Science.gov (United States)

    Clementi, Nina; Polacek, Norbert

    2010-01-01

    The GTPase super-family comprises a variety of G proteins found in all three domains of life. Although they are participating in completely different processes like signal transduction, protein biosynthesis and regulation of cell proliferation, they all share a highly conserved G domain and use a common mechanism for GTP hydrolysis. Exact timing in hydrolyzing the bound GTP serves as a molecular switch to initiate diverse cellular reactions. Classical GTPases depend on external proteins to fire GTP hydrolysis (GAPs), and following the GTPase reaction to exchange GDP for GTP (GEFs), converting the GTPase into the active state again. In recent years it became clear that there are many GTPases that do not follow this classical switch mode scheme. Certain ribosome-associated GTPases are not reliant on other GEF proteins to exchange GDP for GTP. Furthermore many of these G proteins are not activated by external GAPs, but by evolutionarily ancient molecules, namely by RNA.

  12. Ribosomal operon intergenic sequence region (ISR) heterogeneity in Campylobacter coli and Campylobacter jejuni

    Science.gov (United States)

    Campylobacter jejuni and Campylobacter coli are closely related species that can not be distinguished by their 16S or 23S rRNA gene sequences. However, the intergenic sequence region (ISR) that is between the 16S and 23S genes is markedly different and characteristic for each species. A peculiarit...

  13. Proteins associated with rRNA in the Escherichia coli ribosome.

    Science.gov (United States)

    Bernabeu, C; Vazquez, D; Ballesta, J P

    1978-04-27

    Ribosomal proteins located near the rRNA have been identified by cross linking to [14C]spermine with 1,5-difluoro-2,4-dinitrobenzene. The polyamine binds to double-stranded rRNA; those proteins showing radioactivity covalently bound after treatment with the bifunctional reagent should therefore be located in the vicinity of these regions of rRNA. Six proteins from the small subunit, S4, S5, S9, S18, S19 and S20 and ten proteins from the large subunit L2, L6, L13, L14, L16, L17, L18, L19, L22 and L27 preferentially take up the label. The results obtained with three proteins from the large subunit, L6, L16 and L27, show a high degree of variability that could reflect differences of conformation in the subunit population. Several proteins were drastically modified by the cross-linking agent but were not detected in the two-dimensional gel electrophoresis (e.g., S1, S11, S21, L7, L8 and L12) and therefore could not be studied.

  14. Analysis of the interaction between bovine mitochondrial 28 S ribosomal subunits and mRNA.

    Science.gov (United States)

    Farwell, M A; Schirawski, J; Hager, P W; Spremulli, L L

    1996-11-11

    The small subunit of the bovine mitochondrial ribosome forms a tight complex with mRNAs. This [28 S:mRNA] complex forms as readily on circular mRNAs as on linear mRNAs indicating that a free 5' end on the mRNA is not required for the interaction observed. The effects of monovalent cations on the equilibrium association constant and on the forward and reverse rate constants governing this interaction have been determined. Monovalent cations have a strong effect on the forward rate constant. Increasing the KCl concentration from 1 mM to 100 mM reduces kon by nearly 100-fold. Monovalent cations have only a small effect on the reverse rate constant, koff'. Analysis of these data indicates that the rate laws governing the formation and dissociation of the [28 S:mRNA] complex cannot be deduced from the chemical equation. This observation suggests that there are "hidden intermediates' in the formation and dissociation of this complex. The implications of these observations are discussed in terms of a model for the interaction between the mitochondrial 28 S subunit and mRNAs.

  15. Pseudoknot in domain II of 23 S rRNA is essential for ribosome function

    DEFF Research Database (Denmark)

    Rosendahl, G; Hansen, L H; Douthwaite, S

    1995-01-01

    The structure of domain II in all 23 S (and 23 S-like) rRNAs is constrained by a pseudoknot formed between nucleotides 1005 and 1138, and between 1006 and 1137 (Escherichia coli numbering). These nucleotides are exclusively conserved as 1005C.1138G and 1006C.1137G pairs in all Bacteria, Archaea...... and chloroplasts, whereas 1005G.1138C and 1006U.1137A pairs occur in Eukarya. We have mutagenized nucleotides 1005C-->G, 1006C-->U, 1137G-->A and 1138G-->C, both individually and in combinations, in a 23 S rRNA gene from the bacterium E. coli. The ability of 23 S rRNA to support cell growth is reduced when either...... "eukaryal" (1005G.1138C or 1006U.1137A) pair and one "bacterial" C.G pair largely restores the structure and function of the rRNA. Bacterial ribosomes containing both these eukaryal pairs also participate in protein synthesis, although at much reduced efficiency, and the structure of their pseudoknot region...

  16. Chemical and structural characterization of a model Post-Termination Complex (PoTC) for the ribosome recycling reaction: Evidence for the release of the mRNA by RRF and EF-G

    Science.gov (United States)

    Iwakura, Nobuhiro; Yokoyama, Takeshi; Quaglia, Fabio; Mitsuoka, Kaoru; Mio, Kazuhiro; Shigematsu, Hideki; Shirouzu, Mikako; Kaji, Akira; Kaji, Hideko

    2017-01-01

    A model Post-Termination Complex (PoTC) used for the discovery of Ribosome Recycling Factor (RRF) was purified and characterized by cryo-electron microscopic analysis and biochemical methods. We established that the model PoTC has mostly one tRNA, at the P/E or P/P position, together with one mRNA. The structural studies were supported by the biochemical measurement of bound tRNA and mRNA. Using this substrate, we establish that the release of tRNA, release of mRNA and splitting of ribosomal subunits occur during the recycling reaction. Order of these events is tRNA release first followed by mRNA release and splitting almost simultaneously. Moreover, we demonstrate that IF3 is not involved in any of the recycling reactions but simply prevents the re-association of split ribosomal subunits. Our finding demonstrates that the important function of RRF includes the release of mRNA, which is often missed by the use of a short ORF with the Shine-Dalgarno sequence near the termination site. PMID:28542628

  17. Fluctuations between multiple EF-G-induced chimeric tRNA states during translocation on the ribosome

    Science.gov (United States)

    Adio, Sarah; Senyushkina, Tamara; Peske, Frank; Fischer, Niels; Wintermeyer, Wolfgang; Rodnina, Marina V.

    2015-06-01

    The coupled translocation of transfer RNA and messenger RNA through the ribosome entails large-scale structural rearrangements, including step-wise movements of the tRNAs. Recent structural work has visualized intermediates of translocation induced by elongation factor G (EF-G) with tRNAs trapped in chimeric states with respect to 30S and 50S ribosomal subunits. The functional role of the chimeric states is not known. Here we follow the formation of translocation intermediates by single-molecule fluorescence resonance energy transfer. Using EF-G mutants, a non-hydrolysable GTP analogue, and fusidic acid, we interfere with either translocation or EF-G release from the ribosome and identify several rapidly interconverting chimeric tRNA states on the reaction pathway. EF-G engagement prevents backward transitions early in translocation and increases the fraction of ribosomes that rapidly fluctuate between hybrid, chimeric and posttranslocation states. Thus, the engagement of EF-G alters the energetics of translocation towards a flat energy landscape, thereby promoting forward tRNA movement.

  18. Bypassing rRNA methylation by RsmA/Dim1during ribosome maturation in the hyperthermophilic archaeon Nanoarchaeum equitans

    DEFF Research Database (Denmark)

    Seistrup, Kenneth H; Rose, Simon; Birkedal, Ulf

    2017-01-01

    In all free-living organisms a late-stage checkpoint in the biogenesis of the small ribosomal subunit involves rRNA modification by an RsmA/Dim1 methyltransferase. The hyperthermophilic archaeon Nanoarchaeum equitans, whose existence is confined to the surface of a second archaeon, Ignicoccus hos...

  19. The functional half-life of an mRNA depends on the ribosome spacing in an early coding region

    DEFF Research Database (Denmark)

    Pedersen, Margit; Nissen, Søren; Mitarai, Namiko;

    2011-01-01

    . Here, we characterize a determinant of the functional stability of an mRNA, which is located in the early coding region. Using literature values for the mRNA half-lives of variant lacZ mRNAs in Escherichia coli, we modeled how the ribosome spacing is affected by the translation rate of the individual...... of slowly translated codons before codon 20 or after codon 45 should shorten or prolong, respectively, the functional mRNA half-life by altering the ribosome density in the important region. These predictions were tested on eight new lacZ variants, and their experimentally determined mRNA half-lives all...

  20. Global shape mimicry of tRNA within a viral internal ribosome entry site mediates translational reading frame selection

    OpenAIRE

    2015-01-01

    Viruses use alternate mechanisms to increase the coding capacity of their viral genomes. The dicistrovirus intergenic region internal ribosome entry site (IRES) adopts an RNA structure that can direct translation in 0 and +1 reading frames to produce the viral structural proteins and an overlapping ORFx product. Here we provide structural and biochemical evidence that the PKI domain of the IRES mimics a complete tRNA-like structure to facilitate reading frame selection and allows the viral IR...

  1. Heterogeneity within the gram-positive anaerobic cocci demonstrated by analysis of 16S-23S intergenic ribosomal RNA polymorphisms.

    Science.gov (United States)

    Hill, K E; Davies, C E; Wilson, M J; Stephens, P; Lewis, M A O; Hall, V; Brazier, J; Thomas, D W

    2002-11-01

    Peptostreptococci are gram-positive, strictly anaerobic bacteria which, although regarded as members of the commensal human microflora, are also frequently isolated from sites of clinical infection. The study of this diverse group of opportunist pathogens has been hindered by an inadequate taxonomy and the lack of a valid identification scheme. Recent re-classification of the Peptostreptococcus family into five distinct genus groups has helped to clarify the situation. However, this has been on the basis of 16S rRNA sequence determinations, which are both time-consuming and expensive. The aim of the present study was to evaluate the use of PCR-amplified ribosomal DNA spacer polymorphisms for the rapid differentiation of the currently recognised taxa within the group of anaerobic gram-positive cocci. A collection comprising 19 reference strains with representatives of each of the 15 species, two close relatives and two of the well-characterised groups, together with 38 test strains was studied. All strains were identified to species group level by phenotypic means. Amplification of the 16S-23S intergenic spacer region (ISR) with universal primers produced distinct banding patterns for all the 19 reference strains and the patterns could be differentiated easily visually. However, of the 38 test strains, less than half could be speciated from ISR analysis alone. Only five groups produced correlating banding patterns for all members tested (Peptoniphilus lacrimalis, P. ivorii, Anaerococcus octavius, Peptostreptococcus anaerobius and Micromonas micros). For other species, either the type strain differed significantly from other species members (e.g., A. hydrogenalis) or there appeared to be considerable intra-species variation (e.g., A. vaginalis). Partial 16S rRNA gene sequences for the 'trisimilis' and 'betaGAL' groups showed that both are most closely related to the Anaerococcus group. This work highlights the heterogeneous nature of a number of Peptostreptococcus

  2. Photoinduced cross-linkage, in situ, of Escherichia coli 30S ribosomal proteins to 16S rRNA: identification of cross-linked proteins and relationships between reactivity and ribosome structure.

    Science.gov (United States)

    Gorelic, L

    1976-08-10

    The kinetics of photoinduced cross-linkage of Escherichia coli 30S ribosomal proteins to the 16S-rRNA molecule in the intact Escherichia coli 30S ribosomal subunit was studied in this report. All of the 30S ribosomal proteins become cross-linked to the 16S rRNA before changes in the sedimentation characteristics of the 30S ribosomal subunit can be detected. The proteins exhibit different reactivities in the cross-linkage reaction. One group of proteins-S3, S7-S9, S11, S12, and S15-S19-is cross-linked to the 16S rRNA by single-hit kinetics, or by photoprocesses of nonunity but low multiplicities. A second group of proteins--S1, S2, S4-S6, S10, S13, S14, and S21--is cross-linked to the 16S rRNA by photoprocesses of a complex nature. A comparison of these data with other properties of the individual 30S ribosomal proteins related to ribosome structure indicated that most of the 30S ribosomal proteins cross-linked to the 16S rRNA by photoprocesses of low multiplicities had been classified rRNA-binding proteins by nonphotochemical methods, and most of the proteins cross-linked to the 16S rRNA by photoprocesses of large multiplicities had been classified as nonbinding proteins. There were certain exceptions to these correlations. Proteins S4 and S20, both RNA-binding proteins, become cross-linked to the 16S rRNA by photoprocessses of large multiplicities, and proteins S3, S11, S12, and S18, none of which have been classified RNA-binding proteins, exhibited low multiplicities in the cross-linkage reaction. All of these exceptions could be explained in terms of limitations inherent in the photochemical methods used in this study and in other types of methods that have been used to study RNA-protein interactions in the 30S ribosomal subunit. The data presented here also suggest that labile RNA-protein cross-links are present in the uv-irradiated 30S ribosomal subunits, and that neither peptide-bond cleavage nor photoinduced modification of the charged side-chain groups in

  3. Optimal eukaryotic 18S and universal 16S/18S ribosomal RNA primers and their application in a study of symbiosis.

    Science.gov (United States)

    Wang, Yong; Tian, Ren Mao; Gao, Zhao Ming; Bougouffa, Salim; Qian, Pei-Yuan

    2014-01-01

    Eukaryotic 18S ribosomal RNA (rRNA) gene primers that feature a wide coverage are critical in detecting the composition of eukaryotic microscopic organisms in ecosystems. Here, we predicted 18S rRNA primers based on consecutive conserved sites and evaluated their coverage efficiency and scope of application to different eukaryotic groups. After evaluation, eight of them were considered as qualified 18S primers based on coverage rate. Next, we examined common conserved regions in prokaryotic 16S and eukaryotic 18S rRNA sequences to design 16S/18S universal primers. Three 16S/18S candidate primers, U515, U1390 and U1492, were then considered to be suitable for simultaneous amplification of the rRNA sequences in three domains. Eukaryotic 18S and prokaryotic 16S rRNA genes in a sponge were amplified simultaneously using universal primers U515 and U1390, and the subsequent sorting of pyrosequenced reads revealed some distinctive communities in different parts of the sample. The real difference in biodiversity between prokaryotic and eukaryotic symbionts could be discerned as the dissimilarity between OTUs was increased from 0.005 to 0.1. A network of the communities in external and internal parts of the sponge illustrated the co-variation of some unique microbes in certain parts of the sponge, suggesting that the universal primers are useful in simultaneous detection of prokaryotic and eukaryotic microbial communities.

  4. Optimal eukaryotic 18S and universal 16S/18S ribosomal RNA primers and their application in a study of symbiosis.

    Directory of Open Access Journals (Sweden)

    Yong Wang

    Full Text Available Eukaryotic 18S ribosomal RNA (rRNA gene primers that feature a wide coverage are critical in detecting the composition of eukaryotic microscopic organisms in ecosystems. Here, we predicted 18S rRNA primers based on consecutive conserved sites and evaluated their coverage efficiency and scope of application to different eukaryotic groups. After evaluation, eight of them were considered as qualified 18S primers based on coverage rate. Next, we examined common conserved regions in prokaryotic 16S and eukaryotic 18S rRNA sequences to design 16S/18S universal primers. Three 16S/18S candidate primers, U515, U1390 and U1492, were then considered to be suitable for simultaneous amplification of the rRNA sequences in three domains. Eukaryotic 18S and prokaryotic 16S rRNA genes in a sponge were amplified simultaneously using universal primers U515 and U1390, and the subsequent sorting of pyrosequenced reads revealed some distinctive communities in different parts of the sample. The real difference in biodiversity between prokaryotic and eukaryotic symbionts could be discerned as the dissimilarity between OTUs was increased from 0.005 to 0.1. A network of the communities in external and internal parts of the sponge illustrated the co-variation of some unique microbes in certain parts of the sponge, suggesting that the universal primers are useful in simultaneous detection of prokaryotic and eukaryotic microbial communities.

  5. Short RNA indicator sequences are not completely degraded by autoclaving

    Science.gov (United States)

    Unnithan, Veena V.; Unc, Adrian; Joe, Valerisa; Smith, Geoffrey B.

    2014-01-01

    Short indicator RNA sequences (autoclaving and are recovered intact by molecular amplification. Primers targeting longer sequences are most likely to produce false positives due to amplification errors easily verified by melting curves analyses. If short indicator RNA sequences are used for virus identification and quantification then post autoclave RNA degradation methodology should be employed, which may include further autoclaving. PMID:24518856

  6. Ribosomal RNA genes challenge the monophyly of the Hyalospheniidae (Amoebozoa: Arcellinida)

    DEFF Research Database (Denmark)

    Lara, Enrique; Heger, Thierry J; Ekelund, Flemming

    2008-01-01

    To date only five partial and two complete SSU rRNA gene sequences are available for the lobose testate amoebae (Arcellinida). Consequently, the phylogenetic relationships among taxa and the definition of species are still largely dependant on morphological characters of uncertain value, which...

  7. A mutation in the 530 loop of Escherichia coli 16S ribosomal RNA causes resistance to streptomycin.

    OpenAIRE

    1988-01-01

    Oligonucleotide-directed mutagenesis was used to introduce an A to C transversion at position 523 in the 16S ribosomal RNA gene of Escherichia coli rrnB operon cloned in plasmid pKK3535. E. coli cells transformed with the mutated plasmid were resistant to streptomycin. The mutated ribosomes isolated from these cells were not stimulated by streptomycin to misread the message in a poly(U)-directed assay. They were also restrictive to the stimulation of misreading by other error-promoting relate...

  8. Chromosomal organization of the ribosomal RNA genes in the genus Chironomus (Diptera, Chironomidae

    Directory of Open Access Journals (Sweden)

    Larisa Gunderina

    2015-05-01

    Full Text Available Chromosomal localization of ribosomal RNA coding genes has been studied by using FISH (fluorescence in situ hybridization in 21 species from the genus Chironomus Meigen, 1803. Analysis of the data has shown intra- and interspecific variation in number and location of 5.8S rDNA hybridization sites in 17 species from the subgenus Chironomus and 4 species from the subgenus Camptochironomus Kieffer, 1914. In the majority of studied species the location of rDNA sites coincided with the sites where active NORs (nucleolus organizer regions were found. The number of hybridization sites in karyotypes of studied chironomids varied from 1 to 6. More than half of the species possessed only one NOR (12 out of 21. Two rDNA hybridization sites were found in karyotypes of five species, three – in two species, and five and six sites – in one species each. NORs were found in all chromosomal arms of species from the subgenus Chironomus with one of them always located on arm G. On the other hand, no hybridization sites were found on arm G in four studied species from the subgenus Camptochironomus. Two species from the subgenus Chironomus – Ch. balatonicus Devai, Wuelker & Scholl, 1983 and Ch. “annularius” sensu Strenzke, 1959 – showed intraspecific variability in the number of hybridization signals. Possible mechanisms of origin of variability in number and location of rRNA genes in the karyotypes of species from the genus Chironomus are discussed.

  9. Clinical identification of bacteria in human chronic wound infections: culturing vs. 16S ribosomal DNA sequencing

    Directory of Open Access Journals (Sweden)

    Rhoads Daniel D

    2012-11-01

    Full Text Available Abstract Background Chronic wounds affect millions of people and cost billions of dollars in the United States each year. These wounds harbor polymicrobial biofilm communities, which can be difficult to elucidate using culturing methods. Clinical molecular microbiological methods are increasingly being employed to investigate the microbiota of chronic infections, including wounds, as part of standard patient care. However, molecular testing is more sensitive than culturing, which results in markedly different results being reported to clinicians. This study compares the results of aerobic culturing and molecular testing (culture-free 16S ribosomal DNA sequencing, and it examines the relative abundance score that is generated by the molecular test and the usefulness of the relative abundance score in predicting the likelihood that the same organism would be detected by culture. Methods Parallel samples from 51 chronic wounds were studied using aerobic culturing and 16S DNA sequencing for the identification of bacteria. Results One hundred forty-five (145 unique genera were identified using molecular methods, and 68 of these genera were aerotolerant. Fourteen (14 unique genera were identified using aerobic culture methods. One-third (31/92 of the cultures were determined to be Staphylococcus aureus, Pseudomonas aeruginosa, and Enterococcus faecalis with higher relative abundance scores were more likely to be detected by culture as demonstrated with regression modeling. Conclusion Discordance between molecular and culture testing is often observed. However, culture-free 16S ribosomal DNA sequencing and its relative abundance score can provide clinicians with insight into which bacteria are most abundant in a sample and which are most likely to be detected by culture.

  10. Functional variants of 5S rRNA in the ribosomes of common sea urchin Paracentrotus lividus.

    Science.gov (United States)

    Dimarco, Eufrosina; Cascone, Eleonora; Bellavia, Daniele; Caradonna, Fabio

    2012-10-15

    We have previously reported a molecular and cytogenetic characterization of three different 5S rDNA clusters in the sea urchin Paracentrotus lividus; this study, performed at DNA level only, lends itself as starting point to verify that these clusters could contain transcribed genes, then, to demonstrate the presence of heterogeneity at functional RNA level, also. In the present work we report in P. lividus ribosomes the existence of several transcribed variants of the 5S rRNA and we associate all transcribed variants to the cluster to which belong. Our finding is the first demonstration of the presence of high heterogeneity in functional 5S rRNA molecules in animal ribosomes, a feature that had been considered a peculiarity of some plants.

  11. Phylogenetics of the brachyuran crabs (Crustacea: Decapoda): the status of Podotremata based on small subunit nuclear ribosomal RNA.

    Science.gov (United States)

    Ahyong, Shane T; Lai, Joelle C Y; Sharkey, Deirdre; Colgan, Donald J; Ng, Peter K L

    2007-11-01

    The true crabs, the Brachyura, are generally divided into two major groups: Eubrachyura or 'advanced' crabs, and Podotremata or 'primitive' crabs. The status of Podotremata is one of the most controversial issues in brachyuran systematics. The podotreme crabs, best recognised by the possession of gonopores on the coxae of the pereopods, have variously been regarded as mono-, para- or polyphyletic, or even as non-brachyuran. For the first time, the phylogenetic positions of the podotreme crabs were studied by cladistic analysis of small subunit nuclear ribosomal RNA sequences. Eight of 10 podotreme families were represented along with representatives of 17 eubrachyuran families. Under both maximum parsimony and Bayesian Inference, Podotremata was found to be significantly paraphyletic, comprising three major clades: Dromiacea, Raninoida, and Cyclodorippoida. The most 'basal' is Dromiacea, followed by Raninoida and Cylodorippoida. Notably, Cyclodorippoida was identified as the sister group of the Eubrachyura. Previous hypotheses that the dromiid crab, Hypoconcha, is an anomuran were unsupported, though Dromiidae as presently composed could be paraphyletic. Topologies constrained for podotreme monophyly were found to be significantly worse (P < 0.04) than unconstrained topologies under Templeton and S-H tests. The clear pattern of podotreme paraphyly and robustness of topologies recovered indicates that Podotremata as a formal concept is untenable. Relationships among the eubrachyurans were generally equivocal, though results indicate the majoids or dorippoids were the least derived of the Eubrachyura. A new high level classification of the Brachyura is proposed.

  12. Distribution of dwell times of a ribosome: effects of infidelity, kinetic proofreading and ribosome crowding.

    Science.gov (United States)

    Sharma, Ajeet K; Chowdhury, Debashish

    2011-04-01

    Ribosome is a molecular machine that polymerizes a protein where the sequence of the amino acid residues, the monomers of the protein, is dictated by the sequence of codons (triplets of nucleotides) on a messenger RNA (mRNA) that serves as the template. The ribosome is a molecular motor that utilizes the template mRNA strand also as the track. Thus, in each step the ribosome moves forward by one codon and, simultaneously, elongates the protein by one amino acid. We present a theoretical model that captures most of the main steps in the mechanochemical cycle of a ribosome. The stochastic movement of the ribosome consists of an alternating sequence of pause and translocation; the sum of the durations of a pause and the following translocation is the time of dwell of the ribosome at the corresponding codon. We derive the analytical expression for the distribution of the dwell times of a ribosome in our model. Wherever experimental data are available, our theoretical predictions are consistent with those results. We suggest appropriate experiments to test the new predictions of our model, particularly the effects of the quality control mechanism of the ribosome and that of their crowding on the mRNA track.

  13. HIV-1 frameshift efficiency is primarily determined by the stability of base pairs positioned at the mRNA entrance channel of the ribosome.

    Science.gov (United States)

    Mouzakis, Kathryn D; Lang, Andrew L; Vander Meulen, Kirk A; Easterday, Preston D; Butcher, Samuel E

    2013-02-01

    The human immunodeficiency virus (HIV) requires a programmed -1 ribosomal frameshift for Pol gene expression. The HIV frameshift site consists of a heptanucleotide slippery sequence (UUUUUUA) followed by a spacer region and a downstream RNA stem-loop structure. Here we investigate the role of the RNA structure in promoting the -1 frameshift. The stem-loop was systematically altered to decouple the contributions of local and overall thermodynamic stability towards frameshift efficiency. No correlation between overall stability and frameshift efficiency is observed. In contrast, there is a strong correlation between frameshift efficiency and the local thermodynamic stability of the first 3-4 bp in the stem-loop, which are predicted to reside at the opening of the mRNA entrance channel when the ribosome is paused at the slippery site. Insertion or deletions in the spacer region appear to correspondingly change the identity of the base pairs encountered 8 nt downstream of the slippery site. Finally, the role of the surrounding genomic secondary structure was investigated and found to have a modest impact on frameshift efficiency, consistent with the hypothesis that the genomic secondary structure attenuates frameshifting by affecting the overall rate of translation.

  14. Nuclear Ribosomal RNA Small Subunit (18S rRNA) Nucleotide Sequen Nuclear Ribosomal RNA Small Subunit (18S rRNA) Nucleotide Sequen cing and Characterization of Sailonggu(Whole Bone of Myospalax baileyi Thomas)cing%塞隆骨原动物高原鼢鼠核基因18S rRNA序列测定与分析

    Institute of Scientific and Technical Information of China (English)

    曹晖; 刘玉萍; 张绍来; 周开亚

    2001-01-01

    目的:测定仓鼠科动物高原鼢鼠Myospalax b aileyi的核rDNA基因序列,为塞隆骨正品基原检定提供分子依据。方法:采用PCR直接测序技术测定高原鼢鼠18S rRNA基因核苷酸序列并作序列特征分析。[ HT5”H〗结果:高原鼢鼠的18S rRNA序列长度为1 851 bp。根据排序比较,高原鼢鼠与2种鼠科动物间的DNA序列同源性 为72.04%~72.18%。结论:通过基因序列分析,DNA测序技术可成为 塞隆骨正品基原检定的准确有效手段。%Objective: Sequencing the nuclear ribosomal RNA small subunit (18S r RNA) gene of Myospalax baileyi (Cricetidae) to develop an ultimate and defi nitive means for origin identification of genuine Sailonggu. Methods: The total DNA wa s prepared from dried tail tissues. The nuclear 18S rRNA gene region was amplifi ed by PCR using a consensus primer set and its nucleotide sequence was determine d by PCR direct sequencing. The characteristic analysis of 18S rRNA sequences wa s generated usin software program Genetyx-SV/R Version 10.1. Results: The entire 18S rRNA gene region of M. baileyi spanned 1851 bp in length. Althou gh m ultiple alignment of sequence indicates that there are only lower homology (72.0 4%~72.18%)comparing with its two alias Mus musculus (GenBank Accession numb er X 00686)and Rattus norvegicus (M11188)(Muridae), their highly conservative dom ain i s located in 1020~1509 nt. There are many variable sites from upstream of 5'-e nd , which coud provide a novel information for molecular recognition of Sailonggu. Conclusion:DNA sequencing could be a useful and reliable tool in the origin identification of genuine Sailonggu.

  15. Binding site for Xenopus ribosomal protein L5 and accompanying structural changes in 5S rRNA.

    Science.gov (United States)

    Scripture, J Benjamin; Huber, Paul W

    2011-05-10

    The structure of the eukaryotic L5-5S rRNA complex was investigated in protection and interference experiments and is compared with the corresponding structure (L18-5S rRNA) in the Haloarcula marismortui 50S subunit. In close correspondence with the archaeal structure, the contact sites for the eukaryotic ribosomal protein are located primarily in helix III and loop C and secondarily in loop A and helix V. While the former is unique to L5, the latter is also a critical contact site for transcription factor IIIA (TFIIIA), accounting for the mutually exclusive binding of these two proteins to 5S RNA. The binding of L5 causes structural changes in loops B and C that expose nucleotides that contact the Xenopus L11 ortholog in H. marismortui. This induced change in the structure of the RNA reveals the origins of the cooperative binding to 5S rRNA that has been observed for the bacterial counterparts of these proteins. The native structure of helix IV and loop D antagonizes binding of L5, indicating that this region of the RNA is dynamic and also influenced by the protein. Examination of the crystal structures of Thermus thermophilus ribosomes in the pre- and post-translocation states identified changes in loop D and in the surrounding region of 23S rRNA that support the proposal that 5S rRNA acts to transmit information between different functional domains of the large subunit.

  16. Limited portability of G-patch domains in regulators of the Prp43 RNA helicase required for pre-mRNA splicing and ribosomal RNA maturation in Saccharomyces cerevisiae.

    Science.gov (United States)

    Banerjee, Daipayan; McDaniel, Peter M; Rymond, Brian C

    2015-05-01

    The Prp43 DExD/H-box protein is required for progression of the biochemically distinct pre-messenger RNA and ribosomal RNA (rRNA) maturation pathways. In Saccharomyces cerevisiae, the Spp382/Ntr1, Sqs1/Pfa1, and Pxr1/Gno1 proteins are implicated as cofactors necessary for Prp43 helicase activation during spliceosome dissociation (Spp382) and rRNA processing (Sqs1 and Pxr1). While otherwise dissimilar in primary sequence, these Prp43-binding proteins each contain a short glycine-rich G-patch motif required for function and thought to act in protein or nucleic acid recognition. Here yeast two-hybrid, domain-swap, and site-directed mutagenesis approaches are used to investigate G-patch domain activity and portability. Our results reveal that the Spp382, Sqs1, and Pxr1 G-patches differ in Prp43 two-hybrid response and in the ability to reconstitute the Spp382 and Pxr1 RNA processing factors. G-patch protein reconstitution did not correlate with the apparent strength of the Prp43 two-hybrid response, suggesting that this domain has function beyond that of a Prp43 tether. Indeed, while critical for Pxr1 activity, the Pxr1 G-patch appears to contribute little to the yeast two-hybrid interaction. Conversely, deletion of the primary Prp43 binding site within Pxr1 (amino acids 102-149) does not impede rRNA processing but affects small nucleolar RNA (snoRNA) biogenesis, resulting in the accumulation of slightly extended forms of select snoRNAs, a phenotype unexpectedly shared by the prp43 loss-of-function mutant. These and related observations reveal differences in how the Spp382, Sqs1, and Pxr1 proteins interact with Prp43 and provide evidence linking G-patch identity with pathway-specific DExD/H-box helicase activity.

  17. Evolutionary relationships within the protostome phylum Sipuncula: a molecular analysis of ribosomal genes and histone H3 sequence data.

    Science.gov (United States)

    Maxmen, Amy B; King, Burnett F; Cutler, Edward B; Giribet, Gonzalo

    2003-06-01

    The phylogenetic relationships of the members of the phylum Sipuncula are investigated by means of DNA sequence data from three nuclear markers, two ribosomal genes (18S rRNA and the D3 expansion fragment of 28S rRNA), and one protein-coding gene, histone H3. Phylogenetic analysis via direct optimization of DNA sequence data using parsimony as optimality criterion is executed for 12 combinations of parameter sets accounting for different indel costs and transversion/transition cost ratios in a sensitivity analysis framework. Alternative outgroup analyses are also performed to test whether they affected rooting of the sipunculan topology. Nodal support is measured by parsimony jackknifing and Bremer support values. Results from the different partitions are highly congruent, and the combined analysis for the parameter set that minimizes overall incongruence supports monophyly of Sipuncula, but nonmonophyly of several higher taxa recognized for the phylum. Mostly responsible for this is the split of the family Sipunculidae in three main lineages, with the genus Sipunculus being the sister group to the remaining sipunculans, the genus Phascolopsis nesting within the Golfingiiformes, and the genus Siphonosoma being associated to the Phascolosomatidea. Other interesting results are the position of Phascolion within Golfingiidae and the position of Antillesoma within Aspidosiphonidae. These results are not affected by the loci selected or by the outgroup chosen. The position of Apionsoma is discussed, although more data would be needed to better ascertain its phylogenetic affinities. Monophyly of the genera with multiple representatives (Themiste, Aspidosiphon, and Phascolosoma) is well supported, but not the monophyly of the genera Nephasoma or Golfingia. Interesting phylogeographic questions arise from analysis of multiple representatives of a few species.

  18. Phylogenetic analysis of Bambusa (Poaceae: Bambusoideae) based on internal transcribed spacer sequences of nuclear ribosomal DNA.

    Science.gov (United States)

    Sun, Ye; Xia, Nianhe; Lin, Rushun

    2005-12-01

    Phylogenetic analyses of Bambusa species were performed using internal transcribed spacer sequences of nuclear ribosomal DNA. The 21 species sampled included members of Bambusa (sensu stricto), Dendrocalamopsis, Dendrocalamus, Guadua, Leleba, and Lingnania. Arundinaria gigantea was used as an outgroup. Using the maximum parsimony method with PAUP*, gaps were treated as missing states or new states. Parsimonious analysis revealed that Dendrocalamus latiflorus was closely related to the members of Dendrocalamopsis. Dendrocalamus membranaceus was a sister species to Dendrocalamus strictus. Three Dendrocalamus species were closely related to and nested in a polyphyletic Bambusa. Bambusa subaequalis was a sister species to B. multiplex, B. emeiensis to B. chungii, B. contracta to B. hainanensis, and B. flexuosa was a sister species to B. sinospinosa, B. tuldoides, B. surrecta, B. intermedia, and B. valida group, which raised doubts about the monophyly of the subgenera Bambusa (sensu stricto), Dendrocalamopsis, Leleba, and Lingnania under the genus Bambusa.

  19. Evidence for compensatory evolution of ribosomal proteins in response to rapid divergence of mitochondrial rRNA.

    Science.gov (United States)

    Barreto, Felipe S; Burton, Ronald S

    2013-02-01

    Rapid evolution of mitochondrial DNA (mtDNA) places intrinsic selective pressures on many nuclear genes involved in mitochondrial functions. Mitochondrial ribosomes, for example, are composed of mtDNA-encoded ribosomal RNAs (rRNAs) and a set of more than 60 nuclear-encoded ribosomal proteins (mRP) distinct from the cytosolic RPs (cRP). We hypothesized that the rapid divergence of mt-rRNA would result in rapid evolution of mRPs relative to cRPs, which respond to slowly evolving nuclear-encoded rRNA. In comparisons of rates of nonsynonymous and synonymous substitutions between a pair of divergent populations of the copepod Tigriopus californicus, we found that mRPs showed elevated levels of amino acid changes relative to cRPs. This pattern was equally strong at the interspecific level, between three pairs of sister species (Nasonia vitripennis vs. N. longicornis, Drosophila melanogaster vs. D. simulans, and Saccharomyces cerevisae vs. S. paradoxus). This high rate of mRP evolution may result in intergenomic incompatibilities between taxonomic lineages, and such incompatibilities could lead to dysfunction of mitochondrial ribosomes and the loss of fitness observed among interpopulation hybrids in T. californicus and interspecific hybrids in other species.

  20. 16S rRNA sequences of uncultivated hot spring cyanobacterial mat inhabitants retrieved as randomly primed cDNA

    Energy Technology Data Exchange (ETDEWEB)

    Weller, R.; Ward, D.M. (Montana State Univ., Bozeman (United States)); Weller, J.W. (Univ. of Montana, Missoula (United States))

    1991-04-01

    Cloning and analysis of cDNAs synthesized from rRNAs is one approach to assess the species composition of natural microbial communities. In some earlier attempts to synthesize cDNA from 16S rRNA (16S rcDNA) from the Octopus Spring cyanobacterial mat, a dominance of short 16S rcDNAs was observed, which appear to have originated only from certain organisms. Priming of cDNA synthesis from small ribosomal subunit RNA with random deoxyhexanucleotides can retrieve longer sequences, more suitable for phylogenetic analysis. Here we report the retrieval of 16S rRNA sequences form three formerly uncultured community members. One sequence type, which was retrieved three times from a total of five sequences analyzed, can be placed in the cyanobacterial phylum. A second sequence type is related to 16S rRNAs from green nonsulfur bacteria. The third sequence type may represent a novel phylogenetic type.

  1. Phylogenetic position of the genus Perkinsus (Protista, Apicomplexa) based on small subunit ribosomal RNA.

    Science.gov (United States)

    Goggin, C L; Barker, S C

    1993-07-01

    Parasites of the genus Perkinsus destroy marine molluscs worldwide. Their phylogenetic position within the kingdom Protista is controversial. Nucleotide sequence data (1792 bp) from the small subunit rRNA gene of Perkinsus sp. from Anadara trapezia (Mollusca: Bivalvia) from Moreton Bay, Queensland, was used to examine the phylogenetic affinities of this enigmatic genus. These data were aligned with nucleotide sequences from 6 apicomplexans, 3 ciliates, 3 flagellates, a dinoflagellate, 3 fungi, maize and human. Phylogenetic trees were constructed after analysis with maximum parsimony and distance matrix methods. Our analyses indicate that Perkinsus is phylogenetically closer to dinoflagellates and to coccidean and piroplasm apicomplexans than to fungi or flagellates.

  2. Comparison of Biolog GEN III MicroStation semi-automated bacterial identification system with matrix-assisted laser desorption ionization-time of flight mass spectrometry and 16S ribosomal RNA gene sequencing for the identification of bacteria of veterinary interest.

    Science.gov (United States)

    Wragg, P; Randall, L; Whatmore, A M

    2014-10-01

    Recent advances in phenotypic and chemotaxonomic methods have improved the ability of systems to resolve bacterial identities at the species level. Key to the effective use of these systems is the ability to draw upon databases which can be augmented with new data gleaned from atypical or novel isolates. In this study we compared the performance of the Biolog GEN III identification system (hereafter, GEN III) with matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS) and 16S rRNA gene sequencing in the identification of isolates of veterinary interest. The use of strains that had proven more difficult to identify by routine methods was designed to test the systems' abilities at the extremes of their performance range. Over an 18month period, 100 strains were analysed by all three methods. To highlight the importance of identification to species level, a weighted scoring system was devised to differentiate the capacity to identify at genus and species levels. The overall relative weighted scores were 0.869:0.781:0.769, achieved by 16S rRNA gene sequencing, GEN III and MALDI-TOF MS respectively, when compared to the 'gold standard'. Performance to the genus level was significantly better using 16S rRNA gene sequencing; however, performance to the species level was similar for all three systems.

  3. Analysis of the relationship between ribosomal DNA ITS sequences and active components in Rhodiola plants.

    Science.gov (United States)

    Zhang, D J; Yuan, W T; Li, M T; Zhang, Y H

    2016-12-23

    Rhodiola plants are a valuable resource in traditional Chinese medicine. The objective of this study was to evaluate the correlation between ribosomal DNA internal transcribed spacer (ITS) sequences and the three active components in Rhodiola plants. For this, we determined ITS sequence polymorphisms and the concentrations of active components salidroside, tyrosol, and gallic acid in different Rhodiola species from the Tibetan Plateau. In a total of 23 Rhodiola samples, 16 different haplotypes were defined based on their ITS sequences. Analysis of the active components in these same samples revealed that salidroside was not detected in species with haplotypes H4, H5, or H10, tyrosol was not detected with haplotypes H3, H5, H7, H10, H14, or H15, and gallic acid was detected in with all haplotypes except H14 and H15. In addition, the concentrations of salidroside, tyrosol and gallic acid varied between samples with different haplotypes as well as those with the same haplotype, implying that no significant correlation exists between haplotype and salidroside, tyrosol or gallic acid concentrations. However, a statistically significant positive correlation was observed for among these three active components.

  4. Origin and relationships of Saintpaulia (Gesneriaceae) based on ribosomal DNA internal transcribed spacer (ITS) sequences.

    Science.gov (United States)

    Moller, M; Cronk, Q

    1997-07-01

    Phylogenetic relationships of eight species of Saintpaulia H. Wendl., 19 species of Streptocarpus Lindl. (representing all major growth forms within the genus), and two outgroups (Haberlea rhodopensis Friv., Chirita spadiciformis W. T. Wang) were examined using comparative nucleotide sequences from the two internal transcribed spacers (ITS) of nuclear ribosomal DNA. The length of the ITS 1 region ranged from 228 to 249 base pairs (bp) and the ITS 2 region from 196 to 245 bp. Pairwise sequence divergence across both spacers for ingroup and outgroup species ranged from 0 to 29%. Streptocarpus is not monophyletic, and Saintpaulia is nested within Streptocarpus subgenus Streptocarpella. Streptocarpus subgenus Streptocarpus is monophyletic. The ITS sequence data demonstrate that the unifoliate Streptocarpus species form a clade, and are also characterized by a unique 47-bp deletion in ITS 2. The results strongly support the monophyly of (1) Saintpaulia, and (2) Saintpaulia plus the African members of the subgenus Streptocarpella of Streptocarpus. The data suggest the evolution of Saintpaulia from Streptocarpus subgenus Streptocarpella. The differences in flower and vegetative characters are probably due to ecological adaptation leading to a relatively rapid radiation of Saintpaulia.

  5. A phylogeny of the Passerida (Aves:Passeriformes) based on mitochondrial 12S ribosomal RNA gene

    Institute of Scientific and Technical Information of China (English)

    Lina Wu; Yanfeng Sun; Juyong Li; Yaqing Li; Yuefeng Wu; and Dongming Li

    2015-01-01

    Background:Passerida is the largest avian radiation within the order Passeriformes. Current understanding of the high-level relationships within Passerida is based on DNA–DNA hybridizations;however, the phylogenetic relationships within this assemblage have been the subject of many debates. Methods:We analyzed the 12S ribosomal RNA gene from 49 species of Passerida, representing 14 currently recognized families, to outline the phylogenetic relationships within this group. Results:Our results identified the monophyly of the three superfamilies in Passerida:Sylvioidea, Muscicapoidea and Passeroidea. However, current delimitation of some species is at variance with our phylogeny estimate. First, the Parus major, which had been placed as a distinct clade sister to Sylvioidea was identified as a member of the super family;second, the genus Regulus was united with the Sturnidae and nested in the Muscicapoidea clade instead of being a clade of Passerida. Conclusion:Our results were consistent with Johansson’s study of the three superfamilies except for the al ocation of two families, Paridae and Regulidae.

  6. A telescope for the RNA universe : novel bioinformatic approaches to analyze RNA sequencing data

    NARCIS (Netherlands)

    Pulyakhina, Irina

    2016-01-01

    In this thesis I focus on the application of bioinformatics to analyze RNA. The type of experimental data of interest is sequencing data generated with various Next Generation Sequencing technique: nuclear RNA, cytoplasmic RNA, captured polyadenylated RNA fragments, etc. I highlight the necessity in

  7. Insulin receptor substrate-1 (IRS-1 associates with small nucleolar RNA which contributes to ribosome biogenesis

    Directory of Open Access Journals (Sweden)

    Atsufumi eOzoe

    2014-03-01

    Full Text Available Insulin receptor substrates (IRSs are well known to play crucial roles in mediating intracellular signals of insulin-like growth factors (IGFs/insulin. Previously we showed that IRS-1 forms high molecular mass complexes containing RNAs. To identify RNAs in IRS-1 complexes, we performed UV cross-linking and immunoprecipitation (CLIP analysis using HEK293 cells expressing FLAG-IRS-1 and FLAG-IRS-2. We detected the radioactive signals in the immunoprecipitates of FLAG-IRS-1 proportional to the UV irradiation, but not in the immunoprecipitates of FLAG-IRS-2, suggesting the direct contact of RNAs with IRS-1. RNAs cross-linked to IRS-1 were then amplified by RT-PCR, followed by sequence analysis. We isolated sequence tags attributed to 25 messenger RNAs and 8 non-coding RNAs, including small nucleolar RNAs (snoRNAs. We focused on the interaction of IRS-1 with U96A snoRNA (U96A and its host Rack1 (receptor for activated C kinase 1 pre-mRNA. We confirmed the interaction of IRS-1 with U96A, and with RACK1 pre-mRNA by immunoprecipitation with IRS-1 followed by Northern blotting or RT-PCR analyses. Mature U96A in IRS-1-/- mouse embryonic fibroblasts was quantitatively less than WT. We also found that a part of nuclear IRS-1 is localized in the Cajal body, a nuclear subcompartment where snoRNA mature. The unanticipated function of IRS-1 in snoRNA biogenesis highlights the potential of RNA-associated IRS-1 complex to open a new line of investigation to dissect the novel mechanisms regulating IGFs/insulin-mediated biological events.

  8. Transcriptional repressor NIR functions in the ribosome RNA processing of both 40S and 60S subunits.

    Science.gov (United States)

    Wu, Jianguo; Zhang, Ying; Wang, Yingshuang; Kong, Ruirui; Hu, Lelin; Schuele, Roland; Du, Xiaojuan; Ke, Yang

    2012-01-01

    NIR was identified as an inhibitor of histone acetyltransferase and it represses transcriptional activation of p53. NIR is predominantly localized in the nucleolus and known as Noc2p, which is involved in the maturation of the 60S ribosomal subunit. However, how NIR functions in the nucleolus remains undetermined. In the nucleolus, a 47S ribosomal RNA precursor (pre-rRNA) is transcribed and processed to produce 18S, 5.8S and 28S rRNAs. The 18S rRNA is incorporated into the 40S ribosomal subunit, whereas the 28S and 5.8S rRNAs are incorporated into the 60S subunit. U3 small nucleolar RNA (snoRNA) directs 18S rRNA processing and U8 snoRNA mediates processing of 28S and 5.8 S rRNAs. Functional disruption of nucleolus often causes p53 activation to inhibit cell proliferation. Western blotting showed that NIR is ubiquitously expressed in different human cell lines. Knock-down of NIR by siRNA led to inhibition of the 18S, 28S and 5.8S rRNAs evaluated by pulse-chase experiment. Pre-rRNA particles (pre-rRNPs) were fractionated from the nucleus by sucrose gradient centrifugation and analysis of the pre-RNPs components showed that NIR existed in the pre-RNPs of both the 60S and 40S subunits and co-fractionated with 32S and 12S pre-rRNAs in the 60S pre-rRNP. Protein-RNA binding experiments demonstrated that NIR is associated with the 32S pre-rRNA and U8 snoRNA. In addition, NIR bound U3 snoRNA. It is a novel finding that depletion of NIR did not affect p53 protein level but de-repressed acetylation of p53 and activated p21. We provide the first evidence for a transcriptional repressor to function in the rRNA biogenesis of both the 40S and 60S subunits. Our findings also suggested that a nucleolar protein may alternatively signal to p53 by affecting the p53 modification rather than affecting p53 protein level.

  9. Transcriptional repressor NIR functions in the ribosome RNA processing of both 40S and 60S subunits.

    Directory of Open Access Journals (Sweden)

    Jianguo Wu

    Full Text Available BACKGROUND: NIR was identified as an inhibitor of histone acetyltransferase and it represses transcriptional activation of p53. NIR is predominantly localized in the nucleolus and known as Noc2p, which is involved in the maturation of the 60S ribosomal subunit. However, how NIR functions in the nucleolus remains undetermined. In the nucleolus, a 47S ribosomal RNA precursor (pre-rRNA is transcribed and processed to produce 18S, 5.8S and 28S rRNAs. The 18S rRNA is incorporated into the 40S ribosomal subunit, whereas the 28S and 5.8S rRNAs are incorporated into the 60S subunit. U3 small nucleolar RNA (snoRNA directs 18S rRNA processing and U8 snoRNA mediates processing of 28S and 5.8 S rRNAs. Functional disruption of nucleolus often causes p53 activation to inhibit cell proliferation. METHODOLOGY/PRINCIPAL FINDINGS: Western blotting showed that NIR is ubiquitously expressed in different human cell lines. Knock-down of NIR by siRNA led to inhibition of the 18S, 28S and 5.8S rRNAs evaluated by pulse-chase experiment. Pre-rRNA particles (pre-rRNPs were fractionated from the nucleus by sucrose gradient centrifugation and analysis of the pre-RNPs components showed that NIR existed in the pre-RNPs of both the 60S and 40S subunits and co-fractionated with 32S and 12S pre-rRNAs in the 60S pre-rRNP. Protein-RNA binding experiments demonstrated that NIR is associated with the 32S pre-rRNA and U8 snoRNA. In addition, NIR bound U3 snoRNA. It is a novel finding that depletion of NIR did not affect p53 protein level but de-repressed acetylation of p53 and activated p21. CONCLUSIONS: We provide the first evidence for a transcriptional repressor to function in the rRNA biogenesis of both the 40S and 60S subunits. Our findings also suggested that a nucleolar protein may alternatively signal to p53 by affecting the p53 modification rather than affecting p53 protein level.

  10. Unexpected Diagnosis of Cerebral Toxoplasmosis by 16S and D2 Large-Subunit Ribosomal DNA PCR and Sequencing

    DEFF Research Database (Denmark)

    Kruse, Alexandra Yasmin Collin; Kvich, Lasse Andersson; Eickhardt-Dalbøge, Steffen Robert;

    2015-01-01

    The protozoan parasite Toxoplasma gondii causes severe opportunistic infections. Here, we report an unexpected diagnosis of cerebral toxoplasmosis. T. gondii was diagnosed by 16S and D2 large-subunit (LSU) ribosomal DNA (rDNA) sequencing of a cerebral biopsy specimen and confirmed by T. gondii......-specific PCR and immunohistochemistry. The patient was later diagnosed with HIV/AIDS....

  11. The utility of internally transcribed spacer 2 DNA sequences of the nuclear ribosomal gene for distinguishing sibling species of Trichogramma

    NARCIS (Netherlands)

    Stouthamer, R.; Hu, J.; Kan, van F.J.P.M.; Platner, G.R.; Pinto, J.D.

    1999-01-01

    The usefulness of the internally transcribed spacer 2 (ITS2) of the nuclear ribosomal gene complex is tested for providing taxonomic characters to identify Trichogramma species. The ITS2 sequences of a group of sibling species of the T. deion/T. pretiosum complexes were determined. A simple and prec

  12. Chromosomal localization and partial sequencing of the 18S and 28S ribosomal genes from Bradysia hygida (Diptera: Sciaridae).

    Science.gov (United States)

    Gaspar, V P; Shimauti, E L T; Fernandez, M A

    2014-03-26

    In insects, ribosomal genes are usually detected in sex chromosomes, but have also or only been detected in autosomal chromosomes in some cases. Previous results from our research group indicated that in Bradysia hygida, nucleolus organizer regions were associated with heterochromatic regions of the autosomal C chromosome, using the silver impregnation technique. The present study confirmed this location of the ribosomal genes using fluorescence in situ hybridization analysis. This analysis also revealed the partial sequences of the 18S and 28S genes for this sciarid. The sequence alignment showed that the 18S gene has 98% identity to Corydalus armatus and 91% identity to Drosophila persimilis and Drosophila melanogaster. The partial sequence analysis of the 28S gene showed 95% identity with Bradysia amoena and 93% identity with Schwenckfeldina sp. These results confirmed the location of ribosomal genes of B. hygida in an autosomal chromosome, and the partial sequence analysis of the 18S and 28S genes demonstrated a high percentage of identity among several insect ribosomal genes.

  13. Diversification in insular plants: Inferring the phylogenetic relationship in Aeonium (Crassulaceae) using ITS sequences of nuclear ribosomal DNA

    DEFF Research Database (Denmark)

    Jorgensen, T.H.; Frydenberg, J.

    1999-01-01

    The ITS regions of nuclear ribosomal DNA were sequenced in 37 species of the genus Aeonium. A phylogeny obtained through the use of parsimony agrees to some extent with the sectional division of the genus and confirms the position of two newly described species. It also suggests the potential...

  14. Cyanobacterial ribosomal RNA genes with multiple, endonuclease-encoding group I introns

    Directory of Open Access Journals (Sweden)

    Turner Seán

    2007-09-01

    Full Text Available Abstract Background Group I introns are one of the four major classes of introns as defined by their distinct splicing mechanisms. Because they catalyze their own removal from precursor transcripts, group I introns are referred to as autocatalytic introns. Group I introns are common in fungal and protist nuclear ribosomal RNA genes and in organellar genomes. In contrast, they are rare in all other organisms and genomes, including bacteria. Results Here we report five group I introns, each containing a LAGLIDADG homing endonuclease gene (HEG, in large subunit (LSU rRNA genes of cyanobacteria. Three of the introns are located in the LSU gene of Synechococcus sp. C9, and the other two are in the LSU gene of Synechococcus lividus strain C1. Phylogenetic analyses show that these introns and their HEGs are closely related to introns and HEGs located at homologous insertion sites in organellar and bacterial rDNA genes. We also present a compilation of group I introns with homing endonuclease genes in bacteria. Conclusion We have discovered multiple HEG-containing group I introns in a single bacterial gene. To our knowledge, these are the first cases of multiple group I introns in the same bacterial gene (multiple group I introns have been reported in at least one phage gene and one prophage gene. The HEGs each contain one copy of the LAGLIDADG motif and presumably function as homodimers. Phylogenetic analysis, in conjunction with their patchy taxonomic distribution, suggests that these intron-HEG elements have been transferred horizontally among organelles and bacteria. However, the mode of transfer and the nature of the biological connections among the intron-containing organisms are unknown.

  15. A new model for the three-dimensional folding of Escherichia coli 16 S ribosomal RNA. II. The RNA-protein interaction data.

    Science.gov (United States)

    Mueller, F; Brimacombe, R

    1997-08-29

    The map of the mass centres of the 21 proteins from the Escherichia coli 30 S ribosomal subunit, as determined by neutron scattering, was fitted to a cryoelectron microscopic (cryo-EM) model at a resolution of 20 A of 70 S ribosomes in the pre-translocational state, carrying tRNA molecules at the A and P sites. The fit to the 30 S moiety of the 70 S particles was accomplished with the help of the well-known distribution of the ribosomal proteins in the head, body and side lobe regions of the 30 S subunit, as determined by immuno electron microscopy (IEM). Most of the protein mass centres were found to lie close to the surface (or even outside) of the cryo-EM contour of the 30 S subunit, supporting the idea that the ribosomal proteins are arranged peripherally around the rRNA. The ribosomal protein distribution was then compared with the corresponding model for the 16 S rRNA, fitted to the same EM contour (described in an accompanying paper), in order to analyse the mutual compatibility of the arrangement of proteins and rRNA in terms of the available RNA-protein interaction data. The information taken into account included the hydroxyl radical and base foot-printing data from Noller's laboratory, and our own in situ cross-linking results. Proteins S1 and S14 were not considered, due to the lack of RNA-protein data. Among the 19 proteins analysed, 12 (namely S2, S4, S5, S7, S8, S9, S10, S11, S12, S15, S17 and S21) showed a fit to the rRNA model that varied from being excellent to at least acceptable. Of the remaining 7, S3 and S13 showed a rather poor fit, as did S18 (which is considered in combination with S6 in the foot-printing experiments). S16 was difficult to evaluate, as the foot-print data for this protein cover a large area of the rRNA. S19 and S20 showed a bad fit in terms of the neutron map, but their foot-print and cross-link sites were clustered into compact groups in the rRNA model in those regions of the 30 S subunit where these proteins have

  16. Cockayne syndrome protein A is a transcription factor of RNA polymerase I and stimulates ribosomal biogenesis and growth

    Science.gov (United States)

    Koch, Sylvia; Garcia Gonzalez, Omar; Assfalg, Robin; Schelling, Adrian; Schäfer, Patrick; Scharffetter-Kochanek, Karin; Iben, Sebastian

    2014-01-01

    Mutations in the Cockayne syndrome A (CSA) protein account for 20% of Cockayne syndrome (CS) cases, a childhood disorder of premature aging and early death. Hitherto, CSA has exclusively been described as DNA repair factor of the transcription-coupled branch of nucleotide excision repair. Here we show a novel function of CSA as transcription factor of RNA polymerase I in the nucleolus. Knockdown of CSA reduces pre-rRNA synthesis by RNA polymerase I. CSA associates with RNA polymerase I and the active fraction of the rDNA and stimulates re-initiation of rDNA transcription by recruiting the Cockayne syndrome proteins TFIIH and CSB. Moreover, compared with CSA deficient parental CS cells, CSA transfected CS cells reveal significantly more rRNA with induced growth and enhanced global translation. A previously unknown global dysregulation of ribosomal biogenesis most likely contributes to the reduced growth and premature aging of CS patients. PMID:24781187

  17. Selection of random RNA fragments as method for searching for a site of regulation of translation of E. coli streptomycin mRNA by ribosomal protein S7.

    Science.gov (United States)

    Surdina, A V; Rassokhin, T I; Golovin, A V; Spiridonova, V A; Kraal, B; Kopylov, A M

    2008-06-01

    In E. coli cells ribosomal small subunit biogenesis is regulated by RNA-protein interactions involving protein S7. S7 initiates the subunit assembly interacting with 16S rRNA. During shift-down of rRNA synthesis level, free S7 inhibits self-translation by interacting with 96 nucleotides long specific region of streptomycin (str) mRNA between cistrons S12 and S7 (intercistron). Many bacteria do not have the extended intercistron challenging development of specific approaches for searching putative mRNA regulatory regions, which are able to interact with proteins. The paper describes application of SERF approach (Selection of Random RNA Fragments) to reveal regulatory regions of str mRNA. Set of random DNA fragments has been generated from str operon by random hydrolysis and then transcribed into RNA; the fragments being able to bind protein S7 (serfamers) have been selected by iterative rounds. S7 binds to single serfamer, 109 nucleotide long (RNA109), derived from the intercistron. After multiple copying and selection, the intercistronic mutant (RNA109) has been isolated; it has enhanced affinity to S7. RNA109 binds to the protein better than authentic intercistronic str mRNA; apparent dissociation constants are 26 +/- 5 and 60 +/- 8 nM, respectively. Location of S7 binding site on the mRNA, as well as putative mode of regulation of coupled translation of S12 and S7 cistrons have been hypothesized.

  18. Identification of the cis-elements mediating the autogenous control of ribosomal protein L2 mRNA stability in yeast.

    Science.gov (United States)

    Presutti, C; Villa, T; Hall, D; Pertica, C; Bozzoni, I

    1995-08-15

    The ribosomal protein L2 (rpL2) of Saccharomyces cerevisiae regulates the accumulation of its own mRNA by a feedback mechanism. An RNA sequence is responsible for this control, initially characterized as a 360 nucleotide-long region, localized at the 5' end of the transcript. This region, fused to an unrelated coding sequence, is able to down-regulate the accumulation of the chimeric transcript when increased levels of rpL2 are induced in the cell. The target regulatory region also responds to regulation when inserted inside an intron, demonstrating that the control process can take place inside the nucleus. Deletion analysis from the 5' and 3' borders have restricted the responsive region to approximately 200 nt. The insertion of a poly-G cassette downstream of the regulatory region allowed the identification of truncated 3' cut-off poly(A)+ RNA molecules. The parallel identification of cut-off molecules containing the 5' portion of the transcript allowed us to deduce that the truncated products originate by endonucleolytic cleavage. Altogether, these results are consistent with a mechanism by which the presence of excess amounts of rpL2 in the cell triggers its own mRNA to a degradative pathway; this involves an initial endonucleolytic cleavage that is followed by exonucleolytic trimming. Such a regulatory mechanism shows interesting analogies with the translational regulation of r-proteins in Escherichia coli.

  19. Evolutionary relationships of the coelacanth, lungfishes, and tetrapods based on the 28S ribosomal RNA gene.

    Science.gov (United States)

    Zardoya, R; Meyer, A

    1996-05-28

    The origin of land vertebrates was one of the major transitions in the history of vertebrates. Yet, despite many studies that are based on either morphology or molecules, the phylogenetic relationships among tetrapods and the other two living groups of lobe-finned fishes, the coelacanth and the lungfishes, are still unresolved and debated. Knowledge of the relationships among these lineages, which originated back in the Devonian, has profound implications for the reconstruction of the evolutionary scenario of the conquest of land. We collected the largest molecular data set on this issue so far, about 3,500 base pairs from seven species of the large 28S nuclear ribosomal gene. All phylogenetic analyses (maximum parsimony, neighbor-joining, and maximum likelihood) point toward the hypothesis that lungfishes and coelacanths form a monophyletic group and are equally closely related to land vertebrates. This evolutionary hypothesis complicates the identification of morphological or physiological preadaptations that might have permitted the common ancestor of tetrapods to colonize land. This is because the reconstruction of its ancestral conditions would be hindered by the difficulty to separate uniquely derived characters from shared derived characters in the coelacanth/lungfish and tetrapod lineages. This molecular phylogeny aids in the reconstruction of morphological evolutionary steps by providing a framework; however, only paleontological evidence can determine the sequence of morphological acquisitions that allowed lobe-finned fishes to colonize land.

  20. The nucleotide sequence of Beneckea harveyi 5S rRNA. [bioluminescent marine bacterium

    Science.gov (United States)

    Luehrsen, K. R.; Fox, G. E.

    1981-01-01

    The primary sequence of the 5S ribosomal RNA isolated from the free-living bioluminescent marine bacterium Beneckea harveyi is reported and discussed in regard to indications of phylogenetic relationships with the bacteria Escherichia coli and Photobacterium phosphoreum. Sequences were determined for oligonucleotide products generated by digestion with ribonuclease T1, pancreatic ribonuclease and ribonuclease T2. The presence of heterogeneity is indicated for two sites. The B. harveyi sequence can be arranged into the same four helix secondary structures as E. coli and other prokaryotic 5S rRNAs. Examination of the 5S-RNS sequences of the three bacteria indicates that B. harveyi and P. phosphoreum are specifically related and share a common ancestor which diverged from an ancestor of E. coli at a somewhat earlier time, consistent with previous studies.

  1. In vitro replication of plasmids containing human ribosomal gene sequences: origin localization and dependence on an aprotinin-binding cytosolic protein.

    Science.gov (United States)

    Coffman, F D; Georgoff, I; Fresa, K L; Sylvester, J; Gonzalez, I; Cohen, S

    1993-11-01

    We previously investigated the role of an aprotinin-binding protein (ADR) in the initiation of DNA replication in isolated quiescent nuclei. In the present study, we have used a cell-free DNA replication system to test the ability of plasmid vectors which contain sequences from the human ribosomal RNA gene to serve as replicative templates in vitro when exposed to ADR-containing preparations. Significant dTTP incorporation was seen using DNA from either a 7-kb sequence in the 5' spacer region (CHE) or a 7-kb sequence which begins near the end of the 28S coding region and extends into the 3' spacer region (ADBB), while sequences from other regions of the rRNA gene mediated little or no dTTP incorporation. The characteristics of plasmid-directed dTTP incorporation indicate that most incorporation is due to DNA replication and not repair or damage-initiated processes. To conclusively demonstrate origin-dependent replication in the plasmid system and to further map replication origins, an approach was developed using ddGTP to restrict the length of daughter strands followed by hybridization of these replication products to restriction fragments spanning the putative origin region. This approach allowed us to identify replication origin activity apart from parent strand repair or synthesis initiated at random damaged sites. One of the origins was localized to a 1375-bp fragment within the 5' spacer region, and this fragment contains sequences homologous to those found in other replication origins.

  2. Hepatitis C virus internal ribosome entry site RNA contains a tertiary structural element in a functional domain of stem–loop II

    Science.gov (United States)

    Lyons, Alita J.; Lytle, J. Robin; Gomez, Jordi; Robertson, Hugh D.

    2001-01-01

    The internal ribosome entry site (IRES) of hepatitis C virus (HCV) RNA contains >300 bases of highly conserved 5′-terminal sequence, most of it in the uncapped 5′-untranslated region (5′-UTR) upstream from the single AUG initiator triplet at which translation of the HCV polyprotein begins. Although progress has been made in defining singularities like the RNA pseudoknot near this AUG, the sequence and structural features of the HCV IRES which stimulate accurate and efficient initiation of protein synthesis are only partially defined. Here we report that a region further upstream from the AUG, stem–loop II of the HCV IRES, also contains an element of local tertiary structure which we have detected using RNase H cleavage and have mapped using the singular ability of two bases therein to undergo covalent intra-chain crosslinking stimulated by UV light. This pre-existing element maps to two non-contiguous stretches of the HCV IRES sequence, residues 53–68 and 103–117. Several earlier studies have shown that the correct sequence between bases 45 and 70 of the HCV IRES stem–loop II domain is required for initiation of protein synthesis. Because features of local tertiary structure like the one we report here are often associated with protein binding, we propose that the HCV stem–loop II element is directly involved in IRES action. PMID:11410661

  3. Factors that affect large subunit ribosomal DNA amplicon sequencing studies of fungal communities: classification method, primer choice, and error.

    Directory of Open Access Journals (Sweden)

    Teresita M Porter

    Full Text Available Nuclear large subunit ribosomal DNA is widely used in fungal phylogenetics and to an increasing extent also amplicon-based environmental sequencing. The relatively short reads produced by next-generation sequencing, however, makes primer choice and sequence error important variables for obtaining accurate taxonomic classifications. In this simulation study we tested the performance of three classification methods: 1 a similarity-based method (BLAST + Metagenomic Analyzer, MEGAN; 2 a composition-based method (Ribosomal Database Project naïve bayesian classifier, NBC; and, 3 a phylogeny-based method (Statistical Assignment Package, SAP. We also tested the effects of sequence length, primer choice, and sequence error on classification accuracy and perceived community composition. Using a leave-one-out cross validation approach, results for classifications to the genus rank were as follows: BLAST + MEGAN had the lowest error rate and was particularly robust to sequence error; SAP accuracy was highest when long LSU query sequences were classified; and, NBC runs significantly faster than the other tested methods. All methods performed poorly with the shortest 50-100 bp sequences. Increasing simulated sequence error reduced classification accuracy. Community shifts were detected due to sequence error and primer selection even though there was no change in the underlying community composition. Short read datasets from individual primers, as well as pooled datasets, appear to only approximate the true community composition. We hope this work informs investigators of some of the factors that affect the quality and interpretation of their environmental gene surveys.

  4. cDNA sequence analysis of ribosomal protein S13 gene in Plutella xylostella (Lepidoptera: Plutellidae)

    Institute of Scientific and Technical Information of China (English)

    SHAO-LIWANG; CHENG-FASHENG; CHUAN-LINGQIAO; MIYATATADASHI

    2005-01-01

    Ribosomal protein S 13 gene has been cloned and analyzed in many organisms,but there are few documents relating to insects. In this communication, the full-length cDNA sequence of ribosomal protein S 13 gene in the diamondback moth, Plutella xylostella(Lepidoptera: Plutellidae), was determined by using PCR amplification technique. The features of the ribosomal protein S 13 gene sequence were analyzed and the deduced amino acids sequence was compared with those from other insects. The results of multi-alignment of the amino acid sequences between the diamondback moth and other insect species revealed that this gene sequence is highly conserved in insects. Based on maximum likelihood method, a phylogenetic tree was constructed from 10 different species using PHYLIP software. It showed that nematode is one separate lineage and the five insect speciesbe long to another lineage, whereas those species higher than insects form the third one. The pattern of this phylogenetic tree evidently represented the evolution of different species.

  5. Detection of Ribosomal DNA Sequence Polymorphisms in the Protist Plasmodiophora brassicae for the Identification of Geographical Isolates

    Directory of Open Access Journals (Sweden)

    Rawnak Laila

    2017-01-01

    Full Text Available Clubroot is a soil-borne disease caused by the protist Plasmodiophora brassicae (P. brassicae. It is one of the most economically important diseases of Brassica rapa and other cruciferous crops as it can cause remarkable yield reductions. Understanding P. brassicae genetics, and developing efficient molecular markers, is essential for effective detection of harmful races of this pathogen. Samples from 11 Korean field populations of P. brassicae (geographic isolates, collected from nine different locations in South Korea, were used in this study. Genomic DNA was extracted from the clubroot-infected samples to sequence the ribosomal DNA. Primers and probes for P. brassicae were designed using a ribosomal DNA gene sequence from a Japanese strain available in GenBank (accession number AB526843; isolate NGY. The nuclear ribosomal DNA (rDNA sequence of P. brassicae, comprising 6932 base pairs (bp, was cloned and sequenced and found to include the small subunits (SSUs and a large subunit (LSU, internal transcribed spacers (ITS1 and ITS2, and a 5.8s. Sequence variation was observed in both the SSU and LSU. Four markers showed useful differences in high-resolution melting analysis to identify nucleotide polymorphisms including single- nucleotide polymorphisms (SNPs, oligonucleotide polymorphisms, and insertions/deletions (InDels. A combination of three markers was able to distinguish the geographical isolates into two groups.

  6. Phylogenetic analysis of Mexican Babesia bovis isolates using msa and ssrRNA gene sequences.

    Science.gov (United States)

    Genis, Alma D; Mosqueda, Juan J; Borgonio, Verónica M; Falcón, Alfonso; Alvarez, Antonio; Camacho, Minerva; de Lourdes Muñoz, Maria; Figueroa, Julio V

    2008-12-01

    Variable merozoite surface antigens of Babesia bovis are exposed glycoproteins having a role in erythrocyte invasion. Members of this gene family include msa-1 and msa-2 (msa-2c, msa-2a(1), msa-2a(2), and msa-2b). Small subunit ribosomal (ssr)RNA gene is subject to evolutive pressure and has been used in phylogenetic studies. To determine the phylogenetic relationship among B. bovis Mexican isolates using different genetic markers, PCR amplicons, corresponding to msa-1, msa-2c, msa-2b, and ssrRNA genes, were cloned and plasmids carrying the corresponding inserts were sequenced. Comparative analysis of nucleotide and deduced amino acid sequences revealed distinct degrees of variability and identity among the coding gene sequences obtained from 12 geographically different B. bovis isolates and a reference strain. Overall sequence identities of 47.7%, 72.3%, 87.7%, and 94% were determined for msa-1, msa-2b, msa-2c, and ssrRNA, respectively. A robust phylogenetic tree was obtained with msa-2b sequences. The phylogenetic analysis suggests that Mexican B. bovis isolates group in clades not concordant with the Mexican geography. However, the Mexican isolates group together in an American clade separated from the Australian clade. Sequence heterogeneity in msa-1, msa-2b, and msa-2c coding regions of Mexican B. bovis isolates present in different geographical regions can be a result of either differential evolutive pressure or cattle movement from commercial trade.

  7. Phylogeny-function analysis of (meta)genomic libraries: screening for expression of ribosomal RNA genes by large-insert library fluorescent in situ hybridization (LIL-FISH).

    Science.gov (United States)

    Leveau, Johan H J; Gerards, Saskia; de Boer, Wietse; van Veen, Johannes A

    2004-09-01

    We assessed the utility of fluorescent in situ hybridization (FISH) in the screening of clone libraries of (meta)genomic or environmental DNA for the presence and expression of bacterial ribosomal RNA (rRNA) genes. To establish proof-of-principle, we constructed a fosmid-based library in Escherichia coli of large-sized genomic DNA fragments of the mycophagous soil bacterium Collimonas fungivorans, and hybridized 768 library clones with the Collimonas-specific fluorescent probe CTE998-1015. Critical to the success of this approach (which we refer to as large-insert library FISH or LIL-FISH) was the ability to induce fosmid copy number, the exponential growth status of library clones in the FISH assay and the use of a simple pooling strategy to reduce the number of hybridizations. Twelve out of 768 E. coli clones were suspected to harbour and express Collimonas 16S rRNA genes based on their hybridization to CTE998-1015. This was confirmed by the finding that all 12 clones were also identified in an independent polymerase chain reaction-based screening of the same 768 clones using a primer set for the specific detection of Collimonas 16S ribosomal DNA (rDNA). Fosmids isolated from these clones were grouped by restriction analysis into two distinct contigs, confirming that C. fungivorans harbours at least two 16S rRNA genes. For one contig, representing 1-2% of the genome, the nucleotide sequence was determined, providing us with a narrow but informative view of Collimonas genome structure and content.

  8. WDR55 is a nucleolar modulator of ribosomal RNA synthesis, cell cycle progression, and teleost organ development.

    Directory of Open Access Journals (Sweden)

    Norimasa Iwanami

    2008-08-01

    Full Text Available The thymus is a vertebrate-specific organ where T lymphocytes are generated. Genetic programs that lead to thymus development are incompletely understood. We previously screened ethylnitrosourea-induced medaka mutants for recessive defects in thymus development. Here we report that one of those mutants is caused by a missense mutation in a gene encoding the previously uncharacterized protein WDR55 carrying the tryptophan-aspartate-repeat motif. We find that WDR55 is a novel nucleolar protein involved in the production of ribosomal RNA (rRNA. Defects in WDR55 cause aberrant accumulation of rRNA intermediates and cell cycle arrest. A mutation in WDR55 in zebrafish also leads to analogous defects in thymus development, whereas WDR55-null mice are lethal before implantation. These results indicate that WDR55 is a nuclear modulator of rRNA synthesis, cell cycle progression, and embryonic organogenesis including teleost thymus development.

  9. Activation of ribosomal RNA genes in porcine embryos produced in vitro or by somatic cell nuclear transfer

    DEFF Research Database (Denmark)

    Bjerregaard, Bolette; Pedersen, Hanne Gervi; Jakobsen, Anne Sørig

    2007-01-01

    The onset of ribosomal RNA (rRNA) synthesis occurs during the second half of the third cell cycle, that is, at the four-cell stage, in porcine embryos developed in vivo. In the present study the onset of rRNA synthesis was investigated in porcine embryos produced in vitro (IVP) or by somatic cell...... nuclear transfer (SCNT) using fluorescence in situ hybridization (FISH) with an rDNA probe and subsequent visualization of the nucleolar proteins by silver staining. In the 205 IVP embryos investigated, all two-cell embryos (n = 34) were categorized as transcriptionally inactive. At the late four......-cell stage (n = 45), 38% of the embryos contained 1-3 nuclei with signs of rRNA transcription, indicating an asynchronous transcription initiation. This pattern continued in the following stages, as 78% (n = 47), 47% (n = 42) and 83% (n = 37) of the embryos revealed a mixture of transcriptionally inactive...

  10. Recovery from ultraviolet light-induced depression of ribosomal RNA synthesis in normal human, xeroderma pigmentosum and cockayne syndrome cells

    Energy Technology Data Exchange (ETDEWEB)

    Ayaki, Hitoshi; Hara, Ryujiro; Ikenaga, Mituo [Kyoto Univ. (Japan). Radiation Biology Center

    1996-06-01

    The rate of ribosomal RNA (rRNA) synthesis was analyzed at different times after ultraviolet light (UV) irradiation in normal human, xeroderma pigmentosum (XP) and Cockayne syndrome (CS) cells. In normal cells, the rate of rRNA synthesis, as measured by the incorporation of {sup 3}H-uridine into 18S and 28S rRNAs, decreased immediately after UV irradiation to about half of that of unirradiated cells, and then recovered significantly at 24h after UV. However, the rate of synthesis continued to decrease during post-UV incubation in XP cells belonging to groups A, D, E, F and G, as well as in CS cells of groups A and B. In contrast, group C XP cells showed a slight recovery at 24h after UV, suggesting that they have the capacity to repair UV lesions in rRNA genes. (author)

  11. Species-genomic relationships among the tribasic diploid and polyploid Carthamus taxa based on physical mapping of active and inactive 18S-5.8S-26S and 5S ribosomal RNA gene families, and the two tandemly repeated DNA sequences.

    Science.gov (United States)

    Agrawal, Renuka; Tsujimoto, Hisashi; Tandon, Rajesh; Rao, Satyawada Rama; Raina, Soom Nath

    2013-05-25

    In the genus Carthamus (2n=20, 22, 24, 44, 64; x=10, 11, 12), most of the homologues within and between the chromosome complements are difficult to be identified. In the present work, we used fluorescent in situ hybridisation (FISH) to determine the chromosome distribution of the two rRNA gene families, and the two isolated repeated DNA sequences in the 14 Carthamus taxa. The distinctive variability in the distribution, number and signal intensity of hybridisation sites for 18S-26S and 5S rDNA loci could generally distinguish the 14 Carthamus taxa. Active 18S-26S rDNA sites were generally associated with NOR loci on the nucleolar chromosomes. The two A genome taxa, C. glaucus ssp. anatolicus and C. boissieri with 2n=20, and the two botanical varieties of B genome C. tinctorius (2n=24) had diagnostic FISH patterns. The present results support the origin of C. tinctorius from C. palaestinus. FISH patterns of C. arborescens vis-à-vis the other taxa indicate a clear division of Carthamus taxa into two distinct lineages. Comparative distribution and intensity pattern of 18S-26S rDNA sites could distinguish each of the tetraploid and hexaploid taxa. The present results indicate that C. boissieri (2n=20) is one of the genome donors for C. lanatus and C. lanatus ssp. lanatus (2n=44), and C. lanatus is one of the progenitors for the hexaploid (2n=64) taxa. The association of pCtKpnI-2 repeated sequence with rRNA gene cluster (orphon) in 2-10 nucleolar and non-nucleolar chromosomes and the consistent occurrence of pCtKpnI-1 repeated sequence at the subtelomeric region in all the taxa analysed indicate some functional role of these sequences.

  12. Approaching marine bioprospecting in hexacorals by RNA deep sequencing.

    Science.gov (United States)

    Johansen, Steinar D; Emblem, Ase; Karlsen, Bård Ove; Okkenhaug, Siri; Hansen, Hilde; Moum, Truls; Coucheron, Dag H; Seternes, Ole Morten

    2010-07-31

    RNA deep sequencing represents a new complementary approach in marine bioprospecting. Next-generation sequencing platforms have recently been developed for de novo whole transcriptome analysis, small RNA discovery and gene expression profiling. Deep sequencing transcriptomics (sequencing the complete set of cellular transcripts at a specific stage or condition) leads to sequential identification of all expressed genes in a sample. When combined to high-throughput bioinformatics and protein synthesis, RNA deep sequencing represents a new powerful approach in gene product discovery and bioprospecting. Here we summarize recent progress in the analyses of hexacoral transcriptomes with the focus on cold-water sea anemones and related organisms.

  13. Ribosome profiling-guided depletion of an mRNA increases cell growth rate and protein secretion

    Science.gov (United States)

    Kallehauge, Thomas Beuchert; Li, Shangzhong; Pedersen, Lasse Ebdrup; Ha, Tae Kwang; Ley, Daniel; Andersen, Mikael Rørdam; Kildegaard, Helene Faustrup; Lee, Gyun Min; Lewis, Nathan E.

    2017-01-01

    Recombinant protein production coopts the host cell machinery to provide high protein yields of industrial enzymes or biotherapeutics. However, since protein translation is energetically expensive and tightly controlled, it is unclear if highly expressed recombinant genes are translated as efficiently as host genes. Furthermore, it is unclear how the high expression impacts global translation. Here, we present the first genome-wide view of protein translation in an IgG-producing CHO cell line, measured with ribosome profiling. Through this we found that our recombinant mRNAs were translated as efficiently as the host cell transcriptome, and sequestered up to 15% of the total ribosome occupancy. During cell culture, changes in recombinant mRNA translation were consistent with changes in transcription, demonstrating that transcript levels influence specific productivity. Using this information, we identified the unnecessary resistance marker NeoR to be a highly transcribed and translated gene. Through siRNA knock-down of NeoR, we improved the production- and growth capacity of the host cell. Thus, ribosomal profiling provides valuable insights into translation in CHO cells and can guide efforts to enhance protein production. PMID:28091612

  14. Ribosome profiling-guided depletion of an mRNA increases cell growth rate and protein secretion

    Science.gov (United States)

    Kallehauge, Thomas Beuchert; Li, Shangzhong; Pedersen, Lasse Ebdrup; Ha, Tae Kwang; Ley, Daniel; Andersen, Mikael Rørdam; Kildegaard, Helene Faustrup; Lee, Gyun Min; Lewis, Nathan E.

    2017-01-01

    Recombinant protein production coopts the host cell machinery to provide high protein yields of industrial enzymes or biotherapeutics. However, since protein translation is energetically expensive and tightly controlled, it is unclear if highly expressed recombinant genes are translated as efficiently as host genes. Furthermore, it is unclear how the high expression impacts global translation. Here, we present the first genome-wide view of protein translation in an IgG-producing CHO cell line, measured with ribosome profiling. Through this we found that our recombinant mRNAs were translated as efficiently as the host cell transcriptome, and sequestered up to 15% of the total ribosome occupancy. During cell culture, changes in recombinant mRNA translation were consistent with changes in transcription, demonstrating that transcript levels influence specific productivity. Using this information, we identified the unnecessary resistance marker NeoR to be a highly transcribed and translated gene. Through siRNA knock-down of NeoR, we improved the production- and growth capacity of the host cell. Thus, ribosomal profiling provides valuable insights into translation in CHO cells and can guide efforts to enhance protein production.

  15. Ribosome profiling-guided depletion of an mRNA increases cell growth rate and protein secretion

    DEFF Research Database (Denmark)

    Beuchert Kallehauge, Thomas; Li, Shangzhong; Pedersen, Lasse Ebdrup

    2017-01-01

    as efficiently as the host cell transcriptome, and sequestered up to 15% of the total ribosome occupancy. During cell culture, changes in recombinant mRNA translation were consistent with changes in transcription, demonstrating that transcript levels influence specific productivity. Using this information, we......Recombinant protein production coopts the host cell machinery to provide high protein yields of industrial enzymes or biotherapeutics. However, since protein translation is energetically expensive and tightly controlled, it is unclear if highly expressed recombinant genes are translated...... as efficiently as host genes. Furthermore, it is unclear how the high expression impacts global translation. Here, we present the first genome-wide view of protein translation in an IgG-producing CHO cell line, measured with ribosome profiling. Through this we found that our recombinant mRNAs were translated...

  16. A novel mutation 3090 G>A of the mitochondrial 16S ribosomal RNA associated with myopathy.

    Science.gov (United States)

    Coulbault, L; Deslandes, B; Herlicoviez, D; Read, M H; Leporrier, N; Schaeffer, S; Mouadil, A; Lombès, A; Chapon, F; Jauzac, P; Allouche, S

    2007-10-26

    We describe a young woman who presented with a progressive myopathy since the age of 9. Spectrophotometric analysis of the respiratory chain in muscle tissue revealed combined and profound complex I, III, II+III, and IV deficiency ranging from 60% to 95% associated with morphological and histochemical abnormalities of the muscle. An exhaustive screening of mitochondrial transfer and ribosomal RNAs showed a novel G>A substitution at nucleotide position 3090 which was detected only in urine sediment and muscle of the patient and was not found in her mother's blood cells and urine sample. We suggest that this novel de novo mutation in the 16S ribosomal RNA, a nucleotide which is highly conserved in different species, would impair mitochondrial protein synthesis and would cause a severe myopathy.

  17. A mutation in the 530 loop of Escherichia coli 16S ribosomal RNA causes resistance to streptomycin.

    Science.gov (United States)

    Melançon, P; Lemieux, C; Brakier-Gingras, L

    1988-10-25

    Oligonucleotide-directed mutagenesis was used to introduce an A to C transversion at position 523 in the 16S ribosomal RNA gene of Escherichia coli rrnB operon cloned in plasmid pKK3535. E. coli cells transformed with the mutated plasmid were resistant to streptomycin. The mutated ribosomes isolated from these cells were not stimulated by streptomycin to misread the message in a poly(U)-directed assay. They were also restrictive to the stimulation of misreading by other error-promoting related aminoglycoside antibiotics such as neomycin, kanamycin or gentamicin, which do not compete for the streptomycin binding site. The 530 loop where the mutation in the 16S rRNA is located has been mapped at the external surface of the 30S subunit, and is therefore distal from the streptomycin binding site at the subunit interface. Our results support the conclusion that the mutation at position 523 in the 16S rRNA does not interfere with the binding of streptomycin, but prevents the drug from inducing conformational changes in the 530 loop which account for its miscoding effect. Since this effect primarily results from a perturbation of the translational proofreading control, our results also provide evidence that the 530 loop of the 16S rRNA is involved in this accuracy control.

  18. RNA sequencing uncovers antisense RNAs and novel small RNAs in Streptococcus pyogenes.

    Science.gov (United States)

    Le Rhun, Anaïs; Beer, Yan Yan; Reimegård, Johan; Chylinski, Krzysztof; Charpentier, Emmanuelle

    2016-01-01

    Streptococcus pyogenes is a human pathogen responsible for a wide spectrum of diseases ranging from mild to life-threatening infections. During the infectious process, the temporal and spatial expression of pathogenicity factors is tightly controlled by a complex network of protein and RNA regulators acting in response to various environmental signals. Here, we focus on the class of small RNA regulators (sRNAs) and present the first complete analysis of sRNA sequencing data in S. pyogenes. In the SF370 clinical isolate (M1 serotype), we identified 197 and 428 putative regulatory RNAs by visual inspection and bioinformatics screening of the sequencing data, respectively. Only 35 from the 197 candidates identified by visual screening were assigned a predicted function (T-boxes, ribosomal protein leaders, characterized riboswitches or sRNAs), indicating how little is known about sRNA regulation in S. pyogenes. By comparing our list of predicted sRNAs with previous S. pyogenes sRNA screens using bioinformatics or microarrays, 92 novel sRNAs were revealed, including antisense RNAs that are for the first time shown to be expressed in this pathogen. We experimentally validated the expression of 30 novel sRNAs and antisense RNAs. We show that the expression profile of 9 sRNAs including 2 predicted regulatory elements is affected by the endoribonucleases RNase III and/or RNase Y, highlighting the critical role of these enzymes in sRNA regulation.

  19. The differential expression of ribosomal 18S RNA paralog genes from the chaetognath Spadella cephaloptera.

    Science.gov (United States)

    Barthélémy, Roxane-Marie; Grino, Michel; Pontarotti, Pierre; Casanova, Jean-Paul; Faure, Eric

    2007-01-01

    Chaetognaths constitute a small marine phylum of approximately 120 species. Two classes of both 18S and 28S rRNA gene sequences have been evidenced in this phylum, even though significant intraindividual variation in the sequences of rRNA genes is unusual in animal genomes. These observations led to the hypothesis that this unusual genetic characteristic could play one or more physiological role(s). Using in situ hybridization on the frontal sections of the chaetognath Spadella cephaloptera, we found that the 18S Class I genes are expressed in the whole body, with a strong expression throughout the gut epithelium, whereas the expression of the 18S Class II genes is restricted to the oocytes. Our results could suggest that the paralog products of the 18S Class I genes are probably the "housekeeping" 18S rRNAs, whereas those of class II would only be essential in specific tissues. These results provide support for the idea that each type of 18S paralog is important for specific cellular functions and is under the control of selective factors.

  20. Comparison of 16S ribosomal RNA genes in Clavibacter michiganensis subspecies with other coryneform bacteria.

    Science.gov (United States)

    Li, X; De Boer, S H

    1995-10-01

    Nearly complete sequences (97-99%) of the 16S rRNA genes were determined for type strains of Clavibacter michiganensis subsp. michiganensis, Clavibacter michiganensis subsp. insidiosus, Clavibacter michiganensis subsp. sepedonicus, and Clavibacter michiganensis subsp. nebraskensis. The four subspecies had less than 1% dissimilarity in their 16S rRNA genes. Comparative studies indicated that the C. michiganensis subsp. shared relatively high homology with the 16S rRNA gene of Clavibacter xyli. Further comparison with representatives of other Gram-positive coryneform and related bacteria with high G+C% values showed that this group of bacteria was subdivided into three clusters. One cluster consisted of the Clavibacter michiganensis subsp., Clavibacter xyli, Arthrobacter globiformis, Arthrobacter simplex, and Frankia sp.; another cluster consisted of members of the corynebacteria-mycobacteria-nocardia (CMN) group of Mycobacteriaceae including Tsukamurella paurometabolum; and Propionibacterium freudenreichii alone formed a unique cluster, which was remote from other coryneform bacteria analyzed. The three clusters may reflect a systematic rank higher than the genus level among these bacteria.

  1. Crosstalk in gene expression: coupling and co-regulation of rDNA transcription, pre-ribosome assembly and pre-rRNA processing.

    Science.gov (United States)

    Granneman, Sander; Baserga, Susan J

    2005-06-01

    Ribosomes, the large RNPs that translate mRNA into protein in the cytoplasm of eukaryotic cells, are synthesized in a subcompartment of the nucleus, the nucleolus. There, transcription by Pol I yields a pre-rRNA which is modified, cleaved and assembled with ribosomal proteins to make functional ribosomes. Previously, rRNA transcription and pre-rRNA cleavage in eukaryotes were considered to be separable steps in gene expression. However, recent findings suggest that these two steps in gene expression can be concurrent and are co-regulated. Unexpectedly, optimal rDNA transcription requires the presence of a defined subset of components of the pre-rRNA processing machinery.

  2. Studies on the ability of partially iodinated 16S RNA to participate in 30S ribosome assembly.

    Science.gov (United States)

    Schendel, P L; Craven, G R

    1976-11-01

    Deproteinated 16S RNA was iodinated at pH 5.0 in an aqueous solution containing TlCl3 plus KI for 1-5 hours at 42 degrees C. Under these conditions 33 moles of iodine are incorporated per mole of RNA. As judged by sucrose gradient sedimentation, the iodinated RNA does not exhibit any large alteration in conformation as compared to unmodified 16S. The iodinated RNA was examined for its ability to reconstitute with total 30S proteins. Sedimentation velocity analysis reveals that the reconstituted subunit has a sedimentation constant of approximately 20S. In addition, protein analysis of particles reconstituted with 16S RNA iodinated for 5 hours indicates that proteins S2, S10, S13, S14, S15, S17, S18, S19, and S21 are no longer able to participate in the 30S assembly process and that proteins S6, S16 and S20 are present in reduced amounts. The ramifications of these results concerning protein-RNA and RNA-RNA interactions occurring in ribosome assembly are discussed.

  3. First structural evidence of sequestration of mRNA cap structures by type 1 ribosome inactivating protein from Momordica balsamina.

    Science.gov (United States)

    Kushwaha, Gajraj Singh; Yamini, Shavait; Kumar, Mukesh; Sinha, Mau; Kaur, Punit; Sharma, Sujata; Singh, Tej P

    2013-05-01

    This is the first structural evidence of recognition of mRNA cap structures by a ribosome inactivating protein. It is well known that a unique cap structure is formed at the 5' end of mRNA for carrying out various processes including mRNA maturation, translation initiation, and RNA turnover. The binding studies and crystal structure determinations of type 1 ribosome inactivating protein (RIP-1) from Momordica balsamina (MbRIP-1) were carried out with mRNA cap structures including (i) N7-methyl guanine (m7G), (ii) N7-methyl guanosine diphosphate (m7GDP), and (iii) N7-methyl guanosine triphosphate (m7GTP). These compounds showed affinities to MbRIP-1 at nanomolar concentrations. The structure determinations of the complexes of MbRIP-1 with m7G, m7GDP, and m7GTP at 2.65, 1.77, and 1.75 Å resolutions revealed that all the three compounds bound to MbRIP-1 in the substrate binding site at the positions which are slightly shifted towards Glu85 as compared to those of rRNA substrates. In this position, Glu85 forms several hydrogen bonds with guanine moiety while N-7 methyl group forms van der Waals contacts. However, the guanine rings are poorly stacked in these complexes. Thus, the mode of binding by MbRIP-1 to mRNA cap structures is different which results in the inhibition of depurination. Since some viruses are known to exploit the capping property of the host, this action of MbRIP-1 may have implications for the antiviral activity of this protein in vivo. The understanding of the mode of binding of MbRIP-1 to cap structures may also assist in the design of anti-viral agents. Copyright © 2013 Wiley Periodicals, Inc.

  4. Complete ecological isolation and cryptic diversity in Polynucleobacter bacteria not resolved by 16S rRNA gene sequences.

    Science.gov (United States)

    Hahn, Martin W; Jezberová, Jitka; Koll, Ulrike; Saueressig-Beck, Tanja; Schmidt, Johanna

    2016-07-01

    Transplantation experiments and genome comparisons were used to determine if lineages of planktonic Polynucleobacter almost indistinguishable by their 16S ribosomal RNA (rRNA) sequences differ distinctively in their ecophysiological and genomic traits. The results of three transplantation experiments differing in complexity of biotic interactions revealed complete ecological isolation between some of the lineages. This pattern fits well to the previously detected environmental distribution of lineages along chemical gradients, as well as to differences in gene content putatively providing adaptation to chemically distinct habitats. Patterns of distribution of iron transporter genes across 209 Polynucleobacter strains obtained from freshwater systems and representing a broad pH spectrum further emphasize differences in habitat-specific adaptations. Genome comparisons of six strains sharing ⩾99% 16S rRNA similarities suggested that each strain represents a distinct species. Comparison of sequence diversity among genomes with sequence diversity among 240 cultivated Polynucleobacter strains indicated a large cryptic species complex not resolvable by 16S rRNA sequences. The revealed ecological isolation and cryptic diversity in Polynucleobacter bacteria is crucial in the interpretation of diversity studies on freshwater bacterioplankton based on ribosomal sequences.

  5. Phylogeny and systematics of 18 Colletotrichum species based on ribosomal DNA spacer sequences.

    Science.gov (United States)

    Sreenivasaprasad, S; Mills, P R; Meehan, B M; Brown, A E

    1996-06-01

    The potential use of the ribosomal DNA internal transcribed spacer (ITS) sequences in understanding the phylogeny and systematics of Colletotrichum species has been evaluated. Sequence data from a limited number of isolates revealed that in Colletotrichum species the ITS 1 region (50.3% variable sites) shows a greater degree of intra- and inter-specific divergence than ITS 2 (12.4% variable sites). Nucleotide sequences of the ITS 1 region from 93 isolates representing 18 Colletotrichum species were determined. Data for 71 of these isolates where molecular and morphological identities concurred were used for phylogenetic analysis. The size of the ITS 1 region varied from 159 to 185 base pairs. Maximum intraspecific divergence was recorded with C. acutatum (5.8%), and C. capsici showed the greatest level of interspecific divergence (8.9-23.3%). Parsimony and distance analyses gave similar tree topologies. The bootstrapped consensus parsimony tree divided the 18 Colletotrichum species into six phylogenetic groups, designated 1-6. These groups, however, are not congruent with species clusterings based on spore shape. For example, the straight cylindrical spored species were represented both in groups 1 and 6; group 6 also included the falcate fusiform spored species C. capsici. The molecular evidence suggests refinement of the species concepts of some of the taxa examined. In group 6, divergence between C. gloeosporioides and C. fuscum (0.6-3.0%) or C. kahawae (0.6-3.0%) or C. fragariae (0.6-4.2%) overlap the divergence (3.6%) within C. gloeosporioides. It is suggested that C. fuscum as well as C. kahawae and C. fragariae fall within the group species C. gloeosporioides. ITS 1 data enabled clear distinction (7.1%) of Colletotrichum isolates from maize and sorghum into C. graminicola and C. sublineolum, respectively (group 2). Species such as C. acutatum, C. coccodes, C. dematium, and C. trichellum can be clearly distinguished based on ITS 1 sequence divergence, but C

  6. Distribution of dwell times of a ribosome: effects of infidelity, kinetic proofreading and ribosome crowding

    CERN Document Server

    Sharma, Ajeet K

    2010-01-01

    Ribosome is a molecular machine that polymerizes a protein where the sequence of the amino acid subunits of the protein is dictated by the sequence of codons (triplets of nucleotide subunits) on a messenger RNA (mRNA) that serves as the template. The ribosome is a molecular motor that utilizes the template mRNA strand also as the track. Thus, in each step the ribosome moves forward by one codon and, simultaneously, elongates the protein by one amino acid. We present a theoretical model that captures most of the main steps in the mechano-chemical cycle of a ribosome. The stochastic movement of the ribosome consists of an alternating sequence of pause and translocation; the sum of the durations of a pause and the following translocation is defined as the time of dwell of the ribosome at the corresponding codon. We present an analytical calculation of the distribution of the dwell times of a ribosome in our model. Our theoretical prediction is consistent with the experimental results reported in the literature.

  7. Isolation, characterization, sequencing and crystal structure of charybdin, a type 1 ribosome-inactivating protein from Charybdis maritima agg.

    Science.gov (United States)

    Touloupakis, Eleftherios; Gessmann, Renate; Kavelaki, Kalliopi; Christofakis, Emmanuil; Petratos, Kyriacos; Ghanotakis, Demetrios F

    2006-06-01

    A novel, type 1 ribosome-inactivating protein designated charybdin was isolated from bulbs of Charybdis maritima agg. The protein, consisting of a single polypeptide chain with a molecular mass of 29 kDa, inhibited translation in rabbit reticulocytes with an IC50 of 27.2 nm. Plant genomic DNA extracted from the bulb was amplified by PCR between primers based on the N-terminal and C-terminal sequence of the protein from dissolved crystals. The complete mature protein sequence was derived by partial DNA sequencing and terminal protein sequencing, and was confirmed by high-resolution crystal structure analysis. The protein contains Val at position 79 instead of the conserved Tyr residue of the ribosome-inactivating proteins known to date. To our knowledge, this is the first observation of a natural substitution of a catalytic residue at the active site of a natural ribosome-inactivating protein. This substitution in the active site may be responsible for the relatively low in vitro translation inhibitory effect compared with other ribosome-inactivating proteins. Single crystals were grown in the cold room from PEG6000 solutions. Diffraction data collected to 1.6 A resolution were used to determine the protein structure by the molecular replacement method. The fold of the protein comprises two structural domains: an alpha + beta N-terminal domain (residues 4-190) and a mainly alpha-helical C-terminal domain (residues 191-257). The active site is located in the interface between the two domains and comprises residues Val79, Tyr117, Glu167 and Arg170.

  8. An RNA-binding complex involved in ribosome biogenesis contains a protein with homology to tRNA CCA-adding enzyme.

    Directory of Open Access Journals (Sweden)

    Jinzhong Lin

    2013-10-01

    Full Text Available A multitude of proteins and small nucleolar RNAs transiently associate with eukaryotic ribosomal RNAs to direct their modification and processing and the assembly of ribosomal proteins. Utp22 and Rrp7, two interacting proteins with no recognizable domain, are components of the 90S preribosome or the small subunit processome that conducts early processing of 18S rRNA. Here, we determine the cocrystal structure of Utp22 and Rrp7 complex at 1.97 Å resolution and the NMR structure of a C-terminal fragment of Rrp7, which is not visible in the crystal structure. The structure reveals that Utp22 surprisingly resembles a dimeric class I tRNA CCA-adding enzyme yet with degenerate active sites, raising an interesting evolutionary connection between tRNA and rRNA processing machineries. Rrp7 binds extensively to Utp22 using a deviant RNA recognition motif and an extended linker. Functional sites on the two proteins were identified by structure-based mutagenesis in yeast. We show that Rrp7 contains a flexible RNA-binding C-terminal tail that is essential for association with preribosomes. RNA-protein crosslinking shows that Rrp7 binds at the central domain of 18S rRNA and shares a neighborhood with two processing H/ACA snoRNAs snR30 and snR10. Depletion of snR30 prevents the stable assembly of Rrp7 into preribosomes. Our results provide insight into the evolutionary origin and functional context of Utp22 and Rrp7.

  9. Isolation, crystallization, and investigation of ribosomal protein S8 complexed with specific fragments of rRNA of bacterial or archaeal origin.

    Science.gov (United States)

    Tishchenko, S V; Vassilieva, J M; Platonova, O B; Serganov, A A; Fomenkova, N P; Mudrik, E S; Piendl, W; Ehresmann, C; Ehresmann, B; Garber, M B

    2001-09-01

    The core ribosomal protein S8 binds to the central domain of 16S rRNA independently of other ribosomal proteins and is required for assembling the 30S subunit. It has been shown with E. coli ribosomes that a short rRNA fragment restricted by nucleotides 588-602 and 636-651 is sufficient for strong and specific protein S8 binding. In this work, we studied the complexes formed by ribosomal protein S8 from Thermus thermophilus and Methanococcus jannaschii with short rRNA fragments isolated from the same organisms. The dissociation constants of the complexes of protein S8 with rRNA fragments were determined. Based on the results of binding experiments, rRNA fragments of different length were designed and synthesized in preparative amounts in vitro using T7 RNA-polymerase. Stable S8-RNA complexes were crystallized. Crystals were obtained both for homologous bacterial and archaeal complexes and for hybrid complexes of archaeal protein with bacterial rRNA. Crystals of the complex of protein S8 from M. jannaschii with the 37-nucleotide rRNA fragment from the same organism suitable for X-ray analysis were obtained.

  10. Finding Common Sequence and Structure Motifs in a set of RNA sequences

    DEFF Research Database (Denmark)

    Gorodkin, Jan; Heyer, Laurie J.; Stormo, Gary D.

    1997-01-01

    We present a computational scheme to search for the most common motif, composed of a combination of sequence and structure constraints, among a collection of RNA sequences. The method uses a simplified version of the Sankoff algorithm for simultaneous folding and alignment of RNA sequences...

  11. LKB1 promotes cell survival by modulating TIF-IA-mediated pre-ribosomal RNA synthesis under uridine downregulated conditions.

    Science.gov (United States)

    Liu, Fakeng; Jin, Rui; Liu, Xiuju; Huang, Henry; Wilkinson, Scott C; Zhong, Diansheng; Khuri, Fadlo R; Fu, Haian; Marcus, Adam; He, Yulong; Zhou, Wei

    2016-01-19

    We analyzed the mechanism underlying 5-aminoimidazole-4-carboxamide riboside (AICAR) mediated apoptosis in LKB1-null non-small cell lung cancer (NSCLC) cells. Metabolic profile analysis revealed depletion of the intracellular pyrimidine pool after AICAR treatment, but uridine was the only nucleotide precursor capable of rescuing this apoptosis, suggesting the involvement of RNA metabolism. Because half of RNA transcription in cancer is for pre-ribosomal RNA (rRNA) synthesis, which is suppressed by over 90% after AICAR treatment, we evaluated the role of TIF-IA-mediated rRNA synthesis. While the depletion of TIF-IA by RNAi alone promoted apoptosis in LKB1-null cells, the overexpression of a wild-type or a S636A TIF-IA mutant, but not a S636D mutant, attenuated AICAR-induced apoptosis. In LKB1-null H157 cells, pre-rRNA synthesis was not suppressed by AICAR when wild-type LKB1 was present, and cellular fractionation analysis indicated that TIF-IA quickly accumulated in the nucleus in the presence of a wild-type LKB1 but not a kinase-dead mutant. Furthermore, ectopic expression of LKB1 was capable of attenuating AICAR-induced death in AMPK-null cells. Because LKB1 promotes cell survival by modulating TIF-IA-mediated pre-rRNA synthesis, this discovery suggested that targeted depletion of uridine related metabolites may be exploited in the clinic to eliminate LKB1-null cancer cells.

  12. Control of ribosome traffic by position-dependent choice of synonymous codons

    DEFF Research Database (Denmark)

    Mitarai, Namiko; Pedersen, Steen

    2013-01-01

    Messenger RNA (mRNA) encodes a sequence of amino acids by using codons. For most amino acids, there are multiple synonymous codons that can encode the amino acid. The translation speed can vary from one codon to another, thus there is room for changing the ribosome speed while keeping the amino...... acid sequence and hence the resulting protein. Recently, it has been noticed that the choice of the synonymous codon, via the resulting distribution of slow- and fast-translated codons, affects not only on the average speed of one ribosome translating the mRNA but also might have an effect on nearby...... ribosomes by affecting the appearance of 'traffic jams' where multiple ribosomes collide and form queues. To test this 'context effect' further, we here investigate the effect of the sequence of synonymous codons on the ribosome traffic by using a ribosome traffic model with codon-dependent rates, estimated...

  13. [Mutual effect of human ribosomal proteins S5 and S16 on their binding with 18S rRNA fragment 1203-1236/1521-1698].

    Science.gov (United States)

    Ian'shina, D D; Malygin, A A; Karpova, G G

    2009-01-01

    Human ribosomal proteins S5 and S16 are homologues of prokaryotic ribosomal proteins S7p and S9p, respectively, that according to X-ray crystallography data on the Thermus thermophilus 30S ribosomal subunit contact the 3'-terminal 16S rRNA region formed by helices H28-H30 and H38-H43. In the present work we report studying mutual effect of human ribosomal proteins S5 and S16 on their binding with RNA transcript corresponding to the region 1203-1236/1521-1698 of the 18S rRNA (helices H28-30 and H41-43), which is homologous to thel6S rRNA region known to contain binding site of S7p and part of binding site of S9p. It was shown that simultaneous binding of ribosomal proteins S5 and S16 with this RNA transcript causes conformational changes in it stabilizing the complex by involvement of new parts of the RNA that interact with neither S5 nor S16 in the respective binary complexes.

  14. Analysis of natural variants of the hepatitis C virus internal ribosome entry site reveals that primary sequence plays a key role in cap-independent translation

    Science.gov (United States)

    Barría, María Inés; González, Angel; Vera-Otarola, Jorge; León, Ursula; Vollrath, Valeska; Marsac, Delphine; Monasterio, Octavio; Pérez-Acle, Tomás; Soza, Alejandro; López-Lastra, Marcelo

    2009-01-01

    The HCV internal ribosome entry site (IRES) spans a region of ∼340 nt that encompasses most of the 5′ untranslated region (5′UTR) of the viral mRNA and the first 24–40 nt of the core-coding region. To investigate the implication of altering the primary sequence of the 5′UTR on IRES activity, naturally occurring variants of the 5′UTR were isolated from clinical samples and analyzed. The impact of the identified mutations on translation was evaluated in the context of RLuc/FLuc bicistronic RNAs. Results show that depending on their location within the RNA structure, these naturally occurring mutations cause a range of effects on IRES activity. However, mutations within subdomain IIId hinder HCV IRES-mediated translation. In an attempt to explain these data, the dynamic behavior of the subdomain IIId was analyzed by means of molecular dynamics (MD) simulations. Despite the loss of function, MD simulations predicted that mutant G266A/G268U possesses a structure similar to the wt-RNA. This prediction was validated by analyzing the secondary structure of the isolated IIId RNAs by circular dichroism spectroscopy in the presence or absence of Mg2+ ions. These data strongly suggest that the primary sequence of subdomain IIId plays a key role in HCV IRES-mediated translation. PMID:19106142

  15. Quinacrine impairs enterovirus 71 RNA replication by preventing binding of polypyrimidine-tract binding protein with internal ribosome entry sites.

    Directory of Open Access Journals (Sweden)

    Jianmin Wang

    Full Text Available Since the 1980s, epidemics of enterovirus 71 (EV71 and other enteroviruses have occurred in Asian countries and regions, causing a wide range of human diseases. No effective therapy is available for the treatment of these infections. Internal ribosome entry sites (IRESs are indispensable for the initiation of translation in enteroviruses. Several cellular factors, as well as the ribosome, are recruited to the conserved IRES during this process. Quinacrine intercalates into the RNA architecture and inhibits RNA transcription and protein synthesis, and a recent study showed that quinacrine inhibited encephalomyocarditis virus and poliovirus IRES-mediated translation in vitro without disrupting internal cellular IRES. Here, we report that quinacrine was highly active against EV71, protecting cells from EV71 infection. Replication of viral RNA, expression of viral capsid protein, and production of virus were all strongly inhibited by quinacrine. Interaction of the polypyrimidine tract-binding protein (PTB with the conserved IRES was prevented by quinacrine. Coxsackieviruses and echovirus were also inhibited by quinacrine in cultured cells. These results indicate that quinacrine may serve as a potential protective agent for use in the treatment of patients with chronic enterovirus infection.

  16. Complete mitochondrial genomes and nuclear ribosomal RNA operons of two species of Diplostomum (Platyhelminthes: Trematoda): a molecular resource for taxonomy and molecular epidemiology of important fish pathogens.

    Science.gov (United States)

    Brabec, Jan; Kostadinova, Aneta; Scholz, Tomáš; Littlewood, D Timothy J

    2015-06-19

    The genus Diplostomum (Platyhelminthes: Trematoda: Diplostomidae) is a diverse group of freshwater parasites with complex life-cycles and global distribution. The larval stages are important pathogens causing eye fluke disease implicated in substantial impacts on natural fish populations and losses in aquaculture. However, the problematic species delimitation and difficulties in the identification of larval stages hamper the assessment of the distributional and host ranges of Diplostomum spp. and their transmission ecology. Total genomic DNA was isolated from adult worms and shotgun sequenced using Illumina MiSeq technology. Mitochondrial (mt) genomes and nuclear ribosomal RNA (rRNA) operons were assembled using established bioinformatic tools and fully annotated. Mt protein-coding genes and nuclear rRNA genes were subjected to phylogenetic analysis by maximum likelihood and the resulting topologies compared. We characterised novel complete mt genomes and nuclear rRNA operons of two closely related species, Diplostomum spathaceum and D. pseudospathaceum. Comparative mt genome assessment revealed that the cox1 gene and its 'barcode' region used for molecular identification are the most conserved regions; instead, nad4 and nad5 genes were identified as most promising molecular diagnostic markers. Using the novel data, we provide the first genome wide estimation of the phylogenetic relationships of the order Diplostomida, one of the two fundamental lineages of the Digenea. Analyses of the mitogenomic data invariably recovered the Diplostomidae as a sister lineage of the order Plagiorchiida rather than as a basal lineage of the Diplostomida as inferred in rDNA phylogenies; this was concordant with the mt gene order of Diplostomum spp. exhibiting closer match to the conserved gene order of the Plagiorchiida. Complete sequences of the mt genome and rRNA operon of two species of Diplostomum provide a valuable resource for novel genetic markers for species delineation and

  17. DSAP: deep-sequencing small RNA analysis pipeline.

    Science.gov (United States)

    Huang, Po-Jung; Liu, Yi-Chung; Lee, Chi-Ching; Lin, Wei-Chen; Gan, Richie Ruei-Chi; Lyu, Ping-Chiang; Tang, Petrus

    2010-07-01

    DSAP is an automated multiple-task web service designed to provide a total solution to analyzing deep-sequencing small RNA datasets generated by next-generation sequencing technology. DSAP uses a tab-delimited file as an input format, which holds the unique sequence reads (tags) and their corresponding number of copies generated by the Solexa sequencing platform. The input data will go through four analysis steps in DSAP: (i) cleanup: removal of adaptors and poly-A/T/C/G/N nucleotides; (ii) clustering: grouping of cleaned sequence tags into unique sequence clusters; (iii) non-coding RNA (ncRNA) matching: sequence homology mapping against a transcribed sequence library from the ncRNA database Rfam (http://rfam.sanger.ac.uk/); and (iv) known miRNA matching: detection of known miRNAs in miRBase (http://www.mirbase.org/) based on sequence homology. The expression levels corresponding to matched ncRNAs and miRNAs are summarized in multi-color clickable bar charts linked to external databases. DSAP is also capable of displaying miRNA expression levels from different jobs using a log(2)-scaled color matrix. Furthermore, a cross-species comparative function is also provided to show the distribution of identified miRNAs in different species as deposited in miRBase. DSAP is available at http://dsap.cgu.edu.tw.

  18. Sensitivity of Ribosomal RNA Character Sampling in the Phylogeny of Rhabditida.

    Science.gov (United States)

    Holovachov, Oleksandr; Camp, Lauren; Nadler, Steven A

    2015-12-01

    Near-full-length 18S and 28S rRNA gene sequences were obtained for 33 nematode species. Datasets were constructed based on secondary structure and progressive multiple alignments, and clades were compared for phylogenies inferred by Bayesian and maximum likelihood methods. Clade comparisons were also made following removal of ambiguously aligned sites as determined using the program ProAlign. Different alignments of these data produced tree topologies that differed, sometimes markedly, when analyzed by the same inference method. With one exception, the same alignment produced an identical tree topology when analyzed by different methods. Removal of ambiguously aligned sites altered the tree topology and also reduced resolution. Nematode clades were sensitive to differences in multiple alignments, and more than doubling the amount of sequence data by addition of 28S rRNA did not fully mitigate this result. Although some individual clades showed substantially higher support when 28S data were combined with 18S data, the combined analysis yielded no statistically significant increases in the number of clades receiving higher support when compared to the 18S data alone. Secondary structure alignment increased accuracy in positional homology assignment and, when used in combination with paired-site substitution models, these structural hypotheses of characters and improved models of character state change yielded high levels of phylogenetic resolution. Phylogenetic results included strong support for inclusion of Daubaylia potomaca within Cephalobidae, whereas the position of Fescia grossa within Tylenchina varied depending on the alignment, and the relationships among Rhabditidae, Diplogastridae, and Bunonematidae were not resolved.

  19. Sensitivity of Ribosomal RNA Character Sampling in the Phylogeny of Rhabditida

    Science.gov (United States)

    Holovachov, Oleksandr; Camp, Lauren; Nadler, Steven A.

    2015-01-01

    Near-full-length 18S and 28S rRNA gene sequences were obtained for 33 nematode species. Datasets were constructed based on secondary structure and progressive multiple alignments, and clades were compared for phylogenies inferred by Bayesian and maximum likelihood methods. Clade comparisons were also made following removal of ambiguously aligned sites as determined using the program ProAlign. Different alignments of these data produced tree topologies that differed, sometimes markedly, when analyzed by the same inference method. With one exception, the same alignment produced an identical tree topology when analyzed by different methods. Removal of ambiguously aligned sites altered the tree topology and also reduced resolution. Nematode clades were sensitive to differences in multiple alignments, and more than doubling the amount of sequence data by addition of 28S rRNA did not fully mitigate this result. Although some individual clades showed substantially higher support when 28S data were combined with 18S data, the combined analysis yielded no statistically significant increases in the number of clades receiving higher support when compared to the 18S data alone. Secondary structure alignment increased accuracy in positional homology assignment and, when used in combination with paired-site substitution models, these structural hypotheses of characters and improved models of character state change yielded high levels of phylogenetic resolution. Phylogenetic results included strong support for inclusion of Daubaylia potomaca within Cephalobidae, whereas the position of Fescia grossa within Tylenchina varied depending on the alignment, and the relationships among Rhabditidae, Diplogastridae, and Bunonematidae were not resolved. PMID:26941463

  20. A phylogenetic study on galactose-containing Candida species based on 18S ribosomal DNA sequences.

    Science.gov (United States)

    Suzuki, Motofumi; Suh, Sung-Oui; Sugita, Takashi; Nakase, Takashi

    1999-10-01

    Phylogenetic relationships of 33 Candida species containing galactose in the cells were investigated by using 18S ribosomal DNA sequence analysis. Galactose-containing Candida species and galactose-containing species from nine ascomycetous genera were a heterogeneous assemblage. They were divided into three clusters (II, III, and IV) which were phylogenetically distant from cluster I, comprising 9 galactose-lacking Candida species, C. glabrata, C. holmii, C. krusei, C. tropicalis (the type species of Candida), C. albicans, C. viswanathii, C. maltosa, C. parapsilosis, C. guilliermondii, and C. lusitaniae, and 17 related ascomycetous yeasts. These three clusters were also phylogenetically distant from Schizosaccharomyces pombe, which contains galactomannan in its cell wall. Cluster II comprised C. magnoliae, C. vaccinii, C. apis, C. gropengiesseri, C. etchellsii, C. floricola, C. lactiscondensi, Wickerhamiella domercqiae, C. versatilis, C. azyma, C. vanderwaltii, C. pararugosa, C. sorbophila, C. spandovensis, C. galacta, C. ingens, C. incommunis, Yarrowia lipolytica, Galactomyces geotrichum, and Dipodascus albidus. Cluster III comprised C. tepae, C. antillancae and its synonym C. bondarzewiae, C. ancudensis, C. petrohuensis, C. santjacobensis, C. ciferrii (anamorph of Stephanoascus ciferrii), Arxula terrestris, C. castrensis, C. valdiviana, C. paludigena, C. blankii, C. salmanticensis, C. auringiensis, C. bertae, and its synonym C. bertae var. chiloensis, C. edax (anamorph of Stephanoascus smithiae), Arxula adeninivorans, and C. steatolytica (synonym of Zygoascus hellenicus). Cluster IV comprised C. cantarellii, C. vinaria, Dipodascopsis uninucleata, and Lipomyces lipofer. Two galactose-lacking and Q-8-forming species, C. stellata and Pichia pastoris, and 5 galactose-lacking and Q-9-forming species, C. apicola, C. bombi, C. bombicola, C. geochares, and C. insectalens, were included in Cluster II. Two galactose-lacking and Q-9-forming species, C. drimydis and C

  1. Studies on the 3'-terminal sequences of the large ribosomal ribonucleic acid of different eukaryotes and those associated with "hidden" breaks in heart-dissociable insects 26S ribonucleic acid.

    Science.gov (United States)

    Shine, J; Hunt, J A; Dalgarno, L

    1974-09-01

    The 3'-terminal sequences associated with the large rRNA complex from a range of eukaryotes were determined after pancreatic or T(1)-ribonuclease digestion of RNA terminally labelled with [(3)H]isoniazid. In all higher eukaryotes examined except Drosophila melanogaster, the 3'-terminal sequences Y-G-U(OH) and G-C-U(OH) were demonstrated for the large RNA component(s) and for 6S RNA respectively. The 3'-terminal sequence of Saccharomyces cerevisiae 26S RNA was Y-G-U(OH) and that of 6S RNA Y-A-U-U-U(OH). Three 3'-terminal sequences were found in equimolar amounts in the heat-dissociable 26S rRNA characteristic of insect ribosomes. These were Y-G-U-G-U(OH), Y-C-G-U(OH) and G-C-U(OH) for cultured Antheraea eucalypti cells, Y-G-U(OH), Y-G-U(OH) and G-C-U(OH) for Galleria mellonella larvae and Y-C-G-A(OH), Y-G-U-A(OH) and G-Y-U-G(OH) for Drosophila melanogaster flies. Thus the introduction of the central scission in insect 26S rRNA results in the generation of a unique 3'-terminus and does not arise from random cleavage of the polynucleotide chain.

  2. A definition of the domains Archaea, Bacteria and Eucarya in terms of small subunit ribosomal RNA characteristics

    Energy Technology Data Exchange (ETDEWEB)

    Winker, S. [Argonne National Lab., IL (United States). Mathematics and Computer Science Div.; Woese, C.R. [Univ. of Illinois, Urbana, IL (United States). Dept. of Microbiology

    1994-11-01

    The number of small subunit rRNA sequences is not great enough that the three domains Archaea, Bacteria, and Eucarya (Woese, et al., 1990) can be reliably defined in terms of their sequence ``signatures.`` Approximately 50 homologous positions (or nucleotide pairs) in the small subunit rRNA characterized and distinguish among the three. In addition, the three can be recognized by a variety of nonhomologous rRNA characters, either individual positions and/or higher-order structural features. The Crenarchaeota and the Euryarchaeota, the two archaeal kingdoms, can also be defined and distinguished by their characteristic composition at approximately fifteen positions in the small subunit rRNA molecule.

  3. A definition of the domains Archaea, Bacteria and Eucarya in terms of small subunit ribosomal RNA characteristics

    Science.gov (United States)

    Winker, S.; Woese, C. R.

    1991-01-01

    The number of small subunit rRNA sequences is now great enough that the three domains Archaea, Bacteria and Eucarya (Woese et al., 1990) can be reliably defined in terms of their sequence "signatures". Approximately 50 homologous positions (or nucleotide pairs) in the small subunit rRNA characterize and distinguish among the three. In addition, the three can be recognized by a variety of nonhomologous rRNA characters, either individual positions and/or higher-order structural features. The Crenarchaeota and the Euryarchaeota, the two archaeal kingdoms, can also be defined and distinguished by their characteristic compositions at approximately fifteen positions in the small subunit rRNA molecule.

  4. Molecular inventory control in ribosome biosynthesis.

    Science.gov (United States)

    Warner, J R; Johnson, S P

    1986-11-01

    The eukaryotic cell coordinates the accumulation of each ribosomal protein with every other ribosomal protein, with ribosomal RNA and with the needs of the cell. To do so it regulates the transcription, processing, translation and lifetime of the mRNA for ribosomal proteins. When all else fails, it rapidly degrades any excess ribosomal protein which is synthesized.

  5. Specific 16S ribosomal RNA targeted oligonucleotide probe against Clavibacter michiganensis subsp. sepedonicus.

    Science.gov (United States)

    Mirza, M S; Rademaker, J L; Janse, J D; Akkermans, A D

    1993-11-01

    In this article we report on the polymerase chain reaction amplification of a partial 16S rRNA gene from the plant pathogenic bacterium Clavibacter michiganensis subsp. sepedonicus. A partial sequence (about 400 base pairs) of the gene was determined that covered two variable regions important for oligonucleotide probe development. A specific 24mer oligonucleotide probe targeted against the V6 region of 16S rRNA was designed. Specificity of the probe was determined using dot blot hybridization. Under stringent conditions (60 degrees C), the probe hybridized with all 16 Cl. michiganensis subsp. sepedonicus strains tested. Hybridization did not occur with 32 plant pathogenic and saprophytic bacteria used as controls under the same conditions. Under less stringent conditions (55 degrees C) the related Clavibacter michiganensis subsp. insidiosus, Clavibacter michiganensis subsp. nebraskensis, and Clavibacter michiganensis subsp. tesselarius also showed hybridization. At even lower stringency (40 degrees C), all Cl. michiganensis subspecies tested including Clavibacter michiganensis subsp. michiganensis showed hybridization signal, suggesting that under these conditions the probe may be used as a species-specific probe for Cl. michiganensis.

  6. Employment of Near Full-Length Ribosome Gene TA-Cloning and Primer-Blast to Detect Multiple Species in a Natural Complex Microbial Community Using Species-Specific Primers Designed with Their Genome Sequences.

    Science.gov (United States)

    Zhang, Huimin; He, Hongkui; Yu, Xiujuan; Xu, Zhaohui; Zhang, Zhizhou

    2016-11-01

    It remains an unsolved problem to quantify a natural microbial community by rapidly and conveniently measuring multiple species with functional significance. Most widely used high throughput next-generation sequencing methods can only generate information mainly for genus-level taxonomic identification and quantification, and detection of multiple species in a complex microbial community is still heavily dependent on approaches based on near full-length ribosome RNA gene or genome sequence information. In this study, we used near full-length rRNA gene library sequencing plus Primer-Blast to design species-specific primers based on whole microbial genome sequences. The primers were intended to be specific at the species level within relevant microbial communities, i.e., a defined genomics background. The primers were tested with samples collected from the Daqu (also called fermentation starters) and pit mud of a traditional Chinese liquor production plant. Sixteen pairs of primers were found to be suitable for identification of individual species. Among them, seven pairs were chosen to measure the abundance of microbial species through quantitative PCR. The combination of near full-length ribosome RNA gene library sequencing and Primer-Blast may represent a broadly useful protocol to quantify multiple species in complex microbial population samples with species-specific primers.

  7. Mutation of miRNA target sequences during human evolution

    DEFF Research Database (Denmark)

    Gardner, Paul P; Vinther, Jeppe

    2008-01-01

    It has long-been hypothesized that changes in non-protein-coding genes and the regulatory sequences controlling expression could undergo positive selection. Here we identify 402 putative microRNA (miRNA) target sequences that have been mutated specifically in the human lineage and show that genes...... containing such deletions are more highly expressed than their mouse orthologs. Our findings indicate that some miRNA target mutations are fixed by positive selection and might have been involved in the evolution of human-specific traits.......It has long-been hypothesized that changes in non-protein-coding genes and the regulatory sequences controlling expression could undergo positive selection. Here we identify 402 putative microRNA (miRNA) target sequences that have been mutated specifically in the human lineage and show that genes...

  8. Comparison of fungi within the Gaeumannomyces-Phialophora complex by analysis of ribosomal DNA sequences.

    Science.gov (United States)

    Bryan, G T; Daniels, M J; Osbourn, A E

    1995-02-01

    Four ascomycete species of the genus Gaeumannomyces infect roots of monocotyledons. Gaeumannomyces graminis contains four varieties, var. tritici, var. avenae, var. graminis, and var. maydis. G. graminis varieties tritici, avenae, and graminis have Phialophora-like anamorphs and, together with the other Gaeumannomyces and Phialophora species found on cereal roots, constitute the Gaeumannomyces-Phialophora complex. Relatedness of a number of Gaeumannomyces and Phialophora isolates was assessed by comparison of DNA sequences of the 18S rRNA gene, the 5.8S rRNA gene, and the internal transcribed spacers (ITS). G. graminis var. tritici, G. graminis var. avenae, and G. graminis var. graminis isolates can be distinguished from each other by nucleotide sequence differences in the ITS regions. The G. graminis var. tritici isolates can be further subdivided into R and N isolates (correlating with ability [R] or inability [N] to infect rye). Phylogenetic analysis of the ITS regions of several oat-infecting G. graminis var. tritici isolates suggests that these isolates are actually more closely related to G. graminis var. avenae. The isolates of Magnaporthe grisea included in the analysis showed a surprising degree of relatedness to members of the Gaeumannomyces-Phialophora complex. G. graminis variety-specific oligonucleotide primers were used in PCRs to amplify DNA from cereal seedlings infected with G. graminis var. tritici or G. graminis var. avenae, and these should be valuable for sensitive detection of pathogenic isolates and for diagnosis of take-all.

  9. Phylogeny-function analysis of (meta)genomic libraries: screening for expression of ribosomal RNA genes by large-insert library fluorescent in situ hybridization (LIL-FISH)

    NARCIS (Netherlands)

    Leveau, J.H.J.; Gerards, S.; De Boer, W.; Van Veen, J.A.

    2004-01-01

    We assessed the utility of fluorescent in situ hybridization (FISH) in the screening of clone libraries of (meta)genomic or environmental DNA for the presence and expression of bacterial ribosomal RNA (rRNA) genes. To establish proof-of-principle, we constructed a fosmid-based library in Escherichia

  10. The structure of the archaebacterial ribosomal protein S7 and its possible interaction with 16S rRNA.

    Science.gov (United States)

    Hosaka, H; Yao, M; Kimura, M; Tanaka, I

    2001-11-01

    Ribosomal protein S7 is one of the ubiquitous components of the small subunit of the ribosome. It is a 16S rRNA-binding protein positioned close to the exit of the tRNA, and it plays a role in initiating assembly of the head of the 30S subunit. Previous structural analyses of eubacterial S7 have shown that it has a stable alpha-helix core and a flexible beta-arm. Unlike these eubacterial proteins, archaebacterial or eukaryotic S7 has an N-terminal extension of approximately 60 residues. The crystal structure of S7 from archaebacterium Pyrococcus horikoshii (PhoS7) has been determined at 2.1 A resolution. The final model of PhoS7 consists of six major alpha-helices, a short 3(10)-helix and two beta-stands. The major part (residues 18-45) of the N-terminal extension of PhoS7 reinforces the alpha-helical core by well-extended hydrophobic interactions, while the other part (residues 46-63) is not visible in the crystal and is possibly fixed only by interacting with 16S rRNA. These differences in the N-terminal extension as well as in the insertion (between alpha1 and alpha2) of the archaebacterial S7 structure from eubacterial S7 are such that they do not necessitate a major change in the structure of the currently available eubacterial 16S rRNA. Some of the inserted chains might pass through gaps formed by helices of the 16S rRNA.

  11. Inhibition of the protein kinase PKR by the internal ribosome entry site of hepatitis C virus genomic RNA.

    Science.gov (United States)

    Vyas, Jashmin; Elia, Androulla; Clemens, Michael J

    2003-07-01

    Translation of the hepatitis C genome is mediated by internal ribosome entry on the structurally complex 5' untranslated region of the large viral RNA. Initiation of protein synthesis by this mechanism is independent of the cap-binding factor eIF4E, but activity of the initiator Met-tRNA(f)-binding factor eIF2 is still required. HCV protein synthesis is thus potentially sensitive to the inhibition of eIF2 activity that can result from the phosphorylation of the latter by the interferon-inducible, double-stranded RNA-activated protein kinase PKR. Two virally encoded proteins, NS5A and E2, have been shown to reduce this inhibitory effect of PKR by impairing the activation of the kinase. Here we present evidence for a third viral strategy for PKR inhibition. A region of the viral RNA comprising part of the internal ribosome entry site (IRES) is able to bind to PKR in competition with double-stranded RNA and can prevent autophosphorylation and activation of the kinase in vitro. The HCV IRES itself has no PKR-activating ability. Consistent with these findings, cotransfection experiments employing a bicistronic reporter construct and wild-type PKR indicate that expression of the protein kinase is less inhibitory towards HCV IRES-driven protein synthesis than towards cap-dependent protein synthesis. These data suggest a dual function for the viral IRES, with both a structural role in promoting initiation complex formation and a regulatory role in preventing inhibition of initiation by PKR.

  12. Nucleotide sequence of cDNA coding for dianthin 30, a ribosome inactivating protein from Dianthus caryophyllus.

    Science.gov (United States)

    Legname, G; Bellosta, P; Gromo, G; Modena, D; Keen, J N; Roberts, L M; Lord, J M

    1991-08-27

    Rabbit antibodies raised against dianthin 30, a ribosome inactivating protein from carnation (Dianthus caryophyllus) leaves, were used to identify a full length dianthin precursor cDNA clone from a lambda gt11 expression library. N-terminal amino acid sequencing of purified dianthin 30 and dianthin 32 confirmed that the clone encoded dianthin 30. The cDNA was 1153 basepairs in length and encoded a precursor protein of 293 amino acid residues. The first 23 N-terminal amino acids of the precursor represented the signal sequence. The protein contained a carboxy-terminal region which, by analogy with barley lectin, may contain a vacuolar targeting signal.

  13. Inter-Protein Sequence Co-Evolution Predicts Known Physical Interactions in Bacterial Ribosomes and the Trp Operon.

    Science.gov (United States)

    Feinauer, Christoph; Szurmant, Hendrik; Weigt, Martin; Pagnani, Andrea

    2016-01-01

    Interaction between proteins is a fundamental mechanism that underlies virtually all biological processes. Many important interactions are conserved across a large variety of species. The need to maintain interaction leads to a high degree of co-evolution between residues in the interface between partner proteins. The inference of protein-protein interaction networks from the rapidly growing sequence databases is one of the most formidable tasks in systems biology today. We propose here a novel approach based on the Direct-Coupling Analysis of the co-evolution between inter-protein residue pairs. We use ribosomal and trp operon proteins as test cases: For the small resp. large ribosomal subunit our approach predicts protein-interaction partners at a true-positive rate of 70% resp. 90% within the first 10 predictions, with areas of 0.69 resp. 0.81 under the ROC curves for all predictions. In the trp operon, it assigns the two largest interaction scores to the only two interactions experimentally known. On the level of residue interactions we show that for both the small and the large ribosomal subunit our approach predicts interacting residues in the system with a true positive rate of 60% and 85% in the first 20 predictions. We use artificial data to show that the performance of our approach depends crucially on the size of the joint multiple sequence alignments and analyze how many sequences would be necessary for a perfect prediction if the sequences were sampled from the same model that we use for prediction. Given the performance of our approach on the test data we speculate that it can be used to detect new interactions, especially in the light of the rapid growth of available sequence data.

  14. A tRNA body with high affinity for EF-Tu hastens ribosomal incorporation of unnatural amino acids.

    Science.gov (United States)

    Ieong, Ka-Weng; Pavlov, Michael Y; Kwiatkowski, Marek; Ehrenberg, Måns; Forster, Anthony C

    2014-05-01

    There is evidence that tRNA bodies have evolved to reduce differences between aminoacyl-tRNAs in their affinity to EF-Tu. Here, we study the kinetics of incorporation of L-amino acids (AAs) Phe, Ala allyl-glycine (aG), methyl-serine (mS), and biotinyl-lysine (bK) using a tRNA(Ala)-based body (tRNA(AlaB)) with a high affinity for EF-Tu. Results are compared with previous data on the kinetics of incorporation of the same AAs using a tRNA(PheB) body with a comparatively low affinity for EF-Tu. All incorporations exhibited fast and slow phases, reflecting the equilibrium fraction of AA-tRNA in active ternary complex with EF-Tu:GTP before the incorporation reaction. Increasing the concentration of EF-Tu increased the amplitude of the fast phase and left its rate unaltered. This allowed estimation of the affinity of each AA-tRNA to EF-Tu:GTP during translation, showing about a 10-fold higher EF-Tu affinity for AA-tRNAs formed from the tRNA(AlaB) body than from the tRNA(PheB) body. At ∼1 µM EF-Tu, tRNA(AlaB) conferred considerably faster incorporation kinetics than tRNA(PheB), especially in the case of the bulky bK. In contrast, the swap to the tRNA(AlaB) body did not increase the fast phase fraction of N-methyl-Phe incorporation, suggesting that the slow incorporation of N-methyl-Phe had a different cause than low EF-Tu:GTP affinity. The total time for AA-tRNA release from EF-Tu:GDP, accommodation, and peptidyl transfer on the ribosome was similar for the tRNA(AlaB) and tRNA(PheB) bodies. We conclude that a tRNA body with high EF-Tu affinity can greatly improve incorporation of unnatural AAs in a potentially generalizable manner.

  15. The ribosomal genes of Mycoplasma capricolum.

    Science.gov (United States)

    Muto, A; Hori, H; Sawada, M; Kawauchi, Y; Iwami, M; Yamao, F; Osawa, S

    1983-01-01

    The nucleotide sequence of 5S rRNA from Mycoplasma capricolum is more similar to that of the gram-positive bacteria than that of the gram-negative bacteria. The presence of two copies of rRNA genes in M. capricolum genome has been demonstrated. The two different rRNA gene clusters have been cloned in E. coli plasmid vectors and analyzed for the rRNA gene organizations, demonstrating that the gene arrangement is in the order of 16S, 23S, and 5S rDNA. The ribosomes of M. capricolum contain about 30 species of proteins in 50S and 20 in 30S subunits. The number and size of the ribosomal proteins are not significantly different from those of other eubacterial ribosomes.

  16. Archaea box C/D enzymes methylate two distinct substrate rRNA sequences with different efficiency.

    Science.gov (United States)

    Graziadei, Andrea; Masiewicz, Pawel; Lapinaite, Audrone; Carlomagno, Teresa

    2016-05-01

    RNA modifications confer complexity to the 4-nucleotide polymer; nevertheless, their exact function is mostly unknown. rRNA 2'-O-ribose methylation concentrates to ribosome functional sites and is important for ribosome biogenesis. The methyl group is transferred to rRNA by the box C/D RNPs: The rRNA sequence to be methylated is recognized by a complementary sequence on the guide RNA, which is part of the enzyme. In contrast to their eukaryotic homologs, archaeal box C/D enzymes can be assembled in vitro and are used to study the mechanism of 2'-O-ribose methylation. In Archaea, each guide RNA directs methylation to two distinct rRNA sequences, posing the question whether this dual architecture of the enzyme has a regulatory role. Here we use methylation assays and low-resolution structural analysis with small-angle X-ray scattering to study the methylation reaction guided by the sR26 guide RNA fromPyrococcus furiosus We find that the methylation efficacy at sites D and D' differ substantially, with substrate D' turning over more efficiently than substrate D. This observation correlates well with structural data: The scattering profile of the box C/D RNP half-loaded with substrate D' is similar to that of the holo complex, which has the highest activity. Unexpectedly, the guide RNA secondary structure is not responsible for the functional difference at the D and D' sites. Instead, this difference is recapitulated by the nature of the first base pair of the guide-substrate duplex. We suggest that substrate turnover may occur through a zip mechanism that initiates at the 5'-end of the product.

  17. Translating RNA sequencing into clinical diagnostics: opportunities and challenges.

    Science.gov (United States)

    Byron, Sara A; Van Keuren-Jensen, Kendall R; Engelthaler, David M; Carpten, John D; Craig, David W

    2016-05-01

    With the emergence of RNA sequencing (RNA-seq) technologies, RNA-based biomolecules hold expanded promise for their diagnostic, prognostic and therapeutic applicability in various diseases, including cancers and infectious diseases. Detection of gene fusions and differential expression of known disease-causing transcripts by RNA-seq represent some of the most immediate opportunities. However, it is the diversity of RNA species detected through RNA-seq that holds new promise for the multi-faceted clinical applicability of RNA-based measures, including the potential of extracellular RNAs as non-invasive diagnostic indicators of disease. Ongoing efforts towards the establishment of benchmark standards, assay optimization for clinical conditions and demonstration of assay reproducibility are required to expand the clinical utility of RNA-seq.

  18. Symportin 1 chaperones 5S RNP assembly during ribosome biogenesis by occupying an essential rRNA-binding site.

    Science.gov (United States)

    Calviño, Fabiola R; Kharde, Satyavati; Ori, Alessandro; Hendricks, Astrid; Wild, Klemens; Kressler, Dieter; Bange, Gert; Hurt, Ed; Beck, Martin; Sinning, Irmgard

    2015-04-07

    During 60S biogenesis, mature 5S RNP consisting of 5S RNA, RpL5 and RpL11, assembles into a pre-60S particle, where docking relies on RpL11 interacting with helix 84 (H84) of the 25S RNA. How 5S RNP is assembled for recruitment into the pre-60S is not known. Here we report the crystal structure of a ternary symportin Syo1-RpL5-N-RpL11 complex and provide biochemical and structural insights into 5S RNP assembly. Syo1 guards the 25S RNA-binding surface on RpL11 and competes with H84 for binding. Pull-down experiments show that H84 releases RpL11 from the ternary complex, but not in the presence of 5S RNA. Crosslinking mass spectrometry visualizes structural rearrangements on incorporation of 5S RNA into the Syo1-RpL5-RpL11 complex supporting the formation of a pre-5S RNP. Our data underline the dual role of Syo1 in ribosomal protein transport and as an assembly platform for 5S RNP.

  19. Symportin 1 chaperones 5S RNP assembly during ribosome biogenesis by occupying an essential rRNA-binding site

    Science.gov (United States)

    Calviño, Fabiola R.; Kharde, Satyavati; Ori, Alessandro; Hendricks, Astrid; Wild, Klemens; Kressler, Dieter; Bange, Gert; Hurt, Ed; Beck, Martin; Sinning, Irmgard

    2015-04-01

    During 60S biogenesis, mature 5S RNP consisting of 5S RNA, RpL5 and RpL11, assembles into a pre-60S particle, where docking relies on RpL11 interacting with helix 84 (H84) of the 25S RNA. How 5S RNP is assembled for recruitment into the pre-60S is not known. Here we report the crystal structure of a ternary symportin Syo1-RpL5-N-RpL11 complex and provide biochemical and structural insights into 5S RNP assembly. Syo1 guards the 25S RNA-binding surface on RpL11 and competes with H84 for binding. Pull-down experiments show that H84 releases RpL11 from the ternary complex, but not in the presence of 5S RNA. Crosslinking mass spectrometry visualizes structural rearrangements on incorporation of 5S RNA into the Syo1-RpL5-RpL11 complex supporting the formation of a pre-5S RNP. Our data underline the dual role of Syo1 in ribosomal protein transport and as an assembly platform for 5S RNP.

  20. An intron in a ribosomal protein gene from Tetrahymena

    DEFF Research Database (Denmark)

    Nielsen, Henrik; Andreasen, Per Hove; Dreisig, Hanne

    1986-01-01

    We have cloned and sequenced a single copy gene encoding a ribosomal protein from the ciliate Tetrahymena thermophila. The gene product was identified as ribosomal protein S25 by comparison of the migration in two-dimensional polyacrylamide gels of the protein synthesized by translation in vitro...... of hybrid-selected mRNA and authentic ribosomal proteins. The proteins show strong homology to ribosomal protein S12 from Escherichia coli. The coding region of the gene is interrupted by a 979-bp intron 68 bp downstream of the translation start. This is the first intron in a protein encoding gene...

  1. Phylogenetic relationships of Salmonella based on rRNA sequences

    DEFF Research Database (Denmark)

    Christensen, H.; Nordentoft, Steen; Olsen, J.E.

    1998-01-01

    To establish the phylogenetic relationships between the subspecies of Salmonella enterica (official name Salmonella choleraesuis), Salmonella bongori and related members of Enterobacteriaceae, sequence comparison of rRNA was performed by maximum-likelihood analysis. The two Salmonella species wer...

  2. Molecular systematics of the Phyllachorales (ascomycota, fungi based on 18S ribosomal DNA sequences

    Directory of Open Access Journals (Sweden)

    Wanderlei-Silva Denise

    2003-01-01

    Full Text Available In order to evaluate the monophyly of the Phyllachorales from a molecular standpoint and elucidate its phylogenetic relationships with other orders, a segment of the 18S rRNA gene from several representatives of the Phyllachorales, including species of Glomerella, Phyllachora, Coccodiella (=Coccostroma, Sphaerodothis, Ophiodothella, as well as Magnaporthe was sequenced. Maximum Parsimony analysis revealed that the Phyllachorales was a polyphyletic assemblage of taxa. None of the other members of the Phyllachorales, which produced either a clypeus or stroma, clustered with Glomerella. Of the taxa examined, was Coccodiella the closest relative of Phyllachora. Magnaporthe was closely related to the Diaporthales. Our 18S rDNA data highly supported Glomerella being accommodated in a separate family.

  3. Hyper-regulation of pyr-gene expression in Escherichia coli cells with slow ribosomes. Evidence for RNA polymerase pausing in vivo

    DEFF Research Database (Denmark)

    Jensen, Kaj Frank

    1988-01-01

    transcription should terminate or continue into the structural genes. This paper described a study of pyrBI and pyrE gene regulation in cells where the ribosomes move slowly as a result of mutation in rpsL. It appears that expression of the two genes is hyper-regulated by the UTP pool in this type of cells......UTP-modulated attenuation of transcription is involved in regulating the synthesis of pyrimidine nucleotides in Escherichia coli. Thus, expression of two genes, pyrBI and pyrE, was shown to be under this type of control. The genes encode the two subunits of aspartate transcarbamylase and orotate....... Mechanistically this will couple the ribosomes translating a leader peptide gene more tightly to the elongating RNA polymerase. The ribosomes will then be more prone to prevent the folding of the mRNA chains into terminating hairpin structures when RNA polymerase is at the attenuator and has to decide whether...

  4. VITCOMIC: visualization tool for taxonomic compositions of microbial communities based on 16S rRNA gene sequences

    Directory of Open Access Journals (Sweden)

    Kurokawa Ken

    2010-06-01

    Full Text Available Abstract Background Understanding the community structure of microbes is typically accomplished by sequencing 16S ribosomal RNA (16S rRNA genes. These community data can be represented by constructing a phylogenetic tree and comparing it with other samples using statistical methods. However, owing to high computational complexity, these methods are insufficient to effectively analyze the millions of sequences produced by new sequencing technologies such as pyrosequencing. Results We introduce a web tool named VITCOMIC (VIsualization tool for Taxonomic COmpositions of MIcrobial Community that can analyze millions of bacterial 16S rRNA gene sequences and calculate the overall taxonomic composition for a microbial community. The 16S rRNA gene sequences of genome-sequenced strains are used as references to identify the nearest relative of each sample sequence. With this information, VITCOMIC plots all sequences in a single figure and indicates relative evolutionary distances. Conclusions VITCOMIC yields a clear representation of the overall taxonomic composition of each sample and facilitates an intuitive understanding of differences in community structure between samples. VITCOMIC is freely available at http://mg.bio.titech.ac.jp/vitcomic/.

  5. The localization of multiple sites on 16S RNA which are cross-linked to proteins S7 and S8 in Escherichia coli 30S ribosomal subunits by treatment with 2-iminothiolane.

    Science.gov (United States)

    Wower, I; Brimacombe, R

    1983-03-11

    RNA-protein cross-links were introduced into E. coli 30S ribosomal subunits by reaction with 2-iminothiolane followed by a mild ultraviolet irradiation treatment. After removal of non-reacted protein and partial nuclease digestion of the cross-linked 16S RNA-protein moiety, a number of individual cross-linked complexes could be isolated and the sites of attachment of the proteins to the RNA determined. Protein S8 was cross-linked to the RNA at three different positions, within oligo-nucleotides encompassing positions 629-633, 651-654, and (tentatively) 593-597 in the 16S sequence. Protein S7 was cross-linked within two oligonucleotides encompassing positions 1238-1240, and 1377-1378. In addition, a site at position 723-724 was observed, cross-linked to protein S19, S20 or S21.

  6. Babesia canis canis, Babesia canis vogeli, Babesia canis rossi: differentiation of the three subspecies by a restriction fragment length polymorphism analysis on amplified small subunit ribosomal RNA genes.

    Science.gov (United States)

    Carret, C; Walas, F; Carcy, B; Grande, N; Précigout, E; Moubri, K; Schetters, T P; Gorenflot, A

    1999-01-01

    The parasites Babesia canis and Babesia gibsoni (phylum Apicomplexa) are responsible for canine babesiosis throughout the world. Babesia canis was previously described as a group of three biologically different subspecies, namely B. canis canis, B. canis vogeli, and B. canis rossi. We report partial sequences of small subunit ribosomal RNA gene (ssu-rDNA) of each subspecies amplified in vitro with primers derived from a semi-conserved region of the ssu-rDNA genes in other Babesia species. The polymerase chain reaction combined with a restriction fragment length polymorphism analysis, using HinfI and TaqI restriction enzymes, confirmed the separation of B. canis into three subspecies. These sequences were compared with previously published sequences of other Babesia species. A phylogenetic approach showed that the three subspecies of B. canis belong to the clade of Babesia species sensu stricto where B. canis canis clusters with B. canis rossi whereas B. canis vogeli might form a monophyletic group with the cluster B. divergens and B. odocoilei. Our results show that the three subspecies of B. canis can readily be differentiated at the molecular level and suggest that they might be considered as true species.

  7. A Nucleolar PUF RNA-binding Protein with Specificity for a Unique RNA Sequence.

    Science.gov (United States)

    Zhang, Chi; Muench, Douglas G

    2015-12-11

    PUF proteins are a conserved group of sequence specific RNA-binding proteins that bind to RNA in a modular fashion. The RNA-binding domain of PUF proteins typically consists of eight clustered Puf repeats. Plant genomes code for large families of PUF proteins that show significant variability in their predicted Puf repeat number, organization, and amino acid sequence. Here we sought to determine whether the observed variability in the RNA-binding domains of four plant PUFs results in a preference for nonclassical PUF RNA target sequences. We report the identification of a novel RNA binding sequence for a nucleolar Arabidopsis PUF protein that contains an atypical RNA-binding domain. The Arabidopsis PUM23 (APUM23) binding sequence was 10 nucleotides in length, contained a centrally located UUGA core element, and had a preferred cytosine at nucleotide position 8. These RNA sequence characteristics differ from those of other PUF proteins, because all natural PUFs studied to date bind to RNAs that contain a conserved UGU sequence at their 5' end and lack specificity for cytosine. Gel mobility shift assays validated the identity of the APUM23 binding sequence and supported the location of 3 of the 10 predicted Puf repeats in APUM23, including the cytosine-binding repeat. The preferred 10-nucleotide sequence bound by APUM23 is present within the 18S rRNA sequence, supporting the known role of APUM23 in 18S rRNA maturation. This work also reveals that APUM23, an ortholog of yeast Nop9, could provide an advanced structural backbone for Puf repeat engineering and target-specific regulation of cellular RNAs.

  8. Ribosome maturation in E. coli.

    Science.gov (United States)

    Silengo, L; Altruda, F; Dotto, G P; Lacquaniti, F; Perlo, C; Turco, E; Mangiarotti, G

    1977-01-01

    In vivo and in vitro experiments have shown that processing of ribosomal RNA is a late event in ribosome biogenesis. The precursor form of RNA is probably necessary to speed up the assembly of ribomal proteins. Newly formed ribosomal particles which have already entered polyribosomes differ from mature ribosomes not only in their RNA content but also in their susceptibility to unfolding in low Mg concentration and to RNase attack. Final maturation of new ribosomes is probably dependent on their functioning in protein synthesis. Thus only those ribosomes which have proven to be functional may be converted into stable cellular structures.

  9. Molecular characterization of the full-length 23S and 5S ribosomal RNA (rRNA) genes of Taylorella asinigenitalis.

    Science.gov (United States)

    Tazumi, Akihiro; Saito, Satoru; Sekizuka, Tsuyoshi; Murayama, Ohoshi; Takamiya, Shinzaburo; Moore, John E; Millar, B Cherie; Matsuda, Motoo

    2007-08-01

    An approximately 4.2 kbp region encoding 23S and 5S rRNA genes was identified when recombinant plasmid DNAs from two genomic DNA libraries and an inverse PCR product of Taylorella asinigenitalis UK-1 isolate were analyzed. Full-length genes of 23S rRNA (3,225 bp) and 5S rRNA (117 bp) of T. asinigenitalis are described. The present sequence analysis identified a non-coding hypothetically intrinsic transcription terminator region downstream of the 5S rRNA gene. The sequence, however, downstream of the 5S rRNA gene did not show any distal tRNA genes. Surprisingly, an intervening sequence (IVS) of 270 bp in length, including two specific tandem repeat units of 80 bp and one partial unit of 48 bp with unknown functions was identified in the first quarter of the 23S rRNA gene sequence. A second IVS of 70 bp in length was also identified in the central region of the 23S rRNA gene. In addition, by using PCR and sequencing procedures, two T. asinigenitalis isolates, UK-1 and UK-2, carried multiple IVSs in the first quarter and central regions. Moreover, the 23S rRNA fragmentation occurred in the UK-1 isolate. A phylogenetic analysis was first carried out based on the 23S rRNA sequence data from T. asinigenitalis UK-1 and 13 other beta-Proteobacteria. This is the first report of IVSs in the 23S rRNA gene from the beta-Proteobacteria.

  10. Ribosomal RNA phylogeny of bodonid and diplonemid flagellates and the evolution of euglenozoa.

    Science.gov (United States)

    von der Heyden, Sophie; Chao, Ema E; Vickerman, Keith; Cavalier-Smith, Thomas

    2004-01-01

    Euglenozoa is a major phylum of excavate protozoa (comprising euglenoids, kinetoplastids, and diplonemids) with highly unusual nuclear, mitochondrial, and chloroplast genomes. To improve understanding of euglenozoan evolution, we sequenced nuclear small-subunit rRNA genes from 34 bodonids (Bodo, Neobodo, Parabodo, Dimastigella-like, Rhynchobodo, Rhynchomonas, and unidentified strains), nine diplonemids (Diplonema, Rhynchopus), and a euglenoid (Entosiphon). Phylogenetic analysis reveals that diplonemids and bodonids are more diverse than previously recognised, but does not clearly establish the branching order of kinetoplastids, euglenoids, and diplonemids. Rhynchopus is holophyletic; parasitic species arose from within free-living species. Kinetoplastea (bodonids and trypanosomatids) are robustly holophyletic and comprise a major clade including all trypanosomatids and most bodonids ('core bodonids') and a very divergent minor one including Ichthyobodo. The root of the major kinetoplastid clade is probably between trypanosomatids and core bodonids. Core bodonids have three distinct subclades. Clade 1 has two distinct Rhynchobodo-like lineages; a lineage comprising Dimastigella and Rhynchomonas; and another including Cruzella and Neobodo. Clade 2 comprises Cryptobia/ Trypanoplasma, Procryptobia, and Parabodo. Clade 3 is an extensive Bodo saltans species complex. Neobodo designis is a vast genetically divergent species complex with mutually exclusive marine and freshwater subclades. Our analysis supports three phagotrophic euglenoid orders: Petalomonadida (holophyletic), Ploeotiida (probably holophyletic), Peranemida (paraphyletic).

  11. The majority of total nuclear-encoded non-ribosomal RNA in a human cell is 'dark matter' un-annotated RNA

    Directory of Open Access Journals (Sweden)

    Milos Patrice

    2010-12-01

    Full Text Available Abstract Background Discovery that the transcriptional output of the human genome is far more complex than predicted by the current set of protein-coding annotations and that most RNAs produced do not appear to encode proteins has transformed our understanding of genome complexity and suggests new paradigms of genome regulation. However, the fraction of all cellular RNA whose function we do not understand and the fraction of the genome that is utilized to produce that RNA remain controversial. This is not simply a bookkeeping issue because the degree to which this un-annotated transcription is present has important implications with respect to its biologic function and to the general architecture of genome regulation. For example, efforts to elucidate how non-coding RNAs (ncRNAs regulate genome function will be compromised if that class of RNAs is dismissed as simply 'transcriptional noise'. Results We show that the relative mass of RNA whose function and/or structure we do not understand (the so called 'dark matter' RNAs, as a proportion of all non-ribosomal, non-mitochondrial human RNA (mt-RNA, can be greater than that of protein-encoding transcripts. This observation is obscured in studies that focus only on polyA-selected RNA, a method that enriches for protein coding RNAs and at the same time discards the vast majority of RNA prior to analysis. We further show the presence of a large number of very long, abundantly-transcribed regions (100's of kb in intergenic space and further show that expression of these regions is associated with neoplastic transformation. These overlap some regions found previously in normal human embryonic tissues and raises an interesting hypothesis as to the function of these ncRNAs in both early development and neoplastic transformation. Conclusions We conclude that 'dark matter' RNA can constitute the majority of non-ribosomal, non-mitochondrial-RNA and a significant fraction arises from numerous very long

  12. A comparison between ribo-minus RNA-sequencing and polyA-selected RNA-sequencing.

    Science.gov (United States)

    Cui, Peng; Lin, Qiang; Ding, Feng; Xin, Chengqi; Gong, Wei; Zhang, Lingfang; Geng, Jianing; Zhang, Bing; Yu, Xiaomin; Yang, Jin; Hu, Songnian; Yu, Jun

    2010-11-01

    To compare the two RNA-sequencing protocols, ribo-minus RNA-sequencing (rmRNA-seq) and polyA-selected RNA-sequencing (mRNA-seq), we acquired transcriptomic data-52 and 32 million alignable reads of 35 bases in length-from the mouse cerebrum, respectively. We found that a higher proportion, 44% and 25%, of the uniquely alignable rmRNA-seq reads, is in intergenic and intronic regions, respectively, as compared to 23% and 15% from the mRNA-seq dataset. Further analysis made an additional discovery of transcripts of protein-coding genes (such as Histone, Heg1, and Dux), ncRNAs, snoRNAs, snRNAs, and novel ncRNAs as well as repeat elements in rmRNA-seq dataset. This result suggests that rmRNA-seq method should detect more polyA- or bimorphic transcripts. Finally, through comparative analyses of gene expression profiles among multiple datasets, we demonstrated that different RNA sample preparations may result in significant variations in gene expression profiles. Copyright © 2010 Elsevier Inc. All rights reserved.

  13. CRM1 and its ribosome export adaptor NMD3 localize to the nucleolus and affect rRNA synthesis.

    Science.gov (United States)

    Bai, Baoyan; Moore, Henna M; Laiho, Marikki

    2013-01-01

    CRM1 is an export factor that together with its adaptor NMD3 transports numerous cargo molecules from the nucleus to cytoplasm through the nuclear pore. Previous studies have suggested that CRM1 and NMD3 are detected in the nucleolus. However, their localization with subnucleolar domains or participation in the activities of the nucleolus are unclear. We demonstrate here biochemically and using imaging analyses that CRM1 and NMD3 co-localize with nucleolar marker proteins in the nucleolus. In particular, their nucleolar localization is markedly increased by inhibition of RNA polymerase I (Pol I) transcription by actinomycin D or by silencing Pol I catalytic subunit, RPA194. We show that CRM1 nucleolar localization is dependent on its activity and the expression of NMD3, whereas NMD3 nucleolar localization is independent of CRM1. This suggests that NMD3 provides nucleolar tethering of CRM1. While inhibition of CRM1 by leptomycin B inhibited processing of 28S ribosomal (r) RNA, depletion of NMD3 did not, suggesting that their effects on 28S rRNA processing are distinct. Markedly, depletion of NMD3 and inhibition of CRM1 reduced the rate of pre-47S rRNA synthesis. However, their inactivation did not lead to nucleolar disintegration, a hallmark of Pol I transcription stress, suggesting that they do not directly regulate transcription. These results indicate that CRM1 and NMD3 have complex functions in pathways that couple rRNA synthetic and processing engines and that the rRNA synthesis rate may be adjusted according to proficiency in rRNA processing and export.

  14. Engineered ribosomal RNA operon copy-number variants of E. coli reveal the evolutionary trade-offs shaping rRNA operon number.

    Science.gov (United States)

    Gyorfy, Zsuzsanna; Draskovits, Gabor; Vernyik, Viktor; Blattner, Frederick F; Gaal, Tamas; Posfai, Gyorgy

    2015-02-18

    Ribosomal RNA (rrn) operons, characteristically present in several copies in bacterial genomes (7 in E. coli), play a central role in cellular physiology. We investigated the factors determining the optimal number of rrn operons in E. coli by constructing isogenic variants with 5-10 operons. We found that the total RNA and protein content, as well as the size of the cells reflected the number of rrn operons. While growth parameters showed only minor differences, competition experiments revealed a clear pattern: 7-8 copies were optimal under conditions of fluctuating, occasionally rich nutrient influx and lower numbers were favored in stable, nutrient-limited environments. We found that the advantages of quick adjustment to nutrient availability, rapid growth and economic regulation of ribosome number all contribute to the selection of the optimal rrn operon number. Our results suggest that the wt rrn operon number of E. coli reflects the natural, 'feast and famine' life-style of the bacterium, however, different copy numbers might be beneficial under different environmental conditions. Understanding the impact of the copy number of rrn operons on the fitness of the cell is an important step towards the creation of functional and robust genomes, the ultimate goal of synthetic biology.

  15. The chemical structure of DNA sequence signals for RNA transcription

    Science.gov (United States)

    George, D. G.; Dayhoff, M. O.

    1982-01-01

    The proposed recognition sites for RNA transcription for E. coli NRA polymerase, bacteriophage T7 RNA polymerase, and eukaryotic RNA polymerase Pol II are evaluated in the light of the requirements for efficient recognition. It is shown that although there is good experimental evidence that specific nucleic acid sequence patterns are involved in transcriptional regulation in bacteria and bacterial viruses, among the sequences now available, only in the case of the promoters recognized by bacteriophage T7 polymerase does it seem likely that the pattern is sufficient. It is concluded that the eukaryotic pattern that is investigated is not restrictive enough to serve as a recognition site.

  16. Accuracy of initial codon selection by aminoacyl-tRNAs on the mRNA-programmed bacterial ribosome.

    Science.gov (United States)

    Zhang, Jingji; Ieong, Ka-Weng; Johansson, Magnus; Ehrenberg, Måns

    2015-08-04

    We used a cell-free system with pure Escherichia coli components to study initial codon selection of aminoacyl-tRNAs in ternary complex with elongation factor Tu and GTP on messenger RNA-programmed ribosomes. We took advantage of the universal rate-accuracy trade-off for all enzymatic selections to determine how the efficiency of initial codon readings decreased linearly toward zero as the accuracy of discrimination against near-cognate and wobble codon readings increased toward the maximal asymptote, the d value. We report data on the rate-accuracy variation for 7 cognate, 7 wobble, and 56 near-cognate codon readings comprising about 15% of the genetic code. Their d values varied about 400-fold in the 200-80,000 range depending on type of mismatch, mismatch position in the codon, and tRNA isoacceptor type. We identified error hot spots (d = 200) for U:G misreading in second and U:U or G:A misreading in third codon position by His-tRNA(His) and, as also seen in vivo, Glu-tRNA(Glu). We suggest that the proofreading mechanism has evolved to attenuate error hot spots in initial selection such as those found here.

  17. Posttranscriptional down-regulation of small ribosomal subunit proteins correlates with reduction of 18S rRNA in RPS19 deficiency.

    Science.gov (United States)

    Badhai, Jitendra; Fröjmark, Anne-Sophie; Razzaghian, Hamid Reza; Davey, Edward; Schuster, Jens; Dahl, Niklas

    2009-06-18

    Ribosomal protein S19 (RPS19) is mutated in patients with Diamond-Blackfan anemia (DBA). We hypothesized that decreased levels of RPS19 lead to a coordinated down-regulation of other ribosomal (r-)proteins at the subunit level. We show that small interfering RNA (siRNA) knock-down of RPS19 results in a relative decrease of small subunit (SSU) r-proteins (S20, S21 and S24) when compared to large subunit (LSU) r-proteins (L3, L9, L30 and L38). This correlates with a relative decrease in 18S rRNA with respect to 28S rRNA. The r-protein mRNA levels remain relatively unchanged indicating a post transcriptional regulation of r-proteins at the level of subunit formation.

  18. Genetic differentiation of strongyloides stercoralis from two different climate zones revealed by 18S ribosomal DNA sequence comparison.

    Science.gov (United States)

    Pakdee, Wallop; Thaenkham, Urusa; Dekumyoy, Paron; Sa-Nguankiat, Surapol; Maipanich, Wanna; Pubampen, Somchit

    2012-11-01

    Over 70 countries in tropical and subtropical zones are endemic areas for Strongyloides stercoralis, with a higher prevalence of the parasite often occurring in tropical regions compared to subtropical ones. In order to explore genetic variations of S. stercoralis form different climate zones, 18S ribosomal DNA of parasite specimens obtained from Thailand were sequenced and compared with those from Japan. The maximum likelihood indicates that S. stercoralis populations from these two different climate zones have genetically diverged. The genetic relationship between S. stercoralis populations is not related to the host species, but rather to moisture and temperature. These factors may directly drive genetic differentiation among isolated populations of S. stercoralis.

  19. [RIBOSOMAL DNA INTERNAL TRANSCRIBED SPACER 2 SEQUENCE AS A PHYLOGENETIC MARKER FOR THE IDENTIFICATION OF TRICHINELLA NEMATODES].

    Science.gov (United States)

    Odoyevskaya, I M; Spiridonov, S E

    2015-01-01

    The results of testing several primer combinations were used to choose an optimal pair for the amplification of the internal transcribed spacer 2 (ITS2) region of ribosomal DNA (direct: Tri58s F 5 CGG TGG ATC RCT TGG CTC GTA CG and reverse: AB28 Rr (CGA CCG CTT ATT GAT ATG C). This pair of primers yields a 900 bp PCR product. Comparative analysis of obtained ITS2 sequences, for 8 Trichinella isolates from different regions of the Russian Federation permits different species and individual genotypes of these parasitic nematodes to be validly distinguished.

  20. Predicting RNA-Protein Interactions Using Only Sequence Information

    Directory of Open Access Journals (Sweden)

    Muppirala Usha K

    2011-12-01

    Full Text Available Abstract Background RNA-protein interactions (RPIs play important roles in a wide variety of cellular processes, ranging from transcriptional and post-transcriptional regulation of gene expression to host defense against pathogens. High throughput experiments to identify RNA-protein interactions are beginning to provide valuable information about the complexity of RNA-protein interaction networks, but are expensive and time consuming. Hence, there is a need for reliable computational methods for predicting RNA-protein interactions. Results We propose RPISeq, a family of classifiers for predicting RNA-protein interactions using only sequence information. Given the sequences of an RNA and a protein as input, RPIseq predicts whether or not the RNA-protein pair interact. The RNA sequence is encoded as a normalized vector of its ribonucleotide 4-mer composition, and the protein sequence is encoded as a normalized vector of its 3-mer composition, based on a 7-letter reduced alphabet representation. Two variants of RPISeq are presented: RPISeq-SVM, which uses a Support Vector Machine (SVM classifier and RPISeq-RF, which uses a Random Forest classifier. On two non-redundant benchmark datasets extracted from the Protein-RNA Interface Database (PRIDB, RPISeq achieved an AUC (Area Under the Receiver Operating Characteristic (ROC curve of 0.96 and 0.92. On a third dataset containing only mRNA-protein interactions, the performance of RPISeq was competitive with that of a published method that requires information regarding many different features (e.g., mRNA half-life, GO annotations of the putative RNA and protein partners. In addition, RPISeq classifiers trained using the PRIDB data correctly predicted the majority (57-99% of non-coding RNA-protein interactions in NPInter-derived networks from E. coli, S. cerevisiae, D. melanogaster, M. musculus, and H. sapiens. Conclusions Our experiments with RPISeq demonstrate that RNA-protein interactions can be

  1. Nuclear RNA sequencing of the mouse erythroid cell transcriptome.

    Science.gov (United States)

    Mitchell, Jennifer A; Clay, Ieuan; Umlauf, David; Chen, Chih-Yu; Moir, Catherine A; Eskiw, Christopher H; Schoenfelder, Stefan; Chakalova, Lyubomira; Nagano, Takashi; Fraser, Peter

    2012-01-01

    In addition to protein coding genes a substantial proportion of mammalian genomes are transcribed. However, most transcriptome studies investigate steady-state mRNA levels, ignoring a considerable fraction of the transcribed genome. In addition, steady-state mRNA levels are influenced by both transcriptional and posttranscriptional mechanisms, and thus do not provide a clear picture of transcriptional output. Here, using deep sequencing of nuclear RNAs (nucRNA-Seq) in parallel with chromatin immunoprecipitation sequencing (ChIP-Seq) of active RNA polymerase II, we compared the nuclear transcriptome of mouse anemic spleen erythroid cells with polymerase occupancy on a genome-wide scale. We demonstrate that unspliced transcripts quantified by nucRNA-seq correlate with primary transcript frequencies measured by RNA FISH, but differ from steady-state mRNA levels measured by poly(A)-enriched RNA-seq. Highly expressed protein coding genes showed good correlation between RNAPII occupancy and transcriptional output; however, genome-wide we observed a poor correlation between transcriptional output and RNAPII association. This poor correlation is due to intergenic regions associated with RNAPII which correspond with transcription factor bound regulatory regions and a group of stable, nuclear-retained long non-coding transcripts. In conclusion, sequencing the nuclear transcriptome provides an opportunity to investigate the transcriptional landscape in a given cell type through quantification of unspliced primary transcripts and the identification of nuclear-retained long non-coding RNAs.

  2. Nuclear RNA sequencing of the mouse erythroid cell transcriptome.

    Directory of Open Access Journals (Sweden)

    Jennifer A Mitchell

    Full Text Available In addition to protein coding genes a substantial proportion of mammalian genomes are transcribed. However, most transcriptome studies investigate steady-state mRNA levels, ignoring a considerable fraction of the transcribed genome. In addition, steady-state mRNA levels are influenced by both transcriptional and posttranscriptional mechanisms, and thus do not provide a clear picture of transcriptional output. Here, using deep sequencing of nuclear RNAs (nucRNA-Seq in parallel with chromatin immunoprecipitation sequencing (ChIP-Seq of active RNA polymerase II, we compared the nuclear transcriptome of mouse anemic spleen erythroid cells with polymerase occupancy on a genome-wide scale. We demonstrate that unspliced transcripts quantified by nucRNA-seq correlate with primary transcript frequencies measured by RNA FISH, but differ from steady-state mRNA levels measured by poly(A-enriched RNA-seq. Highly expressed protein coding genes showed good correlation between RNAPII occupancy and transcriptional output; however, genome-wide we observed a poor correlation between transcriptional output and RNAPII association. This poor correlation is due to intergenic regions associated with RNAPII which correspond with transcription factor bound regulatory regions and a group of stable, nuclear-retained long non-coding transcripts. In conclusion, sequencing the nuclear transcriptome provides an opportunity to investigate the transcriptional landscape in a given cell type through quantification of unspliced primary transcripts and the identification of nuclear-retained long non-coding RNAs.

  3. Functional and structural analysis of the internal ribosome entry site present in the mRNA of natural variants of the HIV-1.

    Science.gov (United States)

    Vallejos, Maricarmen; Carvajal, Felipe; Pino, Karla; Navarrete, Camilo; Ferres, Marcela; Huidobro-Toro, Juan Pablo; Sargueil, Bruno; López-Lastra, Marcelo

    2012-01-01

    The 5'untranslated regions (UTR) of the full length mRNA of the HIV-1 proviral clones pNL4.3 and pLAI, harbor an internal ribosomal entry site (IRES). In this study we extend this finding by demonstrating that the mRNA 5'UTRs of natural variants of HIV-1 also exhibit IRES-activity. Cap-independent translational activity was demonstrated using bicistronic mRNAs in HeLa cells and in Xenopus laevis oocytes. The possibility that expression of the downstream cistron in these constructs was due to alternative splicing or to cryptic promoter activity was ruled out. The HIV-1 variants exhibited significant 5'UTR nucleotide diversity with respect to the control sequence recovered from pNL4.3. Interestingly, translational activity from the 5'UTR of some of the HIV-1 variants was enhanced relative to that observed for the 5'UTR of pNL4.3. In an attempt to explain these findings we probed the secondary structure of the variant HIV-1 5'UTRs using enzymatic and chemical approaches. Yet subsequent structural analyses did not reveal significant variations when compared to the pNL4.3-5'UTR. Thus, the increased IRES-activity observed for some of the HIV-1 variants cannot be ascribed to a specific structural modification. A model to explain these findings is proposed.

  4. Functional and structural analysis of the internal ribosome entry site present in the mRNA of natural variants of the HIV-1.

    Directory of Open Access Journals (Sweden)

    Maricarmen Vallejos

    Full Text Available The 5'untranslated regions (UTR of the full length mRNA of the HIV-1 proviral clones pNL4.3 and pLAI, harbor an internal ribosomal entry site (IRES. In this study we extend this finding by demonstrating that the mRNA 5'UTRs of natural variants of HIV-1 also exhibit IRES-activity. Cap-independent translational activity was demonstrated using bicistronic mRNAs in HeLa cells and in Xenopus laevis oocytes. The possibility that expression of the downstream cistron in these constructs was due to alternative splicing or to cryptic promoter activity was ruled out. The HIV-1 variants exhibited significant 5'UTR nucleotide diversity with respect to the control sequence recovered from pNL4.3. Interestingly, translational activity from the 5'UTR of some of the HIV-1 variants was enhanced relative to that observed for the 5'UTR of pNL4.3. In an attempt to explain these findings we probed the secondary structure of the variant HIV-1 5'UTRs using enzymatic and chemical approaches. Yet subsequent structural analyses did not reveal significant variations when compared to the pNL4.3-5'UTR. Thus, the increased IRES-activity observed for some of the HIV-1 variants cannot be ascribed to a specific structural modification. A model to explain these findings is proposed.

  5. Statistical design and analysis of RNA sequencing data.

    Science.gov (United States)

    Auer, Paul L; Doerge, R W

    2010-06-01

    Next-generation sequencing technologies are quickly becoming the preferred approach for characterizing and quantifying entire genomes. Even though data produced from these technologies are proving to be the most informative of any thus far, very little attention has been paid to fundamental design aspects of data collection and analysis, namely sampling, randomization, replication, and blocking. We discuss these concepts in an RNA sequencing framework. Using simulations we demonstrate the benefits of collecting replicated RNA sequencing data according to well known statistical designs that partition the sources of biological and technical variation. Examples of these designs and their corresponding models are presented with the goal of testing differential expression.

  6. Library preparation for highly accurate population sequencing of RNA viruses

    Science.gov (United States)

    Acevedo, Ashley; Andino, Raul

    2015-01-01

    Circular resequencing (CirSeq) is a novel technique for efficient and highly accurate next-generation sequencing (NGS) of RNA virus populations. The foundation of this approach is the circularization of fragmented viral RNAs, which are then redundantly encoded into tandem repeats by ‘rolling-circle’ reverse transcription. When sequenced, the redundant copies within each read are aligned to derive a consensus sequence of their initial RNA template. This process yields sequencing data with error rates far below the variant frequencies observed for RNA viruses, facilitating ultra-rare variant detection and accurate measurement of low-frequency variants. Although library preparation takes ~5 d, the high-quality data generated by CirSeq simplifies downstream data analysis, making this approach substantially more tractable for experimentalists. PMID:24967624

  7. RNA-Pareto: interactive analysis of Pareto-optimal RNA sequence-structure alignments.

    Science.gov (United States)

    Schnattinger, Thomas; Schöning, Uwe; Marchfelder, Anita; Kestler, Hans A

    2013-12-01

    Incorporating secondary structure information into the alignment process improves the quality of RNA sequence alignments. Instead of using fixed weighting parameters, sequence and structure components can be treated as different objectives and optimized simultaneously. The result is not a single, but a Pareto-set of equally optimal solutions, which all represent different possible weighting parameters. We now provide the interactive graphical software tool RNA-Pareto, which allows a direct inspection of all feasible results to the pairwise RNA sequence-structure alignment problem and greatly facilitates the exploration of the optimal solution set.

  8. Open complex scrunching before nucleotide addition accounts for the unusual transcription start site of E. coli ribosomal RNA promoters.

    Science.gov (United States)

    Winkelman, Jared T; Chandrangsu, Pete; Ross, Wilma; Gourse, Richard L

    2016-03-29

    Most Escherichia coli promoters initiate transcription with a purine 7 or 8 nt downstream from the -10 hexamer, but some promoters, including the ribosomal RNA promoter rrnB P1, start 9 nt from the -10 element. We identified promoter and RNA polymerase determinants of this noncanonical rrnB P1 start site using biochemical and genetic approaches including mutational analysis of the promoter, Fe(2+) cleavage assays to monitor template strand positions near the active-site, and Bpa cross-linking to map the path of open complex DNA at amino acid and nucleotide resolution. We find that mutations in several promoter regions affect transcription start site (TSS) selection. In particular, we show that the absence of strong interactions between the discriminator region and σ region 1.2 and between the extended -10 element and σ region 3.0, identified previously as a determinant of proper regulation of rRNA promoters, is also required for the unusual TSS. We find that the DNA in the single-stranded transcription bubble of the rrnB P1 promoter complex expands and is "scrunched" into the active site channel of RNA polymerase, similar to the situation in initial transcribing complexes. However, in the rrnB P1 open complex, scrunching occurs before RNA synthesis begins. We find that the scrunched open complex exhibits reduced abortive product synthesis, suggesting that scrunching and unusual TSS selection contribute to the extraordinary transcriptional activity of rRNA promoters by increasing promoter escape, helping to offset the reduction in promoter activity that would result from the weak interactions with σ.

  9. 'Candidatus Phytoplasma pruni', a novel taxon associated with X-disease of stone fruits, Prunus spp.: multilocus characterization based on 16S rRNA, secY, and ribosomal protein genes.

    Science.gov (United States)

    Davis, Robert E; Zhao, Yan; Dally, Ellen L; Lee, Ing-Ming; Jomantiene, Rasa; Douglas, Sharon M

    2013-02-01

    X-disease is one of the most serious diseases known in peach (Prunus persica). Based on RFLP analysis of 16S rRNA gene sequences, peach X-disease phytoplasma strains from eastern and western United States and eastern Canada were classified in 16S rRNA gene RFLP group 16SrIII, subgroup A. Phylogenetic analyses of 16S rRNA gene sequences revealed that the X-disease phytoplasma strains formed a distinct subclade within the phytoplasma clade, supporting the hypothesis that they represented a lineage distinct from those of previously described 'Candidatus Phytoplasma' species. Nucleotide sequence alignments revealed that all studied X-disease phytoplasma strains shared less than 97.5 % 16S rRNA gene sequence similarity with previously described 'Candidatus Phytoplasma' species. Based on unique properties of the DNA, we propose recognition of X-disease phytoplasma strain PX11CT1(R) as representative of a novel taxon, 'Candidatus Phytoplasma pruni'. Results from nucleotide and phylogenetic analyses of secY and ribosomal protein (rp) gene sequences provided additional molecular markers of the 'Ca. Phytoplasma pruni' lineage. We propose that the term 'Ca. Phytoplasma pruni' be applied to phytoplasma strains whose 16S rRNA gene sequences contain the oligonucleotide sequences of unique regions that are designated in the formally published description of the taxon. Such strains include X-disease phytoplasma and--within the tolerance of a single base difference in one unique sequence--peach rosette, peach red suture, and little peach phytoplasmas. Although not employed for taxon delineation in this work, we further propose that secY, rp, and other genetic loci from the reference strain of a taxon, and where possible oligonucleotide sequences of unique regions of those genes that distinguish taxa within a given 16Sr group, be incorporated in emended descriptions and as part of future descriptions of 'Candidatus Phytoplasma' taxa.

  10. A Nuclear Ribosomal DNA Phylogeny of Acer Inferred with Maximum Likelihood, Splits Graphs, and Motif Analysis of 606 Sequences

    Directory of Open Access Journals (Sweden)

    Guido W. Grimm

    2006-01-01

    Full Text Available The multi-copy internal transcribed spacer (ITS region of nuclear ribosomal DNA is widely used to infer phylogenetic relationships among closely related taxa. Here we use maximum likelihood (ML and splits graph analyses to extract phylogenetic information from ~ 600 mostly cloned ITS sequences, representing 81 species and subspecies of Acer, and both species of its sister Dipteronia. Additional analyses compared sequence motifs in Acer and several hundred Anacardiaceae, Burseraceae, Meliaceae, Rutaceae, and Sapindaceae ITS sequences in GenBank. We also assessed the effects of using smaller data sets of consensus sequences with ambiguity coding (accounting for within-species variation instead of the full (partly redundant original sequences. Neighbor-nets and bipartition networks were used to visualize conflict among character state patterns. Species clusters observed in the trees and networks largely agree with morphology-based classifications; of de Jong’s (1994 16 sections, nine are supported in neighbor-net and bipartition networks, and ten by sequence motifs and the ML tree; of his 19 series, 14 are supported in networks, motifs, and the ML tree. Most nodes had higher bootstrap support with matrices of 105 or 40 consensus sequences than with the original matrix. Within-taxon ITS divergence did not differ between diploid and polyploid Acer, and there was little evidence of differentiated parental ITS haplotypes, suggesting that concerted evolution in Acer acts rapidly.

  11. Structure analysis of free and bound states of an RNA aptamer against ribosomal protein S8 from Bacillus anthracis.

    Science.gov (United States)

    Davlieva, Milya; Donarski, James; Wang, Jiachen; Shamoo, Yousif; Nikonowicz, Edward P

    2014-01-01

    Several protein-targeted RNA aptamers have been identified for a variety of applications and although the affinities of numerous protein-aptamer complexes have been determined, the structural details of these complexes have not been widely explored. We examined the structural accommodation of an RNA aptamer that binds bacterial r-protein S8. The core of the primary binding site for S8 on helix 21 of 16S rRNA contains a pair of conserved base triples that mold the sugar-phosphate backbone to S8. The aptamer, which does not contain the conserved sequence motif, is specific for the rRNA binding site of S8. The protein-free RNA aptamer adopts a helical structure with multiple non-canonical base pairs. Surprisingly, binding of S8 leads to a dramatic change in the RNA conformation that restores the signature S8 recognition fold through a novel combination of nucleobase interactions. Nucleotides within the non-canonical core rearrange to create a G-(G-C) triple and a U-(A-U)-U quartet. Although native-like S8-RNA interactions are present in the aptamer-S8 complex, the topology of the aptamer RNA differs from that of the helix 21-S8 complex. This is the first example of an RNA aptamer that adopts substantially different secondary structures in the free and protein-bound states and highlights the remarkable plasticity of RNA secondary structure.

  12. Nucleotide sequence of papaya mosaic virus RNA.

    Science.gov (United States)

    Sit, T L; Abouhaidar, M G; Holy, S

    1989-09-01

    The RNA genome of papaya mosaic virus is 6656 nucleotides long [excluding the poly(A) tail] with six open reading frames (ORFs) more than 200 nucleotides long. The four nearest the 5' end each overlap with adjacent ORFs and could code for proteins with Mr 176307, 26248, 11949 and 7224 (ORFs 1 to 4). The fifth ORF produces the capsid protein of Mr 23043 and the sixth ORF, located completely within ORF1, could code for a protein with Mr 14113. The translation products of ORFs 1 to 3 show strong similarity with those of other potexviruses but the ORF 4 protein has only limited similarity with the other potexvirus ORF 4 proteins of 7K to 11K.

  13. RNA:protein ratio of the unicellular organism as a characteristic of phosphorous and nitrogen stoichiometry and of the cellular requirement of ribosomes for protein synthesis

    Directory of Open Access Journals (Sweden)

    Sams Carl E

    2006-09-01

    Full Text Available Abstract Background Mean phosphorous:nitrogen (P:N ratios and relationships of P:N ratios with the growth rate of organisms indicate a surprising similarity among and within microbial species, plants, and insect herbivores. To reveal the cellular mechanisms underling this similarity, the macromolecular composition of seven microorganisms and the effect of specific growth rate (SGR on RNA:protein ratio, the number of ribosomes, and peptide elongation rate (PER were analyzed under different conditions of exponential growth. Results It was found that P:N ratios calculated from RNA and protein contents in these particular organisms were in the same range as the mean ratios reported for diverse organisms and had similar positive relationships with growth rate, consistent with the growth-rate hypothesis. The efficiency of protein synthesis in microorganisms is estimated as the number of active ribosomes required for the incorporation of one amino acid into the synthesized protein. This parameter is calculated as the SGR:PER ratio. Experimental and theoretical evidence indicated that the requirement of ribosomes for protein synthesis is proportional to the RNA:protein ratio. The constant of proportionality had the same values for all organisms, and was derived mechanistically from the characteristics of the protein-synthesis machinery of the cell (the number of nucleotides per ribosome, the average masses of nucleotides and amino acids, the fraction of ribosomal RNA in the total RNA, and the fraction of active ribosomes. Impairment of the growth conditions decreased the RNA:protein ratio and increased the overall efficiency of protein synthesis in the microorganisms. Conclusion Our results suggest that the decrease in RNA:protein and estimated P:N ratios with decrease in the growth rate of the microorganism is a consequence of an increased overall efficiency of protein synthesis in the cell resulting from activation of the general stress response and

  14. Structural and functional evaluation of interaction between mammalian ribosomal RNA with platinum-containing antineoplastic drugs.

    Science.gov (United States)

    Theile, Dirk; Kos, Martin

    2016-02-03

    Cisplatin, oxaliplatin, and carboplatin primarily target DNA, but also alter RNA functionality, albeit to different extent. This study determined the in vitro cytotoxicity (IC50 values) of platinum drugs in LS180 cells and compared the rRNA platination patterns following IC50 exposure. Relevance of particular secondary RNA structures for platination susceptibility was evaluated by primer extension methodology using 18S rRNA as a model RNA. Consequences of rRNA platination for translation efficiency were evaluated by monitoring fluorescence of a destabilised green fluorescent protein variant through flow cytometry. Oxaliplatin and cisplatin were most cytotoxic with IC50 values of 1.7 μM±0.8 and 4.1 μM±0.1, respectively. Carboplatin was significantly less efficient (IC50 147.1 μM±19.4). When exposed to equitoxic concentrations (respective IC50), all three compounds caused similar stop signal incidence or intensity. Moreover, the same rRNA sites were targeted without selectivity for particular secondary structures but with a slight preference for guanine-rich regions. Compared to cycloheximide, none of the drugs diminished translation efficiency at typical in vivo concentrations. In conclusion, equitoxic concentrations of platinum drugs target the same sites in cellular rRNA and cause similar platination intensities. At pharmacokinetically relevant concentrations, cisplatin, oxaliplatin or carboplatin do not inhibit translation efficiency. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  15. Activation of the ribosomal RNA genes late in the third cell cycle of porcine embryos

    DEFF Research Database (Denmark)

    Viuff, Dorthe; Greve, Torben; Holm, Peter

    2002-01-01

    electron microscopy. In general, the 2-cell and 4-cell embryos fixed at 10 and 20 h postcleavage (hpc) showed no signs of rRNA transcription. Four small clusters of fluorescein isothiocyanate (FITC) labeling were visible in interphase nuclei, consistent with hybridization to the rRNA gene clusters only...

  16. Activation of the ribosomal RNA genes late in the third cell cycle of porcine embryos

    DEFF Research Database (Denmark)

    Viuff, Dorthe; Greve, Torben; Holm, Peter

    2002-01-01

    In porcine embryos, nucleoli are first observed during the third postfertilization cell cycle, i.e., at the 4-cell stage. However, direct studies of the initiation of rRNA transcription have not been reported. This transcription was investigated in the present study by simultaneous visualization...... of the rRNA genes and the rRNA by fluorescent in situ hybridization using a porcine 28S rDNA probe and subsequent visualization of argyrophilic nucleolar proteins by silver staining of extracted and fixed nuclei from in vivo-derived porcine embryos (n = 229). Nucleologenesis was observed by transmission...... electron microscopy. In general, the 2-cell and 4-cell embryos fixed at 10 and 20 h postcleavage (hpc) showed no signs of rRNA transcription. Four small clusters of fluorescein isothiocyanate (FITC) labeling were visible in interphase nuclei, consistent with hybridization to the rRNA gene clusters only...

  17. Insects’ RNA Profiling Reveals Absence of “Hidden Break” in 28S Ribosomal RNA Molecule of Onion Thrips, Thrips tabaci

    Directory of Open Access Journals (Sweden)

    Rosaline Wanjiru Macharia

    2015-01-01

    Full Text Available With an exception of aphids, insects’ 28S rRNA is thought to harbor a “hidden break” which cleaves under denaturing conditions to comigrate with 18S rRNA band to exhibit a degraded appearance on native agarose gels. The degraded appearance confounds determination of RNA integrity in laboratories that rely on gel electrophoresis. To provide guidelines for RNA profiles, RNA from five major insect orders, namely, Diptera, Hemiptera, Thysanoptera, Hymenoptera, and Lepidoptera, was compared under denaturing and nondenaturing conditions. This study confirmed that although present in most of insect’s RNA, the “hidden break” is absent in the 28S rRNA of onion thrips, Thrips tabaci. On the other hand, presence of “hidden break” was depicted in whiteflies’ 28S rRNA despite their evolutionary grouping under same order with aphids. Divergence of 28S rRNA sequences confirms variation of both size and composition of gap region among insect species. However, phylogeny reconstruction does not support speciation as a possible source of the hidden break in insect’s 28S rRNA. In conclusion, we show that RNA from a given insect order does not conform to a particular banding profile and therefore this approach cannot be reliably used to characterize newly discovered species.

  18. Insects' RNA Profiling Reveals Absence of “Hidden Break” in 28S Ribosomal RNA Molecule of Onion Thrips, Thrips tabaci

    Science.gov (United States)

    Macharia, Rosaline Wanjiru; Ombura, Fidelis Levi; Aroko, Erick Onyango

    2015-01-01

    With an exception of aphids, insects' 28S rRNA is thought to harbor a “hidden break” which cleaves under denaturing conditions to comigrate with 18S rRNA band to exhibit a degraded appearance on native agarose gels. The degraded appearance confounds determination of RNA integrity in laboratories that rely on gel electrophoresis. To provide guidelines for RNA profiles, RNA from five major insect orders, namely, Diptera, Hemiptera, Thysanoptera, Hymenoptera, and Lepidoptera, was compared under denaturing and nondenaturing conditions. This study confirmed that although present in most of insect's RNA, the “hidden break” is absent in the 28S rRNA of onion thrips, Thrips tabaci. On the other hand, presence of “hidden break” was depicted in whiteflies' 28S rRNA despite their evolutionary grouping under same order with aphids. Divergence of 28S rRNA sequences confirms variation of both size and composition of gap region among insect species. However, phylogeny reconstruction does not support speciation as a possible source of the hidden break in insect's 28S rRNA. In conclusion, we show that RNA from a given insect order does not conform to a particular banding profile and therefore this approach cannot be reliably used to characterize newly discovered species. PMID:25767721

  19. Mitochondrial 12S Ribosomal RNA A1555G Mutation Associated with Cardiomyopathy and Hearing Loss following High-Dose Chemotherapy and Repeated Aminoglycoside Exposure

    DEFF Research Database (Denmark)

    Skou, Anne-Sofie; Tranebjærg, Lisbeth; Jensen, Tim

    2014-01-01

    A 19-month-old girl with the A1555G mitochondrial mutation in the 12S ribosomal RNA gene and acute myelogenous leukemia developed dilated cardiomyopathy and bilateral sensorineural hearing loss before undergoing allogeneic stem cell transplantation. She had received gentamicin during episodes...

  20. A mutant RNA pseudoknot that promotes ribosomal frameshifting in mouse mammary tumor virus.

    Science.gov (United States)

    Kang, H; Tinoco, I

    1997-05-15

    A single A-->G mutation that changes a potential A.U base pair to a G.U pair at the junction of the stems and loops of a non-frameshifting pseudoknot dramatically increases its frameshifting efficiency in mouse mammary tumor virus. The structure of the non-frameshifting pseudoknot APK has been found to be very different from that of pseudoknots that cause efficient frameshifting [Kang,H., Hines,J.V. and Tinoco,I. (1995) J. Mol. Biol. , 259, 135-147]. The 3-dimensional structure of the mutant pseudoknot was determined by restrained molecular dynamics based on NMR-derived interproton distance and torsion angle constraints. One striking feature of the mutant pseudoknot compared with the parent pseudoknot is that a G.U base pair forms at the top of stem 2, thus leaving only 1 nt at the junction of the two stems. The conformation is very different from that of the previously determined non-frameshifting parent pseudoknot, which lacks the A.U base pair at the top of the stem and has 2 nt between the stems. However, the conformation is quite similar to that of efficient frameshifting pseudoknots whose structures were previously determined by NMR. A single adenylate residue intervenes between the two stems and interrupts their coaxial stacking. This unpaired nucleotide produces a bent structure. The structural similarity among the efficient frameshifting pseudoknots indicates that a specific conformation is required for ribosomal frameshifting, further implying a specific interaction of the pseudoknot with the ribosome.

  1. [Sequence of the ITS region of nuclear ribosomal DNA(nrDNA) in Xinjiang wild Dianthus and its phylogenetic relationship].

    Science.gov (United States)

    Zhang, Lu; Cai, You-Ming; Zhuge, Qiang; Zou, Hui-Yu; Huang, Min-Ren

    2002-06-01

    Xinjiang is a center of distribution and differentiation of genus Dianthus in China, and has a great deal of species resources. The sequences of ITS region (including ITS-1, 5.8S rDNA and ITS-2) of nuclear ribosomal DNA from 8 species of genus Dianthus wildly distributed in Xinjiang were determined by direct sequencing of PCR products. The result showed that the size of the ITS of Dianthus is from 617 to 621 bp, and the length variation is only 4 bp. There are very high homogeneous (97.6%-99.8%) sequences between species, and about 80% homogeneous sequences between genus Dianthus and outgroup. The sequences of ITS in genus Dianthus are relatively conservative. In general, there are more conversion than transition in the variation sites among genus Dianthus. The conversion rates are relatively high, and the ratios of conversion/transition are 1.0-3.0. On the basis of phylogenetic analysis of nucleotide sequences the species of Dianthus in China would be divided into three sections. There is a distant relationship between sect. Barbulatum Williams and sect. Dianthus and between sect. Barbulatum Williams and sect. Fimbriatum Williams, and there is a close relationship between sect. Dianthus and sect. Fimbriatum Williams. From the phylogenetic tree of ITS it was found that the origin of sect. Dianthusis is earlier than that of sect. Fimbriatum Williams and sect. Barbulatum Williams.

  2. Using mitogenomic and nuclear ribosomal sequence data to investigate the phylogeny of the Xiphinema americanum species complex.

    Directory of Open Access Journals (Sweden)

    Inga A Zasada

    Full Text Available Nematodes within the Xiphinema americanum species complex are economically important because they vector nepoviruses which cause considerable damage to a variety of agricultural crops. The taxonomy of X. americanum species complex is controversial, with the number of putative species being the subject of debate. Accurate phylogenetic knowledge of this group is highly desirable as it may ultimately reveal genetic differences between species. For this study, nematodes belonging to the X. americanum species complex, including potentially mixed