WorldWideScience

Sample records for ribosomal rna processing

  1. A ribosome without RNA

    Directory of Open Access Journals (Sweden)

    Harold S Bernhardt

    2015-11-01

    Full Text Available It was Francis Crick who first asked why the ribosome contains so much RNA, and discussed the implications of this for the direct flow of genetic information from DNA to protein. Remarkable advances in our understanding of the ribosome and protein synthesis, including the recent publication of two mammalian mitochondrial ribosome structures, have shed new light on this intriguing aspect of evolution in molecular biology. We examine here whether RNA is indispensable for coded protein synthesis, or whether an all-protein ‘ribosome’ (or ‘synthosome’ might be possible, with a protein enzyme catalyzing peptide synthesis, and release factor-like protein adaptors able to read a message composed of deoxyribonucleotides. We also compare the RNA world hypothesis with the alternative ‘proteins first’ hypothesis in terms of their different understandings of the evolution of the ribosome, and whether this might have been preceded by an ancestral form of nonribosomal peptide synthesis catalyzed by protein enzymes.

  2. Myb-binding protein 1a (Mybbp1a) regulates levels and processing of pre-ribosomal RNA.

    Science.gov (United States)

    Hochstatter, Julia; Hölzel, Michael; Rohrmoser, Michaela; Schermelleh, Lothar; Leonhardt, Heinrich; Keough, Rebecca; Gonda, Thomas J; Imhof, Axel; Eick, Dirk; Längst, Gernot; Németh, Attila

    2012-07-13

    Ribosomal RNA gene transcription, co-transcriptional processing, and ribosome biogenesis are highly coordinated processes that are tightly regulated during cell growth. In this study we discovered that Mybbp1a is associated with both the RNA polymerase I complex and the ribosome biogenesis machinery. Using a reporter assay that uncouples transcription and RNA processing, we show that Mybbp1a represses rRNA gene transcription. In addition, overexpression of the protein reduces RNA polymerase I loading on endogenous rRNA genes as revealed by chromatin immunoprecipitation experiments. Accordingly, depletion of Mybbp1a results in an accumulation of the rRNA precursor in vivo but surprisingly also causes growth arrest of the cells. This effect can be explained by the observation that the modulation of Mybbp1a protein levels results in defects in pre-rRNA processing within the cell. Therefore, the protein may play a dual role in the rRNA metabolism, potentially linking and coordinating ribosomal DNA transcription and pre-rRNA processing to allow for the efficient synthesis of ribosomes.

  3. Genome-wide mRNA processing in methanogenic archaea reveals post-transcriptional regulation of ribosomal protein synthesis.

    Science.gov (United States)

    Qi, Lei; Yue, Lei; Feng, Deqin; Qi, Fengxia; Li, Jie; Dong, Xiuzhu

    2017-07-07

    Unlike stable RNAs that require processing for maturation, prokaryotic cellular mRNAs generally follow an 'all-or-none' pattern. Herein, we used a 5΄ monophosphate transcript sequencing (5΄P-seq) that specifically captured the 5΄-end of processed transcripts and mapped the genome-wide RNA processing sites (PSSs) in a methanogenic archaeon. Following statistical analysis and stringent filtration, we identified 1429 PSSs, among which 23.5% and 5.4% were located in 5΄ untranslated region (uPSS) and intergenic region (iPSS), respectively. A predominant uridine downstream PSSs served as a processing signature. Remarkably, 5΄P-seq detected overrepresented uPSS and iPSS in the polycistronic operons encoding ribosomal proteins, and the majority upstream and proximal ribosome binding sites, suggesting a regulatory role of processing on translation initiation. The processed transcripts showed increased stability and translation efficiency. Particularly, processing within the tricistronic transcript of rplA-rplJ-rplL enhanced the translation of rplL, which can provide a driving force for the 1:4 stoichiometry of L10 to L12 in the ribosome. Growth-associated mRNA processing intensities were also correlated with the cellular ribosomal protein levels, thereby suggesting that mRNA processing is involved in tuning growth-dependent ribosome synthesis. In conclusion, our findings suggest that mRNA processing-mediated post-transcriptional regulation is a potential mechanism of ribosomal protein synthesis and stoichiometry. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  4. 5S rRNA and ribosome.

    Science.gov (United States)

    Gongadze, G M

    2011-12-01

    5S rRNA is an integral component of the ribosome of all living organisms. It is known that the ribosome without 5S rRNA is functionally inactive. However, the question about the specific role of this RNA in functioning of the translation apparatus is still open. This review presents a brief history of the discovery of 5S rRNA and studies of its origin and localization in the ribosome. The previously expressed hypotheses about the role of this RNA in the functioning of the ribosome are discussed considering the unique location of 5S rRNA in the ribosome and its intermolecular contacts. Based on analysis of the current data on ribosome structure and its functional complexes, the role of 5S rRNA as an intermediary between ribosome functional domains is discussed.

  5. Depletion of key protein components of the RISC pathway impairs pre-ribosomal RNA processing.

    Science.gov (United States)

    Liang, Xue-Hai; Crooke, Stanley T

    2011-06-01

    Little is known about whether components of the RNA-induced silencing complex (RISC) mediate the biogenesis of RNAs other than miRNA. Here, we show that depletion of key proteins of the RISC pathway by antisense oligonucleotides significantly impairs pre-rRNA processing in human cells. In cells depleted of Drosha or Dicer, different precursors to 5.8S rRNA strongly accumulated, without affecting normal endonucleolytic cleavages. Moderate yet distinct processing defects were also observed in Ago2-depleted cells. Physical links between pre-rRNA and these proteins were identified by co-immunoprecipitation analyses. Interestingly, simultaneous depletion of Dicer and Drosha led to a different processing defect, causing slower production of 28S rRNA and its precursor. Both Dicer and Ago2 were detected in the nuclear fraction, and reduction of Dicer altered the structure of the nucleolus, where pre-rRNA processing occurs. Together, these results suggest that Drosha and Dicer are implicated in rRNA biogenesis.

  6. Processing of the 17-S Escherichia coli precursor RNA in the 27-S pre-ribosomal particle

    Energy Technology Data Exchange (ETDEWEB)

    Hayes, F; Vasseur, M [Institut de Biologie Physico-Chimique, 75 - Paris (France)

    1976-01-01

    An RNase activity probably involved in the maturation of 16-S pre-ribosomal RNA in Escherichia coli has been partially purified from crude cell extracts. When 27-S ribosome precursor particles are incubated with this enzyme preparation in vitro, their 17-S RNA is converted to a product with the same electrophoretic mobility as mature 16-S rRNA. FingerprS rRNA. Generation of the normal 5'-P terminus seems to require a factor present in cell extracts since incubation of the 27-S precursor particle in an extract obtained after centrifugation at 30,000 x g causes conversion of the 17-S RNA to a 16-S species containing both termini of mature 16-S rRNS. Preliminary experiments suggest that correct maturation of the 5' end of the 17-S precursor RNA requires a system in which protein synthesis can take place.

  7. Cisplatin Targeting of Bacterial Ribosomal RNA Hairpins

    Directory of Open Access Journals (Sweden)

    Gayani N. P. Dedduwa-Mudalige

    2015-09-01

    Full Text Available Cisplatin is a clinically important chemotherapeutic agent known to target purine bases in nucleic acids. In addition to major deoxyribonucleic acid (DNA intrastrand cross-links, cisplatin also forms stable adducts with many types of ribonucleic acid (RNA including siRNA, spliceosomal RNAs, tRNA, and rRNA. All of these RNAs play vital roles in the cell, such as catalysis of protein synthesis by rRNA, and therefore serve as potential drug targets. This work focused on platination of two highly conserved RNA hairpins from E. coli ribosomes, namely pseudouridine-modified helix 69 from 23S rRNA and the 790 loop of helix 24 from 16S rRNA. RNase T1 probing, MALDI mass spectrometry, and dimethyl sulfate mapping revealed platination at GpG sites. Chemical probing results also showed platination-induced RNA structural changes. These findings reveal solvent and structural accessibility of sites within bacterial RNA secondary structures that are functionally significant and therefore viable targets for cisplatin as well as other classes of small molecules. Identifying target preferences at the nucleotide level, as well as determining cisplatin-induced RNA conformational changes, is important for the design of more potent drug molecules. Furthermore, the knowledge gained through studies of RNA-targeting by cisplatin is applicable to a broad range of organisms from bacteria to human.

  8. Yeast polypeptide exit tunnel ribosomal proteins L17, L35 and L37 are necessary to recruit late-assembling factors required for 27SB pre-rRNA processing.

    Science.gov (United States)

    Gamalinda, Michael; Jakovljevic, Jelena; Babiano, Reyes; Talkish, Jason; de la Cruz, Jesús; Woolford, John L

    2013-02-01

    Ribosome synthesis involves the coordinated folding and processing of pre-rRNAs with assembly of ribosomal proteins. In eukaryotes, these events are facilitated by trans-acting factors that propel ribosome maturation from the nucleolus to the cytoplasm. However, there is a gap in understanding how ribosomal proteins configure pre-ribosomes in vivo to enable processing to occur. Here, we have examined the role of adjacent yeast r-proteins L17, L35 and L37 in folding and processing of pre-rRNAs, and binding of other proteins within assembling ribosomes. These three essential ribosomal proteins, which surround the polypeptide exit tunnel, are required for 60S subunit formation as a consequence of their role in removal of the ITS2 spacer from 27SB pre-rRNA. L17-, L35- and L37-depleted cells exhibit turnover of aberrant pre-60S assembly intermediates. Although the structure of ITS2 does not appear to be grossly affected in their absence, these three ribosomal proteins are necessary for efficient recruitment of factors required for 27SB pre-rRNA processing, namely, Nsa2 and Nog2, which associate with pre-60S ribosomal particles containing 27SB pre-rRNAs. Altogether, these data support that L17, L35 and L37 are specifically required for a recruiting step immediately preceding removal of ITS2.

  9. Synthesis and methylation of ribosomal RNA in HeLa cells infected with the herpes virus pseudorabies virus

    International Nuclear Information System (INIS)

    Furlong, J.C.; Kyriakidis, S.; Stevely, W.S.

    1982-01-01

    The effects of infection with the herpes virus pseudorabies virus on the metabolism of HeLa cell ribosomal RNA were examined. There is a decline both in the synthesis of nucleolar 45S ribosomal precursor RNA and in its processing to mature cytoplasmic RNA. The methylated oligonucleotides in the ribosomal RNA species were studied. The methylation of cytoplasmic ribosomal RNA was essentially unchanged. However there was some undermethylation of the nucleolar precursor. If undermethylated RNA does not mature then this may partly explain the reduced processing in the infected cells. (Author)

  10. Aggregation of Ribosomal Protein S6 at Nucleolus Is Cell Cycle-Controlled and Its Function in Pre-rRNA Processing Is Phosphorylation Dependent.

    Science.gov (United States)

    Zhang, Duo; Chen, Hui-Peng; Duan, Hai-Feng; Gao, Li-Hua; Shao, Yong; Chen, Ke-Yan; Wang, You-Liang; Lan, Feng-Hua; Hu, Xian-Wen

    2016-07-01

    Ribosomal protein S6 (rpS6) has long been regarded as one of the primary r-proteins that functions in the early stage of 40S subunit assembly, but its actual role is still obscure. The correct forming of 18S rRNA is a key step in the nuclear synthesis of 40S subunit. In this study, we demonstrate that rpS6 participates in the processing of 30S pre-rRNA to 18S rRNA only when its C-terminal five serines are phosphorylated, however, the process of entering the nucleus and then targeting the nucleolus does not dependent its phosphorylation. Remarkably, we also find that the aggregation of rpS6 at the nucleolus correlates to the phasing of cell cycle, beginning to concentrate in the nucleolus at later S phase and disaggregate at M phase. J. Cell. Biochem. 117: 1649-1657, 2016. © 2015 Wiley Periodicals, Inc. © 2015 Wiley Periodicals, Inc.

  11. High-resolution microscopy of active ribosomal genes and key members of the rRNA processing machinery inside nucleolus-like bodies of fully-grown mouse oocytes.

    Science.gov (United States)

    Shishova, Kseniya V; Khodarovich, Yuriy M; Lavrentyeva, Elena A; Zatsepina, Olga V

    2015-10-01

    Nucleolus-like bodies (NLBs) of fully-grown (germinal vesicle, GV) mammalian oocytes are traditionally considered as morphologically distinct entities, which, unlike normal nucleoli, contain transcribed ribosomal genes (rDNA) solely at their surface. In the current study, we for the first time showed that active ribosomal genes are present not only on the surface but also inside NLBs of the NSN-type oocytes. The "internal" rRNA synthesis was evidenced by cytoplasmic microinjections of BrUTP as precursor and by fluorescence in situ hybridization with a probe to the short-lived 5'ETS segment of the 47S pre-rRNA. We further showed that in the NLB mass of NSN-oocytes, distribution of active rDNA, RNA polymerase I (UBF) and rRNA processing (fibrillarin) protein factors, U3 snoRNA, pre-rRNAs and 18S/28S rRNAs is remarkably similar to that in somatic nucleoli capable to make pre-ribosomes. Overall, these observations support the occurrence of rDNA transcription, rRNA processing and pre-ribosome assembly in the NSN-type NLBs and so that their functional similarity to normal nucleoli. Unlike the NSN-type NLBs, the NLBs of more mature SN-oocytes do not contain transcribed rRNA genes, U3 snoRNA, pre-rRNAs, 18S and 28S rRNAs. These results favor the idea that in a process of transformation of NSN-oocytes to SN-oocytes, NLBs cease to produce pre-ribosomes and, moreover, lose their rRNAs. We also concluded that a denaturing fixative 70% ethanol used in the study to fix oocytes could be more appropriate for light microscopy analysis of nucleolar RNAs and proteins in mammalian fully-grown oocytes than a commonly used cross-linking aldehyde fixative, formalin. Copyright © 2015 Elsevier Inc. All rights reserved.

  12. Proto-ribosome: a theoretical approach based on RNA relics

    OpenAIRE

    Demongeot, Jacques

    2017-01-01

    We describe in this paper, based on already published articles, a contribution to the theory postulating the existence of a proto-ribosome, which could have appeared early at the origin of life and we discuss the interest of this notion in an evolutionary perspective, taking into account the existence of possible RNA relics of this proto-ribosome.

  13. Effect of primary and secondary radicals on chain breaks in ribosomal RNA in E. coli ribosomes

    International Nuclear Information System (INIS)

    Singh, H.; Bishop, J.

    1984-01-01

    It has been shown previously that, in dilute aerated solutions, ribosomes are inactivated by OH radicals and by secondary radicals produced from added alcohols (Singh and Vadasz 1983 a). In de-aerated solutions, both radicalH and e - sub(aq) also inactivate ribosomes (Singh and Vadasz 1983 b). The results of these studies and other on different systems (Adams et al. 1973, Aldrich and Cundall 1969, Dewey and Stein 1970, Masuda et al. 1971, Nabben et al. 1982, 1983, Samuni et al. 1980, Singh and Singh 1982) have shown that damage to biological systems occurs by diverse mechanisms. One of these mechanisms involves chain breaks in RNA (Pollard and Weller 1967). The purpose of this study was to determine which of the primary and secondary radicals cause chain breaks in ribosomal RNA (rRNA) within the ribosomes. (author)

  14. Cis-regulatory RNA elements that regulate specialized ribosome activity.

    Science.gov (United States)

    Xue, Shifeng; Barna, Maria

    2015-01-01

    Recent evidence has shown that the ribosome itself can play a highly regulatory role in the specialized translation of specific subpools of mRNAs, in particular at the level of ribosomal proteins (RP). However, the mechanism(s) by which this selection takes place has remained poorly understood. In our recent study, we discovered a combination of unique RNA elements in the 5'UTRs of mRNAs that allows for such control by the ribosome. These mRNAs contain a Translation Inhibitory Element (TIE) that inhibits general cap-dependent translation, and an Internal Ribosome Entry Site (IRES) that relies on a specific RP for activation. The unique combination of an inhibitor of general translation and an activator of specialized translation is key to ribosome-mediated control of gene expression. Here we discuss how these RNA regulatory elements provide a new level of control to protein expression and their implications for gene expression, organismal development and evolution.

  15. Ribosomal RNA: a key to phylogeny

    Science.gov (United States)

    Olsen, G. J.; Woese, C. R.

    1993-01-01

    As molecular phylogeny increasingly shapes our understanding of organismal relationships, no molecule has been applied to more questions than have ribosomal RNAs. We review this role of the rRNAs and some of the insights that have been gained from them. We also offer some of the practical considerations in extracting the phylogenetic information from the sequences. Finally, we stress the importance of comparing results from multiple molecules, both as a method for testing the overall reliability of the organismal phylogeny and as a method for more broadly exploring the history of the genome.

  16. Interaction of tRNA with Eukaryotic Ribosome

    Directory of Open Access Journals (Sweden)

    Dmitri Graifer

    2015-03-01

    Full Text Available This paper is a review of currently available data concerning interactions of tRNAs with the eukaryotic ribosome at various stages of translation. These data include the results obtained by means of cryo-electron microscopy and X-ray crystallography applied to various model ribosomal complexes, site-directed cross-linking with the use of tRNA derivatives bearing chemically or photochemically reactive groups in the CCA-terminal fragment and chemical probing of 28S rRNA in the region of the peptidyl transferase center. Similarities and differences in the interactions of tRNAs with prokaryotic and eukaryotic ribosomes are discussed with concomitant consideration of the extent of resemblance between molecular mechanisms of translation in eukaryotes and bacteria.

  17. rRNA:mRNA pairing alters the length and the symmetry of mRNA-protected fragments in ribosome profiling experiments

    OpenAIRE

    O?Connor, Patrick B. F.; Li, Gene-Wei; Weissman, Jonathan S.; Atkins, John F.; Baranov, Pavel V.

    2013-01-01

    Motivation: Ribosome profiling is a new technique that allows monitoring locations of translating ribosomes on mRNA at a whole transcriptome level. A recent ribosome profiling study demonstrated that internal Shine?Dalgarno (SD) sequences have a major global effect on translation rates in bacteria: ribosomes pause at SD sites in mRNA. Therefore, it is important to understand how SD sites effect mRNA movement through the ribosome and generation of ribosome footprints. Results: Here, we provide...

  18. Ribosomal RNA in the salivary gland of Sciara ocellaris during larval development

    International Nuclear Information System (INIS)

    Dessen, E.M.B.; Perondini, A.L.P.

    1979-01-01

    Ribosomal RNA in the salivary gland of Sciara ocellaris during larval development. The molecular weights of the precursor and of the 28S and 18S mature fractions of the ribosomal RNA estimated by poliacrilamid gel electrophoresis are 2.6 X 10 6 D, 1.4 X 10 6 D and 0.68 X 10 6 D, respectively. The in vivo processing of pre-rRNA is very fast since radioactivity could be detected in the mature fractions fifteen minutes after incorporation. The processing rate of salivary pre-rRNA increases after the stage of metamorphosis induction. The in vitro processing of the pre-rRNA is less rapid when compared to that in vivo, and no differences were found in RNAs [pt

  19. A Listeria monocytogenes RNA helicase essential for growth and ribosomal maturation at low temperatures uses its C terminus for appropriate interaction with the ribosome.

    Science.gov (United States)

    Netterling, Sakura; Vaitkevicius, Karolis; Nord, Stefan; Johansson, Jörgen

    2012-08-01

    Listeria monocytogenes, a Gram-positive food-borne human pathogen, is able to grow at temperatures close to 0°C and is thus of great concern for the food industry. In this work, we investigated the physiological role of one DExD-box RNA helicase in Listeria monocytogenes. The RNA helicase Lmo1722 was required for optimal growth at low temperatures, whereas it was dispensable at 37°C. A Δlmo1722 strain was less motile due to downregulation of the major subunit of the flagellum, FlaA, caused by decreased flaA expression. By ribosomal fractionation experiments, it was observed that Lmo1722 was mainly associated with the 50S subunit of the ribosome. Absence of Lmo1722 decreased the fraction of 50S ribosomal subunits and mature 70S ribosomes and affected the processing of the 23S precursor rRNA. The ribosomal profile could be restored to wild-type levels in a Δlmo1722 strain expressing Lmo1722. Interestingly, the C-terminal part of Lmo1722 was redundant for low-temperature growth, motility, 23S rRNA processing, and appropriate ribosomal maturation. However, Lmo1722 lacking the C terminus showed a reduced affinity for the 50S and 70S fractions, suggesting that the C terminus is important for proper guidance of Lmo1722 to the 50S subunit. Taken together, our results show that the Listeria RNA helicase Lmo1722 is essential for growth at low temperatures, motility, and rRNA processing and is important for ribosomal maturation, being associated mainly with the 50S subunit of the ribosome.

  20. The use of 125iodine-labeled RNA for detection of the RNA binding to ribosomes

    International Nuclear Information System (INIS)

    Mori, Tomohiko; Fukuda, Mitsuru

    1975-01-01

    The in vitro labeling of RNA with radioactive iodine is the efficient method to obtain the RNA with high specific activity. The present paper reports on the application of this technique to the production of iodine-labeled RNA for use in the experiment of binding RNA to ribosomes. Tobacco mosaic virus (TMV) RNA was used as natural mRNA, and E. coli S-30 preparation was used as a source of ribosomes. The TMV-RNA was prepared by bentonite-phenol extraction from TMV, and the method used for the iodation of RNA was based on the procedure described by Getz et al. The iodine-labeled RNA was incubated in a cell-free protein synthesizing system (S-30) prepared from E. coli K-12. After the incubation, the reaction mixture was layered onto sucrose gradient, centrifuged, and fractionated into 18 fractions. Optical density at 260 nm was measured, and radioactivity was counted, for each fraction. The binding of mRNA to ribosomes occurred even at 0 deg C, and the occurrence of the nonspecific binding was also shown. Consequently, the specific binding, i.e. the formation of the initiation complex being involved in amino acid incorporation, may be estimated by subtracting the radioactivity associated with monosomes in the presence of both rRNA and ATA from that in the presence of rRNA only. It was shown that the iodine-labeled RNA can be used for the studies of binding RNA to ribosomes. (Kako, I.)

  1. rRNA maturation in yeast cells depleted of large ribosomal subunit proteins.

    Directory of Open Access Journals (Sweden)

    Gisela Pöll

    Full Text Available The structural constituents of the large eukaryotic ribosomal subunit are 3 ribosomal RNAs, namely the 25S, 5.8S and 5S rRNA and about 46 ribosomal proteins (r-proteins. They assemble and mature in a highly dynamic process that involves more than 150 proteins and 70 small RNAs. Ribosome biogenesis starts in the nucleolus, continues in the nucleoplasm and is completed after nucleo-cytoplasmic translocation of the subunits in the cytoplasm. In this work we created 26 yeast strains, each of which conditionally expresses one of the large ribosomal subunit (LSU proteins. In vivo depletion of the analysed LSU r-proteins was lethal and led to destabilisation and degradation of the LSU and/or its precursors. Detailed steady state and metabolic pulse labelling analyses of rRNA precursors in these mutant strains showed that LSU r-proteins can be grouped according to their requirement for efficient progression of different steps of large ribosomal subunit maturation. Comparative analyses of the observed phenotypes and the nature of r-protein-rRNA interactions as predicted by current atomic LSU structure models led us to discuss working hypotheses on i how individual r-proteins control the productive processing of the major 5' end of 5.8S rRNA precursors by exonucleases Rat1p and Xrn1p, and ii the nature of structural characteristics of nascent LSUs that are required for cytoplasmic accumulation of nascent subunits but are nonessential for most of the nuclear LSU pre-rRNA processing events.

  2. Simulating movement of tRNA through the ribosome during hybrid-state formation.

    Science.gov (United States)

    Whitford, Paul C; Sanbonmatsu, Karissa Y

    2013-09-28

    Biomolecular simulations provide a means for exploring the relationship between flexibility, energetics, structure, and function. With the availability of atomic models from X-ray crystallography and cryoelectron microscopy (cryo-EM), and rapid increases in computing capacity, it is now possible to apply molecular dynamics (MD) simulations to large biomolecular machines, and systematically partition the factors that contribute to function. A large biomolecular complex for which atomic models are available is the ribosome. In the cell, the ribosome reads messenger RNA (mRNA) in order to synthesize proteins. During this essential process, the ribosome undergoes a wide range of conformational rearrangements. One of the most poorly understood transitions is translocation: the process by which transfer RNA (tRNA) molecules move between binding sites inside of the ribosome. The first step of translocation is the adoption of a "hybrid" configuration by the tRNAs, which is accompanied by large-scale rotations in the ribosomal subunits. To illuminate the relationship between these rearrangements, we apply MD simulations using a multi-basin structure-based (SMOG) model, together with targeted molecular dynamics protocols. From 120 simulated transitions, we demonstrate the viability of a particular route during P/E hybrid-state formation, where there is asynchronous movement along rotation and tRNA coordinates. These simulations not only suggest an ordering of events, but they highlight atomic interactions that may influence the kinetics of hybrid-state formation. From these simulations, we also identify steric features (H74 and surrounding residues) encountered during the hybrid transition, and observe that flexibility of the single-stranded 3'-CCA tail is essential for it to reach the endpoint. Together, these simulations provide a set of structural and energetic signatures that suggest strategies for modulating the physical-chemical properties of protein synthesis by the

  3. Heavy ion effects on yeast: Inhibition of ribosomal RNA synthesis

    International Nuclear Information System (INIS)

    Weber, K.J.; Schneider, E.; Kiefer, J.; Kraft, G.

    1990-01-01

    Diploid wild-type yeast cells were exposed to beams of heavy ions covering a wide range of linear energy transfer (LET) (43-13,700 keV/microns). Synthesis of ribosomal RNA (rRNA) was assessed as a functional measure of damage produced by particle radiation. An exponential decrease of relative rRNA synthesis with particle fluence was demonstrated in all cases. The inactivation cross sections derived were found to increase with LET over the entire range of LET studied. The corresponding values for relative biological effectiveness were slightly less than unity. Maximum cross sections measured were close to 1 micron 2, implying that some larger structure within the yeast nucleus (e.g., the nucleolus) might represent the target for an impairment of synthetic activity by very heavy ions rather than the genes coding for rRNA. Where tested, an oxygen effect for rRNA synthesis could not be demonstrated

  4. 5S ribosomal RNA database Y2K.

    Science.gov (United States)

    Szymanski, M; Barciszewska, M Z; Barciszewski, J; Erdmann, V A

    2000-01-01

    This paper presents the updated version (Y2K) of the database of ribosomal 5S ribonucleic acids (5S rRNA) and their genes (5S rDNA), http://rose.man/poznan.pl/5SData/index.html. This edition of the database contains 1985primary structures of 5S rRNA and 5S rDNA. They include 60 archaebacterial, 470 eubacterial, 63 plastid, nine mitochondrial and 1383 eukaryotic sequences. The nucleotide sequences of the 5S rRNAs or 5S rDNAs are divided according to the taxonomic position of the source organisms.

  5. The SmpB C-terminal tail helps tmRNA to recognize and enter stalled ribosomes

    Directory of Open Access Journals (Sweden)

    Mickey R. Miller

    2014-09-01

    Full Text Available In bacteria, transfer-messenger RNA (tmRNA and SmpB comprise the most common and effective system for rescuing stalled ribosomes. Ribosomes stall on mRNA transcripts lacking stop codons and are rescued as the defective mRNA is swapped for the tmRNA template in a process known as trans-translation. The tmRNA–SmpB complex is recruited to the ribosome independent of a codon–anticodon interaction. Given that the ribosome uses robust discriminatory mechanisms to select against non-cognate tRNAs during canonical decoding, it has been hard to explain how this can happen. Recent structural and biochemical studies show that SmpB licenses tmRNA entry through its interactions with the decoding center and mRNA channel. In particular, the C-terminal tail of SmpB promotes both EFTu activation and accommodation of tmRNA, the former through interactions with 16S rRNA nucleotide G530 and the latter through interactions with the mRNA channel downstream of the A site. Here we present a detailed model of the earliest steps in trans-translation, and in light of these mechanistic considerations, revisit the question of how tmRNA preferentially reacts with stalled, non-translating ribosomes.

  6. Fluctuations in protein synthesis from a single RNA template: stochastic kinetics of ribosomes.

    Science.gov (United States)

    Garai, Ashok; Chowdhury, Debashish; Ramakrishnan, T V

    2009-01-01

    Proteins are polymerized by cyclic machines called ribosomes, which use their messenger RNA (mRNA) track also as the corresponding template, and the process is called translation. We explore, in depth and detail, the stochastic nature of the translation. We compute various distributions associated with the translation process; one of them--namely, the dwell time distribution--has been measured in recent single-ribosome experiments. The form of the distribution, which fits best with our simulation data, is consistent with that extracted from the experimental data. For our computations, we use a model that captures both the mechanochemistry of each individual ribosome and their steric interactions. We also demonstrate the effects of the sequence inhomogeneities of real genes on the fluctuations and noise in translation. Finally, inspired by recent advances in the experimental techniques of manipulating single ribosomes, we make theoretical predictions on the force-velocity relation for individual ribosomes. In principle, all our predictions can be tested by carrying out in vitro experiments.

  7. Transcriptional activation of ribosomal RNA genes during compensatory renal hypertrophy

    International Nuclear Information System (INIS)

    Ouellette, A.J.; Moonka, R.; Zelenetz, A.; Malt, R.A.

    1986-01-01

    The overall rate of rDNA transcription increases by 50% during the first 24 hours of compensatory renal hypertrophy in the mouse. To study mechanisms of ribosome accumulation after uninephrectomy, transcription rates were measured in isolated kidneys by transcriptional runoff. 32 P-labeled nascent transcripts were hybridized to blots containing linearized, denatured cloned rDNA, and hybridization was quantitated autoradiographically and by direct counting. Overall transcriptional activity of rDNA was increased by 30% above control levels at 6 hrs after nephrectomy and by 50% at 12, 18, and 24 hrs after operation. Hybridizing RNA was insensitive to inhibiby alpha-amanitin, and no hybridization was detected to vector DNA. Thus, accelerated rDNA transcription is one regulatory element in the accretion of ribosomes in renal growth, and the regulatory event is an early event. Mechanisms of activation may include enhanced transcription of active genes or induction of inactive DNA

  8. mRNA decapping enzyme from ribosomes of Saccharomyces cerevisiae

    International Nuclear Information System (INIS)

    Stevens, A.

    1980-01-01

    By use of [ 3 H]methyl-5'-capped [ 14 C]mRNA from yeast as a substrate, a decapping enzyme activity has been detected in enzyme fractions derived from a high salt wash of ribosomes of Saccharomyces cerevisiae. The product of the decapping reaction is [ 3 H]m 7 GDP. That the enzyme is not a non-specific pyrophosphatase is suggested by the finding that the diphosphate product, m 7 GpppA(G), and UDP-glucose are not hydrolyzed

  9. Inhibition of ribosomal RNA synthesis in yeast by ionizing radiations

    Energy Technology Data Exchange (ETDEWEB)

    Weber, K; Kiefer, J [Giessen Univ. (Germany, F.R.). Strahlenzentrum

    1984-12-01

    Synthesis of ribosomal RNA(r-RNA) was measured for 1 h after exposure of Saccharomyces cerevisiae to ..gamma..-rays, X-rays or ..cap alpha.. particles. ..gamma..- or X-ray induced transcription inhibition was always found to decrease exponentially with dose. D/sub 0/ values of 2150 or 1950 Gy were determined in wild-type cells, corresponding to a mean energy of about 60 eV per r-RNA gene. The finding of differential sensitivities of the two high molecular-weight r-RNA species which are cotranscribed from r-DNA is compatible with the existence of a transcription terminating mechanism. Cells from a mutant strain (rad-9), radiation sensitive to colony forming ability, showed an approximately equal sensitivity for transcription inhibition compared to the wild-type (D/sub 0/ (2095) = 2400 Gy). Inactivation of r-RNA synthesis in cells exposed to ..cap alpha..-particles at room-temperature showed a decreased sensitivity with higher particle fluences ('resistant tail'). This phenomenon was drastically reduced if the temperature during irradiation was lowered to 4/sup 0/C and completely abolished when dried cells were used. An inactivation cross-section for ..cap alpha..-particle induced transcription inhibition of about 0.02 ..mu..m/sup 2/ can be derived from the experimental data.

  10. The Circadian Clock Modulates Global Daily Cycles of mRNA Ribosome Loading[OPEN

    Science.gov (United States)

    Missra, Anamika; Ernest, Ben; Jia, Qidong; Ke, Kenneth

    2015-01-01

    Circadian control of gene expression is well characterized at the transcriptional level, but little is known about diel or circadian control of translation. Genome-wide translation state profiling of mRNAs in Arabidopsis thaliana seedlings grown in long day was performed to estimate ribosome loading per mRNA. The experiments revealed extensive translational regulation of key biological processes. Notably, translation of mRNAs for ribosomal proteins and mitochondrial respiration peaked at night. Central clock mRNAs are among those subject to fluctuations in ribosome loading. There was no consistent phase relationship between peak translation states and peak transcript levels. The overlay of distinct transcriptional and translational cycles can be expected to alter the waveform of the protein synthesis rate. Plants that constitutively overexpress the clock gene CCA1 showed phase shifts in peak translation, with a 6-h delay from midnight to dawn or from noon to evening being particularly common. Moreover, cycles of ribosome loading that were detected under continuous light in the wild type collapsed in the CCA1 overexpressor. Finally, at the transcript level, the CCA1-ox strain adopted a global pattern of transcript abundance that was broadly correlated with the light-dark environment. Altogether, these data demonstrate that gene-specific diel cycles of ribosome loading are controlled in part by the circadian clock. PMID:26392078

  11. Selective inhibition of precursor incorporation into ribosomal RNA in gamma-irradiated Tetrahymena pyriformis

    International Nuclear Information System (INIS)

    Ernst, S.G.; Oleinick, N.L.; Rustad, R.C.; Greenblatt, R.M.

    1979-01-01

    Sublethal doses of γ radiation are known to inhibit total RNA synthesis in the ciliate protozoan Tetrahymena. To determine if the synthesis of a particular class of RNA is preferentially inhibited, pulse-labeled RNA was isolated from normal exponentially growing cells, irradiated cells, and cells in which total RNA synthesis had recovered to the pre-irradiation level. The RNAs were analyzed by SDS-polyacrylamide gel electrphoresis and oligo(dT)-cellulose column chromatography. Inhibition of RNA synthesis primarily involves ribosomal RNA. However, radiation does not cause a delay in the processing of precursor rRNA or a preferential loss of either of the mature rRNAs. Following irradiation, poly(A)-containing RNA [poly(A+)RNA] is synthesized at a rate up to three times greater than the control rate. The elevated poly(A+)RNA synthesis occurs during the period of depressed rRNA synthesis and even after rRNA synthesis has recovered to its pre-irradiation rate. While the sizes of the total cellular ribonucleoside triphosphate pools are depressed in the irradiated cells, these pools probably do not represent the actual compartments containing the precursors for RNA synthesis, and the observed changes cannot explain the modifications in macromolecular synthesis in irradiated Tetrahymena. (Auth.)

  12. Structural Studies of RNA Helicases Involved in Eukaryotic Pre-mRNA Splicing, Ribosome Biogenesis, and Translation Initiation

    DEFF Research Database (Denmark)

    He, Yangzi

    and ligates the neighbouring exons to generate mature mRNAs. Prp43 is an RNA helicase of the DEAH/RHA family. In yeast, once mRNAs are released, Prp43 catalyzes the disassembly of spliceosomes. The 18S, 5.8S and 25S rRNAs are transcribed as a single polycistronic transcript—the 35S pre......-rRNA. It is nucleolytically cleaved and chemically modified to generate mature rRNAs, which assemble with ribosomal proteins to form the ribosome. Prp43 is required for the processing of the 18S rRNA. Using X-ray crystallography, I determined a high resolution structure of Prp43 bound to ADP, the first structure of a DEAH....../RHA helicase. It defined the conserved structural features of all DEAH/RHA helicases, and unveiled a novel nucleotide binding site. Additionally a preliminary low resolution structure of a ternary complex comprising Prp43, a non-hydrolyzable ATP analogue, and a single-stranded RNA, was obtained. The ribosome...

  13. Spontaneous reverse movement of mRNA-bound tRNA through the ribosome.

    Science.gov (United States)

    Konevega, Andrey L; Fischer, Niels; Semenkov, Yuri P; Stark, Holger; Wintermeyer, Wolfgang; Rodnina, Marina V

    2007-04-01

    During the translocation step of protein synthesis, a complex of two transfer RNAs bound to messenger RNA (tRNA-mRNA) moves through the ribosome. The reaction is promoted by an elongation factor, called EF-G in bacteria, which, powered by GTP hydrolysis, induces an open, unlocked conformation of the ribosome that allows for spontaneous tRNA-mRNA movement. Here we show that, in the absence of EF-G, there is spontaneous backward movement, or retrotranslocation, of two tRNAs bound to mRNA. Retrotranslocation is driven by the gain in affinity when a cognate E-site tRNA moves into the P site, which compensates the affinity loss accompanying the movement of peptidyl-tRNA from the P to the A site. These results lend support to the diffusion model of tRNA movement during translocation. In the cell, tRNA movement is biased in the forward direction by EF-G, which acts as a Brownian ratchet and prevents backward movement.

  14. The Ribosomal RNA is a Useful Marker to Visualize Rhizobia Interacting with Legume Plants

    Science.gov (United States)

    Rinaudi, Luciana; Isola, Maria C.; Giordano, Walter

    2004-01-01

    Symbiosis between rhizobia and leguminous plants leads to the formation of nitrogen-fixing root nodules. In the present article, we recommend the use of the ribosomal RNA (rRNA) isolated from legume nodules in an experimental class with the purpose of introducing students to the structure of eukaryotic and prokaryotic ribosomes and of…

  15. Ribosome dynamics and tRNA movement by time-resolved electron cryomicroscopy.

    Science.gov (United States)

    Fischer, Niels; Konevega, Andrey L; Wintermeyer, Wolfgang; Rodnina, Marina V; Stark, Holger

    2010-07-15

    The translocation step of protein synthesis entails large-scale rearrangements of the ribosome-transfer RNA (tRNA) complex. Here we have followed tRNA movement through the ribosome during translocation by time-resolved single-particle electron cryomicroscopy (cryo-EM). Unbiased computational sorting of cryo-EM images yielded 50 distinct three-dimensional reconstructions, showing the tRNAs in classical, hybrid and various novel intermediate states that provide trajectories and kinetic information about tRNA movement through the ribosome. The structures indicate how tRNA movement is coupled with global and local conformational changes of the ribosome, in particular of the head and body of the small ribosomal subunit, and show that dynamic interactions between tRNAs and ribosomal residues confine the path of the tRNAs through the ribosome. The temperature dependence of ribosome dynamics reveals a surprisingly flat energy landscape of conformational variations at physiological temperature. The ribosome functions as a Brownian machine that couples spontaneous conformational changes driven by thermal energy to directed movement.

  16. The Absence of the Transcription Factor Yrr1p, Identified from Comparative Genome Profiling, Increased Vanillin Tolerance Due to Enhancements of ABC Transporters Expressing, rRNA Processing and Ribosome Biogenesis in Saccharomyces cerevisiae.

    Science.gov (United States)

    Wang, Xinning; Liang, Zhenzhen; Hou, Jin; Shen, Yu; Bao, Xiaoming

    2017-01-01

    Enhancing the tolerance of Saccharomyces cerevisiae to inhibitors derived from lignocellulose is conducive to producing biofuel and chemicals using abundant lignocellulosic materials. Vanillin is a major type of phenolic inhibitor in lignocellulose hydrolysates for S. cerevisiae . In the present work, the factors beneficial to vanillin resistance in yeast were identified from the vanillin-resistant strain EMV-8, which was derived from strain NAN-27 by adaptive evolution. We found 450 SNPs and 44 genes with InDels in the vanillin-tolerant strain EMV-8 by comparing the genome sequences of EMV-8 and NAN-27. To investigate the effects of InDels, InDels were deleted in BY4741, respectively. We demonstrated that the deletion of YRR1 improved vanillin tolerance of strain. In the presence of 6 mM vanillin, deleting YRR1 increase the maximum specific growth rate and the vanillin consumption rate by 142 and 51%, respectively. The subsequent transcriptome analysis revealed that deleting YRR1 resulted in changed expression of over 200 genes in the presence of 5 mM vanillin. The most marked changes were the significant up-regulation of the dehydrogenase ADH7 , several ATP-binding cassette (ABC) transporters, and dozens of genes involved in ribosome biogenesis and rRNA processing. Coincidently, the crude enzyme solution of BY4741( yrr1 Δ) exhibited higher NADPH-dependent vanillin reduction activity than control. In addition, overexpressing the ABC transporter genes PDR5, YOR1 , and SNQ2 , as well as the RNA helicase gene DBP2 , increased the vanillin tolerance of strain. Interestingly, unlike the marked changes we mentioned above, under vanillin-free conditions, there are only limited transcriptional differences between wildtype and yrr1 Δ. This indicated that vanillin might act as an effector in Yrr1p-related regulatory processes. The new findings of the relationship between YRR1 and vanillin tolerance, as well as the contribution of rRNA processing and ribosome biogenesis to

  17. Oxidative damage of 18S and 5S ribosomal RNA in digestive gland of mussels exposed to trace metals.

    Science.gov (United States)

    Kournoutou, Georgia G; Giannopoulou, Panagiota C; Sazakli, Eleni; Leotsinidis, Michel; Kalpaxis, Dimitrios L

    2017-11-01

    Numerous studies have shown the ability of trace metals to accumulate in marine organisms and cause oxidative stress that leads to perturbations in many important intracellular processes, including protein synthesis. This study is mainly focused on the exploration of structural changes, like base modifications, scissions, and conformational changes, caused in 18S and 5S ribosomal RNA (rRNA) isolated from the mussel Mytilus galloprovincialis exposed to 40μg/L Cu, 30μg/L Hg, or 100μg/L Cd, for 5 or 15days. 18S rRNA and 5S rRNA are components of the small and large ribosomal subunit, respectively, found in complex with ribosomal proteins, translation factors and other auxiliary components (metal ions, toxins etc). 18S rRNA plays crucial roles in all stages of protein synthesis, while 5S rRNA serves as a master signal transducer between several functional regions of 28S rRNA. Therefore, structural changes in these ribosomal constituents could affect the basic functions of ribosomes and hence the normal metabolism of cells. Especially, 18S rRNA along with ribosomal proteins forms the decoding centre that ensures the correct codon-anticodon pairing. As exemplified by ELISA, primer extension analysis and DMS footprinting analysis, each metal caused oxidative damage to rRNA, depending on the nature of metal ion and the duration of exposure. Interestingly, exposure of mussels to Cu or Hg caused structural alterations in 5S rRNA, localized in paired regions and within loops A, B, C, and E, leading to a continuous progressive loss of the 5S RNA structural integrity. In contrast, structural impairments of 5S rRNA in mussels exposed to Cd were accumulating for the initial 5days, and then progressively decreased to almost the normal level by day 15, probably due to the parallel elevation of metallothionein content that depletes the pools of free Cd. Regions of interest in 18S rRNA, such as the decoding centre, sites implicated in the binding of tRNAs (A- and P-sites) or

  18. AtRH57, a DEAD-box RNA helicase, is involved in feedback inhibition of glucose-mediated abscisic acid accumulation during seedling development and additively affects pre-ribosomal RNA processing with high glucose.

    Science.gov (United States)

    Hsu, Yi-Feng; Chen, Yun-Chu; Hsiao, Yu-Chun; Wang, Bing-Jyun; Lin, Shih-Yun; Cheng, Wan-Hsing; Jauh, Guang-Yuh; Harada, John J; Wang, Co-Shine

    2014-01-01

    The Arabidopsis thaliana T-DNA insertion mutant rh57-1 exhibited hypersensitivity to glucose (Glc) and abscisic acid (ABA). The other two rh57 mutants also showed Glc hypersensitivity similar to rh57-1, strongly suggesting that the Glc-hypersensitive feature of these mutants results from mutation of AtRH57. rh57-1 and rh57-3 displayed severely impaired seedling growth when grown in Glc concentrations higher than 3%. The gene, AtRH57 (At3g09720), was expressed in all Arabidopsis organs and its transcript was significantly induced by ABA, high Glc and salt. The new AtRH57 belongs to class II DEAD-box RNA helicase gene family. Transient expression of AtRH57-EGFP (enhanced green fluorescent protein) in onion cells indicated that AtRH57 was localized in the nucleus and nucleolus. Purified AtRH57-His protein was shown to unwind double-stranded RNA independent of ATP in vitro. The ABA biosynthesis inhibitor fluridone profoundly redeemed seedling growth arrest mediated by sugar. rh57-1 showed increased ABA levels when exposed to high Glc. Quantitative real time polymerase chain reaction analysis showed that AtRH57 acts in a signaling network downstream of HXK1. A feedback inhibition of ABA accumulation mediated by AtRH57 exists within the sugar-mediated ABA signaling. AtRH57 mutation and high Glc conditions additively caused a severe defect in small ribosomal subunit formation. The accumulation of abnormal pre-rRNA and resistance to protein synthesis-related antibiotics were observed in rh57 mutants and in the wild-type Col-0 under high Glc conditions. These results suggested that AtRH57 plays an important role in rRNA biogenesis in Arabidopsis and participates in response to sugar involving Glc- and ABA signaling during germination and seedling growth. © 2013 The Authors The Plant Journal © 2013 John Wiley & Sons Ltd.

  19. tmRNA-mediated trans-translation as the major ribosome rescue system in a bacterial cell

    Directory of Open Access Journals (Sweden)

    Hyouta eHimeno

    2014-04-01

    Full Text Available tmRNA (transfer messenger RNA; also known as 10Sa RNA or SsrA RNA is a small RNA molecule that is conserved among bacteria. It has structural and functional similarities to tRNA: it has an upper half of the tRNA-like structure, its 5’ end is processed by RNase P, it has typical tRNA-specific base modifications, it is aminoacylated with alanine, it binds to EF-Tu after aminoacylation and it enters the ribosome with EF-Tu and GTP. However, tmRNA lacks an anticodon, and instead it has a coding sequence for a short peptide called tag-peptide. An elaborate interplay of actions of tmRNA as both tRNA and mRNA with the help of a tmRNA-binding protein, SmpB, facilitates trans-translation, which produces a single polypeptide from two mRNA molecules. Initially alanyl-tmRNA in complex with EF-Tu and SmpB enters the vacant A-site of the stalled ribosome like aminoacyl-tRNA but without a codon-anticodon interaction, and subsequently truncated mRNA is replaced with the tag-encoding region of tmRNA. During these processes, not only tmRNA but also SmpB structurally and functionally mimics both tRNA and mRNA. Thus trans-translation rescues the stalled ribosome, thereby allowing recycling of the ribosome. Since the tag-peptide serves as a target of AAA+ proteases, the trans-translation products are preferentially degraded so that they do not accumulate in the cell. Although alternative rescue systems have recently been revealed, trans-translation is the only system that universally exists in bacteria. Furthermore, it is unique in that it employs a small RNA and that it prevents accumulation of nonfunctional proteins from truncated mRNA in the cell. It might play the major role in rescuing the stalled translation in the bacterial cell.

  20. The ribosome as a molecular machine: the mechanism of tRNA-mRNA movement in translocation.

    Science.gov (United States)

    Rodnina, Marina V; Wintermeyer, Wolfgang

    2011-04-01

    Translocation of tRNA and mRNA through the ribosome is one of the most dynamic events during protein synthesis. In the cell, translocation is catalysed by EF-G (elongation factor G) and driven by GTP hydrolysis. Major unresolved questions are: how the movement is induced and what the moving parts of the ribosome are. Recent progress in time-resolved cryoelectron microscopy revealed trajectories of tRNA movement through the ribosome. Driven by thermal fluctuations, the ribosome spontaneously samples a large number of conformational states. The spontaneous movement of tRNAs through the ribosome is loosely coupled to the motions within the ribosome. EF-G stabilizes conformational states prone to translocation and promotes a conformational rearrangement of the ribosome (unlocking) that accelerates the rate-limiting step of translocation: the movement of the tRNA anticodons on the small ribosomal subunit. EF-G acts as a Brownian ratchet providing directional bias for movement at the cost of GTP hydrolysis.

  1. The ribosome uses two active mechanisms to unwind messenger RNA during translation.

    Science.gov (United States)

    Qu, Xiaohui; Wen, Jin-Der; Lancaster, Laura; Noller, Harry F; Bustamante, Carlos; Tinoco, Ignacio

    2011-07-06

    The ribosome translates the genetic information encoded in messenger RNA into protein. Folded structures in the coding region of an mRNA represent a kinetic barrier that lowers the peptide elongation rate, as the ribosome must disrupt structures it encounters in the mRNA at its entry site to allow translocation to the next codon. Such structures are exploited by the cell to create diverse strategies for translation regulation, such as programmed frameshifting, the modulation of protein expression levels, ribosome localization and co-translational protein folding. Although strand separation activity is inherent to the ribosome, requiring no exogenous helicases, its mechanism is still unknown. Here, using a single-molecule optical tweezers assay on mRNA hairpins, we find that the translation rate of identical codons at the decoding centre is greatly influenced by the GC content of folded structures at the mRNA entry site. Furthermore, force applied to the ends of the hairpin to favour its unfolding significantly speeds translation. Quantitative analysis of the force dependence of its helicase activity reveals that the ribosome, unlike previously studied helicases, uses two distinct active mechanisms to unwind mRNA structure: it destabilizes the helical junction at the mRNA entry site by biasing its thermal fluctuations towards the open state, increasing the probability of the ribosome translocating unhindered; and it mechanically pulls apart the mRNA single strands of the closed junction during the conformational changes that accompany ribosome translocation. The second of these mechanisms ensures a minimal basal rate of translation in the cell; specialized, mechanically stable structures are required to stall the ribosome temporarily. Our results establish a quantitative mechanical basis for understanding the mechanism of regulation of the elongation rate of translation by structured mRNAs. ©2011 Macmillan Publishers Limited. All rights reserved

  2. Production of RNA-protein cross links in γ irradiated E. Coli ribosomes

    International Nuclear Information System (INIS)

    Ekert, Bernard; Giocanti, Nicole

    1976-01-01

    γ irradiation in de-aerated conditions of E. coli MRE 600 ribosomes, labelled with 14 C uracil, leads to a decrease of extractibility of 14 C RNA by lithium chloride 4 M-urea 8 M. On the other hand, the radioactivity of the protein fraction increases with irradiation. These results strongly suggest that RNA-protein cross links are formed in irradiated ribosomes [fr

  3. Cross-linking of streptomycin to the 16S ribosomal RNA of Escherichia coli

    International Nuclear Information System (INIS)

    Gravel, M.; Melancon, P.; Barkier-Gingras, L.

    1987-01-01

    [ 3 H]Dihydrostreptomycin was cross-linked to the 30S ribosomal subunit from Escherichia coli with the bifunctional reagent nitrogen mustard. The cross-linking primarily involved the 16S RNA. To localize the site of cross-linking of streptomycin to the 16S RNA, the authors hybridized RNA labeled with streptomycin to restriction fragments of the 16S RNA gene. Labeled RNA hybridized to DNA fragments corresponding to bases 892-917 and bases 1394-1415. These two segments of the ribosomal RNA must by juxtaposed in the ribosome, since there is a single binding site for streptomycin. This region has been implicated both in the decoding site and in the binding of initiation factor IF-3, indicating its functional importance

  4. The ribosome structure controls and directs mRNA entry, translocation and exit dynamics

    International Nuclear Information System (INIS)

    Kurkcuoglu, Ozge; Doruker, Pemra; Jernigan, Robert L; Sen, Taner Z; Kloczkowski, Andrzej

    2008-01-01

    The protein-synthesizing ribosome undergoes large motions to effect the translocation of tRNAs and mRNA; here, the domain motions of this system are explored with a coarse-grained elastic network model using normal mode analysis. Crystal structures are used to construct various model systems of the 70S complex with/without tRNA, elongation factor Tu and the ribosomal proteins. Computed motions reveal the well-known ratchet-like rotational motion of the large subunits, as well as the head rotation of the small subunit and the high flexibility of the L1 and L7/L12 stalks, even in the absence of ribosomal proteins. This result indicates that these experimentally observed motions during translocation are inherently controlled by the ribosomal shape and only partially dependent upon GTP hydrolysis. Normal mode analysis further reveals the mobility of A- and P-tRNAs to increase in the absence of the E-tRNA. In addition, the dynamics of the E-tRNA is affected by the absence of the ribosomal protein L1. The mRNA in the entrance tunnel interacts directly with helicase proteins S3 and S4, which constrain the mRNA in a clamp-like fashion, as well as with protein S5, which likely orients the mRNA to ensure correct translation. The ribosomal proteins S7, S11 and S18 may also be involved in assuring translation fidelity by constraining the mRNA at the exit site of the channel. The mRNA also interacts with the 16S 3' end forming the Shine–Dalgarno complex at the initiation step; the 3' end may act as a 'hook' to reel in the mRNA to facilitate its exit

  5. Identification and role of functionally important motifs in the 970 loop of Escherichia coli 16S ribosomal RNA.

    Science.gov (United States)

    Saraiya, Ashesh A; Lamichhane, Tek N; Chow, Christine S; SantaLucia, John; Cunningham, Philip R

    2008-02-22

    The 970 loop (helix 31) of Escherichia coli 16S ribosomal RNA contains two modified nucleotides, m(2)G966 and m(5)C967. Positions A964, A969, and C970 are conserved among the Bacteria, Archaea, and Eukarya. The nucleotides present at positions 965, 966, 967, 968, and 971, however, are only conserved and unique within each domain. All organisms contain a modified nucleoside at position 966, but the type of the modification is domain specific. Biochemical and structure studies have placed this loop near the P site and have shown it to be involved in the decoding process and in binding the antibiotic tetracycline. To identify the functional components of this ribosomal RNA hairpin, the eight nucleotides of the 970 loop of helix 31 were subjected to saturation mutagenesis and 107 unique functional mutants were isolated and analyzed. Nonrandom nucleotide distributions were observed at each mutated position among the functional isolates. Nucleotide identity at positions 966 and 969 significantly affects ribosome function. Ribosomes with single mutations of m(2)G966 or m(5)C967 produce more protein in vivo than do wild-type ribosomes. Overexpression of initiation factor 3 specifically restored wild-type levels of protein synthesis to the 966 and 967 mutants, suggesting that modification of these residues is important for initiation factor 3 binding and for the proper initiation of protein synthesis.

  6. Biosynthesis of ribosomal RNA in nucleoli regulates pluripotency and differentiation ability of pluripotent stem cells.

    Science.gov (United States)

    Watanabe-Susaki, Kanako; Takada, Hitomi; Enomoto, Kei; Miwata, Kyoko; Ishimine, Hisako; Intoh, Atsushi; Ohtaka, Manami; Nakanishi, Mahito; Sugino, Hiromu; Asashima, Makoto; Kurisaki, Akira

    2014-12-01

    Pluripotent stem cells have been shown to have unique nuclear properties, for example, hyperdynamic chromatin and large, condensed nucleoli. However, the contribution of the latter unique nucleolar character to pluripotency has not been well understood. Here, we show that fibrillarin (FBL), a critical methyltransferase for ribosomal RNA (rRNA) processing in nucleoli, is one of the proteins highly expressed in pluripotent embryonic stem (ES) cells. Stable expression of FBL in ES cells prolonged the pluripotent state of mouse ES cells cultured in the absence of leukemia inhibitory factor (LIF). Analyses using deletion mutants and a point mutant revealed that the methyltransferase activity of FBL regulates stem cell pluripotency. Knockdown of this gene led to significant delays in rRNA processing, growth inhibition, and apoptosis in mouse ES cells. Interestingly, both partial knockdown of FBL and treatment with actinomycin D, an inhibitor of rRNA synthesis, induced the expression of differentiation markers in the presence of LIF and promoted stem cell differentiation into neuronal lineages. Moreover, we identified p53 signaling as the regulatory pathway for pluripotency and differentiation of ES cells. These results suggest that proper activity of rRNA production in nucleoli is a novel factor for the regulation of pluripotency and differentiation ability of ES cells. © 2014 AlphaMed Press.

  7. Translation initiation in bacterial polysomes through ribosome loading on a standby site on a highly translated mRNA

    Science.gov (United States)

    Andreeva, Irena

    2018-01-01

    During translation, consecutive ribosomes load on an mRNA and form a polysome. The first ribosome binds to a single-stranded mRNA region and moves toward the start codon, unwinding potential mRNA structures on the way. In contrast, the following ribosomes can dock at the start codon only when the first ribosome has vacated the initiation site. Here we show that loading of the second ribosome on a natural 38-nt-long 5′ untranslated region of lpp mRNA, which codes for the outer membrane lipoprotein from Escherichia coli, takes place before the leading ribosome has moved away from the start codon. The rapid formation of this standby complex depends on the presence of ribosomal proteins S1/S2 in the leading ribosome. The early recruitment of the second ribosome to the standby site before translation by the leading ribosome and the tight coupling between translation elongation by the first ribosome and the accommodation of the second ribosome can contribute to high translational efficiency of the lpp mRNA. PMID:29632209

  8. Defining the structural requirements for a helix in 23 S ribosomal RNA that confers erythromycin resistance

    DEFF Research Database (Denmark)

    Douthwaite, S; Powers, T; Lee, J Y

    1989-01-01

    The helix spanning nucleotides 1198 to 1247 (helix 1200-1250) in Escherichia coli 23 S ribosomal RNA (rRNA) is functionally important in protein synthesis, and deletions in this region confer erythromycin resistance. In order to define the structural requirements for resistance, we have dissected...... deletion mutants show a sensitive phenotype. Deletions that extend into the base-pairing between GCC1208 and GGU1240 result in non-functional 23 S RNAs, which consequently do not confer resistance. A number of phylogenetically conserved nucleotides have been shown to be non-essential for 23 S RNA function....... However, removal of either these or non-conserved nucleotides from helix 1200-1250 measurably reduces the efficiency of 23 S RNA in forming functional ribosomes. We have used chemical probing and a modified primer extension method to investigate erythromycin binding to wild-type and resistant ribosomes...

  9. Studies of the effects of ultraviolet radiation on the structural integrities of ribosomal RNA components of the Escherichia coli 50S ribosomal subunit

    International Nuclear Information System (INIS)

    Gorelic, L.; Parker, D.

    1978-01-01

    The effects of 254-nm radiation on the structural integrities of free and 50S ribosome-bound 5S and 23S ribosomal ribonucleic acids (rRNA) have been elucidated. Irradiation of aqueous solutions of Escherichia coli 50S ribosomes with 253.7-nm radiation results in the formation of single-strand breaks in double-stranded regions of the 23S rRNA component, but not in rRNA chain scission, and destabilization of the secondary structure of the 23S rRNA toward denaturation. The minimum doses of 253.7-nm radiation required for the first detection of the two effects are 7 x 10 19 quanta for the production of single-strand breaks in double-stranded regions of the 23S rRNA, and 19 quanta for destabilization of the 23S rRNA secondary structure. Free 23S rRNA is resistant toward photoinduced chain breakage at doses of 253.7-nm radiation up to at least 2.3 x 10 20 and is much less sensitive toward destabilization of secondary structure than ribosome-bound 23S rRNA. In contrast to the photosensitivity of 50S ribosome-bound 23S rRNA toward chain breakage, 50S ribosome-bound 5S rRNA is resistant toward chain breakage at doses of 253.7-nm radiation up to at least 2.3 x 10 20 quanta. Ribosome-bound 5S and 23S rRNA are also not photosensitive toward intermolecular 5S/23S rRNA cross-linkage

  10. The NBS1-Treacle complex controls ribosomal RNA transcription in response to DNA damage

    DEFF Research Database (Denmark)

    Larsen, Dorthe H; Hari, Flurina; Clapperton, Julie A

    2014-01-01

    Chromosome breakage elicits transient silencing of ribosomal RNA synthesis, but the mechanisms involved remained elusive. Here we discover an in trans signalling mechanism that triggers pan-nuclear silencing of rRNA transcription in response to DNA damage. This is associated with transient...... recruitment of the Nijmegen breakage syndrome protein 1 (NBS1), a central regulator of DNA damage responses, into the nucleoli. We further identify TCOF1 (also known as Treacle), a nucleolar factor implicated in ribosome biogenesis and mutated in Treacher Collins syndrome, as an interaction partner of NBS1...

  11. Defective replication initiation results in locus specific chromosome breakage and a ribosomal RNA deficiency in yeast.

    Directory of Open Access Journals (Sweden)

    Joseph C Sanchez

    2017-10-01

    Full Text Available A form of dwarfism known as Meier-Gorlin syndrome (MGS is caused by recessive mutations in one of six different genes (ORC1, ORC4, ORC6, CDC6, CDT1, and MCM5. These genes encode components of the pre-replication complex, which assembles at origins of replication prior to S phase. Also, variants in two additional replication initiation genes have joined the list of causative mutations for MGS (Geminin and CDC45. The identity of the causative MGS genetic variants strongly suggests that some aspect of replication is amiss in MGS patients; however, little evidence has been obtained regarding what aspect of chromosome replication is faulty. Since the site of one of the missense mutations in the human ORC4 alleles is conserved between humans and yeast, we sought to determine in what way this single amino acid change affects the process of chromosome replication, by introducing the comparable mutation into yeast (orc4Y232C. We find that yeast cells with the orc4Y232C allele have a prolonged S-phase, due to compromised replication initiation at the ribosomal DNA (rDNA locus located on chromosome XII. The inability to initiate replication at the rDNA locus results in chromosome breakage and a severely reduced rDNA copy number in the survivors, presumably helping to ensure complete replication of chromosome XII. Although reducing rDNA copy number may help ensure complete chromosome replication, orc4Y232C cells struggle to meet the high demand for ribosomal RNA synthesis. This finding provides additional evidence linking two essential cellular pathways-DNA replication and ribosome biogenesis.

  12. Defective replication initiation results in locus specific chromosome breakage and a ribosomal RNA deficiency in yeast.

    Science.gov (United States)

    Sanchez, Joseph C; Kwan, Elizabeth X; Pohl, Thomas J; Amemiya, Haley M; Raghuraman, M K; Brewer, Bonita J

    2017-10-01

    A form of dwarfism known as Meier-Gorlin syndrome (MGS) is caused by recessive mutations in one of six different genes (ORC1, ORC4, ORC6, CDC6, CDT1, and MCM5). These genes encode components of the pre-replication complex, which assembles at origins of replication prior to S phase. Also, variants in two additional replication initiation genes have joined the list of causative mutations for MGS (Geminin and CDC45). The identity of the causative MGS genetic variants strongly suggests that some aspect of replication is amiss in MGS patients; however, little evidence has been obtained regarding what aspect of chromosome replication is faulty. Since the site of one of the missense mutations in the human ORC4 alleles is conserved between humans and yeast, we sought to determine in what way this single amino acid change affects the process of chromosome replication, by introducing the comparable mutation into yeast (orc4Y232C). We find that yeast cells with the orc4Y232C allele have a prolonged S-phase, due to compromised replication initiation at the ribosomal DNA (rDNA) locus located on chromosome XII. The inability to initiate replication at the rDNA locus results in chromosome breakage and a severely reduced rDNA copy number in the survivors, presumably helping to ensure complete replication of chromosome XII. Although reducing rDNA copy number may help ensure complete chromosome replication, orc4Y232C cells struggle to meet the high demand for ribosomal RNA synthesis. This finding provides additional evidence linking two essential cellular pathways-DNA replication and ribosome biogenesis.

  13. Connecting the kinetics and energy landscape of tRNA translocation on the ribosome.

    Directory of Open Access Journals (Sweden)

    Paul C Whitford

    Full Text Available Functional rearrangements in biomolecular assemblies result from diffusion across an underlying energy landscape. While bulk kinetic measurements rely on discrete state-like approximations to the energy landscape, single-molecule methods can project the free energy onto specific coordinates. With measures of the diffusion, one may establish a quantitative bridge between state-like kinetic measurements and the continuous energy landscape. We used an all-atom molecular dynamics simulation of the 70S ribosome (2.1 million atoms; 1.3 microseconds to provide this bridge for specific conformational events associated with the process of tRNA translocation. Starting from a pre-translocation configuration, we identified sets of residues that collectively undergo rotary rearrangements implicated in ribosome function. Estimates of the diffusion coefficients along these collective coordinates for translocation were then used to interconvert between experimental rates and measures of the energy landscape. This analysis, in conjunction with previously reported experimental rates of translocation, provides an upper-bound estimate of the free-energy barriers associated with translocation. While this analysis was performed for a particular kinetic scheme of translocation, the quantitative framework is general and may be applied to energetic and kinetic descriptions that include any number of intermediates and transition states.

  14. Molecular characterization of 5S ribosomal RNA genes and transcripts in the protozoan parasite Leishmania major.

    Science.gov (United States)

    Moreno-Campos, Rodrigo; Florencio-Martínez, Luis E; Nepomuceno-Mejía, Tomás; Rojas-Sánchez, Saúl; Vélez-Ramírez, Daniel E; Padilla-Mejía, Norma E; Figueroa-Angulo, Elisa; Manning-Cela, Rebeca; Martínez-Calvillo, Santiago

    2016-12-01

    Eukaryotic 5S rRNA, synthesized by RNA polymerase III (Pol III), is an essential component of the large ribosomal subunit. Most organisms contain hundreds of 5S rRNA genes organized into tandem arrays. However, the genome of the protozoan parasite Leishmania major contains only 11 copies of the 5S rRNA gene, which are interspersed and associated with other Pol III-transcribed genes. Here we report that, in general, the number and order of the 5S rRNA genes is conserved between different species of Leishmania. While in most organisms 5S rRNA genes are normally associated with the nucleolus, combined fluorescent in situ hybridization and indirect immunofluorescence experiments showed that 5S rRNA genes are mainly located at the nuclear periphery in L. major. Similarly, the tandemly repeated 5S rRNA genes in Trypanosoma cruzi are dispersed throughout the nucleus. In contrast, 5S rRNA transcripts in L. major were localized within the nucleolus, and scattered throughout the cytoplasm, where mature ribosomes are located. Unlike other rRNA species, stable antisense RNA complementary to 5S rRNA is not detected in L. major.

  15. Locus-specific ribosomal RNA gene silencing in nucleolar dominance.

    Directory of Open Access Journals (Sweden)

    Michelle S Lewis

    2007-08-01

    Full Text Available The silencing of one parental set of rRNA genes in a genetic hybrid is an epigenetic phenomenon known as nucleolar dominance. We showed previously that silencing is restricted to the nucleolus organizer regions (NORs, the loci where rRNA genes are tandemly arrayed, and does not spread to or from neighboring protein-coding genes. One hypothesis is that nucleolar dominance is the net result of hundreds of silencing events acting one rRNA gene at a time. A prediction of this hypothesis is that rRNA gene silencing should occur independent of chromosomal location. An alternative hypothesis is that the regulatory unit in nucleolar dominance is the NOR, rather than each individual rRNA gene, in which case NOR localization may be essential for rRNA gene silencing. To test these alternative hypotheses, we examined the fates of rRNA transgenes integrated at ectopic locations. The transgenes were accurately transcribed in all independent transgenic Arabidopsis thaliana lines tested, indicating that NOR localization is not required for rRNA gene expression. Upon crossing the transgenic A. thaliana lines as ovule parents with A. lyrata to form F1 hybrids, a new system for the study of nucleolar dominance, the endogenous rRNA genes located within the A. thaliana NORs are silenced. However, rRNA transgenes escaped silencing in multiple independent hybrids. Collectively, our data suggest that rRNA gene activation can occur in a gene-autonomous fashion, independent of chromosomal location, whereas rRNA gene silencing in nucleolar dominance is locus-dependent.

  16. The functional half-life of an mRNA depends on the ribosome spacing in an early coding region

    DEFF Research Database (Denmark)

    Pedersen, Margit; Nissen, Søren; Mitarai, Namiko

    2011-01-01

    Bacterial mRNAs are translated by closely spaced ribosomes and degraded from the 5'-end, with half-lives of around 2 min at 37 °C in most cases. Ribosome-free or "naked" mRNA is known to be readily degraded, but the initial event that inactivates the mRNA functionally has not been fully described...

  17. Evidence for rRNA 2'-O-methylation plasticity: Control of intrinsic translational capabilities of human ribosomes.

    Science.gov (United States)

    Erales, Jenny; Marchand, Virginie; Panthu, Baptiste; Gillot, Sandra; Belin, Stéphane; Ghayad, Sandra E; Garcia, Maxime; Laforêts, Florian; Marcel, Virginie; Baudin-Baillieu, Agnès; Bertin, Pierre; Couté, Yohann; Adrait, Annie; Meyer, Mélanie; Therizols, Gabriel; Yusupov, Marat; Namy, Olivier; Ohlmann, Théophile; Motorin, Yuri; Catez, Frédéric; Diaz, Jean-Jacques

    2017-12-05

    Ribosomal RNAs (rRNAs) are main effectors of messenger RNA (mRNA) decoding, peptide-bond formation, and ribosome dynamics during translation. Ribose 2'-O-methylation (2'-O-Me) is the most abundant rRNA chemical modification, and displays a complex pattern in rRNA. 2'-O-Me was shown to be essential for accurate and efficient protein synthesis in eukaryotic cells. However, whether rRNA 2'-O-Me is an adjustable feature of the human ribosome and a means of regulating ribosome function remains to be determined. Here we challenged rRNA 2'-O-Me globally by inhibiting the rRNA methyl-transferase fibrillarin in human cells. Using RiboMethSeq, a nonbiased quantitative mapping of 2'-O-Me, we identified a repertoire of 2'-O-Me sites subjected to variation and demonstrate that functional domains of ribosomes are targets of 2'-O-Me plasticity. Using the cricket paralysis virus internal ribosome entry site element, coupled to in vitro translation, we show that the intrinsic capability of ribosomes to translate mRNAs is modulated through a 2'-O-Me pattern and not by nonribosomal actors of the translational machinery. Our data establish rRNA 2'-O-Me plasticity as a mechanism providing functional specificity to human ribosomes.

  18. Initiation of ribosomal RNA synthesis in Escherichia coli

    NARCIS (Netherlands)

    Hamming, Jantina

    1981-01-01

    Het E. coli chromosoom is éên lang circulair dubbelstrengs DNA molecuul en beslaat ongeveer 3000 genen. Het enzym RNA polymerase is verantwoordelijk voor de transcriptie in RNA van alle genetische informatie in de ce1. Er zijn 2 soorten transcripten: de ribosomale en transfer RNAs die deel uitmaken

  19. High-Resolution Analysis of Coronavirus Gene Expression by RNA Sequencing and Ribosome Profiling.

    Science.gov (United States)

    Irigoyen, Nerea; Firth, Andrew E; Jones, Joshua D; Chung, Betty Y-W; Siddell, Stuart G; Brierley, Ian

    2016-02-01

    Members of the family Coronaviridae have the largest genomes of all RNA viruses, typically in the region of 30 kilobases. Several coronaviruses, such as Severe acute respiratory syndrome-related coronavirus (SARS-CoV) and Middle East respiratory syndrome-related coronavirus (MERS-CoV), are of medical importance, with high mortality rates and, in the case of SARS-CoV, significant pandemic potential. Other coronaviruses, such as Porcine epidemic diarrhea virus and Avian coronavirus, are important livestock pathogens. Ribosome profiling is a technique which exploits the capacity of the translating ribosome to protect around 30 nucleotides of mRNA from ribonuclease digestion. Ribosome-protected mRNA fragments are purified, subjected to deep sequencing and mapped back to the transcriptome to give a global "snap-shot" of translation. Parallel RNA sequencing allows normalization by transcript abundance. Here we apply ribosome profiling to cells infected with Murine coronavirus, mouse hepatitis virus, strain A59 (MHV-A59), a model coronavirus in the same genus as SARS-CoV and MERS-CoV. The data obtained allowed us to study the kinetics of virus transcription and translation with exquisite precision. We studied the timecourse of positive and negative-sense genomic and subgenomic viral RNA production and the relative translation efficiencies of the different virus ORFs. Virus mRNAs were not found to be translated more efficiently than host mRNAs; rather, virus translation dominates host translation at later time points due to high levels of virus transcripts. Triplet phasing of the profiling data allowed precise determination of translated reading frames and revealed several translated short open reading frames upstream of, or embedded within, known virus protein-coding regions. Ribosome pause sites were identified in the virus replicase polyprotein pp1a ORF and investigated experimentally. Contrary to expectations, ribosomes were not found to pause at the ribosomal

  20. High-Resolution Analysis of Coronavirus Gene Expression by RNA Sequencing and Ribosome Profiling.

    Directory of Open Access Journals (Sweden)

    Nerea Irigoyen

    2016-02-01

    Full Text Available Members of the family Coronaviridae have the largest genomes of all RNA viruses, typically in the region of 30 kilobases. Several coronaviruses, such as Severe acute respiratory syndrome-related coronavirus (SARS-CoV and Middle East respiratory syndrome-related coronavirus (MERS-CoV, are of medical importance, with high mortality rates and, in the case of SARS-CoV, significant pandemic potential. Other coronaviruses, such as Porcine epidemic diarrhea virus and Avian coronavirus, are important livestock pathogens. Ribosome profiling is a technique which exploits the capacity of the translating ribosome to protect around 30 nucleotides of mRNA from ribonuclease digestion. Ribosome-protected mRNA fragments are purified, subjected to deep sequencing and mapped back to the transcriptome to give a global "snap-shot" of translation. Parallel RNA sequencing allows normalization by transcript abundance. Here we apply ribosome profiling to cells infected with Murine coronavirus, mouse hepatitis virus, strain A59 (MHV-A59, a model coronavirus in the same genus as SARS-CoV and MERS-CoV. The data obtained allowed us to study the kinetics of virus transcription and translation with exquisite precision. We studied the timecourse of positive and negative-sense genomic and subgenomic viral RNA production and the relative translation efficiencies of the different virus ORFs. Virus mRNAs were not found to be translated more efficiently than host mRNAs; rather, virus translation dominates host translation at later time points due to high levels of virus transcripts. Triplet phasing of the profiling data allowed precise determination of translated reading frames and revealed several translated short open reading frames upstream of, or embedded within, known virus protein-coding regions. Ribosome pause sites were identified in the virus replicase polyprotein pp1a ORF and investigated experimentally. Contrary to expectations, ribosomes were not found to pause at the

  1. Replication and meiotic transmission of yeast ribosomal RNA genes.

    Science.gov (United States)

    Brewer, B J; Zakian, V A; Fangman, W L

    1980-11-01

    The yeast Saccharomyces cerevisiae has approximately 120 genes for the ribosomal RNAs (rDNA) which are organized in tandem within chromosomal DNA. These multiple-copy genes are homogeneous in sequence but can undergo changes in copy number and topology. To determine if these changes reflect unusual features of rDNA metabolism, we have examined both the replication of rDNA in the mitotic cell cycle and the inheritance of rDNA during meiosis. The results indicate that rDNA behaves identically to chromosomal DNA: each rDNA unit is replicated once during the S phase of each cell cycle and each unit is conserved through meiosis. Therefore, the flexibility in copy number and topology of rDNA does not arise from the selective replication of units in each S phase nor by the selective inheritance of units in meiosis.

  2. Assessing the 5S ribosomal RNA heterogeneity in Arabidopsis thaliana using short RNA next generation sequencing data.

    Science.gov (United States)

    Szymanski, Maciej; Karlowski, Wojciech M

    2016-01-01

    In eukaryotes, ribosomal 5S rRNAs are products of multigene families organized within clusters of tandemly repeated units. Accumulation of genomic data obtained from a variety of organisms demonstrated that the potential 5S rRNA coding sequences show a large number of variants, often incompatible with folding into a correct secondary structure. Here, we present results of an analysis of a large set of short RNA sequences generated by the next generation sequencing techniques, to address the problem of heterogeneity of the 5S rRNA transcripts in Arabidopsis and identification of potentially functional rRNA-derived fragments.

  3. The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus.

    Science.gov (United States)

    Hori, H; Osawa, S; Murao, K; Ishikura, H

    1980-01-01

    The nucleotide sequence of ribosomal 5S RNA from Micrococcus lysodeikticus is pGUUACGGCGGCUAUAGCGUGGGGGAAACGCCCGGCCGUAUAUCGAACCCGGAAGCUAAGCCCCAUAGCGCCGAUGGUUACUGUAACCGGGAGGUUGUGGGAGAGUAGGUCGCCGCCGUGAOH. When compared to other 5S RNAs, the sequence homology is greatest with Thermus aquaticus, and these two 5S RNAs reveal several features intermediate between those of typical gram-positive bacteria and gram-negative bacteria. PMID:6780979

  4. Analysis of Pteridium ribosomal RNA sequences by rapid direct sequencing.

    Science.gov (United States)

    Tan, M K

    1991-08-01

    A total of 864 bases from 5 regions interspersed in the 18S and 26S rRNA molecules from various clones of Pteridium covering the general geographical distribution of the genus was analysed using a rapid rRNA sequencing technique. No base difference has been detected amongst the three major lineages, two of which apparently separated before the breakup of the ancient supercontinent, Pangaea. These regions of the rRNA sequences have thus been conserved for at least 160 million years and are here compared with other eukaryotic, especially plant rRNAs.

  5. Can we estimate bacterial growth rates from ribosomal RNA content?

    Energy Technology Data Exchange (ETDEWEB)

    Kemp, P.F.

    1995-12-31

    Several studies have demonstrated a strong relationship between the quantity of RNA in bacterial cells and their growth rate under laboratory conditions. It may be possible to use this relationship to provide information on the activity of natural bacterial communities, and in particular on growth rate. However, if this approach is to provide reliably interpretable information, the relationship between RNA content and growth rate must be well-understood. In particular, a requisite of such applications is that the relationship must be universal among bacteria, or alternately that the relationship can be determined and measured for specific bacterial taxa. The RNA-growth rate relationship has not been used to evaluate bacterial growth in field studies, although RNA content has been measured in single cells and in bulk extracts of field samples taken from coastal environments. These measurements have been treated as probable indicators of bacterial activity, but have not yet been interpreted as estimators of growth rate. The primary obstacle to such interpretations is a lack of information on biological and environmental factors that affect the RNA-growth rate relationship. In this paper, the available data on the RNA-growth rate relationship in bacteria will be reviewed, including hypotheses regarding the regulation of RNA synthesis and degradation as a function of growth rate and environmental factors; i.e. the basic mechanisms for maintaining RNA content in proportion to growth rate. An assessment of the published laboratory and field data, the current status of this research area, and some of the remaining questions will be presented.

  6. Revealing stable processing products from ribosome-associated small RNAs by deep-sequencing data analysis.

    Science.gov (United States)

    Zywicki, Marek; Bakowska-Zywicka, Kamilla; Polacek, Norbert

    2012-05-01

    The exploration of the non-protein-coding RNA (ncRNA) transcriptome is currently focused on profiling of microRNA expression and detection of novel ncRNA transcription units. However, recent studies suggest that RNA processing can be a multi-layer process leading to the generation of ncRNAs of diverse functions from a single primary transcript. Up to date no methodology has been presented to distinguish stable functional RNA species from rapidly degraded side products of nucleases. Thus the correct assessment of widespread RNA processing events is one of the major obstacles in transcriptome research. Here, we present a novel automated computational pipeline, named APART, providing a complete workflow for the reliable detection of RNA processing products from next-generation-sequencing data. The major features include efficient handling of non-unique reads, detection of novel stable ncRNA transcripts and processing products and annotation of known transcripts based on multiple sources of information. To disclose the potential of APART, we have analyzed a cDNA library derived from small ribosome-associated RNAs in Saccharomyces cerevisiae. By employing the APART pipeline, we were able to detect and confirm by independent experimental methods multiple novel stable RNA molecules differentially processed from well known ncRNAs, like rRNAs, tRNAs or snoRNAs, in a stress-dependent manner.

  7. Eigenvectors determination of the ribosome dynamics model during mRNA translation using the Kleene Star algorithm

    Science.gov (United States)

    Ernawati; Carnia, E.; Supriatna, A. K.

    2018-03-01

    Eigenvalues and eigenvectors in max-plus algebra have the same important role as eigenvalues and eigenvectors in conventional algebra. In max-plus algebra, eigenvalues and eigenvectors are useful for knowing dynamics of the system such as in train system scheduling, scheduling production systems and scheduling learning activities in moving classes. In the translation of proteins in which the ribosome move uni-directionally along the mRNA strand to recruit the amino acids that make up the protein, eigenvalues and eigenvectors are used to calculate protein production rates and density of ribosomes on the mRNA. Based on this, it is important to examine the eigenvalues and eigenvectors in the process of protein translation. In this paper an eigenvector formula is given for a ribosome dynamics during mRNA translation by using the Kleene star algorithm in which the resulting eigenvector formula is simpler and easier to apply to the system than that introduced elsewhere. This paper also discusses the properties of the matrix {B}λ \\otimes n of model. Among the important properties, it always has the same elements in the first column for n = 1, 2,… if the eigenvalue is the time of initiation, λ = τin , and the column is the eigenvector of the model corresponding to λ.

  8. The CRM domain: an RNA binding module derived from an ancient ribosome-associated protein.

    Science.gov (United States)

    Barkan, Alice; Klipcan, Larik; Ostersetzer, Oren; Kawamura, Tetsuya; Asakura, Yukari; Watkins, Kenneth P

    2007-01-01

    The CRS1-YhbY domain (also called the CRM domain) is represented as a stand-alone protein in Archaea and Bacteria, and in a family of single- and multidomain proteins in plants. The function of this domain is unknown, but structural data and the presence of the domain in several proteins known to interact with RNA have led to the proposal that it binds RNA. Here we describe a phylogenetic analysis of the domain, its incorporation into diverse proteins in plants, and biochemical properties of a prokaryotic and eukaryotic representative of the domain family. We show that a bacterial member of the family, Escherichia coli YhbY, is associated with pre-50S ribosomal subunits, suggesting that YhbY functions in ribosome assembly. GFP fused to a single-domain CRM protein from maize localizes to the nucleolus, suggesting that an analogous activity may have been retained in plants. We show further that an isolated maize CRM domain has RNA binding activity in vitro, and that a small motif shared with KH RNA binding domains, a conserved "GxxG" loop, contributes to its RNA binding activity. These and other results suggest that the CRM domain evolved in the context of ribosome function prior to the divergence of Archaea and Bacteria, that this function has been maintained in extant prokaryotes, and that the domain was recruited to serve as an RNA binding module during the evolution of plant genomes.

  9. Structural and functional implications in the eubacterial ribosome as revealed by protein-rRNA and antibiotic contact sites.

    Science.gov (United States)

    Wittmann-Liebold, B; Uhlein, M; Urlaub, H; Müller, E C; Otto, A; Bischof, O

    1995-01-01

    Contact sites between protein and rRNA in 30S and 50S ribosomal subunits of Escherichia coli and Bacillus stearothermophilus were investigated at the molecular level using UV and 2-iminothiolane as cross-linkers. Thirteen ribosomal proteins (S3, S4, S7, S14, S17, L2, L4, L6, L14, L27, L28, L29, and L36) from these organisms were cross-linked in direct contact with the RNAs, and the peptide stretches as well as amino acids involved were identified. Further, the binding sites of puromycin and spiramycin were established at the peptide level in several proteins that were found to constitute the antibiotic-binding sites. Peptide stretches of puromycin binding were identified from proteins S7, S14, S18, L18, AND L29; those of spiramycin attachment were derived from proteins S12, S14, L17, L18, L27, and L35. Comparison of the RNA-peptide contact sites with the peptides identified for antibiotic binding and with those altered in antibiotic-resistant mutants clearly showed identical peptide areas to be involved and, hence, demonstrated the functional importance of these peptides. Further evidence for a functional implication of ribosomal proteins in the translational process came from complementation experiments in which protein L2 from Halobacterium marismortui was incorporated into the E. coli ribosomes that were active. The incorporated protein was present in 50S subunits and 70S particles, in disomes, and in higher polysomes. These results clearly demonstrate the functional implication of protein L2 in protein biosynthesis. Incorporation studies with a mutant of HmaL2 with a replacement of histidine-229 by glycine completely abolished the functional activity of the ribosome. Accordingly, protein L2 with histidine-229 is a crucial element of the translational machinery.

  10. Validation of two ribosomal RNA removal methods for microbial metatranscriptomics

    Energy Technology Data Exchange (ETDEWEB)

    He, Shaomei; Wurtzel, Omri; Singh, Kanwar; Froula, Jeff L; Yilmaz, Suzan; Tringe, Susannah G; Wang, Zhong; Chen, Feng; Lindquist, Erika A; Sorek, Rotem; Hugenholtz, Philip

    2010-10-01

    The predominance of rRNAs in the transcriptome is a major technical challenge in sequence-based analysis of cDNAs from microbial isolates and communities. Several approaches have been applied to deplete rRNAs from (meta)transcriptomes, but no systematic investigation of potential biases introduced by any of these approaches has been reported. Here we validated the effectiveness and fidelity of the two most commonly used approaches, subtractive hybridization and exonuclease digestion, as well as combinations of these treatments, on two synthetic five-microorganism metatranscriptomes using massively parallel sequencing. We found that the effectiveness of rRNA removal was a function of community composition and RNA integrity for these treatments. Subtractive hybridization alone introduced the least bias in relative transcript abundance, whereas exonuclease and in particular combined treatments greatly compromised mRNA abundance fidelity. Illumina sequencing itself also can compromise quantitative data analysis by introducing a G+C bias between runs.

  11. Reconstruction of ribosomal RNA genes from metagenomic data.

    Directory of Open Access Journals (Sweden)

    Lu Fan

    Full Text Available Direct sequencing of environmental DNA (metagenomics has a great potential for describing the 16S rRNA gene diversity of microbial communities. However current approaches using this 16S rRNA gene information to describe community diversity suffer from low taxonomic resolution or chimera problems. Here we describe a new strategy that involves stringent assembly and data filtering to reconstruct full-length 16S rRNA genes from metagenomicpyrosequencing data. Simulations showed that reconstructed 16S rRNA genes provided a true picture of the community diversity, had minimal rates of chimera formation and gave taxonomic resolution down to genus level. The strategy was furthermore compared to PCR-based methods to determine the microbial diversity in two marine sponges. This showed that about 30% of the abundant phylotypes reconstructed from metagenomic data failed to be amplified by PCR. Our approach is readily applicable to existing metagenomic datasets and is expected to lead to the discovery of new microbial phylotypes.

  12. Biological significance of 5S rRNA import into human mitochondria: role of ribosomal protein MRP-L18

    Science.gov (United States)

    Smirnov, Alexandre; Entelis, Nina; Martin, Robert P.; Tarassov, Ivan

    2011-01-01

    5S rRNA is an essential component of ribosomes of all living organisms, the only known exceptions being mitochondrial ribosomes of fungi, animals, and some protists. An intriguing situation distinguishes mammalian cells: Although the mitochondrial genome contains no 5S rRNA genes, abundant import of the nuclear DNA-encoded 5S rRNA into mitochondria was reported. Neither the detailed mechanism of this pathway nor its rationale was clarified to date. In this study, we describe an elegant molecular conveyor composed of a previously identified human 5S rRNA import factor, rhodanese, and mitochondrial ribosomal protein L18, thanks to which 5S rRNA molecules can be specifically withdrawn from the cytosolic pool and redirected to mitochondria, bypassing the classic nucleolar reimport pathway. Inside mitochondria, the cytosolic 5S rRNA is shown to be associated with mitochondrial ribosomes. PMID:21685364

  13. Ribosomal RNA gene sequences confirm that protistan endoparasite of larval cod Gadus morhua is Ichthyodinium sp

    DEFF Research Database (Denmark)

    Skovgaard, Alf; Meyer, Stefan; Overton, Julia Lynne

    2010-01-01

    An enigmatic protistan endoparasite found in eggs and larvae of cod Gadus morhua and turbot Psetta maxima was isolated from Baltic cod larvae, and DNA was extracted for sequencing of the parasite's small Subunit ribosomal RNA (SSU rRNA) gene. The endoparasite has previously been suggested...... to be related to Ichthyodinium chabelardi, a dinoflagellate-like protist that parasitizes yolk sacs of embryos and larvae of a variety of fish species. Comparison of a 1535 bp long fragment of the SSU rRNA gene of the cod endoparasite showed absolute identify with I. chabelardi, demonstrating that the 2...

  14. Dwell-Time Distribution, Long Pausing and Arrest of Single-Ribosome Translation through the mRNA Duplex.

    Science.gov (United States)

    Xie, Ping

    2015-10-09

    Proteins in the cell are synthesized by a ribosome translating the genetic information encoded on the single-stranded messenger RNA (mRNA). It has been shown that the ribosome can also translate through the duplex region of the mRNA by unwinding the duplex. Here, based on our proposed model of the ribosome translation through the mRNA duplex we study theoretically the distribution of dwell times of the ribosome translation through the mRNA duplex under the effect of a pulling force externally applied to the ends of the mRNA to unzip the duplex. We provide quantitative explanations of the available single molecule experimental data on the distribution of dwell times with both short and long durations, on rescuing of the long paused ribosomes by raising the pulling force to unzip the duplex, on translational arrests induced by the mRNA duplex and Shine-Dalgarno(SD)-like sequence in the mRNA. The functional consequences of the pauses or arrests caused by the mRNA duplex and the SD sequence are discussed and compared with those obtained from other types of pausing, such as those induced by "hungry" codons or interactions of specific sequences in the nascent chain with the ribosomal exit tunnel.

  15. Fragmentation of the large subunit ribosomal RNA gene in oyster mitochondrial genomes

    Directory of Open Access Journals (Sweden)

    Milbury Coren A

    2010-09-01

    Full Text Available Abstract Background Discontinuous genes have been observed in bacteria, archaea, and eukaryotic nuclei, mitochondria and chloroplasts. Gene discontinuity occurs in multiple forms: the two most frequent forms result from introns that are spliced out of the RNA and the resulting exons are spliced together to form a single transcript, and fragmented gene transcripts that are not covalently attached post-transcriptionally. Within the past few years, fragmented ribosomal RNA (rRNA genes have been discovered in bilateral metazoan mitochondria, all within a group of related oysters. Results In this study, we have characterized this fragmentation with comparative analysis and experimentation. We present secondary structures, modeled using comparative sequence analysis of the discontinuous mitochondrial large subunit rRNA genes of the cupped oysters C. virginica, C. gigas, and C. hongkongensis. Comparative structure models for the large subunit rRNA in each of the three oyster species are generally similar to those for other bilateral metazoans. We also used RT-PCR and analyzed ESTs to determine if the two fragmented LSU rRNAs are spliced together. The two segments are transcribed separately, and not spliced together although they still form functional rRNAs and ribosomes. Conclusions Although many examples of discontinuous ribosomal genes have been documented in bacteria and archaea, as well as the nuclei, chloroplasts, and mitochondria of eukaryotes, oysters are some of the first characterized examples of fragmented bilateral animal mitochondrial rRNA genes. The secondary structures of the oyster LSU rRNA fragments have been predicted on the basis of previous comparative metazoan mitochondrial LSU rRNA structure models.

  16. Translational regulation of ribosomal protein S15 drives characteristic patterns of protein-mRNA epistasis.

    Science.gov (United States)

    Mallik, Saurav; Basu, Sudipto; Hait, Suman; Kundu, Sudip

    2018-04-21

    Do coding and regulatory segments of a gene co-evolve with each-other? Seeking answers to this question, here we analyze the case of Escherichia coli ribosomal protein S15, that represses its own translation by specifically binding its messenger RNA (rpsO mRNA) and stabilizing a pseudoknot structure at the upstream untranslated region, thus trapping the ribosome into an incomplete translation initiation complex. In the absence of S15, ribosomal protein S1 recognizes rpsO and promotes translation by melting this very pseudoknot. We employ a robust statistical method to detect signatures of positive epistasis between residue site pairs and find that biophysical constraints of translational regulation (S15-rpsO and S1-rpsO recognition, S15-mediated rpsO structural rearrangement, and S1-mediated melting) are strong predictors of positive epistasis. Transforming the epistatic pairs into a network, we find that signatures of two different, but interconnected regulatory cascades are imprinted in the sequence-space and can be captured in terms of two dense network modules that are sparsely connected to each other. This network topology further reflects a general principle of how functionally coupled components of biological networks are interconnected. These results depict a model case, where translational regulation drives characteristic residue-level epistasis-not only between a protein and its own mRNA but also between a protein and the mRNA of an entirely different protein. © 2018 Wiley Periodicals, Inc.

  17. Expedited quantification of mutant ribosomal RNA by binary deoxyribozyme (BiDz) sensors.

    Science.gov (United States)

    Gerasimova, Yulia V; Yakovchuk, Petro; Dedkova, Larisa M; Hecht, Sidney M; Kolpashchikov, Dmitry M

    2015-10-01

    Mutations in ribosomal RNA (rRNA) have traditionally been detected by the primer extension assay, which is a tedious and multistage procedure. Here, we describe a simple and straightforward fluorescence assay based on binary deoxyribozyme (BiDz) sensors. The assay uses two short DNA oligonucleotides that hybridize specifically to adjacent fragments of rRNA, one of which contains a mutation site. This hybridization results in the formation of a deoxyribozyme catalytic core that produces the fluorescent signal and amplifies it due to multiple rounds of catalytic action. This assay enables us to expedite semi-quantification of mutant rRNA content in cell cultures starting from whole cells, which provides information useful for optimization of culture preparation prior to ribosome isolation. The method requires less than a microliter of a standard Escherichia coli cell culture and decreases analysis time from several days (for primer extension assay) to 1.5 h with hands-on time of ∼10 min. It is sensitive to single-nucleotide mutations. The new assay simplifies the preliminary analysis of RNA samples and cells in molecular biology and cloning experiments and is promising in other applications where fast detection/quantification of specific RNA is required. © 2015 Gerasimova et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  18. Distribution of protein and RNA in the 30S ribosomal subunit

    International Nuclear Information System (INIS)

    Ramakrishnan, V.

    1986-01-01

    In Escherichia coli, the small ribosomal subunit has a sedimentation coefficient of 30S, and consists of a 16S RNA molecule of 1541 nucleotides complexed with 21 proteins. Over the last few years, a controversy has emerged regarding the spatial distribution of RNA and protein in the 30S subunit. Contrast variation with neutron scattering was used to suggest that the RNA was located in a central core of the subunit and the proteins mainly in the periphery, with virtually no separation between the centers of mass of protein and RNA. However, these findings are incompatible with the results of efforts to locate individual ribosomal proteins by immune electron microscopy and triangulation with interprotein distance measurements. The conflict between these two views is resolved in this report of small-angle neutron scattering measurements on 30S subunits with and without protein S1, and on subunits reconstituted from deuterated 16S RNA and unlabeled proteins. The results show that (i) the proteins and RNA are intermingled, with neither component dominating at the core or the periphery, and (ii) the spatial distribution of protein and RNA is asymmetrical, with a separation between their centers of mass of about 25 angstroms

  19. Novel mRNA-specific effects of ribosome drop-off on translation rate and polysome profile.

    Directory of Open Access Journals (Sweden)

    Pierre Bonnin

    2017-05-01

    Full Text Available The well established phenomenon of ribosome drop-off plays crucial roles in translational accuracy and nutrient starvation responses during protein translation. When cells are under stress conditions, such as amino acid starvation or aminoacyl-tRNA depletion due to a high level of recombinant protein expression, ribosome drop-off can substantially affect the efficiency of protein expression. Here we introduce a mathematical model that describes the effects of ribosome drop-off on the ribosome density along the mRNA and on the concomitant protein synthesis rate. Our results show that ribosome premature termination may lead to non-intuitive ribosome density profiles, such as a ribosome density which increases from the 5' to the 3' end. Importantly, the model predicts that the effects of ribosome drop-off on the translation rate are mRNA-specific, and we quantify their resilience to drop-off, showing that the mRNAs which present ribosome queues are much less affected by ribosome drop-off than those which do not. Moreover, among those mRNAs that do not present ribosome queues, resilience to drop-off correlates positively with the elongation rate, so that sequences using fast codons are expected to be less affected by ribosome drop-off. This result is consistent with a genome-wide analysis of S. cerevisiae, which reveals that under favourable growth conditions mRNAs coding for proteins involved in the translation machinery, known to be highly codon biased and using preferentially fast codons, are highly resilient to ribosome drop-off. Moreover, in physiological conditions, the translation rate of mRNAs coding for regulatory, stress-related proteins, is less resilient to ribosome drop-off. This model therefore allows analysis of variations in the translational efficiency of individual mRNAs by accounting for the full range of known ribosome behaviours, as well as explaining mRNA-specific variations in ribosome density emerging from ribosome profiling

  20. Nuclear Export of Pre-Ribosomal Subunits Requires Dbp5, but Not as an RNA-Helicase as for mRNA Export.

    Science.gov (United States)

    Neumann, Bettina; Wu, Haijia; Hackmann, Alexandra; Krebber, Heike

    2016-01-01

    The DEAD-box RNA-helicase Dbp5/Rat8 is known for its function in nuclear mRNA export, where it displaces the export receptor Mex67 from the mRNA at the cytoplasmic side of the nuclear pore complex (NPC). Here we show that Dbp5 is also required for the nuclear export of both pre-ribosomal subunits. Yeast temperature-sensitive dbp5 mutants accumulate both ribosomal particles in their nuclei. Furthermore, Dbp5 genetically and physically interacts with known ribosomal transport factors such as Nmd3. Similar to mRNA export we show that also for ribosomal transport Dbp5 is required at the cytoplasmic side of the NPC. However, unlike its role in mRNA export, Dbp5 does not seem to undergo its ATPase cycle for this function, as ATPase-deficient dbp5 mutants that selectively inhibit mRNA export do not affect ribosomal transport. Furthermore, mutants of GLE1, the ATPase stimulating factor of Dbp5, show no major ribosomal export defects. Consequently, while Dbp5 uses its ATPase cycle to displace the export receptor Mex67 from the translocated mRNAs, Mex67 remains bound to ribosomal subunits upon transit to the cytoplasm, where it is detectable on translating ribosomes. Therefore, we propose a model, in which Dbp5 supports ribosomal transport by capturing ribosomal subunits upon their cytoplasmic appearance at the NPC, possibly by binding export factors such as Mex67. Thus, our findings reveal that although different ribonucleoparticles, mRNAs and pre-ribosomal subunits, use shared export factors, they utilize different transport mechanisms.

  1. Affinity labelling of ribosomes from the livers of different vertebrates by 2-nitro-4-azidobenzoyl-Phe-tRNA

    International Nuclear Information System (INIS)

    Stahl, J.; Boehm, H.; Voderberg, M.

    1981-01-01

    Ribosomal protein L 10 from the livers of trout, hen, and rat was found to be the main target for 2-nitro-4-azidobenzoyl-Phe-tRNA in affinity labelling experiments. Therefore, despite somewhat different electrophoretic mobilities, this protein seems to be involved in the organization of the peptidyl transferase centre in ribosomes of various vertebrates. (author)

  2. In situ DNA-RNA hybridization using in vitro 125I-labeled ribosomal RNA of higher plant

    International Nuclear Information System (INIS)

    Sato, Seiichi; Kikuchi, Tadatoshi; Ishida, M.R.; Tanaka, Ryuso.

    1975-01-01

    In situ hybridization using 125 I-labeled ribosomal RNA was applied to plant cells. Cytoplasmic 25 s rRNA, which was eluted from acrylamide gels after electrophoretic separation, was labeled in vitro with carrier-free 125 I and hybridized with the interphase nuclei in root tips of Vicia faba. In most of the preparations, the nucleoli were more heavily labeled than the other regions within nuclei, and several types of grain distribution were observed on the nucleoli. From these results, it was confirmed that in situ hybridization using 125 I-labeled rRNA can be used very effectively to detect the annealing sites of different molecular species of rRNA within the nuclei of plant cells, for which it is not as easy to obtain high specific radioactive rRNA in vivo as it is in the case of cultured animal cells. (auth.)

  3. Chromatin structure of ribosomal RNA genes in dipterans and its relationship to the location of nucleolar organizers.

    Science.gov (United States)

    Madalena, Christiane Rodriguez Gutierrez; Díez, José Luís; Gorab, Eduardo

    2012-01-01

    Nucleoli, nuclear organelles in which ribosomal RNA is synthesized and processed, emerge from nucleolar organizers (NORs) located in distinct chromosomal regions. In polytene nuclei of dipterans, nucleoli of some species can be observed under light microscopy exhibiting distinctive morphology: Drosophila and chironomid species display well-formed nucleoli in contrast to the fragmented and dispersed nucleoli seen in sciarid flies. The available data show no apparent relationship between nucleolar morphology and location of NORs in Diptera. The regulation of rRNA transcription involves controlling both the transcription rate per gene as well as the proportion of rRNA genes adopting a proper chromatin structure for transcription, since active and inactive rRNA gene copies coexist in NORs. Transcription units organized in nucleosomes and those lacking canonical nucleosomes can be analyzed by the method termed psoralen gel retarding assay (PGRA), allowing inferences on the ratio of active to inactive rRNA gene copies. In this work, possible connections between chromosomal location of NORs and proportion of active rRNA genes were studied in Drosophila melanogaster, and in chironomid and sciarid species. The data suggested a link between location of NORs and proportion of active rRNA genes since the copy number showing nucleosomal organization predominates when NORs are located in the pericentric heterochromatin. The results presented in this work are in agreement with previous data on the chromatin structure of rRNA genes from distantly related eukaryotes, as assessed by the PGRA.

  4. Chromatin structure of ribosomal RNA genes in dipterans and its relationship to the location of nucleolar organizers.

    Directory of Open Access Journals (Sweden)

    Christiane Rodriguez Gutierrez Madalena

    Full Text Available Nucleoli, nuclear organelles in which ribosomal RNA is synthesized and processed, emerge from nucleolar organizers (NORs located in distinct chromosomal regions. In polytene nuclei of dipterans, nucleoli of some species can be observed under light microscopy exhibiting distinctive morphology: Drosophila and chironomid species display well-formed nucleoli in contrast to the fragmented and dispersed nucleoli seen in sciarid flies. The available data show no apparent relationship between nucleolar morphology and location of NORs in Diptera. The regulation of rRNA transcription involves controlling both the transcription rate per gene as well as the proportion of rRNA genes adopting a proper chromatin structure for transcription, since active and inactive rRNA gene copies coexist in NORs. Transcription units organized in nucleosomes and those lacking canonical nucleosomes can be analyzed by the method termed psoralen gel retarding assay (PGRA, allowing inferences on the ratio of active to inactive rRNA gene copies. In this work, possible connections between chromosomal location of NORs and proportion of active rRNA genes were studied in Drosophila melanogaster, and in chironomid and sciarid species. The data suggested a link between location of NORs and proportion of active rRNA genes since the copy number showing nucleosomal organization predominates when NORs are located in the pericentric heterochromatin. The results presented in this work are in agreement with previous data on the chromatin structure of rRNA genes from distantly related eukaryotes, as assessed by the PGRA.

  5. Replicative age induces mitotic recombination in the ribosomal RNA gene cluster of Saccharomyces cerevisiae.

    Directory of Open Access Journals (Sweden)

    Derek L Lindstrom

    2011-03-01

    Full Text Available Somatic mutations contribute to the development of age-associated disease. In earlier work, we found that, at high frequency, aging Saccharomyces cerevisiae diploid cells produce daughters without mitochondrial DNA, leading to loss of respiration competence and increased loss of heterozygosity (LOH in the nuclear genome. Here we used the recently developed Mother Enrichment Program to ask whether aging cells that maintain the ability to produce respiration-competent daughters also experience increased genomic instability. We discovered that this population exhibits a distinct genomic instability phenotype that primarily affects the repeated ribosomal RNA gene array (rDNA array. As diploid cells passed their median replicative life span, recombination rates between rDNA arrays on homologous chromosomes progressively increased, resulting in mutational events that generated LOH at >300 contiguous open reading frames on the right arm of chromosome XII. We show that, while these recombination events were dependent on the replication fork block protein Fob1, the aging process that underlies this phenotype is Fob1-independent. Furthermore, we provide evidence that this aging process is not driven by mechanisms that modulate rDNA recombination in young cells, including loss of cohesion within the rDNA array or loss of Sir2 function. Instead, we suggest that the age-associated increase in rDNA recombination is a response to increasing DNA replication stress generated in aging cells.

  6. Promoter-wide hypermethylation of the ribosomal RNA gene promoter in the suicide brain.

    Directory of Open Access Journals (Sweden)

    Patrick O McGowan

    Full Text Available BACKGROUND: Alterations in gene expression in the suicide brain have been reported and for several genes DNA methylation as an epigenetic regulator is thought to play a role. rRNA genes, that encode ribosomal RNA, are the backbone of the protein synthesis machinery and levels of rRNA gene promoter methylation determine rRNA transcription. METHODOLOGY/PRINCIPAL FINDINGS: We test here by sodium bisulfite mapping of the rRNA promoter and quantitative real-time PCR of rRNA expression the hypothesis that epigenetic differences in critical loci in the brain are involved in the pathophysiology of suicide. Suicide subjects in this study were selected for a history of early childhood neglect/abuse, which is associated with decreased hippocampal volume and cognitive impairments. rRNA was significantly hypermethylated throughout the promoter and 5' regulatory region in the brain of suicide subjects, consistent with reduced rRNA expression in the hippocampus. This difference in rRNA methylation was not evident in the cerebellum and occurred in the absence of genome-wide changes in methylation, as assessed by nearest neighbor. CONCLUSIONS/SIGNIFICANCE: This is the first study to show aberrant regulation of the protein synthesis machinery in the suicide brain. The data implicate the epigenetic modulation of rRNA in the pathophysiology of suicide.

  7. Cell Death-Associated Ribosomal RNA Cleavage in Postmortem Tissues and Its Forensic Applications.

    Science.gov (United States)

    Kim, Ji Yeon; Kim, Yunmi; Cha, Hyo Kyeong; Lim, Hye Young; Kim, Hyungsub; Chung, Sooyoung; Hwang, Juck-Joon; Park, Seong Hwan; Son, Gi Hoon

    2017-06-30

    Estimation of postmortem interval (PMI) is a key issue in the field of forensic pathology. With the availability of quantitative analysis of RNA levels in postmortem tissues, several studies have assessed the postmortem degradation of constitutively expressed RNA species to estimate PMI. However, conventional RNA quantification as well as biochemical and physiological changes employed thus far have limitations related to standardization or normalization. The present study focuses on an interesting feature of the subdomains of certain RNA species, in which they are site-specifically cleaved during apoptotic cell death. We found that the D8 divergent domain of ribosomal RNA (rRNA) bearing cell death-related cleavage sites was rapidly removed during postmortem RNA degradation. In contrast to the fragile domain, the 5' terminal region of 28S rRNA was remarkably stable during the postmortem period. Importantly, the differences in the degradation rates between the two domains in mammalian 28S rRNA were highly proportional to increasing PMI with a significant linear correlation observed in mice as well as human autopsy tissues. In conclusion, we demonstrate that comparison of the degradation rates between domains of a single RNA species provides quantitative information on postmortem degradation states, which can be applied for the estimation of PMI.

  8. The pre-existing population of 5S rRNA effects p53 stabilization during ribosome biogenesis inhibition.

    Science.gov (United States)

    Onofrillo, Carmine; Galbiati, Alice; Montanaro, Lorenzo; Derenzini, Massimo

    2017-01-17

    Pre-ribosomal complex RPL5/RPL11/5S rRNA (5S RNP) is considered the central MDM2 inhibitory complex that control p53 stabilization during ribosome biogenesis inhibition. Despite its role is well defined, the dynamic of 5S RNP assembly still requires further characterization. In the present work, we report that MDM2 inhibition is dependent by a pre-existing population of 5S rRNA.

  9. Improved Ribosome-Footprint and mRNA Measurements Provide Insights into Dynamics and Regulation of Yeast Translation

    Science.gov (United States)

    2016-02-11

    unlimited. Improved Ribosome-Footprint and mRNA Measurements Provide Insights into Dynamics and Regulation of Yeast Translation The views, opinions and...into Dynamics and Regulation of Yeast Translation Report Title Ribosome-footprint profiling provides genome-wide snapshots of translation, but...tend to slow translation. With the improved mRNA measurements, the variation attributable to translational control in exponentially growing yeast was

  10. Activation of ribosomal RNA genes in porcine embryos produced in vitro or by somatic cell nuclear transfer

    DEFF Research Database (Denmark)

    Bjerregaard, Bolette; Pedersen, Hanne Gervi; Jakobsen, Anne Sørig

    2007-01-01

    The onset of ribosomal RNA (rRNA) synthesis occurs during the second half of the third cell cycle, that is, at the four-cell stage, in porcine embryos developed in vivo. In the present study the onset of rRNA synthesis was investigated in porcine embryos produced in vitro (IVP) or by somatic cell...

  11. 18S Ribosomal RNA Evaluation as Preanalytical Quality Control for Animal DNA

    Directory of Open Access Journals (Sweden)

    Cory Ann Leonard

    2016-01-01

    Full Text Available The 18S ribosomal RNA (rRNA gene is present in all eukaryotic cells. In this study, we evaluated the use of this gene to verify the presence of PCR-amplifiable host (animal DNA as an indicator of sufficient sample quality for quantitative real-time PCR (qPCR analysis. We compared (i samples from various animal species, tissues, and sample types, including swabs; (ii multiple DNA extraction methods; and (iii both fresh and formalin-fixed paraffin-embedded (FFPE samples. Results showed that 18S ribosomal RNA gene amplification was possible from all tissue samples evaluated, including avian, reptile, and FFPE samples and most swab samples. A single swine rectal swab, which showed sufficient DNA quantity and the demonstrated lack of PCR inhibitors, nonetheless was negative by 18S qPCR. Such a sample specifically illustrates the improvement of determination of sample integrity afforded by inclusion of 18S rRNA gene qPCR analysis in addition to spectrophotometric analysis and the use of internal controls for PCR inhibition. Other possible applications for the described 18S rRNA qPCR are preselection of optimal tissue specimens for studies or preliminary screening of archived samples prior to acceptance for biobanking projects.

  12. Highly divergent 16S rRNA sequences in ribosomal operons of Scytonema hyalinum (Cyanobacteria.

    Directory of Open Access Journals (Sweden)

    Jeffrey R Johansen

    Full Text Available A highly divergent 16S rRNA gene was found in one of the five ribosomal operons present in a species complex currently circumscribed as Scytonema hyalinum (Nostocales, Cyanobacteria using clone libraries. If 16S rRNA sequence macroheterogeneity among ribosomal operons due to insertions, deletions or truncation is excluded, the sequence heterogeneity observed in S. hyalinum was the highest observed in any prokaryotic species thus far (7.3-9.0%. The secondary structure of the 16S rRNA molecules encoded by the two divergent operons was nearly identical, indicating possible functionality. The 23S rRNA gene was examined for a few strains in this complex, and it was also found to be highly divergent from the gene in Type 2 operons (8.7%, and likewise had nearly identical secondary structure between the Type 1 and Type 2 operons. Furthermore, the 16S-23S ITS showed marked differences consistent between operons among numerous strains. Both operons have promoter sequences that satisfy consensus requirements for functional prokaryotic transcription initiation. Horizontal gene transfer from another unknown heterocytous cyanobacterium is considered the most likely explanation for the origin of this molecule, but does not explain the ultimate origin of this sequence, which is very divergent from all 16S rRNA sequences found thus far in cyanobacteria. The divergent sequence is highly conserved among numerous strains of S. hyalinum, suggesting adaptive advantage and selective constraint of the divergent sequence.

  13. The AAA-ATPase NVL2 is a component of pre-ribosomal particles that interacts with the DExD/H-box RNA helicase DOB1

    International Nuclear Information System (INIS)

    Nagahama, Masami; Yamazoe, Takeshi; Hara, Yoshimitsu; Tani, Katsuko; Tsuji, Akihiko; Tagaya, Mitsuo

    2006-01-01

    Nuclear VCP/p97-like protein 2 (NVL2) is a member of the chaperone-like AAA-ATPase family with two conserved ATP-binding modules. Our previous studies have shown that NVL2 is localized to the nucleolus by interacting with ribosomal protein L5 and may participate in ribosome synthesis, a process involving various non-ribosomal factors including chaperones and RNA helicases. Here, we show that NVL2 is associated with pre-ribosomal particles in the nucleus. Moreover, we used yeast two-hybrid and co-immunoprecipitation assays to identify an NVL2-interacting protein that could yield insights into NVL2 function in ribosome biogenesis. We found that NVL2 interacts with DOB1, a DExD/H-box RNA helicase, whose yeast homologue functions in a late stage of the 60S subunit synthesis. DOB1 can interact with a second ATP-binding module mutant of NVL2, which shows a dominant negative effect on ribosome synthesis. In contrast, it cannot interact with a first ATP-binding module mutant, which does not show the dominant negative effect. When the dominant negative mutant of NVL2 was overexpressed in cells, DOB1 appeared to remain associated with nuclear pre-ribosomal particles. Such accumulation was not observed upon overexpression of wild-type NVL2 or a nondominant-negative mutant. Taken together, our results suggest that NVL2 might regulate the association/dissociation reaction of DOB1 with pre-ribosomal particles by acting as a molecular chaperone

  14. 5S Ribosomal RNA Is an Essential Component of a Nascent Ribosomal Precursor Complex that Regulates the Hdm2-p53 Checkpoint

    Directory of Open Access Journals (Sweden)

    Giulio Donati

    2013-07-01

    Full Text Available Recently, we demonstrated that RPL5 and RPL11 act in a mutually dependent manner to inhibit Hdm2 and stabilize p53 following impaired ribosome biogenesis. Given that RPL5 and RPL11 form a preribosomal complex with noncoding 5S ribosomal RNA (rRNA and the three have been implicated in the p53 response, we reasoned they may be part of an Hdm2-inhibitory complex. Here, we show that small interfering RNAs directed against 5S rRNA have no effect on total or nascent levels of the noncoding rRNA, though they prevent the reported Hdm4 inhibition of p53. To achieve efficient inhibition of 5S rRNA synthesis, we targeted TFIIIA, a specific RNA polymerase III cofactor, which, like depletion of either RPL5 or RPL11, did not induce p53. Instead, 5S rRNA acts in a dependent manner with RPL5 and RPL11 to inhibit Hdm2 and stabilize p53. Moreover, depletion of any one of the three components abolished the binding of the other two to Hdm2, explaining their common dependence. Finally, we demonstrate that the RPL5/RPL11/5S rRNA preribosomal complex is redirected from assembly into nascent 60S ribosomes to Hdm2 inhibition as a consequence of impaired ribosome biogenesis. Thus, the activation of the Hdm2-inhibitory complex is not a passive but a regulated event, whose potential role in tumor suppression has been recently noted.

  15. 5S ribosomal RNA is an essential component of a nascent ribosomal precursor complex that regulates the Hdm2-p53 checkpoint.

    Science.gov (United States)

    Donati, Giulio; Peddigari, Suresh; Mercer, Carol A; Thomas, George

    2013-07-11

    Recently, we demonstrated that RPL5 and RPL11 act in a mutually dependent manner to inhibit Hdm2 and stabilize p53 following impaired ribosome biogenesis. Given that RPL5 and RPL11 form a preribosomal complex with noncoding 5S ribosomal RNA (rRNA) and the three have been implicated in the p53 response, we reasoned they may be part of an Hdm2-inhibitory complex. Here, we show that small interfering RNAs directed against 5S rRNA have no effect on total or nascent levels of the noncoding rRNA, though they prevent the reported Hdm4 inhibition of p53. To achieve efficient inhibition of 5S rRNA synthesis, we targeted TFIIIA, a specific RNA polymerase III cofactor, which, like depletion of either RPL5 or RPL11, did not induce p53. Instead, 5S rRNA acts in a dependent manner with RPL5 and RPL11 to inhibit Hdm2 and stabilize p53. Moreover, depletion of any one of the three components abolished the binding of the other two to Hdm2, explaining their common dependence. Finally, we demonstrate that the RPL5/RPL11/5S rRNA preribosomal complex is redirected from assembly into nascent 60S ribosomes to Hdm2 inhibition as a consequence of impaired ribosome biogenesis. Thus, the activation of the Hdm2-inhibitory complex is not a passive but a regulated event, whose potential role in tumor suppression has been recently noted. Copyright © 2013 The Authors. Published by Elsevier Inc. All rights reserved.

  16. Mutations in ribosomal protein L3 and 23S ribosomal RNA at the peptidyl transferase centre are associated with reduced susceptibility to tiamulin in Brachyspira spp. isolates.

    Science.gov (United States)

    Pringle, Märit; Poehlsgaard, Jacob; Vester, Birte; Long, Katherine S

    2004-12-01

    The pleuromutilin antibiotic tiamulin binds to the ribosomal peptidyl transferase centre. Three groups of Brachyspira spp. isolates with reduced tiamulin susceptibility were analysed to define resistance mechanisms to the drug. Mutations were identified in genes encoding ribosomal protein L3 and 23S rRNA at positions proximal to the peptidyl transferase centre. In two groups of laboratory-selected mutants, mutations were found at nucleotide positions 2032, 2055, 2447, 2499, 2504 and 2572 of 23S rRNA (Escherichia coli numbering) and at amino acid positions 148 and 149 of ribosomal protein L3 (Brachyspira pilosicoli numbering). In a third group of clinical B. hyodysenteriae isolates, only a single mutation at amino acid 148 of ribosomal protein L3 was detected. Chemical footprinting experiments show a reduced binding of tiamulin to ribosomal subunits from mutants with decreased susceptibility to the drug. This reduction in drug binding is likely the resistance mechanism for these strains. Hence, the identified mutations located near the tiamulin binding site are predicted to be responsible for the resistance phenotype. The positions of the mutated residues relative to the bound drug advocate a model where the mutations affect tiamulin binding indirectly through perturbation of nucleotide U2504.

  17. Sequence characterization of 5S ribosomal RNA from eight gram positive procaryotes

    Science.gov (United States)

    Woese, C. R.; Luehrsen, K. R.; Pribula, C. D.; Fox, G. E.

    1976-01-01

    Complete nucleotide sequences are presented for 5S rRNA from Bacillus subtilis, B. firmus, B. pasteurii, B. brevis, Lactobacillus brevis, and Streptococcus faecalis, and 5S rRNA oligonucleotide catalogs and partial sequence data are given for B. cereus and Sporosarcina ureae. These data demonstrate a striking consistency of 5S rRNA primary and secondary structure within a given bacterial grouping. An exception is B. brevis, in which the 5S rRNA sequence varies significantly from that of other bacilli in the tuned helix and the procaryotic loop. The localization of these variations suggests that B. brevis occupies an ecological niche that selects such changes. It is noted that this organism produces antibiotics which affect ribosome function.

  18. Ribosomal RNA and nucleolar proteins from the oocyte are to some degree used for embryonic nucleolar formation in cattle and pig

    DEFF Research Database (Denmark)

    Maddox-Hyttel, Poul; Svarcova, Olga; Laurincik, Josef

    2007-01-01

    The nucleolus is the site of ribosomal RNA (rRNA) and ribosome production. In the bovine primordial follicle oocyte, this organelle is inactive, but in the secondary follicle an active fibrillo-granular nucleolus develops and proteins involved in rDNA transcription (topoisomerase I, RNA polymerase...... I and upstream binding factor) and early (fibrillarin) or late rRNA processing (nucleolin and nucleophosmin) localize to it. At the end of the oocyte growth phase, the nucleolus is inactivated again and transforms into a solid remnant. The nucleolar remnant is dissolved when meiosis is resumed. Upon...... fertilization, structures resembling the nucleolar remnant, now referred to as nucleolus precursor bodies (NPBs), are established in the pronuclei. These entities are engaged in the re-establishment of fibrilo-granular nucleoli at the major activation of the embryonic genome. This nucleolar formation can...

  19. Ribosomal proteins S12 and S13 function as control elements for translocation of the mRNA:tRNA complex.

    Science.gov (United States)

    Cukras, Anthony R; Southworth, Daniel R; Brunelle, Julie L; Culver, Gloria M; Green, Rachel

    2003-08-01

    Translocation of the mRNA:tRNA complex through the ribosome is promoted by elongation factor G (EF-G) during the translation cycle. Previous studies established that modification of ribosomal proteins with thiol-specific reagents promotes this event in the absence of EF-G. Here we identify two small subunit interface proteins S12 and S13 that are essential for maintenance of a pretranslocation state. Omission of these proteins using in vitro reconstitution procedures yields ribosomal particles that translate in the absence of enzymatic factors. Conversely, replacement of cysteine residues in these two proteins yields ribosomal particles that are refractive to stimulation with thiol-modifying reagents. These data support a model where S12 and S13 function as control elements for the more ancient rRNA- and tRNA-driven movements of translocation.

  20. SINA: accurate high-throughput multiple sequence alignment of ribosomal RNA genes.

    Science.gov (United States)

    Pruesse, Elmar; Peplies, Jörg; Glöckner, Frank Oliver

    2012-07-15

    In the analysis of homologous sequences, computation of multiple sequence alignments (MSAs) has become a bottleneck. This is especially troublesome for marker genes like the ribosomal RNA (rRNA) where already millions of sequences are publicly available and individual studies can easily produce hundreds of thousands of new sequences. Methods have been developed to cope with such numbers, but further improvements are needed to meet accuracy requirements. In this study, we present the SILVA Incremental Aligner (SINA) used to align the rRNA gene databases provided by the SILVA ribosomal RNA project. SINA uses a combination of k-mer searching and partial order alignment (POA) to maintain very high alignment accuracy while satisfying high throughput performance demands. SINA was evaluated in comparison with the commonly used high throughput MSA programs PyNAST and mothur. The three BRAliBase III benchmark MSAs could be reproduced with 99.3, 97.6 and 96.1 accuracy. A larger benchmark MSA comprising 38 772 sequences could be reproduced with 98.9 and 99.3% accuracy using reference MSAs comprising 1000 and 5000 sequences. SINA was able to achieve higher accuracy than PyNAST and mothur in all performed benchmarks. Alignment of up to 500 sequences using the latest SILVA SSU/LSU Ref datasets as reference MSA is offered at http://www.arb-silva.de/aligner. This page also links to Linux binaries, user manual and tutorial. SINA is made available under a personal use license.

  1. Ribosomal proteins L11 and L10.(L12)4 and the antibiotic thiostrepton interact with overlapping regions of the 23 S rRNA backbone in the ribosomal GTPase centre

    DEFF Research Database (Denmark)

    Rosendahl, G; Douthwaite, S

    1993-01-01

    RNA, and to investigate how this interaction is influenced by other ribosomal components. Complexes were characterized in both naked 23 S rRNA and ribosomes from an E. coli L11-minus strain, before and after reconstitution with L11. The protein protects 17 riboses between positions 1058 and 1085 in the naked 23 S r......The Escherichia coli ribosomal protein (r-protein) L11 and its binding site on 23 S ribosomal RNA (rRNA) are associated with ribosomal hydrolysis of guanosine 5'-triphosphate (GTP). We have used hydroxyl radical footprinting to map the contacts between L11 and the backbone riboses in 23 S r......)4 and other proteins within the ribosome. The antibiotics thiostrepton and micrococcin inhibit the catalytic functions of this region by slotting in between the accessible loops and interacting with nucleotides there....

  2. Clusters of basic amino acids contribute to RNA binding and nucleolar localization of ribosomal protein L22.

    Directory of Open Access Journals (Sweden)

    Jennifer L Houmani

    Full Text Available The ribosomal protein L22 is a component of the 60S eukaryotic ribosomal subunit. As an RNA-binding protein, it has been shown to interact with both cellular and viral RNAs including 28S rRNA and the Epstein-Barr virus encoded RNA, EBER-1. L22 is localized to the cell nucleus where it accumulates in nucleoli. Although previous studies demonstrated that a specific amino acid sequence is required for nucleolar localization, the RNA-binding domain has not been identified. Here, we investigated the hypothesis that the nucleolar accumulation of L22 is linked to its ability to bind RNA. To address this hypothesis, mutated L22 proteins were generated to assess the contribution of specific amino acids to RNA binding and protein localization. Using RNA-protein binding assays, we demonstrate that basic amino acids 80-93 are required for high affinity binding of 28S rRNA and EBER-1 by L22. Fluorescence localization studies using GFP-tagged mutated L22 proteins further reveal that basic amino acids 80-93 are critical for nucleolar accumulation and for incorporation into ribosomes. Our data support the growing consensus that the nucleolar accumulation of ribosomal proteins may not be mediated by a defined localization signal, but rather by specific interaction with established nucleolar components such as rRNA.

  3. Naked mole-rat has increased translational fidelity compared with the mouse, as well as a unique 28S ribosomal RNA cleavage.

    Science.gov (United States)

    Azpurua, Jorge; Ke, Zhonghe; Chen, Iris X; Zhang, Quanwei; Ermolenko, Dmitri N; Zhang, Zhengdong D; Gorbunova, Vera; Seluanov, Andrei

    2013-10-22

    The naked mole-rat (Heterocephalus glaber) is a subterranean eusocial rodent with a markedly long lifespan and resistance to tumorigenesis. Multiple data implicate modulation of protein translation in longevity. Here we report that 28S ribosomal RNA (rRNA) of the naked mole-rat is processed into two smaller fragments of unequal size. The two breakpoints are located in the 28S rRNA divergent region 6 and excise a fragment of 263 nt. The excised fragment is unique to the naked mole-rat rRNA and does not show homology to other genomic regions. Because this hidden break site could alter ribosome structure, we investigated whether translation rate and amino acid incorporation fidelity were altered. We report that naked mole-rat fibroblasts have significantly increased translational fidelity despite having comparable translation rates with mouse fibroblasts. Although we cannot directly test whether the unique 28S rRNA structure contributes to the increased fidelity of translation, we speculate that it may change the folding or dynamics of the large ribosomal subunit, altering the rate of GTP hydrolysis and/or interaction of the large subunit with tRNA during accommodation, thus affecting the fidelity of protein synthesis. In summary, our results show that naked mole-rat cells produce fewer aberrant proteins, supporting the hypothesis that the more stable proteome of the naked mole-rat contributes to its longevity.

  4. MMB-GUI: a fast morphing method demonstrates a possible ribosomal tRNA translocation trajectory.

    Science.gov (United States)

    Tek, Alex; Korostelev, Andrei A; Flores, Samuel Coulbourn

    2016-01-08

    Easy-to-use macromolecular viewers, such as UCSF Chimera, are a standard tool in structural biology. They allow rendering and performing geometric operations on large complexes, such as viruses and ribosomes. Dynamical simulation codes enable modeling of conformational changes, but may require considerable time and many CPUs. There is an unmet demand from structural and molecular biologists for software in the middle ground, which would allow visualization combined with quick and interactive modeling of conformational changes, even of large complexes. This motivates MMB-GUI. MMB uses an internal-coordinate, multiscale approach, yielding as much as a 2000-fold speedup over conventional simulation methods. We use Chimera as an interactive graphical interface to control MMB. We show how this can be used for morphing of macromolecules that can be heterogeneous in biopolymer type, sequence, and chain count, accurately recapitulating structural intermediates. We use MMB-GUI to create a possible trajectory of EF-G mediated gate-passing translocation in the ribosome, with all-atom structures. This shows that the GUI makes modeling of large macromolecules accessible to a wide audience. The morph highlights similarities in tRNA conformational changes as tRNA translocates from A to P and from P to E sites and suggests that tRNA flexibility is critical for translocation completion. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  5. An approach to analyse the specific impact of rapamycin on mRNA-ribosome association

    Directory of Open Access Journals (Sweden)

    Jaquier-Gubler Pascale

    2008-08-01

    Full Text Available Abstract Background Recent work, using both cell culture model systems and tumour derived cell lines, suggests that the differential recruitment into polysomes of mRNA populations may be sufficient to initiate and maintain tumour formation. Consequently, a major effort is underway to use high density microarray profiles to establish molecular fingerprints for cells exposed to defined drug regimes. The aim of these pharmacogenomic approaches is to provide new information on how drugs can impact on the translational read-out within a defined cellular background. Methods We describe an approach that permits the analysis of de-novo mRNA-ribosome association in-vivo during short drug exposures. It combines hypertonic shock, polysome fractionation and high-throughput analysis to provide a molecular phenotype of translationally responsive transcripts. Compared to previous translational profiling studies, the procedure offers increased specificity due to the elimination of the drugs secondary effects (e.g. on the transcriptional read-out. For this pilot "proof-of-principle" assay we selected the drug rapamycin because of its extensively studied impact on translation initiation. Results High throughput analysis on both the light and heavy polysomal fractions has identified mRNAs whose re-recruitment onto free ribosomes responded to short exposure to the drug rapamycin. The results of the microarray have been confirmed using real-time RT-PCR. The selective down-regulation of TOP transcripts is also consistent with previous translational profiling studies using this drug. Conclusion The technical advance outlined in this manuscript offers the possibility of new insights into mRNA features that impact on translation initiation and provides a molecular fingerprint for transcript-ribosome association in any cell type and in the presence of a range of drugs of interest. Such molecular phenotypes defined pre-clinically may ultimately impact on the evaluation of

  6. How does a scanning ribosomal particle move along the 5'-untranslated region of eukaryotic mRNA? Brownian Ratchet model.

    Science.gov (United States)

    Spirin, Alexander S

    2009-11-17

    A model of the ATP-dependent unidirectional movement of the 43S ribosomal initiation complex (=40S ribosomal subunit + eIF1 + eIF1A + eIF2.GTP.Met-tRNA(i) + eIF3) during scanning of the 5'-untranslated region of eukaryotic mRNA is proposed. The model is based on the principles of molecular Brownian ratchet machines and explains several enigmatic data concerning the scanning complex. In this model, the one-dimensional diffusion of the ribosomal initiation complex along the mRNA chain is rectified into the net-unidirectional 5'-to-3' movement by the Feynman ratchet-and-pawl mechanism. The proposed mechanism is organized by the heterotrimeric protein eIF4F (=eIF4A + eIF4E + eIF4G), attached to the scanning ribosomal particle via eIF3, and the RNA-binding protein eIF4B that is postulated to play the role of the pawl. The energy for the useful work of the ratchet-and-pawl mechanism is supplied from ATP hydrolysis induced by the eIF4A subunit: ATP binding and its hydrolysis alternately change the affinities of eIF4A for eIF4B and for mRNA, resulting in the restriction of backward diffusional sliding of the 43S ribosomal complex along the mRNA chain, while stochastic movements ahead are allowed.

  7. Chromophore-assisted light inactivation of pKi-67 leads to inhibition of ribosomal RNA synthesis.

    Science.gov (United States)

    Rahmanzadeh, R; Hüttmann, G; Gerdes, J; Scholzen, T

    2007-06-01

    Expression of the nuclear Ki-67 protein (pKi-67) is strongly associated with cell proliferation. For this reason, antibodies against this protein are widely used as prognostic tools for the assessment of cell proliferation in biopsies from cancer patients. Despite this broad application in histopathology, functional evidence for the physiological role of pKi-67 is still missing. Recently, we proposed a function of pKi-67 in the early steps of ribosomal RNA (rRNA) synthesis. Here, we have examined the involvement of pKi-67 in this process by photochemical inhibition using chromophore-assisted light inactivation (CALI). Anti-pKi-67 antibodies were labelled with the fluorochrome fluorescein 5(6)-isothiocyanate and were irradiated after binding to their target protein. Performing CALI in vitro on cell lysates led to specific cross-linking of pKi-67. Moreover, the upstream binding factor (UBF) necessary for rRNA transcription was also partly subjected to cross-link formation, indicating a close spatial proximity of UBF and pKi-67. CALI in living cells, using micro-injected antibody, caused a striking relocalization of UBF from foci within the nucleoli to spots located at the nucleolar rim or within the nucleoplasm. pKi-67-CALI resulted in dramatic inhibition of RNA polymerase I-dependent nucleolar rRNA synthesis, whereas RNA polymerase II-dependent nucleoplasmic RNA synthesis remained almost unaltered. Our data presented here argue for a crucial role of pKi-67 in RNA polymerase I-dependent nucleolar rRNA synthesis.

  8. CRM1 and its ribosome export adaptor NMD3 localize to the nucleolus and affect rRNA synthesis.

    Science.gov (United States)

    Bai, Baoyan; Moore, Henna M; Laiho, Marikki

    2013-01-01

    CRM1 is an export factor that together with its adaptor NMD3 transports numerous cargo molecules from the nucleus to cytoplasm through the nuclear pore. Previous studies have suggested that CRM1 and NMD3 are detected in the nucleolus. However, their localization with subnucleolar domains or participation in the activities of the nucleolus are unclear. We demonstrate here biochemically and using imaging analyses that CRM1 and NMD3 co-localize with nucleolar marker proteins in the nucleolus. In particular, their nucleolar localization is markedly increased by inhibition of RNA polymerase I (Pol I) transcription by actinomycin D or by silencing Pol I catalytic subunit, RPA194. We show that CRM1 nucleolar localization is dependent on its activity and the expression of NMD3, whereas NMD3 nucleolar localization is independent of CRM1. This suggests that NMD3 provides nucleolar tethering of CRM1. While inhibition of CRM1 by leptomycin B inhibited processing of 28S ribosomal (r) RNA, depletion of NMD3 did not, suggesting that their effects on 28S rRNA processing are distinct. Markedly, depletion of NMD3 and inhibition of CRM1 reduced the rate of pre-47S rRNA synthesis. However, their inactivation did not lead to nucleolar disintegration, a hallmark of Pol I transcription stress, suggesting that they do not directly regulate transcription. These results indicate that CRM1 and NMD3 have complex functions in pathways that couple rRNA synthetic and processing engines and that the rRNA synthesis rate may be adjusted according to proficiency in rRNA processing and export.

  9. Effect of mutations in the A site of 16 S rRNA on aminoglycoside antibiotic-ribosome interaction

    DEFF Research Database (Denmark)

    Recht, M I; Douthwaite, S; Dahlquist, K D

    1999-01-01

    antibiotics, which also interact with this region of rRNA. Mutations of certain nucleotides in rRNA reduce aminoglycoside binding affinity, as previously demonstrated using a model RNA oligonucleotide system. Here, predictions from the oligonucleotide system were tested in the ribosome by mutation...... for the aminoglycoside paromomycin, whereas no discernible reduction in affinity was observed with 1406 mutant ribosomes. These data are consistent with prior NMR structural determination of aminoglycoside interaction with the decoding region, and further our understanding of how aminoglycoside resistance can...

  10. Deciphering the role of the Gag-Pol ribosomal frameshift signal in HIV-1 RNA genome packaging.

    Science.gov (United States)

    Nikolaitchik, Olga A; Hu, Wei-Shau

    2014-04-01

    A key step of retroviral replication is packaging of the viral RNA genome during virus assembly. Specific packaging is mediated by interactions between the viral protein Gag and elements in the viral RNA genome. In HIV-1, similar to most retroviruses, the packaging signal is located within the 5' untranslated region and extends into the gag-coding region. A recent study reported that a region including the Gag-Pol ribosomal frameshift signal plays an important role in HIV-1 RNA packaging; deletions or mutations that affect the RNA structure of this signal lead to drastic decreases (10- to 50-fold) in viral RNA packaging and virus titer. We examined here the role of the ribosomal frameshift signal in HIV-1 RNA packaging by studying the RNA packaging and virus titer in the context of proviruses. Three mutants with altered ribosomal frameshift signal, either through direct deletion of the signal, mutation of the 6U slippery sequence, or alterations of the secondary structure were examined. We found that RNAs from all three mutants were packaged efficiently, and they generate titers similar to that of a virus containing the wild-type ribosomal frameshift signal. We conclude that although the ribosomal frameshift signal plays an important role in regulating the replication cycle, this RNA element is not directly involved in regulating RNA encapsidation. To generate infectious viruses, HIV-1 must package viral RNA genome during virus assembly. The specific HIV-1 genome packaging is mediated by interactions between the structural protein Gag and elements near the 5' end of the viral RNA known as packaging signal. In this study, we examined whether the Gag-Pol ribosomal frameshift signal is important for HIV-1 RNA packaging as recently reported. Our results demonstrated that when Gag/Gag-Pol is supplied in trans, none of the tested ribosomal frameshift signal mutants has defects in RNA packaging or virus titer. These studies provide important information on how HIV-1

  11. Selection of mRNA 5'-untranslated region sequence with high translation efficiency through ribosome display

    International Nuclear Information System (INIS)

    Mie, Masayasu; Shimizu, Shun; Takahashi, Fumio; Kobatake, Eiry

    2008-01-01

    The 5'-untranslated region (5'-UTR) of mRNAs functions as a translation enhancer, promoting translation efficiency. Many in vitro translation systems exhibit a reduced efficiency in protein translation due to decreased translation initiation. The use of a 5'-UTR sequence with high translation efficiency greatly enhances protein production in these systems. In this study, we have developed an in vitro selection system that favors 5'-UTRs with high translation efficiency using a ribosome display technique. A 5'-UTR random library, comprised of 5'-UTRs tagged with a His-tag and Renilla luciferase (R-luc) fusion, were in vitro translated in rabbit reticulocytes. By limiting the translation period, only mRNAs with high translation efficiency were translated. During translation, mRNA, ribosome and translated R-luc with His-tag formed ternary complexes. They were collected with translated His-tag using Ni-particles. Extracted mRNA from ternary complex was amplified using RT-PCR and sequenced. Finally, 5'-UTR with high translation efficiency was obtained from random 5'-UTR library

  12. Evidence for an RNA pseudoknot loop-helix interaction essential for efficient -1 ribosomal frameshifting.

    Science.gov (United States)

    Liphardt, J; Napthine, S; Kontos, H; Brierley, I

    1999-05-07

    RNA pseudoknots are structural elements that participate in a variety of biological processes. At -1 ribosomal frameshifting sites, several types of pseudoknot have been identified which differ in their organisation and functionality. The pseudoknot found in infectious bronchitis virus (IBV) is typical of those that possess a long stem 1 of 11-12 bp and a long loop 2 (30-164 nt). A second group of pseudoknots are distinguishable that contain stems of only 5 to 7 bp and shorter loops. The NMR structure of one such pseudoknot, that of mouse mammary tumor virus (MMTV), has revealed that it is kinked at the stem 1-stem 2 junction, and that this kinked conformation is essential for efficient frameshifting. We recently investigated the effect on frameshifting of modulating stem 1 length and stability in IBV-based pseudoknots, and found that a stem 1 with at least 11 bp was needed for efficient frameshifting. Here, we describe the sequence manipulations that are necessary to bypass the requirement for an 11 bp stem 1 and to convert a short non-functional IBV-derived pseudoknot into a highly efficient, kinked frameshifter pseudoknot. Simple insertion of an adenine residue at the stem 1-stem 2 junction (an essential feature of a kinked pseudoknot) was not sufficient to create a functional pseudoknot. An additional change was needed: efficient frameshifting was recovered only when the last nucleotide of loop 2 was changed from a G to an A. The requirement for an A at the end of loop 2 is consistent with a loop-helix contact similar to those described in other RNA tertiary structures. A mutational analysis of both partners of the proposed interaction, the loop 2 terminal adenine residue and two G.C pairs near the top of stem 1, revealed that the interaction was essential for efficient frameshifting. The specific requirement for a 3'-terminal A residue was lost when loop 2 was increased from 8 to 14 nt, suggesting that the loop-helix contact may be required only in those

  13. Novel extraction strategy of ribosomal RNA and genomic DNA from cheese for PCR-based investigations.

    Science.gov (United States)

    Bonaïti, Catherine; Parayre, Sandrine; Irlinger, Françoise

    2006-03-15

    Cheese microorganisms, such as bacteria and fungi, constitute a complex ecosystem that plays a central role in cheeses ripening. The molecular study of cheese microbial diversity and activity is essential but the extraction of high quality nucleic acid may be problematic: the cheese samples are characterised by a strong buffering capacity which negatively influenced the yield of the extracted rRNA. The objective of this study is to develop an effective method for the direct and simultaneous isolation of yeast and bacterial ribosomal RNA and genomic DNA from the same cheese samples. DNA isolation was based on a protocol used for nucleic acids isolation from anaerobic digestor, without preliminary washing step with the combined use of the action of chaotropic agent (acid guanidinium thiocyanate), detergents (SDS, N-lauroylsarcosine), chelating agent (EDTA) and a mechanical method (bead beating system). The DNA purification was carried out by two washing steps of phenol-chloroform. RNA was isolated successfully after the second acid extraction step by recovering it from the phenolic phase of the first acid extraction. The novel method yielded pure preparation of undegraded RNA accessible for reverse transcription-PCR. The extraction protocol of genomic DNA and rRNA was applicable to complex ecosystem of different cheese matrices.

  14. Comparison of preribosomal RNA processing pathways in yeast, plant and human cells - focus on coordinated action of endo- and exoribonucleases.

    Science.gov (United States)

    Tomecki, Rafal; Sikorski, Pawel J; Zakrzewska-Placzek, Monika

    2017-07-01

    Proper regulation of ribosome biosynthesis is mandatory for cellular adaptation, growth and proliferation. Ribosome biogenesis is the most energetically demanding cellular process, which requires tight control. Abnormalities in ribosome production have severe consequences, including developmental defects in plants and genetic diseases (ribosomopathies) in humans. One of the processes occurring during eukaryotic ribosome biogenesis is processing of the ribosomal RNA precursor molecule (pre-rRNA), synthesized by RNA polymerase I, into mature rRNAs. It must not only be accurate but must also be precisely coordinated with other phenomena leading to the synthesis of functional ribosomes: RNA modification, RNA folding, assembly with ribosomal proteins and nucleocytoplasmic RNP export. A multitude of ribosome biogenesis factors ensure that these events take place in a correct temporal order. Among them are endo- and exoribonucleases involved in pre-rRNA processing. Here, we thoroughly present a wide spectrum of ribonucleases participating in rRNA maturation, focusing on their biochemical properties, regulatory mechanisms and substrate specificity. We also discuss cooperation between various ribonucleolytic activities in particular stages of pre-rRNA processing, delineating major similarities and differences between three representative groups of eukaryotes: yeast, plants and humans. © 2017 Federation of European Biochemical Societies.

  15. Ribosomal protein L5 has a highly twisted concave surface and flexible arms responsible for rRNA binding.

    OpenAIRE

    Nakashima, T; Yao, M; Kawamura, S; Iwasaki, K; Kimura, M; Tanaka, I

    2001-01-01

    Ribosomal protein L5 is a 5S rRNA binding protein in the large subunit and plays an essential role in the promotion of a particular conformation of 5S rRNA. The crystal structure of the ribosomal protein L5 from Bacillus stearothermophilus has been determined at 1.8 A resolution. The molecule consists of a five-stranded antiparallel beta-sheet and four alpha-helices, which fold in a way that is topologically similar to the ribonucleoprotein (RNP) domain. The molecular shape and electrostatic ...

  16. Functional characterization of the Drosophila MRP (mitochondrial RNA processing) RNA gene.

    Science.gov (United States)

    Schneider, Mary D; Bains, Anupinder K; Rajendra, T K; Dominski, Zbigniew; Matera, A Gregory; Simmonds, Andrew J

    2010-11-01

    MRP RNA is a noncoding RNA component of RNase mitochondrial RNA processing (MRP), a multi-protein eukaryotic endoribonuclease reported to function in multiple cellular processes, including ribosomal RNA processing, mitochondrial DNA replication, and cell cycle regulation. A recent study predicted a potential Drosophila ortholog of MRP RNA (CR33682) by computer-based genome analysis. We have confirmed the expression of this gene and characterized the phenotype associated with this locus. Flies with mutations that specifically affect MRP RNA show defects in growth and development that begin in the early larval period and end in larval death during the second instar stage. We present several lines of evidence demonstrating a role for Drosophila MRP RNA in rRNA processing. The nuclear fraction of Drosophila MRP RNA localizes to the nucleolus. Further, a mutant strain shows defects in rRNA processing that include a defect in 5.8S rRNA processing, typical of MRP RNA mutants in other species, as well as defects in early stages of rRNA processing.

  17. Targeted CRISPR disruption reveals a role for RNase MRP RNA in human preribosomal RNA processing.

    Science.gov (United States)

    Goldfarb, Katherine C; Cech, Thomas R

    2017-01-01

    MRP RNA is an abundant, essential noncoding RNA whose functions have been proposed in yeast but are incompletely understood in humans. Mutations in the genomic locus for MRP RNA cause pleiotropic human diseases, including cartilage hair hypoplasia (CHH). Here we applied CRISPR-Cas9 genome editing to disrupt the endogenous human MRP RNA locus, thereby attaining what has eluded RNAi and RNase H experiments: elimination of MRP RNA in the majority of cells. The resulting accumulation of ribosomal RNA (rRNA) precursor-analyzed by RNA fluorescent in situ hybridization (FISH), Northern blots, and RNA sequencing-implicates MRP RNA in pre-rRNA processing. Amelioration of pre-rRNA imbalance is achieved through rescue of MRP RNA levels by ectopic expression. Furthermore, affinity-purified MRP ribonucleoprotein (RNP) from HeLa cells cleaves the human pre-rRNA in vitro at at least one site used in cells, while RNP isolated from cells with CRISPR-edited MRP loci loses this activity, and ectopic MRP RNA expression restores cleavage activity. Thus, a role for RNase MRP in human pre-rRNA processing is established. As demonstrated here, targeted CRISPR disruption is a valuable tool for functional studies of essential noncoding RNAs that are resistant to RNAi and RNase H-based degradation. © 2017 Goldfarb and Cech; Published by Cold Spring Harbor Laboratory Press.

  18. Expression and RNA Interference of Ribosomal Protein L5 Gene in Nilaparvata lugens (Hemiptera: Delphacidae).

    Science.gov (United States)

    Zhu, Jiajun; Hao, Peiying; Lu, Chaofeng; Ma, Yan; Feng, Yalin; Yu, Xiaoping

    2017-05-01

    The ribosomal proteins play important roles in the growth and development of organisms. This study aimed to explore the function of NlRPL5 (GenBank KX379234), a ribosomal protein L5 gene, in the brown planthopper Nilaparvata lugens. The open reading frame of NlRPL5 was cloned from N. lugens based on a previous transcriptome analysis. The results revealed that the open reading frame of NlRPL5 is of 900 bp, encoding 299 amino acid residues. The reverse transcription quantitative PCR results suggested that the expression of NlRPL5 gene was stronger in gravid females, but was relatively low in nymphs, males, and newly emerged females. The expression level of NlRPL5 in the ovary was about twofolds of that in the head, thorax, or fat body. RNAi of dsNlRPL5 resulted in a significant reduction of mRNA levels, ∼50% decrease in comparison with the dsGFP control at day 6. Treatment of dsNlRPL5 significantly restricted the ovarian development, and decreased the number of eggs laid on the rice (Oryza sativa) plants. This study provided a new clue for further study on the function and regulation mechanism of NlRPL5 in N. lugens. © The Author 2017. Published by Oxford University Press on behalf of the Entomological Society of America.

  19. Mutant forms of Escherichia coli protein L25 unable to bind to 5S rRNA are incorporated efficiently into the ribosome in vivo.

    Science.gov (United States)

    Anikaev, A Y; Korepanov, A P; Korobeinikova, A V; Kljashtorny, V G; Piendl, W; Nikonov, S V; Garber, M B; Gongadze, G M

    2014-08-01

    5S rRNA-binding ribosomal proteins of the L25 family are an evolutional acquisition of bacteria. Earlier we showed that (i) single replacements in the RNA-binding module of the protein of this family result in destabilization or complete impossibility to form a complex with 5S rRNA in vitro; (ii) ΔL25 ribosomes of Escherichia coli are less efficient in protein synthesis in vivo than the control ribosomes. In the present work, the efficiency of incorporation of the E. coli protein L25 with mutations in the 5S rRNA-binding region into the ribosome in vivo was studied. It was found that the mutations in L25 that abolish its ability to form the complex with free 5S rRNA do not prevent its correct and efficient incorporation into the ribosome. This is supported by the fact that even the presence of a very weakly retained mutant form of the protein in the ribosome has a positive effect on the activity of the translational machinery in vivo. All this suggests the existence of an alternative incorporation pathway for this protein into the ribosome, excluding the preliminary formation of the complex with 5S rRNA. At the same time, the stable L25-5S rRNA contact is important for the retention of the protein within the ribosome, and the conservative amino acid residues of the RNA-binding module play a key role in this.

  20. Identification of a Recently Active Mammalian SINE Derived from Ribosomal RNA

    Science.gov (United States)

    Longo, Mark S.; Brown, Judy D.; Zhang, Chu; O’Neill, Michael J.; O’Neill, Rachel J.

    2015-01-01

    Complex eukaryotic genomes are riddled with repeated sequences whose derivation does not coincide with phylogenetic history and thus is often unknown. Among such sequences, the capacity for transcriptional activity coupled with the adaptive use of reverse transcription can lead to a diverse group of genomic elements across taxa, otherwise known as selfish elements or mobile elements. Short interspersed nuclear elements (SINEs) are nonautonomous mobile elements found in eukaryotic genomes, typically derived from cellular RNAs such as tRNAs, 7SL or 5S rRNA. Here, we identify and characterize a previously unknown SINE derived from the 3′-end of the large ribosomal subunit (LSU or 28S rDNA) and transcribed via RNA polymerase III. This new element, SINE28, is represented in low-copy numbers in the human reference genome assembly, wherein we have identified 27 discrete loci. Phylogenetic analysis indicates these elements have been transpositionally active within primate lineages as recently as 6 MYA while modern humans still carry transcriptionally active copies. Moreover, we have identified SINE28s in all currently available assembled mammalian genome sequences. Phylogenetic comparisons indicate that these elements are frequently rederived from the highly conserved LSU rRNA sequences in a lineage-specific manner. We propose that this element has not been previously recognized as a SINE given its high identity to the canonical LSU, and that SINE28 likely represents one of possibly many unidentified, active transposable elements within mammalian genomes. PMID:25637222

  1. [Characterization of Black and Dichothrix Cyanobacteria Based on the 16S Ribosomal RNA Gene Sequence

    Science.gov (United States)

    Ortega, Maya

    2010-01-01

    My project focuses on characterizing different cyanobacteria in thrombolitic mats found on the island of Highborn Cay, Bahamas. Thrombolites are interesting ecosystems because of the ability of bacteria in these mats to remove carbon dioxide from the atmosphere and mineralize it as calcium carbonate. In the future they may be used as models to develop carbon sequestration technologies, which could be used as part of regenerative life systems in space. These thrombolitic communities are also significant because of their similarities to early communities of life on Earth. I targeted two cyanobacteria in my research, Dichothrix spp. and whatever black is, since they are believed to be important to carbon sequestration in these thrombolitic mats. The goal of my summer research project was to molecularly identify these two cyanobacteria. DNA was isolated from each organism through mat dissections and DNA extractions. I ran Polymerase Chain Reactions (PCR) to amplify the 16S ribosomal RNA (rRNA) gene in each cyanobacteria. This specific gene is found in almost all bacteria and is highly conserved, meaning any changes in the sequence are most likely due to evolution. As a result, the 16S rRNA gene can be used for bacterial identification of different species based on the sequence of their 16S rRNA gene. Since the exact sequence of the Dichothrix gene was unknown, I designed different primers that flanked the gene based on the known sequences from other taxonomically similar cyanobacteria. Once the 16S rRNA gene was amplified, I cloned the gene into specialized Escherichia coli cells and sent the gene products for sequencing. Once the sequence is obtained, it will be added to a genetic database for future reference to and classification of other Dichothrix sp.

  2. 16S ribosomal RNA sequence analysis for determination of phylogenetic relationship among methylotrophs.

    Science.gov (United States)

    Tsuji, K; Tsien, H C; Hanson, R S; DePalma, S R; Scholtz, R; LaRoche, S

    1990-01-01

    16S ribosomal RNAs (rRNA) of 12 methylotrophic bacteria have been almost completely sequenced to establish their phylogenetic relationships. Methylotrophs that are physiologically related are phylogenetically diverse and are scattered among the purple eubacteria (class Proteobacteria). Group I methylotrophs can be classified in the beta- and the gamma-subdivisions and group II methylotrophs in the alpha-subdivision of the purple eubacteria, respectively. Pink-pigmented facultative and non-pigmented obligate group II methylotrophs form two distinctly separate branches within the alpha-subdivision. The secondary structures of the 16S rRNA sequences of 'Methylocystis parvus' strain OBBP, 'Methylosinus trichosporium' strain OB3b, 'Methylosporovibrio methanica' strain 81Z and Hyphomicrobium sp. strain DM2 are similar, and these non-pigmented obligate group II methylotrophs form one tight cluster in the alpha-subdivision. The pink-pigmented facultative methylotrophs, Methylobacterium extorquens strain AM1, Methylobacterium sp. strain DM4 and Methylobacterium organophilum strain XX form another cluster within the alpha-subdivision. Although similar in phenotypic characteristics, Methylobacterium organophilum strain XX and Methylobacterium extorquens strain AM1 are clearly distinguishable by their 16S rRNA sequences. The group I methylotrophs, Methylophilus methylotrophus strain AS1 and methylotrophic species DM11, which do not utilize methane, are similar in 16S rRNA sequence to bacteria in the beta-subdivision. The methane-utilizing, obligate group I methanotrophs, Methylococcus capsulatus strain BATH and Methylomonas methanica, are placed in the gamma-subdivision. The results demonstrate that it is possible to distinguish and classify the methylotrophic bacteria using 16S rRNA sequence analysis.

  3. Fluctuations between multiple EF-G-induced chimeric tRNA states during translocation on the ribosome

    Science.gov (United States)

    Adio, Sarah; Senyushkina, Tamara; Peske, Frank; Fischer, Niels; Wintermeyer, Wolfgang; Rodnina, Marina V.

    2015-06-01

    The coupled translocation of transfer RNA and messenger RNA through the ribosome entails large-scale structural rearrangements, including step-wise movements of the tRNAs. Recent structural work has visualized intermediates of translocation induced by elongation factor G (EF-G) with tRNAs trapped in chimeric states with respect to 30S and 50S ribosomal subunits. The functional role of the chimeric states is not known. Here we follow the formation of translocation intermediates by single-molecule fluorescence resonance energy transfer. Using EF-G mutants, a non-hydrolysable GTP analogue, and fusidic acid, we interfere with either translocation or EF-G release from the ribosome and identify several rapidly interconverting chimeric tRNA states on the reaction pathway. EF-G engagement prevents backward transitions early in translocation and increases the fraction of ribosomes that rapidly fluctuate between hybrid, chimeric and posttranslocation states. Thus, the engagement of EF-G alters the energetics of translocation towards a flat energy landscape, thereby promoting forward tRNA movement.

  4. Phylogenetic evidence for the acquisition of ribosomal RNA introns subsequent to the divergence of some of the major Tetrahymena groups

    DEFF Research Database (Denmark)

    Sogin, M L; Ingold, A; Karlok, M

    1986-01-01

    . In an attempt to evaluate the evolutionary origins of the intervening sequences, we have now determined complete small subunit ribosomal RNA gene sequences from 13 species of Tetrahymena and the absolute number of nucleotide differences between the sequences was used to construct a phylogenetic tree...

  5. Evidence for functional interaction between domains II and V of 23S ribosomal RNA from an erythromycin-resistant mutant

    DEFF Research Database (Denmark)

    Douthwaite, S; Prince, J B; Noller, H F

    1985-01-01

    A mutation affording low levels of erythromycin resistance has been obtained by in vitro hydroxylamine mutagenesis of a cloned ribosomal RNA operon from Escherichia coli. The site of the mutational event responsible for antibiotic resistance was localized to the gene region encoding domain II of ...

  6. Comparison of 16S ribosomal RNA gene sequence analysis and conventional culture in the environmental survey of a hospital

    OpenAIRE

    Manaka, Akihiro; Tokue, Yutaka; Murakami, Masami

    2017-01-01

    Background Nosocomial infection is one of the most common complications within health care facilities. Certain studies have reported outbreaks resulting from contaminated hospital environments. Although the identification of bacteria in the environment can readily be achieved using culturing methods, these methods detect live bacteria. Sequencing of the 16S ribosomal RNA (16S rRNA) gene is recognized to be effective for bacterial identification. In this study, we surveyed wards where drug-res...

  7. Ribosomal synthesis of polylysine from individual lysyl-tRNA/sup Lys/ in the absence of a template

    International Nuclear Information System (INIS)

    Yusupova, G.Z.; Remme, Y.L.; Belitsina, N.B.; Spirin, A.S.

    1987-01-01

    Earlier studies showed that ribosomes of Escherichia coli, in the absence of a template, can synthesize oligolysine, using lysyl-tRNA as a substrate. The authors present results on the use of preparations of individual lysyl-tRNA/sup Lys/ and phenylalanyl-tRNA/sup Phe/ in a system of templateless peptide synthesis. For these studies, the authors used ribosomes of E. coli MRE 600, washed four times with 1 M NH 4 Cl with 10 MM MgCl 2 . The purified ribosomes were stored at -70 0 C in standard buffer, containing 20 mM Tris-HCl, 100 mM NH 4 Cl, 10 mM MgCl 2 , 0.1 mM ethylenediamine tetraacetate (EDTA), and 10% glycerin, pH/sub 37 0 C/7.6. A preparation of [ 14 C]lysyl-tRNA/sup Lys/ was produced by affinity chromatography on immobilized factor EF-T/sub u/ from Thermus thermophilus HB8. The elongation factor EF-T/sub u/ from T. thermophilus and immobilized on BrCN-activated Sepharose 4B. The initial preparation of total tRNA of E. coli, enzymatically acylated by [ 14 C]lysine (348 Ci/mole, Amersham), was produced as described earlier. The degree of aminoacylation was 52-59 pmoles [ 14 C]lysine per unit of A 260 of tRNA

  8. Detailed analysis of RNA-protein interactions within the bacterial ribosomal protein L5/5S rRNA complex.

    Science.gov (United States)

    Perederina, Anna; Nevskaya, Natalia; Nikonov, Oleg; Nikulin, Alexei; Dumas, Philippe; Yao, Min; Tanaka, Isao; Garber, Maria; Gongadze, George; Nikonov, Stanislav

    2002-12-01

    The crystal structure of ribosomal protein L5 from Thermus thermophilus complexed with a 34-nt fragment comprising helix III and loop C of Escherichia coli 5S rRNA has been determined at 2.5 A resolution. The protein specifically interacts with the bulged nucleotides at the top of loop C of 5S rRNA. The rRNA and protein contact surfaces are strongly stabilized by intramolecular interactions. Charged and polar atoms forming the network of conserved intermolecular hydrogen bonds are located in two narrow planar parallel layers belonging to the protein and rRNA, respectively. The regions, including these atoms conserved in Bacteria and Archaea, can be considered an RNA-protein recognition module. Comparison of the T. thermophilus L5 structure in the RNA-bound form with the isolated Bacillus stearothermophilus L5 structure shows that the RNA-recognition module on the protein surface does not undergo significant changes upon RNA binding. In the crystal of the complex, the protein interacts with another RNA molecule in the asymmetric unit through the beta-sheet concave surface. This protein/RNA interface simulates the interaction of L5 with 23S rRNA observed in the Haloarcula marismortui 50S ribosomal subunit.

  9. Chromosomal organization of the ribosomal RNA genes in the genus Chironomus (Diptera, Chironomidae

    Directory of Open Access Journals (Sweden)

    Larisa Gunderina

    2015-05-01

    Full Text Available Chromosomal localization of ribosomal RNA coding genes has been studied by using FISH (fluorescence in situ hybridization in 21 species from the genus Chironomus Meigen, 1803. Analysis of the data has shown intra- and interspecific variation in number and location of 5.8S rDNA hybridization sites in 17 species from the subgenus Chironomus and 4 species from the subgenus Camptochironomus Kieffer, 1914. In the majority of studied species the location of rDNA sites coincided with the sites where active NORs (nucleolus organizer regions were found. The number of hybridization sites in karyotypes of studied chironomids varied from 1 to 6. More than half of the species possessed only one NOR (12 out of 21. Two rDNA hybridization sites were found in karyotypes of five species, three – in two species, and five and six sites – in one species each. NORs were found in all chromosomal arms of species from the subgenus Chironomus with one of them always located on arm G. On the other hand, no hybridization sites were found on arm G in four studied species from the subgenus Camptochironomus. Two species from the subgenus Chironomus – Ch. balatonicus Devai, Wuelker & Scholl, 1983 and Ch. “annularius” sensu Strenzke, 1959 – showed intraspecific variability in the number of hybridization signals. Possible mechanisms of origin of variability in number and location of rRNA genes in the karyotypes of species from the genus Chironomus are discussed.

  10. The pleuromutilin drugs tiamulin and valnemulin bind to the RNA at the peptidyl transferase centre on the ribosome

    DEFF Research Database (Denmark)

    Poulsen, S M; Karlsson, M; Johansson, L B

    2001-01-01

    The pleuromutilin antibiotic derivatives, tiamulin and valnemulin, inhibit protein synthesis by binding to the 50S ribosomal subunit of bacteria. The action and binding site of tiamulin and valnemulin was further characterized on Escherichia coli ribosomes. It was revealed that these drugs...... centre and have been associated with binding of several antibiotics. Competitive footprinting shows that tiamulin and valnemulin can bind concurrently with the macrolide erythromycin but compete with the macrolide carbomycin, which is a peptidyl transferase inhibitor. We infer from these and previous...... results that tiamulin and valnemulin interact with the rRNA in the peptidyl transferase slot on the ribosomes in which they prevent the correct positioning of the CCA-ends of tRNAs for peptide transfer....

  11. Dynamic enzyme docking to the ribosome coordinates N-terminal processing with polypeptide folding.

    Science.gov (United States)

    Sandikci, Arzu; Gloge, Felix; Martinez, Michael; Mayer, Matthias P; Wade, Rebecca; Bukau, Bernd; Kramer, Günter

    2013-07-01

    Newly synthesized polypeptides undergo various cotranslational maturation steps, including N-terminal enzymatic processing, chaperone-assisted folding and membrane targeting, but the spatial and temporal coordination of these steps is unclear. We show that Escherichia coli methionine aminopeptidase (MAP) associates with ribosomes through a charged loop that is crucial for nascent-chain processing and cell viability. MAP competes with peptide deformylase (PDF), the first enzyme to act on nascent chains, for binding sites at the ribosomal tunnel exit. PDF has extremely fast association and dissociation kinetics, which allows it to frequently sample ribosomes and ensure the processing of nascent chains after their emergence. Premature recruitment of the chaperone trigger factor, or polypeptide folding, negatively affect processing efficiency. Thus, the fast ribosome association kinetics of PDF and MAP are crucial for the temporal separation of nascent-chain processing from later maturation events, including chaperone recruitment and folding.

  12. Histone and ribosomal RNA repetitive gene clusters of the boll weevil are linked in a tandem array.

    Science.gov (United States)

    Roehrdanz, R; Heilmann, L; Senechal, P; Sears, S; Evenson, P

    2010-08-01

    Histones are the major protein component of chromatin structure. The histone family is made up of a quintet of proteins, four core histones (H2A, H2B, H3 & H4) and the linker histones (H1). Spacers are found between the coding regions. Among insects this quintet of genes is usually clustered and the clusters are tandemly repeated. Ribosomal DNA contains a cluster of the rRNA sequences 18S, 5.8S and 28S. The rRNA genes are separated by the spacers ITS1, ITS2 and IGS. This cluster is also tandemly repeated. We found that the ribosomal RNA repeat unit of at least two species of Anthonomine weevils, Anthonomus grandis and Anthonomus texanus (Coleoptera: Curculionidae), is interspersed with a block containing the histone gene quintet. The histone genes are situated between the rRNA 18S and 28S genes in what is known as the intergenic spacer region (IGS). The complete reiterated Anthonomus grandis histone-ribosomal sequence is 16,248 bp.

  13. A Deconvolution Protocol for ChIP-Seq Reveals Analogous Enhancer Structures on the Mouse and Human Ribosomal RNA Genes

    Directory of Open Access Journals (Sweden)

    Jean-Clement Mars

    2018-01-01

    Full Text Available The combination of Chromatin Immunoprecipitation and Massively Parallel Sequencing, or ChIP-Seq, has greatly advanced our genome-wide understanding of chromatin and enhancer structures. However, its resolution at any given genetic locus is limited by several factors. In applying ChIP-Seq to the study of the ribosomal RNA genes, we found that a major limitation to resolution was imposed by the underlying variability in sequence coverage that very often dominates the protein–DNA interaction profiles. Here, we describe a simple numerical deconvolution approach that, in large part, corrects for this variability, and significantly improves both the resolution and quantitation of protein–DNA interaction maps deduced from ChIP-Seq data. This approach has allowed us to determine the in vivo organization of the RNA polymerase I preinitiation complexes that form at the promoters and enhancers of the mouse (Mus musculus and human (Homo sapiens ribosomal RNA genes, and to reveal a phased binding of the HMG-box factor UBF across the rDNA. The data identify and map a “Spacer Promoter” and associated stalled polymerase in the intergenic spacer of the human ribosomal RNA genes, and reveal a very similar enhancer structure to that found in rodents and lower vertebrates.

  14. Genetic variability of Echinococcus granulosus based on the mitochondrial 16S ribosomal RNA gene.

    Science.gov (United States)

    Wang, Ning; Wang, Jiahai; Hu, Dandan; Zhong, Xiuqin; Jiang, Zhongrong; Yang, Aiguo; Deng, Shijin; Guo, Li; Tsering, Dawa; Wang, Shuxian; Gu, Xiaobin; Peng, Xuerong; Yang, Guangyou

    2015-06-01

    Echinococcus granulosus is the etiological agent of cystic echinococcosis, a major zoonotic disease of both humans and animals. In this study, we assessed genetic variability and genetic structure of E. granulosus in the Tibet plateau, using the complete mitochondrial 16 S ribosomal RNA gene for the first time. We collected and sequenced 62 isolates of E. granulosus from 3 populations in the Tibet plateau. A BLAST analysis indicated that 61 isolates belonged to E. granulosus sensu stricto (genotypes G1-G3), while one isolate belonged to E. canadensis (genotype G6). We detected 16 haplotypes with a haplotype network revealing a star-like expansion, with the most common haplotype occupying the center of the network. Haplotype diversity and nucleotide diversity were low, while negative values were observed for Tajima's D and Fu's Fs. AMOVA results and Fst values revealed that the three geographic populations were not genetically differentiated. Our results suggest that a population bottleneck or population expansion has occurred in the past, and that this explains the low genetic variability of E. granulosus in the Tibet Plateau.

  15. The CCA-end of P-tRNA Contacts Both the Human RPL36AL and the A-site Bound Translation Termination Factor eRF1 at the Peptidyl Transferase Center of the Human 80S Ribosome.

    Science.gov (United States)

    Hountondji, Codjo; Bulygin, Konstantin; Créchet, Jean-Bernard; Woisard, Anne; Tuffery, Pierre; Nakayama, Jun-Ichi; Frolova, Ludmila; Nierhaus, Knud H; Karpova, Galina; Baouz, Soria

    2014-01-01

    We have demonstrated previously that the E-site specific protein RPL36AL present in human ribosomes can be crosslinked with the CCA-end of a P-tRNA in situ. Here we report the following: (i) We modeled RPL36AL into the structure of the archaeal ortholog RPL44E extracted from the known X-ray structure of the 50S subunit of Haloarcula marismortui. Superimposing the obtained RPL36AL structure with that of P/E tRNA observed in eukaryotic 80S ribosomes suggested that RPL36AL might in addition to its CCA neighbourhood interact with the inner site of the tRNA elbow similar to an interaction pattern known from tRNA•synthetase pairs. (ii) Accordingly, we detected that the isolated recombinant protein RPL36AL can form a tight binary complex with deacylated tRNA, and even tRNA fragments truncated at their CCA end showed a high affinity in the nanomolar range supporting a strong interaction outside the CCA end. (iii) We constructed programmed 80S complexes containing the termination factor eRF1 (stop codon UAA at the A-site) and a 2',3'-dialdehyde tRNA (tRNAox) analog at the P-site. Surprisingly, we observed a crosslinked ternary complex containing the tRNA, eRF1 and RPL36AL crosslinked both to the aldehyde groups of tRNAox at the 2'- and 3'-positions of the ultimate A. We also demonstrated that, upon binding to the ribosomal A-site, eRF1 induces an alternative conformation of the ribosome and/or the tRNA, leading to a novel crosslink of tRNAox to another large-subunit ribosomal protein (namely L37) rather than to RPL36AL, both ribosomal proteins being labeled in a mutually exclusive fashion. Since the human 80S ribosome in complex with P-site bound tRNAox and A-site bound eRF1 corresponds to the post-termination state of the ribosome, the results represent the first biochemical evidence for the positioning of the CCA-arm of the P-tRNA in close proximity to both RPL36AL and eRF1 at the end of the translation process.

  16. Advantages and Limitations of Ribosomal RNA PCR and DNA Sequencing for Identification of Bacteria in Cardiac Valves of Danish Patients

    DEFF Research Database (Denmark)

    Kemp, Michael; Bangsborg, Jette; Kjerulf, Anne

    2013-01-01

    of direct molecular identification should also address weaknesses, their relevance in the given setting, and possible improvements. In this study cardiac valves from 56 Danish patients referred for surgery for infective endocarditis were analysed by microscopy and culture as well as by PCR targeting part...... of the bacterial 16S rRNA gene followed by DNA sequencing of the PCR product. PCR and DNA sequencing identified significant bacteria in 49 samples from 43 patients, including five out of 13 culture-negative cases. No rare, exotic, or intracellular bacteria were identified. There was a general agreement between...... bacterial identity obtained by ribosomal PCR and DNA sequencing from the valves and bacterial isolates from blood culture. However, DNA sequencing of the 16S rRNA gene did not discriminate well among non-haemolytic streptococci, especially within the Streptococcus mitis group. Ribosomal PCR with subsequent...

  17. Detailed analysis of RNA-protein interactions within the bacterial ribosomal protein L5/5S rRNA complex.

    OpenAIRE

    Perederina, Anna; Nevskaya, Natalia; Nikonov, Oleg; Nikulin, Alexei; Dumas, Philippe; Yao, Min; Tanaka, Isao; Garber, Maria; Gongadze, George; Nikonov, Stanislav

    2002-01-01

    The crystal structure of ribosomal protein L5 from Thermus thermophilus complexed with a 34-nt fragment comprising helix III and loop C of Escherichia coli 5S rRNA has been determined at 2.5 A resolution. The protein specifically interacts with the bulged nucleotides at the top of loop C of 5S rRNA. The rRNA and protein contact surfaces are strongly stabilized by intramolecular interactions. Charged and polar atoms forming the network of conserved intermolecular hydrogen bonds are located in ...

  18. Inhibition by Siomycin and Thiostrepton of Both Aminoacyl-tRNA and Factor G Binding to Ribosomes

    Science.gov (United States)

    Ll, Juan Modole; Cabrer, Bartolomé; Parmeggiani, Andrea; Azquez, David V

    1971-01-01

    Siomycin, a peptide antibiotic that interacts with the 50S ribosomal subunit and inhibits binding of factor G, is shown also to inhibit binding of aminoacyl-tRNA; however, it does not impair binding of fMet-tRNA and completion of the initiation complex. Moreover, unlike other inhibitors of aminoacyl-tRNA binding (tetracycline, sparsomycin, and streptogramin A), siomycin completely abolishes the GTPase activity associated with the binding of aminoacyl-tRNA catalyzed by factor Tu. A single-site interaction of siomycin appears to be responsible for its effect on both the binding of the aminoacyl-tRNA-Tu-GTP complex and that of factor G. PMID:4331558

  19. Is The Ribosome Targeted By Adaptive Mutations

    DEFF Research Database (Denmark)

    Jimenez Fernandez, Alicia; Molin, Søren; Johansen, Helle Krogh

    2015-01-01

    Introduction: RNA polymerase and ribosomes, composing the macromolecular synthesis machinery (MMSM), carry out the central processes of transcription and translation, but are usually seen as mechanical elements with no regulatory function. Extensive investigations of gene regulation and the high ...

  20. RNA-binding domain of the A protein component of the U1 small nuclear ribonucleoprotein analyzed by NMR spectroscopy is structurally similar to ribosomal proteins

    International Nuclear Information System (INIS)

    Hoffman, D.W.; Query, C.C.; Golden, B.L.; White, S.W.; Keene, J.D.

    1991-01-01

    An RNA recognition motif (RRM) of ∼80 amino acids constitutes the core of RNA-binding domains found in a large family of proteins involved in RNA processing. The U1 RNA-binding domain of the A protein component of the human U1 small nuclear ribonucleoprotein (RNP), which encompasses the RRM sequence, was analyzed by using NMR spectroscopy. The domain of the A protein is a highly stable monomer in solution consisting of four antiparallel β-strands and two α-helices. The highly conserved RNP1 and RNP2 consensus sequences, containing residues previously suggested to be involved in nucleic acid binding, are juxtaposed in adjacent β-strands. Conserved aromatic side chains that are critical for RNA binding are clustered on the surface to the molecule adjacent to a variable loop that influences recognition of specific RNA sequences. The secondary structure and topology of the RRM are similar to those of ribosomal proteins L12 and L30, suggesting a distant evolutionary relationship between these two types of RNA-associated proteins

  1. Potential pitfalls of modelling ribosomal RNA data in phylogenetic tree reconstruction: evidence from case studies in the Metazoa.

    Science.gov (United States)

    Letsch, Harald O; Kjer, Karl M

    2011-05-27

    Failure to account for covariation patterns in helical regions of ribosomal RNA (rRNA) genes has the potential to misdirect the estimation of the phylogenetic signal of the data. Furthermore, the extremes of length variation among taxa, combined with regional substitution rate variation can mislead the alignment of rRNA sequences and thus distort subsequent tree reconstructions. However, recent developments in phylogenetic methodology now allow a comprehensive integration of secondary structures in alignment and tree reconstruction analyses based on rRNA sequences, which has been shown to correct some of these problems. Here, we explore the potentials of RNA substitution models and the interactions of specific model setups with the inherent pattern of covariation in rRNA stems and substitution rate variation among loop regions. We found an explicit impact of RNA substitution models on tree reconstruction analyses. The application of specific RNA models in tree reconstructions is hampered by interaction between the appropriate modelling of covarying sites in stem regions, and excessive homoplasy in some loop regions. RNA models often failed to recover reasonable trees when single-stranded regions are excessively homoplastic, because these regions contribute a greater proportion of the data when covarying sites are essentially downweighted. In this context, the RNA6A model outperformed all other models, including the more parametrized RNA7 and RNA16 models. Our results depict a trade-off between increased accuracy in estimation of interdependencies in helical regions with the risk of magnifying positions lacking phylogenetic signal. We can therefore conclude that caution is warranted when applying rRNA covariation models, and suggest that loop regions be independently screened for phylogenetic signal, and eliminated when they are indistinguishable from random noise. In addition to covariation and homoplasy, other factors, like non-stationarity of substitution rates

  2. The pleuromutilin drugs tiamulin and valnemulin bind to the RNA at the peptidyl transferase centre on the ribosome.

    Science.gov (United States)

    Poulsen, S M; Karlsson, M; Johansson, L B; Vester, B

    2001-09-01

    The pleuromutilin antibiotic derivatives, tiamulin and valnemulin, inhibit protein synthesis by binding to the 50S ribosomal subunit of bacteria. The action and binding site of tiamulin and valnemulin was further characterized on Escherichia coli ribosomes. It was revealed that these drugs are strong inhibitors of peptidyl transferase and interact with domain V of 23S RNA, giving clear chemical footprints at nucleotides A2058-9, U2506 and U2584-5. Most of these nucleotides are highly conserved phylogenetically and functionally important, and all of them are at or near the peptidyl transferase centre and have been associated with binding of several antibiotics. Competitive footprinting shows that tiamulin and valnemulin can bind concurrently with the macrolide erythromycin but compete with the macrolide carbomycin, which is a peptidyl transferase inhibitor. We infer from these and previous results that tiamulin and valnemulin interact with the rRNA in the peptidyl transferase slot on the ribosomes in which they prevent the correct positioning of the CCA-ends of tRNAs for peptide transfer.

  3. Ribosomal protein L5 has a highly twisted concave surface and flexible arms responsible for rRNA binding.

    Science.gov (United States)

    Nakashima, T; Yao, M; Kawamura, S; Iwasaki, K; Kimura, M; Tanaka, I

    2001-05-01

    Ribosomal protein L5 is a 5S rRNA binding protein in the large subunit and plays an essential role in the promotion of a particular conformation of 5S rRNA. The crystal structure of the ribosomal protein L5 from Bacillus stearothermophilus has been determined at 1.8 A resolution. The molecule consists of a five-stranded antiparallel beta-sheet and four alpha-helices, which fold in a way that is topologically similar to the ribonucleoprotein (RNP) domain. The molecular shape and electrostatic representation suggest that the concave surface and loop regions are involved in 5S rRNA binding. To identify amino acid residues responsible for 5S rRNA binding, we made use of Ala-scanning mutagenesis of evolutionarily conserved amino acids occurring in the beta-strands and loop regions. The mutations of Asn37 at the beta1-strand and Gln63 at the loop between helix 2 and beta3-strand as well as that of Phe77 at the tip of the loop structure between the beta2- and beta3-strands caused a significant reduction in 5S rRNA binding. In addition, the mutations of Thr90 on the beta3-strand and Ile141 and Asp144 at the loop between beta4- and beta5-strands moderately reduced the 5S rRNA-binding affinity. Comparison of these results with the more recently analyzed structure of the 50S subunit from Haloarcula marismortui suggests that there are significant differences in the structure at N- and C-terminal regions and probably in the 5S rRNA binding.

  4. Structural basis for ribosome protein S1 interaction with RNA in trans-translation of Mycobacterium tuberculosis.

    Science.gov (United States)

    Fan, Yi; Dai, Yazhuang; Hou, Meijing; Wang, Huilin; Yao, Hongwei; Guo, Chenyun; Lin, Donghai; Liao, Xinli

    2017-05-27

    Ribosomal protein S1 (RpsA), the largest 30S protein in ribosome, plays a significant role in translation and trans-translation. In Mycobacterium tuberculosis, the C-terminus of RpsA is known as tuberculosis drug target of pyrazinoic acid, which inhibits the interaction between MtRpsA and tmRNA in trans-translation. However, the molecular mechanism underlying the interaction of MtRpsA with tmRNA remains unknown. We herein analyzed the interaction of the C-terminal domain of MtRpsA with three RNA fragments poly(A), sMLD and pre-sMLD. NMR titration analysis revealed that the RNA binding sites on MtRpsA CTD are mainly located in the β2, β3 and β5 strands and the adjacent L3 loop of the S1 domain. Fluorescence experiments determined the MtRpsA CTD binding to RNAs are in the micromolar affinity range. Sequence analysis also revealed conserved residues in the mapped RNA binding region. Residues L304, V305, G308, F310, H322, I323, R357 and I358 were verified to be the key residues influencing the interaction between MtRpsA CTD and pre-sMLD. Molecular docking further confirmed that the poly(A)-like sequence and sMLD of tmRNA are all involved in the protein-RNA interaction, through charged interaction and hydrogen bonds. The results will be beneficial for designing new anti-tuberculosis drugs. Copyright © 2017 Elsevier Inc. All rights reserved.

  5. Endogenous ribosomal frameshift signals operate as mRNA destabilizing elements through at least two molecular pathways in yeast.

    Science.gov (United States)

    Belew, Ashton T; Advani, Vivek M; Dinman, Jonathan D

    2011-04-01

    Although first discovered in viruses, previous studies have identified operational -1 ribosomal frameshifting (-1 RF) signals in eukaryotic genomic sequences, and suggested a role in mRNA stability. Here, four yeast -1 RF signals are shown to promote significant mRNA destabilization through the nonsense mediated mRNA decay pathway (NMD), and genetic evidence is presented suggesting that they may also operate through the no-go decay pathway (NGD) as well. Yeast EST2 mRNA is highly unstable and contains up to five -1 RF signals. Ablation of the -1 RF signals or of NMD stabilizes this mRNA, and changes in -1 RF efficiency have opposing effects on the steady-state abundance of the EST2 mRNA. These results demonstrate that endogenous -1 RF signals function as mRNA destabilizing elements through at least two molecular pathways in yeast. Consistent with current evolutionary theory, phylogenetic analyses suggest that -1 RF signals are rapidly evolving cis-acting regulatory elements. Identification of high confidence -1 RF signals in ∼10% of genes in all eukaryotic genomes surveyed suggests that -1 RF is a broadly used post-transcriptional regulator of gene expression.

  6. Detection of Aspergillus fumigatus pulmonary fungal infections in mice with 99mTc-labeled MORF oligomers targeting ribosomal RNA

    International Nuclear Information System (INIS)

    Wang Yuzhen; Chen Ling; Liu Xinrong; Cheng Dengfeng; Liu Guozheng; Liu Yuxia; Dou Shuping; Hnatowich, Donald J.; Rusckowski, Mary

    2013-01-01

    Purpose: Invasive aspergillosis is a major cause of infectious morbidity and mortality in immunocompromised patients. The fungus Aspergillus fumigatus (A. fumigatus) is the primary causative agent of invasive aspergillosis. However, A. fumigatus infections remain difficult to diagnose particularly in the early stages due to the lack of a rapid, sensitive and specific diagnostic approach. In this study, we investigated 99m Tc labeled MORF oligomers targeting fungal ribosomal RNA (rRNA) for the imaging detection of fungal infections. Procedures: Three phosphorodiamidate morpholino (MORF) oligomer (a DNA analogue) probes were designed: AGEN, complementary to a sequence of the fungal 28S ribosomal RNA (rRNA) of Aspergillus, as a genus-specific probe; AFUM, complementary to the 28S rRNA sequence of A. fumigatus, as a fungus species-specific probe; and cMORF, irrelevant to all fungal species, as a control probe. The probes were conjugated with Alexa Fluor 633 carboxylic acid succinimidyl ester (AF633) for fluorescence imaging or with NHS-mercaptoacetyl triglycine (NHS-MAG3) for nuclear imaging with 99m Tc and then evaluated in vitro and in vivo. Results: The specific binding of AGEN and AFUM to fungal total RNA was confirmed by dot blot hybridization while specific binding of AGEN and AFUM in fixed and live A. fumigatus was demonstrated by both fluorescent in situ hybridization (FISH) analysis and accumulation in live cells. SPECT imaging of BALB/c mice with pulmonary A. fumigatus infections and administered 99m Tc labeled AGEN and AFUM showed immediate and obvious accumulation in the infected lungs, while no significant accumulation of the control 99m Tc-cMORF in the infected lung was observed. Compared to non-infected mice, with sacrifice at 1 h, the accumulation of 99m Tc-AGEN and 99m Tc-AFUM in the lungs of mice infected with A. fumigatus was 2 and 2.7 fold higher respectively. Conclusions: In vivo targeting fungal ribosomal RNA with 99m Tc labeled MORF probes AGEN

  7. Ribosomal incorporation of backbone modified amino acids via an editing-deficient aminoacyl-tRNA synthetase.

    Science.gov (United States)

    Iqbal, Emil S; Dods, Kara K; Hartman, Matthew C T

    2018-02-14

    The ability to incorporate non-canonical amino acids (ncAA) using translation offers researchers the ability to extend the functionality of proteins and peptides for many applications including synthetic biology, biophysical and structural studies, and discovery of novel ligands. Here we describe the high promiscuity of an editing-deficient valine-tRNA synthetase (ValRS T222P). Using this enzyme, we demonstrate ribosomal translation of 11 ncAAs including those with novel side chains, α,α-disubstitutions, and cyclic β-amino acids.

  8. Diversity of ribosomal 16S DNA- and RNA-based bacterial community in an office building drinking water system.

    Science.gov (United States)

    Inkinen, J; Jayaprakash, B; Santo Domingo, J W; Keinänen-Toivola, M M; Ryu, H; Pitkänen, T

    2016-06-01

    Next-generation sequencing of 16S ribosomal RNA genes (rDNA) and ribosomal RNA (rRNA) was used to characterize water and biofilm microbiome collected from a drinking water distribution system of an office building after its first year of operation. The total bacterial community (rDNA) and active bacterial members (rRNA) sequencing databases were generated by Illumina MiSeq PE250 platform. As estimated by Chao1 index, species richness in cold water system was lower (180-260) in biofilms (Sphingomonas spp., Methylobacterium spp., Limnohabitans spp., Rhizobiales order) than in waters (250-580), (also Methylotenera spp.) (P = 0·005, n = 20). Similarly species richness (Chao1) was slightly higher (210-580) in rDNA libraries compared to rRNA libraries (150-400; P = 0·054, n = 24). Active Mycobacterium spp. was found in cross-linked polyethylene (PEX), but not in corresponding copper pipeline biofilm. Nonpathogenic Legionella spp. was found in rDNA libraries but not in rRNA libraries. Microbial communities differed between water and biofilms, between cold and hot water systems, locations in the building and between water rRNA and rDNA libraries, as shown by clear clusters in principal component analysis (PcoA). By using the rRNA method, we found that not all bacterial community members were active (e.g. Legionella spp.), whereas other members showed increased activity in some locations; for example, Pseudomonas spp. in hot water circulations' biofilm and order Rhizobiales and Limnohabitans spp. in stagnated locations' water and biofilm. rRNA-based methods may be better than rDNA-based methods for evaluating human health implications as rRNA methods can be used to describe the active bacterial fraction. This study indicates that copper as a pipeline material might have an adverse impact on the occurrence of Mycobacterium spp. The activity of Legionella spp. maybe questionable when detected solely by using DNA-based methods. © 2016 The Society for Applied

  9. Ribosomal RNA Genes Contribute to the Formation of Pseudogenes and Junk DNA in the Human Genome.

    Science.gov (United States)

    Robicheau, Brent M; Susko, Edward; Harrigan, Amye M; Snyder, Marlene

    2017-02-01

    Approximately 35% of the human genome can be identified as sequence devoid of a selected-effect function, and not derived from transposable elements or repeated sequences. We provide evidence supporting a known origin for a fraction of this sequence. We show that: 1) highly degraded, but near full length, ribosomal DNA (rDNA) units, including both 45S and Intergenic Spacer (IGS), can be found at multiple sites in the human genome on chromosomes without rDNA arrays, 2) that these rDNA sequences have a propensity for being centromere proximal, and 3) that sequence at all human functional rDNA array ends is divergent from canonical rDNA to the point that it is pseudogenic. We also show that small sequence strings of rDNA (from 45S + IGS) can be found distributed throughout the genome and are identifiable as an "rDNA-like signal", representing 0.26% of the q-arm of HSA21 and ∼2% of the total sequence of other regions tested. The size of sequence strings found in the rDNA-like signal intergrade into the size of sequence strings that make up the full-length degrading rDNA units found scattered throughout the genome. We conclude that the displaced and degrading rDNA sequences are likely of a similar origin but represent different stages in their evolution towards random sequence. Collectively, our data suggests that over vast evolutionary time, rDNA arrays contribute to the production of junk DNA. The concept that the production of rDNA pseudogenes is a by-product of concerted evolution represents a previously under-appreciated process; we demonstrate here its importance. © The Author(s) 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  10. Ribosomal history reveals origins of modern protein synthesis.

    Directory of Open Access Journals (Sweden)

    Ajith Harish

    Full Text Available The origin and evolution of the ribosome is central to our understanding of the cellular world. Most hypotheses posit that the ribosome originated in the peptidyl transferase center of the large ribosomal subunit. However, these proposals do not link protein synthesis to RNA recognition and do not use a phylogenetic comparative framework to study ribosomal evolution. Here we infer evolution of the structural components of the ribosome. Phylogenetic methods widely used in morphometrics are applied directly to RNA structures of thousands of molecules and to a census of protein structures in hundreds of genomes. We find that components of the small subunit involved in ribosomal processivity evolved earlier than the catalytic peptidyl transferase center responsible for protein synthesis. Remarkably, subunit RNA and proteins coevolved, starting with interactions between the oldest proteins (S12 and S17 and the oldest substructure (the ribosomal ratchet in the small subunit and ending with the rise of a modern multi-subunit ribosome. Ancestral ribonucleoprotein components show similarities to in vitro evolved RNA replicase ribozymes and protein structures in extant replication machinery. Our study therefore provides important clues about the chicken-or-egg dilemma associated with the central dogma of molecular biology by showing that ribosomal history is driven by the gradual structural accretion of protein and RNA structures. Most importantly, results suggest that functionally important and conserved regions of the ribosome were recruited and could be relics of an ancient ribonucleoprotein world.

  11. Transcription of ribosomal RNA genes is initiated in the third cell cycle of bovine embryos

    DEFF Research Database (Denmark)

    Jakobsen, Anne Sørig; Avery, Birthe; Dieleman, Steph J.

    2006-01-01

    Transcription from the embryos own ribosomal genes is initiated in most species at the same time as the maternal-embryonic transition. Recently data have indicated that a minor activation may take place during the third embryonic cell cycle in the bovine, one cell cycle before the major activation...

  12. In silico modelling and analysis of ribosome kinetics and aa-tRNA competition

    NARCIS (Netherlands)

    Bošnački, D.; Pronk, T.E.; de Vink, E.P.

    2008-01-01

    We present a formal analysis of ribosome kinetics using probabilistic model checking and the tool Prism. We compute different parameters of the model, like probabilities of translation errors and average insertion times per codon. The model predicts strong correlation to the quotient of the

  13. The nuclear 18S ribosomal RNA gene as a source of phylogenetic information in the genus Taenia.

    Science.gov (United States)

    Yan, Hongbin; Lou, Zhongzi; Li, Li; Ni, Xingwei; Guo, Aijiang; Li, Hongmin; Zheng, Yadong; Dyachenko, Viktor; Jia, Wanzhong

    2013-03-01

    Most species of the genus Taenia are of considerable medical and veterinary significance. In this study, complete nuclear 18S rRNA gene sequences were obtained from seven members of genus Taenia [Taenia multiceps, Taenia saginata, Taenia asiatica, Taenia solium, Taenia pisiformis, Taenia hydatigena, and Taenia taeniaeformis] and a phylogeny inferred using these sequences. Most of the variable sites fall within the variable regions, V1-V5. We show that sequences from the nuclear 18S ribosomal RNA gene have considerable promise as sources of phylogenetic information within the genus Taenia. Furthermore, given that almost all the variable sites lie within defined variable portions of that gene, it will be appropriate and economical to sequence only those regions for additional species of Taenia.

  14. Symportin 1 chaperones 5S RNP assembly during ribosome biogenesis by occupying an essential rRNA-binding site.

    Science.gov (United States)

    Calviño, Fabiola R; Kharde, Satyavati; Ori, Alessandro; Hendricks, Astrid; Wild, Klemens; Kressler, Dieter; Bange, Gert; Hurt, Ed; Beck, Martin; Sinning, Irmgard

    2015-04-07

    During 60S biogenesis, mature 5S RNP consisting of 5S RNA, RpL5 and RpL11, assembles into a pre-60S particle, where docking relies on RpL11 interacting with helix 84 (H84) of the 25S RNA. How 5S RNP is assembled for recruitment into the pre-60S is not known. Here we report the crystal structure of a ternary symportin Syo1-RpL5-N-RpL11 complex and provide biochemical and structural insights into 5S RNP assembly. Syo1 guards the 25S RNA-binding surface on RpL11 and competes with H84 for binding. Pull-down experiments show that H84 releases RpL11 from the ternary complex, but not in the presence of 5S RNA. Crosslinking mass spectrometry visualizes structural rearrangements on incorporation of 5S RNA into the Syo1-RpL5-RpL11 complex supporting the formation of a pre-5S RNP. Our data underline the dual role of Syo1 in ribosomal protein transport and as an assembly platform for 5S RNP.

  15. The origin of the 5S ribosomal RNA molecule could have been caused by a single inverse duplication: strong evidence from its sequences.

    Science.gov (United States)

    Branciamore, Sergio; Di Giulio, Massimo

    2012-04-01

    The secondary structure of the 5S ribosomal RNA (5S rRNA) molecule shows a high degree of symmetry. In order to explain the origin of this symmetry, it has been conjectured that one half of the 5S rRNA molecule was its precursor and that an indirect duplication of this precursor created the other half and thus the current symmetry of the molecule. Here, we have subjected to an empirical test both the indirect duplication model, analysing a total of 684 5S rRNA sequences for complementarity between the two halves of the 5S rRNA, and the direct duplication model analysing in this case the similarity between the two halves of this molecule. In intra- and inter-molecule and intra- and inter-domain comparisons, we find a high statistical support to the hypothesis of a complementarity relationship between the two halves of the 5S rRNA molecule, denying vice versa the hypothesis of similarity between these halves. Therefore, these observations corroborate the indirect duplication model at the expense of the direct duplication model, as reason of the origin of the 5S rRNA molecule. More generally, we discuss and favour the hypothesis that all RNAs and proteins, which present symmetry, did so through gene duplication and not by gradualistic accumulation of few monomers or segments of molecule into a gradualistic growth process. This would be the consequence of the very high propensity that nucleic acids have to be subjected to duplications.

  16. Molecular phylogenetic studies on an unnamed bovine Babesia sp. based on small subunit ribosomal RNA gene sequences.

    Science.gov (United States)

    Luo, Jianxun; Yin, Hong; Liu, Zhijie; Yang, Dongying; Guan, Guiquan; Liu, Aihong; Ma, Miling; Dang, Shengzhi; Lu, Bingyi; Sun, Caiqin; Bai, Qi; Lu, Wenshun; Chen, Puyan

    2005-10-10

    The 18S small subunit ribosomal RNA (18S rRNA) gene of an unnamed Babesia species (designated B. U sp.) was sequenced and analyzed in an attempt to distinguish it from other Babesia species in China. The target DNA segment was amplified by polymerase chain reaction (PCR). The PCR product was ligated to the pGEM-T Easy vector for sequencing. It was found that the length of the 18S rRNA gene of all B. U sp. Kashi 1 and B. U sp. Kashi 2 was 1699 bp and 1689 bp. Two phylogenetic trees were, respectively, inferred based on 18S rRNA sequence of the Chinese bovine Babesia isolates and all of Babesia species available in GenBank. The first tree showed that B. U sp. was situated in the branch between B. major Yili and B. bovis Shannxian, and the second tree revealed that B. U sp. was confined to the same group as B. caballi. The percent identity of B. U sp. with other Chinese Babesia species was between 74.2 and 91.8, while the percent identity between two B. U sp. isolates was 99.7. These results demonstrated that this B. U sp. is different from other Babesia species, but that two B. U sp. isolates obtained with nymphal and adultal Hyalomma anatolicum anatolicum tick belong to the same species.

  17. Restriction fragment length polymorphism (RFLP) analysis of PCR products amplified from 18S ribosomal RNA gene of Trypanosoma congolense

    International Nuclear Information System (INIS)

    Osanyo, A.; Majiwa, P.W.

    2006-01-01

    Oligonucleotide primers were designed from the conserved nucleotide sequences of 18S ribosomal RNA (18S rRNA) gene of protozoans: Trypanosoma brucei, Leishmania donovani, Triponema aequale and Lagenidium gigantum. The primers were used in polymerace chain reaction (PCR) to generate PCR products of approximately 1 Kb using genomic DNA from T. brucei and the four genotypic groups of T. congolense as template. The five PCR products so produced were digested with several restriction enzymes and hybridized to a DNA probe made from T. brucei PCR product of the same 18S rRNA gene region. Most restriction enzyme digests revealed polymorphism with respect to the location of their recognition sites on the five PCR products. The restriction fragment length polymorphism (RFLP) pattern observed indicate that the 18S rRNA gene sequences of trypanosomes: T. brucei and the four genotypes of T.congolence group are heterogeneous. The results further demonstrate that the region that was amplified can be used in specific identification of trypanosomes species and subspecies.(author)

  18. Engineered ribosomal RNA operon copy-number variants of E. coli reveal the evolutionary trade-offs shaping rRNA operon number

    Science.gov (United States)

    Gyorfy, Zsuzsanna; Draskovits, Gabor; Vernyik, Viktor; Blattner, Frederick F.; Gaal, Tamas; Posfai, Gyorgy

    2015-01-01

    Ribosomal RNA (rrn) operons, characteristically present in several copies in bacterial genomes (7 in E. coli), play a central role in cellular physiology. We investigated the factors determining the optimal number of rrn operons in E. coli by constructing isogenic variants with 5–10 operons. We found that the total RNA and protein content, as well as the size of the cells reflected the number of rrn operons. While growth parameters showed only minor differences, competition experiments revealed a clear pattern: 7–8 copies were optimal under conditions of fluctuating, occasionally rich nutrient influx and lower numbers were favored in stable, nutrient-limited environments. We found that the advantages of quick adjustment to nutrient availability, rapid growth and economic regulation of ribosome number all contribute to the selection of the optimal rrn operon number. Our results suggest that the wt rrn operon number of E. coli reflects the natural, ‘feast and famine’ life-style of the bacterium, however, different copy numbers might be beneficial under different environmental conditions. Understanding the impact of the copy number of rrn operons on the fitness of the cell is an important step towards the creation of functional and robust genomes, the ultimate goal of synthetic biology. PMID:25618851

  19. Characterization of the regions from E. coli 16 S RNA covalently linked to ribosomal proteins S4 and S20 after ultraviolet irradiation

    International Nuclear Information System (INIS)

    Ehresmann, B.; Backendorf, C.; Ehresmann, C.; Ebel, J.P.

    1977-01-01

    The use of ultraviolet irradiation to form photochemical covalent bonds between the 16 S RNA and a ribosomal protein is a reliable method to check RNA regions which are interacting with the protein. This technique was successfully used to covalently link RNA or DNA and specific proteins in several cases. In the case of ribosome, it has been shown that the irradiation of 30 S and 50 S subunits using high doses of ultraviolet light allowed the covalent binding of almost all of the ribosomal proteins to the 16 S or 23 S RNAs. Using mild conditions, only proteins S7 and L4 could be covalently linked to the 16 S and 23 S RNAs, respectively, and the 16 S RNA region linked to protein S7 has now been characterized. The specificity of the photoreaction was demonstrated earlier and the tryptic peptides from proteins S4 and S7, photochemically linked to the 16 S RNA complexes, were identified. A report is presented on the sequences of the RNA regions which can be photochemically linked to proteins S4 and S7 after ultraviolet irradiation of the specific S4-16 S RNA and 20 S-16 S RNA complexes

  20. Mapping posttranscriptional modifications in 5S ribosomal RNA by MALDI mass spectrometry

    DEFF Research Database (Denmark)

    Kirpekar, F; Douthwaite, S; Roepstorff, P

    2000-01-01

    RNases in parallel combined with further fragmentation by Post Source Decay (PSD). This approach allows fast and sensitive screening of a purified RNA for posttranscriptional modification, and has been applied on 5S rRNA from two thermophilic microorganisms, the bacterium Bacillus stearothermophilus...... that is clearly conserved with respect to both sequence and position in B. stearothermophilus and H. halobium and to some degree also in H. marismortui. However, no analogous modification was identified in the latter three organisms. We further find that the 5' end of H. halobium 5S rRNA is dephosphorylated......, in contrast to the other 5S rRNA species investigated. The method additionally gives an immediate indication of whether the expected RNA sequence is in agreement with the observed fragment masses. Discrepancies with two of the published 5S rRNA sequences were identified and are reported here....

  1. Genetic characterization of human-pathogenic Cyclospora cayetanensis parasites from three endemic regions at the 18S ribosomal RNA locus.

    Science.gov (United States)

    Sulaiman, Irshad M; Ortega, Ynes; Simpson, Steven; Kerdahi, Khalil

    2014-03-01

    Cyclospora cayetanensis is an apicocomplexan parasite that infects the gastrointestinal tract and causes acute diarrheal disease in humans. In recent years, this human-pathogenic parasite has led to several foodborne outbreaks in the United States and Canada, mostly associated with imported produce. Understanding the biology and epidemiology of C. cayetanensis is difficult because little is known about its origin, possible zoonotic reservoirs, and genetic relationships with other coccidian parasites. Recently, we developed a 70kDa heat shock protein (HSP70) gene based nested PCR protocol for detection of C. cayetanensis parasite and sequenced the PCR products of 16 human isolates from Nepal, Mexico, and Peru. In this study, we have characterized the regions of 18S ribosomal RNA (rRNA) gene of 17 human C. cayetanensis isolates for molecular detection, and also to ascertain the genetic diversity of this parasite. The 18S rRNA primer sets were further tested by PCR amplification followed by nucleotide sequencing of the PCR amplified products of previously characterized C. cayetanensis isolates from three endemic regions at HSP70 locus. Although no genetic polymorphism was observed at the regions of HSP70 locus characterized in our previous study, the data analysis of this study revealed a minor genetic diversity at the 18S rRNA locus among the C. cayetanensis isolates. The 18S rRNA gene-based nested PCR protocol provides a useful genetic marker for the detection of C. cayetanensis parasite and confirms it as a genetically distinct species in genus Cyclospora. The results also supported lack of geographic segregation and existence of genetically homogeneous population for the C. cayetanensis parasites both at the HSP70 as well as at the18S rRNA loci. Published by Elsevier B.V.

  2. Ribosome profiling-guided depletion of an mRNA increases cell growth rate and protein secretion

    DEFF Research Database (Denmark)

    Beuchert Kallehauge, Thomas; Li, Shangzhong; Pedersen, Lasse Ebdrup

    2017-01-01

    Recombinant protein production coopts the host cell machinery to provide high protein yields of industrial enzymes or biotherapeutics. However, since protein translation is energetically expensive and tightly controlled, it is unclear if highly expressed recombinant genes are translated as effici......Recombinant protein production coopts the host cell machinery to provide high protein yields of industrial enzymes or biotherapeutics. However, since protein translation is energetically expensive and tightly controlled, it is unclear if highly expressed recombinant genes are translated...... as efficiently as host genes. Furthermore, it is unclear how the high expression impacts global translation. Here, we present the first genome-wide view of protein translation in an IgG-producing CHO cell line, measured with ribosome profiling. Through this we found that our recombinant mRNAs were translated...... as efficiently as the host cell transcriptome, and sequestered up to 15% of the total ribosome occupancy. During cell culture, changes in recombinant mRNA translation were consistent with changes in transcription, demonstrating that transcript levels influence specific productivity. Using this information, we...

  3. RNase MRP and the RNA processing cascade in the eukaryotic ancestor.

    Science.gov (United States)

    Woodhams, Michael D; Stadler, Peter F; Penny, David; Collins, Lesley J

    2007-02-08

    Within eukaryotes there is a complex cascade of RNA-based macromolecules that process other RNA molecules, especially mRNA, tRNA and rRNA. An example is RNase MRP processing ribosomal RNA (rRNA) in ribosome biogenesis. One hypothesis is that this complexity was present early in eukaryotic evolution; an alternative is that an initial simpler network later gained complexity by gene duplication in lineages that led to animals, fungi and plants. Recently there has been a rapid increase in support for the complexity-early theory because the vast majority of these RNA-processing reactions are found throughout eukaryotes, and thus were likely to be present in the last common ancestor of living eukaryotes, herein called the Eukaryotic Ancestor. We present an overview of the RNA processing cascade in the Eukaryotic Ancestor and investigate in particular, RNase MRP which was previously thought to have evolved later in eukaryotes due to its apparent limited distribution in fungi and animals and plants. Recent publications, as well as our own genomic searches, find previously unknown RNase MRP RNAs, indicating that RNase MRP has a wide distribution in eukaryotes. Combining secondary structure and promoter region analysis of RNAs for RNase MRP, along with analysis of the target substrate (rRNA), allows us to discuss this distribution in the light of eukaryotic evolution. We conclude that RNase MRP can now be placed in the RNA-processing cascade of the Eukaryotic Ancestor, highlighting the complexity of RNA-processing in early eukaryotes. Promoter analyses of MRP-RNA suggest that regulation of the critical processes of rRNA cleavage can vary, showing that even these key cellular processes (for which we expect high conservation) show some species-specific variability. We present our consensus MRP-RNA secondary structure as a useful model for further searches.

  4. The ribosome can prevent aggregation of partially folded protein intermediates: studies using the Escherichia coli ribosome.

    Directory of Open Access Journals (Sweden)

    Bani Kumar Pathak

    Full Text Available BACKGROUND: Molecular chaperones that support de novo folding of proteins under non stress condition are classified as chaperone 'foldases' that are distinct from chaperone' holdases' that provide high affinity binding platform for unfolded proteins and prevent their aggregation specifically under stress conditions. Ribosome, the cellular protein synthesis machine can act as a foldase chaperone that can bind unfolded proteins and release them in folding competent state. The peptidyl transferase center (PTC located in the domain V of the 23S rRNA of Escherichia coli ribosome (bDV RNA is the chaperoning center of the ribosome. It has been proposed that via specific interactions between the RNA and refolding proteins, the chaperone provides information for the correct folding of unfolded polypeptide chains. RESULTS: We demonstrate using Escherichia coli ribosome and variants of its domain V RNA that the ribosome can bind to partially folded intermediates of bovine carbonic anhydrase II (BCAII and lysozyme and suppress aggregation during their refolding. Using mutants of domain V RNA we demonstrate that the time for which the chaperone retains the bound protein is an important factor in determining its ability to suppress aggregation and/or support reactivation of protein. CONCLUSION: The ribosome can behave like a 'holdase' chaperone and has the ability to bind and hold back partially folded intermediate states of proteins from participating in the aggregation process. Since the ribosome is an essential organelle that is present in large numbers in all living cells, this ability of the ribosome provides an energetically inexpensive way to suppress cellular aggregation. Further, this ability of the ribosome might also be crucial in the context that the ribosome is one of the first chaperones to be encountered by a large nascent polypeptide chains that have a tendency to form partially folded intermediates immediately following their synthesis.

  5. Genetic and epigenetic variation in 5S ribosomal RNA genes reveals genome dynamics in Arabidopsis thaliana.

    Science.gov (United States)

    Simon, Lauriane; Rabanal, Fernando A; Dubos, Tristan; Oliver, Cecilia; Lauber, Damien; Poulet, Axel; Vogt, Alexander; Mandlbauer, Ariane; Le Goff, Samuel; Sommer, Andreas; Duborjal, Hervé; Tatout, Christophe; Probst, Aline V

    2018-04-06

    Organized in tandem repeat arrays in most eukaryotes and transcribed by RNA polymerase III, expression of 5S rRNA genes is under epigenetic control. To unveil mechanisms of transcriptional regulation, we obtained here in depth sequence information on 5S rRNA genes from the Arabidopsis thaliana genome and identified differential enrichment in epigenetic marks between the three 5S rDNA loci situated on chromosomes 3, 4 and 5. We reveal the chromosome 5 locus as the major source of an atypical, long 5S rRNA transcript characteristic of an open chromatin structure. 5S rRNA genes from this locus translocated in the Landsberg erecta ecotype as shown by linkage mapping and chromosome-specific FISH analysis. These variations in 5S rDNA locus organization cause changes in the spatial arrangement of chromosomes in the nucleus. Furthermore, 5S rRNA gene arrangements are highly dynamic with alterations in chromosomal positions through translocations in certain mutants of the RNA-directed DNA methylation pathway and important copy number variations among ecotypes. Finally, variations in 5S rRNA gene sequence, chromatin organization and transcripts indicate differential usage of 5S rDNA loci in distinct ecotypes. We suggest that both the usage of existing and new 5S rDNA loci resulting from translocations may impact neighboring chromatin organization.

  6. Activation of the ribosomal RNA genes late in the third cell cycle of porcine embryos

    DEFF Research Database (Denmark)

    Viuff, Dorthe; Greve, Torben; Holm, Peter

    2002-01-01

    ; there was no silver staining at the sites of the rRNA genes and nucleolus precursor bodies. From 30 hpc onwards, most 4-cell embryos had medium size to large clusters of FITC-labeled areas colocalized with silver staining of rRNA gene clusters and fibrillogranular nucleoli. These observations indicate that r...

  7. Import of desired nucleic acid sequences using addressing motif of mitochondrial ribosomal 5S-rRNA for fluorescent in vivo hybridization of mitochondrial DNA and RNA.

    Science.gov (United States)

    Zelenka, Jaroslav; Alán, Lukáš; Jabůrek, Martin; Ježek, Petr

    2014-04-01

    Based on the matrix-addressing sequence of mitochondrial ribosomal 5S-rRNA (termed MAM), which is naturally imported into mitochondria, we have constructed an import system for in vivo targeting of mitochondrial DNA (mtDNA) or mt-mRNA, in order to provide fluorescence hybridization of the desired sequences. Thus DNA oligonucleotides were constructed, containing the 5'-flanked T7 RNA polymerase promoter. After in vitro transcription and fluorescent labeling with Alexa Fluor(®) 488 or 647 dye, we obtained the fluorescent "L-ND5 probe" containing MAM and exemplar cargo, i.e., annealing sequence to a short portion of ND5 mRNA and to the light-strand mtDNA complementary to the heavy strand nd5 mt gene (5'-end 21 base pair sequence). For mitochondrial in vivo fluorescent hybridization, HepG2 cells were treated with dequalinium micelles, containing the fluorescent probes, bringing the probes proximally to the mitochondrial outer membrane and to the natural import system. A verification of import into the mitochondrial matrix of cultured HepG2 cells was provided by confocal microscopy colocalizations. Transfections using lipofectamine or probes without 5S-rRNA addressing MAM sequence or with MAM only were ineffective. Alternatively, the same DNA oligonucleotides with 5'-CACC overhang (substituting T7 promoter) were transcribed from the tetracycline-inducible pENTRH1/TO vector in human embryonic kidney T-REx®-293 cells, while mitochondrial matrix localization after import of the resulting unlabeled RNA was detected by PCR. The MAM-containing probe was then enriched by three-order of magnitude over the natural ND5 mRNA in the mitochondrial matrix. In conclusion, we present a proof-of-principle for mitochondrial in vivo hybridization and mitochondrial nucleic acid import.

  8. A Sensitive and Specific PCR Based Method for Identification of Cryptosporidium Sp. Using New Primers from 18S Ribosomal RNA

    Directory of Open Access Journals (Sweden)

    M Heydarnezhadi

    2011-09-01

    Full Text Available Background: The main goal of the present study was to develop a new sensitive and specific PCR based method for Identification of Cryptosporidium sp. using novel primers from 18S ribosomal RNA. Cryptosporidi­osis in high-risk host groups particularly in neonates and immuno-compromised individuals may result in death. To the best of our knowledge this is the first study regarding develop a new PCR based method to diagnose the cryptosporidiosis in Iran.Methods: A total of 850 human fecal samples from patients clinically suspected to cryptosporidiosis and 100 healthy and diarrheic cattle stool specimens were collected. The simplified formol-ether concentration method was carried out for all samples. They were then examined microscopically by modified Ziehl-Neel­sen staining method. Total DNA was extracted by QIA amp DNA stool mini kit was carried out by using designed prim­ers.Results: Twenty nine cases of cryptosporidiosis infection in human and 30 samples from cattle microscopi­cally were posi­tive. The described primary and nested PCR method could detect all Cryptospori­dium positive samples from human and cattle. Regards to suspected negative samples in pri­mary PCR examination, the Nested PCR could ap­prove two more positive results. Furthermore, Nested PCR analysis was able to detect one more case which was nega­tive in both microscopically examination and primary PCR. Specificity of the test was 100%. Sensitivity of Nested PCR in comparison to our gold standard; microscopy after Ridley concentration modified ziehl-Neelsen, was 100 %.Conclusion: Our developed PCR based method by using new primers devised from 18S ribosomal RNA revealed the ability for identification of the Cryptosporidium species such as C. parvum and C. huminis with high specificity and sensitivity.

  9. Affinity labelling in situ of the bL12 protein on E. coli 70S ribosomes by means of a tRNA dialdehyde derivative.

    Science.gov (United States)

    Hountondji, Codjo; Créchet, Jean-Bernard; Le Caër, Jean-Pierre; Lancelot, Véronique; Cognet, Jean A H; Baouz, Soria

    2017-12-01

    In this report, we have used periodate-oxidized tRNA (tRNAox) as an affinity laleling reagent to demonstrate that: (i) the bL12 protein contacts the CCA-arm of P-site bound tRNA on the Escherichia coli 70S ribosomes; (ii) the stoichiometry of labelling is one molecule of tRNAox bound to one polypeptide chain of endogenous bL12; (iii) cross-linking in situ of bL12 with tRNAox on the ribosomes provokes the loss of activity; (iv) intact tRNA protects bL12 in the 70S ribosomes against cross-linking with tRNAox; (v) both tRNAox and pyridoxal 5'-phosphate (PLP) compete for the same or for proximal cross-linking site(s) on bL12 inside the ribosome; (vi) the stoichiometry of cross-linking of PLP to the recombinant E. coli bL12 protein is one molecule of PLP covalently bound per polypeptide chain; (vii) the amino acid residue of recombinant bL12 cross-linked with PLP is Lys-65; (viii) Lys-65 of E. coli bL12 corresponds to Lys-53 of eL42 which was previously shown to cross-link with P-site bound tRNAox on human 80S ribosomes in situ; (ix) finally, E. coli bL12 and human eL42 proteins display significant primary structure similarities, which argues for evolutionary conservation of these two proteins located at the tRNA-CCA binding site on eubacterial and eukaryal ribosomes. © The Authors 2017. Published by Oxford University Press on behalf of the Japanese Biochemical Society. All rights reserved.

  10. Involvement of DNA topoisomerase I in transcription of human ribosomal RNA genes

    International Nuclear Information System (INIS)

    Zhang, H.; Wang, J.C.; Liu, L.F.

    1988-01-01

    Treatment of HeLa cells with a DNA topoisomerase I-specific inhibitor, camptothecin, results in rapid cessation of the synthesis of the 45S rRNA precursor. The inhibition of rRNA synthesis is reversible following drug removal and correlates with the presence of camptothecin-trapped topoisomerase I-DNA abortive complexes, which can be detected as topoisomerase I-linked DNA breaks upon lysis with sodium dodecyl sulfate. These breaks were found to be concentrated within the transcribed region of human rRNA genes. No such sites can be detected in the inactive human rRNA genes in mouse-human hybrid cells, suggesting a preferential association of topoisomerase I with actively transcribed genes. The distribution of RNA polymerase molecules along the transcription unit of human rRNA genes in camptothecin-treated HeLa cells, as assayed by nuclear run-on transcription, shows a graded decrease of the RNA polymerase density toward the 3' end of the transcription unit; the density is minimally affected near the 5' start of the transcription unit. These results suggest that DNA topoisomerase I is normally involved in the elongation step of transcription, especially when the transcripts are long, and that camptothecin interferes with this role

  11. A unique enhancer boundary complex on the mouse ribosomal RNA genes persists after loss of Rrn3 or UBF and the inactivation of RNA polymerase I transcription.

    Science.gov (United States)

    Herdman, Chelsea; Mars, Jean-Clement; Stefanovsky, Victor Y; Tremblay, Michel G; Sabourin-Felix, Marianne; Lindsay, Helen; Robinson, Mark D; Moss, Tom

    2017-07-01

    Transcription of the several hundred of mouse and human Ribosomal RNA (rRNA) genes accounts for the majority of RNA synthesis in the cell nucleus and is the determinant of cytoplasmic ribosome abundance, a key factor in regulating gene expression. The rRNA genes, referred to globally as the rDNA, are clustered as direct repeats at the Nucleolar Organiser Regions, NORs, of several chromosomes, and in many cells the active repeats are transcribed at near saturation levels. The rDNA is also a hotspot of recombination and chromosome breakage, and hence understanding its control has broad importance. Despite the need for a high level of rDNA transcription, typically only a fraction of the rDNA is transcriptionally active, and some NORs are permanently silenced by CpG methylation. Various chromatin-remodelling complexes have been implicated in counteracting silencing to maintain rDNA activity. However, the chromatin structure of the active rDNA fraction is still far from clear. Here we have combined a high-resolution ChIP-Seq protocol with conditional inactivation of key basal factors to better understand what determines active rDNA chromatin. The data resolve questions concerning the interdependence of the basal transcription factors, show that preinitiation complex formation is driven by the architectural factor UBF (UBTF) independently of transcription, and that RPI termination and release corresponds with the site of TTF1 binding. They further reveal the existence of an asymmetric Enhancer Boundary Complex formed by CTCF and Cohesin and flanked upstream by phased nucleosomes and downstream by an arrested RNA Polymerase I complex. We find that the Enhancer Boundary Complex is the only site of active histone modification in the 45kbp rDNA repeat. Strikingly, it not only delimits each functional rRNA gene, but also is stably maintained after gene inactivation and the re-establishment of surrounding repressive chromatin. Our data define a poised state of rDNA chromatin

  12. A unique enhancer boundary complex on the mouse ribosomal RNA genes persists after loss of Rrn3 or UBF and the inactivation of RNA polymerase I transcription.

    Directory of Open Access Journals (Sweden)

    Chelsea Herdman

    2017-07-01

    Full Text Available Transcription of the several hundred of mouse and human Ribosomal RNA (rRNA genes accounts for the majority of RNA synthesis in the cell nucleus and is the determinant of cytoplasmic ribosome abundance, a key factor in regulating gene expression. The rRNA genes, referred to globally as the rDNA, are clustered as direct repeats at the Nucleolar Organiser Regions, NORs, of several chromosomes, and in many cells the active repeats are transcribed at near saturation levels. The rDNA is also a hotspot of recombination and chromosome breakage, and hence understanding its control has broad importance. Despite the need for a high level of rDNA transcription, typically only a fraction of the rDNA is transcriptionally active, and some NORs are permanently silenced by CpG methylation. Various chromatin-remodelling complexes have been implicated in counteracting silencing to maintain rDNA activity. However, the chromatin structure of the active rDNA fraction is still far from clear. Here we have combined a high-resolution ChIP-Seq protocol with conditional inactivation of key basal factors to better understand what determines active rDNA chromatin. The data resolve questions concerning the interdependence of the basal transcription factors, show that preinitiation complex formation is driven by the architectural factor UBF (UBTF independently of transcription, and that RPI termination and release corresponds with the site of TTF1 binding. They further reveal the existence of an asymmetric Enhancer Boundary Complex formed by CTCF and Cohesin and flanked upstream by phased nucleosomes and downstream by an arrested RNA Polymerase I complex. We find that the Enhancer Boundary Complex is the only site of active histone modification in the 45kbp rDNA repeat. Strikingly, it not only delimits each functional rRNA gene, but also is stably maintained after gene inactivation and the re-establishment of surrounding repressive chromatin. Our data define a poised state

  13. Mapping posttranscriptional modifications in 5S ribosomal RNA by MALDI mass spectrometry.

    Science.gov (United States)

    Kirpekar, F; Douthwaite, S; Roepstorff, P

    2000-02-01

    We present a method to screen RNA for posttranscriptional modifications based on Matrix Assisted Laser Desorption/Ionization mass spectrometry (MALDI-MS). After the RNA is digested to completion with a nucleotide-specific RNase, the fragments are analyzed by mass spectrometry. A comparison of the observed mass data with the data predicted from the gene sequence identifies fragments harboring modified nucleotides. Fragments larger than dinucleotides were valuable for the identification of posttranscriptional modifications. A more refined mapping of RNA modifications can be obtained by using two RNases in parallel combined with further fragmentation by Post Source Decay (PSD). This approach allows fast and sensitive screening of a purified RNA for posttranscriptional modification, and has been applied on 5S rRNA from two thermophilic microorganisms, the bacterium Bacillus stearothermophilus and the archaeon Sulfolobus acidocaldarius, as well as the halophile archaea Halobacterium halobium and Haloarcula marismortui. One S. acidocaldarius posttranscriptional modification was identified and was further characterized by PSD as a methylation of cytidine32. The modified C is located in a region that is clearly conserved with respect to both sequence and position in B. stearothermophilus and H. halobium and to some degree also in H. marismortui. However, no analogous modification was identified in the latter three organisms. We further find that the 5' end of H. halobium 5S rRNA is dephosphorylated, in contrast to the other 5S rRNA species investigated. The method additionally gives an immediate indication of whether the expected RNA sequence is in agreement with the observed fragment masses. Discrepancies with two of the published 5S rRNA sequences were identified and are reported here.

  14. Mitochondrial 12S ribosomal RNA A1555G mutation associated with cardiomyopathy and hearing loss following high-dose chemotherapy and repeated aminoglycoside exposure

    DEFF Research Database (Denmark)

    Skou, Anne-Sofie; Tranebjærg, Lisbeth; Jensen, Tim

    2014-01-01

    A 19-month-old girl with the A1555G mitochondrial mutation in the 12S ribosomal RNA gene and acute myelogenous leukemia developed dilated cardiomyopathy and bilateral sensorineural hearing loss before undergoing allogeneic stem cell transplantation. She had received gentamicin during episodes of ...... of febrile neutropenia. Testing for the A1555G mutation is recommended in patients frequently treated with aminoglycosides....

  15. A ribosomal RNA gene intergenic spacer based PCR and DGGE fingerprinting method for the analysis of specific rhizobial communities in soil

    NARCIS (Netherlands)

    de Oliveira, VM; Manfio, GP; Coutinho, HLD; Keijzer-Wolters, AC; van Elsas, JD

    A direct molecular method for assessing the diversity of specific populations of rhizobia in soil, based on nested PCR amplification of 16S-23S ribosomal RNA gene (rDNA) intergenic spacer (IGS) sequences, was developed. Initial generic amplification of bacterial rDNA IGS sequences from soil DNA was

  16. A ribosomal RNA gene intergenic spacer based PCR and DGGE fingerprinting method for the analysis of specific rhizobial communities in soil

    NARCIS (Netherlands)

    Oliveira, de V.M.; Manfio, G.P.; Coutinho, H.L.D.; Keijzer-Wolters, A.C.; Elsas, van J.D.

    2006-01-01

    A direct molecular method for assessing the diversity of specific populations of rhizobia in soil, based on nested PCR amplification of 16S-23S ribosomal RNA gene (rDNA) intergenic spacer (IGS) sequences, was developed. Initial generic amplification of bacterial rDNA IGS sequences from soil DNA was

  17. Requirement for a conserved, tertiary interaction in the core of 23S ribosomal RNA

    DEFF Research Database (Denmark)

    Aagaard, C; Douthwaite, S

    1994-01-01

    RNA. Every substitution that disrupts the potential for Watson-Crick base pairing between these positions reduces or abolishes the participation of 23S rRNA in protein synthesis. All mutant 23S rRNAs are assembled into 50S subunits, but the mutant subunits are less able to stably interact with 30S subunits...... is nonfunctional. In contrast to the considerable effect the mutations have on function, they impart only slight structural changes on the naked rRNA, and these are limited to the immediate vicinity of the mutations. The data show that positions 1262 and 2017 pair in a Watson-Crick manner, but the data also...

  18. Critical 23S rRNA interactions for macrolide-dependent ribosome stalling on the ErmCL nascent peptide chain.

    Science.gov (United States)

    Koch, Miriam; Willi, Jessica; Pradère, Ugo; Hall, Jonathan; Polacek, Norbert

    2017-06-20

    The nascent peptide exit tunnel has recently been identified as a functional region of ribosomes contributing to translation regulation and co-translational protein folding. Inducible expression of the erm resistance genes depends on ribosome stalling at specific codons of an upstream open reading frame in the presence of an exit tunnel-bound macrolide antibiotic. The molecular basis for this translation arrest is still not fully understood. Here, we used a nucleotide analog interference approach to unravel important functional groups on 23S rRNA residues in the ribosomal exit tunnel for ribosome stalling on the ErmC leader peptide. By replacing single nucleobase functional groups or even single atoms we were able to demonstrate the importance of A2062, A2503 and U2586 for drug-dependent ribosome stalling. Our data show that the universally conserved A2062 and A2503 are capable of forming a non-Watson-Crick base pair that is critical for sensing and transmitting the stalling signal from the exit tunnel back to the peptidyl transferase center of the ribosome. The nucleobases of A2062, A2503 as well as U2586 do not contribute significantly to the overall mechanism of protein biosynthesis, yet their elaborate role for co-translational monitoring of nascent peptide chains inside the exit tunnel can explain their evolutionary conservation. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  19. Mapping posttranscriptional modifications in 5S ribosomal RNA by MALDI mass spectrometry.

    OpenAIRE

    Kirpekar, F; Douthwaite, S; Roepstorff, P

    2000-01-01

    We present a method to screen RNA for posttranscriptional modifications based on Matrix Assisted Laser Desorption/Ionization mass spectrometry (MALDI-MS). After the RNA is digested to completion with a nucleotide-specific RNase, the fragments are analyzed by mass spectrometry. A comparison of the observed mass data with the data predicted from the gene sequence identifies fragments harboring modified nucleotides. Fragments larger than dinucleotides were valuable for the identification of post...

  20. DEAD-box helicase DDX27 regulates 3′ end formation of ribosomal 47S RNA and stably associates with the PeBoW-complex

    Energy Technology Data Exchange (ETDEWEB)

    Kellner, Markus; Rohrmoser, Michaela [Department of Molecular Epigenetics, Helmholtz Center Munich, Center for Integrated Protein Science Munich (CIPSM), Marchioninistr. 25, Munich 81377 (Germany); Forné, Ignasi [Adolf Butenandt Institute, Ludwig Maximilians University of Munich, Center for Integrated Protein Science Munich (CIPSM), Schillerstr. 44, Munich 80336 (Germany); Voss, Kirsten; Burger, Kaspar; Mühl, Bastian; Gruber-Eber, Anita [Department of Molecular Epigenetics, Helmholtz Center Munich, Center for Integrated Protein Science Munich (CIPSM), Marchioninistr. 25, Munich 81377 (Germany); Kremmer, Elisabeth [Institute of Molecular Immunology, Helmholtz Center Munich, Marchioninistr. 25, Munich 81377 (Germany); Imhof, Axel [Adolf Butenandt Institute, Ludwig Maximilians University of Munich, Center for Integrated Protein Science Munich (CIPSM), Schillerstr. 44, Munich 80336 (Germany); Eick, Dirk, E-mail: eick@helmholtz-muenchen.de [Department of Molecular Epigenetics, Helmholtz Center Munich, Center for Integrated Protein Science Munich (CIPSM), Marchioninistr. 25, Munich 81377 (Germany)

    2015-05-15

    PeBoW, a trimeric complex consisting of pescadillo (Pes1), block of proliferation (Bop1), and the WD repeat protein 12 (WDR12), is essential for processing and maturation of mammalian 5.8S and 28S ribosomal RNAs. Applying a mass spectrometric analysis, we identified the DEAD-box helicase DDX27 as stably associated factor of the PeBoW-complex. DDX27 interacts with the PeBoW-complex via an evolutionary conserved F×F motif in the N-terminal domain and is recruited to the nucleolus via its basic C-terminal domain. This recruitment is RNA-dependent and occurs independently of the PeBoW-complex. Interestingly, knockdown of DDX27, but not of Pes1, induces the accumulation of an extended form of the primary 47S rRNA. We conclude that DDX27 can interact specifically with the Pes1 and Bop1 but fulfils critical function(s) for proper 3′ end formation of 47S rRNA independently of the PeBoW-complex. - Highlights: • DEAD-box helicase DDX27 is a new constituent of the PeBoW-complex. • The N-terminal F×F motif of DDX27 interacts with the PeBoW components Pes1 and Bop1. • Nucleolar anchoring of DDX27 via its basic C-terminal domain is RNA dependent. • Knockdown of DDX27 induces a specific defect in 3′ end formation of 47S rRNA.

  1. Analysis of ribosomal RNA stability in dead cells of wine yeast by quantitative PCR.

    Science.gov (United States)

    Sunyer-Figueres, Merce; Wang, Chunxiao; Mas, Albert

    2018-04-02

    During wine production, some yeasts enter a Viable But Not Culturable (VBNC) state, which may influence the quality and stability of the final wine through remnant metabolic activity or by resuscitation. Culture-independent techniques are used for obtaining an accurate estimation of the number of live cells, and quantitative PCR could be the most accurate technique. As a marker of cell viability, rRNA was evaluated by analyzing its stability in dead cells. The species-specific stability of rRNA was tested in Saccharomyces cerevisiae, as well as in three species of non-Saccharomyces yeast (Hanseniaspora uvarum, Torulaspora delbrueckii and Starmerella bacillaris). High temperature and antimicrobial dimethyl dicarbonate (DMDC) treatments were efficient in lysing the yeast cells. rRNA gene and rRNA (as cDNA) were analyzed over 48 h after cell lysis by quantitative PCR. The results confirmed the stability of rRNA for 48 h after the cell lysis treatments. To sum up, rRNA may not be a good marker of cell viability in the wine yeasts that were tested. Copyright © 2018 Elsevier B.V. All rights reserved.

  2. Mitochondrial 16S ribosomal RNA gene for forensic identification of crocodile species.

    Science.gov (United States)

    Naga Jogayya, K; Meganathan, P R; Dubey, Bhawna; Haque, I

    2013-05-01

    All crocodilians are under various threats due to over exploitation and these species have been listed in Appendix I or II of CITES. Lack of molecular techniques for the forensic identification of confiscated samples makes it difficult to enforce the law. Therefore, we herein present a molecular method developed on the basis on 16S rRNA gene of mitochondrial DNA for identification of crocodile species. We have developed a set of 16S rRNA primers for PCR based identification of crocodilian species. These novel primers amplify partial 16S rRNA sequences of six crocodile species which can be later combined to obtain a larger region (1290 bp) of 16S rRNA gene. This 16S rRNA gene could be used as an effective tool for forensic authentication of crocodiles. The described primers hold great promise in forensic identification of crocodile species, which can aid in the effective enforcement of law and conservation of these species. Copyright © 2012 Elsevier Ltd and Faculty of Forensic and Legal Medicine. All rights reserved.

  3. Characterization of 16S rRNA Processing with Pre-30S Subunit Assembly Intermediates from E. coli.

    Science.gov (United States)

    Smith, Brian A; Gupta, Neha; Denny, Kevin; Culver, Gloria M

    2018-06-08

    Ribosomal RNA (rRNA) is a major component of ribosomes and is fundamental to the process of translation. In bacteria, 16S rRNA is a component of the small ribosomal subunit and plays a critical role in mRNA decoding. rRNA maturation entails the removal of intervening spacer sequences contained within the pre-rRNA transcript by nucleolytic enzymes. Enzymatic activities involved in maturation of the 5'-end of 16S rRNA have been identified, but those involved in 3'-end maturation of 16S rRNA are more enigmatic. Here, we investigate molecular details of 16S rRNA maturation using purified in vivo-formed small subunit (SSU) assembly intermediates (pre-SSUs) from wild-type Escherichia coli that contain precursor 16S rRNA (17S rRNA). Upon incubation of pre-SSUs with E. coli S100 cell extracts or purified enzymes implicated in 16S rRNA processing, the 17S rRNA is processed into additional intermediates and mature 16S rRNA. These results illustrate that exonucleases RNase R, RNase II, PNPase, and RNase PH can process the 3'-end of pre-SSUs in vitro. However, the endonuclease YbeY did not exhibit nucleolytic activity with pre-SSUs under these conditions. Furthermore, these data demonstrate that multiple pathways facilitate 16S rRNA maturation with pre-SSUs in vitro, with the dominant pathways entailing complete processing of the 5'-end of 17S rRNA prior to 3'-end maturation or partial processing of the 5'-end with concomitant processing of the 3'-end. These results reveal the multifaceted nature of SSU biogenesis and suggest that E. coli may be able to escape inactivation of any one enzyme by using an existing complementary pathway. Copyright © 2018 Elsevier Ltd. All rights reserved.

  4. On the Spatial Organization of mRNA, Plasmids, and Ribosomes in a Bacterial Host Overexpressing Membrane Proteins.

    Directory of Open Access Journals (Sweden)

    Lieke A van Gijtenbeek

    2016-12-01

    Full Text Available By using fluorescence imaging, we provide a time-resolved single-cell view on coupled defects in transcription, translation, and growth during expression of heterologous membrane proteins in Lactococcus lactis. Transcripts encoding poorly produced membrane proteins accumulate in mRNA-dense bodies at the cell poles, whereas transcripts of a well-expressed homologous membrane protein show membrane-proximal localization in a translation-dependent fashion. The presence of the aberrant polar mRNA foci correlates with cessation of cell division, which is restored once these bodies are cleared. In addition, activation of the heat-shock response and a loss of nucleoid-occluded ribosomes are observed. We show that the presence of a native-like N-terminal domain is key to SRP-dependent membrane localization and successful production of membrane proteins. The work presented gives new insights and detailed understanding of aberrant membrane protein biogenesis, which can be used for strategies to optimize membrane protein production.

  5. ITSoneDB: a comprehensive collection of eukaryotic ribosomal RNA Internal Transcribed Spacer 1 (ITS1) sequences.

    Science.gov (United States)

    Santamaria, Monica; Fosso, Bruno; Licciulli, Flavio; Balech, Bachir; Larini, Ilaria; Grillo, Giorgio; De Caro, Giorgio; Liuni, Sabino; Pesole, Graziano

    2018-01-04

    A holistic understanding of environmental communities is the new challenge of metagenomics. Accordingly, the amplicon-based or metabarcoding approach, largely applied to investigate bacterial microbiomes, is moving to the eukaryotic world too. Indeed, the analysis of metabarcoding data may provide a comprehensive assessment of both bacterial and eukaryotic composition in a variety of environments, including human body. In this respect, whereas hypervariable regions of the 16S rRNA are the de facto standard barcode for bacteria, the Internal Transcribed Spacer 1 (ITS1) of ribosomal RNA gene cluster has shown a high potential in discriminating eukaryotes at deep taxonomic levels. As metabarcoding data analysis rely on the availability of a well-curated barcode reference resource, a comprehensive collection of ITS1 sequences supplied with robust taxonomies, is highly needed. To address this issue, we created ITSoneDB (available at http://itsonedb.cloud.ba.infn.it/) which in its current version hosts 985 240 ITS1 sequences spanning over 134 000 eukaryotic species. Each ITS1 is mapped on the NCBI reference taxonomy with its start and end positions precisely annotated. ITSoneDB has been developed in agreement to the FAIR guidelines by enabling the users to query and download its content through a simple web-interface and access relevant metadata by cross-linking to European Nucleotide Archive. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  6. Pseudoknot in domain II of 23 S rRNA is essential for ribosome function

    DEFF Research Database (Denmark)

    Rosendahl, G; Hansen, L H; Douthwaite, S

    1995-01-01

    The structure of domain II in all 23 S (and 23 S-like) rRNAs is constrained by a pseudoknot formed between nucleotides 1005 and 1138, and between 1006 and 1137 (Escherichia coli numbering). These nucleotides are exclusively conserved as 1005C.1138G and 1006C.1137G pairs in all Bacteria, Archaea...... increased accessibility in the rRNA structure close to the sites of the mutations. The degree to which the mutations increase rRNA accessibility correlates with the severity of their phenotypic effects. Nucleotide 1131G is extremely reactive to dimethyl sulphate modification in wild-type subunits...

  7. Exploiting Pre-rRNA Processing in Diamond Blackfan Anemia Gene Discovery and Diagnosis

    Science.gov (United States)

    Farrar, Jason E.; Quarello, Paola; Fisher, Ross; O’Brien, Kelly A.; Aspesi, Anna; Parrella, Sara; Henson, Adrianna L.; Seidel, Nancy E.; Atsidaftos, Eva; Prakash, Supraja; Bari, Shahla; Garelli, Emanuela; Arceci, Robert J.; Dianzani, Irma; Ramenghi, Ugo; Vlachos, Adrianna; Lipton, Jeffrey M.; Bodine, David M.; Ellis, Steven R.

    2014-01-01

    Diamond Blackfan anemia (DBA), a syndrome primarily characterized by anemia and physical abnormalities, is one among a group of related inherited bone marrow failure syndromes (IBMFS) which share overlapping clinical features. Heterozygous mutations or single-copy deletions have been identified in 12 ribosomal protein genes in approximately 60% of DBA cases, with the genetic etiology unexplained in most remaining patients. Unlike many IBMFS, for which functional screening assays complement clinical and genetic findings, suspected DBA in the absence of typical alterations of the known genes must frequently be diagnosed after exclusion of other IBMFS. We report here a novel deletion in a child that presented such a diagnostic challenge and prompted development of a novel functional assay that can assist in the diagnosis of a significant fraction of patients with DBA. The ribosomal proteins affected in DBA are required for pre-rRNA processing, a process which can be interrogated to monitor steps in the maturation of 40S and 60S ribosomal subunits. In contrast to prior methods used to assess pre-rRNA processing, the assay reported here, based on capillary electrophoresis measurement of the maturation of rRNA in pre-60S ribosomal subunits, would be readily amenable to use in diagnostic laboratories. In addition to utility as a diagnostic tool, we applied this technique to gene discovery in DBA, resulting in the identification of RPL31 as a novel DBA gene. PMID:25042156

  8. Phylogenetic analysis of subgenus vigna species using nuclear ribosomal RNA ITS: evidence of hybridization among Vigna unguiculata subspecies.

    Science.gov (United States)

    Vijaykumar, Archana; Saini, Ajay; Jawali, Narendra

    2010-01-01

    Molecular phylogeny among species belonging to subgenus Vigna (genus Vigna) was inferred based on internal transcribed spacer (ITS) sequences of 18S-5.8S-26S ribosomal RNA gene unit. Analysis showed a total of 356 polymorphic sites of which approximately 80% were parsimony informative. Phylogenetic reconstruction by neighbor joining and maximum parsimony methods placed the 57 Vigna accessions (belonging to 15 species) into 5 major clades. Five species viz. Vigna heterophylla, Vigna pubigera, Vigna parkeri, Vigna laurentii, and Vigna gracilis whose position in the subgenus was previously not known were placed in the section Vigna. A single accession (Vigna unguiculata ssp. tenuis, NI 1637) harbored 2 intragenomic ITS variants, indicative of 2 different types of ribosomal DNA (rDNA) repeat units. ITS variant type-I was close to ITS from V. unguiculata ssp. pubescens, whereas type-II was close to V. unguiculata ssp. tenuis. Transcript analysis clearly demonstrates that in accession NI 1637, rDNA repeat units with only type-II ITS variants are transcriptionally active. Evidence from sequence analysis (of 5.8S, ITS1, and ITS2) and secondary structure analysis (of ITS1 and ITS2) indicates that the type-I ITS variant probably does not belong to the pseudogenic rDNA repeat units. The results from phylogenetic and transcript analysis suggest that the rDNA units with the type-I ITS may have introgressed as a result of hybridization (between ssp. tenuis and ssp. pubescens); however, it has been epigenetically silenced. The results also demonstrate differential evolution of ITS sequence among wild and cultivated forms of V. unguiculata.

  9. Highly divergent 16S rRNA sequences in ribosomal operons of Scytonema hyalinum (Cyanobacteria)

    Czech Academy of Sciences Publication Activity Database

    Johansen, J. R.; Mareš, Jan; Pietrasiak, N.; Bohunická, Markéta; Zima, Jan; Štenclová, L.; Hauer, Tomáš

    2017-01-01

    Roč. 12, č. 10 (2017), č. článku e0186393. E-ISSN 1932-6203 R&D Projects: GA ČR(CZ) GA15-11912S Institutional support: RVO:67985939 Keywords : rRNA operon * heterogenita * Scytonema hyalinum Subject RIV: EF - Botanics OBOR OECD: Plant sciences, botany Impact factor: 2.806, year: 2016

  10. Highly divergent 16S rRNA sequences in ribosomal operons of Scytonema hyalinum (Cyanobacteria)

    Czech Academy of Sciences Publication Activity Database

    Johansen, J. R.; Mareš, Jan; Pietrasiak, N.; Bohunická, M.; Zima Jr., J.; Štenclová, Lenka; Hauer, T.

    2017-01-01

    Roč. 12, č. 10 (2017), č. článku e0186393. E-ISSN 1932-6203 Institutional support: RVO:60077344 Keywords : rRNA operon * heterogenita * Scytonema hyalinum Subject RIV: EF - Botanics OBOR OECD: Microbiology Impact factor: 2.806, year: 2016

  11. Ribosomal RNA genes challenge the monophyly of the Hyalospheniidae (Amoebozoa: Arcellinida)

    DEFF Research Database (Denmark)

    Lara, Enrique; Heger, Thierry J; Ekelund, Flemming

    2008-01-01

    causes confusion in the phylogeny, taxonomy and the debate on cosmopolitanism of free-living protists. Here we present a SSU rRNA-based phylogeny of the Hyalospheniidae including the most common species. Similar to the filose testate amoebae of the order Euglyphida the most basal clades have a terminal...

  12. Development of molecular cytogenetics and physical mapping of ribosomal RNA genes in Lupinus

    Czech Academy of Sciences Publication Activity Database

    Naganowska, B.; Doležel, Jaroslav; Swiecicki, W. K.

    2003-01-01

    Roč. 46, - (2003), s. 211-215 ISSN 0006-3134 R&D Projects: GA ČR GA521/03/0595 Institutional research plan: CEZ:AV0Z5038910 Keywords : fluorescent in situ hybridization * Lupinus sp. * rRNA genes Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 0.919, year: 2003

  13. Crystallization of the two-domain N-terminal fragment of the archaeal ribosomal protein L10(P0) in complex with a specific fragment of 23S rRNA

    Science.gov (United States)

    Kravchenko, O. V.; Mitroshin, I. V.; Gabdulkhakov, A. G.; Nikonov, S. V.; Garber, M. B.

    2011-07-01

    Lateral L12-stalk (P1-stalk in Archaea, P1/P2-stalk in eukaryotes) is an obligatory morphological element of large ribosomal subunits in all organisms studied. This stalk is composed of the complex of ribosomal proteins L10(P0) and L12(P1) and interacts with 23S rRNA through the protein L10(P0). L12(P1)-stalk is involved in the formation of GTPase center of the ribosome and plays an important role in the ribosome interaction with translation factors. High mobility of this stalk puts obstacles in determination of its structure within the intact ribosome. Crystals of a two-domain N-terminal fragment of ribosomal protein L10(P0) from the archaeon Methanococcus jannaschii in complex with a specific fragment of rRNA from the same organism have been obtained. The crystals diffract X-rays at 3.2 Å resolution.

  14. Crystallization of the two-domain N-terminal fragment of the archaeal ribosomal protein L10(P0) in complex with a specific fragment of 23S rRNA

    Energy Technology Data Exchange (ETDEWEB)

    Kravchenko, O. V.; Mitroshin, I. V.; Gabdulkhakov, A. G.; Nikonov, S. V.; Garber, M. B., E-mail: garber@vega.protres.ru [Institute of Protein Research RAS (Russian Federation)

    2011-07-15

    Lateral L12-stalk (P1-stalk in Archaea, P1/P2-stalk in eukaryotes) is an obligatory morphological element of large ribosomal subunits in all organisms studied. This stalk is composed of the complex of ribosomal proteins L10(P0) and L12(P1) and interacts with 23S rRNA through the protein L10(P0). L12(P1)-stalk is involved in the formation of GTPase center of the ribosome and plays an important role in the ribosome interaction with translation factors. High mobility of this stalk puts obstacles in determination of its structure within the intact ribosome. Crystals of a two-domain N-terminal fragment of ribosomal protein L10(P0) from the archaeon Methanococcus jannaschii in complex with a specific fragment of rRNA from the same organism have been obtained. The crystals diffract X-rays at 3.2 Angstrom-Sign resolution.

  15. The importance of highly conserved nucleotides in the binding region of chloramphenicol at the peptidyl transfer centre of Escherichia coli 23S ribosomal RNA

    DEFF Research Database (Denmark)

    Vester, Birte; Garrett, Roger Antony

    1988-01-01

    in vivo on a plasmid-encoded rRNA (rrnB) operon and each one yielded dramatically altered phenotypes. Cells exhibiting A2060----C or A2450----C transversions were inviable and it was shown by inserting the mutated genes after a temperature-inducible promoter that the mutant RNAs were directly responsible...... into 50S subunits, but while the two lethal mutant RNAs were strongly selected against in 70S ribosomes, the plasmid-encoded A2503----C RNA was preferred over the chromosome-encoded RNA, contrary to current regulatory theories. The results establish the critical structural and functional importance...

  16. Morpholino spin-labeling for base-pair sequencing of a 3'-terminal RNA stem by proton homonuclear Overhauser enhancements: yeast ribosomal 5S RNA

    International Nuclear Information System (INIS)

    Lee, K.M.; Marshall, A.G.

    1987-01-01

    Base-pair sequences for 5S and 5.8S RNAs are not readily extracted from proton homonuclear nuclear Overhauser enhancement (NOE) connectivity experiments alone, due to extensive peak overlap in the downfield (11-15 ppm) proton NMR spectrum. In this paper, we introduce a new method for base-pair proton peak assignment for ribosomal RNAs, based upon the distance-dependent broadening of the resonances of base-pair protons spatially proximal to a paramagnetic group. Introduction of a nitroxide spin-label covalently attached to the 3'-terminal ribose provides an unequivocal starting point for base-pair hydrogen-bond proton NMR assignment. Subsequent NOE connectivities then establish the base-pair sequence for the terminal stem of a 5S RNA. Periodate oxidation of yeast 5S RNA, followed by reaction with 4-amino-2,2,6,6-tetramethylpiperidinyl-1-oxy (TEMPO-NH2) and sodium borohydride reduction, produces yeast 5S RNA specifically labeled with a paramagnetic nitroxide group at the 3'-terminal ribose. Comparison of the 500-MHz 1H NMR spectra of native and 3'-terminal spin-labeled yeast 5S RNA serves to identify the terminal base pair (G1 . C120) and its adjacent base pair (G2 . U119) on the basis of their proximity to the 3'-terminal spin-label. From that starting point, we have then identified (G . C, A . U, or G . U) and sequenced eight of the nine base pairs in the terminal helix via primary and secondary NOE's

  17. Placeholder factors in ribosome biogenesis: please, pave my way

    Directory of Open Access Journals (Sweden)

    Francisco J. Espinar-Marchena

    2017-04-01

    Full Text Available The synthesis of cytoplasmic eukaryotic ribosomes is an extraordinarily energy-demanding cellular activity that occurs progressively from the nucleolus to the cytoplasm. In the nucleolus, precursor rRNAs associate with a myriad of trans-acting factors and some ribosomal proteins to form pre-ribosomal particles. These factors include snoRNPs, nucleases, ATPases, GTPases, RNA helicases, and a vast list of proteins with no predicted enzymatic activity. Their coordinate activity orchestrates in a spatiotemporal manner the modification and processing of precursor rRNAs, the rearrangement reactions required for the formation of productive RNA folding intermediates, the ordered assembly of the ribosomal proteins, and the export of pre-ribosomal particles to the cytoplasm; thus, providing speed, directionality and accuracy to the overall process of formation of translation-competent ribosomes. Here, we review a particular class of trans-acting factors known as “placeholders”. Placeholder factors temporarily bind selected ribosomal sites until these have achieved a structural context that is appropriate for exchanging the placeholder with another site-specific binding factor. By this strategy, placeholders sterically prevent premature recruitment of subsequently binding factors, premature formation of structures, avoid possible folding traps, and act as molecular clocks that supervise the correct progression of pre-ribosomal particles into functional ribosomal subunits. We summarize the current understanding of those factors that delay the assembly of distinct ribosomal proteins or subsequently bind key sites in pre-ribosomal particles. We also discuss recurrent examples of RNA-protein and protein-protein mimicry between rRNAs and/or factors, which have clear functional implications for the ribosome biogenesis pathway.

  18. Crystallization of ribosomes from Thermus thermophilus

    International Nuclear Information System (INIS)

    Karpova, E.A.; Serdyuk, I.N.; Tarkhovskii, Yu.S.; Orlova, E.V.; Borovyagin, V.L.

    1987-01-01

    An understanding of the molecular bases of the process of protein biosynthesis on the ribosome requires a knowledge of its structure with high three-dimensional resolution involving the method of x-ray crystallographic analysis. The authors report on the production of crystals of the 70S ribosomes from a new source - the highly thermophilic bacterium Thermus thermophilus. Ribosomes for crystallization were obtained from Th. thermophilus strain HB8 by two washings in buffer with high ionic strength. The ribosome preparation was investigated for homogeneity by the method of high-speed sedimentation in a buffer containing 15 mM MgCl 2 , 50 mM NH 4 Cl, and 10 MM Tris-HCl, pH 7.5. Analysis showed that the preparation if homogeneous. The same preparation was investigated for intactness of ribosomal RNA by the method of gel electrophoresis in 2.75% acrylamide 0.5% agarose gel in a buffer containing 30 mM Tris, 30 mM NaH 2 PO 4 , 10 mM EDTA, 1-2% SDS, and 6 M urea. Analysis showed that the preparation possesses intact 16S and 23S RNA. The latter did not degrade, at least in a week of exposure of the ribosomes in buffer solution at 5 0 C. The ribosome preparation had no appreciable RNase activity, which was verified by incubating 4.5 micrograms of ribosomes with 3 micrograms of 14 C-labeled 16S rRna (50 0 C, 90 min) in a buffer containing 10 mM MgCl 2 , 100 mM NH 4 Cl, and 10 mM Tris-HCl, pH/sub 20 0 / 7.5. The incubated nonhydrolyzed RNA was precipitated with 5% trichloroacetic acid and applied on a GF/C filter. The radioactivity was determined in a toluene scintillator on an LS-100C counter

  19. 5SRNAdb: an information resource for 5S ribosomal RNAs.

    Science.gov (United States)

    Szymanski, Maciej; Zielezinski, Andrzej; Barciszewski, Jan; Erdmann, Volker A; Karlowski, Wojciech M

    2016-01-04

    Ribosomal 5S RNA (5S rRNA) is the ubiquitous RNA component found in the large subunit of ribosomes in all known organisms. Due to its small size, abundance and evolutionary conservation 5S rRNA for many years now is used as a model molecule in studies on RNA structure, RNA-protein interactions and molecular phylogeny. 5SRNAdb (http://combio.pl/5srnadb/) is the first database that provides a high quality reference set of ribosomal 5S RNAs (5S rRNA) across three domains of life. Here, we give an overview of new developments in the database and associated web tools since 2002, including updates to database content, curation processes and user web interfaces. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  20. Effect of single base changes and the absence of modified bases in 16S RNA on the reconstitution and function of Escherichia coli 30S ribosomes

    International Nuclear Information System (INIS)

    Denman, R.; Krzyzosiak, W.; Nurse, K.; Ofengand, J.

    1987-01-01

    The gene coding for E. coli 16S rRNA was placed in pUC19 under the control of the strong class III T7 promoter, phi 10, by ligation of the 1490 bp BclI/BstEII fragment of the rrnB operon with appropriate synthetic oligodeoxynucleotides. Such constructs allowed efficient in vitro synthesis of full-length transcripts (up to 900 mol RNA/mol template) free of modified bases. The synthetic RNA could be assembled into 30S subunits upon addition of E. coli 30S ribosomal proteins. The particles co-sedimented with authentic 30S particles and were electron microscopically indistinguishable from them. Upon addition of 50S subunits, codon-dependent P-site binding of tRNA and codon-dependent polypeptide synthesis were >80% of 30S reconstituted from natural 16S RNA and >50% of isolated 30S. UV-induced crosslinking of P-site bound AcVal-tRNA to residue C 1400 was preserved. Changing C 1400 to A had little effect on reconstitution, P-site binding, or polypeptide synthesis. However, the substitution of C 1499 by G markedly inhibited assembly. The effect on P-site binding and polypeptide synthesis is under study. These results show (1) none of the modified bases of 16S RNA are essential for protein synthesis, (2) substitution of A for C 1400 has little functional effect, and (3) position 1400 may be important for ribosome assembly

  1. Bacterial clade with the ribosomal RNA operon on a small plasmid rather than the chromosome.

    Science.gov (United States)

    Anda, Mizue; Ohtsubo, Yoshiyuki; Okubo, Takashi; Sugawara, Masayuki; Nagata, Yuji; Tsuda, Masataka; Minamisawa, Kiwamu; Mitsui, Hisayuki

    2015-11-17

    rRNA is essential for life because of its functional importance in protein synthesis. The rRNA (rrn) operon encoding 16S, 23S, and 5S rRNAs is located on the "main" chromosome in all bacteria documented to date and is frequently used as a marker of chromosomes. Here, our genome analysis of a plant-associated alphaproteobacterium, Aureimonas sp. AU20, indicates that this strain has its sole rrn operon on a small (9.4 kb), high-copy-number replicon. We designated this unusual replicon carrying the rrn operon on the background of an rrn-lacking chromosome (RLC) as the rrn-plasmid. Four of 12 strains close to AU20 also had this RLC/rrn-plasmid organization. Phylogenetic analysis showed that those strains having the RLC/rrn-plasmid organization represented one clade within the genus Aureimonas. Our finding introduces a previously unaddressed viewpoint into studies of genetics, genomics, and evolution in microbiology and biology in general.

  2. Identification and characterization of rhizospheric microbial diversity by 16S ribosomal RNA gene sequencing

    Directory of Open Access Journals (Sweden)

    Muhammad Naveed

    2014-09-01

    Full Text Available In the present study, samples of rhizosphere and root nodules were collected from different areas of Pakistan to isolate plant growth promoting rhizobacteria. Identification of bacterial isolates was made by 16S rRNA gene sequence analysis and taxonomical confirmation on EzTaxon Server. The identified bacterial strains were belonged to 5 genera i.e. Ensifer, Bacillus, Pseudomona, Leclercia and Rhizobium. Phylogenetic analysis inferred from 16S rRNA gene sequences showed the evolutionary relationship of bacterial strains with the respective genera. Based on phylogenetic analysis, some candidate novel species were also identified. The bacterial strains were also characterized for morphological, physiological, biochemical tests and glucose dehydrogenase (gdh gene that involved in the phosphate solublization using cofactor pyrroloquinolone quinone (PQQ. Seven rhizoshperic and 3 root nodulating stains are positive for gdh gene. Furthermore, this study confirms a novel association between microbes and their hosts like field grown crops, leguminous and non-leguminous plants. It was concluded that a diverse group of bacterial population exist in the rhizosphere and root nodules that might be useful in evaluating the mechanisms behind plant microbial interactions and strains QAU-63 and QAU-68 have sequence similarity of 97 and 95% which might be declared as novel after further taxonomic characterization.

  3. [Molecular phylogeny of Turbellaria, based on data from comparing the nucleotide sequences of 18S ribosomal RNA genes].

    Science.gov (United States)

    Kuznedelov, K D; Timoshkin, O A

    1995-01-01

    Polymerase chain reaction and direct sequencing of the 5'-end region of the 18S ribosomal RNA gene were used to infer phylogenetic relationship among turbellarian flatworms from Lake Baikal. Representatives of 5 orders (Tricladida--10 spp., Lecithoepitheliata--5 spp., Prolecithophora--3 spp., Proseriata and Kalyptorhynchia one for each) were studied; nucleotide sequence of more than 340 nucleotides was determined for each species. Consensus sequence for each order having more than one representative species was determined. Distance matrix and maximum parsimony approaches were applied to infer phylogenies. Bootstrap procedure was used to estimate confidence limits, at the 100% level by bootstrapping, the group of three orders: Kalyptorhynchia, Proseriata and Lecithoepitheliata was found to be monophyletic. However, subsets inside the group had no significant support to be preferred or rejected. Our data do not support traditional systematics which joins two suborders Tricladida and Proseriata into the single order Seriata, and also do not support comparative anatomical data which show close relationship of Lecithoepitheliata and lower Prolecithophora.

  4. Automated insertion of sequences into a ribosomal RNA alignment: An application of computational linguistics in molecular biology

    Energy Technology Data Exchange (ETDEWEB)

    Taylor, Ronald C. [Case Western Reserve Univ., Cleveland, OH (United States)

    1991-11-01

    This thesis involved the construction of (1) a grammar that incorporates knowledge on base invariancy and secondary structure in a molecule and (2) a parser engine that uses the grammar to position bases into the structural subunits of the molecule. These concepts were combined with a novel pinning technique to form a tool that semi-automates insertion of a new species into the alignment for the 16S rRNA molecule (a component of the ribosome) maintained by Dr. Carl Woese`s group at the University of Illinois at Urbana. The tool was tested on species extracted from the alignment and on a group of entirely new species. The results were very encouraging, and the tool should be substantial aid to the curators of the 16S alignment. The construction of the grammar was itself automated, allowing application of the tool to alignments for other molecules. The logic programming language Prolog was used to construct all programs involved. The computational linguistics approach used here was found to be a useful way to attach the problem of insertion into an alignment.

  5. Automated insertion of sequences into a ribosomal RNA alignment: An application of computational linguistics in molecular biology

    Energy Technology Data Exchange (ETDEWEB)

    Taylor, R.C.

    1991-11-01

    This thesis involved the construction of (1) a grammar that incorporates knowledge on base invariancy and secondary structure in a molecule and (2) a parser engine that uses the grammar to position bases into the structural subunits of the molecule. These concepts were combined with a novel pinning technique to form a tool that semi-automates insertion of a new species into the alignment for the 16S rRNA molecule (a component of the ribosome) maintained by Dr. Carl Woese's group at the University of Illinois at Urbana. The tool was tested on species extracted from the alignment and on a group of entirely new species. The results were very encouraging, and the tool should be substantial aid to the curators of the 16S alignment. The construction of the grammar was itself automated, allowing application of the tool to alignments for other molecules. The logic programming language Prolog was used to construct all programs involved. The computational linguistics approach used here was found to be a useful way to attach the problem of insertion into an alignment.

  6. Involvement of Arabidopsis thaliana ribosomal protein S27 in mRNA degradation triggered by genotoxic stress

    International Nuclear Information System (INIS)

    Revenkova, E.; Masson, J.; Koncz, C.; Afsar, K.; Jakovleva, L.; Paszkowski, J.

    1999-01-01

    A recessive Arabidopsis mutant with elevated sensitivity to DNA damaging treatments was identified in one out of 800 families generated by T-DNA insertion mutagenesis. The T-DNA generated a chromosomal deletion of 1287 bp in the promoter of one of three S27 ribosomal protein genes (ARS27A) preventing its expression. Seedlings of ars27A developed normally under standard growth conditions, suggesting wildtype proficiency of translation. However, growth was strongly inhibited in media supplemented with methyl methane sulfate (MMS) at a concentration not affecting the wild type. This inhibition was accompanied by the formation of tumor–like structures instead of auxiliary roots. Wild-type seedlings treated with increasing concentrations of MMS up to a lethal dose never displayed such a trait, neither was this phenotype observed in ars27A plants in the absence of MMS or under other stress conditions. Thus, the hypersensitivity and tumorous growth are mutant-specific responses to the genotoxic MMS treatment. Another important feature of the mutant is its inability to perform rapid degradation of transcripts after UV treatment, as seen in wild-type plants. Therefore, we propose that the ARS27A protein is dispensable for protein synthesis under standard conditions but is required for the elimination of possibly damaged mRNA after UV irradiation. (author)

  7. Direct crosslinking of the antitumor antibiotic sparsomycin, and its derivatives, to A2602 in the peptidyl transferase center of 23S-like rRNA within ribosome-tRNA complexes

    DEFF Research Database (Denmark)

    Porse, B T; Kirillov, S V; Awayez, M J

    1999-01-01

    of action was investigated by inducing a crosslink between sparsomycin and bacterial, archaeal, and eukaryotic ribosomes complexed with P-site-bound tRNA, on irradiating with low energy ultraviolet light (at 365 nm). The crosslink was localized exclusively to the universally conserved nucleotide A2602...

  8. A review on architecture of the gag-pol ribosomal frameshifting RNA in human immunodeficiency virus: a variability survey of virus genotypes.

    Science.gov (United States)

    Qiao, Qi; Yan, Yanhua; Guo, Jinmei; Du, Shuqiang; Zhang, Jiangtao; Jia, Ruyue; Ren, Haimin; Qiao, Yuanbiao; Li, Qingshan

    2017-06-01

    Programmed '-1' ribosomal frameshifting is necessary for expressing the pol gene overlapped from a gag of human immunodeficiency virus. A viral RNA structure that requires base pairing across the overlapping sequence region suggests a mechanism of regulating ribosome and helicase traffic during expression. To get precise roles of an element around the frameshift site, a review on architecture of the frameshifting RNA is performed in combination of reported information with augments of a representative set of 19 viral samples. In spite of a different length for the viral RNAs, a canonical comparison on the element sequence allocation is performed for viewing variability associations between virus genotypes. Additionally, recent and historical insights recognized in frameshifting regulation are looked back as for indel and single nucleotide polymorphism of RNA. As specially noted, structural changes at a frameshift site, the spacer sequence, and a three-helix junction element, as well as two Watson-Crick base pairs near a bulge and a C-G pair close a loop, are the most vital strategies for the virus frameshifting regulations. All of structural changes, which are dependent upon specific sequence variations, facilitate an elucidation about the RNA element conformation-dependent mechanism for frameshifting. These facts on disrupting base pair interactions also allow solving the problem of competition between ribosome and helicase on a same RNA template, common to single-stranded RNA viruses. In a broad perspective, each new insight of frameshifting regulation in the competition systems introduced by the RNA element construct changes will offer a compelling target for antiviral therapy.

  9. Post-transcriptional regulation of ribosome biogenesis in yeast

    Directory of Open Access Journals (Sweden)

    Isabelle C. Kos-Braun

    2017-05-01

    Full Text Available Most microorganisms are exposed to the constantly and often rapidly changing environment. As such they evolved mechanisms to balance their metabolism and energy expenditure with the resources available to them. When resources become scarce or conditions turn out to be unfavourable for growth, cells reduce their metabolism and energy usage to survive. One of the major energy consuming processes in the cell is ribosome biogenesis. Unsurprisingly, cells encountering adverse conditions immediately shut down production of new ribosomes. It is well established that nutrient depletion leads to a rapid repression of transcription of the genes encoding ribosomal proteins, ribosome biogenesis factors as well as ribosomal RNA (rRNA. However, if pre-rRNA processing and ribosome assembly are regulated post-transcriptionally remains largely unclear. We have recently uncovered that the yeast Saccharomyces cerevisiae rapidly switches between two alternative pre-rRNA processing pathways depending on the environmental conditions. Our findings reveal a new level of complexity in the regulation of ribosome biogenesis.

  10. Complete mitochondrial genomes and nuclear ribosomal RNA operons of two species of Diplostomum (Platyhelminthes: Trematoda): a molecular resource for taxonomy and molecular epidemiology of important fish pathogens

    Czech Academy of Sciences Publication Activity Database

    Brabec, Jan; Kostadinova, Aneta; Scholz, Tomáš; Littlewood, D. T. J.

    2015-01-01

    Roč. 8, JUN 19 2015 (2015), s. 336 ISSN 1756-3305 R&D Projects: GA MŠk(CZ) EE2.3.30.0032; GA ČR(CZ) GA15-14198S Grant - others:GA MŠk(CZ) LM2010005 Institutional support: RVO:60077344 Keywords : Diplostomum (Platyhelminthes: Trematoda) * fish pathogens * mitochondrial genome * ribosomal RNA * illumina next-generation sequencing * phylogeny Subject RIV: EG - Zoology Impact factor: 3.234, year: 2015

  11. Effects of S-adenosylmethionine decarboxylase, polyamines, amino acids, and weak bases (amines and ammonia) on development and ribosomal RNA synthesis in Xenopus embryos.

    Science.gov (United States)

    Shiokawa, Koichiro; Aso, Mai; Kondo, Takeshi; Takai, Jun-Ichi; Yoshida, Junki; Mishina, Takamichi; Fuchimukai, Kota; Ogasawara, Tsukasa; Kariya, Taro; Tashiro, Kosuke; Igarashi, Kazuei

    2010-02-01

    We have been studying control mechanisms of gene expression in early embryogenesis in a South African clawed toad Xenopus laevis, especially during the period of midblastula transition (MBT), or the transition from the phase of active cell division (cleavage stage) to the phase of extensive morphogenesis (post-blastular stages). We first found that ribosomal RNA synthesis is initiated shortly after MBT in Xenopus embryos and those weak bases, such as amines and ammonium ion, selectively inhibit the initiation and subsequent activation of rRNA synthesis. We then found that rapidly labeled heterogeneous mRNA-like RNA is synthesized in embryos at pre-MBT stage. We then performed cloning and expression studies of several genes, such as those for activin receptors, follistatin and aldolases, and then reached the studies of S-adenosylmethionine decarboxylase (SAMDC), a key enzyme in polyamine metabolism. Here, we cloned a Xenopus SAMDC cDNA and performed experiments to overexpress the in vitro-synthesized SAMDC mRNA in Xenopus early embryos, and found that the maternally preset program of apoptosis occurs in cleavage stage embryos, which is executed when embryos reach the stage of MBT. In the present article, we first summarize results on SAMDC and the maternal program of apoptosis, and then describe our studies on small-molecular-weight substances like polyamines, amino acids, and amines in Xenopus embryos. Finally, we summarize our studies on weak bases, especially on ammonium ion, as the specific inhibitor of ribosomal RNA synthesis in Xenopus embryonic cells.

  12. Graphical representation of ribosomal RNA probe accessibility data using ARB software package

    Directory of Open Access Journals (Sweden)

    Amann Rudolf

    2005-03-01

    Full Text Available Abstract Background Taxon specific hybridization probes in combination with a variety of commonly used hybridization formats nowadays are standard tools in microbial identification. A frequently applied technology, fluorescence in situ hybridization (FISH, besides single cell identification, allows the localization and functional studies of the microbial community composition. Careful in silico design and evaluation of potential oligonucleotide probe targets is therefore crucial for performing successful hybridization experiments. Results The PROBE Design tools of the ARB software package take into consideration several criteria such as number, position and quality of diagnostic sequence differences while designing oligonucleotide probes. Additionally, new visualization tools were developed to enable the user to easily examine further sequence associated criteria such as higher order structure, conservation, G+C content, transition-transversion profiles and in situ target accessibility patterns. The different types of sequence associated information (SAI can be visualized by user defined background colors within the ARB primary and secondary structure editors as well as in the PROBE Match tool. Conclusion Using this tool, in silico probe design and evaluation can be performed with respect to in situ probe accessibility data. The evaluation of proposed probe targets with respect to higher-order rRNA structure is of importance for successful design and performance of in situ hybridization experiments. The entire ARB software package along with the probe accessibility data is available from the ARB home page http://www.arb-home.de.

  13. 5-Methyldeoxycytidine in the Physarum minichromosome containing the ribosomal RNA genes.

    Science.gov (United States)

    Cooney, C A; Matthews, H R; Bradbury, E M

    1984-01-01

    5-Methyldeoxycytidine (5MC) was analyzed by high pressure liquid chromatography (HPLC) and by restriction enzyme digestion in rDNA isolated from Physarum polycephalum. rDNA from Physarum M3C strain microplasmodia has a significant 5MC content (about half that of the whole genomic DNA). This rDNA contains many C5MCGG sites because it is clearly digested further by Msp I than by Hpa II. However, most 5MC is in other sites. In particular, alternating CG sequences appear to be highly methylated. HPLC of deoxyribonucleosides shows tha most of the transcribed regions contain little or no 5MC. Restriction digestion indicates that there is little or no 5MC in any of the transcribed regions including the transcription origin and adjacent sequences. Over 90% of the total 5MC is in or near the central nontranscribed spacer and most methylated restriction sites are in inverted repeats of this spacer. rDNA is very heterogeneous with respect to 5MC. The 5MC pattern doesn't appear to change with inactivation of the rRNA genes during reversible differentiation from microplasmodia (growing) to microsclerotia (dormant), showing that inactivation is due to changes in other chromatin variables. The 5MC pattern is different between Physarum strains. The possible involvement of this 5MC in rDNA chromatin structure and in cruciform and Z-DNA formation is discussed. Images PMID:6322108

  14. Using the Ribodeblur pipeline to recover A-sites from yeast ribosome profiling data.

    Science.gov (United States)

    Wang, Hao; Kingsford, Carl; McManus, C Joel

    2018-03-15

    Ribosome profiling has emerged as a powerful technique to study mRNA translation. Ribosome profiling has the potential to determine the relative quantities and locations of ribosomes on mRNA genome wide. Taking full advantage of this approach requires accurate measurement of ribosome locations. However, experimental inconsistencies often obscure the positional information encoded in ribosome profiling data. Here, we describe the Ribodeblur pipeline, a computational analysis tool that uses a maximum likelihood framework to infer ribosome positions from heterogeneous datasets. Ribodeblur is simple to install, and can be run on an average modern Mac or Linux-based laptop. We detail the process of applying the pipeline to high-coverage ribosome profiling data in yeast, and discuss important considerations for potential extension to other organisms. Copyright © 2018 Elsevier Inc. All rights reserved.

  15. Global identification of new substrates for the yeast endoribonuclease, RNase mitochondrial RNA processing (MRP).

    Science.gov (United States)

    Aulds, Jason; Wierzbicki, Sara; McNairn, Adrian; Schmitt, Mark E

    2012-10-26

    RNase mitochondrial RNA processing (MRP) is an essential, evolutionarily conserved endoribonuclease composed of 10 different protein subunits and a single RNA. RNase MRP has established roles in multiple pathways including ribosome biogenesis, cell cycle regulation, and mitochondrial DNA replication. Although each of these functions is important to cell growth, additional functions may exist given the essential nature of the complex. To identify novel RNase MRP substrates, we utilized RNA immunoprecipitation and microarray chip analysis to identify RNA that physically associates with RNase MRP. We identified several new potential substrates for RNase MRP including a cell cycle-regulated transcript, CTS1; the yeast homolog of the mammalian p27(Kip1), SIC1; and the U2 RNA component of the spliceosome. In addition, we found RNase MRP to be involved in the regulation of the Ty1 transposon RNA. These results reinforce and broaden the role of RNase MRP in cell cycle regulation and help to identify new roles of this endoribonuclease.

  16. A Sequence-Specific Interaction between the Saccharomyces cerevisiae rRNA Gene Repeats and a Locus Encoding an RNA Polymerase I Subunit Affects Ribosomal DNA Stability

    Science.gov (United States)

    Cahyani, Inswasti; Cridge, Andrew G.; Engelke, David R.; Ganley, Austen R. D.

    2014-01-01

    The spatial organization of eukaryotic genomes is linked to their functions. However, how individual features of the global spatial structure contribute to nuclear function remains largely unknown. We previously identified a high-frequency interchromosomal interaction within the Saccharomyces cerevisiae genome that occurs between the intergenic spacer of the ribosomal DNA (rDNA) repeats and the intergenic sequence between the locus encoding the second largest RNA polymerase I subunit and a lysine tRNA gene [i.e., RPA135-tK(CUU)P]. Here, we used quantitative chromosome conformation capture in combination with replacement mapping to identify a 75-bp sequence within the RPA135-tK(CUU)P intergenic region that is involved in the interaction. We demonstrate that the RPA135-IGS1 interaction is dependent on the rDNA copy number and the Msn2 protein. Surprisingly, we found that the interaction does not govern RPA135 transcription. Instead, replacement of a 605-bp region within the RPA135-tK(CUU)P intergenic region results in a reduction in the RPA135-IGS1 interaction level and fluctuations in rDNA copy number. We conclude that the chromosomal interaction that occurs between the RPA135-tK(CUU)P and rDNA IGS1 loci stabilizes rDNA repeat number and contributes to the maintenance of nucleolar stability. Our results provide evidence that the DNA loci involved in chromosomal interactions are composite elements, sections of which function in stabilizing the interaction or mediating a functional outcome. PMID:25421713

  17. Free-Energy Landscape of Reverse tRNA Translocation through the Ribosome Analyzed by Electron Microscopy Density Maps and Molecular Dynamics Simulations

    Science.gov (United States)

    Ishida, Hisashi; Matsumoto, Atsushi

    2014-01-01

    To understand the mechanism of reverse tRNA translocation in the ribosome, all-atom molecular dynamics simulations of the ribosome-tRNAs-mRNA-EFG complex were performed. The complex at the post-translocational state was directed towards the translocational and pre-translocational states by fitting the complex into cryo-EM density maps. Between a series of the fitting simulations, umbrella sampling simulations were performed to obtain the free-energy landscape. Multistep structural changes, such as a ratchet-like motion and rotation of the head of the small subunit were observed. The free-energy landscape showed that there were two main free-energy barriers: one between the post-translocational and intermediate states, and the other between the pre-translocational and intermediate states. The former corresponded to a clockwise rotation, which was coupled to the movement of P-tRNA over the P/E-gate made of G1338, A1339 and A790 in the small subunit. The latter corresponded to an anticlockwise rotation of the head, which was coupled to the location of the two tRNAs in the hybrid state. This indicates that the coupled motion of the head rotation and tRNA translocation plays an important role in opening and closing of the P/E-gate during the ratchet-like movement in the ribosome. Conformational change of EF-G was interpreted to be the result of the combination of the external motion by L12 around an axis passing near the sarcin-ricin loop, and internal hinge-bending motion. These motions contributed to the movement of domain IV of EF-G to maintain its interaction with A/P-tRNA. PMID:24999999

  18. Free-energy landscape of reverse tRNA translocation through the ribosome analyzed by electron microscopy density maps and molecular dynamics simulations.

    Directory of Open Access Journals (Sweden)

    Hisashi Ishida

    Full Text Available To understand the mechanism of reverse tRNA translocation in the ribosome, all-atom molecular dynamics simulations of the ribosome-tRNAs-mRNA-EFG complex were performed. The complex at the post-translocational state was directed towards the translocational and pre-translocational states by fitting the complex into cryo-EM density maps. Between a series of the fitting simulations, umbrella sampling simulations were performed to obtain the free-energy landscape. Multistep structural changes, such as a ratchet-like motion and rotation of the head of the small subunit were observed. The free-energy landscape showed that there were two main free-energy barriers: one between the post-translocational and intermediate states, and the other between the pre-translocational and intermediate states. The former corresponded to a clockwise rotation, which was coupled to the movement of P-tRNA over the P/E-gate made of G1338, A1339 and A790 in the small subunit. The latter corresponded to an anticlockwise rotation of the head, which was coupled to the location of the two tRNAs in the hybrid state. This indicates that the coupled motion of the head rotation and tRNA translocation plays an important role in opening and closing of the P/E-gate during the ratchet-like movement in the ribosome. Conformational change of EF-G was interpreted to be the result of the combination of the external motion by L12 around an axis passing near the sarcin-ricin loop, and internal hinge-bending motion. These motions contributed to the movement of domain IV of EF-G to maintain its interaction with A/P-tRNA.

  19. mRNA processing in yeast

    International Nuclear Information System (INIS)

    Stevens, A.

    1982-01-01

    Investigations in this laboratory center on basic enzymatic reactions of RNA. Still undefined are reactions involved in the conversion of precursors of mRA (pre-mRNA) to mRNA in eukaryotes. The pre-mRNA is called heterogeneous nuclear RNA and is 2 to 6 times larger than mRNA. The conversion, called splicing, involves a removal of internal sequences called introns by endoribonuclease action followed by a rejoining of the 3'- and 5'-end fragments, called exons, by ligating activity. It has not been possible yet to study the enzymes involved in vitro. Also undefined are reactions involved in the turnover or discarding of certain of the pre-mRNA molecules. Yeast is a simple eukaryote and may be expected to have the same, but perhaps simpler, processing reactions as the higher eukaryotes. Two enzymes involved in the processing of pre-mRNA and mRNA in yeast are under investigation. Both enzymes have been partially purified from ribonucleoprotein particles of yeast. The first is a unique decapping enzyme which cleaves [ 3 H]m 7 Gppp [ 14 C]RNA-poly (A) of yeast, yielding [ 3 H]m 7 GDP and is suggested by the finding that the diphosphate product, m 7 GpppA(G), and UDP-glucose are not hydrolyzed. The second enzyme is an endoribonuclease which converts both the [ 3 H] and [ 14 C] labels of [ 3 H]m 7 Gppp[ 14 C]RNA-poly(A) from an oligo(dT)-cellulose bound form to an unbound, acid-insoluble form. Results show that the stimulation involves an interaction of the labeled RNA with the small nuclear RNA. The inhibition of the enzyme by ethidium bromide and its stimulation by small nuclear RNA suggest that it may be a processing ribonuclease, requiring specific double-stranded features in its substrate. The characterization of the unique decapping enzyme and endoribonuclease may help to understand reactions involved in the processing of pre-mRNA and mRNA in eukaryotes

  20. Mycobacterial RNA isolation optimized for non-coding RNA: high fidelity isolation of 5S rRNA from Mycobacterium bovis BCG reveals novel post-transcriptional processing and a complete spectrum of modified ribonucleosides.

    Science.gov (United States)

    Hia, Fabian; Chionh, Yok Hian; Pang, Yan Ling Joy; DeMott, Michael S; McBee, Megan E; Dedon, Peter C

    2015-03-11

    A major challenge in the study of mycobacterial RNA biology is the lack of a comprehensive RNA isolation method that overcomes the unusual cell wall to faithfully yield the full spectrum of non-coding RNA (ncRNA) species. Here, we describe a simple and robust procedure optimized for the isolation of total ncRNA, including 5S, 16S and 23S ribosomal RNA (rRNA) and tRNA, from mycobacteria, using Mycobacterium bovis BCG to illustrate the method. Based on a combination of mechanical disruption and liquid and solid-phase technologies, the method produces all major species of ncRNA in high yield and with high integrity, enabling direct chemical and sequence analysis of the ncRNA species. The reproducibility of the method with BCG was evident in bioanalyzer electrophoretic analysis of isolated RNA, which revealed quantitatively significant differences in the ncRNA profiles of exponentially growing and non-replicating hypoxic bacilli. The method also overcame an historical inconsistency in 5S rRNA isolation, with direct sequencing revealing a novel post-transcriptional processing of 5S rRNA to its functional form and with chemical analysis revealing seven post-transcriptional ribonucleoside modifications in the 5S rRNA. This optimized RNA isolation procedure thus provides a means to more rigorously explore the biology of ncRNA species in mycobacteria. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  1. Expression of the double-stranded RNA of the soybean pod borer Leguminivora glycinivorella (Lepidoptera: Tortricidae) ribosomal protein P0 gene enhances the resistance of transgenic soybean plants.

    Science.gov (United States)

    Meng, Fanli; Li, Yang; Zang, Zhenyuan; Li, Na; Ran, Ruixue; Cao, Yingxue; Li, Tianyu; Zhou, Quan; Li, Wenbin

    2017-12-01

    The soybean pod borer [SPB; Leguminivora glycinivorella (Matsumura) (Lepidoptera: Tortricidae)] is the most important soybean pest in northeastern Asia. Silencing genes using plant-mediated RNA-interference is a promising strategy for controlling SPB infestations. The ribosomal protein P0 is important for protein translation and DNA repair in the SPB. Thus, transferring P0 double-stranded RNA (dsRNA) into plants may help prevent SPB-induced damage. We investigated the effects of SpbP0 dsRNA injections and SpbP0 dsRNA-expressing transgenic soybean plants on the SPB. Larval mortality rates were greater for SpbP0 dsRNA-injected larvae (96%) than for the control larvae (31%) at 14 days after injections. Transgenic T 2 soybean plants expressing SpbP0 dsRNA sustained less damage from SPB larvae than control plants. In addition, the expression level of the SpbP0 gene decreased and the mortality rate increased when SPB larvae were fed on T 3 transgenic soybean pods. Moreover, the surviving larvae were deformed and exhibited inhibited growth. Silencing SpbP0 expression is lethal to the SPB. Transgenic soybean plants expressing SpbP0 dsRNA are more resistant to the SPB than wild-type plants. Thus, SpbP0 dsRNA-expressing transgenic plants may be useful for controlling insect pests. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

  2. Resistance to linezolid in Staphylococcus spp. clinical isolates associated with ribosomal binding site modifications: novel mutation in domain V of 23S rRNA.

    Science.gov (United States)

    Musumeci, Rosario; Calaresu, Enrico; Gerosa, Jolanda; Oggioni, Davide; Bramati, Simone; Morelli, Patrizia; Mura, Ida; Piana, Andrea; Are, Bianca Maria; Cocuzza, Clementina Elvezia

    2016-10-01

    Linezolid is the main representative of the oxazolidinones, introduced in 2000 in clinical practice to treat severe Gram-positive infections. This compound inhibits protein synthesis by binding to the peptidyl transferase centre of the 50S bacterial ribosomal subunit. The aim of this study was to characterize 12 clinical strains of linezolid-resistant Staphylococcus spp. isolated in Northern Italy. All isolates of Staphylococcus spp. studied showed a multi-antibiotic resistance phenotype. In particular, all isolates showed the presence of the mecA gene associated with SSCmec types IVa, V or I. Mutations in domain V of 23S rRNA were shown to be the most prevalent mechanism of linezolid resistance: among these a new C2551T mutation was found in S. aureus, whilst the G2576T mutation was shown to be the most prevalent overall. Moreover, three S. epidermidis isolates were shown to have linezolid resistance associated only with alterations in both L3 and L4 ribosomal proteins. No strain was shown to harbor the previously described cfr gene. These results have shown how the clinical use of linezolid in Northern Italy has resulted in the selection of multiple antibiotic-resistant clinical isolates of Staphylococcus spp., with linezolid resistance in these strains being associated with mutations in 23S rRNA or ribosomal proteins L3 and L4.

  3. Repeated reunions and splits feature the highly dynamic evolution of 5S and 35S ribosomal RNA genes (rDNA) in the Asteraceae family.

    Science.gov (United States)

    Garcia, Sònia; Panero, José L; Siroky, Jiri; Kovarik, Ales

    2010-08-16

    In flowering plants and animals the most common ribosomal RNA genes (rDNA) organisation is that in which 35S (encoding 18S-5.8S-26S rRNA) and 5S genes are physically separated occupying different chromosomal loci. However, recent observations established that both genes have been unified to a single 35S-5S unit in the genus Artemisia (Asteraceae), a genomic arrangement typical of primitive eukaryotes such as yeast, among others. Here we aim to reveal the origin, distribution and mechanisms leading to the linked organisation of rDNA in the Asteraceae by analysing unit structure (PCR, Southern blot, sequencing), gene copy number (quantitative PCR) and chromosomal position (FISH) of 5S and 35S rRNA genes in approximately 200 species representing the family diversity and other closely related groups. Dominant linked rDNA genotype was found within three large groups in subfamily Asteroideae: tribe Anthemideae (93% of the studied cases), tribe Gnaphalieae (100%) and in the "Heliantheae alliance" (23%). The remaining five tribes of the Asteroideae displayed canonical non linked arrangement of rDNA, as did the other groups in the Asteraceae. Nevertheless, low copy linked genes were identified among several species that amplified unlinked units. The conserved position of functional 5S insertions downstream from the 26S gene suggests a unique, perhaps retrotransposon-mediated integration event at the base of subfamily Asteroideae. Further evolution likely involved divergence of 26S-5S intergenic spacers, amplification and homogenisation of units across the chromosomes and concomitant elimination of unlinked arrays. However, the opposite trend, from linked towards unlinked arrangement was also surmised in few species indicating possible reversibility of these processes. Our results indicate that nearly 25% of Asteraceae species may have evolved unusual linked arrangement of rRNA genes. Thus, in plants, fundamental changes in intrinsic structure of rDNA units, their copy

  4. The Unexplored Mechanisms and Regulatory Functions of Ribosomal Translocation

    Science.gov (United States)

    Alejo, Jose Luis

    In every cell, protein synthesis is carried out by the ribosome, a complex macromolecular RNA-protein assembly. Decades of structural and kinetic studies have increased our understanding of ribosome initiation, decoding, translocation and termination. Yet, the underlying mechanism of these fundamental processes has yet to be fully delineated. Hence, the molecular basis of regulation remains obscure. Here, single-molecule fluorescence methods are applied to decipher the mechanism and regulatory roles of the multi-step process of directional substrate translocation on the ribosome that accompanies every round of protein synthesis. In Chapter 1, single-molecule fluorescence resonance energy transfer (smFRET) is introduced as a tool for studying bacterial ribosome translocation. Chapter 2 details the experimental methods. In Chapter 3, the elongation factor G(EF-G)-catalyzed movement of substrates through the ribosome is examined from several perspectives or signals reporting on various degrees of freedom of ribosome dynamics. Two ribosomal states interconvert in the presence of EF-G(GDP), displaying novel head domain motions, until relocking takes place. In Chapter 4, in order to test if the mentioned fluctuations leading to relocking are correlated to the engagement of the P-site by the peptidyl-tRNA, the translocation of miscoded tRNAs is studied. Severe defects in the relocking stages of translocation reveal the correlation between this new stage of translocation and P-site tRNA engagement.

  5. Probing the structure of ribosome assembly intermediates in vivo using DMS and hydroxyl radical footprinting.

    Science.gov (United States)

    Hulscher, Ryan M; Bohon, Jen; Rappé, Mollie C; Gupta, Sayan; D'Mello, Rhijuta; Sullivan, Michael; Ralston, Corie Y; Chance, Mark R; Woodson, Sarah A

    2016-07-01

    The assembly of the Escherichia coli ribosome has been widely studied and characterized in vitro. Despite this, ribosome biogenesis in living cells is only partly understood because assembly is coupled with transcription, modification and processing of the pre-ribosomal RNA. We present a method for footprinting and isolating pre-rRNA as it is synthesized in E. coli cells. Pre-rRNA synthesis is synchronized by starvation, followed by nutrient upshift. RNA synthesized during outgrowth is metabolically labeled to facilitate isolation of recent transcripts. Combining this technique with two in vivo RNA probing methods, hydroxyl radical and DMS footprinting, allows the structure of nascent RNA to be probed over time. Together, these can be used to determine changes in the structures of ribosome assembly intermediates as they fold in vivo. Copyright © 2016 Elsevier Inc. All rights reserved.

  6. Processivity and coupling in messenger RNA transcription.

    Directory of Open Access Journals (Sweden)

    Stuart Aitken

    2010-01-01

    Full Text Available The complexity of messenger RNA processing is now being uncovered by experimental techniques that are capable of detecting individual copies of mRNA in cells, and by quantitative real-time observations that reveal the kinetics. This processing is commonly modelled by permitting mRNA to be transcribed only when the promoter is in the on state. In this simple on/off model, the many processes involved in active transcription are represented by a single reaction. These processes include elongation, which has a minimum time for completion and processing that is not captured in the model.In this paper, we explore the impact on the mRNA distribution of representing the elongation process in more detail. Consideration of the mechanisms of elongation leads to two alternative models of the coupling between the elongating polymerase and the state of the promoter: Processivity allows polymerases to complete elongation irrespective of the promoter state, whereas coupling requires the promoter to be active to produce a full-length transcript. We demonstrate that these alternatives have a significant impact on the predicted distributions. Models are simulated by the Gillespie algorithm, and the third and fourth moments of the resulting distribution are computed in order to characterise the length of the tail, and sharpness of the peak. By this methodology, we show that the moments provide a concise summary of the distribution, showing statistically-significant differences across much of the feasible parameter range.We conclude that processivity is not fully consistent with the on/off model unless the probability of successfully completing elongation is low--as has been observed. The results also suggest that some form of coupling between the promoter and a rate-limiting step in transcription may explain the cell's inability to maintain high mRNA levels at low noise--a prediction of the on/off model that has no supporting evidence.

  7. The Р60-S6K1 isoform of ribosomal protein S6 kinase 1 is a product of alternative mRNA translation

    Directory of Open Access Journals (Sweden)

    I. V. Zaiets

    2018-07-01

    Full Text Available Ribosomal protein S6 kinase 1 (S6K1 is a well-known downstream effector of mTORC1 (mechanistic target of rapamycin complex 1 participating primarily in the regulation of cell growth and metabolism. Deregulation of mTOR/S6K1 signaling can promote numerous human pathologies, including cancer, neurodegeneration, cardiovascular disease, and metabolic disorders. As existing data suggest, the S6K1 gene encodes several protein isoforms, including p85-S6K1, p70-S6K1, and p60-S6K1. The two of these isoforms, p85-S6K1 and p70-S6K1, were extensively studied to date. The origin and functional significance of the p60-S6K1 isoform remains a mystery, however, it was suggested that the isoform could be a product of alternative S6K1 mRNA translation. Herein we report the generation of HEK-293 cells exclusively expressing p60-S6K1 as a result of CRISPR/Cas9-mediated inactivation of p85/p70-S6K1 translation. Moreover, the generated modified cells displayed the elevated level of p60-S6K1 expression compared to that in wild-type HEK-293 cells. Our data confirm an assumption that p60-S6K1 is alternatively translated, most probably, from the common for both p70- and p85-S6K1 mRNA transcript and reveal a link between p60-S6K1 expression and such cellular processes as cell proliferation and motility. In addition, our findings indicate that the p60-S6K1 isoform of S6K1 may undergo a mode of regulation distinct from p70- and p85-S6K1 due to the absence of mTOR-regulated p60-S6K1 phosphorylation at T389 that is important for S6K1 activation.

  8. An elongated model of the Xenopus laevis transcription factor IIIA-5S ribosomal RNA complex derived from neutron scattering and hydrodynamic measurements

    International Nuclear Information System (INIS)

    Timmins, P.A.; Langowski, J.; Brown, R.S.

    1988-01-01

    The precise molecular composition of the Xenopus laevis TFIIIA-5S ribosomal RNA complex (7S particle) has been established from small angle neutron and dynamic light scattering. The molecular weight of the particle was found to be 95,700±10,000 and 86,700±9,000 daltons from these two methods respectively. The observed match point of 54.4% D 2 O obtained from contrast variation experiments indicates a 1:1 molar ratio. It is concluded that only a single molecule of TFIIIA, a zinc-finger protein, and of 5S RNA are present in this complex. A simple elongated cylindrical model with dimensions of 140 angstrom length and 59 angstrom diameter is compatible with the neutron results. A globular model can be excluded by the shallow nature of the neutron scattering curves. It is proposed that the observed difference of 15 angstrom in length between the 7S particle and isolated 5S RNA most likely indicates that part(s) of the protein protrudes from the end(s) of the RNA molecule. There is no biochemical evidence for any gross alteration in 5S RNA conformation upon binding to TFIIIA

  9. Miscoding-induced stalling of substrate translocation on the bacterial ribosome.

    Science.gov (United States)

    Alejo, Jose L; Blanchard, Scott C

    2017-10-10

    Directional transit of the ribosome along the messenger RNA (mRNA) template is a key determinant of the rate and processivity of protein synthesis. Imaging of the multistep translocation mechanism using single-molecule FRET has led to the hypothesis that substrate movements relative to the ribosome resolve through relatively long-lived late intermediates wherein peptidyl-tRNA enters the P site of the small ribosomal subunit via reversible, swivel-like motions of the small subunit head domain within the elongation factor G (GDP)-bound ribosome complex. Consistent with translocation being rate-limited by recognition and productive engagement of peptidyl-tRNA within the P site, we now show that base-pairing mismatches between the peptidyl-tRNA anticodon and the mRNA codon dramatically delay this rate-limiting, intramolecular process. This unexpected relationship between aminoacyl-tRNA decoding and translocation suggests that miscoding antibiotics may impact protein synthesis by impairing the recognition of peptidyl-tRNA in the small subunit P site during EF-G-catalyzed translocation. Strikingly, we show that elongation factor P (EF-P), traditionally known to alleviate ribosome stalling at polyproline motifs, can efficiently rescue translocation defects arising from miscoding. These findings help reveal the nature and origin of the rate-limiting steps in substrate translocation on the bacterial ribosome and indicate that EF-P can aid in resuming translation elongation stalled by miscoding errors.

  10. Biochemistry and Function of the RNA Exosomes

    DEFF Research Database (Denmark)

    Lubas, Michal Szymon; Chlebowski, Aleksander; Dziembowski, Andrzej

    2012-01-01

    Discovery of the evolutionary conserved RNA exosome was a milestone in RNA biology. First identified as an activity essential for the processing of ribosomal RNA, the exosome has since proved to be central for RNA processing and degradation in both the nucleus and the cytoplasm of eukaryotic cell...

  11. Footprints of a trypanosomatid RNA world: pre-small subunit rRNA processing by spliced leader addition trans-splicing

    Directory of Open Access Journals (Sweden)

    Mario Gustavo Mayer

    2012-06-01

    Full Text Available The addition of a capped mini-exon [spliced leader (SL] through trans-splicing is essential for the maturation of RNA polymerase (pol II-transcribed polycistronic pre-mRNAs in all members of the Trypanosomatidae family. This process is an inter-molecular splicing reaction that follows the same basic rules of cis-splicing reactions. In this study, we demonstrated that mini-exons were added to precursor ribosomal RNA (pre-rRNA are transcribed by RNA pol I, including the 5' external transcribed spacer (ETS region. Additionally, we detected the SL-5'ETS molecule using three distinct methods and located the acceptor site between two known 5'ETS rRNA processing sites (A' and A1 in four different trypanosomatids. Moreover, we detected a polyadenylated 5'ETS upstream of the trans-splicing acceptor site, which also occurs in pre-mRNA trans-splicing. After treatment with an indirect trans-splicing inhibitor (sinefungin, we observed SL-5'ETS decay. However, treatment with 5-fluorouracil (a precursor of RNA synthesis that inhibits the degradation of pre-rRNA led to the accumulation of SL-5'ETS, suggesting that the molecule may play a role in rRNA degradation. The detection of trans-splicing in these molecules may indicate broad RNA-joining properties, regardless of the polymerase used for transcription.

  12. Yeast eIF4B binds to the head of the 40S ribosomal subunit and promotes mRNA recruitment through its N-terminal and internal repeat domains.

    Science.gov (United States)

    Walker, Sarah E; Zhou, Fujun; Mitchell, Sarah F; Larson, Victoria S; Valasek, Leos; Hinnebusch, Alan G; Lorsch, Jon R

    2013-02-01

    Eukaryotic translation initiation factor (eIF)4B stimulates recruitment of mRNA to the 43S ribosomal pre-initiation complex (PIC). Yeast eIF4B (yeIF4B), shown previously to bind single-stranded (ss) RNA, consists of an N-terminal domain (NTD), predicted to be unstructured in solution; an RNA-recognition motif (RRM); an unusual domain comprised of seven imperfect repeats of 26 amino acids; and a C-terminal domain. Although the mechanism of yeIF4B action has remained obscure, most models have suggested central roles for its RRM and ssRNA-binding activity. We have dissected the functions of yeIF4B's domains and show that the RRM and its ssRNA-binding activity are dispensable in vitro and in vivo. Instead, our data indicate that the 7-repeats and NTD are the most critical domains, which mediate binding of yeIF4B to the head of the 40S ribosomal subunit via interaction with Rps20. This interaction induces structural changes in the ribosome's mRNA entry channel that could facilitate mRNA loading. We also show that yeIF4B strongly promotes productive interaction of eIF4A with the 43S•mRNA PIC in a manner required for efficient mRNA recruitment.

  13. In vitro degradation of ribosomes.

    Science.gov (United States)

    Mora, G; Rivas, A

    1976-12-01

    The cytoplasmic ribosomes from Euglena gracilis var. bacillaris are found to be of two types taking into consideration their stability "in vitro". In the group of unstable ribosomes the large subunit is degraded. The other group apparently does not suffer any degradation under the conditions described. However the RNAs extracted from both types of ribosomes are degraded during sucrose density gradients. The degradation of the largest RNA species has been reported previously, but no comment has been made about the stability of the ribosome itself.

  14. An image processing approach to computing distances between RNA secondary structures dot plots

    Directory of Open Access Journals (Sweden)

    Sapiro Guillermo

    2009-02-01

    Full Text Available Abstract Background Computing the distance between two RNA secondary structures can contribute in understanding the functional relationship between them. When used repeatedly, such a procedure may lead to finding a query RNA structure of interest in a database of structures. Several methods are available for computing distances between RNAs represented as strings or graphs, but none utilize the RNA representation with dot plots. Since dot plots are essentially digital images, there is a clear motivation to devise an algorithm for computing the distance between dot plots based on image processing methods. Results We have developed a new metric dubbed 'DoPloCompare', which compares two RNA structures. The method is based on comparing dot plot diagrams that represent the secondary structures. When analyzing two diagrams and motivated by image processing, the distance is based on a combination of histogram correlations and a geometrical distance measure. We introduce, describe, and illustrate the procedure by two applications that utilize this metric on RNA sequences. The first application is the RNA design problem, where the goal is to find the nucleotide sequence for a given secondary structure. Examples where our proposed distance measure outperforms others are given. The second application locates peculiar point mutations that induce significant structural alternations relative to the wild type predicted secondary structure. The approach reported in the past to solve this problem was tested on several RNA sequences with known secondary structures to affirm their prediction, as well as on a data set of ribosomal pieces. These pieces were computationally cut from a ribosome for which an experimentally derived secondary structure is available, and on each piece the prediction conveys similarity to the experimental result. Our newly proposed distance measure shows benefit in this problem as well when compared to standard methods used for assessing

  15. An internal ribosome entry site directs translation of the 3'-gene from Pelargonium flower break virus genomic RNA: implications for infectivity.

    Directory of Open Access Journals (Sweden)

    Olga Fernández-Miragall

    Full Text Available Pelargonium flower break virus (PFBV, genus Carmovirus has a single-stranded positive-sense genomic RNA (gRNA which contains five ORFs. The two 5'-proximal ORFs encode the replicases, two internal ORFs encode movement proteins, and the 3'-proximal ORF encodes a polypeptide (p37 which plays a dual role as capsid protein and as suppressor of RNA silencing. Like other members of family Tombusviridae, carmoviruses express ORFs that are not 5'-proximal from subgenomic RNAs. However, in one case, corresponding to Hisbiscus chlorotic ringspot virus, it has been reported that the 3'-proximal gene can be translated from the gRNA through an internal ribosome entry site (IRES. Here we show that PFBV also holds an IRES that mediates production of p37 from the gRNA, raising the question of whether this translation strategy may be conserved in the genus. The PFBV IRES was functional both in vitro and in vivo and either in the viral context or when inserted into synthetic bicistronic constructs. Through deletion and mutagenesis studies we have found that the IRES is contained within a 80 nt segment and have identified some structural traits that influence IRES function. Interestingly, mutations that diminish IRES activity strongly reduced the infectivity of the virus while the progress of the infection was favoured by mutations potentiating such activity. These results support the biological significance of the IRES-driven p37 translation and suggest that production of the silencing suppressor from the gRNA might allow the virus to early counteract the defence response of the host, thus facilitating pathogen multiplication and spread.

  16. An internal ribosome entry site directs translation of the 3'-gene from Pelargonium flower break virus genomic RNA: implications for infectivity.

    Science.gov (United States)

    Fernández-Miragall, Olga; Hernández, Carmen

    2011-01-01

    Pelargonium flower break virus (PFBV, genus Carmovirus) has a single-stranded positive-sense genomic RNA (gRNA) which contains five ORFs. The two 5'-proximal ORFs encode the replicases, two internal ORFs encode movement proteins, and the 3'-proximal ORF encodes a polypeptide (p37) which plays a dual role as capsid protein and as suppressor of RNA silencing. Like other members of family Tombusviridae, carmoviruses express ORFs that are not 5'-proximal from subgenomic RNAs. However, in one case, corresponding to Hisbiscus chlorotic ringspot virus, it has been reported that the 3'-proximal gene can be translated from the gRNA through an internal ribosome entry site (IRES). Here we show that PFBV also holds an IRES that mediates production of p37 from the gRNA, raising the question of whether this translation strategy may be conserved in the genus. The PFBV IRES was functional both in vitro and in vivo and either in the viral context or when inserted into synthetic bicistronic constructs. Through deletion and mutagenesis studies we have found that the IRES is contained within a 80 nt segment and have identified some structural traits that influence IRES function. Interestingly, mutations that diminish IRES activity strongly reduced the infectivity of the virus while the progress of the infection was favoured by mutations potentiating such activity. These results support the biological significance of the IRES-driven p37 translation and suggest that production of the silencing suppressor from the gRNA might allow the virus to early counteract the defence response of the host, thus facilitating pathogen multiplication and spread.

  17. Single Cell Analysis Linking Ribosomal (r)DNA and rRNA Copy Numbers to Cell Size and Growth Rate Provides Insights into Molecular Protistan Ecology.

    Science.gov (United States)

    Fu, Rao; Gong, Jun

    2017-11-01

    Ribosomal (r)RNA and rDNA have been golden molecular markers in microbial ecology. However, it remains poorly understood how ribotype copy number (CN)-based characteristics are linked with diversity, abundance, and activity of protist populations and communities observed at organismal levels. Here, we applied a single-cell approach to quantify ribotype CNs in two ciliate species reared at different temperatures. We found that in actively growing cells, the per-cell rDNA and rRNA CNs scaled with cell volume (CV) to 0.44 and 0.58 powers, respectively. The modeled rDNA and rRNA concentrations thus appear to be much higher in smaller than in larger cells. The observed rRNA:rDNA ratio scaled with CV 0.14 . The maximum growth rate could be well predicted by a combination of per-cell ribotype CN and temperature. Our empirical data and modeling on single-cell ribotype scaling are in agreement with both the metabolic theory of ecology and the growth rate hypothesis, providing a quantitative framework for linking cellular rDNA and rRNA CNs with body size, growth (activity), and biomass stoichiometry. This study also demonstrates that the expression rate of rRNA genes is constrained by cell size, and favors biomass rather than abundance-based interpretation of quantitative ribotype data in population and community ecology of protists. © 2017 The Authors. Journal of Eukaryotic Microbiology published by Wiley Periodicals, Inc. on behalf of International Society of Protistologists.

  18. Multiperspective smFRET reveals rate-determining late intermediates of ribosomal translocation.

    Science.gov (United States)

    Wasserman, Michael R; Alejo, Jose L; Altman, Roger B; Blanchard, Scott C

    2016-04-01

    Directional translocation of the ribosome through the mRNA open reading frame is a critical determinant of translational fidelity. This process entails a complex interplay of large-scale conformational changes within the actively translating particle, which together coordinate the movement of tRNA and mRNA substrates with respect to the large and small ribosomal subunits. Using pre-steady state, single-molecule fluorescence resonance energy transfer imaging, we tracked the nature and timing of these conformational events within the Escherichia coli ribosome from five structural perspectives. Our investigations revealed direct evidence of structurally and kinetically distinct late intermediates during substrate movement, whose resolution determines the rate of translocation. These steps involve intramolecular events within the EF-G-GDP-bound ribosome, including exaggerated, reversible fluctuations of the small-subunit head domain, which ultimately facilitate peptidyl-tRNA's movement into its final post-translocation position.

  19. Identification of Biomphalaria havanensis and Biomphalaria obstructa populations from Cuba using polymerase chain reaction and restriction fragment length polymorphism of the ribosomal RNA intergenic spacer

    Directory of Open Access Journals (Sweden)

    Teofânia HDA Vidigal

    2001-07-01

    Full Text Available In Cuba, several Biomphalaria species have been reported such as B. orbignyi, B. schrammi, B. helophila, B. havanensis and B. peregrina; only the latter three are considered as potential hosts of Schistosoma mansoni. The specific identification of Biomphalaria species is based on anatomical and morphological characters of genital organs and shells. The correct identification of these snails is complicated by the high variation in these characters, similarity among species and in some cases by the small size of the snails. In this paper, we reported the classical morphological identification, the use of PCR and RFLP analysis of the internal transcribed spacer region of the ribosomal RNA genes for molecular identification of seven snail populations from different localities in Cuba. Using morphological and molecular analysis, we showed that among the studied Cuban Biomphalaria populations only B. havanensis and B. obstructa species were found.

  20. Identification of planorbids from Venezuela by polymerase chain reaction amplification and restriction fragment length polymorphism of internal transcriber spacer of the RNA ribosomal gene

    Directory of Open Access Journals (Sweden)

    Caldeira Roberta L

    2000-01-01

    Full Text Available Snails of the genus Biomphalaria from Venezuela were subjected to morphological assessment as well as polymerase chain reaction and restriction fragment length polymorphism (PCR-RFLP analysis. Morphological identification was carried out by comparison of characters of the shell and the male and female reproductive apparatus. The PCR-RFLP involved amplification of the internal spacer region ITS1 and ITS2 of the RNA ribosomal gene and subsequent digestion of this fragment by the restriction enzymes DdeI, MnlI, HaeIII and MspI. The planorbids were compared with snails of the same species and others reported from Venezuela and present in Brazil, Cuba and Mexico. All the enzymes showed a specific profile for each species, that of DdeI being the clearest. The snails were identified as B. glabrata, B. prona and B. kuhniana.

  1. Internal ribosome entry site-mediated translation of a mammalian mRNA is regulated by amino acid availability

    NARCIS (Netherlands)

    Fernandez, J.; Yaman, I.; Mishra, R.; Merrick, W. C.; Snider, M. D.; Lamers, W. H.; Hatzoglou, M.

    2001-01-01

    The cationic amino acid transporter, Cat-1, facilitates the uptake of the essential amino acids arginine and lysine. Amino acid starvation causes accumulation and increased translation of cat-1 mRNA, resulting in a 58-fold increase in protein levels and increased arginine uptake. A bicistronic mRNA

  2. In Profile: Models of Ribosome Biogenesis Defects and Regulation of Protein Synthesis

    NARCIS (Netherlands)

    Essers, P.B.M.

    2013-01-01

    Ribosomes are the mediators of protein synthesis in the cell and therefore crucial to proper cell function. In addition, ribosomes are highly abundant, with ribosomal RNA making up 80% of the RNA in the cell. A large amount of resources go into maintaining this pool of ribosomes, so ribosome

  3. Amplification and sequence analysis of partial bacterial 16S ribosomal RNA gene in gallbladder bile from patients with primary biliary cirrhosis.

    Science.gov (United States)

    Hiramatsu, K; Harada, K; Tsuneyama, K; Sasaki, M; Fujita, S; Hashimoto, T; Kaneko, S; Kobayashi, K; Nakanuma, Y

    2000-07-01

    The etiopathogenesis of bile duct lesion in primary biliary cirrhosis is unknown, though the participation of bacteria and/or their components and products is suspected. In this study, we tried to detect and identify bacteria in the bile of patients with primary biliary cirrhosis by polymerase chain reaction using universal bacterial primers of the 16S ribosomal RNA gene. Gallbladder bile samples from 15 patients with primary biliary cirrhosis, 5 with primary sclerosing cholangitis, 5 with hepatitis C virus-related liver cirrhosis, 11 with cholecystolithiasis, and from 12 normal adult gallbladders were used. In addition to the culture study, partial bacterial 16S ribosomal RNA gene was amplified by polymerase chain reaction (PCR) taking advantage of universal primers that can amplify the gene of almost all bacterial species, and the amplicons were cloned and sequenced. Sequence homology with specific bacterial species was analyzed by database research. Bacterial contamination at every step of the bile sampling, DNA extraction and PCR study was avoided. Furthermore, to confirm whether bacterial DNA is detectable in liver explants, the same analysis was performed using 10 liver explants of patients with primary biliary cirrhosis. In primary biliary cirrhosis, 75% (p<0.0001) of 100 clones were identified as so-called gram-positive cocci while these cocci were positive in only 5% in cholecystolithiasis (p<0.0001). In cholecystolithiasis gram-negative rods were predominant instead. One bacterial species detected in a normal adult was not related to those detected in primary biliary cirrhosis and cholecystolithiasis patients. No bacterial DNA was detected by PCR amplification in 10 liver explants of patients with primary biliary cirrhosis. The present results raise several possible roles of gram-positive bacteria in bile in the etiopathogenesis of primary biliary cirrhosis. However, these results could also reflect an epiphenomenon due to decreased bile flow in the

  4. Complete mitochondrial genomes and nuclear ribosomal RNA operons of two species of Diplostomum (Platyhelminthes: Trematoda): a molecular resource for taxonomy and molecular epidemiology of important fish pathogens.

    Science.gov (United States)

    Brabec, Jan; Kostadinova, Aneta; Scholz, Tomáš; Littlewood, D Timothy J

    2015-06-19

    The genus Diplostomum (Platyhelminthes: Trematoda: Diplostomidae) is a diverse group of freshwater parasites with complex life-cycles and global distribution. The larval stages are important pathogens causing eye fluke disease implicated in substantial impacts on natural fish populations and losses in aquaculture. However, the problematic species delimitation and difficulties in the identification of larval stages hamper the assessment of the distributional and host ranges of Diplostomum spp. and their transmission ecology. Total genomic DNA was isolated from adult worms and shotgun sequenced using Illumina MiSeq technology. Mitochondrial (mt) genomes and nuclear ribosomal RNA (rRNA) operons were assembled using established bioinformatic tools and fully annotated. Mt protein-coding genes and nuclear rRNA genes were subjected to phylogenetic analysis by maximum likelihood and the resulting topologies compared. We characterised novel complete mt genomes and nuclear rRNA operons of two closely related species, Diplostomum spathaceum and D. pseudospathaceum. Comparative mt genome assessment revealed that the cox1 gene and its 'barcode' region used for molecular identification are the most conserved regions; instead, nad4 and nad5 genes were identified as most promising molecular diagnostic markers. Using the novel data, we provide the first genome wide estimation of the phylogenetic relationships of the order Diplostomida, one of the two fundamental lineages of the Digenea. Analyses of the mitogenomic data invariably recovered the Diplostomidae as a sister lineage of the order Plagiorchiida rather than as a basal lineage of the Diplostomida as inferred in rDNA phylogenies; this was concordant with the mt gene order of Diplostomum spp. exhibiting closer match to the conserved gene order of the Plagiorchiida. Complete sequences of the mt genome and rRNA operon of two species of Diplostomum provide a valuable resource for novel genetic markers for species delineation and

  5. Characterization of anti-P monoclonal antibodies directed against the ribosomal protein-RNA complex antigen and produced using Murphy Roths large autoimmune-prone mice.

    Science.gov (United States)

    Sato, H; Onozuka, M; Hagiya, A; Hoshino, S; Narita, I; Uchiumi, T

    2015-02-01

    Autoantibodies, including anti-ribosomal P proteins (anti-P), are thought to be produced by an antigen-driven immune response in systemic lupus erythematosus (SLE). To test this hypothesis, we reconstituted the ribosomal antigenic complex in vitro using human P0, phosphorylated P1 and P2 and a 28S rRNA fragment covering the P0 binding site, and immunized Murphy Roths large (MRL)/lrp lupus mice with this complex without any added adjuvant to generate anti-P antibodies. Using hybridoma technology, we subsequently obtained 34 clones, each producing an anti-P monoclonal antibody (mAb) that recognized the conserved C-terminal tail sequence common to all three P proteins. We also obtained two P0-specific monoclonal antibodies, but no antibody specific to P1, P2 or rRNA fragment. Two types of mAbs were found among these anti-P antibodies: one type (e.g. 9D5) reacted more strongly with the phosphorylated P1 and P2 than that with their non-phosphorylated forms, whereas the other type (e.g. 4H11) reacted equally with both phosphorylated and non-phosphorylated forms of P1/P2. Both 9D5 and 4H11 inhibited the ribosome/eukaryotic elongation factor-2 (eEF-2)-coupled guanosine triphosphate (GTP)ase activity. However, preincubation with a synthetic peptide corresponding to the C-terminal sequence common to all three P proteins, but not the peptide that lacked the last three C-terminal amino acids, mostly prevented the mAb-induced inhibition of GTPase activity. Thus, at least two types of anti-P were produced preferentially following the immunization of MRL mice with the reconstituted antigenic complex. Presence of multiple copies of the C-termini, particularly that of the last three C-terminal amino acid residues, in the antigenic complex appears to contribute to the immunogenic stimulus. © 2014 British Society for Immunology.

  6. Characterization of anti-P monoclonal antibodies directed against the ribosomal protein–RNA complex antigen and produced using Murphy Roths large autoimmune-prone mice

    Science.gov (United States)

    Sato, H; Onozuka, M; Hagiya, A; Hoshino, S; Narita, I; Uchiumi, T

    2015-01-01

    Autoantibodies, including anti-ribosomal P proteins (anti-P), are thought to be produced by an antigen-driven immune response in systemic lupus erythematosus (SLE). To test this hypothesis, we reconstituted the ribosomal antigenic complex in vitro using human P0, phosphorylated P1 and P2 and a 28S rRNA fragment covering the P0 binding site, and immunized Murphy Roths large (MRL)/lrp lupus mice with this complex without any added adjuvant to generate anti-P antibodies. Using hybridoma technology, we subsequently obtained 34 clones, each producing an anti-P monoclonal antibody (mAb) that recognized the conserved C-terminal tail sequence common to all three P proteins. We also obtained two P0-specific monoclonal antibodies, but no antibody specific to P1, P2 or rRNA fragment. Two types of mAbs were found among these anti-P antibodies: one type (e.g. 9D5) reacted more strongly with the phosphorylated P1 and P2 than that with their non-phosphorylated forms, whereas the other type (e.g. 4H11) reacted equally with both phosphorylated and non-phosphorylated forms of P1/P2. Both 9D5 and 4H11 inhibited the ribosome/eukaryotic elongation factor-2 (eEF-2)-coupled guanosine triphosphate (GTP)ase activity. However, preincubation with a synthetic peptide corresponding to the C-terminal sequence common to all three P proteins, but not the peptide that lacked the last three C-terminal amino acids, mostly prevented the mAb-induced inhibition of GTPase activity. Thus, at least two types of anti-P were produced preferentially following the immunization of MRL mice with the reconstituted antigenic complex. Presence of multiple copies of the C-termini, particularly that of the last three C-terminal amino acid residues, in the antigenic complex appears to contribute to the immunogenic stimulus. PMID:25255895

  7. Hierarchical recruitment of ribosomal proteins and assembly factors remodels nucleolar pre-60S ribosomes.

    Science.gov (United States)

    Biedka, Stephanie; Micic, Jelena; Wilson, Daniel; Brown, Hailey; Diorio-Toth, Luke; Woolford, John L

    2018-04-24

    Ribosome biogenesis involves numerous preribosomal RNA (pre-rRNA) processing events to remove internal and external transcribed spacer sequences, ultimately yielding three mature rRNAs. Removal of the internal transcribed spacer 2 spacer RNA is the final step in large subunit pre-rRNA processing and begins with endonucleolytic cleavage at the C 2 site of 27SB pre-rRNA. C 2 cleavage requires the hierarchical recruitment of 11 ribosomal proteins and 14 ribosome assembly factors. However, the function of these proteins in C 2 cleavage remained unclear. In this study, we have performed a detailed analysis of the effects of depleting proteins required for C 2 cleavage and interpreted these results using cryo-electron microscopy structures of assembling 60S subunits. This work revealed that these proteins are required for remodeling of several neighborhoods, including two major functional centers of the 60S subunit, suggesting that these remodeling events form a checkpoint leading to C 2 cleavage. Interestingly, when C 2 cleavage is directly blocked by depleting or inactivating the C 2 endonuclease, assembly progresses through all other subsequent steps. © 2018 Biedka et al.

  8. Control of ribosome formation in rat heart

    International Nuclear Information System (INIS)

    Russo, L.A.

    1987-01-01

    Diabetes of 9 days duration produced a 17% diminution in the rate of total protein synthesis in rat hearts perfused as Langendorff preparations supplied with glucose, plasma levels of amino acids, and 400 μU/ml insulin. This reduction was attributable to a decrease in efficiency of protein synthesis and total RNA content. Total messenger RNA content decreased in diabetic hearts in proportion to the reduction in total RNA. Diabetes also resulted in diminished ribosome content as reflected by the induction in total RNA. Ribosome production was investigated by monitoring incorporation of [ 3 H]phenylalanine into the proteins of cytoplasmic ribosomes. Rates of ribosome formation in diabetic hearts were as fast as control rates in the presence of insulin, and were faster than control rates in the absence of the hormone. These results indicated that ribosome content fell in diabetic hearts despite unchanged or faster rates of ribosome formation

  9. The human nucleolar protein FTSJ3 associates with NIP7 and functions in pre-rRNA processing.

    Directory of Open Access Journals (Sweden)

    Luis G Morello

    Full Text Available NIP7 is one of the many trans-acting factors required for eukaryotic ribosome biogenesis, which interacts with nascent pre-ribosomal particles and dissociates as they complete maturation and are exported to the cytoplasm. By using conditional knockdown, we have shown previously that yeast Nip7p is required primarily for 60S subunit synthesis while human NIP7 is involved in the biogenesis of 40S subunit. This raised the possibility that human NIP7 interacts with a different set of proteins as compared to the yeast protein. By using the yeast two-hybrid system we identified FTSJ3, a putative ortholog of yeast Spb1p, as a human NIP7-interacting protein. A functional association between NIP7 and FTSJ3 is further supported by colocalization and coimmunoprecipitation analyses. Conditional knockdown revealed that depletion of FTSJ3 affects cell proliferation and causes pre-rRNA processing defects. The major pre-rRNA processing defect involves accumulation of the 34S pre-rRNA encompassing from site A' to site 2b. Accumulation of this pre-rRNA indicates that processing of sites A0, 1 and 2 are slower in cells depleted of FTSJ3 and implicates FTSJ3 in the pathway leading to 18S rRNA maturation as observed previously for NIP7. The results presented in this work indicate a close functional interaction between NIP7 and FTSJ3 during pre-rRNA processing and show that FTSJ3 participates in ribosome synthesis in human cells.

  10. A discontinuous RNA platform mediates RNA virus replication: building an integrated model for RNA-based regulation of viral processes.

    Directory of Open Access Journals (Sweden)

    Baodong Wu

    2009-03-01

    Full Text Available Plus-strand RNA viruses contain RNA elements within their genomes that mediate a variety of fundamental viral processes. The traditional view of these elements is that of local RNA structures. This perspective, however, is changing due to increasing discoveries of functional viral RNA elements that are formed by long-range RNA-RNA interactions, often spanning thousands of nucleotides. The plus-strand RNA genomes of tombusviruses exemplify this concept by possessing different long-range RNA-RNA interactions that regulate both viral translation and transcription. Here we report that a third fundamental tombusvirus process, viral genome replication, requires a long-range RNA-based interaction spanning approximately 3000 nts. In vivo and in vitro analyses suggest that the discontinuous RNA platform formed by the interaction facilitates efficient assembly of the viral RNA replicase. This finding has allowed us to build an integrated model for the role of global RNA structure in regulating the reproduction of a eukaryotic RNA virus, and the insights gained have extended our understanding of the multifunctional nature of viral RNA genomes.

  11. RNA.

    Science.gov (United States)

    Darnell, James E., Jr.

    1985-01-01

    Ribonucleic acid (RNA) converts genetic information into protein and usually must be processed to serve its function. RNA types, chemical structure, protein synthesis, translation, manufacture, and processing are discussed. Concludes that the first genes might have been spliced RNA and that humans might be closer than bacteria to primitive…

  12. Ribosome evolution: Emergence of peptide synthesis machinery

    Indian Academy of Sciences (India)

    suggested the dynamic movement of ribosomal proteins. The L2 protein (a .... Such kinds of interactions are important in elucidating the evolution of RNA .... Tamura K 2009 Molecular handedness of life: significance of RNA aminoacylation.

  13. Analysis of clustered point mutations in the human ribosomal RNA gene promoter by transient expression in vivo

    International Nuclear Information System (INIS)

    Jones, M.H.; Learned, R.M.; Tjian, R.

    1988-01-01

    The authors have mapped the cis regulatory elements required in vivo for initiation at the human rRNA promoter by RNA polymerase I. Transient expression in COS-7 cells was used to evaluate the transcription phenotype of clustered base substitution mutations in the human rRNA promoter. The promoter consists of two major elements: a large upstream region, composed of several domains, that lies between nucleotides -234 and -107 relative to the transcription initiation site and affects transcription up to 100-fold and a core element that lies between nucleotides -45 and +20 and affects transcription up to 1000-fold. The upstream regions is able to retain partial function when positioned within 100-160 nucleotides of the transcription initiation site, but it cannot stimulate transcription from distances of ≥ 600 nucleotides. In addition, they demonstrate, using mouse-human hybrid rRNA promoters, that the sequences responsible for human species-specific transcription in vivo appear to reside in both the core and upstream elements, and sequences from the mouse rRNA promoter cannot be substituted for them

  14. Mutational analysis of S12 protein and implications for the accuracy of decoding by the ribosome.

    Science.gov (United States)

    Sharma, Divya; Cukras, Anthony R; Rogers, Elizabeth J; Southworth, Daniel R; Green, Rachel

    2007-12-07

    The fidelity of aminoacyl-tRNA selection by the ribosome depends on a conformational switch in the decoding center of the small ribosomal subunit induced by cognate but not by near-cognate aminoacyl-tRNA. The aminoglycosides paromomycin and streptomycin bind to the decoding center and induce related structural rearrangements that explain their observed effects on miscoding. Structural and biochemical studies have identified ribosomal protein S12 (as well as specific nucleotides in 16S ribosomal RNA) as a critical molecular contributor in distinguishing between cognate and near-cognate tRNA species as well as in promoting more global rearrangements in the small subunit, referred to as "closure." Here we use a mutational approach to define contributions made by two highly conserved loops in S12 to the process of tRNA selection. Most S12 variant ribosomes tested display increased levels of fidelity (a "restrictive" phenotype). Interestingly, several variants, K42A and R53A, were substantially resistant to the miscoding effects of paromomycin. Further characterization of the compromised paromomycin response identified a probable second, fidelity-modulating binding site for paromomycin in the 16S ribosomal RNA that facilitates closure of the small subunit and compensates for defects associated with the S12 mutations.

  15. Crystal Structure of the 23S rRNA Fragment Specific to r-Protein L1 and Designed Model of the Ribosomal L1 Stalk from Haloarcula marismortui

    Directory of Open Access Journals (Sweden)

    Azat Gabdulkhakov

    2017-02-01

    Full Text Available The crystal structure of the 92-nucleotide L1-specific fragment of 23S rRNA from Haloarcula marismortui (Hma has been determined at 3.3 Å resolution. Similar to the corresponding bacterial rRNA fragments, this structure contains joined helix 76-77 topped by an approximately globular structure formed by the residual part of the L1 stalk rRNA. The position of HmaL1 relative to the rRNA was found by its docking to the rRNA fragment using the L1-rRNA complex from Thermus thermophilus as a guide model. In spite of the anomalous negative charge of the halophilic archaeal protein, the conformation of the HmaL1-rRNA interface appeared to be very close to that observed in all known L1-rRNA complexes. The designed structure of the L1 stalk was incorporated into the H. marismortui 50S ribosomal subunit. Comparison of relative positions of L1 stalks in 50S subunits from H. marismortui and T. thermophilus made it possible to reveal the site of inflection of rRNA during the ribosome function.

  16. Prevalence, Genetic Characterization, and 18S Small Subunit Ribosomal RNA Diversity of Trypanosoma rangeli in Triatomine and Mammal Hosts in Endemic Areas for Chagas Disease in Ecuador.

    Science.gov (United States)

    Ocaña-Mayorga, Sofia; Aguirre-Villacis, Fernanda; Pinto, C Miguel; Vallejo, Gustavo A; Grijalva, Mario J

    2015-12-01

    Trypanosoma rangeli is a nonpathogenic parasite for humans; however, its medical importance relies in its similarity and overlapping distribution with Trypanosoma cruzi, causal agent of Chagas disease in the Americas. The genetic diversity of T. rangeli and its association with host species (triatomines and mammals) has been identified along Central and the South America; however, it has not included data of isolates from Ecuador. This study reports infection with T. rangeli in 18 genera of mammal hosts and five species of triatomines in three environments (domestic, peridomestic, and sylvatic). Higher infection rates were found in the sylvatic environment, in close association with Rhodnius ecuadoriensis. The results of this study extend the range of hosts infected with this parasite and the geographic range of the T. rangeli genotype KP1(-)/lineage C in South America. It was not possible to detect variation on T. rangeli from the central coastal region and southern Ecuador with the analysis of the small subunit ribosomal RNA (SSU-rRNA) gene, even though these areas are ecologically different and a phenotypic subdivision of R. ecuadoriensis has been found. R. ecuadoriensis is considered one of the most important vectors for Chagas disease transmission in Ecuador due to its wide distribution and adaptability to diverse environments. An extensive knowledge of the trypanosomes circulating in this species of triatomine, and associated mammal hosts, is important for delineating transmission dynamics and preventive measures in the endemic areas of Ecuador and Northern Peru.

  17. Prevalence, Genetic Characterization, and 18S Small Subunit Ribosomal RNA Diversity of Trypanosoma rangeli in Triatomine and Mammal Hosts in Endemic Areas for Chagas Disease in Ecuador

    Science.gov (United States)

    Ocaña-Mayorga, Sofia; Aguirre-Villacis, Fernanda; Pinto, C. Miguel; Vallejo, Gustavo A.

    2015-01-01

    Abstract Trypanosoma rangeli is a nonpathogenic parasite for humans; however, its medical importance relies in its similarity and overlapping distribution with Trypanosoma cruzi, causal agent of Chagas disease in the Americas. The genetic diversity of T. rangeli and its association with host species (triatomines and mammals) has been identified along Central and the South America; however, it has not included data of isolates from Ecuador. This study reports infection with T. rangeli in 18 genera of mammal hosts and five species of triatomines in three environments (domestic, peridomestic, and sylvatic). Higher infection rates were found in the sylvatic environment, in close association with Rhodnius ecuadoriensis. The results of this study extend the range of hosts infected with this parasite and the geographic range of the T. rangeli genotype KP1(−)/lineage C in South America. It was not possible to detect variation on T. rangeli from the central coastal region and southern Ecuador with the analysis of the small subunit ribosomal RNA (SSU-rRNA) gene, even though these areas are ecologically different and a phenotypic subdivision of R. ecuadoriensis has been found. R. ecuadoriensis is considered one of the most important vectors for Chagas disease transmission in Ecuador due to its wide distribution and adaptability to diverse environments. An extensive knowledge of the trypanosomes circulating in this species of triatomine, and associated mammal hosts, is important for delineating transmission dynamics and preventive measures in the endemic areas of Ecuador and Northern Peru. PMID:26645579

  18. Global Identification of New Substrates for the Yeast Endoribonuclease, RNase Mitochondrial RNA Processing (MRP)*

    Science.gov (United States)

    Aulds, Jason; Wierzbicki, Sara; McNairn, Adrian; Schmitt, Mark E.

    2012-01-01

    RNase mitochondrial RNA processing (MRP) is an essential, evolutionarily conserved endoribonuclease composed of 10 different protein subunits and a single RNA. RNase MRP has established roles in multiple pathways including ribosome biogenesis, cell cycle regulation, and mitochondrial DNA replication. Although each of these functions is important to cell growth, additional functions may exist given the essential nature of the complex. To identify novel RNase MRP substrates, we utilized RNA immunoprecipitation and microarray chip analysis to identify RNA that physically associates with RNase MRP. We identified several new potential substrates for RNase MRP including a cell cycle-regulated transcript, CTS1; the yeast homolog of the mammalian p27Kip1, SIC1; and the U2 RNA component of the spliceosome. In addition, we found RNase MRP to be involved in the regulation of the Ty1 transposon RNA. These results reinforce and broaden the role of RNase MRP in cell cycle regulation and help to identify new roles of this endoribonuclease. PMID:22977255

  19. Characterizing the transcriptome upon depletion of RNA processing factors

    DEFF Research Database (Denmark)

    Herudek, Jan

    , it is not clear how they target and discriminate their RNA substrates. Moreover, many novel RNA species are poorly characterized and their function is not understood. Over the last decade, protein function has been studied using RNA interference. However, this approach does not allow investigation of instant......The human genome is pervasively transcribed and produces an enormous amount of non-coding RNA (ncRNA). Compared to protein-coding transcripts, many classes of ncRNAs are very unstable and rapidly degraded by the RNA decay machinery. The RNA exosome complex is a main RNA ‘degrader’ in the human...... nucleus and is responsible for the proper processing and decay of a wide range of RNA molecules. Notably, the RNA exosome complex associates with a plethora of co-factors and activators that assist in the recognition of specific RNA substrates. Although many exosome partners have been characterized...

  20. Partial nucleotide sequence analysis of 18S ribosomal RNA gene of the four genotypes of Trypanosoma congolense

    International Nuclear Information System (INIS)

    Osanya, A.; Majiwa, P.A.O.; Kinyanjui, P.W.

    2006-01-01

    Specific oligonucleotide primers based on conserved nucleotide sequences of 18s ribisomal RNA (18s rRNA) gene of Trypanosoma brucei, Leishmania donovani, Triponema aequale and Lagenidium gigantum have been designed and used in the ploymerase chain reaction (PCR) to amplify genomic DNA from four different clones each representing a different genotypic group of T. congolence. PCR products of approximately 1Kb were generated using as template DNA from each of the trypanosomes. The PCR products cross-hybridized with genomic DNA from T.brucei, T. simiae and the four genotypes of T.congolense implying significant sequence homology of 18S rRNA gene among trypanosomes. The nucleotide sequence of a segment of the PCR products were determined by direct sequencing to provide partial nucleotide sequence of the 18s rRNA gene in each T.congolense genotypic group. The sequences obtained together with those that have been published for T.brucei reveals that although most regions show inter and intra species nucleotide identity, there are several sites where deletions, insertions and base changes have occured in nucleotide sequence of of T.brucei and the four genotypes of T.congolense.(author)

  1. The importance of ribosome production, and the 5S RNP-MDM2 pathway, in health and disease.

    Science.gov (United States)

    Pelava, Andria; Schneider, Claudia; Watkins, Nicholas J

    2016-08-15

    Ribosomes are abundant, large RNA-protein complexes that are the source of all protein synthesis in the cell. The production of ribosomes is an extremely energetically expensive cellular process that has long been linked to human health and disease. More recently, it has been shown that ribosome biogenesis is intimately linked to multiple cellular signalling pathways and that defects in ribosome production can lead to a wide variety of human diseases. Furthermore, changes in ribosome production in response to nutrient levels in the diet lead to metabolic re-programming of the liver. Reduced or abnormal ribosome production in response to cellular stress or mutations in genes encoding factors critical for ribosome biogenesis causes the activation of the tumour suppressor p53, which leads to re-programming of cellular transcription. The ribosomal assembly intermediate 5S RNP (ribonucleoprotein particle), containing RPL5, RPL11 and the 5S rRNA, accumulates when ribosome biogenesis is blocked. The excess 5S RNP binds to murine double minute 2 (MDM2), the main p53-suppressor in the cell, inhibiting its function and leading to p53 activation. Here, we discuss the involvement of ribosome biogenesis in the homoeostasis of p53 in the cell and in human health and disease. © 2016 The Author(s).

  2. Evolution of blue-flowered species of genus Linum based on high-throughput sequencing of ribosomal RNA genes.

    Science.gov (United States)

    Bolsheva, Nadezhda L; Melnikova, Nataliya V; Kirov, Ilya V; Speranskaya, Anna S; Krinitsina, Anastasia A; Dmitriev, Alexey A; Belenikin, Maxim S; Krasnov, George S; Lakunina, Valentina A; Snezhkina, Anastasiya V; Rozhmina, Tatiana A; Samatadze, Tatiana E; Yurkevich, Olga Yu; Zoshchuk, Svyatoslav A; Amosova, Аlexandra V; Kudryavtseva, Anna V; Muravenko, Olga V

    2017-12-28

    The species relationships within the genus Linum have already been studied several times by means of different molecular and phylogenetic approaches. Nevertheless, a number of ambiguities in phylogeny of Linum still remain unresolved. In particular, the species relationships within the sections Stellerolinum and Dasylinum need further clarification. Also, the question of independence of the species of the section Adenolinum still remains unanswered. Moreover, the relationships of L. narbonense and other species of the section Linum require further clarification. Additionally, the origin of tetraploid species of the section Linum (2n = 30) including the cultivated species L. usitatissimum has not been explored. The present study examines the phylogeny of blue-flowered species of Linum by comparisons of 5S rRNA gene sequences as well as ITS1 and ITS2 sequences of 35S rRNA genes. High-throughput sequencing has been used for analysis of multicopy rRNA gene families. In addition to the molecular phylogenetic analysis, the number and chromosomal localization of 5S and 35S rDNA sites has been determined by FISH. Our findings confirm that L. stelleroides forms a basal branch from the clade of blue-flowered flaxes which is independent of the branch formed by species of the sect. Dasylinum. The current molecular phylogenetic approaches, the cytogenetic analysis as well as different genomic DNA fingerprinting methods applied previously did not discriminate certain species within the sect. Adenolinum. The allotetraploid cultivated species L. usitatissimum and its wild ancestor L. angustifolium (2n = 30) could originate either as the result of hybridization of two diploid species (2n = 16) related to the modern L. gandiflorum and L. decumbens, or hybridization of a diploid species (2n = 16) and a diploid ancestor of modern L. narbonense (2n = 14). High-throughput sequencing of multicopy rRNA gene families allowed us to make several adjustments to the

  3. The pre-rRNA processing factor DEF is rate limiting for the pathogenesis of MYCN-driven neuroblastoma.

    Science.gov (United States)

    Tao, T; Sondalle, S B; Shi, H; Zhu, S; Perez-Atayde, A R; Peng, J; Baserga, S J; Look, A T

    2017-07-06

    The nucleolar factor, digestive organ expansion factor (DEF), has a key role in ribosome biogenesis, functioning in pre-ribosomal RNA (pre-rRNA) processing as a component of the small ribosomal subunit (SSU) processome. Here we show that the peripheral sympathetic nervous system (PSNS) is very underdeveloped in def-deficient zebrafish, and that def haploinsufficiency significantly decreases disease penetrance and tumor growth rate in a MYCN-driven transgenic zebrafish model of neuroblastoma that arises in the PSNS. Consistent with these findings, DEF is highly expressed in human neuroblastoma, and its depletion in human neuroblastoma cell lines induces apoptosis. Interestingly, overexpression of MYCN in zebrafish and in human neuroblastoma cells results in the appearance of intermediate pre-rRNAs species that reflect the processing of pre-rRNAs through Pathway 2, a pathway that processes pre-rRNAs in a different temporal order than the more often used Pathway 1. Our results indicate that DEF and possibly other components of the SSU processome provide a novel site of vulnerability in neuroblastoma cells that could be exploited for targeted therapy.

  4. Deep Sequencing Insights in Therapeutic shRNA Processing and siRNA Target Cleavage Precision.

    Science.gov (United States)

    Denise, Hubert; Moschos, Sterghios A; Sidders, Benjamin; Burden, Frances; Perkins, Hannah; Carter, Nikki; Stroud, Tim; Kennedy, Michael; Fancy, Sally-Ann; Lapthorn, Cris; Lavender, Helen; Kinloch, Ross; Suhy, David; Corbau, Romu

    2014-02-04

    TT-034 (PF-05095808) is a recombinant adeno-associated virus serotype 8 (AAV8) agent expressing three short hairpin RNA (shRNA) pro-drugs that target the hepatitis C virus (HCV) RNA genome. The cytosolic enzyme Dicer cleaves each shRNA into multiple, potentially active small interfering RNA (siRNA) drugs. Using next-generation sequencing (NGS) to identify and characterize active shRNAs maturation products, we observed that each TT-034-encoded shRNA could be processed into as many as 95 separate siRNA strands. Few of these appeared active as determined by Sanger 5' RNA Ligase-Mediated Rapid Amplification of cDNA Ends (5-RACE) and through synthetic shRNA and siRNA analogue studies. Moreover, NGS scrutiny applied on 5-RACE products (RACE-seq) suggested that synthetic siRNAs could direct cleavage in not one, but up to five separate positions on targeted RNA, in a sequence-dependent manner. These data support an on-target mechanism of action for TT-034 without cytotoxicity and question the accepted precision of substrate processing by the key RNA interference (RNAi) enzymes Dicer and siRNA-induced silencing complex (siRISC).Molecular Therapy-Nucleic Acids (2014) 3, e145; doi:10.1038/mtna.2013.73; published online 4 February 2014.

  5. 8-Methoxypsoralen DNA interstrand cross-linking of the ribosomal RNA genes in Tetrahymena thermophila. Distribution, repair and effect on rRNA synthesis

    DEFF Research Database (Denmark)

    Fengquin, X; Nielsen, Henrik; Zhen, W

    1993-01-01

    between three domains (terminal spacer, transcribed region and central spacer) as defined by restriction enzyme analysis (BamHI and ClaI). It is furthermore shown that a dosage resulting in approximately one cross-link per rDNA molecule (21 kbp, two genes) is sufficient to block RNA synthesis. Finally......, it is shown that the cross-links in the rDNA molecules are repaired at equal rate in all three domains within 24 h and that RNA synthesis is partly restored during this repair period. The majority of the cells also go through one to two cell divisions in this period but do not survive....

  6. Variability in secondary structure of 18S ribosomal RNA as topological marker for identification of Paramecium species.

    Science.gov (United States)

    Shakoori, Farah R; Tasneem, Fareeda; Al-Ghanim, K; Mahboob, S; Al-Misned, F; Jahan, Nusrat; Shakoori, Abdul Rauf

    2014-12-01

    Besides cytological and molecular applications, Paramecium is being used in water quality assessment and for determination of saprobic levels. An unambiguous identification of these unicellular eukaryotes is not only essential, but its ecological diversity must also be explored in the local environment. 18SrRNA genes of all the strains of Paramecium species isolated from waste water were amplified, cloned and sequenced. Phylogenetic comparison of the nucleotide sequences of these strains with 23 closely related Paramecium species from GenBank Database enabled identification of Paramecium multimicronucleatum and Paramecium jenningsi. Some isolates did not show significant close association with other Paramecium species, and because of their unique position in the phylogenetic tree, they were considered new to the field. In the present report, these isolates are being designated as Paramecium caudatum pakistanicus. In this article, secondary structure of 18SrRNA has also been analyzed as an additional and perhaps more reliable topological marker for species discrimination and for determining possible phylogenetic relationship between the ciliate species. On the basis of comparison of secondary structure of 18SrRNA of various isolated Paramacium strains, and among Paramecium caudatum pakistanicus, Tetrahymena thermophila, Drosophila melanogaster, and Homo sapiens, it can be deduced that variable regions are more helpful in differentiating the species at interspecific level rather than at intraspecific level. It was concluded that V3 was the least variable region in all the organisms, V2 and V7 were the longest expansion segments of D. melanogaster and there was continuous mutational bias towards G.C base pairing in H. sapiens. © 2014 Wiley Periodicals, Inc.

  7. Transcriptional Regulation of Mouse Ribosomal RNA Synthesis by Pathways Involving Protein Kinase C, Calcium, Insulin and Serum

    Science.gov (United States)

    1992-05-08

    Southern California 1ha.iITRINUTIONI AVAILASILITY STATEMENT 12b. DITIUINCCD1 This document has been approved { OSRUTO for public release and sale ...and 500 gIl of CHCI3 : Isoamyl alcohol (24 : 1), and 2X with 1ml of CHCI 3 : Iso amyl alcohol (24 : 1). RNA was precipitated at -200C overnight in the...control. Plasmid constructions. Plasmids pMrA and pMrD (Kuhn and Grummt, 1987) were kind gifts of Dr. Ingrid Grummt. Plasmid p119 and p123 (Arnhiem

  8. Lack of WDR36 leads to preimplantation embryonic lethality in mice and delays the formation of small subunit ribosomal RNA in human cells in vitro.

    Science.gov (United States)

    Gallenberger, Martin; Meinel, Dominik M; Kroeber, Markus; Wegner, Michael; Milkereit, Philipp; Bösl, Michael R; Tamm, Ernst R

    2011-02-01

    Mutations in WD repeat domain 36 gene (WDR36) play a causative role in some forms of primary open-angle glaucoma, a leading cause of blindness worldwide. WDR36 is characterized by the presence of multiple WD40 repeats and shows homology to Utp21, an essential protein component of the yeast small subunit (SSU) processome required for maturation of 18S rRNA. To clarify the functional role of WDR36 in the mammalian organism, we generated and investigated mutant mice with a targeted deletion of Wdr36. In parallel experiments, we used RNA interference to deplete WDR36 mRNA in mouse embryos and cultured human trabecular meshwork (HTM-N) cells. Deletion of Wdr36 in the mouse caused preimplantation embryonic lethality, and essentially similar effects were observed when WDR36 mRNA was depleted in mouse embryos by RNA interference. Depletion of WDR36 mRNA in HTM-N cells caused apoptotic cell death and upregulation of mRNA for BAX, TP53 and CDKN1A. By immunocytochemistry, staining for WDR36 was observed in the nucleolus of cells, which co-localized with that of nucleolar proteins such as nucleophosmin and PWP2. In addition, recombinant and epitope-tagged WDR36 localized to the nucleolus of HTM-N cells. By northern blot analysis, a substantial decrease in 21S rRNA, the precursor of 18S rRNA, was observed following knockdown of WDR36. In addition, metabolic-labeling experiments consistently showed a delay of 18S rRNA maturation in WDR36-depleted cells. Our results provide evidence that WDR36 is an essential protein in mammalian cells which is involved in the nucleolar processing of SSU 18S rRNA.

  9. RNA processing and ribonucleoprotein assembly studied in vivo by RNA transfection

    International Nuclear Information System (INIS)

    Kleinschmidt, A.M.; Pederson, T.

    1990-01-01

    The authors present a method for studying RNA processing and ribonucleoprotein assembly in vivo, by using RNA synthesized in vitro. SP6-transcribed 32 P-labeled U2 small nuclear RNA precursor molecules were introduced into cultured human 293 cells by calcium phosphate-mediated uptake, as in standard DNA transfection experiments. RNase protection mapping demonstrated that the introduced pre-U2 RNA underwent accurate 3' end processing. The introduced U2 RNA was assembled into ribonucleoprotein particles that reacted with an antibody specific for proteins known to be associated with the U2 small nuclear ribonucleoprotein particle. The 3' end-processed, ribonucleoprotein-assembled U2 RNA accumulated in the nuclear fraction. When pre-U2 RNA with a 7-methylguanosine group at the 5' end was introduced into cells, it underwent conversion to a 2,2,7-trimethylguanosine cap structure, a characteristic feature of the U-small nuclear RNAs. Pre-U2 RNA introduced with an adenosine cap (Ap-ppG) also underwent processing, small nuclear ribonucleoprotein assembly, and nuclear accumulation, establishing that a methylated guanosine cap structure is not required for these steps in U2 small nuclear ribonucleprotein biosynthesis. Beyond its demonstrated usefulness in the study of small nuclear ribonucleoprotein biosynthesis, RNA transfection may be of general applicability to the investigation of eukaryotic RNA processing in vivo and may also offer opportunities for introducing therapeutically targeted RNAs (ribozymes or antisense RNA) into cells

  10. Ribosomal RNA analysis indicates a benthic pennate diatom ancestry for the endosymbionts of the dinoflagellates Peridinium foliaceum and Peridinium balticum (Pyrrhophyta).

    Science.gov (United States)

    Chesnick, J M; Kooistra, W H; Wellbrock, U; Medlin, L K

    1997-01-01

    The establishment of chloroplasts as cellular organelles in the dinoflagellate, heterokont (stramenopile), haptophyte, and cryptophyte algae is widely accepted to have been the result of secondary endosymbiotic events, that is, the uptake of a photosynthetic eukaryote by a phagotrophic eukaryote. However, the circumstances that promote such associations between two phylogenetically distinct organisms and result in the integration of their genomes to form a single functional photosynthetic cell is unclear. The dinoflagellates Peridinium foliaceum and Peridinium balticum are unusual in that each contains a membrane-bound eukaryotic heterokont endosymbiont. These symbioses have been interpreted, through data derived from ultrastructural and biochemical investigations, to represent an intermediate stage of secondary endosymbiotic chloroplast acquisition. In this study we have examined the phylogenetic origin of the P. foliaceum and P. balticum heterokont endosymbionts through analysis of their nuclear small subunit ribosomal RNA genes. Our analyses clearly demonstrate both endosymbionts are pennate diatoms belonging to the family Bacillariaceae. Since members of the Bacillariaceae are usually benthic, living on shallow marine sediments, the manner in which establishment of a symbiosis between a planktonic flagellated dinoflagellate and a bottom-dwelling diatom is discussed. In particular, specific environmentally-associated life strategy stages of the host and symbiont, coupled with diatom food preferences by the dinoflagellate, may have been vital to the formation of this association.

  11. A ribosomal RNA gene intergenic spacer based PCR and DGGE fingerprinting method for the analysis of specific rhizobial communities in soil.

    Science.gov (United States)

    de Oliveira, Valéria Maia; Manfio, Gilson Paulo; da Costa Coutinho, Heitor Luiz; Keijzer-Wolters, Anneke Christina; van Elsas, Jan Dirk

    2006-03-01

    A direct molecular method for assessing the diversity of specific populations of rhizobia in soil, based on nested PCR amplification of 16S-23S ribosomal RNA gene (rDNA) intergenic spacer (IGS) sequences, was developed. Initial generic amplification of bacterial rDNA IGS sequences from soil DNA was followed by specific amplification of (1) sequences affiliated with Rhizobium leguminosarum "sensu lato" and (2) R. tropici. Using analysis of the amplified sequences in clone libraries obtained on the basis of soil DNA, this two-sided method was shown to be very specific for rhizobial subpopulations in soil. It was then further validated as a direct fingerprinting tool of the target rhizobia based on denaturing gradient gel electrophoresis (DGGE). The PCR-DGGE approach was applied to soils from fields in Brazil cultivated with common bean (Phaseolus vulgaris) under conventional or no-tillage practices. The community fingerprints obtained allowed the direct analysis of the respective rhizobial community structures in soil samples from the two contrasting agricultural practices. Data obtained with both primer sets revealed clustering of the community structures of the target rhizobial types along treatment. Moreover, the DGGE profiles obtained with the R. tropici primer set indicated that the abundance and diversity of these organisms were favoured under NT practices. These results suggest that the R. leguminosarum-as well as R. tropici-targeted IGS-based nested PCR and DGGE are useful tools for monitoring the effect of agricultural practices on these and related rhizobial subpopulations in soils.

  12. Molecular and phylogenetic characterizations of an Eimeria krijgsmanni Yakimoff & Gouseff, 1938 (Apicomplexa: Eimeriidae) mouse intestinal protozoan parasite by partial 18S ribosomal RNA gene sequence analysis.

    Science.gov (United States)

    Takeo, Toshinori; Tanaka, Tetsuya; Matsubayashi, Makoto; Maeda, Hiroki; Kusakisako, Kodai; Matsui, Toshihiro; Mochizuki, Masami; Matsuo, Tomohide

    2014-08-01

    Previously, we characterized an undocumented strain of Eimeria krijgsmanni by morphological and biological features. Here, we present a detailed molecular phylogenetic analysis of this organism. Namely, 18S ribosomal RNA gene (rDNA) sequences of E. krijgsmanni were analyzed to incorporate this species into a comprehensive Eimeria phylogeny. As a result, partial 18S rDNA sequence from E. krijgsmanni was successfully determined, and two different types, Type A and Type B, that differed by 1 base pair were identified. E. krijgsmanni was originally isolated from a single oocyst, and thus the result show that the two types might have allelic sequence heterogeneity in the 18S rDNA. Based on phylogenetic analyses, the two types of E. krijgsmanni 18S rDNA formed one of two clades among murine Eimeria spp.; these Eimeria clades reflected morphological similarity among the Eimeria spp. This is the third molecular phylogenetic characterization of a murine Eimeria spp. in addition to E. falciformis and E. papillata. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  13. Characterization of an internal ribosomal entry segment within the 5' leader of avian reticuloendotheliosis virus type A RNA and development of novel MLV-REV-based retroviral vectors.

    Science.gov (United States)

    López-Lastra, M; Gabus, C; Darlix, J L

    1997-11-01

    The murine leukemia virus (MLV)-related type C viruses constitute a major class of retroviruses that includes numerous endogenous and exogenous mammalian viruses and the related avian spleen necrosis virus (SNV). The MLV-related viruses possess a long and multifunctional 5' untranslated leader involved in key steps of the viral life cycle--splicing, translation, RNA dimerization, encapsidation, and reverse transcription. Recent studies have shown that the 5' leader of Friend murine leukemia virus and Moloney murine leukemia virus can direct cap independent translation of gag precursor proteins (Berlioz et al., 1995; Vagner et al., 1995b). These data, together with structural homology studies (Koning et al., 1992), prompted us to undertake a search for new internal ribosome entry segment (IRES) of retroviral origin. Here we describe an IRES element within the 5' leader of avian reticuloendotheliosis virus type A (REV-A) genomic RNA. Data show that the REV-A 5' IRES element maps downstream of the packaging/dimerization (E/DLS) sequence (Watanabe and Temin, 1982; Darlix et al., 1992) and the minimal IRES sequence appears to be within a 129 nt fragment (nucleotides 452-580) of the 5' leader, immediately upstream of the gag AUG codon. The REV-A IRES has been successfully utilized in the construction of novel high titer MLV-based retroviral vectors, containing one or more IRES elements of retroviral origin. These retroviral constructs, which represent a starting point for the design of novel vectors suitable for gene therapy, are also of interest as a model system of internal translation initiation and its possible regulation during development, cancer, or virus infection.

  14. Protein-protein interactions within late pre-40S ribosomes.

    Directory of Open Access Journals (Sweden)

    Melody G Campbell

    2011-01-01

    Full Text Available Ribosome assembly in eukaryotic organisms requires more than 200 assembly factors to facilitate and coordinate rRNA transcription, processing, and folding with the binding of the ribosomal proteins. Many of these assembly factors bind and dissociate at defined times giving rise to discrete assembly intermediates, some of which have been partially characterized with regards to their protein and RNA composition. Here, we have analyzed the protein-protein interactions between the seven assembly factors bound to late cytoplasmic pre-40S ribosomes using recombinant proteins in binding assays. Our data show that these factors form two modules: one comprising Enp1 and the export adaptor Ltv1 near the beak structure, and the second comprising the kinase Rio2, the nuclease Nob1, and a regulatory RNA binding protein Dim2/Pno1 on the front of the head. The GTPase-like Tsr1 and the universally conserved methylase Dim1 are also peripherally connected to this second module. Additionally, in an effort to further define the locations for these essential proteins, we have analyzed the interactions between these assembly factors and six ribosomal proteins: Rps0, Rps3, Rps5, Rps14, Rps15 and Rps29. Together, these results and previous RNA-protein crosslinking data allow us to propose a model for the binding sites of these seven assembly factors. Furthermore, our data show that the essential kinase Rio2 is located at the center of the pre-ribosomal particle and interacts, directly or indirectly, with every other assembly factor, as well as three ribosomal proteins required for cytoplasmic 40S maturation. These data suggest that Rio2 could play a central role in regulating cytoplasmic maturation steps.

  15. Conservation of RNA sequence and cross-linking ability in ribosomes from a higher eukaryote: photochemical cross-linking of the anticodon of P site bound tRNA to the penultimate cytidine of the UACACACG sequence in Artemia salina 18S rRNA

    International Nuclear Information System (INIS)

    Ciesiolka, J.; Nurse, K.; Klein, J.; Ofengand, J.

    1985-01-01

    The complex of Artemia salina ribosomes and Escherichia coli acetylvalyl-tRNA could be cross-linked by irradiation with near-UV light. Cross-linking required the presence of the codon GUU, GUA being ineffective. The acetylvalyl group could be released from the cross-linked tRNA by treatment with puromycin, demonstrating that cross-linking had occurred at the P site. This was true both for pGUU- and also for poly(U2,G)-dependent cross-linking. All of the cross-linking was to the 18S rRNA of the small ribosomal subunit. Photolysis of the cross-link at 254 nm occurred with the same kinetics as that for the known cyclobutane dimer between this tRNA and Escherichia coli 16S rRNA. T1 RNase digestion of the cross-linked tRNA yielded an oligonucleotide larger in molecular weight than any from un-cross-linked rRNA or tRNA or from a prephotolyzed complex. Extended electrophoresis showed this material to consist of two oligomers of similar mobility, a faster one-third component and a slower two-thirds component. Each oligomer yielded two components on 254-nm photolysis. The slower band from each was the tRNA T1 oligomer CACCUCCCUVACAAGp, which includes the anticodon. The faster band was the rRNA 9-mer UACACACCGp and its derivative UACACACUG. Unexpectedly, the dephosphorylated and slower moving 9-mer was derived from the faster moving dimer. Deamination of the penultimate C to U is probably due to cyclobutane dimer formation and was evidence for that nucleotide being the site of cross-linking. Direct confirmation of the cross-linking site was obtained by Z-gel analysis

  16. Molecular characterization of tlyA gene product, Rv1694 of Mycobacterium tuberculosis: A non-conventional hemolysin and a ribosomal RNA methyl transferase

    Directory of Open Access Journals (Sweden)

    Ahmed Neesar

    2010-09-01

    was significantly slower than mock vector transformed E. coli. The S30 extract of E. coli expressing the Rv1694 had poor translational activity in presence of capreomycin, further confirming its methylation activity. Finally, incorporation of methyl group of [3H]-S-adenosylmethionine in isolated ribosomes also confirmed its methylation activity. Conclusions The Rv1694 has an unusual dual activity. It appears to contain two diverse functions such as haemolytic activity and ribosomal RNA methylation activity. It is possible that the haemolytic activity might be relevant to intra-cellular compartments such as phagosomes rather than cell lysis of erythrocytes and the self-assembly trait may have a potential role after successful entry into macrophages by Mycobacterium tuberculosis.

  17. Crosstalk between Wnt Signaling and RNA Processing in Colorectal Cancer

    Directory of Open Access Journals (Sweden)

    Michael Bordonaro

    2013-01-01

    Full Text Available RNA processing involves a variety of processes affecting gene expression, including the removal of introns through RNA splicing, as well as 3' end processing (cleavage and polyadenylation. Alternative RNA processing is fundamentally important for gene regulation, and aberrant processing is associated with the initiation and progression of cancer. Deregulated Wnt signaling, which is the initiating event in the development of most cases of human colorectal cancer (CRC, has been linked to modified RNA processing, which may contribute to Wnt-mediated colonic carcinogenesis. Crosstalk between Wnt signaling and alternative RNA splicing with relevance to CRC includes effects on the expression of Rac1b, an alternatively spliced gene associated with tumorigenesis, which exhibits alternative RNA splicing that is influenced by Wnt activity. In addition, Tcf4, a crucial component of Wnt signaling, also exhibits alternative splicing, which is likely involved in colonic tumorigenesis. Modulation of 3' end formation, including of the Wnt target gene COX-2, also can influence the neoplastic process, with implications for CRC. While many human genes are dependent on introns and splicing for normal levels of gene expression, naturally intronless genes exist with a unique metabolism that allows for intron-independent gene expression. Effects of Wnt activity on the RNA metabolism of the intronless Wnt-target gene c-jun is a likely contributor to cancer development. Further, butyrate, a breakdown product of dietary fiber and a histone deacetylase inhibitor, upregulates Wnt activity in CRC cells, and also modulates RNA processing; therefore, the interplay between Wnt activity, the modulation of this activity by butyrate, and differential RNA metabolism in colonic cells can significantly influence tumorigenesis. Determining the role played by altered RNA processing in Wnt-mediated neoplasia may lead to novel interventions aimed at restoring normal RNA metabolism for

  18. Crosstalk between Wnt Signaling and RNA Processing in Colorectal Cancer.

    Science.gov (United States)

    Bordonaro, Michael

    2013-01-01

    RNA processing involves a variety of processes affecting gene expression, including the removal of introns through RNA splicing, as well as 3' end processing (cleavage and polyadenylation). Alternative RNA processing is fundamentally important for gene regulation, and aberrant processing is associated with the initiation and progression of cancer. Deregulated Wnt signaling, which is the initiating event in the development of most cases of human colorectal cancer (CRC), has been linked to modified RNA processing, which may contribute to Wnt-mediated colonic carcinogenesis. Crosstalk between Wnt signaling and alternative RNA splicing with relevance to CRC includes effects on the expression of Rac1b, an alternatively spliced gene associated with tumorigenesis, which exhibits alternative RNA splicing that is influenced by Wnt activity. In addition, Tcf4, a crucial component of Wnt signaling, also exhibits alternative splicing, which is likely involved in colonic tumorigenesis. Modulation of 3' end formation, including of the Wnt target gene COX-2, also can influence the neoplastic process, with implications for CRC. While many human genes are dependent on introns and splicing for normal levels of gene expression, naturally intronless genes exist with a unique metabolism that allows for intron-independent gene expression. Effects of Wnt activity on the RNA metabolism of the intronless Wnt-target gene c-jun is a likely contributor to cancer development. Further, butyrate, a breakdown product of dietary fiber and a histone deacetylase inhibitor, upregulates Wnt activity in CRC cells, and also modulates RNA processing; therefore, the interplay between Wnt activity, the modulation of this activity by butyrate, and differential RNA metabolism in colonic cells can significantly influence tumorigenesis. Determining the role played by altered RNA processing in Wnt-mediated neoplasia may lead to novel interventions aimed at restoring normal RNA metabolism for therapeutic benefit

  19. Multi-perspective smFRET reveals rate-determining late intermediates of ribosomal translocation

    Science.gov (United States)

    Wasserman, Michael R.; Alejo, Jose L.; Altman, Roger B.; Blanchard, Scott C.

    2016-01-01

    Directional translocation of the ribosome through the messenger RNA open reading frame is a critical determinant of translational fidelity. This process entails a complex interplay of large-scale conformational changes within the actively translating particle, which together coordinate the movement of transfer and messenger RNA substrates with respect to the large and small ribosomal subunits. Using pre-steady state, single-molecule fluorescence resonance energy transfer imaging, we have tracked the nature and timing of these conformational events within the Escherichia coli ribosome from five structural perspectives. Our investigations reveal direct evidence of structurally and kinetically distinct, late intermediates during substrate movement, whose resolution is rate-determining to the translocation mechanism. These steps involve intra-molecular events within the EFG(GDP)-bound ribosome, including exaggerated, reversible fluctuations of the small subunit head domain, which ultimately facilitate peptidyl-tRNA’s movement into its final post-translocation position. PMID:26926435

  20. Structural insights into methyltransferase KsgA function in 30S ribosomal subunit biogenesis.

    Science.gov (United States)

    Boehringer, Daniel; O'Farrell, Heather C; Rife, Jason P; Ban, Nenad

    2012-03-23

    The assembly of the ribosomal subunits is facilitated by ribosome biogenesis factors. The universally conserved methyltransferase KsgA modifies two adjacent adenosine residues in the 3'-terminal helix 45 of the 16 S ribosomal RNA (rRNA). KsgA recognizes its substrate adenosine residues only in the context of a near mature 30S subunit and is required for the efficient processing of the rRNA termini during ribosome biogenesis. Here, we present the cryo-EM structure of KsgA bound to a nonmethylated 30S ribosomal subunit. The structure reveals that KsgA binds to the 30S platform with the catalytic N-terminal domain interacting with substrate adenosine residues in helix 45 and the C-terminal domain making extensive contacts to helix 27 and helix 24. KsgA excludes the penultimate rRNA helix 44 from adopting its position in the mature 30S subunit, blocking the formation of the decoding site and subunit joining. We suggest that the activation of methyltransferase activity and subsequent dissociation of KsgA control conformational changes in helix 44 required for final rRNA processing and translation initiation.

  1. Structural Insights into Methyltransferase KsgA Function in 30S Ribosomal Subunit Biogenesis*

    Science.gov (United States)

    Boehringer, Daniel; O'Farrell, Heather C.; Rife, Jason P.; Ban, Nenad

    2012-01-01

    The assembly of the ribosomal subunits is facilitated by ribosome biogenesis factors. The universally conserved methyltransferase KsgA modifies two adjacent adenosine residues in the 3′-terminal helix 45 of the 16 S ribosomal RNA (rRNA). KsgA recognizes its substrate adenosine residues only in the context of a near mature 30S subunit and is required for the efficient processing of the rRNA termini during ribosome biogenesis. Here, we present the cryo-EM structure of KsgA bound to a nonmethylated 30S ribosomal subunit. The structure reveals that KsgA binds to the 30S platform with the catalytic N-terminal domain interacting with substrate adenosine residues in helix 45 and the C-terminal domain making extensive contacts to helix 27 and helix 24. KsgA excludes the penultimate rRNA helix 44 from adopting its position in the mature 30S subunit, blocking the formation of the decoding site and subunit joining. We suggest that the activation of methyltransferase activity and subsequent dissociation of KsgA control conformational changes in helix 44 required for final rRNA processing and translation initiation. PMID:22308031

  2. Trapping the ribosome to control gene expression.

    Science.gov (United States)

    Boehringer, Daniel; Ban, Nenad

    2007-09-21

    Protein synthesis is often regulated by structured mRNAs that interact with ribosomes. In this issue of Cell, Marzi et al. (2007) provide insights into the autoregulation of protein S15 by visualizing the folded repressor mRNA on the ribosome stalled in the preinitiation state. These results have implications for our understanding of the mechanism of translation initiation in general.

  3. RNase MRP is required for entry of 35S precursor rRNA into the canonical processing pathway.

    Science.gov (United States)

    Lindahl, Lasse; Bommankanti, Ananth; Li, Xing; Hayden, Lauren; Jones, Adrienne; Khan, Miriam; Oni, Tolulope; Zengel, Janice M

    2009-07-01

    RNase MRP is a nucleolar RNA-protein enzyme that participates in the processing of rRNA during ribosome biogenesis. Previous experiments suggested that RNase MRP makes a nonessential cleavage in the first internal transcribed spacer. Here we report experiments with new temperature-sensitive RNase MRP mutants in Saccharomyces cerevisiae that show that the abundance of all early intermediates in the processing pathway is severely reduced upon inactivation of RNase MRP. Transcription of rRNA continues unabated as determined by RNA polymerase run-on transcription, but the precursor rRNA transcript does not accumulate, and appears to be unstable. Taken together, these observations suggest that inactivation of RNase MRP blocks cleavage at sites A0, A1, A2, and A3, which in turn, prevents precursor rRNA from entering the canonical processing pathway (35S > 20S + 27S > 18S + 25S + 5.8S rRNA). Nevertheless, at least some cleavage at the processing site in the second internal transcribed spacer takes place to form an unusual 24S intermediate, suggesting that cleavage at C2 is not blocked. Furthermore, the long form of 5.8S rRNA is made in the absence of RNase MRP activity, but only in the presence of Xrn1p (exonuclease 1), an enzyme not required for the canonical pathway. We conclude that RNase MRP is a key enzyme for initiating the canonical processing of precursor rRNA transcripts, but alternative pathway(s) might provide a backup for production of small amounts of rRNA.

  4. Bacteriological incidence in pneumonia patients with pulmonary emphysema: a bacterial floral analysis using the 16S ribosomal RNA gene in bronchoalveolar lavage fluid.

    Science.gov (United States)

    Naito, Keisuke; Yamasaki, Kei; Yatera, Kazuhiro; Akata, Kentaro; Noguchi, Shingo; Kawanami, Toshinori; Fukuda, Kazumasa; Kido, Takashi; Ishimoto, Hiroshi; Mukae, Hiroshi

    2017-01-01

    Pulmonary emphysema is an important radiological finding in chronic obstructive pulmonary disease patients, but bacteriological differences in pneumonia patients according to the severity of emphysematous changes have not been reported. Therefore, we evaluated the bacteriological incidence in the bronchoalveolar lavage fluid (BALF) of pneumonia patients using cultivation and a culture-independent molecular method. Japanese patients with community-acquired pneumonia (83) and healthcare-associated pneumonia (94) between April 2010 and February 2014 were evaluated. The BALF obtained from pneumonia lesions was evaluated by both cultivation and a molecular method. In the molecular method, ~600 base pairs of bacterial 16S ribosomal RNA genes in the BALF were amplified by polymerase chain reaction, and clone libraries were constructed. The nucleotide sequences of 96 randomly selected colonies were determined, and a homology search was performed to identify the bacterial species. A qualitative radiological evaluation of pulmonary emphysema based on chest computed tomography (CT) images was performed using the Goddard classification. The severity of pulmonary emphysema based on the Goddard classification was none in 47.4% (84/177), mild in 36.2% (64/177), moderate in 10.2% (18/177), and severe in 6.2% (11/177). Using the culture-independent molecular method, Moraxella catarrhalis was significantly more frequently detected in moderate or severe emphysema patients than in patients with no or mild emphysematous changes. The detection rates of Haemophilus influenzae and Pseudomonas aeruginosa were unrelated to the severity of pulmonary emphysematous changes, and Streptococcus species - except for the S. anginosus group and S. pneumoniae - were detected more frequently using the molecular method we used for the BALF of patients with pneumonia than using culture methods. Our findings suggest that M. catarrhalis is more frequently detected in pneumonia patients with moderate or

  5. Polysome profiling of mAb producing CHO cell lines links translational control of cell proliferation and recombinant mRNA loading onto ribosomes with global and recombinant protein synthesis.

    Science.gov (United States)

    Godfrey, Charlotte L; Mead, Emma J; Daramola, Olalekan; Dunn, Sarah; Hatton, Diane; Field, Ray; Pettman, Gary; Smales, C Mark

    2017-08-01

    mRNA translation is a key process determining growth, proliferation and duration of a Chinese hamster ovary (CHO) cell culture and influences recombinant protein synthesis rate. During bioprocessing, CHO cells can experience stresses leading to reprogramming of translation and decreased global protein synthesis. Here we apply polysome profiling to determine reprogramming and translational capabilities in host and recombinant monoclonal antibody-producing (mAb) CHO cell lines during batch culture. Recombinant cell lines with the fastest cell specific growth rates were those with the highest global translational efficiency. However, total ribosomal capacity, determined from polysome profiles, did not relate to the fastest growing or highest producing mAb cell line, suggesting it is the ability to utilise available machinery that determines protein synthetic capacity. Cell lines with higher cell specific productivities tended to have elevated recombinant heavy chain transcript copy numbers, localised to the translationally active heavy polysomes. The highest titre cell line was that which sustained recombinant protein synthesis and maintained high recombinant transcript copy numbers in polysomes. Investigation of specific endogenous transcripts revealed a number that maintained or reprogrammed into heavy polysomes, identifying targets for potential cell engineering or those with 5' untranslated regions that might be utilised to enhance recombinant transcript translation. © 2017 The Authors. Biotechnology Journal published by WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  6. Diverse Regulators of Human Ribosome Biogenesis Discovered by Changes in Nucleolar Number

    Directory of Open Access Journals (Sweden)

    Katherine I. Farley-Barnes

    2018-02-01

    Full Text Available Ribosome biogenesis is a highly regulated, essential cellular process. Although studies in yeast have established some of the biological principles of ribosome biogenesis, many of the intricacies of its regulation in higher eukaryotes remain unknown. To understand how ribosome biogenesis is globally integrated in human cells, we conducted a genome-wide siRNA screen for regulators of nucleolar number. We found 139 proteins whose depletion changed the number of nucleoli per nucleus from 2–3 to only 1 in human MCF10A cells. Follow-up analyses on 20 hits found many (90% to be essential for the nucleolar functions of rDNA transcription (7, pre-ribosomal RNA (pre-rRNA processing (16, and/or global protein synthesis (14. This genome-wide analysis exploits the relationship between nucleolar number and function to discover diverse cellular pathways that regulate the making of ribosomes and paves the way for further exploration of the links between ribosome biogenesis and human disease.

  7. The chaperonin of the archaeon Sulfolobus solfataricus is an RNA-binding protein that participates in ribosomal RNA processing.

    OpenAIRE

    Ruggero, D; Ciammaruconi, A; Londei, P

    1998-01-01

    The 60 kDa molecular chaperones (chaperonins) are high molecular weight protein complexes having a characteristic double-ring toroidal shape; they are thought to aid the folding of denatured or newly synthesized polypeptides. These proteins exist as two functionally similar, but distantly related families, one comprising the bacterial and organellar chaperonins and another (the so-called CCT-TRiC family) including the chaperonins of the archaea and the eukaryotes. Although some evidence exist...

  8. Conservative fragments in bacterial 16S rRNA genes and primer design for 16S ribosomal DNA amplicons in metagenomic studies

    KAUST Repository

    Wang, Yong; Qian, Pei-Yuan

    2009-01-01

    Bacterial 16S ribosomal DNA (rDNA) amplicons have been widely used in the classification of uncultured bacteria inhabiting environmental niches. Primers targeting conservative regions of the rDNAs are used to generate amplicons of variant regions

  9. Interphase ribosomal RNA cistron staining in thyroid epithelial cells in Grave's disease, Hashimoto's thyroiditis and benign and malignant tumours of the thyroid gland

    OpenAIRE

    Mamaev, N N; Grynyeva, E N; Blagosklonnaya, Y V

    1996-01-01

    Aim—To evaluate the expression of ribosomal cistrons in human thyroid epithelial cells (TECs) of patients with Grave's disease, Hashimoto's thyroiditis and benign and malignant tumours of the thyroid gland.

  10. RNA assemblages orchestrate complex cellular processes

    DEFF Research Database (Denmark)

    Nielsen, Finn Cilius; Hansen, Heidi Theil; Christiansen, Jan

    2016-01-01

    Eukaryotic mRNAs are monocistronic, and therefore mechanisms exist that coordinate the synthesis of multiprotein complexes in order to obtain proper stoichiometry at the appropriate intracellular locations. RNA-binding proteins containing low-complexity sequences are prone to generate liquid drop...

  11. A distinct group of hepacivirus/pestivirus-like internal ribosomal entry sites in members of diverse picornavirus genera: evidence for modular exchange of functional noncoding RNA elements by recombination.

    Science.gov (United States)

    Hellen, Christopher U T; de Breyne, Sylvain

    2007-06-01

    The 5' untranslated regions (UTRs) of the RNA genomes of Flaviviridae of the Hepacivirus and Pestivirus genera contain internal ribosomal entry sites (IRESs) that are unrelated to the two principal classes of IRESs of Picornaviridae. The mechanism of translation initiation on hepacivirus/pestivirus (HP) IRESs, which involves factor-independent binding to ribosomal 40S subunits, also differs fundamentally from initiation on these picornavirus IRESs. Ribosomal binding to HP IRESs requires conserved sequences that form a pseudoknot and the adjacent IIId and IIIe domains; analogous elements do not occur in the two principal groups of picornavirus IRESs. Here, comparative sequence analysis was used to identify a subset of picornaviruses from multiple genera that contain 5' UTR sequences with significant similarities to HP IRESs. They are avian encephalomyelitis virus, duck hepatitis virus 1, duck picornavirus, porcine teschovirus, porcine enterovirus 8, Seneca Valley virus, and simian picornavirus. Their 5' UTRs are predicted to form several structures, in some of which the peripheral elements differ from the corresponding HP IRES elements but in which the core pseudoknot, domain IIId, and domain IIIe elements are all closely related. These findings suggest that HP-like IRESs have been exchanged between unrelated virus families by recombination and support the hypothesis that RNA viruses consist of modular coding and noncoding elements that can exchange and evolve independently.

  12. A Distinct Group of Hepacivirus/Pestivirus-Like Internal Ribosomal Entry Sites in Members of Diverse Picornavirus Genera: Evidence for Modular Exchange of Functional Noncoding RNA Elements by Recombination▿ †

    Science.gov (United States)

    Hellen, Christopher U. T.; de Breyne, Sylvain

    2007-01-01

    The 5′ untranslated regions (UTRs) of the RNA genomes of Flaviviridae of the Hepacivirus and Pestivirus genera contain internal ribosomal entry sites (IRESs) that are unrelated to the two principal classes of IRESs of Picornaviridae. The mechanism of translation initiation on hepacivirus/pestivirus (HP) IRESs, which involves factor-independent binding to ribosomal 40S subunits, also differs fundamentally from initiation on these picornavirus IRESs. Ribosomal binding to HP IRESs requires conserved sequences that form a pseudoknot and the adjacent IIId and IIIe domains; analogous elements do not occur in the two principal groups of picornavirus IRESs. Here, comparative sequence analysis was used to identify a subset of picornaviruses from multiple genera that contain 5′ UTR sequences with significant similarities to HP IRESs. They are avian encephalomyelitis virus, duck hepatitis virus 1, duck picornavirus, porcine teschovirus, porcine enterovirus 8, Seneca Valley virus, and simian picornavirus. Their 5′ UTRs are predicted to form several structures, in some of which the peripheral elements differ from the corresponding HP IRES elements but in which the core pseudoknot, domain IIId, and domain IIIe elements are all closely related. These findings suggest that HP-like IRESs have been exchanged between unrelated virus families by recombination and support the hypothesis that RNA viruses consist of modular coding and noncoding elements that can exchange and evolve independently. PMID:17392358

  13. Assembly constraints drive co-evolution among ribosomal constituents.

    Science.gov (United States)

    Mallik, Saurav; Akashi, Hiroshi; Kundu, Sudip

    2015-06-23

    Ribosome biogenesis, a central and essential cellular process, occurs through sequential association and mutual co-folding of protein-RNA constituents in a well-defined assembly pathway. Here, we construct a network of co-evolving nucleotide/amino acid residues within the ribosome and demonstrate that assembly constraints are strong predictors of co-evolutionary patterns. Predictors of co-evolution include a wide spectrum of structural reconstitution events, such as cooperativity phenomenon, protein-induced rRNA reconstitutions, molecular packing of different rRNA domains, protein-rRNA recognition, etc. A correlation between folding rate of small globular proteins and their topological features is known. We have introduced an analogous topological characteristic for co-evolutionary network of ribosome, which allows us to differentiate between rRNA regions subjected to rapid reconstitutions from those hindered by kinetic traps. Furthermore, co-evolutionary patterns provide a biological basis for deleterious mutation sites and further allow prediction of potential antibiotic targeting sites. Understanding assembly pathways of multicomponent macromolecules remains a key challenge in biophysics. Our study provides a 'proof of concept' that directly relates co-evolution to biophysical interactions during multicomponent assembly and suggests predictive power to identify candidates for critical functional interactions as well as for assembly-blocking antibiotic target sites. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  14. Ribosomal protein methyltransferases in the yeast Saccharomyces cerevisiae: Roles in ribosome biogenesis and translation.

    Science.gov (United States)

    Al-Hadid, Qais; White, Jonelle; Clarke, Steven

    2016-02-12

    A significant percentage of the methyltransferasome in Saccharomyces cerevisiae and higher eukaryotes is devoted to methylation of the translational machinery. Methylation of the RNA components of the translational machinery has been studied extensively and is important for structure stability, ribosome biogenesis, and translational fidelity. However, the functional effects of ribosomal protein methylation by their cognate methyltransferases are still largely unknown. Previous work has shown that the ribosomal protein Rpl3 methyltransferase, histidine protein methyltransferase 1 (Hpm1), is important for ribosome biogenesis and translation elongation fidelity. In this study, yeast strains deficient in each of the ten ribosomal protein methyltransferases in S. cerevisiae were examined for potential defects in ribosome biogenesis and translation. Like Hpm1-deficient cells, loss of four of the nine other ribosomal protein methyltransferases resulted in defects in ribosomal subunit synthesis. All of the mutant strains exhibited resistance to the ribosome inhibitors anisomycin and/or cycloheximide in plate assays, but not in liquid culture. Translational fidelity assays measuring stop codon readthrough, amino acid misincorporation, and programmed -1 ribosomal frameshifting, revealed that eight of the ten enzymes are important for translation elongation fidelity and the remaining two are necessary for translation termination efficiency. Altogether, these results demonstrate that ribosomal protein methyltransferases in S. cerevisiae play important roles in ribosome biogenesis and translation. Copyright © 2016 Elsevier Inc. All rights reserved.

  15. A comparative study of ribosomal proteins: linkage between amino acid distribution and ribosomal assembly

    International Nuclear Information System (INIS)

    Lott, Brittany Burton; Wang, Yongmei; Nakazato, Takuya

    2013-01-01

    Assembly of the ribosome from its protein and RNA constituents must occur quickly and efficiently in order to synthesize the proteins necessary for all cellular activity. Since the early 1960’s, certain characteristics of possible assembly pathways have been elucidated, yet the mechanisms that govern the precise recognition events remain unclear. We utilize a comparative analysis to investigate the amino acid composition of ribosomal proteins (r-proteins) with respect to their role in the assembly process. We compared small subunit (30S) r-protein sequences to those of other housekeeping proteins from 560 bacterial species and searched for correlations between r-protein amino acid content and factors such as assembly binding order, environmental growth temperature, protein size, and contact with ribosomal RNA (rRNA) in the 30S complex. We find r-proteins have a significantly high percent of positive residues, which are highly represented at rRNA contact sites. An inverse correlation between the percent of positive residues and r-protein size was identified and is mainly due to the content of Lysine residues, rather than Arginine. Nearly all r-proteins carry a net positive charge, but no statistical correlation between the net charge and the binding order was detected. Thermophilic (high-temperature) r-proteins contain increased Arginine, Isoleucine, and Tyrosine, and decreased Serine and Threonine compared to mesophilic (lower-temperature), reflecting a known distinction between thermophiles and mesophiles, possibly to account for protein thermostability. However, this difference in amino acid content does not extend to rRNA contact sites, as the proportions of thermophilic and mesophilic contact residues are not significantly different. Given the significantly higher level of positively charged residues in r-proteins and at contact sites, we conclude that ribosome assembly relies heavily on an electrostatic component of interaction. However, the binding order of

  16. Theoretical analysis of the distribution of isolated particles in totally asymmetric exclusion processes: Application to mRNA translation rate estimation

    Science.gov (United States)

    Dao Duc, Khanh; Saleem, Zain H.; Song, Yun S.

    2018-01-01

    The Totally Asymmetric Exclusion Process (TASEP) is a classical stochastic model for describing the transport of interacting particles, such as ribosomes moving along the messenger ribonucleic acid (mRNA) during translation. Although this model has been widely studied in the past, the extent of collision between particles and the average distance between a particle to its nearest neighbor have not been quantified explicitly. We provide here a theoretical analysis of such quantities via the distribution of isolated particles. In the classical form of the model in which each particle occupies only a single site, we obtain an exact analytic solution using the matrix ansatz. We then employ a refined mean-field approach to extend the analysis to a generalized TASEP with particles of an arbitrary size. Our theoretical study has direct applications in mRNA translation and the interpretation of experimental ribosome profiling data. In particular, our analysis of data from Saccharomyces cerevisiae suggests a potential bias against the detection of nearby ribosomes with a gap distance of less than approximately three codons, which leads to some ambiguity in estimating the initiation rate and protein production flux for a substantial fraction of genes. Despite such ambiguity, however, we demonstrate theoretically that the interference rate associated with collisions can be robustly estimated and show that approximately 1% of the translating ribosomes get obstructed.

  17. RNA-SeQC: RNA-seq metrics for quality control and process optimization.

    Science.gov (United States)

    DeLuca, David S; Levin, Joshua Z; Sivachenko, Andrey; Fennell, Timothy; Nazaire, Marc-Danie; Williams, Chris; Reich, Michael; Winckler, Wendy; Getz, Gad

    2012-06-01

    RNA-seq, the application of next-generation sequencing to RNA, provides transcriptome-wide characterization of cellular activity. Assessment of sequencing performance and library quality is critical to the interpretation of RNA-seq data, yet few tools exist to address this issue. We introduce RNA-SeQC, a program which provides key measures of data quality. These metrics include yield, alignment and duplication rates; GC bias, rRNA content, regions of alignment (exon, intron and intragenic), continuity of coverage, 3'/5' bias and count of detectable transcripts, among others. The software provides multi-sample evaluation of library construction protocols, input materials and other experimental parameters. The modularity of the software enables pipeline integration and the routine monitoring of key measures of data quality such as the number of alignable reads, duplication rates and rRNA contamination. RNA-SeQC allows investigators to make informed decisions about sample inclusion in downstream analysis. In summary, RNA-SeQC provides quality control measures critical to experiment design, process optimization and downstream computational analysis. See www.genepattern.org to run online, or www.broadinstitute.org/rna-seqc/ for a command line tool.

  18. The Response of a 16S Ribosomal RNA Gene Fragment Amplified Community to Lead, Zinc, and Copper Pollution in a Shanghai Field Trial

    Directory of Open Access Journals (Sweden)

    Shumeng Kou

    2018-03-01

    Full Text Available Industrial and agricultural activities have caused extensive metal contamination of land throughout China and across the globe. The pervasive nature of metal pollution can be harmful to human health and can potentially cause substantial negative impact to the biosphere. To investigate the impact of anthropogenic metal pollution found in high concentrations in industrial, agricultural, and urban environments, 16S ribosomal RNA gene amplicon sequencing was used to track change in the amplified microbial community after metal contamination in a large-scale field experiment in Shanghai. A total of 1,566 operational taxonomic units (OTUs identified from 448,108 sequences gathered from 20 plots treated as controls or with lead, zinc, copper, or all three metals. Constrained Analysis of Principal Coordinates ordination did not separate control and lead treatment but could separate control/lead, zinc, copper, and three metal treatment. DESeq2 was applied to identify 93 significantly differentially abundant OTUs varying in 211 pairwise instances between the treatments. Differentially abundant OTUs representing genera or species belonging to the phyla Chloroflexi, Cyanobacteria, Firmicutes, Latescibacteria, and Planctomycetes were almost universally reduced in abundance due to zinc, copper, or three metal treatment; with three metal treatment abolishing the detection of some OTUs, such as Leptolyngbya, Desmonostoc muscorum, and Microcoleus steenstrupii. The greatest increases due to metal treatment were observed in Bacteroidetes, Actinobacteria, Chlamydiae, Nitrospirae, and Proteobacteria (α, β, δ, and γ; the most (relative abundant being uncharacterized species within the genera Methylobacillus, Solirubrobacter, and Ohtaekwangia. Three metal treatment alone resulted in identification of 22 OTUs (genera or species which were not detected in control soil, notably including Yonghaparkia alkaliphila, Pedobacter steynii, Pseudolabrys taiwanensis

  19. Bacteriological incidence in pneumonia patients with pulmonary emphysema: a bacterial floral analysis using the 16S ribosomal RNA gene in bronchoalveolar lavage fluid

    Directory of Open Access Journals (Sweden)

    Naito K

    2017-07-01

    Full Text Available Keisuke Naito,1 Kei Yamasaki,1 Kazuhiro Yatera,1 Kentaro Akata,1 Shingo Noguchi,1 Toshinori Kawanami,1 Kazumasa Fukuda,2 Takashi Kido,1 Hiroshi Ishimoto,3 Hiroshi Mukae3 1Department of Respiratory Medicine, 2Department of Microbiology, University of Occupational and Environmental Health, Japan, Kitakyushu City, Fukuoka, 3Second Department of Internal Medicine, Nagasaki University School of Medicine, Nagasaki City, Nagasaki, Japan Abstract: Pulmonary emphysema is an important radiological finding in chronic obstructive pulmonary disease patients, but bacteriological differences in pneumonia patients according to the severity of emphysematous changes have not been reported. Therefore, we evaluated the bacteriological incidence in the bronchoalveolar lavage fluid (BALF of pneumonia patients using cultivation and a culture-independent molecular method. Japanese patients with community-acquired pneumonia (83 and healthcare-associated pneumonia (94 between April 2010 and February 2014 were evaluated. The BALF obtained from pneumonia lesions was evaluated by both cultivation and a molecular method. In the molecular method, ~600 base pairs of bacterial 16S ribosomal RNA genes in the BALF were amplified by polymerase chain reaction, and clone libraries were constructed. The nucleotide sequences of 96 randomly selected colonies were determined, and a homology search was performed to identify the bacterial species. A qualitative radiological evaluation of pulmonary emphysema based on chest computed tomography (CT images was performed using the Goddard classification. The severity of pulmonary emphysema based on the Goddard classification was none in 47.4% (84/177, mild in 36.2% (64/177, moderate in 10.2% (18/177, and severe in 6.2% (11/177. Using the culture-independent molecular method, Moraxella catarrhalis was significantly more frequently detected in moderate or severe emphysema patients than in patients with no or mild emphysematous changes. The

  20. The Response of a 16S Ribosomal RNA Gene Fragment Amplified Community to Lead, Zinc, and Copper Pollution in a Shanghai Field Trial.

    Science.gov (United States)

    Kou, Shumeng; Vincent, Gilles; Gonzalez, Emmanuel; Pitre, Frederic E; Labrecque, Michel; Brereton, Nicholas J B

    2018-01-01

    Industrial and agricultural activities have caused extensive metal contamination of land throughout China and across the globe. The pervasive nature of metal pollution can be harmful to human health and can potentially cause substantial negative impact to the biosphere. To investigate the impact of anthropogenic metal pollution found in high concentrations in industrial, agricultural, and urban environments, 16S ribosomal RNA gene amplicon sequencing was used to track change in the amplified microbial community after metal contamination in a large-scale field experiment in Shanghai. A total of 1,566 operational taxonomic units (OTUs) identified from 448,108 sequences gathered from 20 plots treated as controls or with lead, zinc, copper, or all three metals. Constrained Analysis of Principal Coordinates ordination did not separate control and lead treatment but could separate control/lead, zinc, copper, and three metal treatment. DESeq2 was applied to identify 93 significantly differentially abundant OTUs varying in 211 pairwise instances between the treatments. Differentially abundant OTUs representing genera or species belonging to the phyla Chloroflexi, Cyanobacteria, Firmicutes, Latescibacteria, and Planctomycetes were almost universally reduced in abundance due to zinc, copper, or three metal treatment; with three metal treatment abolishing the detection of some OTUs, such as Leptolyngbya , Desmonostoc muscorum , and Microcoleus steenstrupii . The greatest increases due to metal treatment were observed in Bacteroidetes, Actinobacteria, Chlamydiae, Nitrospirae, and Proteobacteria (α, β, δ, and γ); the most (relative) abundant being uncharacterized species within the genera Methylobacillus , Solirubrobacter , and Ohtaekwangia . Three metal treatment alone resulted in identification of 22 OTUs (genera or species) which were not detected in control soil, notably including Yonghaparkia alkaliphila , Pedobacter steynii , Pseudolabrys taiwanensis , Methylophilus

  1. Phylogeography, genetic variability and structure of Acanthamoeba metapopulations in Iran inferred by 18S ribosomal RNA sequences: A systematic review and meta-analysis.

    Science.gov (United States)

    Spotin, Adel; Moslemzadeh, Hamid Reza; Mahami-Oskouei, Mahmoud; Ahmadpour, Ehsan; Niyyati, Maryam; Hejazi, Seyed Hossein; Memari, Fatemeh; Noori, Jafar

    2017-09-01

    To verify phylogeography and genetic structure of Acanthamoeba populations among the Iranian clinical isolates and natural/artificial environments distributed in various regions of the country. We searched electronic databases including Medline, PubMed, Science Direct, Scopus and Google Scholar from 2005 to 2016. To explore the genetic variability of Acanthamoeba sp, 205 sequences were retrieved from keratitis patients, immunosuppressed cases and environmental sources as of various geographies of Iran. T4 genotype was the predominant strain in Iran, and the rare genotypes belonged to T2, T3, T5 (Acanthamoeba lenticulata), T6, T9, T11, T13 and T15 (Acanthamoeba jacobsi). A total of 47 unique haplotypes of T4 were identified. A parsimonious network of the sequence haplotypes demonstrated star-like feature containing haplogroups IR6 (34.1%) and IR7 (31.2%) as the most common haplotypes. In accordance with the analysis of molecular variance, the high value of haplotype diversity (0.612-0.848) of Acanthamoeba T4 represented genetic variability within populations. Neutrality indices of the 18S ribosomal RNA demonstrated negative values in all populations which represented a considerable divergence from neutrality. The majority of genetic diversity belonged to the infected contact lens and dust samples in immunodeficiency and ophthalmology wards, which indicated potential routes for exposure to a pathogenic Acanthamoeba sp. in at-risk individuals. A pairwise fixation index (F ST ) was from low to high values (0.02433-0.41892). The statistically F ST points out that T4 is genetically differentiated between north-west, north-south and central-south metapopulations, but not differentiated between west-central, west-south, central-south, and north-central isolates. An occurrence of IR6 and IR7 displays that possibly a gene flow of Acanthamoeba T4 occurred after the founder effect or bottleneck experience through ecological changes or host mobility. This is the first

  2. Dissecting the interactions of SERRATE with RNA and DICER-LIKE 1 in Arabidopsis microRNA precursor processing

    KAUST Repository

    Iwata, Yuji; Takahashi, Masateru; Fedoroff, Nina V.; Hamdan, Samir

    2013-01-01

    ). In the present study, we examined primary miRNA precursor (pri-miRNA) processing by highly purified recombinant DCL1 and SE proteins and found that SE is integral to pri-miRNA processing by DCL1. SE stimulates DCL1 cleavage of the pri-miRNA in an ionic strength

  3. Selective blockade of microRNA processing by Lin-28

    Science.gov (United States)

    Viswanathan, Srinivas R.; Daley, George Q.; Gregory, Richard I.

    2012-01-01

    MicroRNAs (miRNAs) play critical roles in development, and dysregulation of miRNA expression has been observed in human malignancies. Recent evidence suggests that the processing of several primary miRNA transcripts (pri-miRNAs) is blocked post-transcriptionally in embryonic stem (ES) cells, embryonal carcinoma (EC) cells, and primary tumors. Here we show that Lin-28, a developmentally regulated RNA-binding protein, selectively blocks the processing of pri-let-7 miRNAs in embryonic cells. Using in vitro and in vivo studies, we demonstrate that Lin-28 is necessary and sufficient for blocking Microprocessor-mediated cleavage of pri-let-7 miRNAs. Our results identify Lin-28 as a negative regulator of miRNA biogenesis and suggest that Lin-28 may play a central role in blocking miRNA-mediated differentiation in stem cells and certain cancers. PMID:18292307

  4. NVL2, a nucleolar AAA-ATPase, is associated with the nuclear exosome and is involved in pre-rRNA processing.

    Science.gov (United States)

    Yoshikatsu, Yuki; Ishida, Yo-ichi; Sudo, Haruka; Yuasa, Keizo; Tsuji, Akihiko; Nagahama, Masami

    2015-08-28

    Nuclear VCP-like 2 (NVL2) is a member of the chaperone-like AAA-ATPase family and is involved in the biosynthesis of 60S ribosomal subunits in mammalian cells. We previously showed the interaction of NVL2 with a DExD/H-box RNA helicase MTR4/DOB1, which is a known cofactor for an exoribonuclease complex, the exosome. This finding implicated NVL2 in RNA metabolic processes during ribosome biogenesis. In the present study, we found that a series of mutations within the ATPase domain of NVL2 causes a defect in pre-rRNA processing into mature 28S and 5.8S rRNAs. Co-immunoprecipitation analysis showed that NVL2 was associated with the nuclear exosome complex, which includes RRP6 as a nucleus-specific catalytic subunit. This interaction was prevented by depleting either MTR4 or RRP6, indicating their essential role in mediating this interaction with NVL2. Additionally, knockdown of MPP6, another cofactor for the nuclear exosome, also prevented the interaction by causing MTR4 to dissociate from the nuclear exosome. These results suggest that NVL2 is involved in pre-rRNA processing by associating with the nuclear exosome complex and that MPP6 is required for maintaining the integrity of this rRNA processing complex. Copyright © 2015 Elsevier Inc. All rights reserved.

  5. Small-angle X-ray titration study on the complex formation between 5-S RNA and the L18 protein of the Escherichia coli 50-S ribosome particle

    International Nuclear Information System (INIS)

    Oesterberg, R.; Garrett, A.

    1977-01-01

    The 5-S RNA (A) and the L 18 protein (B) from Escherichia coli ribosomes form one single AB complex in the concentration ranges supposed to prevail in vivo; at concentrations of L 18 higher than 40 mM there is some indication for a minor species, most probably an AB 2 species. This is indicated from the X-ray scattering titration data of the 5-S RNA/L 18 system recorded at 21 0 C in ribosomal reconstitution buffer. As a result of the 1 : 1 complex formation, there is a relatively small but defined increase in the radius of gyration from 3.61 to 3.85 nm. This result as well as the experimental scattering curve can be explained by models where it is assumed that the elongated L 18 model is quite far from the electron density centre and where protein L 18 interacts with one or both of the minor arms of the supposed Y-shaped 5-S RNA molecule. (orig.) [de

  6. Could a Proto-Ribosome Emerge Spontaneously in the Prebiotic World?

    Directory of Open Access Journals (Sweden)

    Ilana C. Agmon

    2016-12-01

    Full Text Available An indispensable prerequisite for establishing a scenario of life emerging by natural processes is the requirement that the first simple proto-molecules could have had a realistic probability of self-assembly from random molecular polymers in the prebiotic world. The vestige of the proto-ribosome, which is believed to be still embedded in the contemporary ribosome, is used to assess the feasibility of such spontaneous emergence. Three concentric structural elements of different magnitudes, having a dimeric nature derived from the symmetrical region of the ribosomal large subunit, were suggested to constitute the vestige of the proto-ribosome. It is assumed to have materialized spontaneously in the prebiotic world, catalyzing non-coded peptide bond formation and simple elongation. Probabilistic and energetic considerations are applied in order to evaluate the suitability of the three contenders for being the initial proto-ribosome. The analysis points to the simplest proto-ribosome, comprised of a dimer of tRNA-like molecules presently embedded in the core of the symmetrical region, as the only one having a realistic statistical likelihood of spontaneous emergence from random RNA chains. Hence it offers a feasible starting point for a continuous evolutionary path from the prebiotic matter, through natural processes, into the intricate modern translation system.

  7. The RNA recognition motif of eukaryotic translation initiation factor 3g (eIF3g) is required for resumption of scanning of posttermination ribosomes for reinitiation on GCN4 and together with eIF3i stimulates linear scanning.

    Science.gov (United States)

    Cuchalová, Lucie; Kouba, Tomás; Herrmannová, Anna; Dányi, István; Chiu, Wen-Ling; Valásek, Leos

    2010-10-01

    Recent reports have begun unraveling the details of various roles of individual eukaryotic translation initiation factor 3 (eIF3) subunits in translation initiation. Here we describe functional characterization of two essential Saccharomyces cerevisiae eIF3 subunits, g/Tif35 and i/Tif34, previously suggested to be dispensable for formation of the 48S preinitiation complexes (PICs) in vitro. A triple-Ala substitution of conserved residues in the RRM of g/Tif35 (g/tif35-KLF) or a single-point mutation in the WD40 repeat 6 of i/Tif34 (i/tif34-Q258R) produces severe growth defects and decreases the rate of translation initiation in vivo without affecting the integrity of eIF3 and formation of the 43S PICs in vivo. Both mutations also diminish induction of GCN4 expression, which occurs upon starvation via reinitiation. Whereas g/tif35-KLF impedes resumption of scanning for downstream reinitiation by 40S ribosomes terminating at upstream open reading frame 1 (uORF1) in the GCN4 mRNA leader, i/tif34-Q258R prevents full GCN4 derepression by impairing the rate of scanning of posttermination 40S ribosomes moving downstream from uORF1. In addition, g/tif35-KLF reduces processivity of scanning through stable secondary structures, and g/Tif35 specifically interacts with Rps3 and Rps20 located near the ribosomal mRNA entry channel. Together these results implicate g/Tif35 and i/Tif34 in stimulation of linear scanning and, specifically in the case of g/Tif35, also in proper regulation of the GCN4 reinitiation mechanism.

  8. SR proteins are NXF1 adaptors that link alternative RNA processing to mRNA export.

    Science.gov (United States)

    Müller-McNicoll, Michaela; Botti, Valentina; de Jesus Domingues, Antonio M; Brandl, Holger; Schwich, Oliver D; Steiner, Michaela C; Curk, Tomaz; Poser, Ina; Zarnack, Kathi; Neugebauer, Karla M

    2016-03-01

    Nuclear export factor 1 (NXF1) exports mRNA to the cytoplasm after recruitment to mRNA by specific adaptor proteins. How and why cells use numerous different export adaptors is poorly understood. Here we critically evaluate members of the SR protein family (SRSF1-7) for their potential to act as NXF1 adaptors that couple pre-mRNA processing to mRNA export. Consistent with this proposal, >1000 endogenous mRNAs required individual SR proteins for nuclear export in vivo. To address the mechanism, transcriptome-wide RNA-binding profiles of NXF1 and SRSF1-7 were determined in parallel by individual-nucleotide-resolution UV cross-linking and immunoprecipitation (iCLIP). Quantitative comparisons of RNA-binding sites showed that NXF1 and SR proteins bind mRNA targets at adjacent sites, indicative of cobinding. SRSF3 emerged as the most potent NXF1 adaptor, conferring sequence specificity to RNA binding by NXF1 in last exons. Interestingly, SRSF3 and SRSF7 were shown to bind different sites in last exons and regulate 3' untranslated region length in an opposing manner. Both SRSF3 and SRSF7 promoted NXF1 recruitment to mRNA. Thus, SRSF3 and SRSF7 couple alternative splicing and polyadenylation to NXF1-mediated mRNA export, thereby controlling the cytoplasmic abundance of transcripts with alternative 3' ends. © 2016 Müller-McNicoll et al.; Published by Cold Spring Harbor Laboratory Press.

  9. Chaperoning 5S RNA assembly.

    Science.gov (United States)

    Madru, Clément; Lebaron, Simon; Blaud, Magali; Delbos, Lila; Pipoli, Juliana; Pasmant, Eric; Réty, Stéphane; Leulliot, Nicolas

    2015-07-01

    In eukaryotes, three of the four ribosomal RNAs (rRNAs)—the 5.8S, 18S, and 25S/28S rRNAs—are processed from a single pre-rRNA transcript and assembled into ribosomes. The fourth rRNA, the 5S rRNA, is transcribed by RNA polymerase III and is assembled into the 5S ribonucleoprotein particle (RNP), containing ribosomal proteins Rpl5/uL18 and Rpl11/uL5, prior to its incorporation into preribosomes. In mammals, the 5S RNP is also a central regulator of the homeostasis of the tumor suppressor p53. The nucleolar localization of the 5S RNP and its assembly into preribosomes are performed by a specialized complex composed of Rpf2 and Rrs1 in yeast or Bxdc1 and hRrs1 in humans. Here we report the structural and functional characterization of the Rpf2-Rrs1 complex alone, in complex with the 5S RNA, and within pre-60S ribosomes. We show that the Rpf2-Rrs1 complex contains a specialized 5S RNA E-loop-binding module, contacts the Rpl5 protein, and also contacts the ribosome assembly factor Rsa4 and the 25S RNA. We propose that the Rpf2-Rrs1 complex establishes a network of interactions that guide the incorporation of the 5S RNP in preribosomes in the initial conformation prior to its rotation to form the central protuberance found in the mature large ribosomal subunit. © 2015 Madru et al.; Published by Cold Spring Harbor Laboratory Press.

  10. G-Quadruplexes influence pri-microRNA processing.

    Science.gov (United States)

    Rouleau, Samuel G; Garant, Jean-Michel; Bolduc, François; Bisaillon, Martin; Perreault, Jean-Pierre

    2018-02-01

    RNA G-Quadruplexes (G4) have been shown to possess many biological functions, including the regulation of microRNA (miRNA) biogenesis and function. However, their impact on pri-miRNA processing remains unknown. We identified G4 located near the Drosha cleavage site in three distinct pri-miRNAs: pri-mir200c, pri-mir451a, and pri-mir497. The folding of the potential G4 motifs was determined in solution. Subsequently, mutations disrupting G4 folding led to important changes in the mature miRNAs levels in cells. Moreover, using small antisense oligonucleotides binding to the pri-miRNA, it was possible to modulate, either positively or negatively, the mature miRNA levels. Together, these data demonstrate that G4 motifs could contribute to the regulation of pri-mRNA processing, a novel role for G4. Considering that bio-informatics screening indicates that between 9% and 50% of all pri-miRNAs contain a putative G4, these structures possess interesting potential as future therapeutic targets.

  11. Differential Stoichiometry among Core Ribosomal Proteins

    Directory of Open Access Journals (Sweden)

    Nikolai Slavov

    2015-11-01

    Full Text Available Understanding the regulation and structure of ribosomes is essential to understanding protein synthesis and its dysregulation in disease. While ribosomes are believed to have a fixed stoichiometry among their core ribosomal proteins (RPs, some experiments suggest a more variable composition. Testing such variability requires direct and precise quantification of RPs. We used mass spectrometry to directly quantify RPs across monosomes and polysomes of mouse embryonic stem cells (ESC and budding yeast. Our data show that the stoichiometry among core RPs in wild-type yeast cells and ESC depends both on the growth conditions and on the number of ribosomes bound per mRNA. Furthermore, we find that the fitness of cells with a deleted RP-gene is inversely proportional to the enrichment of the corresponding RP in polysomes. Together, our findings support the existence of ribosomes with distinct protein composition and physiological function.

  12. Neuron-Like Networks Between Ribosomal Proteins Within the Ribosome

    Science.gov (United States)

    Poirot, Olivier; Timsit, Youri

    2016-05-01

    From brain to the World Wide Web, information-processing networks share common scale invariant properties. Here, we reveal the existence of neural-like networks at a molecular scale within the ribosome. We show that with their extensions, ribosomal proteins form complex assortative interaction networks through which they communicate through tiny interfaces. The analysis of the crystal structures of 50S eubacterial particles reveals that most of these interfaces involve key phylogenetically conserved residues. The systematic observation of interactions between basic and aromatic amino acids at the interfaces and along the extension provides new structural insights that may contribute to decipher the molecular mechanisms of signal transmission within or between the ribosomal proteins. Similar to neurons interacting through “molecular synapses”, ribosomal proteins form a network that suggest an analogy with a simple molecular brain in which the “sensory-proteins” innervate the functional ribosomal sites, while the “inter-proteins” interconnect them into circuits suitable to process the information flow that circulates during protein synthesis. It is likely that these circuits have evolved to coordinate both the complex macromolecular motions and the binding of the multiple factors during translation. This opens new perspectives on nanoscale information transfer and processing.

  13. Nuclear pre-mRNA processing in plants

    Energy Technology Data Exchange (ETDEWEB)

    Reddy, A.S.N. [Colorado State Univ., Fort Collins, CO (United States). Dept. of Biology and Program in Molecular Plant Biology; Golovkin, M. (eds.) [Thomas Jefferson Univ., Philadelphia, PA (United States). Dept. of Microbiology

    2008-07-01

    This volume of CTMI, entitled Nuclear premRNA Processing in Plants, with 16 chapters from leading scientists in this area, summarizes recent advances in nuclear pre-mRNA processing and its role in plant growth and development. It provides researchers in the field, as well as those in related areas, with an up-to-date and comprehensive, yet concise, overview of the current status and future potential of this research in understanding plant biology. The first four chapters focus on spliceosome composition, genome-wide alternative splicing, and splice site requirements for U1 and U12 introns using computational and empirical approaches. Analysis of sequenced plant genomes has revealed that 80% of all protein-coding nuclear genes contain one or more introns. The lack of an in vitro plant splicing system has made it difficult to identify general and plant-specific components of splicing machinery in plants. The next three chapters focus on serine/arginine-rich (SR) proteins, a family of highly conserved proteins, which are known to play key roles in constitutive and regulated splicing of pre-mRNA and other aspects of RNA metabolism in metazoans. These proteins engage both in RNA binding and protein.protein interactions and function as splicing regulators at multiple stages of spliceosome assembly. This family of proteins has expanded considerably in plants with several plant-specific SR proteins. Several serendipitous discoveries made using forward genetics are indicating that RNA metabolism (alternative splicing, alternative polyadenylation, mRNA transport) plays an important role in many aspects of plant growth and development and in plant responses to biotic and abiotic stresses. The next seven chapters focus on these aspects of RNA metabolism. The plant hormone abscisic acid (ABA) regulates a number of physiological processes during plant growth and development. The next chapter or A.B. Rose discusses the ways introns affect gene expression both positively and

  14. Nuclear pre-mRNA processing in plants

    International Nuclear Information System (INIS)

    Reddy, A.S.N.; Golovkin, M.

    2008-01-01

    This volume of CTMI, entitled Nuclear premRNA Processing in Plants, with 16 chapters from leading scientists in this area, summarizes recent advances in nuclear pre-mRNA processing and its role in plant growth and development. It provides researchers in the field, as well as those in related areas, with an up-to-date and comprehensive, yet concise, overview of the current status and future potential of this research in understanding plant biology. The first four chapters focus on spliceosome composition, genome-wide alternative splicing, and splice site requirements for U1 and U12 introns using computational and empirical approaches. Analysis of sequenced plant genomes has revealed that 80% of all protein-coding nuclear genes contain one or more introns. The lack of an in vitro plant splicing system has made it difficult to identify general and plant-specific components of splicing machinery in plants. The next three chapters focus on serine/arginine-rich (SR) proteins, a family of highly conserved proteins, which are known to play key roles in constitutive and regulated splicing of pre-mRNA and other aspects of RNA metabolism in metazoans. These proteins engage both in RNA binding and protein.protein interactions and function as splicing regulators at multiple stages of spliceosome assembly. This family of proteins has expanded considerably in plants with several plant-specific SR proteins. Several serendipitous discoveries made using forward genetics are indicating that RNA metabolism (alternative splicing, alternative polyadenylation, mRNA transport) plays an important role in many aspects of plant growth and development and in plant responses to biotic and abiotic stresses. The next seven chapters focus on these aspects of RNA metabolism. The plant hormone abscisic acid (ABA) regulates a number of physiological processes during plant growth and development. The next chapter or A.B. Rose discusses the ways introns affect gene expression both positively and

  15. Acrolein preferentially damages nucleolus eliciting ribosomal stress and apoptosis in human cancer cells.

    Science.gov (United States)

    Wang, Hsiang-Tsui; Chen, Tzu-Ying; Weng, Ching-Wen; Yang, Chun-Hsiang; Tang, Moon-Shong

    2016-12-06

    Acrolein (Acr) is a potent cytotoxic and DNA damaging agent which is ubiquitous in the environment and abundant in tobacco smoke. Acr is also an active cytotoxic metabolite of the anti-cancer drugs cyclophosphamide and ifosfamide. The mechanisms via which Acr exerts its anti-cancer activity and cytotoxicity are not clear. In this study, we found that Acr induces cytotoxicity and cell death in human cancer cells with different activities of p53. Acr preferentially binds nucleolar ribosomal DNA (rDNA) to form Acr-deoxyguanosine adducts, and induces oxidative damage to both rDNA and ribosomal RNA (rRNA). Acr triggers ribosomal stress responses, inhibits rRNA synthesis, reduces RNA polymerase I binding to the promoter of rRNA gene, disrupts nucleolar integrity, and impairs ribosome biogenesis and polysome formation. Acr causes an increase in MDM2 levels and phosphorylation of MDM2 in A549 and HeLa cells which are p53 active and p53 inactive, respectively. It enhances the binding of ribosomal protein RPL11 to MDM2 and reduces the binding of p53 and E2F-1 to MDM2 resulting in stabilization/activation of p53 in A549 cells and degradation of E2F-1 in A549 and HeLa cells. We propose that Acr induces ribosomal stress which leads to activation of MDM2 and RPL11-MDM2 binding, consequently, activates p53 and enhances E2F-1 degradation, and that taken together these two processes induce apoptosis and cell death.

  16. miRNA-Processing Gene Methylation and Cancer Risk.

    Science.gov (United States)

    Joyce, Brian T; Zheng, Yinan; Zhang, Zhou; Liu, Lei; Kocherginsky, Masha; Murphy, Robert; Achenbach, Chad J; Musa, Jonah; Wehbe, Firas; Just, Allan; Shen, Jincheng; Vokonas, Pantel; Schwartz, Joel; Baccarelli, Andrea A; Hou, Lifang

    2018-05-01

    Background: Dysregulation of miRNA and methylation levels are epigenetic hallmarks of cancer, potentially linked via miRNA-processing genes. Studies have found genetic alterations to miRNA-processing genes in cancer cells and human population studies. Our objective was to prospectively examine changes in DNA methylation of miRNA-processing genes and their associations with cancer risk. Methods: We examined cohort data from the Department of Veterans' Affairs Normative Aging Study. Participants were assessed every 3 to 5 years starting in 1999 through 2013 including questionnaires, medical record review, and blood collection. Blood from 686 consenting participants was analyzed using the Illumina 450K BeadChip array to measure methylation at CpG sites throughout the genome. We selected 19 genes based on a literature review, with 519 corresponding CpG sites. We then used Cox proportional hazards models to examine associations with cancer incidence, and generalized estimating equations to examine associations with cancer prevalence. Associations at false discovery rate time to cancer development (positively for cg06751583, inversely for cg23230564 and cg21034183), whereas methylation of one CpG site ( DROSHA : cg16131300) was positively associated with cancer prevalence. Conclusions: DNA methylation of DROSHA , a key miRNA-processing gene, and TNRC6B may play a role in early carcinogenesis. Impact: Changes in miRNA processing may exert multiple effects on cancer development, including protecting against it via altered global miRNAs, and may be a useful early detection biomarker of cancer. Cancer Epidemiol Biomarkers Prev; 27(5); 550-7. ©2018 AACR . ©2018 American Association for Cancer Research.

  17. Evolutionary Conservation of the Ribosomal Biogenesis Factor Rbm19/Mrd1: Implications for Function

    OpenAIRE

    Kallberg, Yvonne; Segerstolpe, Åsa; Lackmann, Fredrik; Persson, Bengt; Wieslander, Lars

    2012-01-01

    Ribosome biogenesis in eukaryotes requires coordinated folding and assembly of a pre-rRNA into sequential pre-rRNA-protein complexes in which chemical modifications and RNA cleavages occur. These processes require many small nucleolar RNAs (snoRNAs) and proteins. Rbm19/Mrd1 is one such protein that is built from multiple RNA-binding domains (RBDs). We find that Rbm19/Mrd1 with five RBDs is present in all branches of the eukaryotic phylogenetic tree, except in animals and Choanoflagellates, th...

  18. Ribosomal studies on the 70S ribosome of E.coli by means of neutron scattering

    International Nuclear Information System (INIS)

    Burkhardt, N.

    1997-01-01

    Ribosomes are ribonucleo-protein complexes, which catalyse proteinbiosynthesis in all living organisms. Currently, most of the structural models of the prokaryotic 70S ribosome rely on electron microscopy and describe mainly the outer shape of the particle. Neutron scattering can provide information on the internal structure of the ribosome. Parts of the structure can be contrasted for neutrons by means of an isotopic exchange of the naturally occurring hydrogen ( 1 H) for deuterium ( 2 H), allowing direct measurements in situ. Specifically deuterium-labeled ribosomes (E. coli) were prepared and analysed with neutron scattering. The biochemical methods were established and combined to a generally applicable preparation system. This allows labeling of all ribosomal components in any combination. A systematic analysis of the protein and RNA phases resulted in the development of a new model for the 70S ribosome. This model describes not only the outer shape of the particle, but displays also an experimentally determined internal protein-RNA distribution and the border of subunits for the first time (four-phase model; resolution: 50A). Models of the 70S ribosome from other studies were evaluated and ranked according to consistency with the measured scattering data. Applying a new neutron scattering technique of particular sensitivity, the proton-spin contrast-variation, single proteins could be measured and localized. The positions of the proteins S6 and S10 were determined, providing the first coordinates of protein mass centers within the 70S ribosome. (orig.) [de

  19. Hyper-regulation of pyr-gene expression in Escherichia coli cells with slow ribosomes. Evidence for RNA polymerase pausing in vivo

    DEFF Research Database (Denmark)

    Jensen, Kaj Frank

    1988-01-01

    UTP-modulated attenuation of transcription is involved in regulating the synthesis of pyrimidine nucleotides in Escherichia coli. Thus, expression of two genes, pyrBI and pyrE, was shown to be under this type of control. The genes encode the two subunits of aspartate transcarbamylase and orotate...... transcription should terminate or continue into the structural genes. This paper described a study of pyrBI and pyrE gene regulation in cells where the ribosomes move slowly as a result of mutation in rpsL. It appears that expression of the two genes is hyper-regulated by the UTP pool in this type of cells...

  20. NVL2, a nucleolar AAA-ATPase, is associated with the nuclear exosome and is involved in pre-rRNA processing

    Energy Technology Data Exchange (ETDEWEB)

    Yoshikatsu, Yuki [Department of Life Systems, Institute of Technology and Science, The University of Tokushima Graduate School, Tokushima 770-8506 (Japan); Ishida, Yo-ichi; Sudo, Haruka [Department of Molecular and Cellular Biochemistry, Meiji Pharmaceutical University, Kiyose, Tokyo 204-8588 (Japan); Yuasa, Keizo; Tsuji, Akihiko [Department of Life Systems, Institute of Technology and Science, The University of Tokushima Graduate School, Tokushima 770-8506 (Japan); Nagahama, Masami, E-mail: nagahama@my-pharm.ac.jp [Department of Molecular and Cellular Biochemistry, Meiji Pharmaceutical University, Kiyose, Tokyo 204-8588 (Japan)

    2015-08-28

    Nuclear VCP-like 2 (NVL2) is a member of the chaperone-like AAA-ATPase family and is involved in the biosynthesis of 60S ribosomal subunits in mammalian cells. We previously showed the interaction of NVL2 with a DExD/H-box RNA helicase MTR4/DOB1, which is a known cofactor for an exoribonuclease complex, the exosome. This finding implicated NVL2 in RNA metabolic processes during ribosome biogenesis. In the present study, we found that a series of mutations within the ATPase domain of NVL2 causes a defect in pre-rRNA processing into mature 28S and 5.8S rRNAs. Co-immunoprecipitation analysis showed that NVL2 was associated with the nuclear exosome complex, which includes RRP6 as a nucleus-specific catalytic subunit. This interaction was prevented by depleting either MTR4 or RRP6, indicating their essential role in mediating this interaction with NVL2. Additionally, knockdown of MPP6, another cofactor for the nuclear exosome, also prevented the interaction by causing MTR4 to dissociate from the nuclear exosome. These results suggest that NVL2 is involved in pre-rRNA processing by associating with the nuclear exosome complex and that MPP6 is required for maintaining the integrity of this rRNA processing complex. - Highlights: • ATPase-deficient mutants of NVL2 have decreased pre-rRNA processing. • NVL2 associates with the nuclear exosome through interactions with MTR4 and RRP6. • MPP6 stabilizes MTR4-RRP6 interaction and allows NVL2 to interact with the complex.

  1. Structure of Ribosomal Silencing Factor Bound to Mycobacterium tuberculosis Ribosome.

    Science.gov (United States)

    Li, Xiaojun; Sun, Qingan; Jiang, Cai; Yang, Kailu; Hung, Li-Wei; Zhang, Junjie; Sacchettini, James C

    2015-10-06

    The ribosomal silencing factor RsfS slows cell growth by inhibiting protein synthesis during periods of diminished nutrient availability. The crystal structure of Mycobacterium tuberculosis (Mtb) RsfS, together with the cryo-electron microscopy (EM) structure of the large subunit 50S of Mtb ribosome, reveals how inhibition of protein synthesis by RsfS occurs. RsfS binds to the 50S at L14, which, when occupied, blocks the association of the small subunit 30S. Although Mtb RsfS is a dimer in solution, only a single subunit binds to 50S. The overlap between the dimer interface and the L14 binding interface confirms that the RsfS dimer must first dissociate to a monomer in order to bind to L14. RsfS interacts primarily through electrostatic and hydrogen bonding to L14. The EM structure shows extended rRNA density that it is not found in the Escherichia coli ribosome, the most striking of these being the extended RNA helix of H54a. Copyright © 2015 Elsevier Ltd. All rights reserved.

  2. Neighborhood of 16S rRNA nucleotides U788/U789 in the 30S ribosomal subunit determined by site-directed crosslinking.

    OpenAIRE

    Mundus, D; Wollenzien, P

    1998-01-01

    Site-specific photo crosslinking has been used to investigate the RNA neighborhood of 16S rRNA positions U788/ U789 in Escherichia coli 30S subunits. For these studies, site-specific psoralen (SSP) which contains a sulfhydryl group on a 17 A side chain was first added to nucleotides U788/U789 using a complementary guide DNA by annealing and phototransfer. Modified RNA was purified from the DNA and unmodified RNA. For some experiments, the SSP, which normally crosslinks at an 8 A distance, was...

  3. Dynamical modeling of microRNA action on the protein translation process.

    Science.gov (United States)

    Zinovyev, Andrei; Morozova, Nadya; Nonne, Nora; Barillot, Emmanuel; Harel-Bellan, Annick; Gorban, Alexander N

    2010-02-24

    Protein translation is a multistep process which can be represented as a cascade of biochemical reactions (initiation, ribosome assembly, elongation, etc.), the rate of which can be regulated by small non-coding microRNAs through multiple mechanisms. It remains unclear what mechanisms of microRNA action are the most dominant: moreover, many experimental reports deliver controversial messages on what is the concrete mechanism actually observed in the experiment. Nissan and Parker have recently demonstrated that it might be impossible to distinguish alternative biological hypotheses using the steady state data on the rate of protein synthesis. For their analysis they used two simple kinetic models of protein translation. In contrary to the study by Nissan and Parker, we show that dynamical data allow discriminating some of the mechanisms of microRNA action. We demonstrate this using the same models as developed by Nissan and Parker for the sake of comparison but the methods developed (asymptotology of biochemical networks) can be used for other models. We formulate a hypothesis that the effect of microRNA action is measurable and observable only if it affects the dominant system (generalization of the limiting step notion for complex networks) of the protein translation machinery. The dominant system can vary in different experimental conditions that can partially explain the existing controversy of some of the experimental data. Our analysis of the transient protein translation dynamics shows that it gives enough information to verify or reject a hypothesis about a particular molecular mechanism of microRNA action on protein translation. For multiscale systems only that action of microRNA is distinguishable which affects the parameters of dominant system (critical parameters), or changes the dominant system itself. Dominant systems generalize and further develop the old and very popular idea of limiting step. Algorithms for identifying dominant systems in multiscale

  4. Dynamical modeling of microRNA action on the protein translation process

    Directory of Open Access Journals (Sweden)

    Barillot Emmanuel

    2010-02-01

    Full Text Available Abstract Background Protein translation is a multistep process which can be represented as a cascade of biochemical reactions (initiation, ribosome assembly, elongation, etc., the rate of which can be regulated by small non-coding microRNAs through multiple mechanisms. It remains unclear what mechanisms of microRNA action are the most dominant: moreover, many experimental reports deliver controversial messages on what is the concrete mechanism actually observed in the experiment. Nissan and Parker have recently demonstrated that it might be impossible to distinguish alternative biological hypotheses using the steady state data on the rate of protein synthesis. For their analysis they used two simple kinetic models of protein translation. Results In contrary to the study by Nissan and Parker, we show that dynamical data allow discriminating some of the mechanisms of microRNA action. We demonstrate this using the same models as developed by Nissan and Parker for the sake of comparison but the methods developed (asymptotology of biochemical networks can be used for other models. We formulate a hypothesis that the effect of microRNA action is measurable and observable only if it affects the dominant system (generalization of the limiting step notion for complex networks of the protein translation machinery. The dominant system can vary in different experimental conditions that can partially explain the existing controversy of some of the experimental data. Conclusions Our analysis of the transient protein translation dynamics shows that it gives enough information to verify or reject a hypothesis about a particular molecular mechanism of microRNA action on protein translation. For multiscale systems only that action of microRNA is distinguishable which affects the parameters of dominant system (critical parameters, or changes the dominant system itself. Dominant systems generalize and further develop the old and very popular idea of limiting step

  5. Functional Dynamics within the Human Ribosome Regulate the Rate of Active Protein Synthesis.

    Science.gov (United States)

    Ferguson, Angelica; Wang, Leyi; Altman, Roger B; Terry, Daniel S; Juette, Manuel F; Burnett, Benjamin J; Alejo, Jose L; Dass, Randall A; Parks, Matthew M; Vincent, C Theresa; Blanchard, Scott C

    2015-11-05

    The regulation of protein synthesis contributes to gene expression in both normal physiology and disease, yet kinetic investigations of the human translation mechanism are currently lacking. Using single-molecule fluorescence imaging methods, we have quantified the nature and timing of structural processes in human ribosomes during single-turnover and processive translation reactions. These measurements reveal that functional complexes exhibit dynamic behaviors and thermodynamic stabilities distinct from those observed for bacterial systems. Structurally defined sub-states of pre- and post-translocation complexes were sensitive to specific inhibitors of the eukaryotic ribosome, demonstrating the utility of this platform to probe drug mechanism. The application of three-color single-molecule fluorescence resonance energy transfer (smFRET) methods further revealed a long-distance allosteric coupling between distal tRNA binding sites within ribosomes bearing three tRNAs, which contributed to the rate of processive translation. Copyright © 2015 Elsevier Inc. All rights reserved.

  6. SOT1, a pentatricopeptide repeat protein with a small MutS-related domain, is required for correct processing of plastid 23S-4.5S rRNA precursors in Arabidopsis thaliana.

    Science.gov (United States)

    Wu, Wenjuan; Liu, Sheng; Ruwe, Hannes; Zhang, Delin; Melonek, Joanna; Zhu, Yajuan; Hu, Xupeng; Gusewski, Sandra; Yin, Ping; Small, Ian D; Howell, Katharine A; Huang, Jirong

    2016-03-01

    Ribosomal RNA processing is essential for plastid ribosome biogenesis, but is still poorly understood in higher plants. Here, we show that SUPPRESSOR OF THYLAKOID FORMATION1 (SOT1), a plastid-localized pentatricopeptide repeat (PPR) protein with a small MutS-related domain, is required for maturation of the 23S-4.5S rRNA dicistron. Loss of SOT1 function leads to slower chloroplast development, suppression of leaf variegation, and abnormal 23S and 4.5S processing. Predictions based on the PPR motif sequences identified the 5' end of the 23S-4.5S rRNA dicistronic precursor as a putative SOT1 binding site. This was confirmed by electrophoretic mobility shift assay, and by loss of the abundant small RNA 'footprint' associated with this site in sot1 mutants. We found that more than half of the 23S-4.5S rRNA dicistrons in sot1 mutants contain eroded and/or unprocessed 5' and 3' ends, and that the endonucleolytic cleavage product normally released from the 5' end of the precursor is absent in a sot1 null mutant. We postulate that SOT1 binding protects the 5' extremity of the 23S-4.5S rRNA dicistron from exonucleolytic attack, and favours formation of the RNA structure that allows endonucleolytic processing of its 5' and 3' ends. © 2016 The Authors The Plant Journal © 2016 John Wiley & Sons Ltd.

  7. The ribosome biogenesis factor Nol11 is required for optimal rDNA transcription and craniofacial development in Xenopus.

    Directory of Open Access Journals (Sweden)

    John N Griffin

    2015-03-01

    Full Text Available The production of ribosomes is ubiquitous and fundamental to life. As such, it is surprising that defects in ribosome biogenesis underlie a growing number of symptomatically distinct inherited disorders, collectively called ribosomopathies. We previously determined that the nucleolar protein, NOL11, is essential for optimal pre-rRNA transcription and processing in human tissue culture cells. However, the role of NOL11 in the development of a multicellular organism remains unknown. Here, we reveal a critical function for NOL11 in vertebrate ribosome biogenesis and craniofacial development. Nol11 is strongly expressed in the developing cranial neural crest (CNC of both amphibians and mammals, and knockdown of Xenopus nol11 results in impaired pre-rRNA transcription and processing, increased apoptosis, and abnormal development of the craniofacial cartilages. Inhibition of p53 rescues this skeletal phenotype, but not the underlying ribosome biogenesis defect, demonstrating an evolutionarily conserved control mechanism through which ribosome-impaired craniofacial cells are removed. Excessive activation of this mechanism impairs craniofacial development. Together, our findings reveal a novel requirement for Nol11 in craniofacial development, present the first frog model of a ribosomopathy, and provide further insight into the clinically important relationship between specific ribosome biogenesis proteins and craniofacial cell survival.

  8. Dissecting the interactions of SERRATE with RNA and DICER-LIKE 1 in Arabidopsis microRNA precursor processing

    KAUST Repository

    Iwata, Yuji

    2013-08-05

    Efficient and precise microRNA (miRNA) biogenesis in Arabidopsis is mediated by the RNaseIII-family enzyme DICER-LIKE 1 (DCL1), double-stranded RNA-binding protein HYPONASTIC LEAVES 1 and the zinc-finger (ZnF) domain-containing protein SERRATE (SE). In the present study, we examined primary miRNA precursor (pri-miRNA) processing by highly purified recombinant DCL1 and SE proteins and found that SE is integral to pri-miRNA processing by DCL1. SE stimulates DCL1 cleavage of the pri-miRNA in an ionic strength-dependent manner. SE uses its N-terminal domain to bind to RNA and requires both N-terminal and ZnF domains to bind to DCL1. However, when DCL1 is bound to RNA, the interaction with the ZnF domain of SE becomes indispensible and stimulates the activity of DCL1 without requiring SE binding to RNA. Our results suggest that the interactions among SE, DCL1 and RNA are a potential point for regulating pri-miRNA processing. 2013 The Author(s) 2013.

  9. Mapping of the 18S and 5S ribosomal RNA genes in Astyanax altiparanae Garutti & Britski, 2000 (Teleostei, Characidae from the upper Paraná river basin, Brazil

    Directory of Open Access Journals (Sweden)

    Carlos Alexandre Fernandes

    2006-01-01

    Full Text Available Fluorescence in situ hybridization (FISH was undertaken in order to determinate the chromosomal distribution pattern of 18S and 5S ribosomal DNAs (rDNA in four populations of the characid fish Astyanax altiparanae from the upper Paraná river basin, Brazil. The 18S rDNA probe FISH revealed numerical and positional variations among specimens from the Keçaba stream compared to specimens of the other populations studied. In contrast to the variable 18S rDNA distribution pattern, highly stable chromosomal positioning of the 5S rDNA sites was observed in the four A. altiparanae populations. Divergence in the distribution pattern of 18S and 5S rDNA sites is also discussed.

  10. Characterization of Biomphalaria orbignyi, Biomphalaria peregrina and Biomphalaria oligoza by polymerase chain reaction and restriction enzyme digestion of the internal transcribed spacer region of the RNA ribosomal gene

    Directory of Open Access Journals (Sweden)

    Spatz Linus

    2000-01-01

    Full Text Available The correct identification of Biomphalaria oligoza, B. orbignyi and B. peregrina species is difficult due to the morphological similarities among them. B. peregrina is widely distributed in South America and is considered a potential intermediate host of Schistosoma mansoni. We have reported the use of the polymerase chain reaction and restriction fragment length polymorphism analysis of the internal transcribed spacer region of the ribosomal DNA for the molecular identification of these snails. The snails were obtained from different localities of Argentina, Brazil and Uruguay. The restriction patterns obtained with MvaI enzyme presented the best profile to identify the three species. The profiles obtained with all enzymes were used to estimate genetic similarities among B. oligoza, B. peregrina and B. orbignyi. This is also the first report of B. orbignyi in Uruguay.

  11. Identification of EhTIF-IA: The putative E. histolytica orthologue of the human ribosomal RNA transcription initiation factor-IA.

    Science.gov (United States)

    Srivastava, Ankita; Bhattacharya, Alok; Bhattacharya, Sudha; Jhingan, Gagan Deep

    2016-03-01

    Initiation of rDNA transcription requires the assembly of a specific multi-protein complex at the rDNA promoter containing the RNA Pol I with auxiliary factors. One of these factors is known as Rrn3P in yeast and Transcription Initiation Factor IA (TIF-IA) in mammals. Rrn3p/TIF-IA serves as a bridge between RNA Pol I and the pre-initiation complex at the promoter. It is phosphorylated at multiple sites and is involved in regulation of rDNA transcription in a growth-dependent manner. In the early branching parasitic protist Entamoeba histolytica, the rRNA genes are present exclusively on circular extra chromosomal plasmids. The protein factors involved in regulation of rDNA transcription in E. histolytica are not known. We have identified the E. histolytica equivalent of TIF-1A (EhTIF-IA) by homology search within the database and was further cloned and expressed. Immuno-localization studies showed that EhTIF-IA co-localized partially with fibrillarin in the peripherally localized nucleolus. EhTIF-IA was shown to interact with the RNA Pol I-specific subunit RPA12 both in vivo and in vitro. Mass spectroscopy data identified RNA Pol I-specific subunits and other nucleolar proteins to be the interacting partners of EhTIF-IA. Our study demonstrates for the first time a conserved putative RNA Pol I transcription factor TIF-IA in E. histolytica.

  12. Suboptimal T-cell receptor signaling compromises protein translation, ribosome biogenesis, and proliferation of mouse CD8 T cells.

    Science.gov (United States)

    Tan, Thomas C J; Knight, John; Sbarrato, Thomas; Dudek, Kate; Willis, Anne E; Zamoyska, Rose

    2017-07-25

    Global transcriptomic and proteomic analyses of T cells have been rich sources of unbiased data for understanding T-cell activation. Lack of full concordance of these datasets has illustrated that important facets of T-cell activation are controlled at the level of translation. We undertook translatome analysis of CD8 T-cell activation, combining polysome profiling and microarray analysis. We revealed that altering T-cell receptor stimulation influenced recruitment of mRNAs to heavy polysomes and translation of subsets of genes. A major pathway that was compromised, when TCR signaling was suboptimal, was linked to ribosome biogenesis, a rate-limiting factor in both cell growth and proliferation. Defective TCR signaling affected transcription and processing of ribosomal RNA precursors, as well as the translation of specific ribosomal proteins and translation factors. Mechanistically, IL-2 production was compromised in weakly stimulated T cells, affecting the abundance of Myc protein, a known regulator of ribosome biogenesis. Consequently, weakly activated T cells showed impaired production of ribosomes and a failure to maintain proliferative capacity after stimulation. We demonstrate that primary T cells respond to various environmental cues by regulating ribosome biogenesis and mRNA translation at multiple levels to sustain proliferation and differentiation.

  13. Emerging functions of ribosomal proteins in gene-specific transcription and translation

    International Nuclear Information System (INIS)

    Lindstroem, Mikael S.

    2009-01-01

    Ribosomal proteins have remained highly conserved during evolution presumably reflecting often critical functions in ribosome biogenesis or mature ribosome function. In addition, several ribosomal proteins possess distinct extra-ribosomal functions in apoptosis, DNA repair and transcription. An increasing number of ribosomal proteins have been shown to modulate the trans-activation function of important regulatory proteins such as NF-κB, p53, c-Myc and nuclear receptors. Furthermore, a subset of ribosomal proteins can bind directly to untranslated regions of mRNA resulting in transcript-specific translational control outside of the ribosome itself. Collectively, these findings suggest that ribosomal proteins may have a wider functional repertoire within the cell than previously thought. The future challenge is to identify and validate these novel functions in the background of an often essential primary function in ribosome biogenesis and cell growth.

  14. The Arabidopsis gene DIG6 encodes a large 60S subunit nuclear export GTPase 1 that is involved in ribosome biogenesis and affects multiple auxin-regulated development processes

    KAUST Repository

    Zhao, Huayan

    2015-08-13

    The circularly permuted GTPase large subunit GTPase 1 (LSG1) is involved in the maturation step of the 60S ribosome and is essential for cell viability in yeast. Here, an Arabidopsis mutant dig6 (drought inhibited growth of lateral roots) was isolated. The mutant exhibited multiple auxin-related phenotypes, which included reduced lateral root number, altered leaf veins, and shorter roots. Genetic mapping combined with next-generation DNA sequencing identified that the mutation occurred in AtLSG1-2. This gene was highly expressed in regions of auxin accumulation. Ribosome profiling revealed that a loss of function of AtLSG1-2 led to decreased levels of monosomes, further demonstrating its role in ribosome biogenesis. Quantitative proteomics showed that the expression of certain proteins involved in ribosome biogenesis was differentially regulated, indicating that ribosome biogenesis processes were impaired in the mutant. Further investigations showed that an AtLSG1-2 deficiency caused the alteration of auxin distribution, response, and transport in plants. It is concluded that AtLSG1-2 is integral to ribosome biogenesis, consequently affecting auxin homeostasis and plant development.

  15. The Arabidopsis gene DIG6 encodes a large 60S subunit nuclear export GTPase 1 that is involved in ribosome biogenesis and affects multiple auxin-regulated development processes

    KAUST Repository

    Zhao, Huayan; Lü , Shiyou; Li, Ruixi; Chen, Tao; Zhang, Huoming; Cui, Peng; Ding, Feng; Liu, Pei; Wang, Guangchao; Xia, Yiji; Running, Mark P.; Xiong, Liming

    2015-01-01

    The circularly permuted GTPase large subunit GTPase 1 (LSG1) is involved in the maturation step of the 60S ribosome and is essential for cell viability in yeast. Here, an Arabidopsis mutant dig6 (drought inhibited growth of lateral roots) was isolated. The mutant exhibited multiple auxin-related phenotypes, which included reduced lateral root number, altered leaf veins, and shorter roots. Genetic mapping combined with next-generation DNA sequencing identified that the mutation occurred in AtLSG1-2. This gene was highly expressed in regions of auxin accumulation. Ribosome profiling revealed that a loss of function of AtLSG1-2 led to decreased levels of monosomes, further demonstrating its role in ribosome biogenesis. Quantitative proteomics showed that the expression of certain proteins involved in ribosome biogenesis was differentially regulated, indicating that ribosome biogenesis processes were impaired in the mutant. Further investigations showed that an AtLSG1-2 deficiency caused the alteration of auxin distribution, response, and transport in plants. It is concluded that AtLSG1-2 is integral to ribosome biogenesis, consequently affecting auxin homeostasis and plant development.

  16. Expression of protein-coding genes embedded in ribosomal DNA

    DEFF Research Database (Denmark)

    Johansen, Steinar D; Haugen, Peik; Nielsen, Henrik

    2007-01-01

    Ribosomal DNA (rDNA) is a specialised chromosomal location that is dedicated to high-level transcription of ribosomal RNA genes. Interestingly, rDNAs are frequently interrupted by parasitic elements, some of which carry protein genes. These are non-LTR retrotransposons and group II introns that e...... in the nucleolus....

  17. Sample preservation, transport and processing strategies for honeybee RNA extraction: Influence on RNA yield, quality, target quantification and data normalization.

    Science.gov (United States)

    Forsgren, Eva; Locke, Barbara; Semberg, Emilia; Laugen, Ane T; Miranda, Joachim R de

    2017-08-01

    Viral infections in managed honey bees are numerous, and most of them are caused by viruses with an RNA genome. Since RNA degrades rapidly, appropriate sample management and RNA extraction methods are imperative to get high quality RNA for downstream assays. This study evaluated the effect of various sampling-transport scenarios (combinations of temperature, RNA stabilizers, and duration) of transport on six RNA quality parameters; yield, purity, integrity, cDNA synthesis efficiency, target detection and quantification. The use of water and extraction buffer were also compared for a primary bee tissue homogenate prior to RNA extraction. The strategy least affected by time was preservation of samples at -80°C. All other regimens turned out to be poor alternatives unless the samples were frozen or processed within 24h. Chemical stabilizers have the greatest impact on RNA quality and adding an extra homogenization step (a QIAshredder™ homogenizer) to the extraction protocol significantly improves the RNA yield and chemical purity. This study confirms that RIN values (RNA Integrity Number), should be used cautiously with bee RNA. Using water for the primary homogenate has no negative effect on RNA quality as long as this step is no longer than 15min. Copyright © 2017 Elsevier B.V. All rights reserved.

  18. Unique phylogenetic position of Diplomonadida based on the complete small subunit ribosomal RNA sequence of Giardia ardeae, G. muris, G. duodenalis and Hexamita sp.

    Science.gov (United States)

    van Keulen, H; Gutell, R R; Gates, M A; Campbell, S R; Erlandsen, S L; Jarroll, E L; Kulda, J; Meyer, E A

    1993-01-01

    Complete small-subunit rRNA (SSU-rRNA) coding region sequences were determined for two species of the intestinal parasite Giardia: G. ardeae and G. muris, both belonging to the order Diplomonadida, and a free-living member of this order, Hexamita sp. These sequences were compared to published SSU-rDNA sequences from a third member of the genus Giardia, G. duodenalis (often called G. intestinalis or G. lamblia) and various representative organisms from other taxa. Of the three Giardia sequences analyzed, the SSU-rRNA from G. muris is the smallest (1432 bases as compared to 1435 and 1453 for G. ardeae and G. duodenalis, respectively) and has the lowest G+C content (58.9%). The Hexamita SSU-rRNA is the largest in this group, containing 1550 bases. Because the sizes of the SSU-rRNA are prokaryotic rather than typically eukaryotic, the secondary structures of the SSU-rRNAs were constructed. These structures show a number of typically eukaryotic signature sequences. Sequence alignments based on constraints imposed by secondary structure were used for construction of a phylogenetic tree for these four taxa. The results show that of the four diplomonads represented, the Giardia species form a distinct group. The other diplomonad Hexamita and the microsporidium Vairimorpha necatrix appear to be distinct from Giardia.

  19. Conservative fragments in bacterial 16S rRNA genes and primer design for 16S ribosomal DNA amplicons in metagenomic studies

    KAUST Repository

    Wang, Yong

    2009-10-09

    Bacterial 16S ribosomal DNA (rDNA) amplicons have been widely used in the classification of uncultured bacteria inhabiting environmental niches. Primers targeting conservative regions of the rDNAs are used to generate amplicons of variant regions that are informative in taxonomic assignment. One problem is that the percentage coverage and application scope of the primers used in previous studies are largely unknown. In this study, conservative fragments of available rDNA sequences were first mined and then used to search for candidate primers within the fragments by measuring the coverage rate defined as the percentage of bacterial sequences containing the target. Thirty predicted primers with a high coverage rate (>90%) were identified, which were basically located in the same conservative regions as known primers in previous reports, whereas 30% of the known primers were associated with a coverage rate of <90%. The application scope of the primers was also examined by calculating the percentages of failed detections in bacterial phyla. Primers A519-539, E969- 983, E1063-1081, U515 and E517, are highly recommended because of their high coverage in almost all phyla. As expected, the three predominant phyla, Firmicutes, Gemmatimonadetes and Proteobacteria, are best covered by the predicted primers. The primers recommended in this report shall facilitate a comprehensive and reliable survey of bacterial diversity in metagenomic studies. © 2009 Wang, Qian.

  20. Eukaryotic ribosome display with in situ DNA recovery.

    Science.gov (United States)

    He, Mingyue; Edwards, Bryan M; Kastelic, Damjana; Taussig, Michael J

    2012-01-01

    Ribosome display is a cell-free display technology for in vitro selection and optimisation of proteins from large diversified libraries. It operates through the formation of stable protein-ribosome-mRNA (PRM) complexes and selection of ligand-binding proteins, followed by DNA recovery from the selected genetic information. Both prokaryotic and eukaryotic ribosome display systems have been developed. In this chapter, we describe the eukaryotic rabbit reticulocyte method in which a distinct in situ single-primer RT-PCR procedure is used to recover DNA from the selected PRM complexes without the need for prior disruption of the ribosome.

  1. Molecular characterizations of somatic hybrids developed between Pleurotus florida and Lentinus squarrosulus through inter-simple sequence repeat markers and sequencing of ribosomal RNA-ITS gene.

    Science.gov (United States)

    Mallick, Pijush; Chattaraj, Shruti; Sikdar, Samir Ranjan

    2017-10-01

    The 12 pfls somatic hybrids and 2 parents of Pleurotus florida and Lentinus s quarrosulus were characterized by ISSR and sequencing of rRNA-ITS genes. Five ISSR primers were used and amplified a total of 54 reproducible fragments with 98.14% polymorphism among all the pfls hybrid populations and parental strains. UPGMA-based cluster exhibited a dendrogram with three major groups between the parents and pfls hybrids. Parent P . florida and L . squarrosulus showed different degrees of genetic distance with all the hybrid lines and they showed closeness to hybrid pfls 1m and pfls 1h , respectively. ITS1(F) and ITS4(R) amplified the rRNA-ITS gene with 611-867 bp sequence length. The nucleotide polymorphisms were found in the ITS1, ITS2 and 5.8S rRNA region with different number of bases. Based on rRNA-ITS sequence, UPGMA cluster exhibited three distinct groups between L. squarrosulus and pfls 1p , pfls 1m and pfls 1s , and pfls 1e and P. florida .

  2. Eukaryotic translation initiation factor 3 plays distinct roles at the mRNA entry and exit channels of the ribosomal preinitiation complex

    Czech Academy of Sciences Publication Activity Database

    Aitken, C.E.; Beznosková, Petra; Vlčková, Vladislava; Chiu, W.-L.; Zhou, F.; Valášek, Leoš Shivaya; Hinnebusch, A. G.; Lorsch, J. R.

    2016-01-01

    Roč. 5, OCT26 (2016), e20934 ISSN 2050-084X R&D Projects: GA ČR(CZ) GBP305/12/G034 Institutional support: RVO:61388971 Keywords : S. cerevisiae * eIF3 * mRNA recruitment Subject RIV: EE - Microbiology, Virology Impact factor: 7.725, year: 2016

  3. Interphase ribosomal RNA cistron staining in thyroid epithelial cells in Grave's disease, Hashimoto's thyroiditis and benign and malignant tumours of the thyroid gland

    Science.gov (United States)

    Mamaev, N N; Grynyeva, E N; Blagosklonnaya, Y V

    1996-01-01

    Aim—To evaluate the expression of ribosomal cistrons in human thyroid epithelial cells (TECs) of patients with Grave's disease, Hashimoto's thyroiditis and benign and malignant tumours of the thyroid gland. Methods—TEC nucleoli were investigated in fine needle biopsy specimens from 10 controls, 39 patients with Grave's disease, 15 with Hashimoto's thyroiditis, 56 with benign, and 15 with malignant tumours of the thyroid. A one step silver staining method was applied. In most cases serum concentrations of thyroxine and triiodothyronine as well as goitre size were determined. In every case 100 TECs were evaluated for the mean numbers of nucleoli and for the average number of argyrophilic nucleolar organiser regions (AgNORs) per nucleus. Results—NORs were activated in all patients, but not in controls. The numbers of AgNORs in patients with Grave's disease were closely correlated with thyroxine or triiodothyronine, or both, concentrations and with the size of the thyroid. In patients with Hashimoto's thyroiditis about 30% of TECs nucleoli did not contain AgNORs, whereas others were heavily impregnated with silver. Compared with controls and benign tumours, the nucleoli of carcinomatous TECs were larger and irregular in shape. The mean number of AgNORs per nucleus in malignant cells was higher than that in their benign counterparts. Conclusions—The mechanism by which NORs are activated in TECs varies depending on the type of lesion. The higher AgNOR score in TECs from malignant tumours can be used to distinguish them from their benign counterparts. Images PMID:16696083

  4. Molecular dynamics simulation of ribosome jam

    KAUST Repository

    Matsumoto, Shigenori; Takagi, Fumiko; Shimada, Takashi; Ito, Nobuyasu

    2011-01-01

    We propose a coarse-grained molecular dynamics model of ribosome molecules to study the dependence of translation process on environmental parameters. We found the model exhibits traffic jam property, which is consistent with an ASEP model. We

  5. Translational control of human acetyl-CoA carboxylase 1 mRNA is mediated by an internal ribosome entry site in response to ER stress, serum deprivation or hypoxia mimetic CoCl2.

    Science.gov (United States)

    Damiano, Fabrizio; Testini, Mariangela; Tocci, Romina; Gnoni, Gabriele V; Siculella, Luisa

    2018-04-01

    Acetyl-CoA carboxylase 1 (ACC1) is a cytosolic enzyme catalyzing the rate limiting step in de novo fatty acid biosynthesis. There is mounting evidence showing that ACC1 is susceptible to dysregulation and that it is over-expressed in liver diseases associated with lipid accumulation and in several cancers. In the present study, ACC1 regulation at the translational level is reported. Using several experimental approaches, the presence of an internal ribosome entry site (IRES) has been established in the 5' untranslated region (5' UTR) of the ACC1 mRNA. Transfection experiments with the ACC1 5' UTR inserted in a dicistronic reporter vector show a remarkable increase in the downstream cistron translation, through a cap-independent mechanism. The endoplasmic reticulum (ER) stress condition and the related unfolded protein response (UPR), triggered by treatment with thapsigargin and tunicamycin, cause an increase of the cap-independent translation of ACC1 mRNA in HepG2 cells, despite the overall reduction in global protein synthesis. Other stress conditions, such as serum starvation and incubation with hypoxia mimetic agent CoCl 2 , up-regulate ACC1 expression in HepG2 cells at the translational level. Overall, these findings indicate that the presence of an IRES in the ACC1 5' UTR allows ACC1 mRNA translation in conditions that are inhibitory to cap-dependent translation. A potential involvement of the cap-independent translation of ACC1 in several pathologies, such as obesity and cancer, has been discussed. Copyright © 2018 Elsevier B.V. All rights reserved.

  6. Architecture of the large subunit of the mammalian mitochondrial ribosome.

    Science.gov (United States)

    Greber, Basil J; Boehringer, Daniel; Leitner, Alexander; Bieri, Philipp; Voigts-Hoffmann, Felix; Erzberger, Jan P; Leibundgut, Marc; Aebersold, Ruedi; Ban, Nenad

    2014-01-23

    Mitochondrial ribosomes synthesize a number of highly hydrophobic proteins encoded on the genome of mitochondria, the organelles in eukaryotic cells that are responsible for energy conversion by oxidative phosphorylation. The ribosomes in mammalian mitochondria have undergone massive structural changes throughout their evolution, including ribosomal RNA shortening and acquisition of mitochondria-specific ribosomal proteins. Here we present the three-dimensional structure of the 39S large subunit of the porcine mitochondrial ribosome determined by cryo-electron microscopy at 4.9 Å resolution. The structure, combined with data from chemical crosslinking and mass spectrometry experiments, reveals the unique features of the 39S subunit at near-atomic resolution and provides detailed insight into the architecture of the polypeptide exit site. This region of the mitochondrial ribosome has been considerably remodelled compared to its bacterial counterpart, providing a specialized platform for the synthesis and membrane insertion of the highly hydrophobic protein components of the respiratory chain.

  7. Simulation and analysis of single-ribosome translation

    International Nuclear Information System (INIS)

    Tinoco, Ignacio Jr; Wen, Jin-Der

    2009-01-01

    In the cell, proteins are synthesized by ribosomes in a multi-step process called translation. The ribosome translocates along the messenger RNA to read the codons that encode the amino acid sequence of a protein. Elongation factors, including EF-G and EF-Tu, are used to catalyze the process. Recently, we have shown that translation can be followed at the single-molecule level using optical tweezers; this technique allows us to study the kinetics of translation by measuring the lifetime the ribosome spends at each codon. Here, we analyze the data from single-molecule experiments and fit the data with simple kinetic models. We also simulate the translation kinetics based on a multi-step mechanism from ensemble kinetic measurements. The mean lifetimes from the simulation were consistent with our experimental single-molecule measurements. We found that the calculated lifetime distributions were fit in general by equations with up to five rate-determining steps. Two rate-determining steps were only obtained at low concentrations of elongation factors. These analyses can be used to design new single-molecule experiments to better understand the kinetics and mechanism of translation

  8. miRge - A Multiplexed Method of Processing Small RNA-Seq Data to Determine MicroRNA Entropy.

    Directory of Open Access Journals (Sweden)

    Alexander S Baras

    Full Text Available Small RNA RNA-seq for microRNAs (miRNAs is a rapidly developing field where opportunities still exist to create better bioinformatics tools to process these large datasets and generate new, useful analyses. We built miRge to be a fast, smart small RNA-seq solution to process samples in a highly multiplexed fashion. miRge employs a Bayesian alignment approach, whereby reads are sequentially aligned against customized mature miRNA, hairpin miRNA, noncoding RNA and mRNA sequence libraries. miRNAs are summarized at the level of raw reads in addition to reads per million (RPM. Reads for all other RNA species (tRNA, rRNA, snoRNA, mRNA are provided, which is useful for identifying potential contaminants and optimizing small RNA purification strategies. miRge was designed to optimally identify miRNA isomiRs and employs an entropy based statistical measurement to identify differential production of isomiRs. This allowed us to identify decreasing entropy in isomiRs as stem cells mature into retinal pigment epithelial cells. Conversely, we show that pancreatic tumor miRNAs have similar entropy to matched normal pancreatic tissues. In a head-to-head comparison with other miRNA analysis tools (miRExpress 2.0, sRNAbench, omiRAs, miRDeep2, Chimira, UEA small RNA Workbench, miRge was faster (4 to 32-fold and was among the top-two methods in maximally aligning miRNAs reads per sample. Moreover, miRge has no inherent limits to its multiplexing. miRge was capable of simultaneously analyzing 100 small RNA-Seq samples in 52 minutes, providing an integrated analysis of miRNA expression across all samples. As miRge was designed for analysis of single as well as multiple samples, miRge is an ideal tool for high and low-throughput users. miRge is freely available at http://atlas.pathology.jhu.edu/baras/miRge.html.

  9. DNA replication initiator Cdc6 also regulates ribosomal DNA transcription initiation.

    Science.gov (United States)

    Huang, Shijiao; Xu, Xiaowei; Wang, Guopeng; Lu, Guoliang; Xie, Wenbing; Tao, Wei; Zhang, Hongyin; Jiang, Qing; Zhang, Chuanmao

    2016-04-01

    RNA-polymerase-I-dependent ribosomal DNA (rDNA) transcription is fundamental to rRNA processing, ribosome assembly and protein synthesis. However, how this process is initiated during the cell cycle is not fully understood. By performing a proteomic analysis of transcription factors that bind RNA polymerase I during rDNA transcription initiation, we identified that the DNA replication initiator Cdc6 interacts with RNA polymerase I and its co-factors, and promotes rDNA transcription in G1 phase in an ATPase-activity-dependent manner. We further showed that Cdc6 is targeted to the nucleolus during late mitosis and G1 phase in a manner that is dependent on B23 (also known as nucleophosmin, NPM1), and preferentially binds to the rDNA promoter through its ATP-binding domain. Overexpression of Cdc6 increases rDNA transcription, whereas knockdown of Cdc6 results in a decreased association of both RNA polymerase I and the RNA polymerase I transcription factor RRN3 with rDNA, and a reduction of rDNA transcription. Furthermore, depletion of Cdc6 impairs the interaction between RRN3 and RNA polymerase I. Taken together, our data demonstrate that Cdc6 also serves as a regulator of rDNA transcription initiation, and indicate a mechanism by which initiation of rDNA transcription and DNA replication can be coordinated in cells. © 2016. Published by The Company of Biologists Ltd.

  10. Comparison of sequencing the D2 region of the large subunit ribosomal RNA gene (MicroSEQ®) versus the internal transcribed spacer (ITS) regions using two public databases for identification of common and uncommon clinically relevant fungal species.

    Science.gov (United States)

    Arbefeville, S; Harris, A; Ferrieri, P

    2017-09-01

    Fungal infections cause considerable morbidity and mortality in immunocompromised patients. Rapid and accurate identification of fungi is essential to guide accurately targeted antifungal therapy. With the advent of molecular methods, clinical laboratories can use new technologies to supplement traditional phenotypic identification of fungi. The aims of the study were to evaluate the sole commercially available MicroSEQ® D2 LSU rDNA Fungal Identification Kit compared to the in-house developed internal transcribed spacer (ITS) regions assay in identifying moulds, using two well-known online public databases to analyze sequenced data. 85 common and uncommon clinically relevant fungi isolated from clinical specimens were sequenced for the D2 region of the large subunit (LSU) of ribosomal RNA (rRNA) gene with the MicroSEQ® Kit and the ITS regions with the in house developed assay. The generated sequenced data were analyzed with the online GenBank and MycoBank public databases. The D2 region of the LSU rRNA gene identified 89.4% or 92.9% of the 85 isolates to the genus level and the full ITS region (f-ITS) 96.5% or 100%, using GenBank or MycoBank, respectively, when compared to the consensus ID. When comparing species-level designations to the consensus ID, D2 region of the LSU rRNA gene aligned with 44.7% (38/85) or 52.9% (45/85) of these isolates in GenBank or MycoBank, respectively. By comparison, f-ITS possessed greater specificity, followed by ITS1, then ITS2 regions using GenBank or MycoBank. Using GenBank or MycoBank, D2 region of the LSU rRNA gene outperformed phenotypic based ID at the genus level. Comparing rates of ID between D2 region of the LSU rRNA gene and the ITS regions in GenBank or MycoBank at the species level against the consensus ID, f-ITS and ITS2 exceeded performance of the D2 region of the LSU rRNA gene, but ITS1 had similar performance to the D2 region of the LSU rRNA gene using MycoBank. Our results indicated that the MicroSEQ® D2 LSU r

  11. Glia to axon RNA transfer.

    Science.gov (United States)

    Sotelo, José Roberto; Canclini, Lucía; Kun, Alejandra; Sotelo-Silveira, José Roberto; Calliari, Aldo; Cal, Karina; Bresque, Mariana; Dipaolo, Andrés; Farias, Joaquina; Mercer, John A

    2014-03-01

    The existence of RNA in axons has been a matter of dispute for decades. Evidence for RNA and ribosomes has now accumulated to a point at which it is difficult to question, much of the disputes turned to the origin of these axonal RNAs. In this review, we focus on studies addressing the origin of axonal RNAs and ribosomes. The neuronal soma as the source of most axonal RNAs has been demonstrated and is indisputable. However, the surrounding glial cells may be a supplemental source of axonal RNAs, a matter scarcely investigated in the literature. Here, we review the few papers that have demonstrated that glial-to-axon RNA transfer is not only feasible, but likely. We describe this process in both invertebrate axons and vertebrate axons. Schwann cell to axon ribosomes transfer was conclusively demonstrated (Court et al. [2008]: J. Neurosci 28:11024-11029; Court et al. [2011]: Glia 59:1529-1539). However, mRNA transfer still remains to be demonstrated in a conclusive way. The intercellular transport of mRNA has interesting implications, particularly with respect to the integration of glial and axonal function. This evolving field is likely to impact our understanding of the cell biology of the axon in both normal and pathological conditions. Most importantly, if the synthesis of proteins in the axon can be controlled by interacting glia, the possibilities for clinical interventions in injury and neurodegeneration are greatly increased. Copyright © 2013 Wiley Periodicals, Inc.

  12. Diamond Blackfan Anemia at the Crossroad between Ribosome Biogenesis and Heme Metabolism

    Directory of Open Access Journals (Sweden)

    Deborah Chiabrando

    2010-01-01

    Full Text Available Diamond-Blackfan anemia (DBA is a rare, pure red-cell aplasia that presents during infancy. Approximately 40% of cases are associated with other congenital defects, particularly malformations of the upper limb or craniofacial region. Mutations in the gene coding for the ribosomal protein RPS19 have been identified in 25% of patients with DBA, with resulting impairment of 18S rRNA processing and 40S ribosomal subunit formation. Moreover, mutations in other ribosomal protein coding genes account for about 25% of other DBA cases. Recently, the analysis of mice from which the gene coding for the heme exporter Feline Leukemia Virus subgroup C Receptor (FLVCR1 is deleted suggested that this gene may be involved in the pathogenesis of DBA. FLVCR1-null mice show a phenotype resembling that of DBA patients, including erythroid failure and malformations. Interestingly, some DBA patients have disease linkage to chromosome 1q31, where FLVCR1 is mapped. Moreover, it has been reported that cells from DBA patients express alternatively spliced isoforms of FLVCR1 which encode non-functional proteins. Herein, we review the known roles of RPS19 and FLVCR1 in ribosome function and heme metabolism respectively, and discuss how the deficiency of a ribosomal protein or of a heme exporter may result in the same phenotype.

  13. Detection of Cryptosporidium species in feces or gastric contents from snakes and lizards as determined by polymerase chain reaction analysis and partial sequencing of the 18S ribosomal RNA gene.

    Science.gov (United States)

    Richter, Barbara; Nedorost, Nora; Maderner, Anton; Weissenböck, Herbert

    2011-05-01

    Cryptosporidiosis is a well-known gastrointestinal disease of snakes and lizards. In the current study, 672 samples (feces and/or gastric contents or regurgitated food items) of various snakes and lizards were examined for the presence of cryptosporidia by polymerase chain reaction (PCR) assay targeting a part of the 18S ribosomal RNA gene. A consecutive sequencing reaction was used to identify the cryptosporidian species present in PCR-positive samples. Cryptosporidium varanii (saurophilum) was detected in 17 out of 106 (16%) samples from corn snakes (Pantherophis guttatus) and in 32 out of 462 (7%) samples from leopard geckos (Eublepharis macularius). Cryptosporidium serpentis was found in 8 out of 462 (2%) leopard gecko samples, but in no other reptile. The Cryptosporidium sp. "lizard genotype" was present in 1 leopard gecko sample, and 1 sample from a corn snake showed a single nucleotide mismatch to this genotype. Pseudoparasitic cryptosporidian species were identified in 5 out of 174 (3%) ophidian samples, but not in lizards. Other sequences did not show complete similarity to previously published Cryptosporidium sequences. The results stress the importance for diagnostic methods to be specific for Cryptosporidium species especially in snakes and show a relatively high prevalence of C. varanii in leopard geckos and corn snakes. © 2011 The Author(s)

  14. The first report: An analysis of bacterial flora of the first voided urine specimens of patients with male urethritis using the 16S ribosomal RNA gene-based clone library method.

    Science.gov (United States)

    You, Chunlin; Hamasuna, Ryoichi; Ogawa, Midori; Fukuda, Kazumasa; Hachisuga, Toru; Matsumoto, Tetsuro; Taniguchi, Hatsumi

    2016-06-01

    To analyse the bacterial flora of urine from patients with male urethritis using the clone library method. Urine specimens from patients with urethritis were used. The bacterial flora was analysed according to the 16S ribosomal RNA gene-based clone library method. In addition, Neisseria gonorrhoeae, Chlamydia trachomatis, Mycoplasma genitalium, Mycoplasma hominis, Ureaplasma urealyticum or Ureaplasma parvum were detected by the conventional PCR methods (TMA or real-time PCR) and data from the clone library and conventional PCR methods were compared. Among 58 urine specimens, 38 were successfully analysed using the clone library method. From the specimens, 2427 clones were evaluated and 95 bacterial phylotypes were detected. N. gonorrhoeae was detected from 6 specimens and as the predominant bacterial species in 5 specimens. M. genitalium was detected from 5 specimens and as the predominant bacterial species in 3 specimens. C. trachomatis was detected from 15 specimens using the TMA method, but was detected from only 1 specimen using the clone library method. U. parvum was detected from only 2 specimens using the clone library method. In addition, Haemophilus influenzae and Neisseria meningitidis were also detected in 8 and 1 specimens, respectively. Gardnerella vaginalis, which is a potential pathogen for bacterial vaginitis in women, was detected in 10 specimens. The clone library method can detect the occupancy rate of each bacteria species among the bacterial flora and may be a new method for bacterial analyses in male urethritis. Copyright © 2016 Elsevier Ltd. All rights reserved.

  15. Molecular mimicry between Mycobacterium leprae proteins (50S ribosomal protein L2 and Lysyl-tRNA synthetase) and myelin basic protein: a possible mechanism of nerve damage in leprosy.

    Science.gov (United States)

    Singh, Itu; Yadav, Asha Ram; Mohanty, Keshar Kunja; Katoch, Kiran; Sharma, Prashant; Mishra, Bishal; Bisht, Deepa; Gupta, U D; Sengupta, Utpal

    2015-04-01

    Autoantibodies against various components of host are known to occur in leprosy. Nerve damage is the primary cause of disability associated with leprosy. The aim of this study was to detect the level of autoantibodies and lympho-proliferative response against myelin basic protein (MBP) in leprosy patients (LPs) and their correlation with clinical phenotypes of LPs. Further, probable role of molecular mimicry in nerve damage of LPs was investigated. We observed significantly high level of anti-MBP antibodies in LPs across the spectrum and a positive significant correlation between the level of anti-MBP antibodies and the number of nerves involved in LPs. We report here that 4 B cell epitopes of myelin A1 and Mycobacterium leprae proteins, 50S ribosomal L2 and lysyl tRNA synthetase are cross-reactive. Further, M. leprae sonicated antigen hyperimmunization was responsible for induction of autoantibody response in mice which could be adoptively transferred to naive mice. For the first time our findings suggest the role of molecular mimicry in nerve damage in leprosy. Copyright © 2015 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.

  16. Antimicrobial susceptibility and Ribosomal-RNA gene restriction patterns among Staphylococcus-intermedius from healthy dogs and from dogs sufferning from pyoderma or otitis-externa

    DEFF Research Database (Denmark)

    Pedersen, Karl; Wegener, Henrik Caspar

    1995-01-01

    A total of 60 Staphlococcus intermedius strains from dogs were investigated by their sensitivity to various antibiotics (50 strains) and by their rRNA gene restriction patterns (ribotyping) (60 strains). Fifteen isolates were from healthy dogs, 9 with otitis externa, and 36 with pyoderma, including......, enrofloxacin, and sulphonamides with trimethoprim. There were no significant differences in antimicrobial susceptibility patterns observed among isolates from pyoderma, otitis externa or healthy dogs. Among the 60 strains studied by ribotyping, 10 different ribotypes were identified: 6 different ribotypes...... among isolates from otitis externa, 8 among isolates from pyoderma, and 5 among isolates from healthy dogs. One ribotype (profile C) was dominant among the isolates from healthy dogs while another ribotype (profile A) was dominant among strains from dogs suffering from pyoderma. This profile...

  17. Allele-Specific Alternative mRNA processing (ASARP) | Informatics Technology for Cancer Research (ITCR)

    Science.gov (United States)

    A software pipeline for prediction of allele-specific alternative RNA processing events using single RNA-seq data. The current version focuses on prediction of alternative splicing and alternative polyadenylation modulated by genetic variants.

  18. Full-length mRNA sequencing uncovers a widespread coupling between transcription initiation and mRNA processing.

    Science.gov (United States)

    Anvar, Seyed Yahya; Allard, Guy; Tseng, Elizabeth; Sheynkman, Gloria M; de Klerk, Eleonora; Vermaat, Martijn; Yin, Raymund H; Johansson, Hans E; Ariyurek, Yavuz; den Dunnen, Johan T; Turner, Stephen W; 't Hoen, Peter A C

    2018-03-29

    The multifaceted control of gene expression requires tight coordination of regulatory mechanisms at transcriptional and post-transcriptional level. Here, we studied the interdependence of transcription initiation, splicing and polyadenylation events on single mRNA molecules by full-length mRNA sequencing. In MCF-7 breast cancer cells, we find 2700 genes with interdependent alternative transcription initiation, splicing and polyadenylation events, both in proximal and distant parts of mRNA molecules, including examples of coupling between transcription start sites and polyadenylation sites. The analysis of three human primary tissues (brain, heart and liver) reveals similar patterns of interdependency between transcription initiation and mRNA processing events. We predict thousands of novel open reading frames from full-length mRNA sequences and obtained evidence for their translation by shotgun proteomics. The mapping database rescues 358 previously unassigned peptides and improves the assignment of others. By recognizing sample-specific amino-acid changes and novel splicing patterns, full-length mRNA sequencing improves proteogenomics analysis of MCF-7 cells. Our findings demonstrate that our understanding of transcriptome complexity is far from complete and provides a basis to reveal largely unresolved mechanisms that coordinate transcription initiation and mRNA processing.

  19. Differential Regulation of rRNA and tRNA Transcription from the rRNA-tRNA Composite Operon in Escherichia coli.

    Directory of Open Access Journals (Sweden)

    Hiraku Takada

    Full Text Available Escherichia coli contains seven rRNA operons, each consisting of the genes for three rRNAs (16S, 23S and 5S rRNA in this order and one or two tRNA genes in the spacer between 16S and 23S rRNA genes and one or two tRNA genes in the 3' proximal region. All of these rRNA and tRNA genes are transcribed from two promoters, P1 and P2, into single large precursors that are afterward processed to individual rRNAs and tRNAs by a set of RNases. In the course of Genomic SELEX screening of promoters recognized by RNA polymerase (RNAP holoenzyme containing RpoD sigma, a strong binding site was identified within 16S rRNA gene in each of all seven rRNA operons. The binding in vitro of RNAP RpoD holoenzyme to an internal promoter, referred to the promoter of riRNA (an internal RNA of the rRNA operon, within each 16S rRNA gene was confirmed by gel shift assay and AFM observation. Using this riRNA promoter within the rrnD operon as a representative, transcription in vitro was detected with use of the purified RpoD holoenzyme, confirming the presence of a constitutive promoter in this region. LacZ reporter assay indicated that this riRNA promoter is functional in vivo. The location of riRNA promoter in vivo as identified using a set of reporter plasmids agrees well with that identified in vitro. Based on transcription profile in vitro and Northern blot analysis in vivo, the majority of transcript initiated from this riRNA promoter was estimated to terminate near the beginning of 23S rRNA gene, indicating that riRNA leads to produce the spacer-coded tRNA. Under starved conditions, transcription of the rRNA operon is markedly repressed to reduce the intracellular level of ribosomes, but the levels of both riRNA and its processed tRNAGlu stayed unaffected, implying that riRNA plays a role in the continued steady-state synthesis of tRNAs from the spacers of rRNA operons. We then propose that the tRNA genes organized within the spacers of rRNA-tRNA composite operons

  20. The Complete Structure of the Mycobacterium smegmatis 70S Ribosome

    Directory of Open Access Journals (Sweden)

    Jendrik Hentschel

    2017-07-01

    Full Text Available The ribosome carries out the synthesis of proteins in every living cell. It consequently represents a frontline target in anti-microbial therapy. Tuberculosis ranks among the leading causes of death worldwide, due in large part to the combination of difficult-to-treat latency and antibiotic resistance. Here, we present the 3.3-Å cryo-EM structure of the 70S ribosome of Mycobacterium smegmatis, a close relative to the human pathogen Mycobacterium tuberculosis. The structure reveals two additional ribosomal proteins and localizes them to the vicinity of drug-target sites in both the catalytic center and the decoding site of the ribosome. Furthermore, we visualized actinobacterium-specific rRNA and protein expansions that extensively remodel the ribosomal surface with implications for polysome organization. Our results provide a foundation for understanding the idiosyncrasies of mycobacterial translation and reveal atomic details of the structure that will facilitate the design of anti-tubercular therapeutics.

  1. Splicing of goose parvovirus pre-mRNA influences cytoplasmic translation of the processed mRNA

    Energy Technology Data Exchange (ETDEWEB)

    Li, Long; Pintel, David J., E-mail: pinteld@missouri.edu

    2012-04-25

    Translation of goose parvovirus (GPV) 72 kDa Rep 1 is initiated from unspliced P9-generated mRNAs in ORF1 from the first in-frame AUG (537 AUG); however, this AUG is bypassed in spliced P9-generated RNA: translation of the 52 kDa Rep 2 protein from spliced RNA is initiated in ORF2 at the next AUG downstream (650 AUG). Usage of the 537 AUG was restored in spliced RNA when the GPV intron was replaced with a chimeric SV40 intron, or following specific mutations of the GPV intron which did not appear in the final spliced mRNA. Additionally, 650 AUG usage was gained in unspliced RNA when the GPV intron splice sites were debilitated. Splicing-dependent regulation of translation initiation was mediated in cis by GPV RNA surrounding the target AUGs. Thus, nuclear RNA processing of GPV P9-generated pre-mRNAs has a complex, but significant, effect on alternative translation initiation of the GPV Rep proteins.

  2. Splicing of goose parvovirus pre-mRNA influences cytoplasmic translation of the processed mRNA

    International Nuclear Information System (INIS)

    Li, Long; Pintel, David J.

    2012-01-01

    Translation of goose parvovirus (GPV) 72 kDa Rep 1 is initiated from unspliced P9-generated mRNAs in ORF1 from the first in-frame AUG (537 AUG); however, this AUG is bypassed in spliced P9-generated RNA: translation of the 52 kDa Rep 2 protein from spliced RNA is initiated in ORF2 at the next AUG downstream (650 AUG). Usage of the 537 AUG was restored in spliced RNA when the GPV intron was replaced with a chimeric SV40 intron, or following specific mutations of the GPV intron which did not appear in the final spliced mRNA. Additionally, 650 AUG usage was gained in unspliced RNA when the GPV intron splice sites were debilitated. Splicing-dependent regulation of translation initiation was mediated in cis by GPV RNA surrounding the target AUGs. Thus, nuclear RNA processing of GPV P9-generated pre-mRNAs has a complex, but significant, effect on alternative translation initiation of the GPV Rep proteins.

  3. Methods and compositions for controlling gene expression by RNA processing

    Science.gov (United States)

    Doudna, Jennifer A.; Qi, Lei S.; Haurwitz, Rachel E.; Arkin, Adam P.

    2017-08-29

    The present disclosure provides nucleic acids encoding an RNA recognition sequence positioned proximal to an insertion site for the insertion of a sequence of interest; and host cells genetically modified with the nucleic acids. The present disclosure also provides methods of modifying the activity of a target RNA, and kits and compositions for carrying out the methods.

  4. Control of ribosome traffic by position-dependent choice of synonymous codons

    DEFF Research Database (Denmark)

    Mitarai, Namiko; Pedersen, Steen

    2013-01-01

    Messenger RNA (mRNA) encodes a sequence of amino acids by using codons. For most amino acids, there are multiple synonymous codons that can encode the amino acid. The translation speed can vary from one codon to another, thus there is room for changing the ribosome speed while keeping the amino...... acid sequence and hence the resulting protein. Recently, it has been noticed that the choice of the synonymous codon, via the resulting distribution of slow- and fast-translated codons, affects not only on the average speed of one ribosome translating the mRNA but also might have an effect on nearby...... ribosomes by affecting the appearance of 'traffic jams' where multiple ribosomes collide and form queues. To test this 'context effect' further, we here investigate the effect of the sequence of synonymous codons on the ribosome traffic by using a ribosome traffic model with codon-dependent rates, estimated...

  5. Charge Segregation and Low Hydrophobicity Are Key Features of Ribosomal Proteins from Different Organisms*

    Science.gov (United States)

    Fedyukina, Daria V.; Jennaro, Theodore S.; Cavagnero, Silvia

    2014-01-01

    Ribosomes are large and highly charged macromolecular complexes consisting of RNA and proteins. Here, we address the electrostatic and nonpolar properties of ribosomal proteins that are important for ribosome assembly and interaction with other cellular components and may influence protein folding on the ribosome. We examined 50 S ribosomal subunits from 10 species and found a clear distinction between the net charge of ribosomal proteins from halophilic and non-halophilic organisms. We found that ∼67% ribosomal proteins from halophiles are negatively charged, whereas only up to ∼15% of ribosomal proteins from non-halophiles share this property. Conversely, hydrophobicity tends to be lower for ribosomal proteins from halophiles than for the corresponding proteins from non-halophiles. Importantly, the surface electrostatic potential of ribosomal proteins from all organisms, especially halophiles, has distinct positive and negative regions across all the examined species. Positively and negatively charged residues of ribosomal proteins tend to be clustered in buried and solvent-exposed regions, respectively. Hence, the majority of ribosomal proteins is characterized by a significant degree of intramolecular charge segregation, regardless of the organism of origin. This key property enables the ribosome to accommodate proteins within its complex scaffold regardless of their overall net charge. PMID:24398678

  6. Condensin suppresses recombination and regulates double-strand break processing at the repetitive ribosomal DNA array to ensure proper chromosome segregation during meiosis in budding yeast

    Science.gov (United States)

    Li, Ping; Jin, Hui; Yu, Hong-Guo

    2014-01-01

    During meiosis, homologues are linked by crossover, which is required for bipolar chromosome orientation before chromosome segregation at anaphase I. The repetitive ribosomal DNA (rDNA) array, however, undergoes little or no meiotic recombination. Hyperrecombination can cause chromosome missegregation and rDNA copy number instability. We report here that condensin, a conserved protein complex required for chromosome organization, regulates double-strand break (DSB) formation and repair at the rDNA gene cluster during meiosis in budding yeast. Condensin is highly enriched at the rDNA region during prophase I, released at the prophase I/metaphase I transition, and reassociates with rDNA before anaphase I onset. We show that condensin plays a dual role in maintaining rDNA stability: it suppresses the formation of Spo11-mediated rDNA breaks, and it promotes DSB processing to ensure proper chromosome segregation. Condensin is unnecessary for the export of rDNA breaks outside the nucleolus but required for timely repair of meiotic DSBs. Our work reveals that condensin coordinates meiotic recombination with chromosome segregation at the repetitive rDNA sequence, thereby maintaining genome integrity. PMID:25103240

  7. On the control of ribosomal protein biosynthesis in Escherichia coli

    International Nuclear Information System (INIS)

    Pichon, J.; Marvaldi, J.; Coeroli, C.; Cozzone, A.; Marchis-Mouren, G.

    1977-01-01

    The rate of individual ribosomal protein synthesis relative to total protein synthesis has been determined in Escherichia coli rel + and rel - cells, under valyl-tRNA deprivation. These strains have a temperature-sensitive valyl-tRNA synthetase. Starvation was obtained following transfer of the cells to non-permissive temperature. Ribosomal proteins were obtained by treatment of either total lysates of freeze-thawed lysozyme spheroplasts or ammonium sulphate precipitate of ribosomes, with acetic acid. Differential labelling of the ribosomal proteins was observed in both strains: proteins from the rel + strain appear more labelled than those from the rel - strain, the rate of labelling of individual proteins being about the same in both strains. Moreover ribosomal proteins were found as stable during starvation as total protein. It is thus concluded that in starving cells individual ribosomal proteins are not synthesized at equal rates. This indicates that the synthesis of ribosomal proteins is not only under the control of the rel gene

  8. Translation activity of chimeric ribosomes composed of Escherichia coli and Bacillus subtilis or Geobacillus stearothermophilus subunits

    Directory of Open Access Journals (Sweden)

    Sayaka Tsuji

    2017-07-01

    Full Text Available Ribosome composition, consisting of rRNA and ribosomal proteins, is highly conserved among a broad range of organisms. However, biochemical studies focusing on ribosomal subunit exchangeability between organisms remain limited. In this study, we show that chimeric ribosomes, composed of Escherichia coli and Bacillus subtilis or E. coli and Geobacillus stearothermophilus subunits, are active for β-galactosidase translation in a highly purified E. coli translation system. Activities of the chimeric ribosomes showed only a modest decrease when using E. coli 30 S subunits, indicating functional conservation of the 50 S subunit between these bacterial species.

  9. Regulatory RNPs: a novel class of ribonucleoproteins that potentially contribute to ribosome heterogeneity

    Directory of Open Access Journals (Sweden)

    Aaron R. Poole

    2017-09-01

    Full Text Available Many ribonucleoproteins (RNPs, which are comprised of noncoding RNA and associated proteins, are involved in essential cellular processes such as translation and pre-mRNA splicing. One class of RNP is the small Cajal body-specific RNP (scaRNP, which contributes to the biogenesis of small nuclear RNPs (snRNPs that are central components of the spliceosome. Three scaRNAs are internally processed, generating stable nucleolus-enriched RNAs of unknown function. Here, we provide data that show that these RNAs become part of RNPs we term regulatory RNPs (regRNPs. Most modifications within rRNA (predominantly pseudouridylation and ribose 2′-O-methylation are conducted by small nucleolar RNPs (snoRNPs, and we provide evidence that the activity of at least some of these snoRNPs is under the control of regRNPs. Because modifications within rRNA can vary in different physiological or pathological situations, rRNA modifications are thought to be the major source of ribosome heterogeneity. Our identification of regRNPs thus provides a potential mechanism for how ribosome heterogeneity may be accomplished. This work also provides additional functional connections between the Cajal body and the nucleolus.

  10. GTPases and the origin of the ribosome

    Directory of Open Access Journals (Sweden)

    Smith Temple F

    2010-05-01

    Full Text Available Abstract Background This paper is an attempt to trace the evolution of the ribosome through the evolution of the universal P-loop GTPases that are involved with the ribosome in translation and with the attachment of the ribosome to the membrane. The GTPases involved in translation in Bacteria/Archaea are the elongation factors EFTu/EF1, the initiation factors IF2/aeIF5b + aeIF2, and the elongation factors EFG/EF2. All of these GTPases also contain the OB fold also found in the non GTPase IF1 involved in initiation. The GTPase involved in the signal recognition particle in most Bacteria and Archaea is SRP54. Results 1 The Elongation Factors of the Archaea based on structural considerations of the domains have the following evolutionary path: EF1→ aeIF2 → EF2. The evolution of the aeIF5b was a later event; 2 the Elongation Factors of the Bacteria based on the topological considerations of the GTPase domain have a similar evolutionary path: EFTu→ IF→2→EFG. These evolutionary sequences reflect the evolution of the LSU followed by the SSU to form the ribosome; 3 the OB-fold IF1 is a mimic of an ancient tRNA minihelix. Conclusion The evolution of translational GTPases of both the Archaea and Bacteria point to the evolution of the ribosome. The elongation factors, EFTu/EF1, began as a Ras-like GTPase bringing the activated minihelix tRNA to the Large Subunit Unit. The initiation factors and elongation factor would then have evolved from the EFTu/EF1 as the small subunit was added to the evolving ribosome. The SRP has an SRP54 GTPase and a specific RNA fold in its RNA component similar to the PTC. We consider the SRP to be a remnant of an ancient form of an LSU bound to a membrane. Reviewers This article was reviewed by George Fox, Leonid Mirny and Chris Sander.

  11. A computational investigation on the connection between dynamics properties of ribosomal proteins and ribosome assembly.

    Directory of Open Access Journals (Sweden)

    Brittany Burton

    Full Text Available Assembly of the ribosome from its protein and RNA constituents has been studied extensively over the past 50 years, and experimental evidence suggests that prokaryotic ribosomal proteins undergo conformational changes during assembly. However, to date, no studies have attempted to elucidate these conformational changes. The present work utilizes computational methods to analyze protein dynamics and to investigate the linkage between dynamics and binding of these proteins during the assembly of the ribosome. Ribosomal proteins are known to be positively charged and we find the percentage of positive residues in r-proteins to be about twice that of the average protein: Lys+Arg is 18.7% for E. coli and 21.2% for T. thermophilus. Also, positive residues constitute a large proportion of RNA contacting residues: 39% for E. coli and 46% for T. thermophilus. This affirms the known importance of charge-charge interactions in the assembly of the ribosome. We studied the dynamics of three primary proteins from E. coli and T. thermophilus 30S subunits that bind early in the assembly (S15, S17, and S20 with atomic molecular dynamic simulations, followed by a study of all r-proteins using elastic network models. Molecular dynamics simulations show that solvent-exposed proteins (S15 and S17 tend to adopt more stable solution conformations than an RNA-embedded protein (S20. We also find protein residues that contact the 16S rRNA are generally more mobile in comparison with the other residues. This is because there is a larger proportion of contacting residues located in flexible loop regions. By the use of elastic network models, which are computationally more efficient, we show that this trend holds for most of the 30S r-proteins.

  12. Cryo-EM Structure of the Archaeal 50S Ribosomal Subunit in Complex with Initiation Factor 6 and Implications for Ribosome Evolution

    Science.gov (United States)

    Greber, Basil J.; Boehringer, Daniel; Godinic-Mikulcic, Vlatka; Crnkovic, Ana; Ibba, Michael; Weygand-Durasevic, Ivana; Ban, Nenad

    2013-01-01

    Translation of mRNA into proteins by the ribosome is universally conserved in all cellular life. The composition and complexity of the translation machinery differ markedly between the three domains of life. Organisms from the domain Archaea show an intermediate level of complexity, sharing several additional components of the translation machinery with eukaryotes that are absent in bacteria. One of these translation factors is initiation factor 6 (IF6), which associates with the large ribosomal subunit. We have reconstructed the 50S ribosomal subunit from the archaeon Methanothermobacter thermautotrophicus in complex with archaeal IF6 at 6.6 Å resolution using cryo-electron microscopy (EM). The structure provides detailed architectural insights into the 50S ribosomal subunit from a methanogenic archaeon through identification of the rRNA expansion segments and ribosomal proteins that are shared between this archaeal ribosome and eukaryotic ribosomes but are mostly absent in bacteria and in some archaeal lineages. Furthermore, the structure reveals that, in spite of highly divergent evolutionary trajectories of the ribosomal particle and the acquisition of novel functions of IF6 in eukaryotes, the molecular binding of IF6 on the ribosome is conserved between eukaryotes and archaea. The structure also provides a snapshot of the reductive evolution of the archaeal ribosome and offers new insights into the evolution of the translation system in archaea. PMID:22306461

  13. Ribosomal Antibiotics: Contemporary Challenges

    Directory of Open Access Journals (Sweden)

    Tamar Auerbach-Nevo

    2016-06-01

    Full Text Available Most ribosomal antibiotics obstruct distinct ribosomal functions. In selected cases, in addition to paralyzing vital ribosomal tasks, some ribosomal antibiotics are involved in cellular regulation. Owing to the global rapid increase in the appearance of multi-drug resistance in pathogenic bacterial strains, and to the extremely slow progress in developing new antibiotics worldwide, it seems that, in addition to the traditional attempts at improving current antibiotics and the intensive screening for additional natural compounds, this field should undergo substantial conceptual revision. Here, we highlight several contemporary issues, including challenging the common preference of broad-range antibiotics; the marginal attention to alterations in the microbiome population resulting from antibiotics usage, and the insufficient awareness of ecological and environmental aspects of antibiotics usage. We also highlight recent advances in the identification of species-specific structural motifs that may be exploited for the design and the creation of novel, environmental friendly, degradable, antibiotic types, with a better distinction between pathogens and useful bacterial species in the microbiome. Thus, these studies are leading towards the design of “pathogen-specific antibiotics,” in contrast to the current preference of broad range antibiotics, partially because it requires significant efforts in speeding up the discovery of the unique species motifs as well as the clinical pathogen identification.

  14. Expanding the ribosomal universe.

    Science.gov (United States)

    Dinman, Jonathan D; Kinzy, Terri Goss

    2009-12-09

    In this issue of Structure, Taylor et al. (2009) present the most complete model of an eukaryotic ribosome to date. This achievement represents a critical milestone along the path to structurally defining the unique aspects of the eukaryotic protein synthetic machinery.

  15. New RNA playgrounds : non-coding RNAs and RNA-binding proteins control cellular processes

    NARCIS (Netherlands)

    Kedde, Martijn

    2009-01-01

    Het eiwit Dead End noodzakelijk is voor het overleven van geslachtscellen. Het beschermt enkele genen tegen blokkades door microRNA’s. Dat stelt onderzoeker Martijn Kedde van het NKI-AVL in zijn proefschrift. Kedde promoveert donderdag 22 januari. MicroRNA’s, kleine stukjes RNA, blokkeren de

  16. Can we always sweep the details of RNA-processing under the carpet?

    International Nuclear Information System (INIS)

    Klironomos, Filippos D; Berg, Johannes; De Meaux, Juliette

    2013-01-01

    RNA molecules follow a succession of enzyme-mediated processing steps from transcription to maturation. The participating enzymes, for example the spliceosome for mRNAs and Drosha and Dicer for microRNAs, are also produced in the cell and their copy-numbers fluctuate over time. Enzyme copy-number changes affect the processing rate of the substrate molecules; high enzyme numbers increase the processing rate, while low enzyme numbers decrease it. We study different RNA-processing cascades where enzyme copy-numbers are either fixed or fluctuate. We find that for the fixed enzyme copy-numbers, the substrates at steady-state are Poisson-distributed, and the whole RNA cascade dynamics can be understood as a single birth–death process of the mature RNA product. In this case, solely fluctuations in the timing of RNA processing lead to variation in the number of RNA molecules. However, we show analytically and numerically that when enzyme copy-numbers fluctuate, the strength of RNA fluctuations increases linearly with the RNA transcription rate. This linear effect becomes stronger as the speed of enzyme dynamics decreases relative to the speed of RNA dynamics. Interestingly, we find that under certain conditions, the RNA cascade can reduce the strength of fluctuations in the expression level of the mature RNA product. Finally, by investigating the effects of processing polymorphisms, we show that it is possible for the effects of transcriptional polymorphisms to be enhanced, reduced or even reversed. Our results provide a framework to understand the dynamics of RNA processing. (paper)

  17. Estradiol and ribosomal RNA in rooster liver

    NARCIS (Netherlands)

    Berg, Johannes Abel van den

    1975-01-01

    Het steroid hormoon 17-β-oestradiol zet de lever van een haan aan tot vorming van het eiwit vitellogenine, de precursoreiwit van de dooier fosfoproteinen fosvitine en lipoviteline. De in mijn experimenten gebruikte hoeveelheden van het hormoon geven aanleidlng tot een synthesesnelheid van de

  18. Deep Sequence Analysis of AgoshRNA Processing Reveals 3' A Addition and Trimming

    NARCIS (Netherlands)

    Harwig, Alex; Herrera-Carrillo, Elena; Jongejan, Aldo; van Kampen, Antonius Hubertus; Berkhout, Ben

    2015-01-01

    The RNA interference (RNAi) pathway, in which microprocessor and Dicer collaborate to process microRNAs (miRNA), was recently expanded by the description of alternative processing routes. In one of these noncanonical pathways, Dicer action is replaced by the Argonaute2 (Ago2) slicer function. It was

  19. Pre-mRNA Splicing in Plants: In Vivo Functions of RNA-Binding Proteins Implicated in the Splicing Process

    Directory of Open Access Journals (Sweden)

    Katja Meyer

    2015-07-01

    Full Text Available Alternative pre-messenger RNA splicing in higher plants emerges as an important layer of regulation upon exposure to exogenous and endogenous cues. Accordingly, mutants defective in RNA-binding proteins predicted to function in the splicing process show severe phenotypic alterations. Among those are developmental defects, impaired responses to pathogen threat or abiotic stress factors, and misregulation of the circadian timing system. A suite of splicing factors has been identified in the model plant Arabidopsis thaliana. Here we summarize recent insights on how defects in these splicing factors impair plant performance.

  20. Genome-wide polysomal analysis of a yeast strain with mutated ribosomal protein S9

    Directory of Open Access Journals (Sweden)

    Arava Yoav

    2007-08-01

    Full Text Available Abstract Background The yeast ribosomal protein S9 (S9 is located at the entrance tunnel of the mRNA into the ribosome. It is known to play a role in accurate decoding and its bacterial homolog (S4 has recently been shown to be involved in opening RNA duplexes. Here we examined the effects of changing the C terminus of S9, which is rich in acidic amino acids and extends out of the ribosome surface. Results We performed a genome-wide analysis to reveal effects at the transcription and translation levels of all yeast genes. While negligible relative changes were observed in steady-state mRNA levels, a significant number of mRNAs appeared to have altered ribosomal density. Notably, 40% of the genes having reliable signals changed their ribosomal association by more than one ribosome. Yet, no general correlations with physical or functional features of the mRNA were observed. Ribosome Density Mapping (RDM along four of the mRNAs with increased association revealed an increase in ribosomal density towards the end of the coding region for at least two of them. Read-through analysis did not reveal any increase in read-through of a premature stop codon by the mutant strain. Conclusion The ribosomal protein rpS9 appears to be involved in the translation of many mRNAs, since altering its C terminus led to a significant change in ribosomal association of many mRNAs. We did not find strong correlations between these changes and several physical features of the mRNA, yet future studies with advanced tools may allow such correlations to be determined. Importantly, our results indicate an accumulation of ribosomes towards the end of the coding regions of some mRNAs. This suggests an involvement of S9 in ribosomal dissociation during translation termination.

  1. The Potential of Targeting Ribosome Biogenesis in High-Grade Serous Ovarian Cancer

    Directory of Open Access Journals (Sweden)

    Shunfei Yan

    2017-01-01

    Full Text Available Overall survival for patients with ovarian cancer (OC has shown little improvement for decades meaning new therapeutic options are critical. OC comprises multiple histological subtypes, of which the most common and aggressive subtype is high-grade serous ovarian cancer (HGSOC. HGSOC is characterized by genomic structural variations with relatively few recurrent somatic mutations or dominantly acting oncogenes that can be targeted for the development of novel therapies. However, deregulation of pathways controlling homologous recombination (HR and ribosome biogenesis has been observed in a high proportion of HGSOC, raising the possibility that targeting these basic cellular processes may provide improved patient outcomes. The poly (ADP-ribose polymerase (PARP inhibitor olaparib has been approved to treat women with defects in HR due to germline BRCA mutations. Recent evidence demonstrated the efficacy of targeting ribosome biogenesis with the specific inhibitor of ribosomal RNA synthesis, CX-5461 in v-myc avian myelocytomatosis viral oncogene homolog (MYC-driven haematological and prostate cancers. CX-5461 has now progressed to a phase I clinical trial in patients with haematological malignancies and phase I/II trial in breast cancer. Here we review the currently available targeted therapies for HGSOC and discuss the potential of targeting ribosome biogenesis as a novel therapeutic approach against HGSOC.

  2. Seventeen copies of the human 37 kDa laminin receptor precursor/p40 ribosome-associated protein gene are processed pseudogenes arisen from retropositional events

    DEFF Research Database (Denmark)

    Jackers, P; Clausse, N; Fernandez, M

    1996-01-01

    A cDNA coding for a 37 kDa polypeptide has been identified in several species as both the potential precursor of the 67 kDa laminin receptor (37LRP) and a putative ribosome-associated protein (p40). Interestingly, increased expression of this polypeptide (37LRP/p40) is consistently observed...

  3. Initial bridges between two ribosomal subunits are formed within 9.4 milliseconds, as studied by time-resolved cryo-EM.

    Science.gov (United States)

    Shaikh, Tanvir R; Yassin, Aymen S; Lu, Zonghuan; Barnard, David; Meng, Xing; Lu, Toh-Ming; Wagenknecht, Terence; Agrawal, Rajendra K

    2014-07-08

    Association of the two ribosomal subunits during the process of translation initiation is a crucial step of protein synthesis. The two subunits (30S and 50S) of the bacterial 70S ribosome are held together by 12 dynamic bridges involving RNA-RNA, RNA-protein, and protein-protein interactions. The process of bridge formation, such as whether all these bridges are formed simultaneously or in a sequential order, is poorly understood. To understand such processes, we have developed and implemented a class of microfluidic devices that mix two components to completion within 0.4 ms and spray the mixture in the form of microdroplets onto an electron microscopy grid, yielding a minimum reaction time of 9.4 ms before cryofixation. Using these devices, we have obtained cryo-EM data corresponding to reaction times of 9.4 and 43 ms and have determined 3D structures of ribosomal subunit association intermediates. Molecular analyses of the cryo-EM maps reveal that eight intersubunit bridges (bridges B1a, B1b, B2a, B2b, B3, B7a, B7b, and B8) form within 9.4 ms, whereas the remaining four bridges (bridges B2c, B4, B5, and B6) take longer than 43 ms to form, suggesting that bridges are formed in a stepwise fashion. Our approach can be used to characterize sequences of various dynamic functional events on complex macromolecular assemblies such as ribosomes.

  4. Roles of Transcriptional and Translational Control Mechanisms in Regulation of Ribosomal Protein Synthesis in Escherichia coli.

    Science.gov (United States)

    Burgos, Hector L; O'Connor, Kevin; Sanchez-Vazquez, Patricia; Gourse, Richard L

    2017-11-01

    Bacterial ribosome biogenesis is tightly regulated to match nutritional conditions and to prevent formation of defective ribosomal particles. In Escherichia coli , most ribosomal protein (r-protein) synthesis is coordinated with rRNA synthesis by a translational feedback mechanism: when r-proteins exceed rRNAs, specific r-proteins bind to their own mRNAs and inhibit expression of the operon. It was recently discovered that the second messenger nucleotide guanosine tetra and pentaphosphate (ppGpp), which directly regulates rRNA promoters, is also capable of regulating many r-protein promoters. To examine the relative contributions of the translational and transcriptional control mechanisms to the regulation of r-protein synthesis, we devised a reporter system that enabled us to genetically separate the cis -acting sequences responsible for the two mechanisms and to quantify their relative contributions to regulation under the same conditions. We show that the synthesis of r-proteins from the S20 and S10 operons is regulated by ppGpp following shifts in nutritional conditions, but most of the effect of ppGpp required the 5' region of the r-protein mRNA containing the target site for translational feedback regulation and not the promoter. These results suggest that most regulation of the S20 and S10 operons by ppGpp following nutritional shifts is indirect and occurs in response to changes in rRNA synthesis. In contrast, we found that the promoters for the S20 operon were regulated during outgrowth, likely in response to increasing nucleoside triphosphate (NTP) levels. Thus, r-protein synthesis is dynamic, with different mechanisms acting at different times. IMPORTANCE Bacterial cells have evolved complex and seemingly redundant strategies to regulate many high-energy-consuming processes. In E. coli , synthesis of ribosomal components is tightly regulated with respect to nutritional conditions by mechanisms that act at both the transcription and translation steps. In

  5. Studies on the catalytic rate constant of ribosomal peptidyltransferase.

    Science.gov (United States)

    Synetos, D; Coutsogeorgopoulos, C

    1987-02-20

    A detailed kinetic analysis of a model reaction for the ribosomal peptidyltransferase is described, using fMet-tRNA or Ac-Phe-tRNA as the peptidyl donor and puromycin as the acceptor. The initiation complex (fMet-tRNA X AUG X 70 S ribosome) or (Ac-Phe-tRNA X poly(U) X 70 S ribosome) (complex C) is isolated and then reacted with excess puromycin (S) to give fMet-puromycin or Ac-Phe-puromycin. This reaction (puromycin reaction) is first order at all concentrations of S tested. An important asset of this kinetic analysis is the fact that the relationship between the first order rate constant kobs and [S] shows hyperbolic saturation and that the value of kobs at saturating [S] is a measure of the catalytic rate constant (k cat) of peptidyltransferase in the puromycin reaction. With fMet-tRNA as the donor, this kcat of peptidyltransferase is 8.3 min-1 when the 0.5 M NH4Cl ribosomal wash is present, compared to 3.8 min-1 in its absence. The kcat of peptidyltransferase is 2.0 min-1 when Ac-Phe-tRNA replaces fMet-tRNA in the presence of the ribosomal wash and decreases to 0.8 min-1 in its absence. This kinetic procedure is the best method available for evaluating changes in the activity of peptidyltransferase in vitro. The results suggest that peptidyltransferase is subjected to activation by the binding of fMet-tRNA to the 70 S initiation complex.

  6. Interaction of pleuromutilin derivatives with the ribosomal peptidyl transferase center

    DEFF Research Database (Denmark)

    Long, K. S.; Hansen, L. K.; Jakobsen, L.

    2006-01-01

    Tiamulin is a pleuromutilin antibiotic that is used in veterinary medicine. The recently published crystal structure of a tiamulin-50S ribosomal subunit complex provides detailed information about how this drug targets the peptidyl transferase center of the ribosome. To promote rational design...... mutant strain is resistant to tiamulin and pleuromutilin, but not valnemulin, implying that valnemulin is better able to withstand an altered rRNA binding surface around the mutilin core. This is likely due to additional interactions made between the valnemulin side chain extension and the rRNA binding...

  7. Deep Sequence Analysis of AgoshRNA Processing Reveals 3' A Addition and Trimming.

    Science.gov (United States)

    Harwig, Alex; Herrera-Carrillo, Elena; Jongejan, Aldo; van Kampen, Antonius Hubertus; Berkhout, Ben

    2015-07-14

    The RNA interference (RNAi) pathway, in which microprocessor and Dicer collaborate to process microRNAs (miRNA), was recently expanded by the description of alternative processing routes. In one of these noncanonical pathways, Dicer action is replaced by the Argonaute2 (Ago2) slicer function. It was recently shown that the stem-length of precursor-miRNA or short hairpin RNA (shRNA) molecules is a major determinant for Dicer versus Ago2 processing. Here we present the results of a deep sequence study on the processing of shRNAs with different stem length and a top G·U wobble base pair (bp). This analysis revealed some unexpected properties of these so-called AgoshRNA molecules that are processed by Ago2 instead of Dicer. First, we confirmed the gradual shift from Dicer to Ago2 processing upon shortening of the hairpin length. Second, hairpins with a stem larger than 19 base pair are inefficiently cleaved by Ago2 and we noticed a shift in the cleavage site. Third, the introduction of a top G·U bp in a regular shRNA can promote Ago2-cleavage, which coincides with a loss of Ago2-loading of the Dicer-cleaved 3' strand. Fourth, the Ago2-processed AgoshRNAs acquire a short 3' tail of 1-3 A-nucleotides (nt) and we present evidence that this product is subsequently trimmed by the poly(A)-specific ribonuclease (PARN).

  8. Ribosome-catalyzed formation of an abnormal peptide analogue

    International Nuclear Information System (INIS)

    Roesser, J.R.; Chorghade, M.S.; Hecht, S.M.

    1986-01-01

    The peptidyl-tRNA analogue N-(chloracetyl) phenylalanyl-tRNA/sup Phe/ was prepared by chemical aminoacylation and prebound to the P site of Escherichia coli ribosomes in response to poly(uridylic acid). Admixture of phenylalanyl-tRNA/sup Phe/ to the A site resulted in the formation of two dipeptides, one of which was found by displacement of chloride ion from the peptidyl-tRNA. This constitutes the first example of ribosome-mediated formation of a peptide of altered connectivity and suggests a need for revision of the current model of peptide bond formation. Also suggested by the present finding is the feasibility of utilizing tRNAs to prepare polypeptides of altered connectivity in an in vitro protein biosynthesizing system. [ 32 P]-oligo(rA), [ 3 H]- and [ 14 C] phenylalanines were used in the assay of the peptidye-tRNA analogue

  9. Pioglitazone enhances mitochondrial biogenesis and ribosomal protein biosynthesis in skeletal muscle in polycystic ovary syndrome

    DEFF Research Database (Denmark)

    Skov, Vibe; Glintborg, Dorte; Knudsen, Steen

    2008-01-01

    indicate that pioglitazone therapy restores insulin sensitivity, in part, by a coordinated upregulation of genes involved in mitochondrial OXPHOS and ribosomal protein biosynthesis in muscle in PCOS. These transcriptional effects of pioglitazone may contribute to prevent the onset of type 2 diabetes...... by changes in the transcriptional profile of muscle favoring insulin sensitivity. Using Affymetrix microarrays, we examined the effect of pioglitazone (30 mg/day for 16 weeks) on gene expression in skeletal muscle of 10 obese women with PCOS metabolically characterized by a euglycemic-hyperinsulinemic clamp...... Annotator and Pathway Profiler (GenMAPP 2.1) and Gene Set Enrichment Analysis (GSEA 2.0.1) revealed a significant upregulation of genes representing mitochondrial oxidative phosphorylation (OXPHOS), ribosomal proteins, mRNA processing reactome, translation factors, and proteasome degradation in PCOS after...

  10. An RNA-seq transcriptome analysis of histone modifiers and RNA silencing genes in soybean during floral initiation process.

    Directory of Open Access Journals (Sweden)

    Lim Chee Liew

    Full Text Available Epigenetics has been recognised to play vital roles in many plant developmental processes, including floral initiation through the epigenetic regulation of gene expression. The histone modifying proteins that mediate these modifications involve the SET domain-containing histone methyltransferases, JmjC domain-containing demethylase, acetylases and deacetylases. In addition, RNA interference (RNAi-associated genes are also involved in epigenetic regulation via RNA-directed DNA methylation and post-transcriptional gene silencing. Soybean, a major crop legume, requires a short day to induce flowering. How histone modifications regulate the plant response to external cues that initiate flowering is still largely unknown. Here, we used RNA-seq to address the dynamics of transcripts that are potentially involved in the epigenetic programming and RNAi mediated gene silencing during the floral initiation of soybean. Soybean is a paleopolyploid that has been subjected to at least two rounds of whole genome duplication events. We report that the expanded genomic repertoire of histone modifiers and RNA silencing genes in soybean includes 14 histone acetyltransferases, 24 histone deacetylases, 47 histone methyltransferases, 15 protein arginine methyltransferases, 24 JmjC domain-containing demethylases and 47 RNAi-associated genes. To investigate the role of these histone modifiers and RNA silencing genes during floral initiation, we compared the transcriptional dynamics of the leaf and shoot apical meristem at different time points after a short-day treatment. Our data reveal that the extensive activation of genes that are usually involved in the epigenetic programming and RNAi gene silencing in the soybean shoot apical meristem are reprogrammed for floral development following an exposure to inductive conditions.

  11. Control of Ribosome Synthesis in Escherichia coli

    DEFF Research Database (Denmark)

    Molin, Søren; Meyenburg, K. von; Måløe, O.

    1977-01-01

    The rate of ribosome synthesis and accumulation in Escherichia coli during the transition after an energy source shift-down was analyzed. The shift was imposed on cultures of stringent and relaxed strains growing in glucose minimal medium by the addition of the glucose analogue {alpha...... and to estimate the transcription time for the rRNA operon under different conditions. In steady states of growth with growth rates ranging from 0.75 to 2.3 doublings/h, as well as during the transition after a shift-down, the transcription time of the rRNA operon was constant. The rate of synthesis of r......RNA correlated during this transition – in contrast to the rate of accumulation (M. T. Hansen et al., J. Bacteriol. 122: 585-591, 1975) – with the ppGpp pool in the same way as has been observed during partial amino acid starvation....

  12. Genetic interactions of MAF1 identify a role for Med20 in transcriptional repression of ribosomal protein genes.

    Directory of Open Access Journals (Sweden)

    Ian M Willis

    2008-07-01

    Full Text Available Transcriptional repression of ribosomal components and tRNAs is coordinately regulated in response to a wide variety of environmental stresses. Part of this response involves the convergence of different nutritional and stress signaling pathways on Maf1, a protein that is essential for repressing transcription by RNA polymerase (pol III in Saccharomyces cerevisiae. Here we identify the functions buffering yeast cells that are unable to down-regulate transcription by RNA pol III. MAF1 genetic interactions identified in screens of non-essential gene-deletions and conditionally expressed essential genes reveal a highly interconnected network of 64 genes involved in ribosome biogenesis, RNA pol II transcription, tRNA modification, ubiquitin-dependent proteolysis and other processes. A survey of non-essential MAF1 synthetic sick/lethal (SSL genes identified six gene-deletions that are defective in transcriptional repression of ribosomal protein (RP genes following rapamycin treatment. This subset of MAF1 SSL genes included MED20 which encodes a head module subunit of the RNA pol II Mediator complex. Genetic interactions between MAF1 and subunits in each structural module of Mediator were investigated to examine the functional relationship between these transcriptional regulators. Gene expression profiling identified a prominent and highly selective role for Med20 in the repression of RP gene transcription under multiple conditions. In addition, attenuated repression of RP genes by rapamycin was observed in a strain deleted for the Mediator tail module subunit Med16. The data suggest that Mediator and Maf1 function in parallel pathways to negatively regulate RP mRNA and tRNA synthesis.

  13. The effect of tRNA levels on decoding times of mRNA codons.

    Science.gov (United States)

    Dana, Alexandra; Tuller, Tamir

    2014-08-01

    The possible effect of transfer ribonucleic acid (tRNA) concentrations on codons decoding time is a fundamental biomedical research question; however, due to a large number of variables affecting this process and the non-direct relation between them, a conclusive answer to this question has eluded so far researchers in the field. In this study, we perform a novel analysis of the ribosome profiling data of four organisms which enables ranking the decoding times of different codons while filtering translational phenomena such as experimental biases, extreme ribosomal pauses and ribosome traffic jams. Based on this filtering, we show for the first time that there is a significant correlation between tRNA concentrations and the codons estimated decoding time both in prokaryotes and in eukaryotes in natural conditions (-0.38 to -0.66, all P values decoding times are not correlated with aminoacyl-tRNA levels. The reported results support the conjecture that translation efficiency is directly influenced by the tRNA levels in the cell. Thus, they should help to understand the evolution of synonymous aspects of coding sequences via the adaptation of their codons to the tRNA pool. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  14. Therapeutic dosages of aspirin counteract the IL-6 induced pro-tumorigenic effects by slowing down the ribosome biogenesis rate

    Science.gov (United States)

    Brighenti, Elisa; Giannone, Ferdinando Antonino; Fornari, Francesca; Onofrillo, Carmine; Govoni, Marzia; Montanaro, Lorenzo; Treré, Davide; Derenzini, Massimo

    2016-01-01

    Chronic inflammation is a risk factor for the onset of cancer and the regular use of aspirin reduces the risk of cancer development. Here we showed that therapeutic dosages of aspirin counteract the pro-tumorigenic effects of the inflammatory cytokine interleukin(IL)-6 in cancer and non-cancer cell lines, and in mouse liver in vivo. We found that therapeutic dosages of aspirin prevented IL-6 from inducing the down-regulation of p53 expression and the acquisition of the epithelial mesenchymal transition (EMT) phenotypic changes in the cell lines. This was the result of a reduction in c-Myc mRNA transcription which was responsible for a down-regulation of the ribosomal protein S6 expression which, in turn, slowed down the rRNA maturation process, thus reducing the ribosome biogenesis rate. The perturbation of ribosome biogenesis hindered the Mdm2-mediated proteasomal degradation of p53, throughout the ribosomal protein-Mdm2-p53 pathway. P53 stabilization hindered the IL-6 induction of the EMT changes. The same effects were observed in livers from mice stimulated with IL-6 and treated with aspirin. It is worth noting that aspirin down-regulated ribosome biogenesis, stabilized p53 and up-regulated E-cadherin expression in unstimulated control cells also. In conclusion, these data showed that therapeutic dosages of aspirin increase the p53-mediated tumor-suppressor activity of the cells thus being in this way able to reduce the risk of cancer onset, either or not linked to chronic inflammatory processes. PMID:27557515

  15. Therapeutic dosages of aspirin counteract the IL-6 induced pro-tumorigenic effects by slowing down the ribosome biogenesis rate.

    Science.gov (United States)

    Brighenti, Elisa; Giannone, Ferdinando Antonino; Fornari, Francesca; Onofrillo, Carmine; Govoni, Marzia; Montanaro, Lorenzo; Treré, Davide; Derenzini, Massimo

    2016-09-27

    Chronic inflammation is a risk factor for the onset of cancer and the regular use of aspirin reduces the risk of cancer development. Here we showed that therapeutic dosages of aspirin counteract the pro-tumorigenic effects of the inflammatory cytokine interleukin(IL)-6 in cancer and non-cancer cell lines, and in mouse liver in vivo. We found that therapeutic dosages of aspirin prevented IL-6 from inducing the down-regulation of p53 expression and the acquisition of the epithelial mesenchymal transition (EMT) phenotypic changes in the cell lines. This was the result of a reduction in c-Myc mRNA transcription which was responsible for a down-regulation of the ribosomal protein S6 expression which, in turn, slowed down the rRNA maturation process, thus reducing the ribosome biogenesis rate. The perturbation of ribosome biogenesis hindered the Mdm2-mediated proteasomal degradation of p53, throughout the ribosomal protein-Mdm2-p53 pathway. P53 stabilization hindered the IL-6 induction of the EMT changes. The same effects were observed in livers from mice stimulated with IL-6 and treated with aspirin. It is worth noting that aspirin down-regulated ribosome biogenesis, stabilized p53 and up-regulated E-cadherin expression in unstimulated control cells also. In conclusion, these data showed that therapeutic dosages of aspirin increase the p53-mediated tumor-suppressor activity of the cells thus being in this way able to reduce the risk of cancer onset, either or not linked to chronic inflammatory processes.

  16. Noncoding Subgenomic Flavivirus RNA Is Processed by the Mosquito RNA Interference Machinery and Determines West Nile Virus Transmission by Culex pipiens Mosquitoes.

    Science.gov (United States)

    Göertz, G P; Fros, J J; Miesen, P; Vogels, C B F; van der Bent, M L; Geertsema, C; Koenraadt, C J M; van Rij, R P; van Oers, M M; Pijlman, G P

    2016-11-15

    cycle is important to identify novel targets to interfere with disease and to aid development of virus control strategies. Flaviviruses produce an abundant noncoding viral RNA called sfRNA in both arthropod and mammalian cells. To evaluate the role of sfRNA in flavivirus transmission, we infected mosquitoes with the flavivirus West Nile virus and an sfRNA-deficient mutant West Nile virus. We demonstrate that sfRNA determines the infection and transmission rates of West Nile virus in Culex pipiens mosquitoes. Comparison of infection via the blood meal versus intrathoracic injection, which bypasses the midgut, revealed that sfRNA is important to overcome the mosquito midgut barrier. We also show that sfRNA is processed by the antiviral RNA interference machinery in mosquitoes. This is the first report to describe a pivotal biological function of sfRNA in arthropods. The results explain why sfRNA production is evolutionarily conserved. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  17. Integrating ribosomal promoter vectors that offer a choice of constitutive expression profiles in Leishmania donovani.

    Science.gov (United States)

    Soysa, Radika; Tran, Khoa D; Ullman, Buddy; Yates, Phillip A

    2015-12-01

    We have designed a novel series of integrating ribosomal RNA promoter vectors with five incrementally different constitutive expression profiles, covering a 250-fold range. Differential expression was achieved by placing different combinations of synthetic or leishmanial DNA sequences upstream and downstream of the transgene coding sequence in order to modulate pre-mRNA processing efficiency and mRNA stability, respectively. All of the vectors have extensive multiple cloning sites, and versions are available for producing N- or C- terminal GFP fusions at each of the possible relative expression levels. In addition, the modular configuration of the vectors allows drug resistance cassettes and other components to be readily exchanged. In toto, these vectors should be useful additions to the toolkit available for molecular and genetic studies of Leishmania donovani. Copyright © 2016 Elsevier B.V. All rights reserved.

  18. Yeast ribosomal proteins

    International Nuclear Information System (INIS)

    Otaka, E.; Kobata, K.

    1978-01-01

    The cytoplasmic 80s ribosomal proteins from the cells of yeast Saccharomyces cerevisiae were analyzed by SDS two-dimensional polyacrylamide gel electrophoresis. Seventyfour proteins were identified and consecutively numbered from 1 to 74. Upon oxidation of the 80s proteins with performic acid, ten proteins (no. 15, 20, 35, 40, 44, 46, 49, 51, 54 and 55) were dislocated on the gel without change of the total number of protein spots. Five proteins (no. 8, 14, 16, 36 and 74) were phosphorylated in vivo as seen in 32 P-labelling experiments. The large and small subunits separated in low magnesium medium were analyzed by the above gel electrophoresis. At least forty-five and twenty-eight proteins were assumed to be in the large and small subunits, respectively. All proteins found in the 80s ribosomes, except for no. 3, were detected in either subunit without appearance of new spots. The acidic protein no. 3 seems to be lost during subunit dissociation. (orig.) [de

  19. Finding Order in Randomness: Single-Molecule Studies Reveal Stochastic RNA Processing | Center for Cancer Research

    Science.gov (United States)

    Producing a functional eukaryotic messenger RNA (mRNA) requires the coordinated activity of several large protein complexes to initiate transcription, elongate nascent transcripts, splice together exons, and cleave and polyadenylate the 3’ end. Kinetic competition between these various processes has been proposed to regulate mRNA maturation, but this model could lead to multiple, randomly determined, or stochastic, pathways or outcomes. Regulatory checkpoints have been suggested as a means of ensuring quality control. However, current methods have been unable to tease apart the contributions of these processes at a single gene or on a time scale that could provide mechanistic insight. To begin to investigate the kinetic relationship between transcription and splicing, Daniel Larson, Ph.D., of CCR’s Laboratory of Receptor Biology and Gene Expression, and his colleagues employed a single-molecule RNA imaging approach to monitor production and processing of a human β-globin reporter gene in living cells.

  20. Architecture of the E.coli 70S ribosome

    DEFF Research Database (Denmark)

    Burkhardt, N.; Diedrich, G.; Nierhaus, K.H.

    1997-01-01

    The 70S ribosome from E.coli was analysed by neutron scattering focusing on the shape and the internal protein-RNA-distribution of the complex. Measurements on selectively deuterated 70S particles and free 30S and 50S subunits applying conventional contrast variation and proton-spin contrast...

  1. Nuclei of aged myofibres undergo structural and functional changes suggesting impairment in RNA processing

    Directory of Open Access Journals (Sweden)

    C Pellicciari

    2009-06-01

    Full Text Available Advancing adult age is associated with a progressive decrease in skeletal muscle mass, strength and quality known as sarcopenia. The mechanisms underlying age-related skeletal muscle wasting and weakness are manifold and still remain to be fully elucidated. Despite the increasing evidence that the progress of muscle diseases leading to muscle atrophy/dystrophy may be related to defective RNA processing, no data on the morpho-functional features of skeletal muscle nuclei in sarcopenia are available at present. In this view, we have investigated, by combining morphometry and immunocytochemistry at light and electron microscopy, the fine structure of myonuclei as well as the distribution and amount of RNA processing factors in skeletal myofibres of biceps brachii and quadriceps femoris from adult and old rats. Results demonstrate that the myonuclei of aged type II fibres show an increased amount of condensed chromatin and lower amounts of phosphorylated polymerase II and DNA/RNA hybrid molecules, clearly indicating a decrease in pre-mRNA transcription rate compared to adult animals. In addition, myonuclei of aged fibres show decreased amounts of nucleoplasmic splicing factors and an accumulation of cleavage factors, polyadenilated RNA and perichromatin granules, suggesting a reduction in the processing and transport rate of premRNA. During ageing, it seems therefore that in rat myonuclei the entire production chain of mRNA, from synthesis to cytoplasmic export, is less efficient. This failure likely contributes to the reduced responsiveness of muscle cells to anabolic stimuli in the elderly.

  2. Chloroplast RNA-Binding Protein RBD1 Promotes Chilling Tolerance through 23S rRNA Processing in Arabidopsis.

    Directory of Open Access Journals (Sweden)

    Shuai Wang

    2016-05-01

    Full Text Available Plants have varying abilities to tolerate chilling (low but not freezing temperatures, and it is largely unknown how plants such as Arabidopsis thaliana achieve chilling tolerance. Here, we describe a genome-wide screen for genes important for chilling tolerance by their putative knockout mutants in Arabidopsis thaliana. Out of 11,000 T-DNA insertion mutant lines representing half of the genome, 54 lines associated with disruption of 49 genes had a drastic chilling sensitive phenotype. Sixteen of these genes encode proteins with chloroplast localization, suggesting a critical role of chloroplast function in chilling tolerance. Study of one of these proteins RBD1 with an RNA binding domain further reveals the importance of chloroplast translation in chilling tolerance. RBD1 is expressed in the green tissues and is localized in the chloroplast nucleoid. It binds directly to 23S rRNA and the binding is stronger under chilling than at normal growth temperatures. The rbd1 mutants are defective in generating mature 23S rRNAs and deficient in chloroplast protein synthesis especially under chilling conditions. Together, our study identifies RBD1 as a regulator of 23S rRNA processing and reveals the importance of chloroplast function especially protein translation in chilling tolerance.

  3. Regulation of photosensitisation processes by an RNA aptamer

    Science.gov (United States)

    Thoa, Tran Thi Thanh; Minagawa, Noriko; Aigaki, Toshiro; Ito, Yoshihiro; Uzawa, Takanori

    2017-02-01

    One of the most powerful attributes of proteins is their ability to bind to and modulate the chemistry of cofactors and prosthetic groups. Here, we demonstrated the ability of an artificial nucleic acid (an aptamer) to similarly control the functionality of a non-biological element. Specifically, we selected an RNA aptamer that binds tris(bipyridine) ruthenium (II), Ru(bpy)32+, an inorganic complex that has attracted intense interest due to its photoredox chemistry, including its ability to split water by visible light. We found that a newly discovered aptamer strongly and enantioselectively binds Λ-Ru(bpy)32+ (Kd = 65 nM) and, in doing so, selectively suppresses deactivation via energy transfer, thereby elongating the lifetime of its photo-excited state by four-fold. The ability of the aptamer to enhance this important aspect of Ru(bpy)32+ chemistry illustrates a broader point concerning the potential power of combining in vitro-created biomolecules with non-biological reactants to perform enhanced chemical reactions.

  4. Reconstruction of phylogenetic relationships in dermatomycete genus Trichophyton Malmsten 1848 based on ribosomal internal transcribed spacer region, partial 28S rRNA and beta-tubulin genes sequences.

    Science.gov (United States)

    Pchelin, Ivan M; Zlatogursky, Vasily V; Rudneva, Mariya V; Chilina, Galina A; Rezaei-Matehkolaei, Ali; Lavnikevich, Dmitry M; Vasilyeva, Natalya V; Taraskina, Anastasia E

    2016-09-01

    Trichophyton spp. are important causative agents of superficial mycoses. The phylogeny of the genus and accurate strain identification, based on the ribosomal ITS region sequencing, are still under development. The present work is aimed at (i) inferring the genus phylogeny from partial ITS, LSU and BT2 sequences (ii) description of ribosomal ITS region polymorphism in 15 strains of Trichophyton interdigitale. We performed DNA sequence-based species identification and phylogenetic analysis on 48 strains belonging to the genus Trichophyton. Phylogenetic relationships were inferred by maximum likelihood and Bayesian methods on concatenated ITS, LSU and BT2 sequences. Ribosomal ITS region polymorphisms were assessed directly on the alignment. By phylogenetic reconstruction, we reveal major anthropophilic and zoophilic species clusters in the genus Trichophyton. We describe several sequences of the ITS region of T. interdigitale, which do not fit in the traditional polymorphism scheme and propose emendations in this scheme for discrimination between ITS sequence types in T. interdigitale. The new polymorphism scheme will allow inclusion of a wider spectrum of isolates while retaining its explanatory power. This scheme was also found to be partially congruent with NTS typing technique. © 2016 Blackwell Verlag GmbH.

  5. Structure based hypothesis of a mitochondrial ribosome rescue mechanism

    Directory of Open Access Journals (Sweden)

    Huynen Martijn A

    2012-05-01

    Full Text Available Abstract Background mtRF1 is a vertebrate mitochondrial protein with an unknown function that arose from a duplication of the mitochondrial release factor mtRF1a. To elucidate the function of mtRF1, we determined the positions that are conserved among mtRF1 sequences but that are different in their mtRF1a paralogs. We subsequently modeled the 3D structure of mtRF1a and mtRF1 bound to the ribosome, highlighting the structural implications of these differences to derive a hypothesis for the function of mtRF1. Results Our model predicts, in agreement with the experimental data, that the 3D structure of mtRF1a allows it to recognize the stop codons UAA and UAG in the A-site of the ribosome. In contrast, we show that mtRF1 likely can only bind the ribosome when the A-site is devoid of mRNA. Furthermore, while mtRF1a will adopt its catalytic conformation, in which it functions as a peptidyl-tRNA hydrolase in the ribosome, only upon binding of a stop codon in the A-site, mtRF1 appears specifically adapted to assume this extended, peptidyl-tRNA hydrolyzing conformation in the absence of mRNA in the A-site. Conclusions We predict that mtRF1 specifically recognizes ribosomes with an empty A-site and is able to function as a peptidyl-tRNA hydrolase in those situations. Stalled ribosomes with empty A-sites that still contain a tRNA bound to a peptide chain can result from the translation of truncated, stop-codon less mRNAs. We hypothesize that mtRF1 recycles such stalled ribosomes, performing a function that is analogous to that of tmRNA in bacteria. Reviewers This article was reviewed by Dr. Eugene Koonin, Prof. Knud H. Nierhaus (nominated by Dr. Sarah Teichmann and Dr. Shamil Sunyaev.

  6. gamma. radiation effect on the functional properties of the cotton ribosomes

    Energy Technology Data Exchange (ETDEWEB)

    Ibragimov, A P; Safarov, Sh

    1973-01-01

    A study is made of the action of radiation on the functional properties of ribosomes in irradiated organisms and on isolated ribosomes exposed to different doses. With increase in dose there occurs a reduction in the incorporation of labelled amino acids by the ribosomes released from irradiated sprouts and also during irradiation of isolated ribosomes. The study covered the functional activity of ribosomes irradiated at different doses with the use of synthetic poly-U and poly-A matrices synthesizing polyphenylalanine and polylysine, depending on the irradiation dose. The inhibition of the activity of the protein synthesis system at high doses is due to structural and functional changes in ribosomes and also to disturbance in the biosynthesis and functions of the messenger RNA.

  7. Senescent changes in the ribosomes of animal cells in vivo and in vitro

    Science.gov (United States)

    Miquel, J.; Johnson, J. E., Jr.

    1979-01-01

    The paper examines RNA-ribosomal changes observed in protozoa and fixed postmitotic cells, as well as the characteristics of intermitotic cells. Attention is given to a discussion of the implications of the reported ribosomal changes as to the senescent deterioration of protein synthesis and physiological functions. A survey of the literature suggests that, while the data on ribosomal change in dividing cells both in vivo and in vitro are inconclusive, there is strong histological and biochemical evidence in favor of some degree of quantitative ribosomal loss in fixed postmitotic cells. Since these decreases in ribosomes are demonstrated in differential cells from nematodes, insects and mammals, they may represent a universal manifestation of cytoplasmic senescence in certain types of fixed postmitotic animal cells. The observed variability in ribosomal loss for cells belonging to the same type suggests that this involution phenomenon is rather related to the wear and tear suffered by a particular cell.

  8. Control of ribosome traffic by position-dependent choice of synonymous codons

    International Nuclear Information System (INIS)

    Mitarai, Namiko; Pedersen, Steen

    2013-01-01

    Messenger RNA (mRNA) encodes a sequence of amino acids by using codons. For most amino acids, there are multiple synonymous codons that can encode the amino acid. The translation speed can vary from one codon to another, thus there is room for changing the ribosome speed while keeping the amino acid sequence and hence the resulting protein. Recently, it has been noticed that the choice of the synonymous codon, via the resulting distribution of slow- and fast-translated codons, affects not only on the average speed of one ribosome translating the mRNA but also might have an effect on nearby ribosomes by affecting the appearance of ‘traffic jams’ where multiple ribosomes collide and form queues. To test this ‘context effect’ further, we here investigate the effect of the sequence of synonymous codons on the ribosome traffic by using a ribosome traffic model with codon-dependent rates, estimated from experiments. We compare the ribosome traffic on wild-type (WT) sequences and sequences where the synonymous codons were swapped randomly. By simulating translation of 87 genes, we demonstrate that the WT sequences, especially those with a high bias in codon usage, tend to have the ability to reduce ribosome collisions, hence optimizing the cellular investment in the translation apparatus. The magnitude of such reduction of the translation time might have a significant impact on the cellular growth rate and thereby have importance for the survival of the species. (paper)

  9. A conserved chloramphenicol binding site at the entrance to the ribosomal peptide exit tunnel

    DEFF Research Database (Denmark)

    Long, Katherine S; Porse, Bo T

    2003-01-01

    , of E.coli 23S rRNA and G2084 (2058 in E.coli numbering) in domain V of H.halobium 23S rRNA. The modification sites overlap with a portion of the macrolide binding site and cluster at the entrance to the peptide exit tunnel. The data correlate with the recently reported chloramphenicol binding site...... on an archaeal ribosome and suggest that a similar binding site is present on the E.coli ribosome....

  10. A new version of the RDP (Ribosomal Database Project)

    Science.gov (United States)

    Maidak, B. L.; Cole, J. R.; Parker, C. T. Jr; Garrity, G. M.; Larsen, N.; Li, B.; Lilburn, T. G.; McCaughey, M. J.; Olsen, G. J.; Overbeek, R.; hide

    1999-01-01

    The Ribosomal Database Project (RDP-II), previously described by Maidak et al. [ Nucleic Acids Res. (1997), 25, 109-111], is now hosted by the Center for Microbial Ecology at Michigan State University. RDP-II is a curated database that offers ribosomal RNA (rRNA) nucleotide sequence data in aligned and unaligned forms, analysis services, and associated computer programs. During the past two years, data alignments have been updated and now include >9700 small subunit rRNA sequences. The recent development of an ObjectStore database will provide more rapid updating of data, better data accuracy and increased user access. RDP-II includes phylogenetically ordered alignments of rRNA sequences, derived phylogenetic trees, rRNA secondary structure diagrams, and various software programs for handling, analyzing and displaying alignments and trees. The data are available via anonymous ftp (ftp.cme.msu. edu) and WWW (http://www.cme.msu.edu/RDP). The WWW server provides ribosomal probe checking, approximate phylogenetic placement of user-submitted sequences, screening for possible chimeric rRNA sequences, automated alignment, and a suggested placement of an unknown sequence on an existing phylogenetic tree. Additional utilities also exist at RDP-II, including distance matrix, T-RFLP, and a Java-based viewer of the phylogenetic trees that can be used to create subtrees.

  11. Inhibition of Escherichia coli precursor-16S rRNA processing by mouse intestinal contents

    DEFF Research Database (Denmark)

    Licht, Tine Rask; Tolker-Nielsen, Tim; Holmstrøm, Kim

    1999-01-01

    . We have applied fluorescence in situ hybridization of pre-16S rRNA to Escherichia coli cells growing in vitro in extracts from two different compartments of the mouse intestine: the caecal mucus layer, where E. coli grew rapidly, and the contents of the caecum, which supported much slower bacterial...... content of pre-16S rRNA than cultures of the same strain growing rapidly in rich media. We present results suggesting that the mouse intestinal contents contain an agent that inhibits the growth of E. coli by disturbing its ability to process pre-16S rRNA....

  12. Deep Sequence Analysis of AgoshRNA Processing Reveals 3’ A Addition and Trimming

    Directory of Open Access Journals (Sweden)

    Alex Harwig

    2015-01-01

    Full Text Available The RNA interference (RNAi pathway, in which microprocessor and Dicer collaborate to process microRNAs (miRNA, was recently expanded by the description of alternative processing routes. In one of these noncanonical pathways, Dicer action is replaced by the Argonaute2 (Ago2 slicer function. It was recently shown that the stem-length of precursor-miRNA or short hairpin RNA (shRNA molecules is a major determinant for Dicer versus Ago2 processing. Here we present the results of a deep sequence study on the processing of shRNAs with different stem length and a top G·U wobble base pair (bp. This analysis revealed some unexpected properties of these so-called AgoshRNA molecules that are processed by Ago2 instead of Dicer. First, we confirmed the gradual shift from Dicer to Ago2 processing upon shortening of the hairpin length. Second, hairpins with a stem larger than 19 base pair are inefficiently cleaved by Ago2 and we noticed a shift in the cleavage site. Third, the introduction of a top G·U bp in a regular shRNA can promote Ago2-cleavage, which coincides with a loss of Ago2-loading of the Dicer-cleaved 3’ strand. Fourth, the Ago2-processed AgoshRNAs acquire a short 3’ tail of 1–3 A-nucleotides (nt and we present evidence that this product is subsequently trimmed by the poly(A-specific ribonuclease (PARN.

  13. Binding site of ribosomal proteins on prokaryotic 5S ribonucleic acids: a study with ribonucleases

    DEFF Research Database (Denmark)

    Douthwaite, S; Christensen, A; Garrett, R A

    1982-01-01

    The binding sites of ribosomal proteins L18 and L25 on 5S RNA from Escherichia coli were probed with ribonucleases A, T1, and T2 and a double helix specific cobra venom endonuclease. The results for the protein-RNA complexes, which were compared with those for the free RNA [Douthwaite, S...... stearothermophilus 5S RNA. Several protein-induced changes in the RNA structures were identified; some are possibly allosteric in nature. The two prokaryotic 5S RNAs were also incubated with total 50S subunit proteins from E. coli and B. stearothermophilus ribosomes. Homologous and heterologous reconstitution....... stearothermophilus 5S RNA, which may have been due to a third ribosomal protein L5....

  14. Plasma processing conditions substantially influence circulating microRNA biomarker levels.

    Science.gov (United States)

    Cheng, Heather H; Yi, Hye Son; Kim, Yeonju; Kroh, Evan M; Chien, Jason W; Eaton, Keith D; Goodman, Marc T; Tait, Jonathan F; Tewari, Muneesh; Pritchard, Colin C

    2013-01-01

    Circulating, cell-free microRNAs (miRNAs) are promising candidate biomarkers, but optimal conditions for processing blood specimens for miRNA measurement remain to be established. Our previous work showed that the majority of plasma miRNAs are likely blood cell-derived. In the course of profiling lung cancer cases versus healthy controls, we observed a broad increase in circulating miRNA levels in cases compared to controls and that higher miRNA expression correlated with higher platelet and particle counts. We therefore hypothesized that the quantity of residual platelets and microparticles remaining after plasma processing might impact miRNA measurements. To systematically investigate this, we subjected matched plasma from healthy individuals to stepwise processing with differential centrifugation and 0.22 µm filtration and performed miRNA profiling. We found a major effect on circulating miRNAs, with the majority (72%) of detectable miRNAs substantially affected by processing alone. Specifically, 10% of miRNAs showed 4-30x variation, 46% showed 30-1,000x variation, and 15% showed >1,000x variation in expression solely from processing. This was predominantly due to platelet contamination, which persisted despite using standard laboratory protocols. Importantly, we show that platelet contamination in archived samples could largely be eliminated by additional centrifugation, even in frozen samples stored for six years. To minimize confounding effects in microRNA biomarker studies, additional steps to limit platelet contamination for circulating miRNA biomarker studies are necessary. We provide specific practical recommendations to help minimize confounding variation attributable to plasma processing and platelet contamination.

  15. Origins of the plant chloroplasts and mitochondria based on comparisons of 5S ribosomal RNAs

    Science.gov (United States)

    Delihas, N.; Fox, G. E.

    1987-01-01

    In this paper, we provide macromolecular comparisons utilizing the 5S ribosomal RNA structure to suggest extant bacteria that are the likely descendants of chloroplast and mitochondria endosymbionts. The genetic stability and near universality of the 5S ribosomal gene allows for a useful means to study ancient evolutionary changes by macromolecular comparisons. The value in current and future ribosomal RNA comparisons is in fine tuning the assignment of ancestors to the organelles and in establishing extant species likely to be descendants of bacteria involved in presumed multiple endosymbiotic events.

  16. Trans-acting translational regulatory RNA binding proteins.

    Science.gov (United States)

    Harvey, Robert F; Smith, Tom S; Mulroney, Thomas; Queiroz, Rayner M L; Pizzinga, Mariavittoria; Dezi, Veronica; Villenueva, Eneko; Ramakrishna, Manasa; Lilley, Kathryn S; Willis, Anne E

    2018-05-01

    The canonical molecular machinery required for global mRNA translation and its control has been well defined, with distinct sets of proteins involved in the processes of translation initiation, elongation and termination. Additionally, noncanonical, trans-acting regulatory RNA-binding proteins (RBPs) are necessary to provide mRNA-specific translation, and these interact with 5' and 3' untranslated regions and coding regions of mRNA to regulate ribosome recruitment and transit. Recently it has also been demonstrated that trans-acting ribosomal proteins direct the translation of specific mRNAs. Importantly, it has been shown that subsets of RBPs often work in concert, forming distinct regulatory complexes upon different cellular perturbation, creating an RBP combinatorial code, which through the translation of specific subsets of mRNAs, dictate cell fate. With the development of new methodologies, a plethora of novel RNA binding proteins have recently been identified, although the function of many of these proteins within mRNA translation is unknown. In this review we will discuss these methodologies and their shortcomings when applied to the study of translation, which need to be addressed to enable a better understanding of trans-acting translational regulatory proteins. Moreover, we discuss the protein domains that are responsible for RNA binding as well as the RNA motifs to which they bind, and the role of trans-acting ribosomal proteins in directing the translation of specific mRNAs. This article is categorized under: RNA Interactions with Proteins and Other Molecules > RNA-Protein Complexes Translation > Translation Regulation Translation > Translation Mechanisms. © 2018 Medical Research Council and University of Cambridge. WIREs RNA published by Wiley Periodicals, Inc.

  17. Eukaryotic 5S rRNA biogenesis

    Science.gov (United States)

    Ciganda, Martin; Williams, Noreen

    2012-01-01

    The ribosome is a large complex containing both protein and RNA which must be assembled in a precise manner to allow proper functioning in the critical role of protein synthesis. 5S rRNA is the smallest of the RNA components of the ribosome, and although it has been studied for decades, we still do not have a clear understanding of its function within the complex ribosome machine. It is the only RNA species that binds ribosomal proteins prior to its assembly into the ribosome. Its transport into the nucleolus requires this interaction. Here we present an overview of some of the key findings concerning the structure and function of 5S rRNA and how its association with specific proteins impacts its localization and function. PMID:21957041

  18. Utilización del patrón de restricción del DNA codificante para el RNA Ribosomal de la subunidad pequeña para la caracterización de Apicomplexa

    OpenAIRE

    López Adelaida; Carvajal Humberto; Royero Nelson

    1996-01-01

    Los Apicomplexos constituyen un phylum de protozoarios que se caracterizan por ser parásitos obligados de una gran variedad de huéspedes vertebrados e invertebrados. Hoy en día hay fuertes polémicas en tomo a su clasificación taxonómica, sus relaciones filogenéticas, y los patrones de coevolución con sus hospederos. El gen que codifica para el ARN ribosomal de la subunidad pequeña (ARN-SURp) se utiliza como marcador molecular para resolver estas inquietudes. A partir del ADN de las especies d...

  19. Ribonucleoprotein organization of eukaryotic RNA. XXXII. U2 small nuclear RNA precursors and their accurate 3' processing in vitro as ribonucleoprotein particles.

    Science.gov (United States)

    Wieben, E D; Nenninger, J M; Pederson, T

    1985-05-05

    Biosynthetic precursors of U2 small nuclear RNA have been identified in cultured human cells by hybrid-selection of pulse-labeled RNA with cloned U2 DNA. These precursor molecules are one to approximately 16 nucleotides longer than mature U2 RNA and contain 2,2,7-trimethylguanosine "caps". The U2 RNA precursors are associated with proteins that react with a monoclonal antibody for antigens characteristic of small nuclear ribonucleoprotein particles. Like previously described precursors of U1 and U4 small nuclear RNAs, the pre-U2 RNAs are recovered in cytoplasmic fractions, although it is not known if this is their location in vivo. The precursors are processed to mature-size U2 RNA when cytoplasmic extracts are incubated in vitro at 37 degrees C. Mg2+ is required but ATP is not. The ribonucleoprotein structure of the pre-U2 RNA is maintained during the processing reaction in vitro, as are the 2,2,7-trimethylguanosine caps. The ribonucleoprotein organization is of major importance, as exogenous, protein-free U2 RNA precursors are degraded rapidly in the in vitro system. Two lines of evidence indicate that the conversion of U2 precursors to mature-size U2 RNA involves a 3' processing reaction. First, the reaction is unaffected by a large excess of mature U2 small nuclear RNP, whose 5' trimethylguanosine caps would be expected to compete for a 5' processing activity. Second, when pre-U2 RNA precursors are first stoichiometrically decorated with an antibody specific for 2,2,7-trimethylguanosine, the extent of subsequent processing in vitro is unaffected. These results provide the first demonstration of a eukaryotic RNA processing reaction in vitro occurring within a ribonucleoprotein particle.

  20. Regulatory Role of N6 -methyladenosine (m6 A) Methylation in RNA Processing and Human Diseases.

    Science.gov (United States)

    Wei, Wenqiang; Ji, Xinying; Guo, Xiangqian; Ji, Shaoping

    2017-09-01

    N 6 -methyladenosine (m 6 A) modification is an abundant and conservative RNA modification in bacterial and eukaryotic cells. m 6 A modification mainly occurs in the 3' untranslated regions (UTRs) and near the stop codons of mRNA. Diverse strategies have been developed for identifying m 6 A sites in single nucleotide resolution. Dynamic regulation of m 6 A is found in metabolism, embryogenesis, and developmental processes, indicating a possible epigenetic regulation role along RNA processing and exerting biological functions. It has been known that m 6 A editing involves in nuclear RNA export, mRNA degradation, protein translation, and RNA splicing. Deficiency of m 6 A modification will lead to kinds of diseases, such as obesity, cancer, type 2 diabetes mellitus (T2DM), infertility, and developmental arrest. Some specific inhibitors against methyltransferase and demethylase have been developed to selectively regulate m 6 A modification, which may be advantageous for treatment of m 6 A related diseases. J. Cell. Biochem. 118: 2534-2543, 2017. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

  1. Deep sequencing of Salmonella RNA associated with heterologous Hfq proteins in vivo reveals small RNAs as a major target class and identifies RNA processing phenotypes.

    Science.gov (United States)

    Sittka, Alexandra; Sharma, Cynthia M; Rolle, Katarzyna; Vogel, Jörg

    2009-01-01

    The bacterial Sm-like protein, Hfq, is a key factor for the stability and function of small non-coding RNAs (sRNAs) in Escherichia coli. Homologues of this protein have been predicted in many distantly related organisms yet their functional conservation as sRNA-binding proteins has not entirely been clear. To address this, we expressed in Salmonella the Hfq proteins of two eubacteria (Neisseria meningitides, Aquifex aeolicus) and an archaeon (Methanocaldococcus jannaschii), and analyzed the associated RNA by deep sequencing. This in vivo approach identified endogenous Salmonella sRNAs as a major target of the foreign Hfq proteins. New Salmonella sRNA species were also identified, and some of these accumulated specifically in the presence of a foreign Hfq protein. In addition, we observed specific RNA processing defects, e.g., suppression of precursor processing of SraH sRNA by Methanocaldococcus Hfq, or aberrant accumulation of extracytoplasmic target mRNAs of the Salmonella GcvB, MicA or RybB sRNAs. Taken together, our study provides evidence of a conserved inherent sRNA-binding property of Hfq, which may facilitate the lateral transmission of regulatory sRNAs among distantly related species. It also suggests that the expression of heterologous RNA-binding proteins combined with deep sequencing analysis of RNA ligands can be used as a molecular tool to dissect individual steps of RNA metabolism in vivo.

  2. Further characterization of ribosome binding to thylakoid membranes

    International Nuclear Information System (INIS)

    Hurewitz, J.; Jagendorf, A.T.

    1987-01-01

    Previous work indicated more polysomes bound to pea (Pisum sativum cv Progress No. 9) thylakoids in light than in the dark, in vivo. With isolated intact chloroplasts incubated in darkness, addition of MgATP had no effect but 24 to 74% more RNA was thylakoid-bound at pH 8.3 than at pH 7. Thus, the major effect of light on ribosome-binding in vivo may be due to higher stroma pH. In isolated pea chloroplasts, initiation inhibitors (pactamycin and kanamycin) decreased the extent of RNA binding, and elongation inhibitors (lincomycin and streptomycin) increased it. Thus, cycling of ribosomes is controlled by translation, initiation, and termination. Bound RNA accounted for 19 to 24% of the total chloroplast RNA and the incorporation of [ 3 H]leucine into thylakoids was proportional to the amount of this bound RNA. These data support the concept that stroma ribosomes are recruited into thylakoid polysomes, which are active in synthesizing thylakoid proteins

  3. Identification, characterization and structure analysis of a type I ribosome-inactivating protein from Sapium sebiferum (Euphorbiaceae)

    Energy Technology Data Exchange (ETDEWEB)

    Wu, Ying [Key Laboratory of Ion Beam Bioengineering and Bioenergy Forest Research Center of State Forestry Administration, Hefei Institutes of Physical Science, Chinese Academy of Sciences, Hefei 230031, Anhui (China); School of Life Sciences, University of Science and Technology of China, Hefei 230027, Anhui (China); College of Food and Bioengineering, Henan University of Science and Technology, Luoyang 471023, Henan (China); Mao, Yingji [Key Laboratory of Ion Beam Bioengineering and Bioenergy Forest Research Center of State Forestry Administration, Hefei Institutes of Physical Science, Chinese Academy of Sciences, Hefei 230031, Anhui (China); School of Life Sciences, University of Science and Technology of China, Hefei 230027, Anhui (China); Jin, Shan; Hou, Jinyan; Du, Hua [Key Laboratory of Ion Beam Bioengineering and Bioenergy Forest Research Center of State Forestry Administration, Hefei Institutes of Physical Science, Chinese Academy of Sciences, Hefei 230031, Anhui (China); Yang, Minglei, E-mail: yml888@mail.ustc.edu.cn [Key Laboratory of Ion Beam Bioengineering and Bioenergy Forest Research Center of State Forestry Administration, Hefei Institutes of Physical Science, Chinese Academy of Sciences, Hefei 230031, Anhui (China); Wu, Lifang, E-mail: lfwu@ipp.ac.cn [Key Laboratory of Ion Beam Bioengineering and Bioenergy Forest Research Center of State Forestry Administration, Hefei Institutes of Physical Science, Chinese Academy of Sciences, Hefei 230031, Anhui (China); School of Life Sciences, University of Science and Technology of China, Hefei 230027, Anhui (China)

    2015-08-07

    Ribosome-inactivating proteins (RIPs) are N-glycosidases (EC3.2.2.22) that universally inactivate the ribosome, thereby inhibiting protein biosynthesis. In this study, a novel type I RIPs named SEBIN was identified in Sapium sebiferum. Nuclear acid depurine experiment showed that SEBIN had rRNA N-Glycosidase activity. Further experiment indicated that SEBIN significantly inhibited Caenorhabditis elegans development as well as resulted in worm cell apoptosis. This is the first report to evaluate RIPs toxicity using C. elegans. We proposed that SEBIN may impaire C. elegans reproduction in a DNA-damage manner besides traditional protein synthesis inhibition approach. The predicted 3D structure was modeled using threading and ab initio modeling, and the r-RNA binding residue of SEBIN was identified through the protein-ligand docking approach. It showed the amino acid residues, Glu195, Asn81, Ala82, Tyr83, Glu164, Ser163, Ile159 and Arg167, played critical roles in catalytic process. Our results provided the theoretical foundation of structure–function relationships between enzymatic properties, toxicity and structural characterization of SEBIN. - Graphical abstract: Superposition of main chains of ricin (cyan) and SEBIN (brown), and adenine binding site residues of SEBIN. - Highlights: • A Ribosome-inactivating proteins gene (SEBIN) was isolated from Sapium sebiferum. • SEBIN had DNase activity besides widely reported ribosome inactivation via N-glycosidases activity. • SEBIN significantly inhibited Caenorhabditis elegans development in vivo. • SEBIN may impaire C. elegans reproduction in a DNA-damage manner with the aid of mutant strains hus-1 and clk-2. • The possible active sites between SEBIN and the adenine of rRNA were predicted.

  4. Identification, characterization and structure analysis of a type I ribosome-inactivating protein from Sapium sebiferum (Euphorbiaceae)

    International Nuclear Information System (INIS)

    Wu, Ying; Mao, Yingji; Jin, Shan; Hou, Jinyan; Du, Hua; Yang, Minglei; Wu, Lifang

    2015-01-01

    Ribosome-inactivating proteins (RIPs) are N-glycosidases (EC3.2.2.22) that universally inactivate the ribosome, thereby inhibiting protein biosynthesis. In this study, a novel type I RIPs named SEBIN was identified in Sapium sebiferum. Nuclear acid depurine experiment showed that SEBIN had rRNA N-Glycosidase activity. Further experiment indicated that SEBIN significantly inhibited Caenorhabditis elegans development as well as resulted in worm cell apoptosis. This is the first report to evaluate RIPs toxicity using C. elegans. We proposed that SEBIN may impaire C. elegans reproduction in a DNA-damage manner besides traditional protein synthesis inhibition approach. The predicted 3D structure was modeled using threading and ab initio modeling, and the r-RNA binding residue of SEBIN was identified through the protein-ligand docking approach. It showed the amino acid residues, Glu195, Asn81, Ala82, Tyr83, Glu164, Ser163, Ile159 and Arg167, played critical roles in catalytic process. Our results provided the theoretical foundation of structure–function relationships between enzymatic properties, toxicity and structural characterization of SEBIN. - Graphical abstract: Superposition of main chains of ricin (cyan) and SEBIN (brown), and adenine binding site residues of SEBIN. - Highlights: • A Ribosome-inactivating proteins gene (SEBIN) was isolated from Sapium sebiferum. • SEBIN had DNase activity besides widely reported ribosome inactivation via N-glycosidases activity. • SEBIN significantly inhibited Caenorhabditis elegans development in vivo. • SEBIN may impaire C. elegans reproduction in a DNA-damage manner with the aid of mutant strains hus-1 and clk-2. • The possible active sites between SEBIN and the adenine of rRNA were predicted

  5. Ribosome. The complete structure of the 55S mammalian mitochondrial ribosome.

    Science.gov (United States)

    Greber, Basil J; Bieri, Philipp; Leibundgut, Marc; Leitner, Alexander; Aebersold, Ruedi; Boehringer, Daniel; Ban, Nenad

    2015-04-17

    Mammalian mitochondrial ribosomes (mitoribosomes) synthesize mitochondrially encoded membrane proteins that are critical for mitochondrial function. Here we present the complete atomic structure of the porcine 55S mitoribosome at 3.8 angstrom resolution by cryo-electron microscopy and chemical cross-linking/mass spectrometry. The structure of the 28S subunit in the complex was resolved at 3.6 angstrom resolution by focused alignment, which allowed building of a detailed atomic structure including all of its 15 mitoribosomal-specific proteins. The structure reveals the intersubunit contacts in the 55S mitoribosome, the molecular architecture of the mitoribosomal messenger RNA (mRNA) binding channel and its interaction with transfer RNAs, and provides insight into the highly specialized mechanism of mRNA recruitment to the 28S subunit. Furthermore, the structure contributes to a mechanistic understanding of aminoglycoside ototoxicity. Copyright © 2015, American Association for the Advancement of Science.

  6. DHX9 suppresses RNA processing defects originating from the Alu invasion of the human genome.

    Science.gov (United States)

    Aktaş, Tuğçe; Avşar Ilık, İbrahim; Maticzka, Daniel; Bhardwaj, Vivek; Pessoa Rodrigues, Cecilia; Mittler, Gerhard; Manke, Thomas; Backofen, Rolf; Akhtar, Asifa

    2017-04-06

    Transposable elements are viewed as 'selfish genetic elements', yet they contribute to gene regulation and genome evolution in diverse ways. More than half of the human genome consists of transposable elements. Alu elements belong to the short interspersed nuclear element (SINE) family of repetitive elements, and with over 1 million insertions they make up more than 10% of the human genome. Despite their abundance and the potential evolutionary advantages they confer, Alu elements can be mutagenic to the host as they can act as splice acceptors, inhibit translation of mRNAs and cause genomic instability. Alu elements are the main targets of the RNA-editing enzyme ADAR and the formation of Alu exons is suppressed by the nuclear ribonucleoprotein HNRNPC, but the broad effect of massive secondary structures formed by inverted-repeat Alu elements on RNA processing in the nucleus remains unknown. Here we show that DHX9, an abundant nuclear RNA helicase, binds specifically to inverted-repeat Alu elements that are transcribed as parts of genes. Loss of DHX9 leads to an increase in the number of circular-RNA-producing genes and amount of circular RNAs, translational repression of reporters containing inverted-repeat Alu elements, and transcriptional rewiring (the creation of mostly nonsensical novel connections between exons) of susceptible loci. Biochemical purifications of DHX9 identify the interferon-inducible isoform of ADAR (p150), but not the constitutively expressed ADAR isoform (p110), as an RNA-independent interaction partner. Co-depletion of ADAR and DHX9 augments the double-stranded RNA accumulation defects, leading to increased circular RNA production, revealing a functional link between these two enzymes. Our work uncovers an evolutionarily conserved function of DHX9. We propose that it acts as a nuclear RNA resolvase that neutralizes the immediate threat posed by transposon insertions and allows these elements to evolve as tools for the post

  7. How short RNAs impact the human ribonuclease Dicer activity: putative regulatory feedback-loops and other RNA-mediated mechanisms controlling microRNA processing.

    Science.gov (United States)

    Koralewska, Natalia; Hoffmann, Weronika; Pokornowska, Maria; Milewski, Marek; Lipinska, Andrea; Bienkowska-Szewczyk, Krystyna; Figlerowicz, Marek; Kurzynska-Kokorniak, Anna

    2016-01-01

    Ribonuclease Dicer plays a pivotal role in RNA interference pathways by processing long double-stranded RNAs and single-stranded hairpin RNA precursors into small interfering RNAs (siRNAs) and microRNAs (miRNAs), respectively. While details of Dicer regulation by a variety of proteins are being elucidated, less is known about non-protein factors, e.g. RNA molecules, that may influence this enzyme's activity. Therefore, we decided to investigate the question of whether the RNA molecules can function not only as Dicer substrates but also as its regulators. Our previous in vitro studies indicated that the activity of human Dicer can be influenced by short RNA molecules that either bind to Dicer or interact with its substrates, or both. Those studies were carried out with commercial Dicer preparations. Nevertheless, such preparations are usually not homogeneous enough to carry out more detailed RNA-binding studies. Therefore, we have established our own system for the production of human Dicer in insect cells. In this manuscript, we characterize the RNA-binding and RNA-cleavage properties of the obtained preparation. We demonstrate that Dicer can efficiently bind single-stranded RNAs that are longer than ~20-nucleotides. Consequently, we revisit possible scenarios of Dicer regulation by single-stranded RNA species ranging from ~10- to ~60-nucleotides, in the context of their binding to this enzyme. Finally, we show that siRNA/miRNA-sized RNAs may affect miRNA production either by binding to Dicer or by participating in regulatory feedback-loops. Altogether, our studies suggest a broad regulatory role of short RNAs in Dicer functioning.

  8. The Complete Structure of the Mycobacterium smegmatis 70S Ribosome.

    Science.gov (United States)

    Hentschel, Jendrik; Burnside, Chloe; Mignot, Ingrid; Leibundgut, Marc; Boehringer, Daniel; Ban, Nenad

    2017-07-05

    The ribosome carries out the synthesis of proteins in every living cell. It consequently represents a frontline target in anti-microbial therapy. Tuberculosis ranks among the leading causes of death worldwide, due in large part to the combination of difficult-to-treat latency and antibiotic resistance. Here, we present the 3.3-Å cryo-EM structure of the 70S ribosome of Mycobacterium smegmatis, a close relative to the human pathogen Mycobacterium tuberculosis. The structure reveals two additional ribosomal proteins and localizes them to the vicinity of drug-target sites in both the catalytic center and the decoding site of the ribosome. Furthermore, we visualized actinobacterium-specific rRNA and protein expansions that extensively remodel the ribosomal surface with implications for polysome organization. Our results provide a foundation for understanding the idiosyncrasies of mycobacterial translation and reveal atomic details of the structure that will facilitate the design of anti-tubercular therapeutics. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

  9. Regulation of pri-microRNA BIC transcription and processing in Burkitt lymphoma

    NARCIS (Netherlands)

    Kluiver, J.; van den Berg, Anke; de Jong, Doetje; Blokzijl, T.; Harms, G.; Bouwman, E.; Jacobs, Susan; Poppema, Sibrand; Kroesen, Bart-Jan

    2007-01-01

    BIC is a primary microRNA (pri-miR-155) that can be processed to mature miR-155. In this study, we show the crucial involvement of protein kinase C (PKC) and nuclear factor-kappa B (NF-kappa B) in the regulation of BIC expression upon B-cell receptor triggering. Surprisingly, Northern blot analysis

  10. Rare Drosha Splice Variants Are Deficient in MicroRNA Processing but Do Not Affect General MicroRNA Expression in Cancer Cells

    Directory of Open Access Journals (Sweden)

    Stefanie E. Grund

    2012-03-01

    Full Text Available Drosha is a key enzyme in microRNA biogenesis, generating the precursor miRNA (pre-miRNA by excising the stem-loop embedded in the primary transcripts (pri-miRNA. The specificity for the pri-miRNAs and determination of the cleavage site are provided by its binding partner DGCR8, which is necessary for efficient processing. The crucial Drosha domains for pri-miRNA cleavage are the middle part, the two enzymatic RNase III domains (RIIID, and the dsRNA binding domain (dsRBD in the C-terminus. Here, we identify alternatively spliced transcripts in human melanoma and NT2 cell lines, encoding C-terminally truncated Drosha proteins lacking part of the RIIIDb and the entire dsRBD. Proteins generated from these alternative splice variants fail to bind to DGCR8 but still interact with Ewing sarcoma protein (EWS. In vitro as well as in vivo, the Drosha splice variants are deficient in pri-miRNA processing. However, the aberrant transcripts in melanoma cells do not consistently reduce mature miRNA levels compared with melanoma cell lines lacking those splice variants, possibly owing to their limited abundance. Our findings show that alternative processing-deficient Drosha splice variants exist in melanoma cells. In elevated amounts, these alternatively spliced transcripts could provide one potential mechanism accounting for the deregulation of miRNAs in cancer cells. On the basis of our results, the search for alternative inactive splice variants might be fruitful in different tumor entities to unravel the molecular basis of the previously observed decreased microRNA processing efficiency in cancer.

  11. Cross-site comparison of ribosomal depletion kits for Illumina RNAseq library construction.

    Science.gov (United States)

    Herbert, Zachary T; Kershner, Jamie P; Butty, Vincent L; Thimmapuram, Jyothi; Choudhari, Sulbha; Alekseyev, Yuriy O; Fan, Jun; Podnar, Jessica W; Wilcox, Edward; Gipson, Jenny; Gillaspy, Allison; Jepsen, Kristen; BonDurant, Sandra Splinter; Morris, Krystalynne; Berkeley, Maura; LeClerc, Ashley; Simpson, Stephen D; Sommerville, Gary; Grimmett, Leslie; Adams, Marie; Levine, Stuart S

    2018-03-15

    Ribosomal RNA (rRNA) comprises at least 90% of total RNA extracted from mammalian tissue or cell line samples. Informative transcriptional profiling using massively parallel sequencing technologies requires either enrichment of mature poly-adenylated transcripts or targeted depletion of the rRNA fraction. The latter method is of particular interest because it is compatible with degraded samples such as those extracted from FFPE and also captures transcripts that are not poly-adenylated such as some non-coding RNAs. Here we provide a cross-site study that evaluates the performance of ribosomal RNA removal kits from Illumina, Takara/Clontech, Kapa Biosystems, Lexogen, New England Biolabs and Qiagen on intact and degraded RNA samples. We find that all of the kits are capable of performing significant ribosomal depletion, though there are differences in their ease of use. All kits were able to remove ribosomal RNA to below 20% with intact RNA and identify ~ 14,000 protein coding genes from the Universal Human Reference RNA sample at >1FPKM. Analysis of differentially detected genes between kits suggests that transcript length may be a key factor in library production efficiency. These results provide a roadmap for labs on the strengths of each of these methods and how best to utilize them.

  12. Absence of ribosomal DNA amplification in the meroistic (telotrophic) ovary of the large milkweed bug Oncopeltus fasciatus (Dallas) (Hemiptera: Lygaeidae)

    Science.gov (United States)

    1975-01-01

    In the typical meroistic insect ovary, the oocyte nucleus synthesizes little if any RNA. Nurse cells or trophocytes actively synthesize ribosomes which are transported to and accumulated by the oocyte. In the telotrophic ovary a morphological separation exists, the nurse cells being localized at the apical end of each ovariole and communicating with the ooocytes via nutritive cords. In order to determine whether the genes coding for ribosomal RNA (rRNA) are amplified in the telotrophic ovary of the milkweed bug Oncopeltus fasciatus, the percentages of the genome coding for ribosomal RNA in somatic cells, spermatogenic cells, ovarian follicles, and nurse cells were compared. The oocytes and most of the nurse cells of O. fasciatus are uninucleolate. DNA hybridizing with ribosomal RNA is localized in a satellite DNA, the density of which is 1.712 g/cm(-3). The density of main-band DNA is 1.694 g/cm(-3). The ribosomal DNA satellite accounts for approximately 0.2% of the DNA in somatic and gametogenic tissues of both males and females. RNA-DNA hybridization analysis demonstrates that approximately 0.03% of the DNA in somatic tissues, testis, ovarian follicles, and isolated nurse cells hybridizes with ribosomal RNA. The fact that the percentage of DNA hybridizing with rRNA is the same in somatic and in male and female gametogenic tissues indicates that amplification of ribosomal DNA does not occur in nurse cells and that if it occurs in oocytes, it represents less than a 50- fold increase in ribosomal DNA. An increase in total genome DNA accounted by polyploidization appears to provide for increasing the amount of ribosomal DNA in the nurse cells. PMID:1158969

  13. Several genes encoding ribosomal proteins are over-expressed in prostate-cancer cell lines: confirmation of L7a and L37 over-expression in prostate-cancer tissue samples.

    Science.gov (United States)

    Vaarala, M H; Porvari, K S; Kyllönen, A P; Mustonen, M V; Lukkarinen, O; Vihko, P T

    1998-09-25

    A cDNA library specific for mRNA over-expressed in prostate cancer was generated by subtractive hybridization of transcripts originating from prostatic hyperplasia and cancer tissues. cDNA encoding ribosomal proteins L4, L5, L7a, L23a, L30, L37, S14 and S18 was found to be present among 100 analyzed clones. Levels of ribosomal mRNA were significantly higher at least in one of the prostate-cancer cell lines, LNCaP, DU-145 and PC-3, than in hyperplastic tissue, as determined by slot-blot hybridization. Furthermore, L23a- and S14-transcript levels were significantly elevated in PC-3 cells as compared with those in the normal prostate epithelial cell line PrEC. Generally, dramatic changes in the mRNA content of the ribosomal proteins were not detected, the most evident over-expression being that of L37 mRNA, which was 3.4 times more abundant in LNCaP cells than in hyperplastic prostate tissue. The over-expression of L7a and L37 mRNA was confirmed in prostate-cancer tissue samples by in situ hybridization. Elevated cancer-related expression of L4 and L30 has not been reported, but levels of the other ribosomal proteins are known to be increased in several types of cancers. These results therefore suggest that prostate cancer is comparable with other types of cancers, in that a larger pool of some ribosomal proteins is gained during the transformation process, by an unknown mechanism.

  14. Defining the bacteroides ribosomal binding site.

    Science.gov (United States)

    Wegmann, Udo; Horn, Nikki; Carding, Simon R

    2013-03-01

    The human gastrointestinal tract, in particular the colon, hosts a vast number of commensal microorganisms. Representatives of the genus Bacteroides are among the most abundant bacterial species in the human colon. Bacteroidetes diverged from the common line of eubacterial descent before other eubacterial groups. As a result, they employ unique transcription initiation signals and, because of this uniqueness, they require specific genetic tools. Although some tools exist, they are not optimal for studying the roles and functions of these bacteria in the human gastrointestinal tract. Focusing on translation initiation signals in Bacteroides, we created a series of expression vectors allowing for different levels of protein expression in this genus, and we describe the use of pepI from Lactobacillus delbrueckii subsp. lactis as a novel reporter gene for Bacteroides. Furthermore, we report the identification of the 3' end of the 16S rRNA of Bacteroides ovatus and analyze in detail its ribosomal binding site, thus defining a core region necessary for efficient translation, which we have incorporated into the design of our expression vectors. Based on the sequence logo information from the 5' untranslated region of other Bacteroidales ribosomal protein genes, we conclude that our findings are relevant to all members of this order.

  15. Global investigation of RNA 3'end processing and transcription termination pathways

    DEFF Research Database (Denmark)

    Molska, Ewa

    2018-01-01

    . For example, contrary to prediction, a subset of protein-coding genes utilise the machinery used by genes encoding U snRNAs. This same machinery is predominantly used by a class of lncRNA genes, encoding so-called PROMPTs, despite the presence of sequence elements predicted to guide the usage of the pathway......RNA polymerases transcribe diverse classes of genes and the produced RNAs need to be targeted to their appropriate cognate biochemical maturation pathways. The vast majority of the human transcriptome consists of long non-coding RNAs (lncRNAs), which is a heterogeneous group of RNAs...... that is inadequately divided into classes based e.g. on length, stability and association with protein-coding genes. We reasoned that further classification based on biochemical properties, in this case transcription termination and the mechanistically coupled RNA 3’-end processing, would enable a better understanding...

  16. Mechanisms controlling mRNA processing and translation : decoding the regulatory layers defining gene expression through RNA sequencing

    NARCIS (Netherlands)

    Klerk, Eleonora de

    2015-01-01

    The work described in this thesis focuses on the mechanisms that give rise to alternative mRNAs and their alternative translation into proteins. Each of the described studies has been based on a specific set of high-throughput RNA sequencing technologies. An overview of the available RNA sequencing

  17. Salinity inhibits post transcriptional processing of chloroplast 16S rRNA in shoot cultures of jojoba (Simmondsia chinesis).

    Science.gov (United States)

    Mizrahi-Aviv, Ela; Mills, David; Benzioni, Aliza; Bar-Zvi, Dudy

    2005-03-01

    Chloroplast metabolism is rapidly affected by salt stress. Photosynthesis is one of the first processes known to be affected by salinity. Here, we report that salinity inhibits chloroplast post-transcriptional RNA processing. A differentially expressed 680-bp cDNA, containing the 3' sequence of 16S rRNA, transcribed intergenic spacer, exon 1 and intron of tRNA(Ile), was isolated by differential display reverse transcriptase PCR from salt-grown jojoba (Simmondsia chinesis) shoot cultures. Northern blot analysis indicated that although most rRNA appears to be fully processed, partially processed chloroplast 16S rRNA accumulates in salt-grown cultures. Thus, salinity appears to decrease the processing of the rrn transcript. The possible effect of this decreased processing on physiological processes is, as yet, unknown.

  18. Translation affects YoeB and MazF messenger RNA interferase activities by different mechanisms

    DEFF Research Database (Denmark)

    Christensen-Dalsgaard, Mikkel; Gerdes, Kenn

    2008-01-01

    Prokaryotic toxin-antitoxin loci encode mRNA cleaving enzymes that inhibit translation. Two types are known: those that cleave mRNA codons at the ribosomal A site and those that cleave any RNA site specifically. RelE of Escherichia coli cleaves mRNA at the ribosomal A site in vivo and in vitro bu...

  19. Mature clustered, regularly interspaced, short palindromic repeats RNA (crRNA) length is measured by a ruler mechanism anchored at the precursor processing site.

    Science.gov (United States)

    Hatoum-Aslan, Asma; Maniv, Inbal; Marraffini, Luciano A

    2011-12-27

    Precise RNA processing is fundamental to all small RNA-mediated interference pathways. In prokaryotes, clustered, regularly interspaced, short palindromic repeats (CRISPR) loci encode small CRISPR RNAs (crRNAs) that protect against invasive genetic elements by antisense targeting. CRISPR loci are transcribed as a long precursor that is cleaved within repeat sequences by CRISPR-associated (Cas) proteins. In many organisms, this primary processing generates crRNA intermediates that are subject to additional nucleolytic trimming to render mature crRNAs of specific lengths. The molecular mechanisms underlying this maturation event remain poorly understood. Here, we defined the genetic requirements for crRNA primary processing and maturation in Staphylococcus epidermidis. We show that changes in the position of the primary processing site result in extended or diminished maturation to generate mature crRNAs of constant length. These results indicate that crRNA maturation occurs by a ruler mechanism anchored at the primary processing site. We also show that maturation is mediated by specific cas genes distinct from those genes involved in primary processing, showing that this event is directed by CRISPR/Cas loci.

  20. Perturbation of ribosome biogenesis drives cells into senescence through 5S RNP-mediated p53 activation.

    Science.gov (United States)

    Nishimura, Kazuho; Kumazawa, Takuya; Kuroda, Takao; Katagiri, Naohiro; Tsuchiya, Mai; Goto, Natsuka; Furumai, Ryohei; Murayama, Akiko; Yanagisawa, Junn; Kimura, Keiji

    2015-03-03

    The 5S ribonucleoprotein particle (RNP) complex, consisting of RPL11, RPL5, and 5S rRNA, is implicated in p53 regulation under ribotoxic stress. Here, we show that the 5S RNP contributes to p53 activation and promotes cellular senescence in response to oncogenic or replicative stress. Oncogenic stress accelerates rRNA transcription and replicative stress delays rRNA processing, resulting in RPL11 and RPL5 accumulation in the ribosome-free fraction, where they bind MDM2. Experimental upregulation of rRNA transcription or downregulation of rRNA processing, mimicking the nucleolus under oncogenic or replicative stress, respectively, also induces RPL11-mediated p53 activation and cellular senescence. We demonstrate that exogenous expression of certain rRNA-processing factors rescues the processing defect, attenuates p53 accumulation, and increases replicative lifespan. To summarize, the nucleolar-5S RNP-p53 pathway functions as a senescence inducer in response to oncogenic and replicative stresses. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

  1. Perturbation of Ribosome Biogenesis Drives Cells into Senescence through 5S RNP-Mediated p53 Activation

    Directory of Open Access Journals (Sweden)

    Kazuho Nishimura

    2015-03-01

    Full Text Available The 5S ribonucleoprotein particle (RNP complex, consisting of RPL11, RPL5, and 5S rRNA, is implicated in p53 regulation under ribotoxic stress. Here, we show that the 5S RNP contributes to p53 activation and promotes cellular senescence in response to oncogenic or replicative stress. Oncogenic stress accelerates rRNA transcription and replicative stress delays rRNA processing, resulting in RPL11 and RPL5 accumulation in the ribosome-free fraction, where they bind MDM2. Experimental upregulation of rRNA transcription or downregulation of rRNA processing, mimicking the nucleolus under oncogenic or replicative stress, respectively, also induces RPL11-mediated p53 activation and cellular senescence. We demonstrate that exogenous expression of certain rRNA-processing factors rescues the processing defect, attenuates p53 accumulation, and increases replicative lifespan. To summarize, the nucleolar-5S RNP-p53 pathway functions as a senescence inducer in response to oncogenic and replicative stresses.

  2. The Ribosomal Protein uL22 Modulates the Shape of the Protein Exit Tunnel

    DEFF Research Database (Denmark)

    Wekselman, Itai; Zimmerman, Ella; Davidovich, Chen

    2017-01-01

    Erythromycin is a clinically useful antibiotic that binds to an rRNA pocket in the ribosomal exit tunnel. Commonly, resistance to erythromycin is acquired by alterations of rRNA nucleotides that interact with the drug. Mutations in the β hairpin of ribosomal protein uL22, which is rather distal...... of the β hairpin of the mutated uL22 toward the interior of the exit tunnel, triggering a cascade of structural alterations of rRNA nucleotides that propagate to the erythromycin binding pocket. Our findings support recent studies showing that the interactions between uL22 and specific sequences within...

  3. Molecular dynamics simulation of ribosome jam

    KAUST Repository

    Matsumoto, Shigenori

    2011-09-01

    We propose a coarse-grained molecular dynamics model of ribosome molecules to study the dependence of translation process on environmental parameters. We found the model exhibits traffic jam property, which is consistent with an ASEP model. We estimated the influence of the temperature and concentration of molecules on the hopping probability used in the ASEP model. Our model can also treat environmental effects on the translation process that cannot be explained by such cellular automaton models. © 2010 Elsevier B.V. All rights reserved.

  4. Comprehensive processing of high-throughput small RNA sequencing data including quality checking, normalization, and differential expression analysis using the UEA sRNA Workbench.

    Science.gov (United States)

    Beckers, Matthew; Mohorianu, Irina; Stocks, Matthew; Applegate, Christopher; Dalmay, Tamas; Moulton, Vincent

    2017-06-01

    Recently, high-throughput sequencing (HTS) has revealed compelling details about the small RNA (sRNA) population in eukaryotes. These 20 to 25 nt noncoding RNAs can influence gene expression by acting as guides for the sequence-specific regulatory mechanism known as RNA silencing. The increase in sequencing depth and number of samples per project enables a better understanding of the role sRNAs play by facilitating the study of expression patterns. However, the intricacy of the biological hypotheses coupled with a lack of appropriate tools often leads to inadequate mining of the available data and thus, an incomplete description of the biological mechanisms involved. To enable a comprehensive study of differential expression in sRNA data sets, we present a new interactive pipeline that guides researchers through the various stages of data preprocessing and analysis. This includes various tools, some of which we specifically developed for sRNA analysis, for quality checking and normalization of sRNA samples as well as tools for the detection of differentially expressed sRNAs and identification of the resulting expression patterns. The pipeline is available within the UEA sRNA Workbench, a user-friendly software package for the processing of sRNA data sets. We demonstrate the use of the pipeline on a H. sapiens data set; additional examples on a B. terrestris data set and on an A. thaliana data set are described in the Supplemental Information A comparison with existing approaches is also included, which exemplifies some of the issues that need to be addressed for sRNA analysis and how the new pipeline may be used to do this. © 2017 Beckers et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  5. Ribosome stalling regulates IRES-mediated translation in eukaryotes, a parallel to prokaryotic attenuation

    NARCIS (Netherlands)

    Fernandez, James; Yaman, Ibrahim; Huang, Charles; Liu, Haiyan; Lopez, Alex B.; Komar, Anton A.; Caprara, Mark G.; Merrick, William C.; Snider, Martin D.; Kaufman, Randal J.; Lamers, Wouter H.; Hatzoglou, Maria

    2005-01-01

    It was previously shown that the mRNA for the cat-1 Arg/Lys transporter is translated from an internal ribosome entry site (IRES) that is regulated by cellular stress. Amino acid starvation stimulated cat-1 translation via a mechanism that requires translation of an ORF in the mRNA leader and

  6. B Cell Receptor Activation Predominantly Regulates AKT-mTORC1/2 Substrates Functionally Related to RNA Processing.

    Directory of Open Access Journals (Sweden)

    Dara K Mohammad

    Full Text Available Protein kinase B (AKT phosphorylates numerous substrates on the consensus motif RXRXXpS/T, a docking site for 14-3-3 interactions. To identify novel AKT-induced phosphorylation events following B cell receptor (BCR activation, we performed proteomics, biochemical and bioinformatics analyses. Phosphorylated consensus motif-specific antibody enrichment, followed by tandem mass spectrometry, identified 446 proteins, containing 186 novel phosphorylation events. Moreover, we found 85 proteins with up regulated phosphorylation, while in 277 it was down regulated following stimulation. Up regulation was mainly in proteins involved in ribosomal and translational regulation, DNA binding and transcription regulation. Conversely, down regulation was preferentially in RNA binding, mRNA splicing and mRNP export proteins. Immunoblotting of two identified RNA regulatory proteins, RBM25 and MEF-2D, confirmed the proteomics data. Consistent with these findings, the AKT-inhibitor (MK-2206 dramatically reduced, while the mTORC-inhibitor PP242 totally blocked phosphorylation on the RXRXXpS/T motif. This demonstrates that this motif, previously suggested as an AKT target sequence, also is a substrate for mTORC1/2. Proteins with PDZ, PH and/or SH3 domains contained the consensus motif, whereas in those with an HMG-box, H15 domains and/or NF-X1-zinc-fingers, the motif was absent. Proteins carrying the consensus motif were found in all eukaryotic clades indicating that they regulate a phylogenetically conserved set of proteins.

  7. An Archaea 5S rRNA analog is stably expressed in Escherichia coli

    Science.gov (United States)

    Yang, Y.; Fox, G. E.

    1996-01-01

    Mini-genes for 5S-like rRNA were constructed. These genes had a sequence which largely resembles that of the naturally occurring 5S rRNA of a bacterium, Halococcus morrhuae, which phylogenetically belongs to the Archaea. Plasmids carrying the mini-genes were transformed into Escherichia coli (Ec). Ribosomal incorporation was not a prerequisite for stable accumulation of the RNA product. However, only those constructs with a well-base-paired helix I accumulated RNA product. This result strongly implies that this aspect of the structure is likely to be an important condition for stabilizing 5S rRNA-like products. The results are consistent with our current understanding of 5S rRNA processing in Ec. When used in conjunction with rRNA probe technology, the resulting chimeric RNA may be useful as a monitoring tool for genetically engineered microorganisms or naturally occurring organisms that are released into the environment.

  8. Folate deficiency facilitates recruitment of upstream binding factor to hot spots of DNA double-strand breaks of rRNA genes and promotes its transcription.

    Science.gov (United States)

    Xie, Qiu; Li, Caihua; Song, Xiaozhen; Wu, Lihua; Jiang, Qian; Qiu, Zhiyong; Cao, Haiyan; Yu, Kaihui; Wan, Chunlei; Li, Jianting; Yang, Feng; Huang, Zebing; Niu, Bo; Jiang, Zhengwen; Zhang, Ting

    2017-03-17

    The biogenesis of ribosomes in vivo is an essential process for cellular functions. Transcription of ribosomal RNA (rRNA) genes is the rate-limiting step in ribosome biogenesis controlled by environmental conditions. Here, we investigated the role of folate antagonist on changes of DNA double-strand breaks (DSBs) landscape in mouse embryonic stem cells. A significant DSB enhancement was detected in the genome of these cells and a large majority of these DSBs were found in rRNA genes. Furthermore, spontaneous DSBs in cells under folate deficiency conditions were located exclusively within the rRNA gene units, representing a H3K4me1 hallmark. Enrichment H3K4me1 at the hot spots of DSB regions enhanced the recruitment of upstream binding factor (UBF) to rRNA genes, resulting in the increment of rRNA genes transcription. Supplement of folate resulted in a restored UBF binding across DNA breakage sites of rRNA genes, and normal rRNA gene transcription. In samples from neural tube defects (NTDs) with low folate level, up-regulation of rRNA gene transcription was observed, along with aberrant UBF level. Our results present a new view by which alterations in folate levels affects DNA breakage through epigenetic control leading to the regulation of rRNA gene transcription during the early stage of development. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  9. Rrp12 and the Exportin Crm1 participate in late assembly events in the nucleolus during 40S ribosomal subunit biogenesis.

    Science.gov (United States)

    Moriggi, Giulia; Nieto, Blanca; Dosil, Mercedes

    2014-12-01

    During the biogenesis of small ribosomal subunits in eukaryotes, the pre-40S particles formed in the nucleolus are rapidly transported to the cytoplasm. The mechanisms underlying the nuclear export of these particles and its coordination with other biogenesis steps are mostly unknown. Here we show that yeast Rrp12 is required for the exit of pre-40S particles to the cytoplasm and for proper maturation dynamics of upstream 90S pre-ribosomes. Due to this, in vivo elimination of Rrp12 leads to an accumulation of nucleoplasmic 90S to pre-40S transitional particles, abnormal 35S pre-rRNA processing, delayed elimination of processing byproducts, and no export of intermediate pre-40S complexes. The exportin Crm1 is also required for the same pre-ribosome maturation events that involve Rrp12. Thus, in addition to their implication in nuclear export, Rrp12 and Crm1 participate in earlier biosynthetic steps that take place in the nucleolus. Our results indicate that, in the 40S subunit synthesis pathway, the completion of early pre-40S particle assembly, the initiation of byproduct degradation and the priming for nuclear export occur in an integrated manner in late 90S pre-ribosomes.

  10. Yeast eIF4B binds to the head of the 40S ribosomal subunit and promotes mRNA recruitment through its N-terminal and internal repeat domains

    Czech Academy of Sciences Publication Activity Database

    Walker, S. E.; Zhou, F.; Mitchell, S. F.; Larson, V. S.; Valášek, Leoš Shivaya; Hinnebusch, A. G.; Lorsch, J. R.

    2013-01-01

    Roč. 19, č. 2 (2013), s. 191-207 ISSN 1355-8382 R&D Projects: GA ČR(CZ) GBP305/12/G034 Institutional support: RVO:61388971 Keywords : eIF4A * eIF4B * mRNA Subject RIV: EE - Microbiology, Virology Impact factor: 4.622, year: 2013

  11. The RB/E2F pathway and regulation of RNA processing

    Energy Technology Data Exchange (ETDEWEB)

    Ahlander, Joseph [Department of Molecular and Cellular Biology, 1007 East Lowell Street, University of Arizona, Tucson, AZ 85721 (United States); Bosco, Giovanni, E-mail: gbosco@email.arizona.edu [Department of Molecular and Cellular Biology, 1007 East Lowell Street, University of Arizona, Tucson, AZ 85721 (United States)

    2009-07-03

    The retinoblastoma tumor suppressor protein (RB) is inactivated in a majority of cancers. RB restricts cell proliferation by inhibiting the E2F family of transcription factors. The current model for RB/E2F function describes its role in regulating transcription at gene promoters. Whether the RB or E2F proteins might play a role in gene expression beyond transcription initiation is not well known. This review describes evidence that points to a novel role for the RB/E2F network in the regulation of RNA processing, and we propose a model as a framework for future research. The elucidation of a novel role of RB in RNA processing will have a profound impact on our understanding of the role of this tumor suppressor family in cell and developmental biology.

  12. Yeast linker histone Hho1p is required for efficient RNA polymerase I processivity and transcriptional silencing at the ribosomal DNA

    OpenAIRE

    Levy, Anat; Eyal, Miri; Hershkovits, Gitit; Salmon-Divon, Mali; Klutstein, Michael; Katcoff, Don Jay

    2008-01-01

    Nucleosome core particles in eukaryotes are linked by a stretch of DNA that is usually associated with a linker histone. Here, we show in yeast, that the presence of yeast linker histone Hho1p represses expression of a pol II transcribed gene (MET15) embedded in the rDNA. In vivo deletions of Hho1p sequences showed that the second globular domain is sufficient for that repression, whereas the presence of the N terminus is required for its derepression. In contrast, a run-on assay confirmed by...

  13. Mpn1, Mutated in Poikiloderma with Neutropenia Protein 1, Is a Conserved 3′-to-5′ RNA Exonuclease Processing U6 Small Nuclear RNA

    Directory of Open Access Journals (Sweden)

    Vadim Shchepachev

    2012-10-01

    Full Text Available Clericuzio-type poikiloderma with neutropenia (PN is a rare genodermatosis associated with mutations in the C16orf57 gene, which codes for the uncharacterized protein hMpn1. We show here that, in both fission yeasts and humans, Mpn1 processes the spliceosomal U6 small nuclear RNA (snRNA posttranscriptionally. In Mpn1-deficient cells, U6 molecules carry 3′ end polyuridine tails that are longer than those in normal cells and lack a terminal 2′,3′ cyclic phosphate group. In mpn1Δ yeast cells, U6 snRNA and U4/U6 di-small nuclear RNA protein complex levels are diminished, leading to precursor messenger RNA splicing defects, which are reverted by expression of either yeast or human Mpn1 and by overexpression of U6. Recombinant hMpn1 is a 3′-to-5′ RNA exonuclease that removes uridines from U6 3′ ends, generating terminal 2′,3′ cyclic phosphates in vitro. Finally, U6 degradation rates increase in mpn1Δ yeasts and in lymphoblasts established from individuals affected by PN. Our data indicate that Mpn1 promotes U6 stability through 3′ end posttranscriptional processing and implicate altered U6 metabolism as a potential mechanism for PN pathogenesis.

  14. Two Nucleolar Proteins, GDP1 and OLI2, Function As Ribosome Biogenesis Factors and Are Preferentially Involved in Promotion of Leaf Cell Proliferation without Strongly Affecting Leaf Adaxial–Abaxial Patterning in Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    Koji Kojima

    2018-01-01

    Full Text Available Leaf abaxial–adaxial patterning is dependent on the mutual repression of leaf polarity genes expressed either adaxially or abaxially. In Arabidopsis thaliana, this process is strongly affected by mutations in ribosomal protein genes and in ribosome biogenesis genes in a sensitized genetic background, such as asymmetric leaves2 (as2. Most ribosome-related mutants by themselves do not show leaf abaxialization, and one of their typical phenotypes is the formation of pointed rather than rounded leaves. In this study, we characterized two ribosome-related mutants to understand how ribosome biogenesis is linked to several aspects of leaf development. Previously, we isolated oligocellula2 (oli2 which exhibits the pointed-leaf phenotype and has a cell proliferation defect. OLI2 encodes a homolog of Nop2 in Saccharomyces cerevisiae, a ribosome biogenesis factor involved in pre-60S subunit maturation. In this study, we found another pointed-leaf mutant that carries a mutation in a gene encoding an uncharacterized protein with a G-patch domain. Similar to oli2, this mutant, named g-patch domain protein1 (gdp1, has a reduced number of leaf cells. In addition, gdp1 oli2 double mutants showed a strong genetic interaction such that they synergistically impaired cell proliferation in leaves and produced markedly larger cells. On the other hand, they showed additive phenotypes when combined with several known ribosomal protein mutants. Furthermore, these mutants have a defect in pre-rRNA processing. GDP1 and OLI2 are strongly expressed in tissues with high cell proliferation activity, and GDP1-GFP and GFP-OLI2 are localized in the nucleolus. These results suggest that OLI2 and GDP1 are involved in ribosome biogenesis. We then examined the effects of gdp1 and oli2 on adaxial–abaxial patterning by crossing them with as2. Interestingly, neither gdp1 nor oli2 strongly enhanced the leaf polarity defect of as2. Similar results were obtained with as2 gdp1 oli2

  15. Epigenetic up-regulation of ribosome biogenesis and more aggressive phenotype triggered by the lack of the histone demethylase JHDM1B in mammary epithelial cells.

    Science.gov (United States)

    Galbiati, Alice; Penzo, Marianna; Bacalini, Maria Giulia; Onofrillo, Carmine; Guerrieri, Ania Naila; Garagnani, Paolo; Franceschi, Claudio; Treré, Davide; Montanaro, Lorenzo

    2017-06-06

    The alterations of ribosome biogenesis and protein synthesis play a direct role in the development of tumors. The accessibility and transcription of ribosomal genes is controlled at several levels, with their epigenetic regulation being one of the most important. Here we explored the JmjC domain-containing histone demethylase 1B (JHDM1B) function in the epigenetic control of rDNA transcription. Since JHDM1B is a negative regulator of gene transcription, we focused on the effects induced by JHDM1B knock-down (KD). We studied the consequences of stable inducible JHDM1B silencing in cell lines derived from transformed and untransformed mammary epithelial cells. In these cellular models, prolonged JHDM1B downregulation triggered a surge of 45S pre-rRNA transcription and processing, associated with a re-modulation of the H3K36me2 levels at rDNA loci and with changes in DNA methylation of specific CpG sites in rDNA genes. We also found that after JHDM1B KD, cells showed a higher ribosome content: which were engaged in mRNA translation. JHDM1B KD and the consequent stimulation of ribosomes biogenesis conferred more aggressive features to the tested cellular models, which acquired a greater clonogenic, staminal and invasive potential. Taken together, these data indicate that the reduction of JHDM1B leads to a more aggressive cellular phenotype in mammary gland cells, by virtue of its negative regulatory activity on ribosome biogenesis.

  16. Impaired Telomere Maintenance and Decreased Canonical WNT Signaling but Normal Ribosome Biogenesis in Induced Pluripotent Stem Cells from X-Linked Dyskeratosis Congenita Patients.

    Directory of Open Access Journals (Sweden)

    Bai-Wei Gu

    Full Text Available Dyskeratosis congenita (DC is an inherited bone marrow failure syndrome characterized by the presence of short telomeres at presentation. Mutations in ten different genes, whose products are involved in the telomere maintenance pathway, have been shown to cause DC. The X-linked form is the most common form of the disease and is caused by mutations in the gene DKC1, encoding the protein dyskerin. Dyskerin is required for the assembly and stability of telomerase and is also involved in ribosomal RNA (rRNA processing where it converts specific uridines to pseudouridine. DC is thought to result from failure to maintain tissues, like blood, that are renewed by stem cell activity, but research into pathogenic mechanisms has been hampered by the difficulty of obtaining stem cells from patients. We reasoned that induced pluripotent stem (iPS cells from X-linked DC patients may provide information about the mechanisms involved. Here we describe the production of iPS cells from DC patients with DKC1 mutations Q31E, A353V and ΔL37. In addition we constructed "corrected" lines with a copy of the wild type dyskerin cDNA expressed from the AAVS1 safe harbor locus. We show that in iPS cells with DKC1 mutations telomere maintenance is compromised with short telomere lengths and decreased telomerase activity. The degree to which telomere lengths are affected by expression of telomerase during reprograming, or with ectopic expression of wild type dyskerin, is variable. The recurrent mutation A353V shows the most severe effect on telomere maintenance. A353V cells but not Q31E or ΔL37 cells, are refractory to correction by expression of wild type DKC1 cDNA. Because dyskerin is involved in both telomere maintenance and ribosome biogenesis it has been postulated that defective ribosome biogenesis and translation may contribute to the disease phenotype. Evidence from mouse and zebra fish models has supported the involvement of ribosome biogenesis but primary cells

  17. Impaired Telomere Maintenance and Decreased Canonical WNT Signaling but Normal Ribosome Biogenesis in Induced Pluripotent Stem Cells from X-Linked Dyskeratosis Congenita Patients.

    Science.gov (United States)

    Gu, Bai-Wei; Apicella, Marisa; Mills, Jason; Fan, Jian-Meng; Reeves, Dara A; French, Deborah; Podsakoff, Gregory M; Bessler, Monica; Mason, Philip J

    2015-01-01

    Dyskeratosis congenita (DC) is an inherited bone marrow failure syndrome characterized by the presence of short telomeres at presentation. Mutations in ten different genes, whose products are involved in the telomere maintenance pathway, have been shown to cause DC. The X-linked form is the most common form of the disease and is caused by mutations in the gene DKC1, encoding the protein dyskerin. Dyskerin is required for the assembly and stability of telomerase and is also involved in ribosomal RNA (rRNA) processing where it converts specific uridines to pseudouridine. DC is thought to result from failure to maintain tissues, like blood, that are renewed by stem cell activity, but research into pathogenic mechanisms has been hampered by the difficulty of obtaining stem cells from patients. We reasoned that induced pluripotent stem (iPS) cells from X-linked DC patients may provide information about the mechanisms involved. Here we describe the production of iPS cells from DC patients with DKC1 mutations Q31E, A353V and ΔL37. In addition we constructed "corrected" lines with a copy of the wild type dyskerin cDNA expressed from the AAVS1 safe harbor locus. We show that in iPS cells with DKC1 mutations telomere maintenance is compromised with short telomere lengths and decreased telomerase activity. The degree to which telomere lengths are affected by expression of telomerase during reprograming, or with ectopic expression of wild type dyskerin, is variable. The recurrent mutation A353V shows the most severe effect on telomere maintenance. A353V cells but not Q31E or ΔL37 cells, are refractory to correction by expression of wild type DKC1 cDNA. Because dyskerin is involved in both telomere maintenance and ribosome biogenesis it has been postulated that defective ribosome biogenesis and translation may contribute to the disease phenotype. Evidence from mouse and zebra fish models has supported the involvement of ribosome biogenesis but primary cells from human

  18. Ribosomal and hematopoietic defects in induced pluripotent stem cells derived from Diamond Blackfan anemia patients.

    Science.gov (United States)

    Garçon, Loïc; Ge, Jingping; Manjunath, Shwetha H; Mills, Jason A; Apicella, Marisa; Parikh, Shefali; Sullivan, Lisa M; Podsakoff, Gregory M; Gadue, Paul; French, Deborah L; Mason, Philip J; Bessler, Monica; Weiss, Mitchell J

    2013-08-08

    Diamond Blackfan anemia (DBA) is a congenital disorder with erythroid (Ery) hypoplasia and tissue morphogenic abnormalities. Most DBA cases are caused by heterozygous null mutations in genes encoding ribosomal proteins. Understanding how haploinsufficiency of these ubiquitous proteins causes DBA is hampered by limited availability of tissues from affected patients. We generated induced pluripotent stem cells (iPSCs) from fibroblasts of DBA patients carrying mutations in RPS19 and RPL5. Compared with controls, DBA fibroblasts formed iPSCs inefficiently, although we obtained 1 stable clone from each fibroblast line. RPS19-mutated iPSCs exhibited defects in 40S (small) ribosomal subunit assembly and production of 18S ribosomal RNA (rRNA). Upon induced differentiation, the mutant clone exhibited globally impaired hematopoiesis, with the Ery lineage affected most profoundly. RPL5-mutated iPSCs exhibited defective 60S (large) ribosomal subunit assembly, accumulation of 12S pre-rRNA, and impaired erythropoiesis. In both mutant iPSC lines, genetic correction of ribosomal protein deficiency via complementary DNA transfer into the "safe harbor" AAVS1 locus alleviated abnormalities in ribosome biogenesis and hematopoiesis. Our studies show that pathological features of DBA are recapitulated by iPSCs, provide a renewable source of cells to model various tissue defects, and demonstrate proof of principle for genetic correction strategies in patient stem cells.

  19. Primary processing of CRISPR RNA by the endonuclease Cas6 in Staphylococcus epidermidis.

    Science.gov (United States)

    Wakefield, Noelle; Rajan, Rakhi; Sontheimer, Erik J

    2015-10-07

    In many bacteria and archaea, an adaptive immune system (CRISPR-Cas) provides immunity against foreign genetic elements. This system uses CRISPR RNAs (crRNAs) derived from the CRISPR array, along with CRISPR-associated (Cas) proteins, to target foreign nucleic acids. In most CRISPR systems, endonucleolytic processing of crRNA precursors (pre-crRNAs) is essential for the pathway. Here we study the Cas6 endonuclease responsible for crRNA processing in the Type III-A CRISPR-Cas system from Staphylococcus epidermidis RP62a, a model for Type III-A CRISPR-Cas systems, and define substrate requirements for SeCas6 activity. We find that SeCas6 is necessary and sufficient for full-length crRNA biogenesis in vitro, and that it relies on both sequence and stem-loop structure in the 3' half of the CRISPR repeat for recognition and processing. Copyright © 2015 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

  20. Stimulation of Pol III-dependent 5S rRNA and U6 snRNA gene expression by AP-1 transcription factors.

    Science.gov (United States)

    Ahuja, Richa; Kumar, Vijay

    2017-07-01

    RNA polymerase III transcribes structurally diverse group of essential noncoding RNAs including 5S ribosomal RNA (5SrRNA) and U6 snRNA. These noncoding RNAs are involved in RNA processing and ribosome biogenesis, thus, coupling Pol III activity to the rate of protein synthesis, cell growth, and proliferation. Even though a few Pol II-associated transcription factors have been reported to participate in Pol III-dependent transcription, its activation by activator protein 1 (AP-1) factors, c-Fos and c-Jun, has remained unexplored. Here, we show that c-Fos and c-Jun bind to specific sites in the regulatory regions of 5S rRNA (type I) and U6 snRNA (type III) gene promoters and stimulate their transcription. Our chromatin immunoprecipitation studies suggested that endogenous AP-1 factors bind to their cognate promoter elements during the G1/S transition of cell cycle apparently synchronous with Pol III transcriptional activity. Furthermore, the interaction of c-Jun with histone acetyltransferase p300 promoted the recruitment of p300/CBP complex on the promoters and facilitated the occupancy of Pol III transcriptional machinery via histone acetylation and chromatin remodeling. The findings of our study, together, suggest that AP-1 factors are novel regulators of Pol III-driven 5S rRNA and U6 snRNA expression with a potential role in cell proliferation. © 2017 Federation of European Biochemical Societies.

  1. A phylogenetic framework for root lesion nematodes of the genus Pratylenchus (Nematoda): Evidence from 18S and D2-D3 expansion segments of 28S ribosomal RNA genes and morphological characters.

    Science.gov (United States)

    Subbotin, Sergei A; Ragsdale, Erik J; Mullens, Teresa; Roberts, Philip A; Mundo-Ocampo, Manuel; Baldwin, James G

    2008-08-01

    The root lesion nematodes of the genus Pratylenchus Filipjev, 1936 are migratory endoparasites of plant roots, considered among the most widespread and important nematode parasites in a variety of crops. We obtained gene sequences from the D2 and D3 expansion segments of 28S rRNA partial and 18S rRNA from 31 populations belonging to 11 valid and two unidentified species of root lesion nematodes and five outgroup taxa. These datasets were analyzed using maximum parsimony and Bayesian inference. The alignments were generated using the secondary structure models for these molecules and analyzed with Bayesian inference under the standard models and the complex model, considering helices under the doublet model and loops and bulges under the general time reversible model. The phylogenetic informativeness of morphological characters is tested by reconstruction of their histories on rRNA based trees using parallel parsimony and Bayesian approaches. Phylogenetic and sequence analyses of the 28S D2-D3 dataset with 145 accessions for 28 species and 18S dataset with 68 accessions for 15 species confirmed among large numbers of geographical diverse isolates that most classical morphospecies are monophyletic. Phylogenetic analyses revealed at least six distinct major clades of examined Pratylenchus species and these clades are generally congruent with those defined by characters derived from lip patterns, numbers of lip annules, and spermatheca shape. Morphological results suggest the need for sophisticated character discovery and analysis for morphology based phylogenetics in nematodes.

  2. DEAH-RHA helicase•Znf cofactor systems in kinetoplastid RNA editing and evolutionarily distant RNA processes

    Science.gov (United States)

    Cruz-Reyes, Jorge; Mooers, Blaine H.M.; Abu-Adas, Zakaria; Kumar, Vikas; Gulati, Shelly

    2016-01-01

    Multi-zinc finger proteins are an emerging class of cofactors in DEAH-RHA RNA helicases across highly divergent eukaryotic lineages. DEAH-RHA helicase•zinc finger cofactor partnerships predate the split of kinetoplastid protozoa, which include several human pathogens, from other eukaryotic lineages 100–400 Ma. Despite a long evolutionary history, the prototypical DEAH-RHA domains remain highly conserved. This short review focuses on a recently identified DEAH-RHA helicase•zinc finger cofactor system in kinetoplastid RNA editing, and its potential functional parallels with analogous systems in embryogenesis control in nematodes and antivirus protection in humans. PMID:27540585

  3. LAMMER kinase Kic1 is involved in pre-mRNA processing

    International Nuclear Information System (INIS)

    Tang, Zhaohua; Luca, Maria; Portillio, Jessica; Ngo, Benson; Chang, Cathey; Wen, Teresa; Murray, Johanne; Carr, Antony

    2011-01-01

    The LAMMER kinases are conserved through evolution. They play vital roles in cell growth/differentiation, development, and metabolism. One of the best known functions of the kinases in animal cells is the regulation of pre-mRNA splicing. Kic1 is the LAMMER kinase in fission yeast Schizosaccharomyces pombe. Despite the reported pleiotropic effects of kic1 + deletion/overexpression on various cellular processes the involvement of Kic1 in splicing remains elusive. In this study, we demonstrate for the first time that Kic1 not only is required for efficient splicing but also affects mRNA export, providing evidence for the conserved roles of LAMMER kinases in the unicellular context of fission yeast. Consistent with the hypothesis of its direct participation in multiple steps of pre-mRNA processing, Kic1 is predominantly present in the nucleus during interphase. In addition, the kinase activity of Kic1 plays a role in modulating its own cellular partitioning. Interestingly, Kic1 expression oscillates in a cell cycle-dependent manner and the peak level coincides with mitosis and cytokinesis, revealing a potential mechanism for controlling the kinase activity during the cell cycle. The novel information about the in vivo functions and regulation of Kic1 offers insights into the conserved biological roles fundamental to LAMMER kinases in eukaryotes.

  4. Spatial Organization and Dynamics of Transcription Elongation and Pre-mRNA Processing in Live Cells

    Directory of Open Access Journals (Sweden)

    Miguel Sánchez-Álvarez

    2011-01-01

    Full Text Available During the last 30 years, systematic biochemical and functional studies have significantly expanded our knowledge of the transcriptional molecular components and the pre-mRNA processing machinery of the cell. However, our current understanding of how these functions take place spatiotemporally within the highly compartmentalized eukaryotic nucleus remains limited. Moreover, it is increasingly clear that “the whole is more than the sum of its parts” and that an understanding of the dynamic coregulation of genes is essential for fully characterizing complex biological phenomena and underlying diseases. Recent technological advances in light microscopy in addition to novel cell and molecular biology approaches have led to the development of new tools, which are being used to address these questions and may contribute to achieving an integrated and global understanding of how the genome works at a cellular level. Here, we review major hallmarks and novel insights in RNA polymerase II activity and pre-mRNA processing in the context of nuclear organization, as well as new concepts and challenges arising from our ability to gather extensive dynamic information at the single-cell resolution.

  5. Sequestration of DROSHA and DGCR8 by Expanded CGG RNA Repeats Alters MicroRNA Processing in Fragile X-Associated Tremor/Ataxia Syndrome

    Directory of Open Access Journals (Sweden)

    Chantal Sellier

    2013-03-01

    Full Text Available Fragile X-associated tremor/ataxia syndrome (FXTAS is an inherited neurodegenerative disorder caused by the expansion of 55–200 CGG repeats in the 5′ UTR of FMR1. These expanded CGG repeats are transcribed and accumulate in nuclear RNA aggregates that sequester one or more RNA-binding proteins, thus impairing their functions. Here, we have identified that the double-stranded RNA-binding protein DGCR8 binds to expanded CGG repeats, resulting in the partial sequestration of DGCR8 and its partner, DROSHA, within CGG RNA aggregates. Consequently, the processing of microRNAs (miRNAs is reduced, resulting in decreased levels of mature miRNAs in neuronal cells expressing expanded CGG repeats and in brain tissue from patients with FXTAS. Finally, overexpression of DGCR8 rescues the neuronal cell death induced by expression of expanded CGG repeats. These results support a model in which a human neurodegenerative disease originates from the alteration, in trans, of the miRNA-processing machinery.

  6. Genetic determinants of PAM-dependent DNA targeting and pre-crRNA processing in Sulfolobus islandicus

    DEFF Research Database (Denmark)

    Peng, Wenfang; Li, Huan; Hallstrøm, Søren

    2013-01-01

    -adjacent motif (PAM)-dependent DNA targeting activity and mature CRISPR RNA (crRNA) production in this organism, mutants deleting individual genes of the type IA system or removing each of other Cas modules were constructed. Characterization of these mutants revealed that Cas7, Cas5, Cas6, Cas3' and Cas3......" are essential for PAM-dependent DNA targeting activity, whereas Csa5, along with all other Cas modules, is dispensable for the targeting in the crenarchaeon. Cas6 is implicated as the only enzyme for pre-crRNA processing and the crRNA maturation is independent of the DNA targeting activity. Importantly, we show...

  7. Towards RNAi based therapy of liver diseases : diversity and complexity of shRNA and miRNA processing and functions

    NARCIS (Netherlands)

    Maczuga, Piotr

    2013-01-01

    Familial hypercholesterolemia (FH) is a genetic disorder characterized by high levels of low density lipoprotein cholesterol (LDL-C) and increasing the risk of cardio vascular diseases. FH and many other liver diseases can possibly be treated with RNA interference (RNAi). RNAi is a natural process

  8. The rRNA evolution and procaryotic phylogeny

    Science.gov (United States)

    Fox, G. E.

    1986-01-01

    Studies of ribosomal RNA primary structure allow reconstruction of phylogenetic trees for prokaryotic organisms. Such studies reveal major dichotomy among the bacteria that separates them into eubacteria and archaebacteria. Both groupings are further segmented into several major divisions. The results obtained from 5S rRNA sequences are essentially the same as those obtained with the 16S rRNA data. In the case of Gram negative bacteria the ribosomal RNA sequencing results can also be directly compared with hybridization studies and cytochrome c sequencing studies. There is again excellent agreement among the several methods. It seems likely then that the overall picture of microbial phylogeny that is emerging from the RNA sequence studies is a good approximation of the true history of these organisms. The RNA data allow examination of the evolutionary process in a semi-quantitative way. The secondary structures of these RNAs are largely established. As a result it is possible to recognize examples of local structural evolution. Evolutionary pathways accounting for these events can be proposed and their probability can be assessed.

  9. The Old and New RNA World

    Directory of Open Access Journals (Sweden)

    Zofia Szweykowska-Kulińska

    2014-12-01

    Full Text Available Among the numerous hypotheses offering a scenario for the origin of life on Earth, the one called “The RNA World” has gained the most attention. According to this hypothesis RNA acted as a genetic information storage material, as a catalyst of all metabolic reactions, and as a regulator of all processes in the primordial world. Various experiments show that RNA molecules could have been synthesized abiotically, with the potential to mediate a whole repertoire of metabolic reactions. Ribozymes carrying out aminoacyl-tRNA reactions have been found in SELEX (systematic evolution of ligands by exponential enrichment approaches and the development of a ribosome from a RNA-built protoribosome is easy to imagine. Transfer RNA aminoacylation, protoribosome origin, and the availability of amino acids on early Earth allowed the genetic code to evolve. Encoded proteins most likely stabilized RNA molecules and were able to create channels across membranes. In the modern cell, DNA replaced RNA as the main depositor of genetic information and proteins carry out almost all metabolic reactions. However, RNA is still playing versatile, crucial roles in the cell. Apart from its classical functions in the cell, a huge small RNA world is controlling gene expression, chromatin condensation, response to environmental cues, and protecting the cell against the invasion of various nucleic acids forms. Long non-coding RNAs act as crucial gene expression regulators. Riboswitches act at the level of transcription, splicing or translation and mediate feedback regulation on biosynthesis and transport of the ligand they sense. Alternative splicing generates genetic variability and increases the protein repertoire in response to developmental or environmental changes. All these regulatory functions are essential in shaping cell plasticity in the changing milieu. Recent discoveries of new, unexpected and important functions of RNA molecules support the hypothesis that we

  10. RNA Processing Factor 5 is required for efficient 5' cleavage at a processing site conserved in RNAs of three different mitochondrial genes in Arabidopsis thaliana.

    Science.gov (United States)

    Hauler, Aron; Jonietz, Christian; Stoll, Birgit; Stoll, Katrin; Braun, Hans-Peter; Binder, Stefan

    2013-05-01

    The 5' ends of many mitochondrial transcripts are generated post-transcriptionally. Recently, we identified three RNA PROCESSING FACTORs required for 5' end maturation of different mitochondrial mRNAs in Arabidopsis thaliana. All of these factors are pentatricopeptide repeat proteins (PPRPs), highly similar to RESTORERs OF FERTILTY (RF), that rescue male fertility in cytoplasmic male-sterile lines from different species. Therefore, we suggested a general role of these RF-like PPRPs in mitochondrial 5' processing. We now identified RNA PROCESSING FACTOR 5, a PPRP not classified as an RF-like protein, required for the efficient 5' maturation of the nad6 and atp9 mRNAs as well as 26S rRNA. The precursor molecules of these RNAs share conserved sequence elements, approximately ranging from positions -50 to +9 relative to mature 5' mRNA termini, suggesting these sequences to be at least part of the cis elements required for processing. The knockout of RPF5 has only a moderate influence on 5' processing of atp9 mRNA, whereas the generation of the mature nad6 mRNA and 26S rRNA is almost completely abolished in the mutant. The latter leads to a 50% decrease of total 26S rRNA species, resulting in an imbalance between the large rRNA and 18S rRNA. Despite these severe changes in RNA levels and in the proportion between the 26S and 18S rRNAs, mitochondrial protein levels appear to be unaltered in the mutant, whereas seed germination capacity is markedly reduced. © 2013 The Authors The Plant Journal © 2013 John Wiley & Sons Ltd.

  11. In-vivo quantification of primary microRNA processing by Drosha with a luciferase based system

    International Nuclear Information System (INIS)

    Allegra, Danilo; Mertens, Daniel

    2011-01-01

    Research highlights: → Posttranscriptional regulation of miRNA processing is difficult to quantify. → Our in-vivo processing assay can quantify Drosha cleavage in live cells. → It is based on luciferase reporters fused with pri-miRNAs. → The assay validates the processing defect caused by a mutation in pri-16-1. → It is a sensitive method to quantify pri-miRNA cleavage by Drosha in live cells. -- Abstract: The RNAse III Drosha is responsible for the first step of microRNA maturation, the cleavage of primary miRNA to produce the precursor miRNA. Processing by Drosha is finely regulated and influences the amount of mature microRNA in a cell. We describe in the present work a method to quantify Drosha processing activity in-vivo, which is applicable to any microRNA. With respect to other methods for measuring Drosha activity, our system is faster and scalable, can be used with any cellular system and does not require cell sorting or use of radioactive isotopes. This system is useful to study regulation of Drosha activity in physiological and pathological conditions.

  12. Processing of nuclear viroids in vivo: an interplay between RNA conformations.

    Directory of Open Access Journals (Sweden)

    María-Eugenia Gas

    2007-11-01

    Full Text Avai