WorldWideScience

Sample records for ribosomal rna maturation

  1. rRNA maturation as a "quality" control step in ribosomal subunit assembly in Dictyostelium discoideum.

    Science.gov (United States)

    Mangiarotti, G; Chiaberge, S; Bulfone, S

    1997-10-31

    In Dictyostelium discoideum, newly assembled ribosomal subunits enter polyribosomes while they still contain immature rRNA. rRNA maturation requires the engagement of the subunits in protein synthesis and leads to stabilization of their structure. Maturation of pre-17 S rRNA occurs only after the newly formed 40 S ribosomal particle has entered an 80 S ribosome and participated at least in the formation of one peptide bond or in one translocation event; maturation of pre-26 S rRNA requires the presence on the 80 S particle of a peptidyl-tRNA containing at least 6 amino acids. Newly assembled particles that cannot fulfill these requirements for structural reasons are disassembled into free immature rRNA and ribosomal proteins.

  2. Ribosome maturation in E. coli.

    Science.gov (United States)

    Silengo, L; Altruda, F; Dotto, G P; Lacquaniti, F; Perlo, C; Turco, E; Mangiarotti, G

    1977-01-01

    In vivo and in vitro experiments have shown that processing of ribosomal RNA is a late event in ribosome biogenesis. The precursor form of RNA is probably necessary to speed up the assembly of ribomal proteins. Newly formed ribosomal particles which have already entered polyribosomes differ from mature ribosomes not only in their RNA content but also in their susceptibility to unfolding in low Mg concentration and to RNase attack. Final maturation of new ribosomes is probably dependent on their functioning in protein synthesis. Thus only those ribosomes which have proven to be functional may be converted into stable cellular structures.

  3. rRNA maturation in yeast cells depleted of large ribosomal subunit proteins.

    Directory of Open Access Journals (Sweden)

    Gisela Pöll

    Full Text Available The structural constituents of the large eukaryotic ribosomal subunit are 3 ribosomal RNAs, namely the 25S, 5.8S and 5S rRNA and about 46 ribosomal proteins (r-proteins. They assemble and mature in a highly dynamic process that involves more than 150 proteins and 70 small RNAs. Ribosome biogenesis starts in the nucleolus, continues in the nucleoplasm and is completed after nucleo-cytoplasmic translocation of the subunits in the cytoplasm. In this work we created 26 yeast strains, each of which conditionally expresses one of the large ribosomal subunit (LSU proteins. In vivo depletion of the analysed LSU r-proteins was lethal and led to destabilisation and degradation of the LSU and/or its precursors. Detailed steady state and metabolic pulse labelling analyses of rRNA precursors in these mutant strains showed that LSU r-proteins can be grouped according to their requirement for efficient progression of different steps of large ribosomal subunit maturation. Comparative analyses of the observed phenotypes and the nature of r-protein-rRNA interactions as predicted by current atomic LSU structure models led us to discuss working hypotheses on i how individual r-proteins control the productive processing of the major 5' end of 5.8S rRNA precursors by exonucleases Rat1p and Xrn1p, and ii the nature of structural characteristics of nascent LSUs that are required for cytoplasmic accumulation of nascent subunits but are nonessential for most of the nuclear LSU pre-rRNA processing events.

  4. GTPases involved in bacterial ribosome maturation.

    Science.gov (United States)

    Goto, Simon; Muto, Akira; Himeno, Hyouta

    2013-05-01

    The ribosome is an RNA- and protein-based macromolecule having multiple functional domains to facilitate protein synthesis, and it is synthesized through multiple steps including transcription, stepwise cleavages of the primary transcript, modifications of ribosomal proteins and RNAs and assemblies of ribosomal proteins with rRNAs. This process requires dozens of trans-acting factors including GTP- and ATP-binding proteins to overcome several energy-consuming steps. Despite accumulation of genetic, biochemical and structural data, the entire process of bacterial ribosome synthesis remains elusive. Here, we review GTPases involved in bacterial ribosome maturation.

  5. Reconstitution of functional eukaryotic ribosomes from Dictyostelium discoideum ribosomal proteins and RNA.

    Science.gov (United States)

    Mangiarotti, G; Chiaberge, S

    1997-08-08

    40 and 60 S ribosomal subunits have been reconstituted in vitro from purified ribosomal RNA and ribosomal proteins of Dictyostelium discoideum. The functionality of the reconstituted ribosomes was demonstrated in in vitro mRNA-directed protein synthesis. The reassembly proceeded well with immature precursors of ribosomal RNA but poorly if at all with mature cytoplasmic RNA species. Reassembly also required a preparation of small nuclear RNA(s), acting as morphopoietic factor(s).

  6. Bypassing rRNA methylation by RsmA/Dim1during ribosome maturation in the hyperthermophilic archaeon Nanoarchaeum equitans

    DEFF Research Database (Denmark)

    Seistrup, Kenneth H; Rose, Simon; Birkedal, Ulf

    2017-01-01

    In all free-living organisms a late-stage checkpoint in the biogenesis of the small ribosomal subunit involves rRNA modification by an RsmA/Dim1 methyltransferase. The hyperthermophilic archaeon Nanoarchaeum equitans, whose existence is confined to the surface of a second archaeon, Ignicoccus hos...

  7. [Ribosomal RNA Evolution

    Science.gov (United States)

    1997-01-01

    It is generally believed that an RNA World existed at an early stage in the history of life. During this early period, RNA molecules are seen to be potentially involved in both catalysis and the storage of genetic information. Translation presents several interrelated themes of inquiry for exobiology. First, it is essential, for understanding the very origin of life, how peptides and eventually proteins might have come to be made on the early Earth in a template directed manner. Second, it is necessary to understand how a machinery of similar complexity to that found in the ribosomes of modern organisms came to exist by the time of the last common ancestor (as detected by 16S rRNA sequence studies). Third, the ribosomal RNAs themselves likely had a very early origin and studies of their history may be very informative about the nature of the RNA World. Moreover, studies of these RNAs will contribute to a better understanding of the potential roles of RNA in early evolution.During the past year we have ave conducted a comparative study of four completely sequenced bacterial genoames. We have focused initially on conservation of gene order. The second component of the project continues to build on the model system for studying the validity of variant 5S rRNA sequences in the vicinity of the modern Vibrio proteolyticus 5S rRNA that we established earlier. This system has made it possible to conduct a detailed and extensive analysis of a local portion of the sequence space. These core methods have been used to construct numerous mutants during the last several years. Although it has been a secondary focus, this work has continued over the last year such that we now have in excess of 125 V. proteolyticus derived constructs which have been made and characterized. We have also continued high resolution NMR work on RNA oligomers originally initiated by G. Kenneth Smith who was funded by a NASA Graduate Student Researcher's Fellowship Award until May of 1996. Mr. Smith

  8. Limited portability of G-patch domains in regulators of the Prp43 RNA helicase required for pre-mRNA splicing and ribosomal RNA maturation in Saccharomyces cerevisiae.

    Science.gov (United States)

    Banerjee, Daipayan; McDaniel, Peter M; Rymond, Brian C

    2015-05-01

    The Prp43 DExD/H-box protein is required for progression of the biochemically distinct pre-messenger RNA and ribosomal RNA (rRNA) maturation pathways. In Saccharomyces cerevisiae, the Spp382/Ntr1, Sqs1/Pfa1, and Pxr1/Gno1 proteins are implicated as cofactors necessary for Prp43 helicase activation during spliceosome dissociation (Spp382) and rRNA processing (Sqs1 and Pxr1). While otherwise dissimilar in primary sequence, these Prp43-binding proteins each contain a short glycine-rich G-patch motif required for function and thought to act in protein or nucleic acid recognition. Here yeast two-hybrid, domain-swap, and site-directed mutagenesis approaches are used to investigate G-patch domain activity and portability. Our results reveal that the Spp382, Sqs1, and Pxr1 G-patches differ in Prp43 two-hybrid response and in the ability to reconstitute the Spp382 and Pxr1 RNA processing factors. G-patch protein reconstitution did not correlate with the apparent strength of the Prp43 two-hybrid response, suggesting that this domain has function beyond that of a Prp43 tether. Indeed, while critical for Pxr1 activity, the Pxr1 G-patch appears to contribute little to the yeast two-hybrid interaction. Conversely, deletion of the primary Prp43 binding site within Pxr1 (amino acids 102-149) does not impede rRNA processing but affects small nucleolar RNA (snoRNA) biogenesis, resulting in the accumulation of slightly extended forms of select snoRNAs, a phenotype unexpectedly shared by the prp43 loss-of-function mutant. These and related observations reveal differences in how the Spp382, Sqs1, and Pxr1 proteins interact with Prp43 and provide evidence linking G-patch identity with pathway-specific DExD/H-box helicase activity.

  9. 5S rRNA and ribosome.

    Science.gov (United States)

    Gongadze, G M

    2011-12-01

    5S rRNA is an integral component of the ribosome of all living organisms. It is known that the ribosome without 5S rRNA is functionally inactive. However, the question about the specific role of this RNA in functioning of the translation apparatus is still open. This review presents a brief history of the discovery of 5S rRNA and studies of its origin and localization in the ribosome. The previously expressed hypotheses about the role of this RNA in the functioning of the ribosome are discussed considering the unique location of 5S rRNA in the ribosome and its intermolecular contacts. Based on analysis of the current data on ribosome structure and its functional complexes, the role of 5S rRNA as an intermediary between ribosome functional domains is discussed.

  10. Ribosomal ribonucleic acid maturation during bacterial spore germination.

    Science.gov (United States)

    Bleyman, M; Woese, C

    1969-01-01

    All the ribosomal ribonucleic acid made during the early stages of germination of spores of Bacillus subtilis is of the "precursor" type, i.e., that type appearing in the incomplete forms of the ribosome. Shortly before the onset of deoxyribonucleic acid synthesis in germination, this precursor ribonucleic acid changed to the mature ribosomal ribonucleic acid characteristic of the 30S and 50S ribosomal subunits.

  11. Precursors of ribosomal RNA in yeast nucleus : Biosynthesis and relation to cytoplasmic ribosomal RNA

    NARCIS (Netherlands)

    Sillevis Smitt, W.W.; Vlak, J.M.; Schiphof, R.; Rozijn, Th.H.

    In vivo methylated precursors of ribosomal RNA in yeast have been characterized on acrylamide gels. The initial ribosomal precursor in the yeast nucleus is a 37S RNA component, which is processed to a nuclear 28S RNA. Both the 37S and the 28S RNA components are important constituents of the yeast

  12. Ribosomal RNA pseudouridines and pseudouridine synthases.

    Science.gov (United States)

    Ofengand, James

    2002-03-01

    Pseudouridines are found in virtually all ribosomal RNAs but their function is unknown. There are four to eight times more pseudouridines in eukaryotes than in eubacteria. Mapping 19 Haloarcula marismortui pseudouridines on the three-dimensional 50S subunit does not show clustering. In bacteria, specific enzymes choose the site of pseudouridine formation. In eukaryotes, and probably also in archaea, selection and modification is done by a guide RNA-protein complex. No unique specific role for ribosomal pseudouridines has been identified. We propose that pseudouridine's function is as a molecular glue to stabilize required RNA conformations that would otherwise be too flexible.

  13. Cisplatin Targeting of Bacterial Ribosomal RNA Hairpins

    Directory of Open Access Journals (Sweden)

    Gayani N. P. Dedduwa-Mudalige

    2015-09-01

    Full Text Available Cisplatin is a clinically important chemotherapeutic agent known to target purine bases in nucleic acids. In addition to major deoxyribonucleic acid (DNA intrastrand cross-links, cisplatin also forms stable adducts with many types of ribonucleic acid (RNA including siRNA, spliceosomal RNAs, tRNA, and rRNA. All of these RNAs play vital roles in the cell, such as catalysis of protein synthesis by rRNA, and therefore serve as potential drug targets. This work focused on platination of two highly conserved RNA hairpins from E. coli ribosomes, namely pseudouridine-modified helix 69 from 23S rRNA and the 790 loop of helix 24 from 16S rRNA. RNase T1 probing, MALDI mass spectrometry, and dimethyl sulfate mapping revealed platination at GpG sites. Chemical probing results also showed platination-induced RNA structural changes. These findings reveal solvent and structural accessibility of sites within bacterial RNA secondary structures that are functionally significant and therefore viable targets for cisplatin as well as other classes of small molecules. Identifying target preferences at the nucleotide level, as well as determining cisplatin-induced RNA conformational changes, is important for the design of more potent drug molecules. Furthermore, the knowledge gained through studies of RNA-targeting by cisplatin is applicable to a broad range of organisms from bacteria to human.

  14. Reverse Translocation of tRNA in the Ribosome

    OpenAIRE

    2006-01-01

    A widely held view is that directional movement of tRNA in the ribosome is determined by an intrinsic mechanism and driven thermodynamically by transpeptidation. Here, we show that, in certain ribosomal complexes, the pretranslocation (PRE) state is thermodynamically favored over the posttranslocation (POST) state. Spontaneous and efficient conversion from the POST to PRE state is observed when EF-G is depleted from ribosomes in the POST state or when tRNA is added to the E site of ribosomes ...

  15. Higher order structure in ribosomal RNA.

    Science.gov (United States)

    Gutell, R R; Noller, H F; Woese, C R

    1986-05-01

    The only reliable general method currently available for determining precise higher order structure in the large ribosomal RNAs is comparative sequence analysis. The method is here applied to reveal 'tertiary' structure in the 16S-like rRNAs, i.e. structure more complex than simple double-helical, secondary structure. From a list of computer-generated potential higher order interactions within 16S rRNA one such interaction considered likely was selected for experimental test. The putative interaction involves a Watson-Crick one to one correspondence between positions 570 and 866 in the molecule (E. coli numbering). Using existing oligonucleotide catalog information several organisms were selected whose 16S rRNA sequences might test the proposed co-variation. In all of the (phylogenetically independent) cases selected, full sequence evidence confirms the predicted one to one (Watson-Crick) correspondence. An interaction between positions 570 and 866 is, therefore, considered proven phylogenetically.

  16. Structural features of the tmRNA-ribosome interaction.

    Science.gov (United States)

    Bugaeva, Elizaveta Y; Surkov, Serhiy; Golovin, Andrey V; Ofverstedt, Lars-Göran; Skoglund, Ulf; Isaksson, Leif A; Bogdanov, Alexey A; Shpanchenko, Olga V; Dontsova, Olga A

    2009-12-01

    Trans-translation is a process which switches the synthesis of a polypeptide chain encoded by a nonstop messenger RNA to the mRNA-like domain of a transfer-messenger RNA (tmRNA). It is used in bacterial cells for rescuing the ribosomes arrested during translation of damaged mRNA and directing this mRNA and the product polypeptide for degradation. The molecular basis of this process is not well understood. Earlier, we developed an approach that allowed isolation of tmRNA-ribosomal complexes arrested at a desired step of tmRNA passage through the ribosome. We have here exploited it to examine the tmRNA structure using chemical probing and cryo-electron microscopy tomography. Computer modeling has been used to develop a model for spatial organization of the tmRNA inside the ribosome at different stages of trans-translation.

  17. The human Shwachman-Diamond syndrome protein, SBDS, associates with ribosomal RNA.

    Science.gov (United States)

    Ganapathi, Karthik A; Austin, Karyn M; Lee, Chung-Sheng; Dias, Anusha; Malsch, Maggie M; Reed, Robin; Shimamura, Akiko

    2007-09-01

    Shwachman-Diamond syndrome (SDS) is an autosomal recessive disorder characterized by bone marrow failure, exocrine pancreatic dysfunction, and leukemia predisposition. Mutations in the SBDS gene are identified in most patients with SDS. SBDS encodes a highly conserved protein of unknown function. Data from SBDS orthologs suggest that SBDS may play a role in ribosome biogenesis or RNA processing. Human SBDS is enriched in the nucleolus, the major cellular site of ribosome biogenesis. Here we report that SBDS nucleolar localization is dependent on active rRNA transcription. Cells from patients with SDS or Diamond-Blackfan anemia are hypersensitive to low doses of actinomycin D, an inhibitor of rRNA transcription. The addition of wild-type SBDS complements the actinomycin D hypersensitivity of SDS patient cells. SBDS migrates together with the 60S large ribosomal subunit in sucrose gradients and coprecipitates with 28S ribosomal RNA (rRNA). Loss of SBDS is not associated with a discrete block in rRNA maturation or with decreased levels of the 60S ribosomal subunit. SBDS forms a protein complex with nucleophosmin, a multifunctional protein implicated in ribosome biogenesis and leukemogenesis. Our studies support the addition of SDS to the growing list of human bone marrow failure syndromes involving the ribosome.

  18. Mapping the interaction of SmpB with ribosomes by footprinting of ribosomal RNA

    Science.gov (United States)

    Ivanova, Natalia; Pavlov, Michael Y.; Bouakaz, Elli; Ehrenberg, Måns; Schiavone, Lovisa Holmberg

    2005-01-01

    In trans-translation transfer messenger RNA (tmRNA) and small protein B (SmpB) rescue ribosomes stalled on truncated or in other ways problematic mRNAs. SmpB promotes the binding of tmRNA to the ribosome but there is uncertainty about the number of participating SmpB molecules as well as their ribosomal location. Here, the interaction of SmpB with ribosomal subunits and ribosomes was studied by isolation of SmpB containing complexes followed by chemical modification of ribosomal RNA with dimethyl sulfate, kethoxal and hydroxyl radicals. The results show that SmpB binds 30S and 50S subunits with 1:1 molar ratios and the 70S ribosome with 2:1 molar ratio. SmpB-footprints are similar on subunits and the ribosome. In the 30S subunit, SmpB footprints nucleotides that are in the vicinity of the P-site facing the E-site, and in the 50S subunit SmpB footprints nucleotides that are located below the L7/L12 stalk in the 3D structure of the ribosome. Based on these results, we suggest a mechanism where two molecules of SmpB interact with tmRNA and the ribosome during trans-translation. The first SmpB molecule binds near the factor-binding site on the 50S subunit helping tmRNA accommodation on the ribosome, whereas the second SmpB molecule may functionally substitute for a missing anticodon stem–loop in tmRNA during later steps of trans-translation. PMID:15972795

  19. Structural and Functional Studies of Ribosome-inactivating Proteins and Ribosomal RNA

    Institute of Scientific and Technical Information of China (English)

    LIU Wangyi; ZHANG Jinsong; LIU Renshui; HE Wenjun; LING Jun

    2007-01-01

    @@ A plant's ribosome-inactivating proteins (RIPs) are a group of toxic proteins. Theoretically, they can be employed as a tool enzyme in the exploration of the structure and function of the ribosomal RNA; in practical application, they can be used as an insecticide in agriculture, for preparation of immuno-toxic protein to kill cancer cells or against viral infection in medicine.

  20. Translation with frameshifting of ribosome along mRNA transcript

    CERN Document Server

    Li, Jingwei

    2015-01-01

    Translation is an important process for prokaryotic and eukaryotic cells to produce necessary proteins for cell growth. Numerious experiments have been performed to explore the translational properties. Diverse models have also been developed to determine the biochemical mechanism of translation. However, to simplify the majority of the existing models, the frameshifting of ribosome along the mRNA transcript is neglected, which actually occurs in real cells and has been extensively experimentally studied. The frameshifting of ribosome evidently influences the efficiency and speed of translation, considering that the peptide chains synthesized by shifted ribosomes will not fold into functional proteins and will degrade rapidly. In this study, a theoretical model is presented to describe the translational process based on the model for totally asymmetric simple exclusion process. In this model, the frameshifting of the ribosome along the mRNA transcript and the attachment/detachment of the ribosome to/from the ...

  1. Hierarchical RNA Processing Is Required for Mitochondrial Ribosome Assembly

    Directory of Open Access Journals (Sweden)

    Oliver Rackham

    2016-08-01

    Full Text Available The regulation of mitochondrial RNA processing and its importance for ribosome biogenesis and energy metabolism are not clear. We generated conditional knockout mice of the endoribonuclease component of the RNase P complex, MRPP3, and report that it is essential for life and that heart and skeletal-muscle-specific knockout leads to severe cardiomyopathy, indicating that its activity is non-redundant. Transcriptome-wide parallel analyses of RNA ends (PARE and RNA-seq enabled us to identify that in vivo 5′ tRNA cleavage precedes 3′ tRNA processing, and this is required for the correct biogenesis of the mitochondrial ribosomal subunits. We identify that mitoribosomal biogenesis proceeds co-transcriptionally because large mitoribosomal proteins can form a subcomplex on an unprocessed RNA containing the 16S rRNA. Taken together, our data show that RNA processing links transcription to translation via assembly of the mitoribosome.

  2. mRNA pseudoknot structures can act as ribosomal roadblocks

    DEFF Research Database (Denmark)

    Hansen, Jesper Tholstrup; Oddershede, Lene Broeng; Sørensen, Michael Askvad

    2012-01-01

    Several viruses utilize programmed ribosomal frameshifting mediated by mRNA pseudoknots in combination with a slippery sequence to produce a well defined stochiometric ratio of the upstream encoded to the downstream-encoded protein. A correlation between the mechanical strength of mRNA pseudoknot...

  3. A Molecular Titration System Coordinates Ribosomal Protein Gene Transcription with Ribosomal RNA Synthesis.

    Science.gov (United States)

    Albert, Benjamin; Knight, Britta; Merwin, Jason; Martin, Victoria; Ottoz, Diana; Gloor, Yvonne; Bruzzone, Maria Jessica; Rudner, Adam; Shore, David

    2016-11-17

    Cell growth potential is determined by the rate of ribosome biogenesis, a complex process that requires massive and coordinated transcriptional output. In the yeast Saccharomyces cerevisiae, ribosome biogenesis is highly regulated at the transcriptional level. Although evidence for a system that coordinates ribosomal RNA (rRNA) and ribosomal protein gene (RPG) transcription has been described, the molecular mechanisms remain poorly understood. Here we show that an interaction between the RPG transcriptional activator Ifh1 and the rRNA processing factor Utp22 serves to coordinate RPG transcription with that of rRNA. We demonstrate that Ifh1 is rapidly released from RPG promoters by a Utp22-independent mechanism following growth inhibition, but that its long-term dissociation requires Utp22. We present evidence that RNA polymerase I activity inhibits the ability of Utp22 to titrate Ifh1 from RPG promoters and propose that a dynamic Ifh1-Utp22 interaction fine-tunes RPG expression to coordinate RPG and rRNA transcription. Copyright © 2016 Elsevier Inc. All rights reserved.

  4. Molecular characterization of 5S ribosomal RNA genes and transcripts in the protozoan parasite Leishmania major.

    Science.gov (United States)

    Moreno-Campos, Rodrigo; Florencio-Martínez, Luis E; Nepomuceno-Mejía, Tomás; Rojas-Sánchez, Saúl; Vélez-Ramírez, Daniel E; Padilla-Mejía, Norma E; Figueroa-Angulo, Elisa; Manning-Cela, Rebeca; Martínez-Calvillo, Santiago

    2016-12-01

    Eukaryotic 5S rRNA, synthesized by RNA polymerase III (Pol III), is an essential component of the large ribosomal subunit. Most organisms contain hundreds of 5S rRNA genes organized into tandem arrays. However, the genome of the protozoan parasite Leishmania major contains only 11 copies of the 5S rRNA gene, which are interspersed and associated with other Pol III-transcribed genes. Here we report that, in general, the number and order of the 5S rRNA genes is conserved between different species of Leishmania. While in most organisms 5S rRNA genes are normally associated with the nucleolus, combined fluorescent in situ hybridization and indirect immunofluorescence experiments showed that 5S rRNA genes are mainly located at the nuclear periphery in L. major. Similarly, the tandemly repeated 5S rRNA genes in Trypanosoma cruzi are dispersed throughout the nucleus. In contrast, 5S rRNA transcripts in L. major were localized within the nucleolus, and scattered throughout the cytoplasm, where mature ribosomes are located. Unlike other rRNA species, stable antisense RNA complementary to 5S rRNA is not detected in L. major.

  5. Ribosomal RNA: a key to phylogeny

    Science.gov (United States)

    Olsen, G. J.; Woese, C. R.

    1993-01-01

    As molecular phylogeny increasingly shapes our understanding of organismal relationships, no molecule has been applied to more questions than have ribosomal RNAs. We review this role of the rRNAs and some of the insights that have been gained from them. We also offer some of the practical considerations in extracting the phylogenetic information from the sequences. Finally, we stress the importance of comparing results from multiple molecules, both as a method for testing the overall reliability of the organismal phylogeny and as a method for more broadly exploring the history of the genome.

  6. Ribosomal RNA: a key to phylogeny

    Science.gov (United States)

    Olsen, G. J.; Woese, C. R.

    1993-01-01

    As molecular phylogeny increasingly shapes our understanding of organismal relationships, no molecule has been applied to more questions than have ribosomal RNAs. We review this role of the rRNAs and some of the insights that have been gained from them. We also offer some of the practical considerations in extracting the phylogenetic information from the sequences. Finally, we stress the importance of comparing results from multiple molecules, both as a method for testing the overall reliability of the organismal phylogeny and as a method for more broadly exploring the history of the genome.

  7. Reverse translocation of tRNA in the ribosome.

    Science.gov (United States)

    Shoji, Shinichiro; Walker, Sarah E; Fredrick, Kurt

    2006-12-28

    A widely held view is that directional movement of tRNA in the ribosome is determined by an intrinsic mechanism and driven thermodynamically by transpeptidation. Here, we show that, in certain ribosomal complexes, the pretranslocation (PRE) state is thermodynamically favored over the posttranslocation (POST) state. Spontaneous and efficient conversion from the POST to PRE state is observed when EF-G is depleted from ribosomes in the POST state or when tRNA is added to the E site of ribosomes containing P-site tRNA. In the latter assay, the rate of tRNA movement is increased by streptomycin and neomycin, decreased by tetracycline, and not affected by the acylation state of the tRNA. In one case, we provide evidence that complex conversion occurs by reverse translocation (i.e., direct movement of the tRNAs from the E and P sites to the P and A sites, respectively). These findings have important implications for the energetics of translocation.

  8. Polyadenylation of ribosomal RNA in human cells

    OpenAIRE

    Slomovic, Shimyn; Laufer, David; Geiger, Dan; Schuster, Gadi

    2006-01-01

    The addition of poly(A)-tails to RNA is a process common to almost all organisms. In eukaryotes, stable poly(A)-tails, important for mRNA stability and translation initiation, are added to the 3′ ends of most nuclear-encoded mRNAs, but not to rRNAs. Contrarily, in prokaryotes and organelles, polyadenylation stimulates RNA degradation. Recently, polyadenylation of nuclear-encoded transcripts in yeast was reported to promote RNA degradation, demonstrating that polyadenylation can play a double-...

  9. RNA structures regulating ribosomal protein biosynthesis in bacilli.

    Science.gov (United States)

    Deiorio-Haggar, Kaila; Anthony, Jon; Meyer, Michelle M

    2013-07-01

    In Bacilli, there are three experimentally validated ribosomal-protein autogenous regulatory RNAs that are not shared with E. coli. Each of these RNAs forms a unique secondary structure that interacts with a ribosomal protein encoded by a downstream gene, namely S4, S15, and L20. Only one of these RNAs that interacts with L20 is currently found in the RNA Families Database. We created, or modified, existing structural alignments for these three RNAs and used them to perform homology searches. We have determined that each structure exhibits a narrow phylogenetic distribution, mostly relegated to the Firmicute class Bacilli. This work, in conjunction with other similar work, demonstrates that there are most likely many non-homologous RNA regulatory elements regulating ribosomal protein biosynthesis that still await discovery and characterization in other bacterial species.

  10. Interaction of tRNA with Eukaryotic Ribosome

    Directory of Open Access Journals (Sweden)

    Dmitri Graifer

    2015-03-01

    Full Text Available This paper is a review of currently available data concerning interactions of tRNAs with the eukaryotic ribosome at various stages of translation. These data include the results obtained by means of cryo-electron microscopy and X-ray crystallography applied to various model ribosomal complexes, site-directed cross-linking with the use of tRNA derivatives bearing chemically or photochemically reactive groups in the CCA-terminal fragment and chemical probing of 28S rRNA in the region of the peptidyl transferase center. Similarities and differences in the interactions of tRNAs with prokaryotic and eukaryotic ribosomes are discussed with concomitant consideration of the extent of resemblance between molecular mechanisms of translation in eukaryotes and bacteria.

  11. The European database on small subunit ribosomal RNA

    OpenAIRE

    Wuyts, Jan; Van de Peer, Yves; Winkelmans, Tina; De Wachter, Rupert

    2002-01-01

    The European database on SSU rRNA can be consulted via the World WideWeb at http://rrna.uia.ac.be/ssu/ and compiles all complete or nearly complete small subunit ribosomal RNA sequences. Sequences are provided in aligned format. The alignment takes into account the secondary structure information derived by comparative sequence analysis of thousands of sequences. Additional information such as literature references, taxonomy, secondary structure models and nucleotide variability maps, is also...

  12. Structural Studies of RNA Helicases Involved in Eukaryotic Pre-mRNA Splicing, Ribosome Biogenesis, and Translation Initiation

    DEFF Research Database (Denmark)

    He, Yangzi

    -rRNA. It is nucleolytically cleaved and chemically modified to generate mature rRNAs, which assemble with ribosomal proteins to form the ribosome. Prp43 is required for the processing of the 18S rRNA. Using X-ray crystallography, I determined a high resolution structure of Prp43 bound to ADP, the first structure of a DEAH....../RHA helicase. It defined the conserved structural features of all DEAH/RHA helicases, and unveiled a novel nucleotide binding site. Additionally a preliminary low resolution structure of a ternary complex comprising Prp43, a non-hydrolyzable ATP analogue, and a single-stranded RNA, was obtained. The ribosome...... translates the genetic message encoded in mRNAs to synthesize proteins. Initiation of translation requires localization and recognition of the start codon at the P-site of the 40S small ribosomal subunit. On most eukaryotic mRNAs, the start codon is identified by a scanning mechanism, whereby a small subunit...

  13. RNA polymerase and the ribosome: the close relationship.

    Science.gov (United States)

    McGary, Katelyn; Nudler, Evgeny

    2013-04-01

    In bacteria transcription and translation are linked in time and space. When coupled to RNA polymerase (RNAP), the translating ribosome ensures transcriptional processivity by preventing RNAP backtracking. Recent advances in the field have characterized important linker proteins that bridge the gap between transcription and translation: In particular, the NusE(S10):NusG complex and the NusG homolog, RfaH. The direct link between the moving ribosome and RNAP provides a basis for maintaining genomic integrity while enabling efficient transcription and timely translation of various genes within the bacterial cell. Copyright © 2013 Elsevier Ltd. All rights reserved.

  14. DNAJC21 Mutations Link a Cancer-Prone Bone Marrow Failure Syndrome to Corruption in 60S Ribosome Subunit Maturation.

    Science.gov (United States)

    Tummala, Hemanth; Walne, Amanda J; Williams, Mike; Bockett, Nicholas; Collopy, Laura; Cardoso, Shirleny; Ellison, Alicia; Wynn, Rob; Leblanc, Thierry; Fitzgibbon, Jude; Kelsell, David P; van Heel, David A; Payne, Elspeth; Plagnol, Vincent; Dokal, Inderjeet; Vulliamy, Tom

    2016-07-07

    A substantial number of individuals with bone marrow failure (BMF) present with one or more extra-hematopoietic abnormality. This suggests a constitutional or inherited basis, and yet many of them do not fit the diagnostic criteria of the known BMF syndromes. Through exome sequencing, we have now identified a subgroup of these individuals, defined by germline biallelic mutations in DNAJC21 (DNAJ homolog subfamily C member 21). They present with global BMF, and one individual developed a hematological cancer (acute myeloid leukemia) in childhood. We show that the encoded protein associates with rRNA and plays a highly conserved role in the maturation of the 60S ribosomal subunit. Lymphoblastoid cells obtained from an affected individual exhibit increased sensitivity to the transcriptional inhibitor actinomycin D and reduced amounts of rRNA. Characterization of mutations revealed impairment in interactions with cofactors (PA2G4, HSPA8, and ZNF622) involved in 60S maturation. DNAJC21 deficiency resulted in cytoplasmic accumulation of the 60S nuclear export factor PA2G4, aberrant ribosome profiles, and increased cell death. Collectively, these findings demonstrate that mutations in DNAJC21 cause a cancer-prone BMF syndrome due to corruption of early nuclear rRNA biogenesis and late cytoplasmic maturation of the 60S subunit.

  15. c-Myc co-ordinates mRNA cap methylation and ribosomal RNA production.

    Science.gov (United States)

    Dunn, Sianadh; Lombardi, Olivia; Cowling, Victoria H

    2017-02-01

    The mRNA cap is a structure added to RNA pol II transcripts in eukaryotes, which recruits factors involved in RNA processing, nuclear export and translation initiation. RNA guanine-7 methyltransferase (RNMT)-RNA-activating miniprotein (RAM), the mRNA cap methyltransferase complex, completes the basic functional mRNA cap structure, cap 0, by methylating the cap guanosine. Here, we report that RNMT-RAM co-ordinates mRNA processing with ribosome production. Suppression of RNMT-RAM reduces synthesis of the 45S ribosomal RNA (rRNA) precursor. RNMT-RAM is required for c-Myc expression, a major regulator of RNA pol I, which synthesises 45S rRNA. Constitutive expression of c-Myc restores rRNA synthesis when RNMT-RAM is suppressed, indicating that RNMT-RAM controls rRNA production predominantly by controlling c-Myc expression. We report that RNMT-RAM is recruited to the ribosomal DNA locus, which may contribute to rRNA synthesis in certain contexts. © 2017 The Author(s).

  16. Depletion of Ribosomal RNA Sequences from Single-Cell RNA-Sequencing Library.

    Science.gov (United States)

    Fang, Nan; Akinci-Tolun, Rumeysa

    2016-07-01

    Recent advances in single-cell RNA sequencing technologies have revealed high heterogeneity of gene expression profiles in individual cells. However, most current single-cell RNA-seq methods use oligo-dT priming in the reverse transcription steps and detect only polyA-positive for more accuracy, since there are also polyA-positive non-coding RNAs transcripts, not other important RNA species, such as polyA-negative noncoding RNA. Reverse transcription using random oligos enables detection of not only the noncoding RNA species without polyA tails, but also ribosomal RNA (rRNA). rRNA comprises more than 90% of the total RNA and should be depleted from the RNA-seq library to ensure efficient usage of the sequencing capacity. Commonly used hybridization-based rRNA depletion methods can preserve noncoding RNA in the standard RNA-seq library. However, such rRNA depletion methods require high input amounts of total RNA and do not work at the single-cell level or with limited input DNA. This unit describes a novel procedure for RNA-seq library construction from single cells or a minimal amount of RNA. A thermostable duplex-specific nuclease is used in this method to effectively remove ribosomal RNA sequences following whole-transcriptome amplification and sequencing library construction. © 2016 by John Wiley & Sons, Inc.

  17. Kinetoplastid Specific RNA-Protein Interactions in Trypanosoma cruzi Ribosome Biogenesis.

    Directory of Open Access Journals (Sweden)

    Khan Umaer

    Full Text Available RNA binding proteins (RBP play essential roles in the highly conserved and coordinated process of ribosome biogenesis. Our laboratory has previously characterized two essential and abundant RBPs, P34 and P37, in Trypanosoma brucei which are required for several critical steps in ribosome biogenesis. The genes for these proteins have only been identified in kinetoplastid organisms but not in the host genome. We have identified a homolog of the TbP34 and TbP37 in a T. cruzi strain (termed TcP37/NRBD. Although the N-terminal APK-rich domain and RNA recognition motifs are conserved, the C-terminal region which contains putative nuclear and nucleolar localization signals in TbP34 and TbP37 is almost entirely missing from TcP37/NRBD. We have shown that TcP37/NRBD is expressed in T. cruzi epimastigotes at the level of mature mRNA and protein. Despite the loss of the C-terminal domain, TcP37/NRBD is present in the nucleus, including the nucleolus, and the cytoplasm. TcP37/NRBD interacts directly with Tc 5S rRNA, but does not associate with polyadenylated RNA. TcP37/NRBD also associates in vivo and in vitro with large ribosomal protein TcL5 and, unlike the case of T. brucei, this association is strongly enhanced by the presence of 5S rRNA, suggesting that the loss of the C-terminal domain of TcP37/NRBD may alter the interactions within the complex. These results indicate that the unique preribosomal complex comprised of L5, 5S rRNA, and the trypanosome-specific TcP37/NRBD or TbP34 and TbP37 is functionally conserved in trypanosomes despite the differences in the C-termini of the trypanosome-specific protein components.

  18. Kinetoplastid Specific RNA-Protein Interactions in Trypanosoma cruzi Ribosome Biogenesis.

    Science.gov (United States)

    Umaer, Khan; Williams, Noreen

    2015-01-01

    RNA binding proteins (RBP) play essential roles in the highly conserved and coordinated process of ribosome biogenesis. Our laboratory has previously characterized two essential and abundant RBPs, P34 and P37, in Trypanosoma brucei which are required for several critical steps in ribosome biogenesis. The genes for these proteins have only been identified in kinetoplastid organisms but not in the host genome. We have identified a homolog of the TbP34 and TbP37 in a T. cruzi strain (termed TcP37/NRBD). Although the N-terminal APK-rich domain and RNA recognition motifs are conserved, the C-terminal region which contains putative nuclear and nucleolar localization signals in TbP34 and TbP37 is almost entirely missing from TcP37/NRBD. We have shown that TcP37/NRBD is expressed in T. cruzi epimastigotes at the level of mature mRNA and protein. Despite the loss of the C-terminal domain, TcP37/NRBD is present in the nucleus, including the nucleolus, and the cytoplasm. TcP37/NRBD interacts directly with Tc 5S rRNA, but does not associate with polyadenylated RNA. TcP37/NRBD also associates in vivo and in vitro with large ribosomal protein TcL5 and, unlike the case of T. brucei, this association is strongly enhanced by the presence of 5S rRNA, suggesting that the loss of the C-terminal domain of TcP37/NRBD may alter the interactions within the complex. These results indicate that the unique preribosomal complex comprised of L5, 5S rRNA, and the trypanosome-specific TcP37/NRBD or TbP34 and TbP37 is functionally conserved in trypanosomes despite the differences in the C-termini of the trypanosome-specific protein components.

  19. Kinetoplastid Specific RNA-Protein Interactions in Trypanosoma cruzi Ribosome Biogenesis

    Science.gov (United States)

    Umaer, Khan; Williams, Noreen

    2015-01-01

    RNA binding proteins (RBP) play essential roles in the highly conserved and coordinated process of ribosome biogenesis. Our laboratory has previously characterized two essential and abundant RBPs, P34 and P37, in Trypanosoma brucei which are required for several critical steps in ribosome biogenesis. The genes for these proteins have only been identified in kinetoplastid organisms but not in the host genome. We have identified a homolog of the TbP34 and TbP37 in a T. cruzi strain (termed TcP37/NRBD). Although the N-terminal APK-rich domain and RNA recognition motifs are conserved, the C-terminal region which contains putative nuclear and nucleolar localization signals in TbP34 and TbP37 is almost entirely missing from TcP37/NRBD. We have shown that TcP37/NRBD is expressed in T. cruzi epimastigotes at the level of mature mRNA and protein. Despite the loss of the C-terminal domain, TcP37/NRBD is present in the nucleus, including the nucleolus, and the cytoplasm. TcP37/NRBD interacts directly with Tc 5S rRNA, but does not associate with polyadenylated RNA. TcP37/NRBD also associates in vivo and in vitro with large ribosomal protein TcL5 and, unlike the case of T. brucei, this association is strongly enhanced by the presence of 5S rRNA, suggesting that the loss of the C-terminal domain of TcP37/NRBD may alter the interactions within the complex. These results indicate that the unique preribosomal complex comprised of L5, 5S rRNA, and the trypanosome-specific TcP37/NRBD or TbP34 and TbP37 is functionally conserved in trypanosomes despite the differences in the C-termini of the trypanosome-specific protein components. PMID:26121669

  20. Mechanisms for ribotoxin-induced ribosomal RNA cleavage

    Energy Technology Data Exchange (ETDEWEB)

    He, Kaiyu [Department of Microbiology and Molecular Genetics (United States); Center for Integrative Toxicology, Michigan State University, East Lansing, MI 48824 (United States); Zhou, Hui-Ren [Food Science and Human Nutrition (United States); Pestka, James J., E-mail: pestka@msu.edu [Department of Microbiology and Molecular Genetics (United States); Food Science and Human Nutrition (United States); Center for Integrative Toxicology, Michigan State University, East Lansing, MI 48824 (United States)

    2012-11-15

    The Type B trichothecene deoxynivalenol (DON), a ribotoxic mycotoxin known to contaminate cereal-based foods, induces ribosomal RNA (rRNA) cleavage in the macrophage via p38-directed activation of caspases. Here we employed the RAW 264.7 murine macrophage model to test the hypothesis that this rRNA cleavage pathway is similarly induced by other ribotoxins. Capillary electrophoresis confirmed that the antibiotic anisomycin (≥ 25 ng/ml), the macrocylic trichothecene satratoxin G (SG) (≥ 10 ng/ml) and ribosome-inactivating protein ricin (≥ 300 ng/ml) induced 18s and 28s rRNA fragmentation patterns identical to that observed for DON. Also, as found for DON, inhibition of p38, double-stranded RNA-activated kinase (PKR) and hematopoietic cell kinase (Hck) suppressed MAPK anisomycin-induced rRNA cleavage, while, in contrast, their inhibition did not affect SG- and ricin-induced rRNA fragmentation. The p53 inhibitor pifithrin-μ and pan caspase inhibitor Z-VAD-FMK suppressed rRNA cleavage induced by anisomycin, SG and ricin, indicating that these ribotoxins shared with DON a conserved downstream pathway. Activation of caspases 8, 9 and 3 concurrently with apoptosis further suggested that rRNA cleavage occurred in parallel with both extrinsic and intrinsic pathways of programmed cell death. When specific inhibitors of cathepsins L and B (lysosomal cysteine cathepsins active at cytosolic neutral pH) were tested, only the former impaired anisomycin-, SG-, ricin- and DON-induced rRNA cleavage. Taken together, the data suggest that (1) all four ribotoxins induced p53-dependent rRNA cleavage via activation of cathepsin L and caspase 3, and (2) activation of p53 by DON and anisomycin involved p38 whereas SG and ricin activated p53 by an alternative mechanism. Highlights: ► Deoxynivalenol (DON) anisomycin, satratoxin G (SG) and ricin are ribotoxins. ► Ribotoxins induce 18s and 28s rRNA cleavage in the RAW 264.7 macrophage model. ► Ribotoxins induce rRNA cleavage via

  1. Traffic of interacting ribosomes on mRNA during protein synthesis: effects of chemo-mechanics of individual ribosomes

    CERN Document Server

    Basu, A; Basu, Aakash; Chowdhury, Debashish

    2006-01-01

    Many {\\it ribosomes} simultaneously move on the same messenger RNA (mRNA), each synthesizing a protein. In contrast to the earlier models, here {\\it we develope a ``unified'' theoretical model} that not only incorporates the {\\it mutual exclusions} of the interacting ribosomes, but also describes explicitly the mechano-chemistry of each of these individual cyclic machines during protein synthesis. Using a combination of analytical and numerical techniques of non-equilibrium statistical mechanics, we analyze the rates of protein synthesis and the spatio-temporal oraganization of the ribosomes in this model. We also predict how these properties would change with the changes in the rates of the various chemo-mechanical processes in each ribosome. Finally, we illustrate the power of this model by making experimentally testable predictions on the rates of protein synthesis and the density profiles of the ribosomes on some mRNAs in {\\it E-coli}.

  2. The conserved endoribonuclease YbeY is required for chloroplast ribosomal RNA processing in Arabidopsis.

    Science.gov (United States)

    Liu, Jinwen; Zhou, Wenbin; Liu, Guifeng; Yang, Chuanping; Sun, Yi; Wu, Wenjuan; Cao, Shenquan; Wang, Chong; Hai, Guanghui; Wang, Zhifeng; Bock, Ralph; Huang, Jirong; Cheng, Yuxiang

    2015-05-01

    Maturation of chloroplast ribosomal RNAs (rRNAs) comprises several endoribonucleolytic and exoribonucleolytic processing steps. However, little is known about the specific enzymes involved and the cleavage steps they catalyze. Here, we report the functional characterization of the single Arabidopsis (Arabidopsis thaliana) gene encoding a putative YbeY endoribonuclease. AtYbeY null mutants are seedling lethal, indicating that AtYbeY function is essential for plant growth. Knockdown plants display slow growth and show pale-green leaves. Physiological and ultrastructural analyses of atybeY mutants revealed impaired photosynthesis and defective chloroplast development. Fluorescent microcopy analysis showed that, when fused with the green fluorescence protein, AtYbeY is localized in chloroplasts. Immunoblot and RNA gel-blot assays revealed that the levels of chloroplast-encoded subunits of photosynthetic complexes are reduced in atybeY mutants, but the corresponding transcripts accumulate normally. In addition, atybeY mutants display defective maturation of both the 5' and 3' ends of 16S, 23S, and 4.5S rRNAs as well as decreased accumulation of mature transcripts from the transfer RNA genes contained in the chloroplast rRNA operon. Consequently, mutant plants show a severe deficiency in ribosome biogenesis, which, in turn, results in impaired plastid translational activity. Furthermore, biochemical assays show that recombinant AtYbeY is able to cleave chloroplast rRNAs as well as messenger RNAs and transfer RNAs in vitro. Taken together, our findings indicate that AtYbeY is a chloroplast-localized endoribonuclease that is required for chloroplast rRNA processing and thus for normal growth and development.

  3. Structures of the Bacterial Ribosome in Classical and Hybrid States of tRNA Binding

    Energy Technology Data Exchange (ETDEWEB)

    Dunkle, Jack A.; Wang, Leyi; Feldman, Michael B.; Pulk, Arto; Chen, Vincent B.; Kapral, Gary J.; Noeske, Jonas; Richardson, Jane S.; Blanchard, Scott C.; Cate, Jamie H. Doudna (Cornell); (UCB); (Duke)

    2011-09-06

    During protein synthesis, the ribosome controls the movement of tRNA and mRNA by means of large-scale structural rearrangements. We describe structures of the intact bacterial ribosome from Escherichia coli that reveal how the ribosome binds tRNA in two functionally distinct states, determined to a resolution of {approx}3.2 angstroms by means of x-ray crystallography. One state positions tRNA in the peptidyl-tRNA binding site. The second, a fully rotated state, is stabilized by ribosome recycling factor and binds tRNA in a highly bent conformation in a hybrid peptidyl/exit site. The structures help to explain how the ratchet-like motion of the two ribosomal subunits contributes to the mechanisms of translocation, termination, and ribosome recycling.

  4. Patterns and regulation of ribosomal RNA transcription in Borrelia burgdorferi

    Directory of Open Access Journals (Sweden)

    Schwartz Ira

    2011-01-01

    Full Text Available Abstract Background Borrelia burgdorferi contains one 16S and two tandem sets of 23S-5S ribosomal (r RNA genes whose patterns of transcription and regulation are unknown but are likely to be critical for survival and persistence in its hosts. Results RT-PCR of B. burgdorferi N40 and B31 revealed three rRNA region transcripts: 16S rRNA-alanine transfer RNA (tRNAAla; tRNAIle; and both sets of 23S-5S rRNA. At 34°C, there were no differences in growth rate or in accumulation of total protein, DNA and RNA in B31 cultured in Barbour-Stoenner-Kelly (BSK-H whether rabbit serum was present or not. At 23°C, B31 grew more slowly in serum-containing BSK-H than at 34°C. DNA per cell was higher in cells in exponential as compared to stationary phase at either temperature; protein per cell was similar at both temperatures in both phases. Similar amounts of rRNA were produced in exponential phase at both temperatures, and rRNA was down-regulated in stationary phase at either temperature. Interestingly, a relBbu deletion mutant unable to generate (pppGpp did not down-regulate rRNA at transition to stationary phase in serum-containing BSK-H at 34°C, similar to the relaxed phenotype of E. coli relA mutants. Conclusions We conclude that rRNA transcription in B. burgdorferi is complex and regulated both by growth phase and by the stringent response but not by temperature-modulated growth rate.

  5. UtpA and UtpB chaperone nascent pre-ribosomal RNA and U3 snoRNA to initiate eukaryotic ribosome assembly

    Science.gov (United States)

    Hunziker, Mirjam; Barandun, Jonas; Petfalski, Elisabeth; Tan, Dongyan; Delan-Forino, Clémentine; Molloy, Kelly R.; Kim, Kelly H.; Dunn-Davies, Hywel; Shi, Yi; Chaker-Margot, Malik; Chait, Brian T.; Walz, Thomas; Tollervey, David; Klinge, Sebastian

    2016-06-01

    Early eukaryotic ribosome biogenesis involves large multi-protein complexes, which co-transcriptionally associate with pre-ribosomal RNA to form the small subunit processome. The precise mechanisms by which two of the largest multi-protein complexes--UtpA and UtpB--interact with nascent pre-ribosomal RNA are poorly understood. Here, we combined biochemical and structural biology approaches with ensembles of RNA-protein cross-linking data to elucidate the essential functions of both complexes. We show that UtpA contains a large composite RNA-binding site and captures the 5' end of pre-ribosomal RNA. UtpB forms an extended structure that binds early pre-ribosomal intermediates in close proximity to architectural sites such as an RNA duplex formed by the 5' ETS and U3 snoRNA as well as the 3' boundary of the 18S rRNA. Both complexes therefore act as vital RNA chaperones to initiate eukaryotic ribosome assembly.

  6. UtpA and UtpB chaperone nascent pre-ribosomal RNA and U3 snoRNA to initiate eukaryotic ribosome assembly.

    Science.gov (United States)

    Hunziker, Mirjam; Barandun, Jonas; Petfalski, Elisabeth; Tan, Dongyan; Delan-Forino, Clémentine; Molloy, Kelly R; Kim, Kelly H; Dunn-Davies, Hywel; Shi, Yi; Chaker-Margot, Malik; Chait, Brian T; Walz, Thomas; Tollervey, David; Klinge, Sebastian

    2016-06-29

    Early eukaryotic ribosome biogenesis involves large multi-protein complexes, which co-transcriptionally associate with pre-ribosomal RNA to form the small subunit processome. The precise mechanisms by which two of the largest multi-protein complexes-UtpA and UtpB-interact with nascent pre-ribosomal RNA are poorly understood. Here, we combined biochemical and structural biology approaches with ensembles of RNA-protein cross-linking data to elucidate the essential functions of both complexes. We show that UtpA contains a large composite RNA-binding site and captures the 5' end of pre-ribosomal RNA. UtpB forms an extended structure that binds early pre-ribosomal intermediates in close proximity to architectural sites such as an RNA duplex formed by the 5' ETS and U3 snoRNA as well as the 3' boundary of the 18S rRNA. Both complexes therefore act as vital RNA chaperones to initiate eukaryotic ribosome assembly.

  7. Cyclin-dependent kinase 9 links RNA polymerase II transcription to processing of ribosomal RNA.

    Science.gov (United States)

    Burger, Kaspar; Mühl, Bastian; Rohrmoser, Michaela; Coordes, Britta; Heidemann, Martin; Kellner, Markus; Gruber-Eber, Anita; Heissmeyer, Vigo; Strässer, Katja; Eick, Dirk

    2013-07-19

    Ribosome biogenesis is a process required for cellular growth and proliferation. Processing of ribosomal RNA (rRNA) is highly sensitive to flavopiridol, a specific inhibitor of cyclin-dependent kinase 9 (Cdk9). Cdk9 has been characterized as the catalytic subunit of the positive transcription elongation factor b (P-TEFb) of RNA polymerase II (RNAPII). Here we studied the connection between RNAPII transcription and rRNA processing. We show that inhibition of RNAPII activity by α-amanitin specifically blocks processing of rRNA. The block is characterized by accumulation of 3' extended unprocessed 47 S rRNAs and the entire inhibition of other 47 S rRNA-specific processing steps. The transcription rate of rRNA is moderately reduced after inhibition of Cdk9, suggesting that defective 3' processing of rRNA negatively feeds back on RNAPI transcription. Knockdown of Cdk9 caused a strong reduction of the levels of RNAPII-transcribed U8 small nucleolar RNA, which is essential for 3' rRNA processing in mammalian cells. Our data demonstrate a pivotal role of Cdk9 activity for coupling of RNAPII transcription with small nucleolar RNA production and rRNA processing.

  8. The ribosomal RNA transcription unit of Entamoeba invadens: accumulation of unprocessed pre-rRNA and a long non coding RNA during encystation.

    Science.gov (United States)

    Ojha, Sandeep; Singh, Nishant; Bhattacharya, Alok; Bhattacharya, Sudha

    2013-01-01

    The ribosomal RNA genes in Entamoeba spp. are located on extrachromosomal circular molecules. Unlike model organisms where rRNA transcription stops during growth stress, Entamoeba histolytica continues transcription; but unprocessed pre-rRNA accumulates during stress, along with a novel class of circular transcripts from the 5'-external transcribed spacer (ETS). To determine the fate of rRNA transcription during stage conversion between trophozoite to cyst we analyzed Entamoeba invadens, a model system for differentiation studies in Entamoeba. We characterized the complete rDNA transcription unit by mapping the ends of pre-rRNA and mature rRNAs. The 3' end of mature 28S rRNA was located 321 nt downstream of the end predicted by sequence homology with E. histolytica. The major processing sites were mapped in external and internal transcribed spacers. The promoter located within 146 nt upstream of 5' ETS was used to transcribe the pre-rRNA. On the other hand, a second promoter located at the 3' end of 28S rDNA was used to transcribe almost the entire intergenic spacer into a long non coding (nc) RNA (>10 kb). Interestingly we found that the levels of pre-rRNA and long ncRNA, measured by northern hybridization, decreased initially in cells shifted to encystation medium, after which they began to increase and reached high levels by 72 h when mature cysts were formed. Unlike E. histolytica, no circular transcripts were found in E. invadens. E. histolytica and E. invadens express fundamentally different ncRNAs from the rDNA locus, which may reflect their adaptation to different hosts (human and reptiles, respectively). This is the first description of rDNA organization and transcription in E. invadens, and provides the framework for further studies on regulation of rRNA synthesis during cyst formation.

  9. Structure of ERA in complex with the 3′ end of 16S rRNA: Implications for ribosome biogenesis

    Energy Technology Data Exchange (ETDEWEB)

    Tu, Chao; Zhou, Xiaomei; Tropea, Joseph E.; Austin, Brian P.; Waugh, David S.; Court, Donald L.; Ji, Xinhua; (NCI)

    2009-10-09

    ERA, composed of an N-terminal GTPase domain followed by an RNA-binding KH domain, is essential for bacterial cell viability. It binds to 16S rRNA and the 30S ribosomal subunit. However, its RNA-binding site, the functional relationship between the two domains, and its role in ribosome biogenesis remain unclear. We have determined two crystal structures of ERA, a binary complex with GDP and a ternary complex with a GTP-analog and the {sub 1531}AUCACCUCCUUA{sub 1542} sequence at the 3' end of 16S rRNA. In the ternary complex, the first nine of the 12 nucleotides are recognized by the protein. We show that GTP binding is a prerequisite for RNA recognition by ERA and that RNA recognition stimulates its GTP-hydrolyzing activity. Based on these and other data, we propose a functional cycle of ERA, suggesting that the protein serves as a chaperone for processing and maturation of 16S rRNA and a checkpoint for assembly of the 30S ribosomal subunit. The AUCA sequence is highly conserved among bacteria, archaea, and eukaryotes, whereas the CCUCC, known as the anti-Shine-Dalgarno sequence, is conserved in noneukaryotes only. Therefore, these data suggest a common mechanism for a highly conserved ERA function in all three kingdoms of life by recognizing the AUCA, with a 'twist' for noneukaryotic ERA proteins by also recognizing the CCUCC.

  10. lncRNA maturation to initiate heterochromatin formation in the nucleolus is required for exit from pluripotency in ESCs.

    Science.gov (United States)

    Savić, Nataša; Bär, Dominik; Leone, Sergio; Frommel, Sandra C; Weber, Fabienne A; Vollenweider, Eva; Ferrari, Elena; Ziegler, Urs; Kaech, Andres; Shakhova, Olga; Cinelli, Paolo; Santoro, Raffaella

    2014-12-01

    The open chromatin of embryonic stem cells (ESCs) condenses into repressive heterochromatin as cells exit the pluripotent state. How the 3D genome organization is orchestrated and implicated in pluripotency and lineage specification is not understood. Here, we find that maturation of the long noncoding RNA (lncRNA) pRNA is required for establishment of heterochromatin at ribosomal RNA genes, the genetic component of nucleoli, and this process is inactivated in pluripotent ESCs. By using mature pRNA to tether heterochromatin at nucleoli of ESCs, we find that localized heterochromatin condensation of ribosomal RNA genes initiates establishment of highly condensed chromatin structures outside of the nucleolus. Moreover, we reveal that formation of such highly condensed, transcriptionally repressed heterochromatin promotes transcriptional activation of differentiation genes and loss of pluripotency. Our findings unravel the nucleolus as an active regulator of chromatin plasticity and pluripotency and challenge current views on heterochromatin regulation and function in ESCs.

  11. RNase MRP cleaves pre-tRNASer-Met in the tRNA maturation pathway.

    Science.gov (United States)

    Saito, Yuichiro; Takeda, Jun; Adachi, Kousuke; Nobe, Yuko; Kobayashi, Junya; Hirota, Kouji; Oliveira, Douglas V; Taoka, Masato; Isobe, Toshiaki

    2014-01-01

    Ribonuclease mitochondrial RNA processing (RNase MRP) is a multifunctional ribonucleoprotein (RNP) complex that is involved in the maturation of various types of RNA including ribosomal RNA. RNase MRP consists of a potential catalytic RNA and several protein components, all of which are required for cell viability. We show here that the temperature-sensitive mutant of rmp1, the gene for a unique protein component of RNase MRP, accumulates the dimeric tRNA precursor, pre-tRNA(Ser-Met). To examine whether RNase MRP mediates tRNA maturation, we purified the RNase MRP holoenzyme from the fission yeast Schizosaccharomyces pombe and found that the enzyme directly and selectively cleaves pre-tRNA(Ser-Met), suggesting that RNase MRP participates in the maturation of specific tRNA in vivo. In addition, mass spectrometry-based ribonucleoproteomic analysis demonstrated that this RNase MRP consists of one RNA molecule and 11 protein components, including a previously unknown component Rpl701. Notably, limited nucleolysis of RNase MRP generated an active catalytic core consisting of partial mrp1 RNA fragments, which constitute "Domain 1" in the secondary structure of RNase MRP, and 8 proteins. Thus, the present study provides new insight into the structure and function of RNase MRP.

  12. tmRNA-SmpB: a journey to the centre of the bacterial ribosome.

    OpenAIRE

    Weis, Félix; Bron, Patrick; Giudice, Emmanuel; Rolland, Jean-Paul; Thomas, Daniel; Felden, Brice; Gillet, Reynald

    2010-01-01

    International audience; Ribosomes mediate protein synthesis by decoding the information carried by messenger RNAs (mRNAs) and catalysing peptide bond formation between amino acids. When bacterial ribosomes stall on incomplete messages, the trans-translation quality control mechanism is activated by the transfer-messenger RNA bound to small protein B (tmRNA-SmpB ribonucleoprotein complex). Trans-translation liberates the stalled ribosomes and triggers degradation of the incomplete proteins. He...

  13. The Ribosomal RNA is a Useful Marker to Visualize Rhizobia Interacting with Legume Plants

    Science.gov (United States)

    Rinaudi, Luciana; Isola, Maria C.; Giordano, Walter

    2004-01-01

    Symbiosis between rhizobia and leguminous plants leads to the formation of nitrogen-fixing root nodules. In the present article, we recommend the use of the ribosomal RNA (rRNA) isolated from legume nodules in an experimental class with the purpose of introducing students to the structure of eukaryotic and prokaryotic ribosomes and of…

  14. Evidence for several higher order structural elements in ribosomal RNA.

    Science.gov (United States)

    Woese, C R; Gutell, R R

    1989-05-01

    Comparative analysis of small subunit ribosomal RNA sequences suggests the existence of two new higher order interactions: (i) a double-helical structure involving positions 505-507 and 524-526 (Escherichia coli numbering) and (ii) an interaction between the region of position 130 and the helix located approximately between positions 180 and 195. In the first of these, one of the strands of the helix exists in the bulge loop, and the other strand exists in the terminal loop of a previously recognized compound helix involving positions 500-545. Therefore, the new structure formally represents a pseudoknot. In the second, the insertion/deletion of a nucleotide in the vicinity of position 130 correlates with the length of the helix in the 180-195 region, the latter having a 3-base-pair stalk when the base in question is deleted and a stalk of approximately 10 pairs when it is inserted.

  15. Turnover of ribosomal RNA in mouse fibroblasts (3T3) in culture

    Energy Technology Data Exchange (ETDEWEB)

    Kolodny, G.M.

    1975-01-01

    Growing and confluent cultures of mouse fibroblasts were labeled with /sup 3/H-uridine and chased with an excess of nonradioactive uridine to investigate the turnover of ribosomal RNA. Growing cultures did not turn over their 18S and 28S ribosomal RNA; however, confluent cultures did show ribosomal RNA (rRNA) turnover. If the cells were labeled while growing and chased when confluent, 18S RNA displayed a two-component decay curve, while 28S RNA showed only single-component decay, similar in lifetime to the first component of the 18S RNA decay curve. If the cells were labeled while confluent, both the 18S and 28S RNA showed single-component decay curves with a lifetime possibly only slightly longer than the lifetime of the first component of the 18S RNA and the single component of the 28S RNA of the cultures labeled while growing.

  16. tmRNA-SmpB: a journey to the centre of the bacterial ribosome.

    Science.gov (United States)

    Weis, Félix; Bron, Patrick; Giudice, Emmanuel; Rolland, Jean-Paul; Thomas, Daniel; Felden, Brice; Gillet, Reynald

    2010-11-17

    Ribosomes mediate protein synthesis by decoding the information carried by messenger RNAs (mRNAs) and catalysing peptide bond formation between amino acids. When bacterial ribosomes stall on incomplete messages, the trans-translation quality control mechanism is activated by the transfer-messenger RNA bound to small protein B (tmRNA-SmpB ribonucleoprotein complex). Trans-translation liberates the stalled ribosomes and triggers degradation of the incomplete proteins. Here, we present the cryo-electron microscopy structures of tmRNA-SmpB accommodated or translocated into stalled ribosomes. Two atomic models for each state are proposed. This study reveals how tmRNA-SmpB crosses the ribosome and how, as the problematic mRNA is ejected, the tmRNA resume codon is placed onto the ribosomal decoding site by new contacts between SmpB and the nucleotides upstream of the tag-encoding sequence. This provides a structural basis for the transit of the large tmRNA-SmpB complex through the ribosome and for the means by which the tmRNA internal frame is set for translation to resume.

  17. Dynamics of translation by single ribosomes through mRNA secondary structures

    OpenAIRE

    Chen, Chunlai; Zhang, Haibo; Broitman, Steven L.; Reiche, Michael; Farrell, Ian; Cooperman, Barry S.; Goldman, Yale E.

    2013-01-01

    During protein synthesis, the ribosome translates nucleotide triplets in single-stranded mRNA into polypeptide sequences. Strong downstream mRNA secondary (2°) structures, which must be unfolded for translation, can slow or even halt protein synthesis. Here we employ single molecule fluorescence resonance energy transfer to determine reaction rates for specific steps within the elongation cycle as the Escherichia coli ribosome encounters stem loop or pseudoknot mRNA 2° structures. Downstream ...

  18. Specialized yeast ribosomes: a customized tool for selective mRNA translation.

    Directory of Open Access Journals (Sweden)

    Johann W Bauer

    Full Text Available Evidence is now accumulating that sub-populations of ribosomes - so-called specialized ribosomes - can favour the translation of subsets of mRNAs. Here we use a large collection of diploid yeast strains, each deficient in one or other copy of the set of ribosomal protein (RP genes, to generate eukaryotic cells carrying distinct populations of altered 'specialized' ribosomes. We show by comparative protein synthesis assays that different heterologous mRNA reporters based on luciferase are preferentially translated by distinct populations of specialized ribosomes. These mRNAs include reporters carrying premature termination codons (PTC thus allowing us to identify specialized ribosomes that alter the efficiency of translation termination leading to enhanced synthesis of the wild-type protein. This finding suggests that these strains can be used to identify novel therapeutic targets in the ribosome. To explore this further we examined the translation of the mRNA encoding the extracellular matrix protein laminin β3 (LAMB3 since a LAMB3-PTC mutant is implicated in the blistering skin disease Epidermolysis bullosa (EB. This screen identified specialized ribosomes with reduced levels of RP L35B as showing enhanced synthesis of full-length LAMB3 in cells expressing the LAMB3-PTC mutant. Importantly, the RP L35B sub-population of specialized ribosomes leave both translation of a reporter luciferase carrying a different PTC and bulk mRNA translation largely unaltered.

  19. Mutational robustness of 16S ribosomal RNA, shown by experimental horizontal gene transfer in Escherichia coli

    OpenAIRE

    Kitahara, Kei; Yasutake, Yoshiaki; Miyazaki, Kentaro

    2012-01-01

    The bacterial ribosome consists of three rRNA molecules and 57 proteins and plays a crucial role in translating mRNA-encoded information into proteins. Because of the ribosome’s structural and mechanistic complexity, it is believed that each ribosomal component coevolves to maintain its function. Unlike 5S rRNA, 16S and 23S rRNAs appear to lack mutational robustness, because they form the structural core of the ribosome. However, using Escherichia coli Δ7 (null mutant of operons) as a host, w...

  20. Choreography of molecular movements during ribosome progression along mRNA.

    Science.gov (United States)

    Belardinelli, Riccardo; Sharma, Heena; Caliskan, Neva; Cunha, Carlos E; Peske, Frank; Wintermeyer, Wolfgang; Rodnina, Marina V

    2016-04-01

    During translation elongation, ribosome translocation along an mRNA entails rotations of the ribosomal subunits, swiveling motions of the small subunit (SSU) head and stepwise movements of the tRNAs together with the mRNA. Here, we reconstructed the choreography of the collective motions of the Escherichia coli ribosome during translocation promoted by elongation factor EF-G, by recording the fluorescence signatures of nine different reporters placed on both ribosomal subunits, tRNA and mRNA. We captured an early forward swiveling of the SSU head taking place while the SSU body rotates in the opposite, clockwise direction. Backward swiveling of the SSU head starts upon tRNA translocation and continues until the post-translocation state is reached. This work places structures of translocation intermediates along a time axis and unravels principles of the motions of macromolecular machines.

  1. Translation by polysome: theory of ribosome profile on a single mRNA transcript

    CERN Document Server

    Sharma, Ajeet K

    2011-01-01

    The process of polymerizing a protein by a ribosome, using a messenger RNA (mRNA) as the corresponding template, is called {\\it translation}. Ribosome may be regarded as a molecular motor for which the mRNA template serves also as the track. Often several ribosomes may translate the same (mRNA) simultaneously. The ribosomes bound simultaneously to a single mRNA transcript are the members of a polyribosome (or, simply, {\\it polysome}). Experimentally measured {\\it polysome profile} gives the distribution of polysome {\\it sizes}. Recently a breakthrough in determining the instantaneous {\\it positions} of the ribosomes on a given mRNA track has been achieved and the technique is called {\\it ribosome profiling} \\cite{ingolia10,guo10}. Motivated by the success of these techniques, we have studied the spatio-temporal organization of ribosomes by extending a theoretical model that we have reported elsewhere \\cite{sharma11}. This extended version of our model incorporates not only (i) mechano-chemical cycle of indivi...

  2. Modeling of ribosome dynamics on a ds-mRNA under an external load

    Science.gov (United States)

    Shakiba, Bahareh; Dayeri, Maryam; Mohammad-Rafiee, Farshid

    2016-07-01

    Protein molecules in cells are synthesized by macromolecular machines called ribosomes. According to the recent experimental data, we reduce the complexity of the ribosome and propose a model to express its activity in six main states. Using our model, we study the translation rate in different biological relevant situations in the presence of external force and the translation through the RNA double stranded region in the absence or presence of the external force. In the present study, we give a quantitative theory for translation rate and show that the ribosome behaves more like a Brownian Ratchet motor. Our findings could shed some light on understanding behaviors of the ribosome in biological conditions.

  3. Modeling of Ribosome Dynamics on a ds-mRNA under an External Load

    CERN Document Server

    Shakiba, Bahareh; Mohammad-Rafiee, Farshid

    2016-01-01

    Protein molecules in cells are synthesized by macromolecular machines called ribosomes. According to recent experimental data, we reduce the complexity of the ribosome and propose a model to express its activity in six main states. Using our model, we study the translation rate in different biological relevant situations in the presence of external force, and translation through the RNA double stranded region in the absence or presence of the external force. In the present study, we give a quantitative theory for translation rate and show that the ribosome behaves more like a Brownian Ratchet motor. Our findings could shed some light on understanding behaviors of the ribosome in biological conditions.

  4. What do we know about ribosomal RNA methylation in Escherichia coli?

    Science.gov (United States)

    Sergeeva, O V; Bogdanov, A A; Sergiev, P V

    2015-10-01

    A ribosome is a ribonucleoprotein that performs the synthesis of proteins. Ribosomal RNA of all organisms includes a number of modified nucleotides, such as base or ribose methylated and pseudouridines. Methylated nucleotides are highly conserved in bacteria and some even universally. In this review we discuss available data on a set of modification sites in the most studied bacteria, Escherichia coli. While most rRNA modification enzymes are known for this organism, the function of the modified nucleotides is rarely identified.

  5. Ribosome collisions and Translation efficiency: Optimization by codon usage and mRNA destabilization

    DEFF Research Database (Denmark)

    Mitarai, Namiko; Sneppen, Kim; Pedersen, Steen

    2008-01-01

    Individual mRNAs are translated by multiple ribosomes that initiate translation with an interval of a few seconds. The ribosome speed is codon dependent, and ribosome queuing has been suggested to explain specific data for translation of some mRNAs in vivo. By modeling the stochastic translation...... process as a traffic problem, we here analyze conditions and consequences of collisions and queuing. The model allowed us to determine the on-rate (0.8 to 1.1 initiations/s) and the time (1 s) the preceding ribosome occludes initiation for Escherichia coli lacZ mRNA in vivo. We find that ribosome...... collisions and queues are inevitable consequences of a stochastic translation mechanism that reduce the translation efficiency substantially on natural mRNAs. The cells minimize collisions by having its mRNAs being unstable and by a highly selected codon usage in the start of the mRNA. The cost of m...

  6. Binding of 16S rRNA to chloroplast 30S ribosomal proteins blotted on nitrocellulose

    OpenAIRE

    Rozier, Claude; Mache, Régis

    1984-01-01

    Protein-RNA associations were studied by a method using proteins blotted on a nitrocellulose sheet. This method was assayed with Escherichia Coli 30S ribosomal components. In stringent conditions (300 mM NaCl or 20° C) only 9 E. coli ribosomal proteins strongly bound to the 16S rRNA: S4, S5, S7, S9, S12, S13, S14, S19, S20. 8 of these proteins have been previously found to bind independently to the 16S rRNA. The same method was applied to determine protein-RNA interactions in spinach chloropl...

  7. Nucleotide sequence of a crustacean 18S ribosomal RNA gene and secondary structure of eukaryotic small subunit ribosomal RNAs.

    Science.gov (United States)

    Nelles, L; Fang, B L; Volckaert, G; Vandenberghe, A; De Wachter, R

    1984-12-11

    The primary structure of the gene for 18 S rRNA of the crustacean Artemia salina was determined. The sequence has been aligned with 13 other small ribosomal subunit RNA sequences of eukaryotic, archaebacterial, eubacterial, chloroplastic and plant mitochondrial origin. Secondary structure models for these RNAs were derived on the basis of previously proposed models and additional comparative evidence found in the alignment. Although there is a general similarity in the secondary structure models for eukaryotes and prokaryotes, the evidence seems to indicate a different topology in a central area of the structures.

  8. Dynamics of translation by single ribosomes through mRNA secondary structures.

    Science.gov (United States)

    Chen, Chunlai; Zhang, Haibo; Broitman, Steven L; Reiche, Michael; Farrell, Ian; Cooperman, Barry S; Goldman, Yale E

    2013-05-01

    During protein synthesis, the ribosome translates nucleotide triplets in single-stranded mRNA into polypeptide sequences. Strong downstream mRNA secondary structures, which must be unfolded for translation, can slow or even halt protein synthesis. Here we used single-molecule fluorescence resonance energy transfer to determine reaction rates for specific steps within the elongation cycle as the Escherichia coli ribosome encounters stem-loop or pseudoknot mRNA secondary structures. Downstream stem-loops containing 100% GC base pairs decrease the rates of both tRNA translocation within the ribosome and deacylated tRNA dissociation from the ribosomal exit site (E site). Downstream stem-loops or pseudoknots containing both GC and AU pairs also decrease the rate of tRNA dissociation, but they have little effect on tRNA translocation rate. Thus, somewhat unexpectedly, unfolding of mRNA secondary structures is more closely coupled to E-site tRNA dissociation than to tRNA translocation.

  9. Transcriptional repressor NIR functions in the ribosome RNA processing of both 40S and 60S subunits.

    Science.gov (United States)

    Wu, Jianguo; Zhang, Ying; Wang, Yingshuang; Kong, Ruirui; Hu, Lelin; Schuele, Roland; Du, Xiaojuan; Ke, Yang

    2012-01-01

    NIR was identified as an inhibitor of histone acetyltransferase and it represses transcriptional activation of p53. NIR is predominantly localized in the nucleolus and known as Noc2p, which is involved in the maturation of the 60S ribosomal subunit. However, how NIR functions in the nucleolus remains undetermined. In the nucleolus, a 47S ribosomal RNA precursor (pre-rRNA) is transcribed and processed to produce 18S, 5.8S and 28S rRNAs. The 18S rRNA is incorporated into the 40S ribosomal subunit, whereas the 28S and 5.8S rRNAs are incorporated into the 60S subunit. U3 small nucleolar RNA (snoRNA) directs 18S rRNA processing and U8 snoRNA mediates processing of 28S and 5.8 S rRNAs. Functional disruption of nucleolus often causes p53 activation to inhibit cell proliferation. Western blotting showed that NIR is ubiquitously expressed in different human cell lines. Knock-down of NIR by siRNA led to inhibition of the 18S, 28S and 5.8S rRNAs evaluated by pulse-chase experiment. Pre-rRNA particles (pre-rRNPs) were fractionated from the nucleus by sucrose gradient centrifugation and analysis of the pre-RNPs components showed that NIR existed in the pre-RNPs of both the 60S and 40S subunits and co-fractionated with 32S and 12S pre-rRNAs in the 60S pre-rRNP. Protein-RNA binding experiments demonstrated that NIR is associated with the 32S pre-rRNA and U8 snoRNA. In addition, NIR bound U3 snoRNA. It is a novel finding that depletion of NIR did not affect p53 protein level but de-repressed acetylation of p53 and activated p21. We provide the first evidence for a transcriptional repressor to function in the rRNA biogenesis of both the 40S and 60S subunits. Our findings also suggested that a nucleolar protein may alternatively signal to p53 by affecting the p53 modification rather than affecting p53 protein level.

  10. Transcriptional repressor NIR functions in the ribosome RNA processing of both 40S and 60S subunits.

    Directory of Open Access Journals (Sweden)

    Jianguo Wu

    Full Text Available BACKGROUND: NIR was identified as an inhibitor of histone acetyltransferase and it represses transcriptional activation of p53. NIR is predominantly localized in the nucleolus and known as Noc2p, which is involved in the maturation of the 60S ribosomal subunit. However, how NIR functions in the nucleolus remains undetermined. In the nucleolus, a 47S ribosomal RNA precursor (pre-rRNA is transcribed and processed to produce 18S, 5.8S and 28S rRNAs. The 18S rRNA is incorporated into the 40S ribosomal subunit, whereas the 28S and 5.8S rRNAs are incorporated into the 60S subunit. U3 small nucleolar RNA (snoRNA directs 18S rRNA processing and U8 snoRNA mediates processing of 28S and 5.8 S rRNAs. Functional disruption of nucleolus often causes p53 activation to inhibit cell proliferation. METHODOLOGY/PRINCIPAL FINDINGS: Western blotting showed that NIR is ubiquitously expressed in different human cell lines. Knock-down of NIR by siRNA led to inhibition of the 18S, 28S and 5.8S rRNAs evaluated by pulse-chase experiment. Pre-rRNA particles (pre-rRNPs were fractionated from the nucleus by sucrose gradient centrifugation and analysis of the pre-RNPs components showed that NIR existed in the pre-RNPs of both the 60S and 40S subunits and co-fractionated with 32S and 12S pre-rRNAs in the 60S pre-rRNP. Protein-RNA binding experiments demonstrated that NIR is associated with the 32S pre-rRNA and U8 snoRNA. In addition, NIR bound U3 snoRNA. It is a novel finding that depletion of NIR did not affect p53 protein level but de-repressed acetylation of p53 and activated p21. CONCLUSIONS: We provide the first evidence for a transcriptional repressor to function in the rRNA biogenesis of both the 40S and 60S subunits. Our findings also suggested that a nucleolar protein may alternatively signal to p53 by affecting the p53 modification rather than affecting p53 protein level.

  11. Ribosomal protein S7 from Escherichia coli uses the same determinants to bind 16S ribosomal RNA and its messenger RNA.

    Science.gov (United States)

    Robert, F; Brakier-Gingras, L

    2001-02-01

    Ribosomal protein S7 from Escherichia coli binds to the lower half of the 3' major domain of 16S rRNA and initiates its folding. It also binds to its own mRNA, the str mRNA, and represses its translation. Using filter binding assays, we show in this study that the same mutations that interfere with S7 binding to 16S rRNA also weaken its affinity for its mRNA. This suggests that the same protein regions are responsible for mRNA and rRNA binding affinities, and that S7 recognizes identical sequence elements within the two RNA targets, although they have dissimilar secondary structures. Overexpression of S7 is known to inhibit bacterial growth. This phenotypic growth defect was relieved in cells overexpressing S7 mutants that bind poorly the str mRNA, confirming that growth impairment is controlled by the binding of S7 to its mRNA. Interestingly, a mutant with a short deletion at the C-terminus of S7 was more detrimental to cell growth than wild-type S7. This suggests that the C-terminal portion of S7 plays an important role in ribosome function, which is perturbed by the deletion.

  12. Binding of 16S rRNA to chloroplast 30S ribosomal proteins blotted on nitrocellulose.

    Science.gov (United States)

    Rozier, C; Mache, R

    1984-10-11

    Protein-RNA associations were studied by a method using proteins blotted on a nitrocellulose sheet. This method was assayed with Escherichia Coli 30S ribosomal components. In stringent conditions (300 mM NaCl or 20 degrees C) only 9 E. coli ribosomal proteins strongly bound to the 16S rRNA: S4, S5, S7, S9, S12, S13, S14, S19, S20. 8 of these proteins have been previously found to bind independently to the 16S rRNA. The same method was applied to determine protein-RNA interactions in spinach chloroplast 30S ribosomal subunits. A set of only 7 proteins was bound to chloroplast rRNA in stringent conditions: chloroplast S6, S10, S11, S14, S15, S17 and S22. They also bound to E. coli 16S rRNA. This set includes 4 chloroplast-synthesized proteins: S6, S11, S15 and S22. The core particles obtained after treatment by LiCl of chloroplast 30S ribosomal subunit contained 3 proteins (S6, S10 and S14) which are included in the set of 7 binding proteins. This set of proteins probably play a part in the early steps of the assembly of the chloroplast 30S ribosomal subunit.

  13. Zfrp8/PDCD2 Interacts with RpS2 Connecting Ribosome Maturation and Gene-Specific Translation.

    Directory of Open Access Journals (Sweden)

    Svetlana Minakhina

    Full Text Available Zfrp8/PDCD2 is a highly conserved protein essential for stem cell maintenance in both flies and mammals. It is also required in fast proliferating cells such as cancer cells. Our previous studies suggested that Zfrp8 functions in the formation of mRNP (mRNA ribonucleoprotein complexes and also controls RNA of select Transposable Elements (TEs. Here we show that in Zfrp8/PDCD2 knock down (KD ovaries, specific mRNAs and TE transcripts show increased nuclear accumulation. We also show that Zfrp8/PDCD2 interacts with the (40S small ribosomal subunit through direct interaction with RpS2 (uS5. By studying the distribution of endogenous and transgenic fluorescently tagged ribosomal proteins we demonstrate that Zfrp8/PDCD2 regulates the cytoplasmic levels of components of the small (40S ribosomal subunit, but does not control nuclear/nucleolar localization of ribosomal proteins. Our results suggest that Zfrp8/PDCD2 functions at late stages of ribosome assembly and may regulate the binding of specific mRNA-RNPs to the small ribosomal subunit ultimately controlling their cytoplasmic localization and translation.

  14. The NBS1-Treacle complex controls ribosomal RNA transcription in response to DNA damage

    DEFF Research Database (Denmark)

    Larsen, Dorthe H; Hari, Flurina; Clapperton, Julie A

    2014-01-01

    Chromosome breakage elicits transient silencing of ribosomal RNA synthesis, but the mechanisms involved remained elusive. Here we discover an in trans signalling mechanism that triggers pan-nuclear silencing of rRNA transcription in response to DNA damage. This is associated with transient...

  15. Classification of methanogenic bacteria by 16S ribosomal RNA characterization

    Energy Technology Data Exchange (ETDEWEB)

    Fox, G.E.; Magrum, L.J.; Balch, W.E.; Wolfe, R.S.; Woese, C.R.

    1977-10-01

    The 16S ribosomal RNAs from 10 species of methanogenic bacteria have been characterized in terms of the oligonucleotides produced by T/sub 1/ RNase digestion. Comparative analysis of these data reveals the methanogens to constitute a distinct phylogenetic group containing two major divisions. These organisms appear to be only distantly related to typical bacteria.

  16. Interaction of the antibiotics clindamycin and lincomycin with Escherichia coli 23S ribosomal RNA

    DEFF Research Database (Denmark)

    Douthwaite, S

    1992-01-01

    Interaction of the antibiotics clindamycin and lincomycin with Escherichia coli ribosomes has been compared by chemical footprinting. The protection afforded by both drugs is limited to the peptidyl transferase loop of 23S rRNA. Under conditions of stoichiometric binding at 1 mM drug concentration...... of the two drugs for the ribosome, estimated by footprinting, is approximately the same, giving Kdiss values of 5 microM for lincomycin and 8 microM for clindamycin. The results show that in vitro the drugs are equally potent in blocking their ribosomal target site. Their inhibitory effects on peptide bond...

  17. The Expression of Antibiotic Resistance Methyltransferase Correlates with mRNA Stability Independently of Ribosome Stalling.

    Science.gov (United States)

    Dzyubak, Ekaterina; Yap, M N

    2016-12-01

    Members of the Erm methyltransferase family modify 23S rRNA of the bacterial ribosome and render cross-resistance to macrolides and multiple distantly related antibiotics. Previous studies have shown that the expression of erm is activated when a macrolide-bound ribosome stalls the translation of the leader peptide preceding the cotranscribed erm Ribosome stalling is thought to destabilize the inhibitory stem-loop mRNA structure and exposes the erm Shine-Dalgarno (SD) sequence for translational initiation. Paradoxically, mutations that abolish ribosome stalling are routinely found in hyper-resistant clinical isolates; however, the significance of the stalling-dead leader sequence is largely unknown. Here, we show that nonsense mutations in the Staphylococcus aureus ErmB leader peptide (ErmBL) lead to high basal and induced expression of downstream ErmB in the absence or presence of macrolide concomitantly with elevated ribosome methylation and resistance. The overexpression of ErmB is associated with the reduced turnover of the ermBL-ermB transcript, and the macrolide appears to mitigate mRNA cleavage at a site immediately downstream of the ermBL SD sequence. The stabilizing effect of antibiotics on mRNA is not limited to ermBL-ermB; cationic antibiotics representing a ribosome-stalling inducer and a noninducer increase the half-life of specific transcripts. These data unveil a new layer of ermB regulation and imply that ErmBL translation or ribosome stalling serves as a "tuner" to suppress aberrant production of ErmB because methylated ribosome may impose a fitness cost on the bacterium as a result of misregulated translation.

  18. Extraction of ribosomal RNA and genomic DNA from soil for studying the diversity of the indigenous bacterial community

    NARCIS (Netherlands)

    Duarte, G.F.; Rosado, A.S.; Keijzer-Wolters, A.C.; Elsas, van J.D.

    1998-01-01

    A method for the indirect (cell extraction followed by nucleic acid extraction) isolation of bacterial ribosomal RNA (rRNA) and genomic DNA from soil was developed. The protocol allowed for the rapid parallel extraction of genomic DNA as well as small and large ribosomal subunit RNA from four soils

  19. Extraction of ribosomal RNA and genomic DNA from soil for studying the diversity of the indigenous bacterial community

    NARCIS (Netherlands)

    Duarte, G.F.; Rosado, A.S.; Keijzer-Wolters, A.C.; Elsas, van J.D.

    1998-01-01

    A method for the indirect (cell extraction followed by nucleic acid extraction) isolation of bacterial ribosomal RNA (rRNA) and genomic DNA from soil was developed. The protocol allowed for the rapid parallel extraction of genomic DNA as well as small and large ribosomal subunit RNA from four soils

  20. Flipping of the ribosomal A-site adenines provides a basis for tRNA selection

    Science.gov (United States)

    Zeng, Xiancheng; Chugh, Jeetender; Casiano-Negroni, Anette; Al-Hashimi, Hashim M.; Brooks, Charles L.

    2014-01-01

    Ribosomes control the missense error rate of ~10−4 during translation though quantitative contributions of individual mechanistic steps of the conformational changes yet to be fully determined. Biochemical and biophysical studies led to a qualitative tRNA selection model in which ribosomal A-site residues A1492 and A1493 (A1492/3) flip out in response to cognate tRNA binding, promoting the subsequent reactions, but not in the case of near cognate or non-cognate tRNA. However, this model was recently questioned by X-ray structures revealing conformations of extrahelical A1492/3 and domain closure of the decoding center in both cognate and near-cognate tRNA bound ribosome complexes, suggesting that the non-specific flipping of A1492/3 has no active role in tRNA selection. We explore this question by carrying out molecular dynamics (MD) simulations, aided with fluorescence and NMR experiments, to probe the free energy cost of extrahelical flipping of 1492/3 and the strain energy associated with domain conformational change. Our rigorous calculations demonstrate that the A1492/3 flipping is indeed a specific response to the binding of cognate tRNA, contributing 3 kcal/mol to the specificity of tRNA selection. Furthermore, the different A-minor interactions in cognate and near-cognate complexes propagate into the conformational strain and contribute another 4 kcal/mol in domain closure. The recent structure of ribosome with features of extrahelical A1492/3 and closed domain in near-cognate complex is reconciled by possible tautomerization of the wobble base pair in mRNA-tRNA. These results quantitatively rationalize other independent experimental observations and explain the ribosomal discrimination mechanism of selecting cognate versus near-cognate tRNA. PMID:24813122

  1. Assembly factors Rpf2 and Rrs1 recruit 5S rRNA and ribosomal proteins rpL5 and rpL11 into nascent ribosomes.

    Science.gov (United States)

    Zhang, Jingyu; Harnpicharnchai, Piyanun; Jakovljevic, Jelena; Tang, Lan; Guo, Yurong; Oeffinger, Marlene; Rout, Michael P; Hiley, Shawna L; Hughes, Timothy; Woolford, John L

    2007-10-15

    More than 170 proteins are necessary for assembly of ribosomes in eukaryotes. However, cofactors that function with each of these proteins, substrates on which they act, and the precise functions of assembly factors--e.g., recruiting other molecules into preribosomes or triggering structural rearrangements of pre-rRNPs--remain mostly unknown. Here we investigated the recruitment of two ribosomal proteins and 5S ribosomal RNA (rRNA) into nascent ribosomes. We identified a ribonucleoprotein neighborhood in preribosomes that contains two yeast ribosome assembly factors, Rpf2 and Rrs1, two ribosomal proteins, rpL5 and rpL11, and 5S rRNA. Interactions between each of these four proteins have been confirmed by binding assays in vitro. These molecules assemble into 90S preribosomal particles containing 35S rRNA precursor (pre-rRNA). Rpf2 and Rrs1 are required for recruiting rpL5, rpL11, and 5S rRNA into preribosomes. In the absence of association of these molecules with pre-rRNPs, processing of 27SB pre-rRNA is blocked. Consequently, the abortive 66S pre-rRNPs are prematurely released from the nucleolus to the nucleoplasm, and cannot be exported to the cytoplasm.

  2. A detailed view of a ribosomal active site: the structure of the L11-RNA complex.

    Science.gov (United States)

    Wimberly, B T; Guymon, R; McCutcheon, J P; White, S W; Ramakrishnan, V

    1999-05-14

    We report the crystal structure of a 58 nucleotide fragment of 23S ribosomal RNA bound to ribosomal protein L11. This highly conserved ribonucleoprotein domain is the target for the thiostrepton family of antibiotics that disrupt elongation factor function. The highly compact RNA has both familiar and novel structural motifs. While the C-terminal domain of L11 binds RNA tightly, the N-terminal domain makes only limited contacts with RNA and is proposed to function as a switch that reversibly associates with an adjacent region of RNA. The sites of mutations conferring resistance to thiostrepton and micrococcin line a narrow cleft between the RNA and the N-terminal domain. These antibiotics are proposed to bind in this cleft, locking the putative switch and interfering with the function of elongation factors.

  3. Elucidation of pathways of ribosomal RNA degradation: an essential role for RNase E

    Science.gov (United States)

    Sulthana, Shaheen; Basturea, Georgeta N.; Deutscher, Murray P.

    2016-01-01

    Although normally stable in growing cells, ribosomal RNAs are degraded under conditions of stress, such as starvation, and in response to misassembled or otherwise defective ribosomes in a process termed RNA quality control. Previously, our laboratory found that large fragments of 16S and 23S rRNA accumulate in strains lacking the processive exoribonucleases RNase II, RNase R, and PNPase, implicating these enzymes in the later steps of rRNA breakdown. Here, we define the pathways of rRNA degradation in the quality control process and during starvation, and show that the essential endoribonuclease, RNase E, is required to make the initial cleavages in both degradative processes. We also present evidence that explains why the exoribonuclease, RNase PH, is required to initiate the degradation of rRNA during starvation. The data presented here provide the first detailed description of rRNA degradation in bacterial cells. PMID:27298395

  4. Counterselection of prokaryotic ribosomal RNA during reverse transcription using non-random hexameric oligonucleotides.

    Science.gov (United States)

    Gonzalez, J M; Robb, F T

    2007-12-01

    Ribosomal RNA (rRNA) is the major component in total RNA extracts, interfering with the synthesis of cDNA corresponding to messenger RNA (mRNA). In this study, we present a novel strategy for selectively discriminating against rRNA and favoring mRNA from prokaryotes during synthesis of cDNA by reverse transcriptase. Our technique is based on the fact that rRNA sequences, in many species, are G+C rich relative to the genome at large, and highly conserved among prokaryotes. The sequence TTTT is therefore rarely found in rRNA sequences. However, TTTT priming sites are found at a much higher frequency in protein-encoding gene sequences. We designed specific hexamers (HD/DHTTTT) to prime reverse transcription reactions resulting in a selective synthesis of cDNA corresponding to mRNA from prokaryotic total RNA extractions.

  5. Ribosomal RNA and protein transcripts persist in the cysts of Entamoeba invadens.

    Science.gov (United States)

    Ojha, Sandeep; Ahamad, Jamaluddin; Bhattacharya, Alok; Bhattacharya, Sudha

    2014-06-01

    In most organisms rDNA transcription ceases under conditions of growth stress. However, we have earlier shown that pre-rRNA accumulates during encystation in Entamoeba invadens. We labeled newly-synthesized rRNA during encystation, with [methyl-(3)H] methionine in the presence of chitinase to enable uptake of isotope. Incorporation rate reduced after 24h, and then increased to reach levels comparable with normal cells. The label was rapidly chased to the ribosomal pellet in dividing cells, while at late stages of encystation the ratio of counts going to the pellet dropped 3-fold. The transcript levels of selected ribosomal protein genes also went down initially but went up again at later stages of encystation. This suggested that rRNA and ribosomal protein transcription may be coordinately regulated. Our data shows that encysting E. invadens cells accumulate transcripts of both the RNA and protein components of the ribosome, which may ensure rapid synthesis of new ribosomes when growth resumes.

  6. Basic Mechanisms in RNA Polymerase I Transcription of the Ribosomal RNA Genes

    Science.gov (United States)

    Goodfellow, Sarah J.; Zomerdijk, Joost C. B. M.

    2013-01-01

    RNA Polymerase (Pol) I produces ribosomal (r)RNA, an essential component of the cellular protein synthetic machinery that drives cell growth, underlying many fundamental cellular processes. Extensive research into the mechanisms governing transcription by Pol I has revealed an intricate set of control mechanisms impinging upon rRNA production. Pol I-specific transcription factors guide Pol I to the rDNA promoter and contribute to multiple rounds of transcription initiation, promoter escape, elongation and termination. In addition, many accessory factors are now known to assist at each stage of this transcription cycle, some of which allow the integration of transcriptional activity with metabolic demands. The organisation and accessibility of rDNA chromatin also impinge upon Pol I output, and complex mechanisms ensure the appropriate maintenance of the epigenetic state of the nucleolar genome and its effective transcription by Pol I. The following review presents our current understanding of the components of the Pol I transcription machinery, their functions and regulation by associated factors, and the mechanisms operating to ensure the proper transcription of rDNA chromatin. The importance of such stringent control is demonstrated by the fact that deregulated Pol I transcription is a feature of cancer and other disorders characterised by abnormal translational capacity. PMID:23150253

  7. Comment on "Length-dependent translation of messenger RNA by ribosomes"

    CERN Document Server

    Zhang, Yunxin

    2011-01-01

    In recent paper [Phys. Rev. E {\\bf 83}, 042903 (2011)], a simple model for the translation of messenger RNA by ribosomes is provided, and the expression of translational ratio of protein is given. In this comments, varied methods to get this ratio are addressed. Depending on a different method, we find that, roughly speaking, this translational ratio decays exponentially with mRNA length in prokaryotic cell, and reciprocally with mRNA length in eukaryotic cells.

  8. Ribosomal proteins L11 and L10.(L12)4 and the antibiotic thiostrepton interact with overlapping regions of the 23 S rRNA backbone in the ribosomal GTPase centre

    DEFF Research Database (Denmark)

    Rosendahl, G; Douthwaite, S

    1993-01-01

    The Escherichia coli ribosomal protein (r-protein) L11 and its binding site on 23 S ribosomal RNA (rRNA) are associated with ribosomal hydrolysis of guanosine 5'-triphosphate (GTP). We have used hydroxyl radical footprinting to map the contacts between L11 and the backbone riboses in 23 S rRNA, a...

  9. First structural evidence of sequestration of mRNA cap structures by type 1 ribosome inactivating protein from Momordica balsamina.

    Science.gov (United States)

    Kushwaha, Gajraj Singh; Yamini, Shavait; Kumar, Mukesh; Sinha, Mau; Kaur, Punit; Sharma, Sujata; Singh, Tej P

    2013-05-01

    This is the first structural evidence of recognition of mRNA cap structures by a ribosome inactivating protein. It is well known that a unique cap structure is formed at the 5' end of mRNA for carrying out various processes including mRNA maturation, translation initiation, and RNA turnover. The binding studies and crystal structure determinations of type 1 ribosome inactivating protein (RIP-1) from Momordica balsamina (MbRIP-1) were carried out with mRNA cap structures including (i) N7-methyl guanine (m7G), (ii) N7-methyl guanosine diphosphate (m7GDP), and (iii) N7-methyl guanosine triphosphate (m7GTP). These compounds showed affinities to MbRIP-1 at nanomolar concentrations. The structure determinations of the complexes of MbRIP-1 with m7G, m7GDP, and m7GTP at 2.65, 1.77, and 1.75 Å resolutions revealed that all the three compounds bound to MbRIP-1 in the substrate binding site at the positions which are slightly shifted towards Glu85 as compared to those of rRNA substrates. In this position, Glu85 forms several hydrogen bonds with guanine moiety while N-7 methyl group forms van der Waals contacts. However, the guanine rings are poorly stacked in these complexes. Thus, the mode of binding by MbRIP-1 to mRNA cap structures is different which results in the inhibition of depurination. Since some viruses are known to exploit the capping property of the host, this action of MbRIP-1 may have implications for the antiviral activity of this protein in vivo. The understanding of the mode of binding of MbRIP-1 to cap structures may also assist in the design of anti-viral agents. Copyright © 2013 Wiley Periodicals, Inc.

  10. MicroRNA Expression during Bovine Oocyte Maturation and Fertilization

    Directory of Open Access Journals (Sweden)

    Graham C. Gilchrist

    2016-03-01

    Full Text Available Successful fertilization and subsequent embryo development rely on complex molecular processes starting with the development of oocyte competence through maturation. MicroRNAs (miRNAs are small non-coding RNA molecules that function as gene regulators in many biological systems, including the oocyte and embryo. In order to further explore the roles of miRNAs in oocyte maturation, we employed small RNA sequencing as a screening tool to identify and characterize miRNA populations present in pools of bovine germinal vesicle (GV oocytes, metaphase II (MII oocytes, and presumptive zygotes (PZ. Each stage contained a defined miRNA population, some of which showed stable expression while others showed progressive changes between stages that were subsequently confirmed by quantitative reverse transcription polymerase chain reaction (RT-PCR. Bta-miR-155, bta-miR-222, bta-miR-21, bta-let-7d, bta-let-7i, and bta-miR-190a were among the statistically significant differentially expressed miRNAs (p < 0.05. To determine whether changes in specific primary miRNA (pri-miRNA transcripts were responsible for the observed miRNA changes, we evaluated pri-miR-155, -222 and let-7d expression. Pri-miR-155 and -222 were not detected in GV oocytes but pri-miR-155 was present in MII oocytes, indicating transcription during maturation. In contrast, levels of pri-let-7d decreased during maturation, suggesting that the observed increase in let-7d expression was likely due to processing of the primary transcript. This study demonstrates that both dynamic and stable populations of miRNAs are present in bovine oocytes and zygotes and extend previous studies supporting the importance of the small RNA landscape in the maturing bovine oocyte and early embryo.

  11. [Affinity modification of Escherichia coli ribosomes with photoactivated analogs of mRNA].

    Science.gov (United States)

    Gimautdinova, O I; Zenkova, M A; Karpova, G G; Podust, L M

    1984-01-01

    Oligoribonucleotide derivatives containing the photoactivated arylazidogroup at 5'-end of the oligonucleotide fragment [2-(N-2,4-dinitro-5-azidophenyl) aminoethyl] phosphamides of the oligoribonucleotides, azido-NH (CH2)2NHpN (pN) n-1, were prepared. It was demonstrated that azido-NH(CH2)2NHpA(pA)4 and azido-NH (CH2)2NHpU (pU)3 stimulate the binding of the codonspecific aminoacyl-tRNA with ribosome. After irradiation of the ternary complex ribosome-azido-NH (CH2)2NHpU (pU) n-1 X tRNA with UV-light (lambda greater than 350 nm) covalent binding of the reagent to ribosome occurs. Up to 10% of the reagent, bound in the ternary complex with ribosome, is cross-linked with the ribosomal proteins of 30S and 50S subunits. The ribosomal RNA are not modified by azido-NH (CH2)2NHpU (pU) n-1. The proteins of 30S and 50S subunits, modified with azido-NH (CH2)2NHpU (pU) n-1 with n = 4,7 and 8, were identified. It is shown that proteins of 30S subunits S3, S4, S9, S11, S12, S14, S17, S19, S20 undergo modification. The proteins of 50S subunits L2, L13, L16, L27, L32, L33 are modified. The set of the modified proteins essentially depends on the length of the oligonucleotide part of the reagent and on occupancy of ribosome A-site by a molecule of tRNA.

  12. Ribosomal protein L16 binds to the 3'-end of transfer RNA.

    Science.gov (United States)

    Maimets, T; Remme, J; Villems, R

    1984-01-23

    Escherichia coli 50 S ribosomal subunits were reconstituted with and without protein L16 present. The latter particles, although active in puromycin reaction, were unable to use CACCA-Phe as an acceptor substrate. We also found that L16 interacts directly with this oligonucleotide and, in the complex with tRNA, protects its 3'-end from pancreatic ribonuclease digestion. We suggest that the role of L16 is in the fixation of the aminoacyl stem of tRNA to the ribosome at its A-site.

  13. In vitro improvement of a shark IgNAR antibody by Qbeta replicase mutation and ribosome display mimics in vivo affinity maturation.

    Science.gov (United States)

    Kopsidas, George; Roberts, Anthony S; Coia, Gregory; Streltsov, Victor A; Nuttall, Stewart D

    2006-11-15

    We have employed a novel mutagenesis system, which utilizes an error-prone RNA dependent RNA polymerase from Qbeta bacteriophage, to create a diverse library of single domain antibody fragments based on the shark IgNAR antibody isotype. Coupling of these randomly mutated mRNA templates directly to the translating ribosome allowed in vitro selection of affinity matured variants showing enhanced binding to target, the apical membrane antigen 1 (AMA1) from Plasmodium falciparum. One mutation mapping to the IgNAR CDR1 loop was not readily additive to other changes, a result explained by structural analysis of aromatic interactions linking the CDR1, CDR3, and Ig framework regions. This combination appeared also to be counter-selected in experiments, suggesting that in vitro affinity maturation is additionally capable of discriminating against incorrectly produced protein variants. Interestingly, a further mutation was directed to a position in the IgNAR heavy loop 4 which is also specifically targeted during the in vivo shark response to antigen, providing a correlation between natural processes and laboratory-based affinity maturation systems.

  14. Ribosomal RNA in Alzheimer disease is oxidized by bound redox-active iron.

    Science.gov (United States)

    Honda, Kazuhiro; Smith, Mark A; Zhu, Xiongwei; Baus, Diane; Merrick, William C; Tartakoff, Alan M; Hattier, Thomas; Harris, Peggy L; Siedlak, Sandra L; Fujioka, Hisashi; Liu, Quan; Moreira, Paula I; Miller, Frank P; Nunomura, Akihiko; Shimohama, Shun; Perry, George

    2005-06-03

    Oxidative modification of cytoplasmic RNA in vulnerable neurons is an important, well documented feature of the pathophysiology of Alzheimer disease. Here we report that RNA-bound iron plays a pivotal role for RNA oxidation in vulnerable neurons in Alzheimer disease brain. The cytoplasm of hippocampal neurons showed significantly higher redox activity and iron(II) staining than age-matched controls. Notably, both were susceptible to RNase, suggesting a physical association of iron(II) with RNA. Ultrastructural analysis further suggested an endoplasmic reticulum association. Both rRNA and mRNA showed twice the iron binding as tRNA. rRNA, extremely abundant in neurons, was considered to provide the greatest number of iron binding sites among cytoplasmic RNA species. Interestingly, the difference of iron binding capacity disappeared after denaturation of RNA, suggesting that the higher order structure may contribute to the greater iron binding of rRNA. Reflecting the difference of iron binding capacity, oxidation of rRNA by the Fenton reaction formed 13 times more 8-hydroxyguanosine than tRNA. Consistent with in situ findings, ribosomes purified from Alzheimer hippocampus contained significantly higher levels of RNase-sensitive iron(II) and redox activity than control. Furthermore, only Alzheimer rRNA contains 8-hydroxyguanosine in reverse transcriptase-PCR. Addressing the biological significance of ribosome oxidation by redox-active iron, in vitro translation with oxidized ribosomes from rabbit reticulocyte showed a significant reduction of protein synthesis. In conclusion these results suggest that rRNA provides a binding site for redox-active iron and serves as a redox center within the cytoplasm of vulnerable neurons in Alzheimer disease in advance of the appearance of morphological change indicating neurodegeneration.

  15. Impact of P-Site tRNA and antibiotics on ribosome mediated protein folding: studies using the Escherichia coli ribosome.

    Directory of Open Access Journals (Sweden)

    Surojit Mondal

    Full Text Available BACKGROUND: The ribosome, which acts as a platform for mRNA encoded polypeptide synthesis, is also capable of assisting in folding of polypeptide chains. The peptidyl transferase center (PTC that catalyzes peptide bond formation resides in the domain V of the 23S rRNA of the bacterial ribosome. Proper positioning of the 3' -CCA ends of the A- and P-site tRNAs via specific interactions with the nucleotides of the PTC are crucial for peptidyl transferase activity. This RNA domain is also the center for ribosomal chaperoning activity. The unfolded polypeptide chains interact with the specific nucleotides of the PTC and are released in a folding competent form. In vitro transcribed RNA corresponding to this domain (bDV RNA also displays chaperoning activity. RESULTS: The present study explores the effects of tRNAs, antibiotics that are A- and P-site PTC substrate analogs (puromycin and blasticidin and macrolide antibiotics (erythromycin and josamycin on the chaperoning ability of the E. coli ribosome and bDV RNA. Our studies using mRNA programmed ribosomes show that a tRNA positioned at the P-site effectively inhibits the ribosome's chaperoning function. We also show that the antibiotic blasticidin (that mimics the interaction between 3'-CCA end of P/P-site tRNA with the PTC is more effective in inhibiting ribosome and bDV RNA chaperoning ability than either puromycin or the macrolide antibiotics. Mutational studies of the bDV RNA could identify the nucleotides U2585 and G2252 (both of which interact with P-site tRNA to be important for its chaperoning ability. CONCLUSION: Both protein synthesis and their proper folding are crucial for maintenance of a functional cellular proteome. The PTC of the ribosome is attributed with both these abilities. The silencing of the chaperoning ability of the ribosome in the presence of P-site bound tRNA might be a way to segregate these two important functions.

  16. Computational and Experimental Characterization of Ribosomal DNA and RNA G-Quadruplexes

    Science.gov (United States)

    Cho, Samuel

    DNA G-quadruplexes in human telomeres and gene promoters are being extensively studied for their role in controlling the growth of cancer cells. Recent studies strongly suggest that guanine (G)-rich genes encoding pre-ribosomal RNA (pre-rRNA) are a potential anticancer target through the inhibition of RNA polymerase I (Pol I) in ribosome biogenesis. However, the structures of ribosomal G-quadruplexes at atomic resolution are unknown, and very little biophysical characterization has been performed on them to date. Here, we have modeled two putative rDNA G-quadruplex structures, NUC 19P and NUC 23P, which we observe via circular dichroism (CD) spectroscopy to adopt a predominantly parallel topology, and their counterpart rRNA. To validate and refine the putative ribosomal G-quadruplex structures, we performed all-atom molecular dynamics (MD) simulations using the CHARMM36 force field in the presence and absence of stabilizing K + or Na + ions. We optimized the CHARMM36 force field K + parameters to be more consistent with quantum mechanical calculations (and the polarizable Drude model force field) so that the K + ion is predominantly in the G-quadruplex channel. Our MD simulations show that the rDNA G-quadruplex have more well-defined, predominantly parallel-topology structures than rRNA and NUC 19P is more structured than NUC 23P, which features extended loops. Our study demonstrates that they are both potential targets for the design of novel chemotherapeutics.

  17. Locus-specific ribosomal RNA gene silencing in nucleolar dominance.

    Directory of Open Access Journals (Sweden)

    Michelle S Lewis

    Full Text Available The silencing of one parental set of rRNA genes in a genetic hybrid is an epigenetic phenomenon known as nucleolar dominance. We showed previously that silencing is restricted to the nucleolus organizer regions (NORs, the loci where rRNA genes are tandemly arrayed, and does not spread to or from neighboring protein-coding genes. One hypothesis is that nucleolar dominance is the net result of hundreds of silencing events acting one rRNA gene at a time. A prediction of this hypothesis is that rRNA gene silencing should occur independent of chromosomal location. An alternative hypothesis is that the regulatory unit in nucleolar dominance is the NOR, rather than each individual rRNA gene, in which case NOR localization may be essential for rRNA gene silencing. To test these alternative hypotheses, we examined the fates of rRNA transgenes integrated at ectopic locations. The transgenes were accurately transcribed in all independent transgenic Arabidopsis thaliana lines tested, indicating that NOR localization is not required for rRNA gene expression. Upon crossing the transgenic A. thaliana lines as ovule parents with A. lyrata to form F1 hybrids, a new system for the study of nucleolar dominance, the endogenous rRNA genes located within the A. thaliana NORs are silenced. However, rRNA transgenes escaped silencing in multiple independent hybrids. Collectively, our data suggest that rRNA gene activation can occur in a gene-autonomous fashion, independent of chromosomal location, whereas rRNA gene silencing in nucleolar dominance is locus-dependent.

  18. Identification of the methyltransferase targeting C2499 in Deinococcus radiodurans 23S ribosomal RNA

    DEFF Research Database (Denmark)

    Nielsen, Julie Mundus; Flyvbjerg, Karen Freund; Kirpekar, Finn

    2016-01-01

    The bacterium Deinococcus radiodurans-like all other organisms-introduces nucleotide modifications into its ribosomal RNA. We have previously found that the bacterium contains a Carbon-5 methylation on cytidine 2499 of its 23S ribosomal RNA, which is so far the only modified version of cytidine 2...

  19. High-Resolution Analysis of Coronavirus Gene Expression by RNA Sequencing and Ribosome Profiling.

    Science.gov (United States)

    Irigoyen, Nerea; Firth, Andrew E; Jones, Joshua D; Chung, Betty Y-W; Siddell, Stuart G; Brierley, Ian

    2016-02-01

    Members of the family Coronaviridae have the largest genomes of all RNA viruses, typically in the region of 30 kilobases. Several coronaviruses, such as Severe acute respiratory syndrome-related coronavirus (SARS-CoV) and Middle East respiratory syndrome-related coronavirus (MERS-CoV), are of medical importance, with high mortality rates and, in the case of SARS-CoV, significant pandemic potential. Other coronaviruses, such as Porcine epidemic diarrhea virus and Avian coronavirus, are important livestock pathogens. Ribosome profiling is a technique which exploits the capacity of the translating ribosome to protect around 30 nucleotides of mRNA from ribonuclease digestion. Ribosome-protected mRNA fragments are purified, subjected to deep sequencing and mapped back to the transcriptome to give a global "snap-shot" of translation. Parallel RNA sequencing allows normalization by transcript abundance. Here we apply ribosome profiling to cells infected with Murine coronavirus, mouse hepatitis virus, strain A59 (MHV-A59), a model coronavirus in the same genus as SARS-CoV and MERS-CoV. The data obtained allowed us to study the kinetics of virus transcription and translation with exquisite precision. We studied the timecourse of positive and negative-sense genomic and subgenomic viral RNA production and the relative translation efficiencies of the different virus ORFs. Virus mRNAs were not found to be translated more efficiently than host mRNAs; rather, virus translation dominates host translation at later time points due to high levels of virus transcripts. Triplet phasing of the profiling data allowed precise determination of translated reading frames and revealed several translated short open reading frames upstream of, or embedded within, known virus protein-coding regions. Ribosome pause sites were identified in the virus replicase polyprotein pp1a ORF and investigated experimentally. Contrary to expectations, ribosomes were not found to pause at the ribosomal

  20. High-Resolution Analysis of Coronavirus Gene Expression by RNA Sequencing and Ribosome Profiling.

    Directory of Open Access Journals (Sweden)

    Nerea Irigoyen

    2016-02-01

    Full Text Available Members of the family Coronaviridae have the largest genomes of all RNA viruses, typically in the region of 30 kilobases. Several coronaviruses, such as Severe acute respiratory syndrome-related coronavirus (SARS-CoV and Middle East respiratory syndrome-related coronavirus (MERS-CoV, are of medical importance, with high mortality rates and, in the case of SARS-CoV, significant pandemic potential. Other coronaviruses, such as Porcine epidemic diarrhea virus and Avian coronavirus, are important livestock pathogens. Ribosome profiling is a technique which exploits the capacity of the translating ribosome to protect around 30 nucleotides of mRNA from ribonuclease digestion. Ribosome-protected mRNA fragments are purified, subjected to deep sequencing and mapped back to the transcriptome to give a global "snap-shot" of translation. Parallel RNA sequencing allows normalization by transcript abundance. Here we apply ribosome profiling to cells infected with Murine coronavirus, mouse hepatitis virus, strain A59 (MHV-A59, a model coronavirus in the same genus as SARS-CoV and MERS-CoV. The data obtained allowed us to study the kinetics of virus transcription and translation with exquisite precision. We studied the timecourse of positive and negative-sense genomic and subgenomic viral RNA production and the relative translation efficiencies of the different virus ORFs. Virus mRNAs were not found to be translated more efficiently than host mRNAs; rather, virus translation dominates host translation at later time points due to high levels of virus transcripts. Triplet phasing of the profiling data allowed precise determination of translated reading frames and revealed several translated short open reading frames upstream of, or embedded within, known virus protein-coding regions. Ribosome pause sites were identified in the virus replicase polyprotein pp1a ORF and investigated experimentally. Contrary to expectations, ribosomes were not found to pause at the

  1. The nucleolus and transcription of ribosomal genes.

    Science.gov (United States)

    Raska, Ivan; Koberna, Karel; Malínský, Jan; Fidlerová, Helena; Masata, Martin

    2004-10-01

    Ribosome biogenesis is a highly dynamic, steady-state nucleolar process that involves synthesis and maturation of rRNA, its transient interactions with non-ribosomal proteins and RNPs and assembly with ribosomal proteins. In the few years of the 21st century, an exciting progress in the molecular understanding of rRNA and ribosome biogenesis has taken place. In this review, we discuss the recent results on the regulation of rRNA synthesis in relation to the functional organization of the nucleolus, and put an emphasis on the situation encountered in mammalian somatic cells.

  2. Assessing the 5S ribosomal RNA heterogeneity in Arabidopsis thaliana using short RNA next generation sequencing data.

    Science.gov (United States)

    Szymanski, Maciej; Karlowski, Wojciech M

    2016-01-01

    In eukaryotes, ribosomal 5S rRNAs are products of multigene families organized within clusters of tandemly repeated units. Accumulation of genomic data obtained from a variety of organisms demonstrated that the potential 5S rRNA coding sequences show a large number of variants, often incompatible with folding into a correct secondary structure. Here, we present results of an analysis of a large set of short RNA sequences generated by the next generation sequencing techniques, to address the problem of heterogeneity of the 5S rRNA transcripts in Arabidopsis and identification of potentially functional rRNA-derived fragments.

  3. Can we estimate bacterial growth rates from ribosomal RNA content?

    Energy Technology Data Exchange (ETDEWEB)

    Kemp, P.F.

    1995-12-31

    Several studies have demonstrated a strong relationship between the quantity of RNA in bacterial cells and their growth rate under laboratory conditions. It may be possible to use this relationship to provide information on the activity of natural bacterial communities, and in particular on growth rate. However, if this approach is to provide reliably interpretable information, the relationship between RNA content and growth rate must be well-understood. In particular, a requisite of such applications is that the relationship must be universal among bacteria, or alternately that the relationship can be determined and measured for specific bacterial taxa. The RNA-growth rate relationship has not been used to evaluate bacterial growth in field studies, although RNA content has been measured in single cells and in bulk extracts of field samples taken from coastal environments. These measurements have been treated as probable indicators of bacterial activity, but have not yet been interpreted as estimators of growth rate. The primary obstacle to such interpretations is a lack of information on biological and environmental factors that affect the RNA-growth rate relationship. In this paper, the available data on the RNA-growth rate relationship in bacteria will be reviewed, including hypotheses regarding the regulation of RNA synthesis and degradation as a function of growth rate and environmental factors; i.e. the basic mechanisms for maintaining RNA content in proportion to growth rate. An assessment of the published laboratory and field data, the current status of this research area, and some of the remaining questions will be presented.

  4. The CRM domain: an RNA binding module derived from an ancient ribosome-associated protein.

    Science.gov (United States)

    Barkan, Alice; Klipcan, Larik; Ostersetzer, Oren; Kawamura, Tetsuya; Asakura, Yukari; Watkins, Kenneth P

    2007-01-01

    The CRS1-YhbY domain (also called the CRM domain) is represented as a stand-alone protein in Archaea and Bacteria, and in a family of single- and multidomain proteins in plants. The function of this domain is unknown, but structural data and the presence of the domain in several proteins known to interact with RNA have led to the proposal that it binds RNA. Here we describe a phylogenetic analysis of the domain, its incorporation into diverse proteins in plants, and biochemical properties of a prokaryotic and eukaryotic representative of the domain family. We show that a bacterial member of the family, Escherichia coli YhbY, is associated with pre-50S ribosomal subunits, suggesting that YhbY functions in ribosome assembly. GFP fused to a single-domain CRM protein from maize localizes to the nucleolus, suggesting that an analogous activity may have been retained in plants. We show further that an isolated maize CRM domain has RNA binding activity in vitro, and that a small motif shared with KH RNA binding domains, a conserved "GxxG" loop, contributes to its RNA binding activity. These and other results suggest that the CRM domain evolved in the context of ribosome function prior to the divergence of Archaea and Bacteria, that this function has been maintained in extant prokaryotes, and that the domain was recruited to serve as an RNA binding module during the evolution of plant genomes.

  5. Characterization of recombinant bacteriophages containing mosquito ribosomal RNA genes

    Energy Technology Data Exchange (ETDEWEB)

    Park, Y.J.

    1988-01-01

    A family of nine recombinant bacteriophages containing rRNA genes from cultured cells of the mosquito, Aedes albopictus, has been isolated by screening two different genomic DNA libraries - Charon 30 and EMBL 3 using {sup 32}P-labeled 18S and 28S rRNA as probes. These nine recombinant bacteriophages were characterized by restriction mapping, Southern blotting, and S1 nuclease analysis. The 18S rRNA coding region contains an evolutionarily conserved EcoRI site near the 3{prime}-end, and measures 1800 bp. The 28S rRNA genes were divided into {alpha} and {beta} coding regions measuring 1750 bp and 2000 bp, respectively. The gap between these two regions measures about 340 bp. No insertion sequences were found in the rRNA coding regions. The entire rDNA repeat unit had a minimum length of 15.6 kb, including a nontranscribed spacer region. The non-transcribed spacer region of cloned A. albopictus rDNA contained a common series of seven PvuI sites within a 1250 bp region upstream of the 18S rRNA coding region, and a proportion of this region also showed heterogeneity both in the length and in the restriction sites.

  6. Preparation of Biologically Active Arabidopsis Ribosomes and Comparison with Yeast Ribosomes for Binding to a tRNA-Mimic that Enhances Translation of Plant Plus-Strand RNA Viruses

    Directory of Open Access Journals (Sweden)

    Vera Aleksey Stupina

    2013-07-01

    Full Text Available Isolation of biologically active cell components from multicellular eukaryotic organisms often poses difficult challenges such as low yields and inability to retain the integrity and functionality of the purified compound. We previously identified a cap-independent translation enhancer (3’CITE in the 3’UTR of Turnip crinkle virus (TCV that structurally mimics a tRNA and binds to yeast 80S ribosomes and 60S subunits in the P-site. Yeast ribosomes were used for these studies due to the lack of methods for isolation of plant ribosomes with high yields and integrity. To carry out studies with more natural components, a simple and efficient procedure has been developed for the isolation of large quantities of high quality ribosomes and ribosomal subunits from Arabidopsis thaliana protoplasts prepared from seed-derived callus tissue. Attempts to isolate high quality ribosomes from wheat germ, bean sprouts and evacuolated protoplasts were unsuccessful. Addition of purified Arabidopsis 80S plant ribosomes to ribosome-depleted wheat germ lysates resulted in a greater than 1200-fold enhancement in in vitro translation of a luciferase reporter construct. The TCV 3’CITE bound to ribosomes with a 3 to 7-fold higher efficiency when using plant 80S ribosomes compared with yeast ribosomes, indicating that this viral translational enhancer is adapted to interact more efficiently with host plant ribosomes.

  7. Complementarity between the mRNA 5' untranslated region and 18S ribosomal RNA can inhibit translation.

    Science.gov (United States)

    Verrier, S B; Jean-Jean, O

    2000-04-01

    In eubacteria, base pairing between the 3' end of 16S rRNA and the ribosome-binding site of mRNA is required for efficient initiation of translation. An interaction between the 18S rRNA and the mRNA was also proposed for translation initiation in eukaryotes. Here, we used an antisense RNA approach in vivo to identify the regions of 18S rRNA that might interact with the mRNA 5' untranslated region (5' UTR). Various fragments covering the entire mouse 18S rRNA gene were cloned 5' of a cat reporter gene in a eukaryotic vector, and translation products were analyzed after transient expression in human cells. For the largest part of 18S rRNA, we show that the insertion of complementary fragments in the mRNA 5' UTR do not impair translation of the downstream open reading frame (ORF). When translation inhibition is observed, reduction of the size of the complementary sequence to less than 200 nt alleviates the inhibitory effect. A single fragment complementary to the 18S rRNA 3' domain retains its inhibitory potential when reduced to 100 nt. Deletion analyses show that two distinct sequences of approximately 25 nt separated by a spacer sequence of 50 nt are required for the inhibitory effect. Sucrose gradient fractionation of polysomes reveals that mRNAs containing the inhibitory sequences accumulate in the fractions with 40S ribosomal subunits, suggesting that translation is blocked due to stalling of initiation complexes. Our results support an mRNA-rRNA base pairing to explain the translation inhibition observed and suggest that this region of 18S rRNA is properly located for interacting with mRNA.

  8. Symportin 1 chaperones 5S RNP assembly during ribosome biogenesis by occupying an essential rRNA-binding site.

    Science.gov (United States)

    Calviño, Fabiola R; Kharde, Satyavati; Ori, Alessandro; Hendricks, Astrid; Wild, Klemens; Kressler, Dieter; Bange, Gert; Hurt, Ed; Beck, Martin; Sinning, Irmgard

    2015-04-07

    During 60S biogenesis, mature 5S RNP consisting of 5S RNA, RpL5 and RpL11, assembles into a pre-60S particle, where docking relies on RpL11 interacting with helix 84 (H84) of the 25S RNA. How 5S RNP is assembled for recruitment into the pre-60S is not known. Here we report the crystal structure of a ternary symportin Syo1-RpL5-N-RpL11 complex and provide biochemical and structural insights into 5S RNP assembly. Syo1 guards the 25S RNA-binding surface on RpL11 and competes with H84 for binding. Pull-down experiments show that H84 releases RpL11 from the ternary complex, but not in the presence of 5S RNA. Crosslinking mass spectrometry visualizes structural rearrangements on incorporation of 5S RNA into the Syo1-RpL5-RpL11 complex supporting the formation of a pre-5S RNP. Our data underline the dual role of Syo1 in ribosomal protein transport and as an assembly platform for 5S RNP.

  9. Symportin 1 chaperones 5S RNP assembly during ribosome biogenesis by occupying an essential rRNA-binding site

    Science.gov (United States)

    Calviño, Fabiola R.; Kharde, Satyavati; Ori, Alessandro; Hendricks, Astrid; Wild, Klemens; Kressler, Dieter; Bange, Gert; Hurt, Ed; Beck, Martin; Sinning, Irmgard

    2015-04-01

    During 60S biogenesis, mature 5S RNP consisting of 5S RNA, RpL5 and RpL11, assembles into a pre-60S particle, where docking relies on RpL11 interacting with helix 84 (H84) of the 25S RNA. How 5S RNP is assembled for recruitment into the pre-60S is not known. Here we report the crystal structure of a ternary symportin Syo1-RpL5-N-RpL11 complex and provide biochemical and structural insights into 5S RNP assembly. Syo1 guards the 25S RNA-binding surface on RpL11 and competes with H84 for binding. Pull-down experiments show that H84 releases RpL11 from the ternary complex, but not in the presence of 5S RNA. Crosslinking mass spectrometry visualizes structural rearrangements on incorporation of 5S RNA into the Syo1-RpL5-RpL11 complex supporting the formation of a pre-5S RNP. Our data underline the dual role of Syo1 in ribosomal protein transport and as an assembly platform for 5S RNP.

  10. Changes in the conformation of 5S rRNA cause alterations in principal functions of the ribosomal nanomachine.

    Science.gov (United States)

    Kouvela, Ekaterini C; Gerbanas, George V; Xaplanteri, Maria A; Petropoulos, Alexandros D; Dinos, George P; Kalpaxis, Dimitrios L

    2007-01-01

    5S rRNA is an integral component of the large ribosomal subunit in virtually all living organisms. Polyamine binding to 5S rRNA was investigated by cross-linking of N1-azidobenzamidino (ABA)-spermine to naked 5S rRNA or 50S ribosomal subunits and whole ribosomes from Escherichia coli cells. ABA-spermine cross-linking sites were kinetically measured and their positions in 5S rRNA were localized by primer extension analysis. Helices III and V, and loops A, C, D and E in naked 5S rRNA were found to be preferred polyamine binding sites. When 50S ribosomal subunits or poly(U)-programmed 70S ribosomes bearing tRNA(Phe) at the E-site and AcPhe-tRNA at the P-site were targeted, the susceptibility of 5S rRNA to ABA-spermine was greatly reduced. Regardless of 5S rRNA assembly status, binding of spermine induced significant changes in the 5S rRNA conformation; loop A adopted an apparent 'loosening' of its structure, while loops C, D, E and helices III and V achieved a more compact folding. Poly(U)-programmed 70S ribosomes possessing 5S rRNA cross-linked with spermine were more efficient than control ribosomes in tRNA binding, peptidyl transferase activity and translocation. Our results support the notion that 5S rRNA serves as a signal transducer between regions of 23S rRNA responsible for principal ribosomal functions.

  11. CED-4 is an mRNA-binding protein that delivers ced-3 mRNA to ribosomes.

    Science.gov (United States)

    Wang, Miao-xing; Itoh, Masanori; Li, Shimo; Hida, Yoko; Ohta, Kazunori; Hayakawa, Miki; Nishida, Emika; Ueda, Masashi; Islam, Saiful; Tana; Nakagawa, Toshiyuki

    2016-01-29

    Cell death abnormal (ced)-3 and ced-4 genes regulate apoptosis to maintain tissue homeostasis in Caenorhabditis elegans. Apoptosome formation and CED-4 translocation drive CED-3 activation. However, the precise role of CED-4 translocation is not yet fully understood. In this study, using a combination of immunoprecipitation and reverse transcription-polymerase chain reaction methods in cells and a glutathione-S-transferase pull down assay in a cell-free system, we show that CED-4 binds ced-3 mRNA. In the presence of ced-3 mRNA, CED-4 protein is enriched in the microsomal fraction and interacts with ribosomal protein L10a in mammalian cells, increasing the levels of CED-3. These results suggest that CED-4 forms a complex with ced-3 mRNA and delivers it to ribosomes for translation.

  12. Validation of two ribosomal RNA removal methods for microbial metatranscriptomics

    Energy Technology Data Exchange (ETDEWEB)

    He, Shaomei; Wurtzel, Omri; Singh, Kanwar; Froula, Jeff L; Yilmaz, Suzan; Tringe, Susannah G; Wang, Zhong; Chen, Feng; Lindquist, Erika A; Sorek, Rotem; Hugenholtz, Philip

    2010-10-01

    The predominance of rRNAs in the transcriptome is a major technical challenge in sequence-based analysis of cDNAs from microbial isolates and communities. Several approaches have been applied to deplete rRNAs from (meta)transcriptomes, but no systematic investigation of potential biases introduced by any of these approaches has been reported. Here we validated the effectiveness and fidelity of the two most commonly used approaches, subtractive hybridization and exonuclease digestion, as well as combinations of these treatments, on two synthetic five-microorganism metatranscriptomes using massively parallel sequencing. We found that the effectiveness of rRNA removal was a function of community composition and RNA integrity for these treatments. Subtractive hybridization alone introduced the least bias in relative transcript abundance, whereas exonuclease and in particular combined treatments greatly compromised mRNA abundance fidelity. Illumina sequencing itself also can compromise quantitative data analysis by introducing a G+C bias between runs.

  13. Structural and functional analysis of Escherichia coli ribosomes containing small deletions around position 1760 in the 23S ribosomal RNA.

    Science.gov (United States)

    Zweib, C; Dahlberg, A E

    1984-09-25

    Three different small deletions were produced at a single Pvu 2 restriction site in E. coli 23S rDNA of plasmid pKK 3535 using exonuclease Bal 31. The deletions were located around position 1760 in 23S rRNA and were characterized by DNA sequencing as well as by direct fingerprinting and S1-mapping of the rRNA. Two of the mutant plasmids, Pvu 2-32 and Pvu 2-33, greatly reduced the growth rate of transformed cells while the third mutant, Pvu 2-14 grew as fast as cells containing the wild-type plasmid pKK 3535. All three mutant 23S rRNAs were incorporated into 50S-like particles and were even found in 70S ribosomes and polysomes in vivo. The conformation of mutant 23S rRNA in 50S subunits was probed with a double-strand specific RNase from cobra venom. These analyses revealed changes in the accessibility of cleavage sites near the deletions around position 1760 and in the area around position 800 in all three mutant rRNAs. We suggest, that an altered conformation of the rRNAs at the site of the deletion is responsible for the slow growth of cells containing mutant plasmids Pvu 2-32 and Pvu 2-33.

  14. Chromosomal localization of the major ribosomal RNA genes in scallop Chlamys farreri

    Institute of Scientific and Technical Information of China (English)

    HUANG Xiaoting; BAO Zhenmin; BI Ke; HU Jingjie; ZHANG Can; ZHANG Quanqi; HU Xiaoli

    2006-01-01

    The chromosomes of Chlamys farreri were analyzed by means of silver staining and fluorescence in situ hybridization ( FISH ) with 18S-28S rDNA probe. Probe was made by PCR amplification of a DNA fragment containing internal transcribed spacers ITS1 between 18S and 5.8S ribosomal RNA gene, ITS2 between 5.8S and 28S ribosomal RNA gene and 5.8S rRNA gene, and labeled by PCR incorporation of bio-16-dUTP. FISH signals were located on the short arm of subtelocentric chromosome 10. After silverstaining, nucleolus organizer regions (NORs) could be observed on the telomere of the short arm of chromosome 10. However,one metaphase spread displayed an additional silver spot on the short arm of subtelocentric chromosome 12.

  15. Biological significance of 5S rRNA import into human mitochondria: role of ribosomal protein MRP-L18.

    Science.gov (United States)

    Smirnov, Alexandre; Entelis, Nina; Martin, Robert P; Tarassov, Ivan

    2011-06-15

    5S rRNA is an essential component of ribosomes of all living organisms, the only known exceptions being mitochondrial ribosomes of fungi, animals, and some protists. An intriguing situation distinguishes mammalian cells: Although the mitochondrial genome contains no 5S rRNA genes, abundant import of the nuclear DNA-encoded 5S rRNA into mitochondria was reported. Neither the detailed mechanism of this pathway nor its rationale was clarified to date. In this study, we describe an elegant molecular conveyor composed of a previously identified human 5S rRNA import factor, rhodanese, and mitochondrial ribosomal protein L18, thanks to which 5S rRNA molecules can be specifically withdrawn from the cytosolic pool and redirected to mitochondria, bypassing the classic nucleolar reimport pathway. Inside mitochondria, the cytosolic 5S rRNA is shown to be associated with mitochondrial ribosomes.

  16. Reconstruction of ribosomal RNA genes from metagenomic data.

    Directory of Open Access Journals (Sweden)

    Lu Fan

    Full Text Available Direct sequencing of environmental DNA (metagenomics has a great potential for describing the 16S rRNA gene diversity of microbial communities. However current approaches using this 16S rRNA gene information to describe community diversity suffer from low taxonomic resolution or chimera problems. Here we describe a new strategy that involves stringent assembly and data filtering to reconstruct full-length 16S rRNA genes from metagenomicpyrosequencing data. Simulations showed that reconstructed 16S rRNA genes provided a true picture of the community diversity, had minimal rates of chimera formation and gave taxonomic resolution down to genus level. The strategy was furthermore compared to PCR-based methods to determine the microbial diversity in two marine sponges. This showed that about 30% of the abundant phylotypes reconstructed from metagenomic data failed to be amplified by PCR. Our approach is readily applicable to existing metagenomic datasets and is expected to lead to the discovery of new microbial phylotypes.

  17. Targets and intracellular signaling mechanisms for deoxynivalenol-induced ribosomal RNA cleavage.

    Science.gov (United States)

    He, Kaiyu; Zhou, Hui-Ren; Pestka, James J

    2012-06-01

    The trichothecene mycotoxin deoxynivalenol (DON), a known translational inhibitor, induces ribosomal RNA (rRNA) cleavage. Here, we characterized this process relative to (1) specific 18S and 28S ribosomal RNA cleavage sites and (2) identity of specific upstream signaling elements in this pathway. Capillary electrophoresis indicated that DON at concentrations as low as 200 ng/ml evoked selective rRNA cleavage after 6 h and that 1000 ng/ml caused cleavage within 2 h. Northern blot analysis revealed that DON exposure induced six rRNA cleavage fragments from 28S rRNA and five fragments from 18S rRNA. When selective kinase inhibitors were used to identify potential upstream signals, RNA-activated protein kinase (PKR), hematopoietic cell kinase (Hck), and p38 were found to be required for rRNA cleavage, whereas c-Jun N-terminal kinase and extracellular signal-regulated kinase were not. Furthermore, rRNA fragmentation was suppressed by the p53 inhibitors pifithrin-α and pifithrin-μ as well as the pan caspase inhibitor Z-VAD-FMK. Concurrent apoptosis was confirmed by acridine orange/ethidium bromide staining and flow cytometry. DON activated caspases 3, 8, and 9, thus suggesting the possible coinvolvement of both extrinsic and intrinsic apoptotic pathways in rRNA cleavage. Satratoxin G (SG), anisomycin, and ricin also induced specific rRNA cleavage profiles identical to those of DON, suggesting that ribotoxins might share a conserved rRNA cleavage mechanism. Taken together, DON-induced rRNA cleavage is likely to be closely linked to apoptosis activation and appears to involve the sequential activation of PKR/Hck →p38→p53→caspase 8/9→caspase 3.

  18. Regulation of ribosomal rna synthesis in escherichia coli

    OpenAIRE

    Oostra, Bernard Anne

    1981-01-01

    Bacterien kunnen met verschillende snelheden groeien. De groeisnelheid hangt af van het milieu waarin de bakterien zich bevinden. De expressie van genen wordt aangepast aan de groeiomstandigheden. Omdat op een bepaald moment slechts een beperkt deel van de genen tot expressie komt, moet er sprake zijn van regulering. Daarbij is het ook van belang te weten dat prokaryoten één enzym hebben, het RNA polymerase, dat zorgt voor de transcriptie van alle genen. ... Samenvatting

  19. The Circadian Clock Modulates Global Daily Cycles of mRNA Ribosome Loading[OPEN

    Science.gov (United States)

    Missra, Anamika; Ernest, Ben; Jia, Qidong; Ke, Kenneth

    2015-01-01

    Circadian control of gene expression is well characterized at the transcriptional level, but little is known about diel or circadian control of translation. Genome-wide translation state profiling of mRNAs in Arabidopsis thaliana seedlings grown in long day was performed to estimate ribosome loading per mRNA. The experiments revealed extensive translational regulation of key biological processes. Notably, translation of mRNAs for ribosomal proteins and mitochondrial respiration peaked at night. Central clock mRNAs are among those subject to fluctuations in ribosome loading. There was no consistent phase relationship between peak translation states and peak transcript levels. The overlay of distinct transcriptional and translational cycles can be expected to alter the waveform of the protein synthesis rate. Plants that constitutively overexpress the clock gene CCA1 showed phase shifts in peak translation, with a 6-h delay from midnight to dawn or from noon to evening being particularly common. Moreover, cycles of ribosome loading that were detected under continuous light in the wild type collapsed in the CCA1 overexpressor. Finally, at the transcript level, the CCA1-ox strain adopted a global pattern of transcript abundance that was broadly correlated with the light-dark environment. Altogether, these data demonstrate that gene-specific diel cycles of ribosome loading are controlled in part by the circadian clock. PMID:26392078

  20. The Circadian Clock Modulates Global Daily Cycles of mRNA Ribosome Loading.

    Science.gov (United States)

    Missra, Anamika; Ernest, Ben; Lohoff, Tim; Jia, Qidong; Satterlee, James; Ke, Kenneth; von Arnim, Albrecht G

    2015-09-01

    Circadian control of gene expression is well characterized at the transcriptional level, but little is known about diel or circadian control of translation. Genome-wide translation state profiling of mRNAs in Arabidopsis thaliana seedlings grown in long day was performed to estimate ribosome loading per mRNA. The experiments revealed extensive translational regulation of key biological processes. Notably, translation of mRNAs for ribosomal proteins and mitochondrial respiration peaked at night. Central clock mRNAs are among those subject to fluctuations in ribosome loading. There was no consistent phase relationship between peak translation states and peak transcript levels. The overlay of distinct transcriptional and translational cycles can be expected to alter the waveform of the protein synthesis rate. Plants that constitutively overexpress the clock gene CCA1 showed phase shifts in peak translation, with a 6-h delay from midnight to dawn or from noon to evening being particularly common. Moreover, cycles of ribosome loading that were detected under continuous light in the wild type collapsed in the CCA1 overexpressor. Finally, at the transcript level, the CCA1-ox strain adopted a global pattern of transcript abundance that was broadly correlated with the light-dark environment. Altogether, these data demonstrate that gene-specific diel cycles of ribosome loading are controlled in part by the circadian clock.

  1. The pleuromutilin drugs tiamulin and valnemulin bind to the RNA at the peptidyl transferase centre on the ribosome

    DEFF Research Database (Denmark)

    Poulsen, S M; Karlsson, M; Johansson, L B

    2001-01-01

    The pleuromutilin antibiotic derivatives, tiamulin and valnemulin, inhibit protein synthesis by binding to the 50S ribosomal subunit of bacteria. The action and binding site of tiamulin and valnemulin was further characterized on Escherichia coli ribosomes. It was revealed that these drugs...... results that tiamulin and valnemulin interact with the rRNA in the peptidyl transferase slot on the ribosomes in which they prevent the correct positioning of the CCA-ends of tRNAs for peptide transfer....

  2. Dwell-Time Distribution, Long Pausing and Arrest of Single-Ribosome Translation through the mRNA Duplex

    Directory of Open Access Journals (Sweden)

    Ping Xie

    2015-10-01

    Full Text Available Proteins in the cell are synthesized by a ribosome translating the genetic information encoded on the single-stranded messenger RNA (mRNA. It has been shown that the ribosome can also translate through the duplex region of the mRNA by unwinding the duplex. Here, based on our proposed model of the ribosome translation through the mRNA duplex we study theoretically the distribution of dwell times of the ribosome translation through the mRNA duplex under the effect of a pulling force externally applied to the ends of the mRNA to unzip the duplex. We provide quantitative explanations of the available single molecule experimental data on the distribution of dwell times with both short and long durations, on rescuing of the long paused ribosomes by raising the pulling force to unzip the duplex, on translational arrests induced by the mRNA duplex and Shine-Dalgarno(SD-like sequence in the mRNA. The functional consequences of the pauses or arrests caused by the mRNA duplex and the SD sequence are discussed and compared with those obtained from other types of pausing, such as those induced by “hungry” codons or interactions of specific sequences in the nascent chain with the ribosomal exit tunnel.

  3. Recognition of Cognate Transfer RNA by the 30S Ribosomal Subunit

    Energy Technology Data Exchange (ETDEWEB)

    Ogle, James M.; Brodersen, Ditlev E.; Clemons, William M.; Tarry, Michael J.; Carter, Andrew P.; Ramakrishnan, V. (MRC Laboratory of Molecular Biology)

    2009-10-07

    Crystal structures of the 30S ribosomal subunit in complex with messenger RNA and cognate transfer RNA in the A site, both in the presence and absence of the antibiotic paromomycin, have been solved at between 3.1 and 3.3 angstroms resolution. Cognate transfer RNA (tRNA) binding induces global domain movements of the 30S subunit and changes in the conformation of the universally conserved and essential bases A1492, A1493, and G530 of 16S RNA. These bases interact intimately with the minor groove of the first two base pairs between the codon and anticodon, thus sensing Watson-Crick base-pairing geometry and discriminating against near-cognate tRNA. The third, or 'wobble,' position of the codon is free to accommodate certain noncanonical base pairs. By partially inducing these structural changes, paromomycin facilitates binding of near-cognate tRNAs.

  4. Phylogenetic analysis of ruminant Theileria spp. from China based on 28S ribosomal RNA gene.

    Science.gov (United States)

    Gou, Huitian; Guan, Guiquan; Ma, Miling; Liu, Aihong; Liu, Zhijie; Xu, Zongke; Ren, Qiaoyun; Li, Youquan; Yang, Jifei; Chen, Ze; Yin, Hong; Luo, Jianxun

    2013-10-01

    Species identification using DNA sequences is the basis for DNA taxonomy. In this study, we sequenced the ribosomal large-subunit RNA gene sequences (3,037-3,061 bp) in length of 13 Chinese Theileria stocks that were infective to cattle and sheep. The complete 28S rRNA gene is relatively difficult to amplify and its conserved region is not important for phylogenetic study. Therefore, we selected the D2-D3 region from the complete 28S rRNA sequences for phylogenetic analysis. Our analyses of 28S rRNA gene sequences showed that the 28S rRNA was useful as a phylogenetic marker for analyzing the relationships among Theileria spp. in ruminants. In addition, the D2-D3 region was a short segment that could be used instead of the whole 28S rRNA sequence during the phylogenetic analysis of Theileria, and it may be an ideal DNA barcode.

  5. Changes in ribosomal proteins in wheat embryos in the course of grain development and maturation

    Directory of Open Access Journals (Sweden)

    Stanisław Weidner

    2014-01-01

    Full Text Available It was found, by comparing the densitometric profiles of ribosomal proteins of wheat embryos in milk and full grain ripeness, that in the process of development and ripening of caryopses the percentual proportion of low molecular weight proteins increases at the cost of those of high molecular weight. This concerns both acidic and basic proteins. In electrophoretic separation of ribosomal proteins from embryos of fully ripe seeds by the method of two-dimensional electrophoresis the appearance of three new low molecular weight proteins - an acidic one and two basic ones - was observed. These proteins were not found in the embryos of caryopses of milk ripeness. These results indicate that with development and ripening of wheat caryopses new low molecular weight ribosomal proteins are built into the ribosomes in the embryo. These changes are both quantitative and qualitative.

  6. Fragmentation of the large subunit ribosomal RNA gene in oyster mitochondrial genomes

    Directory of Open Access Journals (Sweden)

    Milbury Coren A

    2010-09-01

    Full Text Available Abstract Background Discontinuous genes have been observed in bacteria, archaea, and eukaryotic nuclei, mitochondria and chloroplasts. Gene discontinuity occurs in multiple forms: the two most frequent forms result from introns that are spliced out of the RNA and the resulting exons are spliced together to form a single transcript, and fragmented gene transcripts that are not covalently attached post-transcriptionally. Within the past few years, fragmented ribosomal RNA (rRNA genes have been discovered in bilateral metazoan mitochondria, all within a group of related oysters. Results In this study, we have characterized this fragmentation with comparative analysis and experimentation. We present secondary structures, modeled using comparative sequence analysis of the discontinuous mitochondrial large subunit rRNA genes of the cupped oysters C. virginica, C. gigas, and C. hongkongensis. Comparative structure models for the large subunit rRNA in each of the three oyster species are generally similar to those for other bilateral metazoans. We also used RT-PCR and analyzed ESTs to determine if the two fragmented LSU rRNAs are spliced together. The two segments are transcribed separately, and not spliced together although they still form functional rRNAs and ribosomes. Conclusions Although many examples of discontinuous ribosomal genes have been documented in bacteria and archaea, as well as the nuclei, chloroplasts, and mitochondria of eukaryotes, oysters are some of the first characterized examples of fragmented bilateral animal mitochondrial rRNA genes. The secondary structures of the oyster LSU rRNA fragments have been predicted on the basis of previous comparative metazoan mitochondrial LSU rRNA structure models.

  7. DksA Guards Elongating RNA Polymerase Against Ribosome-Stalling-Induced Arrest

    Science.gov (United States)

    Zhang, Yan; Mooney, Rachel A.; Grass, Jeffrey A.; Sivaramakrishnan, Priya; Herman, Christophe; Landick, Robert; Wang, Jue D.

    2014-01-01

    Summary In bacteria, translation-transcription coupling inhibits RNA polymerase (RNAP) stalling. We present evidence suggesting that, upon amino acid starvation, inactive ribosomes promote rather than inhibit RNAP stalling. We developed an algorithm to evaluate genome-wide polymerase progression independently of local noise, and used it to reveal that the transcription factor DksA inhibits promoter-proximal pausing and increases RNAP elongation when uncoupled from translation by depletion of charged tRNAs. DksA has minimal effect on RNAP elongation in vitro and on untranslated RNAs in vivo. In these cases, transcripts can form RNA structures that prevent backtracking. Thus, the effect of DksA on transcript elongation may occur primarily upon ribosome slowing/stalling or at promoter-proximal locations that limit the potential for RNA structure. We propose that inactive ribosomes prevent formation of backtrack-blocking mRNA structures and that, in this circumstance, DksA acts as a transcription elongation factor in vivo. PMID:24606919

  8. Structure and Function of the Ribosomal Frameshifting Pseudoknot RNA from Beet Western Yellow Virus

    Energy Technology Data Exchange (ETDEWEB)

    Egli, M.; Sarkhel, S.; Minasov, G.; Rich, A.

    2010-03-05

    Many viruses reprogram ribosomes to produce two different proteins from two different reading frames. So-called -1 frameshifting often involves pairwise alignment of two adjacent tRNAs at a 'slippery' sequence in the ribosomal A and P sites such that an overlapping codon is shifted upstream by one base relative to the zero frame. In the majority of cases, an RNA pseudoknot located downstream stimulates this type of frameshift. Crystal structures of the frameshifting RNA pseudoknot from Beet Western Yellow Virus (BWYV) have provided a detailed picture of the tertiary interactions stabilizing this folding motif, including a minor-groove triplex and quadruple-base interactions. The structure determined at atomic resolution revealed the locations of several magnesium ions and provided insights into the role of structured water stabilizing the RNA. Systematic in vitro and in vivo mutational analyses based on the structural results revealed specific tertiary interactions and regions in the pseudoknot that drastically change frameshifting efficiency. Here, we summarize recent advances in our understanding of pseudoknot-mediated ribosomal frameshifting on the basis of the insights gained from structural and functional studies of the RNA pseudoknot from BWYV.

  9. The structure of a ribosomal protein S8/spc operon mRNA complex.

    Science.gov (United States)

    Merianos, Helen J; Wang, Jimin; Moore, Peter B

    2004-06-01

    In bacteria, translation of all the ribosomal protein cistrons in the spc operon mRNA is repressed by the binding of the product of one of them, S8, to an internal sequence at the 5' end of the L5 cistron. The way in which the first two genes of the spc operon are regulated, retroregulation, is mechanistically distinct from translational repression by S8 of the genes from L5 onward. A 2.8 A resolution crystal structure has been obtained of Escherichia coli S8 bound to this site. Despite sequence differences, the structure of this complex is almost identical to that of the S8/helix 21 complex seen in the small ribosomal subunit, consistent with the hypothesis that autogenous regulation of ribosomal protein synthesis results from conformational similarities between mRNAs and rRNAs. S8 binding must repress the translation of its own mRNA by inhibiting the formation of a ribosomal initiation complex at the start of the L5 cistron.

  10. Expanded versions of the 16S and 23S ribosomal RNA mutation databases (16SMDBexp and 23SMDBexp)

    OpenAIRE

    Triman, K L; Peister, A; Goel, R A

    1998-01-01

    Expanded versions of the Ribosomal RNA Mutation Databases provide lists of mutated positions in 16S and 16S-like ribosomal RNA (16SMDBexp) and 23S and 23S-like ribosomal RNA (23SMDBexp) and the identity of each alteration. Alterations from organisms other than Escherichia coli are reported at positions according to the E.coli numbering system. Information provided for each mutation includes: (i) a brief description of the phenotype(s) associated with each mutation, (ii) whether a mutant pheno...

  11. Effect of mutations in the A site of 16 S rRNA on aminoglycoside antibiotic-ribosome interaction

    DEFF Research Database (Denmark)

    Recht, M I; Douthwaite, S; Dahlquist, K D

    1999-01-01

    Decoding of genetic information occurs upon interaction of an mRNA codon-tRNA anticodon complex with the small subunit of the ribosome. The ribosomal decoding region is associated with highly conserved sequences near the 3' end of 16 S rRNA. The decoding process is perturbed by the aminoglycoside...... of universally conserved nucleotides at 1406 to 1408 and 1494 to 1495 in the decoding region of plasmid-encoded bacterial 16 S rRNA. Phenotypic changes range from the benign effect of U1406-->A or A1408-->G substitutions, to the highly deleterious 1406G and 1495 mutations that assemble into 30 S subunits...... but are defective in forming functional ribosomes. Changes in the local conformation of the decoding region caused by these mutations were identified by chemical probing of isolated 30 S subunits. Ribosomes containing 16 S rRNA with mutations at positions 1408, 1407+1494, or 1495 had reduced affinity...

  12. Comparative analyses among the Trichomonas vaginalis, Trichomonas tenax, and Tritrichomonas foetus 5S ribosomal RNA genes.

    Science.gov (United States)

    Torres-Machorro, Ana Lilia; Hernández, Roberto; Alderete, John F; López-Villaseñor, Imelda

    2009-04-01

    The 5S ribosomal RNA (5S rRNA) is an essential component of ribosomes. Throughout evolution, variation is found among 5S rRNA genes regarding their chromosomal localization, copy number, and intergenic regions. In this report, we describe and compare the gene sequences, motifs, genomic copy number, and chromosomal localization of the Trichomonas vaginalis, Trichomonas tenax, and Tritrichomonas foetus 5S rRNA genes. T. vaginalis and T. foetus have a single type of 5S rRNA-coding region, whereas two types were found in T. tenax. The sequence identities among the three organisms are between 94 and 97%. The intergenic regions are more divergent in sequence and size with characteristic species-specific motifs. The T. foetus 5S rRNA gene has larger and more complex intergenic regions, which contain either an ubiquitin gene or repeated sequences. The 5S rRNA genes were located in Trichomonads chromosomes by fluorescent in situ hybridization.

  13. Minor groove RNA triplex in the crystal structure of a ribosomal frameshifting viral pseudoknot

    Science.gov (United States)

    Su, L.; Chen, L.; Egli, M.; Berger, J. M.; Rich, A.

    1999-01-01

    Many viruses regulate translation of polycistronic mRNA using a -1 ribosomal frameshift induced by an RNA pseudoknot. A pseudoknot has two stems that form a quasi-continuous helix and two connecting loops. A 1.6 A crystal structure of the beet western yellow virus (BWYV) pseudoknot reveals rotation and a bend at the junction of the two stems. A loop base is inserted in the major groove of one stem with quadruple-base interactions. The second loop forms a new minor-groove triplex motif with the other stem, involving 2'-OH and triple-base interactions, as well as sodium ion coordination. Overall, the number of hydrogen bonds stabilizing the tertiary interactions exceeds the number involved in Watson-Crick base pairs. This structure will aid mechanistic analyses of ribosomal frameshifting.

  14. 25S ribosomal RNA homologies of basidiomycetous yeasts: taxonomic and phylogenetic implications

    Science.gov (United States)

    Baharaeen, S.; Vishniac, H. S.

    1984-01-01

    Genera, families, and possibly orders of basidiomycetous yeasts can be defined by 25S rRNA homology and correlated phenotypic characters. The teleomorphic genera Filobasidium, Leucosporidium, and Rhodosporidium have greater than 96 relative binding percent (rb%) intrageneric 25S rRNA homology and significant intergeneric separation from each other and from Filobasidiella. The anamorphic genus Cryptococcus can be defined by morphology (monopolar budding), colony color, and greater than 75 rb% intrageneric homology; Vanrija is heterogeneous. Agaricostilbum (Phragmobasidiomycetes, Auriculariales), Hansenula (Ascomycotera, Endomycota), Tremella (Phragmobasidiomycetes, Tremellales), and Ustilago (Ustomycota, Ustilaginales) appear equally unrelated to the Cryptococcus, Filobasidiella, and Rhodosporidium spp. used as probes. The Filobasidiaceae and Sporidiaceae, Filobasidiales and Sporidiales, form coherent homology groups which appear to have undergone convergent 25S rRNA evolution, since their relatedness is much greater than that indicated by 5S rRNA homology. Ribosomal RNA homologies do not appear to measure evolutionary distance.

  15. Sequence of the 16S Ribosomal RNA from Halobacterium volcanii, an Archaebacterium.

    Science.gov (United States)

    Gupta, R; Lanter, J M; Woese, C R

    1983-08-12

    The sequence of the 16S ribosomal RNA (rRNA) from the archaebacterium Halobacterium volcanii has been determined by DNA sequencing methods. The archaebacterial rRNA is similar to its eubacterial counterpart in secondary structure. Although it is closer in sequence to the eubacterial 16S rRNA than to the eukaryotic 16S-like rRNA, the H. volcanii sequence also shows certain points of specific similarity to its eukaryotic counterpart. Since the H. volcanii sequence is closer to both the eubacterial and the eukaryotic sequences than these two are to one another, it follows that the archaebacterial sequence resembles their common ancestral sequence more closely than does either of the other two versions.

  16. Probing the structure of 16 S ribosomal RNA from Bacillus brevis.

    Science.gov (United States)

    Kop, J; Kopylov, A M; Magrum, L; Siegel, R; Gupta, R; Woese, C R; Noller, H F

    1984-12-25

    A majority (approximately 89%) of the nucleotide sequence of Bacillus brevis 16 S rRNA has been determined by a combination of RNA sequencing methods. Several experimental approaches have been used to probe its structure, including (a) partial RNase digestion of 30 S ribosomal subunits, followed by two-dimensional native/denatured gel electrophoresis, in which base-paired fragments were directly identified; (b) identification of positions susceptible to cleavage by RNase A and RNase T1 in 30 S subunits; (c) sites of attack by cobra venom RNase on naked 16 S rRNA; and (d) nucleotides susceptible to attack by bisulfite in 16 S rRNA. These data are discussed with respect to a secondary structure model for B. brevis 16 S rRNA derived by comparative sequence analysis.

  17. Detection of bacterial 16S ribosomal RNA genes for forensic identification of vaginal fluid.

    Science.gov (United States)

    Akutsu, Tomoko; Motani, Hisako; Watanabe, Ken; Iwase, Hirotaro; Sakurada, Koichi

    2012-05-01

    To preliminarily evaluate the applicability of bacterial DNA as a marker for the forensic identification of vaginal fluid, we developed and performed PCR-based detection of 16S ribosomal RNA genes of Lactobacillus spp. dominating the vagina and of bacterial vaginosis-related bacteria from DNA extracted from body fluids and stains. As a result, 16S ribosomal RNA genes of Lactobacillus crispatus, Lactobacillus jensenii and Atopobium vaginae were specifically detected in vaginal fluid and female urine samples. Bacterial genes detected in female urine might have originated from contaminated vaginal fluid. In addition, those of Lactobacillus iners, Lactobacillus gasseri and Gardnerella vaginalis were also detected in non-vaginal body fluids such as semen. Because bacterial genes were successfully amplified in DNA samples extracted by using the general procedure for animal tissues without any optional treatments, DNA samples prepared for the identification of vaginal fluid can also be used for personal identification. In conclusion, 16S ribosomal RNA genes of L. crispatus, L. jensenii and A. vaginae could be effective markers for forensic identification of vaginal fluid.

  18. Detection of Enterobacter sakazakii in neonatal sepsis by PCR on 16S ribosomal RNA

    Directory of Open Access Journals (Sweden)

    Khadijeh Ahmadi

    2014-08-01

    Full Text Available Background: Enterobacter sakazakii is a gram negative, facultative anaerobic, straight rod-shaped bacterium that belongs to the family Enterobacteriaceae. It is also considered an emerging opportunistic pathogen, responsible of cases of neonatal infections including sepsis, meningitis, necrotizing enterocolitis ad bacteremia. The goal of this study was detection of Enterobacter salazakii in neonates with sepsis by PCR on 16S ribosomal RNA gene. Material and Methods: This cross-sectional study was conducted on 405 blood specimens that were taken from hospitalized neonates suspected to sepsis in Ahvaz Abuzar Hospital in 2011. From each neonate 0.5 ml blood sample was taken and placed in CBC tubes containing EDTA at -200C for polymerase chain reaction. For detection of Enterobacter sakazakii, PCR was performed on DNA for amplification of 16S ribosomal RNA gene. Results: In all 405 neonates blood samples’ PCR reactions for Enterobacter sakazakii 16S ribosomal RNA gene were negative. Blood cultures were positive for Streptococcus agalactiae in 8 (1.4 % patients. Conclusion: Because Enterobacter sakazakii is an opportunistic pathogen with high pathogenicity power, more investigation on high risk groups is required. For detection of infection caused by this organism using of different diagnostic methods with high specificity and sensitivity is necessary.

  19. Natural variation in DNA methylation in ribosomal RNA genes of Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    Richards Eric J

    2008-09-01

    Full Text Available Abstract Background DNA methylation is an important biochemical mark that silences repetitive sequences, such as transposons, and reinforces epigenetic gene expression states. An important class of repetitive genes under epigenetic control in eukaryotic genomes encodes ribosomal RNA (rRNA transcripts. The ribosomal genes coding for the 45S rRNA precursor of the three largest eukaryotic ribosomal RNAs (18S, 5.8S, and 25–28S are found in nucleolus organizer regions (NORs, comprised of hundreds to thousands of repeats, only some of which are expressed in any given cell. An epigenetic switch, mediated by DNA methylation and histone modification, turns rRNA genes on and off. However, little is known about the mechanisms that specify and maintain the patterns of NOR DNA methylation. Results Here, we explored the extent of naturally-occurring variation in NOR DNA methylation among accessions of the flowering plant Arabidopsis thaliana. DNA methylation in coding regions of rRNA genes was positively correlated with copy number of 45S rRNA gene and DNA methylation in the intergenic spacer regions. We investigated the inheritance of NOR DNA methylation patterns in natural accessions with hypomethylated NORs in inter-strain crosses and defined three different categories of inheritance in F1 hybrids. In addition, subsequent analysis of F2 segregation for NOR DNA methylation patterns uncovered different patterns of inheritance. We also revealed that NOR DNA methylation in the Arabidopsis accession Bor-4 is influenced by the vim1-1 (variant in methylation 1-1 mutation, but the primary effect is specified by the NORs themselves. Conclusion Our results indicate that the NORs themselves are the most significant determinants of natural variation in NOR DNA methylation. However, the inheritance of NOR DNA methylation suggests the operation of a diverse set of mechanisms, including inheritance of parental methylation patterns, reconfiguration of parental NOR DNA

  20. Identification of Novel RNA-Protein Contact in Complex of Ribosomal Protein S7 and 3'-Terminal Fragment of 16S rRNA in E. coli.

    Science.gov (United States)

    Golovin, A V; Khayrullina, G A; Kraal, B; Kopylov, Capital A Cyrillic М

    2012-10-01

    For prokaryotes in vitro, 16S rRNA and 20 ribosomal proteins are capable of hierarchical self- assembly yielding a 30S ribosomal subunit. The self-assembly is initiated by interactions between 16S rRNA and three key ribosomal proteins: S4, S8, and S7. These proteins also have a regulatory function in the translation of their polycistronic operons recognizing a specific region of mRNA. Therefore, studying the RNA-protein interactions within binary complexes is obligatory for understanding ribosome biogenesis. The non-conventional RNA-protein contact within the binary complex of recombinant ribosomal protein S7 and its 16S rRNA binding site (236 nucleotides) was identified. UV-induced RNA-protein cross-links revealed that S7 cross-links to nucleotide U1321 of 16S rRNA. The careful consideration of the published RNA- protein cross-links for protein S7 within the 30S subunit and their correlation with the X-ray data for the 30S subunit have been performed. The RNA - protein cross-link within the binary complex identified in this study is not the same as the previously found cross-links for a subunit both in a solution, and in acrystal. The structure of the binary RNA-protein complex formed at the initial steps of self-assembly of the small subunit appears to be rearranged during the formation of the final structure of the subunit.

  1. An RNA Element That Facilitates Programmed Ribosomal Readthrough in Turnip Crinkle Virus Adopts Multiple Conformations.

    Science.gov (United States)

    Kuhlmann, Micki M; Chattopadhyay, Maitreyi; Stupina, Vera A; Gao, Feng; Simon, Anne E

    2016-10-01

    Ribosome recoding is used by RNA viruses for translational readthrough or frameshifting past termination codons for the synthesis of extension products. Recoding sites, along with downstream recoding stimulatory elements (RSEs), have long been studied in reporter constructs, because these fragments alone mediate customary levels of recoding and are thus assumed to contain complete instructions for establishment of the proper ratio of termination to recoding. RSEs from the Tombusviridae and Luteoviridae are thought to be exceptions, since they contain a long-distance RNA-RNA connection with the 3' end. This interaction has been suggested to substitute for pseudoknots, thought to be missing in tombusvirid RSEs. We provide evidence that the phylogenetically conserved RSE of the carmovirus Turnip crinkle virus (TCV) adopts an alternative, smaller structure that extends an upstream conserved hairpin and that this alternative structure is the predominant form of the RSE within nascent viral RNA in plant cells and when RNA is synthesized in vitro The TCV RSE also contains an internal pseudoknot along with the long-distance interaction, and the pseudoknot is not compatible with the phylogenetically conserved structure. Conserved residues just past the recoding site are important for recoding, and these residues are also conserved in the RSEs of gammaretroviruses. Our data demonstrate the dynamic nature of the TCV RSE and suggest that studies using reporter constructs may not be effectively recapitulating RSE-mediated recoding within viral genomes. Ribosome recoding is used by RNA viruses to enable ribosomes to extend translation past termination codons for the synthesis of longer products. Recoding sites and a downstream recoding stimulatory element (RSE) mediate expected levels of recoding when excised and placed in reporter constructs and thus are assumed to contain complete instructions for the establishment of the proper ratio of termination to recoding. We provide

  2. The essential nucleolar yeast protein Nop8p controls the exosome function during 60S ribosomal subunit maturation.

    Directory of Open Access Journals (Sweden)

    Marcia C T Santos

    Full Text Available The yeast nucleolar protein Nop8p has previously been shown to interact with Nip7p and to be required for 60S ribosomal subunit formation. Although depletion of Nop8p in yeast cells leads to premature degradation of rRNAs, the biochemical mechanism responsible for this phenotype is still not known. In this work, we show that the Nop8p amino-terminal region mediates interaction with the 5.8S rRNA, while its carboxyl-terminal portion interacts with Nip7p and can partially complement the growth defect of the conditional mutant strain Δnop8/GAL::NOP8. Interestingly, Nop8p mediates association of Nip7p to pre-ribosomal particles. Nop8p also interacts with the exosome subunit Rrp6p and inhibits the complex activity in vitro, suggesting that the decrease in 60S ribosomal subunit levels detected upon depletion of Nop8p may result from degradation of pre-rRNAs by the exosome. These results strongly indicate that Nop8p may control the exosome function during pre-rRNA processing.

  3. The pre-existing population of 5S rRNA effects p53 stabilization during ribosome biogenesis inhibition.

    Science.gov (United States)

    Onofrillo, Carmine; Galbiati, Alice; Montanaro, Lorenzo; Derenzini, Massimo

    2017-01-17

    Pre-ribosomal complex RPL5/RPL11/5S rRNA (5S RNP) is considered the central MDM2 inhibitory complex that control p53 stabilization during ribosome biogenesis inhibition. Despite its role is well defined, the dynamic of 5S RNP assembly still requires further characterization. In the present work, we report that MDM2 inhibition is dependent by a pre-existing population of 5S rRNA.

  4. Helix 69 of Escherichia coli 23S ribosomal RNA as a peptide nucleic acid target.

    Science.gov (United States)

    Kulik, Marta; Markowska-Zagrajek, Agnieszka; Wojciechowska, Monika; Grzela, Renata; Wituła, Tomasz; Trylska, Joanna

    2017-07-01

    A fragment of 23S ribosomal RNA (nucleotides 1906-1924 in E. coli), termed Helix 69, forms a hairpin that is essential for ribosome function. Helix 69 forms a conformationally flexible inter-subunit connection with helix 44 of 16S ribosomal RNA, and the nucleotide A1913 of Helix 69 influences decoding accuracy. Nucleotides U1911 and U1917 are post-transcriptionally modified with pseudouridines (Ψ) and U1915 with 3-methyl-Ψ. We investigated Helix 69 as a target for a complementary synthetic oligonucleotide - peptide nucleic acid (PNA). We determined thermodynamic properties of Helix 69 and its complexes with PNA and tested the performance of PNA targeted at Helix 69 in inhibiting translation in cell-free extracts and growth of E. coli cells. First, we examined the interactions of a PNA oligomer complementary to the G1907-A1919 fragment of Helix 69 with the sequences corresponding to human and bacterial species (with or without pseudouridine modifications). PNA invades the Helix 69 hairpin creating stable complexes and PNA binding to the pseudouridylated bacterial sequence is stronger than to Helix 69 without any modifications. Second, we confirmed the binding of PNA to 23S rRNA and 70S ribosomes. Third, we verified the efficiency of translation inhibition of these PNA oligomers in the cell-free translation/transcription E. coli system, which were in a similar range as tetracycline. Next, we confirmed that PNA conjugated to the (KFF)3K transporter peptide inhibited E. coli growth in micromolar concentrations. Overall, targeting Helix 69 with PNA or other sequence-specific oligomers could be a promising way to inhibit bacterial translation. Copyright © 2017 Elsevier B.V. and Société Française de Biochimie et Biologie Moléculaire (SFBBM). All rights reserved.

  5. RNA tertiary interactions in the large ribosomal subunit: The A-minor motif

    Energy Technology Data Exchange (ETDEWEB)

    Nissen, Poul; Ippolito, Joseph A.; Ban, Nenad; Moore, Peter B.; Steitz, Thomas A. (Yale University); (Yale University); (Yale Unversity)

    2009-10-07

    Analysis of the 2.4-{angstrom} resolution crystal structure of the large ribosomal subunit from Haloarcula marismortui reveals the existence of an abundant and ubiquitous structural motif that stabilizes RNA tertiary and quaternary structures. This motif is termed the A-minor motif, because it involves the insertion of the smooth, minor groove edges of adenines into the minor groove of neighboring helices, preferentially at C-G base pairs, where they form hydrogen bonds with one or both of the 2' OHs of those pairs. A-minor motifs stabilize contacts between RNA helices, interactions between loops and helices, and the conformations of junctions and tight turns. The interactions between the 3' terminal adenine of tRNAs bound in either the A site or the P site with 23S rRNA are examples of functionally significant A-minor interactions. The A-minor motif is by far the most abundant tertiary structure interaction in the large ribosomal subunit; 186 adenines in 23S and 5S rRNA participate, 68 of which are conserved. It may prove to be the universally most important long-range interaction in large RNA structures.

  6. Efficient hammerhead ribozyme and antisense RNA targeting in a slow ribosome Escherichia coli mutant.

    Science.gov (United States)

    Chen, H; Ferbeyre, G; Cedergren, R

    1997-05-01

    We have evaluated inhibition of the plasmid-born chloramphenicol acetyl transferase gene (CAT) by the hammerhead ribozyme and antisense RNA in Escherichia coli where the translation and transcription rates have been modified. Whereas neither antisense nor the hammerhead had an inhibitory effect on CAT activity in wild-type E. coli, both reduced the level of the messenger RNA and the activity of the CAT gene by almost 60% in a slow ribosome mutant. Streptomycin, which increases the speed of translation in this mutant strain, restored full CAT activity. The level of CAT activity expressed from a T7 RNA polymerase promoter was not affected by the presence of either antisense RNA or the hammerhead ribozyme. When the target gene was expressed from a chromosomal locus in wild-type E. coli, both antisense RNA and the hammerhead ribozyme showed some inhibitory activity, but the level of inhibition was significantly increased in the slow ribosome strain. This bacterial system offers a unique entry to the study of cellular factors which mediate the activity of ribozymes in vivo.

  7. 18S Ribosomal RNA Evaluation as Preanalytical Quality Control for Animal DNA

    Directory of Open Access Journals (Sweden)

    Cory Ann Leonard

    2016-01-01

    Full Text Available The 18S ribosomal RNA (rRNA gene is present in all eukaryotic cells. In this study, we evaluated the use of this gene to verify the presence of PCR-amplifiable host (animal DNA as an indicator of sufficient sample quality for quantitative real-time PCR (qPCR analysis. We compared (i samples from various animal species, tissues, and sample types, including swabs; (ii multiple DNA extraction methods; and (iii both fresh and formalin-fixed paraffin-embedded (FFPE samples. Results showed that 18S ribosomal RNA gene amplification was possible from all tissue samples evaluated, including avian, reptile, and FFPE samples and most swab samples. A single swine rectal swab, which showed sufficient DNA quantity and the demonstrated lack of PCR inhibitors, nonetheless was negative by 18S qPCR. Such a sample specifically illustrates the improvement of determination of sample integrity afforded by inclusion of 18S rRNA gene qPCR analysis in addition to spectrophotometric analysis and the use of internal controls for PCR inhibition. Other possible applications for the described 18S rRNA qPCR are preselection of optimal tissue specimens for studies or preliminary screening of archived samples prior to acceptance for biobanking projects.

  8. 5S Ribosomal RNA Is an Essential Component of a Nascent Ribosomal Precursor Complex that Regulates the Hdm2-p53 Checkpoint

    Directory of Open Access Journals (Sweden)

    Giulio Donati

    2013-07-01

    Full Text Available Recently, we demonstrated that RPL5 and RPL11 act in a mutually dependent manner to inhibit Hdm2 and stabilize p53 following impaired ribosome biogenesis. Given that RPL5 and RPL11 form a preribosomal complex with noncoding 5S ribosomal RNA (rRNA and the three have been implicated in the p53 response, we reasoned they may be part of an Hdm2-inhibitory complex. Here, we show that small interfering RNAs directed against 5S rRNA have no effect on total or nascent levels of the noncoding rRNA, though they prevent the reported Hdm4 inhibition of p53. To achieve efficient inhibition of 5S rRNA synthesis, we targeted TFIIIA, a specific RNA polymerase III cofactor, which, like depletion of either RPL5 or RPL11, did not induce p53. Instead, 5S rRNA acts in a dependent manner with RPL5 and RPL11 to inhibit Hdm2 and stabilize p53. Moreover, depletion of any one of the three components abolished the binding of the other two to Hdm2, explaining their common dependence. Finally, we demonstrate that the RPL5/RPL11/5S rRNA preribosomal complex is redirected from assembly into nascent 60S ribosomes to Hdm2 inhibition as a consequence of impaired ribosome biogenesis. Thus, the activation of the Hdm2-inhibitory complex is not a passive but a regulated event, whose potential role in tumor suppression has been recently noted.

  9. 5S ribosomal RNA is an essential component of a nascent ribosomal precursor complex that regulates the Hdm2-p53 checkpoint.

    Science.gov (United States)

    Donati, Giulio; Peddigari, Suresh; Mercer, Carol A; Thomas, George

    2013-07-11

    Recently, we demonstrated that RPL5 and RPL11 act in a mutually dependent manner to inhibit Hdm2 and stabilize p53 following impaired ribosome biogenesis. Given that RPL5 and RPL11 form a preribosomal complex with noncoding 5S ribosomal RNA (rRNA) and the three have been implicated in the p53 response, we reasoned they may be part of an Hdm2-inhibitory complex. Here, we show that small interfering RNAs directed against 5S rRNA have no effect on total or nascent levels of the noncoding rRNA, though they prevent the reported Hdm4 inhibition of p53. To achieve efficient inhibition of 5S rRNA synthesis, we targeted TFIIIA, a specific RNA polymerase III cofactor, which, like depletion of either RPL5 or RPL11, did not induce p53. Instead, 5S rRNA acts in a dependent manner with RPL5 and RPL11 to inhibit Hdm2 and stabilize p53. Moreover, depletion of any one of the three components abolished the binding of the other two to Hdm2, explaining their common dependence. Finally, we demonstrate that the RPL5/RPL11/5S rRNA preribosomal complex is redirected from assembly into nascent 60S ribosomes to Hdm2 inhibition as a consequence of impaired ribosome biogenesis. Thus, the activation of the Hdm2-inhibitory complex is not a passive but a regulated event, whose potential role in tumor suppression has been recently noted. Copyright © 2013 The Authors. Published by Elsevier Inc. All rights reserved.

  10. Functional ribosome biogenesis is a prerequisite for p53 destabilization: impact of chemotherapy on nucleolar functions and RNA metabolism.

    Science.gov (United States)

    Burger, Kaspar; Eick, Dirk

    2013-09-01

    The production and processing of ribosomal RNA is a complex and well-coordinated nucleolar process for ribosome biogenesis. Progress in understanding nucleolar structure and function has lead to the unexpected discovery of the nucleolus as a highly sensitive sensor of cellular stress and an important regulator of the tumor suppressor p53. Inhibition of ribosomal RNA metabolism has been shown to activate a signaling pathway for p53 induction. This review elucidates the potential of classical and recently developed chemotherapeutic drugs to stabilize p53 by inhibiting nucleolar functions.

  11. A growth-dependent transcription initiation factor (TIF-IA) interacting with RNA polymerase I regulates mouse ribosomal RNA synthesis.

    Science.gov (United States)

    Schnapp, A; Pfleiderer, C; Rosenbauer, H; Grummt, I

    1990-09-01

    Control of mouse ribosomal RNA synthesis in response to extracellular signals is mediated by TIF-IA, a regulatory factor whose amount or activity correlates with cell proliferation. Factor TIF-IA interacts with RNA polymerase I (pol I), thus converting it into a transcriptionally active holoenzyme, which is able to initiate specifically at the rDNA promoter in the presence of the other auxiliary transcription initiation factors, designated TIF-IB, TIF-IC and UBF. With regard to several criteria, the growth-dependent factor TIF-IA behaves like a bacterial sigma factor: (i) it associates physically with pol I, (ii) it is required for initiation of transcription, (iii) it is present in limiting amounts and (iv) under certain salt conditions, it is chromatographically separable from the polymerase. In addition, evidence is presented that dephosphorylation of pol I abolishes in vitro transcription initiation from the ribosomal gene promoter without significantly affecting the polymerizing activity of the enzyme at nonspecific templates. The involvement of both a regulatory factor and post-translational modification of the transcribing enzyme provides an efficient and versatile mechanism of rDNA transcription regulation which enables the cell to adapt ribosome synthesis rapidly to a variety of extracellular signals.

  12. Decrease in Ribosomal RNA in Candida albicans Induced by Serum Exposure.

    Science.gov (United States)

    Fleischmann, Jacob; Rocha, Miguel A

    2015-01-01

    Candida albicans is an important polymorphic human pathogen. It can switch from a unicellular yeast form to germinating hypha, which may play a role in making it the successful pathogen it is. This hyphal transformation can be triggered by various extracellular stimuli, the most potent one being serum from any source. We have previously reported that Candida albicans transiently polyadenylates portions of both the large and small subunits of ribosomal RNA, shortly after serum exposure. Northern blots at the same time suggested that serum might induce a decrease in total ribosomal RNA. We have carried out a number of experiments to carefully assess this possibility and now report that serum significantly reduces ribosomal RNA in Candida albicans. Fluorometric measurements, Northern blotting and quantitative RT-PCR, have all confirmed this decrease. Timed experiments show that serum induces this decrease rapidly, as it was seen in as early as five minutes. Cell mass is not decreased as total cellular protein content remains the same and metabolic activity does not appear to slow, as assessed by XTT assay, and by the observation that cells form hyphal structures robustly. Another hyphal inducer, N-acetylglucosamine, also caused RNA decrease, but to a lesser extent. We also observed it in non-germinating yeast, such as Candida glabrata. The reason for this decrease is unknown and overall our data suggests that decrease in rRNA does not play a causal role in hyphal transformation. Rapid and significant decrease in a molecule so central to the yeast's biology is of some importance, and further studies, such as its effect on protein metabolism, will be required to better understand its purpose.

  13. Sequence characterization of 5S ribosomal RNA from eight gram positive procaryotes

    Science.gov (United States)

    Woese, C. R.; Luehrsen, K. R.; Pribula, C. D.; Fox, G. E.

    1976-01-01

    Complete nucleotide sequences are presented for 5S rRNA from Bacillus subtilis, B. firmus, B. pasteurii, B. brevis, Lactobacillus brevis, and Streptococcus faecalis, and 5S rRNA oligonucleotide catalogs and partial sequence data are given for B. cereus and Sporosarcina ureae. These data demonstrate a striking consistency of 5S rRNA primary and secondary structure within a given bacterial grouping. An exception is B. brevis, in which the 5S rRNA sequence varies significantly from that of other bacilli in the tuned helix and the procaryotic loop. The localization of these variations suggests that B. brevis occupies an ecological niche that selects such changes. It is noted that this organism produces antibiotics which affect ribosome function.

  14. RISSC: a novel database for ribosomal 16S-23S RNA genes spacer regions.

    Science.gov (United States)

    García-Martínez, J; Bescós, I; Rodríguez-Sala, J J; Rodríguez-Valera, F

    2001-01-01

    A novel database, under the acronym RISSC (Ribosomal Intergenic Spacer Sequence Collection), has been created. It compiles more than 1600 entries of edited DNA sequence data from the 16S-23S ribosomal spacers present in most prokaryotes and organelles (e.g. mitochondria and chloroplasts) and is accessible through the Internet (http://ulises.umh.es/RISSC), where systematic searches for specific words can be conducted, as well as BLAST-type sequence searches. Additionally, a characteristic feature of this region, the presence/absence and nature of tRNA genes within the spacer, is included in all the entries, even when not previously indicated in the original database. All these combined features could provide a useful documentation tool for studies on evolution, identification, typing and strain characterization, among others.

  15. Global shape mimicry of tRNA within a viral internal ribosome entry site mediates translational reading frame selection.

    Science.gov (United States)

    Au, Hilda H; Cornilescu, Gabriel; Mouzakis, Kathryn D; Ren, Qian; Burke, Jordan E; Lee, Seonghoon; Butcher, Samuel E; Jan, Eric

    2015-11-24

    The dicistrovirus intergenic region internal ribosome entry site (IRES) adopts a triple-pseudoknotted RNA structure and occupies the core ribosomal E, P, and A sites to directly recruit the ribosome and initiate translation at a non-AUG codon. A subset of dicistrovirus IRESs directs translation in the 0 and +1 frames to produce the viral structural proteins and a +1 overlapping open reading frame called ORFx, respectively. Here we show that specific mutations of two unpaired adenosines located at the core of the three-helical junction of the honey bee dicistrovirus Israeli acute paralysis virus (IAPV) IRES PKI domain can uncouple 0 and +1 frame translation, suggesting that the structure adopts distinct conformations that contribute to 0 or +1 frame translation. Using a reconstituted translation system, we show that ribosomes assembled on mutant IRESs that direct exclusive 0 or +1 frame translation lack reading frame fidelity. Finally, a nuclear magnetic resonance/small-angle X-ray scattering hybrid approach reveals that the PKI domain of the IAPV IRES adopts an RNA structure that resembles a complete tRNA. The tRNA shape-mimicry enables the viral IRES to gain access to the ribosome tRNA-binding sites and form intermolecular contacts with the ribosome that are necessary for initiating IRES translation in a specific reading frame.

  16. Dataset of the transcribed 45S ribosomal RNA sequence of the tree crop “yerba mate”

    Directory of Open Access Journals (Sweden)

    Patricia M. Aguilera

    2017-06-01

    Full Text Available This contribution contains data related to the research article entitled “The 18S-25S ribosomal RNA unit of yerba mate (Ilex paraguariensis A. St.-Hil.” (Aguilera et al., 2016 [1]. Through a bioinformatic approach involving NGS data, we provide information of the transcribed 45S ribosomal RNA (rRNA sequence of yerba mate, the first reference for the Ilex L. genus. This dataset (Supplementary file 1 comprises information regarding the assembly and annotation of this rRNA unit. The generated data is applicable for comparative analysis and evolutionary studies among Ilex and related taxa. The raw sequencing data used here is available at DDBJ/EMBL/GenBank (NCBI Resource Coordinators, 2016 [2] Sequence Read Archive (SRA under the accession SRP043293 and the consensus 45S ribosomal RNA sequence has been deposited there under the accession GFHV00000000.

  17. Lateral transfer of eukaryotic ribosomal RNA genes: an emerging concern for molecular ecology of microbial eukaryotes.

    Science.gov (United States)

    Yabuki, Akinori; Toyofuku, Takashi; Takishita, Kiyotaka

    2014-07-01

    Ribosomal RNA (rRNA) genes are widely utilized in depicting organismal diversity and distribution in a wide range of environments. Although a few cases of lateral transfer of rRNA genes between closely related prokaryotes have been reported, it remains to be reported from eukaryotes. Here, we report the first case of lateral transfer of eukaryotic rRNA genes. Two distinct sequences of the 18S rRNA gene were detected from a clonal culture of the stramenopile, Ciliophrys infusionum. One was clearly derived from Ciliophrys, but the other gene originated from a perkinsid alveolate. Genome-walking analyses revealed that this alveolate-type rRNA gene is immediately adjacent to two protein-coding genes (ubc12 and usp39), and the origin of both genes was shown to be a stramenopile (that is, Ciliophrys) in our phylogenetic analyses. These findings indicate that the alveolate-type rRNA gene is encoded on the Ciliophrys genome and that eukaryotic rRNA genes can be transferred laterally.

  18. Transcription of ribosomal RNA genes is initiated in the third cell cycle of bovine embryos

    DEFF Research Database (Denmark)

    Jakobsen, Anne Sørig; Avery, Birthe; Dieleman, Steph J.

    2006-01-01

    of the embryonic genome. In the present study, ribosomal RNA (rRNA) transcription was investigated by visualization of the rRNA by fluorescent in situ hybridization, and subsequent visualization of the argyrophilic nucleolar proteins by silver staining. A total of 145 in vivo developed and 200 in vitro produced...... bovine embryos were investigated to allow comparison of transcription initiation. Signs of active transcription of rRNA were observed in the third cell cycle in 29% of the in vitro produced embryos (n=35) and in 58% of the in vivo developed embryos (n=11). Signs of active transcription of rRNA were...... not apparent in the early phase of the fourth cell cycle but restarted later on. All embryos in the fifth or later cell cycles were all transcribing rRNA. The signs of rRNA synthesis during the third and fourth embryonic cell cycles could be blocked by actinomycin D, which is a strong inhibitor of RNA...

  19. Structures of human SRP72 complexes provide insights into SRP RNA remodeling and ribosome interaction

    Science.gov (United States)

    Becker, Matthias M. M.; Lapouge, Karine; Segnitz, Bernd; Wild, Klemens; Sinning, Irmgard

    2017-01-01

    Co-translational protein targeting and membrane protein insertion is a fundamental process and depends on the signal recognition particle (SRP). In mammals, SRP is composed of the SRP RNA crucial for SRP assembly and function and six proteins. The two largest proteins SRP68 and SRP72 form a heterodimer and bind to a regulatory site of the SRP RNA. Despite their essential roles in the SRP pathway, structural information has been available only for the SRP68 RNA-binding domain (RBD). Here we present the crystal structures of the SRP68 protein-binding domain (PBD) in complex with SRP72-PBD and of the SRP72-RBD bound to the SRP S domain (SRP RNA, SRP19 and SRP68) detailing all interactions of SRP72 within SRP. The SRP72-PBD is a tetratricopeptide repeat, which binds an extended linear motif of SRP68 with high affinity. The SRP72-RBD is a flexible peptide crawling along the 5e- and 5f-loops of SRP RNA. A conserved tryptophan inserts into the 5e-loop forming a novel type of RNA kink-turn stabilized by a potassium ion, which we define as K+-turn. In addition, SRP72-RBD remodels the 5f-loop involved in ribosome binding and visualizes SRP RNA plasticity. Docking of the S domain structure into cryo-electron microscopy density maps reveals multiple contact sites between SRP68/72 and the ribosome, and explains the role of SRP72 in the SRP pathway. PMID:27899666

  20. Polynucleotide phosphorylase hinders mRNA degradation upon ribosomal protein S1 overexpression in Escherichia coli.

    Science.gov (United States)

    Briani, Federica; Curti, Serena; Rossi, Francesca; Carzaniga, Thomas; Mauri, Pierluigi; Dehò, Gianni

    2008-11-01

    The exoribonuclease polynucleotide phosphorylase (PNPase, encoded by pnp) is a major player in bacterial RNA decay. In Escherichia coli, PNPase expression is post-transcriptionally regulated at the level of mRNA stability. The primary transcript is very efficiently processed by the endonuclease RNase III at a specific site and the processed pnp mRNA is rapidly degraded in a PNPase-dependent manner. While investigating the PNPase autoregulation mechanism we found, by UV-cross-linking experiments, that the ribosomal protein S1 in crude extracts binds to the pnp-mRNA leader region. We assayed the potential role of S1 protein in pnp gene regulation by modulating S1 expression from depletion to overexpression. We found that S1 depletion led to a sharp decrease of the amount of pnp and other tested mRNAs, as detected by Northern blotting, whereas S1 overexpression caused a strong stabilization of pnp and the other transcripts. Surprisingly, mRNA stabilization depended on PNPase, as it was not observed in a pnp deletion strain. PNPase-dependent stabilization, however, was not detected by chemical decay assay of bulk mRNA. Overall, our data suggest that PNPase exonucleolytic activity may be modulated by the translation potential of the target mRNAs and that, upon ribosomal protein S1 overexpression, PNPase protects from degradation a set of full-length mRNAs. It thus appears that a single mRNA species may be differentially targeted to either decay or PNPase-dependent stabilization, thus preventing its depletion in conditions of fast turnover.

  1. Highly purified spermatozoal RNA obtained by a novel method indicates an unusual 28S/18S rRNA ratio and suggests impaired ribosome assembly.

    Science.gov (United States)

    Cappallo-Obermann, Heike; Schulze, Wolfgang; Jastrow, Holger; Baukloh, Vera; Spiess, Andrej-Nikolai

    2011-11-01

    Human spermatozoal RNA features special characteristics such as a significantly reduced quantity within spermatozoa compared with somatic cells is described as being devoid of ribosomal RNAs and is difficult to isolate due to a massive excess of genomic DNA in the lysates. Using a novel two-round column-based protocol for human ejaculates delivering highly purified spermatozoal RNA, we uncovered a heterogeneous, but specific banding pattern in microelectrophoresis with 28S ribosomal RNA being indicative for the amount of round cell contamination. Ejaculates with different round cell quantities and density-purified spermatozoa revealed that 18S rRNA but not 28S rRNA is inherent to a pure spermatozoal fraction. Transmission electron microscopy showed monoribosomes and polyribosomes in spermatozoal cytoplasm, while immunohistochemical results suggest the presence of proteins from small and large ribosomal subunits in retained spermatozoal cytoplasm irrespective of 28S rRNA absence.

  2. Clusters of basic amino acids contribute to RNA binding and nucleolar localization of ribosomal protein L22.

    Directory of Open Access Journals (Sweden)

    Jennifer L Houmani

    Full Text Available The ribosomal protein L22 is a component of the 60S eukaryotic ribosomal subunit. As an RNA-binding protein, it has been shown to interact with both cellular and viral RNAs including 28S rRNA and the Epstein-Barr virus encoded RNA, EBER-1. L22 is localized to the cell nucleus where it accumulates in nucleoli. Although previous studies demonstrated that a specific amino acid sequence is required for nucleolar localization, the RNA-binding domain has not been identified. Here, we investigated the hypothesis that the nucleolar accumulation of L22 is linked to its ability to bind RNA. To address this hypothesis, mutated L22 proteins were generated to assess the contribution of specific amino acids to RNA binding and protein localization. Using RNA-protein binding assays, we demonstrate that basic amino acids 80-93 are required for high affinity binding of 28S rRNA and EBER-1 by L22. Fluorescence localization studies using GFP-tagged mutated L22 proteins further reveal that basic amino acids 80-93 are critical for nucleolar accumulation and for incorporation into ribosomes. Our data support the growing consensus that the nucleolar accumulation of ribosomal proteins may not be mediated by a defined localization signal, but rather by specific interaction with established nucleolar components such as rRNA.

  3. Streptomycin binds to the decoding center of 16 S ribosomal RNA.

    Science.gov (United States)

    Spickler, C; Brunelle, M N; Brakier-Gingras, L

    1997-10-31

    Streptomycin, an error-inducing aminoglycoside antibiotic, binds to a single site on the small ribosomal subunit of bacteria, but this site has not yet been defined precisely. Here, we demonstrate that streptomycin binds to E. coli 16 S rRNA in the absence of ribosomal proteins, and protects a set of bases in the decoding region against dimethyl sulfate attack. The binding studies were performed in a high ionic strength buffer containing 20 mM Mg2+. The pattern of protection in the decoding region was similar to that observed when streptomycin binds to the 30 S subunit. However, streptomycin also protects the 915 region of 16 S rRNA within the 30 S subunit, whereas it did not protect the 915 region of the naked 16 S rRNA. The interaction of streptomycin with 16 S rRNA was further defined by using two fragments that correspond to the 3' minor domain of 16 S rRNA and to the decoding analog, a portion of this domain encompassing the decoding center. In the presence of streptomycin, the pattern of protection against dimethyl sulfate attack for the two fragments was similar to that seen with the full-length 16 S rRNA. This indicates that the 3' minor domain as well as the decoding analog contain the recognition signals for the binding of streptomycin. However, streptomycin could not bind to the decoding analog in the absence of Mg2+. This contrasts with neomycin, another error-inducing aminoglycoside antibiotic, that binds to the decoding analog in the absence of Mg2+, but not at 20 mM Mg2+. Our results suggest that both neomycin and streptomycin interact with the decoding center, but recognize alternative conformations of this region.

  4. An approach to analyse the specific impact of rapamycin on mRNA-ribosome association

    Directory of Open Access Journals (Sweden)

    Jaquier-Gubler Pascale

    2008-08-01

    Full Text Available Abstract Background Recent work, using both cell culture model systems and tumour derived cell lines, suggests that the differential recruitment into polysomes of mRNA populations may be sufficient to initiate and maintain tumour formation. Consequently, a major effort is underway to use high density microarray profiles to establish molecular fingerprints for cells exposed to defined drug regimes. The aim of these pharmacogenomic approaches is to provide new information on how drugs can impact on the translational read-out within a defined cellular background. Methods We describe an approach that permits the analysis of de-novo mRNA-ribosome association in-vivo during short drug exposures. It combines hypertonic shock, polysome fractionation and high-throughput analysis to provide a molecular phenotype of translationally responsive transcripts. Compared to previous translational profiling studies, the procedure offers increased specificity due to the elimination of the drugs secondary effects (e.g. on the transcriptional read-out. For this pilot "proof-of-principle" assay we selected the drug rapamycin because of its extensively studied impact on translation initiation. Results High throughput analysis on both the light and heavy polysomal fractions has identified mRNAs whose re-recruitment onto free ribosomes responded to short exposure to the drug rapamycin. The results of the microarray have been confirmed using real-time RT-PCR. The selective down-regulation of TOP transcripts is also consistent with previous translational profiling studies using this drug. Conclusion The technical advance outlined in this manuscript offers the possibility of new insights into mRNA features that impact on translation initiation and provides a molecular fingerprint for transcript-ribosome association in any cell type and in the presence of a range of drugs of interest. Such molecular phenotypes defined pre-clinically may ultimately impact on the evaluation of

  5. MMB-GUI: a fast morphing method demonstrates a possible ribosomal tRNA translocation trajectory.

    Science.gov (United States)

    Tek, Alex; Korostelev, Andrei A; Flores, Samuel Coulbourn

    2016-01-08

    Easy-to-use macromolecular viewers, such as UCSF Chimera, are a standard tool in structural biology. They allow rendering and performing geometric operations on large complexes, such as viruses and ribosomes. Dynamical simulation codes enable modeling of conformational changes, but may require considerable time and many CPUs. There is an unmet demand from structural and molecular biologists for software in the middle ground, which would allow visualization combined with quick and interactive modeling of conformational changes, even of large complexes. This motivates MMB-GUI. MMB uses an internal-coordinate, multiscale approach, yielding as much as a 2000-fold speedup over conventional simulation methods. We use Chimera as an interactive graphical interface to control MMB. We show how this can be used for morphing of macromolecules that can be heterogeneous in biopolymer type, sequence, and chain count, accurately recapitulating structural intermediates. We use MMB-GUI to create a possible trajectory of EF-G mediated gate-passing translocation in the ribosome, with all-atom structures. This shows that the GUI makes modeling of large macromolecules accessible to a wide audience. The morph highlights similarities in tRNA conformational changes as tRNA translocates from A to P and from P to E sites and suggests that tRNA flexibility is critical for translocation completion.

  6. Antibiotic resistance evolved via inactivation of a ribosomal RNA methylating enzyme

    Science.gov (United States)

    Stojković, Vanja; Noda-Garcia, Lianet; Tawfik, Dan S.; Fujimori, Danica Galonić

    2016-01-01

    Modifications of the bacterial ribosome regulate the function of the ribosome and modulate its susceptibility to antibiotics. By modifying a highly conserved adenosine A2503 in 23S rRNA, methylating enzyme Cfr confers resistance to a range of ribosome-targeting antibiotics. The same adenosine is also methylated by RlmN, an enzyme widely distributed among bacteria. While RlmN modifies C2, Cfr modifies the C8 position of A2503. Shared nucleotide substrate and phylogenetic relationship between RlmN and Cfr prompted us to investigate evolutionary origin of antibiotic resistance in this enzyme family. Using directed evolution of RlmN under antibiotic selection, we obtained RlmN variants that mediate low-level resistance. Surprisingly, these variants confer resistance not through the Cfr-like C8 methylation, but via inhibition of the endogenous RlmN C2 methylation of A2503. Detection of RlmN inactivating mutations in clinical resistance isolates suggests that the mechanism used by the in vitro evolved variants is also relevant in a clinical setting. Additionally, as indicated by a phylogenetic analysis, it appears that Cfr did not diverge from the RlmN family but from another distinct family of predicted radical SAM methylating enzymes whose function remains unknown. PMID:27496281

  7. Mutation of the mitochondrial large ribosomal RNA can provide pentamidine resistance to Saccharomyces cerevisiae.

    Science.gov (United States)

    Örs, Ş Tomris; Akdoğan, Emel; Dunn, Cory D

    2014-09-01

    Pentamidine is used to treat several trypanosomal diseases, as well as opportunistic infection by pathogenic fungi. However, the relevant targets of this drug are unknown. We isolated dominant mutations providing pentamidine resistance to Saccharomyces cerevisiae, one of which was localized to mitochondrial DNA. Next-generation sequencing revealed alteration of a widely conserved base at the peptidyl transferase center of the mitochondrial 21S ribosomal RNA. Our results provide a potential rationale for the toxicity of this drug to patients, and we discuss whether blockade of mitochondrial translation is the mechanism by which pathogenic fungi or protists are killed by pentamidine.

  8. Nonstop mRNA Decay: a Special Attribute of Trans-Translation Mediated Ribosome Rescue

    Directory of Open Access Journals (Sweden)

    Krithika eVenkataraman

    2014-03-01

    Full Text Available Decoding of aberrant mRNAs leads to unproductive ribosome stalling and sequestration of components of the translation machinery. Bacteria have evolved three seemingly independent pathways to resolve stalled translation complexes. The trans-translation process, orchestrated by the hybrid transfer-messenger RNA (tmRNA and its essential protein co-factor, SmpB, is the principal translation quality control system for rescuing unproductively stalled ribosomes. Two specialized alternative rescue pathways, coordinated by ArfA and ArfB, have been recently discovered. The SmpB-tmRNA mediated trans-translation pathway, in addition to re-mobilizing stalled translation complexes, co-translationally appends a degradation tag to the associated nascent polypeptides, marking them for proteolysis by various cellular proteases. Another unique feature of trans-translation, not shared by the alternative rescue pathways, is the facility to recruit RNase R for targeted degradation of nonstop mRNAs, thus preventing further futile cycles of translation. The distinct C-terminal lysine-rich (K-rich domain of RNase R is essential for its recruitment to stalled ribosomes. To gain new insights into the structure and function of RNase R, we investigated its global architecture, the spatial arrangement of its distinct domains, and the identities of key functional residues in its unique K-rich domain. Small-angle X-ray scattering (SAXS models of RNase R reveal a tri-lobed structure with flexible N- and C-terminal domains, and suggest intimate contacts between the K-rich domain and the catalytic core of the enzyme. Alanine-scanning mutagenesis of the K-rich domain, in the region spanning residues 735 and 750, has uncovered the precise amino acid determinants required for the productive engagement of RNase R on tmRNA-rescued ribosomes. Theses analyses demonstrate that alanine substitution of conserved residues E740 and K741 result in profound defects, not only in the recruitment

  9. Structural arrangement of tRNA binding sites on Escherichia coli ribosomes, as revealed from data on affinity labelling with photoactivatable tRNA derivatives.

    Science.gov (United States)

    Graifer, D M; Babkina, G T; Matasova, N B; Vladimirov, S N; Karpova, G G; Vlassov, V V

    1989-07-01

    A systematic study of protein environment of tRNA in ribosomes in model complexes representing different translation steps was carried out using the affinity labelling of the ribosomes with tRNA derivatives bearing aryl azide groups scattered statistically over tRNA guanine residues. Analysis of the proteins crosslinked to tRNA derivatives showed that the location of the derivatives in the aminoacyl (A) site led to the labelling of the proteins S5 and S7 in all complexes studied, whereas the labelling of the proteins S2, S8, S9, S11, S14, S16, S17, S18, S19, S21 as well as L9, L11, L14, L15, L21, L23, L24, L29 depended on the state of tRNA in A site. Similarly, the location of tRNA derivatives in the peptidyl (P) site resulted in the labelling of the proteins L27, S11, S13 and S19 in all states, whereas the labelling of the proteins S5, S7, S9, S12, S14, S20, S21 as well as L2, L13, L14, L17, L24, L27, L31, L32, L33 depended on the type of complex. The derivatives of tRNA(fMet) were found to crosslink to S1, S3, S5, S7, S9, S14 and L1, L2, L7/L12, L27. Based on the data obtained, a general principle of the dynamic functioning of ribosomes has been proposed: (i) the formation of each type of ribosomal complex is accompanied by changes in mutual arrangement of proteins - 'conformational adjustment' of the ribosome - and (ii) a ribosome can dynamically change its internal structure at each step of initiation and elongation; on the 70 S ribosome there are no rigidly fixed structures forming tRNA-binding sites (primarily A and P sites).

  10. Nuclear/nucleolar GTPase 2 proteins as a subfamily of YlqF/YawG GTPases function in pre-60S ribosomal subunit maturation of mono- and dicotyledonous plants.

    Science.gov (United States)

    Im, Chak Han; Hwang, Sung Min; Son, Young Sim; Heo, Jae Bok; Bang, Woo Young; Suwastika, I Nengah; Shiina, Takashi; Bahk, Jeong Dong

    2011-03-11

    The YlqF/YawG families are important GTPases involved in ribosome biogenesis, cell proliferation, or cell growth, however, no plant homologs have yet to be characterized. Here we isolated rice (Oryza sativa) and Arabidopsis nuclear/nucleolar GTPase 2 (OsNug2 and AtNug2, respectively) that belong to the YawG subfamily and characterized them for pre-60S ribosomal subunit maturation. They showed typical intrinsic YlqF/YawG family GTPase activities in bacteria and yeasts with k(cat) values 0.12 ± 0.007 min(-1) (n = 6) and 0.087 ± 0.002 min(-1) (n = 4), respectively, and addition of 60S ribosomal subunits stimulated their activities in vitro. In addition, OsNug2 rescued the lethality of the yeast nug2 null mutant through recovery of 25S pre-rRNA processing. By yeast two-hybrid screening five clones, including a putative one of 60S ribosomal proteins, OsL10a, were isolated. Subcellular localization and pulldown assays resulted in that the N-terminal region of OsNug2 is sufficient for nucleolar/nuclear targeting and association with OsL10a. OsNug2 is physically associated with pre-60S ribosomal complexes highly enriched in the 25S, 5.8S, and 5S rRNA, and its interaction was stimulated by exogenous GTP. Furthermore, the AtNug2 knockdown mutant constructed by the RNAi method showed defective growth on the medium containing cycloheximide. Expression pattern analysis revealed that the distribution of AtNug2 mainly in the meristematic region underlies its potential role in active plant growth. Finally, it is concluded that Nug2/Nog2p GTPase from mono- and didicotyledonous plants is linked to the pre-60S ribosome complex and actively processed 27S into 25S during the ribosomal large subunit maturation process, i.e. prior to export to the cytoplasm.

  11. Mapping of the RNA recognition site of Escherichia coli ribosomal protein S7.

    Science.gov (United States)

    Robert, F; Gagnon, M; Sans, D; Michnick, S; Brakier-Gingras, L

    2000-11-01

    Bacterial ribosomal protein S7 initiates the folding of the 3' major domain of 16S ribosomal RNA by binding to its lower half. The X-ray structure of protein S7 from thermophilic bacteria was recently solved and found to be a modular structure, consisting of an alpha-helical domain with a beta-ribbon extension. To gain further insights into its interaction with rRNA, we cloned the S7 gene from Escherichia coli K12 into a pET expression vector and introduced 4 deletions and 12 amino acid substitutions in the protein sequence. The binding of each mutant to the lower half of the 3' major domain of 16S rRNA was assessed by filtration on nitrocellulose membranes. Deletion of the N-terminal 17 residues or deletion of the B hairpins (residues 72-89) severely decreased S7 affinity for the rRNA. Truncation of the C-terminal portion (residues 138-178), which includes part of the terminal alpha-helix, significantly affected S7 binding, whereas a shorter truncation (residues 148-178) only marginally influenced its binding. Severe effects were also observed with several strategic point mutations located throughout the protein, including Q8A and F17G in the N-terminal region, and K35Q, G54S, K113Q, and M115G in loops connecting the alpha-helices. Our results are consistent with the occurrence of several sites of contact between S7 and the 16S rRNA, in line with its role in the folding of the 3' major domain.

  12. Nucleotide sequence of an exceptionally long 5.8S ribosomal RNA from Crithidia fasciculata.

    Science.gov (United States)

    Schnare, M N; Gray, M W

    1982-01-01

    In Crithidia fasciculata, a trypanosomatid protozoan, the large ribosomal subunit contains five small RNA species (e, f, g, i, j) in addition to 5S rRNA [Gray, M.W. (1981) Mol. Cell. Biol. 1, 347-357]. The complete primary sequence of species i is shown here to be pAACGUGUmCGCGAUGGAUGACUUGGCUUCCUAUCUCGUUGA ... AGAmACGCAGUAAAGUGCGAUAAGUGGUApsiCAAUUGmCAGAAUCAUUCAAUUACCGAAUCUUUGAACGAAACGG ... CGCAUGGGAGAAGCUCUUUUGAGUCAUCCCCGUGCAUGCCAUAUUCUCCAmGUGUCGAA(C)OH. This sequence establishes that species i is a 5.8S rRNA, despite its exceptional length (171-172 nucleotides). The extra nucleotides in C. fasciculata 5.8S rRNA are located in a region whose primary sequence and length are highly variable among 5.8S rRNAs, but which is capable of forming a stable hairpin loop structure (the "G+C-rich hairpin"). The sequence of C. fasciculata 5.8S rRNA is no more closely related to that of another protozoan, Acanthamoeba castellanii, than it is to representative 5.8S rRNA sequences from the other eukaryotic kingdoms, emphasizing the deep phylogenetic divisions that seem to exist within the Kingdom Protista. Images PMID:7079176

  13. Studies on the control of ribosomal RNA synthesis in HeLa cells.

    Science.gov (United States)

    Chesterton, C J; Coupar, B E; Butterworth, P H; Green, M H

    1975-09-01

    In many eucaryotic systems protein synthesis is coupled to ribosomal RNA synthesis such that shut-down of the former causes inhibition of the latter. We have investigated this stringency phenomenon in HeLa cells. The protein synthesis inhibitors cycloheximide and puromycin cause inactivation of both processes but valine starvation totally inhibits only the processing of 45-S RNA. DNA-dependent RNA polymerases from A, B and C (or I, II and III respectively) were extracted, separated partially by DEAE-cellulose chromatography and their activity levels determined. These do not decrease significantly during inhibition of protein synthesis. To find out whether or not form A is bound to its template under these conditions, proteins were removed from chromatin with the detergent sarkosyl. This does not affect bound RNA polymerase. Inhibition of protein synthesis caused up to 50% reduction in endogenous alpha-amanitin-insensitive chromatin-RNA-synthesising activity. This reduced level of activity was not affected by sarkosyl treatment. Levels in normal cells were stimulated. This result indicates that the form A RNA polymerase is not bound to its template when protein synthesis is inhibited.

  14. Molecular and cytological characterization of ribosomal RNA genes in Chenopodium quinoa and Chenopodium berlandieri.

    Science.gov (United States)

    Maughan, P J; Kolano, B A; Maluszynska, J; Coles, N D; Bonifacio, A; Rojas, J; Coleman, C E; Stevens, M R; Fairbanks, D J; Parkinson, S E; Jellen, E N

    2006-07-01

    The nucleolus organizer region (NOR) and 5S ribosomal RNA (rRNA) genes are valuable as chromosome landmarks and in evolutionary studies. The NOR intergenic spacers (IGS) and 5S rRNA nontranscribed spacers (NTS) were PCR-amplified and sequenced from 5 cultivars of the Andean grain crop quinoa (Chenopodium quinoa Willd., 2n = 4x = 36) and a related wild ancestor (C. berlandieri Moq. subsp. zschackei (Murr) A. Zobel, 2n = 4x = 36). Length heterogeneity observed in the IGS resulted from copy number difference in subrepeat elements, small re arrangements, and species-specific indels, though the general sequence composition of the 2 species was highly similar. Fifteen of the 41 sequence polymorphisms identified among the C. quinoa lines were synapomorphic and clearly differentiated the highland and lowland ecotypes. Analysis of the NTS sequences revealed 2 basic NTS sequence classes that likely originated from the 2 allopolyploid subgenomes of C. quinoa. Fluorescence in situ hybridization (FISH) analysis showed that C. quinoa possesses an interstitial and a terminal pair of 5S rRNA loci and only 1 pair of NOR, suggesting a reduction in the number of rRNA loci during the evolution of this species. C. berlandieri exhibited variation in both NOR and 5S rRNA loci without changes in ploidy.

  15. Effects of ethidium bromide on the production of ribosomal RNA in cultured mouse cells.

    Science.gov (United States)

    Lange, M; May, P

    1979-06-25

    A treatment of primary mouse kidney cell cultures with 5 microM Ethidium Bromide (Eth Br) reduces the transcription of nuclear-coded genes and especially of ribosomal RNA genes. This effect was consistently observed when comparing drug-treated and control cells for (i), the incorporation of 3H uridine into total nuclear and B RNA polymerases as determined in isolated nuclei. It became more pronounced with exposure time; however, after removal of the drug, there was a progressive recovery of RNA synthesis culminating in the complete reversal of the drug effect. That this effect is probably not due only to the suppression of mitochondrial protein synthesis by the drug, is shown by a comparative study of the effects of chloramphenicol treatment. In addition, in the cytoplasm Eth Br depresses the labeling of 28 S rRNA more than that of 18 S whereas no abnormal accumulation of 28 S rRNA is observed in the nucleus. It is suggested that Eth Br may affect either the stability of the 28 S rRNA or its rate of formation from the 32 S precursor.

  16. The functional half-life of an mRNA depends on the ribosome spacing in an early coding region

    DEFF Research Database (Denmark)

    Pedersen, Margit; Nissen, Søren; Mitarai, Namiko

    2011-01-01

    supported the model. We thus suggest that translation-rate-mediated differences in the spacing between ribosomes in this early coding region is a parameter that determines the mRNAs functional half-life. We present a model that is in accordance with many earlier observations and that allows a prediction...... codons. When comparing the ribosome spacing at various segments of the mRNA to its functional half-life, we found a clear correlation between the functional mRNA half-life and the ribosome spacing in the mRNA region approximately between codon 20 and codon 45. From this finding, we predicted that inserts......Bacterial mRNAs are translated by closely spaced ribosomes and degraded from the 5'-end, with half-lives of around 2 min at 37 °C in most cases. Ribosome-free or "naked" mRNA is known to be readily degraded, but the initial event that inactivates the mRNA functionally has not been fully described...

  17. [Study of the photoaffinity modification of Escherichia coli ribosomes near the donor tRNA-binding center].

    Science.gov (United States)

    Bausk, E V; Graĭfer, D M; Karpova, G G

    1985-01-01

    Affinity labelling of E. coli ribosomes near the donor tRNA-binding (P) site was studied with the use of photoreactive derivatives of tRNAPhe bearing arylazidogroups on N7 atoms of guanine residues (azido-tRNA). UV-irradiation of complexes 70S ribosome.poly(U).azido- tRNA(P-site) and 70S ribosome.poly(U).azido-tRNA(P-site).Phe- tRNAPhe(A-site) resulted in covalent attachment of azido-tRNA to ribosomes, both subunits being labelled. In both cases modification extent of 30S subunit was two-fold than that of the 50S one. It was shown that when the A-site was free the azido-tRNA located in P-site labelled proteins S9, S11, S12, S13, S21 and L14, L27, L31. Azido-tRNA located in P-site when the A-site was occupied with Phe-tRNAPhe labelled proteins S11, S12, S13, S14, S19, L32/L33 and possibly L23, L25. From the comparison of the sets of proteins labelled when A-site was free or occupied a conclusion was drawn that aminoacyl-tRNA located in ribosomal A-site affects the arrangement of deacylated tRNA in P-site. Data obtained allow to propose that proteins S5, S19, S20 and L24, L33 interact with guanine residues important for the tRNA tertiary structure formation.

  18. Oxidative damage of 18S and 5S ribosomal RNA in digestive gland of mussels exposed to trace metals.

    Science.gov (United States)

    Kournoutou, Georgia G; Giannopoulou, Panagiota C; Sazakli, Eleni; Leotsinidis, Michel; Kalpaxis, Dimitrios L

    2017-09-06

    Numerous studies have shown the ability of trace metals to accumulate in marine organisms and cause oxidative stress that leads to perturbations in many important intracellular processes, including protein synthesis. This study is mainly focused on the exploration of structural changes, like base modifications, scissions, and conformational changes, caused in 18S and 5S ribosomal RNA (rRNA) isolated from the mussel Mytilus galloprovincialis exposed to 40μg/L Cu, 30μg/L Hg, or 100μg/L Cd, for 5 or 15days. 18S rRNA and 5S rRNA are components of the small and large ribosomal subunit, respectively, found in complex with ribosomal proteins, translation factors and other auxiliary components (metal ions, toxins etc). 18S rRNA plays crucial roles in all stages of protein synthesis, while 5S rRNA serves as a master signal transducer between several functional regions of 28S rRNA. Therefore, structural changes in these ribosomal constituents could affect the basic functions of ribosomes and hence the normal metabolism of cells. Especially, 18S rRNA along with ribosomal proteins forms the decoding centre that ensures the correct codon-anticodon pairing. As exemplified by ELISA, primer extension analysis and DMS footprinting analysis, each metal caused oxidative damage to rRNA, depending on the nature of metal ion and the duration of exposure. Interestingly, exposure of mussels to Cu or Hg caused structural alterations in 5S rRNA, localized in paired regions and within loops A, B, C, and E, leading to a continuous progressive loss of the 5S RNA structural integrity. In contrast, structural impairments of 5S rRNA in mussels exposed to Cd were accumulating for the initial 5days, and then progressively decreased to almost the normal level by day 15, probably due to the parallel elevation of metallothionein content that depletes the pools of free Cd. Regions of interest in 18S rRNA, such as the decoding centre, sites implicated in the binding of tRNAs (A- and P-sites) or

  19. Cell-Type-Specific mRNA Purification by Translating Ribosome Affinity Purification (TRAP)

    Science.gov (United States)

    Heiman, Myriam; Kulicke, Ruth; Fenster, Robert J.; Greengard, Paul; Heintz, Nathaniel

    2014-01-01

    Cellular diversity and architectural complexity create barriers to understanding the function of the mammalian central nervous system (CNS) at a molecular level. To address this problem, we recently developed a methodology that provides the ability to profile the entire translated mRNA complement of any genetically defined cell population. This methodology, which we termed translating ribosome affinity purification, or TRAP, combines cell-type-specific transgene expression with affinity purification of translating ribosomes. TRAP can be used to study the cell-type-specific mRNA profiles of any genetically defined cell type, and has been successfully used to date in organisms ranging from D. melanogaster to mice and human cultured cells. Unlike other methodologies that rely upon micro-dissection, cell panning, or cell sorting, the TRAP methodology bypasses the need for tissue fixation or single-cell suspensions (and potential artifacts these treatments introduce), and reports on mRNAs in the entire cell body. This protocol provides a step-by-step guide to implementing the TRAP methodology, which takes two days to complete once all materials are in hand. PMID:24810037

  20. The nucleotide sequence of 4.5S ribosomal RNA from tobacco chloroplasts.

    OpenAIRE

    Takaiwa, F; Sugiura, M

    1980-01-01

    The nucleotide sequence of tobacco chloroplast 4.5S ribosomal RNA has been determined to be: OHG-A-A-G-G-U-C-A-C-G-G-C-G-A-G-A-C-G-A-G-C-C-G-U-U-U-A-U-C-A-U-U-A-C-G-A-U-A-G-G-U-G-U-C-A-A-G-U-G-G-A-A-G-U-G-C-A-G-U-G-A-U-G-U-A-U-G-C-(G-A)-C-U-G-A-G-G-C-A-U-C-C-U-A-A-C-A-G-A-C-C-G-G-U-A-G-A-C-U-U-G-A-A-COH. The 4.5S RNA is 103 nucleotides long and its 5'-terminus is not phosphorylated.

  1. Interrelationships between yeast ribosomal protein assembly events and transient ribosome biogenesis factors interactions in early pre-ribosomes.

    Directory of Open Access Journals (Sweden)

    Steffen Jakob

    Full Text Available Early steps of eukaryotic ribosome biogenesis require a large set of ribosome biogenesis factors which transiently interact with nascent rRNA precursors (pre-rRNA. Most likely, concomitant with that initial contacts between ribosomal proteins (r-proteins and ribosome precursors (pre-ribosomes are established which are converted into robust interactions between pre-rRNA and r-proteins during the course of ribosome maturation. Here we analysed the interrelationship between r-protein assembly events and the transient interactions of ribosome biogenesis factors with early pre-ribosomal intermediates termed 90S pre-ribosomes or small ribosomal subunit (SSU processome in yeast cells. We observed that components of the SSU processome UTP-A and UTP-B sub-modules were recruited to early pre-ribosomes independently of all tested r-proteins. On the other hand, groups of SSU processome components were identified whose association with early pre-ribosomes was affected by specific r-protein assembly events in the head-platform interface of the SSU. One of these components, Noc4p, appeared to be itself required for robust incorporation of r-proteins into the SSU head domain. Altogether, the data reveal an emerging network of specific interrelationships between local r-protein assembly events and the functional interactions of SSU processome components with early pre-ribosomes. They point towards some of these components being transient primary pre-rRNA in vivo binders and towards a role for others in coordinating the assembly of major SSU domains.

  2. Non-coding RNA in Spermatogenesis and Epididymal Maturation.

    Science.gov (United States)

    Holt, J E; Stanger, S J; Nixon, B; McLaughlin, E A

    2016-01-01

    Testicular germ and somatic cells express many classes of small ncRNAs, including Dicer-independent PIWI-interacting RNAs, Dicer-dependent miRNAs, and endogenous small interfering RNA. Several studies have identified ncRNAs that are highly, exclusively, or preferentially expressed in the testis and epididymis in specific germ and somatic cell types. Temporal and spatial expression of proteins is a key requirement of successful spermatogenesis and large-scale gene transcription occurs in two key stages, just prior to transcriptional quiescence in meiosis and then during spermiogenesis just prior to nuclear silencing in elongating spermatids. More than 60 % of these transcripts are then stockpiled for subsequent translation. In this capacity ncRNAs may act to interpret and transduce cellular signals to either maintain the undifferentiated stem cell population and/or drive cell differentiation during spermatogenesis and epididymal maturation. The assignation of specific roles to the majority of ncRNA species implicated as having a role in spermatogenesis and epididymal function will underpin fundamental understanding of normal and disease states in humans such as infertility and the development of germ cell tumours.

  3. [Study of the mRNA-binding region of ribosomes at different steps of translation. II. Affinity modification of Escherichia coli ribosomes by benzylidene derivative of AUGU6 in the 70S initiation complex].

    Science.gov (United States)

    Babkina, G T; Karpova, G G; Matasova, N B; Berzin', V M; Gren, E Ia

    1985-01-01

    2',3'-O-(4-[N-(2-chloroethyl)-N-methylamino]) benzylidene derivative of AUGU6 was used for identification of the proteins in the region of the mRNA-binding centre of E. coli ribosomes. This derivative alkylated ribosomes (preferentially 30S ribosomal) with high efficiency within the 70S initiation complex. In both 30S and 50S ribosomal subunits proteins and rRNA were modified. Specificity of the alkylation of ribosomal proteins and rRNA with the reagent was proved by the inhibitory action of AUGU6. Using the method of two-dimensional electrophoresis in polyacrylamide gel the proteins S4, S12, S13, S14, S15, S18, S19 and S20/L26 which are labelled by the analog of mRNA were identified.

  4. Ribosomal RNA gene diversity, effective population size, and evolutionary longevity in asexual glomeromycota.

    Science.gov (United States)

    Vankuren, Nicholas W; den Bakker, Henk C; Morton, Joseph B; Pawlowska, Teresa E

    2013-01-01

    Arbuscular mycorrhizal fungi (phylum Glomeromycota) are among the oldest and most successful symbionts of land plants. With no evidence of sexual reproduction, their evolutionary success is inconsistent with the prediction that asexual taxa are vulnerable to extinction due to accumulation of deleterious mutations. To explore why Glomeromycota defy this prediction, we studied ribosomal RNA (rRNA) gene evolution in the Claroideoglomus lineage and estimated effective population size, N(e) , in C. etunicatum. We found that rRNA genes of these fungi exhibit unusual and complex patterns of molecular evolution. In C. etunicatum, these patterns can be collectively explained by an unexpectedly large N(e) combined with imperfect genome-wide and population-level rRNA gene repeat homogenization. The mutations accumulated in rRNA gene sequences indicate that natural selection is effective at purging deleterious mutations in the Claroideoglomus lineage, which is also consistent with the large N(e) of C. etunicatum. We propose that in the near absence of recombination, asexual reproduction involving massively multinucleate spores typical for Glomeromycota is responsible for the improved efficacy of selection relative to drift. We postulate that large effective population sizes contribute to the evolutionary longevity of Glomeromycota.

  5. Requirement for a conserved, tertiary interaction in the core of 23S ribosomal RNA

    DEFF Research Database (Denmark)

    Aagaard, C; Douthwaite, S

    1994-01-01

    A putative base-pairing interaction that determines the folding of the central region of 23S rRNA has been investigated by mutagenesis. Each of the possible base substitutions has been made at the phylogenetically covariant positions adenine-1262 (A1262) and U2017 in Escherichia coli 23S rRNA....... Every substitution that disrupts the potential for Watson-Crick base pairing between these positions reduces or abolishes the participation of 23S rRNA in protein synthesis. All mutant 23S rRNAs are assembled into 50S subunits, but the mutant subunits are less able to stably interact with 30S subunits...... to form translationally active ribosomes. The function of 23S rRNA is largely reestablished by introduction of an alternative G1262.C2017 or U1262.A2017 pair, although neither of these supports polysome formation quite as effectively as the wild-type pair. A 23S rRNA with a C1262.G2017 pair...

  6. The putative RNA helicase HELZ promotes cell proliferation, translation initiation and ribosomal protein S6 phosphorylation.

    Directory of Open Access Journals (Sweden)

    Philippe A Hasgall

    Full Text Available The hypoxia-inducible transcription factor (HIF is a key component of the cellular adaptation mechanisms to hypoxic conditions. HIFα subunits are degraded by prolyl-4-hydroxylase domain (PHD enzyme-dependent prolyl-4-hydroxylation of LxxLAP motifs that confer oxygen-dependent proteolytic degradation. Interestingly, only three non-HIFα proteins contain two conserved LxxLAP motifs, including the putative RNA helicase with a zinc finger domain HELZ. However, HELZ proteolytic regulation was found to be oxygen-independent, supporting the notion that a LxxLAP sequence motif alone is not sufficient for oxygen-dependent protein destruction. Since biochemical pathways involving RNA often require RNA helicases to modulate RNA structure and activity, we used luciferase reporter gene constructs and metabolic labeling to demonstrate that HELZ overexpression activates global protein translation whereas RNA-interference mediated HELZ suppression had the opposite effect. Although HELZ interacted with the poly(A-binding protein (PABP via its PAM2 motif, PABP was dispensable for HELZ function in protein translation. Importantly, downregulation of HELZ reduced translational initiation, resulting in the disassembly of polysomes, in a reduction of cell proliferation and hypophosphorylation of ribosomal protein S6.

  7. Label- and amplification-free electrochemical detection of bacterial ribosomal RNA.

    Science.gov (United States)

    Henihan, Grace; Schulze, Holger; Corrigan, Damion K; Giraud, Gerard; Terry, Jonathan G; Hardie, Alison; Campbell, Colin J; Walton, Anthony J; Crain, Jason; Pethig, Ronald; Templeton, Kate E; Mount, Andrew R; Bachmann, Till T

    2016-07-15

    Current approaches to molecular diagnostics rely heavily on PCR amplification and optical detection methods which have restrictions when applied to point of care (POC) applications. Herein we describe the development of a label-free and amplification-free method of pathogen detection applied to Escherichia coli which overcomes the bottleneck of complex sample preparation and has the potential to be implemented as a rapid, cost effective test suitable for point of care use. Ribosomal RNA is naturally amplified in bacterial cells, which makes it a promising target for sensitive detection without the necessity for prior in vitro amplification. Using fluorescent microarray methods with rRNA targets from a range of pathogens, an optimal probe was selected from a pool of probe candidates identified in silico. The specificity of probes was investigated on DNA microarray using fluorescently labeled 16S rRNA target. The probe yielding highest specificity performance was evaluated in terms of sensitivity and a LOD of 20 pM was achieved on fluorescent glass microarray. This probe was transferred to an EIS end point format and specificity which correlated to microarray data was demonstrated. Excellent sensitivity was facilitated by the use of uncharged PNA probes and large 16S rRNA target and investigations resulted in an LOD of 50 pM. An alternative kinetic EIS assay format was demonstrated with which rRNA could be detected in a species specific manner within 10-40min at room temperature without wash steps.

  8. Novel extraction strategy of ribosomal RNA and genomic DNA from cheese for PCR-based investigations.

    Science.gov (United States)

    Bonaïti, Catherine; Parayre, Sandrine; Irlinger, Françoise

    2006-03-15

    Cheese microorganisms, such as bacteria and fungi, constitute a complex ecosystem that plays a central role in cheeses ripening. The molecular study of cheese microbial diversity and activity is essential but the extraction of high quality nucleic acid may be problematic: the cheese samples are characterised by a strong buffering capacity which negatively influenced the yield of the extracted rRNA. The objective of this study is to develop an effective method for the direct and simultaneous isolation of yeast and bacterial ribosomal RNA and genomic DNA from the same cheese samples. DNA isolation was based on a protocol used for nucleic acids isolation from anaerobic digestor, without preliminary washing step with the combined use of the action of chaotropic agent (acid guanidinium thiocyanate), detergents (SDS, N-lauroylsarcosine), chelating agent (EDTA) and a mechanical method (bead beating system). The DNA purification was carried out by two washing steps of phenol-chloroform. RNA was isolated successfully after the second acid extraction step by recovering it from the phenolic phase of the first acid extraction. The novel method yielded pure preparation of undegraded RNA accessible for reverse transcription-PCR. The extraction protocol of genomic DNA and rRNA was applicable to complex ecosystem of different cheese matrices.

  9. High-resolution microscopy of active ribosomal genes and key members of the rRNA processing machinery inside nucleolus-like bodies of fully-grown mouse oocytes.

    Science.gov (United States)

    Shishova, Kseniya V; Khodarovich, Yuriy M; Lavrentyeva, Elena A; Zatsepina, Olga V

    2015-10-01

    Nucleolus-like bodies (NLBs) of fully-grown (germinal vesicle, GV) mammalian oocytes are traditionally considered as morphologically distinct entities, which, unlike normal nucleoli, contain transcribed ribosomal genes (rDNA) solely at their surface. In the current study, we for the first time showed that active ribosomal genes are present not only on the surface but also inside NLBs of the NSN-type oocytes. The "internal" rRNA synthesis was evidenced by cytoplasmic microinjections of BrUTP as precursor and by fluorescence in situ hybridization with a probe to the short-lived 5'ETS segment of the 47S pre-rRNA. We further showed that in the NLB mass of NSN-oocytes, distribution of active rDNA, RNA polymerase I (UBF) and rRNA processing (fibrillarin) protein factors, U3 snoRNA, pre-rRNAs and 18S/28S rRNAs is remarkably similar to that in somatic nucleoli capable to make pre-ribosomes. Overall, these observations support the occurrence of rDNA transcription, rRNA processing and pre-ribosome assembly in the NSN-type NLBs and so that their functional similarity to normal nucleoli. Unlike the NSN-type NLBs, the NLBs of more mature SN-oocytes do not contain transcribed rRNA genes, U3 snoRNA, pre-rRNAs, 18S and 28S rRNAs. These results favor the idea that in a process of transformation of NSN-oocytes to SN-oocytes, NLBs cease to produce pre-ribosomes and, moreover, lose their rRNAs. We also concluded that a denaturing fixative 70% ethanol used in the study to fix oocytes could be more appropriate for light microscopy analysis of nucleolar RNAs and proteins in mammalian fully-grown oocytes than a commonly used cross-linking aldehyde fixative, formalin.

  10. Recognizing RNA structural motifs in HT-SELEX data for ribosomal protein S15.

    Science.gov (United States)

    Pei, Shermin; Slinger, Betty L; Meyer, Michelle M

    2017-06-06

    Proteins recognize many different aspects of RNA ranging from single stranded regions to discrete secondary or tertiary structures. High-throughput sequencing (HTS) of in vitro selected populations offers a large scale method to study RNA-proteins interactions. However, most existing analysis methods require that the binding motifs are enriched in the population relative to earlier rounds, and that motifs are found in a loop or single stranded region of the potential RNA secondary structure. Such methods do not generalize to all RNA-protein interaction as some RNA binding proteins specifically recognize more complex structures such as double stranded RNA. In this study, we use HT-SELEX derived populations to study the landscape of RNAs that interact with Geobacillus kaustophilus ribosomal protein S15. Our data show high sequence and structure diversity and proved intractable to existing methods. Conventional programs identified some sequence motifs, but these are found in less than 5-10% of the total sequence pool. Therefore, we developed a novel framework to analyze HT-SELEX data. Our process accounts for both sequence and structure components by abstracting the overall secondary structure into smaller substructures composed of a single base-pair stack, which allows us to leverage existing approaches already used in k-mer analysis to identify enriched motifs. By focusing on secondary structure motifs composed of specific two base-pair stacks, we identified significantly enriched or depleted structure motifs relative to earlier rounds. Discrete substructures are likely to be important to RNA-protein interactions, but they are difficult to elucidate. Substructures can help make highly diverse sequence data more tractable. The structure motifs provide limited accuracy in predicting enrichment suggesting that G. kaustophilus S15 can either recognize many different secondary structure motifs or some aspects of the interaction are not captured by the analysis. This

  11. Molecular Identification of Ptychodera flava (Hemichordata: Enteropneusta): Reconsideration in Light of Nucleotide Polymorphism in the 18S Ribosomal RNA Gene.

    Science.gov (United States)

    Urata, Makoto

    2015-06-01

    Seven nuclear and mitochondrial DNA markers were examined in 12 specimens of Ptychodera flava, a model acorn worm used in molecular biology, collected in Japan from three local populations with different modes of living. A comparison of intraspecific results did not show genetically isolated populations despite the species' enclave habitats and asexual reproduction. Moreover, both the nuclear 18S ribosomal RNA gene and mitochondrial 16S ribosomal RNA gene sequences were identical to those from Moorea in French Polynesia, nearly 10,000 kilometers away from Japan. I also provide the first definitive information regarding polymorphisms in 18S ribosomal RNA gene, the external transcribed spacer (ETS), internal transcribed spacers (ITS), and mitochondrial cytochrome c oxidase subunit 1 (mtCO1) sequence in hemichordates using newly designed primer sets, and I show both high larval vagility and certain criteria for the molecular identification of this species.

  12. The bacterial toxin RelE induces specific mRNA cleavage in the A site of the eukaryote ribosome

    Science.gov (United States)

    Andreev, Dmitri; Hauryliuk, Vasili; Terenin, Ilya; Dmitriev, Sergey; Ehrenberg, Måns; Shatsky, Ivan

    2008-01-01

    RelE/RelB is a well-characterized toxin–anti-toxin pair involved in nutritional stress responses in Bacteria and Archae. RelE lacks any eukaryote homolog, but we demonstrate here that it efficiently and specifically cleaves mRNA in the A site of the eukaryote ribosome. The cleavage mechanism is similar to that in bacteria, showing the feasibility of A-site cleavage of mRNA for regulatory purposes also in eukaryotes. RelE cleavage in the A-site codon of a stalled eukaryote ribosome is precise and easily monitored, making “RelE printing” a useful complement to toeprinting to determine the exact mRNA location on the eukaryote ribosome and to probe the occupancy of its A site. PMID:18083838

  13. tmRNA-mediated trans-translation as the major ribosome rescue system in a bacterial cell

    Directory of Open Access Journals (Sweden)

    Hyouta eHimeno

    2014-04-01

    Full Text Available tmRNA (transfer messenger RNA; also known as 10Sa RNA or SsrA RNA is a small RNA molecule that is conserved among bacteria. It has structural and functional similarities to tRNA: it has an upper half of the tRNA-like structure, its 5’ end is processed by RNase P, it has typical tRNA-specific base modifications, it is aminoacylated with alanine, it binds to EF-Tu after aminoacylation and it enters the ribosome with EF-Tu and GTP. However, tmRNA lacks an anticodon, and instead it has a coding sequence for a short peptide called tag-peptide. An elaborate interplay of actions of tmRNA as both tRNA and mRNA with the help of a tmRNA-binding protein, SmpB, facilitates trans-translation, which produces a single polypeptide from two mRNA molecules. Initially alanyl-tmRNA in complex with EF-Tu and SmpB enters the vacant A-site of the stalled ribosome like aminoacyl-tRNA but without a codon-anticodon interaction, and subsequently truncated mRNA is replaced with the tag-encoding region of tmRNA. During these processes, not only tmRNA but also SmpB structurally and functionally mimics both tRNA and mRNA. Thus trans-translation rescues the stalled ribosome, thereby allowing recycling of the ribosome. Since the tag-peptide serves as a target of AAA+ proteases, the trans-translation products are preferentially degraded so that they do not accumulate in the cell. Although alternative rescue systems have recently been revealed, trans-translation is the only system that universally exists in bacteria. Furthermore, it is unique in that it employs a small RNA and that it prevents accumulation of nonfunctional proteins from truncated mRNA in the cell. It might play the major role in rescuing the stalled translation in the bacterial cell.

  14. Removal of ribosomal subunits (and rRNA) from cytoplasmic extracts before solubilization with SDS and deproteinization.

    Science.gov (United States)

    Rio, Donald C; Ares, Manuel; Hannon, Gregory J; Nilsen, Timothy W

    2010-06-01

    More than 95% of total RNA is composed of ribosomal RNAs (rRNAs) (28S, 18S, 5.8S, and 5S). Here, we present a method that is effective in removing rRNA before extraction and purification of total RNA. If you choose to prepare cytoplasmic RNA and wish to analyze any RNA other than rRNA, it is desirable to eliminate the rRNAs by taking advantage of the fact that the ribosomal subunits are very large (40S and 60S). Few, if any, other cellular RNAs are present in such large macromolecular complexes. The vast majority of rRNAs can be removed by sedimentation. Of course, steps must be taken to avoid co-sedimentation of desired RNAs. Co-sedimentation can be greatly reduced by first dissociating ribosomes into their respective subunits by EDTA treatment. The subunits are then "cleaned" by treatment with high salt and nonionic detergent. Ribosomal subunits remain intact under these conditions and can be sedimented free of other RNAs. Subsequently, the remaining RNAs (messenger RNAs [mRNAs] and all other RNAs) can be purified and analyzed by a variety of methods.

  15. Partial methylation at Am100 in 18S rRNA of baker's yeast reveals ribosome heterogeneity on the level of eukaryotic rRNA modification.

    Directory of Open Access Journals (Sweden)

    Markus Buchhaupt

    Full Text Available Ribosome heterogeneity is of increasing biological significance and several examples have been described for multicellular and single cells organisms. In here we show for the first time a variation in ribose methylation within the 18S rRNA of Saccharomyces cerevisiae. Using RNA-cleaving DNAzymes, we could specifically demonstrate that a significant amount of S. cerevisiae ribosomes are not methylated at 2'-O-ribose of A100 residue in the 18S rRNA. Furthermore, using LC-UV-MS/MS of a respective 18S rRNA fragment, we could not only corroborate the partial methylation at A100, but could also quantify the methylated versus non-methylated A100 residue. Here, we exhibit that only 68% of A100 in the 18S rRNA of S.cerevisiae are methylated at 2'-O ribose sugar. Polysomes also contain a similar heterogeneity for methylated Am100, which shows that 40S ribosome subunits with and without Am100 participate in translation. Introduction of a multicopy plasmid containing the corresponding methylation guide snoRNA gene SNR51 led to an increased A100 methylation, suggesting the cellular snR51 level to limit the extent of this modification. Partial rRNA modification demonstrates a new level of ribosome heterogeneity in eukaryotic cells that might have substantial impact on regulation and fine-tuning of the translation process.

  16. Partial methylation at Am100 in 18S rRNA of baker's yeast reveals ribosome heterogeneity on the level of eukaryotic rRNA modification.

    Science.gov (United States)

    Buchhaupt, Markus; Sharma, Sunny; Kellner, Stefanie; Oswald, Stefanie; Paetzold, Melanie; Peifer, Christian; Watzinger, Peter; Schrader, Jens; Helm, Mark; Entian, Karl-Dieter

    2014-01-01

    Ribosome heterogeneity is of increasing biological significance and several examples have been described for multicellular and single cells organisms. In here we show for the first time a variation in ribose methylation within the 18S rRNA of Saccharomyces cerevisiae. Using RNA-cleaving DNAzymes, we could specifically demonstrate that a significant amount of S. cerevisiae ribosomes are not methylated at 2'-O-ribose of A100 residue in the 18S rRNA. Furthermore, using LC-UV-MS/MS of a respective 18S rRNA fragment, we could not only corroborate the partial methylation at A100, but could also quantify the methylated versus non-methylated A100 residue. Here, we exhibit that only 68% of A100 in the 18S rRNA of S.cerevisiae are methylated at 2'-O ribose sugar. Polysomes also contain a similar heterogeneity for methylated Am100, which shows that 40S ribosome subunits with and without Am100 participate in translation. Introduction of a multicopy plasmid containing the corresponding methylation guide snoRNA gene SNR51 led to an increased A100 methylation, suggesting the cellular snR51 level to limit the extent of this modification. Partial rRNA modification demonstrates a new level of ribosome heterogeneity in eukaryotic cells that might have substantial impact on regulation and fine-tuning of the translation process.

  17. Characterization of the tRNA and ribosome-dependent pppGpp-synthesis by recombinant stringent factor from Escherichia coli.

    Science.gov (United States)

    Knutsson Jenvert, Rose-Marie; Holmberg Schiavone, Lovisa

    2005-02-01

    Stringent factor is a ribosome-dependent ATP:GTP pyrophosphoryl transferase that synthesizes (p)ppGpp upon nutrient deprivation. It is activated by unacylated tRNA in the ribosomal amino-acyl site (A-site) but it is unclear how activation occurs. A His-tagged stringent factor was isolated by affinity-chromatography and precipitation. This procedure yielded a protein of high purity that displayed (a) a low endogenous pyrophosphoryl transferase activity that was inhibited by the antibiotic tetracycline; (b) a low ribosome-dependent activity that was inhibited by the A-site specific antibiotics thiostrepton, micrococcin, tetracycline and viomycin; (c) a tRNA- and ribosome-dependent activity amounting to 4500 pmol pppGpp per pmol stringent factor per minute. Footprinting analysis showed that stringent factor interacted with ribosomes that contained tRNAs bound in classical states. Maximal activity was seen when the ribosomal A-site was presaturated with unacylated tRNA. Less tRNA was required to reach maximal activity when stringent factor and unacylated tRNA were added simultaneously to ribosomes, suggesting that stringent factor formed a complex with tRNA in solution that had higher affinity for the ribosomal A-site. However, tRNA-saturation curves, performed at two different ribosome/stringent factor ratios and filter-binding assays, did not support this hypothesis.

  18. Model of EF4-induced ribosomal state transitions and mRNA translocation

    Science.gov (United States)

    Xie, Ping

    2014-08-01

    EF4, a highly conserved protein present in bacteria, mitochondria and chloroplasts, can bind to both the posttranslocation and pretranslocation ribosomal complexes. When binding to the posttranslocation state, it catalyzes backward translocation to a pretranslocation state. When binding to the pretranslocation state, it catalyzes transition to another pretranslocation state that is similar and possibly identical to that resulting from the posttranslocation state bound by EF4, and competes with EF-G to regulate the elongation cycle. However, the molecular mechanism on how EF4 induces state transitions and mRNA translocation remains unclear. Here, we present both the model for state transitions induced by EF4 binding to the posttranslocation state and that by EF4 binding to the pretranslocation state, based on which we study the kinetics of EF4-induced state transitions and mRNA translocation, giving quantitative explanations of the available experimental data. Moreover, we present some predicted results on state transitions and mRNA translocation induced by EF4 binding to the pretranslocation state complexed with the mRNA containing a duplex region.

  19. Profiling of 2'-O-Me in human rRNA reveals a subset of fractionally modified positions and provides evidence for ribosome heterogeneity

    DEFF Research Database (Denmark)

    Krogh, Nicolai; Jansson, Martin D; Häfner, Sophia J

    2016-01-01

    Ribose methylation is one of the two most abundant modifications in human ribosomal RNA and is believed to be important for ribosome biogenesis, mRNA selectivity and translational fidelity. We have applied RiboMeth-seq to rRNA from HeLa cells for ribosome-wide, quantitative mapping of 2'-O-Me sites...... and obtained a comprehensive set of 106 sites, including two novel sites, and with plausible box C/D guide RNAs assigned to all but three sites. We find approximately two-thirds of the sites to be fully methylated and the remainder to be fractionally modified in support of ribosome heterogeneity at the level...

  20. RACK1 is a ribosome scaffold protein for β-actin mRNA/ZBP1 complex.

    Directory of Open Access Journals (Sweden)

    Marcello Ceci

    Full Text Available In neurons, specific mRNAs are transported in a translationally repressed manner along dendrites or axons by transport ribonucleic-protein complexes called RNA granules. ZBP1 is one RNA binding protein present in transport RNPs, where it transports and represses the translation of cotransported mRNAs, including β-actin mRNA. The release of β-actin mRNA from ZBP1 and its subsequent translation depends on the phosphorylation of ZBP1 by Src kinase, but little is known about how this process is regulated. Here we demonstrate that the ribosomal-associated protein RACK1, another substrate of Src, binds the β-actin mRNA/ZBP1 complex on ribosomes and contributes to the release of β-actin mRNA from ZBP1 and to its translation. We identify the Src binding and phosphorylation site Y246 on RACK1 as the critical site for the binding to the β-actin mRNA/ZBP1 complex. Based on these results we propose RACK1 as a ribosomal scaffold protein for specific mRNA-RBP complexes to tightly regulate the translation of specific mRNAs.

  1. MicroRNA and tasiRNA diversity in mature pollen of Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    Hafidh Said

    2009-12-01

    Full Text Available Abstract Background New generation sequencing technology has allowed investigation of the small RNA populations of flowering plants at great depth. However, little is known about small RNAs in their reproductive cells, especially in post-meiotic cells of the gametophyte generation. Pollen - the male gametophyte - is the specialised haploid structure that generates and delivers the sperm cells to the female gametes at fertilisation. Whether development and differentiation of the male gametophyte depends on the action of microRNAs and trans-acting siRNAs guiding changes in gene expression is largely unknown. Here we have used 454 sequencing to survey the various small RNA populations present in mature pollen of Arabidopsis thaliana. Results In this study we detected the presence of 33 different microRNA families in mature pollen and validated the expression levels of 17 selected miRNAs by Q-RT-PCR. The majority of the selected miRNAs showed pollen-enriched expression compared with leaves. Furthermore, we report for the first time the presence of trans-acting siRNAs in pollen. In addition to describing new patterns of expression for known small RNAs in each of these classes, we identified 7 putative novel microRNAs. One of these, ath-MIR2939, targets a pollen-specific F-box transcript and we demonstrate cleavage of its target mRNA in mature pollen. Conclusions Despite the apparent simplicity of the male gametophyte, comprising just two different cell types, pollen not only utilises many miRNAs and trans-acting siRNAs expressed in the somatic tissues but also expresses novel miRNAs.

  2. The effect of aminoacyl- or peptidyl-tRNA at the A-site on the arrangement of deacylated tRNA at the ribosomal P-site.

    Science.gov (United States)

    Babkina, G T; Bausk, E V; Graifer, D M; Karpova, G G; Matasova, N B

    1984-05-21

    Photoreactive derivatives of E. coli tRNAPhe bearing arylazido groups on guanine residues (azido-tRNA) were used for affinity labelling of E. coli ribosomes in the region of the P-site when the A-site was either free or occupied by aminoacyl- or peptidyl-tRNA. Corresponding complexes of azido-tRNA with ribosomes and poly(U) were obtained both nonenzymatically and with the use of elongation factors. UV-irradiation of the complexes resulted in labelling of ribosomal proteins (preferentially of 30 S subunit). Proteins S9 and S21 were labelled only when the A-site was free; S14 - only when it was occupied; S11, S13, S19 - in both cases; S5, S7, S12, S20 - in some states.

  3. Connecting the kinetics and energy landscape of tRNA translocation on the ribosome.

    Science.gov (United States)

    Whitford, Paul C; Blanchard, Scott C; Cate, Jamie H D; Sanbonmatsu, Karissa Y

    2013-01-01

    Functional rearrangements in biomolecular assemblies result from diffusion across an underlying energy landscape. While bulk kinetic measurements rely on discrete state-like approximations to the energy landscape, single-molecule methods can project the free energy onto specific coordinates. With measures of the diffusion, one may establish a quantitative bridge between state-like kinetic measurements and the continuous energy landscape. We used an all-atom molecular dynamics simulation of the 70S ribosome (2.1 million atoms; 1.3 microseconds) to provide this bridge for specific conformational events associated with the process of tRNA translocation. Starting from a pre-translocation configuration, we identified sets of residues that collectively undergo rotary rearrangements implicated in ribosome function. Estimates of the diffusion coefficients along these collective coordinates for translocation were then used to interconvert between experimental rates and measures of the energy landscape. This analysis, in conjunction with previously reported experimental rates of translocation, provides an upper-bound estimate of the free-energy barriers associated with translocation. While this analysis was performed for a particular kinetic scheme of translocation, the quantitative framework is general and may be applied to energetic and kinetic descriptions that include any number of intermediates and transition states.

  4. Basonuclin regulates a subset of ribosomal RNA genes in HaCaT cells.

    Directory of Open Access Journals (Sweden)

    Shengliang Zhang

    Full Text Available Basonuclin (Bnc1, a cell-type-specific ribosomal RNA (rRNA gene regulator, is expressed mainly in keratinocytes of stratified epithelium and gametogenic cells of testis and ovary. Previously, basonuclin was shown in vitro to interact with rRNA gene (rDNA promoter at three highly conserved sites. Basonuclin's high affinity binding site overlaps with the binding site of a dedicated and ubiquitous Pol I transcription regulator, UBF, suggesting that their binding might interfere with each other if they bind to the same promoter. Knocking-down basonuclin in mouse oocytes eliminated approximately one quarter of RNA polymerase I (Pol I transcription foci, without affecting the BrU incorporation of the remaining ones, suggesting that basonuclin might regulate a subset of rDNA. Here we show, via chromatin immunoprecipitation (ChIP, that basonuclin is associated with rDNA promoters in HaCaT cells, a spontaneously established human keratinocyte line. Immunoprecipitation data suggest that basonuclin is in a complex that also contains the subunits of Pol I (RPA194, RPA116, but not UBF. Knocking-down basonuclin in HaCaT cells partially impairs the association of RPA194 to rDNA promoter, but not that of UBF. Basonuclin-deficiency also reduces the amount of 47S pre-rRNA, but this effect can be seen only after cell-proliferation related rRNA synthesis has subsided at a higher cell density. DNA sequence of basonuclin-bound rDNA promoters shows single nucleotide polymorphisms (SNPs that differ from those associated with UBF-bound promoters, suggesting that basonuclin and UBF interact with different subsets of promoters. In conclusion, our results demonstrate basonuclin's functional association with rDNA promoters and its interaction with Pol I in vivo. Our data also suggest that basonuclin-Pol I complex transcribes a subset of rDNA.

  5. Genetic characterization of clinical acanthamoeba isolates from Japan using nuclear and mitochondrial small subunit ribosomal RNA.

    Science.gov (United States)

    Rahman, Md Moshiur; Yagita, Kenji; Kobayashi, Akira; Oikawa, Yosaburo; Hussein, Amjad I A; Matsumura, Takahiro; Tokoro, Masaharu

    2013-08-01

    Because of an increased number of Acanthamoeba keratitis (AK) along with associated disease burdens, medical professionals have become more aware of this pathogen in recent years. In this study, by analyzing both the nuclear 18S small subunit ribosomal RNA (18S rRNA) and mitochondrial 16S rRNA gene loci, 27 clinical Acanthamoeba strains that caused AK in Japan were classified into 3 genotypes, T3 (3 strains), T4 (23 strains), and T5 (one strain). Most haplotypes were identical to the reference haplotypes reported from all over the world, and thus no specificity of the haplotype distribution in Japan was found. The T4 sub-genotype analysis using the 16S rRNA gene locus also revealed a clear sub-conformation within the T4 cluster, and lead to the recognition of a new sub-genotype T4i, in addition to the previously reported sub-genotypes T4a-T4h. Furthermore, 9 out of 23 strains in the T4 genotype were identified to a specific haplotype (AF479533), which seems to be a causal haplotype of AK. While heterozygous nuclear haplotypes were observed from 2 strains, the mitochondrial haplotypes were homozygous as T4 genotype in the both strains, and suggested a possibility of nuclear hybridization (mating reproduction) between different strains in Acanthamoeba. The nuclear 18S rRNA gene and mitochondrial 16S rRNA gene loci of Acanthamoeba spp. possess different unique characteristics usable for the genotyping analyses, and those specific features could contribute to the establishment of molecular taxonomy for the species complex of Acanthamoeba.

  6. Mutant forms of Escherichia coli protein L25 unable to bind to 5S rRNA are incorporated efficiently into the ribosome in vivo.

    Science.gov (United States)

    Anikaev, A Y; Korepanov, A P; Korobeinikova, A V; Kljashtorny, V G; Piendl, W; Nikonov, S V; Garber, M B; Gongadze, G M

    2014-08-01

    5S rRNA-binding ribosomal proteins of the L25 family are an evolutional acquisition of bacteria. Earlier we showed that (i) single replacements in the RNA-binding module of the protein of this family result in destabilization or complete impossibility to form a complex with 5S rRNA in vitro; (ii) ΔL25 ribosomes of Escherichia coli are less efficient in protein synthesis in vivo than the control ribosomes. In the present work, the efficiency of incorporation of the E. coli protein L25 with mutations in the 5S rRNA-binding region into the ribosome in vivo was studied. It was found that the mutations in L25 that abolish its ability to form the complex with free 5S rRNA do not prevent its correct and efficient incorporation into the ribosome. This is supported by the fact that even the presence of a very weakly retained mutant form of the protein in the ribosome has a positive effect on the activity of the translational machinery in vivo. All this suggests the existence of an alternative incorporation pathway for this protein into the ribosome, excluding the preliminary formation of the complex with 5S rRNA. At the same time, the stable L25-5S rRNA contact is important for the retention of the protein within the ribosome, and the conservative amino acid residues of the RNA-binding module play a key role in this.

  7. Sequence and secondary structure of the mitochondrial 16S ribosomal RNA gene of Ixodes scapularis.

    Science.gov (United States)

    Krakowetz, Chantel N; Chilton, Neil B

    2015-02-01

    The complete DNA sequences and secondary structure of the mitochondrial (mt) 16S ribosomal (r) RNA gene were determined for six Ixodes scapularis adults. There were 44 variable nucleotide positions in the 1252 bp sequence alignment. Most (95%) nucleotide alterations did not affect the integrity of the secondary structure of the gene because they either occurred at unpaired positions or represented compensatory changes that maintained the base pairing in helices. A large proportion (75%) of the intraspecific variation in DNA sequence occurred within Domains I, II and VI of the 16S gene. Therefore, several regions within this gene may be highly informative for studies of the population genetics and phylogeography of I. scapularis, a major vector of pathogens of humans and domestic animals in North America.

  8. Small-subunit ribosomal RNA gene sequences of Phaeodarea challenge the monophyly of Haeckel's Radiolaria.

    Science.gov (United States)

    Polet, Stephane; Berney, Cédric; Fahrni, José; Pawlowski, Jan

    2004-03-01

    In his grand monograph of Radiolaria, Ernst Haeckel originally included Phaeodarea together with Acantharea and Polycystinea, all three taxa characterized by the presence of a central capsule and the possession of axopodia. Cytological and ultrastructural studies, however, questioned the monophyly of Radiolaria, suggesting an independent evolutionary origin of the three taxa, and the first molecular data on Acantharea and Polycystinea brought controversial results. To test further the monophyly of Radiolaria, we sequenced the complete small subunit ribosomal RNA gene of three phaeodarians and three polycystines. Our analyses reveal that phaeodarians clearly branch among the recently described phylum Cercozoa, separately from Acantharea and Polycystinea. This result enhances the morphological variability within the phylum Cercozoa, which already contains very heterogeneous groups of protists. Our study also confirms the common origin of Acantharea and Polycystinea, which form a sister-group to the Cercozoa, and allows a phylogenetic reinterpretation of the morphological features of the three radiolarian groups.

  9. Ribosome-associated GTPases: the role of RNA for GTPase activation.

    Science.gov (United States)

    Clementi, Nina; Polacek, Norbert

    2010-01-01

    The GTPase super-family comprises a variety of G proteins found in all three domains of life. Although they are participating in completely different processes like signal transduction, protein biosynthesis and regulation of cell proliferation, they all share a highly conserved G domain and use a common mechanism for GTP hydrolysis. Exact timing in hydrolyzing the bound GTP serves as a molecular switch to initiate diverse cellular reactions. Classical GTPases depend on external proteins to fire GTP hydrolysis (GAPs), and following the GTPase reaction to exchange GDP for GTP (GEFs), converting the GTPase into the active state again. In recent years it became clear that there are many GTPases that do not follow this classical switch mode scheme. Certain ribosome-associated GTPases are not reliant on other GEF proteins to exchange GDP for GTP. Furthermore many of these G proteins are not activated by external GAPs, but by evolutionarily ancient molecules, namely by RNA.

  10. Routine forensic use of the mitochondrial 12S ribosomal RNA gene for species identification.

    Science.gov (United States)

    Melton, Terry; Holland, Charity

    2007-11-01

    Since July 2004, Mitotyping Technologies has been amplifying and sequencing a approximately 150 base pair fragment of mitochondrial DNA (mtDNA) that codes for 12S ribosomal RNA, to identify the species origin of nonhuman casework samples. The approximately 100 base pair sequence product is searched at http://www.ncbi.nlm.nih.gov/BLAST and the species match is reported. The use of this assay has halved the number of samples for which no mtDNA results are obtained and is especially useful on hairs and degraded samples. The availability of species determination may aid forensic investigators in opening or closing off lines of inquiry where a highly probative but challenging sample has been collected.

  11. 微孢子虫核糖体小亚单位RNA(ssUrRNA)基因%Small Subunit Ribosomal RNA Genes of Microsporidia

    Institute of Scientific and Technical Information of China (English)

    王见杨; 黄可威; 毛西成; 赵 昀; 陆长德

    2001-01-01

    微孢子虫是广泛分布于自然界的细胞内原虫类寄生物。它们可寄生于整个生物界。微孢子虫是真核生物,但其核糖体及核糖体RNA(rRNA)为原核生物型。为探讨9种家蚕病原性微孢子虫的种属地位及亲缘关系,对已广泛用于生物进化分类的核糖体小亚单位RNA(asurRNA)基因进行了研究。由微孢子虫ssurRNA基因序列同源性分析所构建的系统进化发育树及Southam杂交分析表明,这9种微孢子虫同为Nosema属,为同属不同种。%Microsporidia are ubiquitous intracellular parasitic protozoa infecting all types of animals. Their ribosomes and rRNAs are of prokaryotic size. In order to better understand their phylogenetic relationship and identify the uncertain species, the sequences of the small subunit ribosomal RNA (ssurRNA, 16 S rRNA) genesof nine microsporidia infectious to the silkworm, Bombyx mori, were determined. The results of phylogenetic trees and Southern blotting suggest all the nine strains of icrosporidia are various species of the genus Nosema.

  12. Terminal-sequence studies of high-molecular-weight ribonucleic acid. The 3'-termini of rabbit reticulocyte ribosomal RNA.

    Science.gov (United States)

    Hunt, J A

    1970-11-01

    Sequences of the polynucleotide chains of RNA found in the large and small ribosomal subunits of rabbit reticulocytes have been determined from the 3'-end by use of periodate oxidation and condensation with [(3)H]isoniazid and by stepwise degradation. By these methods the hexanucleotide sequences have been found as -pGpUpUpUpGpU for the 28S RNA and -pGpUpCpGpCpU for the 6S RNA of the large ribosomal subunit and the octanucleotide sequence -pGpApUpCpApUpUpA for the 18S rRNA of the small ribosomal subunit. These sequences are present in at least 70% of all the RNA molecules and are discussed in relation to the specific cleavage of rRNA from its precursors and the role of multiple cistrons for rRNA in the DNA of higher organisms. The feasibility of using the method for longer sequence determinations is discussed.

  13. Proteins associated with rRNA in the Escherichia coli ribosome.

    Science.gov (United States)

    Bernabeu, C; Vazquez, D; Ballesta, J P

    1978-04-27

    Ribosomal proteins located near the rRNA have been identified by cross linking to [14C]spermine with 1,5-difluoro-2,4-dinitrobenzene. The polyamine binds to double-stranded rRNA; those proteins showing radioactivity covalently bound after treatment with the bifunctional reagent should therefore be located in the vicinity of these regions of rRNA. Six proteins from the small subunit, S4, S5, S9, S18, S19 and S20 and ten proteins from the large subunit L2, L6, L13, L14, L16, L17, L18, L19, L22 and L27 preferentially take up the label. The results obtained with three proteins from the large subunit, L6, L16 and L27, show a high degree of variability that could reflect differences of conformation in the subunit population. Several proteins were drastically modified by the cross-linking agent but were not detected in the two-dimensional gel electrophoresis (e.g., S1, S11, S21, L7, L8 and L12) and therefore could not be studied.

  14. Identification of a Recently Active Mammalian SINE Derived from Ribosomal RNA

    Science.gov (United States)

    Longo, Mark S.; Brown, Judy D.; Zhang, Chu; O’Neill, Michael J.; O’Neill, Rachel J.

    2015-01-01

    Complex eukaryotic genomes are riddled with repeated sequences whose derivation does not coincide with phylogenetic history and thus is often unknown. Among such sequences, the capacity for transcriptional activity coupled with the adaptive use of reverse transcription can lead to a diverse group of genomic elements across taxa, otherwise known as selfish elements or mobile elements. Short interspersed nuclear elements (SINEs) are nonautonomous mobile elements found in eukaryotic genomes, typically derived from cellular RNAs such as tRNAs, 7SL or 5S rRNA. Here, we identify and characterize a previously unknown SINE derived from the 3′-end of the large ribosomal subunit (LSU or 28S rDNA) and transcribed via RNA polymerase III. This new element, SINE28, is represented in low-copy numbers in the human reference genome assembly, wherein we have identified 27 discrete loci. Phylogenetic analysis indicates these elements have been transpositionally active within primate lineages as recently as 6 MYA while modern humans still carry transcriptionally active copies. Moreover, we have identified SINE28s in all currently available assembled mammalian genome sequences. Phylogenetic comparisons indicate that these elements are frequently rederived from the highly conserved LSU rRNA sequences in a lineage-specific manner. We propose that this element has not been previously recognized as a SINE given its high identity to the canonical LSU, and that SINE28 likely represents one of possibly many unidentified, active transposable elements within mammalian genomes. PMID:25637222

  15. Combined heat shock protein 90 and ribosomal RNA sequence phylogeny supports multiple replacements of dinoflagellate plastids.

    Science.gov (United States)

    Shalchian-Tabrizi, Kamran; Minge, Marianne A; Cavalier-Smith, Tom; Nedreklepp, Joachim M; Klaveness, Dag; Jakobsen, Kjetill S

    2006-01-01

    Dinoflagellates harbour diverse plastids obtained from several algal groups, including haptophytes, diatoms, cryptophytes, and prasinophytes. Their major plastid type with the accessory pigment peridinin is found in the vast majority of photosynthetic species. Some species of dinoflagellates have other aberrantly pigmented plastids. We sequenced the nuclear small subunit (SSU) ribosomal RNA (rRNA) gene of the "green" dinoflagellate Gymnodinium chlorophorum and show that it is sister to Lepidodinium viride, indicating that their common ancestor obtained the prasinophyte (or other green alga) plastid in one event. As the placement of dinoflagellate species that acquired green algal or haptophyte plastids is unclear from small and large subunit (LSU) rRNA trees, we tested the usefulness of the heat shock protein (Hsp) 90 gene for dinoflagellate phylogeny by sequencing it from four species with aberrant plastids (G. chlorophorum, Karlodinium micrum, Karenia brevis, and Karenia mikimotoi) plus Alexandrium tamarense, and constructing phylogenetic trees for Hsp90 and rRNAs, separately and together. Analyses of the Hsp90 and concatenated data suggest an ancestral origin of the peridinin-containing plastid, and two independent replacements of the peridinin plastid soon after the early radiation of the dinoflagellates. Thus, the Hsp90 gene seems to be a promising phylogenetic marker for dinoflagellate phylogeny.

  16. Analysis of the interaction between bovine mitochondrial 28 S ribosomal subunits and mRNA.

    Science.gov (United States)

    Farwell, M A; Schirawski, J; Hager, P W; Spremulli, L L

    1996-11-11

    The small subunit of the bovine mitochondrial ribosome forms a tight complex with mRNAs. This [28 S:mRNA] complex forms as readily on circular mRNAs as on linear mRNAs indicating that a free 5' end on the mRNA is not required for the interaction observed. The effects of monovalent cations on the equilibrium association constant and on the forward and reverse rate constants governing this interaction have been determined. Monovalent cations have a strong effect on the forward rate constant. Increasing the KCl concentration from 1 mM to 100 mM reduces kon by nearly 100-fold. Monovalent cations have only a small effect on the reverse rate constant, koff'. Analysis of these data indicates that the rate laws governing the formation and dissociation of the [28 S:mRNA] complex cannot be deduced from the chemical equation. This observation suggests that there are "hidden intermediates' in the formation and dissociation of this complex. The implications of these observations are discussed in terms of a model for the interaction between the mitochondrial 28 S subunit and mRNAs.

  17. Pseudoknot in domain II of 23 S rRNA is essential for ribosome function

    DEFF Research Database (Denmark)

    Rosendahl, G; Hansen, L H; Douthwaite, S

    1995-01-01

    The structure of domain II in all 23 S (and 23 S-like) rRNAs is constrained by a pseudoknot formed between nucleotides 1005 and 1138, and between 1006 and 1137 (Escherichia coli numbering). These nucleotides are exclusively conserved as 1005C.1138G and 1006C.1137G pairs in all Bacteria, Archaea...... and chloroplasts, whereas 1005G.1138C and 1006U.1137A pairs occur in Eukarya. We have mutagenized nucleotides 1005C-->G, 1006C-->U, 1137G-->A and 1138G-->C, both individually and in combinations, in a 23 S rRNA gene from the bacterium E. coli. The ability of 23 S rRNA to support cell growth is reduced when either...... "eukaryal" (1005G.1138C or 1006U.1137A) pair and one "bacterial" C.G pair largely restores the structure and function of the rRNA. Bacterial ribosomes containing both these eukaryal pairs also participate in protein synthesis, although at much reduced efficiency, and the structure of their pseudoknot region...

  18. [Characterization of Black and Dichothrix Cyanobacteria Based on the 16S Ribosomal RNA Gene Sequence

    Science.gov (United States)

    Ortega, Maya

    2010-01-01

    My project focuses on characterizing different cyanobacteria in thrombolitic mats found on the island of Highborn Cay, Bahamas. Thrombolites are interesting ecosystems because of the ability of bacteria in these mats to remove carbon dioxide from the atmosphere and mineralize it as calcium carbonate. In the future they may be used as models to develop carbon sequestration technologies, which could be used as part of regenerative life systems in space. These thrombolitic communities are also significant because of their similarities to early communities of life on Earth. I targeted two cyanobacteria in my research, Dichothrix spp. and whatever black is, since they are believed to be important to carbon sequestration in these thrombolitic mats. The goal of my summer research project was to molecularly identify these two cyanobacteria. DNA was isolated from each organism through mat dissections and DNA extractions. I ran Polymerase Chain Reactions (PCR) to amplify the 16S ribosomal RNA (rRNA) gene in each cyanobacteria. This specific gene is found in almost all bacteria and is highly conserved, meaning any changes in the sequence are most likely due to evolution. As a result, the 16S rRNA gene can be used for bacterial identification of different species based on the sequence of their 16S rRNA gene. Since the exact sequence of the Dichothrix gene was unknown, I designed different primers that flanked the gene based on the known sequences from other taxonomically similar cyanobacteria. Once the 16S rRNA gene was amplified, I cloned the gene into specialized Escherichia coli cells and sent the gene products for sequencing. Once the sequence is obtained, it will be added to a genetic database for future reference to and classification of other Dichothrix sp.

  19. Fluctuations between multiple EF-G-induced chimeric tRNA states during translocation on the ribosome

    Science.gov (United States)

    Adio, Sarah; Senyushkina, Tamara; Peske, Frank; Fischer, Niels; Wintermeyer, Wolfgang; Rodnina, Marina V.

    2015-06-01

    The coupled translocation of transfer RNA and messenger RNA through the ribosome entails large-scale structural rearrangements, including step-wise movements of the tRNAs. Recent structural work has visualized intermediates of translocation induced by elongation factor G (EF-G) with tRNAs trapped in chimeric states with respect to 30S and 50S ribosomal subunits. The functional role of the chimeric states is not known. Here we follow the formation of translocation intermediates by single-molecule fluorescence resonance energy transfer. Using EF-G mutants, a non-hydrolysable GTP analogue, and fusidic acid, we interfere with either translocation or EF-G release from the ribosome and identify several rapidly interconverting chimeric tRNA states on the reaction pathway. EF-G engagement prevents backward transitions early in translocation and increases the fraction of ribosomes that rapidly fluctuate between hybrid, chimeric and posttranslocation states. Thus, the engagement of EF-G alters the energetics of translocation towards a flat energy landscape, thereby promoting forward tRNA movement.

  20. The functional half-life of an mRNA depends on the ribosome spacing in an early coding region

    DEFF Research Database (Denmark)

    Pedersen, Margit; Nissen, Søren; Mitarai, Namiko;

    2011-01-01

    . Here, we characterize a determinant of the functional stability of an mRNA, which is located in the early coding region. Using literature values for the mRNA half-lives of variant lacZ mRNAs in Escherichia coli, we modeled how the ribosome spacing is affected by the translation rate of the individual...... of slowly translated codons before codon 20 or after codon 45 should shorten or prolong, respectively, the functional mRNA half-life by altering the ribosome density in the important region. These predictions were tested on eight new lacZ variants, and their experimentally determined mRNA half-lives all...

  1. Insulin receptor substrate-1 (IRS-1 associates with small nucleolar RNA which contributes to ribosome biogenesis

    Directory of Open Access Journals (Sweden)

    Atsufumi eOzoe

    2014-03-01

    Full Text Available Insulin receptor substrates (IRSs are well known to play crucial roles in mediating intracellular signals of insulin-like growth factors (IGFs/insulin. Previously we showed that IRS-1 forms high molecular mass complexes containing RNAs. To identify RNAs in IRS-1 complexes, we performed UV cross-linking and immunoprecipitation (CLIP analysis using HEK293 cells expressing FLAG-IRS-1 and FLAG-IRS-2. We detected the radioactive signals in the immunoprecipitates of FLAG-IRS-1 proportional to the UV irradiation, but not in the immunoprecipitates of FLAG-IRS-2, suggesting the direct contact of RNAs with IRS-1. RNAs cross-linked to IRS-1 were then amplified by RT-PCR, followed by sequence analysis. We isolated sequence tags attributed to 25 messenger RNAs and 8 non-coding RNAs, including small nucleolar RNAs (snoRNAs. We focused on the interaction of IRS-1 with U96A snoRNA (U96A and its host Rack1 (receptor for activated C kinase 1 pre-mRNA. We confirmed the interaction of IRS-1 with U96A, and with RACK1 pre-mRNA by immunoprecipitation with IRS-1 followed by Northern blotting or RT-PCR analyses. Mature U96A in IRS-1-/- mouse embryonic fibroblasts was quantitatively less than WT. We also found that a part of nuclear IRS-1 is localized in the Cajal body, a nuclear subcompartment where snoRNA mature. The unanticipated function of IRS-1 in snoRNA biogenesis highlights the potential of RNA-associated IRS-1 complex to open a new line of investigation to dissect the novel mechanisms regulating IGFs/insulin-mediated biological events.

  2. Global shape mimicry of tRNA within a viral internal ribosome entry site mediates translational reading frame selection

    OpenAIRE

    2015-01-01

    Viruses use alternate mechanisms to increase the coding capacity of their viral genomes. The dicistrovirus intergenic region internal ribosome entry site (IRES) adopts an RNA structure that can direct translation in 0 and +1 reading frames to produce the viral structural proteins and an overlapping ORFx product. Here we provide structural and biochemical evidence that the PKI domain of the IRES mimics a complete tRNA-like structure to facilitate reading frame selection and allows the viral IR...

  3. Photoinduced cross-linkage, in situ, of Escherichia coli 30S ribosomal proteins to 16S rRNA: identification of cross-linked proteins and relationships between reactivity and ribosome structure.

    Science.gov (United States)

    Gorelic, L

    1976-08-10

    The kinetics of photoinduced cross-linkage of Escherichia coli 30S ribosomal proteins to the 16S-rRNA molecule in the intact Escherichia coli 30S ribosomal subunit was studied in this report. All of the 30S ribosomal proteins become cross-linked to the 16S rRNA before changes in the sedimentation characteristics of the 30S ribosomal subunit can be detected. The proteins exhibit different reactivities in the cross-linkage reaction. One group of proteins-S3, S7-S9, S11, S12, and S15-S19-is cross-linked to the 16S rRNA by single-hit kinetics, or by photoprocesses of nonunity but low multiplicities. A second group of proteins--S1, S2, S4-S6, S10, S13, S14, and S21--is cross-linked to the 16S rRNA by photoprocesses of a complex nature. A comparison of these data with other properties of the individual 30S ribosomal proteins related to ribosome structure indicated that most of the 30S ribosomal proteins cross-linked to the 16S rRNA by photoprocesses of low multiplicities had been classified rRNA-binding proteins by nonphotochemical methods, and most of the proteins cross-linked to the 16S rRNA by photoprocesses of large multiplicities had been classified as nonbinding proteins. There were certain exceptions to these correlations. Proteins S4 and S20, both RNA-binding proteins, become cross-linked to the 16S rRNA by photoprocessses of large multiplicities, and proteins S3, S11, S12, and S18, none of which have been classified RNA-binding proteins, exhibited low multiplicities in the cross-linkage reaction. All of these exceptions could be explained in terms of limitations inherent in the photochemical methods used in this study and in other types of methods that have been used to study RNA-protein interactions in the 30S ribosomal subunit. The data presented here also suggest that labile RNA-protein cross-links are present in the uv-irradiated 30S ribosomal subunits, and that neither peptide-bond cleavage nor photoinduced modification of the charged side-chain groups in

  4. A mutation in the 530 loop of Escherichia coli 16S ribosomal RNA causes resistance to streptomycin.

    OpenAIRE

    1988-01-01

    Oligonucleotide-directed mutagenesis was used to introduce an A to C transversion at position 523 in the 16S ribosomal RNA gene of Escherichia coli rrnB operon cloned in plasmid pKK3535. E. coli cells transformed with the mutated plasmid were resistant to streptomycin. The mutated ribosomes isolated from these cells were not stimulated by streptomycin to misread the message in a poly(U)-directed assay. They were also restrictive to the stimulation of misreading by other error-promoting relate...

  5. Chromosomal organization of the ribosomal RNA genes in the genus Chironomus (Diptera, Chironomidae

    Directory of Open Access Journals (Sweden)

    Larisa Gunderina

    2015-05-01

    Full Text Available Chromosomal localization of ribosomal RNA coding genes has been studied by using FISH (fluorescence in situ hybridization in 21 species from the genus Chironomus Meigen, 1803. Analysis of the data has shown intra- and interspecific variation in number and location of 5.8S rDNA hybridization sites in 17 species from the subgenus Chironomus and 4 species from the subgenus Camptochironomus Kieffer, 1914. In the majority of studied species the location of rDNA sites coincided with the sites where active NORs (nucleolus organizer regions were found. The number of hybridization sites in karyotypes of studied chironomids varied from 1 to 6. More than half of the species possessed only one NOR (12 out of 21. Two rDNA hybridization sites were found in karyotypes of five species, three – in two species, and five and six sites – in one species each. NORs were found in all chromosomal arms of species from the subgenus Chironomus with one of them always located on arm G. On the other hand, no hybridization sites were found on arm G in four studied species from the subgenus Camptochironomus. Two species from the subgenus Chironomus – Ch. balatonicus Devai, Wuelker & Scholl, 1983 and Ch. “annularius” sensu Strenzke, 1959 – showed intraspecific variability in the number of hybridization signals. Possible mechanisms of origin of variability in number and location of rRNA genes in the karyotypes of species from the genus Chironomus are discussed.

  6. 18S ribosomal RNA gene sequences of Cochliopodium (Himatismenida) and the phylogeny of Amoebozoa.

    Science.gov (United States)

    Kudryavtsev, Alexander; Bernhard, Detlef; Schlegel, Martin; Chao, Ema E Y; Cavalier-Smith, Thomas

    2005-08-01

    Cochliopodium is a very distinctive genus of discoid amoebae covered by a dorsal tectum of carbohydrate microscales. Its phylogenetic position is unclear, since although sharing many features with naked "gymnamoebae", the tectum sets it apart. We sequenced 18S ribosomal RNA genes from three Cochliopodium species (minus, spiniferum and Cochliopodium sp., a new species resembling C. minutum). Phylogenetic analysis shows Cochliopodium as robustly holophyletic and within Amoebozoa, in full accord with morphological data. Cochliopodium is always one of the basal branches within Amoebozoa but its precise position is unstable. In Bayesian analysis it is sister to holophyletic Glycostylida, but distance trees mostly place it between Dermamoeba and a possibly artifactual long-branch cluster including Thecamoeba. These positions are poorly supported and basal amoebozoan branching ill-resolved, making it unclear whether Discosea (Glycostylida, Himatismenida, Dermamoebida) is holophyletic; however, Thecamoeba seems not specifically related to Dermamoeba. We also sequenced the small-subunit rRNA gene of Vannella persistens, which constantly grouped with other Vannella species, and two Hartmannella strains. Our trees suggest that Vexilliferidae, Variosea and Hartmannella are polyphyletic, confirming the existence of two very distinct Hartmannella clades: that comprising H. cantabrigiensis and another divergent species is sister to Glaeseria, whilst Hartmannella vermiformis branches more deeply.

  7. Functional variants of 5S rRNA in the ribosomes of common sea urchin Paracentrotus lividus.

    Science.gov (United States)

    Dimarco, Eufrosina; Cascone, Eleonora; Bellavia, Daniele; Caradonna, Fabio

    2012-10-15

    We have previously reported a molecular and cytogenetic characterization of three different 5S rDNA clusters in the sea urchin Paracentrotus lividus; this study, performed at DNA level only, lends itself as starting point to verify that these clusters could contain transcribed genes, then, to demonstrate the presence of heterogeneity at functional RNA level, also. In the present work we report in P. lividus ribosomes the existence of several transcribed variants of the 5S rRNA and we associate all transcribed variants to the cluster to which belong. Our finding is the first demonstration of the presence of high heterogeneity in functional 5S rRNA molecules in animal ribosomes, a feature that had been considered a peculiarity of some plants.

  8. A study of ribonucleoproteins: The sequence of rabbit 18S ribosomal RNA and the identification of proteins associated with messenger RNA

    Energy Technology Data Exchange (ETDEWEB)

    Connaughton, J.F. Jr.

    1989-01-01

    This study considers the functional role of ribosomal RNA and messenger ribonucleoproteins in the translational regulation of gene expression. The primary structure of rabbit 18S ribosomal RNA was determined by nucleotide sequence analysis of the RNA directly. Rabbit 18S RNA was cleaved with either T{sub 1} ribonuclease or RNase H, using a Pst 1 DNA linker to generate a unique set of overlapping fragments spanning the entire molecule. Both intact and fragmented 18S RNA were end-labeled with {sup 32}P and base-specifically cleaved enzymatically and chemically. Nucleotide sequences were determined from long polyacrylamide sequencing gels run in formamide. To assess functional roles of RNA in gene expression, specific mRNA-protein interactions were also examined. Eukaryotic mRNA is associated with specific proteins that may be important in translational regulation and mRNA stability; mRNP complexes were reconstituted in a message-dependent, cell-free rabbit reticulocyte translation system, using unique mRNA species transcribed in vitro with SP6 polymerase. Transcripts of both rabbit and human {beta}-globin cDNA were labeled with {sup 32}P either throughout the molecule ore selectively at the 5{prime} and 3{prime} terminus.

  9. Structural dynamics of the yeast Shwachman-Diamond syndrome protein (Sdo1) on the ribosome and its implication in the 60S subunit maturation.

    Science.gov (United States)

    Ma, Chengying; Yan, Kaige; Tan, Dan; Li, Ningning; Zhang, Yixiao; Yuan, Yi; Li, Zhifei; Dong, Meng-Qiu; Lei, Jianlin; Gao, Ning

    2016-03-01

    The human Shwachman-Diamond syndrome (SDS) is an autosomal recessive disease caused by mutations in a highly conserved ribosome assembly factor SBDS. The functional role of SBDS is to cooperate with another assembly factor, elongation factor 1-like (Efl1), to promote the release of eukaryotic initiation factor 6 (eIF6) from the late-stage cytoplasmic 60S precursors. In the present work, we characterized, both biochemically and structurally, the interaction between the 60S subunit and SBDS protein (Sdo1p) from yeast. Our data show that Sdo1p interacts tightly with the mature 60S subunit in vitro through its domain I and II, and is capable of bridging two 60S subunits to form a stable 2:2 dimer. Structural analysis indicates that Sdo1p bind to the ribosomal P-site, in the proximity of uL16 and uL5, and with direct contact to H69 and H38. The dynamic nature of Sdo1p on the 60S subunit, together with its strategic binding position, suggests a surveillance role of Sdo1p in monitoring the conformational maturation of the ribosomal P-site. Altogether, our data support a conformational signal-relay cascade during late-stage 60S maturation, involving uL16, Sdo1p, and Efl1p, which interrogates the functional P-site to control the departure of the anti-association factor eIF6.

  10. Structural dynamics of the yeast Shwachman-Diamond syndrome protein (Sdo1 on the ribosome and its implication in the 60S subunit maturation

    Directory of Open Access Journals (Sweden)

    Chengying Ma

    2016-02-01

    Full Text Available Abstract The human Shwachman-Diamond syndrome (SDS is an autosomal recessive disease caused by mutations in a highly conserved ribosome assembly factor SBDS. The functional role of SBDS is to cooperate with another assembly factor, elongation factor 1-like (Efl1, to promote the release of eukaryotic initiation factor 6 (eIF6 from the late-stage cytoplasmic 60S precursors. In the present work, we characterized, both biochemically and structurally, the interaction between the 60S subunit and SBDS protein (Sdo1p from yeast. Our data show that Sdo1p interacts tightly with the mature 60S subunit in vitro through its domain I and II, and is capable of bridging two 60S subunits to form a stable 2:2 dimer. Structural analysis indicates that Sdo1p bind to the ribosomal P-site, in the proximity of uL16 and uL5, and with direct contact to H69 and H38. The dynamic nature of Sdo1p on the 60S subunit, together with its strategic binding position, suggests a surveillance role of Sdo1p in monitoring the conformational maturation of the ribosomal P-site. Altogether, our data support a conformational signal-relay cascade during late-stage 60S maturation, involving uL16, Sdo1p, and Efl1p, which interrogates the functional P-site to control the departure of the anti-association factor eIF6.

  11. Binding site for Xenopus ribosomal protein L5 and accompanying structural changes in 5S rRNA.

    Science.gov (United States)

    Scripture, J Benjamin; Huber, Paul W

    2011-05-10

    The structure of the eukaryotic L5-5S rRNA complex was investigated in protection and interference experiments and is compared with the corresponding structure (L18-5S rRNA) in the Haloarcula marismortui 50S subunit. In close correspondence with the archaeal structure, the contact sites for the eukaryotic ribosomal protein are located primarily in helix III and loop C and secondarily in loop A and helix V. While the former is unique to L5, the latter is also a critical contact site for transcription factor IIIA (TFIIIA), accounting for the mutually exclusive binding of these two proteins to 5S RNA. The binding of L5 causes structural changes in loops B and C that expose nucleotides that contact the Xenopus L11 ortholog in H. marismortui. This induced change in the structure of the RNA reveals the origins of the cooperative binding to 5S rRNA that has been observed for the bacterial counterparts of these proteins. The native structure of helix IV and loop D antagonizes binding of L5, indicating that this region of the RNA is dynamic and also influenced by the protein. Examination of the crystal structures of Thermus thermophilus ribosomes in the pre- and post-translocation states identified changes in loop D and in the surrounding region of 23S rRNA that support the proposal that 5S rRNA acts to transmit information between different functional domains of the large subunit.

  12. Evidence for compensatory evolution of ribosomal proteins in response to rapid divergence of mitochondrial rRNA.

    Science.gov (United States)

    Barreto, Felipe S; Burton, Ronald S

    2013-02-01

    Rapid evolution of mitochondrial DNA (mtDNA) places intrinsic selective pressures on many nuclear genes involved in mitochondrial functions. Mitochondrial ribosomes, for example, are composed of mtDNA-encoded ribosomal RNAs (rRNAs) and a set of more than 60 nuclear-encoded ribosomal proteins (mRP) distinct from the cytosolic RPs (cRP). We hypothesized that the rapid divergence of mt-rRNA would result in rapid evolution of mRPs relative to cRPs, which respond to slowly evolving nuclear-encoded rRNA. In comparisons of rates of nonsynonymous and synonymous substitutions between a pair of divergent populations of the copepod Tigriopus californicus, we found that mRPs showed elevated levels of amino acid changes relative to cRPs. This pattern was equally strong at the interspecific level, between three pairs of sister species (Nasonia vitripennis vs. N. longicornis, Drosophila melanogaster vs. D. simulans, and Saccharomyces cerevisae vs. S. paradoxus). This high rate of mRP evolution may result in intergenomic incompatibilities between taxonomic lineages, and such incompatibilities could lead to dysfunction of mitochondrial ribosomes and the loss of fitness observed among interpopulation hybrids in T. californicus and interspecific hybrids in other species.

  13. The DEAD-box Protein Rok1 Orchestrates 40S and 60S Ribosome Assembly by Promoting the Release of Rrp5 from Pre-40S Ribosomes to Allow for 60S Maturation.

    Directory of Open Access Journals (Sweden)

    Sohail Khoshnevis

    2016-06-01

    Full Text Available DEAD-box proteins are ubiquitous regulators of RNA biology. While commonly dubbed "helicases," their activities also include duplex annealing, adenosine triphosphate (ATP-dependent RNA binding, and RNA-protein complex remodeling. Rok1, an essential DEAD-box protein, and its cofactor Rrp5 are required for ribosome assembly. Here, we use in vivo and in vitro biochemical analyses to demonstrate that ATP-bound Rok1, but not adenosine diphosphate (ADP-bound Rok1, stabilizes Rrp5 binding to 40S ribosomes. Interconversion between these two forms by ATP hydrolysis is required for release of Rrp5 from pre-40S ribosomes in vivo, thereby allowing Rrp5 to carry out its role in 60S subunit assembly. Furthermore, our data also strongly suggest that the previously described accumulation of snR30 upon Rok1 inactivation arises because Rrp5 release is blocked and implicate a previously undescribed interaction between Rrp5 and the DEAD-box protein Has1 in mediating snR30 accumulation when Rrp5 release from pre-40S subunits is blocked.

  14. The DEAD-box Protein Rok1 Orchestrates 40S and 60S Ribosome Assembly by Promoting the Release of Rrp5 from Pre-40S Ribosomes to Allow for 60S Maturation.

    Science.gov (United States)

    Khoshnevis, Sohail; Askenasy, Isabel; Johnson, Matthew C; Dattolo, Maria D; Young-Erdos, Crystal L; Stroupe, M Elizabeth; Karbstein, Katrin

    2016-06-01

    DEAD-box proteins are ubiquitous regulators of RNA biology. While commonly dubbed "helicases," their activities also include duplex annealing, adenosine triphosphate (ATP)-dependent RNA binding, and RNA-protein complex remodeling. Rok1, an essential DEAD-box protein, and its cofactor Rrp5 are required for ribosome assembly. Here, we use in vivo and in vitro biochemical analyses to demonstrate that ATP-bound Rok1, but not adenosine diphosphate (ADP)-bound Rok1, stabilizes Rrp5 binding to 40S ribosomes. Interconversion between these two forms by ATP hydrolysis is required for release of Rrp5 from pre-40S ribosomes in vivo, thereby allowing Rrp5 to carry out its role in 60S subunit assembly. Furthermore, our data also strongly suggest that the previously described accumulation of snR30 upon Rok1 inactivation arises because Rrp5 release is blocked and implicate a previously undescribed interaction between Rrp5 and the DEAD-box protein Has1 in mediating snR30 accumulation when Rrp5 release from pre-40S subunits is blocked.

  15. Covalent crosslinking of tRNA1Val to 16S RNA at the ribosomal P site: identification of crosslinked residues.

    Science.gov (United States)

    Prince, J B; Taylor, B H; Thurlow, D L; Ofengand, J; Zimmermann, R A

    1982-09-01

    N-Acetylvalyl-tRNA1Val (AcVal-tRNA1Val) was bound to the P site of uniformly 32P-labeled 70S ribosomes from Escherichia coli and crosslinked to 16S RNA in the 30S ribosomal subunit by irradiation with light of 300-400 nm. To identify the crosslinked nucleotide in 16S RNA. AcVal-tRNA1Val-16S [32P]RNA was digested completely with RNase T1 and the band containing the covalently attached oligonucleotides from tRNA and rRNA was isolated by polyacrylamide gel electrophoresis. The crosslinked oligonucleotide, and the 32P-labeled rRNA moiety released from it by photoreversal of the crosslink at 254 nm, were then analyzed by secondary hydrolysis with pancreatic RNase A and RNase U2. The oligonucleotide derived from 16S RNA was found to be the evolutionarily conserved sequence, U-A-C-A-C-A-C-C-G1401, and the nucleotide crosslinked to tRNA1Val, C1400. The identity of the covalently attached residue in the tRNA was established by using AcVal-tRNA1Val-16S RNA prepared from unlabeled ribosomes. This complex was digested to completion with RNase T1 and the resulting RNA fragments were labeled at the 3' end with [5'-32P]pCp. The crosslinked T1 oligonucleotide isolated from the mixture yielded one major end-labeled component upon photoreversal. Chemical sequence analysis demonstrated that this product was derived from the anticodon-containing pentadecanucleotide of tRNA1Val, C-A-C-C-U-C-C-C-U-cmo5U-A-C-m6A-A-G39(cmo5U, 5-carboxymethoxyuridine). A similar study of the crosslinked oligonucleotide revealed that the residue covalently bound to 16S was cmo5U34, the 5' or wobble base of the anticodon. The adduct is believed to result from formation of a cyclobutane dimer between cmo5U34 of tRNA1Val and C1400 of the 16S RNA.

  16. An siRNA-based method for efficient silencing of gene expression in mature brown adipocytes.

    Science.gov (United States)

    Isidor, Marie S; Winther, Sally; Basse, Astrid L; Petersen, M Christine H; Cannon, Barbara; Nedergaard, Jan; Hansen, Jacob B

    2016-01-01

    Brown adipose tissue is a promising therapeutic target for opposing obesity, glucose intolerance and insulin resistance. The ability to modulate gene expression in mature brown adipocytes is important to understand brown adipocyte function and delineate novel regulatory mechanisms of non-shivering thermogenesis. The aim of this study was to optimize a lipofection-based small interfering RNA (siRNA) transfection protocol for efficient silencing of gene expression in mature brown adipocytes. We determined that a critical parameter was to deliver the siRNA to mature adipocytes by reverse transfection, i.e. transfection of non-adherent cells. Using this protocol, we effectively knocked down both high- and low-abundance transcripts in a model of mature brown adipocytes (WT-1) as well as in primary mature mouse brown adipocytes. A functional consequence of the knockdown was confirmed by an attenuated increase in uncoupled respiration (thermogenesis) in response to β-adrenergic stimulation of mature WT-1 brown adipocytes transfected with uncoupling protein 1 siRNA. Efficient gene silencing was also obtained in various mouse and human white adipocyte models (3T3-L1, primary mouse white adipocytes, hMADS) with the ability to undergo "browning." In summary, we report an easy and versatile reverse siRNA transfection protocol to achieve specific silencing of gene expression in various models of mature brown and browning-competent white adipocytes, including primary cells.

  17. Combined large and small subunit ribosomal RNA phylogenies support a basal position of the acoelomorph flatworms.

    Science.gov (United States)

    Telford, Maximilian J; Lockyer, Anne E; Cartwright-Finch, Chloë; Littlewood, D Timothy J

    2003-05-22

    The phylogenetic position of the phylum Platyhelminthes has been re-evaluated in the past decade by analysis of diverse molecular datasets. The consensus is that the Rhabditophora + Catenulida, which includes most of the flatworm taxa, are not primitively simple basal bilaterians but are related to coelomate phyla such as molluscs. The status of two other groups of acoelomate worms, Acoela and Nemertodermatida, is less clear. Although many characteristics unite these two groups, initial molecular phylogenetic studies placed the Nemertodermatida within the Rhabditophora, but placed the Acoela at the base of the Bilateria, distant from other flatworms. This contradiction resulted in scepticism about the basal position of acoels and led to calls for further data. We have sequenced large subunit ribosomal RNA genes from 13 rhabditophorans + catenulids, three acoels and one nemertodermatid, tripling the available data. Our analyses strongly support a basal position of both acoels and nemertodermatids. Alternative hypotheses are significantly less well supported by the data. We conclude that the Nemertodermatida and Acoela are basal bilaterians and, owing to their unique body plan and embryogenesis, should be recognized as a separate phylum, the Acoelomorpha.

  18. A phylogeny of the Passerida (Aves:Passeriformes) based on mitochondrial 12S ribosomal RNA gene

    Institute of Scientific and Technical Information of China (English)

    Lina Wu; Yanfeng Sun; Juyong Li; Yaqing Li; Yuefeng Wu; and Dongming Li

    2015-01-01

    Background:Passerida is the largest avian radiation within the order Passeriformes. Current understanding of the high-level relationships within Passerida is based on DNA–DNA hybridizations;however, the phylogenetic relationships within this assemblage have been the subject of many debates. Methods:We analyzed the 12S ribosomal RNA gene from 49 species of Passerida, representing 14 currently recognized families, to outline the phylogenetic relationships within this group. Results:Our results identified the monophyly of the three superfamilies in Passerida:Sylvioidea, Muscicapoidea and Passeroidea. However, current delimitation of some species is at variance with our phylogeny estimate. First, the Parus major, which had been placed as a distinct clade sister to Sylvioidea was identified as a member of the super family;second, the genus Regulus was united with the Sturnidae and nested in the Muscicapoidea clade instead of being a clade of Passerida. Conclusion:Our results were consistent with Johansson’s study of the three superfamilies except for the al ocation of two families, Paridae and Regulidae.

  19. Genetic variability of Echinococcus granulosus based on the mitochondrial 16S ribosomal RNA gene.

    Science.gov (United States)

    Wang, Ning; Wang, Jiahai; Hu, Dandan; Zhong, Xiuqin; Jiang, Zhongrong; Yang, Aiguo; Deng, Shijin; Guo, Li; Tsering, Dawa; Wang, Shuxian; Gu, Xiaobin; Peng, Xuerong; Yang, Guangyou

    2015-06-01

    Echinococcus granulosus is the etiological agent of cystic echinococcosis, a major zoonotic disease of both humans and animals. In this study, we assessed genetic variability and genetic structure of E. granulosus in the Tibet plateau, using the complete mitochondrial 16 S ribosomal RNA gene for the first time. We collected and sequenced 62 isolates of E. granulosus from 3 populations in the Tibet plateau. A BLAST analysis indicated that 61 isolates belonged to E. granulosus sensu stricto (genotypes G1-G3), while one isolate belonged to E. canadensis (genotype G6). We detected 16 haplotypes with a haplotype network revealing a star-like expansion, with the most common haplotype occupying the center of the network. Haplotype diversity and nucleotide diversity were low, while negative values were observed for Tajima's D and Fu's Fs. AMOVA results and Fst values revealed that the three geographic populations were not genetically differentiated. Our results suggest that a population bottleneck or population expansion has occurred in the past, and that this explains the low genetic variability of E. granulosus in the Tibet Plateau.

  20. Ultraviolet damage and nucleosome folding of the 5S ribosomal RNA gene.

    Energy Technology Data Exchange (ETDEWEB)

    Liu, X (Washington State University); Mann, David B.(ASSOC WESTERN UNIVERSITY); Suquet, C (Washington State University); Springer, David L.(BATTELLE (PACIFIC NW LAB)); Smerdon, Michael J.(VISITORS)

    2000-01-25

    The Xenopus borealis somatic 5S ribosomal RNA gene was used as a model system to determine the mutual effects of nucleosome folding and formation of ultraviolet (UV) photoproducts (primarily cis-syn cyclobutane pyrimidine dimers, or CPDs) in chromatin. We analyzed the preferred rotational and translational settings of 5S rDNA on the histone octamer surface after induction of up to 0.8 CPD/nucleosome core (2.5 kJ/m(2) UV dose). DNase I and hydroxyl radical footprints indicate that UV damage at these levels does not affect the average rotational setting of the 5S rDNA molecules. Moreover, a combination of nuclease trimming and restriction enzyme digestion indicates the preferred translational positions of the histone octamer are not affected by this level of UV damage. We also did not observe differences in the UV damage patterns of irradiated 5S rDNA before or after nucleosome formation, indicating there is little difference in the inhibition of nucleosome folding by specific CPD sites in the 5S rRNA gene. Conversely, nucleosome folding significantly restricts CPD formation at all sites in the three helical turns of the nontranscribed strand located in the dyad axis region of the nucleosome, where DNA is bound exclusively by the histone H3-H4 tetramer. Finally, modulation of the CPD distribution in a 14 nt long pyrimidine tract correlates with its rotational setting on the histone surface, when the strong sequence bias for CPD formation in this tract is minimized by normalization. These results help establish the mutual roles of histone binding and UV photoproducts on their formation in chromatin.

  1. Cyanobacterial ribosomal RNA genes with multiple, endonuclease-encoding group I introns

    Directory of Open Access Journals (Sweden)

    Turner Seán

    2007-09-01

    Full Text Available Abstract Background Group I introns are one of the four major classes of introns as defined by their distinct splicing mechanisms. Because they catalyze their own removal from precursor transcripts, group I introns are referred to as autocatalytic introns. Group I introns are common in fungal and protist nuclear ribosomal RNA genes and in organellar genomes. In contrast, they are rare in all other organisms and genomes, including bacteria. Results Here we report five group I introns, each containing a LAGLIDADG homing endonuclease gene (HEG, in large subunit (LSU rRNA genes of cyanobacteria. Three of the introns are located in the LSU gene of Synechococcus sp. C9, and the other two are in the LSU gene of Synechococcus lividus strain C1. Phylogenetic analyses show that these introns and their HEGs are closely related to introns and HEGs located at homologous insertion sites in organellar and bacterial rDNA genes. We also present a compilation of group I introns with homing endonuclease genes in bacteria. Conclusion We have discovered multiple HEG-containing group I introns in a single bacterial gene. To our knowledge, these are the first cases of multiple group I introns in the same bacterial gene (multiple group I introns have been reported in at least one phage gene and one prophage gene. The HEGs each contain one copy of the LAGLIDADG motif and presumably function as homodimers. Phylogenetic analysis, in conjunction with their patchy taxonomic distribution, suggests that these intron-HEG elements have been transferred horizontally among organelles and bacteria. However, the mode of transfer and the nature of the biological connections among the intron-containing organisms are unknown.

  2. Different organisms associated with heartwater as shown by analysis of 16S ribosomal RNA gene sequences.

    Science.gov (United States)

    Allsopp, M; Visser, E S; du Plessis, J L; Vogel, S W; Allsopp, B A

    1997-08-01

    Cowdria ruminantium is a rickettsial parasite which causes heartwater, a economically important disease of domestic and wild ruminants in tropical and subtropical Africa and parts of the Caribbean. Because existing diagnostic methods are unreliable, we investigated the small-subunit ribosomal RNA (srRNA) gene from heartwater-infected material to characterise the organisms present and to develop specific oligonucleotide probes for polymerase chain reaction (PCR) based diagnosis. DNA was obtained from ticks and ruminants from heartwater-free and heartwater-endemic areas from Cowdria in tissue culture. PCR was carried out using primers designed to amplify only rickettsial srRNA genes, the target region being the highly variable V1 loop. Amplicons were cloned and sequenced; 51% were C. ruminantium sequences corresponding to four genotypes, two of which were identical to previously reported C. ruminantium sequences while the other two were new. The four different Cowdria genotypes can be correlated with different phenotypes. Tissue-culture samples yielded only Cowdria genotype sequences, but an extraordinary heterogeneity of 16S sequences was obtained from field samples. In addition to Cowdria genotypes we found sequences from previously unknown Ehrlichia spp., sequences showing homology to other Rickettsiales and a variety of Pseudomonadaceae. One Ehrlichia sequence was phylogenetically closely related to Ehrlichia platys (Group II Ehrlichia) and one to Ehrlichia canis (Group III Ehrlichia). This latter sequence was from an isolate (Germishuys) made from a naturally infected sheep which, from brain smear examination and pathology, appeared to be suffering from heartwater; nevertheless no Cowdria genotype sequences were found in this isolate. In addition no Cowdria sequences were obtained from uninfected ticks. Complete 16S rRNA gene sequences were determined for two C. ruminantium genotypes and for two previously uncharacterised heartwater-associated Ehrlichia spp

  3. A new model for the three-dimensional folding of Escherichia coli 16 S ribosomal RNA. II. The RNA-protein interaction data.

    Science.gov (United States)

    Mueller, F; Brimacombe, R

    1997-08-29

    The map of the mass centres of the 21 proteins from the Escherichia coli 30 S ribosomal subunit, as determined by neutron scattering, was fitted to a cryoelectron microscopic (cryo-EM) model at a resolution of 20 A of 70 S ribosomes in the pre-translocational state, carrying tRNA molecules at the A and P sites. The fit to the 30 S moiety of the 70 S particles was accomplished with the help of the well-known distribution of the ribosomal proteins in the head, body and side lobe regions of the 30 S subunit, as determined by immuno electron microscopy (IEM). Most of the protein mass centres were found to lie close to the surface (or even outside) of the cryo-EM contour of the 30 S subunit, supporting the idea that the ribosomal proteins are arranged peripherally around the rRNA. The ribosomal protein distribution was then compared with the corresponding model for the 16 S rRNA, fitted to the same EM contour (described in an accompanying paper), in order to analyse the mutual compatibility of the arrangement of proteins and rRNA in terms of the available RNA-protein interaction data. The information taken into account included the hydroxyl radical and base foot-printing data from Noller's laboratory, and our own in situ cross-linking results. Proteins S1 and S14 were not considered, due to the lack of RNA-protein data. Among the 19 proteins analysed, 12 (namely S2, S4, S5, S7, S8, S9, S10, S11, S12, S15, S17 and S21) showed a fit to the rRNA model that varied from being excellent to at least acceptable. Of the remaining 7, S3 and S13 showed a rather poor fit, as did S18 (which is considered in combination with S6 in the foot-printing experiments). S16 was difficult to evaluate, as the foot-print data for this protein cover a large area of the rRNA. S19 and S20 showed a bad fit in terms of the neutron map, but their foot-print and cross-link sites were clustered into compact groups in the rRNA model in those regions of the 30 S subunit where these proteins have

  4. Nonsense-mediated mRNA decay controls the changes in yeast ribosomal protein pre-mRNAs levels upon osmotic stress.

    Directory of Open Access Journals (Sweden)

    Elena Garre

    Full Text Available The expression of ribosomal protein (RP genes requires a substantial part of cellular transcription, processing and translation resources. Thus, the RP expression must be tightly regulated in response to conditions that compromise cell survival. In Saccharomyces cerevisiae cells, regulation of the RP gene expression at the transcriptional, mature mRNA stability and translational levels during the response to osmotic stress has been reported. Reprogramming global protein synthesis upon osmotic shock includes the movement of ribosomes from RP transcripts to stress-induced mRNAs. Using tiling arrays, we show that osmotic stress yields a drop in the levels of RP pre-mRNAs in S. cerevisiae cells. An analysis of the tiling array data, together with transcription rates data, shows a poor correlation, indicating that the drop in the RP pre-mRNA levels is not merely a result of the lowered RP transcription rates. A kinetic study using quantitative RT-PCR confirmed the decrease in the levels of several RP-unspliced transcripts during the first 15 minutes of osmotic stress, which seems independent of MAP kinase Hog1. Moreover, we found that the mutations in the components of the nonsense-mediated mRNA decay (NMD, Upf1, Upf2, Upf3 or in exonuclease Xrn1, eliminate the osmotic stress-induced drop in RP pre-mRNAs. Altogether, our results indicate that the degradation of yeast RP unspliced transcripts by NMD increases during osmotic stress, and suggest that this might be another mechanism to control RP synthesis during the stress response.

  5. A Long Noncoding RNA on the Ribosome Is Required for Lifespan Extension

    NARCIS (Netherlands)

    Essers, Paul B.; Nonnekens, Julie; Goos, Yvonne J.; Betist, Marco C.|info:eu-repo/dai/nl/304073202; Viester, Marjon D.; Mossink, Britt; Lansu, Nico; Korswagen, Hendrik C.; Jelier, Rob; Brenkman, Arjan B.; MacInnes, Alyson W.|info:eu-repo/dai/nl/338681388

    2015-01-01

    The biogenesis of ribosomes and their coordination of protein translation consume an enormous amount of cellular energy. As such, it has been established that the inhibition of either process can extend eukaryotic lifespan. Here, we used next-generation sequencing to compare ribosome-associated RNAs

  6. Asaia bogorensis peritonitis identified by 16S ribosomal RNA sequence analysis in a patient receiving peritoneal dialysis.

    Science.gov (United States)

    Snyder, Richard W; Ruhe, Jorg; Kobrin, Sidney; Wasserstein, Alan; Doline, Christa; Nachamkin, Irving; Lipschutz, Joshua H

    2004-08-01

    Here the authors report a case of refractory peritonitis leading to multiple hospitalizations and the loss of peritoneal dialysis access in a patient on automated peritoneal dialysis, caused by Asaia bogorensis, a bacterium not previously described as a human pathogen. This organism was identified by sequence analysis of the 16S ribosomal RNA gene. Unusual microbial agents may cause peritonitis, and molecular microbiological techniques are important tools for identifying these agents.

  7. A ribonucleoprotein fragment of the 30 S ribosome of E. coli containing two contiguous domains of the 16 S RNA.

    Science.gov (United States)

    Spitnik-Elson, P; Elson, D; Avital, S; Abramowitz, R

    1982-08-11

    Ribonucleoprotein fragments of the 30 S ribosome of E. coli have been prepared by limited ribonuclease digestion and mild heating of the ribosome in a constant ionic environment. One such fragment has been described previously. A second electrophoretically homogeneous fragment has now been isolated and its RNA and protein moieties have been characterized. It contains the 5' half of the 16 S RNA, encompassing domains I and II except for the extreme 5' terminus and several small gaps. Seven proteins are present: S4, S5, S6, S8, S12, S15 and S20. The RNA binding sites of five of these proteins are known, and all are RNA sequences that are present in the fragment. Published neutron scattering and immuno-electron microscopic data indicate that six of the proteins are clustered together in a cross sectional slice through the center of the subunit. After deproteinization, the RNA moiety gives two bands in gel electrophoresis, one containing domains I and II and the other, essentially only domain II. The former, although larger, migrates faster in gel electrophoresis, indicating that RNA domains I and II interact with each other in such a way as to become more compact than domain II by itself.

  8. Molecular phylogeny of silk-producing insects based on 16S ribosomal RNA and cytochrome oxidase subunit I genes

    Indian Academy of Sciences (India)

    B. Mahendran; S. K. Ghosh; S. C. Kundu

    2006-04-01

    We have examined the molecular-phylogenetic relationships between nonmulberry and mulberry silkwormspecies that belong to the families Saturniidae, Bombycidae and Lasiocampidae using 16S ribosomal RNA (16S rRNA) and cytochrome oxidase subunit I (coxI) gene sequences. Aligned nucleotide sequences of 16S rRNA and coxI from 14 silk-producing species were used for construction of phylogenetic trees by maximum likelihood and maximum parsimony methods. The tree topology on the basis of 16S rRNA supports monophyly for members of Saturniidae and Bombycidae. Weighted parsimony analysis weighted towards transversions relative to transitions (ts, tv4) for coxI resulted in more robust bootstrap support over unweighted parsimony and favours the 16S rRNA tree topology. Combined analysis reflected clear biogeographic pattern, and agrees with morphological and cytological data.

  9. Cockayne syndrome protein A is a transcription factor of RNA polymerase I and stimulates ribosomal biogenesis and growth

    Science.gov (United States)

    Koch, Sylvia; Garcia Gonzalez, Omar; Assfalg, Robin; Schelling, Adrian; Schäfer, Patrick; Scharffetter-Kochanek, Karin; Iben, Sebastian

    2014-01-01

    Mutations in the Cockayne syndrome A (CSA) protein account for 20% of Cockayne syndrome (CS) cases, a childhood disorder of premature aging and early death. Hitherto, CSA has exclusively been described as DNA repair factor of the transcription-coupled branch of nucleotide excision repair. Here we show a novel function of CSA as transcription factor of RNA polymerase I in the nucleolus. Knockdown of CSA reduces pre-rRNA synthesis by RNA polymerase I. CSA associates with RNA polymerase I and the active fraction of the rDNA and stimulates re-initiation of rDNA transcription by recruiting the Cockayne syndrome proteins TFIIH and CSB. Moreover, compared with CSA deficient parental CS cells, CSA transfected CS cells reveal significantly more rRNA with induced growth and enhanced global translation. A previously unknown global dysregulation of ribosomal biogenesis most likely contributes to the reduced growth and premature aging of CS patients. PMID:24781187

  10. Selection of random RNA fragments as method for searching for a site of regulation of translation of E. coli streptomycin mRNA by ribosomal protein S7.

    Science.gov (United States)

    Surdina, A V; Rassokhin, T I; Golovin, A V; Spiridonova, V A; Kraal, B; Kopylov, A M

    2008-06-01

    In E. coli cells ribosomal small subunit biogenesis is regulated by RNA-protein interactions involving protein S7. S7 initiates the subunit assembly interacting with 16S rRNA. During shift-down of rRNA synthesis level, free S7 inhibits self-translation by interacting with 96 nucleotides long specific region of streptomycin (str) mRNA between cistrons S12 and S7 (intercistron). Many bacteria do not have the extended intercistron challenging development of specific approaches for searching putative mRNA regulatory regions, which are able to interact with proteins. The paper describes application of SERF approach (Selection of Random RNA Fragments) to reveal regulatory regions of str mRNA. Set of random DNA fragments has been generated from str operon by random hydrolysis and then transcribed into RNA; the fragments being able to bind protein S7 (serfamers) have been selected by iterative rounds. S7 binds to single serfamer, 109 nucleotide long (RNA109), derived from the intercistron. After multiple copying and selection, the intercistronic mutant (RNA109) has been isolated; it has enhanced affinity to S7. RNA109 binds to the protein better than authentic intercistronic str mRNA; apparent dissociation constants are 26 +/- 5 and 60 +/- 8 nM, respectively. Location of S7 binding site on the mRNA, as well as putative mode of regulation of coupled translation of S12 and S7 cistrons have been hypothesized.

  11. Characterisation of RNA fragments obtained by mild nuclease digestion of 30-S ribosomal subunits from Escherichia coli.

    Science.gov (United States)

    Rinke, J; Ross, A; Brimacombe, R

    1977-06-01

    When Escherichia coli 30-S ribosomal subunits are hydrolysed under mild conditions, two ribonucleoprotein fragments of unequal size are produced. Knowledge of the RNA sequences contained in these hydrolysis products was required for the experiments described in the preceding paper, and the RNA sub-fragments have therefore been examined by oligonucleotide analysis. Two well-defined small fragments of free RNA, produced concomitantly with the ribonucleoprotein fragments, were also analysed. The larger ribonucleoprotein fragment, containing predominantly proteins S4, S5, S8, S15, S16 (17) and S20, contains a complex mixture of RNA sub-fragments varying from about 100 to 800 nucleotides in length. All these fragments arose from the 5'-terminal 900 nucleotides of 16-S RNA, corresponding to the well-known 12-S fragment. No long-range interactions could be detected within this RNA region in these experiments. The RNA from the smaller ribonucleoprotein fragment (containing proteins S7, S9 S10, S14 and S19) has been described in detail previously, and consists of about 450 nucleotides near the 3' end of the 16-S RNA, but lacking the 3'-terminal 150 nucleotides. The two small free RNA fragments (above) partly account for these missing 150 nucleotides; both fragments arose from section A of the 16-S RNA, but section J (the 3'-terminal 50 nucleotides) was not found. This result suggests that the 3' region of 16-S RNA is not involved in stable interactions with protein.

  12. Improving classification of mature microRNA by solving class imbalance problem

    Science.gov (United States)

    Wang, Ying; Li, Xiaoye; Tao, Bairui

    2016-05-01

    MicroRNAs (miRNAs) are ~20–25 nucleotides non-coding RNAs, which regulated gene expression in the post-transcriptional level. The accurate rate of identifying the start sit of mature miRNA from a given pre-miRNA remains lower. It is noting that the mature miRNA prediction is a class-imbalanced problem which also leads to the unsatisfactory performance of these methods. We improved the prediction accuracy of classifier using balanced datasets and presented MatFind which is used for identifying 5‧ mature miRNAs candidates from their pre-miRNA based on ensemble SVM classifiers with idea of adaboost. Firstly, the balanced-dataset was extract based on K-nearest neighbor algorithm. Secondly, the multiple SVM classifiers were trained in orderly using the balance datasets base on represented features. At last, all SVM classifiers were combined together to form the ensemble classifier. Our results on independent testing dataset show that the proposed method is more efficient than one without treating class imbalance problem. Moreover, MatFind achieves much higher classification accuracy than other three approaches. The ensemble SVM classifiers and balanced-datasets can solve the class-imbalanced problem, as well as improve performance of classifier for mature miRNA identification. MatFind is an accurate and fast method for 5‧ mature miRNA identification.

  13. Seasonal succession leads to habitat-dependent differentiation in ribosomal RNA:DNA ratios among freshwater lake bacteria

    Directory of Open Access Journals (Sweden)

    Vincent J Denef

    2016-04-01

    Full Text Available Relative abundance profiles of bacterial populations measured by sequencing DNA or RNA of marker genes can widely differ. These differences, made apparent when calculating ribosomal RNA:DNA ratios, have been interpreted as variable activities of bacterial populations. However, inconsistent correlations between ribosomal RNA:DNA ratios and metabolic activity or growth rates have led to a more conservative interpretation of this metric as the cellular protein synthesis potential (PSP. Little is known, particularly in freshwater systems, about how PSP varies for specific taxa across temporal and spatial environmental gradients and how conserved PSP is across bacterial phylogeny. Here, we generated 16S rRNA gene sequencing data using simultaneously extracted DNA and RNA from fractionated (free-living and particulate water samples taken seasonally along a eutrophic freshwater estuary to oligotrophic pelagic transect in Lake Michigan. In contrast to previous reports, we observed frequent clustering of DNA and RNA data from the same sample. Analysis of the overlap in taxa detected at the RNA and DNA level indicated that microbial dormancy may be more common in the estuary, the particulate fraction, and during the stratified period. Across spatiotemporal gradients, PSP was often conserved at the phylum and class levels. PSPs for specific taxa were more similar across habitats in spring than in summer and fall. This was most notable for PSPs of the same taxa when located in the free-living or particulate fractions, but also when contrasting surface to deep, and estuary to Lake Michigan communities. Our results show that community composition assessed by RNA and DNA measurements are more similar than previously assumed in freshwater systems. However, the similarity between RNA and DNA measurements and taxa-specific PSPs that drive community-level similarities are conditional on spatiotemporal factors.

  14. WDR55 is a nucleolar modulator of ribosomal RNA synthesis, cell cycle progression, and teleost organ development.

    Directory of Open Access Journals (Sweden)

    Norimasa Iwanami

    2008-08-01

    Full Text Available The thymus is a vertebrate-specific organ where T lymphocytes are generated. Genetic programs that lead to thymus development are incompletely understood. We previously screened ethylnitrosourea-induced medaka mutants for recessive defects in thymus development. Here we report that one of those mutants is caused by a missense mutation in a gene encoding the previously uncharacterized protein WDR55 carrying the tryptophan-aspartate-repeat motif. We find that WDR55 is a novel nucleolar protein involved in the production of ribosomal RNA (rRNA. Defects in WDR55 cause aberrant accumulation of rRNA intermediates and cell cycle arrest. A mutation in WDR55 in zebrafish also leads to analogous defects in thymus development, whereas WDR55-null mice are lethal before implantation. These results indicate that WDR55 is a nuclear modulator of rRNA synthesis, cell cycle progression, and embryonic organogenesis including teleost thymus development.

  15. Activation of ribosomal RNA genes in porcine embryos produced in vitro or by somatic cell nuclear transfer

    DEFF Research Database (Denmark)

    Bjerregaard, Bolette; Pedersen, Hanne Gervi; Jakobsen, Anne Sørig

    2007-01-01

    The onset of ribosomal RNA (rRNA) synthesis occurs during the second half of the third cell cycle, that is, at the four-cell stage, in porcine embryos developed in vivo. In the present study the onset of rRNA synthesis was investigated in porcine embryos produced in vitro (IVP) or by somatic cell...... nuclear transfer (SCNT) using fluorescence in situ hybridization (FISH) with an rDNA probe and subsequent visualization of the nucleolar proteins by silver staining. In the 205 IVP embryos investigated, all two-cell embryos (n = 34) were categorized as transcriptionally inactive. At the late four......-cell stage (n = 45), 38% of the embryos contained 1-3 nuclei with signs of rRNA transcription, indicating an asynchronous transcription initiation. This pattern continued in the following stages, as 78% (n = 47), 47% (n = 42) and 83% (n = 37) of the embryos revealed a mixture of transcriptionally inactive...

  16. Recovery from ultraviolet light-induced depression of ribosomal RNA synthesis in normal human, xeroderma pigmentosum and cockayne syndrome cells

    Energy Technology Data Exchange (ETDEWEB)

    Ayaki, Hitoshi; Hara, Ryujiro; Ikenaga, Mituo [Kyoto Univ. (Japan). Radiation Biology Center

    1996-06-01

    The rate of ribosomal RNA (rRNA) synthesis was analyzed at different times after ultraviolet light (UV) irradiation in normal human, xeroderma pigmentosum (XP) and Cockayne syndrome (CS) cells. In normal cells, the rate of rRNA synthesis, as measured by the incorporation of {sup 3}H-uridine into 18S and 28S rRNAs, decreased immediately after UV irradiation to about half of that of unirradiated cells, and then recovered significantly at 24h after UV. However, the rate of synthesis continued to decrease during post-UV incubation in XP cells belonging to groups A, D, E, F and G, as well as in CS cells of groups A and B. In contrast, group C XP cells showed a slight recovery at 24h after UV, suggesting that they have the capacity to repair UV lesions in rRNA genes. (author)

  17. Ribosome profiling-guided depletion of an mRNA increases cell growth rate and protein secretion

    Science.gov (United States)

    Kallehauge, Thomas Beuchert; Li, Shangzhong; Pedersen, Lasse Ebdrup; Ha, Tae Kwang; Ley, Daniel; Andersen, Mikael Rørdam; Kildegaard, Helene Faustrup; Lee, Gyun Min; Lewis, Nathan E.

    2017-01-01

    Recombinant protein production coopts the host cell machinery to provide high protein yields of industrial enzymes or biotherapeutics. However, since protein translation is energetically expensive and tightly controlled, it is unclear if highly expressed recombinant genes are translated as efficiently as host genes. Furthermore, it is unclear how the high expression impacts global translation. Here, we present the first genome-wide view of protein translation in an IgG-producing CHO cell line, measured with ribosome profiling. Through this we found that our recombinant mRNAs were translated as efficiently as the host cell transcriptome, and sequestered up to 15% of the total ribosome occupancy. During cell culture, changes in recombinant mRNA translation were consistent with changes in transcription, demonstrating that transcript levels influence specific productivity. Using this information, we identified the unnecessary resistance marker NeoR to be a highly transcribed and translated gene. Through siRNA knock-down of NeoR, we improved the production- and growth capacity of the host cell. Thus, ribosomal profiling provides valuable insights into translation in CHO cells and can guide efforts to enhance protein production. PMID:28091612

  18. Ribosome profiling-guided depletion of an mRNA increases cell growth rate and protein secretion

    Science.gov (United States)

    Kallehauge, Thomas Beuchert; Li, Shangzhong; Pedersen, Lasse Ebdrup; Ha, Tae Kwang; Ley, Daniel; Andersen, Mikael Rørdam; Kildegaard, Helene Faustrup; Lee, Gyun Min; Lewis, Nathan E.

    2017-01-01

    Recombinant protein production coopts the host cell machinery to provide high protein yields of industrial enzymes or biotherapeutics. However, since protein translation is energetically expensive and tightly controlled, it is unclear if highly expressed recombinant genes are translated as efficiently as host genes. Furthermore, it is unclear how the high expression impacts global translation. Here, we present the first genome-wide view of protein translation in an IgG-producing CHO cell line, measured with ribosome profiling. Through this we found that our recombinant mRNAs were translated as efficiently as the host cell transcriptome, and sequestered up to 15% of the total ribosome occupancy. During cell culture, changes in recombinant mRNA translation were consistent with changes in transcription, demonstrating that transcript levels influence specific productivity. Using this information, we identified the unnecessary resistance marker NeoR to be a highly transcribed and translated gene. Through siRNA knock-down of NeoR, we improved the production- and growth capacity of the host cell. Thus, ribosomal profiling provides valuable insights into translation in CHO cells and can guide efforts to enhance protein production.

  19. Structural insights into the assembly of the 30S ribosomal subunit in vivo: functional role of S5 and location of the 17S rRNA precursor sequence.

    Science.gov (United States)

    Yang, Zhixiu; Guo, Qiang; Goto, Simon; Chen, Yuling; Li, Ningning; Yan, Kaige; Zhang, Yixiao; Muto, Akira; Deng, Haiteng; Himeno, Hyouta; Lei, Jianlin; Gao, Ning

    2014-05-01

    The in vivo assembly of ribosomal subunits is a highly complex process, with a tight coordination between protein assembly and rRNA maturation events, such as folding and processing of rRNA precursors, as well as modifications of selected bases. In the cell, a large number of factors are required to ensure the efficiency and fidelity of subunit production. Here we characterize the immature 30S subunits accumulated in a factor-null Escherichia coli strain (∆rsgA∆rbfA). The immature 30S subunits isolated with varying salt concentrations in the buffer system show interesting differences on both protein composition and structure. Specifically, intermediates derived under the two contrasting salt conditions (high and low) likely reflect two distinctive assembly stages, the relatively early and late stages of the 3' domain assembly, respectively. Detailed structural analysis demonstrates a mechanistic coupling between the maturation of the 5' end of the 17S rRNA and the assembly of the 30S head domain, and attributes a unique role of S5 in coordinating these two events. Furthermore, our structural results likely reveal the location of the unprocessed terminal sequences of the 17S rRNA, and suggest that the maturation events of the 17S rRNA could be employed as quality control mechanisms on subunit production and protein translation.

  20. Ribosome profiling-guided depletion of an mRNA increases cell growth rate and protein secretion

    DEFF Research Database (Denmark)

    Beuchert Kallehauge, Thomas; Li, Shangzhong; Pedersen, Lasse Ebdrup

    2017-01-01

    as efficiently as the host cell transcriptome, and sequestered up to 15% of the total ribosome occupancy. During cell culture, changes in recombinant mRNA translation were consistent with changes in transcription, demonstrating that transcript levels influence specific productivity. Using this information, we......Recombinant protein production coopts the host cell machinery to provide high protein yields of industrial enzymes or biotherapeutics. However, since protein translation is energetically expensive and tightly controlled, it is unclear if highly expressed recombinant genes are translated...... as efficiently as host genes. Furthermore, it is unclear how the high expression impacts global translation. Here, we present the first genome-wide view of protein translation in an IgG-producing CHO cell line, measured with ribosome profiling. Through this we found that our recombinant mRNAs were translated...

  1. A novel mutation 3090 G>A of the mitochondrial 16S ribosomal RNA associated with myopathy.

    Science.gov (United States)

    Coulbault, L; Deslandes, B; Herlicoviez, D; Read, M H; Leporrier, N; Schaeffer, S; Mouadil, A; Lombès, A; Chapon, F; Jauzac, P; Allouche, S

    2007-10-26

    We describe a young woman who presented with a progressive myopathy since the age of 9. Spectrophotometric analysis of the respiratory chain in muscle tissue revealed combined and profound complex I, III, II+III, and IV deficiency ranging from 60% to 95% associated with morphological and histochemical abnormalities of the muscle. An exhaustive screening of mitochondrial transfer and ribosomal RNAs showed a novel G>A substitution at nucleotide position 3090 which was detected only in urine sediment and muscle of the patient and was not found in her mother's blood cells and urine sample. We suggest that this novel de novo mutation in the 16S ribosomal RNA, a nucleotide which is highly conserved in different species, would impair mitochondrial protein synthesis and would cause a severe myopathy.

  2. DEAD-box helicase DDX27 regulates 3′ end formation of ribosomal 47S RNA and stably associates with the PeBoW-complex

    Energy Technology Data Exchange (ETDEWEB)

    Kellner, Markus; Rohrmoser, Michaela [Department of Molecular Epigenetics, Helmholtz Center Munich, Center for Integrated Protein Science Munich (CIPSM), Marchioninistr. 25, Munich 81377 (Germany); Forné, Ignasi [Adolf Butenandt Institute, Ludwig Maximilians University of Munich, Center for Integrated Protein Science Munich (CIPSM), Schillerstr. 44, Munich 80336 (Germany); Voss, Kirsten; Burger, Kaspar; Mühl, Bastian; Gruber-Eber, Anita [Department of Molecular Epigenetics, Helmholtz Center Munich, Center for Integrated Protein Science Munich (CIPSM), Marchioninistr. 25, Munich 81377 (Germany); Kremmer, Elisabeth [Institute of Molecular Immunology, Helmholtz Center Munich, Marchioninistr. 25, Munich 81377 (Germany); Imhof, Axel [Adolf Butenandt Institute, Ludwig Maximilians University of Munich, Center for Integrated Protein Science Munich (CIPSM), Schillerstr. 44, Munich 80336 (Germany); Eick, Dirk, E-mail: eick@helmholtz-muenchen.de [Department of Molecular Epigenetics, Helmholtz Center Munich, Center for Integrated Protein Science Munich (CIPSM), Marchioninistr. 25, Munich 81377 (Germany)

    2015-05-15

    PeBoW, a trimeric complex consisting of pescadillo (Pes1), block of proliferation (Bop1), and the WD repeat protein 12 (WDR12), is essential for processing and maturation of mammalian 5.8S and 28S ribosomal RNAs. Applying a mass spectrometric analysis, we identified the DEAD-box helicase DDX27 as stably associated factor of the PeBoW-complex. DDX27 interacts with the PeBoW-complex via an evolutionary conserved F×F motif in the N-terminal domain and is recruited to the nucleolus via its basic C-terminal domain. This recruitment is RNA-dependent and occurs independently of the PeBoW-complex. Interestingly, knockdown of DDX27, but not of Pes1, induces the accumulation of an extended form of the primary 47S rRNA. We conclude that DDX27 can interact specifically with the Pes1 and Bop1 but fulfils critical function(s) for proper 3′ end formation of 47S rRNA independently of the PeBoW-complex. - Highlights: • DEAD-box helicase DDX27 is a new constituent of the PeBoW-complex. • The N-terminal F×F motif of DDX27 interacts with the PeBoW components Pes1 and Bop1. • Nucleolar anchoring of DDX27 via its basic C-terminal domain is RNA dependent. • Knockdown of DDX27 induces a specific defect in 3′ end formation of 47S rRNA.

  3. Maturation of the 5S rRNA 5' end is catalyzed in vitro by the endonuclease tRNase Z in the archaeon H. volcanii.

    Science.gov (United States)

    Hölzle, Annette; Fischer, Susan; Heyer, Ruth; Schütz, Stefanie; Zacharias, Martin; Walther, Paul; Allers, Thorsten; Marchfelder, Anita

    2008-05-01

    Ribosomal RNA molecules are synthesized as precursors that have to undergo several processing steps to generate the functional rRNA. The 5S rRNA in the archaeon Haloferax volcanii is transcribed as part of a multicistronic transcript containing both large rRNAs and one or two tRNAs. Release of the 5S rRNA from the precursor requires two endonucleolytic cleavages by enzymes as yet not identified. Here we report the first identification of an archaeal 5S rRNA processing endonuclease. The enzyme tRNase Z, which was initially identified as tRNA processing enzyme, generates not only tRNA 3' ends but also mature 5S rRNA 5' ends in vitro. Interestingly, the sequence upstream of the 5S rRNA can be folded into a mini-tRNA, which might explain the processing of this RNA by tRNase Z. The endonuclease is active only at low salt concentrations in vitro, which is in contrast to the 2-4 M KCl concentration present inside the cell in vivo. Electron microscopy studies show that there are no compartments inside the Haloferax cell that could provide lower salt environments. Processing of the 5S rRNA 5' end is not restricted to the haloarchaeal tRNase Z since tRNase Z enzymes from a thermophilic archaeon, a lower and a higher eukaryote, are as well able to cleave the tRNA-like structure 5' of the 5S rRNA. Knock out of the tRNase Z gene in Haloferax volcanii is lethal, showing that the protein is essential for the cell.

  4. Interdependence of Pes1, Bop1, and WDR12 controls nucleolar localization and assembly of the PeBoW complex required for maturation of the 60S ribosomal subunit.

    Science.gov (United States)

    Rohrmoser, Michaela; Hölzel, Michael; Grimm, Thomas; Malamoussi, Anastassia; Harasim, Thomas; Orban, Mathias; Pfisterer, Iris; Gruber-Eber, Anita; Kremmer, Elisabeth; Eick, Dirk

    2007-05-01

    The PeBoW complex is essential for cell proliferation and maturation of the large ribosomal subunit in mammalian cells. Here we examined the role of PeBoW-specific proteins Pes1, Bop1, and WDR12 in complex assembly and stability, nucleolar transport, and pre-ribosome association. Recombinant expression of the three subunits is sufficient for complex formation. The stability of all three subunits strongly increases upon incorporation into the complex. Only overexpression of Bop1 inhibits cell proliferation and rRNA processing, and its negative effects could be rescued by coexpression of WDR12, but not Pes1. Elevated levels of Bop1 induce Bop1/WDR12 and Bop1/Pes1 subcomplexes. Knockdown of Bop1 abolishes the copurification of Pes1 with WDR12, demonstrating Bop1 as the integral component of the complex. Overexpressed Bop1 substitutes for endogenous Bop1 in PeBoW complex assembly, leading to the instability of endogenous Bop1. Finally, indirect immunofluorescence, cell fractionation, and sucrose gradient centrifugation experiments indicate that transport of Bop1 from the cytoplasm to the nucleolus is Pes1 dependent, while Pes1 can migrate to the nucleolus and bind to preribosomal particles independently of Bop1. We conclude that the assembly and integrity of the PeBoW complex are highly sensitive to changes in Bop1 protein levels.

  5. A mutation in the 530 loop of Escherichia coli 16S ribosomal RNA causes resistance to streptomycin.

    Science.gov (United States)

    Melançon, P; Lemieux, C; Brakier-Gingras, L

    1988-10-25

    Oligonucleotide-directed mutagenesis was used to introduce an A to C transversion at position 523 in the 16S ribosomal RNA gene of Escherichia coli rrnB operon cloned in plasmid pKK3535. E. coli cells transformed with the mutated plasmid were resistant to streptomycin. The mutated ribosomes isolated from these cells were not stimulated by streptomycin to misread the message in a poly(U)-directed assay. They were also restrictive to the stimulation of misreading by other error-promoting related aminoglycoside antibiotics such as neomycin, kanamycin or gentamicin, which do not compete for the streptomycin binding site. The 530 loop where the mutation in the 16S rRNA is located has been mapped at the external surface of the 30S subunit, and is therefore distal from the streptomycin binding site at the subunit interface. Our results support the conclusion that the mutation at position 523 in the 16S rRNA does not interfere with the binding of streptomycin, but prevents the drug from inducing conformational changes in the 530 loop which account for its miscoding effect. Since this effect primarily results from a perturbation of the translational proofreading control, our results also provide evidence that the 530 loop of the 16S rRNA is involved in this accuracy control.

  6. Crosstalk in gene expression: coupling and co-regulation of rDNA transcription, pre-ribosome assembly and pre-rRNA processing.

    Science.gov (United States)

    Granneman, Sander; Baserga, Susan J

    2005-06-01

    Ribosomes, the large RNPs that translate mRNA into protein in the cytoplasm of eukaryotic cells, are synthesized in a subcompartment of the nucleus, the nucleolus. There, transcription by Pol I yields a pre-rRNA which is modified, cleaved and assembled with ribosomal proteins to make functional ribosomes. Previously, rRNA transcription and pre-rRNA cleavage in eukaryotes were considered to be separable steps in gene expression. However, recent findings suggest that these two steps in gene expression can be concurrent and are co-regulated. Unexpectedly, optimal rDNA transcription requires the presence of a defined subset of components of the pre-rRNA processing machinery.

  7. Studies on the ability of partially iodinated 16S RNA to participate in 30S ribosome assembly.

    Science.gov (United States)

    Schendel, P L; Craven, G R

    1976-11-01

    Deproteinated 16S RNA was iodinated at pH 5.0 in an aqueous solution containing TlCl3 plus KI for 1-5 hours at 42 degrees C. Under these conditions 33 moles of iodine are incorporated per mole of RNA. As judged by sucrose gradient sedimentation, the iodinated RNA does not exhibit any large alteration in conformation as compared to unmodified 16S. The iodinated RNA was examined for its ability to reconstitute with total 30S proteins. Sedimentation velocity analysis reveals that the reconstituted subunit has a sedimentation constant of approximately 20S. In addition, protein analysis of particles reconstituted with 16S RNA iodinated for 5 hours indicates that proteins S2, S10, S13, S14, S15, S17, S18, S19, and S21 are no longer able to participate in the 30S assembly process and that proteins S6, S16 and S20 are present in reduced amounts. The ramifications of these results concerning protein-RNA and RNA-RNA interactions occurring in ribosome assembly are discussed.

  8. An RNA-binding complex involved in ribosome biogenesis contains a protein with homology to tRNA CCA-adding enzyme.

    Directory of Open Access Journals (Sweden)

    Jinzhong Lin

    2013-10-01

    Full Text Available A multitude of proteins and small nucleolar RNAs transiently associate with eukaryotic ribosomal RNAs to direct their modification and processing and the assembly of ribosomal proteins. Utp22 and Rrp7, two interacting proteins with no recognizable domain, are components of the 90S preribosome or the small subunit processome that conducts early processing of 18S rRNA. Here, we determine the cocrystal structure of Utp22 and Rrp7 complex at 1.97 Å resolution and the NMR structure of a C-terminal fragment of Rrp7, which is not visible in the crystal structure. The structure reveals that Utp22 surprisingly resembles a dimeric class I tRNA CCA-adding enzyme yet with degenerate active sites, raising an interesting evolutionary connection between tRNA and rRNA processing machineries. Rrp7 binds extensively to Utp22 using a deviant RNA recognition motif and an extended linker. Functional sites on the two proteins were identified by structure-based mutagenesis in yeast. We show that Rrp7 contains a flexible RNA-binding C-terminal tail that is essential for association with preribosomes. RNA-protein crosslinking shows that Rrp7 binds at the central domain of 18S rRNA and shares a neighborhood with two processing H/ACA snoRNAs snR30 and snR10. Depletion of snR30 prevents the stable assembly of Rrp7 into preribosomes. Our results provide insight into the evolutionary origin and functional context of Utp22 and Rrp7.

  9. Isolation, crystallization, and investigation of ribosomal protein S8 complexed with specific fragments of rRNA of bacterial or archaeal origin.

    Science.gov (United States)

    Tishchenko, S V; Vassilieva, J M; Platonova, O B; Serganov, A A; Fomenkova, N P; Mudrik, E S; Piendl, W; Ehresmann, C; Ehresmann, B; Garber, M B

    2001-09-01

    The core ribosomal protein S8 binds to the central domain of 16S rRNA independently of other ribosomal proteins and is required for assembling the 30S subunit. It has been shown with E. coli ribosomes that a short rRNA fragment restricted by nucleotides 588-602 and 636-651 is sufficient for strong and specific protein S8 binding. In this work, we studied the complexes formed by ribosomal protein S8 from Thermus thermophilus and Methanococcus jannaschii with short rRNA fragments isolated from the same organisms. The dissociation constants of the complexes of protein S8 with rRNA fragments were determined. Based on the results of binding experiments, rRNA fragments of different length were designed and synthesized in preparative amounts in vitro using T7 RNA-polymerase. Stable S8-RNA complexes were crystallized. Crystals were obtained both for homologous bacterial and archaeal complexes and for hybrid complexes of archaeal protein with bacterial rRNA. Crystals of the complex of protein S8 from M. jannaschii with the 37-nucleotide rRNA fragment from the same organism suitable for X-ray analysis were obtained.

  10. LKB1 promotes cell survival by modulating TIF-IA-mediated pre-ribosomal RNA synthesis under uridine downregulated conditions.

    Science.gov (United States)

    Liu, Fakeng; Jin, Rui; Liu, Xiuju; Huang, Henry; Wilkinson, Scott C; Zhong, Diansheng; Khuri, Fadlo R; Fu, Haian; Marcus, Adam; He, Yulong; Zhou, Wei

    2016-01-19

    We analyzed the mechanism underlying 5-aminoimidazole-4-carboxamide riboside (AICAR) mediated apoptosis in LKB1-null non-small cell lung cancer (NSCLC) cells. Metabolic profile analysis revealed depletion of the intracellular pyrimidine pool after AICAR treatment, but uridine was the only nucleotide precursor capable of rescuing this apoptosis, suggesting the involvement of RNA metabolism. Because half of RNA transcription in cancer is for pre-ribosomal RNA (rRNA) synthesis, which is suppressed by over 90% after AICAR treatment, we evaluated the role of TIF-IA-mediated rRNA synthesis. While the depletion of TIF-IA by RNAi alone promoted apoptosis in LKB1-null cells, the overexpression of a wild-type or a S636A TIF-IA mutant, but not a S636D mutant, attenuated AICAR-induced apoptosis. In LKB1-null H157 cells, pre-rRNA synthesis was not suppressed by AICAR when wild-type LKB1 was present, and cellular fractionation analysis indicated that TIF-IA quickly accumulated in the nucleus in the presence of a wild-type LKB1 but not a kinase-dead mutant. Furthermore, ectopic expression of LKB1 was capable of attenuating AICAR-induced death in AMPK-null cells. Because LKB1 promotes cell survival by modulating TIF-IA-mediated pre-rRNA synthesis, this discovery suggested that targeted depletion of uridine related metabolites may be exploited in the clinic to eliminate LKB1-null cancer cells.

  11. [Mutual effect of human ribosomal proteins S5 and S16 on their binding with 18S rRNA fragment 1203-1236/1521-1698].

    Science.gov (United States)

    Ian'shina, D D; Malygin, A A; Karpova, G G

    2009-01-01

    Human ribosomal proteins S5 and S16 are homologues of prokaryotic ribosomal proteins S7p and S9p, respectively, that according to X-ray crystallography data on the Thermus thermophilus 30S ribosomal subunit contact the 3'-terminal 16S rRNA region formed by helices H28-H30 and H38-H43. In the present work we report studying mutual effect of human ribosomal proteins S5 and S16 on their binding with RNA transcript corresponding to the region 1203-1236/1521-1698 of the 18S rRNA (helices H28-30 and H41-43), which is homologous to thel6S rRNA region known to contain binding site of S7p and part of binding site of S9p. It was shown that simultaneous binding of ribosomal proteins S5 and S16 with this RNA transcript causes conformational changes in it stabilizing the complex by involvement of new parts of the RNA that interact with neither S5 nor S16 in the respective binary complexes.

  12. Arabidopsis Chloroplast Mini-Ribonuclease III Participates in rRNA Maturation and Intron Recycling

    Science.gov (United States)

    Hotto, Amber M.; Castandet, Benoît; Gilet, Laetitia; Higdon, Andrea; Condon, Ciarán; Stern, David B.

    2015-01-01

    RNase III proteins recognize double-stranded RNA structures and catalyze endoribonucleolytic cleavages that often regulate gene expression. Here, we characterize the functions of RNC3 and RNC4, two Arabidopsis thaliana chloroplast Mini-RNase III-like enzymes sharing 75% amino acid sequence identity. Whereas rnc3 and rnc4 null mutants have no visible phenotype, rnc3/rnc4 (rnc3/4) double mutants are slightly smaller and chlorotic compared with the wild type. In Bacillus subtilis, the RNase Mini-III is integral to 23S rRNA maturation. In Arabidopsis, we observed imprecise maturation of 23S rRNA in the rnc3/4 double mutant, suggesting that exoribonucleases generated staggered ends in the absence of specific Mini-III-catalyzed cleavages. A similar phenotype was found at the 3′ end of the 16S rRNA, and the primary 4.5S rRNA transcript contained 3′ extensions, suggesting that Mini-III catalyzes several processing events of the polycistronic rRNA precursor. The rnc3/4 mutant showed overaccumulation of a noncoding RNA complementary to the 4.5S-5S rRNA intergenic region, and its presence correlated with that of the extended 4.5S rRNA precursor. Finally, we found rnc3/4-specific intron degradation intermediates that are probable substrates for Mini-III and show that B. subtilis Mini-III is also involved in intron regulation. Overall, this study extends our knowledge of the key role of Mini-III in intron and noncoding RNA regulation and provides important insight into plastid rRNA maturation. PMID:25724636

  13. Quinacrine impairs enterovirus 71 RNA replication by preventing binding of polypyrimidine-tract binding protein with internal ribosome entry sites.

    Directory of Open Access Journals (Sweden)

    Jianmin Wang

    Full Text Available Since the 1980s, epidemics of enterovirus 71 (EV71 and other enteroviruses have occurred in Asian countries and regions, causing a wide range of human diseases. No effective therapy is available for the treatment of these infections. Internal ribosome entry sites (IRESs are indispensable for the initiation of translation in enteroviruses. Several cellular factors, as well as the ribosome, are recruited to the conserved IRES during this process. Quinacrine intercalates into the RNA architecture and inhibits RNA transcription and protein synthesis, and a recent study showed that quinacrine inhibited encephalomyocarditis virus and poliovirus IRES-mediated translation in vitro without disrupting internal cellular IRES. Here, we report that quinacrine was highly active against EV71, protecting cells from EV71 infection. Replication of viral RNA, expression of viral capsid protein, and production of virus were all strongly inhibited by quinacrine. Interaction of the polypyrimidine tract-binding protein (PTB with the conserved IRES was prevented by quinacrine. Coxsackieviruses and echovirus were also inhibited by quinacrine in cultured cells. These results indicate that quinacrine may serve as a potential protective agent for use in the treatment of patients with chronic enterovirus infection.

  14. Molecular inventory control in ribosome biosynthesis.

    Science.gov (United States)

    Warner, J R; Johnson, S P

    1986-11-01

    The eukaryotic cell coordinates the accumulation of each ribosomal protein with every other ribosomal protein, with ribosomal RNA and with the needs of the cell. To do so it regulates the transcription, processing, translation and lifetime of the mRNA for ribosomal proteins. When all else fails, it rapidly degrades any excess ribosomal protein which is synthesized.

  15. Phylogeny-function analysis of (meta)genomic libraries: screening for expression of ribosomal RNA genes by large-insert library fluorescent in situ hybridization (LIL-FISH)

    NARCIS (Netherlands)

    Leveau, J.H.J.; Gerards, S.; De Boer, W.; Van Veen, J.A.

    2004-01-01

    We assessed the utility of fluorescent in situ hybridization (FISH) in the screening of clone libraries of (meta)genomic or environmental DNA for the presence and expression of bacterial ribosomal RNA (rRNA) genes. To establish proof-of-principle, we constructed a fosmid-based library in Escherichia

  16. Direct Activation of Ribosome-Associated Double-Stranded RNA-Dependent Protein Kinase (PKR by Deoxynivalenol, Anisomycin and Ricin: A New Model for Ribotoxic Stress Response Induction

    Directory of Open Access Journals (Sweden)

    Hui-Ren Zhou

    2014-12-01

    Full Text Available Double-stranded RNA (dsRNA-activated protein kinase (PKR is a critical upstream mediator of the ribotoxic stress response (RSR to the trichothecene deoxynivalenol (DON and other translational inhibitors. Here, we employed HeLa cell lysates to: (1 characterize PKR’s interactions with the ribosome and ribosomal RNA (rRNA; (2 demonstrate cell-free activation of ribosomal-associated PKR and (3 integrate these findings in a unified model for RSR. Robust PKR-dependent RSR was initially confirmed in intact cells. PKR basally associated with 40S, 60S, 80S and polysome fractions at molar ratios of 7, 2, 23 and 3, respectively. Treatment of ATP-containing HeLa lysates with DON or the ribotoxins anisomycin and ricin concentration-dependently elicited phosphorylation of PKR and its substrate eIF2α. These phosphorylations could be blocked by PKR inhibitors. rRNA immunoprecipitation (RNA-IP of HeLa lysates with PKR-specific antibody and sequencing revealed that in the presence of DON or not, the kinase associated with numerous discrete sites on both the 18S and 28S rRNA molecules, a number of which contained double-stranded hairpins. These findings are consistent with a sentinel model whereby multiple PKR molecules basally associate with the ribosome positioning them to respond to ribotoxin-induced alterations in rRNA structure by dimerizing, autoactivating and, ultimately, evoking RSR.

  17. Direct activation of ribosome-associated double-stranded RNA-dependent protein kinase (PKR) by deoxynivalenol, anisomycin and ricin: a new model for ribotoxic stress response induction.

    Science.gov (United States)

    Zhou, Hui-Ren; He, Kaiyu; Landgraf, Jeff; Pan, Xiao; Pestka, James J

    2014-12-16

    Double-stranded RNA (dsRNA)-activated protein kinase (PKR) is a critical upstream mediator of the ribotoxic stress response (RSR) to the trichothecene deoxynivalenol (DON) and other translational inhibitors. Here, we employed HeLa cell lysates to: (1) characterize PKR's interactions with the ribosome and ribosomal RNA (rRNA); (2) demonstrate cell-free activation of ribosomal-associated PKR and (3) integrate these findings in a unified model for RSR. Robust PKR-dependent RSR was initially confirmed in intact cells. PKR basally associated with 40S, 60S, 80S and polysome fractions at molar ratios of 7, 2, 23 and 3, respectively. Treatment of ATP-containing HeLa lysates with DON or the ribotoxins anisomycin and ricin concentration-dependently elicited phosphorylation of PKR and its substrate eIF2α. These phosphorylations could be blocked by PKR inhibitors. rRNA immunoprecipitation (RNA-IP) of HeLa lysates with PKR-specific antibody and sequencing revealed that in the presence of DON or not, the kinase associated with numerous discrete sites on both the 18S and 28S rRNA molecules, a number of which contained double-stranded hairpins. These findings are consistent with a sentinel model whereby multiple PKR molecules basally associate with the ribosome positioning them to respond to ribotoxin-induced alterations in rRNA structure by dimerizing, autoactivating and, ultimately, evoking RSR.

  18. Translation complex profile sequencing to study the in vivo dynamics of mRNA-ribosome interactions during translation initiation, elongation and termination.

    Science.gov (United States)

    Shirokikh, Nikolay E; Archer, Stuart K; Beilharz, Traude H; Powell, David; Preiss, Thomas

    2017-04-01

    Messenger RNA (mRNA) translation is a tightly controlled process that is integral to gene expression. It features intricate and dynamic interactions of the small and large subunits of the ribosome with mRNAs, aided by multiple auxiliary factors during distinct initiation, elongation and termination phases. The recently developed ribosome profiling method can generate transcriptome-wide surveys of translation and its regulation. Ribosome profiling records the footprints of fully assembled ribosomes along mRNAs and thus primarily interrogates the elongation phase of translation. Importantly, it does not monitor multiple substeps of initiation and termination that involve complexes between the small ribosomal subunit (SSU) and mRNA. Here we describe a related method, termed 'translation complex profile sequencing' (TCP-seq), that is uniquely capable of recording positions of any type of ribosome-mRNA complex transcriptome-wide. It uses fast covalent fixation of translation complexes in live cells, followed by RNase footprinting of translation intermediates and their separation into complexes involving either the full ribosome or the SSU. The footprints derived from each type of complex are then deep-sequenced separately, generating native distribution profiles during the elongation, as well as the initiation and termination stages of translation. We provide the full TCP-seq protocol for Saccharomyces cerevisiae liquid suspension culture, including a data analysis pipeline. The protocol takes ∼3 weeks to complete by a researcher who is well acquainted with standard molecular biology techniques and who has some experience in ultracentrifugation and the preparation of RNA sequencing (RNA-seq) libraries. Basic Bash and UNIX/Linux command skills are required to use the bioinformatics tools provided.

  19. The structure of the archaebacterial ribosomal protein S7 and its possible interaction with 16S rRNA.

    Science.gov (United States)

    Hosaka, H; Yao, M; Kimura, M; Tanaka, I

    2001-11-01

    Ribosomal protein S7 is one of the ubiquitous components of the small subunit of the ribosome. It is a 16S rRNA-binding protein positioned close to the exit of the tRNA, and it plays a role in initiating assembly of the head of the 30S subunit. Previous structural analyses of eubacterial S7 have shown that it has a stable alpha-helix core and a flexible beta-arm. Unlike these eubacterial proteins, archaebacterial or eukaryotic S7 has an N-terminal extension of approximately 60 residues. The crystal structure of S7 from archaebacterium Pyrococcus horikoshii (PhoS7) has been determined at 2.1 A resolution. The final model of PhoS7 consists of six major alpha-helices, a short 3(10)-helix and two beta-stands. The major part (residues 18-45) of the N-terminal extension of PhoS7 reinforces the alpha-helical core by well-extended hydrophobic interactions, while the other part (residues 46-63) is not visible in the crystal and is possibly fixed only by interacting with 16S rRNA. These differences in the N-terminal extension as well as in the insertion (between alpha1 and alpha2) of the archaebacterial S7 structure from eubacterial S7 are such that they do not necessitate a major change in the structure of the currently available eubacterial 16S rRNA. Some of the inserted chains might pass through gaps formed by helices of the 16S rRNA.

  20. Inhibition of the protein kinase PKR by the internal ribosome entry site of hepatitis C virus genomic RNA.

    Science.gov (United States)

    Vyas, Jashmin; Elia, Androulla; Clemens, Michael J

    2003-07-01

    Translation of the hepatitis C genome is mediated by internal ribosome entry on the structurally complex 5' untranslated region of the large viral RNA. Initiation of protein synthesis by this mechanism is independent of the cap-binding factor eIF4E, but activity of the initiator Met-tRNA(f)-binding factor eIF2 is still required. HCV protein synthesis is thus potentially sensitive to the inhibition of eIF2 activity that can result from the phosphorylation of the latter by the interferon-inducible, double-stranded RNA-activated protein kinase PKR. Two virally encoded proteins, NS5A and E2, have been shown to reduce this inhibitory effect of PKR by impairing the activation of the kinase. Here we present evidence for a third viral strategy for PKR inhibition. A region of the viral RNA comprising part of the internal ribosome entry site (IRES) is able to bind to PKR in competition with double-stranded RNA and can prevent autophosphorylation and activation of the kinase in vitro. The HCV IRES itself has no PKR-activating ability. Consistent with these findings, cotransfection experiments employing a bicistronic reporter construct and wild-type PKR indicate that expression of the protein kinase is less inhibitory towards HCV IRES-driven protein synthesis than towards cap-dependent protein synthesis. These data suggest a dual function for the viral IRES, with both a structural role in promoting initiation complex formation and a regulatory role in preventing inhibition of initiation by PKR.

  1. Slip of grip of a molecular motor on a crowded track: Modeling shift of reading frame of ribosome on RNA template

    Science.gov (United States)

    Mishra, Bhavya; Schütz, Gunter M.; Chowdhury, Debashish

    2016-06-01

    We develop a stochastic model for the programmed frameshift of ribosomes synthesizing a protein while moving along a mRNA template. Normally the reading frame of a ribosome decodes successive triplets of nucleotides on the mRNA in a step-by-step manner. We focus on the programmed shift of the ribosomal reading frame, forward or backward, by only one nucleotide which results in a fusion protein; it occurs when a ribosome temporarily loses its grip to its mRNA track. Special “slippery” sequences of nucleotides and also downstream secondary structures of the mRNA strand are believed to play key roles in programmed frameshift. Here we explore the role of an hitherto neglected parameter in regulating -1 programmed frameshift. Specifically, we demonstrate that the frameshift frequency can be strongly regulated also by the density of the ribosomes, all of which are engaged in simultaneous translation of the same mRNA, at and around the slippery sequence. Monte Carlo simulations support the analytical predictions obtained from a mean-field analysis of the stochastic dynamics.

  2. Slip of grip of a molecular motor on a crowded track: Modeling shift of reading frame of ribosome on RNA template

    CERN Document Server

    Mishra, Bhavya; Chowdhury, Debashish

    2016-01-01

    We develop a stochastic model for the programmed frameshift of ribosomes synthesizing a protein while moving along a mRNA template. Normally the reading frame of a ribosome decodes successive triplets of nucleotides on the mRNA in a step-by-step manner. We focus on the programmed shift of the ribosomal reading frame, forward or backward, by only one nucleotide which results in a fusion protein; it occurs when a ribosome temporarily loses its grip to its mRNA track. Special "slippery" sequences of nucleotides and also downstream secondary structures of the mRNA strand are believed to play key roles in programmed frameshift. Here we explore the role of an hitherto neglected parameter in regulating -1 programmed frameshift. Specifically, we demonstrate that the frameshift frequency can be strongly regulated also by the density of the ribosomes, all of which are engaged in simultaneous translation of the same mRNA, at and around the slippery sequence. Monte Carlo simulations support the analytical predictions obt...

  3. A Happy 3' Ending to the piRNA Maturation Story.

    Science.gov (United States)

    Czech, Benjamin; Hannon, Gregory J

    2016-02-25

    For a decade, mystery has surrounded the mechanisms by which piRNA biogenesis yields distinct size classes of small RNAs within individual PIWI proteins. In this issue of Cell, two studies shed light on this process, identifying conserved PARN-family exonucleases that trim piRNAs to their mature size in silkworms and C. elegans.

  4. A tRNA body with high affinity for EF-Tu hastens ribosomal incorporation of unnatural amino acids.

    Science.gov (United States)

    Ieong, Ka-Weng; Pavlov, Michael Y; Kwiatkowski, Marek; Ehrenberg, Måns; Forster, Anthony C

    2014-05-01

    There is evidence that tRNA bodies have evolved to reduce differences between aminoacyl-tRNAs in their affinity to EF-Tu. Here, we study the kinetics of incorporation of L-amino acids (AAs) Phe, Ala allyl-glycine (aG), methyl-serine (mS), and biotinyl-lysine (bK) using a tRNA(Ala)-based body (tRNA(AlaB)) with a high affinity for EF-Tu. Results are compared with previous data on the kinetics of incorporation of the same AAs using a tRNA(PheB) body with a comparatively low affinity for EF-Tu. All incorporations exhibited fast and slow phases, reflecting the equilibrium fraction of AA-tRNA in active ternary complex with EF-Tu:GTP before the incorporation reaction. Increasing the concentration of EF-Tu increased the amplitude of the fast phase and left its rate unaltered. This allowed estimation of the affinity of each AA-tRNA to EF-Tu:GTP during translation, showing about a 10-fold higher EF-Tu affinity for AA-tRNAs formed from the tRNA(AlaB) body than from the tRNA(PheB) body. At ∼1 µM EF-Tu, tRNA(AlaB) conferred considerably faster incorporation kinetics than tRNA(PheB), especially in the case of the bulky bK. In contrast, the swap to the tRNA(AlaB) body did not increase the fast phase fraction of N-methyl-Phe incorporation, suggesting that the slow incorporation of N-methyl-Phe had a different cause than low EF-Tu:GTP affinity. The total time for AA-tRNA release from EF-Tu:GDP, accommodation, and peptidyl transfer on the ribosome was similar for the tRNA(AlaB) and tRNA(PheB) bodies. We conclude that a tRNA body with high EF-Tu affinity can greatly improve incorporation of unnatural AAs in a potentially generalizable manner.

  5. A Genome-Wide Analysis of RNA Pseudoknots That Stimulate Efficient −1 Ribosomal Frameshifting or Readthrough in Animal Viruses

    Directory of Open Access Journals (Sweden)

    Xiaolan Huang

    2013-01-01

    Full Text Available Programmed −1 ribosomal frameshifting (PRF and stop codon readthrough are two translational recoding mechanisms utilized by some RNA viruses to express their structural and enzymatic proteins at a defined ratio. Efficient recoding usually requires an RNA pseudoknot located several nucleotides downstream from the recoding site. To assess the strategic importance of the recoding pseudoknots, we have carried out a large scale genome-wide analysis in which we used an in-house developed program to detect all possible H-type pseudoknots within the genomic mRNAs of 81 animal viruses. Pseudoknots are detected downstream from ~85% of the recoding sites, including many previously unknown pseudoknots. ~78% of the recoding pseudoknots are the most stable pseudoknot within the viral genomes. However, they are not as strong as some designed pseudoknots that exhibit roadblocking effect on the translating ribosome. Strong roadblocking pseudoknots are not detected within the viral genomes. These results indicate that the decoding pseudoknots have evolved to possess optimal stability for efficient recoding. We also found that the sequence at the gag-pol frameshift junction of HIV1 harbors potential elaborated pseudoknots encompassing the frameshift site. A novel mechanism is proposed for possible involvement of the elaborated pseudoknots in the HIV1 PRF event.

  6. Delimitation of the Thoracosphaeraceae (Dinophyceae), including the calcareous dinoflagellates, based on large amounts of ribosomal RNA sequence data.

    Science.gov (United States)

    Gottschling, Marc; Soehner, Sylvia; Zinssmeister, Carmen; John, Uwe; Plötner, Jörg; Schweikert, Michael; Aligizaki, Katerina; Elbrächter, Malte

    2012-01-01

    The phylogenetic relationships of the Dinophyceae (Alveolata) are not sufficiently resolved at present. The Thoracosphaeraceae (Peridiniales) are the only group of the Alveolata that include members with calcareous coccoid stages; this trait is considered apomorphic. Although the coccoid stage apparently is not calcareous, Bysmatrum has been assigned to the Thoracosphaeraceae based on thecal morphology. We tested the monophyly of the Thoracosphaeraceae using large sets of ribosomal RNA sequence data of the Alveolata including the Dinophyceae. Phylogenetic analyses were performed using Maximum Likelihood and Bayesian approaches. The Thoracosphaeraceae were monophyletic, but included also a number of non-calcareous dinophytes (such as Pentapharsodinium and Pfiesteria) and even parasites (such as Duboscquodinium and Tintinnophagus). Bysmatrum had an isolated and uncertain phylogenetic position outside the Thoracosphaeraceae. The phylogenetic relationships among calcareous dinophytes appear complex, and the assumption of the single origin of the potential to produce calcareous structures is challenged. The application of concatenated ribosomal RNA sequence data may prove promising for phylogenetic reconstructions of the Dinophyceae in future.

  7. The nuclear 18S ribosomal RNA gene as a source of phylogenetic information in the genus Taenia.

    Science.gov (United States)

    Yan, Hongbin; Lou, Zhongzi; Li, Li; Ni, Xingwei; Guo, Aijiang; Li, Hongmin; Zheng, Yadong; Dyachenko, Viktor; Jia, Wanzhong

    2013-03-01

    Most species of the genus Taenia are of considerable medical and veterinary significance. In this study, complete nuclear 18S rRNA gene sequences were obtained from seven members of genus Taenia [Taenia multiceps, Taenia saginata, Taenia asiatica, Taenia solium, Taenia pisiformis, Taenia hydatigena, and Taenia taeniaeformis] and a phylogeny inferred using these sequences. Most of the variable sites fall within the variable regions, V1-V5. We show that sequences from the nuclear 18S ribosomal RNA gene have considerable promise as sources of phylogenetic information within the genus Taenia. Furthermore, given that almost all the variable sites lie within defined variable portions of that gene, it will be appropriate and economical to sequence only those regions for additional species of Taenia.

  8. Bioinformatic evidence for a widely distributed, ribosomally produced electron carrier precursor, its maturation proteins, and its nicotinoprotein redox partners

    Directory of Open Access Journals (Sweden)

    Haft Daniel H

    2011-01-01

    Full Text Available Abstract Background Enzymes in the radical SAM (rSAM domain family serve in a wide variety of biological processes, including RNA modification, enzyme activation, bacteriocin core peptide maturation, and cofactor biosynthesis. Evolutionary pressures and relationships to other cellular constituents impose recognizable grammars on each class of rSAM-containing system, shaping patterns in results obtained through various comparative genomics analyses. Results An uncharacterized gene cluster found in many Actinobacteria and sporadically in Firmicutes, Chloroflexi, Deltaproteobacteria, and one Archaeal plasmid contains a PqqE-like rSAM protein family that includes Rv0693 from Mycobacterium tuberculosis. Members occur clustered with a strikingly well-conserved small polypeptide we designate "mycofactocin," similar in size to bacteriocins and PqqA, precursor of pyrroloquinoline quinone (PQQ. Partial Phylogenetic Profiling (PPP based on the distribution of these markers identifies the mycofactocin cluster, but also a second tier of high-scoring proteins. This tier, strikingly, is filled with up to thirty-one members per genome from three variant subfamilies that occur, one each, in three unrelated classes of nicotinoproteins. The pattern suggests these variant enzymes require not only NAD(P, but also the novel gene cluster. Further study was conducted using SIMBAL, a PPP-like tool, to search these nicotinoproteins for subsequences best correlated across multiple genomes to the presence of mycofactocin. For both the short chain dehydrogenase/reductase (SDR and iron-containing dehydrogenase families, aligning SIMBAL's top-scoring sequences to homologous solved crystal structures shows signals centered over NAD(P-binding sites rather than over substrate-binding or active site residues. Previous studies on some of these proteins have revealed a non-exchangeable NAD cofactor, such that enzymatic activity in vitro requires an artificial electron acceptor such

  9. Hyper-regulation of pyr-gene expression in Escherichia coli cells with slow ribosomes. Evidence for RNA polymerase pausing in vivo

    DEFF Research Database (Denmark)

    Jensen, Kaj Frank

    1988-01-01

    transcription should terminate or continue into the structural genes. This paper described a study of pyrBI and pyrE gene regulation in cells where the ribosomes move slowly as a result of mutation in rpsL. It appears that expression of the two genes is hyper-regulated by the UTP pool in this type of cells......UTP-modulated attenuation of transcription is involved in regulating the synthesis of pyrimidine nucleotides in Escherichia coli. Thus, expression of two genes, pyrBI and pyrE, was shown to be under this type of control. The genes encode the two subunits of aspartate transcarbamylase and orotate....... Mechanistically this will couple the ribosomes translating a leader peptide gene more tightly to the elongating RNA polymerase. The ribosomes will then be more prone to prevent the folding of the mRNA chains into terminating hairpin structures when RNA polymerase is at the attenuator and has to decide whether...

  10. 3'uridylation controls mature microRNA turnover during CD4 T cell activation.

    Science.gov (United States)

    Gutierrez-Vazquez, Cristina; Enright, Anton J; Rodríguez-Galán, Ana; Perez-García, Arantxa; Collier, Paul; Jones, Matthew R; Benes, Vladimir; Mizgerd, Joseph P; Mittelbrunn, María; Ramiro, Almudena R; Sanchez-Madrid, Francisco

    2017-03-28

    Activation of T lymphocytes requires a tight regulation of microRNAs (miRNAs) expression. Terminal uridyltransferases (TUTases) catalyze 3' non-templated nucleotide addition (3'NTA) to miRNAs which may influence miRNA stability and function. Here, we investigated 3'NTA to mature miRNA in CD4 T lymphocytes by deep sequencing. Upon T cell activation, miRNA sequences bearing terminal uridines are specifically decreased, concomitantly with downregulation of TUT4 and TUT7 enzymes. Analyzing TUT4 deficient T lymphocytes, we proved that this terminal uridyltransferase is essential for the maintenance of miRNA uridylation in steady state of T lymphocytes. Analysis of synthetic uridylated miRNAs shows that 3' addition of uridine promotes degradation of these uridylated miRNAs after T cell activation. Our data underline post-transcriptional uridylation as a mechanism to fine tune miRNA levels during T cell activation.

  11. The majority of total nuclear-encoded non-ribosomal RNA in a human cell is 'dark matter' un-annotated RNA

    Directory of Open Access Journals (Sweden)

    Milos Patrice

    2010-12-01

    Full Text Available Abstract Background Discovery that the transcriptional output of the human genome is far more complex than predicted by the current set of protein-coding annotations and that most RNAs produced do not appear to encode proteins has transformed our understanding of genome complexity and suggests new paradigms of genome regulation. However, the fraction of all cellular RNA whose function we do not understand and the fraction of the genome that is utilized to produce that RNA remain controversial. This is not simply a bookkeeping issue because the degree to which this un-annotated transcription is present has important implications with respect to its biologic function and to the general architecture of genome regulation. For example, efforts to elucidate how non-coding RNAs (ncRNAs regulate genome function will be compromised if that class of RNAs is dismissed as simply 'transcriptional noise'. Results We show that the relative mass of RNA whose function and/or structure we do not understand (the so called 'dark matter' RNAs, as a proportion of all non-ribosomal, non-mitochondrial human RNA (mt-RNA, can be greater than that of protein-encoding transcripts. This observation is obscured in studies that focus only on polyA-selected RNA, a method that enriches for protein coding RNAs and at the same time discards the vast majority of RNA prior to analysis. We further show the presence of a large number of very long, abundantly-transcribed regions (100's of kb in intergenic space and further show that expression of these regions is associated with neoplastic transformation. These overlap some regions found previously in normal human embryonic tissues and raises an interesting hypothesis as to the function of these ncRNAs in both early development and neoplastic transformation. Conclusions We conclude that 'dark matter' RNA can constitute the majority of non-ribosomal, non-mitochondrial-RNA and a significant fraction arises from numerous very long

  12. Insects' RNA Profiling Reveals Absence of "Hidden Break" in 28S Ribosomal RNA Molecule of Onion Thrips, Thrips tabaci.

    Science.gov (United States)

    Macharia, Rosaline Wanjiru; Ombura, Fidelis Levi; Aroko, Erick Onyango

    2015-01-01

    With an exception of aphids, insects' 28S rRNA is thought to harbor a "hidden break" which cleaves under denaturing conditions to comigrate with 18S rRNA band to exhibit a degraded appearance on native agarose gels. The degraded appearance confounds determination of RNA integrity in laboratories that rely on gel electrophoresis. To provide guidelines for RNA profiles, RNA from five major insect orders, namely, Diptera, Hemiptera, Thysanoptera, Hymenoptera, and Lepidoptera, was compared under denaturing and nondenaturing conditions. This study confirmed that although present in most of insect's RNA, the "hidden break" is absent in the 28S rRNA of onion thrips, Thrips tabaci. On the other hand, presence of "hidden break" was depicted in whiteflies' 28S rRNA despite their evolutionary grouping under same order with aphids. Divergence of 28S rRNA sequences confirms variation of both size and composition of gap region among insect species. However, phylogeny reconstruction does not support speciation as a possible source of the hidden break in insect's 28S rRNA. In conclusion, we show that RNA from a given insect order does not conform to a particular banding profile and therefore this approach cannot be reliably used to characterize newly discovered species.

  13. CRM1 and its ribosome export adaptor NMD3 localize to the nucleolus and affect rRNA synthesis.

    Science.gov (United States)

    Bai, Baoyan; Moore, Henna M; Laiho, Marikki

    2013-01-01

    CRM1 is an export factor that together with its adaptor NMD3 transports numerous cargo molecules from the nucleus to cytoplasm through the nuclear pore. Previous studies have suggested that CRM1 and NMD3 are detected in the nucleolus. However, their localization with subnucleolar domains or participation in the activities of the nucleolus are unclear. We demonstrate here biochemically and using imaging analyses that CRM1 and NMD3 co-localize with nucleolar marker proteins in the nucleolus. In particular, their nucleolar localization is markedly increased by inhibition of RNA polymerase I (Pol I) transcription by actinomycin D or by silencing Pol I catalytic subunit, RPA194. We show that CRM1 nucleolar localization is dependent on its activity and the expression of NMD3, whereas NMD3 nucleolar localization is independent of CRM1. This suggests that NMD3 provides nucleolar tethering of CRM1. While inhibition of CRM1 by leptomycin B inhibited processing of 28S ribosomal (r) RNA, depletion of NMD3 did not, suggesting that their effects on 28S rRNA processing are distinct. Markedly, depletion of NMD3 and inhibition of CRM1 reduced the rate of pre-47S rRNA synthesis. However, their inactivation did not lead to nucleolar disintegration, a hallmark of Pol I transcription stress, suggesting that they do not directly regulate transcription. These results indicate that CRM1 and NMD3 have complex functions in pathways that couple rRNA synthetic and processing engines and that the rRNA synthesis rate may be adjusted according to proficiency in rRNA processing and export.

  14. Decoding the Long Noncoding RNA During Cardiac Maturation: A Roadmap for Functional Discovery.

    Science.gov (United States)

    Touma, Marlin; Kang, Xuedong; Zhao, Yan; Cass, Ashley A; Gao, Fuying; Biniwale, Reshma; Coppola, Giovanni; Xiao, Xinshu; Reemtsen, Brian; Wang, Yibin

    2016-10-01

    Cardiac maturation during perinatal transition of heart is critical for functional adaptation to hemodynamic load and nutrient environment. Perturbation in this process has major implications in congenital heart defects. Transcriptome programming during perinatal stages is an important information but incomplete in current literature, particularly, the expression profiles of the long noncoding RNAs (lncRNAs) are not fully elucidated. From comprehensive analysis of transcriptomes derived from neonatal mouse heart left and right ventricles, a total of 45 167 unique transcripts were identified, including 21 916 known and 2033 novel lncRNAs. Among these lncRNAs, 196 exhibited significant dynamic regulation along maturation process. By implementing parallel weighted gene co-expression network analysis of mRNA and lncRNA data sets, several lncRNA modules coordinately expressed in a developmental manner similar to protein coding genes, while few lncRNAs revealed chamber-specific patterns. Out of 2262 lncRNAs located within 50 kb of protein coding genes, 5% significantly correlate with the expression of their neighboring genes. The impact of Ppp1r1b-lncRNA on the corresponding partner gene Tcap was validated in cultured myoblasts. This concordant regulation was also conserved in human infantile hearts. Furthermore, the Ppp1r1b-lncRNA/Tcap expression ratio was identified as a molecular signature that differentiated congenital heart defect phenotypes. The study provides the first high-resolution landscape on neonatal cardiac lncRNAs and reveals their potential interaction with mRNA transcriptome during cardiac maturation. Ppp1r1b-lncRNA was identified as a regulator of Tcap expression, with dynamic interaction in postnatal cardiac development and congenital heart defects. © 2016 American Heart Association, Inc.

  15. Engineered ribosomal RNA operon copy-number variants of E. coli reveal the evolutionary trade-offs shaping rRNA operon number.

    Science.gov (United States)

    Gyorfy, Zsuzsanna; Draskovits, Gabor; Vernyik, Viktor; Blattner, Frederick F; Gaal, Tamas; Posfai, Gyorgy

    2015-02-18

    Ribosomal RNA (rrn) operons, characteristically present in several copies in bacterial genomes (7 in E. coli), play a central role in cellular physiology. We investigated the factors determining the optimal number of rrn operons in E. coli by constructing isogenic variants with 5-10 operons. We found that the total RNA and protein content, as well as the size of the cells reflected the number of rrn operons. While growth parameters showed only minor differences, competition experiments revealed a clear pattern: 7-8 copies were optimal under conditions of fluctuating, occasionally rich nutrient influx and lower numbers were favored in stable, nutrient-limited environments. We found that the advantages of quick adjustment to nutrient availability, rapid growth and economic regulation of ribosome number all contribute to the selection of the optimal rrn operon number. Our results suggest that the wt rrn operon number of E. coli reflects the natural, 'feast and famine' life-style of the bacterium, however, different copy numbers might be beneficial under different environmental conditions. Understanding the impact of the copy number of rrn operons on the fitness of the cell is an important step towards the creation of functional and robust genomes, the ultimate goal of synthetic biology.

  16. Accuracy of initial codon selection by aminoacyl-tRNAs on the mRNA-programmed bacterial ribosome.

    Science.gov (United States)

    Zhang, Jingji; Ieong, Ka-Weng; Johansson, Magnus; Ehrenberg, Måns

    2015-08-04

    We used a cell-free system with pure Escherichia coli components to study initial codon selection of aminoacyl-tRNAs in ternary complex with elongation factor Tu and GTP on messenger RNA-programmed ribosomes. We took advantage of the universal rate-accuracy trade-off for all enzymatic selections to determine how the efficiency of initial codon readings decreased linearly toward zero as the accuracy of discrimination against near-cognate and wobble codon readings increased toward the maximal asymptote, the d value. We report data on the rate-accuracy variation for 7 cognate, 7 wobble, and 56 near-cognate codon readings comprising about 15% of the genetic code. Their d values varied about 400-fold in the 200-80,000 range depending on type of mismatch, mismatch position in the codon, and tRNA isoacceptor type. We identified error hot spots (d = 200) for U:G misreading in second and U:U or G:A misreading in third codon position by His-tRNA(His) and, as also seen in vivo, Glu-tRNA(Glu). We suggest that the proofreading mechanism has evolved to attenuate error hot spots in initial selection such as those found here.

  17. Posttranscriptional down-regulation of small ribosomal subunit proteins correlates with reduction of 18S rRNA in RPS19 deficiency.

    Science.gov (United States)

    Badhai, Jitendra; Fröjmark, Anne-Sophie; Razzaghian, Hamid Reza; Davey, Edward; Schuster, Jens; Dahl, Niklas

    2009-06-18

    Ribosomal protein S19 (RPS19) is mutated in patients with Diamond-Blackfan anemia (DBA). We hypothesized that decreased levels of RPS19 lead to a coordinated down-regulation of other ribosomal (r-)proteins at the subunit level. We show that small interfering RNA (siRNA) knock-down of RPS19 results in a relative decrease of small subunit (SSU) r-proteins (S20, S21 and S24) when compared to large subunit (LSU) r-proteins (L3, L9, L30 and L38). This correlates with a relative decrease in 18S rRNA with respect to 28S rRNA. The r-protein mRNA levels remain relatively unchanged indicating a post transcriptional regulation of r-proteins at the level of subunit formation.

  18. Predicted class-I aminoacyl tRNA synthetase-like proteins in non-ribosomal peptide synthesis

    Directory of Open Access Journals (Sweden)

    Iyer Lakshminarayan M

    2010-08-01

    Full Text Available Abstract Background Recent studies point to a great diversity of non-ribosomal peptide synthesis systems with major roles in amino acid and co-factor biosynthesis, secondary metabolism, and post-translational modifications of proteins by peptide tags. The least studied of these systems are those utilizing tRNAs or aminoacyl-tRNA synthetases (AAtRS in non-ribosomal peptide ligation. Results Here we describe novel examples of AAtRS related proteins that are likely to be involved in the synthesis of widely distributed peptide-derived metabolites. Using sensitive sequence profile methods we show that the cyclodipeptide synthases (CDPSs are members of the HUP class of Rossmannoid domains and are likely to be highly derived versions of the class-I AAtRS catalytic domains. We also identify the first eukaryotic CDPSs in fungi and in animals; they might be involved in immune response in the latter organisms. We also identify a paralogous version of the methionyl-tRNA synthetase, which is widespread in bacteria, and present evidence using contextual information that it might function independently of protein synthesis as a peptide ligase in the formation of a peptide- derived secondary metabolite. This metabolite is likely to be heavily modified through multiple reactions catalyzed by a metal-binding cupin domain and a lysine N6 monooxygenase that are strictly associated with this paralogous methionyl-tRNA synthetase (MtRS. We further identify an analogous system wherein the MtRS has been replaced by more typical peptide ligases with the ATP-grasp or modular condensation-domains. Conclusions The prevalence of these predicted biosynthetic pathways in phylogenetically distant, pathogenic or symbiotic bacteria suggests that metabolites synthesized by them might participate in interactions with the host. More generally, these findings point to a complete spectrum of recruitment of AAtRS to various non-ribosomal biosynthetic pathways, ranging from the

  19. Neonatal Meningitis by Multidrug Resistant Elizabethkingia meningosepticum Identified by 16S Ribosomal RNA Gene Sequencing

    Directory of Open Access Journals (Sweden)

    V. V. Shailaja

    2014-01-01

    Full Text Available Clinical and microbiological profile of 9 neonates with meningitis by Elizabethkingia meningosepticum identified by 16S ribosomal gene sequencing was studied. All the clinical isolates were resistant to cephalosporins, aminoglycosides, trimethoprim-sulfamethoxazole, β-lactam combinations, carbapenems and only one isolate was susceptible to ciprofloxacin. All the isolates were susceptible to vancomycin. Six of nine neonates died even after using vancomycin, based on susceptibility results. E. meningosepticum meningitis in neonates results in high mortality rate. Though the organism is susceptible to vancomycin in vitro, its efficacy in vivo is questionable and it is difficult to determine the most appropriate antibiotic for treating E. meningosepticum meningitis in neonates.

  20. Open complex scrunching before nucleotide addition accounts for the unusual transcription start site of E. coli ribosomal RNA promoters.

    Science.gov (United States)

    Winkelman, Jared T; Chandrangsu, Pete; Ross, Wilma; Gourse, Richard L

    2016-03-29

    Most Escherichia coli promoters initiate transcription with a purine 7 or 8 nt downstream from the -10 hexamer, but some promoters, including the ribosomal RNA promoter rrnB P1, start 9 nt from the -10 element. We identified promoter and RNA polymerase determinants of this noncanonical rrnB P1 start site using biochemical and genetic approaches including mutational analysis of the promoter, Fe(2+) cleavage assays to monitor template strand positions near the active-site, and Bpa cross-linking to map the path of open complex DNA at amino acid and nucleotide resolution. We find that mutations in several promoter regions affect transcription start site (TSS) selection. In particular, we show that the absence of strong interactions between the discriminator region and σ region 1.2 and between the extended -10 element and σ region 3.0, identified previously as a determinant of proper regulation of rRNA promoters, is also required for the unusual TSS. We find that the DNA in the single-stranded transcription bubble of the rrnB P1 promoter complex expands and is "scrunched" into the active site channel of RNA polymerase, similar to the situation in initial transcribing complexes. However, in the rrnB P1 open complex, scrunching occurs before RNA synthesis begins. We find that the scrunched open complex exhibits reduced abortive product synthesis, suggesting that scrunching and unusual TSS selection contribute to the extraordinary transcriptional activity of rRNA promoters by increasing promoter escape, helping to offset the reduction in promoter activity that would result from the weak interactions with σ.

  1. Mapping posttranscriptional modifications in 5S ribosomal RNA by MALDI mass spectrometry

    DEFF Research Database (Denmark)

    Kirpekar, F; Douthwaite, S; Roepstorff, P

    2000-01-01

    RNases in parallel combined with further fragmentation by Post Source Decay (PSD). This approach allows fast and sensitive screening of a purified RNA for posttranscriptional modification, and has been applied on 5S rRNA from two thermophilic microorganisms, the bacterium Bacillus stearothermophilus...... that is clearly conserved with respect to both sequence and position in B. stearothermophilus and H. halobium and to some degree also in H. marismortui. However, no analogous modification was identified in the latter three organisms. We further find that the 5' end of H. halobium 5S rRNA is dephosphorylated......, in contrast to the other 5S rRNA species investigated. The method additionally gives an immediate indication of whether the expected RNA sequence is in agreement with the observed fragment masses. Discrepancies with two of the published 5S rRNA sequences were identified and are reported here....

  2. The sequence of the 5S ribosomal RNA of the crustacean Artemia salina

    OpenAIRE

    Diels, Ludo; De Baere, Raymond; Vandenberghe, Antoon; De Wachter, Rupert

    1981-01-01

    The primary structure of the 5 S rRNA isolated from the cryptobiotic cysts of the brine shrimp Artemia salina is pACCAACGGCCAUACCACGUUGAAAGUACCCAGUCUCGUCAGAUCCUGGAAGUCACACAACGUCGGGCCCGGUCAGUACUUGGAUGGGUGACCGCCUGGGAACACCGGGUGCUGUUGGCAU OH.

  3. Intra-genomic ribosomal RNA polymorphism and morphological variation in Elphidium macellum suggests inter-specific hybridization in foraminifera.

    Directory of Open Access Journals (Sweden)

    Loïc Pillet

    Full Text Available Elphidium macellum is a benthic foraminifer commonly found in the Patagonian fjords. To test whether its highly variable morphotypes are ecophenotypes or different genotypes, we analysed 70 sequences of the SSU rRNA gene from 25 specimens. Unexpectedly, we identified 11 distinct ribotypes, with up to 5 ribotypes co-occurring within the same specimen. The ribotypes differ by varying blocks of sequence located at the end of stem-loop motifs in the three expansion segments specific to foraminifera. These changes, distinct from typical SNPs and indels, directly affect the structure of the expansion segments. Their mosaic distribution suggests that ribotypes originated by recombination of two or more clusters of ribosomal genes. We propose that this expansion segment polymorphism (ESP could originate from hybridization of morphologically different populations of Patagonian Elphidium. We speculate that the complex geological history of Patagonia enhanced divergence of coastal foraminiferal species and contributed to increasing genetic and morphological variation.

  4. RNA:protein ratio of the unicellular organism as a characteristic of phosphorous and nitrogen stoichiometry and of the cellular requirement of ribosomes for protein synthesis

    Directory of Open Access Journals (Sweden)

    Sams Carl E

    2006-09-01

    Full Text Available Abstract Background Mean phosphorous:nitrogen (P:N ratios and relationships of P:N ratios with the growth rate of organisms indicate a surprising similarity among and within microbial species, plants, and insect herbivores. To reveal the cellular mechanisms underling this similarity, the macromolecular composition of seven microorganisms and the effect of specific growth rate (SGR on RNA:protein ratio, the number of ribosomes, and peptide elongation rate (PER were analyzed under different conditions of exponential growth. Results It was found that P:N ratios calculated from RNA and protein contents in these particular organisms were in the same range as the mean ratios reported for diverse organisms and had similar positive relationships with growth rate, consistent with the growth-rate hypothesis. The efficiency of protein synthesis in microorganisms is estimated as the number of active ribosomes required for the incorporation of one amino acid into the synthesized protein. This parameter is calculated as the SGR:PER ratio. Experimental and theoretical evidence indicated that the requirement of ribosomes for protein synthesis is proportional to the RNA:protein ratio. The constant of proportionality had the same values for all organisms, and was derived mechanistically from the characteristics of the protein-synthesis machinery of the cell (the number of nucleotides per ribosome, the average masses of nucleotides and amino acids, the fraction of ribosomal RNA in the total RNA, and the fraction of active ribosomes. Impairment of the growth conditions decreased the RNA:protein ratio and increased the overall efficiency of protein synthesis in the microorganisms. Conclusion Our results suggest that the decrease in RNA:protein and estimated P:N ratios with decrease in the growth rate of the microorganism is a consequence of an increased overall efficiency of protein synthesis in the cell resulting from activation of the general stress response and

  5. Import of desired nucleic acid sequences using addressing motif of mitochondrial ribosomal 5S-rRNA for fluorescent in vivo hybridization of mitochondrial DNA and RNA.

    Science.gov (United States)

    Zelenka, Jaroslav; Alán, Lukáš; Jabůrek, Martin; Ježek, Petr

    2014-04-01

    Based on the matrix-addressing sequence of mitochondrial ribosomal 5S-rRNA (termed MAM), which is naturally imported into mitochondria, we have constructed an import system for in vivo targeting of mitochondrial DNA (mtDNA) or mt-mRNA, in order to provide fluorescence hybridization of the desired sequences. Thus DNA oligonucleotides were constructed, containing the 5'-flanked T7 RNA polymerase promoter. After in vitro transcription and fluorescent labeling with Alexa Fluor(®) 488 or 647 dye, we obtained the fluorescent "L-ND5 probe" containing MAM and exemplar cargo, i.e., annealing sequence to a short portion of ND5 mRNA and to the light-strand mtDNA complementary to the heavy strand nd5 mt gene (5'-end 21 base pair sequence). For mitochondrial in vivo fluorescent hybridization, HepG2 cells were treated with dequalinium micelles, containing the fluorescent probes, bringing the probes proximally to the mitochondrial outer membrane and to the natural import system. A verification of import into the mitochondrial matrix of cultured HepG2 cells was provided by confocal microscopy colocalizations. Transfections using lipofectamine or probes without 5S-rRNA addressing MAM sequence or with MAM only were ineffective. Alternatively, the same DNA oligonucleotides with 5'-CACC overhang (substituting T7 promoter) were transcribed from the tetracycline-inducible pENTRH1/TO vector in human embryonic kidney T-REx®-293 cells, while mitochondrial matrix localization after import of the resulting unlabeled RNA was detected by PCR. The MAM-containing probe was then enriched by three-order of magnitude over the natural ND5 mRNA in the mitochondrial matrix. In conclusion, we present a proof-of-principle for mitochondrial in vivo hybridization and mitochondrial nucleic acid import.

  6. Structural and functional evaluation of interaction between mammalian ribosomal RNA with platinum-containing antineoplastic drugs.

    Science.gov (United States)

    Theile, Dirk; Kos, Martin

    2016-02-03

    Cisplatin, oxaliplatin, and carboplatin primarily target DNA, but also alter RNA functionality, albeit to different extent. This study determined the in vitro cytotoxicity (IC50 values) of platinum drugs in LS180 cells and compared the rRNA platination patterns following IC50 exposure. Relevance of particular secondary RNA structures for platination susceptibility was evaluated by primer extension methodology using 18S rRNA as a model RNA. Consequences of rRNA platination for translation efficiency were evaluated by monitoring fluorescence of a destabilised green fluorescent protein variant through flow cytometry. Oxaliplatin and cisplatin were most cytotoxic with IC50 values of 1.7 μM±0.8 and 4.1 μM±0.1, respectively. Carboplatin was significantly less efficient (IC50 147.1 μM±19.4). When exposed to equitoxic concentrations (respective IC50), all three compounds caused similar stop signal incidence or intensity. Moreover, the same rRNA sites were targeted without selectivity for particular secondary structures but with a slight preference for guanine-rich regions. Compared to cycloheximide, none of the drugs diminished translation efficiency at typical in vivo concentrations. In conclusion, equitoxic concentrations of platinum drugs target the same sites in cellular rRNA and cause similar platination intensities. At pharmacokinetically relevant concentrations, cisplatin, oxaliplatin or carboplatin do not inhibit translation efficiency. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  7. Activation of the ribosomal RNA genes late in the third cell cycle of porcine embryos

    DEFF Research Database (Denmark)

    Viuff, Dorthe; Greve, Torben; Holm, Peter

    2002-01-01

    electron microscopy. In general, the 2-cell and 4-cell embryos fixed at 10 and 20 h postcleavage (hpc) showed no signs of rRNA transcription. Four small clusters of fluorescein isothiocyanate (FITC) labeling were visible in interphase nuclei, consistent with hybridization to the rRNA gene clusters only...

  8. The major transcripts of the kinetoplast Trypanosoma brucei are very small ribosomal RNA's.

    NARCIS (Netherlands)

    I.C. Eperon; J.W.G. Janssen; J.H.J. Hoeijmakers (Jan); P. Borst (Piet)

    1983-01-01

    textabstractThe nucleotide sequence has been determined of a 2.2 kb segment of kinetoplast DNA, which encodes the major mitochondrial transcripts (12S and 9S) of Trypanosoma brucei. The sequence shows that the 12S RNA is a large subunit rRNA, although sufficiently unusual for resistance to chloramph

  9. Synergistic Internal Ribosome Entry Site/MicroRNA-Based Approach for Flavivirus Attenuation and Live Vaccine Development

    Directory of Open Access Journals (Sweden)

    Konstantin A. Tsetsarkin

    2017-04-01

    Full Text Available The recent emergence of Zika virus underscores the need for new strategies for a rapid development of safe flavivirus vaccines. Using another flavivirus (Langat virus [LGTV] that belongs to the group of tick-borne flaviviruses as a model, we describe a dual strategy for virus attenuation which synergistically accesses the specificity of microRNA (miRNA genome targeting and the effectiveness of internal ribosome entry site (IRES insertion. To increase the stability and immunogenicity of bicistronic LGTVs, we developed a novel approach in which the capsid (C protein gene was relocated into the 3′ noncoding region (NCR and expressed under translational control from an IRES. Engineered bicistronic LGTVs carrying multiple target sequences for brain-specific miRNAs were stable in Vero cells and induced adaptive immunity in mice. Importantly, miRNA-targeted bicistronic LGTVs were not pathogenic for either newborn mice after intracranial inoculation or adult immunocompromised mice (SCID or type I interferon receptor knockout after intraperitoneal injection. Moreover, bicistronic LGTVs were restricted for replication in tick-derived cells, suggesting an interruption of viral transmission in nature by arthropod vectors. This approach is suitable for reliable attenuation of many flaviviruses and may enable development of live attenuated flavivirus vaccines.

  10. Activation of the ribosomal RNA genes late in the third cell cycle of porcine embryos

    DEFF Research Database (Denmark)

    Viuff, Dorthe; Greve, Torben; Holm, Peter

    2002-01-01

    In porcine embryos, nucleoli are first observed during the third postfertilization cell cycle, i.e., at the 4-cell stage. However, direct studies of the initiation of rRNA transcription have not been reported. This transcription was investigated in the present study by simultaneous visualization...... of the rRNA genes and the rRNA by fluorescent in situ hybridization using a porcine 28S rDNA probe and subsequent visualization of argyrophilic nucleolar proteins by silver staining of extracted and fixed nuclei from in vivo-derived porcine embryos (n = 229). Nucleologenesis was observed by transmission...... electron microscopy. In general, the 2-cell and 4-cell embryos fixed at 10 and 20 h postcleavage (hpc) showed no signs of rRNA transcription. Four small clusters of fluorescein isothiocyanate (FITC) labeling were visible in interphase nuclei, consistent with hybridization to the rRNA gene clusters only...

  11. An intron within the 16S ribosomal RNA gene of the archaeon Pyrobaculum aerophilum

    Science.gov (United States)

    Burggraf, S.; Larsen, N.; Woese, C. R.; Stetter, K. O.

    1993-01-01

    The 16S rRNA genes of Pyrobaculum aerophilum and Pyrobaculum islandicum were amplified by the polymerase chain reaction, and the resulting products were sequenced directly. The two organisms are closely related by this measure (over 98% similar). However, they differ in that the (lone) 16S rRNA gene of Pyrobaculum aerophilum contains a 713-bp intron not seen in the corresponding gene of Pyrobaculum islandicum. To our knowledge, this is the only intron so far reported in the small subunit rRNA gene of a prokaryote. Upon excision the intron is circularized. A secondary structure model of the intron-containing rRNA suggests a splicing mechanism of the same type as that invoked for the tRNA introns of the Archaea and Eucarya and 23S rRNAs of the Archaea. The intron contains an open reading frame whose protein translation shows no certain homology with any known protein sequence.

  12. An intron within the 16S ribosomal RNA gene of the archaeon Pyrobaculum aerophilum

    Science.gov (United States)

    Burggraf, S.; Larsen, N.; Woese, C. R.; Stetter, K. O.

    1993-01-01

    The 16S rRNA genes of Pyrobaculum aerophilum and Pyrobaculum islandicum were amplified by the polymerase chain reaction, and the resulting products were sequenced directly. The two organisms are closely related by this measure (over 98% similar). However, they differ in that the (lone) 16S rRNA gene of Pyrobaculum aerophilum contains a 713-bp intron not seen in the corresponding gene of Pyrobaculum islandicum. To our knowledge, this is the only intron so far reported in the small subunit rRNA gene of a prokaryote. Upon excision the intron is circularized. A secondary structure model of the intron-containing rRNA suggests a splicing mechanism of the same type as that invoked for the tRNA introns of the Archaea and Eucarya and 23S rRNAs of the Archaea. The intron contains an open reading frame whose protein translation shows no certain homology with any known protein sequence.

  13. Massive-scale RNA-Seq analysis of non ribosomal transcriptome in human trisomy 21.

    Directory of Open Access Journals (Sweden)

    Valerio Costa

    Full Text Available Hybridization- and tag-based technologies have been successfully used in Down syndrome to identify genes involved in various aspects of the pathogenesis. However, these technologies suffer from several limits and drawbacks and, to date, information about rare, even though relevant, RNA species such as long and small non-coding RNAs, is completely missing. Indeed, none of published works has still described the whole transcriptional landscape of Down syndrome. Although the recent advances in high-throughput RNA sequencing have revealed the complexity of transcriptomes, most of them rely on polyA enrichment protocols, able to detect only a small fraction of total RNA content. On the opposite end, massive-scale RNA sequencing on rRNA-depleted samples allows the survey of the complete set of coding and non-coding RNA species, now emerging as novel contributors to pathogenic mechanisms. Hence, in this work we analysed for the first time the complete transcriptome of human trisomic endothelial progenitor cells to an unprecedented level of resolution and sensitivity by RNA-sequencing. Our analysis allowed us to detect differential expression of even low expressed genes crucial for the pathogenesis, to disclose novel regions of active transcription outside yet annotated loci, and to investigate a plethora of non-polyadenylated long as well as short non coding RNAs. Novel splice isoforms for a large subset of crucial genes, and novel extended untranslated regions for known genes--possibly novel miRNA targets or regulatory sites for gene transcription--were also identified in this study. Coupling the rRNA depletion of samples, followed by high-throughput RNA-sequencing, to the easy availability of these cells renders this approach very feasible for transcriptome studies, offering the possibility of investigating in-depth blood-related pathological features of Down syndrome, as well as other genetic disorders.

  14. Macrolides and lincomycin susceptibility of Mycoplasma hyorhinis and variable mutation of domain II and V in 23S ribosomal RNA.

    Science.gov (United States)

    Kobayashi, Hideki; Nakajima, Hiromi; Shimizu, Yuka; Eguchi, Masashi; Hata, Eiji; Yamamoto, Koshi

    2005-08-01

    A total of 151 strains of Mycoplasma hyorhinis isolated from porcine lung lesions (weaned pigs, n=71, and finishers, n=80) were investigated for their in vitro susceptibility to 10 antimicrobial agents. Thirty-one strains (28 from weaned pigs and 3 from finishers) showed resistance to 16-membered macrolide antibiotics and lincomycin. The prevalence of the 16-membered macrolide-resistant M. hyorhinis strain in weaned pigs from Japanese herds has approximately quadrupled in the past 10 years. Several of the 31 strains were examined for mutations in the 23S ribosomal RNA (rRNA). All field strains tested showed a transition of A to G at position 2059 of 23S rRNA-rendered Escherichia coli. On the other hand, individual tylosin- and lincomycin-resistant mutants of M. hyorhinis were selected in vitro from the susceptible type strain BTS7 by 3 to 9 serial passages in subinhibitory concentrations of each antibiotic. The 23S rRNA sequences of both tylosin and lincomycin-resistant mutants were compared with that of the radical BTS7 strain. The BTS7 mutant strain selected by tylosin showed the same transition as the field-isolated strains of A2059G. However, the transition selected in lincomycin showed mutations in domains II and V of 23S rRNA, G2597U, C2611U in domain V, and the addition of an adenine at the pentameric adenine loop in domain II. The strain selected by lincomycin showed an additional point mutation of A2062G selected by tylosin.

  15. Mitochondrial 12S Ribosomal RNA A1555G Mutation Associated with Cardiomyopathy and Hearing Loss following High-Dose Chemotherapy and Repeated Aminoglycoside Exposure

    DEFF Research Database (Denmark)

    Skou, Anne-Sofie; Tranebjærg, Lisbeth; Jensen, Tim

    2014-01-01

    A 19-month-old girl with the A1555G mitochondrial mutation in the 12S ribosomal RNA gene and acute myelogenous leukemia developed dilated cardiomyopathy and bilateral sensorineural hearing loss before undergoing allogeneic stem cell transplantation. She had received gentamicin during episodes...

  16. A ribosomal RNA gene intergenic spacer based PCR and DGGE fingerprinting method for the analysis of specific rhizobial communities in soil

    NARCIS (Netherlands)

    de Oliveira, VM; Manfio, GP; Coutinho, HLD; Keijzer-Wolters, AC; van Elsas, JD

    2006-01-01

    A direct molecular method for assessing the diversity of specific populations of rhizobia in soil, based on nested PCR amplification of 16S-23S ribosomal RNA gene (rDNA) intergenic spacer (IGS) sequences, was developed. Initial generic amplification of bacterial rDNA IGS sequences from soil DNA was

  17. A mutant RNA pseudoknot that promotes ribosomal frameshifting in mouse mammary tumor virus.

    Science.gov (United States)

    Kang, H; Tinoco, I

    1997-05-15

    A single A-->G mutation that changes a potential A.U base pair to a G.U pair at the junction of the stems and loops of a non-frameshifting pseudoknot dramatically increases its frameshifting efficiency in mouse mammary tumor virus. The structure of the non-frameshifting pseudoknot APK has been found to be very different from that of pseudoknots that cause efficient frameshifting [Kang,H., Hines,J.V. and Tinoco,I. (1995) J. Mol. Biol. , 259, 135-147]. The 3-dimensional structure of the mutant pseudoknot was determined by restrained molecular dynamics based on NMR-derived interproton distance and torsion angle constraints. One striking feature of the mutant pseudoknot compared with the parent pseudoknot is that a G.U base pair forms at the top of stem 2, thus leaving only 1 nt at the junction of the two stems. The conformation is very different from that of the previously determined non-frameshifting parent pseudoknot, which lacks the A.U base pair at the top of the stem and has 2 nt between the stems. However, the conformation is quite similar to that of efficient frameshifting pseudoknots whose structures were previously determined by NMR. A single adenylate residue intervenes between the two stems and interrupts their coaxial stacking. This unpaired nucleotide produces a bent structure. The structural similarity among the efficient frameshifting pseudoknots indicates that a specific conformation is required for ribosomal frameshifting, further implying a specific interaction of the pseudoknot with the ribosome.

  18. Purification and characterization of Moschatin, a novel type I ribosome-inactivating protein from the mature seeds of pumpkin (Cucurbita moschata), and preparation of its immunotoxin against human melanoma cells.

    Science.gov (United States)

    Xia, Heng Chuan; Li, Feng; Li, Zhen; Zhang, Zu Chuan

    2003-10-01

    A novel ribosome-inactivating protein designated Moschatin from the mature seeds of pumpkin (Cucurbita moschata) has been successively purified to homogeneity, using ammonium sulfate precipitation, CM-cellulose 52 column chromatography, Blue Sepharose CL-6B Affinity column chromatography and FPLC size-exclusion column chromatography. Moschatin is a type 1 RIP with a pI of 9.4 and molecular weight of approximately 29 kD. It is a rRNA N-glycosidase and potently blocked the protein synthesis in the rabbit reticulocyte lysate with a IC50 of 0.26 nM. Using the anti-human melanoma McAb Ng76, a novel immunotoxin Moschatin-Ng76 was prepared successfully and it efficiently inhibited the growth of targeted melanoma cells M21 with a IC50 of 0.04 nM, 1500 times lower than that of free Moschatin. The results implied that Moschatin could be used as a new potential anticancer agent.

  19. Purification and characterization of Moschatin, a novel type Ⅰ ribosome-inactivating protein from the mature seeds of pumpkin (Cucurbita moschata),and preparation of its immunotoxin against human melanoma cells

    Institute of Scientific and Technical Information of China (English)

    CHAO TONG; HENG YU FAN; DA YUAN CHEN; XIANG FEN SONG; HEIDE SCHATTEN; QING YUAN SUN

    2003-01-01

    A novel ribosome-inactivating protein designated Moschatin from the mature seeds of pumpkin (Cucurbita moschata) has been successively purified to homogeneity, using ammonium sulfate precipitation, CM-cellulose 52 column chromatography, Blue Sepharose CL-6B Affinity column chromatography and FPLC size-exclusion column chromatography. Moschatin is a type 1 RIP with a pI of 9.4 and molecular weight of~29 kD. It is a rRNA Nglycosidase and potently blocked the protein synthesis in the rabbit reticulocyte lysate with a IC50 of 0.26 nM. Using the anti-human melanoma McAb Ng76, a novel immunotoxin Moschatin-Ng76 was prepared successfully and it efficiently inhibited the growth of targeted melanoma cells M21 with a IC50 of 0.04 nM, 1500 times lower than that of free Moschatin. The results implied that Moschatin could be used as a new potential anticancer agent.

  20. Naked mole-rat has increased translational fidelity compared with the mouse, as well as a unique 28S ribosomal RNA cleavage

    Science.gov (United States)

    Azpurua, Jorge; Ke, Zhonghe; Chen, Iris X.; Zhang, Quanwei; Ermolenko, Dmitri N.; Zhang, Zhengdong D.; Gorbunova, Vera; Seluanov, Andrei

    2013-01-01

    The naked mole-rat (Heterocephalus glaber) is a subterranean eusocial rodent with a markedly long lifespan and resistance to tumorigenesis. Multiple data implicate modulation of protein translation in longevity. Here we report that 28S ribosomal RNA (rRNA) of the naked mole-rat is processed into two smaller fragments of unequal size. The two breakpoints are located in the 28S rRNA divergent region 6 and excise a fragment of 263 nt. The excised fragment is unique to the naked mole-rat rRNA and does not show homology to other genomic regions. Because this hidden break site could alter ribosome structure, we investigated whether translation rate and amino acid incorporation fidelity were altered. We report that naked mole-rat fibroblasts have significantly increased translational fidelity despite having comparable translation rates with mouse fibroblasts. Although we cannot directly test whether the unique 28S rRNA structure contributes to the increased fidelity of translation, we speculate that it may change the folding or dynamics of the large ribosomal subunit, altering the rate of GTP hydrolysis and/or interaction of the large subunit with tRNA during accommodation, thus affecting the fidelity of protein synthesis. In summary, our results show that naked mole-rat cells produce fewer aberrant proteins, supporting the hypothesis that the more stable proteome of the naked mole-rat contributes to its longevity. PMID:24082110

  1. Binding of helix-threading peptides to E. coli 16S ribosomal RNA and inhibition of the S15-16S complex.

    Science.gov (United States)

    Gooch, Barry D; Krishnamurthy, Malathy; Shadid, Mohammad; Beal, Peter A

    2005-12-01

    Helix-threading peptides (HTPs) constitute a new class of small molecules that bind selectively to duplex RNA structures adjacent to helix defects and project peptide functionality into the dissimilar duplex grooves. To further explore and develop the capabilities of the HTP design for binding RNA selectively, we identified helix 22 of the prokaryotic ribosomal RNA 16S as a target. This helix is a component of the binding site for the ribosomal protein S15. In addition, the S15-16S RNA interaction is important for the ordered assembly of the bacterial ribosome. Here we present the synthesis and characterization of helix-threading peptides that bind selectively to helix 22 of E. coli 16S RNA. These compounds bind helix 22 by threading intercalation placing the N termini in the minor groove and the C termini in the major groove. Binding is dependent on the presence of a highly conserved purine-rich internal loop in the RNA, whereas removal of the loop minimally affects binding of the classical intercalators ethidium bromide and methidiumpropyl-EDTAFe (MPEFe). Moreover, binding selectivity translates into selective inhibition of formation of the S15-16S complex.

  2. Mutations in eukaryotic 18S ribosomal RNA affect translational fidelity and resistance to aminoglycoside antibiotics.

    Science.gov (United States)

    Chernoff, Y O; Vincent, A; Liebman, S W

    1994-02-15

    Mutations have been created in the Saccharomyces cerevisiae 18S rRNA gene that correspond to those known to be involved in the control of translational fidelity or antibiotic resistance in prokaryotes. Yeast strains, in which essentially all chromosomal rDNA repeats are deleted and all cellular rRNAs are encoded by plasmid, have been constructed that contain only mutant 18S rRNA. In Escherichia coli, a C-->U substitution at position 912 of the small subunit rRNA causes streptomycin resistance. Eukaryotes normally carry U at the corresponding position and are naturally resistant to streptomycin. We show that a U-->C transition (rdn-4) at this position of the yeast 18S rRNA gene decreases resistance to streptomycin. The rdn-4 mutation also increases resistance to paromomycin and G-418, and inhibits nonsense suppression induced by paromomycin. The same phenotypes, as well as a slow growth phenotype, are also associated with rdn-2, whose prokaryotic counterpart, 517 G-->A, manifests itself as a suppressor rather than an antisuppressor. Neither rdn-2- nor rdn-4-related phenotypes could be detected in the presence of the normal level of wild-type rDNA repeats. Our data demonstrate that eukaryotic rRNA is involved in the control of translational fidelity, and indicate that rRNA features important for interactions with aminoglycosides have been conserved throughout evolution.

  3. Comment on ``Length-dependent translation of messenger RNA by ribosomes''

    Science.gov (United States)

    Zhang, Yunxin

    2012-02-01

    In a recent paper by Valleriani [Phys. Rev. EPLEEE81539-375510.1103/PhysRevE.83.042903 83, 042903 (2011)], a simple model for the translation of messenger RNA (mRNA) is presented. Using this model, the protein translational ratio r, defined as the ratio of protein translation rate ωtl from mRNA to protein degradation rate ωp, is obtained. The key point in obtaining the translational ratio r is to get the protein translation rate ωtl. In Valleriani 's paper, ωtl is obtained as the mean value of the measured translation rate, which is the ratio of the synthesized protein number to the mRNA lifetime. However, in experiments, different methods might be used to obtain the value of ωtl. Therefore, to apply Valleriani 's model to more general experiments, in this Comment three methods to obtain the translation rate ωtl, and consequently the translational ratio r, are presented. Based on one of the methods which might be employed in most of the experiments, we find that the translational ratio r decays exponentially with mRNA length in prokaryotic cells, and decays reciprocally with mRNA length in eukaryotic cells. This result is slight different from that which was obtained in Valleriani 's paper.

  4. Peptidyl transferase antibiotics perturb the relative positioning of the 3'-terminal adenosine of P/P'-site-bound tRNA and 23S rRNA in the ribosome

    DEFF Research Database (Denmark)

    Kirillov, S V; Porse, B T; Garrett, R A

    1999-01-01

    A range of antibiotic inhibitors that act within the peptidyl transferase center of the ribosome were examined for their capacity to perturb the relative positioning of the 3' end of P/P'-site-bound tRNA and the Escherichia coli ribosome. The 3'-terminal adenosines of deacylated tRNA and N......-Ac-Phe-tRNA were derivatized at the 2 position with an azido group and the tRNAs were cross-linked to the ribosome on irradiation with ultraviolet light at 365 nm. The cross-links were localized on the rRNA within extended versions of three previously characterized 23S rRNA fragments F1', F2', and F4......' at nucleotides C2601/A2602, U2584/U2585 (F1'), U2506 (F2'), and A2062/C2063 (F4'). Each of these nucleotides lies within the peptidyl transferase loop region of the 23S rRNA. Cross-links were also formed with ribosomal proteins L27 (strong) and L33 (weak), as shown earlier. The antibiotics sparsomycin...

  5. The RNA-binding protein, ZFP36L2, influences ovulation and oocyte maturation.

    Directory of Open Access Journals (Sweden)

    Christopher B Ball

    Full Text Available ZFP36L2 protein destabilizes AU-rich element-containing transcripts and has been implicated in female fertility. In the C57BL/6NTac mouse, a mutation in Zfp36l2 that results in the decreased expression of a form of ZFP36L2 in which the 29 N-terminal amino acid residues have been deleted, ΔN-ZFP36L2, leads to fertilized eggs that arrest at the two-cell stage. Interestingly, homozygous ΔN-Zfp36l2 females in the C57BL/6NTac strain release 40% fewer eggs than the WT littermates (Ramos et al., 2004, suggesting an additional defect in ovulation and/or oocyte maturation. Curiously, the same ΔN-Zfp36l2 mutation into the SV129 strain resulted in anovulation, prompting us to investigate a potential problem in ovulation and oocyte maturation. Remarkably, only 20% of ΔN-Zfp36l2 oocytes in the 129S6/SvEvTac strain matured ex vivo, suggesting a defect on the oocyte meiotic maturation process. Treatment of ΔN-Zfp36l2 oocytes with a PKA inhibitor partially rescued the meiotic arrested oocytes. Furthermore, cAMP levels were increased in ΔN-Zfp36l2 oocytes, linking the cAMP/PKA pathway and ΔN-Zfp36l2 with meiotic arrest. Since ovulation and oocyte maturation are both triggered by LHR signaling, the downstream pathway was investigated. Adenylyl cyclase activity was increased in ΔN-Zfp36l2 ovaries only upon LH stimulation. Moreover, we discovered that ZFP36L2 interacts with the 3'UTR of LHR mRNA and that decreased expression levels of Zfp36l2 correlates with higher levels of LHR mRNA in synchronized ovaries. Furthermore, overexpression of ZFP36L2 decreases the endogenous expression of LHR mRNA in a cell line. Therefore, we propose that lack of the physiological down regulation of LHR mRNA levels by ZFP36L2 in the ovaries is associated with anovulation and oocyte meiotic arrest.

  6. Site-specific reverse splicing of a HEG-containing group I intron in ribosomal RNA

    Science.gov (United States)

    Birgisdottir, Åsa B.; Johansen, Steinar

    2005-01-01

    The wide, but scattered distribution of group I introns in nature is a result of two processes; the vertical inheritance of introns with or without losses, and the occasional transfer of introns across species barriers. Reversal of the group I intron self-splicing reaction, termed reverse splicing, coupled with reverse transcription and genomic integration potentially mediate an RNA-based intron mobility pathway. Compared to the well characterized endonuclease-mediated intron homing, reverse splicing is less specific and represents a likely explanation for many intron transpositions into new genomic sites. However, the frequency and general role of an RNA-based mobility pathway in the spread of natural group I introns is still unclear. We have used the twin-ribozyme intron (Dir.S956-1) from the myxomycete Didymium iridis to test how a mobile group I intron containing a homing endonuclease gene (HEG) selects between potential insertion sites in the small subunit (SSU) rRNA in vitro, in Escherichia coli and in yeast. Surprisingly, the results show a site-specific RNA-based targeting of Dir.S956-1 into its natural (S956) SSU rRNA site. Our results suggest that reverse splicing, in addition to the established endonuclease-mediated homing mechanism, potentially accounts for group I intron spread into the homologous sites of different strains and species. PMID:15817568

  7. Native Valve Endocarditis due to Corynebacterium striatum confirmed by 16S Ribosomal RNA Sequencing: A Case Report and Literature Review

    Science.gov (United States)

    2016-01-01

    Corynebacterium species are non-fermentous Gram-positive bacilli that are normal flora of human skin and mucous membranes and are commonly isolated in clinical specimens. Non-diphtheriae Corynebacterium are regarded as contaminants when found in blood culture. Currently, Corynebacterium striatum is considered one of the emerging nosocomial agents implicated in endocarditis and serious infections. We report a case of native-valve infective endocarditis caused by C. striatum, which was misidentified by automated identification system but identified accurately by 16S ribosomal RNA sequencing, in a 55-year-old male patient. The patient had two mobile vegetations on his mitral valve, both of which had high embolic risk. Through surgical valve replacement and an antibiotic regimen, the patient recovered completely. In unusual clinical scenarios, C. striatum should not be simply dismissed as a contaminant when isolated from clinical specimens. The possibility of C. striatum infection should be considered even in an immunocompetent patient, and we suggest a genotypic assay, such as 16S rRNA sequencing, to confirm species identity. PMID:27659439

  8. The phylogenetic position of Allocreadiidae (Trematoda: Digenea) from partial sequences of the 18S and 28S ribosomal RNA genes.

    Science.gov (United States)

    Choudhury, Anindo; Rosas Valdez, Rogelio; Johnson, Ryan C; Hoffmann, Brian; Pérez-Ponce de León, Gerardo

    2007-02-01

    Species of Allocreadiidae are an important component of the parasite fauna of freshwater vertebrates, particularly fishes, and yet their systematic relationships with other trematodes have not been clarified. Partial sequences of the 18S and 28S ribosomal RNA genes from 3 representative species of Allocreadiidae, i.e., Crepidostomum cooperi, Bunodera mediovitellata, and Polylekithum ictaluri, and from 79 other taxa representing 78 families of trematodes obtained from GenBank, were used in a phylogenetic analysis to address the relationships of Allocreadiidae with other plagiorchiiforms/plagiorchiidans. Maximum parsimony and Bayesian analyses of combined 18S and 28S rRNA gene sequence data place 2 of the allocreadiids, Crepidostomum cooperi and Bunodera mediovitellata, in a clade with species of Callodistomidae and Gorgoderidae, which, in turn is sister to a clade containing Polylekithum ictaluri and representatives of Encyclometridae, Dicrocoelidae, and Orchipedidae, a grouping supported by high bootstrap values. These results suggest that Polylekithum ictaluri is not an allocreadiid, a conclusion that is supported by reported differences between its cercaria and that of other allocreadiids. Although details of the life cycle of callodistomids, the sister taxon to Allocreadiidae, remain unknown, the relationship of Allocreadiidae and Gorgoderidae is consistent with their larval development in bivalve, rather than gastropod, molluscs, and with their host relationships (predominantly freshwater vertebrates). The results also indicate that, whereas Allocreadiidae is not a basal taxon, it is not included within the suborder Plagiorchiata. No support was found for a direct relationship between allocreadiids and opecoelids either.

  9. Study of several factors in RNA-protein cross-link formation induced by ionizing radiations within 70S ribosomes of E. coli MRE 600.

    Science.gov (United States)

    Ekert, B; Giocanti, N; Sabattier, R

    1986-09-01

    The induction of RNA-protein crosslinks in E. coli 70S ribosomes by gamma-irradiation was studied by measuring the dependence of cross-link formation on ribosome concentration. The inverse dependence of cross-link percentage upon concentration up to at least 20 A260 nm units ml-1 indicate that indirect effects seem to play a more major part than direct effects for these ribosome concentrations. The effect of various gases and free radical scavengers was used to determine the roles of the radicals H., CO2-., OH. and e-aq and to estimate their relative efficiencies for cross-links. They were found to be: 7.2(H.), 6(CO2-.), 2(OH.) and 1(e-aq). The extent of RNA-protein cross-link production in 70S ribosomes induced by gamma-rays and neutrons in the presence and absence of oxygen was also investigated. Cross-link formation was estimated by separation of linked and unlinked material on nitrocellulose filters or after separation by SDS-sucrose gradient centrifugation under dissociating conditions. Oxygen inhibited cross-link formation by both neutrons and gamma-rays. However, very few cross-links were formed in de-aerated solutions by exposure to neutrons, compared to those produced by gamma-rays under the same conditions. This suggests that molecular oxygen generated along the secondary particle track can reduce the formation of RNA-protein cross-links.

  10. mRNA translation during oocyte maturation plays a key role in development of primordial germ cells in Xenopus embryos

    Indian Academy of Sciences (India)

    Bahman Zeynali; Keith E Dixon

    2004-09-01

    It is believed that cytoplasmic localization in the egg is necessary for development of primordial germ cells (PGCs) in Xenopus embryos. In this study, we sought to determine if translation of maternal mRNA during oocyte maturation is involved in the development of PGCs. Donor oocytes were collected from both stimulated (those who receive gonadotropin) and unstimulated females, artificially matured and fertilized using a host transfer technique. Using chloramphenicol (50 M and 500 M RNA), RNA translation was inhibited during oocyte maturation. Our results showed that in unstimulated embryos treated with 50 M chloramphenicol, there was a significant reduction in the number of PGCs reaching genital ridges. In stimulated embryos, however, the number of PGCs was unchanged unless a higher concentration (500 M) of chloramphenicol was used. From these results it is suggested that maternal mRNA translation during oocyte maturation plays a key role in development of PGCs.

  11. Evolutionary relationships of the coelacanth, lungfishes, and tetrapods based on the 28S ribosomal RNA gene.

    Science.gov (United States)

    Zardoya, R; Meyer, A

    1996-05-28

    The origin of land vertebrates was one of the major transitions in the history of vertebrates. Yet, despite many studies that are based on either morphology or molecules, the phylogenetic relationships among tetrapods and the other two living groups of lobe-finned fishes, the coelacanth and the lungfishes, are still unresolved and debated. Knowledge of the relationships among these lineages, which originated back in the Devonian, has profound implications for the reconstruction of the evolutionary scenario of the conquest of land. We collected the largest molecular data set on this issue so far, about 3,500 base pairs from seven species of the large 28S nuclear ribosomal gene. All phylogenetic analyses (maximum parsimony, neighbor-joining, and maximum likelihood) point toward the hypothesis that lungfishes and coelacanths form a monophyletic group and are equally closely related to land vertebrates. This evolutionary hypothesis complicates the identification of morphological or physiological preadaptations that might have permitted the common ancestor of tetrapods to colonize land. This is because the reconstruction of its ancestral conditions would be hindered by the difficulty to separate uniquely derived characters from shared derived characters in the coelacanth/lungfish and tetrapod lineages. This molecular phylogeny aids in the reconstruction of morphological evolutionary steps by providing a framework; however, only paleontological evidence can determine the sequence of morphological acquisitions that allowed lobe-finned fishes to colonize land.

  12. Mature clustered, regularly interspaced, short palindromic repeats RNA (crRNA) length is measured by a ruler mechanism anchored at the precursor processing site.

    Science.gov (United States)

    Hatoum-Aslan, Asma; Maniv, Inbal; Marraffini, Luciano A

    2011-12-27

    Precise RNA processing is fundamental to all small RNA-mediated interference pathways. In prokaryotes, clustered, regularly interspaced, short palindromic repeats (CRISPR) loci encode small CRISPR RNAs (crRNAs) that protect against invasive genetic elements by antisense targeting. CRISPR loci are transcribed as a long precursor that is cleaved within repeat sequences by CRISPR-associated (Cas) proteins. In many organisms, this primary processing generates crRNA intermediates that are subject to additional nucleolytic trimming to render mature crRNAs of specific lengths. The molecular mechanisms underlying this maturation event remain poorly understood. Here, we defined the genetic requirements for crRNA primary processing and maturation in Staphylococcus epidermidis. We show that changes in the position of the primary processing site result in extended or diminished maturation to generate mature crRNAs of constant length. These results indicate that crRNA maturation occurs by a ruler mechanism anchored at the primary processing site. We also show that maturation is mediated by specific cas genes distinct from those genes involved in primary processing, showing that this event is directed by CRISPR/Cas loci.

  13. Phylogenetic analysis of subgenus vigna species using nuclear ribosomal RNA ITS: evidence of hybridization among Vigna unguiculata subspecies.

    Science.gov (United States)

    Vijaykumar, Archana; Saini, Ajay; Jawali, Narendra

    2010-01-01

    Molecular phylogeny among species belonging to subgenus Vigna (genus Vigna) was inferred based on internal transcribed spacer (ITS) sequences of 18S-5.8S-26S ribosomal RNA gene unit. Analysis showed a total of 356 polymorphic sites of which approximately 80% were parsimony informative. Phylogenetic reconstruction by neighbor joining and maximum parsimony methods placed the 57 Vigna accessions (belonging to 15 species) into 5 major clades. Five species viz. Vigna heterophylla, Vigna pubigera, Vigna parkeri, Vigna laurentii, and Vigna gracilis whose position in the subgenus was previously not known were placed in the section Vigna. A single accession (Vigna unguiculata ssp. tenuis, NI 1637) harbored 2 intragenomic ITS variants, indicative of 2 different types of ribosomal DNA (rDNA) repeat units. ITS variant type-I was close to ITS from V. unguiculata ssp. pubescens, whereas type-II was close to V. unguiculata ssp. tenuis. Transcript analysis clearly demonstrates that in accession NI 1637, rDNA repeat units with only type-II ITS variants are transcriptionally active. Evidence from sequence analysis (of 5.8S, ITS1, and ITS2) and secondary structure analysis (of ITS1 and ITS2) indicates that the type-I ITS variant probably does not belong to the pseudogenic rDNA repeat units. The results from phylogenetic and transcript analysis suggest that the rDNA units with the type-I ITS may have introgressed as a result of hybridization (between ssp. tenuis and ssp. pubescens); however, it has been epigenetically silenced. The results also demonstrate differential evolution of ITS sequence among wild and cultivated forms of V. unguiculata.

  14. Mapping posttranscriptional modifications in 5S ribosomal RNA by MALDI mass spectrometry

    DEFF Research Database (Denmark)

    Kirpekar, F; Douthwaite, S; Roepstorff, P

    2000-01-01

    RNases in parallel combined with further fragmentation by Post Source Decay (PSD). This approach allows fast and sensitive screening of a purified RNA for posttranscriptional modification, and has been applied on 5S rRNA from two thermophilic microorganisms, the bacterium Bacillus stearothermophilus...... and the archaeon Sulfolobus acidocaldarius, as well as the halophile archaea Halobacterium halobium and Haloarcula marismortui. One S. acidocaldarius posttranscriptional modification was identified and was further characterized by PSD as a methylation of cytidine32. The modified C is located in a region...

  15. Two forms of RNA editing are required for tRNA maturation in Physarum mitochondria

    Science.gov (United States)

    Gott, Jonatha M.; Somerlot, Benjamin H.; Gray, Michael W.

    2010-01-01

    The mitochondrial genome of Physarum polycephalum encodes five tRNAs, four of which are edited by nucleotide insertion. Two of these tRNAs, tRNAmet1 and tRNAmet2, contain predicted mismatches at the beginning (proximal end) of the acceptor stem. In addition, the putative 5′ end of tRNAmet2 overlaps the 3′ end of a small, abundant, noncoding RNA, which we term ppoRNA. These anomalies led us to hypothesize that these two Physarum mitochondrial tRNAs undergo additional editing events. Here, we show that tRNAmet1 and tRNAmet2 each has a nonencoded G at its 5′ end. In contrast to the other nucleotides that are added to Physarum mitochondrial RNAs, these extra G residues are likely added post-transcriptionally based on (1) the absence of added G in precursor transcripts containing inserted C and AA residues, (2) the presence of potential intermediates characteristic of 5′ replacement editing, and (3) preferential incorporation of GTP into tRNA molecules under conditions that do not support transcription. This is the first report of both post-transcriptional nucleotide insertions and the addition of single Gs in P. polycephalum mitochondrial transcripts. We postulate that tRNAmet1 and tRNAmet2 are acted upon by an activity similar to that present in the mitochondria of certain other amoebozoons and chytrid fungi, suggesting that enzymes that repair the 5′ end of tRNAs may be widespread. PMID:20106952

  16. Defining the structural requirements for a helix in 23 S ribosomal RNA that confers erythromycin resistance

    DEFF Research Database (Denmark)

    Douthwaite, S; Powers, T; Lee, J Y

    1989-01-01

    deletion mutants show a sensitive phenotype. Deletions that extend into the base-pairing between GCC1208 and GGU1240 result in non-functional 23 S RNAs, which consequently do not confer resistance. A number of phylogenetically conserved nucleotides have been shown to be non-essential for 23 S RNA function...

  17. Ribosomal RNA genes challenge the monophyly of the Hyalospheniidae (Amoebozoa: Arcellinida)

    DEFF Research Database (Denmark)

    Lara, Enrique; Heger, Thierry J; Ekelund, Flemming

    2008-01-01

    To date only five partial and two complete SSU rRNA gene sequences are available for the lobose testate amoebae (Arcellinida). Consequently, the phylogenetic relationships among taxa and the definition of species are still largely dependant on morphological characters of uncertain value, which...

  18. Nematode Diversity of Qingdao Coast Inferred from the 18S Ribosomal RNA Gene Sequence Analysis

    Institute of Scientific and Technical Information of China (English)

    SHEN Xiquan; YANG Guanpin; LIU Yongjian

    2007-01-01

    The 18S ribosomal DNA gene (18S rDNA) sequences (approximately 1300 bp in length) were amplified from the DNA extracted from the free-living marine nematodes collected from the inter-tidal sediment of Qingdao coast in bulk with nematode specific primers. The PCR products were cloned, re-amplified, digested with Rsa I and Hin6Ⅰ restriction endonucleases and separated in agarose gel. Among 17 restriction fragment length types, types 1, 2 and 6 covered 61.2%, 14.4% and 9.3% of the clones analyzed, respectively, while the remaining 14 only covered 21 clones, which accounted for 15.1% of the total. Twenty-four representative clones were sequenced and phylogenetically analyzed by referring to those currently available in RDP and GenBank databases. Although it was hard to assign these sequences to known species or genera due to the lack of the 18S rDNA sequence data of known marine free-living nematodes, the obtained sequences were assigned to the nematodes of Adenophorea. Among them, twelve sequences were close to Pontonema vulgare and Adoncholaimus sp., four to Daptonemaprocerus and two (identical) to Enoplus brevis. Our results showed that free-living marine nematode diversities could be determined by PCR retrieving and analysis of the 18S rDNA sequences and an 18S rDNA sequence could be assigned to a species or a genus only if the 18S rDNA sequences of the free-living marine nematodes were accumulated to some extent.

  19. Ribosomal RNA gene silencing in interpopulation hybrids of Tigriopus californicus: nucleolar dominance in the absence of intergenic spacer subrepeats.

    Science.gov (United States)

    Flowers, Jonathan M; Burton, Ronald S

    2006-07-01

    A common feature of interspecific animal and plant hybrids is the uniparental silencing of ribosomal RNA gene transcription, or nucleolar dominance. A leading explanation for the genetic basis of nucleolar dominance in animal hybrids is the enhancer-imbalance model. The model proposes that limiting transcription factors are titrated by a greater number of enhancer-bearing subrepeat elements in the intergenic spacer (IGS) of the dominant cluster of genes. The importance of subrepeats for nucleolar dominance has repeatedly been supported in competition assays between Xenopus laevis and X. borealis minigene constructs injected into oocytes. However, a more general test of the importance of IGS subrepeats for nuclear dominance in vivo has not been conducted. In this report, rRNA gene expression was examined in interpopulation hybrids of the marine copepod Tigriopus californicus. This species offers a rare opportunity to test the role of IGS subrepeats in nucleolar dominance because the internal subrepeat structure, found in the IGS of virtually all animal and plant species, is absent in T. californicus. Our results clearly establish that nucleolar dominance occurs in F1 and F2 interpopulation hybrids of this species. In the F2 generation, nucleolar dominance appears to break down in some hybrids in a fashion that is inconsistent with a transcription factor titration model. These results are significant because they indicate that nucleolar dominance can be established and maintained without enhancer-bearing repeat elements in the IGS. This challenges the generality of the enhancer-imbalance model for nucleolar dominance and suggests that dominance of rRNA transcription in animals may be determined by epigenetic factors as has been established in plants.

  20. TAXONOMIC STATUS OF CAR BACILLUS BASED ON THE SMALL SUBUNIT RIBOSOMAL RNA SEQUENCES

    Institute of Scientific and Technical Information of China (English)

    魏强; TsujiM; TakahashiT; IshiharaC; ItohT

    1995-01-01

    In an attempt to identify the taxonomic relationship between CAR bacillus and other bacteria, the SSU rRNA gene sequences of two CAR bacillus strains, CBM and CBR isolated from mice and rats respectively were used in the present studies. The SSU rRNA gene sequences, approximately 1.5 kb in size amplified from genomic DNAs from both strains, were determined and 96. 8% homologies were found to exist be-tween them. Those sequences were aligned to most euhacteria with a computer search showing high homol-ogy with those of Flavobacter/Flexibacter species especially closed to Fx. sanai and Ft. ferrugineum. Phylogenetic analysts indicated that CAR bacillus belongs to a species close to Fx. sancti and Ft. ferrug-imum subdivision.

  1. Architecture of ribosomal RNA: Constraints on the sequence of tetra-loops

    Energy Technology Data Exchange (ETDEWEB)

    Woese, C.R. (Univ. of Illinois, Urbana (United States)); Winker, S. (Argonne National Lab., IL (United States)); Gutell, R.R. (Univ. of Illinois, Urbana (United States) Cangene Corp., Mississauga, Ontario (Canada))

    1990-11-01

    The four-base loops that cap many double-helical structures in rRNA (the so-called tetra-loops) exhibit highly invariant to highly variable sequences depending upon their location in the molecule. However, in the vast majority of these cases the sequence of a tetra-loop is independent of its location and conforms to one of three general motifs, GNRA, UNCG, and (more rarely) CUUG. For the most frequently varying of the 16S rRNA tetra-loops, that at position 83 (Escherichia coli numbering), the three sequences CUUG, UUCG, and GCAA account for almost all examples encountered, and each of them has independently arisen at least a dozen times. The closing base pair of tetra-loop hairpins reflects the loop sequence, tending to be C{center dot}G for CUUG loops.

  2. New Hosts of Simplicimonas similis and Trichomitus batrachorum Identified by 18S Ribosomal RNA Gene Sequences

    Directory of Open Access Journals (Sweden)

    Kris Genelyn B. Dimasuay

    2013-01-01

    Full Text Available Trichomonads are obligate anaerobes generally found in the digestive and genitourinary tract of domestic animals. In this study, four trichomonad isolates were obtained from carabao, dog, and pig hosts using rectal swab. Genomic DNA was extracted using Chelex method and the 18S rRNA gene was successfully amplified through novel sets of primers and undergone DNA sequencing. Aligned isolate sequences together with retrieved 18S rRNA gene sequences of known trichomonads were utilized to generate phylogenetic trees using maximum likelihood and neighbor-joining analyses. Two isolates from carabao were identified as Simplicimonas similis while each isolate from dog and pig was identified as Pentatrichomonas hominis and Trichomitus batrachorum, respectively. This is the first report of S. similis in carabao and the identification of T. batrachorum in pig using 18S rRNA gene sequence analysis. The generated phylogenetic tree yielded three distinct groups mostly with relatively moderate to high bootstrap support and in agreement with the most recent classification. Pathogenic potential of the trichomonads in these hosts still needs further investigation.

  3. Sequence analysis of mitochondrial 16S ribosomal RNA gene fragment from seven mosquito species

    Indian Academy of Sciences (India)

    Yogesh S Shouche; Milind S Patole

    2000-12-01

    Mosquitoes are vectors for the transmission of many human pathogens that include viruses, nematodes and protozoa. For the understanding of their vectorial capacity, identification of disease carrying and refractory strains is essential. Recently, molecular taxonomic techniques have been utilized for this purpose. Sequence analysis of the mitochondrial 16S rRNA gene has been used for molecular taxonomy in many insects. In this paper, we have analysed a 450 bp hypervariable region of the mitochondrial 16S rRNA gene in three major genera of mosquitoes, Aedes, Anopheles and Culex. The sequence was found to be unusually A + T rich and in substitutions the rate of transversions was higher than the transition rate. A phylogenetic tree was constructed with these sequences. An interesting feature of the sequences was a stretch of Ts that distinguished between Aedes and Culex on the one hand, and Anopheles on the other. This is the first report of mitochondrial rRNA sequences from these medically important genera of mosquitoes.

  4. Comparison of 16S ribosomal RNA genes in Clavibacter michiganensis subspecies with other coryneform bacteria.

    Science.gov (United States)

    Li, X; De Boer, S H

    1995-10-01

    Nearly complete sequences (97-99%) of the 16S rRNA genes were determined for type strains of Clavibacter michiganensis subsp. michiganensis, Clavibacter michiganensis subsp. insidiosus, Clavibacter michiganensis subsp. sepedonicus, and Clavibacter michiganensis subsp. nebraskensis. The four subspecies had less than 1% dissimilarity in their 16S rRNA genes. Comparative studies indicated that the C. michiganensis subsp. shared relatively high homology with the 16S rRNA gene of Clavibacter xyli. Further comparison with representatives of other Gram-positive coryneform and related bacteria with high G+C% values showed that this group of bacteria was subdivided into three clusters. One cluster consisted of the Clavibacter michiganensis subsp., Clavibacter xyli, Arthrobacter globiformis, Arthrobacter simplex, and Frankia sp.; another cluster consisted of members of the corynebacteria-mycobacteria-nocardia (CMN) group of Mycobacteriaceae including Tsukamurella paurometabolum; and Propionibacterium freudenreichii alone formed a unique cluster, which was remote from other coryneform bacteria analyzed. The three clusters may reflect a systematic rank higher than the genus level among these bacteria.

  5. Two trypanosome-specific proteins are essential factors for 5S rRNA abundance and ribosomal assembly in Trypanosoma brucei.

    Science.gov (United States)

    Hellman, Kristina M; Ciganda, Martin; Brown, Silvia V; Li, Jinlei; Ruyechan, William; Williams, Noreen

    2007-10-01

    We have previously identified and characterized two novel nuclear RNA binding proteins, p34 and p37, which have been shown to bind 5S rRNA in Trypanosoma brucei. These two proteins are nearly identical, with one major difference, an 18-amino-acid insert in the N-terminal region of p37, as well as three minor single-amino-acid differences. Homologues to p34 and p37 have been found only in other trypanosomatids, suggesting that these proteins are unique to this ancient family. We have employed RNA interference (RNAi) studies in order to gain further insight into the interaction between p34 and p37 with 5S rRNA in T. brucei. In our p34/p37 RNAi cells, decreased expression of the p34 and p37 proteins led to morphological alterations, including loss of cell shape and vacuolation, as well as to growth arrest and ultimately to cell death. Disruption of a higher-molecular-weight complex containing 5S rRNA occurs as well as a dramatic decrease in 5S rRNA levels, suggesting that p34 and p37 serve to stabilize 5S rRNA. In addition, an accumulation of 60S ribosomal subunits was observed, accompanied by a significant decrease in overall protein synthesis within p34/p37 RNAi cells. Thus, the loss of the trypanosomatid-specific proteins p34 and p37 correlates with a diminution in 5S rRNA levels as well as a decrease in ribosome activity and an alteration in ribosome biogenesis.

  6. SrmB, a DEAD-box helicase involved in Escherichia coli ribosome assembly, is specifically targeted to 23S rRNA in vivo.

    Science.gov (United States)

    Trubetskoy, Dmitrii; Proux, Florence; Allemand, Frédéric; Dreyfus, Marc; Iost, Isabelle

    2009-10-01

    DEAD-box proteins play specific roles in remodeling RNA or ribonucleoprotein complexes. Yet, in vitro, they generally behave as nonspecific RNA-dependent ATPases, raising the question of what determines their specificity in vivo. SrmB, one of the five Escherichia coli DEAD-box proteins, participates in the assembly of the large ribosomal subunit. Moreover, when overexpressed, it compensates for a mutation in L24, the ribosomal protein (r-protein) thought to initiate assembly. Here, using the tandem affinity purification (TAP) procedure, we show that SrmB forms a complex with r-proteins L4, L24 and a region near the 5'-end of 23S rRNA that binds these proteins. In vitro reconstitution experiments show that the stability of this complex reflects cooperative interactions of SrmB with L4, L24 and rRNA. These observations are consistent with an early role of SrmB in assembly and explain the genetic link between SrmB and L24. Besides its catalytic core, SrmB possesses a nonconserved C-terminal extension that, we show, is not essential for SrmB function and specificity. In this regard, SrmB differs from DbpA, another DEAD-box protein involved in ribosome assembly.

  7. Identification of Novel RNA-Protein Contact in Complex of Ribosomal Protein S7 and 3’-Terminal Fragment of 16S rRNA in E. coli

    Science.gov (United States)

    Golovin, A.V.; Khayrullina, G.A.; Kraal, B.; Kopylov, А.М.

    2012-01-01

    For prokaryotes in vitro, 16S rRNA and 20 ribosomal proteins are capable of hierarchical self- assembly yielding a 30S ribosomal subunit. The self-assembly is initiated by interactions between 16S rRNA and three key ribosomal proteins: S4, S8, and S7. These proteins also have a regulatory function in the translation of their polycistronic operons recognizing a specific region of mRNA. Therefore, studying the RNA–protein interactions within binary complexes is obligatory for understanding ribosome biogenesis. The non-conventional RNA–protein contact within the binary complex of recombinant ribosomal protein S7 and its 16S rRNA binding site (236 nucleotides) was identified. UV–induced RNA–protein cross-links revealed that S7 cross-links to nucleotide U1321 of 16S rRNA. The careful consideration of the published RNA– protein cross-links for protein S7 within the 30S subunit and their correlation with the X-ray data for the 30S subunit have been performed. The RNA – protein cross–link within the binary complex identified in this study is not the same as the previously found cross-links for a subunit both in a solution, and in acrystal. The structure of the binary RNA–protein complex formed at the initial steps of self-assembly of the small subunit appears to be rearranged during the formation of the final structure of the subunit. PMID:23346381

  8. Phylogenetic position of the genus Perkinsus (Protista, Apicomplexa) based on small subunit ribosomal RNA.

    Science.gov (United States)

    Goggin, C L; Barker, S C

    1993-07-01

    Parasites of the genus Perkinsus destroy marine molluscs worldwide. Their phylogenetic position within the kingdom Protista is controversial. Nucleotide sequence data (1792 bp) from the small subunit rRNA gene of Perkinsus sp. from Anadara trapezia (Mollusca: Bivalvia) from Moreton Bay, Queensland, was used to examine the phylogenetic affinities of this enigmatic genus. These data were aligned with nucleotide sequences from 6 apicomplexans, 3 ciliates, 3 flagellates, a dinoflagellate, 3 fungi, maize and human. Phylogenetic trees were constructed after analysis with maximum parsimony and distance matrix methods. Our analyses indicate that Perkinsus is phylogenetically closer to dinoflagellates and to coccidean and piroplasm apicomplexans than to fungi or flagellates.

  9. Specific 16S ribosomal RNA targeted oligonucleotide probe against Clavibacter michiganensis subsp. sepedonicus.

    Science.gov (United States)

    Mirza, M S; Rademaker, J L; Janse, J D; Akkermans, A D

    1993-11-01

    In this article we report on the polymerase chain reaction amplification of a partial 16S rRNA gene from the plant pathogenic bacterium Clavibacter michiganensis subsp. sepedonicus. A partial sequence (about 400 base pairs) of the gene was determined that covered two variable regions important for oligonucleotide probe development. A specific 24mer oligonucleotide probe targeted against the V6 region of 16S rRNA was designed. Specificity of the probe was determined using dot blot hybridization. Under stringent conditions (60 degrees C), the probe hybridized with all 16 Cl. michiganensis subsp. sepedonicus strains tested. Hybridization did not occur with 32 plant pathogenic and saprophytic bacteria used as controls under the same conditions. Under less stringent conditions (55 degrees C) the related Clavibacter michiganensis subsp. insidiosus, Clavibacter michiganensis subsp. nebraskensis, and Clavibacter michiganensis subsp. tesselarius also showed hybridization. At even lower stringency (40 degrees C), all Cl. michiganensis subspecies tested including Clavibacter michiganensis subsp. michiganensis showed hybridization signal, suggesting that under these conditions the probe may be used as a species-specific probe for Cl. michiganensis.

  10. Identification and characterization of rhizospheric microbial diversity by 16S ribosomal RNA gene sequencing

    Directory of Open Access Journals (Sweden)

    Muhammad Naveed

    2014-09-01

    Full Text Available In the present study, samples of rhizosphere and root nodules were collected from different areas of Pakistan to isolate plant growth promoting rhizobacteria. Identification of bacterial isolates was made by 16S rRNA gene sequence analysis and taxonomical confirmation on EzTaxon Server. The identified bacterial strains were belonged to 5 genera i.e. Ensifer, Bacillus, Pseudomona, Leclercia and Rhizobium. Phylogenetic analysis inferred from 16S rRNA gene sequences showed the evolutionary relationship of bacterial strains with the respective genera. Based on phylogenetic analysis, some candidate novel species were also identified. The bacterial strains were also characterized for morphological, physiological, biochemical tests and glucose dehydrogenase (gdh gene that involved in the phosphate solublization using cofactor pyrroloquinolone quinone (PQQ. Seven rhizoshperic and 3 root nodulating stains are positive for gdh gene. Furthermore, this study confirms a novel association between microbes and their hosts like field grown crops, leguminous and non-leguminous plants. It was concluded that a diverse group of bacterial population exist in the rhizosphere and root nodules that might be useful in evaluating the mechanisms behind plant microbial interactions and strains QAU-63 and QAU-68 have sequence similarity of 97 and 95% which might be declared as novel after further taxonomic characterization.

  11. Bacterial clade with the ribosomal RNA operon on a small plasmid rather than the chromosome.

    Science.gov (United States)

    Anda, Mizue; Ohtsubo, Yoshiyuki; Okubo, Takashi; Sugawara, Masayuki; Nagata, Yuji; Tsuda, Masataka; Minamisawa, Kiwamu; Mitsui, Hisayuki

    2015-11-17

    rRNA is essential for life because of its functional importance in protein synthesis. The rRNA (rrn) operon encoding 16S, 23S, and 5S rRNAs is located on the "main" chromosome in all bacteria documented to date and is frequently used as a marker of chromosomes. Here, our genome analysis of a plant-associated alphaproteobacterium, Aureimonas sp. AU20, indicates that this strain has its sole rrn operon on a small (9.4 kb), high-copy-number replicon. We designated this unusual replicon carrying the rrn operon on the background of an rrn-lacking chromosome (RLC) as the rrn-plasmid. Four of 12 strains close to AU20 also had this RLC/rrn-plasmid organization. Phylogenetic analysis showed that those strains having the RLC/rrn-plasmid organization represented one clade within the genus Aureimonas. Our finding introduces a previously unaddressed viewpoint into studies of genetics, genomics, and evolution in microbiology and biology in general.

  12. The differential expression of ribosomal 18S RNA paralog genes from the chaetognath Spadella cephaloptera.

    Science.gov (United States)

    Barthélémy, Roxane-Marie; Grino, Michel; Pontarotti, Pierre; Casanova, Jean-Paul; Faure, Eric

    2007-01-01

    Chaetognaths constitute a small marine phylum of approximately 120 species. Two classes of both 18S and 28S rRNA gene sequences have been evidenced in this phylum, even though significant intraindividual variation in the sequences of rRNA genes is unusual in animal genomes. These observations led to the hypothesis that this unusual genetic characteristic could play one or more physiological role(s). Using in situ hybridization on the frontal sections of the chaetognath Spadella cephaloptera, we found that the 18S Class I genes are expressed in the whole body, with a strong expression throughout the gut epithelium, whereas the expression of the 18S Class II genes is restricted to the oocytes. Our results could suggest that the paralog products of the 18S Class I genes are probably the "housekeeping" 18S rRNAs, whereas those of class II would only be essential in specific tissues. These results provide support for the idea that each type of 18S paralog is important for specific cellular functions and is under the control of selective factors.

  13. Identification and characterization of rhizospheric microbial diversity by 16S ribosomal RNA gene sequencing.

    Science.gov (United States)

    Naveed, Muhammad; Mubeen, Samavia; Khan, SamiUllah; Ahmed, Iftikhar; Khalid, Nauman; Suleria, Hafiz Ansar Rasul; Bano, Asghari; Mumtaz, Abdul Samad

    2014-01-01

    In the present study, samples of rhizosphere and root nodules were collected from different areas of Pakistan to isolate plant growth promoting rhizobacteria. Identification of bacterial isolates was made by 16S rRNA gene sequence analysis and taxonomical confirmation on EzTaxon Server. The identified bacterial strains were belonged to 5 genera i.e. Ensifer, Bacillus, Pseudomona, Leclercia and Rhizobium. Phylogenetic analysis inferred from 16S rRNA gene sequences showed the evolutionary relationship of bacterial strains with the respective genera. Based on phylogenetic analysis, some candidate novel species were also identified. The bacterial strains were also characterized for morphological, physiological, biochemical tests and glucose dehydrogenase (gdh) gene that involved in the phosphate solublization using cofactor pyrroloquinolone quinone (PQQ). Seven rhizoshperic and 3 root nodulating stains are positive for gdh gene. Furthermore, this study confirms a novel association between microbes and their hosts like field grown crops, leguminous and non-leguminous plants. It was concluded that a diverse group of bacterial population exist in the rhizosphere and root nodules that might be useful in evaluating the mechanisms behind plant microbial interactions and strains QAU-63 and QAU-68 have sequence similarity of 97 and 95% which might be declared as novel after further taxonomic characterization.

  14. Phylogenetics of the brachyuran crabs (Crustacea: Decapoda): the status of Podotremata based on small subunit nuclear ribosomal RNA.

    Science.gov (United States)

    Ahyong, Shane T; Lai, Joelle C Y; Sharkey, Deirdre; Colgan, Donald J; Ng, Peter K L

    2007-11-01

    The true crabs, the Brachyura, are generally divided into two major groups: Eubrachyura or 'advanced' crabs, and Podotremata or 'primitive' crabs. The status of Podotremata is one of the most controversial issues in brachyuran systematics. The podotreme crabs, best recognised by the possession of gonopores on the coxae of the pereopods, have variously been regarded as mono-, para- or polyphyletic, or even as non-brachyuran. For the first time, the phylogenetic positions of the podotreme crabs were studied by cladistic analysis of small subunit nuclear ribosomal RNA sequences. Eight of 10 podotreme families were represented along with representatives of 17 eubrachyuran families. Under both maximum parsimony and Bayesian Inference, Podotremata was found to be significantly paraphyletic, comprising three major clades: Dromiacea, Raninoida, and Cyclodorippoida. The most 'basal' is Dromiacea, followed by Raninoida and Cylodorippoida. Notably, Cyclodorippoida was identified as the sister group of the Eubrachyura. Previous hypotheses that the dromiid crab, Hypoconcha, is an anomuran were unsupported, though Dromiidae as presently composed could be paraphyletic. Topologies constrained for podotreme monophyly were found to be significantly worse (P < 0.04) than unconstrained topologies under Templeton and S-H tests. The clear pattern of podotreme paraphyly and robustness of topologies recovered indicates that Podotremata as a formal concept is untenable. Relationships among the eubrachyurans were generally equivocal, though results indicate the majoids or dorippoids were the least derived of the Eubrachyura. A new high level classification of the Brachyura is proposed.

  15. Automated insertion of sequences into a ribosomal RNA alignment: An application of computational linguistics in molecular biology

    Energy Technology Data Exchange (ETDEWEB)

    Taylor, R.C.

    1991-11-01

    This thesis involved the construction of (1) a grammar that incorporates knowledge on base invariancy and secondary structure in a molecule and (2) a parser engine that uses the grammar to position bases into the structural subunits of the molecule. These concepts were combined with a novel pinning technique to form a tool that semi-automates insertion of a new species into the alignment for the 16S rRNA molecule (a component of the ribosome) maintained by Dr. Carl Woese`s group at the University of Illinois at Urbana. The tool was tested on species extracted from the alignment and on a group of entirely new species. The results were very encouraging, and the tool should be substantial aid to the curators of the 16S alignment. The construction of the grammar was itself automated, allowing application of the tool to alignments for other molecules. The logic programming language Prolog was used to construct all programs involved. The computational linguistics approach used here was found to be a useful way to attach the problem of insertion into an alignment.

  16. Automated insertion of sequences into a ribosomal RNA alignment: An application of computational linguistics in molecular biology

    Energy Technology Data Exchange (ETDEWEB)

    Taylor, R.C.

    1991-11-01

    This thesis involved the construction of (1) a grammar that incorporates knowledge on base invariancy and secondary structure in a molecule and (2) a parser engine that uses the grammar to position bases into the structural subunits of the molecule. These concepts were combined with a novel pinning technique to form a tool that semi-automates insertion of a new species into the alignment for the 16S rRNA molecule (a component of the ribosome) maintained by Dr. Carl Woese's group at the University of Illinois at Urbana. The tool was tested on species extracted from the alignment and on a group of entirely new species. The results were very encouraging, and the tool should be substantial aid to the curators of the 16S alignment. The construction of the grammar was itself automated, allowing application of the tool to alignments for other molecules. The logic programming language Prolog was used to construct all programs involved. The computational linguistics approach used here was found to be a useful way to attach the problem of insertion into an alignment.

  17. Prevalent ciliate symbiosis on copepods: high genetic diversity and wide distribution detected using small subunit ribosomal RNA gene.

    Science.gov (United States)

    Guo, Zhiling; Liu, Sheng; Hu, Simin; Li, Tao; Huang, Yousong; Liu, Guangxing; Zhang, Huan; Lin, Senjie

    2012-01-01

    Toward understanding the genetic diversity and distribution of copepod-associated symbiotic ciliates and the evolutionary relationships with their hosts in the marine environment, we developed a small subunit ribosomal RNA gene (18S rDNA)-based molecular method and investigated the genetic diversity and genotype distribution of the symbiotic ciliates on copepods. Of the 10 copepod species representing six families collected from six locations of Pacific and Atlantic Oceans, 9 were found to harbor ciliate symbionts. Phylogenetic analysis of the 391 ciliate 18S rDNA sequences obtained revealed seven groups (ribogroups), six (containing 99% of all the sequences) belonging to subclass Apostomatida, the other clustered with peritrich ciliate Vorticella gracilis. Among the Apostomatida groups, Group III were essentially identical to Vampyrophrya pelagica, and the other five groups represented the undocumented ciliates that were close to Vampyrophrya/Gymnodinioides/Hyalophysa. Group VI ciliates were found in all copepod species but one (Calanus sinicus), and were most abundant among all ciliate sequences obtained, indicating that they are the dominant symbiotic ciliates universally associated with copepods. In contrast, some ciliate sequences were found only in some of the copepods examined, suggesting the host selectivity and geographic differentiation of ciliates, which requires further verification by more extensive sampling. Our results reveal the wide occurrence and high genetic diversity of symbiotic ciliates on marine copepods and highlight the need to systematically investigate the host- and geography-based genetic differentiation and ecological roles of these ciliates globally.

  18. Prevalent ciliate symbiosis on copepods: high genetic diversity and wide distribution detected using small subunit ribosomal RNA gene.

    Directory of Open Access Journals (Sweden)

    Zhiling Guo

    Full Text Available Toward understanding the genetic diversity and distribution of copepod-associated symbiotic ciliates and the evolutionary relationships with their hosts in the marine environment, we developed a small subunit ribosomal RNA gene (18S rDNA-based molecular method and investigated the genetic diversity and genotype distribution of the symbiotic ciliates on copepods. Of the 10 copepod species representing six families collected from six locations of Pacific and Atlantic Oceans, 9 were found to harbor ciliate symbionts. Phylogenetic analysis of the 391 ciliate 18S rDNA sequences obtained revealed seven groups (ribogroups, six (containing 99% of all the sequences belonging to subclass Apostomatida, the other clustered with peritrich ciliate Vorticella gracilis. Among the Apostomatida groups, Group III were essentially identical to Vampyrophrya pelagica, and the other five groups represented the undocumented ciliates that were close to Vampyrophrya/Gymnodinioides/Hyalophysa. Group VI ciliates were found in all copepod species but one (Calanus sinicus, and were most abundant among all ciliate sequences obtained, indicating that they are the dominant symbiotic ciliates universally associated with copepods. In contrast, some ciliate sequences were found only in some of the copepods examined, suggesting the host selectivity and geographic differentiation of ciliates, which requires further verification by more extensive sampling. Our results reveal the wide occurrence and high genetic diversity of symbiotic ciliates on marine copepods and highlight the need to systematically investigate the host- and geography-based genetic differentiation and ecological roles of these ciliates globally.

  19. 5S ribosomal RNA genes in six species of Mediterranean grey mullets: genomic organization and phylogenetic inference.

    Science.gov (United States)

    Gornung, Ekaterina; Colangelo, Paolo; Annesi, Flavia

    2007-09-01

    This paper describes a study of the 5S ribosomal RNA genes (5S rDNA) in a group of 6 species belonging to 4 genera of Mugilidae. In these 6 species, the relatively short 5S rDNA repeat units, generated by PCR and ranging in size from 219 to 257 bp, show a high level of intragenomic homogeneity of both coding and spacer regions (NTS-I). Phylogenetic reconstructions based on this data set highlight the greater phylogenetic and genetic diversity of Mugil cephalus and Oedalechilus labeo compared with the genera Liza and Chelon. Comparative sequence analysis revealed significant conservation of the short 5S rDNA repeat units across Chelon and Liza. Moreover, a second size class of 5S rDNA repeat units, ranging from roughly 800 to 1100 bp, was produced in the Liza and Chelon samples. Only short 5S rDNA repeat units were found in M. cephalus and O. labeo. The sequences of the long 5S rDNA repeat units, obtained in Chelon labrosus and Liza ramada, differ owing to the presence of 2 large insertion/deletions (indels) in the spacers (NTS-II) and show considerable sequence identity with NTS-I spacers. Interspecific sequence variation of NTS-II spacers, excluding the indels, is low. Southern-blot hybridization patterns suggest an intermixed arrangement of short and long repeat units within a single chromosome locus.

  20. A phylogeny of the Passerida(Aves: Passeriformes)based on mitochondrial 12S ribosomal RNA gene

    Institute of Scientific and Technical Information of China (English)

    Lina; Wu; Yanfeng; Sun; Juyong; Li; Yaqing; Li; Yuefeng; Wu; Dongming; Li

    2015-01-01

    Background: Passerida is the largest avian radiation within the order Passeriformes. Current understanding of the high-level relationships within Passerida is based on DNA–DNA hybridizations; however, the phylogenetic relationships within this assemblage have been the subject of many debates.Methods: We analyzed the 12 S ribosomal RNA gene from 49 species of Passerida, representing 14 currently recognized families, to outline the phylogenetic relationships within this group.Results: Our results identified the monophyly of the three superfamilies in Passerida: Sylvioidea, Muscicapoidea and Passeroidea. However, current delimitation of some species is at variance with our phylogeny estimate. First, the Parus major, which had been placed as a distinct clade sister to Sylvioidea was identified as a member of the super family;second, the genus Regulus was united with the Sturnidae and nested in the Muscicapoidea clade instead of being a clade of Passerida.Conclusion: Our results were consistent with Johansson’s study of the three superfamilies except for the al ocation of two families, Paridae and Regulidae.

  1. Effect of acidic ribosomal phosphoprotein mRNA 5'-untranslated region on gene expression and protein accumulation.

    Science.gov (United States)

    Bermejo, B; Remacha, M; Ortiz-Reyes, B; Santos, C; Ballesta, J P

    1994-02-11

    Constructions were made from genes encoding ribosomal acidic phosphoproteins YP1 beta (L44') and YP2 beta (L45) from Saccharomyces cerevisiae in which different parts of the 5'-untranslated regions were included. The constructs were inserted into centromeric plasmids under the control of the GAL1 promoter and expressed in yeast strains in which the genes coding for each acidic protein family, P1 and P2, had been disrupted. Deletions in the 5' region of the two genes have been found to oppositely affect their expression. Deletion of most of this region strongly stimulates the expression of YP2 beta (L45), increasing the translation efficiency of the mRNA, and generating a 6-fold excess of protein in the cell. A similar deletion in the rpYP1 beta gene represses the expression of the protein, reducing drastically the amount of the mRNA in the cell. The overexpression of rpYP2 beta affects the cell growth by inhibiting protein synthesis at the level of initiation. Reduction of the YP2 beta(L45) overproduction by growing in controlled concentrations of glucose abolishes the inhibitory effect. The excess protein, probably as a high molecular weight complex, apparently interferes with the joining of the 60 S subunit to the initiation complex generating the accumulation of polysome half-mers. In addition, the results indicate the existence of a regulatory mechanism by which each one of the two acidic proteins controls the expression of the other polypeptide. YP1 beta(L44') represses the expression of YP2 beta(L45), while this protein stimulates the expression of YP1 beta(L44').

  2. Heterogeneity within the gram-positive anaerobic cocci demonstrated by analysis of 16S-23S intergenic ribosomal RNA polymorphisms.

    Science.gov (United States)

    Hill, K E; Davies, C E; Wilson, M J; Stephens, P; Lewis, M A O; Hall, V; Brazier, J; Thomas, D W

    2002-11-01

    Peptostreptococci are gram-positive, strictly anaerobic bacteria which, although regarded as members of the commensal human microflora, are also frequently isolated from sites of clinical infection. The study of this diverse group of opportunist pathogens has been hindered by an inadequate taxonomy and the lack of a valid identification scheme. Recent re-classification of the Peptostreptococcus family into five distinct genus groups has helped to clarify the situation. However, this has been on the basis of 16S rRNA sequence determinations, which are both time-consuming and expensive. The aim of the present study was to evaluate the use of PCR-amplified ribosomal DNA spacer polymorphisms for the rapid differentiation of the currently recognised taxa within the group of anaerobic gram-positive cocci. A collection comprising 19 reference strains with representatives of each of the 15 species, two close relatives and two of the well-characterised groups, together with 38 test strains was studied. All strains were identified to species group level by phenotypic means. Amplification of the 16S-23S intergenic spacer region (ISR) with universal primers produced distinct banding patterns for all the 19 reference strains and the patterns could be differentiated easily visually. However, of the 38 test strains, less than half could be speciated from ISR analysis alone. Only five groups produced correlating banding patterns for all members tested (Peptoniphilus lacrimalis, P. ivorii, Anaerococcus octavius, Peptostreptococcus anaerobius and Micromonas micros). For other species, either the type strain differed significantly from other species members (e.g., A. hydrogenalis) or there appeared to be considerable intra-species variation (e.g., A. vaginalis). Partial 16S rRNA gene sequences for the 'trisimilis' and 'betaGAL' groups showed that both are most closely related to the Anaerococcus group. This work highlights the heterogeneous nature of a number of Peptostreptococcus

  3. Sensitivity of Ribosomal RNA Character Sampling in the Phylogeny of Rhabditida.

    Science.gov (United States)

    Holovachov, Oleksandr; Camp, Lauren; Nadler, Steven A

    2015-12-01

    Near-full-length 18S and 28S rRNA gene sequences were obtained for 33 nematode species. Datasets were constructed based on secondary structure and progressive multiple alignments, and clades were compared for phylogenies inferred by Bayesian and maximum likelihood methods. Clade comparisons were also made following removal of ambiguously aligned sites as determined using the program ProAlign. Different alignments of these data produced tree topologies that differed, sometimes markedly, when analyzed by the same inference method. With one exception, the same alignment produced an identical tree topology when analyzed by different methods. Removal of ambiguously aligned sites altered the tree topology and also reduced resolution. Nematode clades were sensitive to differences in multiple alignments, and more than doubling the amount of sequence data by addition of 28S rRNA did not fully mitigate this result. Although some individual clades showed substantially higher support when 28S data were combined with 18S data, the combined analysis yielded no statistically significant increases in the number of clades receiving higher support when compared to the 18S data alone. Secondary structure alignment increased accuracy in positional homology assignment and, when used in combination with paired-site substitution models, these structural hypotheses of characters and improved models of character state change yielded high levels of phylogenetic resolution. Phylogenetic results included strong support for inclusion of Daubaylia potomaca within Cephalobidae, whereas the position of Fescia grossa within Tylenchina varied depending on the alignment, and the relationships among Rhabditidae, Diplogastridae, and Bunonematidae were not resolved.

  4. Sensitivity of Ribosomal RNA Character Sampling in the Phylogeny of Rhabditida

    Science.gov (United States)

    Holovachov, Oleksandr; Camp, Lauren; Nadler, Steven A.

    2015-01-01

    Near-full-length 18S and 28S rRNA gene sequences were obtained for 33 nematode species. Datasets were constructed based on secondary structure and progressive multiple alignments, and clades were compared for phylogenies inferred by Bayesian and maximum likelihood methods. Clade comparisons were also made following removal of ambiguously aligned sites as determined using the program ProAlign. Different alignments of these data produced tree topologies that differed, sometimes markedly, when analyzed by the same inference method. With one exception, the same alignment produced an identical tree topology when analyzed by different methods. Removal of ambiguously aligned sites altered the tree topology and also reduced resolution. Nematode clades were sensitive to differences in multiple alignments, and more than doubling the amount of sequence data by addition of 28S rRNA did not fully mitigate this result. Although some individual clades showed substantially higher support when 28S data were combined with 18S data, the combined analysis yielded no statistically significant increases in the number of clades receiving higher support when compared to the 18S data alone. Secondary structure alignment increased accuracy in positional homology assignment and, when used in combination with paired-site substitution models, these structural hypotheses of characters and improved models of character state change yielded high levels of phylogenetic resolution. Phylogenetic results included strong support for inclusion of Daubaylia potomaca within Cephalobidae, whereas the position of Fescia grossa within Tylenchina varied depending on the alignment, and the relationships among Rhabditidae, Diplogastridae, and Bunonematidae were not resolved. PMID:26941463

  5. Mutagens interfere with microRNA maturation by inhibiting DICER. An in silico biology analysis.

    Science.gov (United States)

    Ligorio, Matteo; Izzotti, Alberto; Pulliero, Alessandra; Arrigo, Patrizio

    2011-12-01

    Exposure to environmental mutagens results in alteration of microRNA expression mainly oriented towards down-regulation, as typically observed in cigarette smoke. However, the molecular mechanism triggering this event is still unknown. To shed light on this issue, we developed an 'in silico' analysis testing 25 established environmental mutagens (polycyclic aromatic hydrocarbons, heterocyclic compounds, nitrosoamines, morpholine, ethylnitrosurea, benzene derivatives, hydroxyl amines, alkenes) for their potential to interfere with the function of DICER, the enzyme involved in the cytoplasmic phase of microRNA maturation. In order to analyse the binding affinity between DICER and each mutagen, the three-dimensional bioinformatic structures of DICER-RNase III domains and of mutagens have been constructed. The binding affinity of mutagens for each DICER's RNase III domain was estimated by calculating the global contact-energy and the number of intermolecular contacts. These two parameters reflect the stability of the DICER-mutagen complexes. All the 25 mutagens tested form stable complexes with DICER, 20 of which form a complex with DICER A domain, that is more stable than those formed by DICER with its natural substrate, i.e. double strand short RNAs. These mutagens are benzo(a)pyrene diol epoxide, nitroimidazoles, fluorenes, naphthalene, morpholine, stilbenes, hydroxylamines, fecapentenes. In the case of exposure to mutagen mixtures (benzo(a)pyrene-diolepoxide and 4-acetylaminostilbene), synergistic or less than addictive effects occur depending on the docking order of the compounds. A group of 8 mutagens with the highest ability to interfere with this DICER function, was identified by hierarchical cluster analysis. This group included 1-ethyl-1-nitrosourea and 4-nitrosomorpholine. Herein, presented data support the view that mutagens interfere with microRNA maturation by binding DICER. This finding sheds light on a new epigenetic mechanism exerted by environmental

  6. Using RNA-Seq to profile soybean seed development from fertilization to maturity.

    Science.gov (United States)

    Jones, Sarah I; Vodkin, Lila O

    2013-01-01

    To understand gene expression networks leading to functional properties and compositional traits of the soybean seed, we have undertaken a detailed examination of soybean seed development from a few days post-fertilization to the mature seed using Illumina high-throughput transcriptome sequencing (RNA-Seq). RNA was sequenced from seven different stages of seed development, yielding between 12 million and 78 million sequenced transcripts. These have been aligned to the 79,000 gene models predicted from the soybean genome recently sequenced by the Department of Energy Joint Genome Institute. Over one hundred gene models were identified with high expression exclusively in young seed stages, starting at just four days after fertilization. These were annotated as being related to many basic components and processes such as histones and proline-rich proteins. Genes encoding storage proteins such as glycinin and beta-conglycinin had their highest expression levels at the stages of largest fresh weight, confirming previous knowledge that these storage products are being rapidly accumulated before the seed begins the desiccation process. Other gene models showed high expression in the dry, mature seeds, perhaps indicating the preparation of pathways needed later, in the early stages of imbibition. Many highly-expressed gene models at the dry seed stage are, as expected, annotated as hydrophilic proteins associated with low water conditions, such as late embryogenesis abundant (LEA) proteins and dehydrins, which help preserve the cellular structures and nutrients within the seed during desiccation. More significantly, the power of RNA-Seq to detect genes expressed at low levels revealed hundreds of transcription factors with notable expression in at least one stage of seed development. Results from a second biological replicate demonstrate high reproducibility of these data revealing a comprehensive view of the transciptome of seed development in the cultivar Williams, the

  7. Using RNA-Seq to profile soybean seed development from fertilization to maturity.

    Directory of Open Access Journals (Sweden)

    Sarah I Jones

    Full Text Available To understand gene expression networks leading to functional properties and compositional traits of the soybean seed, we have undertaken a detailed examination of soybean seed development from a few days post-fertilization to the mature seed using Illumina high-throughput transcriptome sequencing (RNA-Seq. RNA was sequenced from seven different stages of seed development, yielding between 12 million and 78 million sequenced transcripts. These have been aligned to the 79,000 gene models predicted from the soybean genome recently sequenced by the Department of Energy Joint Genome Institute. Over one hundred gene models were identified with high expression exclusively in young seed stages, starting at just four days after fertilization. These were annotated as being related to many basic components and processes such as histones and proline-rich proteins. Genes encoding storage proteins such as glycinin and beta-conglycinin had their highest expression levels at the stages of largest fresh weight, confirming previous knowledge that these storage products are being rapidly accumulated before the seed begins the desiccation process. Other gene models showed high expression in the dry, mature seeds, perhaps indicating the preparation of pathways needed later, in the early stages of imbibition. Many highly-expressed gene models at the dry seed stage are, as expected, annotated as hydrophilic proteins associated with low water conditions, such as late embryogenesis abundant (LEA proteins and dehydrins, which help preserve the cellular structures and nutrients within the seed during desiccation. More significantly, the power of RNA-Seq to detect genes expressed at low levels revealed hundreds of transcription factors with notable expression in at least one stage of seed development. Results from a second biological replicate demonstrate high reproducibility of these data revealing a comprehensive view of the transciptome of seed development in the

  8. Effects of S-adenosylmethionine decarboxylase, polyamines, amino acids, and weak bases (amines and ammonia) on development and ribosomal RNA synthesis in Xenopus embryos.

    Science.gov (United States)

    Shiokawa, Koichiro; Aso, Mai; Kondo, Takeshi; Takai, Jun-Ichi; Yoshida, Junki; Mishina, Takamichi; Fuchimukai, Kota; Ogasawara, Tsukasa; Kariya, Taro; Tashiro, Kosuke; Igarashi, Kazuei

    2010-02-01

    We have been studying control mechanisms of gene expression in early embryogenesis in a South African clawed toad Xenopus laevis, especially during the period of midblastula transition (MBT), or the transition from the phase of active cell division (cleavage stage) to the phase of extensive morphogenesis (post-blastular stages). We first found that ribosomal RNA synthesis is initiated shortly after MBT in Xenopus embryos and those weak bases, such as amines and ammonium ion, selectively inhibit the initiation and subsequent activation of rRNA synthesis. We then found that rapidly labeled heterogeneous mRNA-like RNA is synthesized in embryos at pre-MBT stage. We then performed cloning and expression studies of several genes, such as those for activin receptors, follistatin and aldolases, and then reached the studies of S-adenosylmethionine decarboxylase (SAMDC), a key enzyme in polyamine metabolism. Here, we cloned a Xenopus SAMDC cDNA and performed experiments to overexpress the in vitro-synthesized SAMDC mRNA in Xenopus early embryos, and found that the maternally preset program of apoptosis occurs in cleavage stage embryos, which is executed when embryos reach the stage of MBT. In the present article, we first summarize results on SAMDC and the maternal program of apoptosis, and then describe our studies on small-molecular-weight substances like polyamines, amino acids, and amines in Xenopus embryos. Finally, we summarize our studies on weak bases, especially on ammonium ion, as the specific inhibitor of ribosomal RNA synthesis in Xenopus embryonic cells.

  9. The importance of highly conserved nucleotides in the binding region of chloramphenicol at the peptidyl transfer centre of Escherichia coli 23S ribosomal RNA

    DEFF Research Database (Denmark)

    Vester, Birte; Garrett, Roger Antony

    1988-01-01

    conserved nucleotides. With a view to investigate the function of this RNA region further, four of these conserved nucleotides, including one indirectly implicated in chloramphenicol binding, were selected for mutation in Escherichia coli 23S rRNA using oligonucleotide primers. Mutant RNAs were expressed......The peptidyl transfer site has been localized at the centre of domain V of 23S-like ribosomal RNA (rRNA) primarily on the basis of a chloramphenicol binding site. The implicated region constitutes an unstructured circle in the current secondary structural model which contains several universally...... in vivo on a plasmid-encoded rRNA (rrnB) operon and each one yielded dramatically altered phenotypes. Cells exhibiting A2060----C or A2450----C transversions were inviable and it was shown by inserting the mutated genes after a temperature-inducible promoter that the mutant RNAs were directly responsible...

  10. Ribosomal RNA phylogeny of bodonid and diplonemid flagellates and the evolution of euglenozoa.

    Science.gov (United States)

    von der Heyden, Sophie; Chao, Ema E; Vickerman, Keith; Cavalier-Smith, Thomas

    2004-01-01

    Euglenozoa is a major phylum of excavate protozoa (comprising euglenoids, kinetoplastids, and diplonemids) with highly unusual nuclear, mitochondrial, and chloroplast genomes. To improve understanding of euglenozoan evolution, we sequenced nuclear small-subunit rRNA genes from 34 bodonids (Bodo, Neobodo, Parabodo, Dimastigella-like, Rhynchobodo, Rhynchomonas, and unidentified strains), nine diplonemids (Diplonema, Rhynchopus), and a euglenoid (Entosiphon). Phylogenetic analysis reveals that diplonemids and bodonids are more diverse than previously recognised, but does not clearly establish the branching order of kinetoplastids, euglenoids, and diplonemids. Rhynchopus is holophyletic; parasitic species arose from within free-living species. Kinetoplastea (bodonids and trypanosomatids) are robustly holophyletic and comprise a major clade including all trypanosomatids and most bodonids ('core bodonids') and a very divergent minor one including Ichthyobodo. The root of the major kinetoplastid clade is probably between trypanosomatids and core bodonids. Core bodonids have three distinct subclades. Clade 1 has two distinct Rhynchobodo-like lineages; a lineage comprising Dimastigella and Rhynchomonas; and another including Cruzella and Neobodo. Clade 2 comprises Cryptobia/ Trypanoplasma, Procryptobia, and Parabodo. Clade 3 is an extensive Bodo saltans species complex. Neobodo designis is a vast genetically divergent species complex with mutually exclusive marine and freshwater subclades. Our analysis supports three phagotrophic euglenoid orders: Petalomonadida (holophyletic), Ploeotiida (probably holophyletic), Peranemida (paraphyletic).

  11. Maternal RNA regulates Aurora C kinase during mouse oocyte maturation in a translation-independent fashion.

    Science.gov (United States)

    Balboula, Ahmed Z; Blengini, Cecilia S; Gentilello, Amanda S; Takahashi, Masashi; Schindler, Karen

    2017-06-01

    During oocyte meiotic maturation, Aurora kinase C (AURKC) is required to accomplish many critical functions including destabilizing erroneous kinetochore-microtubule (K-MT)attachments and regulating bipolar spindle assembly. How localized activity of AURKC is regulated in mammalian oocytes, however, is not fully understood. Female gametes from many species, including mouse, contain stores of maternal transcripts that are required for downstream developmental events. We show here that depletion of maternal RNA in mouse oocytes resulted in impaired meiotic progression, increased incidence of chromosome misalignment and abnormal spindle formation at metaphase I (Met I), and cytokinesis defects. Importantly, depletion of maternal RNA perturbed the localization and activity of AURKC within the chromosomal passenger complex (CPC). These perturbations were not observed when translation was inhibited by cycloheximide (CHX) treatment. These results demonstrate a translation-independent function of maternal RNA to regulate AURKC-CPC function in mouse oocytes. © The Authors 2017. Published by Oxford University Press on behalf of Society for the Study of Reproduction. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  12. Molecular phylogenetic inference of the woolly mammoth Mammuthus primigenius, based on complete sequences of mitochondrial cytochrome b and 12S ribosomal RNA genes.

    Science.gov (United States)

    Noro, M; Masuda, R; Dubrovo, I A; Yoshida, M C; Kato, M

    1998-03-01

    Complete sequences of cytochrome b (1,137 bases) and 12S ribosomal RNA (961 bases) genes in mitochondrial DNA were successfully determined from the woolly mammoth (Mammuthus primigenius), African elephant (Loxodonta africana), and Asian elephant (Elephas maximus). From these sequence data, phylogenetic relationships among three genera were examined. Molecular phylogenetic trees reconstructed by the neighbor-joining and the maximum parsimony methods provided an identical topology both for cytochrome b and 12S rRNA genes. These results support the "Mammuthus-Loxodonta" clade, which is contrary to some previous morphological reports that Mammuthus is more closely related to Elephas than to Loxodonta.

  13. Codon-Anticodon Recognition in the Bacillus subtilis glyQS T Box Riboswitch: RNA-DEPENDENT CODON SELECTION OUTSIDE THE RIBOSOME.

    Science.gov (United States)

    Caserta, Enrico; Liu, Liang-Chun; Grundy, Frank J; Henkin, Tina M

    2015-09-18

    Many amino acid-related genes in Gram-positive bacteria are regulated by the T box riboswitch. The leader RNA of genes in the T box family controls the expression of downstream genes by monitoring the aminoacylation status of the cognate tRNA. Previous studies identified a three-nucleotide codon, termed the "Specifier Sequence," in the riboswitch that corresponds to the amino acid identity of the downstream genes. Pairing of the Specifier Sequence with the anticodon of the cognate tRNA is the primary determinant of specific tRNA recognition. This interaction mimics codon-anticodon pairing in translation but occurs in the absence of the ribosome. The goal of the current study was to determine the effect of a full range of mismatches for comparison with codon recognition in translation. Mutations were individually introduced into the Specifier Sequence of the glyQS leader RNA and tRNA(Gly) anticodon to test the effect of all possible pairing combinations on tRNA binding affinity and antitermination efficiency. The functional role of the conserved purine 3' of the Specifier Sequence was also verifiedin this study. We found that substitutions at the Specifier Sequence resulted in reduced binding, the magnitude of which correlates well with the predicted stability of the RNA-RNA pairing. However, the tolerance for specific mismatches in antitermination was generally different from that during decoding, which reveals a unique tRNA recognition pattern in the T box antitermination system.

  14. The structure of Aquifex aeolicus ribosomal protein S8 reveals a unique subdomain that contributes to an extremely tight association with 16S rRNA.

    Science.gov (United States)

    Menichelli, Elena; Edgcomb, Stephen P; Recht, Michael I; Williamson, James R

    2012-01-20

    The assembly of ribonucleoprotein complexes occurs under a broad range of conditions, but the principles that promote assembly and allow function at high temperature are poorly understood. The ribosomal protein S8 from Aquifex aeolicus (AS8) is unique in that there is a 41-residue insertion in the consensus S8 sequence. In addition, AS8 exhibits an unusually high affinity for the 16S ribosomal RNA, characterized by a picomolar dissociation constant that is approximately 26,000-fold tighter than the equivalent interaction from Escherichia coli. Deletion analysis demonstrated that binding to the minimal site on helix 21 occurred at the same nanomolar affinity found for other bacterial species. The additional affinity required the presence of a three-helix junction between helices 20, 21, and 22. The crystal structure of AS8 was solved, revealing the helix-loop-helix geometry of the unique AS8 insertion region, while the core of the molecule is conserved with known S8 structures. The AS8 structure was modeled onto the structure of the 30S ribosomal subunit from E. coli, suggesting the possibility that the unique subdomain provides additional backbone and side-chain contacts between the protein and an unpaired base within the three-way junction of helices 20, 21, and 22. Point mutations in the protein insertion subdomain resulted in a significantly reduced RNA binding affinity with respect to wild-type AS8. These results indicate that the AS8-specific subdomain provides additional interactions with the three-way junction that contribute to the extremely tight binding to ribosomal RNA.

  15. Inhibitor RNA blocks the protein translation mediated by hepatitis C virus internal ribosome entry site in vivo

    Institute of Scientific and Technical Information of China (English)

    Xue-Song Liang; Jian-Qi Lian; Yong-Xing Zhou; Mo-Bin Wan

    2004-01-01

    AIM: To investigate the inhibitory effect of hepatitis C virus internal ribosome entry site (HCV IRES) specific inhibitor RNA (IRNA) on gene expression mediated by HCV IRES in vivo.METHODS: By using G418 screening system, hepatoma cells constitutively expressing IRNA or mutant IRNA (mIRNA) were established and characterized, and HCV replicons containing the 5' untranslated region (5'UTR) were constructed by using the same method. Cotransfection of pCMVNCRluc containing HCV 5'UTR-luc fusion genes and eukaryotic vector of IRNA into human hepatic carcinoma cells (HepG2) was performed and the eukaryotic expression plasmid of IRNA was transfected transiently into HCV replicons, pCMVNCRluc or pCDNA-luc was cotransfected with pSV40-β Gal into IRNA expressing hepatoma cells by using lipofectamine 2000 in vitro. Then the reporting gene expression level was examined at 48 h after transfection by using a luminometer and the expressing level of HCV C antigen was analysed with a confocal microscope.RESULTS: Transient expression of IRES specific IRNA could significantly inhibit the expression of reporter gene and viral antigen mediated by HCV IRES by 50% to 90% in vivo, but mIRNA lost its inhibitory activity completely. The luciferase gene expression mediated by HCV IRES was blocked in the HHCC constitutively expressing IRNA. At 48 h after transfection, the expression level of reportor gene descreased by 20%, but cap-dependent luciferase gene expression was not affected. IRNA could inhibit the HCV replicon expression 24 h after transfection and the highest inhibitory activity was 80% by 72 h, and the inhibitory activity was not increased until 7d after transfection.CONCLUSION: IRNA can inhibit HCV IRES mediated gene expression in vivo.

  16. Genes Involved in Human Ribosome Biogenesis areTranscriptionally Upregulated in Colorectal Cancer

    DEFF Research Database (Denmark)

    Mansilla, Francisco; Lamy, Philippe; Ørntoft, Torben Falck

    2009-01-01

    Microarray gene expression profiling comprising 168 colorectal adenocarcinomas and 10 normal mucosas showed that over 79% of the genes involved in human ribosome biogenesis are significantly upregulated (log2>0.5, p<10-3) when compared to normal mucosa. Overexpression was independent of microsate......Microarray gene expression profiling comprising 168 colorectal adenocarcinomas and 10 normal mucosas showed that over 79% of the genes involved in human ribosome biogenesis are significantly upregulated (log2>0.5, p... of rRNA processing genes points towards a coordinated process enabling the overproduction of matured ribosomal structures....

  17. Evaluation of sequence alignments and oligonucleotide probes with respect to three-dimensional structure of ribosomal RNA using ARB software package

    Directory of Open Access Journals (Sweden)

    Meier Harald

    2006-05-01

    Full Text Available Abstract Background Availability of high-resolution RNA crystal structures for the 30S and 50S ribosomal subunits and the subsequent validation of comparative secondary structure models have prompted the biologists to use three-dimensional structure of ribosomal RNA (rRNA for evaluating sequence alignments of rRNA genes. Furthermore, the secondary and tertiary structural features of rRNA are highly useful and successfully employed in designing rRNA targeted oligonucleotide probes intended for in situ hybridization experiments. RNA3D, a program to combine sequence alignment information with three-dimensional structure of rRNA was developed. Integration into ARB software package, which is used extensively by the scientific community for phylogenetic analysis and molecular probe designing, has substantially extended the functionality of ARB software suite with 3D environment. Results Three-dimensional structure of rRNA is visualized in OpenGL 3D environment with the abilities to change the display and overlay information onto the molecule, dynamically. Phylogenetic information derived from the multiple sequence alignments can be overlaid onto the molecule structure in a real time. Superimposition of both statistical and non-statistical sequence associated information onto the rRNA 3D structure can be done using customizable color scheme, which is also applied to a textual sequence alignment for reference. Oligonucleotide probes designed by ARB probe design tools can be mapped onto the 3D structure along with the probe accessibility models for evaluation with respect to secondary and tertiary structural conformations of rRNA. Conclusion Visualization of three-dimensional structure of rRNA in an intuitive display provides the biologists with the greater possibilities to carry out structure based phylogenetic analysis. Coupled with secondary structure models of rRNA, RNA3D program aids in validating the sequence alignments of rRNA genes and evaluating

  18. Protein-protein interactions within late pre-40S ribosomes.

    Directory of Open Access Journals (Sweden)

    Melody G Campbell

    Full Text Available Ribosome assembly in eukaryotic organisms requires more than 200 assembly factors to facilitate and coordinate rRNA transcription, processing, and folding with the binding of the ribosomal proteins. Many of these assembly factors bind and dissociate at defined times giving rise to discrete assembly intermediates, some of which have been partially characterized with regards to their protein and RNA composition. Here, we have analyzed the protein-protein interactions between the seven assembly factors bound to late cytoplasmic pre-40S ribosomes using recombinant proteins in binding assays. Our data show that these factors form two modules: one comprising Enp1 and the export adaptor Ltv1 near the beak structure, and the second comprising the kinase Rio2, the nuclease Nob1, and a regulatory RNA binding protein Dim2/Pno1 on the front of the head. The GTPase-like Tsr1 and the universally conserved methylase Dim1 are also peripherally connected to this second module. Additionally, in an effort to further define the locations for these essential proteins, we have analyzed the interactions between these assembly factors and six ribosomal proteins: Rps0, Rps3, Rps5, Rps14, Rps15 and Rps29. Together, these results and previous RNA-protein crosslinking data allow us to propose a model for the binding sites of these seven assembly factors. Furthermore, our data show that the essential kinase Rio2 is located at the center of the pre-ribosomal particle and interacts, directly or indirectly, with every other assembly factor, as well as three ribosomal proteins required for cytoplasmic 40S maturation. These data suggest that Rio2 could play a central role in regulating cytoplasmic maturation steps.

  19. Mechanical unfolding kinetics of the SRV-1 gag-pro mRNA pseudoknot: possible implications for ‑1 ribosomal frameshifting stimulation

    Science.gov (United States)

    Zhong, Zhensheng; Yang, Lixia; Zhang, Haiping; Shi, Jiahao; Vandana, J. Jeya; Lam, Do Thuy Uyen Ha; Olsthoorn, René C. L.; Lu, Lanyuan; Chen, Gang

    2016-12-01

    Minus-one ribosomal frameshifting is a translational recoding mechanism widely utilized by many RNA viruses to generate accurate ratios of structural and catalytic proteins. An RNA pseudoknot structure located in the overlapping region of the gag and pro genes of Simian Retrovirus type 1 (SRV-1) stimulates frameshifting. However, the experimental characterization of SRV-1 pseudoknot (un)folding dynamics and the effect of the base triple formation is lacking. Here, we report the results of our single-molecule nanomanipulation using optical tweezers and theoretical simulation by steered molecular dynamics. Our results directly reveal that the energetic coupling between loop 2 and stem 1 via minor-groove base triple formation enhances the mechanical stability. The terminal base pair in stem 1 (directly in contact with a translating ribosome at the slippery site) also affects the mechanical stability of the pseudoknot. The ‑1 frameshifting efficiency is positively correlated with the cooperative one-step unfolding force and inversely correlated with the one-step mechanical unfolding rate at zero force. A significantly improved correlation was observed between ‑1 frameshifting efficiency and unfolding rate at forces of 15–35 pN, consistent with the fact that the ribosome is a force-generating molecular motor with helicase activity. No correlation was observed between thermal stability and ‑1 frameshifting efficiency.

  20. Effect of thiostrepton and 3'-terminal fragments of aminoacyl-tRNA on EF-Tu and ribosome-dependent GTP hydrolysis.

    Science.gov (United States)

    Bhuta, P; Chládek, S

    1982-08-30

    The effect of the antibiotics thiostrepton and micrococcin on EF-Tu-catalyzed (ribosome-dependent) GTP hydrolysis in the presence of A-Phe, C-A-Phe, or C-C-A-Phe (related to the sequence of the 3'-terminus of aminoacyl-tRNA)(System I) or by methanol ('uncoupled GTPase', System II) was investigated. In System I, thiostrepton increases the binding affinities of the effectors to the EF-Tu.GTP.70 S ribosome complex, as well as the extent of the GTP hydrolysis, while the KmGTP is virtually unchanged. Similarly, in the uncoupled system (System II) and in the absence of effectors, thiostrepton significantly increases VmaxGTP, whereas KmGTP remains unaffected. Micrococcin is without any effect in both systems. The 'uncoupled GTPase' (in System II) is also strongly inhibited by C-A-Phe. The results indicate the crucial role of the EF-Tu site which binds the aminoacylated C-C-A terminus of aminoacyl-tRNA in promoting GTP hydrolysis. It follows that the binding of the model effectors (such as C-C-A-Phe) to that site is favorably influenced by the interaction of thiostrepton with the 50 S ribosomal subunit, whereas thiostrepton, per se, does not influence the affinity of EF-Tu for GTP.

  1. Potential key bases of ribosomal RNA to kingdom-specific spectra of antibiotic susceptibility and the possible archaeal origin of eukaryotes.

    Directory of Open Access Journals (Sweden)

    Qiang Xie

    Full Text Available In support of the hypothesis of the endosymbiotic origin of eukaryotes, much evidence has been found to support the idea that some organelles of eukaryotic cells originated from bacterial ancestors. Less attention has been paid to the identity of the host cell, although some biochemical and molecular genetic properties shared by archaea and eukaryotes have been documented. Through comparing 507 taxa of 16S-18S rDNA and 347 taxa of 23S-28S rDNA, we found that archaea and eukaryotes share twenty-six nucleotides signatures in ribosomal DNA. These signatures exist in all living eukaryotic organisms, whether protist, green plant, fungus, or animal. This evidence explicitly supports the archaeal origin of eukaryotes. In the ribosomal RNA, besides A2058 in Escherichia coli vs. G2400 in Saccharomyces cerevisiae, there still exist other twenties of sites, in which the bases are kingdom-specific. Some of these sites concentrate in the peptidyl transferase centre (PTC of the 23S-28S rRNA. The results suggest potential key sites to explain the kingdom-specific spectra of drug resistance of ribosomes.

  2. Interaction of ribosomal proteins S5, S6, S11, S12, S18 and S21 with 16 S rRNA.

    Science.gov (United States)

    Stern, S; Powers, T; Changchien, L M; Noller, H F

    1988-06-20

    We have examined the effects of assembly of ribosomal proteins S5, S6, S11, S12, S18 and S21 on the reactivities of residues in 16 S rRNA towards chemical probes. The results show that S6, S18 and S11 interact with the 690-720 and 790 loop regions of 16 S rRNA in a highly co-operative manner, that is consistent with the previously defined assembly map relationships among these proteins. The results also indicate that these proteins, one of which (S18) has previously been implicated as a component of the ribosomal P-site, interact with residues near some of the recently defined P-site (class II tRNA protection) nucleotides in 16 S rRNA. In addition, assembly of protein S12 has been found to result in the protection of residues in both the 530 stem/loop and the 900 stem regions; the latter group is closely juxtaposed to a segment of 16 S rRNA recently shown to be protected from chemical probes by streptomycin. Interestingly, both S5 and S12 appear to protect, to differing degrees, a well-defined set of residues in the 900 stem/loop and 5'-terminal regions. These observations are discussed in terms of the effects of S5 and S12 on streptomycin binding, and in terms of the class III tRNA protection found in the 900 stem of 16 S rRNA. Altogether these results show that many of the small subunit proteins, which have previously been shown to be functionally important, appear to be associated with functionally implicated segments of 16 S rRNA.

  3. [Mg2+ ions affect the structure of the central domain of the 18S rRNA in the vicinity of the ribosomal protein S13 binding site].

    Science.gov (United States)

    Ivanov, A V; Malygin, A A; Karpova, G G

    2013-01-01

    It is known that Mg2+ ions at high concentrations stabilize the structure of the 16S rRNA in a conformation favorable for binding to the ribosomal proteins in the course of the eubacterial 30S ribosomal subunits assembly in vitro. Effect of Mg2+ on the formation of the 18S rRNA structure at the 40S subunit assembly remains poorly explored. In this paper, we show that the sequentional increase of the Mg2+ concentration from 0.5 mM to 20 mM leads to a significant decrease of the affinity of recombinant human ribosomal protein S13 (rpS13e) to a RNA transcript corresponding to the central domain fragment of the 18S rRNA (18SCD). The regions near the rpS13e binding site in 18SCD (including the nucleotides of helices H20 and H22), whose availabilities to hydroxyl radicals were dependent on the Mg2+ concentration, were determined. It was found that increase of the concentrations of Mg2+ results in the enhanced accessibilities of nucleotides G933-C937 and C1006-A1009 in helix H22 and reduces those of nucleotides A1023, A1024, and A1028-S1026 in the helix H20. Comparison of the results obtained with the crystallographic data on the structure of the central domain of 18S rRNA in the 40S ribosomal subunit led to conclusion that increase of Mg2+ concentrations results in the reorientation of helices H20 and H24 relatively helices H22 and H23 to form a structure, in which these helices are positioned the same way as in 40S subunits. Hence, saturation of the central domain of 18S rRNA with coordinated Mg2+ ions causes the same changes in its structure as rpS13e binding does, and leads to decreasing of this domain affinity to the protein.

  4. Stimulation of poliovirus RNA synthesis and virus maturation in a HeLa cell-free in vitro translation-RNA replication system by viral protein 3CDpro

    Directory of Open Access Journals (Sweden)

    Wimmer Eckard

    2005-11-01

    Full Text Available Abstract Poliovirus protein 3CDpro possesses both proteinase and RNA binding activities, which are located in the 3Cpro domain of the protein. The RNA polymerase (3Dpol domain of 3CDpro modulates these activities of the protein. We have recently shown that the level of 3CDpro in HeLa cell-free in vitro translation-RNA replication reactions is suboptimal for efficient virus production. However, the addition of either 3CDpro mRNA or of purified 3CDpro protein to in vitro reactions, programmed with viral RNA, results in a 100-fold increase in virus yield. Mutational analyses of 3CDpro indicated that RNA binding by the 3Cpro domain and the integrity of interface I in the 3Dpol domain of the protein are both required for function. The aim of these studies was to determine the exact step or steps at which 3CDpro enhances virus yield and to determine the mechanism by which this occurs. Our results suggest that the addition of extra 3CDpro to in vitro translation RNA-replication reactions results in a mild enhancement of both minus and plus strand RNA synthesis. By examining the viral particles formed in the in vitro reactions on sucrose gradients we determined that 3CDpro has only a slight stimulating effect on the synthesis of capsid precursors but it strikingly enhances the maturation of virus particles. Both the stimulation of RNA synthesis and the maturation of the virus particles are dependent on the presence of an intact RNA binding site within the 3Cpro domain of 3CDpro. In addition, the integrity of interface I in the 3Dpol domain of 3CDpro is required for efficient production of mature virus. Surprisingly, plus strand RNA synthesis and virus production in in vitro reactions, programmed with full-length transcript RNA, are not enhanced by the addition of extra 3CDpro. Our results indicate that the stimulation of RNA synthesis and virus maturation by 3CDpro in vitro is dependent on the presence of a VPg-linked RNA template.

  5. Studies on mRNA electroporation of immature and mature dendritic cells: Effects on their immunogenic potential

    DEFF Research Database (Denmark)

    Met, O.; Eriksen, J.; Svane, Inge Marie

    2008-01-01

    Previous studies have shown that mRNA-electroporated dendritic cells (DCs) are able to process and present tumor-associated antigens, leading to the activation of tumor-specific T cells in vitro and in vivo. However, the optimal maturation state of antigen loading and half-life of the m...

  6. Evidence that E. coli ribosomal protein S13 has two separable functional domains involved in 16S RNA recognition and protein S19 binding.

    Science.gov (United States)

    Schwarzbauer, J; Craven, G R

    1985-09-25

    We have found that E. coli ribosomal protein S13 recognizes multiple sites on 16S RNA. However, when protein S19 is included with a mixture of proteins S4, S7, S8, S16/S17 and S20, the S13 binds to the complex with measurably greater strength and with a stoichiometry of 1.5 copies per particle. This suggests that the protein may have two functional domains. We have tested this idea by cleaving the protein into two polypeptides. It was found that one of the fragments, composed of amino acid residues 84-117, retained the capacity to bind 16S RNA at multiple sites. Protein S19 had no affect on the strength or stoichiometry of the binding of this fragment. These data suggest that S13 has a C-terminal domain primarily responsible for RNA recognition and possibly that the N-terminal region is important for association with protein S19.

  7. Aggregation of Ribosomal Protein S6 at Nucleolus Is Cell Cycle-Controlled and Its Function in Pre-rRNA Processing Is Phosphorylation Dependent.

    Science.gov (United States)

    Zhang, Duo; Chen, Hui-Peng; Duan, Hai-Feng; Gao, Li-Hua; Shao, Yong; Chen, Ke-Yan; Wang, You-Liang; Lan, Feng-Hua; Hu, Xian-Wen

    2016-07-01

    Ribosomal protein S6 (rpS6) has long been regarded as one of the primary r-proteins that functions in the early stage of 40S subunit assembly, but its actual role is still obscure. The correct forming of 18S rRNA is a key step in the nuclear synthesis of 40S subunit. In this study, we demonstrate that rpS6 participates in the processing of 30S pre-rRNA to 18S rRNA only when its C-terminal five serines are phosphorylated, however, the process of entering the nucleus and then targeting the nucleolus does not dependent its phosphorylation. Remarkably, we also find that the aggregation of rpS6 at the nucleolus correlates to the phasing of cell cycle, beginning to concentrate in the nucleolus at later S phase and disaggregate at M phase. J. Cell. Biochem. 117: 1649-1657, 2016. © 2015 Wiley Periodicals, Inc.

  8. Analysis of mRNA associated factors during bovine oocyte maturation and early embryonic development.

    Science.gov (United States)

    Siemer, Corinna; Smiljakovic, Tatjana; Bhojwani, Monika; Leiding, Claus; Kanitz, Wilhelm; Kubelka, Michal; Tomek, Wolfgang

    2009-12-01

    Regulation of gene expression at the translational level is particularly essential during developmental periods, when transcription is impaired. According to the closed-loop model of translational initiation, we have analyzed components of the 5 -mRNA cap-binding complex eIF4F (eIF4E, eIF4G, eIF4A), the eIF4E repressor 4E-BP1, and 3 -mRNA poly-(A) tail-associated proteins (PABP1 and 3, PAIP1 and 2, CPEB1, Maskin) during in vitro maturation of bovine oocytes and early embryonic development up to the 16-cell stage. Furthermore, we have elucidated the activity of distinct kinases which are potentially involved in their phosphorylation. Major phosphorylation of specific target sequences of PKA, PKB, PKC, CDKs, ATM/ATR, and MAPK were observed in M II stage oocytes. Furthermore, main changes in the abundance and/or phosphorylation of distinct mRNA-binding factors occur at the transition from M II stage oocytes to 2-cell embryos. In conclusion, the results indicate that, at the transition from oocyte to embryonic development, translational initiation is regulated by striking differences in the abundance and/or phosphorylation of 5 -end and 3 -end mRNA associated factors, mainly the poly-(A) bindings proteins PABP1 and 3, their repressor PAIP2 and a Maskin-like protein with distinct eIF4E-binding properties which prevents eIF4E/cap binding and eIF4F formation in vitro. Nevertheless, from the M II stage to 16-cell embryos a substantial amount of eIF4E and, to a lesser extent, of eIF4G was precipitated by (7)m-GTP-Separose indicating eIF4F complex formation. Therefore, it is likely that in general the reduction in PABP1 and 3 abundance represses overall translation during early embryonic development.

  9. Structural basis for 5'-ETS recognition by Utp4 at the early stages of ribosome biogenesis.

    Science.gov (United States)

    Calviño, Fabiola R; Kornprobst, Markus; Schermann, Géza; Birkle, Fabienne; Wild, Klemens; Fischer, Tamas; Hurt, Ed; Ahmed, Yasar Luqman; Sinning, Irmgard

    2017-01-01

    Eukaryotic ribosome biogenesis begins with the co-transcriptional assembly of the 90S pre-ribosome. The 'U three protein' (UTP) complexes and snoRNP particles arrange around the nascent pre-ribosomal RNA chaperoning its folding and further maturation. The earliest event in this hierarchical process is the binding of the UTP-A complex to the 5'-end of the pre-ribosomal RNA (5'-ETS). This oligomeric complex predominantly consists of β-propeller and α-solenoidal proteins. Here we present the structure of the Utp4 subunit from the thermophilic fungus Chaetomium thermophilum at 2.15 Å resolution and analyze its function by UV RNA-crosslinking (CRAC) and in context of a recent cryo-EM structure of the 90S pre-ribosome. Utp4 consists of two orthogonal and highly basic β-propellers that perfectly fit the EM-data. The Utp4 structure highlights an unusual Velcro-closure of its C-terminal β-propeller as relevant for protein integrity and potentially Utp8 recognition in the context of the pre-ribosome. We provide a first model of the 5'-ETS RNA from the internally hidden 5'-end up to the region that hybridizes to the 3'-hinge sequence of U3 snoRNA and validate a specific Utp4/5'-ETS interaction by CRAC analysis.

  10. Expression of gyrB and 16S ribosomal RNA genes as indicators of growth and physiological activities of Legionella pneumophila.

    Science.gov (United States)

    Okuno, Toshihiro; Tani, Katsuji; Yamaguchi, Nobuyasu; Nasu, Masao

    2015-01-01

    To determine whether the DNA gyrase (gyrB) and 16S ribosomal RNA (16S rRNA) genes can be used as indicators of the biological activities of Legionella pneumophila, the expression levels were estimated. The ratio of mRNA/DNA in gyrB was 0.7 in mid log phase and decreased drastically after the log phase. For 16S rRNA, the ratio was highest in mid log phase (7.0×10(3)), and the value that was about 10% of that in the log phase was maintained for six days. The rRNA may be vital in the resting or active but nonculturable cells that are not growing but physiologically active. The expression levels of gyrB mRNA and 16S rRNA can be used as indicators of the growth activity and the physiological activity of L. pneumophila, respectively. Therefore, by measurement of these indicators, we can evaluate the activities of Legionella cells in various environments.

  11. HIV-1 frameshift efficiency is primarily determined by the stability of base pairs positioned at the mRNA entrance channel of the ribosome.

    Science.gov (United States)

    Mouzakis, Kathryn D; Lang, Andrew L; Vander Meulen, Kirk A; Easterday, Preston D; Butcher, Samuel E

    2013-02-01

    The human immunodeficiency virus (HIV) requires a programmed -1 ribosomal frameshift for Pol gene expression. The HIV frameshift site consists of a heptanucleotide slippery sequence (UUUUUUA) followed by a spacer region and a downstream RNA stem-loop structure. Here we investigate the role of the RNA structure in promoting the -1 frameshift. The stem-loop was systematically altered to decouple the contributions of local and overall thermodynamic stability towards frameshift efficiency. No correlation between overall stability and frameshift efficiency is observed. In contrast, there is a strong correlation between frameshift efficiency and the local thermodynamic stability of the first 3-4 bp in the stem-loop, which are predicted to reside at the opening of the mRNA entrance channel when the ribosome is paused at the slippery site. Insertion or deletions in the spacer region appear to correspondingly change the identity of the base pairs encountered 8 nt downstream of the slippery site. Finally, the role of the surrounding genomic secondary structure was investigated and found to have a modest impact on frameshift efficiency, consistent with the hypothesis that the genomic secondary structure attenuates frameshifting by affecting the overall rate of translation.

  12. Ribosome Biogenesis in African Trypanosomes Requires Conserved and Trypanosome-Specific Factors

    Science.gov (United States)

    Umaer, Khan; Ciganda, Martin

    2014-01-01

    Large ribosomal subunit protein L5 is responsible for the stability and trafficking of 5S rRNA to the site of eukaryotic ribosomal assembly. In Trypanosoma brucei, in addition to L5, trypanosome-specific proteins P34 and P37 also participate in this process. These two essential proteins form a novel preribosomal particle through interactions with both the ribosomal protein L5 and 5S rRNA. We have generated a procyclic L5 RNA interference cell line and found that L5 itself is a protein essential for trypanosome growth, despite the presence of other 5S rRNA binding proteins. Loss of L5 decreases the levels of all large-subunit rRNAs, 25/28S, 5.8S, and 5S rRNAs, but does not alter small-subunit 18S rRNA. Depletion of L5 specifically reduced the levels of the other large ribosomal proteins, L3 and L11, whereas the steady-state levels of the mRNA for these proteins were increased. L5-knockdown cells showed an increase in the 40S ribosomal subunit and a loss of the 60S ribosomal subunits, 80S monosomes, and polysomes. In addition, L5 was involved in the processing and maturation of precursor rRNAs. Analysis of polysomal fractions revealed that unprocessed rRNA intermediates accumulate in the ribosome when L5 is depleted. Although we previously found that the loss of P34 and P37 does not result in a change in the levels of L5, the loss of L5 resulted in an increase of P34 and P37 proteins, suggesting the presence of a compensatory feedback loop. This study demonstrates that ribosomal protein L5 has conserved functions, in addition to nonconserved trypanosome-specific features, which could be targeted for drug intervention. PMID:24706018

  13. Electroporated Antigen-Encoding mRNA Is Not a Danger Signal to Human Mature Monocyte-Derived Dendritic Cells

    Directory of Open Access Journals (Sweden)

    Stefanie Hoyer

    2015-01-01

    Full Text Available For therapeutic cancer vaccination, the adoptive transfer of mRNA-electroporated dendritic cells (DCs is frequently performed, usually with monocyte-derived, cytokine-matured DCs (moDCs. However, DCs are rich in danger-sensing receptors which could recognize the exogenously delivered mRNA and induce DC activation, hence influencing the DCs’ immunogenicity. Therefore, we examined whether electroporation of mRNA with a proper cap and a poly-A tail of at least 64 adenosines had any influence on cocktail-matured moDCs. We used 16 different RNAs, encoding tumor antigens (MelanA, NRAS, BRAF, GNAQ, GNA11, and WT1, and variants thereof. None of those RNAs induced changes in the expression of CD25, CD40, CD83, CD86, and CD70 or the secretion of the cytokines IL-8, IL-6, and TNFα of more than 1.5-fold compared to the control condition, while an mRNA encoding an NF-κB-activation protein as positive control induced massive secretion of the cytokines. To determine whether mRNA electroporation had any effect on the whole transcriptome of the DCs, we performed microarray analyses of DCs of 6 different donors. None of 60,000 probes was significantly different between mock-electroporated DCs and MelanA-transfected DCs. Hence, we conclude that no transcriptional programs were induced within cocktail-matured DCs by electroporation of single tumor-antigen-encoding mRNAs.

  14. Identification of Bacteria Synthesizing Ribosomal RNA in Response to Uranium Addition During Biostimulation at the Rifle, CO Integrated Field Research Site.

    Directory of Open Access Journals (Sweden)

    Lora R McGuinness

    Full Text Available Understanding which organisms are capable of reducing uranium at historically contaminated sites provides crucial information needed to evaluate treatment options and outcomes. One approach is determination of the bacteria which directly respond to uranium addition. In this study, uranium amendments were made to groundwater samples from a site of ongoing biostimulation with acetate. The active microbes in the planktonic phase were deduced by monitoring ribosomes production via RT-PCR. The results indicated several microorganisms were synthesizing ribosomes in proportion with uranium amendment up to 2 μM. Concentrations of U (VI >2 μM were generally found to inhibit ribosome synthesis. Two active bacteria responding to uranium addition in the field were close relatives of Desulfobacter postgateii and Geobacter bemidjiensis. Since RNA content often increases with growth rate, our findings suggest it is possible to rapidly elucidate active bacteria responding to the addition of uranium in field samples and provides a more targeted approach to stimulate specific populations to enhance radionuclide reduction in contaminated sites.

  15. Interconversion of active and inactive 30 S ribosomal subunits is accompanied by a conformational change in the decoding region of 16 S rRNA

    DEFF Research Database (Denmark)

    Moazed, D; Van Stolk, B J; Douthwaite, S

    1986-01-01

    Zamir, Elson and their co-workers have shown that 30 S ribosomal subunits are reversibly inactivated by depletion of monovalent or divalent cations. We have re-investigated the conformation of 16 S rRNA in the active and inactive forms of the 30 S subunit, using a strategy that is designed...... by end-labeling followed by analine-induced strand scission (in some cases preceded by hybrid selection), or by primer extension using synthetic DNA oligomers. These studies show the following: The transition from the active to the inactive state cannot be described as a simple loosening or unfolding...

  16. Direct crosslinking of the antitumor antibiotic sparsomycin, and its derivatives, to A2602 in the peptidyl transferase center of 23S-like rRNA within ribosome-tRNA complexes

    DEFF Research Database (Denmark)

    Porse, B T; Kirillov, S V; Awayez, M J

    1999-01-01

    of action was investigated by inducing a crosslink between sparsomycin and bacterial, archaeal, and eukaryotic ribosomes complexed with P-site-bound tRNA, on irradiating with low energy ultraviolet light (at 365 nm). The crosslink was localized exclusively to the universally conserved nucleotide A2602...... within the peptidyl transferase loop region of 23S-like rRNA by using a combination of a primer extension approach, RNase H fragment analysis, and crosslinking with radioactive [(125)I]phenol-alanine-sparsomycin. Crosslinking of several sparsomycin derivatives, modified near the sulfoxy group, implicated...

  17. The protein domains of the Dictyostelium microprocessor that are required for correct subcellular localization and for microRNA maturation.

    Science.gov (United States)

    Kruse, Janis; Meier, Doreen; Zenk, Fides; Rehders, Maren; Nellen, Wolfgang; Hammann, Christian

    2016-10-02

    The maturation pathways of microRNAs (miRNAs) have been delineated for plants and several animals, belonging to the evolutionary supergroups of Archaeplastida and Opisthokonta, respectively. Recently, we reported the discovery of the microprocessor complex in Dictyostelium discoideum of the Amoebozoa supergroup. The complex is composed of the Dicer DrnB and the dsRBD (double-stranded RNA binding domain) containing protein RbdB. Both proteins localize at nucleoli, where they physically interact, and both are required for miRNA maturation. Here we show that the miRNA phenotype of a ΔdrnB gene deletion strain can be rescued by ectopic expression of a series of DrnB GFP fusion proteins, which consistently showed punctate perinucleolar localization in fluorescence microscopy. These punctate foci appear surprisingly stable, as they persist both disintegration of nucleoli and degradation of cellular nucleic acids. We observed that DrnB expression levels influence the number of microprocessor foci and alter RbdB accumulation. An investigation of DrnB variants revealed that its newly identified nuclear localization signal is necessary, but not sufficient for the perinucleolar localization. Biogenesis of miRNAs, which are RNA Pol II transcripts, is correlated with that localization. Besides its bidentate RNase III domains, DrnB contains only a dsRBD, which surprisingly is dispensable for miRNA maturation. This dsRBD can, however, functionally replace the homologous domain in RbdB. Based on the unique setup of the Dictyostelium microprocessor with a subcellular localization similar to plants, but a protein domain composition similar to animals, we propose a model for the evolutionary origin of RNase III proteins acting in miRNA maturation.

  18. The location of protein S8 and surrounding elements of 16S rRNA in the 70S ribosome from combined use of directed hydroxyl radical probing and X-ray crystallography.

    Science.gov (United States)

    Lancaster, L; Culver, G M; Yusupova, G Z; Cate, J H; Yusupov, M M; Noller, H F

    2000-05-01

    Ribosomal protein S8, which is essential for the assembly of the central domain of 16S rRNA, is one of the most thoroughly studied RNA-binding proteins. To map its surrounding RNA in the ribosome, we carried out directed hydroxyl radical probing of 16S rRNA using Fe(II) tethered to nine different positions on the surface of protein S8 in 70S ribosomes. Hydroxyl radical-induced cleavage was observed near the classical S8-binding site in the 620 stem, and flanking the other S8-footprinted regions of the central domain at the three-helix junction near position 650 and the 825 and 860 stems. In addition, cleavage near the 5' terminus of 16S rRNA, in the 300 region of its 5' domain, and in the 1070 region of its 3'-major domain provide information about the proximity to S8 of RNA elements not directly involved in its binding. These data, along with previous footprinting and crosslinking results, allowed positioning of protein S8 and its surrounding RNA elements in a 7.8-A map of the Thermus thermophilus 70S ribosome. The resulting model is in close agreement with the extensive body of data from previous studies using protein-protein and protein-RNA crosslinking, chemical and enzymatic footprinting, and genetics.

  19. The rluC gene of Escherichia coli codes for a pseudouridine synthase that is solely responsible for synthesis of pseudouridine at positions 955, 2504, and 2580 in 23 S ribosomal RNA.

    Science.gov (United States)

    Conrad, J; Sun, D; Englund, N; Ofengand, J

    1998-07-17

    Escherichia coli ribosomal RNA contains 10 pseudouridines, one in the 16 S RNA and nine in the 23 S RNA. Previously, the gene for the synthase responsible for the 16 S RNA pseudouridine was identified and cloned, as was a gene for a synthase that makes a single pseudouridine in 23 S RNA. The yceC open reading frame of E. coli is one of a set of genes homologous to these previously identified ribosomal RNA pseudouridine synthases. In this work, the gene was cloned, overexpressed, and shown to code for a pseudouridine synthase able to react with in vitro transcripts of 23 S ribosomal RNA. Deletion of the gene and analysis of the 23 S RNA from the deletion strain for the presence of pseudouridine at its nine known sites revealed that this synthase is solely responsible in vivo for the synthesis of three of the nine pseudouridine residues, at positions 955, 2504, and 2580. Therefore, this gene has been renamed rluC. Despite the absence of one-third of the normal complement of pseudouridines, there was no change in the exponential growth rate in either LB or M-9 medium at temperatures ranging from 24 to 42 degrees C. From this work and our previous studies, we have now identified three synthases that account for 50% of the pseudouridines in the E. coli ribosome.

  20. The Comparative RNA Web (CRW Site: an online database of comparative sequence and structure information for ribosomal, intron, and other RNAs

    Directory of Open Access Journals (Sweden)

    Müller Kirsten M

    2002-01-01

    Full Text Available Abstract Background Comparative analysis of RNA sequences is the basis for the detailed and accurate predictions of RNA structure and the determination of phylogenetic relationships for organisms that span the entire phylogenetic tree. Underlying these accomplishments are very large, well-organized, and processed collections of RNA sequences. This data, starting with the sequences organized into a database management system and aligned to reveal their higher-order structure, and patterns of conservation and variation for organisms that span the phylogenetic tree, has been collected and analyzed. This type of information can be fundamental for and have an influence on the study of phylogenetic relationships, RNA structure, and the melding of these two fields. Results We have prepared a large web site that disseminates our comparative sequence and structure models and data. The four major types of comparative information and systems available for the three ribosomal RNAs (5S, 16S, and 23S rRNA, transfer RNA (tRNA, and two of the catalytic intron RNAs (group I and group II are: (1 Current Comparative Structure Models; (2 Nucleotide Frequency and Conservation Information; (3 Sequence and Structure Data; and (4 Data Access Systems. Conclusions This online RNA sequence and structure information, the result of extensive analysis, interpretation, data collection, and computer program and web development, is accessible at our Comparative RNA Web (CRW Site http://www.rna.icmb.utexas.edu. In the future, more data and information will be added to these existing categories, new categories will be developed, and additional RNAs will be studied and presented at the CRW Site.

  1. Chromosomal localization and copy number of 18S + 28S ribosomal RNA genes in evolutionarily diverse mosquitoes (Diptera, Culicidae)

    National Research Council Canada - National Science Library

    Kumar, A; Rai, K S

    1990-01-01

    In situ hybridization using 3H-labeled 18S and 28S ribosomal DNA (rDNA) probes from Aedes albopictus was performed on the mitotic chromosomes of 20 species of mosquitoes belonging to 8 genera of subfamilies Culicinae and Anophelinae...

  2. Molecular signatures of ribosomal evolution.

    Science.gov (United States)

    Roberts, Elijah; Sethi, Anurag; Montoya, Jonathan; Woese, Carl R; Luthey-Schulten, Zaida

    2008-09-16

    Ribosomal signatures, idiosyncrasies in the ribosomal RNA (rRNA) and/or proteins, are characteristic of the individual domains of life. As such, insight into the early evolution of the domains can be gained from a comparative analysis of their respective signatures in the translational apparatus. In this work, we identify signatures in both the sequence and structure of the rRNA and analyze their contributions to the universal phylogenetic tree using both sequence- and structure-based methods. Domain-specific ribosomal proteins can be considered signatures in their own right. Although it is commonly assumed that they developed after the universal ribosomal proteins, we present evidence that at least one may have been present before the divergence of the organismal lineages. We find correlations between the rRNA signatures and signatures in the ribosomal proteins showing that the rRNA signatures coevolved with both domain-specific and universal ribosomal proteins. Finally, we show that the genomic organization of the universal ribosomal components contains these signatures as well. From these studies, we propose the ribosomal signatures are remnants of an evolutionary-phase transition that occurred as the cell lineages began to coalesce and so should be reflected in corresponding signatures throughout the fabric of the cell and its genome.

  3. Crystal structure of the eukaryotic ribosome.

    Science.gov (United States)

    Ben-Shem, Adam; Jenner, Lasse; Yusupova, Gulnara; Yusupov, Marat

    2010-11-26

    Crystal structures of prokaryotic ribosomes have described in detail the universally conserved core of the translation mechanism. However, many facets of the translation process in eukaryotes are not shared with prokaryotes. The crystal structure of the yeast 80S ribosome determined at 4.15 angstrom resolution reveals the higher complexity of eukaryotic ribosomes, which are 40% larger than their bacterial counterparts. Our model shows how eukaryote-specific elements considerably expand the network of interactions within the ribosome and provides insights into eukaryote-specific features of protein synthesis. Our crystals capture the ribosome in the ratcheted state, which is essential for translocation of mRNA and transfer RNA (tRNA), and in which the small ribosomal subunit has rotated with respect to the large subunit. We describe the conformational changes in both ribosomal subunits that are involved in ratcheting and their implications in coordination between the two associated subunits and in mRNA and tRNA translocation.

  4. Alternative patterns of transcription and translation of the ribosomal protein L32 mRNA in somatic and spermatogenic cells in mice.

    Science.gov (United States)

    Kleene, Kenneth C; Cataldo, Leah; Mastrangelo, Mary-Ann; Tagne, Jean-Bosco

    2003-11-15

    The patterns of transcription and translation of the ribosomal protein L32 (Rpl32) mRNA differ greatly in adult testis and somatic tissues. Northern blots reveal that the levels of Rpl32 mRNA are four- to five-fold higher in prepubertal and adult testes, and purified pachytene spermatocytes and round spermatids than in a variety of nongrowing adult somatic tissues. 5' RACE demonstrates that transcription in 8-day prepubertal testis, which lacks meiotic and haploid cells, strongly prefers the same start site in the 5' terminal oligopyrimidine tract (5' TOP) that is used is somatic cells. The 5' TOP is a cis element that inhibits translation of many mRNAs in nongrowing somatic cells. Although the sizes of deadenylated Rpl32 mRNAs are indistinguishable in somatic and spermatogenic cells, transcription initiates at 11 sites over a 31-nt segment in adult testis and approximately 62% of Rpl32 mRNAs lack a 5' TOP. In agreement with previous studies, low levels of cycloheximide increase the proportions and sizes of polysomes in absorbance profiles, and increase the proportions and sizes of polysomes translating four 5' TOP mRNA species including the Rpl32 mRNA in 8-day seminiferous tubules. In contrast, cycloheximide has little or no effect on the absorbance profiles and distribution of Rpl32 mRNA and 5' TOP mRNAs in adult seminiferous tubules. The failure of cycloheximide to increase the size of polysomes in adult seminiferous tubules implies a block in the pathway by which ribosomes are recruited onto translationally active mRNAs.

  5. Overaccumulation of the chloroplast antisense RNA AS5 is correlated with decreased abundance of 5S rRNA in vivo and inefficient 5S rRNA maturation in vitro.

    Science.gov (United States)

    Sharwood, Robert E; Hotto, Amber M; Bollenbach, Thomas J; Stern, David B

    2011-02-01

    Post-transcriptional regulation in the chloroplast is exerted by nucleus-encoded ribonucleases and RNA-binding proteins. One of these ribonucleases is RNR1, a 3'-to-5' exoribonuclease of the RNase II family. We have previously shown that Arabidopsis rnr1-null mutants exhibit specific abnormalities in the expression of the rRNA operon, including the accumulation of precursor 23S, 16S, and 4.5S species and a concomitant decrease in the mature species. 5S rRNA transcripts, however, accumulate to a very low level in both precursor and mature forms, suggesting that they are unstable in the rnr1 background. Here we demonstrate that rnr1 plants overaccumulate an antisense RNA, AS5, that is complementary to the 5S rRNA, its intergenic spacer, and the downstream trnR gene, which encodes tRNA(Arg), raising the possibility that AS5 destabilizes 5S rRNA or its precursor and/or blocks rRNA maturation. To investigate this, we used an in vitro system that supports 5S rRNA and trnR processing. We show that AS5 inhibits 5S rRNA maturation from a 5S-trnR precursor, and shorter versions of AS5 demonstrate that inhibition requires intergenic sequences. To test whether the sense and antisense RNAs form double-stranded regions in vitro, treatment with the single-strand-specific mung bean nuclease was used. These results suggest that 5S-AS5 duplexes interfere with a sense-strand secondary structure near the endonucleolytic cleavage site downstream from the 5S rRNA coding region. We hypothesize that these duplexes are degraded by a dsRNA-specific ribonuclease in vivo, contributing to the 5S rRNA deficiency observed in rnr1.

  6. Optimal eukaryotic 18S and universal 16S/18S ribosomal RNA primers and their application in a study of symbiosis.

    Science.gov (United States)

    Wang, Yong; Tian, Ren Mao; Gao, Zhao Ming; Bougouffa, Salim; Qian, Pei-Yuan

    2014-01-01

    Eukaryotic 18S ribosomal RNA (rRNA) gene primers that feature a wide coverage are critical in detecting the composition of eukaryotic microscopic organisms in ecosystems. Here, we predicted 18S rRNA primers based on consecutive conserved sites and evaluated their coverage efficiency and scope of application to different eukaryotic groups. After evaluation, eight of them were considered as qualified 18S primers based on coverage rate. Next, we examined common conserved regions in prokaryotic 16S and eukaryotic 18S rRNA sequences to design 16S/18S universal primers. Three 16S/18S candidate primers, U515, U1390 and U1492, were then considered to be suitable for simultaneous amplification of the rRNA sequences in three domains. Eukaryotic 18S and prokaryotic 16S rRNA genes in a sponge were amplified simultaneously using universal primers U515 and U1390, and the subsequent sorting of pyrosequenced reads revealed some distinctive communities in different parts of the sample. The real difference in biodiversity between prokaryotic and eukaryotic symbionts could be discerned as the dissimilarity between OTUs was increased from 0.005 to 0.1. A network of the communities in external and internal parts of the sponge illustrated the co-variation of some unique microbes in certain parts of the sponge, suggesting that the universal primers are useful in simultaneous detection of prokaryotic and eukaryotic microbial communities.

  7. Optimal eukaryotic 18S and universal 16S/18S ribosomal RNA primers and their application in a study of symbiosis.

    Directory of Open Access Journals (Sweden)

    Yong Wang

    Full Text Available Eukaryotic 18S ribosomal RNA (rRNA gene primers that feature a wide coverage are critical in detecting the composition of eukaryotic microscopic organisms in ecosystems. Here, we predicted 18S rRNA primers based on consecutive conserved sites and evaluated their coverage efficiency and scope of application to different eukaryotic groups. After evaluation, eight of them were considered as qualified 18S primers based on coverage rate. Next, we examined common conserved regions in prokaryotic 16S and eukaryotic 18S rRNA sequences to design 16S/18S universal primers. Three 16S/18S candidate primers, U515, U1390 and U1492, were then considered to be suitable for simultaneous amplification of the rRNA sequences in three domains. Eukaryotic 18S and prokaryotic 16S rRNA genes in a sponge were amplified simultaneously using universal primers U515 and U1390, and the subsequent sorting of pyrosequenced reads revealed some distinctive communities in different parts of the sample. The real difference in biodiversity between prokaryotic and eukaryotic symbionts could be discerned as the dissimilarity between OTUs was increased from 0.005 to 0.1. A network of the communities in external and internal parts of the sponge illustrated the co-variation of some unique microbes in certain parts of the sponge, suggesting that the universal primers are useful in simultaneous detection of prokaryotic and eukaryotic microbial communities.

  8. Lack of WDR36 leads to preimplantation embryonic lethality in mice and delays the formation of small subunit ribosomal RNA in human cells in vitro.

    Science.gov (United States)

    Gallenberger, Martin; Meinel, Dominik M; Kroeber, Markus; Wegner, Michael; Milkereit, Philipp; Bösl, Michael R; Tamm, Ernst R

    2011-02-01

    Mutations in WD repeat domain 36 gene (WDR36) play a causative role in some forms of primary open-angle glaucoma, a leading cause of blindness worldwide. WDR36 is characterized by the presence of multiple WD40 repeats and shows homology to Utp21, an essential protein component of the yeast small subunit (SSU) processome required for maturation of 18S rRNA. To clarify the functional role of WDR36 in the mammalian organism, we generated and investigated mutant mice with a targeted deletion of Wdr36. In parallel experiments, we used RNA interference to deplete WDR36 mRNA in mouse embryos and cultured human trabecular meshwork (HTM-N) cells. Deletion of Wdr36 in the mouse caused preimplantation embryonic lethality, and essentially similar effects were observed when WDR36 mRNA was depleted in mouse embryos by RNA interference. Depletion of WDR36 mRNA in HTM-N cells caused apoptotic cell death and upregulation of mRNA for BAX, TP53 and CDKN1A. By immunocytochemistry, staining for WDR36 was observed in the nucleolus of cells, which co-localized with that of nucleolar proteins such as nucleophosmin and PWP2. In addition, recombinant and epitope-tagged WDR36 localized to the nucleolus of HTM-N cells. By northern blot analysis, a substantial decrease in 21S rRNA, the precursor of 18S rRNA, was observed following knockdown of WDR36. In addition, metabolic-labeling experiments consistently showed a delay of 18S rRNA maturation in WDR36-depleted cells. Our results provide evidence that WDR36 is an essential protein in mammalian cells which is involved in the nucleolar processing of SSU 18S rRNA.

  9. Cinnamomin-A Versatile Type Ⅱ Ribosome-inactivating Protein

    Institute of Scientific and Technical Information of China (English)

    Hong XU; Wang-Yi LIU

    2004-01-01

    Ribosome-inactivating proteins(RIPs)are a group of toxic proteins that can specifically act on the universally conserved sarcin/ricin domain(S/R domain)of the largest RNA in ribosome and thus irreversibly inactivate ribosome for protein synthesis.Cinnamomin is a multifunctional type Ⅱ RIP isolated in our laboratory from the mature seeds of the camphor tree.This protein has been extensively studied with regard to its purification,characteristics,structure and function,genetic expression,enzymatic mechanism,physiological role in seed cell and toxicity to cancer cells and insect larvae.The research results of cinnamomin obtained in our laboratory are summarized in this review.Understanding of cinnamomin and the relative new proteins will help expand our knowledge of RIPs and may accelerate theoretical study and the development of their potential applications.

  10. Nuclear Ribosomal RNA Small Subunit (18S rRNA) Nucleotide Sequen Nuclear Ribosomal RNA Small Subunit (18S rRNA) Nucleotide Sequen cing and Characterization of Sailonggu(Whole Bone of Myospalax baileyi Thomas)cing%塞隆骨原动物高原鼢鼠核基因18S rRNA序列测定与分析

    Institute of Scientific and Technical Information of China (English)

    曹晖; 刘玉萍; 张绍来; 周开亚

    2001-01-01

    目的:测定仓鼠科动物高原鼢鼠Myospalax b aileyi的核rDNA基因序列,为塞隆骨正品基原检定提供分子依据。方法:采用PCR直接测序技术测定高原鼢鼠18S rRNA基因核苷酸序列并作序列特征分析。[ HT5”H〗结果:高原鼢鼠的18S rRNA序列长度为1 851 bp。根据排序比较,高原鼢鼠与2种鼠科动物间的DNA序列同源性 为72.04%~72.18%。结论:通过基因序列分析,DNA测序技术可成为 塞隆骨正品基原检定的准确有效手段。%Objective: Sequencing the nuclear ribosomal RNA small subunit (18S r RNA) gene of Myospalax baileyi (Cricetidae) to develop an ultimate and defi nitive means for origin identification of genuine Sailonggu. Methods: The total DNA wa s prepared from dried tail tissues. The nuclear 18S rRNA gene region was amplifi ed by PCR using a consensus primer set and its nucleotide sequence was determine d by PCR direct sequencing. The characteristic analysis of 18S rRNA sequences wa s generated usin software program Genetyx-SV/R Version 10.1. Results: The entire 18S rRNA gene region of M. baileyi spanned 1851 bp in length. Althou gh m ultiple alignment of sequence indicates that there are only lower homology (72.0 4%~72.18%)comparing with its two alias Mus musculus (GenBank Accession numb er X 00686)and Rattus norvegicus (M11188)(Muridae), their highly conservative dom ain i s located in 1020~1509 nt. There are many variable sites from upstream of 5'-e nd , which coud provide a novel information for molecular recognition of Sailonggu. Conclusion:DNA sequencing could be a useful and reliable tool in the origin identification of genuine Sailonggu.

  11. Structural Dynamics of the Ribosome

    OpenAIRE

    Korostelev, Andrei; Ermolenko, Dmitri N.; Noller, Harry F.

    2008-01-01

    Protein synthesis is inherently a dynamic process, requiring both small- and large-scale movements of tRNA and mRNA. It has long been suspected that these movements might be coupled to conformational changes in the ribosome, and in its RNA moieties in particular. Recently, the nature of ribosome structural dynamics has begun to emerge from a combination of approaches, most notably cryo-EM, X-ray crystallography and FRET. Ribosome movement occurs both on a grand scale, as in the intersubunit r...

  12. Epistasis analysis of 16S rRNA ram mutations helps define the conformational dynamics of the ribosome that influence decoding.

    Science.gov (United States)

    Ying, Lanqing; Fredrick, Kurt

    2016-04-01

    The ribosome actively participates in decoding, with a tRNA-dependent rearrangement of the 30S A site playing a key role. Ribosomal ambiguity (ram) mutations have mapped not only to the A site but also to the h12/S4/S5 region and intersubunit bridge B8, implicating other conformational changes such as 30S shoulder rotation and B8 disruption in the mechanism of decoding. Recent crystallographic data have revealed that mutation G299A in helix h12 allosterically promotes B8 disruption, raising the question of whether G299A and/or other ram mutations act mainly via B8. Here, we compared the effects of each of several ram mutations in the absence and presence of mutation h8Δ2, which effectively takes out bridge B8. The data obtained suggest that a subset of mutations including G299A act in part via B8 but predominantly through another mechanism. We also found that G299A in h12 and G347U in h14 each stabilize tRNA in the A site. Collectively, these data support a model in which rearrangement of the 30S A site, inward shoulder rotation, and bridge B8 disruption are loosely coupled events, all of which promote progression along the productive pathway toward peptide bond formation.

  13. Structural and functional analysis of the Rpf2-Rrs1 complex in ribosome biogenesis

    Science.gov (United States)

    Asano, Nozomi; Kato, Koji; Nakamura, Akiyoshi; Komoda, Keisuke; Tanaka, Isao; Yao, Min

    2015-01-01

    Proteins Rpf2 and Rrs1 are required for 60S ribosomal subunit maturation. These proteins are necessary for the recruitment of three ribosomal components (5S ribosomal RNA [rRNA], RpL5 and RpL11) to the 90S ribosome precursor and subsequent 27SB pre-rRNA processing. Here we present the crystal structure of the Aspergillus nidulans (An) Rpf2-Rrs1 core complex. The core complex contains the tightly interlocked N-terminal domains of Rpf2 and Rrs1. The Rpf2 N-terminal domain includes a Brix domain characterized by similar N- and C-terminal architecture. The long α-helix of Rrs1 joins the C-terminal half of the Brix domain as if it were part of a single molecule. The conserved proline-rich linker connecting the N- and C-terminal domains of Rrs1 wrap around the side of Rpf2 and anchor the C-terminal domain of Rrs1 to a specific site on Rpf2. In addition, gel shift analysis revealed that the Rpf2-Rrs1 complex binds directly to 5S rRNA. Further analysis of Rpf2-Rrs1 mutants demonstrated that Saccharomyces cerevisiae Rpf2 R236 (corresponds to R238 of AnRpf2) plays a significant role in this binding. Based on these studies and previous reports, we have proposed a model for ribosomal component recruitment to the 90S ribosome precursor. PMID:25855814

  14. Mapping contacts of the S12-S7 intercistronic region of str operon mRNA with ribosomal protein S7 of E. coli.

    Science.gov (United States)

    Golovin, Andrey; Spiridonova, Vera; Kopylov, Alexei

    2006-10-30

    In E. coli, S7 initiates 30S ribosome assembly by binding to 16S rRNA. It also regulates translation of the S12 and S7 cistrons of the 'streptomycin' operon transcript by binding to the S12-S7 intercistronic region. Here, we describe the contacts of N-terminally His(6)-tagged S7 with this region as mapped by UV-induced cross-linking. The cross-links are located at U(-34), U(-35), quite distant from the start codons of the two cistrons. In order to explain the mechanism of translational repression of S12-S7, we consider a possible conformational rearrangement of the intercistronic RNA structure induced by S7 binding.

  15. Molecular typing of sand fly species (Diptera, Psychodidae, Phlebotominae) from areas endemic for Leishmaniasis in Ecuador by PCR-RFLP of 18S ribosomal RNA gene.

    Science.gov (United States)

    Terayama, Yoshimi; Kato, Hirotomo; Gomez, Eduardo A; Uezato, Hiroshi; Calvopiña, Manuel; Iwata, Hiroyuki; Hashiguchi, Yoshihisa

    2008-09-01

    Surveillance of the distribution of sand fly species is important for prediction of the risk and expansion of Leishmania infection in endemic and surrounding areas. In the present study, a simple and reliable method of typing New World Lutzomyia species circulating in endemic areas in Ecuador was established by using polymerase chain reaction (PCR)-restriction fragment length polymorphism (RFLP) technique. PCR-RFLP of 18S ribosomal RNA (rRNA) genes with the restriction enzyme AfaI and subsequently HinfI successfully identified seven sand fly species in nine endemic areas in Ecuador. Although intraspecific genetic-diversity affecting the RFLP-patterns was detected in a species, the patterns were species specific. The method promises to be a powerful tool for the classification of New World Lutzomyia species.

  16. The vhs1 mutant form of herpes simplex virus virion host shutoff protein retains significant internal ribosome entry site-directed RNA cleavage activity.

    Science.gov (United States)

    Lu, P; Saffran, H A; Smiley, J R

    2001-01-01

    The virion host shutoff (vhs) protein of herpes simplex virus (HSV) triggers global shutoff of host protein synthesis and accelerated turnover of host and viral mRNAs during HSV infection. As well, it induces endoribonucleolytic cleavage of RNA substrates when produced in a rabbit reticulocyte lysate (RRL) in vitro translation system. The vhs1 point mutation (Thr 214-->Ile) eliminates vhs function during virus infection and in transiently transfected mammalian cells and was therefore previously considered to abolish vhs activity. Here we demonstrate that the vhs1 mutant protein induces readily detectable endoribonuclease activity on RNA substrates bearing the internal ribosome entry site of encephalomyocarditis virus in the RRL assay system. These data document that the vhs1 mutation does not eliminate catalytic activity and raise the possibility that the vhs-dependent endoribonuclease employs more than one mode of substrate recognition.

  17. Phylogeny-function analysis of (meta)genomic libraries: screening for expression of ribosomal RNA genes by large-insert library fluorescent in situ hybridization (LIL-FISH).

    Science.gov (United States)

    Leveau, Johan H J; Gerards, Saskia; de Boer, Wietse; van Veen, Johannes A

    2004-09-01

    We assessed the utility of fluorescent in situ hybridization (FISH) in the screening of clone libraries of (meta)genomic or environmental DNA for the presence and expression of bacterial ribosomal RNA (rRNA) genes. To establish proof-of-principle, we constructed a fosmid-based library in Escherichia coli of large-sized genomic DNA fragments of the mycophagous soil bacterium Collimonas fungivorans, and hybridized 768 library clones with the Collimonas-specific fluorescent probe CTE998-1015. Critical to the success of this approach (which we refer to as large-insert library FISH or LIL-FISH) was the ability to induce fosmid copy number, the exponential growth status of library clones in the FISH assay and the use of a simple pooling strategy to reduce the number of hybridizations. Twelve out of 768 E. coli clones were suspected to harbour and express Collimonas 16S rRNA genes based on their hybridization to CTE998-1015. This was confirmed by the finding that all 12 clones were also identified in an independent polymerase chain reaction-based screening of the same 768 clones using a primer set for the specific detection of Collimonas 16S ribosomal DNA (rDNA). Fosmids isolated from these clones were grouped by restriction analysis into two distinct contigs, confirming that C. fungivorans harbours at least two 16S rRNA genes. For one contig, representing 1-2% of the genome, the nucleotide sequence was determined, providing us with a narrow but informative view of Collimonas genome structure and content.

  18. Nucleolar Dominance and Repression of 45S Ribosomal RNA Genes in Hybrids between Xenopus borealis and X. muelleri (2n = 36).

    Science.gov (United States)

    Maciak, Sebastian; Michalak, Katarzyna; Kale, Shiv D; Michalak, Pawel

    2016-01-01

    Nucleolar dominance is a dramatic disruption in the formation of nucleoli and the expression of ribosomal RNA (rRNA) genes, characteristic of some plant and animal hybrids. Here, we report that F1 hybrids produced from reciprocal crosses between 2 sister species of Xenopus clawed frogs, X. muelleri and X. borealis, undergo nucleolar dominance somewhat distinct from a pattern previously reported in hybrids between phylogenetically more distant Xenopus species. Patterns of nucleolar development, 45S rRNA expression, and gene copy inheritance were investigated using a combination of immunostaining, pyrosequencing, droplet digital PCR, flow cytometry, and epigenetic inhibition. In X. muelleri × X. borealis hybrids, typically only 1 nucleolus is formed, and 45S rRNA genes are predominantly expressed from 1 progenitor's alleles, X. muelleri, regardless of the cross-direction. These changes are accompanied by an extensive (∼80%) loss of rRNA gene copies in the hybrids relative to their parents, with the transcriptionally underdominant variant (X. borealis) being preferentially lost. Chemical treatment of hybrid larvae with a histone deacetylase inhibitor resulted in a partial derepression of the underdominant variant. Together, these observations shed light on the genetic and epigenetic basis of nucleolar dominance as an underappreciated manifestation of genetic conflicts within a hybrid genome.

  19. Transcriptional Regulation of Mouse Ribosomal RNA Synthesis by Pathways Involving Protein Kinase C, Calcium, Insulin and Serum

    Science.gov (United States)

    1992-05-08

    Arnheim , 1983). These enhancer regions share many of the same characteristics of polymerase II enhancers (Khoury and Grussl,1983). They enhance 6...1979) were kind gifts of Dr. Norman Arnheim . Plasmids pUC9, pUC19, and pUC18, T4 DNA ligase, all restriction enzymes and molecular weight markers were...H.E. Morgan, 1991. Phorbol Ester Stimulation of Protein Kinase C Activity and Ribosomal DNA Transcription, j. ;iol. Chem. 266:22003-22009. Arnheim , N

  20. Affinity of ribosomal protein S8 from mesophilic and (hyper)thermophilic archaea and bacteria for 16S rRNA correlates with the growth temperatures of the organisms.

    Science.gov (United States)

    Gruber, Thomas; Köhrer, Caroline; Lung, Birgit; Shcherbakov, Dmitri; Piendl, Wolfgang

    2003-08-14

    The ribosomal protein S8 plays a pivotal role in the assembly of the 30S ribosomal subunit. Using filter binding assays, S8 proteins from mesophilic, and (hyper)thermophilic species of the archaeal genus Methanococcus and from the bacteria Escherichia coli and Thermus thermophilus were tested for their affinity to their specific 16S rRNA target site. S8 proteins from hyperthermophiles exhibit a 100-fold and S8 from thermophiles exhibit a 10-fold higher affinity than their mesophilic counterparts. Thus, there is a striking correlation of affinity of S8 proteins for their specific RNA binding site and the optimal growth temperatures of the respective organisms. The stability of individual rRNA-protein complexes might modulate the stability of the ribosome, providing a maximum of thermostability and flexibility at the growth temperature of the organism.

  1. Ribosomal targets for antibiotic drug discovery

    Energy Technology Data Exchange (ETDEWEB)

    Blanchard, Scott C.; Feldman, Michael Brian; Wang, Leyi; Doudna Cate, James H.; Pulk, Arto; Altman, Roger B.; Wasserman, Michael R

    2016-09-13

    The present invention relates to methods to identify molecules that binds in the neomycin binding pocket of a bacterial ribosome using structures of an intact bacterial ribosome that reveal how the ribosome binds tRNA in two functionally distinct states, determined by x-ray crystallography. One state positions tRNA in the peptidyl-tRNA binding site. The second, a fully rotated state, is stabilized by ribosome recycling factor (RRF) and binds tRNA in a highly bent conformation in a hybrid peptidyl/exit (P/E) site. Additionally, the invention relates to various assays, including single-molecule assay for ribosome recycling, and methods to identify compounds that interfere with ribosomal function by detecting newly identified intermediate FRET states using known and novel FRET pairs on the ribosome. The invention also provides vectors and compositions with an N-terminally tagged S13 protein.

  2. Chemical and structural characterization of a model Post-Termination Complex (PoTC) for the ribosome recycling reaction: Evidence for the release of the mRNA by RRF and EF-G

    Science.gov (United States)

    Iwakura, Nobuhiro; Yokoyama, Takeshi; Quaglia, Fabio; Mitsuoka, Kaoru; Mio, Kazuhiro; Shigematsu, Hideki; Shirouzu, Mikako; Kaji, Akira; Kaji, Hideko

    2017-01-01

    A model Post-Termination Complex (PoTC) used for the discovery of Ribosome Recycling Factor (RRF) was purified and characterized by cryo-electron microscopic analysis and biochemical methods. We established that the model PoTC has mostly one tRNA, at the P/E or P/P position, together with one mRNA. The structural studies were supported by the biochemical measurement of bound tRNA and mRNA. Using this substrate, we establish that the release of tRNA, release of mRNA and splitting of ribosomal subunits occur during the recycling reaction. Order of these events is tRNA release first followed by mRNA release and splitting almost simultaneously. Moreover, we demonstrate that IF3 is not involved in any of the recycling reactions but simply prevents the re-association of split ribosomal subunits. Our finding demonstrates that the important function of RRF includes the release of mRNA, which is often missed by the use of a short ORF with the Shine-Dalgarno sequence near the termination site. PMID:28542628

  3. The origin of the 5S ribosomal RNA molecule could have been caused by a single inverse duplication: strong evidence from its sequences.

    Science.gov (United States)

    Branciamore, Sergio; Di Giulio, Massimo

    2012-04-01

    The secondary structure of the 5S ribosomal RNA (5S rRNA) molecule shows a high degree of symmetry. In order to explain the origin of this symmetry, it has been conjectured that one half of the 5S rRNA molecule was its precursor and that an indirect duplication of this precursor created the other half and thus the current symmetry of the molecule. Here, we have subjected to an empirical test both the indirect duplication model, analysing a total of 684 5S rRNA sequences for complementarity between the two halves of the 5S rRNA, and the direct duplication model analysing in this case the similarity between the two halves of this molecule. In intra- and inter-molecule and intra- and inter-domain comparisons, we find a high statistical support to the hypothesis of a complementarity relationship between the two halves of the 5S rRNA molecule, denying vice versa the hypothesis of similarity between these halves. Therefore, these observations corroborate the indirect duplication model at the expense of the direct duplication model, as reason of the origin of the 5S rRNA molecule. More generally, we discuss and favour the hypothesis that all RNAs and proteins, which present symmetry, did so through gene duplication and not by gradualistic accumulation of few monomers or segments of molecule into a gradualistic growth process. This would be the consequence of the very high propensity that nucleic acids have to be subjected to duplications.

  4. The RDP (Ribosomal Database Project).

    Science.gov (United States)

    Maidak, B L; Olsen, G J; Larsen, N; Overbeek, R; McCaughey, M J; Woese, C R

    1997-01-01

    The Ribosomal Database Project (RDP) is a curated database that offers ribosome-related data, analysis services and associated computer programs. The offerings include phylogenetically ordered alignments of ribosomal RNA (rRNA) sequences, derived phylogenetic trees, rRNA secondary structure diagrams, and various software for handling, analyzing and displaying alignments and trees. The data are available via anonymous FTP (rdp.life.uiuc.edu), electronic mail (server@rdp.life.uiuc.edu), gopher (rdpgopher.life.uiuc.edu) and WWW (http://rdpwww.life.uiuc.edu/ ). The electronic mail and WWW servers provide ribosomal probe checking, approximate phylogenetic placement of user-submitted sequences, screening for possible chimeric rRNA sequences, automated alignment, and a suggested placement of an unknown sequence on an existing phylogenetic tree.

  5. The Ribosomal Database Project (RDP).

    Science.gov (United States)

    Maidak, B L; Olsen, G J; Larsen, N; Overbeek, R; McCaughey, M J; Woese, C R

    1996-01-01

    The Ribosomal Database Project (RDP) is a curated database that offers ribosome-related data, analysis services and associated computer programs. The offerings include phylogenetically ordered alignments of ribosomal RNA (rRNA) sequences, derived phylogenetic trees, rRNA secondary structure diagrams and various software for handling, analyzing and displaying alignments and trees. The data are available via anonymous ftp (rdp.life.uiuc.edu), electronic mail (server@rdp.life.uiuc.edu), gopher (rdpgopher.life.uiuc.edu) and World Wide Web (WWW)(http://rdpwww.life.uiuc.edu/). The electronic mail and WWW servers provide ribosomal probe checking, screening for possible chimeric rRNA sequences, automated alignment and approximate phylogenetic placement of user-submitted sequences on an existing phylogenetic tree.

  6. Mutations of EXOSC3/Rrp40p associated with neurological diseases impact ribosomal RNA processing functions of the exosome in S. cerevisiae

    Science.gov (United States)

    Gillespie, Abby; Gabunilas, Jason; Jen, Joanna C.; Chanfreau, Guillaume F.

    2017-01-01

    The RNA exosome is a conserved multiprotein complex that achieves a large number of processive and degradative functions in eukaryotic cells. Recently, mutations have been mapped to the gene encoding one of the subunits of the exosome, EXOSC3 (yeast Rrp40p), which results in pontocerebellar hypoplasia with motor neuron degeneration in human patients. However, the molecular impact of these mutations in the pathology of these diseases is not well understood. To investigate the molecular consequences of mutations in EXOSC3 that lead to neurological diseases, we analyzed the effect of three of the mutations that affect conserved residues of EXOSC3/Rrp40p (G31A, G191C, and W238R; G8A, G148C, and W195R, respectively, in human and yeast) in S. cerevisiae. We show that the severity of the phenotypes of these mutations in yeast correlate with that of the disease in human patients, with the W195R mutant showing the strongest growth and RNA processing phenotypes. Furthermore, we show that these mutations affect more severely pre-ribosomal RNA processing functions of the exosome rather than other nuclear processing or surveillance functions. These results suggest that delayed or defective pre-rRNA processing might be the primary defect responsible for the pathologies detected in patients with mutations affecting EXOSC3 function in residues conserved throughout eukaryotes. PMID:28053271

  7. The structure of a single unit of ribosomal RNA gene (rDNA) including intergenic subrepeats in the Australian bulldog ant Myrmecia croslandi (Hymenoptera: Formicidae).

    Science.gov (United States)

    Ohnishi, Hitoshi; Yamamoto, Masa-Toshi

    2004-02-01

    A complete single unit of a ribosomal RNA gene (rDNA) of M. croslandi was sequenced. The ends of the 18S, 5.8S and 28S rRNA genes were determined by using the sequences of D. melanogaster rDNAs as references. Each of the tandemly repeated rDNA units consists of coding and non-coding regions whose arrangement is the same as that of D. melanogaster rDNA. The intergenic spacer (IGS) contains, as in other species, a region with subrepeats, of which the sequences are different from those previously reported in other insect species. The length of IGSs was estimated to be 7-12 kb by genomic Southern hybridization, showing that an rDNA repeating unit of M. croslandi is 14-19 kb-long. The sequences of the coding regions are highly conserved, whereas IGS and ITS (internal transcribed spacer) sequences are not. We obtained clones with insertions of various sizes of R2 elements, the target sequence of which was found in the 28S rRNA coding region. A short segment in the IGS that follows the 3' end of the 28S rRNA gene was predicted to form a secondary structure with long stems.

  8. Identification of the cis-elements mediating the autogenous control of ribosomal protein L2 mRNA stability in yeast.

    Science.gov (United States)

    Presutti, C; Villa, T; Hall, D; Pertica, C; Bozzoni, I

    1995-08-15

    The ribosomal protein L2 (rpL2) of Saccharomyces cerevisiae regulates the accumulation of its own mRNA by a feedback mechanism. An RNA sequence is responsible for this control, initially characterized as a 360 nucleotide-long region, localized at the 5' end of the transcript. This region, fused to an unrelated coding sequence, is able to down-regulate the accumulation of the chimeric transcript when increased levels of rpL2 are induced in the cell. The target regulatory region also responds to regulation when inserted inside an intron, demonstrating that the control process can take place inside the nucleus. Deletion analysis from the 5' and 3' borders have restricted the responsive region to approximately 200 nt. The insertion of a poly-G cassette downstream of the regulatory region allowed the identification of truncated 3' cut-off poly(A)+ RNA molecules. The parallel identification of cut-off molecules containing the 5' portion of the transcript allowed us to deduce that the truncated products originate by endonucleolytic cleavage. Altogether, these results are consistent with a mechanism by which the presence of excess amounts of rpL2 in the cell triggers its own mRNA to a degradative pathway; this involves an initial endonucleolytic cleavage that is followed by exonucleolytic trimming. Such a regulatory mechanism shows interesting analogies with the translational regulation of r-proteins in Escherichia coli.

  9. RNA sequencing to characterize transcriptional changes of sexual maturation and mating in the female oriental fruit fly Bactrocera dorsalis.

    Science.gov (United States)

    Zheng, Weiwei; Luo, Deye; Wu, Fangyu; Wang, Jialu; Zhang, Hongyu

    2016-03-05

    Female reproductive potential plays a significant role in the survival and stability of species, and sexual maturation and mating processes are crucial. However, our knowledge of the reproductive genes involved in sexual maturation and mating has been largely limited to model organisms. The oriental fruit fly Bactrocera dorsalis is a highly invasive agricultural pest, known to cause major economic losses; thus, it is of great value to understand the transcriptional changes involved in sexual maturation and mating processes as well as the related genes. Here, we used a high-throughput sequencing method to identify multiple genes potentially involved in sexual maturation and mating in female B. dorsalis. We sequenced 39,999 unique genes with an average length of 883 bp. In total, 3264 differentially expressed genes (DEGs) were detected between mature virgin and immature Bactrocera dorsalis libraries, whereas only 83 DEGs were identified between flies that had mated or were mature virgins. These DEGs were functionally annotated using the GO and KEGG pathway annotation tools. Results showed that the main GO terms associated with the DEGs from the mature virgin vs. immature groups were primarily assigned to the metabolic and developmental processes, which we focused on, whereas those from the mated vs. mature virgin group largely belonged to the response to stimulus and immune system processes. Additionally, we identified multiple DEGs during sexual maturation that are involved in reproduction, and expression pattern analysis revealed that the majority DEGs detected were highly enriched in those linked to the ovaries or fat bodies. Several mating responsive genes differentially expressed after mating were also identified, and all antimicrobial peptides detected were highly enriched in fat body and significantly up-regulated approximately 2- to 10-fold at 24 h after mating. This study supplied female reproductive genes involved in sexual maturation and the post

  10. mRNA decay factor AUF1 binds the internal ribosomal entry site of enterovirus 71 and inhibits virus replication.

    Directory of Open Access Journals (Sweden)

    Jing-Yi Lin

    Full Text Available AU-rich element binding factor 1 (AUF1 has a role in the replication cycles of different viruses. Here we demonstrate that AUF1 binds the internal ribosome entry site (IRES of enterovirus 71 (EV71 and negatively regulates IRES-dependent translation. During EV71 infection, AUF1 accumulates in the cytoplasm where viral replication occurs, whereas AUF1 localizes predominantly in the nucleus in mock-infected cells. AUF1 knockdown in infected cells increases IRES activity and synthesis of viral proteins. Taken together, the results suggest that AUF1 interacts with the EV71 IRES to negatively regulate viral translation and replication.

  11. Structure analysis of free and bound states of an RNA aptamer against ribosomal protein S8 from Bacillus anthracis.

    Science.gov (United States)

    Davlieva, Milya; Donarski, James; Wang, Jiachen; Shamoo, Yousif; Nikonowicz, Edward P

    2014-01-01

    Several protein-targeted RNA aptamers have been identified for a variety of applications and although the affinities of numerous protein-aptamer complexes have been determined, the structural details of these complexes have not been widely explored. We examined the structural accommodation of an RNA aptamer that binds bacterial r-protein S8. The core of the primary binding site for S8 on helix 21 of 16S rRNA contains a pair of conserved base triples that mold the sugar-phosphate backbone to S8. The aptamer, which does not contain the conserved sequence motif, is specific for the rRNA binding site of S8. The protein-free RNA aptamer adopts a helical structure with multiple non-canonical base pairs. Surprisingly, binding of S8 leads to a dramatic change in the RNA conformation that restores the signature S8 recognition fold through a novel combination of nucleobase interactions. Nucleotides within the non-canonical core rearrange to create a G-(G-C) triple and a U-(A-U)-U quartet. Although native-like S8-RNA interactions are present in the aptamer-S8 complex, the topology of the aptamer RNA differs from that of the helix 21-S8 complex. This is the first example of an RNA aptamer that adopts substantially different secondary structures in the free and protein-bound states and highlights the remarkable plasticity of RNA secondary structure.

  12. RNA polymerase II components and Rrn7 form a preinitiation complex on the HomolD box to promote ribosomal protein gene expression in Schizosaccharomyces pombe.

    Science.gov (United States)

    Montes, Matías; Moreira-Ramos, Sandra; Rojas, Diego A; Urbina, Fabiola; Käufer, Norbert F; Maldonado, Edio

    2017-02-01

    In Schizosaccharomyces pombe, ribosomal protein gene (RPG) promoters contain a TATA box analog, the HomolD box, which is bound by the Rrn7 protein. Despite the importance of ribosome biogenesis for cell survival, the mechanisms underlying RPG transcription remain unknown. In this study, we found that components of the RNA polymerase II (RNAPII) system, consisting of the initiation or general transcription factors (GTFs) TFIIA, IIB, IIE, TATA-binding protein (TBP) and the RNAPII holoenzyme, interacted directly with Rrn7 in vitro, and were able to form a preinitiation complex (PIC) on the HomolD box. PIC complex formation follows an ordered pathway on these promoters. The GTFs and RNAPII can also be cross-linked to HomolD-containing promoters in vivo. In an in vitro reconstituted transcription system, RNAPII components and Rrn7 were necessary for HomolD-directed transcription. The Mediator complex was required for basal transcription from those promoters in whole cell extract (WCE). The Med17 subunit of Mediator also can be cross-linked to the promoter region of HomolD-containing promoters in vivo, suggesting the presence of the Mediator complex on HomolD box-containing promoters. Together, these data show that components of the RNAPII machinery and Rrn7 participate in the PIC assembly on the HomolD box, thereby directing RPG transcription. © 2017 Federation of European Biochemical Societies.

  13. An internal ribosome entry site directs translation of the 3'-gene from Pelargonium flower break virus genomic RNA: implications for infectivity.

    Directory of Open Access Journals (Sweden)

    Olga Fernández-Miragall

    Full Text Available Pelargonium flower break virus (PFBV, genus Carmovirus has a single-stranded positive-sense genomic RNA (gRNA which contains five ORFs. The two 5'-proximal ORFs encode the replicases, two internal ORFs encode movement proteins, and the 3'-proximal ORF encodes a polypeptide (p37 which plays a dual role as capsid protein and as suppressor of RNA silencing. Like other members of family Tombusviridae, carmoviruses express ORFs that are not 5'-proximal from subgenomic RNAs. However, in one case, corresponding to Hisbiscus chlorotic ringspot virus, it has been reported that the 3'-proximal gene can be translated from the gRNA through an internal ribosome entry site (IRES. Here we show that PFBV also holds an IRES that mediates production of p37 from the gRNA, raising the question of whether this translation strategy may be conserved in the genus. The PFBV IRES was functional both in vitro and in vivo and either in the viral context or when inserted into synthetic bicistronic constructs. Through deletion and mutagenesis studies we have found that the IRES is contained within a 80 nt segment and have identified some structural traits that influence IRES function. Interestingly, mutations that diminish IRES activity strongly reduced the infectivity of the virus while the progress of the infection was favoured by mutations potentiating such activity. These results support the biological significance of the IRES-driven p37 translation and suggest that production of the silencing suppressor from the gRNA might allow the virus to early counteract the defence response of the host, thus facilitating pathogen multiplication and spread.

  14. An internal ribosome entry site directs translation of the 3'-gene from Pelargonium flower break virus genomic RNA: implications for infectivity.

    Science.gov (United States)

    Fernández-Miragall, Olga; Hernández, Carmen

    2011-01-01

    Pelargonium flower break virus (PFBV, genus Carmovirus) has a single-stranded positive-sense genomic RNA (gRNA) which contains five ORFs. The two 5'-proximal ORFs encode the replicases, two internal ORFs encode movement proteins, and the 3'-proximal ORF encodes a polypeptide (p37) which plays a dual role as capsid protein and as suppressor of RNA silencing. Like other members of family Tombusviridae, carmoviruses express ORFs that are not 5'-proximal from subgenomic RNAs. However, in one case, corresponding to Hisbiscus chlorotic ringspot virus, it has been reported that the 3'-proximal gene can be translated from the gRNA through an internal ribosome entry site (IRES). Here we show that PFBV also holds an IRES that mediates production of p37 from the gRNA, raising the question of whether this translation strategy may be conserved in the genus. The PFBV IRES was functional both in vitro and in vivo and either in the viral context or when inserted into synthetic bicistronic constructs. Through deletion and mutagenesis studies we have found that the IRES is contained within a 80 nt segment and have identified some structural traits that influence IRES function. Interestingly, mutations that diminish IRES activity strongly reduced the infectivity of the virus while the progress of the infection was favoured by mutations potentiating such activity. These results support the biological significance of the IRES-driven p37 translation and suggest that production of the silencing suppressor from the gRNA might allow the virus to early counteract the defence response of the host, thus facilitating pathogen multiplication and spread.

  15. In Profile: Models of Ribosome Biogenesis Defects and Regulation of Protein Synthesis

    NARCIS (Netherlands)

    Essers, P.B.M.

    2013-01-01

    Ribosomes are the mediators of protein synthesis in the cell and therefore crucial to proper cell function. In addition, ribosomes are highly abundant, with ribosomal RNA making up 80% of the RNA in the cell. A large amount of resources go into maintaining this pool of ribosomes, so ribosome biogene

  16. A definition of the domains Archaea, Bacteria and Eucarya in terms of small subunit ribosomal RNA characteristics

    Energy Technology Data Exchange (ETDEWEB)

    Winker, S. [Argonne National Lab., IL (United States). Mathematics and Computer Science Div.; Woese, C.R. [Univ. of Illinois, Urbana, IL (United States). Dept. of Microbiology

    1994-11-01

    The number of small subunit rRNA sequences is not great enough that the three domains Archaea, Bacteria, and Eucarya (Woese, et al., 1990) can be reliably defined in terms of their sequence ``signatures.`` Approximately 50 homologous positions (or nucleotide pairs) in the small subunit rRNA characterized and distinguish among the three. In addition, the three can be recognized by a variety of nonhomologous rRNA characters, either individual positions and/or higher-order structural features. The Crenarchaeota and the Euryarchaeota, the two archaeal kingdoms, can also be defined and distinguished by their characteristic composition at approximately fifteen positions in the small subunit rRNA molecule.

  17. A definition of the domains Archaea, Bacteria and Eucarya in terms of small subunit ribosomal RNA characteristics

    Science.gov (United States)

    Winker, S.; Woese, C. R.

    1991-01-01

    The number of small subunit rRNA sequences is now great enough that the three domains Archaea, Bacteria and Eucarya (Woese et al., 1990) can be reliably defined in terms of their sequence "signatures". Approximately 50 homologous positions (or nucleotide pairs) in the small subunit rRNA characterize and distinguish among the three. In addition, the three can be recognized by a variety of nonhomologous rRNA characters, either individual positions and/or higher-order structural features. The Crenarchaeota and the Euryarchaeota, the two archaeal kingdoms, can also be defined and distinguished by their characteristic compositions at approximately fifteen positions in the small subunit rRNA molecule.

  18. Use of Mature miRNA Strand Selection in miRNAs Families in Cervical Cancer Development

    Directory of Open Access Journals (Sweden)

    Angelica Judith Granados-López

    2017-02-01

    Full Text Available Aberrant miRNA expression is well recognized as a cancer hallmark, nevertheless miRNA function and expression does not always correlate in patients tissues and cell lines studies. In addition to this issue, miRNA strand usage conduces to increased cell signaling pathways modulation diversifying cellular processes regulation. In cervical cancer, 20 miRNA families are involved in carcinogenesis induction and development to this moment. These families have 5p and 3p strands with different nucleotide (nt chain sizes. In general, mature 5p strands are larger: two miRNAs of 24 nt, 24 miRNAs of 23 nt, 35 miRNAs of 22 nt and three miRNAs of 21 nt. On the other hand, the 3p strands lengths observed are: seven miRNAs of 23 nt, 50 miRNAs of 22 nt, six miRNAs of 21 nt and four miRNAs of 20 nt. Based on the analysis of the 20 miRNA families associated with cervical cancer, 67 3p strands and 65 5p strands are selected suggesting selectivity and specificity mechanisms regulating cell processes like proliferation, apoptosis, migration, invasion, metabolism and Warburg effect. The insight reviewed here could be used in the miRNA based therapy, diagnosis and prognosis approaches.

  19. Use of Mature miRNA Strand Selection in miRNAs Families in Cervical Cancer Development

    Science.gov (United States)

    Granados-López, Angelica Judith; Ruiz-Carrillo, José Luis; Servín-González, Luis Steven; Martínez-Rodríguez, José Luis; Reyes-Estrada, Claudia Araceli; Gutiérrez-Hernández, Rosalinda; López, Jesús Adrián

    2017-01-01

    Aberrant miRNA expression is well recognized as a cancer hallmark, nevertheless miRNA function and expression does not always correlate in patients tissues and cell lines studies. In addition to this issue, miRNA strand usage conduces to increased cell signaling pathways modulation diversifying cellular processes regulation. In cervical cancer, 20 miRNA families are involved in carcinogenesis induction and development to this moment. These families have 5p and 3p strands with different nucleotide (nt) chain sizes. In general, mature 5p strands are larger: two miRNAs of 24 nt, 24 miRNAs of 23 nt, 35 miRNAs of 22 nt and three miRNAs of 21 nt. On the other hand, the 3p strands lengths observed are: seven miRNAs of 23 nt, 50 miRNAs of 22 nt, six miRNAs of 21 nt and four miRNAs of 20 nt. Based on the analysis of the 20 miRNA families associated with cervical cancer, 67 3p strands and 65 5p strands are selected suggesting selectivity and specificity mechanisms regulating cell processes like proliferation, apoptosis, migration, invasion, metabolism and Warburg effect. The insight reviewed here could be used in the miRNA based therapy, diagnosis and prognosis approaches. PMID:28216603

  20. Global Annotation of Small RNA and MicroRNA Mature Sequences from Developing Ovules of Gossypium hirsutum L.

    Institute of Scientific and Technical Information of China (English)

    ABDURAKHMONOV Ibrokhim Y; DEVOR Eric J; HUANG Ling-yan; BURIEV Zabardast T; MAKAMOV Abdusalom; SHERMATOV Shukhrat E; ABDUKARIMOV Abdusattor

    2008-01-01

    @@ The involvement of small RNAs in cotton fiber development is under explored.The objective of this work was to directly clone,annotate,and analyze small RNAs of developing ovules to reveal the candidate small interfering RNA/microRNAs (siRNAs/miRNAs) involved in cotton ovule and fiber development.We cloned small RNA sequences from 0~10 days post anthesis (DPA) developing ovules of Gossypium hirsutum var.

  1. Reduced mature microRNA levels in association with dicer loss in human temporal lobe epilepsy with hippocampal sclerosis.

    Directory of Open Access Journals (Sweden)

    Ross C McKiernan

    Full Text Available Hippocampal sclerosis (HS is a common pathological finding in patients with temporal lobe epilepsy (TLE and is associated with altered expression of genes controlling neuronal excitability, glial function, neuroinflammation and cell death. MicroRNAs (miRNAs, a class of small non-coding RNAs, function as post-transcriptional regulators of gene expression and are critical for normal brain development and function. Production of mature miRNAs requires Dicer, an RNAase III, loss of which has been shown to cause neuronal and glial dysfunction, seizures, and neurodegeneration. Here we investigated miRNA biogenesis in hippocampal and neocortical resection specimens from pharmacoresistant TLE patients and autopsy controls. Western blot analysis revealed protein levels of Dicer were significantly lower in certain TLE patients with HS. Dicer levels were also reduced in the hippocampus of mice subject to experimentally-induced epilepsy. To determine if Dicer loss was associated with altered miRNA processing, we profiled levels of 380 mature miRNAs in control and TLE-HS samples. Expression of nearly 200 miRNAs was detected in control human hippocampus. In TLE-HS samples there was a large-scale reduction of miRNA expression, with 51% expressed at lower levels and a further 24% not detectable. Primary transcript (pri-miRNAs expression levels for several tested miRNAs were not different between control and TLE-HS samples. These findings suggest loss of Dicer and failure of mature miRNA expression may be a feature of the pathophysiology of HS in patients with TLE.

  2. The 28S-18S rDNA intergenic spacer from Crithidia fasciculata: repeated sequences, length heterogeneity, putative processing sites and potential interactions between U3 small nucleolar RNA and the ribosomal RNA precursor.

    Science.gov (United States)

    Schnare, M N; Collings, J C; Spencer, D F; Gray, M W

    2000-09-15

    In Crithidia fasciculata, the ribosomal RNA (rRNA) gene repeats range in size from approximately 11 to 12 kb. This length heterogeneity is localized to a region of the intergenic spacer (IGS) that contains tandemly repeated copies of a 19mer sequence. The IGS also contains four copies of an approximately 55 nt repeat that has an internal inverted repeat and is also present in the IGS of Leishmania species. We have mapped the C.fasciculata transcription initiation site as well as two other reverse transcriptase stop sites that may be analogous to the A0 and A' pre-rRNA processing sites within the 5' external transcribed spacer (ETS) of other eukaryotes. Features that could influence processing at these sites include two stretches of conserved primary sequence and three secondary structure elements present in the 5' ETS. We also characterized the C.fasciculata U3 snoRNA, which has the potential for base-pairing with pre-rRNA sequences. Finally, we demonstrate that biosynthesis of large subunit rRNA in both C. fasciculata and Trypanosoma brucei involves 3'-terminal addition of three A residues that are not present in the corresponding DNA sequences.

  3. Complementary roles of initiation factor 1 and ribosome recycling factor in 70S ribosome splitting

    Science.gov (United States)

    Pavlov, Michael Y; Antoun, Ayman; Lovmar, Martin; Ehrenberg, Måns

    2008-01-01

    We demonstrate that ribosomes containing a messenger RNA (mRNA) with a strong Shine–Dalgarno sequence are rapidly split into subunits by initiation factors 1 (IF1) and 3 (IF3), but slowly split by ribosome recycling factor (RRF) and elongation factor G (EF-G). Post-termination-like (PTL) ribosomes containing mRNA and a P-site-bound deacylated transfer RNA (tRNA) are split very rapidly by RRF and EF-G, but extremely slowly by IF1 and IF3. Vacant ribosomes are split by RRF/EF-G much more slowly than PTL ribosomes and by IF1/IF3 much more slowly than mRNA-containing ribosomes. These observations reveal complementary splitting of different ribosomal complexes by IF1/IF3 and RRF/EF-G, and suggest the existence of two major pathways for ribosome splitting into subunits in the living cell. We show that the identity of the deacylated tRNA in the PTL ribosome strongly affects the rate by which it is split by RRF/EF-G and that IF3 is involved in the mechanism of ribosome splitting by IF1/IF3 but not by RRF/EF-G. With support from our experimental data, we discuss the principally different mechanisms of ribosome splitting by IF1/IF3 and by RRF/EF-G. PMID:18497739

  4. Identification of planorbids from Venezuela by polymerase chain reaction amplification and restriction fragment length polymorphism of internal transcriber spacer of the RNA ribosomal gene

    Directory of Open Access Journals (Sweden)

    Caldeira Roberta L

    2000-01-01

    Full Text Available Snails of the genus Biomphalaria from Venezuela were subjected to morphological assessment as well as polymerase chain reaction and restriction fragment length polymorphism (PCR-RFLP analysis. Morphological identification was carried out by comparison of characters of the shell and the male and female reproductive apparatus. The PCR-RFLP involved amplification of the internal spacer region ITS1 and ITS2 of the RNA ribosomal gene and subsequent digestion of this fragment by the restriction enzymes DdeI, MnlI, HaeIII and MspI. The planorbids were compared with snails of the same species and others reported from Venezuela and present in Brazil, Cuba and Mexico. All the enzymes showed a specific profile for each species, that of DdeI being the clearest. The snails were identified as B. glabrata, B. prona and B. kuhniana.

  5. Identification of Biomphalaria havanensis and Biomphalaria obstructa populations from Cuba using polymerase chain reaction and restriction fragment length polymorphism of the ribosomal RNA intergenic spacer

    Directory of Open Access Journals (Sweden)

    Teofânia HDA Vidigal

    2001-07-01

    Full Text Available In Cuba, several Biomphalaria species have been reported such as B. orbignyi, B. schrammi, B. helophila, B. havanensis and B. peregrina; only the latter three are considered as potential hosts of Schistosoma mansoni. The specific identification of Biomphalaria species is based on anatomical and morphological characters of genital organs and shells. The correct identification of these snails is complicated by the high variation in these characters, similarity among species and in some cases by the small size of the snails. In this paper, we reported the classical morphological identification, the use of PCR and RFLP analysis of the internal transcribed spacer region of the ribosomal RNA genes for molecular identification of seven snail populations from different localities in Cuba. Using morphological and molecular analysis, we showed that among the studied Cuban Biomphalaria populations only B. havanensis and B. obstructa species were found.

  6. MicroRNA function is required for neurite outgrowth of mature neurons in the mouse postnatal cerebral cortex

    Directory of Open Access Journals (Sweden)

    Janet eHong

    2013-09-01

    Full Text Available The structure of the postnatal mammalian cerebral cortex is an assembly of numerous mature neurons that exhibit proper neurite outgrowth and axonal and dendritic morphology. While many protein coding genes are shown to be involved in neuronal maturation, the role of microRNAs (miRNAs in this process is also becoming evident. We here report that blocking miRNA biogenesis in differentiated neurons results in microcephaly-like phenotypes in the postnatal mouse brain. The smaller brain defect is not caused by defective neurogenesis, altered neuronal migration or significant neuronal cell death. Surprisingly, a dramatic increase in neuronal packing density within the postnatal brain is observed. Loss of miRNA function causes shorter neurite outgrowth and smaller soma size of mature neurons in vitro. Our results reveal the impact of miRNAs on normal development of neuronal morphology and brain function. Because neurite outgrowth is critical for neuroregeneration, our studies further highlight the importance of miRNAs in the treatment of neurodegenerative diseases.

  7. A comparison of the unfolding and dissociation of the large ribosome subunits from Rhodopseudomonas spheroides N.C.I.B. 8253 and Escherichia coli M.R.E. 600.

    Science.gov (United States)

    Robinson, A; Sykes, J

    1973-08-01

    . spheroides 45S and E. coli M.R.E. 600 and E. coli M.R.E. 162 50S ribosomes are compared. 6. The observations concerning unfolding and dissociation are consistent with previous reports showing the unusual rRNA complement of the mature R. spheroides 45S ribosome and show the dependence of these events upon the rRNA and the importance of protein-protein interactions in the structure of the R. spheroides ribosome.

  8. The aminoglycoside resistance methyltransferases from the ArmA/Rmt family operate late in the 30S ribosomal biogenesis pathway.

    Science.gov (United States)

    Zarubica, Tamara; Baker, Matthew R; Wright, H Tonie; Rife, Jason P

    2011-02-01

    Bacterial resistance to 4,6-type aminoglycoside antibiotics, which target the ribosome, has been traced to the ArmA/RmtA family of rRNA methyltransferases. These plasmid-encoded enzymes transfer a methyl group from S-adenosyl-L-methionine to N7 of the buried G1405 in the aminoglycoside binding site of 16S rRNA of the 30S ribosomal subunit. ArmA methylates mature 30S subunits but not 16S rRNA, 50S, or 70S ribosomal subunits or isolated Helix 44 of the 30S subunit. To more fully characterize this family of enzymes, we have investigated the substrate requirements of ArmA and to a lesser extent its ortholog RmtA. We determined the Mg+² dependence of ArmA activity toward the 30S ribosomal subunits and found that the enzyme recognizes both low Mg+² (translationally inactive) and high Mg+² (translationally active) forms of this substrate. We tested the effects of LiCl pretreatment of the 30S subunits, initiation factor 3 (IF3), and gentamicin/kasugamycin resistance methyltransferase (KsgA) on ArmA activity and determined whether in vivo derived pre-30S ribosomal subunits are ArmA methylation substrates. ArmA failed to methylate the 30S subunits generated from LiCl washes above 0.75 M, despite the apparent retention of ribosomal proteins and a fully mature 16S rRNA. From our experiments, we conclude that ArmA is most active toward the 30S ribosomal subunits that are at or very near full maturity, but that it can also recognize more than one form of the 30S subunit.

  9. MicroRNA-10a binds the 5'UTR of ribosomal protein mRNAs and enhances their translation

    DEFF Research Database (Denmark)

    Ørom, Ulf Andersson; Nielsen, Finn Cilius; Lund, Anders Henrik

    2008-01-01

    MicroRNAs (miRNAs) are small RNAs that function as posttranscriptional regulators of gene expression. miRNAs affect a variety of signaling pathways, and impaired miRNA regulation may contribute to the development of cancer and other diseases. Here we show that miRNA miR-10a interacts with the 5' ...

  10. Insects’ RNA Profiling Reveals Absence of “Hidden Break” in 28S Ribosomal RNA Molecule of Onion Thrips, Thrips tabaci

    Directory of Open Access Journals (Sweden)

    Rosaline Wanjiru Macharia

    2015-01-01

    Full Text Available With an exception of aphids, insects’ 28S rRNA is thought to harbor a “hidden break” which cleaves under denaturing conditions to comigrate with 18S rRNA band to exhibit a degraded appearance on native agarose gels. The degraded appearance confounds determination of RNA integrity in laboratories that rely on gel electrophoresis. To provide guidelines for RNA profiles, RNA from five major insect orders, namely, Diptera, Hemiptera, Thysanoptera, Hymenoptera, and Lepidoptera, was compared under denaturing and nondenaturing conditions. This study confirmed that although present in most of insect’s RNA, the “hidden break” is absent in the 28S rRNA of onion thrips, Thrips tabaci. On the other hand, presence of “hidden break” was depicted in whiteflies’ 28S rRNA despite their evolutionary grouping under same order with aphids. Divergence of 28S rRNA sequences confirms variation of both size and composition of gap region among insect species. However, phylogeny reconstruction does not support speciation as a possible source of the hidden break in insect’s 28S rRNA. In conclusion, we show that RNA from a given insect order does not conform to a particular banding profile and therefore this approach cannot be reliably used to characterize newly discovered species.

  11. Insects' RNA Profiling Reveals Absence of “Hidden Break” in 28S Ribosomal RNA Molecule of Onion Thrips, Thrips tabaci

    Science.gov (United States)

    Macharia, Rosaline Wanjiru; Ombura, Fidelis Levi; Aroko, Erick Onyango

    2015-01-01

    With an exception of aphids, insects' 28S rRNA is thought to harbor a “hidden break” which cleaves under denaturing conditions to comigrate with 18S rRNA band to exhibit a degraded appearance on native agarose gels. The degraded appearance confounds determination of RNA integrity in laboratories that rely on gel electrophoresis. To provide guidelines for RNA profiles, RNA from five major insect orders, namely, Diptera, Hemiptera, Thysanoptera, Hymenoptera, and Lepidoptera, was compared under denaturing and nondenaturing conditions. This study confirmed that although present in most of insect's RNA, the “hidden break” is absent in the 28S rRNA of onion thrips, Thrips tabaci. On the other hand, presence of “hidden break” was depicted in whiteflies' 28S rRNA despite their evolutionary grouping under same order with aphids. Divergence of 28S rRNA sequences confirms variation of both size and composition of gap region among insect species. However, phylogeny reconstruction does not support speciation as a possible source of the hidden break in insect's 28S rRNA. In conclusion, we show that RNA from a given insect order does not conform to a particular banding profile and therefore this approach cannot be reliably used to characterize newly discovered species. PMID:25767721

  12. Real-time quantitative reverse transcription-polymerase chain reaction to detect propionibacterial ribosomal RNA in the lymph nodes of Chinese patients with sarcoidosis.

    Science.gov (United States)

    Zhou, Y; Wei, Y-R; Zhang, Y; Du, S-S; Baughman, R P; Li, H-P

    2015-09-01

    The aim of this study was to investigate the diagnostic value of using the copy number of propionibacterial rRNA as a biomarker for sarcoidosis. Ribosomal RNA of Propionibacterium acnes and P. granulosum was measured by real-time quantitative reverse transcription-polymerase chain reaction (RT-PCR) using formalin-fixed and paraffin-embedded tissue of lymph node biopsy from 65 Chinese patients with sarcoidosis, 45 with tuberculosis and 50 controls with other diseases (23 with non-specific lymphadenitis and 27 with mediastinal lymph node metastasis from lung cancer). The receiver operating characteristic (ROC) curve was analysed to determine an optimal cut-off value for diagnosis, and the diagnostic accuracy of the cut-off value was evaluated in additional tissue samples [24 patients with sarcoidosis and 22 with tuberculosis (TB)]. P. acnes or P. granulosum rRNA was detected in 48 of the 65 sarcoidosis samples but only in four of the 45 TB samples and three of the 50 control samples. Analysis of the ROC curve revealed that an optimal cut-off value of the copy number of propionibacterial rRNA for diagnosis of sarcoidosis was 50·5 copies/ml with a sensitivity and specificity of 73·8 and 92·6%, respectively. Based on the cut-off value, 19 of the 24 additional sarcoidosis samples exhibited positive P. acnes or P. granulosum, whereas only one of the 22 additional TB samples was positive, resulting in a sensitivity and specificity of 79·2 and 95·5%, respectively. These findings suggest that propionibacteria might be associated with sarcoidosis granulomatous inflammation. Detection of propionibacterial rRNA by RT-PCR might possibly distinguish sarcoidosis from TB.

  13. Complete mitochondrial genomes and nuclear ribosomal RNA operons of two species of Diplostomum (Platyhelminthes: Trematoda): a molecular resource for taxonomy and molecular epidemiology of important fish pathogens.

    Science.gov (United States)

    Brabec, Jan; Kostadinova, Aneta; Scholz, Tomáš; Littlewood, D Timothy J

    2015-06-19

    The genus Diplostomum (Platyhelminthes: Trematoda: Diplostomidae) is a diverse group of freshwater parasites with complex life-cycles and global distribution. The larval stages are important pathogens causing eye fluke disease implicated in substantial impacts on natural fish populations and losses in aquaculture. However, the problematic species delimitation and difficulties in the identification of larval stages hamper the assessment of the distributional and host ranges of Diplostomum spp. and their transmission ecology. Total genomic DNA was isolated from adult worms and shotgun sequenced using Illumina MiSeq technology. Mitochondrial (mt) genomes and nuclear ribosomal RNA (rRNA) operons were assembled using established bioinformatic tools and fully annotated. Mt protein-coding genes and nuclear rRNA genes were subjected to phylogenetic analysis by maximum likelihood and the resulting topologies compared. We characterised novel complete mt genomes and nuclear rRNA operons of two closely related species, Diplostomum spathaceum and D. pseudospathaceum. Comparative mt genome assessment revealed that the cox1 gene and its 'barcode' region used for molecular identification are the most conserved regions; instead, nad4 and nad5 genes were identified as most promising molecular diagnostic markers. Using the novel data, we provide the first genome wide estimation of the phylogenetic relationships of the order Diplostomida, one of the two fundamental lineages of the Digenea. Analyses of the mitogenomic data invariably recovered the Diplostomidae as a sister lineage of the order Plagiorchiida rather than as a basal lineage of the Diplostomida as inferred in rDNA phylogenies; this was concordant with the mt gene order of Diplostomum spp. exhibiting closer match to the conserved gene order of the Plagiorchiida. Complete sequences of the mt genome and rRNA operon of two species of Diplostomum provide a valuable resource for novel genetic markers for species delineation and

  14. Chromosome Mapping of 18S Ribosomal RNA Genes in Eleven Hypostomus Species (Siluriformes, Loricariidae): Diversity Analysis of the Sites.

    Science.gov (United States)

    Rubert, Marceléia; da Rosa, Renata; Zawadzki, Claudio H; Mariotto, Sandra; Moreira-Filho, Orlando; Giuliano-Caetano, Lucia

    2016-08-01

    We investigated the chromosomal distribution of 18S ribosomal DNA (rDNA) in different populations of 11 species of Hypostomus collected in important Brazilian basins, namely South Atlantic, Upper Paraná, and Paraguay applying the fluorescence in situ hybridization (FISH). Hypostomus cochliodon, Hypostomus commersoni, Hypostomus hermanni, Hypostomus regani, Hypostomus albopunctatus, Hypostomus paulinus, Hypostomus aff. paulinus, Hypostomus iheringii, and Hypostomus mutucae presented multiple 18S rDNA sites while Hypostomus strigaticeps and Hypostomus nigromaculatus exhibited a single pair of chromosomes with 18S rDNA sites. The studied species presented variations in the number and position of these sites. The results accomplished were similar to those obtained by the analysis of AgNORs, revealing the same interspecific variability. Each species exhibited distinctive patterns of AgNOR and 18S rDNA distribution, which can be considered cytogenetic markers in each species of the genus and help improve the discussions on the phylogeny of the group.

  15. MicroRNA Maturation and MicroRNA Target Gene Expression Regulation Are Severely Disrupted in Soybean dicer-like1 Double Mutants

    Directory of Open Access Journals (Sweden)

    Shaun J. Curtin

    2016-02-01

    Full Text Available Small nonprotein-coding microRNAs (miRNAs are present in most eukaryotes and are central effectors of RNA silencing-mediated mechanisms for gene expression regulation. In plants, DICER-LIKE1 (DCL1 is the founding member of a highly conserved family of RNase III-like endonucleases that function as core machinery proteins to process hairpin-like precursor transcripts into mature miRNAs, small regulatory RNAs, 21–22 nucleotides in length. Zinc finger nucleases (ZFNs were used to generate single and double-mutants of putative soybean DCL1 homologs, DCL1a and DCL1b, to confirm their functional role(s in the soybean miRNA pathway. Neither DCL1 single mutant, dcl1a or dcl1b plants, exhibited a pronounced morphological or molecular phenotype. However, the dcl1a/dcl1b double mutant expressed a strong morphological phenotype, characterized by reduced seed size and aborted seedling development, in addition to defective miRNA precursor transcript processing efficiency and deregulated miRNA target gene expression. Together, these findings indicate that the two soybean DCL1 paralogs, DCL1a and DCL1b, largely play functionally redundant roles in the miRNA pathway and are essential for normal plant development.

  16. Using a commercial DNA extraction kit to obtain RNA from mature rice kernels

    Science.gov (United States)

    Few RNA extraction protocols or commercial kits work well with the starchy endosperm of cereal grains. Standard RNA extraction protocols are time consuming, use large amounts of expensive chemicals, and leave behind hazardous wastes. However, there are numerous commercial DNA extraction kits that ...

  17. Haptophyte Diversity and Vertical Distribution Explored by 18S and 28S Ribosomal RNA Gene Metabarcoding and Scanning Electron Microscopy.

    Science.gov (United States)

    Gran-Stadniczeñko, Sandra; Šupraha, Luka; Egge, Elianne D; Edvardsen, Bente

    2017-07-01

    Haptophyta encompasses more than 300 species of mostly marine pico- and nanoplanktonic flagellates. Our aims were to investigate the Oslofjorden haptophyte diversity and vertical distribution by metabarcoding, and to improve the approach to study haptophyte community composition, richness and proportional abundance by comparing two rRNA markers and scanning electron microscopy (SEM). Samples were collected in August 2013 at the Outer Oslofjorden, Norway. Total RNA/cDNA was amplified by haptophyte-specific primers targeting the V4 region of the 18S, and the D1-D2 region of the 28S rRNA. Taxonomy was assigned using curated haptophyte reference databases and phylogenetic analyses. Both marker genes showed Chrysochromulinaceae and Prymnesiaceae to be the families with highest number of Operational Taxonomic Units (OTUs), as well as proportional abundance. The 18S rRNA data set also contained OTUs assigned to eight supported and defined clades consisting of environmental sequences only, possibly representing novel lineages from family to class. We also recorded new species for the area. Comparing coccolithophores by SEM with metabarcoding shows a good correspondence with the 18S rRNA gene proportional abundances. Our results contribute to link morphological and molecular data and 28S to 18S rRNA gene sequences of haptophytes without cultured representatives, and to improve metabarcoding methodology. © 2016 The Authors Journal of Eukaryotic Microbiology published by Wiley Periodicals, Inc. on behalf of International Society of Protistologists.

  18. Polynucleotide Phosphorylase, RNase E/G, and YbeY Are Involved in the Maturation of 4.5S RNA in Corynebacterium glutamicum.

    Science.gov (United States)

    Maeda, Tomoya; Tanaka, Yuya; Wachi, Masaaki; Inui, Masayuki

    2017-03-01

    Corynebacterium glutamicum has been applied for the industrial production of various metabolites, such as amino acids. To understand the biosynthesis of the membrane protein in this bacterium, we investigated the process of signal recognition particle (SRP) assembly. SRP is found in all three domains of life and plays an important role in the membrane insertion of proteins. SRP RNA is initially transcribed as precursor molecules; however, relatively little is known about its maturation. In C. glutamicum, SRP consists of the Ffh protein and 4.5S RNA lacking an Alu domain. In this study, we found that 3'-to-5' exoribonuclease, polynucleotide phosphorylase (PNPase), and two endo-type RNases, RNase E/G and YbeY, are involved in the 3' maturation of 4.5S RNA in C. glutamicum The mature form of 4.5S RNA was inefficiently formed in ΔrneG Δpnp mutant cells, suggesting the existence of an alternative pathway for the 3' maturation of 4.5S RNA. Primer extension analysis also revealed that the 5' mature end of 4.5S RNA corresponds to that of the transcriptional start site. Immunoprecipitated Ffh protein contained immature 4.5S RNA in Δpnp, ΔrneG, and ΔybeY mutants, suggesting that 4.5S RNA precursors can interact with Ffh. These results imply that the maturation of 4.5S RNA can be performed in the 4.5S RNA-Ffh complex.IMPORTANCE Overproduction of a membrane protein, such as a transporter, is useful for engineering of strains of Corynebacterium glutamicum, which is a workhorse of amino acid production. To understand membrane protein biogenesis in this bacterium, we investigated the process of signal recognition particle (SRP) assembly. SRP contains the Ffh protein and SRP RNA and plays an important role in the membrane insertion of proteins. Although SRP RNA is highly conserved among the three domains of life, relatively little is known about its maturation. We show that PNPase, RNase E/G, and YbeY are involved in the 3' maturation of the SRP RNA (4.5S RNA) in this

  19. Molecular characterization of the full-length 23S and 5S ribosomal RNA (rRNA) genes of Taylorella asinigenitalis.

    Science.gov (United States)

    Tazumi, Akihiro; Saito, Satoru; Sekizuka, Tsuyoshi; Murayama, Ohoshi; Takamiya, Shinzaburo; Moore, John E; Millar, B Cherie; Matsuda, Motoo

    2007-08-01

    An approximately 4.2 kbp region encoding 23S and 5S rRNA genes was identified when recombinant plasmid DNAs from two genomic DNA libraries and an inverse PCR product of Taylorella asinigenitalis UK-1 isolate were analyzed. Full-length genes of 23S rRNA (3,225 bp) and 5S rRNA (117 bp) of T. asinigenitalis are described. The present sequence analysis identified a non-coding hypothetically intrinsic transcription terminator region downstream of the 5S rRNA gene. The sequence, however, downstream of the 5S rRNA gene did not show any distal tRNA genes. Surprisingly, an intervening sequence (IVS) of 270 bp in length, including two specific tandem repeat units of 80 bp and one partial unit of 48 bp with unknown functions was identified in the first quarter of the 23S rRNA gene sequence. A second IVS of 70 bp in length was also identified in the central region of the 23S rRNA gene. In addition, by using PCR and sequencing procedures, two T. asinigenitalis isolates, UK-1 and UK-2, carried multiple IVSs in the first quarter and central regions. Moreover, the 23S rRNA fragmentation occurred in the UK-1 isolate. A phylogenetic analysis was first carried out based on the 23S rRNA sequence data from T. asinigenitalis UK-1 and 13 other beta-Proteobacteria. This is the first report of IVSs in the 23S rRNA gene from the beta-Proteobacteria.

  20. Mutations at three sites in the Escherichia coli 23S ribosomal RNA binding region for protein L11 cause UGA-specific suppression and conditional lethality.

    Science.gov (United States)

    Murgola, E J; Xu, W; Arkov, A L

    1995-01-01

    A single nucleotide change, G to A, at nucleotide position 1093 of E. coli 23S ribosomal RNA was found to cause UGA-specific suppression (D.K. Jemiolo, F.T. Pagel and E.J. Murgola, Proc. Natl. Acad. Sci. USA, in press). To obtain new kinds of UGA-specific suppressors in 23S rRNA, we used segment-directed mutagenic PCR, and targeted first the 1405 nucleotide SnaBI/I-CeuI segment, which includes position 1093, of the rrnB operon cloned into a multicopy plasmid. The mutagenized fragments were subcloned into the plasmid vector and used to transform to ampicillin resistance (Ampr) a recipient strain containing a UGA mutation in trpA. The Ampr transformants were then screened for suppression of UGA. After purification, Trp+ transformants were tested for association of the suppressor phenotype first with the plasmid and then specifically with the SnaBI/I-CeuI fragment. In one screening, four different kinds of mutational change were found, all at three sites within a highly conserved hexanucleotide loop in domain II of 23S rRNA. This region is part of the site for binding of the large subunit protein L11, which has been shown to be involved in peptide chain termination in a specific way. All of the mutants (G1093A, G1093 delta, A1095 delta, and U1097 delta) suppress UGA mutations, but not UAA or UAG mutations, and all four types exhibit high-temperature conditional lethality when highly expressed. Several mechanisms can be suggested for the UGA-specific suppression exhibited by these mutants, including altered interaction with protein L11, Second-site mutations that overcome the conditional lethality of G1093A indicate that intramolecular interactions within 23S rRNA may play a role in peptide chain termination at the UGA stop codon.

  1. Added resolution among ordinal level relationships of tapeworms (Platyhelminthes: Cestoda) with complete small and large subunit nuclear ribosomal RNA genes.

    Science.gov (United States)

    Waeschenbach, Andrea; Webster, Bonnie L; Bray, Rodney A; Littlewood, D T J

    2007-10-01

    The addition of large subunit ribosomal DNA (lsrDNA) to small subunit ribosomal DNA (ssrDNA) has been shown to add resolution to phylogenies at various taxonomic levels for a diversity of phyla. We added nearly complete lsrDNA (4057-4593bp) sequences to ssrDNA (1940-2228bp) for 26 ingroup and 3 outgroup taxa in an attempt to provide an improved ordinal phylogeny for the Cestoda. Ten lsrDNA and seven ssrDNA sequences were generated from new taxa and 13 existing partial lsrDNA sequences were sequenced to completion. The majority of phylogenetic signal in the combined analysis came from lsrDNA (69.6% of parsimonious informative sites, as opposed to 30.4% obtained from ssrDNA), resulting in almost identical topologies for lsrDNA and lsr+ssrDNA (pairwise symmetric distance=6) in model-based analyses. Topology testing found trees based on partial lsrDNA (domains D1-D3)+ssrDNA and complete lsr+ssrDNA to differ significantly; the addition of lsrDNA domains D4-D12 had a significant effect on topology. Overall nodal support was greatest in the combined analysis and weakest for ssrDNA only. Our molecular phylogenies differed significantly from those based on morphology alone. Acetabulate lineages form a monophyletic group, with the Tetraphyllidea being paraphyletic. Support for the combined data was high for the following topology: (Litobothriidea (Lecanicephalidea (Rhinebothrium/Rhodobothrium (Clistobothrium (Pachybothrium(Acanthobothrium Proteocephalidea) (Mesocestoididae, Nippotaeniidea, Cyclophyllidea, Tetrabothriidea)))))); all genus names refer to tetraphyllidean lineages. Although the interrelationships among the four most derived taxa remain uncertain, overall ambiguity of the acetabulate interrelationships was reduced. The Pseudophyllidea were recovered as polyphyletic, with support for a sister-group relationship between Diphyllobothriidae and Haplobothriidea. The monophyly of the Trypanorhyncha was recovered for the first time based on molecular data. The positions

  2. YsxC, an essential protein in Staphylococcus aureus crucial for ribosome assembly/stability

    Directory of Open Access Journals (Sweden)

    García-Lara Jorge

    2009-12-01

    Full Text Available Abstract Background Bacterial growth and division requires a core set of essential proteins, several of which are still of unknown function. They are also attractive targets for the development of new antibiotics. YsxC is a member of a family of GTPases highly conserved across eubacteria with a possible ribosome associated function. Results Here, we demonstrate by the creation of a conditional lethal mutant that ysxC is apparently essential for growth in S. aureus. To begin to elucidate YsxC function, a translational fusion of YsxC to the CBP-ProteinA tag in the staphylococcal chromosome was made, enabling Tandem Affinity Purification (TAP of YsxC-interacting partners. These included the ribosomal proteins S2, S10 and L17, as well as the β' subunit of the RNA polymerase. YsxC was then shown to copurify with ribosomes as an accessory protein specifically localizing to the 50 S subunit. YsxC depletion led to a decrease in the presence of mature ribosomes, indicating a role in ribosome assembly and/or stability in S. aureus. Conclusions In this study we demonstrate that YsxC of S. aureus localizes to the ribosomes, is crucial for ribosomal stability and is apparently essential for the life of S. aureus.

  3. Mapping the ribosomal protein S7 regulatory binding site on mRNA of the E. coli streptomycin operon.

    Science.gov (United States)

    Surdina, A V; Rassokhin, T I; Golovin, A V; Spiridonova, V A; Kopylov, A M

    2010-07-01

    In this work it is shown by deletion analysis that an intercistronic region (ICR) approximately 80 nucleotides in length is necessary for interaction with recombinant E. coli S7 protein (r6hEcoS7). A model is proposed for the interaction of S7 with two ICR sites-region of hairpin bifurcations and Shine-Dalgarno sequence of cistron S7. A de novo RNA binding site for heterologous S7 protein of Thermus thermophilus (r6hTthS7) was constructed by selection of a combinatorial RNA library based on E. coli ICR: it has only a single supposed protein recognition site in the region of bifurcation. The SERW technique was used for selection of two intercistronic RNA libraries in which five nucleotides of a double-stranded region, adjacent to the bifurcation, had the randomized sequence. One library contained an authentic AG (-82/-20) pair, while in the other this pair was replaced by AU. A serwamer capable of specific binding to r6hTthS7 was selected; it appeared to be the RNA68 mutant with eight nucleotide mutations. The serwamer binds to r6hTthS7 with the same affinity as homologous authentic ICR of str mRNA binds to r6hEcoS7; apparent dissociation constants are 89 +/- 43 and 50 +/- 24 nM, respectively.

  4. Functional and structural analysis of the internal ribosome entry site present in the mRNA of natural variants of the HIV-1.

    Science.gov (United States)

    Vallejos, Maricarmen; Carvajal, Felipe; Pino, Karla; Navarrete, Camilo; Ferres, Marcela; Huidobro-Toro, Juan Pablo; Sargueil, Bruno; López-Lastra, Marcelo

    2012-01-01

    The 5'untranslated regions (UTR) of the full length mRNA of the HIV-1 proviral clones pNL4.3 and pLAI, harbor an internal ribosomal entry site (IRES). In this study we extend this finding by demonstrating that the mRNA 5'UTRs of natural variants of HIV-1 also exhibit IRES-activity. Cap-independent translational activity was demonstrated using bicistronic mRNAs in HeLa cells and in Xenopus laevis oocytes. The possibility that expression of the downstream cistron in these constructs was due to alternative splicing or to cryptic promoter activity was ruled out. The HIV-1 variants exhibited significant 5'UTR nucleotide diversity with respect to the control sequence recovered from pNL4.3. Interestingly, translational activity from the 5'UTR of some of the HIV-1 variants was enhanced relative to that observed for the 5'UTR of pNL4.3. In an attempt to explain these findings we probed the secondary structure of the variant HIV-1 5'UTRs using enzymatic and chemical approaches. Yet subsequent structural analyses did not reveal significant variations when compared to the pNL4.3-5'UTR. Thus, the increased IRES-activity observed for some of the HIV-1 variants cannot be ascribed to a specific structural modification. A model to explain these findings is proposed.

  5. Functional and structural analysis of the internal ribosome entry site present in the mRNA of natural variants of the HIV-1.

    Directory of Open Access Journals (Sweden)

    Maricarmen Vallejos

    Full Text Available The 5'untranslated regions (UTR of the full length mRNA of the HIV-1 proviral clones pNL4.3 and pLAI, harbor an internal ribosomal entry site (IRES. In this study we extend this finding by demonstrating that the mRNA 5'UTRs of natural variants of HIV-1 also exhibit IRES-activity. Cap-independent translational activity was demonstrated using bicistronic mRNAs in HeLa cells and in Xenopus laevis oocytes. The possibility that expression of the downstream cistron in these constructs was due to alternative splicing or to cryptic promoter activity was ruled out. The HIV-1 variants exhibited significant 5'UTR nucleotide diversity with respect to the control sequence recovered from pNL4.3. Interestingly, translational activity from the 5'UTR of some of the HIV-1 variants was enhanced relative to that observed for the 5'UTR of pNL4.3. In an attempt to explain these findings we probed the secondary structure of the variant HIV-1 5'UTRs using enzymatic and chemical approaches. Yet subsequent structural analyses did not reveal significant variations when compared to the pNL4.3-5'UTR. Thus, the increased IRES-activity observed for some of the HIV-1 variants cannot be ascribed to a specific structural modification. A model to explain these findings is proposed.

  6. Prevalence, Genetic Characterization, and 18S Small Subunit Ribosomal RNA Diversity of Trypanosoma rangeli in Triatomine and Mammal Hosts in Endemic Areas for Chagas Disease in Ecuador.

    Science.gov (United States)

    Ocaña-Mayorga, Sofia; Aguirre-Villacis, Fernanda; Pinto, C Miguel; Vallejo, Gustavo A; Grijalva, Mario J

    2015-12-01

    Trypanosoma rangeli is a nonpathogenic parasite for humans; however, its medical importance relies in its similarity and overlapping distribution with Trypanosoma cruzi, causal agent of Chagas disease in the Americas. The genetic diversity of T. rangeli and its association with host species (triatomines and mammals) has been identified along Central and the South America; however, it has not included data of isolates from Ecuador. This study reports infection with T. rangeli in 18 genera of mammal hosts and five species of triatomines in three environments (domestic, peridomestic, and sylvatic). Higher infection rates were found in the sylvatic environment, in close association with Rhodnius ecuadoriensis. The results of this study extend the range of hosts infected with this parasite and the geographic range of the T. rangeli genotype KP1(-)/lineage C in South America. It was not possible to detect variation on T. rangeli from the central coastal region and southern Ecuador with the analysis of the small subunit ribosomal RNA (SSU-rRNA) gene, even though these areas are ecologically different and a phenotypic subdivision of R. ecuadoriensis has been found. R. ecuadoriensis is considered one of the most important vectors for Chagas disease transmission in Ecuador due to its wide distribution and adaptability to diverse environments. An extensive knowledge of the trypanosomes circulating in this species of triatomine, and associated mammal hosts, is important for delineating transmission dynamics and preventive measures in the endemic areas of Ecuador and Northern Peru.

  7. Interferons specifically suppress the translation from the internal ribosome entry site of hepatitis C virus through a double-stranded RNA-activated protein kinase-independent pathway.

    Science.gov (United States)

    Kato, Jun; Kato, Naoya; Moriyama, Masaru; Goto, Tadashi; Taniguchi, Hiroyoshi; Shiratori, Yasushi; Omata, Masao

    2002-07-15

    Interferon (IFN) therapy is used worldwide as the best available treatment for hepatitis C virus (HCV) infection; however, little is known about how IFN or other drugs work against liver diseases. The effect of 6 drugs (glycyrrhizin, ursodeoxycholic acid, ribavirin, methylprednisolone, IFN-alpha, and IFN-beta) on HCV RNA translation from the HCV internal ribosome entry site (IRES) was investigated, using a bicistronic reporter containing the HCV IRES. IFNs suppressed both cap-dependent and HCV IRES-dependent translation, with HCV IRES-dependent translation being more significantly suppressed. In contrast to HCV IRES, IFN did not suppress either foot-and-mouth disease virus IRES-dependent or encephalomyocarditis virus IRES-dependent translation more than it suppressed cap-dependent translation. Moreover, dominant inhibition of HCV IRES-dependent over cap-dependent translation depended neither on the double-stranded RNA-activated protein kinase activation nor on La protein function. These results indicate a novel antiviral effect of IFNs against HCV.

  8. Hepatitis C virus internal ribosome entry site RNA contains a tertiary structural element in a functional domain of stem–loop II

    Science.gov (United States)

    Lyons, Alita J.; Lytle, J. Robin; Gomez, Jordi; Robertson, Hugh D.

    2001-01-01

    The internal ribosome entry site (IRES) of hepatitis C virus (HCV) RNA contains >300 bases of highly conserved 5′-terminal sequence, most of it in the uncapped 5′-untranslated region (5′-UTR) upstream from the single AUG initiator triplet at which translation of the HCV polyprotein begins. Although progress has been made in defining singularities like the RNA pseudoknot near this AUG, the sequence and structural features of the HCV IRES which stimulate accurate and efficient initiation of protein synthesis are only partially defined. Here we report that a region further upstream from the AUG, stem–loop II of the HCV IRES, also contains an element of local tertiary structure which we have detected using RNase H cleavage and have mapped using the singular ability of two bases therein to undergo covalent intra-chain crosslinking stimulated by UV light. This pre-existing element maps to two non-contiguous stretches of the HCV IRES sequence, residues 53–68 and 103–117. Several earlier studies have shown that the correct sequence between bases 45 and 70 of the HCV IRES stem–loop II domain is required for initiation of protein synthesis. Because features of local tertiary structure like the one we report here are often associated with protein binding, we propose that the HCV stem–loop II element is directly involved in IRES action. PMID:11410661

  9. MRN1 implicates chromatin remodeling complexes and architectural factors in mRNA maturation

    DEFF Research Database (Denmark)

    Düring, Louis; Thorsen, Michael; Petersen, Darima

    2012-01-01

    A functional relationship between chromatin structure and mRNA processing events has been suggested, however, so far only a few involved factors have been characterized. Here we show that rsc nhp6¿¿ mutants, deficient for the function of the chromatin remodeling factor RSC and the chromatin...... architectural proteins Nhp6A/Nhp6B, accumulate intron-containing pre-mRNA at the restrictive temperature. In addition, we demonstrate that rsc8-ts16 nhp6¿¿ cells contain low levels of U6 snRNA and U4/U6 di-snRNA that is further exacerbated after two hours growth at the restrictive temperature. This change in U6...

  10. Utility of divergent domains of 28S ribosomal RNA in species discrimination of paramphistomes (Trematoda: Digenea: Paramphistomoidea).

    Science.gov (United States)

    Shylla, Jollin A; Ghatani, Sudeep; Tandon, Veena

    2013-12-01

    Among the digenetic trematodes, paramphistomes are known to be the causative agent of "amphistomiasis" or the stomach fluke disease of domestic and wild animals, mainly ruminants. The use of 28S (divergent domains) and 18S rRNA for phylogenetic inference is significantly warranted for these flukes since it is as yet limited to merely the exploration of the second internal transcribed spacer (ITS2) region. The present study intended to explore the divergent domains (D1-D3) of 28S rRNA and simultaneously equate the phylogenetic information with 18S rRNA in paramphistomes. Divergence of the 28S rRNA domains was evident amongst the divergent (D) domains, where D1 domain emerged as the most variable and D2, the most robust domain, since the latter could provide a higher resolution of the species. D2 was the only domain that comprised compensatory mutations in the helices of its structural constraints; this domain is thus well suited for species distinction and may be considered a potential DNA barcode complementary to mitochondrial DNA. 28S (D1 + D2 + D3) rRNA provided a significant resolution of the taxa corroborating with the taxonomy of these flukes and thus proved to be more robust as a phylogenetic marker for lower levels than 18S rRNA. Phylogenetic inferences of paramphitomes are still scarcely explored; additional data from other taxa belonging to this family may estimate better the biodiversity of these flukes.

  11. The active translation of MHCII mRNA during dendritic cells maturation supplies new molecules to the cell surface pool.

    Science.gov (United States)

    Malanga, Donatella; Barba, Pasquale; Harris, Paul E; Maffei, Antonella; Del Pozzo, Giovanna

    2007-04-01

    The transition of human dendritic cells (DCs) from the immature to the mature phenotype is characterized by an increased density of MHC class II (MHCII) molecules on the plasma membrane, a key requirement of their competence as professional antigen presenting cells (APCs). MHCII molecules on the cell surface derive from newly synthesized as well as from preexisting proteins. So far, all the studies done on DCs during maturation, to establish the relative contribution of newly synthesized MHCII molecules to the cell surface pool did not produced a clear, unified scenario. We report that, in human DCs stimulated ex vivo with LPS, the changes in the RNA accumulation specific for at least two MHCII genes (HLA-DRA and HLA-DQA1) due to transcriptional upregulation, is associated with the active translation at high rate of these transcripts. Our finding reveals that, across the 24h of the maturation process in human DCs, newly synthesized MHCII proteins are supplied to the APCs cell surface pool.

  12. Chaperoning 5S RNA assembly.

    Science.gov (United States)

    Madru, Clément; Lebaron, Simon; Blaud, Magali; Delbos, Lila; Pipoli, Juliana; Pasmant, Eric; Réty, Stéphane; Leulliot, Nicolas

    2015-07-01

    In eukaryotes, three of the four ribosomal RNAs (rRNAs)—the 5.8S, 18S, and 25S/28S rRNAs—are processed from a single pre-rRNA transcript and assembled into ribosomes. The fourth rRNA, the 5S rRNA, is transcribed by RNA polymerase III and is assembled into the 5S ribonucleoprotein particle (RNP), containing ribosomal proteins Rpl5/uL18 and Rpl11/uL5, prior to its incorporation into preribosomes. In mammals, the 5S RNP is also a central regulator of the homeostasis of the tumor suppressor p53. The nucleolar localization of the 5S RNP and its assembly into preribosomes are performed by a specialized complex composed of Rpf2 and Rrs1 in yeast or Bxdc1 and hRrs1 in humans. Here we report the structural and functional characterization of the Rpf2-Rrs1 complex alone, in complex with the 5S RNA, and within pre-60S ribosomes. We show that the Rpf2-Rrs1 complex contains a specialized 5S RNA E-loop-binding module, contacts the Rpl5 protein, and also contacts the ribosome assembly factor Rsa4 and the 25S RNA. We propose that the Rpf2-Rrs1 complex establishes a network of interactions that guide the incorporation of the 5S RNP in preribosomes in the initial conformation prior to its rotation to form the central protuberance found in the mature large ribosomal subunit. © 2015 Madru et al.; Published by Cold Spring Harbor Laboratory Press.

  13. On the Spatial Organization of mRNA, Plasmids, and Ribosomes in a Bacterial Host Overexpressing Membrane Proteins

    NARCIS (Netherlands)

    van Gijtenbeek, Lieke A; Robinson, Andrew; van Oijen, Antoine; Poolman, Bert; Kok, Jan

    2016-01-01

    By using fluorescence imaging, we provide a time-resolved single-cell view on coupled defects in transcription, translation, and growth during expression of heterologous membrane proteins in Lactococcus lactis. Transcripts encoding poorly produced membrane proteins accumulate in mRNA-dense bodies at

  14. Ribosomal RNA-based analysis of the bacterial flora from the conjunctivae of cattle with bovine keratoconjunctivitis (BKC).

    Science.gov (United States)

    Hare, William R; Hoyt, Phillip G; Hohn, Christina; Higgins, James A

    2008-10-15

    Bovine keratoconjunctivitis (BKC), colloquially referred to as 'pinkeye', is a disease affecting cattle worldwide; it costs cattle producers millions of dollars in economic loss annually. While Moraxella spp. are the primary etiologic agent of pinkeye, surveys of flora from the conjunctivae of livestock from around the world have indicated that a variety of bacterial commensals occupy this niche. We used molecular biology-based methods to determine the composition of bacterial flora in the conjunctivae of normal dairy and beef cattle from Maryland (n=113), and beef cattle with clinical BKC from Louisiana (n=42). Three regimens were used: 16S rRNA PCR and DGGE analysis of amplicons; 16S rRNA PCR and cloning of amplicons into Escherichia coli followed by screening and sequencing of clones harboring inserts; and culture of bacteria on chromogenic agar followed by 16S rRNA PCR and sequencing. Most taxa were comprised of saprophytes found in the environment, such as Bacillus, Pantoea, E. coli, and Exiguobacterium. Moraxella spp. were infrequently observed. Some species, such as Propionibacterium acnes, represent taxa not previously associated with the conjunctivae. Bacillus pumilus and Bacillus licheniformis isolates from the conjunctivae of Maryland cattle were genetically distinct from isolates previously implicated in septic infections in cattle at the same location. We conclude that employing 16S rRNA-based methods for bacterial identification can be useful in defining the flora present in the conjunctivae of normal cattle, and those with BKC.

  15. RNA-Sequencing Analysis Reveals a Regulatory Role for Transcription Factor Fezf2 in the Mature Motor Cortex

    Directory of Open Access Journals (Sweden)

    Alison J. Clare

    2017-09-01

    Full Text Available Forebrain embryonic zinc finger (Fezf2 encodes a transcription factor essential for the specification of layer 5 projection neurons (PNs in the developing cerebral cortex. As with many developmental transcription factors, Fezf2 continues to be expressed into adulthood, suggesting it remains crucial to the maintenance of neuronal phenotypes. Despite the continued expression, a function has yet to be explored for Fezf2 in the PNs of the developed cortex. Here, we investigated the role of Fezf2 in mature neurons, using lentiviral-mediated delivery of a shRNA to conditionally knockdown the expression of Fezf2 in the mouse primary motor cortex (M1. RNA-sequencing analysis of Fezf2-reduced M1 revealed significant changes to the transcriptome, identifying a regulatory role for Fezf2 in the mature M1. Kyoto Encyclopedia Genes and Genomes (KEGG pathway analyses of Fezf2-regulated genes indicated a role in neuronal signaling and plasticity, with significant enrichment of neuroactive ligand-receptor interaction, cell adhesion molecules and calcium signaling pathways. Gene Ontology analysis supported a functional role for Fezf2-regulated genes in neuronal transmission and additionally indicated an importance in the regulation of behavior. Using the mammalian phenotype ontology database, we identified a significant overrepresentation of Fezf2-regulated genes associated with specific behavior phenotypes, including associative learning, social interaction, locomotor activation and hyperactivity. These roles were distinct from that of Fezf2-regulated genes identified in development, indicating a dynamic transition in Fezf2 function. Together our findings demonstrate a regulatory role for Fezf2 in the mature brain, with Fezf2-regulated genes having functional roles in sustaining normal neuronal and behavioral phenotypes. These results support the hypothesis that developmental transcription factors are important for maintaining neuron transcriptomes and that

  16. Flow Cytometry-assisted Cloning of Specific Sequence Motifs fromComplex 16S ribosomal RNA Gene Libraries.

    Energy Technology Data Exchange (ETDEWEB)

    Nielsen, J.L.; Schramm, A.; Bernhard, A.E.; van den Engh, G.J.; Stahl, D.A.

    2004-07-21

    A flow cytometry method was developed for rapid screeningand recovery of cloned DNA containing common sequence motifs. Thisapproach, termed fluorescence-activated cell sorting-assisted cloning,was used to recover sequences affiliated with a unique lineage within theBacteroidetes not abundant in a clone library of environmental 16S rRNAgenes. Retrieval and sequence analysis of phylogenetically informativegenes has become a standard cultivation-independent technique toinvestigate microbial diversity in nature (7, 18). Genes encoding the 16SrRNA, because of the relative ease of their selective amplification, havebeen most frequently employed for general diversity surveys (16).Environmental studies have also focused on specific subpopulationsaffiliated with a phylogenetic group or identified by genes encodingspecific metabolic functions (e.g., ammonia oxidation, sulfaterespiration, and nitrate reduction) (8,15,20). However, specificpopulations may be of low abundance (1,23), or the genes encodingspecific metabolic functions may be insufficiently conserved to providepriming sites for general PCR amplification. Three general approacheshave been used to obtain 16S rRNA sequence information from low-abundancepopulations: screening hundreds to thousands of clones in a general 16SrRNA gene library (21), flow cytometric sorting of a subpopulation ofenvironmentally derived cells labeled by fluorescent in situhybridization (FISH) (27), or selective PCR amplification using primersspecific for the subpopulation (2,23). While the first approach is simplytime-consuming and tedious, the second has been restricted to fairlylarge and strongly fluorescent cells from aquatic samples (5, 27). Thethird approach often generates fragments of only a few hundred bases dueto the limited number of specific priming sites. Partial sequenceinformation often degrades analysis, obscuring or distorting thephylogenetic placement of the new sequences (11, 20). A more robustcharacterization of environ

  17. MRN1 implicates chromatin remodeling complexes and architectural factors in mRNA maturation

    DEFF Research Database (Denmark)

    Düring, Louis; Thorsen, Michael; Petersen, Darima;

    2012-01-01

    A functional relationship between chromatin structure and mRNA processing events has been suggested, however, so far only a few involved factors have been characterized. Here we show that rsc nhp6¿¿ mutants, deficient for the function of the chromatin remodeling factor RSC and the chromatin....... Genetic interactions are observed between 2 µm-MRN1 and the splicing deficient mutants snt309¿, prp3, prp4, and prp22, and additional genetic analyses link MRN1, SNT309, NHP6A/B, SWI/SNF, and RSC supporting the notion of a role of chromatin structure in mRNA processing....

  18. HIV-1 infection causes a down-regulation of genes involved in ribosome biogenesis.

    Directory of Open Access Journals (Sweden)

    Claudia L Kleinman

    Full Text Available HIV-1 preferentially infects CD4+ T cells, causing fundamental changes that eventually lead to the release of new viral particles and cell death. To investigate in detail alterations in the transcriptome of the CD4+ T cells upon viral infection, we sequenced polyadenylated RNA isolated from Jurkat cells infected or not with HIV-1. We found a marked global alteration of gene expression following infection, with an overall trend toward induction of genes, indicating widespread modification of the host biology. Annotation and pathway analysis of the most deregulated genes showed that viral infection produces a down-regulation of genes associated with the nucleolus, in particular those implicated in regulating the different steps of ribosome biogenesis, such as ribosomal RNA (rRNA transcription, pre-rRNA processing, and ribosome maturation. The impact of HIV-1 infection on genes involved in ribosome biogenesis was further validated in primary CD4+ T cells. Moreover, we provided evidence by Northern Blot experiments, that host pre-rRNA processing in Jurkat cells might be perturbed during HIV-1 infection, thus strengthening the hypothesis of a crosstalk between nucleolar functions and viral pathogenesis.

  19. Phylogenetic position of Dysteria derouxi (Ciliophora:Phyllopharyngea: Dysteriida) inferred from the small subunit ribosomal RNA gene sequence

    Institute of Scientific and Technical Information of China (English)

    2006-01-01

    The complete small subunit rRNA (SSrRNA) gene sequence of a marine ciliate, Dysteria derouxi Gong and Song, 2004, was determined to be of 1 708 nucleotides. The phylogenetic position of this species within the class Phyllopharyngea was deduced using distance matrix, maximum parsimony and maximum likelihood methods. Dysteria derouxi, together with other available ciliates of the class Phyllopharyngea, forms a monophyletic clade with strong bootstrap support in the distance matrix, maximum parsimony and likelihood tree construction methods, while the dysterids are, as a monophyletic group, phylogenetically close to the clade of chlamydodontids [values of 100% LS(least-squares), 100% NJ(neighbor-joining)]. In addition, the trees indicate that dysteriids may be a higher or specialized group within the class, which corresponds well to the morphology and infraciliature.

  20. Impact of folic acid supplementation on single- and double-stranded RNA degradation in human colostrum and mature milk.

    Science.gov (United States)

    Kocic, Gordana; Bjelakovic, Ljiljana; Bjelakovic, Bojko; Jevtoci-Stoimenov, Tatjana; Sokolovic, Dusan; Cvetkovic, Tatjana; Kocic, Hristina; Stojanovic, Svetlana; Langerholc, Tomaz; Jonovic, Marina

    2014-07-01

    Sufficient intake of folic acid is necessary for normal embryogenesis, fetal, and neonatal development. Folic acid facilitates nucleic acid internalization, and protects cellular DNA from nuclease degradation. Human milk contains enzymes, antimicrobial proteins, and antibodies, along with macrophages, that protect against infections and allergies. However, little to no information is available on the effects of folic acid supplementation on degradation of nucleic acids in human milk. In the present study, we aimed to determine the RNase activity (free and inhibitor-bound) in colostrum and mature milk, following folic acid supplementation. The study design included a total of 59 women, 27 of whom received 400 μg of folic acid daily periconceptionally and after. Folic acid supplementation increased the free RNase and polyadenylase activity following lactation. However, the increased RNase activity was not due to de novo enzyme synthesis, as the inhibitor-bound (latent) RNase activity was significantly lower and disappeared after one month. Folic acid reduced RNase activity by using double-stranded RNA as substrate. Data suggests that folic acid supplementation may improve viral RNAs degradation and mRNA degradation, but not dsRNA degradation, preserving in this way the antiviral defense.