WorldWideScience

Sample records for ribosomal rna gene

  1. Transcriptional activation of ribosomal RNA genes during compensatory renal hypertrophy

    International Nuclear Information System (INIS)

    Ouellette, A.J.; Moonka, R.; Zelenetz, A.; Malt, R.A.

    1986-01-01

    The overall rate of rDNA transcription increases by 50% during the first 24 hours of compensatory renal hypertrophy in the mouse. To study mechanisms of ribosome accumulation after uninephrectomy, transcription rates were measured in isolated kidneys by transcriptional runoff. 32 P-labeled nascent transcripts were hybridized to blots containing linearized, denatured cloned rDNA, and hybridization was quantitated autoradiographically and by direct counting. Overall transcriptional activity of rDNA was increased by 30% above control levels at 6 hrs after nephrectomy and by 50% at 12, 18, and 24 hrs after operation. Hybridizing RNA was insensitive to inhibiby alpha-amanitin, and no hybridization was detected to vector DNA. Thus, accelerated rDNA transcription is one regulatory element in the accretion of ribosomes in renal growth, and the regulatory event is an early event. Mechanisms of activation may include enhanced transcription of active genes or induction of inactive DNA

  2. Locus-specific ribosomal RNA gene silencing in nucleolar dominance.

    Directory of Open Access Journals (Sweden)

    Michelle S Lewis

    2007-08-01

    Full Text Available The silencing of one parental set of rRNA genes in a genetic hybrid is an epigenetic phenomenon known as nucleolar dominance. We showed previously that silencing is restricted to the nucleolus organizer regions (NORs, the loci where rRNA genes are tandemly arrayed, and does not spread to or from neighboring protein-coding genes. One hypothesis is that nucleolar dominance is the net result of hundreds of silencing events acting one rRNA gene at a time. A prediction of this hypothesis is that rRNA gene silencing should occur independent of chromosomal location. An alternative hypothesis is that the regulatory unit in nucleolar dominance is the NOR, rather than each individual rRNA gene, in which case NOR localization may be essential for rRNA gene silencing. To test these alternative hypotheses, we examined the fates of rRNA transgenes integrated at ectopic locations. The transgenes were accurately transcribed in all independent transgenic Arabidopsis thaliana lines tested, indicating that NOR localization is not required for rRNA gene expression. Upon crossing the transgenic A. thaliana lines as ovule parents with A. lyrata to form F1 hybrids, a new system for the study of nucleolar dominance, the endogenous rRNA genes located within the A. thaliana NORs are silenced. However, rRNA transgenes escaped silencing in multiple independent hybrids. Collectively, our data suggest that rRNA gene activation can occur in a gene-autonomous fashion, independent of chromosomal location, whereas rRNA gene silencing in nucleolar dominance is locus-dependent.

  3. Replication and meiotic transmission of yeast ribosomal RNA genes.

    Science.gov (United States)

    Brewer, B J; Zakian, V A; Fangman, W L

    1980-11-01

    The yeast Saccharomyces cerevisiae has approximately 120 genes for the ribosomal RNAs (rDNA) which are organized in tandem within chromosomal DNA. These multiple-copy genes are homogeneous in sequence but can undergo changes in copy number and topology. To determine if these changes reflect unusual features of rDNA metabolism, we have examined both the replication of rDNA in the mitotic cell cycle and the inheritance of rDNA during meiosis. The results indicate that rDNA behaves identically to chromosomal DNA: each rDNA unit is replicated once during the S phase of each cell cycle and each unit is conserved through meiosis. Therefore, the flexibility in copy number and topology of rDNA does not arise from the selective replication of units in each S phase nor by the selective inheritance of units in meiosis.

  4. Reconstruction of ribosomal RNA genes from metagenomic data.

    Directory of Open Access Journals (Sweden)

    Lu Fan

    Full Text Available Direct sequencing of environmental DNA (metagenomics has a great potential for describing the 16S rRNA gene diversity of microbial communities. However current approaches using this 16S rRNA gene information to describe community diversity suffer from low taxonomic resolution or chimera problems. Here we describe a new strategy that involves stringent assembly and data filtering to reconstruct full-length 16S rRNA genes from metagenomicpyrosequencing data. Simulations showed that reconstructed 16S rRNA genes provided a true picture of the community diversity, had minimal rates of chimera formation and gave taxonomic resolution down to genus level. The strategy was furthermore compared to PCR-based methods to determine the microbial diversity in two marine sponges. This showed that about 30% of the abundant phylotypes reconstructed from metagenomic data failed to be amplified by PCR. Our approach is readily applicable to existing metagenomic datasets and is expected to lead to the discovery of new microbial phylotypes.

  5. Molecular characterization of 5S ribosomal RNA genes and transcripts in the protozoan parasite Leishmania major.

    Science.gov (United States)

    Moreno-Campos, Rodrigo; Florencio-Martínez, Luis E; Nepomuceno-Mejía, Tomás; Rojas-Sánchez, Saúl; Vélez-Ramírez, Daniel E; Padilla-Mejía, Norma E; Figueroa-Angulo, Elisa; Manning-Cela, Rebeca; Martínez-Calvillo, Santiago

    2016-12-01

    Eukaryotic 5S rRNA, synthesized by RNA polymerase III (Pol III), is an essential component of the large ribosomal subunit. Most organisms contain hundreds of 5S rRNA genes organized into tandem arrays. However, the genome of the protozoan parasite Leishmania major contains only 11 copies of the 5S rRNA gene, which are interspersed and associated with other Pol III-transcribed genes. Here we report that, in general, the number and order of the 5S rRNA genes is conserved between different species of Leishmania. While in most organisms 5S rRNA genes are normally associated with the nucleolus, combined fluorescent in situ hybridization and indirect immunofluorescence experiments showed that 5S rRNA genes are mainly located at the nuclear periphery in L. major. Similarly, the tandemly repeated 5S rRNA genes in Trypanosoma cruzi are dispersed throughout the nucleus. In contrast, 5S rRNA transcripts in L. major were localized within the nucleolus, and scattered throughout the cytoplasm, where mature ribosomes are located. Unlike other rRNA species, stable antisense RNA complementary to 5S rRNA is not detected in L. major.

  6. Fragmentation of the large subunit ribosomal RNA gene in oyster mitochondrial genomes

    Directory of Open Access Journals (Sweden)

    Milbury Coren A

    2010-09-01

    Full Text Available Abstract Background Discontinuous genes have been observed in bacteria, archaea, and eukaryotic nuclei, mitochondria and chloroplasts. Gene discontinuity occurs in multiple forms: the two most frequent forms result from introns that are spliced out of the RNA and the resulting exons are spliced together to form a single transcript, and fragmented gene transcripts that are not covalently attached post-transcriptionally. Within the past few years, fragmented ribosomal RNA (rRNA genes have been discovered in bilateral metazoan mitochondria, all within a group of related oysters. Results In this study, we have characterized this fragmentation with comparative analysis and experimentation. We present secondary structures, modeled using comparative sequence analysis of the discontinuous mitochondrial large subunit rRNA genes of the cupped oysters C. virginica, C. gigas, and C. hongkongensis. Comparative structure models for the large subunit rRNA in each of the three oyster species are generally similar to those for other bilateral metazoans. We also used RT-PCR and analyzed ESTs to determine if the two fragmented LSU rRNAs are spliced together. The two segments are transcribed separately, and not spliced together although they still form functional rRNAs and ribosomes. Conclusions Although many examples of discontinuous ribosomal genes have been documented in bacteria and archaea, as well as the nuclei, chloroplasts, and mitochondria of eukaryotes, oysters are some of the first characterized examples of fragmented bilateral animal mitochondrial rRNA genes. The secondary structures of the oyster LSU rRNA fragments have been predicted on the basis of previous comparative metazoan mitochondrial LSU rRNA structure models.

  7. Ribosomal RNA gene sequences confirm that protistan endoparasite of larval cod Gadus morhua is Ichthyodinium sp

    DEFF Research Database (Denmark)

    Skovgaard, Alf; Meyer, Stefan; Overton, Julia Lynne

    2010-01-01

    An enigmatic protistan endoparasite found in eggs and larvae of cod Gadus morhua and turbot Psetta maxima was isolated from Baltic cod larvae, and DNA was extracted for sequencing of the parasite's small Subunit ribosomal RNA (SSU rRNA) gene. The endoparasite has previously been suggested...... to be related to Ichthyodinium chabelardi, a dinoflagellate-like protist that parasitizes yolk sacs of embryos and larvae of a variety of fish species. Comparison of a 1535 bp long fragment of the SSU rRNA gene of the cod endoparasite showed absolute identify with I. chabelardi, demonstrating that the 2...

  8. A ribosome without RNA

    Directory of Open Access Journals (Sweden)

    Harold S Bernhardt

    2015-11-01

    Full Text Available It was Francis Crick who first asked why the ribosome contains so much RNA, and discussed the implications of this for the direct flow of genetic information from DNA to protein. Remarkable advances in our understanding of the ribosome and protein synthesis, including the recent publication of two mammalian mitochondrial ribosome structures, have shed new light on this intriguing aspect of evolution in molecular biology. We examine here whether RNA is indispensable for coded protein synthesis, or whether an all-protein ‘ribosome’ (or ‘synthosome’ might be possible, with a protein enzyme catalyzing peptide synthesis, and release factor-like protein adaptors able to read a message composed of deoxyribonucleotides. We also compare the RNA world hypothesis with the alternative ‘proteins first’ hypothesis in terms of their different understandings of the evolution of the ribosome, and whether this might have been preceded by an ancestral form of nonribosomal peptide synthesis catalyzed by protein enzymes.

  9. Promoter-wide hypermethylation of the ribosomal RNA gene promoter in the suicide brain.

    Directory of Open Access Journals (Sweden)

    Patrick O McGowan

    Full Text Available BACKGROUND: Alterations in gene expression in the suicide brain have been reported and for several genes DNA methylation as an epigenetic regulator is thought to play a role. rRNA genes, that encode ribosomal RNA, are the backbone of the protein synthesis machinery and levels of rRNA gene promoter methylation determine rRNA transcription. METHODOLOGY/PRINCIPAL FINDINGS: We test here by sodium bisulfite mapping of the rRNA promoter and quantitative real-time PCR of rRNA expression the hypothesis that epigenetic differences in critical loci in the brain are involved in the pathophysiology of suicide. Suicide subjects in this study were selected for a history of early childhood neglect/abuse, which is associated with decreased hippocampal volume and cognitive impairments. rRNA was significantly hypermethylated throughout the promoter and 5' regulatory region in the brain of suicide subjects, consistent with reduced rRNA expression in the hippocampus. This difference in rRNA methylation was not evident in the cerebellum and occurred in the absence of genome-wide changes in methylation, as assessed by nearest neighbor. CONCLUSIONS/SIGNIFICANCE: This is the first study to show aberrant regulation of the protein synthesis machinery in the suicide brain. The data implicate the epigenetic modulation of rRNA in the pathophysiology of suicide.

  10. SINA: accurate high-throughput multiple sequence alignment of ribosomal RNA genes.

    Science.gov (United States)

    Pruesse, Elmar; Peplies, Jörg; Glöckner, Frank Oliver

    2012-07-15

    In the analysis of homologous sequences, computation of multiple sequence alignments (MSAs) has become a bottleneck. This is especially troublesome for marker genes like the ribosomal RNA (rRNA) where already millions of sequences are publicly available and individual studies can easily produce hundreds of thousands of new sequences. Methods have been developed to cope with such numbers, but further improvements are needed to meet accuracy requirements. In this study, we present the SILVA Incremental Aligner (SINA) used to align the rRNA gene databases provided by the SILVA ribosomal RNA project. SINA uses a combination of k-mer searching and partial order alignment (POA) to maintain very high alignment accuracy while satisfying high throughput performance demands. SINA was evaluated in comparison with the commonly used high throughput MSA programs PyNAST and mothur. The three BRAliBase III benchmark MSAs could be reproduced with 99.3, 97.6 and 96.1 accuracy. A larger benchmark MSA comprising 38 772 sequences could be reproduced with 98.9 and 99.3% accuracy using reference MSAs comprising 1000 and 5000 sequences. SINA was able to achieve higher accuracy than PyNAST and mothur in all performed benchmarks. Alignment of up to 500 sequences using the latest SILVA SSU/LSU Ref datasets as reference MSA is offered at http://www.arb-silva.de/aligner. This page also links to Linux binaries, user manual and tutorial. SINA is made available under a personal use license.

  11. [Characterization of Black and Dichothrix Cyanobacteria Based on the 16S Ribosomal RNA Gene Sequence

    Science.gov (United States)

    Ortega, Maya

    2010-01-01

    My project focuses on characterizing different cyanobacteria in thrombolitic mats found on the island of Highborn Cay, Bahamas. Thrombolites are interesting ecosystems because of the ability of bacteria in these mats to remove carbon dioxide from the atmosphere and mineralize it as calcium carbonate. In the future they may be used as models to develop carbon sequestration technologies, which could be used as part of regenerative life systems in space. These thrombolitic communities are also significant because of their similarities to early communities of life on Earth. I targeted two cyanobacteria in my research, Dichothrix spp. and whatever black is, since they are believed to be important to carbon sequestration in these thrombolitic mats. The goal of my summer research project was to molecularly identify these two cyanobacteria. DNA was isolated from each organism through mat dissections and DNA extractions. I ran Polymerase Chain Reactions (PCR) to amplify the 16S ribosomal RNA (rRNA) gene in each cyanobacteria. This specific gene is found in almost all bacteria and is highly conserved, meaning any changes in the sequence are most likely due to evolution. As a result, the 16S rRNA gene can be used for bacterial identification of different species based on the sequence of their 16S rRNA gene. Since the exact sequence of the Dichothrix gene was unknown, I designed different primers that flanked the gene based on the known sequences from other taxonomically similar cyanobacteria. Once the 16S rRNA gene was amplified, I cloned the gene into specialized Escherichia coli cells and sent the gene products for sequencing. Once the sequence is obtained, it will be added to a genetic database for future reference to and classification of other Dichothrix sp.

  12. Expression and RNA Interference of Ribosomal Protein L5 Gene in Nilaparvata lugens (Hemiptera: Delphacidae).

    Science.gov (United States)

    Zhu, Jiajun; Hao, Peiying; Lu, Chaofeng; Ma, Yan; Feng, Yalin; Yu, Xiaoping

    2017-05-01

    The ribosomal proteins play important roles in the growth and development of organisms. This study aimed to explore the function of NlRPL5 (GenBank KX379234), a ribosomal protein L5 gene, in the brown planthopper Nilaparvata lugens. The open reading frame of NlRPL5 was cloned from N. lugens based on a previous transcriptome analysis. The results revealed that the open reading frame of NlRPL5 is of 900 bp, encoding 299 amino acid residues. The reverse transcription quantitative PCR results suggested that the expression of NlRPL5 gene was stronger in gravid females, but was relatively low in nymphs, males, and newly emerged females. The expression level of NlRPL5 in the ovary was about twofolds of that in the head, thorax, or fat body. RNAi of dsNlRPL5 resulted in a significant reduction of mRNA levels, ∼50% decrease in comparison with the dsGFP control at day 6. Treatment of dsNlRPL5 significantly restricted the ovarian development, and decreased the number of eggs laid on the rice (Oryza sativa) plants. This study provided a new clue for further study on the function and regulation mechanism of NlRPL5 in N. lugens. © The Author 2017. Published by Oxford University Press on behalf of the Entomological Society of America.

  13. Chromosomal organization of the ribosomal RNA genes in the genus Chironomus (Diptera, Chironomidae

    Directory of Open Access Journals (Sweden)

    Larisa Gunderina

    2015-05-01

    Full Text Available Chromosomal localization of ribosomal RNA coding genes has been studied by using FISH (fluorescence in situ hybridization in 21 species from the genus Chironomus Meigen, 1803. Analysis of the data has shown intra- and interspecific variation in number and location of 5.8S rDNA hybridization sites in 17 species from the subgenus Chironomus and 4 species from the subgenus Camptochironomus Kieffer, 1914. In the majority of studied species the location of rDNA sites coincided with the sites where active NORs (nucleolus organizer regions were found. The number of hybridization sites in karyotypes of studied chironomids varied from 1 to 6. More than half of the species possessed only one NOR (12 out of 21. Two rDNA hybridization sites were found in karyotypes of five species, three – in two species, and five and six sites – in one species each. NORs were found in all chromosomal arms of species from the subgenus Chironomus with one of them always located on arm G. On the other hand, no hybridization sites were found on arm G in four studied species from the subgenus Camptochironomus. Two species from the subgenus Chironomus – Ch. balatonicus Devai, Wuelker & Scholl, 1983 and Ch. “annularius” sensu Strenzke, 1959 – showed intraspecific variability in the number of hybridization signals. Possible mechanisms of origin of variability in number and location of rRNA genes in the karyotypes of species from the genus Chironomus are discussed.

  14. Comparison of 16S ribosomal RNA gene sequence analysis and conventional culture in the environmental survey of a hospital

    OpenAIRE

    Manaka, Akihiro; Tokue, Yutaka; Murakami, Masami

    2017-01-01

    Background Nosocomial infection is one of the most common complications within health care facilities. Certain studies have reported outbreaks resulting from contaminated hospital environments. Although the identification of bacteria in the environment can readily be achieved using culturing methods, these methods detect live bacteria. Sequencing of the 16S ribosomal RNA (16S rRNA) gene is recognized to be effective for bacterial identification. In this study, we surveyed wards where drug-res...

  15. High-Resolution Analysis of Coronavirus Gene Expression by RNA Sequencing and Ribosome Profiling.

    Science.gov (United States)

    Irigoyen, Nerea; Firth, Andrew E; Jones, Joshua D; Chung, Betty Y-W; Siddell, Stuart G; Brierley, Ian

    2016-02-01

    Members of the family Coronaviridae have the largest genomes of all RNA viruses, typically in the region of 30 kilobases. Several coronaviruses, such as Severe acute respiratory syndrome-related coronavirus (SARS-CoV) and Middle East respiratory syndrome-related coronavirus (MERS-CoV), are of medical importance, with high mortality rates and, in the case of SARS-CoV, significant pandemic potential. Other coronaviruses, such as Porcine epidemic diarrhea virus and Avian coronavirus, are important livestock pathogens. Ribosome profiling is a technique which exploits the capacity of the translating ribosome to protect around 30 nucleotides of mRNA from ribonuclease digestion. Ribosome-protected mRNA fragments are purified, subjected to deep sequencing and mapped back to the transcriptome to give a global "snap-shot" of translation. Parallel RNA sequencing allows normalization by transcript abundance. Here we apply ribosome profiling to cells infected with Murine coronavirus, mouse hepatitis virus, strain A59 (MHV-A59), a model coronavirus in the same genus as SARS-CoV and MERS-CoV. The data obtained allowed us to study the kinetics of virus transcription and translation with exquisite precision. We studied the timecourse of positive and negative-sense genomic and subgenomic viral RNA production and the relative translation efficiencies of the different virus ORFs. Virus mRNAs were not found to be translated more efficiently than host mRNAs; rather, virus translation dominates host translation at later time points due to high levels of virus transcripts. Triplet phasing of the profiling data allowed precise determination of translated reading frames and revealed several translated short open reading frames upstream of, or embedded within, known virus protein-coding regions. Ribosome pause sites were identified in the virus replicase polyprotein pp1a ORF and investigated experimentally. Contrary to expectations, ribosomes were not found to pause at the ribosomal

  16. High-Resolution Analysis of Coronavirus Gene Expression by RNA Sequencing and Ribosome Profiling.

    Directory of Open Access Journals (Sweden)

    Nerea Irigoyen

    2016-02-01

    Full Text Available Members of the family Coronaviridae have the largest genomes of all RNA viruses, typically in the region of 30 kilobases. Several coronaviruses, such as Severe acute respiratory syndrome-related coronavirus (SARS-CoV and Middle East respiratory syndrome-related coronavirus (MERS-CoV, are of medical importance, with high mortality rates and, in the case of SARS-CoV, significant pandemic potential. Other coronaviruses, such as Porcine epidemic diarrhea virus and Avian coronavirus, are important livestock pathogens. Ribosome profiling is a technique which exploits the capacity of the translating ribosome to protect around 30 nucleotides of mRNA from ribonuclease digestion. Ribosome-protected mRNA fragments are purified, subjected to deep sequencing and mapped back to the transcriptome to give a global "snap-shot" of translation. Parallel RNA sequencing allows normalization by transcript abundance. Here we apply ribosome profiling to cells infected with Murine coronavirus, mouse hepatitis virus, strain A59 (MHV-A59, a model coronavirus in the same genus as SARS-CoV and MERS-CoV. The data obtained allowed us to study the kinetics of virus transcription and translation with exquisite precision. We studied the timecourse of positive and negative-sense genomic and subgenomic viral RNA production and the relative translation efficiencies of the different virus ORFs. Virus mRNAs were not found to be translated more efficiently than host mRNAs; rather, virus translation dominates host translation at later time points due to high levels of virus transcripts. Triplet phasing of the profiling data allowed precise determination of translated reading frames and revealed several translated short open reading frames upstream of, or embedded within, known virus protein-coding regions. Ribosome pause sites were identified in the virus replicase polyprotein pp1a ORF and investigated experimentally. Contrary to expectations, ribosomes were not found to pause at the

  17. Histone and ribosomal RNA repetitive gene clusters of the boll weevil are linked in a tandem array.

    Science.gov (United States)

    Roehrdanz, R; Heilmann, L; Senechal, P; Sears, S; Evenson, P

    2010-08-01

    Histones are the major protein component of chromatin structure. The histone family is made up of a quintet of proteins, four core histones (H2A, H2B, H3 & H4) and the linker histones (H1). Spacers are found between the coding regions. Among insects this quintet of genes is usually clustered and the clusters are tandemly repeated. Ribosomal DNA contains a cluster of the rRNA sequences 18S, 5.8S and 28S. The rRNA genes are separated by the spacers ITS1, ITS2 and IGS. This cluster is also tandemly repeated. We found that the ribosomal RNA repeat unit of at least two species of Anthonomine weevils, Anthonomus grandis and Anthonomus texanus (Coleoptera: Curculionidae), is interspersed with a block containing the histone gene quintet. The histone genes are situated between the rRNA 18S and 28S genes in what is known as the intergenic spacer region (IGS). The complete reiterated Anthonomus grandis histone-ribosomal sequence is 16,248 bp.

  18. Genetic variability of Echinococcus granulosus based on the mitochondrial 16S ribosomal RNA gene.

    Science.gov (United States)

    Wang, Ning; Wang, Jiahai; Hu, Dandan; Zhong, Xiuqin; Jiang, Zhongrong; Yang, Aiguo; Deng, Shijin; Guo, Li; Tsering, Dawa; Wang, Shuxian; Gu, Xiaobin; Peng, Xuerong; Yang, Guangyou

    2015-06-01

    Echinococcus granulosus is the etiological agent of cystic echinococcosis, a major zoonotic disease of both humans and animals. In this study, we assessed genetic variability and genetic structure of E. granulosus in the Tibet plateau, using the complete mitochondrial 16 S ribosomal RNA gene for the first time. We collected and sequenced 62 isolates of E. granulosus from 3 populations in the Tibet plateau. A BLAST analysis indicated that 61 isolates belonged to E. granulosus sensu stricto (genotypes G1-G3), while one isolate belonged to E. canadensis (genotype G6). We detected 16 haplotypes with a haplotype network revealing a star-like expansion, with the most common haplotype occupying the center of the network. Haplotype diversity and nucleotide diversity were low, while negative values were observed for Tajima's D and Fu's Fs. AMOVA results and Fst values revealed that the three geographic populations were not genetically differentiated. Our results suggest that a population bottleneck or population expansion has occurred in the past, and that this explains the low genetic variability of E. granulosus in the Tibet Plateau.

  19. Replicative age induces mitotic recombination in the ribosomal RNA gene cluster of Saccharomyces cerevisiae.

    Directory of Open Access Journals (Sweden)

    Derek L Lindstrom

    2011-03-01

    Full Text Available Somatic mutations contribute to the development of age-associated disease. In earlier work, we found that, at high frequency, aging Saccharomyces cerevisiae diploid cells produce daughters without mitochondrial DNA, leading to loss of respiration competence and increased loss of heterozygosity (LOH in the nuclear genome. Here we used the recently developed Mother Enrichment Program to ask whether aging cells that maintain the ability to produce respiration-competent daughters also experience increased genomic instability. We discovered that this population exhibits a distinct genomic instability phenotype that primarily affects the repeated ribosomal RNA gene array (rDNA array. As diploid cells passed their median replicative life span, recombination rates between rDNA arrays on homologous chromosomes progressively increased, resulting in mutational events that generated LOH at >300 contiguous open reading frames on the right arm of chromosome XII. We show that, while these recombination events were dependent on the replication fork block protein Fob1, the aging process that underlies this phenotype is Fob1-independent. Furthermore, we provide evidence that this aging process is not driven by mechanisms that modulate rDNA recombination in young cells, including loss of cohesion within the rDNA array or loss of Sir2 function. Instead, we suggest that the age-associated increase in rDNA recombination is a response to increasing DNA replication stress generated in aging cells.

  20. A Deconvolution Protocol for ChIP-Seq Reveals Analogous Enhancer Structures on the Mouse and Human Ribosomal RNA Genes

    Directory of Open Access Journals (Sweden)

    Jean-Clement Mars

    2018-01-01

    Full Text Available The combination of Chromatin Immunoprecipitation and Massively Parallel Sequencing, or ChIP-Seq, has greatly advanced our genome-wide understanding of chromatin and enhancer structures. However, its resolution at any given genetic locus is limited by several factors. In applying ChIP-Seq to the study of the ribosomal RNA genes, we found that a major limitation to resolution was imposed by the underlying variability in sequence coverage that very often dominates the protein–DNA interaction profiles. Here, we describe a simple numerical deconvolution approach that, in large part, corrects for this variability, and significantly improves both the resolution and quantitation of protein–DNA interaction maps deduced from ChIP-Seq data. This approach has allowed us to determine the in vivo organization of the RNA polymerase I preinitiation complexes that form at the promoters and enhancers of the mouse (Mus musculus and human (Homo sapiens ribosomal RNA genes, and to reveal a phased binding of the HMG-box factor UBF across the rDNA. The data identify and map a “Spacer Promoter” and associated stalled polymerase in the intergenic spacer of the human ribosomal RNA genes, and reveal a very similar enhancer structure to that found in rodents and lower vertebrates.

  1. Transcription of ribosomal RNA genes is initiated in the third cell cycle of bovine embryos

    DEFF Research Database (Denmark)

    Jakobsen, Anne Sørig; Avery, Birthe; Dieleman, Steph J.

    2006-01-01

    Transcription from the embryos own ribosomal genes is initiated in most species at the same time as the maternal-embryonic transition. Recently data have indicated that a minor activation may take place during the third embryonic cell cycle in the bovine, one cell cycle before the major activation...

  2. Chromatin structure of ribosomal RNA genes in dipterans and its relationship to the location of nucleolar organizers.

    Science.gov (United States)

    Madalena, Christiane Rodriguez Gutierrez; Díez, José Luís; Gorab, Eduardo

    2012-01-01

    Nucleoli, nuclear organelles in which ribosomal RNA is synthesized and processed, emerge from nucleolar organizers (NORs) located in distinct chromosomal regions. In polytene nuclei of dipterans, nucleoli of some species can be observed under light microscopy exhibiting distinctive morphology: Drosophila and chironomid species display well-formed nucleoli in contrast to the fragmented and dispersed nucleoli seen in sciarid flies. The available data show no apparent relationship between nucleolar morphology and location of NORs in Diptera. The regulation of rRNA transcription involves controlling both the transcription rate per gene as well as the proportion of rRNA genes adopting a proper chromatin structure for transcription, since active and inactive rRNA gene copies coexist in NORs. Transcription units organized in nucleosomes and those lacking canonical nucleosomes can be analyzed by the method termed psoralen gel retarding assay (PGRA), allowing inferences on the ratio of active to inactive rRNA gene copies. In this work, possible connections between chromosomal location of NORs and proportion of active rRNA genes were studied in Drosophila melanogaster, and in chironomid and sciarid species. The data suggested a link between location of NORs and proportion of active rRNA genes since the copy number showing nucleosomal organization predominates when NORs are located in the pericentric heterochromatin. The results presented in this work are in agreement with previous data on the chromatin structure of rRNA genes from distantly related eukaryotes, as assessed by the PGRA.

  3. Chromatin structure of ribosomal RNA genes in dipterans and its relationship to the location of nucleolar organizers.

    Directory of Open Access Journals (Sweden)

    Christiane Rodriguez Gutierrez Madalena

    Full Text Available Nucleoli, nuclear organelles in which ribosomal RNA is synthesized and processed, emerge from nucleolar organizers (NORs located in distinct chromosomal regions. In polytene nuclei of dipterans, nucleoli of some species can be observed under light microscopy exhibiting distinctive morphology: Drosophila and chironomid species display well-formed nucleoli in contrast to the fragmented and dispersed nucleoli seen in sciarid flies. The available data show no apparent relationship between nucleolar morphology and location of NORs in Diptera. The regulation of rRNA transcription involves controlling both the transcription rate per gene as well as the proportion of rRNA genes adopting a proper chromatin structure for transcription, since active and inactive rRNA gene copies coexist in NORs. Transcription units organized in nucleosomes and those lacking canonical nucleosomes can be analyzed by the method termed psoralen gel retarding assay (PGRA, allowing inferences on the ratio of active to inactive rRNA gene copies. In this work, possible connections between chromosomal location of NORs and proportion of active rRNA genes were studied in Drosophila melanogaster, and in chironomid and sciarid species. The data suggested a link between location of NORs and proportion of active rRNA genes since the copy number showing nucleosomal organization predominates when NORs are located in the pericentric heterochromatin. The results presented in this work are in agreement with previous data on the chromatin structure of rRNA genes from distantly related eukaryotes, as assessed by the PGRA.

  4. Activation of the ribosomal RNA genes late in the third cell cycle of porcine embryos

    DEFF Research Database (Denmark)

    Viuff, Dorthe; Greve, Torben; Holm, Peter

    2002-01-01

    ; there was no silver staining at the sites of the rRNA genes and nucleolus precursor bodies. From 30 hpc onwards, most 4-cell embryos had medium size to large clusters of FITC-labeled areas colocalized with silver staining of rRNA gene clusters and fibrillogranular nucleoli. These observations indicate that r...

  5. Genetic and epigenetic variation in 5S ribosomal RNA genes reveals genome dynamics in Arabidopsis thaliana.

    Science.gov (United States)

    Simon, Lauriane; Rabanal, Fernando A; Dubos, Tristan; Oliver, Cecilia; Lauber, Damien; Poulet, Axel; Vogt, Alexander; Mandlbauer, Ariane; Le Goff, Samuel; Sommer, Andreas; Duborjal, Hervé; Tatout, Christophe; Probst, Aline V

    2018-04-06

    Organized in tandem repeat arrays in most eukaryotes and transcribed by RNA polymerase III, expression of 5S rRNA genes is under epigenetic control. To unveil mechanisms of transcriptional regulation, we obtained here in depth sequence information on 5S rRNA genes from the Arabidopsis thaliana genome and identified differential enrichment in epigenetic marks between the three 5S rDNA loci situated on chromosomes 3, 4 and 5. We reveal the chromosome 5 locus as the major source of an atypical, long 5S rRNA transcript characteristic of an open chromatin structure. 5S rRNA genes from this locus translocated in the Landsberg erecta ecotype as shown by linkage mapping and chromosome-specific FISH analysis. These variations in 5S rDNA locus organization cause changes in the spatial arrangement of chromosomes in the nucleus. Furthermore, 5S rRNA gene arrangements are highly dynamic with alterations in chromosomal positions through translocations in certain mutants of the RNA-directed DNA methylation pathway and important copy number variations among ecotypes. Finally, variations in 5S rRNA gene sequence, chromatin organization and transcripts indicate differential usage of 5S rDNA loci in distinct ecotypes. We suggest that both the usage of existing and new 5S rDNA loci resulting from translocations may impact neighboring chromatin organization.

  6. The nuclear 18S ribosomal RNA gene as a source of phylogenetic information in the genus Taenia.

    Science.gov (United States)

    Yan, Hongbin; Lou, Zhongzi; Li, Li; Ni, Xingwei; Guo, Aijiang; Li, Hongmin; Zheng, Yadong; Dyachenko, Viktor; Jia, Wanzhong

    2013-03-01

    Most species of the genus Taenia are of considerable medical and veterinary significance. In this study, complete nuclear 18S rRNA gene sequences were obtained from seven members of genus Taenia [Taenia multiceps, Taenia saginata, Taenia asiatica, Taenia solium, Taenia pisiformis, Taenia hydatigena, and Taenia taeniaeformis] and a phylogeny inferred using these sequences. Most of the variable sites fall within the variable regions, V1-V5. We show that sequences from the nuclear 18S ribosomal RNA gene have considerable promise as sources of phylogenetic information within the genus Taenia. Furthermore, given that almost all the variable sites lie within defined variable portions of that gene, it will be appropriate and economical to sequence only those regions for additional species of Taenia.

  7. Involvement of DNA topoisomerase I in transcription of human ribosomal RNA genes

    International Nuclear Information System (INIS)

    Zhang, H.; Wang, J.C.; Liu, L.F.

    1988-01-01

    Treatment of HeLa cells with a DNA topoisomerase I-specific inhibitor, camptothecin, results in rapid cessation of the synthesis of the 45S rRNA precursor. The inhibition of rRNA synthesis is reversible following drug removal and correlates with the presence of camptothecin-trapped topoisomerase I-DNA abortive complexes, which can be detected as topoisomerase I-linked DNA breaks upon lysis with sodium dodecyl sulfate. These breaks were found to be concentrated within the transcribed region of human rRNA genes. No such sites can be detected in the inactive human rRNA genes in mouse-human hybrid cells, suggesting a preferential association of topoisomerase I with actively transcribed genes. The distribution of RNA polymerase molecules along the transcription unit of human rRNA genes in camptothecin-treated HeLa cells, as assayed by nuclear run-on transcription, shows a graded decrease of the RNA polymerase density toward the 3' end of the transcription unit; the density is minimally affected near the 5' start of the transcription unit. These results suggest that DNA topoisomerase I is normally involved in the elongation step of transcription, especially when the transcripts are long, and that camptothecin interferes with this role

  8. Mitochondrial 16S ribosomal RNA gene for forensic identification of crocodile species.

    Science.gov (United States)

    Naga Jogayya, K; Meganathan, P R; Dubey, Bhawna; Haque, I

    2013-05-01

    All crocodilians are under various threats due to over exploitation and these species have been listed in Appendix I or II of CITES. Lack of molecular techniques for the forensic identification of confiscated samples makes it difficult to enforce the law. Therefore, we herein present a molecular method developed on the basis on 16S rRNA gene of mitochondrial DNA for identification of crocodile species. We have developed a set of 16S rRNA primers for PCR based identification of crocodilian species. These novel primers amplify partial 16S rRNA sequences of six crocodile species which can be later combined to obtain a larger region (1290 bp) of 16S rRNA gene. This 16S rRNA gene could be used as an effective tool for forensic authentication of crocodiles. The described primers hold great promise in forensic identification of crocodile species, which can aid in the effective enforcement of law and conservation of these species. Copyright © 2012 Elsevier Ltd and Faculty of Forensic and Legal Medicine. All rights reserved.

  9. Development of molecular cytogenetics and physical mapping of ribosomal RNA genes in Lupinus

    Czech Academy of Sciences Publication Activity Database

    Naganowska, B.; Doležel, Jaroslav; Swiecicki, W. K.

    2003-01-01

    Roč. 46, - (2003), s. 211-215 ISSN 0006-3134 R&D Projects: GA ČR GA521/03/0595 Institutional research plan: CEZ:AV0Z5038910 Keywords : fluorescent in situ hybridization * Lupinus sp. * rRNA genes Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 0.919, year: 2003

  10. Restriction fragment length polymorphism (RFLP) analysis of PCR products amplified from 18S ribosomal RNA gene of Trypanosoma congolense

    International Nuclear Information System (INIS)

    Osanyo, A.; Majiwa, P.W.

    2006-01-01

    Oligonucleotide primers were designed from the conserved nucleotide sequences of 18S ribosomal RNA (18S rRNA) gene of protozoans: Trypanosoma brucei, Leishmania donovani, Triponema aequale and Lagenidium gigantum. The primers were used in polymerace chain reaction (PCR) to generate PCR products of approximately 1 Kb using genomic DNA from T. brucei and the four genotypic groups of T. congolense as template. The five PCR products so produced were digested with several restriction enzymes and hybridized to a DNA probe made from T. brucei PCR product of the same 18S rRNA gene region. Most restriction enzyme digests revealed polymorphism with respect to the location of their recognition sites on the five PCR products. The restriction fragment length polymorphism (RFLP) pattern observed indicate that the 18S rRNA gene sequences of trypanosomes: T. brucei and the four genotypes of T.congolence group are heterogeneous. The results further demonstrate that the region that was amplified can be used in specific identification of trypanosomes species and subspecies.(author)

  11. Activation of ribosomal RNA genes in porcine embryos produced in vitro or by somatic cell nuclear transfer

    DEFF Research Database (Denmark)

    Bjerregaard, Bolette; Pedersen, Hanne Gervi; Jakobsen, Anne Sørig

    2007-01-01

    The onset of ribosomal RNA (rRNA) synthesis occurs during the second half of the third cell cycle, that is, at the four-cell stage, in porcine embryos developed in vivo. In the present study the onset of rRNA synthesis was investigated in porcine embryos produced in vitro (IVP) or by somatic cell...

  12. 5S rRNA and ribosome.

    Science.gov (United States)

    Gongadze, G M

    2011-12-01

    5S rRNA is an integral component of the ribosome of all living organisms. It is known that the ribosome without 5S rRNA is functionally inactive. However, the question about the specific role of this RNA in functioning of the translation apparatus is still open. This review presents a brief history of the discovery of 5S rRNA and studies of its origin and localization in the ribosome. The previously expressed hypotheses about the role of this RNA in the functioning of the ribosome are discussed considering the unique location of 5S rRNA in the ribosome and its intermolecular contacts. Based on analysis of the current data on ribosome structure and its functional complexes, the role of 5S rRNA as an intermediary between ribosome functional domains is discussed.

  13. Molecular phylogenetic studies on an unnamed bovine Babesia sp. based on small subunit ribosomal RNA gene sequences.

    Science.gov (United States)

    Luo, Jianxun; Yin, Hong; Liu, Zhijie; Yang, Dongying; Guan, Guiquan; Liu, Aihong; Ma, Miling; Dang, Shengzhi; Lu, Bingyi; Sun, Caiqin; Bai, Qi; Lu, Wenshun; Chen, Puyan

    2005-10-10

    The 18S small subunit ribosomal RNA (18S rRNA) gene of an unnamed Babesia species (designated B. U sp.) was sequenced and analyzed in an attempt to distinguish it from other Babesia species in China. The target DNA segment was amplified by polymerase chain reaction (PCR). The PCR product was ligated to the pGEM-T Easy vector for sequencing. It was found that the length of the 18S rRNA gene of all B. U sp. Kashi 1 and B. U sp. Kashi 2 was 1699 bp and 1689 bp. Two phylogenetic trees were, respectively, inferred based on 18S rRNA sequence of the Chinese bovine Babesia isolates and all of Babesia species available in GenBank. The first tree showed that B. U sp. was situated in the branch between B. major Yili and B. bovis Shannxian, and the second tree revealed that B. U sp. was confined to the same group as B. caballi. The percent identity of B. U sp. with other Chinese Babesia species was between 74.2 and 91.8, while the percent identity between two B. U sp. isolates was 99.7. These results demonstrated that this B. U sp. is different from other Babesia species, but that two B. U sp. isolates obtained with nymphal and adultal Hyalomma anatolicum anatolicum tick belong to the same species.

  14. Identification and characterization of rhizospheric microbial diversity by 16S ribosomal RNA gene sequencing

    Directory of Open Access Journals (Sweden)

    Muhammad Naveed

    2014-09-01

    Full Text Available In the present study, samples of rhizosphere and root nodules were collected from different areas of Pakistan to isolate plant growth promoting rhizobacteria. Identification of bacterial isolates was made by 16S rRNA gene sequence analysis and taxonomical confirmation on EzTaxon Server. The identified bacterial strains were belonged to 5 genera i.e. Ensifer, Bacillus, Pseudomona, Leclercia and Rhizobium. Phylogenetic analysis inferred from 16S rRNA gene sequences showed the evolutionary relationship of bacterial strains with the respective genera. Based on phylogenetic analysis, some candidate novel species were also identified. The bacterial strains were also characterized for morphological, physiological, biochemical tests and glucose dehydrogenase (gdh gene that involved in the phosphate solublization using cofactor pyrroloquinolone quinone (PQQ. Seven rhizoshperic and 3 root nodulating stains are positive for gdh gene. Furthermore, this study confirms a novel association between microbes and their hosts like field grown crops, leguminous and non-leguminous plants. It was concluded that a diverse group of bacterial population exist in the rhizosphere and root nodules that might be useful in evaluating the mechanisms behind plant microbial interactions and strains QAU-63 and QAU-68 have sequence similarity of 97 and 95% which might be declared as novel after further taxonomic characterization.

  15. A ribosomal RNA gene intergenic spacer based PCR and DGGE fingerprinting method for the analysis of specific rhizobial communities in soil

    NARCIS (Netherlands)

    de Oliveira, VM; Manfio, GP; Coutinho, HLD; Keijzer-Wolters, AC; van Elsas, JD

    A direct molecular method for assessing the diversity of specific populations of rhizobia in soil, based on nested PCR amplification of 16S-23S ribosomal RNA gene (rDNA) intergenic spacer (IGS) sequences, was developed. Initial generic amplification of bacterial rDNA IGS sequences from soil DNA was

  16. A ribosomal RNA gene intergenic spacer based PCR and DGGE fingerprinting method for the analysis of specific rhizobial communities in soil

    NARCIS (Netherlands)

    Oliveira, de V.M.; Manfio, G.P.; Coutinho, H.L.D.; Keijzer-Wolters, A.C.; Elsas, van J.D.

    2006-01-01

    A direct molecular method for assessing the diversity of specific populations of rhizobia in soil, based on nested PCR amplification of 16S-23S ribosomal RNA gene (rDNA) intergenic spacer (IGS) sequences, was developed. Initial generic amplification of bacterial rDNA IGS sequences from soil DNA was

  17. A unique enhancer boundary complex on the mouse ribosomal RNA genes persists after loss of Rrn3 or UBF and the inactivation of RNA polymerase I transcription.

    Science.gov (United States)

    Herdman, Chelsea; Mars, Jean-Clement; Stefanovsky, Victor Y; Tremblay, Michel G; Sabourin-Felix, Marianne; Lindsay, Helen; Robinson, Mark D; Moss, Tom

    2017-07-01

    Transcription of the several hundred of mouse and human Ribosomal RNA (rRNA) genes accounts for the majority of RNA synthesis in the cell nucleus and is the determinant of cytoplasmic ribosome abundance, a key factor in regulating gene expression. The rRNA genes, referred to globally as the rDNA, are clustered as direct repeats at the Nucleolar Organiser Regions, NORs, of several chromosomes, and in many cells the active repeats are transcribed at near saturation levels. The rDNA is also a hotspot of recombination and chromosome breakage, and hence understanding its control has broad importance. Despite the need for a high level of rDNA transcription, typically only a fraction of the rDNA is transcriptionally active, and some NORs are permanently silenced by CpG methylation. Various chromatin-remodelling complexes have been implicated in counteracting silencing to maintain rDNA activity. However, the chromatin structure of the active rDNA fraction is still far from clear. Here we have combined a high-resolution ChIP-Seq protocol with conditional inactivation of key basal factors to better understand what determines active rDNA chromatin. The data resolve questions concerning the interdependence of the basal transcription factors, show that preinitiation complex formation is driven by the architectural factor UBF (UBTF) independently of transcription, and that RPI termination and release corresponds with the site of TTF1 binding. They further reveal the existence of an asymmetric Enhancer Boundary Complex formed by CTCF and Cohesin and flanked upstream by phased nucleosomes and downstream by an arrested RNA Polymerase I complex. We find that the Enhancer Boundary Complex is the only site of active histone modification in the 45kbp rDNA repeat. Strikingly, it not only delimits each functional rRNA gene, but also is stably maintained after gene inactivation and the re-establishment of surrounding repressive chromatin. Our data define a poised state of rDNA chromatin

  18. A unique enhancer boundary complex on the mouse ribosomal RNA genes persists after loss of Rrn3 or UBF and the inactivation of RNA polymerase I transcription.

    Directory of Open Access Journals (Sweden)

    Chelsea Herdman

    2017-07-01

    Full Text Available Transcription of the several hundred of mouse and human Ribosomal RNA (rRNA genes accounts for the majority of RNA synthesis in the cell nucleus and is the determinant of cytoplasmic ribosome abundance, a key factor in regulating gene expression. The rRNA genes, referred to globally as the rDNA, are clustered as direct repeats at the Nucleolar Organiser Regions, NORs, of several chromosomes, and in many cells the active repeats are transcribed at near saturation levels. The rDNA is also a hotspot of recombination and chromosome breakage, and hence understanding its control has broad importance. Despite the need for a high level of rDNA transcription, typically only a fraction of the rDNA is transcriptionally active, and some NORs are permanently silenced by CpG methylation. Various chromatin-remodelling complexes have been implicated in counteracting silencing to maintain rDNA activity. However, the chromatin structure of the active rDNA fraction is still far from clear. Here we have combined a high-resolution ChIP-Seq protocol with conditional inactivation of key basal factors to better understand what determines active rDNA chromatin. The data resolve questions concerning the interdependence of the basal transcription factors, show that preinitiation complex formation is driven by the architectural factor UBF (UBTF independently of transcription, and that RPI termination and release corresponds with the site of TTF1 binding. They further reveal the existence of an asymmetric Enhancer Boundary Complex formed by CTCF and Cohesin and flanked upstream by phased nucleosomes and downstream by an arrested RNA Polymerase I complex. We find that the Enhancer Boundary Complex is the only site of active histone modification in the 45kbp rDNA repeat. Strikingly, it not only delimits each functional rRNA gene, but also is stably maintained after gene inactivation and the re-establishment of surrounding repressive chromatin. Our data define a poised state

  19. 5-Methyldeoxycytidine in the Physarum minichromosome containing the ribosomal RNA genes.

    Science.gov (United States)

    Cooney, C A; Matthews, H R; Bradbury, E M

    1984-01-01

    5-Methyldeoxycytidine (5MC) was analyzed by high pressure liquid chromatography (HPLC) and by restriction enzyme digestion in rDNA isolated from Physarum polycephalum. rDNA from Physarum M3C strain microplasmodia has a significant 5MC content (about half that of the whole genomic DNA). This rDNA contains many C5MCGG sites because it is clearly digested further by Msp I than by Hpa II. However, most 5MC is in other sites. In particular, alternating CG sequences appear to be highly methylated. HPLC of deoxyribonucleosides shows tha most of the transcribed regions contain little or no 5MC. Restriction digestion indicates that there is little or no 5MC in any of the transcribed regions including the transcription origin and adjacent sequences. Over 90% of the total 5MC is in or near the central nontranscribed spacer and most methylated restriction sites are in inverted repeats of this spacer. rDNA is very heterogeneous with respect to 5MC. The 5MC pattern doesn't appear to change with inactivation of the rRNA genes during reversible differentiation from microplasmodia (growing) to microsclerotia (dormant), showing that inactivation is due to changes in other chromatin variables. The 5MC pattern is different between Physarum strains. The possible involvement of this 5MC in rDNA chromatin structure and in cruciform and Z-DNA formation is discussed. Images PMID:6322108

  20. Cis-regulatory RNA elements that regulate specialized ribosome activity.

    Science.gov (United States)

    Xue, Shifeng; Barna, Maria

    2015-01-01

    Recent evidence has shown that the ribosome itself can play a highly regulatory role in the specialized translation of specific subpools of mRNAs, in particular at the level of ribosomal proteins (RP). However, the mechanism(s) by which this selection takes place has remained poorly understood. In our recent study, we discovered a combination of unique RNA elements in the 5'UTRs of mRNAs that allows for such control by the ribosome. These mRNAs contain a Translation Inhibitory Element (TIE) that inhibits general cap-dependent translation, and an Internal Ribosome Entry Site (IRES) that relies on a specific RP for activation. The unique combination of an inhibitor of general translation and an activator of specialized translation is key to ribosome-mediated control of gene expression. Here we discuss how these RNA regulatory elements provide a new level of control to protein expression and their implications for gene expression, organismal development and evolution.

  1. [Molecular phylogeny of Turbellaria, based on data from comparing the nucleotide sequences of 18S ribosomal RNA genes].

    Science.gov (United States)

    Kuznedelov, K D; Timoshkin, O A

    1995-01-01

    Polymerase chain reaction and direct sequencing of the 5'-end region of the 18S ribosomal RNA gene were used to infer phylogenetic relationship among turbellarian flatworms from Lake Baikal. Representatives of 5 orders (Tricladida--10 spp., Lecithoepitheliata--5 spp., Prolecithophora--3 spp., Proseriata and Kalyptorhynchia one for each) were studied; nucleotide sequence of more than 340 nucleotides was determined for each species. Consensus sequence for each order having more than one representative species was determined. Distance matrix and maximum parsimony approaches were applied to infer phylogenies. Bootstrap procedure was used to estimate confidence limits, at the 100% level by bootstrapping, the group of three orders: Kalyptorhynchia, Proseriata and Lecithoepitheliata was found to be monophyletic. However, subsets inside the group had no significant support to be preferred or rejected. Our data do not support traditional systematics which joins two suborders Tricladida and Proseriata into the single order Seriata, and also do not support comparative anatomical data which show close relationship of Lecithoepitheliata and lower Prolecithophora.

  2. Ribosomal RNA genes challenge the monophyly of the Hyalospheniidae (Amoebozoa: Arcellinida)

    DEFF Research Database (Denmark)

    Lara, Enrique; Heger, Thierry J; Ekelund, Flemming

    2008-01-01

    causes confusion in the phylogeny, taxonomy and the debate on cosmopolitanism of free-living protists. Here we present a SSU rRNA-based phylogeny of the Hyalospheniidae including the most common species. Similar to the filose testate amoebae of the order Euglyphida the most basal clades have a terminal...

  3. Ribosomal RNA Genes Contribute to the Formation of Pseudogenes and Junk DNA in the Human Genome.

    Science.gov (United States)

    Robicheau, Brent M; Susko, Edward; Harrigan, Amye M; Snyder, Marlene

    2017-02-01

    Approximately 35% of the human genome can be identified as sequence devoid of a selected-effect function, and not derived from transposable elements or repeated sequences. We provide evidence supporting a known origin for a fraction of this sequence. We show that: 1) highly degraded, but near full length, ribosomal DNA (rDNA) units, including both 45S and Intergenic Spacer (IGS), can be found at multiple sites in the human genome on chromosomes without rDNA arrays, 2) that these rDNA sequences have a propensity for being centromere proximal, and 3) that sequence at all human functional rDNA array ends is divergent from canonical rDNA to the point that it is pseudogenic. We also show that small sequence strings of rDNA (from 45S + IGS) can be found distributed throughout the genome and are identifiable as an "rDNA-like signal", representing 0.26% of the q-arm of HSA21 and ∼2% of the total sequence of other regions tested. The size of sequence strings found in the rDNA-like signal intergrade into the size of sequence strings that make up the full-length degrading rDNA units found scattered throughout the genome. We conclude that the displaced and degrading rDNA sequences are likely of a similar origin but represent different stages in their evolution towards random sequence. Collectively, our data suggests that over vast evolutionary time, rDNA arrays contribute to the production of junk DNA. The concept that the production of rDNA pseudogenes is a by-product of concerted evolution represents a previously under-appreciated process; we demonstrate here its importance. © The Author(s) 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  4. Expression of protein-coding genes embedded in ribosomal DNA

    DEFF Research Database (Denmark)

    Johansen, Steinar D; Haugen, Peik; Nielsen, Henrik

    2007-01-01

    Ribosomal DNA (rDNA) is a specialised chromosomal location that is dedicated to high-level transcription of ribosomal RNA genes. Interestingly, rDNAs are frequently interrupted by parasitic elements, some of which carry protein genes. These are non-LTR retrotransposons and group II introns that e...... in the nucleolus....

  5. Expression of the double-stranded RNA of the soybean pod borer Leguminivora glycinivorella (Lepidoptera: Tortricidae) ribosomal protein P0 gene enhances the resistance of transgenic soybean plants.

    Science.gov (United States)

    Meng, Fanli; Li, Yang; Zang, Zhenyuan; Li, Na; Ran, Ruixue; Cao, Yingxue; Li, Tianyu; Zhou, Quan; Li, Wenbin

    2017-12-01

    The soybean pod borer [SPB; Leguminivora glycinivorella (Matsumura) (Lepidoptera: Tortricidae)] is the most important soybean pest in northeastern Asia. Silencing genes using plant-mediated RNA-interference is a promising strategy for controlling SPB infestations. The ribosomal protein P0 is important for protein translation and DNA repair in the SPB. Thus, transferring P0 double-stranded RNA (dsRNA) into plants may help prevent SPB-induced damage. We investigated the effects of SpbP0 dsRNA injections and SpbP0 dsRNA-expressing transgenic soybean plants on the SPB. Larval mortality rates were greater for SpbP0 dsRNA-injected larvae (96%) than for the control larvae (31%) at 14 days after injections. Transgenic T 2 soybean plants expressing SpbP0 dsRNA sustained less damage from SPB larvae than control plants. In addition, the expression level of the SpbP0 gene decreased and the mortality rate increased when SPB larvae were fed on T 3 transgenic soybean pods. Moreover, the surviving larvae were deformed and exhibited inhibited growth. Silencing SpbP0 expression is lethal to the SPB. Transgenic soybean plants expressing SpbP0 dsRNA are more resistant to the SPB than wild-type plants. Thus, SpbP0 dsRNA-expressing transgenic plants may be useful for controlling insect pests. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

  6. A Sequence-Specific Interaction between the Saccharomyces cerevisiae rRNA Gene Repeats and a Locus Encoding an RNA Polymerase I Subunit Affects Ribosomal DNA Stability

    Science.gov (United States)

    Cahyani, Inswasti; Cridge, Andrew G.; Engelke, David R.; Ganley, Austen R. D.

    2014-01-01

    The spatial organization of eukaryotic genomes is linked to their functions. However, how individual features of the global spatial structure contribute to nuclear function remains largely unknown. We previously identified a high-frequency interchromosomal interaction within the Saccharomyces cerevisiae genome that occurs between the intergenic spacer of the ribosomal DNA (rDNA) repeats and the intergenic sequence between the locus encoding the second largest RNA polymerase I subunit and a lysine tRNA gene [i.e., RPA135-tK(CUU)P]. Here, we used quantitative chromosome conformation capture in combination with replacement mapping to identify a 75-bp sequence within the RPA135-tK(CUU)P intergenic region that is involved in the interaction. We demonstrate that the RPA135-IGS1 interaction is dependent on the rDNA copy number and the Msn2 protein. Surprisingly, we found that the interaction does not govern RPA135 transcription. Instead, replacement of a 605-bp region within the RPA135-tK(CUU)P intergenic region results in a reduction in the RPA135-IGS1 interaction level and fluctuations in rDNA copy number. We conclude that the chromosomal interaction that occurs between the RPA135-tK(CUU)P and rDNA IGS1 loci stabilizes rDNA repeat number and contributes to the maintenance of nucleolar stability. Our results provide evidence that the DNA loci involved in chromosomal interactions are composite elements, sections of which function in stabilizing the interaction or mediating a functional outcome. PMID:25421713

  7. Partial nucleotide sequence analysis of 18S ribosomal RNA gene of the four genotypes of Trypanosoma congolense

    International Nuclear Information System (INIS)

    Osanya, A.; Majiwa, P.A.O.; Kinyanjui, P.W.

    2006-01-01

    Specific oligonucleotide primers based on conserved nucleotide sequences of 18s ribisomal RNA (18s rRNA) gene of Trypanosoma brucei, Leishmania donovani, Triponema aequale and Lagenidium gigantum have been designed and used in the ploymerase chain reaction (PCR) to amplify genomic DNA from four different clones each representing a different genotypic group of T. congolence. PCR products of approximately 1Kb were generated using as template DNA from each of the trypanosomes. The PCR products cross-hybridized with genomic DNA from T.brucei, T. simiae and the four genotypes of T.congolense implying significant sequence homology of 18S rRNA gene among trypanosomes. The nucleotide sequence of a segment of the PCR products were determined by direct sequencing to provide partial nucleotide sequence of the 18s rRNA gene in each T.congolense genotypic group. The sequences obtained together with those that have been published for T.brucei reveals that although most regions show inter and intra species nucleotide identity, there are several sites where deletions, insertions and base changes have occured in nucleotide sequence of of T.brucei and the four genotypes of T.congolense.(author)

  8. Cisplatin Targeting of Bacterial Ribosomal RNA Hairpins

    Directory of Open Access Journals (Sweden)

    Gayani N. P. Dedduwa-Mudalige

    2015-09-01

    Full Text Available Cisplatin is a clinically important chemotherapeutic agent known to target purine bases in nucleic acids. In addition to major deoxyribonucleic acid (DNA intrastrand cross-links, cisplatin also forms stable adducts with many types of ribonucleic acid (RNA including siRNA, spliceosomal RNAs, tRNA, and rRNA. All of these RNAs play vital roles in the cell, such as catalysis of protein synthesis by rRNA, and therefore serve as potential drug targets. This work focused on platination of two highly conserved RNA hairpins from E. coli ribosomes, namely pseudouridine-modified helix 69 from 23S rRNA and the 790 loop of helix 24 from 16S rRNA. RNase T1 probing, MALDI mass spectrometry, and dimethyl sulfate mapping revealed platination at GpG sites. Chemical probing results also showed platination-induced RNA structural changes. These findings reveal solvent and structural accessibility of sites within bacterial RNA secondary structures that are functionally significant and therefore viable targets for cisplatin as well as other classes of small molecules. Identifying target preferences at the nucleotide level, as well as determining cisplatin-induced RNA conformational changes, is important for the design of more potent drug molecules. Furthermore, the knowledge gained through studies of RNA-targeting by cisplatin is applicable to a broad range of organisms from bacteria to human.

  9. Evolution of blue-flowered species of genus Linum based on high-throughput sequencing of ribosomal RNA genes.

    Science.gov (United States)

    Bolsheva, Nadezhda L; Melnikova, Nataliya V; Kirov, Ilya V; Speranskaya, Anna S; Krinitsina, Anastasia A; Dmitriev, Alexey A; Belenikin, Maxim S; Krasnov, George S; Lakunina, Valentina A; Snezhkina, Anastasiya V; Rozhmina, Tatiana A; Samatadze, Tatiana E; Yurkevich, Olga Yu; Zoshchuk, Svyatoslav A; Amosova, Аlexandra V; Kudryavtseva, Anna V; Muravenko, Olga V

    2017-12-28

    The species relationships within the genus Linum have already been studied several times by means of different molecular and phylogenetic approaches. Nevertheless, a number of ambiguities in phylogeny of Linum still remain unresolved. In particular, the species relationships within the sections Stellerolinum and Dasylinum need further clarification. Also, the question of independence of the species of the section Adenolinum still remains unanswered. Moreover, the relationships of L. narbonense and other species of the section Linum require further clarification. Additionally, the origin of tetraploid species of the section Linum (2n = 30) including the cultivated species L. usitatissimum has not been explored. The present study examines the phylogeny of blue-flowered species of Linum by comparisons of 5S rRNA gene sequences as well as ITS1 and ITS2 sequences of 35S rRNA genes. High-throughput sequencing has been used for analysis of multicopy rRNA gene families. In addition to the molecular phylogenetic analysis, the number and chromosomal localization of 5S and 35S rDNA sites has been determined by FISH. Our findings confirm that L. stelleroides forms a basal branch from the clade of blue-flowered flaxes which is independent of the branch formed by species of the sect. Dasylinum. The current molecular phylogenetic approaches, the cytogenetic analysis as well as different genomic DNA fingerprinting methods applied previously did not discriminate certain species within the sect. Adenolinum. The allotetraploid cultivated species L. usitatissimum and its wild ancestor L. angustifolium (2n = 30) could originate either as the result of hybridization of two diploid species (2n = 16) related to the modern L. gandiflorum and L. decumbens, or hybridization of a diploid species (2n = 16) and a diploid ancestor of modern L. narbonense (2n = 14). High-throughput sequencing of multicopy rRNA gene families allowed us to make several adjustments to the

  10. Amplification and sequence analysis of partial bacterial 16S ribosomal RNA gene in gallbladder bile from patients with primary biliary cirrhosis.

    Science.gov (United States)

    Hiramatsu, K; Harada, K; Tsuneyama, K; Sasaki, M; Fujita, S; Hashimoto, T; Kaneko, S; Kobayashi, K; Nakanuma, Y

    2000-07-01

    The etiopathogenesis of bile duct lesion in primary biliary cirrhosis is unknown, though the participation of bacteria and/or their components and products is suspected. In this study, we tried to detect and identify bacteria in the bile of patients with primary biliary cirrhosis by polymerase chain reaction using universal bacterial primers of the 16S ribosomal RNA gene. Gallbladder bile samples from 15 patients with primary biliary cirrhosis, 5 with primary sclerosing cholangitis, 5 with hepatitis C virus-related liver cirrhosis, 11 with cholecystolithiasis, and from 12 normal adult gallbladders were used. In addition to the culture study, partial bacterial 16S ribosomal RNA gene was amplified by polymerase chain reaction (PCR) taking advantage of universal primers that can amplify the gene of almost all bacterial species, and the amplicons were cloned and sequenced. Sequence homology with specific bacterial species was analyzed by database research. Bacterial contamination at every step of the bile sampling, DNA extraction and PCR study was avoided. Furthermore, to confirm whether bacterial DNA is detectable in liver explants, the same analysis was performed using 10 liver explants of patients with primary biliary cirrhosis. In primary biliary cirrhosis, 75% (p<0.0001) of 100 clones were identified as so-called gram-positive cocci while these cocci were positive in only 5% in cholecystolithiasis (p<0.0001). In cholecystolithiasis gram-negative rods were predominant instead. One bacterial species detected in a normal adult was not related to those detected in primary biliary cirrhosis and cholecystolithiasis patients. No bacterial DNA was detected by PCR amplification in 10 liver explants of patients with primary biliary cirrhosis. The present results raise several possible roles of gram-positive bacteria in bile in the etiopathogenesis of primary biliary cirrhosis. However, these results could also reflect an epiphenomenon due to decreased bile flow in the

  11. Identification of planorbids from Venezuela by polymerase chain reaction amplification and restriction fragment length polymorphism of internal transcriber spacer of the RNA ribosomal gene

    Directory of Open Access Journals (Sweden)

    Caldeira Roberta L

    2000-01-01

    Full Text Available Snails of the genus Biomphalaria from Venezuela were subjected to morphological assessment as well as polymerase chain reaction and restriction fragment length polymorphism (PCR-RFLP analysis. Morphological identification was carried out by comparison of characters of the shell and the male and female reproductive apparatus. The PCR-RFLP involved amplification of the internal spacer region ITS1 and ITS2 of the RNA ribosomal gene and subsequent digestion of this fragment by the restriction enzymes DdeI, MnlI, HaeIII and MspI. The planorbids were compared with snails of the same species and others reported from Venezuela and present in Brazil, Cuba and Mexico. All the enzymes showed a specific profile for each species, that of DdeI being the clearest. The snails were identified as B. glabrata, B. prona and B. kuhniana.

  12. Repeated reunions and splits feature the highly dynamic evolution of 5S and 35S ribosomal RNA genes (rDNA) in the Asteraceae family.

    Science.gov (United States)

    Garcia, Sònia; Panero, José L; Siroky, Jiri; Kovarik, Ales

    2010-08-16

    In flowering plants and animals the most common ribosomal RNA genes (rDNA) organisation is that in which 35S (encoding 18S-5.8S-26S rRNA) and 5S genes are physically separated occupying different chromosomal loci. However, recent observations established that both genes have been unified to a single 35S-5S unit in the genus Artemisia (Asteraceae), a genomic arrangement typical of primitive eukaryotes such as yeast, among others. Here we aim to reveal the origin, distribution and mechanisms leading to the linked organisation of rDNA in the Asteraceae by analysing unit structure (PCR, Southern blot, sequencing), gene copy number (quantitative PCR) and chromosomal position (FISH) of 5S and 35S rRNA genes in approximately 200 species representing the family diversity and other closely related groups. Dominant linked rDNA genotype was found within three large groups in subfamily Asteroideae: tribe Anthemideae (93% of the studied cases), tribe Gnaphalieae (100%) and in the "Heliantheae alliance" (23%). The remaining five tribes of the Asteroideae displayed canonical non linked arrangement of rDNA, as did the other groups in the Asteraceae. Nevertheless, low copy linked genes were identified among several species that amplified unlinked units. The conserved position of functional 5S insertions downstream from the 26S gene suggests a unique, perhaps retrotransposon-mediated integration event at the base of subfamily Asteroideae. Further evolution likely involved divergence of 26S-5S intergenic spacers, amplification and homogenisation of units across the chromosomes and concomitant elimination of unlinked arrays. However, the opposite trend, from linked towards unlinked arrangement was also surmised in few species indicating possible reversibility of these processes. Our results indicate that nearly 25% of Asteraceae species may have evolved unusual linked arrangement of rRNA genes. Thus, in plants, fundamental changes in intrinsic structure of rDNA units, their copy

  13. An internal ribosome entry site directs translation of the 3'-gene from Pelargonium flower break virus genomic RNA: implications for infectivity.

    Directory of Open Access Journals (Sweden)

    Olga Fernández-Miragall

    Full Text Available Pelargonium flower break virus (PFBV, genus Carmovirus has a single-stranded positive-sense genomic RNA (gRNA which contains five ORFs. The two 5'-proximal ORFs encode the replicases, two internal ORFs encode movement proteins, and the 3'-proximal ORF encodes a polypeptide (p37 which plays a dual role as capsid protein and as suppressor of RNA silencing. Like other members of family Tombusviridae, carmoviruses express ORFs that are not 5'-proximal from subgenomic RNAs. However, in one case, corresponding to Hisbiscus chlorotic ringspot virus, it has been reported that the 3'-proximal gene can be translated from the gRNA through an internal ribosome entry site (IRES. Here we show that PFBV also holds an IRES that mediates production of p37 from the gRNA, raising the question of whether this translation strategy may be conserved in the genus. The PFBV IRES was functional both in vitro and in vivo and either in the viral context or when inserted into synthetic bicistronic constructs. Through deletion and mutagenesis studies we have found that the IRES is contained within a 80 nt segment and have identified some structural traits that influence IRES function. Interestingly, mutations that diminish IRES activity strongly reduced the infectivity of the virus while the progress of the infection was favoured by mutations potentiating such activity. These results support the biological significance of the IRES-driven p37 translation and suggest that production of the silencing suppressor from the gRNA might allow the virus to early counteract the defence response of the host, thus facilitating pathogen multiplication and spread.

  14. An internal ribosome entry site directs translation of the 3'-gene from Pelargonium flower break virus genomic RNA: implications for infectivity.

    Science.gov (United States)

    Fernández-Miragall, Olga; Hernández, Carmen

    2011-01-01

    Pelargonium flower break virus (PFBV, genus Carmovirus) has a single-stranded positive-sense genomic RNA (gRNA) which contains five ORFs. The two 5'-proximal ORFs encode the replicases, two internal ORFs encode movement proteins, and the 3'-proximal ORF encodes a polypeptide (p37) which plays a dual role as capsid protein and as suppressor of RNA silencing. Like other members of family Tombusviridae, carmoviruses express ORFs that are not 5'-proximal from subgenomic RNAs. However, in one case, corresponding to Hisbiscus chlorotic ringspot virus, it has been reported that the 3'-proximal gene can be translated from the gRNA through an internal ribosome entry site (IRES). Here we show that PFBV also holds an IRES that mediates production of p37 from the gRNA, raising the question of whether this translation strategy may be conserved in the genus. The PFBV IRES was functional both in vitro and in vivo and either in the viral context or when inserted into synthetic bicistronic constructs. Through deletion and mutagenesis studies we have found that the IRES is contained within a 80 nt segment and have identified some structural traits that influence IRES function. Interestingly, mutations that diminish IRES activity strongly reduced the infectivity of the virus while the progress of the infection was favoured by mutations potentiating such activity. These results support the biological significance of the IRES-driven p37 translation and suggest that production of the silencing suppressor from the gRNA might allow the virus to early counteract the defence response of the host, thus facilitating pathogen multiplication and spread.

  15. High-resolution microscopy of active ribosomal genes and key members of the rRNA processing machinery inside nucleolus-like bodies of fully-grown mouse oocytes.

    Science.gov (United States)

    Shishova, Kseniya V; Khodarovich, Yuriy M; Lavrentyeva, Elena A; Zatsepina, Olga V

    2015-10-01

    Nucleolus-like bodies (NLBs) of fully-grown (germinal vesicle, GV) mammalian oocytes are traditionally considered as morphologically distinct entities, which, unlike normal nucleoli, contain transcribed ribosomal genes (rDNA) solely at their surface. In the current study, we for the first time showed that active ribosomal genes are present not only on the surface but also inside NLBs of the NSN-type oocytes. The "internal" rRNA synthesis was evidenced by cytoplasmic microinjections of BrUTP as precursor and by fluorescence in situ hybridization with a probe to the short-lived 5'ETS segment of the 47S pre-rRNA. We further showed that in the NLB mass of NSN-oocytes, distribution of active rDNA, RNA polymerase I (UBF) and rRNA processing (fibrillarin) protein factors, U3 snoRNA, pre-rRNAs and 18S/28S rRNAs is remarkably similar to that in somatic nucleoli capable to make pre-ribosomes. Overall, these observations support the occurrence of rDNA transcription, rRNA processing and pre-ribosome assembly in the NSN-type NLBs and so that their functional similarity to normal nucleoli. Unlike the NSN-type NLBs, the NLBs of more mature SN-oocytes do not contain transcribed rRNA genes, U3 snoRNA, pre-rRNAs, 18S and 28S rRNAs. These results favor the idea that in a process of transformation of NSN-oocytes to SN-oocytes, NLBs cease to produce pre-ribosomes and, moreover, lose their rRNAs. We also concluded that a denaturing fixative 70% ethanol used in the study to fix oocytes could be more appropriate for light microscopy analysis of nucleolar RNAs and proteins in mammalian fully-grown oocytes than a commonly used cross-linking aldehyde fixative, formalin. Copyright © 2015 Elsevier Inc. All rights reserved.

  16. Trapping the ribosome to control gene expression.

    Science.gov (United States)

    Boehringer, Daniel; Ban, Nenad

    2007-09-21

    Protein synthesis is often regulated by structured mRNAs that interact with ribosomes. In this issue of Cell, Marzi et al. (2007) provide insights into the autoregulation of protein S15 by visualizing the folded repressor mRNA on the ribosome stalled in the preinitiation state. These results have implications for our understanding of the mechanism of translation initiation in general.

  17. 5S ribosomal RNA database Y2K.

    Science.gov (United States)

    Szymanski, M; Barciszewska, M Z; Barciszewski, J; Erdmann, V A

    2000-01-01

    This paper presents the updated version (Y2K) of the database of ribosomal 5S ribonucleic acids (5S rRNA) and their genes (5S rDNA), http://rose.man/poznan.pl/5SData/index.html. This edition of the database contains 1985primary structures of 5S rRNA and 5S rDNA. They include 60 archaebacterial, 470 eubacterial, 63 plastid, nine mitochondrial and 1383 eukaryotic sequences. The nucleotide sequences of the 5S rRNAs or 5S rDNAs are divided according to the taxonomic position of the source organisms.

  18. Heavy ion effects on yeast: Inhibition of ribosomal RNA synthesis

    International Nuclear Information System (INIS)

    Weber, K.J.; Schneider, E.; Kiefer, J.; Kraft, G.

    1990-01-01

    Diploid wild-type yeast cells were exposed to beams of heavy ions covering a wide range of linear energy transfer (LET) (43-13,700 keV/microns). Synthesis of ribosomal RNA (rRNA) was assessed as a functional measure of damage produced by particle radiation. An exponential decrease of relative rRNA synthesis with particle fluence was demonstrated in all cases. The inactivation cross sections derived were found to increase with LET over the entire range of LET studied. The corresponding values for relative biological effectiveness were slightly less than unity. Maximum cross sections measured were close to 1 micron 2, implying that some larger structure within the yeast nucleus (e.g., the nucleolus) might represent the target for an impairment of synthetic activity by very heavy ions rather than the genes coding for rRNA. Where tested, an oxygen effect for rRNA synthesis could not be demonstrated

  19. 8-Methoxypsoralen DNA interstrand cross-linking of the ribosomal RNA genes in Tetrahymena thermophila. Distribution, repair and effect on rRNA synthesis

    DEFF Research Database (Denmark)

    Fengquin, X; Nielsen, Henrik; Zhen, W

    1993-01-01

    between three domains (terminal spacer, transcribed region and central spacer) as defined by restriction enzyme analysis (BamHI and ClaI). It is furthermore shown that a dosage resulting in approximately one cross-link per rDNA molecule (21 kbp, two genes) is sufficient to block RNA synthesis. Finally......, it is shown that the cross-links in the rDNA molecules are repaired at equal rate in all three domains within 24 h and that RNA synthesis is partly restored during this repair period. The majority of the cells also go through one to two cell divisions in this period but do not survive....

  20. Analysis of clustered point mutations in the human ribosomal RNA gene promoter by transient expression in vivo

    International Nuclear Information System (INIS)

    Jones, M.H.; Learned, R.M.; Tjian, R.

    1988-01-01

    The authors have mapped the cis regulatory elements required in vivo for initiation at the human rRNA promoter by RNA polymerase I. Transient expression in COS-7 cells was used to evaluate the transcription phenotype of clustered base substitution mutations in the human rRNA promoter. The promoter consists of two major elements: a large upstream region, composed of several domains, that lies between nucleotides -234 and -107 relative to the transcription initiation site and affects transcription up to 100-fold and a core element that lies between nucleotides -45 and +20 and affects transcription up to 1000-fold. The upstream regions is able to retain partial function when positioned within 100-160 nucleotides of the transcription initiation site, but it cannot stimulate transcription from distances of ≥ 600 nucleotides. In addition, they demonstrate, using mouse-human hybrid rRNA promoters, that the sequences responsible for human species-specific transcription in vivo appear to reside in both the core and upstream elements, and sequences from the mouse rRNA promoter cannot be substituted for them

  1. A ribosomal RNA gene intergenic spacer based PCR and DGGE fingerprinting method for the analysis of specific rhizobial communities in soil.

    Science.gov (United States)

    de Oliveira, Valéria Maia; Manfio, Gilson Paulo; da Costa Coutinho, Heitor Luiz; Keijzer-Wolters, Anneke Christina; van Elsas, Jan Dirk

    2006-03-01

    A direct molecular method for assessing the diversity of specific populations of rhizobia in soil, based on nested PCR amplification of 16S-23S ribosomal RNA gene (rDNA) intergenic spacer (IGS) sequences, was developed. Initial generic amplification of bacterial rDNA IGS sequences from soil DNA was followed by specific amplification of (1) sequences affiliated with Rhizobium leguminosarum "sensu lato" and (2) R. tropici. Using analysis of the amplified sequences in clone libraries obtained on the basis of soil DNA, this two-sided method was shown to be very specific for rhizobial subpopulations in soil. It was then further validated as a direct fingerprinting tool of the target rhizobia based on denaturing gradient gel electrophoresis (DGGE). The PCR-DGGE approach was applied to soils from fields in Brazil cultivated with common bean (Phaseolus vulgaris) under conventional or no-tillage practices. The community fingerprints obtained allowed the direct analysis of the respective rhizobial community structures in soil samples from the two contrasting agricultural practices. Data obtained with both primer sets revealed clustering of the community structures of the target rhizobial types along treatment. Moreover, the DGGE profiles obtained with the R. tropici primer set indicated that the abundance and diversity of these organisms were favoured under NT practices. These results suggest that the R. leguminosarum-as well as R. tropici-targeted IGS-based nested PCR and DGGE are useful tools for monitoring the effect of agricultural practices on these and related rhizobial subpopulations in soils.

  2. Molecular and phylogenetic characterizations of an Eimeria krijgsmanni Yakimoff & Gouseff, 1938 (Apicomplexa: Eimeriidae) mouse intestinal protozoan parasite by partial 18S ribosomal RNA gene sequence analysis.

    Science.gov (United States)

    Takeo, Toshinori; Tanaka, Tetsuya; Matsubayashi, Makoto; Maeda, Hiroki; Kusakisako, Kodai; Matsui, Toshihiro; Mochizuki, Masami; Matsuo, Tomohide

    2014-08-01

    Previously, we characterized an undocumented strain of Eimeria krijgsmanni by morphological and biological features. Here, we present a detailed molecular phylogenetic analysis of this organism. Namely, 18S ribosomal RNA gene (rDNA) sequences of E. krijgsmanni were analyzed to incorporate this species into a comprehensive Eimeria phylogeny. As a result, partial 18S rDNA sequence from E. krijgsmanni was successfully determined, and two different types, Type A and Type B, that differed by 1 base pair were identified. E. krijgsmanni was originally isolated from a single oocyst, and thus the result show that the two types might have allelic sequence heterogeneity in the 18S rDNA. Based on phylogenetic analyses, the two types of E. krijgsmanni 18S rDNA formed one of two clades among murine Eimeria spp.; these Eimeria clades reflected morphological similarity among the Eimeria spp. This is the third molecular phylogenetic characterization of a murine Eimeria spp. in addition to E. falciformis and E. papillata. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  3. Molecular characterization of tlyA gene product, Rv1694 of Mycobacterium tuberculosis: A non-conventional hemolysin and a ribosomal RNA methyl transferase

    Directory of Open Access Journals (Sweden)

    Ahmed Neesar

    2010-09-01

    was significantly slower than mock vector transformed E. coli. The S30 extract of E. coli expressing the Rv1694 had poor translational activity in presence of capreomycin, further confirming its methylation activity. Finally, incorporation of methyl group of [3H]-S-adenosylmethionine in isolated ribosomes also confirmed its methylation activity. Conclusions The Rv1694 has an unusual dual activity. It appears to contain two diverse functions such as haemolytic activity and ribosomal RNA methylation activity. It is possible that the haemolytic activity might be relevant to intra-cellular compartments such as phagosomes rather than cell lysis of erythrocytes and the self-assembly trait may have a potential role after successful entry into macrophages by Mycobacterium tuberculosis.

  4. Hyper-regulation of pyr-gene expression in Escherichia coli cells with slow ribosomes. Evidence for RNA polymerase pausing in vivo

    DEFF Research Database (Denmark)

    Jensen, Kaj Frank

    1988-01-01

    UTP-modulated attenuation of transcription is involved in regulating the synthesis of pyrimidine nucleotides in Escherichia coli. Thus, expression of two genes, pyrBI and pyrE, was shown to be under this type of control. The genes encode the two subunits of aspartate transcarbamylase and orotate...... transcription should terminate or continue into the structural genes. This paper described a study of pyrBI and pyrE gene regulation in cells where the ribosomes move slowly as a result of mutation in rpsL. It appears that expression of the two genes is hyper-regulated by the UTP pool in this type of cells...

  5. Histone and Ribosomal RNA Repetitive Gene Clusters of the Boll Weevil are Linked in a Tandem Array

    Science.gov (United States)

    Histones are the major protein component of chromatin structure. The histone family is made up of a quintet of proteins, four core histones (H2A, H2B, H3 & H4) and the linker histones (H1). Spacers are found between the coding regions. Among insects this quintet of genes is usually clustered and ...

  6. Proto-ribosome: a theoretical approach based on RNA relics

    OpenAIRE

    Demongeot, Jacques

    2017-01-01

    We describe in this paper, based on already published articles, a contribution to the theory postulating the existence of a proto-ribosome, which could have appeared early at the origin of life and we discuss the interest of this notion in an evolutionary perspective, taking into account the existence of possible RNA relics of this proto-ribosome.

  7. Bacteriological incidence in pneumonia patients with pulmonary emphysema: a bacterial floral analysis using the 16S ribosomal RNA gene in bronchoalveolar lavage fluid.

    Science.gov (United States)

    Naito, Keisuke; Yamasaki, Kei; Yatera, Kazuhiro; Akata, Kentaro; Noguchi, Shingo; Kawanami, Toshinori; Fukuda, Kazumasa; Kido, Takashi; Ishimoto, Hiroshi; Mukae, Hiroshi

    2017-01-01

    Pulmonary emphysema is an important radiological finding in chronic obstructive pulmonary disease patients, but bacteriological differences in pneumonia patients according to the severity of emphysematous changes have not been reported. Therefore, we evaluated the bacteriological incidence in the bronchoalveolar lavage fluid (BALF) of pneumonia patients using cultivation and a culture-independent molecular method. Japanese patients with community-acquired pneumonia (83) and healthcare-associated pneumonia (94) between April 2010 and February 2014 were evaluated. The BALF obtained from pneumonia lesions was evaluated by both cultivation and a molecular method. In the molecular method, ~600 base pairs of bacterial 16S ribosomal RNA genes in the BALF were amplified by polymerase chain reaction, and clone libraries were constructed. The nucleotide sequences of 96 randomly selected colonies were determined, and a homology search was performed to identify the bacterial species. A qualitative radiological evaluation of pulmonary emphysema based on chest computed tomography (CT) images was performed using the Goddard classification. The severity of pulmonary emphysema based on the Goddard classification was none in 47.4% (84/177), mild in 36.2% (64/177), moderate in 10.2% (18/177), and severe in 6.2% (11/177). Using the culture-independent molecular method, Moraxella catarrhalis was significantly more frequently detected in moderate or severe emphysema patients than in patients with no or mild emphysematous changes. The detection rates of Haemophilus influenzae and Pseudomonas aeruginosa were unrelated to the severity of pulmonary emphysematous changes, and Streptococcus species - except for the S. anginosus group and S. pneumoniae - were detected more frequently using the molecular method we used for the BALF of patients with pneumonia than using culture methods. Our findings suggest that M. catarrhalis is more frequently detected in pneumonia patients with moderate or

  8. Cross-linking of streptomycin to the 16S ribosomal RNA of Escherichia coli

    International Nuclear Information System (INIS)

    Gravel, M.; Melancon, P.; Barkier-Gingras, L.

    1987-01-01

    [ 3 H]Dihydrostreptomycin was cross-linked to the 30S ribosomal subunit from Escherichia coli with the bifunctional reagent nitrogen mustard. The cross-linking primarily involved the 16S RNA. To localize the site of cross-linking of streptomycin to the 16S RNA, the authors hybridized RNA labeled with streptomycin to restriction fragments of the 16S RNA gene. Labeled RNA hybridized to DNA fragments corresponding to bases 892-917 and bases 1394-1415. These two segments of the ribosomal RNA must by juxtaposed in the ribosome, since there is a single binding site for streptomycin. This region has been implicated both in the decoding site and in the binding of initiation factor IF-3, indicating its functional importance

  9. Effect of primary and secondary radicals on chain breaks in ribosomal RNA in E. coli ribosomes

    International Nuclear Information System (INIS)

    Singh, H.; Bishop, J.

    1984-01-01

    It has been shown previously that, in dilute aerated solutions, ribosomes are inactivated by OH radicals and by secondary radicals produced from added alcohols (Singh and Vadasz 1983 a). In de-aerated solutions, both radicalH and e - sub(aq) also inactivate ribosomes (Singh and Vadasz 1983 b). The results of these studies and other on different systems (Adams et al. 1973, Aldrich and Cundall 1969, Dewey and Stein 1970, Masuda et al. 1971, Nabben et al. 1982, 1983, Samuni et al. 1980, Singh and Singh 1982) have shown that damage to biological systems occurs by diverse mechanisms. One of these mechanisms involves chain breaks in RNA (Pollard and Weller 1967). The purpose of this study was to determine which of the primary and secondary radicals cause chain breaks in ribosomal RNA (rRNA) within the ribosomes. (author)

  10. Inhibition of ribosomal RNA synthesis in yeast by ionizing radiations

    Energy Technology Data Exchange (ETDEWEB)

    Weber, K; Kiefer, J [Giessen Univ. (Germany, F.R.). Strahlenzentrum

    1984-12-01

    Synthesis of ribosomal RNA(r-RNA) was measured for 1 h after exposure of Saccharomyces cerevisiae to ..gamma..-rays, X-rays or ..cap alpha.. particles. ..gamma..- or X-ray induced transcription inhibition was always found to decrease exponentially with dose. D/sub 0/ values of 2150 or 1950 Gy were determined in wild-type cells, corresponding to a mean energy of about 60 eV per r-RNA gene. The finding of differential sensitivities of the two high molecular-weight r-RNA species which are cotranscribed from r-DNA is compatible with the existence of a transcription terminating mechanism. Cells from a mutant strain (rad-9), radiation sensitive to colony forming ability, showed an approximately equal sensitivity for transcription inhibition compared to the wild-type (D/sub 0/ (2095) = 2400 Gy). Inactivation of r-RNA synthesis in cells exposed to ..cap alpha..-particles at room-temperature showed a decreased sensitivity with higher particle fluences ('resistant tail'). This phenomenon was drastically reduced if the temperature during irradiation was lowered to 4/sup 0/C and completely abolished when dried cells were used. An inactivation cross-section for ..cap alpha..-particle induced transcription inhibition of about 0.02 ..mu..m/sup 2/ can be derived from the experimental data.

  11. The Response of a 16S Ribosomal RNA Gene Fragment Amplified Community to Lead, Zinc, and Copper Pollution in a Shanghai Field Trial

    Directory of Open Access Journals (Sweden)

    Shumeng Kou

    2018-03-01

    Full Text Available Industrial and agricultural activities have caused extensive metal contamination of land throughout China and across the globe. The pervasive nature of metal pollution can be harmful to human health and can potentially cause substantial negative impact to the biosphere. To investigate the impact of anthropogenic metal pollution found in high concentrations in industrial, agricultural, and urban environments, 16S ribosomal RNA gene amplicon sequencing was used to track change in the amplified microbial community after metal contamination in a large-scale field experiment in Shanghai. A total of 1,566 operational taxonomic units (OTUs identified from 448,108 sequences gathered from 20 plots treated as controls or with lead, zinc, copper, or all three metals. Constrained Analysis of Principal Coordinates ordination did not separate control and lead treatment but could separate control/lead, zinc, copper, and three metal treatment. DESeq2 was applied to identify 93 significantly differentially abundant OTUs varying in 211 pairwise instances between the treatments. Differentially abundant OTUs representing genera or species belonging to the phyla Chloroflexi, Cyanobacteria, Firmicutes, Latescibacteria, and Planctomycetes were almost universally reduced in abundance due to zinc, copper, or three metal treatment; with three metal treatment abolishing the detection of some OTUs, such as Leptolyngbya, Desmonostoc muscorum, and Microcoleus steenstrupii. The greatest increases due to metal treatment were observed in Bacteroidetes, Actinobacteria, Chlamydiae, Nitrospirae, and Proteobacteria (α, β, δ, and γ; the most (relative abundant being uncharacterized species within the genera Methylobacillus, Solirubrobacter, and Ohtaekwangia. Three metal treatment alone resulted in identification of 22 OTUs (genera or species which were not detected in control soil, notably including Yonghaparkia alkaliphila, Pedobacter steynii, Pseudolabrys taiwanensis

  12. Bacteriological incidence in pneumonia patients with pulmonary emphysema: a bacterial floral analysis using the 16S ribosomal RNA gene in bronchoalveolar lavage fluid

    Directory of Open Access Journals (Sweden)

    Naito K

    2017-07-01

    Full Text Available Keisuke Naito,1 Kei Yamasaki,1 Kazuhiro Yatera,1 Kentaro Akata,1 Shingo Noguchi,1 Toshinori Kawanami,1 Kazumasa Fukuda,2 Takashi Kido,1 Hiroshi Ishimoto,3 Hiroshi Mukae3 1Department of Respiratory Medicine, 2Department of Microbiology, University of Occupational and Environmental Health, Japan, Kitakyushu City, Fukuoka, 3Second Department of Internal Medicine, Nagasaki University School of Medicine, Nagasaki City, Nagasaki, Japan Abstract: Pulmonary emphysema is an important radiological finding in chronic obstructive pulmonary disease patients, but bacteriological differences in pneumonia patients according to the severity of emphysematous changes have not been reported. Therefore, we evaluated the bacteriological incidence in the bronchoalveolar lavage fluid (BALF of pneumonia patients using cultivation and a culture-independent molecular method. Japanese patients with community-acquired pneumonia (83 and healthcare-associated pneumonia (94 between April 2010 and February 2014 were evaluated. The BALF obtained from pneumonia lesions was evaluated by both cultivation and a molecular method. In the molecular method, ~600 base pairs of bacterial 16S ribosomal RNA genes in the BALF were amplified by polymerase chain reaction, and clone libraries were constructed. The nucleotide sequences of 96 randomly selected colonies were determined, and a homology search was performed to identify the bacterial species. A qualitative radiological evaluation of pulmonary emphysema based on chest computed tomography (CT images was performed using the Goddard classification. The severity of pulmonary emphysema based on the Goddard classification was none in 47.4% (84/177, mild in 36.2% (64/177, moderate in 10.2% (18/177, and severe in 6.2% (11/177. Using the culture-independent molecular method, Moraxella catarrhalis was significantly more frequently detected in moderate or severe emphysema patients than in patients with no or mild emphysematous changes. The

  13. The Response of a 16S Ribosomal RNA Gene Fragment Amplified Community to Lead, Zinc, and Copper Pollution in a Shanghai Field Trial.

    Science.gov (United States)

    Kou, Shumeng; Vincent, Gilles; Gonzalez, Emmanuel; Pitre, Frederic E; Labrecque, Michel; Brereton, Nicholas J B

    2018-01-01

    Industrial and agricultural activities have caused extensive metal contamination of land throughout China and across the globe. The pervasive nature of metal pollution can be harmful to human health and can potentially cause substantial negative impact to the biosphere. To investigate the impact of anthropogenic metal pollution found in high concentrations in industrial, agricultural, and urban environments, 16S ribosomal RNA gene amplicon sequencing was used to track change in the amplified microbial community after metal contamination in a large-scale field experiment in Shanghai. A total of 1,566 operational taxonomic units (OTUs) identified from 448,108 sequences gathered from 20 plots treated as controls or with lead, zinc, copper, or all three metals. Constrained Analysis of Principal Coordinates ordination did not separate control and lead treatment but could separate control/lead, zinc, copper, and three metal treatment. DESeq2 was applied to identify 93 significantly differentially abundant OTUs varying in 211 pairwise instances between the treatments. Differentially abundant OTUs representing genera or species belonging to the phyla Chloroflexi, Cyanobacteria, Firmicutes, Latescibacteria, and Planctomycetes were almost universally reduced in abundance due to zinc, copper, or three metal treatment; with three metal treatment abolishing the detection of some OTUs, such as Leptolyngbya , Desmonostoc muscorum , and Microcoleus steenstrupii . The greatest increases due to metal treatment were observed in Bacteroidetes, Actinobacteria, Chlamydiae, Nitrospirae, and Proteobacteria (α, β, δ, and γ); the most (relative) abundant being uncharacterized species within the genera Methylobacillus , Solirubrobacter , and Ohtaekwangia . Three metal treatment alone resulted in identification of 22 OTUs (genera or species) which were not detected in control soil, notably including Yonghaparkia alkaliphila , Pedobacter steynii , Pseudolabrys taiwanensis , Methylophilus

  14. Ribosomal RNA: a key to phylogeny

    Science.gov (United States)

    Olsen, G. J.; Woese, C. R.

    1993-01-01

    As molecular phylogeny increasingly shapes our understanding of organismal relationships, no molecule has been applied to more questions than have ribosomal RNAs. We review this role of the rRNAs and some of the insights that have been gained from them. We also offer some of the practical considerations in extracting the phylogenetic information from the sequences. Finally, we stress the importance of comparing results from multiple molecules, both as a method for testing the overall reliability of the organismal phylogeny and as a method for more broadly exploring the history of the genome.

  15. Biological significance of 5S rRNA import into human mitochondria: role of ribosomal protein MRP-L18

    Science.gov (United States)

    Smirnov, Alexandre; Entelis, Nina; Martin, Robert P.; Tarassov, Ivan

    2011-01-01

    5S rRNA is an essential component of ribosomes of all living organisms, the only known exceptions being mitochondrial ribosomes of fungi, animals, and some protists. An intriguing situation distinguishes mammalian cells: Although the mitochondrial genome contains no 5S rRNA genes, abundant import of the nuclear DNA-encoded 5S rRNA into mitochondria was reported. Neither the detailed mechanism of this pathway nor its rationale was clarified to date. In this study, we describe an elegant molecular conveyor composed of a previously identified human 5S rRNA import factor, rhodanese, and mitochondrial ribosomal protein L18, thanks to which 5S rRNA molecules can be specifically withdrawn from the cytosolic pool and redirected to mitochondria, bypassing the classic nucleolar reimport pathway. Inside mitochondria, the cytosolic 5S rRNA is shown to be associated with mitochondrial ribosomes. PMID:21685364

  16. Interaction of tRNA with Eukaryotic Ribosome

    Directory of Open Access Journals (Sweden)

    Dmitri Graifer

    2015-03-01

    Full Text Available This paper is a review of currently available data concerning interactions of tRNAs with the eukaryotic ribosome at various stages of translation. These data include the results obtained by means of cryo-electron microscopy and X-ray crystallography applied to various model ribosomal complexes, site-directed cross-linking with the use of tRNA derivatives bearing chemically or photochemically reactive groups in the CCA-terminal fragment and chemical probing of 28S rRNA in the region of the peptidyl transferase center. Similarities and differences in the interactions of tRNAs with prokaryotic and eukaryotic ribosomes are discussed with concomitant consideration of the extent of resemblance between molecular mechanisms of translation in eukaryotes and bacteria.

  17. Myb-binding protein 1a (Mybbp1a) regulates levels and processing of pre-ribosomal RNA.

    Science.gov (United States)

    Hochstatter, Julia; Hölzel, Michael; Rohrmoser, Michaela; Schermelleh, Lothar; Leonhardt, Heinrich; Keough, Rebecca; Gonda, Thomas J; Imhof, Axel; Eick, Dirk; Längst, Gernot; Németh, Attila

    2012-07-13

    Ribosomal RNA gene transcription, co-transcriptional processing, and ribosome biogenesis are highly coordinated processes that are tightly regulated during cell growth. In this study we discovered that Mybbp1a is associated with both the RNA polymerase I complex and the ribosome biogenesis machinery. Using a reporter assay that uncouples transcription and RNA processing, we show that Mybbp1a represses rRNA gene transcription. In addition, overexpression of the protein reduces RNA polymerase I loading on endogenous rRNA genes as revealed by chromatin immunoprecipitation experiments. Accordingly, depletion of Mybbp1a results in an accumulation of the rRNA precursor in vivo but surprisingly also causes growth arrest of the cells. This effect can be explained by the observation that the modulation of Mybbp1a protein levels results in defects in pre-rRNA processing within the cell. Therefore, the protein may play a dual role in the rRNA metabolism, potentially linking and coordinating ribosomal DNA transcription and pre-rRNA processing to allow for the efficient synthesis of ribosomes.

  18. rRNA:mRNA pairing alters the length and the symmetry of mRNA-protected fragments in ribosome profiling experiments

    OpenAIRE

    O?Connor, Patrick B. F.; Li, Gene-Wei; Weissman, Jonathan S.; Atkins, John F.; Baranov, Pavel V.

    2013-01-01

    Motivation: Ribosome profiling is a new technique that allows monitoring locations of translating ribosomes on mRNA at a whole transcriptome level. A recent ribosome profiling study demonstrated that internal Shine?Dalgarno (SD) sequences have a major global effect on translation rates in bacteria: ribosomes pause at SD sites in mRNA. Therefore, it is important to understand how SD sites effect mRNA movement through the ribosome and generation of ribosome footprints. Results: Here, we provide...

  19. Molecular characterizations of somatic hybrids developed between Pleurotus florida and Lentinus squarrosulus through inter-simple sequence repeat markers and sequencing of ribosomal RNA-ITS gene.

    Science.gov (United States)

    Mallick, Pijush; Chattaraj, Shruti; Sikdar, Samir Ranjan

    2017-10-01

    The 12 pfls somatic hybrids and 2 parents of Pleurotus florida and Lentinus s quarrosulus were characterized by ISSR and sequencing of rRNA-ITS genes. Five ISSR primers were used and amplified a total of 54 reproducible fragments with 98.14% polymorphism among all the pfls hybrid populations and parental strains. UPGMA-based cluster exhibited a dendrogram with three major groups between the parents and pfls hybrids. Parent P . florida and L . squarrosulus showed different degrees of genetic distance with all the hybrid lines and they showed closeness to hybrid pfls 1m and pfls 1h , respectively. ITS1(F) and ITS4(R) amplified the rRNA-ITS gene with 611-867 bp sequence length. The nucleotide polymorphisms were found in the ITS1, ITS2 and 5.8S rRNA region with different number of bases. Based on rRNA-ITS sequence, UPGMA cluster exhibited three distinct groups between L. squarrosulus and pfls 1p , pfls 1m and pfls 1s , and pfls 1e and P. florida .

  20. The use of 125iodine-labeled RNA for detection of the RNA binding to ribosomes

    International Nuclear Information System (INIS)

    Mori, Tomohiko; Fukuda, Mitsuru

    1975-01-01

    The in vitro labeling of RNA with radioactive iodine is the efficient method to obtain the RNA with high specific activity. The present paper reports on the application of this technique to the production of iodine-labeled RNA for use in the experiment of binding RNA to ribosomes. Tobacco mosaic virus (TMV) RNA was used as natural mRNA, and E. coli S-30 preparation was used as a source of ribosomes. The TMV-RNA was prepared by bentonite-phenol extraction from TMV, and the method used for the iodation of RNA was based on the procedure described by Getz et al. The iodine-labeled RNA was incubated in a cell-free protein synthesizing system (S-30) prepared from E. coli K-12. After the incubation, the reaction mixture was layered onto sucrose gradient, centrifuged, and fractionated into 18 fractions. Optical density at 260 nm was measured, and radioactivity was counted, for each fraction. The binding of mRNA to ribosomes occurred even at 0 deg C, and the occurrence of the nonspecific binding was also shown. Consequently, the specific binding, i.e. the formation of the initiation complex being involved in amino acid incorporation, may be estimated by subtracting the radioactivity associated with monosomes in the presence of both rRNA and ATA from that in the presence of rRNA only. It was shown that the iodine-labeled RNA can be used for the studies of binding RNA to ribosomes. (Kako, I.)

  1. Conservative fragments in bacterial 16S rRNA genes and primer design for 16S ribosomal DNA amplicons in metagenomic studies

    KAUST Repository

    Wang, Yong; Qian, Pei-Yuan

    2009-01-01

    Bacterial 16S ribosomal DNA (rDNA) amplicons have been widely used in the classification of uncultured bacteria inhabiting environmental niches. Primers targeting conservative regions of the rDNAs are used to generate amplicons of variant regions

  2. The Circadian Clock Modulates Global Daily Cycles of mRNA Ribosome Loading[OPEN

    Science.gov (United States)

    Missra, Anamika; Ernest, Ben; Jia, Qidong; Ke, Kenneth

    2015-01-01

    Circadian control of gene expression is well characterized at the transcriptional level, but little is known about diel or circadian control of translation. Genome-wide translation state profiling of mRNAs in Arabidopsis thaliana seedlings grown in long day was performed to estimate ribosome loading per mRNA. The experiments revealed extensive translational regulation of key biological processes. Notably, translation of mRNAs for ribosomal proteins and mitochondrial respiration peaked at night. Central clock mRNAs are among those subject to fluctuations in ribosome loading. There was no consistent phase relationship between peak translation states and peak transcript levels. The overlay of distinct transcriptional and translational cycles can be expected to alter the waveform of the protein synthesis rate. Plants that constitutively overexpress the clock gene CCA1 showed phase shifts in peak translation, with a 6-h delay from midnight to dawn or from noon to evening being particularly common. Moreover, cycles of ribosome loading that were detected under continuous light in the wild type collapsed in the CCA1 overexpressor. Finally, at the transcript level, the CCA1-ox strain adopted a global pattern of transcript abundance that was broadly correlated with the light-dark environment. Altogether, these data demonstrate that gene-specific diel cycles of ribosome loading are controlled in part by the circadian clock. PMID:26392078

  3. Fluctuations in protein synthesis from a single RNA template: stochastic kinetics of ribosomes.

    Science.gov (United States)

    Garai, Ashok; Chowdhury, Debashish; Ramakrishnan, T V

    2009-01-01

    Proteins are polymerized by cyclic machines called ribosomes, which use their messenger RNA (mRNA) track also as the corresponding template, and the process is called translation. We explore, in depth and detail, the stochastic nature of the translation. We compute various distributions associated with the translation process; one of them--namely, the dwell time distribution--has been measured in recent single-ribosome experiments. The form of the distribution, which fits best with our simulation data, is consistent with that extracted from the experimental data. For our computations, we use a model that captures both the mechanochemistry of each individual ribosome and their steric interactions. We also demonstrate the effects of the sequence inhomogeneities of real genes on the fluctuations and noise in translation. Finally, inspired by recent advances in the experimental techniques of manipulating single ribosomes, we make theoretical predictions on the force-velocity relation for individual ribosomes. In principle, all our predictions can be tested by carrying out in vitro experiments.

  4. Antimicrobial susceptibility and Ribosomal-RNA gene restriction patterns among Staphylococcus-intermedius from healthy dogs and from dogs sufferning from pyoderma or otitis-externa

    DEFF Research Database (Denmark)

    Pedersen, Karl; Wegener, Henrik Caspar

    1995-01-01

    A total of 60 Staphlococcus intermedius strains from dogs were investigated by their sensitivity to various antibiotics (50 strains) and by their rRNA gene restriction patterns (ribotyping) (60 strains). Fifteen isolates were from healthy dogs, 9 with otitis externa, and 36 with pyoderma, including......, enrofloxacin, and sulphonamides with trimethoprim. There were no significant differences in antimicrobial susceptibility patterns observed among isolates from pyoderma, otitis externa or healthy dogs. Among the 60 strains studied by ribotyping, 10 different ribotypes were identified: 6 different ribotypes...... among isolates from otitis externa, 8 among isolates from pyoderma, and 5 among isolates from healthy dogs. One ribotype (profile C) was dominant among the isolates from healthy dogs while another ribotype (profile A) was dominant among strains from dogs suffering from pyoderma. This profile...

  5. Comparison of sequencing the D2 region of the large subunit ribosomal RNA gene (MicroSEQ®) versus the internal transcribed spacer (ITS) regions using two public databases for identification of common and uncommon clinically relevant fungal species.

    Science.gov (United States)

    Arbefeville, S; Harris, A; Ferrieri, P

    2017-09-01

    Fungal infections cause considerable morbidity and mortality in immunocompromised patients. Rapid and accurate identification of fungi is essential to guide accurately targeted antifungal therapy. With the advent of molecular methods, clinical laboratories can use new technologies to supplement traditional phenotypic identification of fungi. The aims of the study were to evaluate the sole commercially available MicroSEQ® D2 LSU rDNA Fungal Identification Kit compared to the in-house developed internal transcribed spacer (ITS) regions assay in identifying moulds, using two well-known online public databases to analyze sequenced data. 85 common and uncommon clinically relevant fungi isolated from clinical specimens were sequenced for the D2 region of the large subunit (LSU) of ribosomal RNA (rRNA) gene with the MicroSEQ® Kit and the ITS regions with the in house developed assay. The generated sequenced data were analyzed with the online GenBank and MycoBank public databases. The D2 region of the LSU rRNA gene identified 89.4% or 92.9% of the 85 isolates to the genus level and the full ITS region (f-ITS) 96.5% or 100%, using GenBank or MycoBank, respectively, when compared to the consensus ID. When comparing species-level designations to the consensus ID, D2 region of the LSU rRNA gene aligned with 44.7% (38/85) or 52.9% (45/85) of these isolates in GenBank or MycoBank, respectively. By comparison, f-ITS possessed greater specificity, followed by ITS1, then ITS2 regions using GenBank or MycoBank. Using GenBank or MycoBank, D2 region of the LSU rRNA gene outperformed phenotypic based ID at the genus level. Comparing rates of ID between D2 region of the LSU rRNA gene and the ITS regions in GenBank or MycoBank at the species level against the consensus ID, f-ITS and ITS2 exceeded performance of the D2 region of the LSU rRNA gene, but ITS1 had similar performance to the D2 region of the LSU rRNA gene using MycoBank. Our results indicated that the MicroSEQ® D2 LSU r

  6. 18S Ribosomal RNA Evaluation as Preanalytical Quality Control for Animal DNA

    Directory of Open Access Journals (Sweden)

    Cory Ann Leonard

    2016-01-01

    Full Text Available The 18S ribosomal RNA (rRNA gene is present in all eukaryotic cells. In this study, we evaluated the use of this gene to verify the presence of PCR-amplifiable host (animal DNA as an indicator of sufficient sample quality for quantitative real-time PCR (qPCR analysis. We compared (i samples from various animal species, tissues, and sample types, including swabs; (ii multiple DNA extraction methods; and (iii both fresh and formalin-fixed paraffin-embedded (FFPE samples. Results showed that 18S ribosomal RNA gene amplification was possible from all tissue samples evaluated, including avian, reptile, and FFPE samples and most swab samples. A single swine rectal swab, which showed sufficient DNA quantity and the demonstrated lack of PCR inhibitors, nonetheless was negative by 18S qPCR. Such a sample specifically illustrates the improvement of determination of sample integrity afforded by inclusion of 18S rRNA gene qPCR analysis in addition to spectrophotometric analysis and the use of internal controls for PCR inhibition. Other possible applications for the described 18S rRNA qPCR are preselection of optimal tissue specimens for studies or preliminary screening of archived samples prior to acceptance for biobanking projects.

  7. Highly divergent 16S rRNA sequences in ribosomal operons of Scytonema hyalinum (Cyanobacteria.

    Directory of Open Access Journals (Sweden)

    Jeffrey R Johansen

    Full Text Available A highly divergent 16S rRNA gene was found in one of the five ribosomal operons present in a species complex currently circumscribed as Scytonema hyalinum (Nostocales, Cyanobacteria using clone libraries. If 16S rRNA sequence macroheterogeneity among ribosomal operons due to insertions, deletions or truncation is excluded, the sequence heterogeneity observed in S. hyalinum was the highest observed in any prokaryotic species thus far (7.3-9.0%. The secondary structure of the 16S rRNA molecules encoded by the two divergent operons was nearly identical, indicating possible functionality. The 23S rRNA gene was examined for a few strains in this complex, and it was also found to be highly divergent from the gene in Type 2 operons (8.7%, and likewise had nearly identical secondary structure between the Type 1 and Type 2 operons. Furthermore, the 16S-23S ITS showed marked differences consistent between operons among numerous strains. Both operons have promoter sequences that satisfy consensus requirements for functional prokaryotic transcription initiation. Horizontal gene transfer from another unknown heterocytous cyanobacterium is considered the most likely explanation for the origin of this molecule, but does not explain the ultimate origin of this sequence, which is very divergent from all 16S rRNA sequences found thus far in cyanobacteria. The divergent sequence is highly conserved among numerous strains of S. hyalinum, suggesting adaptive advantage and selective constraint of the divergent sequence.

  8. mRNA decapping enzyme from ribosomes of Saccharomyces cerevisiae

    International Nuclear Information System (INIS)

    Stevens, A.

    1980-01-01

    By use of [ 3 H]methyl-5'-capped [ 14 C]mRNA from yeast as a substrate, a decapping enzyme activity has been detected in enzyme fractions derived from a high salt wash of ribosomes of Saccharomyces cerevisiae. The product of the decapping reaction is [ 3 H]m 7 GDP. That the enzyme is not a non-specific pyrophosphatase is suggested by the finding that the diphosphate product, m 7 GpppA(G), and UDP-glucose are not hydrolyzed

  9. Translational regulation of ribosomal protein S15 drives characteristic patterns of protein-mRNA epistasis.

    Science.gov (United States)

    Mallik, Saurav; Basu, Sudipto; Hait, Suman; Kundu, Sudip

    2018-04-21

    Do coding and regulatory segments of a gene co-evolve with each-other? Seeking answers to this question, here we analyze the case of Escherichia coli ribosomal protein S15, that represses its own translation by specifically binding its messenger RNA (rpsO mRNA) and stabilizing a pseudoknot structure at the upstream untranslated region, thus trapping the ribosome into an incomplete translation initiation complex. In the absence of S15, ribosomal protein S1 recognizes rpsO and promotes translation by melting this very pseudoknot. We employ a robust statistical method to detect signatures of positive epistasis between residue site pairs and find that biophysical constraints of translational regulation (S15-rpsO and S1-rpsO recognition, S15-mediated rpsO structural rearrangement, and S1-mediated melting) are strong predictors of positive epistasis. Transforming the epistatic pairs into a network, we find that signatures of two different, but interconnected regulatory cascades are imprinted in the sequence-space and can be captured in terms of two dense network modules that are sparsely connected to each other. This network topology further reflects a general principle of how functionally coupled components of biological networks are interconnected. These results depict a model case, where translational regulation drives characteristic residue-level epistasis-not only between a protein and its own mRNA but also between a protein and the mRNA of an entirely different protein. © 2018 Wiley Periodicals, Inc.

  10. Mutations in ribosomal protein L3 and 23S ribosomal RNA at the peptidyl transferase centre are associated with reduced susceptibility to tiamulin in Brachyspira spp. isolates.

    Science.gov (United States)

    Pringle, Märit; Poehlsgaard, Jacob; Vester, Birte; Long, Katherine S

    2004-12-01

    The pleuromutilin antibiotic tiamulin binds to the ribosomal peptidyl transferase centre. Three groups of Brachyspira spp. isolates with reduced tiamulin susceptibility were analysed to define resistance mechanisms to the drug. Mutations were identified in genes encoding ribosomal protein L3 and 23S rRNA at positions proximal to the peptidyl transferase centre. In two groups of laboratory-selected mutants, mutations were found at nucleotide positions 2032, 2055, 2447, 2499, 2504 and 2572 of 23S rRNA (Escherichia coli numbering) and at amino acid positions 148 and 149 of ribosomal protein L3 (Brachyspira pilosicoli numbering). In a third group of clinical B. hyodysenteriae isolates, only a single mutation at amino acid 148 of ribosomal protein L3 was detected. Chemical footprinting experiments show a reduced binding of tiamulin to ribosomal subunits from mutants with decreased susceptibility to the drug. This reduction in drug binding is likely the resistance mechanism for these strains. Hence, the identified mutations located near the tiamulin binding site are predicted to be responsible for the resistance phenotype. The positions of the mutated residues relative to the bound drug advocate a model where the mutations affect tiamulin binding indirectly through perturbation of nucleotide U2504.

  11. Mapping of the 18S and 5S ribosomal RNA genes in Astyanax altiparanae Garutti & Britski, 2000 (Teleostei, Characidae from the upper Paraná river basin, Brazil

    Directory of Open Access Journals (Sweden)

    Carlos Alexandre Fernandes

    2006-01-01

    Full Text Available Fluorescence in situ hybridization (FISH was undertaken in order to determinate the chromosomal distribution pattern of 18S and 5S ribosomal DNAs (rDNA in four populations of the characid fish Astyanax altiparanae from the upper Paraná river basin, Brazil. The 18S rDNA probe FISH revealed numerical and positional variations among specimens from the Keçaba stream compared to specimens of the other populations studied. In contrast to the variable 18S rDNA distribution pattern, highly stable chromosomal positioning of the 5S rDNA sites was observed in the four A. altiparanae populations. Divergence in the distribution pattern of 18S and 5S rDNA sites is also discussed.

  12. Characterization of Biomphalaria orbignyi, Biomphalaria peregrina and Biomphalaria oligoza by polymerase chain reaction and restriction enzyme digestion of the internal transcribed spacer region of the RNA ribosomal gene

    Directory of Open Access Journals (Sweden)

    Spatz Linus

    2000-01-01

    Full Text Available The correct identification of Biomphalaria oligoza, B. orbignyi and B. peregrina species is difficult due to the morphological similarities among them. B. peregrina is widely distributed in South America and is considered a potential intermediate host of Schistosoma mansoni. We have reported the use of the polymerase chain reaction and restriction fragment length polymorphism analysis of the internal transcribed spacer region of the ribosomal DNA for the molecular identification of these snails. The snails were obtained from different localities of Argentina, Brazil and Uruguay. The restriction patterns obtained with MvaI enzyme presented the best profile to identify the three species. The profiles obtained with all enzymes were used to estimate genetic similarities among B. oligoza, B. peregrina and B. orbignyi. This is also the first report of B. orbignyi in Uruguay.

  13. Spontaneous reverse movement of mRNA-bound tRNA through the ribosome.

    Science.gov (United States)

    Konevega, Andrey L; Fischer, Niels; Semenkov, Yuri P; Stark, Holger; Wintermeyer, Wolfgang; Rodnina, Marina V

    2007-04-01

    During the translocation step of protein synthesis, a complex of two transfer RNAs bound to messenger RNA (tRNA-mRNA) moves through the ribosome. The reaction is promoted by an elongation factor, called EF-G in bacteria, which, powered by GTP hydrolysis, induces an open, unlocked conformation of the ribosome that allows for spontaneous tRNA-mRNA movement. Here we show that, in the absence of EF-G, there is spontaneous backward movement, or retrotranslocation, of two tRNAs bound to mRNA. Retrotranslocation is driven by the gain in affinity when a cognate E-site tRNA moves into the P site, which compensates the affinity loss accompanying the movement of peptidyl-tRNA from the P to the A site. These results lend support to the diffusion model of tRNA movement during translocation. In the cell, tRNA movement is biased in the forward direction by EF-G, which acts as a Brownian ratchet and prevents backward movement.

  14. Detection of Cryptosporidium species in feces or gastric contents from snakes and lizards as determined by polymerase chain reaction analysis and partial sequencing of the 18S ribosomal RNA gene.

    Science.gov (United States)

    Richter, Barbara; Nedorost, Nora; Maderner, Anton; Weissenböck, Herbert

    2011-05-01

    Cryptosporidiosis is a well-known gastrointestinal disease of snakes and lizards. In the current study, 672 samples (feces and/or gastric contents or regurgitated food items) of various snakes and lizards were examined for the presence of cryptosporidia by polymerase chain reaction (PCR) assay targeting a part of the 18S ribosomal RNA gene. A consecutive sequencing reaction was used to identify the cryptosporidian species present in PCR-positive samples. Cryptosporidium varanii (saurophilum) was detected in 17 out of 106 (16%) samples from corn snakes (Pantherophis guttatus) and in 32 out of 462 (7%) samples from leopard geckos (Eublepharis macularius). Cryptosporidium serpentis was found in 8 out of 462 (2%) leopard gecko samples, but in no other reptile. The Cryptosporidium sp. "lizard genotype" was present in 1 leopard gecko sample, and 1 sample from a corn snake showed a single nucleotide mismatch to this genotype. Pseudoparasitic cryptosporidian species were identified in 5 out of 174 (3%) ophidian samples, but not in lizards. Other sequences did not show complete similarity to previously published Cryptosporidium sequences. The results stress the importance for diagnostic methods to be specific for Cryptosporidium species especially in snakes and show a relatively high prevalence of C. varanii in leopard geckos and corn snakes. © 2011 The Author(s)

  15. The first report: An analysis of bacterial flora of the first voided urine specimens of patients with male urethritis using the 16S ribosomal RNA gene-based clone library method.

    Science.gov (United States)

    You, Chunlin; Hamasuna, Ryoichi; Ogawa, Midori; Fukuda, Kazumasa; Hachisuga, Toru; Matsumoto, Tetsuro; Taniguchi, Hatsumi

    2016-06-01

    To analyse the bacterial flora of urine from patients with male urethritis using the clone library method. Urine specimens from patients with urethritis were used. The bacterial flora was analysed according to the 16S ribosomal RNA gene-based clone library method. In addition, Neisseria gonorrhoeae, Chlamydia trachomatis, Mycoplasma genitalium, Mycoplasma hominis, Ureaplasma urealyticum or Ureaplasma parvum were detected by the conventional PCR methods (TMA or real-time PCR) and data from the clone library and conventional PCR methods were compared. Among 58 urine specimens, 38 were successfully analysed using the clone library method. From the specimens, 2427 clones were evaluated and 95 bacterial phylotypes were detected. N. gonorrhoeae was detected from 6 specimens and as the predominant bacterial species in 5 specimens. M. genitalium was detected from 5 specimens and as the predominant bacterial species in 3 specimens. C. trachomatis was detected from 15 specimens using the TMA method, but was detected from only 1 specimen using the clone library method. U. parvum was detected from only 2 specimens using the clone library method. In addition, Haemophilus influenzae and Neisseria meningitidis were also detected in 8 and 1 specimens, respectively. Gardnerella vaginalis, which is a potential pathogen for bacterial vaginitis in women, was detected in 10 specimens. The clone library method can detect the occupancy rate of each bacteria species among the bacterial flora and may be a new method for bacterial analyses in male urethritis. Copyright © 2016 Elsevier Ltd. All rights reserved.

  16. Conservative fragments in bacterial 16S rRNA genes and primer design for 16S ribosomal DNA amplicons in metagenomic studies

    KAUST Repository

    Wang, Yong

    2009-10-09

    Bacterial 16S ribosomal DNA (rDNA) amplicons have been widely used in the classification of uncultured bacteria inhabiting environmental niches. Primers targeting conservative regions of the rDNAs are used to generate amplicons of variant regions that are informative in taxonomic assignment. One problem is that the percentage coverage and application scope of the primers used in previous studies are largely unknown. In this study, conservative fragments of available rDNA sequences were first mined and then used to search for candidate primers within the fragments by measuring the coverage rate defined as the percentage of bacterial sequences containing the target. Thirty predicted primers with a high coverage rate (>90%) were identified, which were basically located in the same conservative regions as known primers in previous reports, whereas 30% of the known primers were associated with a coverage rate of <90%. The application scope of the primers was also examined by calculating the percentages of failed detections in bacterial phyla. Primers A519-539, E969- 983, E1063-1081, U515 and E517, are highly recommended because of their high coverage in almost all phyla. As expected, the three predominant phyla, Firmicutes, Gemmatimonadetes and Proteobacteria, are best covered by the predicted primers. The primers recommended in this report shall facilitate a comprehensive and reliable survey of bacterial diversity in metagenomic studies. © 2009 Wang, Qian.

  17. Phylogenetic evidence for the acquisition of ribosomal RNA introns subsequent to the divergence of some of the major Tetrahymena groups

    DEFF Research Database (Denmark)

    Sogin, M L; Ingold, A; Karlok, M

    1986-01-01

    . In an attempt to evaluate the evolutionary origins of the intervening sequences, we have now determined complete small subunit ribosomal RNA gene sequences from 13 species of Tetrahymena and the absolute number of nucleotide differences between the sequences was used to construct a phylogenetic tree...

  18. Evidence for functional interaction between domains II and V of 23S ribosomal RNA from an erythromycin-resistant mutant

    DEFF Research Database (Denmark)

    Douthwaite, S; Prince, J B; Noller, H F

    1985-01-01

    A mutation affording low levels of erythromycin resistance has been obtained by in vitro hydroxylamine mutagenesis of a cloned ribosomal RNA operon from Escherichia coli. The site of the mutational event responsible for antibiotic resistance was localized to the gene region encoding domain II of ...

  19. Sulfur restriction extends fission yeast chronological lifespan through Ecl1 family genes by downregulation of ribosome.

    Science.gov (United States)

    Ohtsuka, Hokuto; Takinami, Masahiro; Shimasaki, Takafumi; Hibi, Takahide; Murakami, Hiroshi; Aiba, Hirofumi

    2017-07-01

    Nutritional restrictions such as calorie restrictions are known to increase the lifespan of various organisms. Here, we found that a restriction of sulfur extended the chronological lifespan (CLS) of the fission yeast Schizosaccharomyces pombe. The restriction decreased cellular size, RNA content, and ribosomal proteins and increased sporulation rate. These responses depended on Ecl1 family genes, the overexpression of which results in the extension of CLS. We also showed that the Zip1 transcription factor results in the sulfur restriction-dependent expression of the ecl1 + gene. We demonstrated that a decrease in ribosomal activity results in the extension of CLS. Based on these observations, we propose that sulfur restriction extends CLS through Ecl1 family genes in a ribosomal activity-dependent manner. © 2017 John Wiley & Sons Ltd.

  20. The Ribosomal RNA is a Useful Marker to Visualize Rhizobia Interacting with Legume Plants

    Science.gov (United States)

    Rinaudi, Luciana; Isola, Maria C.; Giordano, Walter

    2004-01-01

    Symbiosis between rhizobia and leguminous plants leads to the formation of nitrogen-fixing root nodules. In the present article, we recommend the use of the ribosomal RNA (rRNA) isolated from legume nodules in an experimental class with the purpose of introducing students to the structure of eukaryotic and prokaryotic ribosomes and of…

  1. Ribosome dynamics and tRNA movement by time-resolved electron cryomicroscopy.

    Science.gov (United States)

    Fischer, Niels; Konevega, Andrey L; Wintermeyer, Wolfgang; Rodnina, Marina V; Stark, Holger

    2010-07-15

    The translocation step of protein synthesis entails large-scale rearrangements of the ribosome-transfer RNA (tRNA) complex. Here we have followed tRNA movement through the ribosome during translocation by time-resolved single-particle electron cryomicroscopy (cryo-EM). Unbiased computational sorting of cryo-EM images yielded 50 distinct three-dimensional reconstructions, showing the tRNAs in classical, hybrid and various novel intermediate states that provide trajectories and kinetic information about tRNA movement through the ribosome. The structures indicate how tRNA movement is coupled with global and local conformational changes of the ribosome, in particular of the head and body of the small ribosomal subunit, and show that dynamic interactions between tRNAs and ribosomal residues confine the path of the tRNAs through the ribosome. The temperature dependence of ribosome dynamics reveals a surprisingly flat energy landscape of conformational variations at physiological temperature. The ribosome functions as a Brownian machine that couples spontaneous conformational changes driven by thermal energy to directed movement.

  2. The ribosome as a molecular machine: the mechanism of tRNA-mRNA movement in translocation.

    Science.gov (United States)

    Rodnina, Marina V; Wintermeyer, Wolfgang

    2011-04-01

    Translocation of tRNA and mRNA through the ribosome is one of the most dynamic events during protein synthesis. In the cell, translocation is catalysed by EF-G (elongation factor G) and driven by GTP hydrolysis. Major unresolved questions are: how the movement is induced and what the moving parts of the ribosome are. Recent progress in time-resolved cryoelectron microscopy revealed trajectories of tRNA movement through the ribosome. Driven by thermal fluctuations, the ribosome spontaneously samples a large number of conformational states. The spontaneous movement of tRNAs through the ribosome is loosely coupled to the motions within the ribosome. EF-G stabilizes conformational states prone to translocation and promotes a conformational rearrangement of the ribosome (unlocking) that accelerates the rate-limiting step of translocation: the movement of the tRNA anticodons on the small ribosomal subunit. EF-G acts as a Brownian ratchet providing directional bias for movement at the cost of GTP hydrolysis.

  3. Mitochondrial genome evolution in Alismatales: Size reduction and extensive loss of ribosomal protein genes

    DEFF Research Database (Denmark)

    Petersen, Gitte; Cuenca, Argelia; Zervas, Athanasios

    2017-01-01

    The order Alismatales is a hotspot for evolution of plant mitochondrial genomes characterized by remarkable differences in genome size, substitution rates, RNA editing, retrotranscription, gene loss and intron loss. Here we have sequenced the complete mitogenomes of Zostera marina and Stratiotes...... aloides, which together with previously sequenced mitogenomes from Butomus and Spirodela, provide new evolutionary evidence of genome size reduction, gene loss and transfer to the nucleus. The Zostera mitogenome includes a large portion of DNA transferred from the plastome, yet it is the smallest known...... mitogenome from a non-parasitic plant. Using a broad sample of the Alismatales, the evolutionary history of ribosomal protein gene loss is analyzed. In Zostera almost all ribosomal protein genes are lost from the mitogenome, but only some can be found in the nucleus....

  4. The ribosome uses two active mechanisms to unwind messenger RNA during translation.

    Science.gov (United States)

    Qu, Xiaohui; Wen, Jin-Der; Lancaster, Laura; Noller, Harry F; Bustamante, Carlos; Tinoco, Ignacio

    2011-07-06

    The ribosome translates the genetic information encoded in messenger RNA into protein. Folded structures in the coding region of an mRNA represent a kinetic barrier that lowers the peptide elongation rate, as the ribosome must disrupt structures it encounters in the mRNA at its entry site to allow translocation to the next codon. Such structures are exploited by the cell to create diverse strategies for translation regulation, such as programmed frameshifting, the modulation of protein expression levels, ribosome localization and co-translational protein folding. Although strand separation activity is inherent to the ribosome, requiring no exogenous helicases, its mechanism is still unknown. Here, using a single-molecule optical tweezers assay on mRNA hairpins, we find that the translation rate of identical codons at the decoding centre is greatly influenced by the GC content of folded structures at the mRNA entry site. Furthermore, force applied to the ends of the hairpin to favour its unfolding significantly speeds translation. Quantitative analysis of the force dependence of its helicase activity reveals that the ribosome, unlike previously studied helicases, uses two distinct active mechanisms to unwind mRNA structure: it destabilizes the helical junction at the mRNA entry site by biasing its thermal fluctuations towards the open state, increasing the probability of the ribosome translocating unhindered; and it mechanically pulls apart the mRNA single strands of the closed junction during the conformational changes that accompany ribosome translocation. The second of these mechanisms ensures a minimal basal rate of translation in the cell; specialized, mechanically stable structures are required to stall the ribosome temporarily. Our results establish a quantitative mechanical basis for understanding the mechanism of regulation of the elongation rate of translation by structured mRNAs. ©2011 Macmillan Publishers Limited. All rights reserved

  5. Production of RNA-protein cross links in γ irradiated E. Coli ribosomes

    International Nuclear Information System (INIS)

    Ekert, Bernard; Giocanti, Nicole

    1976-01-01

    γ irradiation in de-aerated conditions of E. coli MRE 600 ribosomes, labelled with 14 C uracil, leads to a decrease of extractibility of 14 C RNA by lithium chloride 4 M-urea 8 M. On the other hand, the radioactivity of the protein fraction increases with irradiation. These results strongly suggest that RNA-protein cross links are formed in irradiated ribosomes [fr

  6. RINT-1 interacts with MSP58 within nucleoli and plays a role in ribosomal gene transcription

    International Nuclear Information System (INIS)

    Yang, Chuan-Pin; Kuo, Yu-Liang; Lee, Yi-Chao; Lee, Kuen-Haur; Chiang, Chi-Wu; Wang, Ju-Ming; Hsu, Che-Chia

    2016-01-01

    The nucleolus is the cellular site of ribosomal (r)DNA transcription and ribosome biogenesis. The 58-kDa microspherule protein (MSP58) is a nucleolar protein involved in rDNA transcription and cell proliferation. However, regulation of MSP58-mediated rDNA transcription remains unknown. Using a yeast two-hybrid system with MSP58 as bait, we isolated complementary (c)DNA encoding Rad50-interacting protein 1 (RINT-1), as a MSP58-binding protein. RINT-1 was implicated in the cell cycle checkpoint, membrane trafficking, Golgi apparatus and centrosome dynamic integrity, and telomere length control. Both in vitro and in vivo interaction assays showed that MSP58 directly interacts with RINT-1. Interestingly, microscopic studies revealed the co-localization of MSP58, RINT-1, and the upstream binding factor (UBF), a rRNA transcription factor, in the nucleolus. We showed that ectopic expression of MSP58 or RINT-1 resulted in decreased rRNA expression and rDNA promoter activity, whereas knockdown of MSP58 or RINT-1 by siRNA exerted the opposite effect. Coexpression of MSP58 and RINT-1 robustly decreased rRNA synthesis compared to overexpression of either protein alone, whereas depletion of RINT-1 from MSP58-transfected cells enhanced rRNA synthesis. We also found that MSP58, RINT-1, and the UBF were associated with the rDNA promoter using a chromatin immunoprecipitation assay. Because aberrant ribosome biogenesis contributes to neoplastic transformation, our results revealed a novel protein complex involved in the regulation of rRNA gene expression, suggesting a role for MSP58 and RINT-1 in cancer development. - Highlights: • RINT-1 is a novel MSP58-interacting protein. • RINT-1 is a nucleolar protein that suppresses ribosomal RNA gene transcription. • RINT-1 and MSP58 cooperate to suppress ribosomal RNA gene transcription. • RINT-1, MSP58, and UBF form a complex on the rDNA promoter.

  7. Defective replication initiation results in locus specific chromosome breakage and a ribosomal RNA deficiency in yeast.

    Directory of Open Access Journals (Sweden)

    Joseph C Sanchez

    2017-10-01

    Full Text Available A form of dwarfism known as Meier-Gorlin syndrome (MGS is caused by recessive mutations in one of six different genes (ORC1, ORC4, ORC6, CDC6, CDT1, and MCM5. These genes encode components of the pre-replication complex, which assembles at origins of replication prior to S phase. Also, variants in two additional replication initiation genes have joined the list of causative mutations for MGS (Geminin and CDC45. The identity of the causative MGS genetic variants strongly suggests that some aspect of replication is amiss in MGS patients; however, little evidence has been obtained regarding what aspect of chromosome replication is faulty. Since the site of one of the missense mutations in the human ORC4 alleles is conserved between humans and yeast, we sought to determine in what way this single amino acid change affects the process of chromosome replication, by introducing the comparable mutation into yeast (orc4Y232C. We find that yeast cells with the orc4Y232C allele have a prolonged S-phase, due to compromised replication initiation at the ribosomal DNA (rDNA locus located on chromosome XII. The inability to initiate replication at the rDNA locus results in chromosome breakage and a severely reduced rDNA copy number in the survivors, presumably helping to ensure complete replication of chromosome XII. Although reducing rDNA copy number may help ensure complete chromosome replication, orc4Y232C cells struggle to meet the high demand for ribosomal RNA synthesis. This finding provides additional evidence linking two essential cellular pathways-DNA replication and ribosome biogenesis.

  8. Defective replication initiation results in locus specific chromosome breakage and a ribosomal RNA deficiency in yeast.

    Science.gov (United States)

    Sanchez, Joseph C; Kwan, Elizabeth X; Pohl, Thomas J; Amemiya, Haley M; Raghuraman, M K; Brewer, Bonita J

    2017-10-01

    A form of dwarfism known as Meier-Gorlin syndrome (MGS) is caused by recessive mutations in one of six different genes (ORC1, ORC4, ORC6, CDC6, CDT1, and MCM5). These genes encode components of the pre-replication complex, which assembles at origins of replication prior to S phase. Also, variants in two additional replication initiation genes have joined the list of causative mutations for MGS (Geminin and CDC45). The identity of the causative MGS genetic variants strongly suggests that some aspect of replication is amiss in MGS patients; however, little evidence has been obtained regarding what aspect of chromosome replication is faulty. Since the site of one of the missense mutations in the human ORC4 alleles is conserved between humans and yeast, we sought to determine in what way this single amino acid change affects the process of chromosome replication, by introducing the comparable mutation into yeast (orc4Y232C). We find that yeast cells with the orc4Y232C allele have a prolonged S-phase, due to compromised replication initiation at the ribosomal DNA (rDNA) locus located on chromosome XII. The inability to initiate replication at the rDNA locus results in chromosome breakage and a severely reduced rDNA copy number in the survivors, presumably helping to ensure complete replication of chromosome XII. Although reducing rDNA copy number may help ensure complete chromosome replication, orc4Y232C cells struggle to meet the high demand for ribosomal RNA synthesis. This finding provides additional evidence linking two essential cellular pathways-DNA replication and ribosome biogenesis.

  9. Advantages and Limitations of Ribosomal RNA PCR and DNA Sequencing for Identification of Bacteria in Cardiac Valves of Danish Patients

    DEFF Research Database (Denmark)

    Kemp, Michael; Bangsborg, Jette; Kjerulf, Anne

    2013-01-01

    of direct molecular identification should also address weaknesses, their relevance in the given setting, and possible improvements. In this study cardiac valves from 56 Danish patients referred for surgery for infective endocarditis were analysed by microscopy and culture as well as by PCR targeting part...... of the bacterial 16S rRNA gene followed by DNA sequencing of the PCR product. PCR and DNA sequencing identified significant bacteria in 49 samples from 43 patients, including five out of 13 culture-negative cases. No rare, exotic, or intracellular bacteria were identified. There was a general agreement between...... bacterial identity obtained by ribosomal PCR and DNA sequencing from the valves and bacterial isolates from blood culture. However, DNA sequencing of the 16S rRNA gene did not discriminate well among non-haemolytic streptococci, especially within the Streptococcus mitis group. Ribosomal PCR with subsequent...

  10. Biosynthesis of ribosomal RNA in nucleoli regulates pluripotency and differentiation ability of pluripotent stem cells.

    Science.gov (United States)

    Watanabe-Susaki, Kanako; Takada, Hitomi; Enomoto, Kei; Miwata, Kyoko; Ishimine, Hisako; Intoh, Atsushi; Ohtaka, Manami; Nakanishi, Mahito; Sugino, Hiromu; Asashima, Makoto; Kurisaki, Akira

    2014-12-01

    Pluripotent stem cells have been shown to have unique nuclear properties, for example, hyperdynamic chromatin and large, condensed nucleoli. However, the contribution of the latter unique nucleolar character to pluripotency has not been well understood. Here, we show that fibrillarin (FBL), a critical methyltransferase for ribosomal RNA (rRNA) processing in nucleoli, is one of the proteins highly expressed in pluripotent embryonic stem (ES) cells. Stable expression of FBL in ES cells prolonged the pluripotent state of mouse ES cells cultured in the absence of leukemia inhibitory factor (LIF). Analyses using deletion mutants and a point mutant revealed that the methyltransferase activity of FBL regulates stem cell pluripotency. Knockdown of this gene led to significant delays in rRNA processing, growth inhibition, and apoptosis in mouse ES cells. Interestingly, both partial knockdown of FBL and treatment with actinomycin D, an inhibitor of rRNA synthesis, induced the expression of differentiation markers in the presence of LIF and promoted stem cell differentiation into neuronal lineages. Moreover, we identified p53 signaling as the regulatory pathway for pluripotency and differentiation of ES cells. These results suggest that proper activity of rRNA production in nucleoli is a novel factor for the regulation of pluripotency and differentiation ability of ES cells. © 2014 AlphaMed Press.

  11. Synthesis and methylation of ribosomal RNA in HeLa cells infected with the herpes virus pseudorabies virus

    International Nuclear Information System (INIS)

    Furlong, J.C.; Kyriakidis, S.; Stevely, W.S.

    1982-01-01

    The effects of infection with the herpes virus pseudorabies virus on the metabolism of HeLa cell ribosomal RNA were examined. There is a decline both in the synthesis of nucleolar 45S ribosomal precursor RNA and in its processing to mature cytoplasmic RNA. The methylated oligonucleotides in the ribosomal RNA species were studied. The methylation of cytoplasmic ribosomal RNA was essentially unchanged. However there was some undermethylation of the nucleolar precursor. If undermethylated RNA does not mature then this may partly explain the reduced processing in the infected cells. (Author)

  12. Emerging functions of ribosomal proteins in gene-specific transcription and translation

    International Nuclear Information System (INIS)

    Lindstroem, Mikael S.

    2009-01-01

    Ribosomal proteins have remained highly conserved during evolution presumably reflecting often critical functions in ribosome biogenesis or mature ribosome function. In addition, several ribosomal proteins possess distinct extra-ribosomal functions in apoptosis, DNA repair and transcription. An increasing number of ribosomal proteins have been shown to modulate the trans-activation function of important regulatory proteins such as NF-κB, p53, c-Myc and nuclear receptors. Furthermore, a subset of ribosomal proteins can bind directly to untranslated regions of mRNA resulting in transcript-specific translational control outside of the ribosome itself. Collectively, these findings suggest that ribosomal proteins may have a wider functional repertoire within the cell than previously thought. The future challenge is to identify and validate these novel functions in the background of an often essential primary function in ribosome biogenesis and cell growth.

  13. The ribosome structure controls and directs mRNA entry, translocation and exit dynamics

    International Nuclear Information System (INIS)

    Kurkcuoglu, Ozge; Doruker, Pemra; Jernigan, Robert L; Sen, Taner Z; Kloczkowski, Andrzej

    2008-01-01

    The protein-synthesizing ribosome undergoes large motions to effect the translocation of tRNAs and mRNA; here, the domain motions of this system are explored with a coarse-grained elastic network model using normal mode analysis. Crystal structures are used to construct various model systems of the 70S complex with/without tRNA, elongation factor Tu and the ribosomal proteins. Computed motions reveal the well-known ratchet-like rotational motion of the large subunits, as well as the head rotation of the small subunit and the high flexibility of the L1 and L7/L12 stalks, even in the absence of ribosomal proteins. This result indicates that these experimentally observed motions during translocation are inherently controlled by the ribosomal shape and only partially dependent upon GTP hydrolysis. Normal mode analysis further reveals the mobility of A- and P-tRNAs to increase in the absence of the E-tRNA. In addition, the dynamics of the E-tRNA is affected by the absence of the ribosomal protein L1. The mRNA in the entrance tunnel interacts directly with helicase proteins S3 and S4, which constrain the mRNA in a clamp-like fashion, as well as with protein S5, which likely orients the mRNA to ensure correct translation. The ribosomal proteins S7, S11 and S18 may also be involved in assuring translation fidelity by constraining the mRNA at the exit site of the channel. The mRNA also interacts with the 16S 3' end forming the Shine–Dalgarno complex at the initiation step; the 3' end may act as a 'hook' to reel in the mRNA to facilitate its exit

  14. Ribosomal protein gene knockdown causes developmental defects in zebrafish.

    Directory of Open Access Journals (Sweden)

    Tamayo Uechi

    Full Text Available The ribosomal proteins (RPs form the majority of cellular proteins and are mandatory for cellular growth. RP genes have been linked, either directly or indirectly, to various diseases in humans. Mutations in RP genes are also associated with tissue-specific phenotypes, suggesting a possible role in organ development during early embryogenesis. However, it is not yet known how mutations in a particular RP gene result in specific cellular changes, or how RP genes might contribute to human diseases. The development of animal models with defects in RP genes will be essential for studying these questions. In this study, we knocked down 21 RP genes in zebrafish by using morpholino antisense oligos to inhibit their translation. Of these 21, knockdown of 19 RPs resulted in the development of morphants with obvious deformities. Although mutations in RP genes, like other housekeeping genes, would be expected to result in nonspecific developmental defects with widespread phenotypes, we found that knockdown of some RP genes resulted in phenotypes specific to each gene, with varying degrees of abnormality in the brain, body trunk, eyes, and ears at about 25 hours post fertilization. We focused further on the organogenesis of the brain. Each knocked-down gene that affected the morphogenesis of the brain produced a different pattern of abnormality. Among the 7 RP genes whose knockdown produced severe brain phenotypes, 3 human orthologs are located within chromosomal regions that have been linked to brain-associated diseases, suggesting a possible involvement of RP genes in brain or neurological diseases. The RP gene knockdown system developed in this study could be a powerful tool for studying the roles of ribosomes in human diseases.

  15. Translation initiation in bacterial polysomes through ribosome loading on a standby site on a highly translated mRNA

    Science.gov (United States)

    Andreeva, Irena

    2018-01-01

    During translation, consecutive ribosomes load on an mRNA and form a polysome. The first ribosome binds to a single-stranded mRNA region and moves toward the start codon, unwinding potential mRNA structures on the way. In contrast, the following ribosomes can dock at the start codon only when the first ribosome has vacated the initiation site. Here we show that loading of the second ribosome on a natural 38-nt-long 5′ untranslated region of lpp mRNA, which codes for the outer membrane lipoprotein from Escherichia coli, takes place before the leading ribosome has moved away from the start codon. The rapid formation of this standby complex depends on the presence of ribosomal proteins S1/S2 in the leading ribosome. The early recruitment of the second ribosome to the standby site before translation by the leading ribosome and the tight coupling between translation elongation by the first ribosome and the accommodation of the second ribosome can contribute to high translational efficiency of the lpp mRNA. PMID:29632209

  16. Defining the structural requirements for a helix in 23 S ribosomal RNA that confers erythromycin resistance

    DEFF Research Database (Denmark)

    Douthwaite, S; Powers, T; Lee, J Y

    1989-01-01

    The helix spanning nucleotides 1198 to 1247 (helix 1200-1250) in Escherichia coli 23 S ribosomal RNA (rRNA) is functionally important in protein synthesis, and deletions in this region confer erythromycin resistance. In order to define the structural requirements for resistance, we have dissected...... deletion mutants show a sensitive phenotype. Deletions that extend into the base-pairing between GCC1208 and GGU1240 result in non-functional 23 S RNAs, which consequently do not confer resistance. A number of phylogenetically conserved nucleotides have been shown to be non-essential for 23 S RNA function....... However, removal of either these or non-conserved nucleotides from helix 1200-1250 measurably reduces the efficiency of 23 S RNA in forming functional ribosomes. We have used chemical probing and a modified primer extension method to investigate erythromycin binding to wild-type and resistant ribosomes...

  17. Studies of the effects of ultraviolet radiation on the structural integrities of ribosomal RNA components of the Escherichia coli 50S ribosomal subunit

    International Nuclear Information System (INIS)

    Gorelic, L.; Parker, D.

    1978-01-01

    The effects of 254-nm radiation on the structural integrities of free and 50S ribosome-bound 5S and 23S ribosomal ribonucleic acids (rRNA) have been elucidated. Irradiation of aqueous solutions of Escherichia coli 50S ribosomes with 253.7-nm radiation results in the formation of single-strand breaks in double-stranded regions of the 23S rRNA component, but not in rRNA chain scission, and destabilization of the secondary structure of the 23S rRNA toward denaturation. The minimum doses of 253.7-nm radiation required for the first detection of the two effects are 7 x 10 19 quanta for the production of single-strand breaks in double-stranded regions of the 23S rRNA, and 19 quanta for destabilization of the 23S rRNA secondary structure. Free 23S rRNA is resistant toward photoinduced chain breakage at doses of 253.7-nm radiation up to at least 2.3 x 10 20 and is much less sensitive toward destabilization of secondary structure than ribosome-bound 23S rRNA. In contrast to the photosensitivity of 50S ribosome-bound 23S rRNA toward chain breakage, 50S ribosome-bound 5S rRNA is resistant toward chain breakage at doses of 253.7-nm radiation up to at least 2.3 x 10 20 quanta. Ribosome-bound 5S and 23S rRNA are also not photosensitive toward intermolecular 5S/23S rRNA cross-linkage

  18. Genetic interactions of MAF1 identify a role for Med20 in transcriptional repression of ribosomal protein genes.

    Directory of Open Access Journals (Sweden)

    Ian M Willis

    2008-07-01

    Full Text Available Transcriptional repression of ribosomal components and tRNAs is coordinately regulated in response to a wide variety of environmental stresses. Part of this response involves the convergence of different nutritional and stress signaling pathways on Maf1, a protein that is essential for repressing transcription by RNA polymerase (pol III in Saccharomyces cerevisiae. Here we identify the functions buffering yeast cells that are unable to down-regulate transcription by RNA pol III. MAF1 genetic interactions identified in screens of non-essential gene-deletions and conditionally expressed essential genes reveal a highly interconnected network of 64 genes involved in ribosome biogenesis, RNA pol II transcription, tRNA modification, ubiquitin-dependent proteolysis and other processes. A survey of non-essential MAF1 synthetic sick/lethal (SSL genes identified six gene-deletions that are defective in transcriptional repression of ribosomal protein (RP genes following rapamycin treatment. This subset of MAF1 SSL genes included MED20 which encodes a head module subunit of the RNA pol II Mediator complex. Genetic interactions between MAF1 and subunits in each structural module of Mediator were investigated to examine the functional relationship between these transcriptional regulators. Gene expression profiling identified a prominent and highly selective role for Med20 in the repression of RP gene transcription under multiple conditions. In addition, attenuated repression of RP genes by rapamycin was observed in a strain deleted for the Mediator tail module subunit Med16. The data suggest that Mediator and Maf1 function in parallel pathways to negatively regulate RP mRNA and tRNA synthesis.

  19. RINT-1 interacts with MSP58 within nucleoli and plays a role in ribosomal gene transcription.

    Science.gov (United States)

    Yang, Chuan-Pin; Kuo, Yu-Liang; Lee, Yi-Chao; Lee, Kuen-Haur; Chiang, Chi-Wu; Wang, Ju-Ming; Hsu, Che-Chia; Chang, Wen-Chang; Lin, Ding-Yen

    2016-09-16

    The nucleolus is the cellular site of ribosomal (r)DNA transcription and ribosome biogenesis. The 58-kDa microspherule protein (MSP58) is a nucleolar protein involved in rDNA transcription and cell proliferation. However, regulation of MSP58-mediated rDNA transcription remains unknown. Using a yeast two-hybrid system with MSP58 as bait, we isolated complementary (c)DNA encoding Rad50-interacting protein 1 (RINT-1), as a MSP58-binding protein. RINT-1 was implicated in the cell cycle checkpoint, membrane trafficking, Golgi apparatus and centrosome dynamic integrity, and telomere length control. Both in vitro and in vivo interaction assays showed that MSP58 directly interacts with RINT-1. Interestingly, microscopic studies revealed the co-localization of MSP58, RINT-1, and the upstream binding factor (UBF), a rRNA transcription factor, in the nucleolus. We showed that ectopic expression of MSP58 or RINT-1 resulted in decreased rRNA expression and rDNA promoter activity, whereas knockdown of MSP58 or RINT-1 by siRNA exerted the opposite effect. Coexpression of MSP58 and RINT-1 robustly decreased rRNA synthesis compared to overexpression of either protein alone, whereas depletion of RINT-1 from MSP58-transfected cells enhanced rRNA synthesis. We also found that MSP58, RINT-1, and the UBF were associated with the rDNA promoter using a chromatin immunoprecipitation assay. Because aberrant ribosome biogenesis contributes to neoplastic transformation, our results revealed a novel protein complex involved in the regulation of rRNA gene expression, suggesting a role for MSP58 and RINT-1 in cancer development. Copyright © 2016 Elsevier Inc. All rights reserved.

  20. Analysis of ribosomal protein gene structures: implications for intron evolution.

    Directory of Open Access Journals (Sweden)

    2006-03-01

    Full Text Available Many spliceosomal introns exist in the eukaryotic nuclear genome. Despite much research, the evolution of spliceosomal introns remains poorly understood. In this paper, we tried to gain insights into intron evolution from a novel perspective by comparing the gene structures of cytoplasmic ribosomal proteins (CRPs and mitochondrial ribosomal proteins (MRPs, which are held to be of archaeal and bacterial origin, respectively. We analyzed 25 homologous pairs of CRP and MRP genes that together had a total of 527 intron positions. We found that all 12 of the intron positions shared by CRP and MRP genes resulted from parallel intron gains and none could be considered to be "conserved," i.e., descendants of the same ancestor. This was supported further by the high frequency of proto-splice sites at these shared positions; proto-splice sites are proposed to be sites for intron insertion. Although we could not definitively disprove that spliceosomal introns were already present in the last universal common ancestor, our results lend more support to the idea that introns were gained late. At least, our results show that MRP genes were intronless at the time of endosymbiosis. The parallel intron gains between CRP and MRP genes accounted for 2.3% of total intron positions, which should provide a reliable estimate for future inferences of intron evolution.

  1. Relationship between organization and function of ribosomal genes in Drosophila melanogaster

    International Nuclear Information System (INIS)

    Karpen, G.H.

    1987-01-01

    In most eukaryotic organisms, the genes that encode the 18S and 28S ribosomal RNAs (rDNA genes) are tandemly repeated, and are located in constitutive heterochromatin and/or centromeric or telomeric regions. P-element mediated transformation was used to investigate the relationship between rDNA organization and function in Drosophila melanogaster. Tritiated-uridine incorporation under heat shock conditions and in situ hybridization to rRNA were used to demonstrate that a single rDNA gene inserted into euchromatin can be transcribed at a high rate, in polytene nuclei. P-element-mediated transformation of a single Drosophila rDNA gene was also utilized to investigate the ability of ribosomal DNA to organize a nucleolus. Cytological approaches demonstrated that structures resembling the endogenous nucleoli were preferentially associated with four different sites of rDNA insertion, in polytene nuclei. These mini-nucleoli also contained components specific to the nucleolus, as shown by in situ hybridization to rRNA and indirect immunofluorescence with an antibody that binds to Drosophila nucleoli. The transformed genes were able to partially rescue mutant phenotypes due to a deficiency of rDNA, indicating that the mini-nucleoli were functional

  2. Diagnóstico de Mycoplasma genitalium por amplificación de los genes MgPa y ARN ribosomal 16S Diagnosis of Mycoplasma genitalium by MgPa and rRNA 16S gene amplification

    Directory of Open Access Journals (Sweden)

    Carmen Fernández-Molina

    2008-10-01

    Full Text Available OBJETIVO: El microorganismo Mycoplasma genitalium se ha relacionado con la uretritis no gonocócica (UNG. La técnica de PCR se ha convertido en el principal método de detección de este patógeno. En consecuencia, debe aplicarse un método de diagnóstico mediante la amplificación de fragmentos de ADN por la técnica PCR. MATERIAL Y MÉTODOS: Se seleccionaron los cebadores MGF-MGR y MgPaF-MgPaR, complementarios de los genes de ARNr 16S y MgPa de M. genitalium, respectivamente. Se efectuaron ensayos de especificidad y sensibilidad y se estudiaron muestras clínicas. RESULTADOS: La PCR con cada grupo de cebadores utilizado fue específica sólo para M. genitalium y la sensibilidad fue mayor con el grupo de cebadores MGF-MGR. En el estudio de 34 muestras clínicas, 18.5% fue positivo a M. genitalium y se encontró un mayor número de muestras positivas al utilizar los cebadores MgPaF-MgPaR. CONCLUSIONES: Debe aplicarse en la práctica clínica el diagnóstico de M. genitalium mediante la amplificación del ADN por PCR en los pacientes con UNG.OBJECTIVE: Mycoplasma genitalium has been associated with nongonococcal urethritis (NGU. Diagnosis by PCR has become the primary detection method for this organism. Thus, diagnosis by DNA amplification using the PCR technique should be utilized. MATERIAL AND METHODS: GMF/GMR and MgpF/MgpR primer pairs, complementary to the M. genitalium 16S rRNA and MgPa genes, respectively, were selected. Specificity and sensibility assays were conducted and clinical samples were studied. RESULTS: The PCR with each primer pair was specific only for M. genitalium, and the sensibility was higher with the GMF/GMR primers. In the study of 34 clinical samples, 18,5% were positive for M. genitalium, with more positive samples when the MgpF/MgpR primers were used. CONCLUSIONS: DNA amplification by PCR should be applied in clinical practice to the diagnosis of M. genitalium in patients with NGU should using.

  3. The NBS1-Treacle complex controls ribosomal RNA transcription in response to DNA damage

    DEFF Research Database (Denmark)

    Larsen, Dorthe H; Hari, Flurina; Clapperton, Julie A

    2014-01-01

    Chromosome breakage elicits transient silencing of ribosomal RNA synthesis, but the mechanisms involved remained elusive. Here we discover an in trans signalling mechanism that triggers pan-nuclear silencing of rRNA transcription in response to DNA damage. This is associated with transient...... recruitment of the Nijmegen breakage syndrome protein 1 (NBS1), a central regulator of DNA damage responses, into the nucleoli. We further identify TCOF1 (also known as Treacle), a nucleolar factor implicated in ribosome biogenesis and mutated in Treacher Collins syndrome, as an interaction partner of NBS1...

  4. Ribosomal RNA in the salivary gland of Sciara ocellaris during larval development

    International Nuclear Information System (INIS)

    Dessen, E.M.B.; Perondini, A.L.P.

    1979-01-01

    Ribosomal RNA in the salivary gland of Sciara ocellaris during larval development. The molecular weights of the precursor and of the 28S and 18S mature fractions of the ribosomal RNA estimated by poliacrilamid gel electrophoresis are 2.6 X 10 6 D, 1.4 X 10 6 D and 0.68 X 10 6 D, respectively. The in vivo processing of pre-rRNA is very fast since radioactivity could be detected in the mature fractions fifteen minutes after incorporation. The processing rate of salivary pre-rRNA increases after the stage of metamorphosis induction. The in vitro processing of the pre-rRNA is less rapid when compared to that in vivo, and no differences were found in RNAs [pt

  5. rRNA maturation in yeast cells depleted of large ribosomal subunit proteins.

    Directory of Open Access Journals (Sweden)

    Gisela Pöll

    Full Text Available The structural constituents of the large eukaryotic ribosomal subunit are 3 ribosomal RNAs, namely the 25S, 5.8S and 5S rRNA and about 46 ribosomal proteins (r-proteins. They assemble and mature in a highly dynamic process that involves more than 150 proteins and 70 small RNAs. Ribosome biogenesis starts in the nucleolus, continues in the nucleoplasm and is completed after nucleo-cytoplasmic translocation of the subunits in the cytoplasm. In this work we created 26 yeast strains, each of which conditionally expresses one of the large ribosomal subunit (LSU proteins. In vivo depletion of the analysed LSU r-proteins was lethal and led to destabilisation and degradation of the LSU and/or its precursors. Detailed steady state and metabolic pulse labelling analyses of rRNA precursors in these mutant strains showed that LSU r-proteins can be grouped according to their requirement for efficient progression of different steps of large ribosomal subunit maturation. Comparative analyses of the observed phenotypes and the nature of r-protein-rRNA interactions as predicted by current atomic LSU structure models led us to discuss working hypotheses on i how individual r-proteins control the productive processing of the major 5' end of 5.8S rRNA precursors by exonucleases Rat1p and Xrn1p, and ii the nature of structural characteristics of nascent LSUs that are required for cytoplasmic accumulation of nascent subunits but are nonessential for most of the nuclear LSU pre-rRNA processing events.

  6. Simulating movement of tRNA through the ribosome during hybrid-state formation.

    Science.gov (United States)

    Whitford, Paul C; Sanbonmatsu, Karissa Y

    2013-09-28

    Biomolecular simulations provide a means for exploring the relationship between flexibility, energetics, structure, and function. With the availability of atomic models from X-ray crystallography and cryoelectron microscopy (cryo-EM), and rapid increases in computing capacity, it is now possible to apply molecular dynamics (MD) simulations to large biomolecular machines, and systematically partition the factors that contribute to function. A large biomolecular complex for which atomic models are available is the ribosome. In the cell, the ribosome reads messenger RNA (mRNA) in order to synthesize proteins. During this essential process, the ribosome undergoes a wide range of conformational rearrangements. One of the most poorly understood transitions is translocation: the process by which transfer RNA (tRNA) molecules move between binding sites inside of the ribosome. The first step of translocation is the adoption of a "hybrid" configuration by the tRNAs, which is accompanied by large-scale rotations in the ribosomal subunits. To illuminate the relationship between these rearrangements, we apply MD simulations using a multi-basin structure-based (SMOG) model, together with targeted molecular dynamics protocols. From 120 simulated transitions, we demonstrate the viability of a particular route during P/E hybrid-state formation, where there is asynchronous movement along rotation and tRNA coordinates. These simulations not only suggest an ordering of events, but they highlight atomic interactions that may influence the kinetics of hybrid-state formation. From these simulations, we also identify steric features (H74 and surrounding residues) encountered during the hybrid transition, and observe that flexibility of the single-stranded 3'-CCA tail is essential for it to reach the endpoint. Together, these simulations provide a set of structural and energetic signatures that suggest strategies for modulating the physical-chemical properties of protein synthesis by the

  7. Mitochondrial 12S ribosomal RNA A1555G mutation associated with cardiomyopathy and hearing loss following high-dose chemotherapy and repeated aminoglycoside exposure

    DEFF Research Database (Denmark)

    Skou, Anne-Sofie; Tranebjærg, Lisbeth; Jensen, Tim

    2014-01-01

    A 19-month-old girl with the A1555G mitochondrial mutation in the 12S ribosomal RNA gene and acute myelogenous leukemia developed dilated cardiomyopathy and bilateral sensorineural hearing loss before undergoing allogeneic stem cell transplantation. She had received gentamicin during episodes of ...... of febrile neutropenia. Testing for the A1555G mutation is recommended in patients frequently treated with aminoglycosides....

  8. The mitochondrial gene encoding ribosomal protein S12 has been translocated to the nuclear genome in Oenothera.

    Science.gov (United States)

    Grohmann, L; Brennicke, A; Schuster, W

    1992-01-01

    The Oenothera mitochondrial genome contains only a gene fragment for ribosomal protein S12 (rps12), while other plants encode a functional gene in the mitochondrion. The complete Oenothera rps12 gene is located in the nucleus. The transit sequence necessary to target this protein to the mitochondrion is encoded by a 5'-extension of the open reading frame. Comparison of the amino acid sequence encoded by the nuclear gene with the polypeptides encoded by edited mitochondrial cDNA and genomic sequences of other plants suggests that gene transfer between mitochondrion and nucleus started from edited mitochondrial RNA molecules. Mechanisms and requirements of gene transfer and activation are discussed. Images PMID:1454526

  9. A Listeria monocytogenes RNA helicase essential for growth and ribosomal maturation at low temperatures uses its C terminus for appropriate interaction with the ribosome.

    Science.gov (United States)

    Netterling, Sakura; Vaitkevicius, Karolis; Nord, Stefan; Johansson, Jörgen

    2012-08-01

    Listeria monocytogenes, a Gram-positive food-borne human pathogen, is able to grow at temperatures close to 0°C and is thus of great concern for the food industry. In this work, we investigated the physiological role of one DExD-box RNA helicase in Listeria monocytogenes. The RNA helicase Lmo1722 was required for optimal growth at low temperatures, whereas it was dispensable at 37°C. A Δlmo1722 strain was less motile due to downregulation of the major subunit of the flagellum, FlaA, caused by decreased flaA expression. By ribosomal fractionation experiments, it was observed that Lmo1722 was mainly associated with the 50S subunit of the ribosome. Absence of Lmo1722 decreased the fraction of 50S ribosomal subunits and mature 70S ribosomes and affected the processing of the 23S precursor rRNA. The ribosomal profile could be restored to wild-type levels in a Δlmo1722 strain expressing Lmo1722. Interestingly, the C-terminal part of Lmo1722 was redundant for low-temperature growth, motility, 23S rRNA processing, and appropriate ribosomal maturation. However, Lmo1722 lacking the C terminus showed a reduced affinity for the 50S and 70S fractions, suggesting that the C terminus is important for proper guidance of Lmo1722 to the 50S subunit. Taken together, our results show that the Listeria RNA helicase Lmo1722 is essential for growth at low temperatures, motility, and rRNA processing and is important for ribosomal maturation, being associated mainly with the 50S subunit of the ribosome.

  10. Human nucleolus organizers on nonhomologous chromosomes can share the same ribosomal gene variants.

    Science.gov (United States)

    Krystal, M; D'Eustachio, P; Ruddle, F H; Arnheim, N

    1981-01-01

    The distributions of three human ribosomal gene polymorphisms among individual chromosomes containing nucleolus organizers were analyzed by using mouse--human hybrid cells. Different nucleolus organizers can contain the same variant, suggesting the occurrence of genetic exchanges among ribosomal gene clusters on nonhomologous chromosomes. Such exchanges appear to occur less frequently in mice. This difference is discussed in terms of the nucleolar organization and chromosomal location of ribosomal gene clusters in humans and mice. Images PMID:6272316

  11. The functional half-life of an mRNA depends on the ribosome spacing in an early coding region

    DEFF Research Database (Denmark)

    Pedersen, Margit; Nissen, Søren; Mitarai, Namiko

    2011-01-01

    Bacterial mRNAs are translated by closely spaced ribosomes and degraded from the 5'-end, with half-lives of around 2 min at 37 °C in most cases. Ribosome-free or "naked" mRNA is known to be readily degraded, but the initial event that inactivates the mRNA functionally has not been fully described...

  12. Evidence for rRNA 2'-O-methylation plasticity: Control of intrinsic translational capabilities of human ribosomes.

    Science.gov (United States)

    Erales, Jenny; Marchand, Virginie; Panthu, Baptiste; Gillot, Sandra; Belin, Stéphane; Ghayad, Sandra E; Garcia, Maxime; Laforêts, Florian; Marcel, Virginie; Baudin-Baillieu, Agnès; Bertin, Pierre; Couté, Yohann; Adrait, Annie; Meyer, Mélanie; Therizols, Gabriel; Yusupov, Marat; Namy, Olivier; Ohlmann, Théophile; Motorin, Yuri; Catez, Frédéric; Diaz, Jean-Jacques

    2017-12-05

    Ribosomal RNAs (rRNAs) are main effectors of messenger RNA (mRNA) decoding, peptide-bond formation, and ribosome dynamics during translation. Ribose 2'-O-methylation (2'-O-Me) is the most abundant rRNA chemical modification, and displays a complex pattern in rRNA. 2'-O-Me was shown to be essential for accurate and efficient protein synthesis in eukaryotic cells. However, whether rRNA 2'-O-Me is an adjustable feature of the human ribosome and a means of regulating ribosome function remains to be determined. Here we challenged rRNA 2'-O-Me globally by inhibiting the rRNA methyl-transferase fibrillarin in human cells. Using RiboMethSeq, a nonbiased quantitative mapping of 2'-O-Me, we identified a repertoire of 2'-O-Me sites subjected to variation and demonstrate that functional domains of ribosomes are targets of 2'-O-Me plasticity. Using the cricket paralysis virus internal ribosome entry site element, coupled to in vitro translation, we show that the intrinsic capability of ribosomes to translate mRNAs is modulated through a 2'-O-Me pattern and not by nonribosomal actors of the translational machinery. Our data establish rRNA 2'-O-Me plasticity as a mechanism providing functional specificity to human ribosomes.

  13. Initiation of ribosomal RNA synthesis in Escherichia coli

    NARCIS (Netherlands)

    Hamming, Jantina

    1981-01-01

    Het E. coli chromosoom is éên lang circulair dubbelstrengs DNA molecuul en beslaat ongeveer 3000 genen. Het enzym RNA polymerase is verantwoordelijk voor de transcriptie in RNA van alle genetische informatie in de ce1. Er zijn 2 soorten transcripten: de ribosomale en transfer RNAs die deel uitmaken

  14. Assessing the 5S ribosomal RNA heterogeneity in Arabidopsis thaliana using short RNA next generation sequencing data.

    Science.gov (United States)

    Szymanski, Maciej; Karlowski, Wojciech M

    2016-01-01

    In eukaryotes, ribosomal 5S rRNAs are products of multigene families organized within clusters of tandemly repeated units. Accumulation of genomic data obtained from a variety of organisms demonstrated that the potential 5S rRNA coding sequences show a large number of variants, often incompatible with folding into a correct secondary structure. Here, we present results of an analysis of a large set of short RNA sequences generated by the next generation sequencing techniques, to address the problem of heterogeneity of the 5S rRNA transcripts in Arabidopsis and identification of potentially functional rRNA-derived fragments.

  15. The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus.

    Science.gov (United States)

    Hori, H; Osawa, S; Murao, K; Ishikura, H

    1980-01-01

    The nucleotide sequence of ribosomal 5S RNA from Micrococcus lysodeikticus is pGUUACGGCGGCUAUAGCGUGGGGGAAACGCCCGGCCGUAUAUCGAACCCGGAAGCUAAGCCCCAUAGCGCCGAUGGUUACUGUAACCGGGAGGUUGUGGGAGAGUAGGUCGCCGCCGUGAOH. When compared to other 5S RNAs, the sequence homology is greatest with Thermus aquaticus, and these two 5S RNAs reveal several features intermediate between those of typical gram-positive bacteria and gram-negative bacteria. PMID:6780979

  16. Analysis of Pteridium ribosomal RNA sequences by rapid direct sequencing.

    Science.gov (United States)

    Tan, M K

    1991-08-01

    A total of 864 bases from 5 regions interspersed in the 18S and 26S rRNA molecules from various clones of Pteridium covering the general geographical distribution of the genus was analysed using a rapid rRNA sequencing technique. No base difference has been detected amongst the three major lineages, two of which apparently separated before the breakup of the ancient supercontinent, Pangaea. These regions of the rRNA sequences have thus been conserved for at least 160 million years and are here compared with other eukaryotic, especially plant rRNAs.

  17. Can we estimate bacterial growth rates from ribosomal RNA content?

    Energy Technology Data Exchange (ETDEWEB)

    Kemp, P.F.

    1995-12-31

    Several studies have demonstrated a strong relationship between the quantity of RNA in bacterial cells and their growth rate under laboratory conditions. It may be possible to use this relationship to provide information on the activity of natural bacterial communities, and in particular on growth rate. However, if this approach is to provide reliably interpretable information, the relationship between RNA content and growth rate must be well-understood. In particular, a requisite of such applications is that the relationship must be universal among bacteria, or alternately that the relationship can be determined and measured for specific bacterial taxa. The RNA-growth rate relationship has not been used to evaluate bacterial growth in field studies, although RNA content has been measured in single cells and in bulk extracts of field samples taken from coastal environments. These measurements have been treated as probable indicators of bacterial activity, but have not yet been interpreted as estimators of growth rate. The primary obstacle to such interpretations is a lack of information on biological and environmental factors that affect the RNA-growth rate relationship. In this paper, the available data on the RNA-growth rate relationship in bacteria will be reviewed, including hypotheses regarding the regulation of RNA synthesis and degradation as a function of growth rate and environmental factors; i.e. the basic mechanisms for maintaining RNA content in proportion to growth rate. An assessment of the published laboratory and field data, the current status of this research area, and some of the remaining questions will be presented.

  18. Endogenous ribosomal frameshift signals operate as mRNA destabilizing elements through at least two molecular pathways in yeast.

    Science.gov (United States)

    Belew, Ashton T; Advani, Vivek M; Dinman, Jonathan D

    2011-04-01

    Although first discovered in viruses, previous studies have identified operational -1 ribosomal frameshifting (-1 RF) signals in eukaryotic genomic sequences, and suggested a role in mRNA stability. Here, four yeast -1 RF signals are shown to promote significant mRNA destabilization through the nonsense mediated mRNA decay pathway (NMD), and genetic evidence is presented suggesting that they may also operate through the no-go decay pathway (NGD) as well. Yeast EST2 mRNA is highly unstable and contains up to five -1 RF signals. Ablation of the -1 RF signals or of NMD stabilizes this mRNA, and changes in -1 RF efficiency have opposing effects on the steady-state abundance of the EST2 mRNA. These results demonstrate that endogenous -1 RF signals function as mRNA destabilizing elements through at least two molecular pathways in yeast. Consistent with current evolutionary theory, phylogenetic analyses suggest that -1 RF signals are rapidly evolving cis-acting regulatory elements. Identification of high confidence -1 RF signals in ∼10% of genes in all eukaryotic genomes surveyed suggests that -1 RF is a broadly used post-transcriptional regulator of gene expression.

  19. Active ribosomal genes, translational homeostasis and oxidative stress in the pathogenesis of schizophrenia and autism.

    Science.gov (United States)

    Porokhovnik, Lev N; Passekov, Vladimir P; Gorbachevskaya, Nataliya L; Sorokin, Alexander B; Veiko, Nataliya N; Lyapunova, Nataliya A

    2015-04-01

    Infantile autism and schizophrenia are severe multifactorial disorders with a pronounced genetic predisposition. Their pathogeneses are often associated with oxidative stress in the brain. Previously, we established that a cell's resistance to oxidative stress depended on the copy number of transcriptionally active genes for rRNA (ribosomal genes) in the cell's genome. The feature is measured cytogenetically in cultured lymphocytes derived from patients. It varies from 120 up to 190 copies per diploid genome, with an arithmetic mean of 150±4 (SE) copies in a healthy population (n=239), being considerably lower, according to our previous results, in a sample of patients with rheumatoid arthritis (n=49), another multifactorial disease with a proven significant role of oxidative stress in its pathogenesis: from 115 to 165 copies, with a mean of 140±4 (SE). Conversely, a sample of schizophrenic patients (n=42) previously showed a higher value of copy number of active rRNA genes compared with a healthy population: from 145 to 190 copies, with a mean of 170±4. This fact is of special interest in the context of the well-known, but still unexplained phenomenon of the reduced comorbidity rate of schizophrenia and rheumatoid arthritis. The copy number of active ribosomal genes was estimated in a sample of autistic children (n=51). In contrast with the schizophrenic patients studied previously, we found that the values were significantly lower than those in the healthy population: from 125 to 160 copies, with a mean of 142±5. In this work, we suggest a mathematical model of the oxidative stress dynamics on the basis of Lotka-Volterra's approach to predator-prey interactions. In our model, the 'prey' represents reactive oxygen species, whereas the 'predator' simulates molecules of the antioxidant enzymes. The rate of biosynthesis of the latter is limited by the number of ribosomes available, which, in turn, is determined by the copy number of active rRNA genes. Analysis of

  20. The CRM domain: an RNA binding module derived from an ancient ribosome-associated protein.

    Science.gov (United States)

    Barkan, Alice; Klipcan, Larik; Ostersetzer, Oren; Kawamura, Tetsuya; Asakura, Yukari; Watkins, Kenneth P

    2007-01-01

    The CRS1-YhbY domain (also called the CRM domain) is represented as a stand-alone protein in Archaea and Bacteria, and in a family of single- and multidomain proteins in plants. The function of this domain is unknown, but structural data and the presence of the domain in several proteins known to interact with RNA have led to the proposal that it binds RNA. Here we describe a phylogenetic analysis of the domain, its incorporation into diverse proteins in plants, and biochemical properties of a prokaryotic and eukaryotic representative of the domain family. We show that a bacterial member of the family, Escherichia coli YhbY, is associated with pre-50S ribosomal subunits, suggesting that YhbY functions in ribosome assembly. GFP fused to a single-domain CRM protein from maize localizes to the nucleolus, suggesting that an analogous activity may have been retained in plants. We show further that an isolated maize CRM domain has RNA binding activity in vitro, and that a small motif shared with KH RNA binding domains, a conserved "GxxG" loop, contributes to its RNA binding activity. These and other results suggest that the CRM domain evolved in the context of ribosome function prior to the divergence of Archaea and Bacteria, that this function has been maintained in extant prokaryotes, and that the domain was recruited to serve as an RNA binding module during the evolution of plant genomes.

  1. 5S rRNA gene arrangements in protists: a case of nonadaptive evolution.

    Science.gov (United States)

    Drouin, Guy; Tsang, Corey

    2012-06-01

    Given their high copy number and high level of expression, one might expect that both the sequence and organization of eukaryotic ribosomal RNA genes would be conserved during evolution. Although the organization of 18S, 5.8S and 28S ribosomal RNA genes is indeed relatively well conserved, that of 5S rRNA genes is much more variable. Here, we review the different types of 5S rRNA gene arrangements which have been observed in protists. This includes linkages to the other ribosomal RNA genes as well as linkages to ubiquitin, splice-leader, snRNA and tRNA genes. Mapping these linkages to independently derived phylogenies shows that these diverse linkages have repeatedly been gained and lost during evolution. This argues against such linkages being the primitive condition not only in protists but also in other eukaryote species. Because the only characteristic the diverse genes with which 5S rRNA genes are found linked with is that they are tandemly repeated, these arrangements are unlikely to provide any selective advantage. Rather, the observed high variability in 5S rRNA genes arrangements is likely the result of the fact that 5S rRNA genes contain internal promoters, that these genes are often transposed by diverse recombination mechanisms and that these new gene arrangements are rapidly homogenized by unequal crossingovers and/or by gene conversions events in species with short generation times and frequent founder events.

  2. Potential pitfalls of modelling ribosomal RNA data in phylogenetic tree reconstruction: evidence from case studies in the Metazoa.

    Science.gov (United States)

    Letsch, Harald O; Kjer, Karl M

    2011-05-27

    Failure to account for covariation patterns in helical regions of ribosomal RNA (rRNA) genes has the potential to misdirect the estimation of the phylogenetic signal of the data. Furthermore, the extremes of length variation among taxa, combined with regional substitution rate variation can mislead the alignment of rRNA sequences and thus distort subsequent tree reconstructions. However, recent developments in phylogenetic methodology now allow a comprehensive integration of secondary structures in alignment and tree reconstruction analyses based on rRNA sequences, which has been shown to correct some of these problems. Here, we explore the potentials of RNA substitution models and the interactions of specific model setups with the inherent pattern of covariation in rRNA stems and substitution rate variation among loop regions. We found an explicit impact of RNA substitution models on tree reconstruction analyses. The application of specific RNA models in tree reconstructions is hampered by interaction between the appropriate modelling of covarying sites in stem regions, and excessive homoplasy in some loop regions. RNA models often failed to recover reasonable trees when single-stranded regions are excessively homoplastic, because these regions contribute a greater proportion of the data when covarying sites are essentially downweighted. In this context, the RNA6A model outperformed all other models, including the more parametrized RNA7 and RNA16 models. Our results depict a trade-off between increased accuracy in estimation of interdependencies in helical regions with the risk of magnifying positions lacking phylogenetic signal. We can therefore conclude that caution is warranted when applying rRNA covariation models, and suggest that loop regions be independently screened for phylogenetic signal, and eliminated when they are indistinguishable from random noise. In addition to covariation and homoplasy, other factors, like non-stationarity of substitution rates

  3. Validation of two ribosomal RNA removal methods for microbial metatranscriptomics

    Energy Technology Data Exchange (ETDEWEB)

    He, Shaomei; Wurtzel, Omri; Singh, Kanwar; Froula, Jeff L; Yilmaz, Suzan; Tringe, Susannah G; Wang, Zhong; Chen, Feng; Lindquist, Erika A; Sorek, Rotem; Hugenholtz, Philip

    2010-10-01

    The predominance of rRNAs in the transcriptome is a major technical challenge in sequence-based analysis of cDNAs from microbial isolates and communities. Several approaches have been applied to deplete rRNAs from (meta)transcriptomes, but no systematic investigation of potential biases introduced by any of these approaches has been reported. Here we validated the effectiveness and fidelity of the two most commonly used approaches, subtractive hybridization and exonuclease digestion, as well as combinations of these treatments, on two synthetic five-microorganism metatranscriptomes using massively parallel sequencing. We found that the effectiveness of rRNA removal was a function of community composition and RNA integrity for these treatments. Subtractive hybridization alone introduced the least bias in relative transcript abundance, whereas exonuclease and in particular combined treatments greatly compromised mRNA abundance fidelity. Illumina sequencing itself also can compromise quantitative data analysis by introducing a G+C bias between runs.

  4. Sublethal effects of imidacloprid on targeting muscle and ribosomal protein related genes in the honey bee Apis mellifera L.

    Science.gov (United States)

    Wu, Yan-Yan; Luo, Qi-Hua; Hou, Chun-Sheng; Wang, Qiang; Dai, Ping-Li; Gao, Jing; Liu, Yong-Jun; Diao, Qing-Yun

    2017-11-21

    A sublethal concentration of imidacloprid can cause chronic toxicity in bees and can impact the behavior of honey bees. The nectar- and water-collecting, and climbing abilities of bees are crucial to the survival of the bees and the execution of responsibilities in bee colonies. Besides behavioral impact, data on the molecular mechanisms underlying the toxicity of imidacloprid, especially by the way of RNA-seq at the transcriptomic level, are limited. We treated Apis mellifera L. with sublethal concentrations of imidacloprid (0.1, 1 and 10 ppb) and determined the effect on behaviors and the transcriptomic changes. The sublethal concentrations of imidacloprid had a limited impact on the survival and syrup consumption of bees, but caused a significant increase in water consumption. Moreover, the climbing ability was significantly impaired by 10 ppb imidacloprid at 8 d. In the RNA-seq analysis, gene ontology (GO) term enrichment indicated a significant down-regulation of muscle-related genes, which might contribute to the impairment in climbing ability of bees. The enriched GO terms were attributed to the up-regulated ribosomal protein genes. Considering the ribosomal and extra-ribosomal functions of the ribosomal proteins, we hypothesized that imidacloprid also causes cell dysfunction. Our findings further enhance the understanding of imidacloprid sublethal toxicity.

  5. Structural Studies of RNA Helicases Involved in Eukaryotic Pre-mRNA Splicing, Ribosome Biogenesis, and Translation Initiation

    DEFF Research Database (Denmark)

    He, Yangzi

    and ligates the neighbouring exons to generate mature mRNAs. Prp43 is an RNA helicase of the DEAH/RHA family. In yeast, once mRNAs are released, Prp43 catalyzes the disassembly of spliceosomes. The 18S, 5.8S and 25S rRNAs are transcribed as a single polycistronic transcript—the 35S pre......-rRNA. It is nucleolytically cleaved and chemically modified to generate mature rRNAs, which assemble with ribosomal proteins to form the ribosome. Prp43 is required for the processing of the 18S rRNA. Using X-ray crystallography, I determined a high resolution structure of Prp43 bound to ADP, the first structure of a DEAH....../RHA helicase. It defined the conserved structural features of all DEAH/RHA helicases, and unveiled a novel nucleotide binding site. Additionally a preliminary low resolution structure of a ternary complex comprising Prp43, a non-hydrolyzable ATP analogue, and a single-stranded RNA, was obtained. The ribosome...

  6. A phylogenetic framework for root lesion nematodes of the genus Pratylenchus (Nematoda): Evidence from 18S and D2-D3 expansion segments of 28S ribosomal RNA genes and morphological characters.

    Science.gov (United States)

    Subbotin, Sergei A; Ragsdale, Erik J; Mullens, Teresa; Roberts, Philip A; Mundo-Ocampo, Manuel; Baldwin, James G

    2008-08-01

    The root lesion nematodes of the genus Pratylenchus Filipjev, 1936 are migratory endoparasites of plant roots, considered among the most widespread and important nematode parasites in a variety of crops. We obtained gene sequences from the D2 and D3 expansion segments of 28S rRNA partial and 18S rRNA from 31 populations belonging to 11 valid and two unidentified species of root lesion nematodes and five outgroup taxa. These datasets were analyzed using maximum parsimony and Bayesian inference. The alignments were generated using the secondary structure models for these molecules and analyzed with Bayesian inference under the standard models and the complex model, considering helices under the doublet model and loops and bulges under the general time reversible model. The phylogenetic informativeness of morphological characters is tested by reconstruction of their histories on rRNA based trees using parallel parsimony and Bayesian approaches. Phylogenetic and sequence analyses of the 28S D2-D3 dataset with 145 accessions for 28 species and 18S dataset with 68 accessions for 15 species confirmed among large numbers of geographical diverse isolates that most classical morphospecies are monophyletic. Phylogenetic analyses revealed at least six distinct major clades of examined Pratylenchus species and these clades are generally congruent with those defined by characters derived from lip patterns, numbers of lip annules, and spermatheca shape. Morphological results suggest the need for sophisticated character discovery and analysis for morphology based phylogenetics in nematodes.

  7. Selective inhibition of precursor incorporation into ribosomal RNA in gamma-irradiated Tetrahymena pyriformis

    International Nuclear Information System (INIS)

    Ernst, S.G.; Oleinick, N.L.; Rustad, R.C.; Greenblatt, R.M.

    1979-01-01

    Sublethal doses of γ radiation are known to inhibit total RNA synthesis in the ciliate protozoan Tetrahymena. To determine if the synthesis of a particular class of RNA is preferentially inhibited, pulse-labeled RNA was isolated from normal exponentially growing cells, irradiated cells, and cells in which total RNA synthesis had recovered to the pre-irradiation level. The RNAs were analyzed by SDS-polyacrylamide gel electrphoresis and oligo(dT)-cellulose column chromatography. Inhibition of RNA synthesis primarily involves ribosomal RNA. However, radiation does not cause a delay in the processing of precursor rRNA or a preferential loss of either of the mature rRNAs. Following irradiation, poly(A)-containing RNA [poly(A+)RNA] is synthesized at a rate up to three times greater than the control rate. The elevated poly(A+)RNA synthesis occurs during the period of depressed rRNA synthesis and even after rRNA synthesis has recovered to its pre-irradiation rate. While the sizes of the total cellular ribonucleoside triphosphate pools are depressed in the irradiated cells, these pools probably do not represent the actual compartments containing the precursors for RNA synthesis, and the observed changes cannot explain the modifications in macromolecular synthesis in irradiated Tetrahymena. (Auth.)

  8. Sequencing of 16S rRNA gene for id ntification of Sta h lococcus ...

    African Journals Online (AJOL)

    Asdmin

    2014-01-15

    Jan 15, 2014 ... as the type strains of a species of genus Trichoderma based on phylogenetic tree analysis together with the 18S rRNA gene sequence search in Ribosomal Database Project, small subunit rRNA and large subunit rRNA databases. The sequence was deposited in GenBank with the accession numbers.

  9. Dwell-Time Distribution, Long Pausing and Arrest of Single-Ribosome Translation through the mRNA Duplex.

    Science.gov (United States)

    Xie, Ping

    2015-10-09

    Proteins in the cell are synthesized by a ribosome translating the genetic information encoded on the single-stranded messenger RNA (mRNA). It has been shown that the ribosome can also translate through the duplex region of the mRNA by unwinding the duplex. Here, based on our proposed model of the ribosome translation through the mRNA duplex we study theoretically the distribution of dwell times of the ribosome translation through the mRNA duplex under the effect of a pulling force externally applied to the ends of the mRNA to unzip the duplex. We provide quantitative explanations of the available single molecule experimental data on the distribution of dwell times with both short and long durations, on rescuing of the long paused ribosomes by raising the pulling force to unzip the duplex, on translational arrests induced by the mRNA duplex and Shine-Dalgarno(SD)-like sequence in the mRNA. The functional consequences of the pauses or arrests caused by the mRNA duplex and the SD sequence are discussed and compared with those obtained from other types of pausing, such as those induced by "hungry" codons or interactions of specific sequences in the nascent chain with the ribosomal exit tunnel.

  10. Expedited quantification of mutant ribosomal RNA by binary deoxyribozyme (BiDz) sensors.

    Science.gov (United States)

    Gerasimova, Yulia V; Yakovchuk, Petro; Dedkova, Larisa M; Hecht, Sidney M; Kolpashchikov, Dmitry M

    2015-10-01

    Mutations in ribosomal RNA (rRNA) have traditionally been detected by the primer extension assay, which is a tedious and multistage procedure. Here, we describe a simple and straightforward fluorescence assay based on binary deoxyribozyme (BiDz) sensors. The assay uses two short DNA oligonucleotides that hybridize specifically to adjacent fragments of rRNA, one of which contains a mutation site. This hybridization results in the formation of a deoxyribozyme catalytic core that produces the fluorescent signal and amplifies it due to multiple rounds of catalytic action. This assay enables us to expedite semi-quantification of mutant rRNA content in cell cultures starting from whole cells, which provides information useful for optimization of culture preparation prior to ribosome isolation. The method requires less than a microliter of a standard Escherichia coli cell culture and decreases analysis time from several days (for primer extension assay) to 1.5 h with hands-on time of ∼10 min. It is sensitive to single-nucleotide mutations. The new assay simplifies the preliminary analysis of RNA samples and cells in molecular biology and cloning experiments and is promising in other applications where fast detection/quantification of specific RNA is required. © 2015 Gerasimova et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  11. Distribution of protein and RNA in the 30S ribosomal subunit

    International Nuclear Information System (INIS)

    Ramakrishnan, V.

    1986-01-01

    In Escherichia coli, the small ribosomal subunit has a sedimentation coefficient of 30S, and consists of a 16S RNA molecule of 1541 nucleotides complexed with 21 proteins. Over the last few years, a controversy has emerged regarding the spatial distribution of RNA and protein in the 30S subunit. Contrast variation with neutron scattering was used to suggest that the RNA was located in a central core of the subunit and the proteins mainly in the periphery, with virtually no separation between the centers of mass of protein and RNA. However, these findings are incompatible with the results of efforts to locate individual ribosomal proteins by immune electron microscopy and triangulation with interprotein distance measurements. The conflict between these two views is resolved in this report of small-angle neutron scattering measurements on 30S subunits with and without protein S1, and on subunits reconstituted from deuterated 16S RNA and unlabeled proteins. The results show that (i) the proteins and RNA are intermingled, with neither component dominating at the core or the periphery, and (ii) the spatial distribution of protein and RNA is asymmetrical, with a separation between their centers of mass of about 25 angstroms

  12. The SmpB C-terminal tail helps tmRNA to recognize and enter stalled ribosomes

    Directory of Open Access Journals (Sweden)

    Mickey R. Miller

    2014-09-01

    Full Text Available In bacteria, transfer-messenger RNA (tmRNA and SmpB comprise the most common and effective system for rescuing stalled ribosomes. Ribosomes stall on mRNA transcripts lacking stop codons and are rescued as the defective mRNA is swapped for the tmRNA template in a process known as trans-translation. The tmRNA–SmpB complex is recruited to the ribosome independent of a codon–anticodon interaction. Given that the ribosome uses robust discriminatory mechanisms to select against non-cognate tRNAs during canonical decoding, it has been hard to explain how this can happen. Recent structural and biochemical studies show that SmpB licenses tmRNA entry through its interactions with the decoding center and mRNA channel. In particular, the C-terminal tail of SmpB promotes both EFTu activation and accommodation of tmRNA, the former through interactions with 16S rRNA nucleotide G530 and the latter through interactions with the mRNA channel downstream of the A site. Here we present a detailed model of the earliest steps in trans-translation, and in light of these mechanistic considerations, revisit the question of how tmRNA preferentially reacts with stalled, non-translating ribosomes.

  13. Novel mRNA-specific effects of ribosome drop-off on translation rate and polysome profile.

    Directory of Open Access Journals (Sweden)

    Pierre Bonnin

    2017-05-01

    Full Text Available The well established phenomenon of ribosome drop-off plays crucial roles in translational accuracy and nutrient starvation responses during protein translation. When cells are under stress conditions, such as amino acid starvation or aminoacyl-tRNA depletion due to a high level of recombinant protein expression, ribosome drop-off can substantially affect the efficiency of protein expression. Here we introduce a mathematical model that describes the effects of ribosome drop-off on the ribosome density along the mRNA and on the concomitant protein synthesis rate. Our results show that ribosome premature termination may lead to non-intuitive ribosome density profiles, such as a ribosome density which increases from the 5' to the 3' end. Importantly, the model predicts that the effects of ribosome drop-off on the translation rate are mRNA-specific, and we quantify their resilience to drop-off, showing that the mRNAs which present ribosome queues are much less affected by ribosome drop-off than those which do not. Moreover, among those mRNAs that do not present ribosome queues, resilience to drop-off correlates positively with the elongation rate, so that sequences using fast codons are expected to be less affected by ribosome drop-off. This result is consistent with a genome-wide analysis of S. cerevisiae, which reveals that under favourable growth conditions mRNAs coding for proteins involved in the translation machinery, known to be highly codon biased and using preferentially fast codons, are highly resilient to ribosome drop-off. Moreover, in physiological conditions, the translation rate of mRNAs coding for regulatory, stress-related proteins, is less resilient to ribosome drop-off. This model therefore allows analysis of variations in the translational efficiency of individual mRNAs by accounting for the full range of known ribosome behaviours, as well as explaining mRNA-specific variations in ribosome density emerging from ribosome profiling

  14. Plastid-Nuclear Interaction and Accelerated Coevolution in Plastid Ribosomal Genes in Geraniaceae.

    Science.gov (United States)

    Weng, Mao-Lun; Ruhlman, Tracey A; Jansen, Robert K

    2016-06-27

    Plastids and mitochondria have many protein complexes that include subunits encoded by organelle and nuclear genomes. In animal cells, compensatory evolution between mitochondrial and nuclear-encoded subunits was identified and the high mitochondrial mutation rates were hypothesized to drive compensatory evolution in nuclear genomes. In plant cells, compensatory evolution between plastid and nucleus has rarely been investigated in a phylogenetic framework. To investigate plastid-nuclear coevolution, we focused on plastid ribosomal protein genes that are encoded by plastid and nuclear genomes from 27 Geraniales species. Substitution rates were compared for five sets of genes representing plastid- and nuclear-encoded ribosomal subunit proteins targeted to the cytosol or the plastid as well as nonribosomal protein controls. We found that nonsynonymous substitution rates (dN) and the ratios of nonsynonymous to synonymous substitution rates (ω) were accelerated in both plastid- (CpRP) and nuclear-encoded subunits (NuCpRP) of the plastid ribosome relative to control sequences. Our analyses revealed strong signals of cytonuclear coevolution between plastid- and nuclear-encoded subunits, in which nonsynonymous substitutions in CpRP and NuCpRP tend to occur along the same branches in the Geraniaceae phylogeny. This coevolution pattern cannot be explained by physical interaction between amino acid residues. The forces driving accelerated coevolution varied with cellular compartment of the sequence. Increased ω in CpRP was mainly due to intensified positive selection whereas increased ω in NuCpRP was caused by relaxed purifying selection. In addition, the many indels identified in plastid rRNA genes in Geraniaceae may have contributed to changes in plastid subunits. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  15. Plastid–Nuclear Interaction and Accelerated Coevolution in Plastid Ribosomal Genes in Geraniaceae

    Science.gov (United States)

    Weng, Mao-Lun; Ruhlman, Tracey A.; Jansen, Robert K.

    2016-01-01

    Plastids and mitochondria have many protein complexes that include subunits encoded by organelle and nuclear genomes. In animal cells, compensatory evolution between mitochondrial and nuclear-encoded subunits was identified and the high mitochondrial mutation rates were hypothesized to drive compensatory evolution in nuclear genomes. In plant cells, compensatory evolution between plastid and nucleus has rarely been investigated in a phylogenetic framework. To investigate plastid–nuclear coevolution, we focused on plastid ribosomal protein genes that are encoded by plastid and nuclear genomes from 27 Geraniales species. Substitution rates were compared for five sets of genes representing plastid- and nuclear-encoded ribosomal subunit proteins targeted to the cytosol or the plastid as well as nonribosomal protein controls. We found that nonsynonymous substitution rates (dN) and the ratios of nonsynonymous to synonymous substitution rates (ω) were accelerated in both plastid- (CpRP) and nuclear-encoded subunits (NuCpRP) of the plastid ribosome relative to control sequences. Our analyses revealed strong signals of cytonuclear coevolution between plastid- and nuclear-encoded subunits, in which nonsynonymous substitutions in CpRP and NuCpRP tend to occur along the same branches in the Geraniaceae phylogeny. This coevolution pattern cannot be explained by physical interaction between amino acid residues. The forces driving accelerated coevolution varied with cellular compartment of the sequence. Increased ω in CpRP was mainly due to intensified positive selection whereas increased ω in NuCpRP was caused by relaxed purifying selection. In addition, the many indels identified in plastid rRNA genes in Geraniaceae may have contributed to changes in plastid subunits. PMID:27190001

  16. Nuclear Export of Pre-Ribosomal Subunits Requires Dbp5, but Not as an RNA-Helicase as for mRNA Export.

    Science.gov (United States)

    Neumann, Bettina; Wu, Haijia; Hackmann, Alexandra; Krebber, Heike

    2016-01-01

    The DEAD-box RNA-helicase Dbp5/Rat8 is known for its function in nuclear mRNA export, where it displaces the export receptor Mex67 from the mRNA at the cytoplasmic side of the nuclear pore complex (NPC). Here we show that Dbp5 is also required for the nuclear export of both pre-ribosomal subunits. Yeast temperature-sensitive dbp5 mutants accumulate both ribosomal particles in their nuclei. Furthermore, Dbp5 genetically and physically interacts with known ribosomal transport factors such as Nmd3. Similar to mRNA export we show that also for ribosomal transport Dbp5 is required at the cytoplasmic side of the NPC. However, unlike its role in mRNA export, Dbp5 does not seem to undergo its ATPase cycle for this function, as ATPase-deficient dbp5 mutants that selectively inhibit mRNA export do not affect ribosomal transport. Furthermore, mutants of GLE1, the ATPase stimulating factor of Dbp5, show no major ribosomal export defects. Consequently, while Dbp5 uses its ATPase cycle to displace the export receptor Mex67 from the translocated mRNAs, Mex67 remains bound to ribosomal subunits upon transit to the cytoplasm, where it is detectable on translating ribosomes. Therefore, we propose a model, in which Dbp5 supports ribosomal transport by capturing ribosomal subunits upon their cytoplasmic appearance at the NPC, possibly by binding export factors such as Mex67. Thus, our findings reveal that although different ribonucleoparticles, mRNAs and pre-ribosomal subunits, use shared export factors, they utilize different transport mechanisms.

  17. Affinity labelling of ribosomes from the livers of different vertebrates by 2-nitro-4-azidobenzoyl-Phe-tRNA

    International Nuclear Information System (INIS)

    Stahl, J.; Boehm, H.; Voderberg, M.

    1981-01-01

    Ribosomal protein L 10 from the livers of trout, hen, and rat was found to be the main target for 2-nitro-4-azidobenzoyl-Phe-tRNA in affinity labelling experiments. Therefore, despite somewhat different electrophoretic mobilities, this protein seems to be involved in the organization of the peptidyl transferase centre in ribosomes of various vertebrates. (author)

  18. In situ DNA-RNA hybridization using in vitro 125I-labeled ribosomal RNA of higher plant

    International Nuclear Information System (INIS)

    Sato, Seiichi; Kikuchi, Tadatoshi; Ishida, M.R.; Tanaka, Ryuso.

    1975-01-01

    In situ hybridization using 125 I-labeled ribosomal RNA was applied to plant cells. Cytoplasmic 25 s rRNA, which was eluted from acrylamide gels after electrophoretic separation, was labeled in vitro with carrier-free 125 I and hybridized with the interphase nuclei in root tips of Vicia faba. In most of the preparations, the nucleoli were more heavily labeled than the other regions within nuclei, and several types of grain distribution were observed on the nucleoli. From these results, it was confirmed that in situ hybridization using 125 I-labeled rRNA can be used very effectively to detect the annealing sites of different molecular species of rRNA within the nuclei of plant cells, for which it is not as easy to obtain high specific radioactive rRNA in vivo as it is in the case of cultured animal cells. (auth.)

  19. Saccharomyces cerevisiae ribosomal protein L37 is encoded by duplicate genes that are differentially expressed.

    Science.gov (United States)

    Tornow, J; Santangelo, G M

    1994-06-01

    A duplicate copy of the RPL37A gene (encoding ribosomal protein L37) was cloned and sequenced. The coding region of RPL37B is very similar to that of RPL37A, with only one conservative amino-acid difference. However, the intron and flanking sequences of the two genes are extremely dissimilar. Disruption experiments indicate that the two loci are not functionally equivalent: disruption of RPL37B was insignificant, but disruption of RPL37A severely impaired the growth rate of the cell. When both RPL37 loci are disrupted, the cell is unable to grow at all, indicating that rpL37 is an essential protein. The functional disparity between the two RPL37 loci could be explained by differential gene expression. The results of two experiments support this idea: gene fusion of RPL37A to a reporter gene resulted in six-fold higher mRNA levels than was generated by the same reporter gene fused to RPL37B, and a modest increase in gene dosage of RPL37B overcame the lack of a functional RPL37A gene.

  20. Critical 23S rRNA interactions for macrolide-dependent ribosome stalling on the ErmCL nascent peptide chain.

    Science.gov (United States)

    Koch, Miriam; Willi, Jessica; Pradère, Ugo; Hall, Jonathan; Polacek, Norbert

    2017-06-20

    The nascent peptide exit tunnel has recently been identified as a functional region of ribosomes contributing to translation regulation and co-translational protein folding. Inducible expression of the erm resistance genes depends on ribosome stalling at specific codons of an upstream open reading frame in the presence of an exit tunnel-bound macrolide antibiotic. The molecular basis for this translation arrest is still not fully understood. Here, we used a nucleotide analog interference approach to unravel important functional groups on 23S rRNA residues in the ribosomal exit tunnel for ribosome stalling on the ErmC leader peptide. By replacing single nucleobase functional groups or even single atoms we were able to demonstrate the importance of A2062, A2503 and U2586 for drug-dependent ribosome stalling. Our data show that the universally conserved A2062 and A2503 are capable of forming a non-Watson-Crick base pair that is critical for sensing and transmitting the stalling signal from the exit tunnel back to the peptidyl transferase center of the ribosome. The nucleobases of A2062, A2503 as well as U2586 do not contribute significantly to the overall mechanism of protein biosynthesis, yet their elaborate role for co-translational monitoring of nascent peptide chains inside the exit tunnel can explain their evolutionary conservation. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  1. Ribosome profiling-guided depletion of an mRNA increases cell growth rate and protein secretion

    DEFF Research Database (Denmark)

    Beuchert Kallehauge, Thomas; Li, Shangzhong; Pedersen, Lasse Ebdrup

    2017-01-01

    Recombinant protein production coopts the host cell machinery to provide high protein yields of industrial enzymes or biotherapeutics. However, since protein translation is energetically expensive and tightly controlled, it is unclear if highly expressed recombinant genes are translated as effici......Recombinant protein production coopts the host cell machinery to provide high protein yields of industrial enzymes or biotherapeutics. However, since protein translation is energetically expensive and tightly controlled, it is unclear if highly expressed recombinant genes are translated...... as efficiently as host genes. Furthermore, it is unclear how the high expression impacts global translation. Here, we present the first genome-wide view of protein translation in an IgG-producing CHO cell line, measured with ribosome profiling. Through this we found that our recombinant mRNAs were translated...... as efficiently as the host cell transcriptome, and sequestered up to 15% of the total ribosome occupancy. During cell culture, changes in recombinant mRNA translation were consistent with changes in transcription, demonstrating that transcript levels influence specific productivity. Using this information, we...

  2. The importance of highly conserved nucleotides in the binding region of chloramphenicol at the peptidyl transfer centre of Escherichia coli 23S ribosomal RNA

    DEFF Research Database (Denmark)

    Vester, Birte; Garrett, Roger Antony

    1988-01-01

    in vivo on a plasmid-encoded rRNA (rrnB) operon and each one yielded dramatically altered phenotypes. Cells exhibiting A2060----C or A2450----C transversions were inviable and it was shown by inserting the mutated genes after a temperature-inducible promoter that the mutant RNAs were directly responsible...... into 50S subunits, but while the two lethal mutant RNAs were strongly selected against in 70S ribosomes, the plasmid-encoded A2503----C RNA was preferred over the chromosome-encoded RNA, contrary to current regulatory theories. The results establish the critical structural and functional importance...

  3. Cell Death-Associated Ribosomal RNA Cleavage in Postmortem Tissues and Its Forensic Applications.

    Science.gov (United States)

    Kim, Ji Yeon; Kim, Yunmi; Cha, Hyo Kyeong; Lim, Hye Young; Kim, Hyungsub; Chung, Sooyoung; Hwang, Juck-Joon; Park, Seong Hwan; Son, Gi Hoon

    2017-06-30

    Estimation of postmortem interval (PMI) is a key issue in the field of forensic pathology. With the availability of quantitative analysis of RNA levels in postmortem tissues, several studies have assessed the postmortem degradation of constitutively expressed RNA species to estimate PMI. However, conventional RNA quantification as well as biochemical and physiological changes employed thus far have limitations related to standardization or normalization. The present study focuses on an interesting feature of the subdomains of certain RNA species, in which they are site-specifically cleaved during apoptotic cell death. We found that the D8 divergent domain of ribosomal RNA (rRNA) bearing cell death-related cleavage sites was rapidly removed during postmortem RNA degradation. In contrast to the fragile domain, the 5' terminal region of 28S rRNA was remarkably stable during the postmortem period. Importantly, the differences in the degradation rates between the two domains in mammalian 28S rRNA were highly proportional to increasing PMI with a significant linear correlation observed in mice as well as human autopsy tissues. In conclusion, we demonstrate that comparison of the degradation rates between domains of a single RNA species provides quantitative information on postmortem degradation states, which can be applied for the estimation of PMI.

  4. The pre-existing population of 5S rRNA effects p53 stabilization during ribosome biogenesis inhibition.

    Science.gov (United States)

    Onofrillo, Carmine; Galbiati, Alice; Montanaro, Lorenzo; Derenzini, Massimo

    2017-01-17

    Pre-ribosomal complex RPL5/RPL11/5S rRNA (5S RNP) is considered the central MDM2 inhibitory complex that control p53 stabilization during ribosome biogenesis inhibition. Despite its role is well defined, the dynamic of 5S RNP assembly still requires further characterization. In the present work, we report that MDM2 inhibition is dependent by a pre-existing population of 5S rRNA.

  5. Improved Ribosome-Footprint and mRNA Measurements Provide Insights into Dynamics and Regulation of Yeast Translation

    Science.gov (United States)

    2016-02-11

    unlimited. Improved Ribosome-Footprint and mRNA Measurements Provide Insights into Dynamics and Regulation of Yeast Translation The views, opinions and...into Dynamics and Regulation of Yeast Translation Report Title Ribosome-footprint profiling provides genome-wide snapshots of translation, but...tend to slow translation. With the improved mRNA measurements, the variation attributable to translational control in exponentially growing yeast was

  6. Diversity of ribosomal 16S DNA- and RNA-based bacterial community in an office building drinking water system.

    Science.gov (United States)

    Inkinen, J; Jayaprakash, B; Santo Domingo, J W; Keinänen-Toivola, M M; Ryu, H; Pitkänen, T

    2016-06-01

    Next-generation sequencing of 16S ribosomal RNA genes (rDNA) and ribosomal RNA (rRNA) was used to characterize water and biofilm microbiome collected from a drinking water distribution system of an office building after its first year of operation. The total bacterial community (rDNA) and active bacterial members (rRNA) sequencing databases were generated by Illumina MiSeq PE250 platform. As estimated by Chao1 index, species richness in cold water system was lower (180-260) in biofilms (Sphingomonas spp., Methylobacterium spp., Limnohabitans spp., Rhizobiales order) than in waters (250-580), (also Methylotenera spp.) (P = 0·005, n = 20). Similarly species richness (Chao1) was slightly higher (210-580) in rDNA libraries compared to rRNA libraries (150-400; P = 0·054, n = 24). Active Mycobacterium spp. was found in cross-linked polyethylene (PEX), but not in corresponding copper pipeline biofilm. Nonpathogenic Legionella spp. was found in rDNA libraries but not in rRNA libraries. Microbial communities differed between water and biofilms, between cold and hot water systems, locations in the building and between water rRNA and rDNA libraries, as shown by clear clusters in principal component analysis (PcoA). By using the rRNA method, we found that not all bacterial community members were active (e.g. Legionella spp.), whereas other members showed increased activity in some locations; for example, Pseudomonas spp. in hot water circulations' biofilm and order Rhizobiales and Limnohabitans spp. in stagnated locations' water and biofilm. rRNA-based methods may be better than rDNA-based methods for evaluating human health implications as rRNA methods can be used to describe the active bacterial fraction. This study indicates that copper as a pipeline material might have an adverse impact on the occurrence of Mycobacterium spp. The activity of Legionella spp. maybe questionable when detected solely by using DNA-based methods. © 2016 The Society for Applied

  7. 5S Ribosomal RNA Is an Essential Component of a Nascent Ribosomal Precursor Complex that Regulates the Hdm2-p53 Checkpoint

    Directory of Open Access Journals (Sweden)

    Giulio Donati

    2013-07-01

    Full Text Available Recently, we demonstrated that RPL5 and RPL11 act in a mutually dependent manner to inhibit Hdm2 and stabilize p53 following impaired ribosome biogenesis. Given that RPL5 and RPL11 form a preribosomal complex with noncoding 5S ribosomal RNA (rRNA and the three have been implicated in the p53 response, we reasoned they may be part of an Hdm2-inhibitory complex. Here, we show that small interfering RNAs directed against 5S rRNA have no effect on total or nascent levels of the noncoding rRNA, though they prevent the reported Hdm4 inhibition of p53. To achieve efficient inhibition of 5S rRNA synthesis, we targeted TFIIIA, a specific RNA polymerase III cofactor, which, like depletion of either RPL5 or RPL11, did not induce p53. Instead, 5S rRNA acts in a dependent manner with RPL5 and RPL11 to inhibit Hdm2 and stabilize p53. Moreover, depletion of any one of the three components abolished the binding of the other two to Hdm2, explaining their common dependence. Finally, we demonstrate that the RPL5/RPL11/5S rRNA preribosomal complex is redirected from assembly into nascent 60S ribosomes to Hdm2 inhibition as a consequence of impaired ribosome biogenesis. Thus, the activation of the Hdm2-inhibitory complex is not a passive but a regulated event, whose potential role in tumor suppression has been recently noted.

  8. 5S ribosomal RNA is an essential component of a nascent ribosomal precursor complex that regulates the Hdm2-p53 checkpoint.

    Science.gov (United States)

    Donati, Giulio; Peddigari, Suresh; Mercer, Carol A; Thomas, George

    2013-07-11

    Recently, we demonstrated that RPL5 and RPL11 act in a mutually dependent manner to inhibit Hdm2 and stabilize p53 following impaired ribosome biogenesis. Given that RPL5 and RPL11 form a preribosomal complex with noncoding 5S ribosomal RNA (rRNA) and the three have been implicated in the p53 response, we reasoned they may be part of an Hdm2-inhibitory complex. Here, we show that small interfering RNAs directed against 5S rRNA have no effect on total or nascent levels of the noncoding rRNA, though they prevent the reported Hdm4 inhibition of p53. To achieve efficient inhibition of 5S rRNA synthesis, we targeted TFIIIA, a specific RNA polymerase III cofactor, which, like depletion of either RPL5 or RPL11, did not induce p53. Instead, 5S rRNA acts in a dependent manner with RPL5 and RPL11 to inhibit Hdm2 and stabilize p53. Moreover, depletion of any one of the three components abolished the binding of the other two to Hdm2, explaining their common dependence. Finally, we demonstrate that the RPL5/RPL11/5S rRNA preribosomal complex is redirected from assembly into nascent 60S ribosomes to Hdm2 inhibition as a consequence of impaired ribosome biogenesis. Thus, the activation of the Hdm2-inhibitory complex is not a passive but a regulated event, whose potential role in tumor suppression has been recently noted. Copyright © 2013 The Authors. Published by Elsevier Inc. All rights reserved.

  9. Sequence characterization of 5S ribosomal RNA from eight gram positive procaryotes

    Science.gov (United States)

    Woese, C. R.; Luehrsen, K. R.; Pribula, C. D.; Fox, G. E.

    1976-01-01

    Complete nucleotide sequences are presented for 5S rRNA from Bacillus subtilis, B. firmus, B. pasteurii, B. brevis, Lactobacillus brevis, and Streptococcus faecalis, and 5S rRNA oligonucleotide catalogs and partial sequence data are given for B. cereus and Sporosarcina ureae. These data demonstrate a striking consistency of 5S rRNA primary and secondary structure within a given bacterial grouping. An exception is B. brevis, in which the 5S rRNA sequence varies significantly from that of other bacilli in the tuned helix and the procaryotic loop. The localization of these variations suggests that B. brevis occupies an ecological niche that selects such changes. It is noted that this organism produces antibiotics which affect ribosome function.

  10. Molecular identification of sibling species of Sclerodermus (Hymenoptera: Bethylidae that parasitize buprestid and cerambycid beetles by using partial sequences of mitochondrial DNA cytochrome oxidase subunit 1 and 28S ribosomal RNA gene.

    Directory of Open Access Journals (Sweden)

    Yuan Jiang

    Full Text Available The species belonging to Sclerodermus (Hymenoptera: Bethylidae are currently the most important insect natural enemies of wood borer pests, mainly buprestid and cerambycid beetles, in China. However, some sibling species of this genus are very difficult to distinguish because of their similar morphological features. To address this issue, we conducted phylogenetic and genetic analyses of cytochrome oxidase subunit I (COI and 28S RNA gene sequences from eight species of Sclerodermus reared from different wood borer pests. The eight sibling species were as follows: S. guani Xiao et Wu, S. sichuanensis Xiao, S. pupariae Yang et Yao, and Sclerodermus spp. (Nos. 1-5. A 594-bp fragment of COI and 750-bp fragment of 28S were subsequently sequenced. For COI, the G-C content was found to be low in all the species, averaging to about 30.0%. Sequence divergences (Kimura-2-parameter distances between congeneric species averaged to 4.5%, and intraspecific divergences averaged to about 0.09%. Further, the maximum sequence divergences between congeneric species and Sclerodermus sp. (No. 5 averaged to about 16.5%. All 136 samples analyzed were included in six reciprocally monophyletic clades in the COI neighbor-joining (NJ tree. The NJ tree inferred from the 28S rRNA sequence yielded almost identical results, but the samples from S. guani, S. sichuanensis, S. pupariae, and Sclerodermus spp. (Nos. 1-4 clustered together and only Sclerodermus sp. (No. 5 clustered separately. Our findings indicate that the standard barcode region of COI can be efficiently used to distinguish morphologically similar Sclerodermus species. Further, we speculate that Sclerodermus sp. (No. 5 might be a new species of Sclerodermus.

  11. Reconstruction of phylogenetic relationships in dermatomycete genus Trichophyton Malmsten 1848 based on ribosomal internal transcribed spacer region, partial 28S rRNA and beta-tubulin genes sequences.

    Science.gov (United States)

    Pchelin, Ivan M; Zlatogursky, Vasily V; Rudneva, Mariya V; Chilina, Galina A; Rezaei-Matehkolaei, Ali; Lavnikevich, Dmitry M; Vasilyeva, Natalya V; Taraskina, Anastasia E

    2016-09-01

    Trichophyton spp. are important causative agents of superficial mycoses. The phylogeny of the genus and accurate strain identification, based on the ribosomal ITS region sequencing, are still under development. The present work is aimed at (i) inferring the genus phylogeny from partial ITS, LSU and BT2 sequences (ii) description of ribosomal ITS region polymorphism in 15 strains of Trichophyton interdigitale. We performed DNA sequence-based species identification and phylogenetic analysis on 48 strains belonging to the genus Trichophyton. Phylogenetic relationships were inferred by maximum likelihood and Bayesian methods on concatenated ITS, LSU and BT2 sequences. Ribosomal ITS region polymorphisms were assessed directly on the alignment. By phylogenetic reconstruction, we reveal major anthropophilic and zoophilic species clusters in the genus Trichophyton. We describe several sequences of the ITS region of T. interdigitale, which do not fit in the traditional polymorphism scheme and propose emendations in this scheme for discrimination between ITS sequence types in T. interdigitale. The new polymorphism scheme will allow inclusion of a wider spectrum of isolates while retaining its explanatory power. This scheme was also found to be partially congruent with NTS typing technique. © 2016 Blackwell Verlag GmbH.

  12. Genetic characterization of human-pathogenic Cyclospora cayetanensis parasites from three endemic regions at the 18S ribosomal RNA locus.

    Science.gov (United States)

    Sulaiman, Irshad M; Ortega, Ynes; Simpson, Steven; Kerdahi, Khalil

    2014-03-01

    Cyclospora cayetanensis is an apicocomplexan parasite that infects the gastrointestinal tract and causes acute diarrheal disease in humans. In recent years, this human-pathogenic parasite has led to several foodborne outbreaks in the United States and Canada, mostly associated with imported produce. Understanding the biology and epidemiology of C. cayetanensis is difficult because little is known about its origin, possible zoonotic reservoirs, and genetic relationships with other coccidian parasites. Recently, we developed a 70kDa heat shock protein (HSP70) gene based nested PCR protocol for detection of C. cayetanensis parasite and sequenced the PCR products of 16 human isolates from Nepal, Mexico, and Peru. In this study, we have characterized the regions of 18S ribosomal RNA (rRNA) gene of 17 human C. cayetanensis isolates for molecular detection, and also to ascertain the genetic diversity of this parasite. The 18S rRNA primer sets were further tested by PCR amplification followed by nucleotide sequencing of the PCR amplified products of previously characterized C. cayetanensis isolates from three endemic regions at HSP70 locus. Although no genetic polymorphism was observed at the regions of HSP70 locus characterized in our previous study, the data analysis of this study revealed a minor genetic diversity at the 18S rRNA locus among the C. cayetanensis isolates. The 18S rRNA gene-based nested PCR protocol provides a useful genetic marker for the detection of C. cayetanensis parasite and confirms it as a genetically distinct species in genus Cyclospora. The results also supported lack of geographic segregation and existence of genetically homogeneous population for the C. cayetanensis parasites both at the HSP70 as well as at the18S rRNA loci. Published by Elsevier B.V.

  13. Remodeling of ribosomal genes in somatic cells by Xenopus egg extract

    DEFF Research Database (Denmark)

    Østrup, Olga; Hyttel, Poul; Klærke, Dan Arne

    2011-01-01

    Extracts from Xenopus eggs can reprogram gene expression in somatic nuclei, however little is known about the earliest processes associated with the switch in the transcriptional program. We show here that an early reprogramming event is the remodeling of ribosomal chromatin and gene expression....... This occurs within hours of extract treatment and is distinct from a stress response. Egg extract elicits remodeling of the nuclear envelope, chromatin and nucleolus. Nucleolar remodeling involves a rapid and stable decrease in ribosomal gene transcription, and promoter targeting of the nucleolar remodeling...... and elicits a stress-type nuclear response. Thus, an early event of Xenopus egg extract-mediated nuclear reprogramming is the remodeling of ribosomal genes involving nucleolar remodeling complex. Condition-specific and rapid silencing of ribosomal genes may serve as a sensitive marker for evaluation...

  14. Ribosomal proteins S12 and S13 function as control elements for translocation of the mRNA:tRNA complex.

    Science.gov (United States)

    Cukras, Anthony R; Southworth, Daniel R; Brunelle, Julie L; Culver, Gloria M; Green, Rachel

    2003-08-01

    Translocation of the mRNA:tRNA complex through the ribosome is promoted by elongation factor G (EF-G) during the translation cycle. Previous studies established that modification of ribosomal proteins with thiol-specific reagents promotes this event in the absence of EF-G. Here we identify two small subunit interface proteins S12 and S13 that are essential for maintenance of a pretranslocation state. Omission of these proteins using in vitro reconstitution procedures yields ribosomal particles that translate in the absence of enzymatic factors. Conversely, replacement of cysteine residues in these two proteins yields ribosomal particles that are refractive to stimulation with thiol-modifying reagents. These data support a model where S12 and S13 function as control elements for the more ancient rRNA- and tRNA-driven movements of translocation.

  15. Expression of ribosomal genes in pea cotyledons at the initial stages of germination

    International Nuclear Information System (INIS)

    Gumilevskaya, N.A.; Chumikhina, L.V.; Akhmatova, A.T.; Kretovich, V.L.

    1986-01-01

    The time of appearance of newly synthesized rRNAs and ribosomal proteins (r-proteins) in the ribosomes of pea cotyledons (Pisum sativum L.) during germination was investigated. The ribosomal fraction was isolated and analyzed according to the method of germination of the embryo in the presence of labeled precursors or after pulse labeling of the embryos at different stages of germination. For the identification of newly synthesized rRNAs in the ribosomes we estimated the relative stability of labeled RNAs to the action of RNase, the sedimentation rate, the ability to be methylated in vivo in the presence of [ 14 C]CH 3 -methionine, and the localization in the subunits of dissociated ribosomes. The presence of newly synthesized r-proteins in the ribosomes was judged on the basis of the electrophoretic similarity in SDS-disc electrophoresis of labeled polypeptides of purified ribosome preparations and of genuine r-proteins, as well as according to the localization of labeled proteins in the subunits of the dissociated ribosomes. It was shown that the expression of the ribosomal genes in highly specialized cells of pea cotyledons that have completed their growth occurs at very early stages of germination

  16. Ribosomal proteins L11 and L10.(L12)4 and the antibiotic thiostrepton interact with overlapping regions of the 23 S rRNA backbone in the ribosomal GTPase centre

    DEFF Research Database (Denmark)

    Rosendahl, G; Douthwaite, S

    1993-01-01

    RNA, and to investigate how this interaction is influenced by other ribosomal components. Complexes were characterized in both naked 23 S rRNA and ribosomes from an E. coli L11-minus strain, before and after reconstitution with L11. The protein protects 17 riboses between positions 1058 and 1085 in the naked 23 S r......The Escherichia coli ribosomal protein (r-protein) L11 and its binding site on 23 S ribosomal RNA (rRNA) are associated with ribosomal hydrolysis of guanosine 5'-triphosphate (GTP). We have used hydroxyl radical footprinting to map the contacts between L11 and the backbone riboses in 23 S r......)4 and other proteins within the ribosome. The antibiotics thiostrepton and micrococcin inhibit the catalytic functions of this region by slotting in between the accessible loops and interacting with nucleotides there....

  17. Clusters of basic amino acids contribute to RNA binding and nucleolar localization of ribosomal protein L22.

    Directory of Open Access Journals (Sweden)

    Jennifer L Houmani

    Full Text Available The ribosomal protein L22 is a component of the 60S eukaryotic ribosomal subunit. As an RNA-binding protein, it has been shown to interact with both cellular and viral RNAs including 28S rRNA and the Epstein-Barr virus encoded RNA, EBER-1. L22 is localized to the cell nucleus where it accumulates in nucleoli. Although previous studies demonstrated that a specific amino acid sequence is required for nucleolar localization, the RNA-binding domain has not been identified. Here, we investigated the hypothesis that the nucleolar accumulation of L22 is linked to its ability to bind RNA. To address this hypothesis, mutated L22 proteins were generated to assess the contribution of specific amino acids to RNA binding and protein localization. Using RNA-protein binding assays, we demonstrate that basic amino acids 80-93 are required for high affinity binding of 28S rRNA and EBER-1 by L22. Fluorescence localization studies using GFP-tagged mutated L22 proteins further reveal that basic amino acids 80-93 are critical for nucleolar accumulation and for incorporation into ribosomes. Our data support the growing consensus that the nucleolar accumulation of ribosomal proteins may not be mediated by a defined localization signal, but rather by specific interaction with established nucleolar components such as rRNA.

  18. MMB-GUI: a fast morphing method demonstrates a possible ribosomal tRNA translocation trajectory.

    Science.gov (United States)

    Tek, Alex; Korostelev, Andrei A; Flores, Samuel Coulbourn

    2016-01-08

    Easy-to-use macromolecular viewers, such as UCSF Chimera, are a standard tool in structural biology. They allow rendering and performing geometric operations on large complexes, such as viruses and ribosomes. Dynamical simulation codes enable modeling of conformational changes, but may require considerable time and many CPUs. There is an unmet demand from structural and molecular biologists for software in the middle ground, which would allow visualization combined with quick and interactive modeling of conformational changes, even of large complexes. This motivates MMB-GUI. MMB uses an internal-coordinate, multiscale approach, yielding as much as a 2000-fold speedup over conventional simulation methods. We use Chimera as an interactive graphical interface to control MMB. We show how this can be used for morphing of macromolecules that can be heterogeneous in biopolymer type, sequence, and chain count, accurately recapitulating structural intermediates. We use MMB-GUI to create a possible trajectory of EF-G mediated gate-passing translocation in the ribosome, with all-atom structures. This shows that the GUI makes modeling of large macromolecules accessible to a wide audience. The morph highlights similarities in tRNA conformational changes as tRNA translocates from A to P and from P to E sites and suggests that tRNA flexibility is critical for translocation completion. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  19. An approach to analyse the specific impact of rapamycin on mRNA-ribosome association

    Directory of Open Access Journals (Sweden)

    Jaquier-Gubler Pascale

    2008-08-01

    Full Text Available Abstract Background Recent work, using both cell culture model systems and tumour derived cell lines, suggests that the differential recruitment into polysomes of mRNA populations may be sufficient to initiate and maintain tumour formation. Consequently, a major effort is underway to use high density microarray profiles to establish molecular fingerprints for cells exposed to defined drug regimes. The aim of these pharmacogenomic approaches is to provide new information on how drugs can impact on the translational read-out within a defined cellular background. Methods We describe an approach that permits the analysis of de-novo mRNA-ribosome association in-vivo during short drug exposures. It combines hypertonic shock, polysome fractionation and high-throughput analysis to provide a molecular phenotype of translationally responsive transcripts. Compared to previous translational profiling studies, the procedure offers increased specificity due to the elimination of the drugs secondary effects (e.g. on the transcriptional read-out. For this pilot "proof-of-principle" assay we selected the drug rapamycin because of its extensively studied impact on translation initiation. Results High throughput analysis on both the light and heavy polysomal fractions has identified mRNAs whose re-recruitment onto free ribosomes responded to short exposure to the drug rapamycin. The results of the microarray have been confirmed using real-time RT-PCR. The selective down-regulation of TOP transcripts is also consistent with previous translational profiling studies using this drug. Conclusion The technical advance outlined in this manuscript offers the possibility of new insights into mRNA features that impact on translation initiation and provides a molecular fingerprint for transcript-ribosome association in any cell type and in the presence of a range of drugs of interest. Such molecular phenotypes defined pre-clinically may ultimately impact on the evaluation of

  20. How does a scanning ribosomal particle move along the 5'-untranslated region of eukaryotic mRNA? Brownian Ratchet model.

    Science.gov (United States)

    Spirin, Alexander S

    2009-11-17

    A model of the ATP-dependent unidirectional movement of the 43S ribosomal initiation complex (=40S ribosomal subunit + eIF1 + eIF1A + eIF2.GTP.Met-tRNA(i) + eIF3) during scanning of the 5'-untranslated region of eukaryotic mRNA is proposed. The model is based on the principles of molecular Brownian ratchet machines and explains several enigmatic data concerning the scanning complex. In this model, the one-dimensional diffusion of the ribosomal initiation complex along the mRNA chain is rectified into the net-unidirectional 5'-to-3' movement by the Feynman ratchet-and-pawl mechanism. The proposed mechanism is organized by the heterotrimeric protein eIF4F (=eIF4A + eIF4E + eIF4G), attached to the scanning ribosomal particle via eIF3, and the RNA-binding protein eIF4B that is postulated to play the role of the pawl. The energy for the useful work of the ratchet-and-pawl mechanism is supplied from ATP hydrolysis induced by the eIF4A subunit: ATP binding and its hydrolysis alternately change the affinities of eIF4A for eIF4B and for mRNA, resulting in the restriction of backward diffusional sliding of the 43S ribosomal complex along the mRNA chain, while stochastic movements ahead are allowed.

  1. Effects of S-adenosylmethionine decarboxylase, polyamines, amino acids, and weak bases (amines and ammonia) on development and ribosomal RNA synthesis in Xenopus embryos.

    Science.gov (United States)

    Shiokawa, Koichiro; Aso, Mai; Kondo, Takeshi; Takai, Jun-Ichi; Yoshida, Junki; Mishina, Takamichi; Fuchimukai, Kota; Ogasawara, Tsukasa; Kariya, Taro; Tashiro, Kosuke; Igarashi, Kazuei

    2010-02-01

    We have been studying control mechanisms of gene expression in early embryogenesis in a South African clawed toad Xenopus laevis, especially during the period of midblastula transition (MBT), or the transition from the phase of active cell division (cleavage stage) to the phase of extensive morphogenesis (post-blastular stages). We first found that ribosomal RNA synthesis is initiated shortly after MBT in Xenopus embryos and those weak bases, such as amines and ammonium ion, selectively inhibit the initiation and subsequent activation of rRNA synthesis. We then found that rapidly labeled heterogeneous mRNA-like RNA is synthesized in embryos at pre-MBT stage. We then performed cloning and expression studies of several genes, such as those for activin receptors, follistatin and aldolases, and then reached the studies of S-adenosylmethionine decarboxylase (SAMDC), a key enzyme in polyamine metabolism. Here, we cloned a Xenopus SAMDC cDNA and performed experiments to overexpress the in vitro-synthesized SAMDC mRNA in Xenopus early embryos, and found that the maternally preset program of apoptosis occurs in cleavage stage embryos, which is executed when embryos reach the stage of MBT. In the present article, we first summarize results on SAMDC and the maternal program of apoptosis, and then describe our studies on small-molecular-weight substances like polyamines, amino acids, and amines in Xenopus embryos. Finally, we summarize our studies on weak bases, especially on ammonium ion, as the specific inhibitor of ribosomal RNA synthesis in Xenopus embryonic cells.

  2. Effect of mutations in the A site of 16 S rRNA on aminoglycoside antibiotic-ribosome interaction

    DEFF Research Database (Denmark)

    Recht, M I; Douthwaite, S; Dahlquist, K D

    1999-01-01

    antibiotics, which also interact with this region of rRNA. Mutations of certain nucleotides in rRNA reduce aminoglycoside binding affinity, as previously demonstrated using a model RNA oligonucleotide system. Here, predictions from the oligonucleotide system were tested in the ribosome by mutation...... for the aminoglycoside paromomycin, whereas no discernible reduction in affinity was observed with 1406 mutant ribosomes. These data are consistent with prior NMR structural determination of aminoglycoside interaction with the decoding region, and further our understanding of how aminoglycoside resistance can...

  3. Functional characterization of the Drosophila MRP (mitochondrial RNA processing) RNA gene.

    Science.gov (United States)

    Schneider, Mary D; Bains, Anupinder K; Rajendra, T K; Dominski, Zbigniew; Matera, A Gregory; Simmonds, Andrew J

    2010-11-01

    MRP RNA is a noncoding RNA component of RNase mitochondrial RNA processing (MRP), a multi-protein eukaryotic endoribonuclease reported to function in multiple cellular processes, including ribosomal RNA processing, mitochondrial DNA replication, and cell cycle regulation. A recent study predicted a potential Drosophila ortholog of MRP RNA (CR33682) by computer-based genome analysis. We have confirmed the expression of this gene and characterized the phenotype associated with this locus. Flies with mutations that specifically affect MRP RNA show defects in growth and development that begin in the early larval period and end in larval death during the second instar stage. We present several lines of evidence demonstrating a role for Drosophila MRP RNA in rRNA processing. The nuclear fraction of Drosophila MRP RNA localizes to the nucleolus. Further, a mutant strain shows defects in rRNA processing that include a defect in 5.8S rRNA processing, typical of MRP RNA mutants in other species, as well as defects in early stages of rRNA processing.

  4. Effect of single base changes and the absence of modified bases in 16S RNA on the reconstitution and function of Escherichia coli 30S ribosomes

    International Nuclear Information System (INIS)

    Denman, R.; Krzyzosiak, W.; Nurse, K.; Ofengand, J.

    1987-01-01

    The gene coding for E. coli 16S rRNA was placed in pUC19 under the control of the strong class III T7 promoter, phi 10, by ligation of the 1490 bp BclI/BstEII fragment of the rrnB operon with appropriate synthetic oligodeoxynucleotides. Such constructs allowed efficient in vitro synthesis of full-length transcripts (up to 900 mol RNA/mol template) free of modified bases. The synthetic RNA could be assembled into 30S subunits upon addition of E. coli 30S ribosomal proteins. The particles co-sedimented with authentic 30S particles and were electron microscopically indistinguishable from them. Upon addition of 50S subunits, codon-dependent P-site binding of tRNA and codon-dependent polypeptide synthesis were >80% of 30S reconstituted from natural 16S RNA and >50% of isolated 30S. UV-induced crosslinking of P-site bound AcVal-tRNA to residue C 1400 was preserved. Changing C 1400 to A had little effect on reconstitution, P-site binding, or polypeptide synthesis. However, the substitution of C 1499 by G markedly inhibited assembly. The effect on P-site binding and polypeptide synthesis is under study. These results show (1) none of the modified bases of 16S RNA are essential for protein synthesis, (2) substitution of A for C 1400 has little functional effect, and (3) position 1400 may be important for ribosome assembly

  5. Ribosomal genes as early targets of cadmium-induced toxicity in Chironomus riparius larvae

    International Nuclear Information System (INIS)

    Planello, R.; Martinez-Guitarte, J.L.; Morcillo, G.

    2007-01-01

    Cadmium is a widespread environmental pollutant that causes severe impacts in organisms. Although the effects of cadmium on aquatic insects have been studied in terms of their toxicity and changes in developmental parameters, little is known about its molecular and genetic effects. We have investigated the alterations in the pattern of gene expression provoked by acute exposure to cadmium in Chironomus riparius Mg. (Diptera, Chironomidae), a sentinel organism widely used in aquatic toxicity testing. The early cytotoxic effects were evaluated using immunocytochemistry and specific fluorescent probes in fourth instar larvae after 12 h of 10 mM cadmium treatments; under these conditions no significant effect on larvae mortality was detected until after 36 h of exposure. The changes in the pattern of gene expression were analysed by means of DNA/RNA hybrid antibodies in the polytene chromosomes from salivary gland cells. A decrease in the activity of the nucleolus is especially remarkable, accompanied by a significant reduction in size and the modification in nucleolar architecture, as shown by FISH. The inhibition of rDNA transcription was further evaluated by Northern blot analysis, which showed a marked decrease in the level of preribosomal rRNA (54% 45S 12 h). However, the BR genes, whose products are the giant polypeptides that constitute the silk-like secretion for constructing housing tubes, remain active. Simultaneously, decondensation and activation take place at some chromosomal regions, especially at the centromeres. The changes observed in the pattern of gene expression do not resemble those found after heat shock or other cell stressors. These data provide the first evidence that cadmium interacts with ribosomal genes and results in a drastic impairment of the functional activity of the nucleolus, an essential organelle for cellular survival. Therefore, the depletion of ribosomes would be a long-term effect of Cd-induced cellular damage. These findings may

  6. Ribosomal genes as early targets of cadmium-induced toxicity in Chironomus riparius larvae

    Energy Technology Data Exchange (ETDEWEB)

    Planello, R. [Biologia Ambiental, Facultad de Ciencias, Universidad Nacional de Educacion a Distancia, Senda del Rey 9, 28040, Madrid (Spain); Martinez-Guitarte, J.L. [Biologia Ambiental, Facultad de Ciencias, Universidad Nacional de Educacion a Distancia, Senda del Rey 9, 28040, Madrid (Spain); Morcillo, G. [Biologia Ambiental, Facultad de Ciencias, Universidad Nacional de Educacion a Distancia, Senda del Rey 9, 28040, Madrid (Spain)]. E-mail: gmorcillo@ccia.uned.es

    2007-02-01

    Cadmium is a widespread environmental pollutant that causes severe impacts in organisms. Although the effects of cadmium on aquatic insects have been studied in terms of their toxicity and changes in developmental parameters, little is known about its molecular and genetic effects. We have investigated the alterations in the pattern of gene expression provoked by acute exposure to cadmium in Chironomus riparius Mg. (Diptera, Chironomidae), a sentinel organism widely used in aquatic toxicity testing. The early cytotoxic effects were evaluated using immunocytochemistry and specific fluorescent probes in fourth instar larvae after 12 h of 10 mM cadmium treatments; under these conditions no significant effect on larvae mortality was detected until after 36 h of exposure. The changes in the pattern of gene expression were analysed by means of DNA/RNA hybrid antibodies in the polytene chromosomes from salivary gland cells. A decrease in the activity of the nucleolus is especially remarkable, accompanied by a significant reduction in size and the modification in nucleolar architecture, as shown by FISH. The inhibition of rDNA transcription was further evaluated by Northern blot analysis, which showed a marked decrease in the level of preribosomal rRNA (54% 45S 12 h). However, the BR genes, whose products are the giant polypeptides that constitute the silk-like secretion for constructing housing tubes, remain active. Simultaneously, decondensation and activation take place at some chromosomal regions, especially at the centromeres. The changes observed in the pattern of gene expression do not resemble those found after heat shock or other cell stressors. These data provide the first evidence that cadmium interacts with ribosomal genes and results in a drastic impairment of the functional activity of the nucleolus, an essential organelle for cellular survival. Therefore, the depletion of ribosomes would be a long-term effect of Cd-induced cellular damage. These findings may

  7. Deciphering the role of the Gag-Pol ribosomal frameshift signal in HIV-1 RNA genome packaging.

    Science.gov (United States)

    Nikolaitchik, Olga A; Hu, Wei-Shau

    2014-04-01

    A key step of retroviral replication is packaging of the viral RNA genome during virus assembly. Specific packaging is mediated by interactions between the viral protein Gag and elements in the viral RNA genome. In HIV-1, similar to most retroviruses, the packaging signal is located within the 5' untranslated region and extends into the gag-coding region. A recent study reported that a region including the Gag-Pol ribosomal frameshift signal plays an important role in HIV-1 RNA packaging; deletions or mutations that affect the RNA structure of this signal lead to drastic decreases (10- to 50-fold) in viral RNA packaging and virus titer. We examined here the role of the ribosomal frameshift signal in HIV-1 RNA packaging by studying the RNA packaging and virus titer in the context of proviruses. Three mutants with altered ribosomal frameshift signal, either through direct deletion of the signal, mutation of the 6U slippery sequence, or alterations of the secondary structure were examined. We found that RNAs from all three mutants were packaged efficiently, and they generate titers similar to that of a virus containing the wild-type ribosomal frameshift signal. We conclude that although the ribosomal frameshift signal plays an important role in regulating the replication cycle, this RNA element is not directly involved in regulating RNA encapsidation. To generate infectious viruses, HIV-1 must package viral RNA genome during virus assembly. The specific HIV-1 genome packaging is mediated by interactions between the structural protein Gag and elements near the 5' end of the viral RNA known as packaging signal. In this study, we examined whether the Gag-Pol ribosomal frameshift signal is important for HIV-1 RNA packaging as recently reported. Our results demonstrated that when Gag/Gag-Pol is supplied in trans, none of the tested ribosomal frameshift signal mutants has defects in RNA packaging or virus titer. These studies provide important information on how HIV-1

  8. Oxidative damage of 18S and 5S ribosomal RNA in digestive gland of mussels exposed to trace metals.

    Science.gov (United States)

    Kournoutou, Georgia G; Giannopoulou, Panagiota C; Sazakli, Eleni; Leotsinidis, Michel; Kalpaxis, Dimitrios L

    2017-11-01

    Numerous studies have shown the ability of trace metals to accumulate in marine organisms and cause oxidative stress that leads to perturbations in many important intracellular processes, including protein synthesis. This study is mainly focused on the exploration of structural changes, like base modifications, scissions, and conformational changes, caused in 18S and 5S ribosomal RNA (rRNA) isolated from the mussel Mytilus galloprovincialis exposed to 40μg/L Cu, 30μg/L Hg, or 100μg/L Cd, for 5 or 15days. 18S rRNA and 5S rRNA are components of the small and large ribosomal subunit, respectively, found in complex with ribosomal proteins, translation factors and other auxiliary components (metal ions, toxins etc). 18S rRNA plays crucial roles in all stages of protein synthesis, while 5S rRNA serves as a master signal transducer between several functional regions of 28S rRNA. Therefore, structural changes in these ribosomal constituents could affect the basic functions of ribosomes and hence the normal metabolism of cells. Especially, 18S rRNA along with ribosomal proteins forms the decoding centre that ensures the correct codon-anticodon pairing. As exemplified by ELISA, primer extension analysis and DMS footprinting analysis, each metal caused oxidative damage to rRNA, depending on the nature of metal ion and the duration of exposure. Interestingly, exposure of mussels to Cu or Hg caused structural alterations in 5S rRNA, localized in paired regions and within loops A, B, C, and E, leading to a continuous progressive loss of the 5S RNA structural integrity. In contrast, structural impairments of 5S rRNA in mussels exposed to Cd were accumulating for the initial 5days, and then progressively decreased to almost the normal level by day 15, probably due to the parallel elevation of metallothionein content that depletes the pools of free Cd. Regions of interest in 18S rRNA, such as the decoding centre, sites implicated in the binding of tRNAs (A- and P-sites) or

  9. Selection of mRNA 5'-untranslated region sequence with high translation efficiency through ribosome display

    International Nuclear Information System (INIS)

    Mie, Masayasu; Shimizu, Shun; Takahashi, Fumio; Kobatake, Eiry

    2008-01-01

    The 5'-untranslated region (5'-UTR) of mRNAs functions as a translation enhancer, promoting translation efficiency. Many in vitro translation systems exhibit a reduced efficiency in protein translation due to decreased translation initiation. The use of a 5'-UTR sequence with high translation efficiency greatly enhances protein production in these systems. In this study, we have developed an in vitro selection system that favors 5'-UTRs with high translation efficiency using a ribosome display technique. A 5'-UTR random library, comprised of 5'-UTRs tagged with a His-tag and Renilla luciferase (R-luc) fusion, were in vitro translated in rabbit reticulocytes. By limiting the translation period, only mRNAs with high translation efficiency were translated. During translation, mRNA, ribosome and translated R-luc with His-tag formed ternary complexes. They were collected with translated His-tag using Ni-particles. Extracted mRNA from ternary complex was amplified using RT-PCR and sequenced. Finally, 5'-UTR with high translation efficiency was obtained from random 5'-UTR library

  10. Import of desired nucleic acid sequences using addressing motif of mitochondrial ribosomal 5S-rRNA for fluorescent in vivo hybridization of mitochondrial DNA and RNA.

    Science.gov (United States)

    Zelenka, Jaroslav; Alán, Lukáš; Jabůrek, Martin; Ježek, Petr

    2014-04-01

    Based on the matrix-addressing sequence of mitochondrial ribosomal 5S-rRNA (termed MAM), which is naturally imported into mitochondria, we have constructed an import system for in vivo targeting of mitochondrial DNA (mtDNA) or mt-mRNA, in order to provide fluorescence hybridization of the desired sequences. Thus DNA oligonucleotides were constructed, containing the 5'-flanked T7 RNA polymerase promoter. After in vitro transcription and fluorescent labeling with Alexa Fluor(®) 488 or 647 dye, we obtained the fluorescent "L-ND5 probe" containing MAM and exemplar cargo, i.e., annealing sequence to a short portion of ND5 mRNA and to the light-strand mtDNA complementary to the heavy strand nd5 mt gene (5'-end 21 base pair sequence). For mitochondrial in vivo fluorescent hybridization, HepG2 cells were treated with dequalinium micelles, containing the fluorescent probes, bringing the probes proximally to the mitochondrial outer membrane and to the natural import system. A verification of import into the mitochondrial matrix of cultured HepG2 cells was provided by confocal microscopy colocalizations. Transfections using lipofectamine or probes without 5S-rRNA addressing MAM sequence or with MAM only were ineffective. Alternatively, the same DNA oligonucleotides with 5'-CACC overhang (substituting T7 promoter) were transcribed from the tetracycline-inducible pENTRH1/TO vector in human embryonic kidney T-REx®-293 cells, while mitochondrial matrix localization after import of the resulting unlabeled RNA was detected by PCR. The MAM-containing probe was then enriched by three-order of magnitude over the natural ND5 mRNA in the mitochondrial matrix. In conclusion, we present a proof-of-principle for mitochondrial in vivo hybridization and mitochondrial nucleic acid import.

  11. Novel extraction strategy of ribosomal RNA and genomic DNA from cheese for PCR-based investigations.

    Science.gov (United States)

    Bonaïti, Catherine; Parayre, Sandrine; Irlinger, Françoise

    2006-03-15

    Cheese microorganisms, such as bacteria and fungi, constitute a complex ecosystem that plays a central role in cheeses ripening. The molecular study of cheese microbial diversity and activity is essential but the extraction of high quality nucleic acid may be problematic: the cheese samples are characterised by a strong buffering capacity which negatively influenced the yield of the extracted rRNA. The objective of this study is to develop an effective method for the direct and simultaneous isolation of yeast and bacterial ribosomal RNA and genomic DNA from the same cheese samples. DNA isolation was based on a protocol used for nucleic acids isolation from anaerobic digestor, without preliminary washing step with the combined use of the action of chaotropic agent (acid guanidinium thiocyanate), detergents (SDS, N-lauroylsarcosine), chelating agent (EDTA) and a mechanical method (bead beating system). The DNA purification was carried out by two washing steps of phenol-chloroform. RNA was isolated successfully after the second acid extraction step by recovering it from the phenolic phase of the first acid extraction. The novel method yielded pure preparation of undegraded RNA accessible for reverse transcription-PCR. The extraction protocol of genomic DNA and rRNA was applicable to complex ecosystem of different cheese matrices.

  12. Processing of the 17-S Escherichia coli precursor RNA in the 27-S pre-ribosomal particle

    Energy Technology Data Exchange (ETDEWEB)

    Hayes, F; Vasseur, M [Institut de Biologie Physico-Chimique, 75 - Paris (France)

    1976-01-01

    An RNase activity probably involved in the maturation of 16-S pre-ribosomal RNA in Escherichia coli has been partially purified from crude cell extracts. When 27-S ribosome precursor particles are incubated with this enzyme preparation in vitro, their 17-S RNA is converted to a product with the same electrophoretic mobility as mature 16-S rRNA. FingerprS rRNA. Generation of the normal 5'-P terminus seems to require a factor present in cell extracts since incubation of the 27-S precursor particle in an extract obtained after centrifugation at 30,000 x g causes conversion of the 17-S RNA to a 16-S species containing both termini of mature 16-S rRNS. Preliminary experiments suggest that correct maturation of the 5' end of the 17-S precursor RNA requires a system in which protein synthesis can take place.

  13. tmRNA-mediated trans-translation as the major ribosome rescue system in a bacterial cell

    Directory of Open Access Journals (Sweden)

    Hyouta eHimeno

    2014-04-01

    Full Text Available tmRNA (transfer messenger RNA; also known as 10Sa RNA or SsrA RNA is a small RNA molecule that is conserved among bacteria. It has structural and functional similarities to tRNA: it has an upper half of the tRNA-like structure, its 5’ end is processed by RNase P, it has typical tRNA-specific base modifications, it is aminoacylated with alanine, it binds to EF-Tu after aminoacylation and it enters the ribosome with EF-Tu and GTP. However, tmRNA lacks an anticodon, and instead it has a coding sequence for a short peptide called tag-peptide. An elaborate interplay of actions of tmRNA as both tRNA and mRNA with the help of a tmRNA-binding protein, SmpB, facilitates trans-translation, which produces a single polypeptide from two mRNA molecules. Initially alanyl-tmRNA in complex with EF-Tu and SmpB enters the vacant A-site of the stalled ribosome like aminoacyl-tRNA but without a codon-anticodon interaction, and subsequently truncated mRNA is replaced with the tag-encoding region of tmRNA. During these processes, not only tmRNA but also SmpB structurally and functionally mimics both tRNA and mRNA. Thus trans-translation rescues the stalled ribosome, thereby allowing recycling of the ribosome. Since the tag-peptide serves as a target of AAA+ proteases, the trans-translation products are preferentially degraded so that they do not accumulate in the cell. Although alternative rescue systems have recently been revealed, trans-translation is the only system that universally exists in bacteria. Furthermore, it is unique in that it employs a small RNA and that it prevents accumulation of nonfunctional proteins from truncated mRNA in the cell. It might play the major role in rescuing the stalled translation in the bacterial cell.

  14. Evidence for ribosomal frameshifting and a novel overlapping gene in the genomes of insect-specific flaviviruses

    International Nuclear Information System (INIS)

    Firth, Andrew E.; Blitvich, Bradley J.; Wills, Norma M.; Miller, Cathy L.; Atkins, John F.

    2010-01-01

    Flaviviruses have a positive-sense, single-stranded RNA genome of ∼11 kb, encoding a large polyprotein that is cleaved to produce ∼10 mature proteins. Cell fusing agent virus, Kamiti River virus, Culex flavivirus and several recently discovered flaviviruses have no known vertebrate host and apparently infect only insects. We present compelling bioinformatic evidence for a 253-295 codon overlapping gene (designated fifo) conserved throughout these insect-specific flaviviruses and immunofluorescent detection of its product. Fifo overlaps the NS2A/NS2B coding sequence in the - 1/+ 2 reading frame and is most likely expressed as a trans-frame fusion protein via ribosomal frameshifting at a conserved GGAUUUY slippery heptanucleotide with 3'-adjacent RNA secondary structure (which stimulates efficient frameshifting in vitro). The discovery bears striking parallels to the recently discovered ribosomal frameshifting site in the NS2A coding sequence of the Japanese encephalitis serogroup of flaviviruses and suggests that programmed ribosomal frameshifting may be more widespread in flaviviruses than currently realized.

  15. A review on architecture of the gag-pol ribosomal frameshifting RNA in human immunodeficiency virus: a variability survey of virus genotypes.

    Science.gov (United States)

    Qiao, Qi; Yan, Yanhua; Guo, Jinmei; Du, Shuqiang; Zhang, Jiangtao; Jia, Ruyue; Ren, Haimin; Qiao, Yuanbiao; Li, Qingshan

    2017-06-01

    Programmed '-1' ribosomal frameshifting is necessary for expressing the pol gene overlapped from a gag of human immunodeficiency virus. A viral RNA structure that requires base pairing across the overlapping sequence region suggests a mechanism of regulating ribosome and helicase traffic during expression. To get precise roles of an element around the frameshift site, a review on architecture of the frameshifting RNA is performed in combination of reported information with augments of a representative set of 19 viral samples. In spite of a different length for the viral RNAs, a canonical comparison on the element sequence allocation is performed for viewing variability associations between virus genotypes. Additionally, recent and historical insights recognized in frameshifting regulation are looked back as for indel and single nucleotide polymorphism of RNA. As specially noted, structural changes at a frameshift site, the spacer sequence, and a three-helix junction element, as well as two Watson-Crick base pairs near a bulge and a C-G pair close a loop, are the most vital strategies for the virus frameshifting regulations. All of structural changes, which are dependent upon specific sequence variations, facilitate an elucidation about the RNA element conformation-dependent mechanism for frameshifting. These facts on disrupting base pair interactions also allow solving the problem of competition between ribosome and helicase on a same RNA template, common to single-stranded RNA viruses. In a broad perspective, each new insight of frameshifting regulation in the competition systems introduced by the RNA element construct changes will offer a compelling target for antiviral therapy.

  16. Characterization of the ovine ribosomal protein SA gene and its pseudogenes

    Directory of Open Access Journals (Sweden)

    Van Zeveren Alex

    2010-03-01

    Full Text Available Abstract Background The ribosomal protein SA (RPSA, previously named 37-kDa laminin receptor precursor/67-kDa laminin receptor (LRP/LR is a multifunctional protein that plays a role in a number of pathological processes, such as cancer and prion diseases. In all investigated species, RPSA is a member of a multicopy gene family consisting of one full length functional gene and several pseudogenes. Therefore, for studies on RPSA related pathways/pathologies, it is important to characterize the whole family and to address the possible function of the other RPSA family members. The present work aims at deciphering the RPSA family in sheep. Results In addition to the full length functional ovine RPSA gene, 11 other members of this multicopy gene family, all processed pseudogenes, were identified. Comparison between the RPSA transcript and these pseudogenes shows a large variety in sequence identities ranging from 99% to 74%. Only one of the 11 pseudogenes, i.e. RPSAP7, shares the same open reading frame (ORF of 295 amino acids with the RPSA gene, differing in only one amino acid. All members of the RPSA family were annotated by comparative mapping and fluorescence in situ hybridization (FISH localization. Transcription was investigated in the cerebrum, cerebellum, spleen, muscle, lymph node, duodenum and blood, and transcripts were detected for 6 of the 11 pseudogenes in some of these tissues. Conclusions In the present work we have characterized the ovine RPSA family. Our results have revealed the existence of 11 ovine RPSA pseudogenes and provide new data on their structure and sequence. Such information will facilitate molecular studies of the functional RPSA gene taking into account the existence of these pseudogenes in the design of experiments. It remains to be investigated if the transcribed members are functional as regulatory non-coding RNA or as functional proteins.

  17. Resistance to linezolid in Staphylococcus spp. clinical isolates associated with ribosomal binding site modifications: novel mutation in domain V of 23S rRNA.

    Science.gov (United States)

    Musumeci, Rosario; Calaresu, Enrico; Gerosa, Jolanda; Oggioni, Davide; Bramati, Simone; Morelli, Patrizia; Mura, Ida; Piana, Andrea; Are, Bianca Maria; Cocuzza, Clementina Elvezia

    2016-10-01

    Linezolid is the main representative of the oxazolidinones, introduced in 2000 in clinical practice to treat severe Gram-positive infections. This compound inhibits protein synthesis by binding to the peptidyl transferase centre of the 50S bacterial ribosomal subunit. The aim of this study was to characterize 12 clinical strains of linezolid-resistant Staphylococcus spp. isolated in Northern Italy. All isolates of Staphylococcus spp. studied showed a multi-antibiotic resistance phenotype. In particular, all isolates showed the presence of the mecA gene associated with SSCmec types IVa, V or I. Mutations in domain V of 23S rRNA were shown to be the most prevalent mechanism of linezolid resistance: among these a new C2551T mutation was found in S. aureus, whilst the G2576T mutation was shown to be the most prevalent overall. Moreover, three S. epidermidis isolates were shown to have linezolid resistance associated only with alterations in both L3 and L4 ribosomal proteins. No strain was shown to harbor the previously described cfr gene. These results have shown how the clinical use of linezolid in Northern Italy has resulted in the selection of multiple antibiotic-resistant clinical isolates of Staphylococcus spp., with linezolid resistance in these strains being associated with mutations in 23S rRNA or ribosomal proteins L3 and L4.

  18. Ribosomal protein L5 has a highly twisted concave surface and flexible arms responsible for rRNA binding.

    OpenAIRE

    Nakashima, T; Yao, M; Kawamura, S; Iwasaki, K; Kimura, M; Tanaka, I

    2001-01-01

    Ribosomal protein L5 is a 5S rRNA binding protein in the large subunit and plays an essential role in the promotion of a particular conformation of 5S rRNA. The crystal structure of the ribosomal protein L5 from Bacillus stearothermophilus has been determined at 1.8 A resolution. The molecule consists of a five-stranded antiparallel beta-sheet and four alpha-helices, which fold in a way that is topologically similar to the ribonucleoprotein (RNP) domain. The molecular shape and electrostatic ...

  19. Is The Ribosome Targeted By Adaptive Mutations

    DEFF Research Database (Denmark)

    Jimenez Fernandez, Alicia; Molin, Søren; Johansen, Helle Krogh

    2015-01-01

    Introduction: RNA polymerase and ribosomes, composing the macromolecular synthesis machinery (MMSM), carry out the central processes of transcription and translation, but are usually seen as mechanical elements with no regulatory function. Extensive investigations of gene regulation and the high ...

  20. Connecting the kinetics and energy landscape of tRNA translocation on the ribosome.

    Directory of Open Access Journals (Sweden)

    Paul C Whitford

    Full Text Available Functional rearrangements in biomolecular assemblies result from diffusion across an underlying energy landscape. While bulk kinetic measurements rely on discrete state-like approximations to the energy landscape, single-molecule methods can project the free energy onto specific coordinates. With measures of the diffusion, one may establish a quantitative bridge between state-like kinetic measurements and the continuous energy landscape. We used an all-atom molecular dynamics simulation of the 70S ribosome (2.1 million atoms; 1.3 microseconds to provide this bridge for specific conformational events associated with the process of tRNA translocation. Starting from a pre-translocation configuration, we identified sets of residues that collectively undergo rotary rearrangements implicated in ribosome function. Estimates of the diffusion coefficients along these collective coordinates for translocation were then used to interconvert between experimental rates and measures of the energy landscape. This analysis, in conjunction with previously reported experimental rates of translocation, provides an upper-bound estimate of the free-energy barriers associated with translocation. While this analysis was performed for a particular kinetic scheme of translocation, the quantitative framework is general and may be applied to energetic and kinetic descriptions that include any number of intermediates and transition states.

  1. New Face for Chromatin-Related Mesenchymal Modulator: n-CHD9 Localizes to Nucleoli and Interacts With Ribosomal Genes.

    Science.gov (United States)

    Salomon-Kent, Ronit; Marom, Ronit; John, Sam; Dundr, Miroslav; Schiltz, Louis R; Gutierrez, Jose; Workman, Jerry; Benayahu, Dafna; Hager, Gordon L

    2015-09-01

    Mesenchymal stem cells' differentiation into several lineages is coordinated by a complex of transcription factors and co-regulators which bind to specific gene promoters. The Chromatin-Related Mesenchymal Modulator, CHD9 demonstrated in vitro its ability for remodeling activity to reposition nucleosomes in an ATP-dependent manner. Epigenetically, CHD9 binds with modified H3-(K9me2/3 and K27me3). Previously, we presented a role for CHD9 with RNA Polymerase II (Pol II)-dependent transcription of tissue specific genes. Far less is known about CHD9 function in RNA Polymerase I (Pol I) related transcription of the ribosomal locus that also drives specific cell fate. We here describe a new form, the nucleolar CHD9 (n-CHD9) that is dynamically associated with Pol I, fibrillarin, and upstream binding factor (UBF) in the nucleoli, as shown by imaging and molecular approaches. Inhibitors of transcription disorganized the nucleolar compartment of transcription sites where rDNA is actively transcribed. Collectively, these findings link n-CHD9 with RNA pol I transcription in fibrillar centers. Using chromatin immunoprecipitation (ChIP) and tilling arrays (ChIP- chip), we find an association of n-CHD9 with Pol I related to rRNA biogenesis. Our new findings support the role for CHD9 in chromatin regulation and association with rDNA genes, in addition to its already known function in transcription control of tissue specific genes. © 2015 Wiley Periodicals, Inc.

  2. Mutant forms of Escherichia coli protein L25 unable to bind to 5S rRNA are incorporated efficiently into the ribosome in vivo.

    Science.gov (United States)

    Anikaev, A Y; Korepanov, A P; Korobeinikova, A V; Kljashtorny, V G; Piendl, W; Nikonov, S V; Garber, M B; Gongadze, G M

    2014-08-01

    5S rRNA-binding ribosomal proteins of the L25 family are an evolutional acquisition of bacteria. Earlier we showed that (i) single replacements in the RNA-binding module of the protein of this family result in destabilization or complete impossibility to form a complex with 5S rRNA in vitro; (ii) ΔL25 ribosomes of Escherichia coli are less efficient in protein synthesis in vivo than the control ribosomes. In the present work, the efficiency of incorporation of the E. coli protein L25 with mutations in the 5S rRNA-binding region into the ribosome in vivo was studied. It was found that the mutations in L25 that abolish its ability to form the complex with free 5S rRNA do not prevent its correct and efficient incorporation into the ribosome. This is supported by the fact that even the presence of a very weakly retained mutant form of the protein in the ribosome has a positive effect on the activity of the translational machinery in vivo. All this suggests the existence of an alternative incorporation pathway for this protein into the ribosome, excluding the preliminary formation of the complex with 5S rRNA. At the same time, the stable L25-5S rRNA contact is important for the retention of the protein within the ribosome, and the conservative amino acid residues of the RNA-binding module play a key role in this.

  3. ITSoneDB: a comprehensive collection of eukaryotic ribosomal RNA Internal Transcribed Spacer 1 (ITS1) sequences.

    Science.gov (United States)

    Santamaria, Monica; Fosso, Bruno; Licciulli, Flavio; Balech, Bachir; Larini, Ilaria; Grillo, Giorgio; De Caro, Giorgio; Liuni, Sabino; Pesole, Graziano

    2018-01-04

    A holistic understanding of environmental communities is the new challenge of metagenomics. Accordingly, the amplicon-based or metabarcoding approach, largely applied to investigate bacterial microbiomes, is moving to the eukaryotic world too. Indeed, the analysis of metabarcoding data may provide a comprehensive assessment of both bacterial and eukaryotic composition in a variety of environments, including human body. In this respect, whereas hypervariable regions of the 16S rRNA are the de facto standard barcode for bacteria, the Internal Transcribed Spacer 1 (ITS1) of ribosomal RNA gene cluster has shown a high potential in discriminating eukaryotes at deep taxonomic levels. As metabarcoding data analysis rely on the availability of a well-curated barcode reference resource, a comprehensive collection of ITS1 sequences supplied with robust taxonomies, is highly needed. To address this issue, we created ITSoneDB (available at http://itsonedb.cloud.ba.infn.it/) which in its current version hosts 985 240 ITS1 sequences spanning over 134 000 eukaryotic species. Each ITS1 is mapped on the NCBI reference taxonomy with its start and end positions precisely annotated. ITSoneDB has been developed in agreement to the FAIR guidelines by enabling the users to query and download its content through a simple web-interface and access relevant metadata by cross-linking to European Nucleotide Archive. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  4. Identification of a Recently Active Mammalian SINE Derived from Ribosomal RNA

    Science.gov (United States)

    Longo, Mark S.; Brown, Judy D.; Zhang, Chu; O’Neill, Michael J.; O’Neill, Rachel J.

    2015-01-01

    Complex eukaryotic genomes are riddled with repeated sequences whose derivation does not coincide with phylogenetic history and thus is often unknown. Among such sequences, the capacity for transcriptional activity coupled with the adaptive use of reverse transcription can lead to a diverse group of genomic elements across taxa, otherwise known as selfish elements or mobile elements. Short interspersed nuclear elements (SINEs) are nonautonomous mobile elements found in eukaryotic genomes, typically derived from cellular RNAs such as tRNAs, 7SL or 5S rRNA. Here, we identify and characterize a previously unknown SINE derived from the 3′-end of the large ribosomal subunit (LSU or 28S rDNA) and transcribed via RNA polymerase III. This new element, SINE28, is represented in low-copy numbers in the human reference genome assembly, wherein we have identified 27 discrete loci. Phylogenetic analysis indicates these elements have been transpositionally active within primate lineages as recently as 6 MYA while modern humans still carry transcriptionally active copies. Moreover, we have identified SINE28s in all currently available assembled mammalian genome sequences. Phylogenetic comparisons indicate that these elements are frequently rederived from the highly conserved LSU rRNA sequences in a lineage-specific manner. We propose that this element has not been previously recognized as a SINE given its high identity to the canonical LSU, and that SINE28 likely represents one of possibly many unidentified, active transposable elements within mammalian genomes. PMID:25637222

  5. Genome-wide mRNA processing in methanogenic archaea reveals post-transcriptional regulation of ribosomal protein synthesis.

    Science.gov (United States)

    Qi, Lei; Yue, Lei; Feng, Deqin; Qi, Fengxia; Li, Jie; Dong, Xiuzhu

    2017-07-07

    Unlike stable RNAs that require processing for maturation, prokaryotic cellular mRNAs generally follow an 'all-or-none' pattern. Herein, we used a 5΄ monophosphate transcript sequencing (5΄P-seq) that specifically captured the 5΄-end of processed transcripts and mapped the genome-wide RNA processing sites (PSSs) in a methanogenic archaeon. Following statistical analysis and stringent filtration, we identified 1429 PSSs, among which 23.5% and 5.4% were located in 5΄ untranslated region (uPSS) and intergenic region (iPSS), respectively. A predominant uridine downstream PSSs served as a processing signature. Remarkably, 5΄P-seq detected overrepresented uPSS and iPSS in the polycistronic operons encoding ribosomal proteins, and the majority upstream and proximal ribosome binding sites, suggesting a regulatory role of processing on translation initiation. The processed transcripts showed increased stability and translation efficiency. Particularly, processing within the tricistronic transcript of rplA-rplJ-rplL enhanced the translation of rplL, which can provide a driving force for the 1:4 stoichiometry of L10 to L12 in the ribosome. Growth-associated mRNA processing intensities were also correlated with the cellular ribosomal protein levels, thereby suggesting that mRNA processing is involved in tuning growth-dependent ribosome synthesis. In conclusion, our findings suggest that mRNA processing-mediated post-transcriptional regulation is a potential mechanism of ribosomal protein synthesis and stoichiometry. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  6. 16S ribosomal RNA sequence analysis for determination of phylogenetic relationship among methylotrophs.

    Science.gov (United States)

    Tsuji, K; Tsien, H C; Hanson, R S; DePalma, S R; Scholtz, R; LaRoche, S

    1990-01-01

    16S ribosomal RNAs (rRNA) of 12 methylotrophic bacteria have been almost completely sequenced to establish their phylogenetic relationships. Methylotrophs that are physiologically related are phylogenetically diverse and are scattered among the purple eubacteria (class Proteobacteria). Group I methylotrophs can be classified in the beta- and the gamma-subdivisions and group II methylotrophs in the alpha-subdivision of the purple eubacteria, respectively. Pink-pigmented facultative and non-pigmented obligate group II methylotrophs form two distinctly separate branches within the alpha-subdivision. The secondary structures of the 16S rRNA sequences of 'Methylocystis parvus' strain OBBP, 'Methylosinus trichosporium' strain OB3b, 'Methylosporovibrio methanica' strain 81Z and Hyphomicrobium sp. strain DM2 are similar, and these non-pigmented obligate group II methylotrophs form one tight cluster in the alpha-subdivision. The pink-pigmented facultative methylotrophs, Methylobacterium extorquens strain AM1, Methylobacterium sp. strain DM4 and Methylobacterium organophilum strain XX form another cluster within the alpha-subdivision. Although similar in phenotypic characteristics, Methylobacterium organophilum strain XX and Methylobacterium extorquens strain AM1 are clearly distinguishable by their 16S rRNA sequences. The group I methylotrophs, Methylophilus methylotrophus strain AS1 and methylotrophic species DM11, which do not utilize methane, are similar in 16S rRNA sequence to bacteria in the beta-subdivision. The methane-utilizing, obligate group I methanotrophs, Methylococcus capsulatus strain BATH and Methylomonas methanica, are placed in the gamma-subdivision. The results demonstrate that it is possible to distinguish and classify the methylotrophic bacteria using 16S rRNA sequence analysis.

  7. Structural and functional organization of ribosomal genes within the mammalian cell nucleolus.

    Science.gov (United States)

    Derenzini, Massimo; Pasquinelli, Gianandrea; O'Donohue, Marie-Françoise; Ploton, Dominique; Thiry, Marc

    2006-02-01

    Data on the in situ structural-functional organization of ribosomal genes in the mammalian cell nucleolus are reviewed here. Major findings on chromatin structure in situ come from investigations carried out using the Feulgen-like osmium ammine reaction as a highly specific electron-opaque DNA tracer. Intranucleolar chromatin shows three different levels of organization: compact clumps, fibers ranging from 11 to 30 nm, and loose agglomerates of extended DNA filaments. Both clumps and fibers of chromatin exhibit a nucleosomal organization that is lacking in the loose agglomerates of extended DNA filaments. In fact, these filaments constantly show a thickness of 2-3 nm, the same as a DNA double-helix molecule. The loose agglomerates of DNA filaments are located in the fibrillar centers, the interphase counterpart of metaphase NORs, therefore being constituted by ribosomal DNA. The extended, non-nucleosomal configuration of this rDNA has been shown to be independent of transcriptional activity and characterizes ribosome genes that are either transcribed or transcriptionally silent. Data reviewed are consistent with a model of control for ribosome gene activity that is not mediated by changes in chromatin structure. The presence of rDNA in mammalian cells always structurally ready for transcription might facilitate a more rapid adjustment of the ribosome production in response to the metabolic needs of the cell.

  8. Evolutionary dynamics of a conserved sequence motif in the ribosomal genes of the ciliate Paramecium

    Directory of Open Access Journals (Sweden)

    Lynch Michael

    2010-05-01

    Full Text Available Abstract Background In protozoa, the identification of preserved motifs by comparative genomics is often impeded by difficulties to generate reliable alignments for non-coding sequences. Moreover, the evolutionary dynamics of regulatory elements in 3' untranslated regions (both in protozoa and metazoa remains a virtually unexplored issue. Results By screening Paramecium tetraurelia's 3' untranslated regions for 8-mers that were previously found to be preserved in mammalian 3' UTRs, we detect and characterize a motif that is distinctly conserved in the ribosomal genes of this ciliate. The motif appears to be conserved across Paramecium aurelia species but is absent from the ribosomal genes of four additional non-Paramecium species surveyed, including another ciliate, Tetrahymena thermophila. Motif-free ribosomal genes retain fewer paralogs in the genome and appear to be lost more rapidly relative to motif-containing genes. Features associated with the discovered preserved motif are consistent with this 8-mer playing a role in post-transcriptional regulation. Conclusions Our observations 1 shed light on the evolution of a putative regulatory motif across large phylogenetic distances; 2 are expected to facilitate the understanding of the modulation of ribosomal genes expression in Paramecium; and 3 reveal a largely unexplored--and presumably not restricted to Paramecium--association between the presence/absence of a DNA motif and the evolutionary fate of its host genes.

  9. Evolutionary dynamics of a conserved sequence motif in the ribosomal genes of the ciliate Paramecium.

    Science.gov (United States)

    Catania, Francesco; Lynch, Michael

    2010-05-04

    In protozoa, the identification of preserved motifs by comparative genomics is often impeded by difficulties to generate reliable alignments for non-coding sequences. Moreover, the evolutionary dynamics of regulatory elements in 3' untranslated regions (both in protozoa and metazoa) remains a virtually unexplored issue. By screening Paramecium tetraurelia's 3' untranslated regions for 8-mers that were previously found to be preserved in mammalian 3' UTRs, we detect and characterize a motif that is distinctly conserved in the ribosomal genes of this ciliate. The motif appears to be conserved across Paramecium aurelia species but is absent from the ribosomal genes of four additional non-Paramecium species surveyed, including another ciliate, Tetrahymena thermophila. Motif-free ribosomal genes retain fewer paralogs in the genome and appear to be lost more rapidly relative to motif-containing genes. Features associated with the discovered preserved motif are consistent with this 8-mer playing a role in post-transcriptional regulation. Our observations 1) shed light on the evolution of a putative regulatory motif across large phylogenetic distances; 2) are expected to facilitate the understanding of the modulation of ribosomal genes expression in Paramecium; and 3) reveal a largely unexplored--and presumably not restricted to Paramecium--association between the presence/absence of a DNA motif and the evolutionary fate of its host genes.

  10. Fluctuations between multiple EF-G-induced chimeric tRNA states during translocation on the ribosome

    Science.gov (United States)

    Adio, Sarah; Senyushkina, Tamara; Peske, Frank; Fischer, Niels; Wintermeyer, Wolfgang; Rodnina, Marina V.

    2015-06-01

    The coupled translocation of transfer RNA and messenger RNA through the ribosome entails large-scale structural rearrangements, including step-wise movements of the tRNAs. Recent structural work has visualized intermediates of translocation induced by elongation factor G (EF-G) with tRNAs trapped in chimeric states with respect to 30S and 50S ribosomal subunits. The functional role of the chimeric states is not known. Here we follow the formation of translocation intermediates by single-molecule fluorescence resonance energy transfer. Using EF-G mutants, a non-hydrolysable GTP analogue, and fusidic acid, we interfere with either translocation or EF-G release from the ribosome and identify several rapidly interconverting chimeric tRNA states on the reaction pathway. EF-G engagement prevents backward transitions early in translocation and increases the fraction of ribosomes that rapidly fluctuate between hybrid, chimeric and posttranslocation states. Thus, the engagement of EF-G alters the energetics of translocation towards a flat energy landscape, thereby promoting forward tRNA movement.

  11. Mapping posttranscriptional modifications in 5S ribosomal RNA by MALDI mass spectrometry.

    OpenAIRE

    Kirpekar, F; Douthwaite, S; Roepstorff, P

    2000-01-01

    We present a method to screen RNA for posttranscriptional modifications based on Matrix Assisted Laser Desorption/Ionization mass spectrometry (MALDI-MS). After the RNA is digested to completion with a nucleotide-specific RNase, the fragments are analyzed by mass spectrometry. A comparison of the observed mass data with the data predicted from the gene sequence identifies fragments harboring modified nucleotides. Fragments larger than dinucleotides were valuable for the identification of post...

  12. Phylogenetic analysis of subgenus vigna species using nuclear ribosomal RNA ITS: evidence of hybridization among Vigna unguiculata subspecies.

    Science.gov (United States)

    Vijaykumar, Archana; Saini, Ajay; Jawali, Narendra

    2010-01-01

    Molecular phylogeny among species belonging to subgenus Vigna (genus Vigna) was inferred based on internal transcribed spacer (ITS) sequences of 18S-5.8S-26S ribosomal RNA gene unit. Analysis showed a total of 356 polymorphic sites of which approximately 80% were parsimony informative. Phylogenetic reconstruction by neighbor joining and maximum parsimony methods placed the 57 Vigna accessions (belonging to 15 species) into 5 major clades. Five species viz. Vigna heterophylla, Vigna pubigera, Vigna parkeri, Vigna laurentii, and Vigna gracilis whose position in the subgenus was previously not known were placed in the section Vigna. A single accession (Vigna unguiculata ssp. tenuis, NI 1637) harbored 2 intragenomic ITS variants, indicative of 2 different types of ribosomal DNA (rDNA) repeat units. ITS variant type-I was close to ITS from V. unguiculata ssp. pubescens, whereas type-II was close to V. unguiculata ssp. tenuis. Transcript analysis clearly demonstrates that in accession NI 1637, rDNA repeat units with only type-II ITS variants are transcriptionally active. Evidence from sequence analysis (of 5.8S, ITS1, and ITS2) and secondary structure analysis (of ITS1 and ITS2) indicates that the type-I ITS variant probably does not belong to the pseudogenic rDNA repeat units. The results from phylogenetic and transcript analysis suggest that the rDNA units with the type-I ITS may have introgressed as a result of hybridization (between ssp. tenuis and ssp. pubescens); however, it has been epigenetically silenced. The results also demonstrate differential evolution of ITS sequence among wild and cultivated forms of V. unguiculata.

  13. Identification and role of functionally important motifs in the 970 loop of Escherichia coli 16S ribosomal RNA.

    Science.gov (United States)

    Saraiya, Ashesh A; Lamichhane, Tek N; Chow, Christine S; SantaLucia, John; Cunningham, Philip R

    2008-02-22

    The 970 loop (helix 31) of Escherichia coli 16S ribosomal RNA contains two modified nucleotides, m(2)G966 and m(5)C967. Positions A964, A969, and C970 are conserved among the Bacteria, Archaea, and Eukarya. The nucleotides present at positions 965, 966, 967, 968, and 971, however, are only conserved and unique within each domain. All organisms contain a modified nucleoside at position 966, but the type of the modification is domain specific. Biochemical and structure studies have placed this loop near the P site and have shown it to be involved in the decoding process and in binding the antibiotic tetracycline. To identify the functional components of this ribosomal RNA hairpin, the eight nucleotides of the 970 loop of helix 31 were subjected to saturation mutagenesis and 107 unique functional mutants were isolated and analyzed. Nonrandom nucleotide distributions were observed at each mutated position among the functional isolates. Nucleotide identity at positions 966 and 969 significantly affects ribosome function. Ribosomes with single mutations of m(2)G966 or m(5)C967 produce more protein in vivo than do wild-type ribosomes. Overexpression of initiation factor 3 specifically restored wild-type levels of protein synthesis to the 966 and 967 mutants, suggesting that modification of these residues is important for initiation factor 3 binding and for the proper initiation of protein synthesis.

  14. Ribosomal synthesis of polylysine from individual lysyl-tRNA/sup Lys/ in the absence of a template

    International Nuclear Information System (INIS)

    Yusupova, G.Z.; Remme, Y.L.; Belitsina, N.B.; Spirin, A.S.

    1987-01-01

    Earlier studies showed that ribosomes of Escherichia coli, in the absence of a template, can synthesize oligolysine, using lysyl-tRNA as a substrate. The authors present results on the use of preparations of individual lysyl-tRNA/sup Lys/ and phenylalanyl-tRNA/sup Phe/ in a system of templateless peptide synthesis. For these studies, the authors used ribosomes of E. coli MRE 600, washed four times with 1 M NH 4 Cl with 10 MM MgCl 2 . The purified ribosomes were stored at -70 0 C in standard buffer, containing 20 mM Tris-HCl, 100 mM NH 4 Cl, 10 mM MgCl 2 , 0.1 mM ethylenediamine tetraacetate (EDTA), and 10% glycerin, pH/sub 37 0 C/7.6. A preparation of [ 14 C]lysyl-tRNA/sup Lys/ was produced by affinity chromatography on immobilized factor EF-T/sub u/ from Thermus thermophilus HB8. The elongation factor EF-T/sub u/ from T. thermophilus and immobilized on BrCN-activated Sepharose 4B. The initial preparation of total tRNA of E. coli, enzymatically acylated by [ 14 C]lysine (348 Ci/mole, Amersham), was produced as described earlier. The degree of aminoacylation was 52-59 pmoles [ 14 C]lysine per unit of A 260 of tRNA

  15. Retrieval of a million high-quality, full-length microbial 16S and 18S rRNA gene sequences without primer bias

    DEFF Research Database (Denmark)

    Karst, Søren Michael; Dueholm, Morten Simonsen; McIlroy, Simon Jon

    2018-01-01

    Small subunit ribosomal RNA (SSU rRNA) genes, 16S in bacteria and 18S in eukaryotes, have been the standard phylogenetic markers used to characterize microbial diversity and evolution for decades. However, the reference databases of full-length SSU rRNA gene sequences are skewed to well-studied e...

  16. The nucleotide sequence and organization of nuclear 5S rRNA genes in yellow lupine

    International Nuclear Information System (INIS)

    Nuc, K.; Nuc, P.; Pawelkiewicz, J.

    1993-01-01

    We have isolated a genomic clone containing 'Lupinus luteus' 5S ribosomal RNA genes by screening with 5S rDNA probe clones that were hybridized previously with the initiator methionine tRNA preparation (contaminated) with traces of rRNA or its degradation products). The clone isolated contains ten repeat units of 342 bp with 119 bp fragment showing 100% homology to the 5S rRNA from yellow lupine. Sequence analysis indicates only point heterogeneities among the flanking regions of the genes. (author). 6 refs, 3 figs

  17. Detailed analysis of RNA-protein interactions within the bacterial ribosomal protein L5/5S rRNA complex.

    Science.gov (United States)

    Perederina, Anna; Nevskaya, Natalia; Nikonov, Oleg; Nikulin, Alexei; Dumas, Philippe; Yao, Min; Tanaka, Isao; Garber, Maria; Gongadze, George; Nikonov, Stanislav

    2002-12-01

    The crystal structure of ribosomal protein L5 from Thermus thermophilus complexed with a 34-nt fragment comprising helix III and loop C of Escherichia coli 5S rRNA has been determined at 2.5 A resolution. The protein specifically interacts with the bulged nucleotides at the top of loop C of 5S rRNA. The rRNA and protein contact surfaces are strongly stabilized by intramolecular interactions. Charged and polar atoms forming the network of conserved intermolecular hydrogen bonds are located in two narrow planar parallel layers belonging to the protein and rRNA, respectively. The regions, including these atoms conserved in Bacteria and Archaea, can be considered an RNA-protein recognition module. Comparison of the T. thermophilus L5 structure in the RNA-bound form with the isolated Bacillus stearothermophilus L5 structure shows that the RNA-recognition module on the protein surface does not undergo significant changes upon RNA binding. In the crystal of the complex, the protein interacts with another RNA molecule in the asymmetric unit through the beta-sheet concave surface. This protein/RNA interface simulates the interaction of L5 with 23S rRNA observed in the Haloarcula marismortui 50S ribosomal subunit.

  18. Organization of Mitochondrial Gene Expression in Two Distinct Ribosome-Containing Assemblies

    Directory of Open Access Journals (Sweden)

    Kirsten Kehrein

    2015-02-01

    Full Text Available Mitochondria contain their own genetic system that provides subunits of the complexes driving oxidative phosphorylation. A quarter of the mitochondrial proteome participates in gene expression, but how all these factors are orchestrated and spatially organized is currently unknown. Here, we established a method to purify and analyze native and intact complexes of mitochondrial ribosomes. Quantitative mass spectrometry revealed extensive interactions of ribosomes with factors involved in all the steps of posttranscriptional gene expression. These interactions result in large expressosome-like assemblies that we termed mitochondrial organization of gene expression (MIOREX complexes. Superresolution microscopy revealed that most MIOREX complexes are evenly distributed throughout the mitochondrial network, whereas a subset is present as nucleoid-MIOREX complexes that unite the whole spectrum of organellar gene expression. Our work therefore provides a conceptual framework for the spatial organization of mitochondrial protein synthesis that likely developed to facilitate gene expression in the organelle.

  19. Remodeling of ribosomal genes in somatic cells by Xenopus egg extract

    Energy Technology Data Exchange (ETDEWEB)

    Ostrup, Olga, E-mail: osvarcova@gmail.com [Institute of Basic Animal and Veterinary Sciences, Faculty of Life Sciences, University of Copenhagen, Frederiksberg C (Denmark); Stem Cell Epigenetics Laboratory, Institute of Basic Medical Sciences, Faculty of Medicine, University of Oslo, Oslo (Norway); Norwegian Center for Stem Cell Research, Oslo (Norway); Hyttel, Poul; Klaerke, Dan A. [Institute of Basic Animal and Veterinary Sciences, Faculty of Life Sciences, University of Copenhagen, Frederiksberg C (Denmark); Collas, Philippe, E-mail: philc@medisin.uio.no [Stem Cell Epigenetics Laboratory, Institute of Basic Medical Sciences, Faculty of Medicine, University of Oslo, Oslo (Norway); Norwegian Center for Stem Cell Research, Oslo (Norway)

    2011-09-02

    Highlights: {yields} Xenopus egg extract remodels nuclei and alter cell growth characteristics. {yields} Ribosomal genes are reprogrammed within 6 h after extract exposure. {yields} rDNA reprogramming involves promoter targeting of SNF2H remodeling complex. {yields} Xenopus egg extract does not initiate stress-related response in somatic cells. {yields} Aza-cytidine elicits a stress-induced response in reprogrammed cells. -- Abstract: Extracts from Xenopus eggs can reprogram gene expression in somatic nuclei, however little is known about the earliest processes associated with the switch in the transcriptional program. We show here that an early reprogramming event is the remodeling of ribosomal chromatin and gene expression. This occurs within hours of extract treatment and is distinct from a stress response. Egg extract elicits remodeling of the nuclear envelope, chromatin and nucleolus. Nucleolar remodeling involves a rapid and stable decrease in ribosomal gene transcription, and promoter targeting of the nucleolar remodeling complex component SNF2H without affecting occupancy of the transcription factor UBF and the stress silencers SUV39H1 and SIRT1. During this process, nucleolar localization of UBF and SIRT1 is not altered. On contrary, azacytidine pre-treatment has an adverse effect on rDNA remodeling induced by extract and elicits a stress-type nuclear response. Thus, an early event of Xenopus egg extract-mediated nuclear reprogramming is the remodeling of ribosomal genes involving nucleolar remodeling complex. Condition-specific and rapid silencing of ribosomal genes may serve as a sensitive marker for evaluation of various reprogramming methods.

  20. Identification of Genes Enriched in GnRH Neurons by Translating Ribosome Affinity Purification and RNAseq in Mice.

    Science.gov (United States)

    Burger, Laura L; Vanacker, Charlotte; Phumsatitpong, Chayarndorn; Wagenmaker, Elizabeth R; Wang, Luhong; Olson, David P; Moenter, Suzanne M

    2018-04-01

    Gonadotropin-releasing hormone (GnRH) neurons are a nexus of fertility regulation. We used translating ribosome affinity purification coupled with RNA sequencing to examine messenger RNAs of GnRH neurons in adult intact and gonadectomized (GDX) male and female mice. GnRH neuron ribosomes were tagged with green fluorescent protein (GFP) and GFP-labeled polysomes isolated by immunoprecipitation, producing one RNA fraction enhanced for GnRH neuron transcripts and one RNA fraction depleted. Complementary DNA libraries were created from each fraction and 50-base, paired-end sequencing done and differential expression (enhanced fraction/depleted fraction) determined with a threshold of >1.5- or <0.66-fold (false discovery rate P ≤ 0.05). A core of ∼840 genes was differentially expressed in GnRH neurons in all treatments, including enrichment for Gnrh1 (∼40-fold), and genes critical for GnRH neuron and/or gonadotrope development. In contrast, non-neuronal transcripts were not enriched or were de-enriched. Several epithelial markers were also enriched, consistent with the olfactory epithelial origins of GnRH neurons. Interestingly, many synaptic transmission pathways were de-enriched, in accordance with relatively low innervation of GnRH neurons. The most striking difference between intact and GDX mice of both sexes was a marked downregulation of genes associated with oxidative phosphorylation and upregulation of glucose transporters in GnRH neurons from GDX mice. This may suggest that GnRH neurons switch to an alternate fuel to increase adenosine triphosphate production in the absence of negative feedback when GnRH release is elevated. Knowledge of the GnRH neuron translatome and its regulation can guide functional studies and can be extended to disease states, such as polycystic ovary syndrome.

  1. The pleuromutilin drugs tiamulin and valnemulin bind to the RNA at the peptidyl transferase centre on the ribosome

    DEFF Research Database (Denmark)

    Poulsen, S M; Karlsson, M; Johansson, L B

    2001-01-01

    The pleuromutilin antibiotic derivatives, tiamulin and valnemulin, inhibit protein synthesis by binding to the 50S ribosomal subunit of bacteria. The action and binding site of tiamulin and valnemulin was further characterized on Escherichia coli ribosomes. It was revealed that these drugs...... centre and have been associated with binding of several antibiotics. Competitive footprinting shows that tiamulin and valnemulin can bind concurrently with the macrolide erythromycin but compete with the macrolide carbomycin, which is a peptidyl transferase inhibitor. We infer from these and previous...... results that tiamulin and valnemulin interact with the rRNA in the peptidyl transferase slot on the ribosomes in which they prevent the correct positioning of the CCA-ends of tRNAs for peptide transfer....

  2. Sequence analysis of mitochondrial 16S ribosomal RNA gene ...

    Indian Academy of Sciences (India)

    Unknown

    For the understanding of their vectorial capacity, identification of disease carrying and refractory strains is essential. ... been widely used for phylogenetic studies and sequence differences in ... In order to fill up the internal gap, a new set.

  3. Sequence analysis of mitochondrial 16S ribosomal RNA gene

    Indian Academy of Sciences (India)

    Mosquitoes are vectors for the transmission of many human pathogens that include viruses, nematodes and protozoa. For the understanding of their vectorial capacity, identification of disease carrying and refractory strains is essential. Recently, molecular taxonomic techniques have been utilized for this purpose. Sequence ...

  4. Mouse ribosomal RNA genes contain multiple differentially regulated variants.

    Directory of Open Access Journals (Sweden)

    Hung Tseng

    2008-03-01

    Full Text Available Previous cytogenetic studies suggest that various rDNA chromosomal loci are not equally active in different cell types. Consistent with this variability, rDNA polymorphism is well documented in human and mouse. However, attempts to identify molecularly rDNA variant types, which are regulated individually (i.e., independent of other rDNA variants and tissue-specifically, have not been successful. We report here the molecular cloning and characterization of seven mouse rDNA variants (v-rDNA. The identification of these v-rDNAs was based on restriction fragment length polymorphisms (RFLPs, which are conserved among individuals and mouse strains. The total copy number of the identified variants is less than 100 and the copy number of each individual variant ranges from 4 to 15. Sequence analysis of the cloned v-rDNA identified variant-specific single nucleotide polymorphisms (SNPs in the transcribed region. These SNPs were used to develop a set of variant-specific PCR assays, which permitted analysis of the v-rDNAs' expression profiles in various tissues. These profiles show that three v-rDNAs are expressed in all tissues (constitutively active, two are expressed in some tissues (selectively active, and two are not expressed (silent. These expression profiles were observed in six individuals from three mouse strains, suggesting the pattern is not randomly determined. Thus, the mouse rDNA array likely consists of genetically distinct variants, and some are regulated tissue-specifically. Our results provide the first molecular evidence for cell-type-specific regulation of a subset of rDNA.

  5. Involvement of Arabidopsis thaliana ribosomal protein S27 in mRNA degradation triggered by genotoxic stress

    International Nuclear Information System (INIS)

    Revenkova, E.; Masson, J.; Koncz, C.; Afsar, K.; Jakovleva, L.; Paszkowski, J.

    1999-01-01

    A recessive Arabidopsis mutant with elevated sensitivity to DNA damaging treatments was identified in one out of 800 families generated by T-DNA insertion mutagenesis. The T-DNA generated a chromosomal deletion of 1287 bp in the promoter of one of three S27 ribosomal protein genes (ARS27A) preventing its expression. Seedlings of ars27A developed normally under standard growth conditions, suggesting wildtype proficiency of translation. However, growth was strongly inhibited in media supplemented with methyl methane sulfate (MMS) at a concentration not affecting the wild type. This inhibition was accompanied by the formation of tumor–like structures instead of auxiliary roots. Wild-type seedlings treated with increasing concentrations of MMS up to a lethal dose never displayed such a trait, neither was this phenotype observed in ars27A plants in the absence of MMS or under other stress conditions. Thus, the hypersensitivity and tumorous growth are mutant-specific responses to the genotoxic MMS treatment. Another important feature of the mutant is its inability to perform rapid degradation of transcripts after UV treatment, as seen in wild-type plants. Therefore, we propose that the ARS27A protein is dispensable for protein synthesis under standard conditions but is required for the elimination of possibly damaged mRNA after UV irradiation. (author)

  6. Mapping posttranscriptional modifications in 5S ribosomal RNA by MALDI mass spectrometry.

    Science.gov (United States)

    Kirpekar, F; Douthwaite, S; Roepstorff, P

    2000-02-01

    We present a method to screen RNA for posttranscriptional modifications based on Matrix Assisted Laser Desorption/Ionization mass spectrometry (MALDI-MS). After the RNA is digested to completion with a nucleotide-specific RNase, the fragments are analyzed by mass spectrometry. A comparison of the observed mass data with the data predicted from the gene sequence identifies fragments harboring modified nucleotides. Fragments larger than dinucleotides were valuable for the identification of posttranscriptional modifications. A more refined mapping of RNA modifications can be obtained by using two RNases in parallel combined with further fragmentation by Post Source Decay (PSD). This approach allows fast and sensitive screening of a purified RNA for posttranscriptional modification, and has been applied on 5S rRNA from two thermophilic microorganisms, the bacterium Bacillus stearothermophilus and the archaeon Sulfolobus acidocaldarius, as well as the halophile archaea Halobacterium halobium and Haloarcula marismortui. One S. acidocaldarius posttranscriptional modification was identified and was further characterized by PSD as a methylation of cytidine32. The modified C is located in a region that is clearly conserved with respect to both sequence and position in B. stearothermophilus and H. halobium and to some degree also in H. marismortui. However, no analogous modification was identified in the latter three organisms. We further find that the 5' end of H. halobium 5S rRNA is dephosphorylated, in contrast to the other 5S rRNA species investigated. The method additionally gives an immediate indication of whether the expected RNA sequence is in agreement with the observed fragment masses. Discrepancies with two of the published 5S rRNA sequences were identified and are reported here.

  7. Analysis of ribosomal RNA stability in dead cells of wine yeast by quantitative PCR.

    Science.gov (United States)

    Sunyer-Figueres, Merce; Wang, Chunxiao; Mas, Albert

    2018-04-02

    During wine production, some yeasts enter a Viable But Not Culturable (VBNC) state, which may influence the quality and stability of the final wine through remnant metabolic activity or by resuscitation. Culture-independent techniques are used for obtaining an accurate estimation of the number of live cells, and quantitative PCR could be the most accurate technique. As a marker of cell viability, rRNA was evaluated by analyzing its stability in dead cells. The species-specific stability of rRNA was tested in Saccharomyces cerevisiae, as well as in three species of non-Saccharomyces yeast (Hanseniaspora uvarum, Torulaspora delbrueckii and Starmerella bacillaris). High temperature and antimicrobial dimethyl dicarbonate (DMDC) treatments were efficient in lysing the yeast cells. rRNA gene and rRNA (as cDNA) were analyzed over 48 h after cell lysis by quantitative PCR. The results confirmed the stability of rRNA for 48 h after the cell lysis treatments. To sum up, rRNA may not be a good marker of cell viability in the wine yeasts that were tested. Copyright © 2018 Elsevier B.V. All rights reserved.

  8. The Arabidopsis TOR Kinase Specifically Regulates the Expression of Nuclear Genes Coding for Plastidic Ribosomal Proteins and the Phosphorylation of the Cytosolic Ribosomal Protein S6.

    Science.gov (United States)

    Dobrenel, Thomas; Mancera-Martínez, Eder; Forzani, Céline; Azzopardi, Marianne; Davanture, Marlène; Moreau, Manon; Schepetilnikov, Mikhail; Chicher, Johana; Langella, Olivier; Zivy, Michel; Robaglia, Christophe; Ryabova, Lyubov A; Hanson, Johannes; Meyer, Christian

    2016-01-01

    Protein translation is an energy consuming process that has to be fine-tuned at both the cell and organism levels to match the availability of resources. The target of rapamycin kinase (TOR) is a key regulator of a large range of biological processes in response to environmental cues. In this study, we have investigated the effects of TOR inactivation on the expression and regulation of Arabidopsis ribosomal proteins at different levels of analysis, namely from transcriptomic to phosphoproteomic. TOR inactivation resulted in a coordinated down-regulation of the transcription and translation of nuclear-encoded mRNAs coding for plastidic ribosomal proteins, which could explain the chlorotic phenotype of the TOR silenced plants. We have identified in the 5' untranslated regions (UTRs) of this set of genes a conserved sequence related to the 5' terminal oligopyrimidine motif, which is known to confer translational regulation by the TOR kinase in other eukaryotes. Furthermore, the phosphoproteomic analysis of the ribosomal fraction following TOR inactivation revealed a lower phosphorylation of the conserved Ser240 residue in the C-terminal region of the 40S ribosomal protein S6 (RPS6). These results were confirmed by Western blot analysis using an antibody that specifically recognizes phosphorylated Ser240 in RPS6. Finally, this antibody was used to follow TOR activity in plants. Our results thus uncover a multi-level regulation of plant ribosomal genes and proteins by the TOR kinase.

  9. Exploiting Pre-rRNA Processing in Diamond Blackfan Anemia Gene Discovery and Diagnosis

    Science.gov (United States)

    Farrar, Jason E.; Quarello, Paola; Fisher, Ross; O’Brien, Kelly A.; Aspesi, Anna; Parrella, Sara; Henson, Adrianna L.; Seidel, Nancy E.; Atsidaftos, Eva; Prakash, Supraja; Bari, Shahla; Garelli, Emanuela; Arceci, Robert J.; Dianzani, Irma; Ramenghi, Ugo; Vlachos, Adrianna; Lipton, Jeffrey M.; Bodine, David M.; Ellis, Steven R.

    2014-01-01

    Diamond Blackfan anemia (DBA), a syndrome primarily characterized by anemia and physical abnormalities, is one among a group of related inherited bone marrow failure syndromes (IBMFS) which share overlapping clinical features. Heterozygous mutations or single-copy deletions have been identified in 12 ribosomal protein genes in approximately 60% of DBA cases, with the genetic etiology unexplained in most remaining patients. Unlike many IBMFS, for which functional screening assays complement clinical and genetic findings, suspected DBA in the absence of typical alterations of the known genes must frequently be diagnosed after exclusion of other IBMFS. We report here a novel deletion in a child that presented such a diagnostic challenge and prompted development of a novel functional assay that can assist in the diagnosis of a significant fraction of patients with DBA. The ribosomal proteins affected in DBA are required for pre-rRNA processing, a process which can be interrogated to monitor steps in the maturation of 40S and 60S ribosomal subunits. In contrast to prior methods used to assess pre-rRNA processing, the assay reported here, based on capillary electrophoresis measurement of the maturation of rRNA in pre-60S ribosomal subunits, would be readily amenable to use in diagnostic laboratories. In addition to utility as a diagnostic tool, we applied this technique to gene discovery in DBA, resulting in the identification of RPL31 as a novel DBA gene. PMID:25042156

  10. Detailed analysis of RNA-protein interactions within the bacterial ribosomal protein L5/5S rRNA complex.

    OpenAIRE

    Perederina, Anna; Nevskaya, Natalia; Nikonov, Oleg; Nikulin, Alexei; Dumas, Philippe; Yao, Min; Tanaka, Isao; Garber, Maria; Gongadze, George; Nikonov, Stanislav

    2002-01-01

    The crystal structure of ribosomal protein L5 from Thermus thermophilus complexed with a 34-nt fragment comprising helix III and loop C of Escherichia coli 5S rRNA has been determined at 2.5 A resolution. The protein specifically interacts with the bulged nucleotides at the top of loop C of 5S rRNA. The rRNA and protein contact surfaces are strongly stabilized by intramolecular interactions. Charged and polar atoms forming the network of conserved intermolecular hydrogen bonds are located in ...

  11. Complete mitochondrial genomes and nuclear ribosomal RNA operons of two species of Diplostomum (Platyhelminthes: Trematoda): a molecular resource for taxonomy and molecular epidemiology of important fish pathogens.

    Science.gov (United States)

    Brabec, Jan; Kostadinova, Aneta; Scholz, Tomáš; Littlewood, D Timothy J

    2015-06-19

    The genus Diplostomum (Platyhelminthes: Trematoda: Diplostomidae) is a diverse group of freshwater parasites with complex life-cycles and global distribution. The larval stages are important pathogens causing eye fluke disease implicated in substantial impacts on natural fish populations and losses in aquaculture. However, the problematic species delimitation and difficulties in the identification of larval stages hamper the assessment of the distributional and host ranges of Diplostomum spp. and their transmission ecology. Total genomic DNA was isolated from adult worms and shotgun sequenced using Illumina MiSeq technology. Mitochondrial (mt) genomes and nuclear ribosomal RNA (rRNA) operons were assembled using established bioinformatic tools and fully annotated. Mt protein-coding genes and nuclear rRNA genes were subjected to phylogenetic analysis by maximum likelihood and the resulting topologies compared. We characterised novel complete mt genomes and nuclear rRNA operons of two closely related species, Diplostomum spathaceum and D. pseudospathaceum. Comparative mt genome assessment revealed that the cox1 gene and its 'barcode' region used for molecular identification are the most conserved regions; instead, nad4 and nad5 genes were identified as most promising molecular diagnostic markers. Using the novel data, we provide the first genome wide estimation of the phylogenetic relationships of the order Diplostomida, one of the two fundamental lineages of the Digenea. Analyses of the mitogenomic data invariably recovered the Diplostomidae as a sister lineage of the order Plagiorchiida rather than as a basal lineage of the Diplostomida as inferred in rDNA phylogenies; this was concordant with the mt gene order of Diplostomum spp. exhibiting closer match to the conserved gene order of the Plagiorchiida. Complete sequences of the mt genome and rRNA operon of two species of Diplostomum provide a valuable resource for novel genetic markers for species delineation and

  12. Inhibition by Siomycin and Thiostrepton of Both Aminoacyl-tRNA and Factor G Binding to Ribosomes

    Science.gov (United States)

    Ll, Juan Modole; Cabrer, Bartolomé; Parmeggiani, Andrea; Azquez, David V

    1971-01-01

    Siomycin, a peptide antibiotic that interacts with the 50S ribosomal subunit and inhibits binding of factor G, is shown also to inhibit binding of aminoacyl-tRNA; however, it does not impair binding of fMet-tRNA and completion of the initiation complex. Moreover, unlike other inhibitors of aminoacyl-tRNA binding (tetracycline, sparsomycin, and streptogramin A), siomycin completely abolishes the GTPase activity associated with the binding of aminoacyl-tRNA catalyzed by factor Tu. A single-site interaction of siomycin appears to be responsible for its effect on both the binding of the aminoacyl-tRNA-Tu-GTP complex and that of factor G. PMID:4331558

  13. Diversity of 23S rRNA genes within individual prokaryotic genomes.

    Directory of Open Access Journals (Sweden)

    Anna Pei

    Full Text Available BACKGROUND: The concept of ribosomal constraints on rRNA genes is deduced primarily based on the comparison of consensus rRNA sequences between closely related species, but recent advances in whole-genome sequencing allow evaluation of this concept within organisms with multiple rRNA operons. METHODOLOGY/PRINCIPAL FINDINGS: Using the 23S rRNA gene as an example, we analyzed the diversity among individual rRNA genes within a genome. Of 184 prokaryotic species containing multiple 23S rRNA genes, diversity was observed in 113 (61.4% genomes (mean 0.40%, range 0.01%-4.04%. Significant (1.17%-4.04% intragenomic variation was found in 8 species. In 5 of the 8 species, the diversity in the primary structure had only minimal effect on the secondary structure (stem versus loop transition. In the remaining 3 species, the diversity significantly altered local secondary structure, but the alteration appears minimized through complex rearrangement. Intervening sequences (IVS, ranging between 9 and 1471 nt in size, were found in 7 species. IVS in Deinococcus radiodurans and Nostoc sp. encode transposases. T. tengcongensis was the only species in which intragenomic diversity >3% was observed among 4 paralogous 23S rRNA genes. CONCLUSIONS/SIGNIFICANCE: These findings indicate tight ribosomal constraints on individual 23S rRNA genes within a genome. Although classification using primary 23S rRNA sequences could be erroneous, significant diversity among paralogous 23S rRNA genes was observed only once in the 184 species analyzed, indicating little overall impact on the mainstream of 23S rRNA gene-based prokaryotic taxonomy.

  14. Eigenvectors determination of the ribosome dynamics model during mRNA translation using the Kleene Star algorithm

    Science.gov (United States)

    Ernawati; Carnia, E.; Supriatna, A. K.

    2018-03-01

    Eigenvalues and eigenvectors in max-plus algebra have the same important role as eigenvalues and eigenvectors in conventional algebra. In max-plus algebra, eigenvalues and eigenvectors are useful for knowing dynamics of the system such as in train system scheduling, scheduling production systems and scheduling learning activities in moving classes. In the translation of proteins in which the ribosome move uni-directionally along the mRNA strand to recruit the amino acids that make up the protein, eigenvalues and eigenvectors are used to calculate protein production rates and density of ribosomes on the mRNA. Based on this, it is important to examine the eigenvalues and eigenvectors in the process of protein translation. In this paper an eigenvector formula is given for a ribosome dynamics during mRNA translation by using the Kleene star algorithm in which the resulting eigenvector formula is simpler and easier to apply to the system than that introduced elsewhere. This paper also discusses the properties of the matrix {B}λ \\otimes n of model. Among the important properties, it always has the same elements in the first column for n = 1, 2,… if the eigenvalue is the time of initiation, λ = τin , and the column is the eigenvector of the model corresponding to λ.

  15. Evaluation of two main RNA-seq approaches for gene quantification in clinical RNA sequencing: polyA+ selection versus rRNA depletion.

    Science.gov (United States)

    Zhao, Shanrong; Zhang, Ying; Gamini, Ramya; Zhang, Baohong; von Schack, David

    2018-03-19

    To allow efficient transcript/gene detection, highly abundant ribosomal RNAs (rRNA) are generally removed from total RNA either by positive polyA+ selection or by rRNA depletion (negative selection) before sequencing. Comparisons between the two methods have been carried out by various groups, but the assessments have relied largely on non-clinical samples. In this study, we evaluated these two RNA sequencing approaches using human blood and colon tissue samples. Our analyses showed that rRNA depletion captured more unique transcriptome features, whereas polyA+ selection outperformed rRNA depletion with higher exonic coverage and better accuracy of gene quantification. For blood- and colon-derived RNAs, we found that 220% and 50% more reads, respectively, would have to be sequenced to achieve the same level of exonic coverage in the rRNA depletion method compared with the polyA+ selection method. Therefore, in most cases we strongly recommend polyA+ selection over rRNA depletion for gene quantification in clinical RNA sequencing. Our evaluation revealed that a small number of lncRNAs and small RNAs made up a large fraction of the reads in the rRNA depletion RNA sequencing data. Thus, we recommend that these RNAs are specifically depleted to improve the sequencing depth of the remaining RNAs.

  16. Structural and functional implications in the eubacterial ribosome as revealed by protein-rRNA and antibiotic contact sites.

    Science.gov (United States)

    Wittmann-Liebold, B; Uhlein, M; Urlaub, H; Müller, E C; Otto, A; Bischof, O

    1995-01-01

    Contact sites between protein and rRNA in 30S and 50S ribosomal subunits of Escherichia coli and Bacillus stearothermophilus were investigated at the molecular level using UV and 2-iminothiolane as cross-linkers. Thirteen ribosomal proteins (S3, S4, S7, S14, S17, L2, L4, L6, L14, L27, L28, L29, and L36) from these organisms were cross-linked in direct contact with the RNAs, and the peptide stretches as well as amino acids involved were identified. Further, the binding sites of puromycin and spiramycin were established at the peptide level in several proteins that were found to constitute the antibiotic-binding sites. Peptide stretches of puromycin binding were identified from proteins S7, S14, S18, L18, AND L29; those of spiramycin attachment were derived from proteins S12, S14, L17, L18, L27, and L35. Comparison of the RNA-peptide contact sites with the peptides identified for antibiotic binding and with those altered in antibiotic-resistant mutants clearly showed identical peptide areas to be involved and, hence, demonstrated the functional importance of these peptides. Further evidence for a functional implication of ribosomal proteins in the translational process came from complementation experiments in which protein L2 from Halobacterium marismortui was incorporated into the E. coli ribosomes that were active. The incorporated protein was present in 50S subunits and 70S particles, in disomes, and in higher polysomes. These results clearly demonstrate the functional implication of protein L2 in protein biosynthesis. Incorporation studies with a mutant of HmaL2 with a replacement of histidine-229 by glycine completely abolished the functional activity of the ribosome. Accordingly, protein L2 with histidine-229 is a crucial element of the translational machinery.

  17. Phylogenetic utility of ribosomal genes for reconstructing the phylogeny of five Chinese satyrine tribes (Lepidoptera, Nymphalidae

    Directory of Open Access Journals (Sweden)

    Mingsheng Yang

    2015-03-01

    Full Text Available Satyrinae is one of twelve subfamilies of the butterfly family Nymphalidae, which currently includes nine tribes. However, phylogenetic relationships among them remain largely unresolved, though different researches have been conducted based on both morphological and molecular data. However, ribosomal genes have never been used in tribe level phylogenetic analyses of Satyrinae. In this study we investigate for the first time the phylogenetic relationships among the tribes Elymniini, Amathusiini, Zetherini and Melanitini which are indicated to be a monophyletic group, and the Satyrini, using two ribosomal genes (28s rDNA and 16s rDNA and four protein-coding genes (EF-1α, COI, COII and Cytb. We mainly aim to assess the phylogenetic informativeness of the ribosomal genes as well as clarify the relationships among different tribes. Our results show the two ribosomal genes generally have the same high phylogenetic informativeness compared with EF-1α; and we infer the 28s rDNA would show better informativeness if the 28s rDNA sequence data for each sampling taxon are obtained in this study. The placement of the monotypic genus Callarge Leech in Zetherini is confirmed for the first time based on molecular evidence. In addition, our maximum likelihood (ML and Bayesian inference (BI trees consistently show that the involved Satyrinae including the Amathusiini is monophyletic with high support values. Although the relationships among the five tribes are identical among ML and BI analyses and are mostly strongly-supported in BI analysis, those in ML analysis are lowly- or moderately- supported. Therefore, the relationships among the related five tribes recovered herein need further verification based on more sampling taxa.

  18. The RNA gene information: retroelement-microRNA entangling as the RNA quantum code.

    Science.gov (United States)

    Fujii, Yoichi Robertus

    2013-01-01

    MicroRNA (miRNA) and retroelements may be a master of regulator in our life, which are evolutionally involved in the origin of species. To support the Darwinism from the aspect of molecular evolution process, it has tremendously been interested in the molecular information of naive RNA. The RNA wave model 2000 consists of four concepts that have altered from original idea of the miRNA genes for crosstalk among embryonic stem cells, their niche cells, and retroelements as a carrier vesicle of the RNA genes. (1) the miRNA gene as a mobile genetic element induces transcriptional and posttranscriptional silencing via networking-processes (no hierarchical architecture); (2) the RNA information supplied by the miRNA genes expands to intracellular, intercellular, intraorgan, interorgan, intraspecies, and interspecies under the cycle of life into the global environment; (3) the mobile miRNAs can self-proliferate; and (4) cells contain two types information as resident and genomic miRNAs. Based on RNA wave, we have developed an interest in investigation of the transformation from RNA information to quantum bits as physicochemical characters of RNA with the measurement of RNA electron spin. When it would have been given that the fundamental bases for the acquired characters in genetics can be controlled by RNA gene information, it may be available to apply for challenging against RNA gene diseases, such as stress-induced diseases.

  19. Ribosome Profiling Reveals Pervasive Translation Outside of Annotated Protein-Coding Genes

    Directory of Open Access Journals (Sweden)

    Nicholas T. Ingolia

    2014-09-01

    Full Text Available Ribosome profiling suggests that ribosomes occupy many regions of the transcriptome thought to be noncoding, including 5′ UTRs and long noncoding RNAs (lncRNAs. Apparent ribosome footprints outside of protein-coding regions raise the possibility of artifacts unrelated to translation, particularly when they occupy multiple, overlapping open reading frames (ORFs. Here, we show hallmarks of translation in these footprints: copurification with the large ribosomal subunit, response to drugs targeting elongation, trinucleotide periodicity, and initiation at early AUGs. We develop a metric for distinguishing between 80S footprints and nonribosomal sources using footprint size distributions, which validates the vast majority of footprints outside of coding regions. We present evidence for polypeptide production beyond annotated genes, including the induction of immune responses following human cytomegalovirus (HCMV infection. Translation is pervasive on cytosolic transcripts outside of conserved reading frames, and direct detection of this expanded universe of translated products enables efforts at understanding how cells manage and exploit its consequences.

  20. Genetic divergence of Asiatic Bdellocephala (Turbellaria, Tricladida, Paludicola) as revealed by partial 18S rRNA gene sequence comparisons.

    Science.gov (United States)

    Kuznedelov, K D; Timoshkin, O A; Goldman, E

    1997-01-01

    Polymerase chain reaction (PCR) and direct sequencing of small ribosomal RNA genes were used for analysis of genetic differences among Asiatic species of freshwater triclad genus Bdellocephala. Representatives of four species and four subspecies of this genus were used to establish homology between nucleotides in the 5'-end portion of small ribosomal RNA gene sequences. Within 552 nucleotide sites of aligned sequences compared, six variable base positions were discovered, dividing Bdellocephala into five different genotypes. Sequence data allow to distinguish two groups of these genotypes. One of them unites species from Kamchatka and Japan, another one unites Baikalian taxa. Agreement between available morphological, cytological and sequence data is discussed.

  1. Evidence for an RNA pseudoknot loop-helix interaction essential for efficient -1 ribosomal frameshifting.

    Science.gov (United States)

    Liphardt, J; Napthine, S; Kontos, H; Brierley, I

    1999-05-07

    RNA pseudoknots are structural elements that participate in a variety of biological processes. At -1 ribosomal frameshifting sites, several types of pseudoknot have been identified which differ in their organisation and functionality. The pseudoknot found in infectious bronchitis virus (IBV) is typical of those that possess a long stem 1 of 11-12 bp and a long loop 2 (30-164 nt). A second group of pseudoknots are distinguishable that contain stems of only 5 to 7 bp and shorter loops. The NMR structure of one such pseudoknot, that of mouse mammary tumor virus (MMTV), has revealed that it is kinked at the stem 1-stem 2 junction, and that this kinked conformation is essential for efficient frameshifting. We recently investigated the effect on frameshifting of modulating stem 1 length and stability in IBV-based pseudoknots, and found that a stem 1 with at least 11 bp was needed for efficient frameshifting. Here, we describe the sequence manipulations that are necessary to bypass the requirement for an 11 bp stem 1 and to convert a short non-functional IBV-derived pseudoknot into a highly efficient, kinked frameshifter pseudoknot. Simple insertion of an adenine residue at the stem 1-stem 2 junction (an essential feature of a kinked pseudoknot) was not sufficient to create a functional pseudoknot. An additional change was needed: efficient frameshifting was recovered only when the last nucleotide of loop 2 was changed from a G to an A. The requirement for an A at the end of loop 2 is consistent with a loop-helix contact similar to those described in other RNA tertiary structures. A mutational analysis of both partners of the proposed interaction, the loop 2 terminal adenine residue and two G.C pairs near the top of stem 1, revealed that the interaction was essential for efficient frameshifting. The specific requirement for a 3'-terminal A residue was lost when loop 2 was increased from 8 to 14 nt, suggesting that the loop-helix contact may be required only in those

  2. The pleuromutilin drugs tiamulin and valnemulin bind to the RNA at the peptidyl transferase centre on the ribosome.

    Science.gov (United States)

    Poulsen, S M; Karlsson, M; Johansson, L B; Vester, B

    2001-09-01

    The pleuromutilin antibiotic derivatives, tiamulin and valnemulin, inhibit protein synthesis by binding to the 50S ribosomal subunit of bacteria. The action and binding site of tiamulin and valnemulin was further characterized on Escherichia coli ribosomes. It was revealed that these drugs are strong inhibitors of peptidyl transferase and interact with domain V of 23S RNA, giving clear chemical footprints at nucleotides A2058-9, U2506 and U2584-5. Most of these nucleotides are highly conserved phylogenetically and functionally important, and all of them are at or near the peptidyl transferase centre and have been associated with binding of several antibiotics. Competitive footprinting shows that tiamulin and valnemulin can bind concurrently with the macrolide erythromycin but compete with the macrolide carbomycin, which is a peptidyl transferase inhibitor. We infer from these and previous results that tiamulin and valnemulin interact with the rRNA in the peptidyl transferase slot on the ribosomes in which they prevent the correct positioning of the CCA-ends of tRNAs for peptide transfer.

  3. Early evolutionary colocalization of the nuclear ribosomal 5S and 45S gene families in seed plants: evidence from the living fossil gymnosperm Ginkgo biloba.

    Science.gov (United States)

    Galián, J A; Rosato, M; Rosselló, J A

    2012-06-01

    In seed plants, the colocalization of the 5S loci within the intergenic spacer (IGS) of the nuclear 45S tandem units is restricted to the phylogenetically derived Asteraceae family. However, fluorescent in situ hybridization (FISH) colocalization of both multigene families has also been observed in other unrelated seed plant lineages. Previous work has identified colocalization of 45S and 5S loci in Ginkgo biloba using FISH, but these observations have not been confirmed recently by sequencing a 1.8 kb IGS. In this work, we report the presence of the 45S-5S linkage in G. biloba, suggesting that in seed plants the molecular events leading to the restructuring of the ribosomal loci are much older than estimated previously. We obtained a 6.0 kb IGS fragment showing structural features of functional sequences, and a single copy of the 5S gene was inserted in the same direction of transcription as the ribosomal RNA genes. We also obtained a 1.8 kb IGS that was a truncate variant of the 6.0 kb IGS lacking the 5S gene. Several lines of evidence strongly suggest that the 1.8 kb variants are pseudogenes that are present exclusively on the satellite chromosomes bearing the 45S-5S genes. The presence of ribosomal IGS pseudogenes best reconciles contradictory results concerning the presence or absence of the 45S-5S linkage in Ginkgo. Our finding that both ribosomal gene families have been unified to a single 45S-5S unit in Ginkgo indicates that an accurate reassessment of the organization of rDNA genes in basal seed plants is necessary.

  4. Folate deficiency facilitates recruitment of upstream binding factor to hot spots of DNA double-strand breaks of rRNA genes and promotes its transcription.

    Science.gov (United States)

    Xie, Qiu; Li, Caihua; Song, Xiaozhen; Wu, Lihua; Jiang, Qian; Qiu, Zhiyong; Cao, Haiyan; Yu, Kaihui; Wan, Chunlei; Li, Jianting; Yang, Feng; Huang, Zebing; Niu, Bo; Jiang, Zhengwen; Zhang, Ting

    2017-03-17

    The biogenesis of ribosomes in vivo is an essential process for cellular functions. Transcription of ribosomal RNA (rRNA) genes is the rate-limiting step in ribosome biogenesis controlled by environmental conditions. Here, we investigated the role of folate antagonist on changes of DNA double-strand breaks (DSBs) landscape in mouse embryonic stem cells. A significant DSB enhancement was detected in the genome of these cells and a large majority of these DSBs were found in rRNA genes. Furthermore, spontaneous DSBs in cells under folate deficiency conditions were located exclusively within the rRNA gene units, representing a H3K4me1 hallmark. Enrichment H3K4me1 at the hot spots of DSB regions enhanced the recruitment of upstream binding factor (UBF) to rRNA genes, resulting in the increment of rRNA genes transcription. Supplement of folate resulted in a restored UBF binding across DNA breakage sites of rRNA genes, and normal rRNA gene transcription. In samples from neural tube defects (NTDs) with low folate level, up-regulation of rRNA gene transcription was observed, along with aberrant UBF level. Our results present a new view by which alterations in folate levels affects DNA breakage through epigenetic control leading to the regulation of rRNA gene transcription during the early stage of development. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  5. RNA-seq reveals more consistent reference genes for gene expression studies in human non-melanoma skin cancers

    Directory of Open Access Journals (Sweden)

    Van L.T. Hoang

    2017-08-01

    Full Text Available Identification of appropriate reference genes (RGs is critical to accurate data interpretation in quantitative real-time PCR (qPCR experiments. In this study, we have utilised next generation RNA sequencing (RNA-seq to analyse the transcriptome of a panel of non-melanoma skin cancer lesions, identifying genes that are consistently expressed across all samples. Genes encoding ribosomal proteins were amongst the most stable in this dataset. Validation of this RNA-seq data was examined using qPCR to confirm the suitability of a set of highly stable genes for use as qPCR RGs. These genes will provide a valuable resource for the normalisation of qPCR data for the analysis of non-melanoma skin cancer.

  6. Ribosomal protein L5 has a highly twisted concave surface and flexible arms responsible for rRNA binding.

    Science.gov (United States)

    Nakashima, T; Yao, M; Kawamura, S; Iwasaki, K; Kimura, M; Tanaka, I

    2001-05-01

    Ribosomal protein L5 is a 5S rRNA binding protein in the large subunit and plays an essential role in the promotion of a particular conformation of 5S rRNA. The crystal structure of the ribosomal protein L5 from Bacillus stearothermophilus has been determined at 1.8 A resolution. The molecule consists of a five-stranded antiparallel beta-sheet and four alpha-helices, which fold in a way that is topologically similar to the ribonucleoprotein (RNP) domain. The molecular shape and electrostatic representation suggest that the concave surface and loop regions are involved in 5S rRNA binding. To identify amino acid residues responsible for 5S rRNA binding, we made use of Ala-scanning mutagenesis of evolutionarily conserved amino acids occurring in the beta-strands and loop regions. The mutations of Asn37 at the beta1-strand and Gln63 at the loop between helix 2 and beta3-strand as well as that of Phe77 at the tip of the loop structure between the beta2- and beta3-strands caused a significant reduction in 5S rRNA binding. In addition, the mutations of Thr90 on the beta3-strand and Ile141 and Asp144 at the loop between beta4- and beta5-strands moderately reduced the 5S rRNA-binding affinity. Comparison of these results with the more recently analyzed structure of the 50S subunit from Haloarcula marismortui suggests that there are significant differences in the structure at N- and C-terminal regions and probably in the 5S rRNA binding.

  7. Structural basis for ribosome protein S1 interaction with RNA in trans-translation of Mycobacterium tuberculosis.

    Science.gov (United States)

    Fan, Yi; Dai, Yazhuang; Hou, Meijing; Wang, Huilin; Yao, Hongwei; Guo, Chenyun; Lin, Donghai; Liao, Xinli

    2017-05-27

    Ribosomal protein S1 (RpsA), the largest 30S protein in ribosome, plays a significant role in translation and trans-translation. In Mycobacterium tuberculosis, the C-terminus of RpsA is known as tuberculosis drug target of pyrazinoic acid, which inhibits the interaction between MtRpsA and tmRNA in trans-translation. However, the molecular mechanism underlying the interaction of MtRpsA with tmRNA remains unknown. We herein analyzed the interaction of the C-terminal domain of MtRpsA with three RNA fragments poly(A), sMLD and pre-sMLD. NMR titration analysis revealed that the RNA binding sites on MtRpsA CTD are mainly located in the β2, β3 and β5 strands and the adjacent L3 loop of the S1 domain. Fluorescence experiments determined the MtRpsA CTD binding to RNAs are in the micromolar affinity range. Sequence analysis also revealed conserved residues in the mapped RNA binding region. Residues L304, V305, G308, F310, H322, I323, R357 and I358 were verified to be the key residues influencing the interaction between MtRpsA CTD and pre-sMLD. Molecular docking further confirmed that the poly(A)-like sequence and sMLD of tmRNA are all involved in the protein-RNA interaction, through charged interaction and hydrogen bonds. The results will be beneficial for designing new anti-tuberculosis drugs. Copyright © 2017 Elsevier Inc. All rights reserved.

  8. Detection of Aspergillus fumigatus pulmonary fungal infections in mice with 99mTc-labeled MORF oligomers targeting ribosomal RNA

    International Nuclear Information System (INIS)

    Wang Yuzhen; Chen Ling; Liu Xinrong; Cheng Dengfeng; Liu Guozheng; Liu Yuxia; Dou Shuping; Hnatowich, Donald J.; Rusckowski, Mary

    2013-01-01

    Purpose: Invasive aspergillosis is a major cause of infectious morbidity and mortality in immunocompromised patients. The fungus Aspergillus fumigatus (A. fumigatus) is the primary causative agent of invasive aspergillosis. However, A. fumigatus infections remain difficult to diagnose particularly in the early stages due to the lack of a rapid, sensitive and specific diagnostic approach. In this study, we investigated 99m Tc labeled MORF oligomers targeting fungal ribosomal RNA (rRNA) for the imaging detection of fungal infections. Procedures: Three phosphorodiamidate morpholino (MORF) oligomer (a DNA analogue) probes were designed: AGEN, complementary to a sequence of the fungal 28S ribosomal RNA (rRNA) of Aspergillus, as a genus-specific probe; AFUM, complementary to the 28S rRNA sequence of A. fumigatus, as a fungus species-specific probe; and cMORF, irrelevant to all fungal species, as a control probe. The probes were conjugated with Alexa Fluor 633 carboxylic acid succinimidyl ester (AF633) for fluorescence imaging or with NHS-mercaptoacetyl triglycine (NHS-MAG3) for nuclear imaging with 99m Tc and then evaluated in vitro and in vivo. Results: The specific binding of AGEN and AFUM to fungal total RNA was confirmed by dot blot hybridization while specific binding of AGEN and AFUM in fixed and live A. fumigatus was demonstrated by both fluorescent in situ hybridization (FISH) analysis and accumulation in live cells. SPECT imaging of BALB/c mice with pulmonary A. fumigatus infections and administered 99m Tc labeled AGEN and AFUM showed immediate and obvious accumulation in the infected lungs, while no significant accumulation of the control 99m Tc-cMORF in the infected lung was observed. Compared to non-infected mice, with sacrifice at 1 h, the accumulation of 99m Tc-AGEN and 99m Tc-AFUM in the lungs of mice infected with A. fumigatus was 2 and 2.7 fold higher respectively. Conclusions: In vivo targeting fungal ribosomal RNA with 99m Tc labeled MORF probes AGEN

  9. The origin of the 5S ribosomal RNA molecule could have been caused by a single inverse duplication: strong evidence from its sequences.

    Science.gov (United States)

    Branciamore, Sergio; Di Giulio, Massimo

    2012-04-01

    The secondary structure of the 5S ribosomal RNA (5S rRNA) molecule shows a high degree of symmetry. In order to explain the origin of this symmetry, it has been conjectured that one half of the 5S rRNA molecule was its precursor and that an indirect duplication of this precursor created the other half and thus the current symmetry of the molecule. Here, we have subjected to an empirical test both the indirect duplication model, analysing a total of 684 5S rRNA sequences for complementarity between the two halves of the 5S rRNA, and the direct duplication model analysing in this case the similarity between the two halves of this molecule. In intra- and inter-molecule and intra- and inter-domain comparisons, we find a high statistical support to the hypothesis of a complementarity relationship between the two halves of the 5S rRNA molecule, denying vice versa the hypothesis of similarity between these halves. Therefore, these observations corroborate the indirect duplication model at the expense of the direct duplication model, as reason of the origin of the 5S rRNA molecule. More generally, we discuss and favour the hypothesis that all RNAs and proteins, which present symmetry, did so through gene duplication and not by gradualistic accumulation of few monomers or segments of molecule into a gradualistic growth process. This would be the consequence of the very high propensity that nucleic acids have to be subjected to duplications.

  10. Ribosomal incorporation of backbone modified amino acids via an editing-deficient aminoacyl-tRNA synthetase.

    Science.gov (United States)

    Iqbal, Emil S; Dods, Kara K; Hartman, Matthew C T

    2018-02-14

    The ability to incorporate non-canonical amino acids (ncAA) using translation offers researchers the ability to extend the functionality of proteins and peptides for many applications including synthetic biology, biophysical and structural studies, and discovery of novel ligands. Here we describe the high promiscuity of an editing-deficient valine-tRNA synthetase (ValRS T222P). Using this enzyme, we demonstrate ribosomal translation of 11 ncAAs including those with novel side chains, α,α-disubstitutions, and cyclic β-amino acids.

  11. Identification of Biomphalaria havanensis and Biomphalaria obstructa populations from Cuba using polymerase chain reaction and restriction fragment length polymorphism of the ribosomal RNA intergenic spacer

    Directory of Open Access Journals (Sweden)

    Teofânia HDA Vidigal

    2001-07-01

    Full Text Available In Cuba, several Biomphalaria species have been reported such as B. orbignyi, B. schrammi, B. helophila, B. havanensis and B. peregrina; only the latter three are considered as potential hosts of Schistosoma mansoni. The specific identification of Biomphalaria species is based on anatomical and morphological characters of genital organs and shells. The correct identification of these snails is complicated by the high variation in these characters, similarity among species and in some cases by the small size of the snails. In this paper, we reported the classical morphological identification, the use of PCR and RFLP analysis of the internal transcribed spacer region of the ribosomal RNA genes for molecular identification of seven snail populations from different localities in Cuba. Using morphological and molecular analysis, we showed that among the studied Cuban Biomphalaria populations only B. havanensis and B. obstructa species were found.

  12. In silico modelling and analysis of ribosome kinetics and aa-tRNA competition

    NARCIS (Netherlands)

    Bošnački, D.; Pronk, T.E.; de Vink, E.P.

    2008-01-01

    We present a formal analysis of ribosome kinetics using probabilistic model checking and the tool Prism. We compute different parameters of the model, like probabilities of translation errors and average insertion times per codon. The model predicts strong correlation to the quotient of the

  13. [Identification of Clonorchis sinensis metacercariae based on PCR targeting ribosomal DNA ITS regions and COX1 gene].

    Science.gov (United States)

    Yang, Qing-Li; Shen, Ji-Qing; Jiang, Zhi-Hua; Yang, Yi-Chao; Li, Hong-Mei; Chen, Ying-Dan; Zhou, Xiao-Nong

    2014-06-01

    To identify Clonorchis sinensis metacercariae using PCR targeting ribosomal DNA ITS region and COX1 gene. Pseudorasbora parva were collected from Hengxian County of Guangxi at the end of May 2013. Single metacercaria of C. sinensis and other trematodes were separated from muscle tissue of P. parva by digestion method. Primers targeting ribosomal DNA ITS region and COX1 gene of C. sinensis were designed for PCR and the universal primers were used as control. The sensitivity and specificity of the PCR detection were analyzed. C. sinensis metacercariae at different stages were identified by PCR. DNA from single C. sinensis metacercaria was detected by PCR targeting ribosomal DNA ITS region and COX1 gene. The specific amplicans have sizes of 437/549, 156/249 and 195/166 bp, respectively. The ratio of the two positive numbers in PCR with universal primers and specific primers targeting C. sinensis ribosomal DNA ITS1 and ITS2 regions was 0.905 and 0.952, respectively. The target gene fragments were amplified by PCR using COX1 gene-specific primers. The PCR with specific primers did not show any non-specific amplification. However, the PCR with universal primers targeting ribosomal DNA ITS regions performed serious non-specific amplification. C. sinensis metacercariae at different stages are identified by morphological observation and PCR method. Species-specific primers targeting ribosomal DNA ITS region show higher sensitivity and specificity than the universal primers. PCR targeting COX1 gene shows similar sensitivity and specificity to PCR with specific primers targeting ribosomal DNA ITS regions.

  14. Chromophore-assisted light inactivation of pKi-67 leads to inhibition of ribosomal RNA synthesis.

    Science.gov (United States)

    Rahmanzadeh, R; Hüttmann, G; Gerdes, J; Scholzen, T

    2007-06-01

    Expression of the nuclear Ki-67 protein (pKi-67) is strongly associated with cell proliferation. For this reason, antibodies against this protein are widely used as prognostic tools for the assessment of cell proliferation in biopsies from cancer patients. Despite this broad application in histopathology, functional evidence for the physiological role of pKi-67 is still missing. Recently, we proposed a function of pKi-67 in the early steps of ribosomal RNA (rRNA) synthesis. Here, we have examined the involvement of pKi-67 in this process by photochemical inhibition using chromophore-assisted light inactivation (CALI). Anti-pKi-67 antibodies were labelled with the fluorochrome fluorescein 5(6)-isothiocyanate and were irradiated after binding to their target protein. Performing CALI in vitro on cell lysates led to specific cross-linking of pKi-67. Moreover, the upstream binding factor (UBF) necessary for rRNA transcription was also partly subjected to cross-link formation, indicating a close spatial proximity of UBF and pKi-67. CALI in living cells, using micro-injected antibody, caused a striking relocalization of UBF from foci within the nucleoli to spots located at the nucleolar rim or within the nucleoplasm. pKi-67-CALI resulted in dramatic inhibition of RNA polymerase I-dependent nucleolar rRNA synthesis, whereas RNA polymerase II-dependent nucleoplasmic RNA synthesis remained almost unaltered. Our data presented here argue for a crucial role of pKi-67 in RNA polymerase I-dependent nucleolar rRNA synthesis.

  15. Single Cell Analysis Linking Ribosomal (r)DNA and rRNA Copy Numbers to Cell Size and Growth Rate Provides Insights into Molecular Protistan Ecology.

    Science.gov (United States)

    Fu, Rao; Gong, Jun

    2017-11-01

    Ribosomal (r)RNA and rDNA have been golden molecular markers in microbial ecology. However, it remains poorly understood how ribotype copy number (CN)-based characteristics are linked with diversity, abundance, and activity of protist populations and communities observed at organismal levels. Here, we applied a single-cell approach to quantify ribotype CNs in two ciliate species reared at different temperatures. We found that in actively growing cells, the per-cell rDNA and rRNA CNs scaled with cell volume (CV) to 0.44 and 0.58 powers, respectively. The modeled rDNA and rRNA concentrations thus appear to be much higher in smaller than in larger cells. The observed rRNA:rDNA ratio scaled with CV 0.14 . The maximum growth rate could be well predicted by a combination of per-cell ribotype CN and temperature. Our empirical data and modeling on single-cell ribotype scaling are in agreement with both the metabolic theory of ecology and the growth rate hypothesis, providing a quantitative framework for linking cellular rDNA and rRNA CNs with body size, growth (activity), and biomass stoichiometry. This study also demonstrates that the expression rate of rRNA genes is constrained by cell size, and favors biomass rather than abundance-based interpretation of quantitative ribotype data in population and community ecology of protists. © 2017 The Authors. Journal of Eukaryotic Microbiology published by Wiley Periodicals, Inc. on behalf of International Society of Protistologists.

  16. Identification of Phosphoglycerate Kinase 1 (PGK1 as a reference gene for quantitative gene expression measurements in human blood RNA

    Directory of Open Access Journals (Sweden)

    Unger Elizabeth R

    2011-09-01

    Full Text Available Abstract Background Blood is a convenient sample and increasingly used for quantitative gene expression measurements with a variety of diseases including chronic fatigue syndrome (CFS. Quantitative gene expression measurements require normalization of target genes to reference genes that are stable and independent from variables being tested in the experiment. Because there are no genes that are useful for all situations, reference gene selection is an essential step to any quantitative reverse transcription-PCR protocol. Many publications have described appropriate genes for a wide variety of tissues and experimental conditions, however, reference genes that may be suitable for the analysis of CFS, or human blood RNA derived from whole blood as well as isolated peripheral blood mononuclear cells (PBMCs, have not been described. Findings Literature review and analyses of our unpublished microarray data were used to narrow down the pool of candidate reference genes to six. We assayed whole blood RNA from Tempus tubes and cell preparation tube (CPT-collected PBMC RNA from 46 subjects, and used the geNorm and NormFinder algorithms to select the most stable reference genes. Phosphoglycerate kinase 1 (PGK1 was one of the optimal normalization genes for both whole blood and PBMC RNA, however, additional genes differed for the two sample types; Ribosomal protein large, P0 (RPLP0 for PBMC RNA and Peptidylprolyl isomerase B (PPIB for whole blood RNA. We also show that the use of a single reference gene is sufficient for normalization when the most stable candidates are used. Conclusions We have identified PGK1 as a stable reference gene for use with whole blood RNA and RNA derived from PBMC. When stable genes are selected it is possible to use a single gene for normalization rather than two or three. Optimal normalization will improve the ability of results from PBMC RNA to be compared with those from whole blood RNA and potentially allows comparison of

  17. Symportin 1 chaperones 5S RNP assembly during ribosome biogenesis by occupying an essential rRNA-binding site.

    Science.gov (United States)

    Calviño, Fabiola R; Kharde, Satyavati; Ori, Alessandro; Hendricks, Astrid; Wild, Klemens; Kressler, Dieter; Bange, Gert; Hurt, Ed; Beck, Martin; Sinning, Irmgard

    2015-04-07

    During 60S biogenesis, mature 5S RNP consisting of 5S RNA, RpL5 and RpL11, assembles into a pre-60S particle, where docking relies on RpL11 interacting with helix 84 (H84) of the 25S RNA. How 5S RNP is assembled for recruitment into the pre-60S is not known. Here we report the crystal structure of a ternary symportin Syo1-RpL5-N-RpL11 complex and provide biochemical and structural insights into 5S RNP assembly. Syo1 guards the 25S RNA-binding surface on RpL11 and competes with H84 for binding. Pull-down experiments show that H84 releases RpL11 from the ternary complex, but not in the presence of 5S RNA. Crosslinking mass spectrometry visualizes structural rearrangements on incorporation of 5S RNA into the Syo1-RpL5-RpL11 complex supporting the formation of a pre-5S RNP. Our data underline the dual role of Syo1 in ribosomal protein transport and as an assembly platform for 5S RNP.

  18. Differential Stoichiometry among Core Ribosomal Proteins

    Directory of Open Access Journals (Sweden)

    Nikolai Slavov

    2015-11-01

    Full Text Available Understanding the regulation and structure of ribosomes is essential to understanding protein synthesis and its dysregulation in disease. While ribosomes are believed to have a fixed stoichiometry among their core ribosomal proteins (RPs, some experiments suggest a more variable composition. Testing such variability requires direct and precise quantification of RPs. We used mass spectrometry to directly quantify RPs across monosomes and polysomes of mouse embryonic stem cells (ESC and budding yeast. Our data show that the stoichiometry among core RPs in wild-type yeast cells and ESC depends both on the growth conditions and on the number of ribosomes bound per mRNA. Furthermore, we find that the fitness of cells with a deleted RP-gene is inversely proportional to the enrichment of the corresponding RP in polysomes. Together, our findings support the existence of ribosomes with distinct protein composition and physiological function.

  19. Characteristic differences between the promoters of intron-containing and intronless ribosomal protein genes in yeast

    Directory of Open Access Journals (Sweden)

    Vingron Martin

    2008-10-01

    Full Text Available Abstract Background More than two thirds of the highly expressed ribosomal protein (RP genes in Saccharomyces cerevisiae contain introns, which is in sharp contrast to the genome-wide five percent intron-containing genes. It is well established that introns carry regulatory sequences and that the transcription of RP genes is extensively and coordinately regulated. Here we test the hypotheses that introns are innately associated with heavily transcribed genes and that introns of RP genes contribute regulatory TF binding sequences. Moreover, we investigate whether promoter features are significantly different between intron-containing and intronless RP genes. Results We find that directly measured transcription rates tend to be lower for intron-containing compared to intronless RP genes. We do not observe any specifically enriched sequence motifs in the introns of RP genes other than those of the branch point and the two splice sites. Comparing the promoters of intron-containing and intronless RP genes, we detect differences in number and position of Rap1-binding and IFHL motifs. Moreover, the analysis of the length distribution and the folding free energies suggest that, at least in a sub-population of RP genes, the 5' untranslated sequences are optimized for regulatory function. Conclusion Our results argue against the direct involvement of introns in the regulation of transcription of highly expressed genes. Moreover, systematic differences in motif distributions suggest that RP transcription factors may act differently on intron-containing and intronless gene promoters. Thus, our findings contribute to the decoding of the RP promoter architecture and may fuel the discussion on the evolution of introns.

  20. CRM1 and its ribosome export adaptor NMD3 localize to the nucleolus and affect rRNA synthesis.

    Science.gov (United States)

    Bai, Baoyan; Moore, Henna M; Laiho, Marikki

    2013-01-01

    CRM1 is an export factor that together with its adaptor NMD3 transports numerous cargo molecules from the nucleus to cytoplasm through the nuclear pore. Previous studies have suggested that CRM1 and NMD3 are detected in the nucleolus. However, their localization with subnucleolar domains or participation in the activities of the nucleolus are unclear. We demonstrate here biochemically and using imaging analyses that CRM1 and NMD3 co-localize with nucleolar marker proteins in the nucleolus. In particular, their nucleolar localization is markedly increased by inhibition of RNA polymerase I (Pol I) transcription by actinomycin D or by silencing Pol I catalytic subunit, RPA194. We show that CRM1 nucleolar localization is dependent on its activity and the expression of NMD3, whereas NMD3 nucleolar localization is independent of CRM1. This suggests that NMD3 provides nucleolar tethering of CRM1. While inhibition of CRM1 by leptomycin B inhibited processing of 28S ribosomal (r) RNA, depletion of NMD3 did not, suggesting that their effects on 28S rRNA processing are distinct. Markedly, depletion of NMD3 and inhibition of CRM1 reduced the rate of pre-47S rRNA synthesis. However, their inactivation did not lead to nucleolar disintegration, a hallmark of Pol I transcription stress, suggesting that they do not directly regulate transcription. These results indicate that CRM1 and NMD3 have complex functions in pathways that couple rRNA synthetic and processing engines and that the rRNA synthesis rate may be adjusted according to proficiency in rRNA processing and export.

  1. Engineered ribosomal RNA operon copy-number variants of E. coli reveal the evolutionary trade-offs shaping rRNA operon number

    Science.gov (United States)

    Gyorfy, Zsuzsanna; Draskovits, Gabor; Vernyik, Viktor; Blattner, Frederick F.; Gaal, Tamas; Posfai, Gyorgy

    2015-01-01

    Ribosomal RNA (rrn) operons, characteristically present in several copies in bacterial genomes (7 in E. coli), play a central role in cellular physiology. We investigated the factors determining the optimal number of rrn operons in E. coli by constructing isogenic variants with 5–10 operons. We found that the total RNA and protein content, as well as the size of the cells reflected the number of rrn operons. While growth parameters showed only minor differences, competition experiments revealed a clear pattern: 7–8 copies were optimal under conditions of fluctuating, occasionally rich nutrient influx and lower numbers were favored in stable, nutrient-limited environments. We found that the advantages of quick adjustment to nutrient availability, rapid growth and economic regulation of ribosome number all contribute to the selection of the optimal rrn operon number. Our results suggest that the wt rrn operon number of E. coli reflects the natural, ‘feast and famine’ life-style of the bacterium, however, different copy numbers might be beneficial under different environmental conditions. Understanding the impact of the copy number of rrn operons on the fitness of the cell is an important step towards the creation of functional and robust genomes, the ultimate goal of synthetic biology. PMID:25618851

  2. Characterization of the regions from E. coli 16 S RNA covalently linked to ribosomal proteins S4 and S20 after ultraviolet irradiation

    International Nuclear Information System (INIS)

    Ehresmann, B.; Backendorf, C.; Ehresmann, C.; Ebel, J.P.

    1977-01-01

    The use of ultraviolet irradiation to form photochemical covalent bonds between the 16 S RNA and a ribosomal protein is a reliable method to check RNA regions which are interacting with the protein. This technique was successfully used to covalently link RNA or DNA and specific proteins in several cases. In the case of ribosome, it has been shown that the irradiation of 30 S and 50 S subunits using high doses of ultraviolet light allowed the covalent binding of almost all of the ribosomal proteins to the 16 S or 23 S RNAs. Using mild conditions, only proteins S7 and L4 could be covalently linked to the 16 S and 23 S RNAs, respectively, and the 16 S RNA region linked to protein S7 has now been characterized. The specificity of the photoreaction was demonstrated earlier and the tryptic peptides from proteins S4 and S7, photochemically linked to the 16 S RNA complexes, were identified. A report is presented on the sequences of the RNA regions which can be photochemically linked to proteins S4 and S7 after ultraviolet irradiation of the specific S4-16 S RNA and 20 S-16 S RNA complexes

  3. The AAA-ATPase NVL2 is a component of pre-ribosomal particles that interacts with the DExD/H-box RNA helicase DOB1

    International Nuclear Information System (INIS)

    Nagahama, Masami; Yamazoe, Takeshi; Hara, Yoshimitsu; Tani, Katsuko; Tsuji, Akihiko; Tagaya, Mitsuo

    2006-01-01

    Nuclear VCP/p97-like protein 2 (NVL2) is a member of the chaperone-like AAA-ATPase family with two conserved ATP-binding modules. Our previous studies have shown that NVL2 is localized to the nucleolus by interacting with ribosomal protein L5 and may participate in ribosome synthesis, a process involving various non-ribosomal factors including chaperones and RNA helicases. Here, we show that NVL2 is associated with pre-ribosomal particles in the nucleus. Moreover, we used yeast two-hybrid and co-immunoprecipitation assays to identify an NVL2-interacting protein that could yield insights into NVL2 function in ribosome biogenesis. We found that NVL2 interacts with DOB1, a DExD/H-box RNA helicase, whose yeast homologue functions in a late stage of the 60S subunit synthesis. DOB1 can interact with a second ATP-binding module mutant of NVL2, which shows a dominant negative effect on ribosome synthesis. In contrast, it cannot interact with a first ATP-binding module mutant, which does not show the dominant negative effect. When the dominant negative mutant of NVL2 was overexpressed in cells, DOB1 appeared to remain associated with nuclear pre-ribosomal particles. Such accumulation was not observed upon overexpression of wild-type NVL2 or a nondominant-negative mutant. Taken together, our results suggest that NVL2 might regulate the association/dissociation reaction of DOB1 with pre-ribosomal particles by acting as a molecular chaperone

  4. Mapping posttranscriptional modifications in 5S ribosomal RNA by MALDI mass spectrometry

    DEFF Research Database (Denmark)

    Kirpekar, F; Douthwaite, S; Roepstorff, P

    2000-01-01

    RNases in parallel combined with further fragmentation by Post Source Decay (PSD). This approach allows fast and sensitive screening of a purified RNA for posttranscriptional modification, and has been applied on 5S rRNA from two thermophilic microorganisms, the bacterium Bacillus stearothermophilus...... that is clearly conserved with respect to both sequence and position in B. stearothermophilus and H. halobium and to some degree also in H. marismortui. However, no analogous modification was identified in the latter three organisms. We further find that the 5' end of H. halobium 5S rRNA is dephosphorylated......, in contrast to the other 5S rRNA species investigated. The method additionally gives an immediate indication of whether the expected RNA sequence is in agreement with the observed fragment masses. Discrepancies with two of the published 5S rRNA sequences were identified and are reported here....

  5. Genes Involved in Human Ribosome Biogenesis areTranscriptionally Upregulated in Colorectal Cancer

    DEFF Research Database (Denmark)

    Mansilla, Francisco; Lamy, Philippe; Ørntoft, Torben Falck

    2009-01-01

    Microarray gene expression profiling comprising 168 colorectal adenocarcinomas and 10 normal mucosas showed that over 79% of the genes involved in human ribosome biogenesis are significantly upregulated (log2>0.5, p<10-3) when compared to normal mucosa. Overexpression was independent of microsate......Microarray gene expression profiling comprising 168 colorectal adenocarcinomas and 10 normal mucosas showed that over 79% of the genes involved in human ribosome biogenesis are significantly upregulated (log2>0.5, p... of microsatellite status. The promoters of the genes studied showed a significant enrichment for several transcription factor binding sites. There was a significant correlation between the number of binding site targets for these transcription factors and the observed gene transcript upregulation. The upregulation...

  6. Depletion of key protein components of the RISC pathway impairs pre-ribosomal RNA processing.

    Science.gov (United States)

    Liang, Xue-Hai; Crooke, Stanley T

    2011-06-01

    Little is known about whether components of the RNA-induced silencing complex (RISC) mediate the biogenesis of RNAs other than miRNA. Here, we show that depletion of key proteins of the RISC pathway by antisense oligonucleotides significantly impairs pre-rRNA processing in human cells. In cells depleted of Drosha or Dicer, different precursors to 5.8S rRNA strongly accumulated, without affecting normal endonucleolytic cleavages. Moderate yet distinct processing defects were also observed in Ago2-depleted cells. Physical links between pre-rRNA and these proteins were identified by co-immunoprecipitation analyses. Interestingly, simultaneous depletion of Dicer and Drosha led to a different processing defect, causing slower production of 28S rRNA and its precursor. Both Dicer and Ago2 were detected in the nuclear fraction, and reduction of Dicer altered the structure of the nucleolus, where pre-rRNA processing occurs. Together, these results suggest that Drosha and Dicer are implicated in rRNA biogenesis.

  7. Prevalence, Genetic Characterization, and 18S Small Subunit Ribosomal RNA Diversity of Trypanosoma rangeli in Triatomine and Mammal Hosts in Endemic Areas for Chagas Disease in Ecuador.

    Science.gov (United States)

    Ocaña-Mayorga, Sofia; Aguirre-Villacis, Fernanda; Pinto, C Miguel; Vallejo, Gustavo A; Grijalva, Mario J

    2015-12-01

    Trypanosoma rangeli is a nonpathogenic parasite for humans; however, its medical importance relies in its similarity and overlapping distribution with Trypanosoma cruzi, causal agent of Chagas disease in the Americas. The genetic diversity of T. rangeli and its association with host species (triatomines and mammals) has been identified along Central and the South America; however, it has not included data of isolates from Ecuador. This study reports infection with T. rangeli in 18 genera of mammal hosts and five species of triatomines in three environments (domestic, peridomestic, and sylvatic). Higher infection rates were found in the sylvatic environment, in close association with Rhodnius ecuadoriensis. The results of this study extend the range of hosts infected with this parasite and the geographic range of the T. rangeli genotype KP1(-)/lineage C in South America. It was not possible to detect variation on T. rangeli from the central coastal region and southern Ecuador with the analysis of the small subunit ribosomal RNA (SSU-rRNA) gene, even though these areas are ecologically different and a phenotypic subdivision of R. ecuadoriensis has been found. R. ecuadoriensis is considered one of the most important vectors for Chagas disease transmission in Ecuador due to its wide distribution and adaptability to diverse environments. An extensive knowledge of the trypanosomes circulating in this species of triatomine, and associated mammal hosts, is important for delineating transmission dynamics and preventive measures in the endemic areas of Ecuador and Northern Peru.

  8. Prevalence, Genetic Characterization, and 18S Small Subunit Ribosomal RNA Diversity of Trypanosoma rangeli in Triatomine and Mammal Hosts in Endemic Areas for Chagas Disease in Ecuador

    Science.gov (United States)

    Ocaña-Mayorga, Sofia; Aguirre-Villacis, Fernanda; Pinto, C. Miguel; Vallejo, Gustavo A.

    2015-01-01

    Abstract Trypanosoma rangeli is a nonpathogenic parasite for humans; however, its medical importance relies in its similarity and overlapping distribution with Trypanosoma cruzi, causal agent of Chagas disease in the Americas. The genetic diversity of T. rangeli and its association with host species (triatomines and mammals) has been identified along Central and the South America; however, it has not included data of isolates from Ecuador. This study reports infection with T. rangeli in 18 genera of mammal hosts and five species of triatomines in three environments (domestic, peridomestic, and sylvatic). Higher infection rates were found in the sylvatic environment, in close association with Rhodnius ecuadoriensis. The results of this study extend the range of hosts infected with this parasite and the geographic range of the T. rangeli genotype KP1(−)/lineage C in South America. It was not possible to detect variation on T. rangeli from the central coastal region and southern Ecuador with the analysis of the small subunit ribosomal RNA (SSU-rRNA) gene, even though these areas are ecologically different and a phenotypic subdivision of R. ecuadoriensis has been found. R. ecuadoriensis is considered one of the most important vectors for Chagas disease transmission in Ecuador due to its wide distribution and adaptability to diverse environments. An extensive knowledge of the trypanosomes circulating in this species of triatomine, and associated mammal hosts, is important for delineating transmission dynamics and preventive measures in the endemic areas of Ecuador and Northern Peru. PMID:26645579

  9. A Sensitive and Specific PCR Based Method for Identification of Cryptosporidium Sp. Using New Primers from 18S Ribosomal RNA

    Directory of Open Access Journals (Sweden)

    M Heydarnezhadi

    2011-09-01

    Full Text Available Background: The main goal of the present study was to develop a new sensitive and specific PCR based method for Identification of Cryptosporidium sp. using novel primers from 18S ribosomal RNA. Cryptosporidi­osis in high-risk host groups particularly in neonates and immuno-compromised individuals may result in death. To the best of our knowledge this is the first study regarding develop a new PCR based method to diagnose the cryptosporidiosis in Iran.Methods: A total of 850 human fecal samples from patients clinically suspected to cryptosporidiosis and 100 healthy and diarrheic cattle stool specimens were collected. The simplified formol-ether concentration method was carried out for all samples. They were then examined microscopically by modified Ziehl-Neel­sen staining method. Total DNA was extracted by QIA amp DNA stool mini kit was carried out by using designed prim­ers.Results: Twenty nine cases of cryptosporidiosis infection in human and 30 samples from cattle microscopi­cally were posi­tive. The described primary and nested PCR method could detect all Cryptospori­dium positive samples from human and cattle. Regards to suspected negative samples in pri­mary PCR examination, the Nested PCR could ap­prove two more positive results. Furthermore, Nested PCR analysis was able to detect one more case which was nega­tive in both microscopically examination and primary PCR. Specificity of the test was 100%. Sensitivity of Nested PCR in comparison to our gold standard; microscopy after Ridley concentration modified ziehl-Neelsen, was 100 %.Conclusion: Our developed PCR based method by using new primers devised from 18S ribosomal RNA revealed the ability for identification of the Cryptosporidium species such as C. parvum and C. huminis with high specificity and sensitivity.

  10. Systematic identification of novel, essential host genes affecting bromovirus RNA replication.

    Directory of Open Access Journals (Sweden)

    Brandi L Gancarz

    Full Text Available Positive-strand RNA virus replication involves viral proteins and cellular proteins at nearly every replication step. Brome mosaic virus (BMV is a well-established model for dissecting virus-host interactions and is one of very few viruses whose RNA replication, gene expression and encapsidation have been reproduced in the yeast Saccharomyces cerevisiae. Previously, our laboratory identified ∼100 non-essential host genes whose loss inhibited or enhanced BMV replication at least 3-fold. However, our isolation of additional BMV-modulating host genes by classical genetics and other results underscore that genes essential for cell growth also contribute to BMV RNA replication at a frequency that may be greater than that of non-essential genes. To systematically identify novel, essential host genes affecting BMV RNA replication, we tested a collection of ∼900 yeast strains, each with a single essential gene promoter replaced by a doxycycline-repressible promoter, allowing repression of gene expression by adding doxycycline to the growth medium. Using this strain array of ∼81% of essential yeast genes, we identified 24 essential host genes whose depleted expression reproducibly inhibited or enhanced BMV RNA replication. Relevant host genes are involved in ribosome biosynthesis, cell cycle regulation and protein homeostasis, among other cellular processes. BMV 2a(Pol levels were significantly increased in strains depleted for a heat shock protein (HSF1 or proteasome components (PRE1 and RPT6, suggesting these genes may affect BMV RNA replication by directly or indirectly modulating 2a(Pol localization, post-translational modification or interacting partners. Investigating the diverse functions of these newly identified essential host genes should advance our understanding of BMV-host interactions and normal cellular pathways, and suggest new modes of virus control.

  11. Affinity labelling in situ of the bL12 protein on E. coli 70S ribosomes by means of a tRNA dialdehyde derivative.

    Science.gov (United States)

    Hountondji, Codjo; Créchet, Jean-Bernard; Le Caër, Jean-Pierre; Lancelot, Véronique; Cognet, Jean A H; Baouz, Soria

    2017-12-01

    In this report, we have used periodate-oxidized tRNA (tRNAox) as an affinity laleling reagent to demonstrate that: (i) the bL12 protein contacts the CCA-arm of P-site bound tRNA on the Escherichia coli 70S ribosomes; (ii) the stoichiometry of labelling is one molecule of tRNAox bound to one polypeptide chain of endogenous bL12; (iii) cross-linking in situ of bL12 with tRNAox on the ribosomes provokes the loss of activity; (iv) intact tRNA protects bL12 in the 70S ribosomes against cross-linking with tRNAox; (v) both tRNAox and pyridoxal 5'-phosphate (PLP) compete for the same or for proximal cross-linking site(s) on bL12 inside the ribosome; (vi) the stoichiometry of cross-linking of PLP to the recombinant E. coli bL12 protein is one molecule of PLP covalently bound per polypeptide chain; (vii) the amino acid residue of recombinant bL12 cross-linked with PLP is Lys-65; (viii) Lys-65 of E. coli bL12 corresponds to Lys-53 of eL42 which was previously shown to cross-link with P-site bound tRNAox on human 80S ribosomes in situ; (ix) finally, E. coli bL12 and human eL42 proteins display significant primary structure similarities, which argues for evolutionary conservation of these two proteins located at the tRNA-CCA binding site on eubacterial and eukaryal ribosomes. © The Authors 2017. Published by Oxford University Press on behalf of the Japanese Biochemical Society. All rights reserved.

  12. Stimulation of Pol III-dependent 5S rRNA and U6 snRNA gene expression by AP-1 transcription factors.

    Science.gov (United States)

    Ahuja, Richa; Kumar, Vijay

    2017-07-01

    RNA polymerase III transcribes structurally diverse group of essential noncoding RNAs including 5S ribosomal RNA (5SrRNA) and U6 snRNA. These noncoding RNAs are involved in RNA processing and ribosome biogenesis, thus, coupling Pol III activity to the rate of protein synthesis, cell growth, and proliferation. Even though a few Pol II-associated transcription factors have been reported to participate in Pol III-dependent transcription, its activation by activator protein 1 (AP-1) factors, c-Fos and c-Jun, has remained unexplored. Here, we show that c-Fos and c-Jun bind to specific sites in the regulatory regions of 5S rRNA (type I) and U6 snRNA (type III) gene promoters and stimulate their transcription. Our chromatin immunoprecipitation studies suggested that endogenous AP-1 factors bind to their cognate promoter elements during the G1/S transition of cell cycle apparently synchronous with Pol III transcriptional activity. Furthermore, the interaction of c-Jun with histone acetyltransferase p300 promoted the recruitment of p300/CBP complex on the promoters and facilitated the occupancy of Pol III transcriptional machinery via histone acetylation and chromatin remodeling. The findings of our study, together, suggest that AP-1 factors are novel regulators of Pol III-driven 5S rRNA and U6 snRNA expression with a potential role in cell proliferation. © 2017 Federation of European Biochemical Societies.

  13. Ribosomal RNA and nucleolar proteins from the oocyte are to some degree used for embryonic nucleolar formation in cattle and pig

    DEFF Research Database (Denmark)

    Maddox-Hyttel, Poul; Svarcova, Olga; Laurincik, Josef

    2007-01-01

    The nucleolus is the site of ribosomal RNA (rRNA) and ribosome production. In the bovine primordial follicle oocyte, this organelle is inactive, but in the secondary follicle an active fibrillo-granular nucleolus develops and proteins involved in rDNA transcription (topoisomerase I, RNA polymerase...... I and upstream binding factor) and early (fibrillarin) or late rRNA processing (nucleolin and nucleophosmin) localize to it. At the end of the oocyte growth phase, the nucleolus is inactivated again and transforms into a solid remnant. The nucleolar remnant is dissolved when meiosis is resumed. Upon...... fertilization, structures resembling the nucleolar remnant, now referred to as nucleolus precursor bodies (NPBs), are established in the pronuclei. These entities are engaged in the re-establishment of fibrilo-granular nucleoli at the major activation of the embryonic genome. This nucleolar formation can...

  14. Requirement for a conserved, tertiary interaction in the core of 23S ribosomal RNA

    DEFF Research Database (Denmark)

    Aagaard, C; Douthwaite, S

    1994-01-01

    RNA. Every substitution that disrupts the potential for Watson-Crick base pairing between these positions reduces or abolishes the participation of 23S rRNA in protein synthesis. All mutant 23S rRNAs are assembled into 50S subunits, but the mutant subunits are less able to stably interact with 30S subunits...... is nonfunctional. In contrast to the considerable effect the mutations have on function, they impart only slight structural changes on the naked rRNA, and these are limited to the immediate vicinity of the mutations. The data show that positions 1262 and 2017 pair in a Watson-Crick manner, but the data also...

  15. Screening a yeast promoter library leads to the isolation of the RP29/L32 and SNR17B/RPL37A divergent promoters and the discovery of a gene encoding ribosomal protein L37.

    Science.gov (United States)

    Santangelo, G M; Tornow, J; McLaughlin, C S; Moldave, K

    1991-08-30

    Two promoters (A7 and A23), isolated at random from the Saccharomyces cerevisiae genome by virtue of their capacity to activate transcription, are identical to known intergenic bidirectional promoters. Sequence analysis of the genomic DNA adjacent to the A7 promoter identified a split gene encoding ribosomal (r) protein L37, which is homologous to the tRNA-binding r-proteins, L35a (from human and rat) and L32 (from frogs).

  16. Tumor-adjacent tissue co-expression profile analysis reveals pro-oncogenic ribosomal gene signature for prognosis of resectable hepatocellular carcinoma.

    Science.gov (United States)

    Grinchuk, Oleg V; Yenamandra, Surya P; Iyer, Ramakrishnan; Singh, Malay; Lee, Hwee Kuan; Lim, Kiat Hon; Chow, Pierce Kah-Hoe; Kuznetsov, Vladamir A

    2018-01-01

    Currently, molecular markers are not used when determining the prognosis and treatment strategy for patients with hepatocellular carcinoma (HCC). In the present study, we proposed that the identification of common pro-oncogenic pathways in primary tumors (PT) and adjacent non-malignant tissues (AT) typically used to predict HCC patient risks may result in HCC biomarker discovery. We examined the genome-wide mRNA expression profiles of paired PT and AT samples from 321 HCC patients. The workflow integrated differentially expressed gene selection, gene ontology enrichment, computational classification, survival predictions, image analysis and experimental validation methods. We developed a 24-ribosomal gene-based HCC classifier (RGC), which is prognostically significant in both PT and AT. The RGC gene overexpression in PT was associated with a poor prognosis in the training (hazard ratio = 8.2, P = 9.4 × 10 -6 ) and cross-cohort validation (hazard ratio = 2.63, P = 0.004) datasets. The multivariate survival analysis demonstrated the significant and independent prognostic value of the RGC. The RGC displayed a significant prognostic value in AT of the training (hazard ratio = 5.0, P = 0.03) and cross-validation (hazard ratio = 1.9, P = 0.03) HCC groups, confirming the accuracy and robustness of the RGC. Our experimental and bioinformatics analyses suggested a key role for c-MYC in the pro-oncogenic pattern of ribosomal biogenesis co-regulation in PT and AT. Microarray, quantitative RT-PCR and quantitative immunohistochemical studies of the PT showed that DKK1 in PT is the perspective biomarker for poor HCC outcomes. The common co-transcriptional pattern of ribosome biogenesis genes in PT and AT from HCC patients suggests a new scalable prognostic system, as supported by the model of tumor-like metabolic redirection/assimilation in non-malignant AT. The RGC, comprising 24 ribosomal genes, is introduced as a robust and reproducible prognostic model for

  17. Naked mole-rat has increased translational fidelity compared with the mouse, as well as a unique 28S ribosomal RNA cleavage.

    Science.gov (United States)

    Azpurua, Jorge; Ke, Zhonghe; Chen, Iris X; Zhang, Quanwei; Ermolenko, Dmitri N; Zhang, Zhengdong D; Gorbunova, Vera; Seluanov, Andrei

    2013-10-22

    The naked mole-rat (Heterocephalus glaber) is a subterranean eusocial rodent with a markedly long lifespan and resistance to tumorigenesis. Multiple data implicate modulation of protein translation in longevity. Here we report that 28S ribosomal RNA (rRNA) of the naked mole-rat is processed into two smaller fragments of unequal size. The two breakpoints are located in the 28S rRNA divergent region 6 and excise a fragment of 263 nt. The excised fragment is unique to the naked mole-rat rRNA and does not show homology to other genomic regions. Because this hidden break site could alter ribosome structure, we investigated whether translation rate and amino acid incorporation fidelity were altered. We report that naked mole-rat fibroblasts have significantly increased translational fidelity despite having comparable translation rates with mouse fibroblasts. Although we cannot directly test whether the unique 28S rRNA structure contributes to the increased fidelity of translation, we speculate that it may change the folding or dynamics of the large ribosomal subunit, altering the rate of GTP hydrolysis and/or interaction of the large subunit with tRNA during accommodation, thus affecting the fidelity of protein synthesis. In summary, our results show that naked mole-rat cells produce fewer aberrant proteins, supporting the hypothesis that the more stable proteome of the naked mole-rat contributes to its longevity.

  18. Species-independent MicroRNA Gene Discovery

    KAUST Repository

    Kamanu, Timothy K.

    2012-12-01

    MicroRNA (miRNA) are a class of small endogenous non-coding RNA that are mainly negative transcriptional and post-transcriptional regulators in both plants and animals. Recent studies have shown that miRNA are involved in different types of cancer and other incurable diseases such as autism and Alzheimer’s. Functional miRNAs are excised from hairpin-like sequences that are known as miRNA genes. There are about 21,000 known miRNA genes, most of which have been determined using experimental methods. miRNA genes are classified into different groups (miRNA families). This study reports about 19,000 unknown miRNA genes in nine species whereby approximately 15,300 predictions were computationally validated to contain at least one experimentally verified functional miRNA product. The predictions are based on a novel computational strategy which relies on miRNA family groupings and exploits the physics and geometry of miRNA genes to unveil the hidden palindromic signals and symmetries in miRNA gene sequences. Unlike conventional computational miRNA gene discovery methods, the algorithm developed here is species-independent: it allows prediction at higher accuracy and resolution from arbitrary RNA/DNA sequences in any species and thus enables examination of repeat-prone genomic regions which are thought to be non-informative or ’junk’ sequences. The information non-redundancy of uni-directional RNA sequences compared to information redundancy of bi-directional DNA is demonstrated, a fact that is overlooked by most pattern discovery algorithms. A novel method for computing upstream and downstream miRNA gene boundaries based on mathematical/statistical functions is suggested, as well as cutoffs for annotation of miRNA genes in different miRNA families. Another tool is proposed to allow hypotheses generation and visualization of data matrices, intra- and inter-species chromosomal distribution of miRNA genes or miRNA families. Our results indicate that: miRNA and miRNA

  19. On the Spatial Organization of mRNA, Plasmids, and Ribosomes in a Bacterial Host Overexpressing Membrane Proteins.

    Directory of Open Access Journals (Sweden)

    Lieke A van Gijtenbeek

    2016-12-01

    Full Text Available By using fluorescence imaging, we provide a time-resolved single-cell view on coupled defects in transcription, translation, and growth during expression of heterologous membrane proteins in Lactococcus lactis. Transcripts encoding poorly produced membrane proteins accumulate in mRNA-dense bodies at the cell poles, whereas transcripts of a well-expressed homologous membrane protein show membrane-proximal localization in a translation-dependent fashion. The presence of the aberrant polar mRNA foci correlates with cessation of cell division, which is restored once these bodies are cleared. In addition, activation of the heat-shock response and a loss of nucleoid-occluded ribosomes are observed. We show that the presence of a native-like N-terminal domain is key to SRP-dependent membrane localization and successful production of membrane proteins. The work presented gives new insights and detailed understanding of aberrant membrane protein biogenesis, which can be used for strategies to optimize membrane protein production.

  20. Pseudoknot in domain II of 23 S rRNA is essential for ribosome function

    DEFF Research Database (Denmark)

    Rosendahl, G; Hansen, L H; Douthwaite, S

    1995-01-01

    The structure of domain II in all 23 S (and 23 S-like) rRNAs is constrained by a pseudoknot formed between nucleotides 1005 and 1138, and between 1006 and 1137 (Escherichia coli numbering). These nucleotides are exclusively conserved as 1005C.1138G and 1006C.1137G pairs in all Bacteria, Archaea...... increased accessibility in the rRNA structure close to the sites of the mutations. The degree to which the mutations increase rRNA accessibility correlates with the severity of their phenotypic effects. Nucleotide 1131G is extremely reactive to dimethyl sulphate modification in wild-type subunits...

  1. Highly divergent 16S rRNA sequences in ribosomal operons of Scytonema hyalinum (Cyanobacteria)

    Czech Academy of Sciences Publication Activity Database

    Johansen, J. R.; Mareš, Jan; Pietrasiak, N.; Bohunická, Markéta; Zima, Jan; Štenclová, L.; Hauer, Tomáš

    2017-01-01

    Roč. 12, č. 10 (2017), č. článku e0186393. E-ISSN 1932-6203 R&D Projects: GA ČR(CZ) GA15-11912S Institutional support: RVO:67985939 Keywords : rRNA operon * heterogenita * Scytonema hyalinum Subject RIV: EF - Botanics OBOR OECD: Plant sciences, botany Impact factor: 2.806, year: 2016

  2. Highly divergent 16S rRNA sequences in ribosomal operons of Scytonema hyalinum (Cyanobacteria)

    Czech Academy of Sciences Publication Activity Database

    Johansen, J. R.; Mareš, Jan; Pietrasiak, N.; Bohunická, M.; Zima Jr., J.; Štenclová, Lenka; Hauer, T.

    2017-01-01

    Roč. 12, č. 10 (2017), č. článku e0186393. E-ISSN 1932-6203 Institutional support: RVO:60077344 Keywords : rRNA operon * heterogenita * Scytonema hyalinum Subject RIV: EF - Botanics OBOR OECD: Microbiology Impact factor: 2.806, year: 2016

  3. RNA amplification for successful gene profiling analysis

    Directory of Open Access Journals (Sweden)

    Wang Ena

    2005-07-01

    Full Text Available Abstract The study of clinical samples is often limited by the amount of material available to study. While proteins cannot be multiplied in their natural form, DNA and RNA can be amplified from small specimens and used for high-throughput analyses. Therefore, genetic studies offer the best opportunity to screen for novel insights of human pathology when little material is available. Precise estimates of DNA copy numbers in a given specimen are necessary. However, most studies investigate static variables such as the genetic background of patients or mutations within pathological specimens without a need to assess proportionality of expression among different genes throughout the genome. Comparative genomic hybridization of DNA samples represents a crude exception to this rule since genomic amplification or deletion is compared among different specimens directly. For gene expression analysis, however, it is critical to accurately estimate the proportional expression of distinct RNA transcripts since such proportions directly govern cell function by modulating protein expression. Furthermore, comparative estimates of relative RNA expression at different time points portray the response of cells to environmental stimuli, indirectly informing about broader biological events affecting a particular tissue in physiological or pathological conditions. This cognitive reaction of cells is similar to the detection of electroencephalographic patterns which inform about the status of the brain in response to external stimuli. As our need to understand human pathophysiology at the global level increases, the development and refinement of technologies for high fidelity messenger RNA amplification have become the focus of increasing interest during the past decade. The need to increase the abundance of RNA has been met not only for gene specific amplification, but, most importantly for global transcriptome wide, unbiased amplification. Now gene

  4. Crystallization of the two-domain N-terminal fragment of the archaeal ribosomal protein L10(P0) in complex with a specific fragment of 23S rRNA

    Science.gov (United States)

    Kravchenko, O. V.; Mitroshin, I. V.; Gabdulkhakov, A. G.; Nikonov, S. V.; Garber, M. B.

    2011-07-01

    Lateral L12-stalk (P1-stalk in Archaea, P1/P2-stalk in eukaryotes) is an obligatory morphological element of large ribosomal subunits in all organisms studied. This stalk is composed of the complex of ribosomal proteins L10(P0) and L12(P1) and interacts with 23S rRNA through the protein L10(P0). L12(P1)-stalk is involved in the formation of GTPase center of the ribosome and plays an important role in the ribosome interaction with translation factors. High mobility of this stalk puts obstacles in determination of its structure within the intact ribosome. Crystals of a two-domain N-terminal fragment of ribosomal protein L10(P0) from the archaeon Methanococcus jannaschii in complex with a specific fragment of rRNA from the same organism have been obtained. The crystals diffract X-rays at 3.2 Å resolution.

  5. Crystallization of the two-domain N-terminal fragment of the archaeal ribosomal protein L10(P0) in complex with a specific fragment of 23S rRNA

    Energy Technology Data Exchange (ETDEWEB)

    Kravchenko, O. V.; Mitroshin, I. V.; Gabdulkhakov, A. G.; Nikonov, S. V.; Garber, M. B., E-mail: garber@vega.protres.ru [Institute of Protein Research RAS (Russian Federation)

    2011-07-15

    Lateral L12-stalk (P1-stalk in Archaea, P1/P2-stalk in eukaryotes) is an obligatory morphological element of large ribosomal subunits in all organisms studied. This stalk is composed of the complex of ribosomal proteins L10(P0) and L12(P1) and interacts with 23S rRNA through the protein L10(P0). L12(P1)-stalk is involved in the formation of GTPase center of the ribosome and plays an important role in the ribosome interaction with translation factors. High mobility of this stalk puts obstacles in determination of its structure within the intact ribosome. Crystals of a two-domain N-terminal fragment of ribosomal protein L10(P0) from the archaeon Methanococcus jannaschii in complex with a specific fragment of rRNA from the same organism have been obtained. The crystals diffract X-rays at 3.2 Angstrom-Sign resolution.

  6. Morpholino spin-labeling for base-pair sequencing of a 3'-terminal RNA stem by proton homonuclear Overhauser enhancements: yeast ribosomal 5S RNA

    International Nuclear Information System (INIS)

    Lee, K.M.; Marshall, A.G.

    1987-01-01

    Base-pair sequences for 5S and 5.8S RNAs are not readily extracted from proton homonuclear nuclear Overhauser enhancement (NOE) connectivity experiments alone, due to extensive peak overlap in the downfield (11-15 ppm) proton NMR spectrum. In this paper, we introduce a new method for base-pair proton peak assignment for ribosomal RNAs, based upon the distance-dependent broadening of the resonances of base-pair protons spatially proximal to a paramagnetic group. Introduction of a nitroxide spin-label covalently attached to the 3'-terminal ribose provides an unequivocal starting point for base-pair hydrogen-bond proton NMR assignment. Subsequent NOE connectivities then establish the base-pair sequence for the terminal stem of a 5S RNA. Periodate oxidation of yeast 5S RNA, followed by reaction with 4-amino-2,2,6,6-tetramethylpiperidinyl-1-oxy (TEMPO-NH2) and sodium borohydride reduction, produces yeast 5S RNA specifically labeled with a paramagnetic nitroxide group at the 3'-terminal ribose. Comparison of the 500-MHz 1H NMR spectra of native and 3'-terminal spin-labeled yeast 5S RNA serves to identify the terminal base pair (G1 . C120) and its adjacent base pair (G2 . U119) on the basis of their proximity to the 3'-terminal spin-label. From that starting point, we have then identified (G . C, A . U, or G . U) and sequenced eight of the nine base pairs in the terminal helix via primary and secondary NOE's

  7. Ribosomal RNA analysis indicates a benthic pennate diatom ancestry for the endosymbionts of the dinoflagellates Peridinium foliaceum and Peridinium balticum (Pyrrhophyta).

    Science.gov (United States)

    Chesnick, J M; Kooistra, W H; Wellbrock, U; Medlin, L K

    1997-01-01

    The establishment of chloroplasts as cellular organelles in the dinoflagellate, heterokont (stramenopile), haptophyte, and cryptophyte algae is widely accepted to have been the result of secondary endosymbiotic events, that is, the uptake of a photosynthetic eukaryote by a phagotrophic eukaryote. However, the circumstances that promote such associations between two phylogenetically distinct organisms and result in the integration of their genomes to form a single functional photosynthetic cell is unclear. The dinoflagellates Peridinium foliaceum and Peridinium balticum are unusual in that each contains a membrane-bound eukaryotic heterokont endosymbiont. These symbioses have been interpreted, through data derived from ultrastructural and biochemical investigations, to represent an intermediate stage of secondary endosymbiotic chloroplast acquisition. In this study we have examined the phylogenetic origin of the P. foliaceum and P. balticum heterokont endosymbionts through analysis of their nuclear small subunit ribosomal RNA genes. Our analyses clearly demonstrate both endosymbionts are pennate diatoms belonging to the family Bacillariaceae. Since members of the Bacillariaceae are usually benthic, living on shallow marine sediments, the manner in which establishment of a symbiosis between a planktonic flagellated dinoflagellate and a bottom-dwelling diatom is discussed. In particular, specific environmentally-associated life strategy stages of the host and symbiont, coupled with diatom food preferences by the dinoflagellate, may have been vital to the formation of this association.

  8. A New Class of SINEs with snRNA Gene-Derived Heads.

    Science.gov (United States)

    Kojima, Kenji K

    2015-05-27

    Eukaryotic genomes are colonized by various transposons including short interspersed elements (SINEs). The 5' region (head) of the majority of SINEs is derived from one of the three types of RNA genes--7SL RNA, transfer RNA (tRNA), or 5S ribosomal RNA (rRNA)--and the internal promoter inside the head promotes the transcription of the entire SINEs. Here I report a new group of SINEs whose heads originate from either the U1 or U2 small nuclear RNA gene. These SINEs, named SINEU, are distributed among crocodilians and classified into three families. The structures of the SINEU-1 subfamilies indicate the recurrent addition of a U1- or U2-derived sequence onto the 5' end of SINEU-1 elements. SINEU-1 and SINEU-3 are ancient and shared among alligators, crocodiles, and gharials, while SINEU-2 is absent in the alligator genome. SINEU-2 is the only SINE family that was active after the split of crocodiles and gharials. All SINEU families, especially SINEU-3, are preferentially inserted into a family of Mariner DNA transposon, Mariner-N4_AMi. A group of Tx1 non-long terminal repeat retrotransposons designated Tx1-Mar also show target preference for Mariner-N4_AMi, indicating that SINEU was mobilized by Tx1-Mar. © The Author(s) 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  9. Bacterial clade with the ribosomal RNA operon on a small plasmid rather than the chromosome.

    Science.gov (United States)

    Anda, Mizue; Ohtsubo, Yoshiyuki; Okubo, Takashi; Sugawara, Masayuki; Nagata, Yuji; Tsuda, Masataka; Minamisawa, Kiwamu; Mitsui, Hisayuki

    2015-11-17

    rRNA is essential for life because of its functional importance in protein synthesis. The rRNA (rrn) operon encoding 16S, 23S, and 5S rRNAs is located on the "main" chromosome in all bacteria documented to date and is frequently used as a marker of chromosomes. Here, our genome analysis of a plant-associated alphaproteobacterium, Aureimonas sp. AU20, indicates that this strain has its sole rrn operon on a small (9.4 kb), high-copy-number replicon. We designated this unusual replicon carrying the rrn operon on the background of an rrn-lacking chromosome (RLC) as the rrn-plasmid. Four of 12 strains close to AU20 also had this RLC/rrn-plasmid organization. Phylogenetic analysis showed that those strains having the RLC/rrn-plasmid organization represented one clade within the genus Aureimonas. Our finding introduces a previously unaddressed viewpoint into studies of genetics, genomics, and evolution in microbiology and biology in general.

  10. 16S Ribosomal Ribonucleic Acid Gene Polymerase Chain Reaction in the Diagnosis of Bloodstream Infections: A Systematic Review and Meta-Analysis.

    Science.gov (United States)

    Su, Guoming; Fu, Zhuqing; Hu, Liren; Wang, Yueying; Zhao, Zuguo; Yang, Weiqing

    2015-01-01

    We aim to evaluate the accuracy of the 16S ribosomal ribonucleic acid (rRNA) gene polymerase chain reaction (PCR) test in the diagnosis of bloodstream infections through a systematic review and meta-analysis. A computerized literature search was conducted to identify studies that assessed the diagnostic value of 16S rRNA gene PCR test for bloodstream infections. Study quality was assessed using the revised Quality Assessment of Diagnostic Accuracy Studies (QUADAS-2) tool. We calculated the sensitivity, specificity, positive likelihood ratio (PLR), negative likelihood ratio (NLR), diagnostic odds ratio (DOR) and their 95% confidence intervals (95% CI) for each study. Summary receiver operating characteristic (SROC) curve was used to summarize overall test performance. Statistical analysis was performed in Meta-DiSc 1.4 and Stata/SE 12.0 software. Twenty-eight studies were included in our meta-analysis. Using random-effect model analysis, the pooled sensitivity, specificity, PLR, NLR, and DOR were 0.87 (95% CI, 0.85-0.89), 0.94 (95% CI, 0.93-0.95), 12.65 (95% CI, 8.04-19.90), 0.14 (95% CI, 0.08-0.24), and 116.76 (95% CI, 52.02-262.05), respectively. The SROC curve indicated that the area under the curve (AUC) was 0.9690 and the maximum joint sensitivity and specificity (Q*) was 0.9183. In addition, heterogeneity was statistically significant but was not caused by the threshold effect. Existing data suggest that 16S rRNA gene PCR test is a practical tool for the rapid screening of sepsis. Further prospective studies are needed to assess the diagnostic value of PCR amplification and DNA microarray hybridization of 16S rRNA gene in the future.

  11. Post-transcriptional regulation of ribosome biogenesis in yeast

    Directory of Open Access Journals (Sweden)

    Isabelle C. Kos-Braun

    2017-05-01

    Full Text Available Most microorganisms are exposed to the constantly and often rapidly changing environment. As such they evolved mechanisms to balance their metabolism and energy expenditure with the resources available to them. When resources become scarce or conditions turn out to be unfavourable for growth, cells reduce their metabolism and energy usage to survive. One of the major energy consuming processes in the cell is ribosome biogenesis. Unsurprisingly, cells encountering adverse conditions immediately shut down production of new ribosomes. It is well established that nutrient depletion leads to a rapid repression of transcription of the genes encoding ribosomal proteins, ribosome biogenesis factors as well as ribosomal RNA (rRNA. However, if pre-rRNA processing and ribosome assembly are regulated post-transcriptionally remains largely unclear. We have recently uncovered that the yeast Saccharomyces cerevisiae rapidly switches between two alternative pre-rRNA processing pathways depending on the environmental conditions. Our findings reveal a new level of complexity in the regulation of ribosome biogenesis.

  12. Chromosomal divergence and evolutionary inferences in Rhodniini based on the chromosomal location of ribosomal genes

    Directory of Open Access Journals (Sweden)

    Sebastian Pita

    2013-05-01

    Full Text Available In this study, we used fluorescence in situ hybridisation to determine the chromosomal location of 45S rDNA clusters in 10 species of the tribe Rhodniini (Hemiptera: Reduviidae: Triatominae. The results showed striking inter and intraspecific variability, with the location of the rDNA clusters restricted to sex chromosomes with two patterns: either on one (X chromosome or both sex chromosomes (X and Y chromosomes. This variation occurs within a genus that has an unchanging diploid chromosome number (2n = 22, including 20 autosomes and 2 sex chromosomes and a similar chromosome size and genomic DNA content, reflecting a genome dynamic not revealed by these chromosome traits. The rDNA variation in closely related species and the intraspecific polymorphism in Rhodnius ecuadoriensis suggested that the chromosomal position of rDNA clusters might be a useful marker to identify recently diverged species or populations. We discuss the ancestral position of ribosomal genes in the tribe Rhodniini and the possible mechanisms involved in the variation of the rDNA clusters, including the loss of rDNA loci on the Y chromosome, transposition and ectopic pairing. The last two processes involve chromosomal exchanges between both sex chromosomes, in contrast to the widely accepted idea that the achiasmatic sex chromosomes of Heteroptera do not interchange sequences.

  13. Automated insertion of sequences into a ribosomal RNA alignment: An application of computational linguistics in molecular biology

    Energy Technology Data Exchange (ETDEWEB)

    Taylor, Ronald C. [Case Western Reserve Univ., Cleveland, OH (United States)

    1991-11-01

    This thesis involved the construction of (1) a grammar that incorporates knowledge on base invariancy and secondary structure in a molecule and (2) a parser engine that uses the grammar to position bases into the structural subunits of the molecule. These concepts were combined with a novel pinning technique to form a tool that semi-automates insertion of a new species into the alignment for the 16S rRNA molecule (a component of the ribosome) maintained by Dr. Carl Woese`s group at the University of Illinois at Urbana. The tool was tested on species extracted from the alignment and on a group of entirely new species. The results were very encouraging, and the tool should be substantial aid to the curators of the 16S alignment. The construction of the grammar was itself automated, allowing application of the tool to alignments for other molecules. The logic programming language Prolog was used to construct all programs involved. The computational linguistics approach used here was found to be a useful way to attach the problem of insertion into an alignment.

  14. Automated insertion of sequences into a ribosomal RNA alignment: An application of computational linguistics in molecular biology

    Energy Technology Data Exchange (ETDEWEB)

    Taylor, R.C.

    1991-11-01

    This thesis involved the construction of (1) a grammar that incorporates knowledge on base invariancy and secondary structure in a molecule and (2) a parser engine that uses the grammar to position bases into the structural subunits of the molecule. These concepts were combined with a novel pinning technique to form a tool that semi-automates insertion of a new species into the alignment for the 16S rRNA molecule (a component of the ribosome) maintained by Dr. Carl Woese's group at the University of Illinois at Urbana. The tool was tested on species extracted from the alignment and on a group of entirely new species. The results were very encouraging, and the tool should be substantial aid to the curators of the 16S alignment. The construction of the grammar was itself automated, allowing application of the tool to alignments for other molecules. The logic programming language Prolog was used to construct all programs involved. The computational linguistics approach used here was found to be a useful way to attach the problem of insertion into an alignment.

  15. Direct crosslinking of the antitumor antibiotic sparsomycin, and its derivatives, to A2602 in the peptidyl transferase center of 23S-like rRNA within ribosome-tRNA complexes

    DEFF Research Database (Denmark)

    Porse, B T; Kirillov, S V; Awayez, M J

    1999-01-01

    of action was investigated by inducing a crosslink between sparsomycin and bacterial, archaeal, and eukaryotic ribosomes complexed with P-site-bound tRNA, on irradiating with low energy ultraviolet light (at 365 nm). The crosslink was localized exclusively to the universally conserved nucleotide A2602...

  16. Characterization of an internal ribosomal entry segment within the 5' leader of avian reticuloendotheliosis virus type A RNA and development of novel MLV-REV-based retroviral vectors.

    Science.gov (United States)

    López-Lastra, M; Gabus, C; Darlix, J L

    1997-11-01

    The murine leukemia virus (MLV)-related type C viruses constitute a major class of retroviruses that includes numerous endogenous and exogenous mammalian viruses and the related avian spleen necrosis virus (SNV). The MLV-related viruses possess a long and multifunctional 5' untranslated leader involved in key steps of the viral life cycle--splicing, translation, RNA dimerization, encapsidation, and reverse transcription. Recent studies have shown that the 5' leader of Friend murine leukemia virus and Moloney murine leukemia virus can direct cap independent translation of gag precursor proteins (Berlioz et al., 1995; Vagner et al., 1995b). These data, together with structural homology studies (Koning et al., 1992), prompted us to undertake a search for new internal ribosome entry segment (IRES) of retroviral origin. Here we describe an IRES element within the 5' leader of avian reticuloendotheliosis virus type A (REV-A) genomic RNA. Data show that the REV-A 5' IRES element maps downstream of the packaging/dimerization (E/DLS) sequence (Watanabe and Temin, 1982; Darlix et al., 1992) and the minimal IRES sequence appears to be within a 129 nt fragment (nucleotides 452-580) of the 5' leader, immediately upstream of the gag AUG codon. The REV-A IRES has been successfully utilized in the construction of novel high titer MLV-based retroviral vectors, containing one or more IRES elements of retroviral origin. These retroviral constructs, which represent a starting point for the design of novel vectors suitable for gene therapy, are also of interest as a model system of internal translation initiation and its possible regulation during development, cancer, or virus infection.

  17. Nascent peptide-mediated translation elongation arrest coupled with mRNA degradation in the CGS1 gene of Arabidopsis

    Science.gov (United States)

    Onouchi, Hitoshi; Nagami, Yoko; Haraguchi, Yuhi; Nakamoto, Mari; Nishimura, Yoshiko; Sakurai, Ryoko; Nagao, Nobuhiro; Kawasaki, Daisuke; Kadokura, Yoshitomo; Naito, Satoshi

    2005-01-01

    Expression of the Arabidopsis CGS1 gene that codes for cystathionine γ-synthase is feedback regulated at the step of mRNA stability in response to S-adenosyl-L-methionine (AdoMet). A short stretch of amino acid sequence, called the MTO1 region, encoded by the first exon of CGS1 itself is involved in this regulation. Here, we demonstrate, using a cell-free system, that AdoMet induces temporal translation elongation arrest at the Ser-94 codon located immediately downstream of the MTO1 region, by analyzing a translation intermediate and performing primer extension inhibition (toeprint) analysis. This translation arrest precedes the formation of a degradation intermediate of CGS1 mRNA, which has its 5′ end points near the 5′ edge of the stalled ribosome. The position of ribosome stalling also suggests that the MTO1 region in nascent peptide resides in the ribosomal exit tunnel when translation elongation is temporarily arrested. In addition to the MTO1 region amino acid sequence, downstream Trp-93 is also important for the AdoMet-induced translation arrest. This is the first example of nascent peptide-mediated translation elongation arrest coupled with mRNA degradation in eukaryotes. Furthermore, our data suggest that the ribosome stalls at the step of translocation rather than at the step of peptidyl transfer. PMID:16027170

  18. Elevated expression of ribosomal protein genes L37, RPP-1, and S2 in the presence of mutant p53.

    Science.gov (United States)

    Loging, W T; Reisman, D

    1999-11-01

    The wild-type p53 protein is a DNA-binding transcription factor that activates genes such as p21, MDM2, GADD45, and Bax that are required for the regulation of cell cycle progression or apoptosis in response to DNA damage. Mutant forms of p53, which are transforming oncogenes and are expressed at high levels in tumor cells, generally have a reduced binding affinity for the consensus DNA sequence. Interestingly, some p53 mutants that are no longer effective at binding to the consensus DNA sequence and transactivating promoters containing this target site have acquired the ability to transform cells in culture, in part through their ability to transactivate promoters of a number of genes that are not targets of the wild-type protein. Certain p53 mutants are therefore considered to be gain-of-function mutants and appear to be promoting proliferation or transforming cells through their ability to alter the expression of novel sets of genes. Our goal is to identify genes that have altered expression in the presence of a specific mutant p53 (Arg to Trp mutation at codon 248) protein. Through examining differential gene expression in cells devoid of p53 expression and in cells that express high levels of mutant p53 protein, we have identified three ribosomal protein genes that have elevated expression in response to mutant p53. Consistent with these findings, the overexpression of a number of ribosomal protein genes in human tumors and evidence for their contribution to oncogenic transformation have been reported previously, although the mechanism leading to this overexpression has remained elusive. We show results that indicate that expression of these specific ribosomal protein genes is increased in the presence of the R248W p53 mutant, which provides a mechanism for their overexpression in human tumors.

  19. Drosha regulates gene expression independently of RNA cleavage function

    DEFF Research Database (Denmark)

    Gromak, Natalia; Dienstbier, Martin; Macias, Sara

    2013-01-01

    Drosha is the main RNase III-like enzyme involved in the process of microRNA (miRNA) biogenesis in the nucleus. Using whole-genome ChIP-on-chip analysis, we demonstrate that, in addition to miRNA sequences, Drosha specifically binds promoter-proximal regions of many human genes in a transcription......-dependent manner. This binding is not associated with miRNA production or RNA cleavage. Drosha knockdown in HeLa cells downregulated nascent gene transcription, resulting in a reduction of polyadenylated mRNA produced from these gene regions. Furthermore, we show that this function of Drosha is dependent on its N......-terminal protein-interaction domain, which associates with the RNA-binding protein CBP80 and RNA Polymerase II. Consequently, we uncover a previously unsuspected RNA cleavage-independent function of Drosha in the regulation of human gene expression....

  20. Complete mitochondrial genomes and nuclear ribosomal RNA operons of two species of Diplostomum (Platyhelminthes: Trematoda): a molecular resource for taxonomy and molecular epidemiology of important fish pathogens

    Czech Academy of Sciences Publication Activity Database

    Brabec, Jan; Kostadinova, Aneta; Scholz, Tomáš; Littlewood, D. T. J.

    2015-01-01

    Roč. 8, JUN 19 2015 (2015), s. 336 ISSN 1756-3305 R&D Projects: GA MŠk(CZ) EE2.3.30.0032; GA ČR(CZ) GA15-14198S Grant - others:GA MŠk(CZ) LM2010005 Institutional support: RVO:60077344 Keywords : Diplostomum (Platyhelminthes: Trematoda) * fish pathogens * mitochondrial genome * ribosomal RNA * illumina next-generation sequencing * phylogeny Subject RIV: EG - Zoology Impact factor: 3.234, year: 2015

  1. Sexually dimorphic expression of the genes encoding ribosomal proteins L17 and L37 in the song control nuclei of juvenile zebra finches.

    Science.gov (United States)

    Tang, Yu Ping; Wade, Juli

    2006-12-18

    Studies evaluating the role of steroid hormones in sexual differentiation of the zebra finch song system have produced complicated and at times paradoxical results, and indicate that additional factors may be critical. Therefore, in a previous study we initiated a screen for differential gene expression in the telencephalon of developing male and female zebra finches. The use of cDNA microarrays and real-time quantitative PCR revealed increased expression of the genes encoding ribosomal proteins L17 and L37 (RPL17 and RPL37) in the male forebrain as a whole. Preliminary in situ hybridization data then indicated enhanced expression of both these genes in song control regions. Two experiments in the present study quantified the mRNA expression. The first utilized 25-day-old male and female zebra finches. The second compared a separate set of juveniles to adults of both sexes to both re-confirm enhanced expression in juvenile males and to determine whether it is limited to developing animals. In Experiment 1, males exhibited increased expression of both RPL17 and RPL37 compared to females in Area X, the robust nucleus of the arcopallium (RA), and the ventral ventricular zone (VVZ), which may provide neurons to Area X. Experiment 2 replicated the sexually dimorphic expression of these genes at post-hatching day 25, and documented that the sex differences are eliminated or greatly reduced in adults. The results are consistent with the idea that these ribosomal proteins may influence sexual differentiation of Area X and RA, potentially regulating the genesis and/or survival of neurons.

  2. Graphical representation of ribosomal RNA probe accessibility data using ARB software package

    Directory of Open Access Journals (Sweden)

    Amann Rudolf

    2005-03-01

    Full Text Available Abstract Background Taxon specific hybridization probes in combination with a variety of commonly used hybridization formats nowadays are standard tools in microbial identification. A frequently applied technology, fluorescence in situ hybridization (FISH, besides single cell identification, allows the localization and functional studies of the microbial community composition. Careful in silico design and evaluation of potential oligonucleotide probe targets is therefore crucial for performing successful hybridization experiments. Results The PROBE Design tools of the ARB software package take into consideration several criteria such as number, position and quality of diagnostic sequence differences while designing oligonucleotide probes. Additionally, new visualization tools were developed to enable the user to easily examine further sequence associated criteria such as higher order structure, conservation, G+C content, transition-transversion profiles and in situ target accessibility patterns. The different types of sequence associated information (SAI can be visualized by user defined background colors within the ARB primary and secondary structure editors as well as in the PROBE Match tool. Conclusion Using this tool, in silico probe design and evaluation can be performed with respect to in situ probe accessibility data. The evaluation of proposed probe targets with respect to higher-order rRNA structure is of importance for successful design and performance of in situ hybridization experiments. The entire ARB software package along with the probe accessibility data is available from the ARB home page http://www.arb-home.de.

  3. Genome-wide polysomal analysis of a yeast strain with mutated ribosomal protein S9

    Directory of Open Access Journals (Sweden)

    Arava Yoav

    2007-08-01

    Full Text Available Abstract Background The yeast ribosomal protein S9 (S9 is located at the entrance tunnel of the mRNA into the ribosome. It is known to play a role in accurate decoding and its bacterial homolog (S4 has recently been shown to be involved in opening RNA duplexes. Here we examined the effects of changing the C terminus of S9, which is rich in acidic amino acids and extends out of the ribosome surface. Results We performed a genome-wide analysis to reveal effects at the transcription and translation levels of all yeast genes. While negligible relative changes were observed in steady-state mRNA levels, a significant number of mRNAs appeared to have altered ribosomal density. Notably, 40% of the genes having reliable signals changed their ribosomal association by more than one ribosome. Yet, no general correlations with physical or functional features of the mRNA were observed. Ribosome Density Mapping (RDM along four of the mRNAs with increased association revealed an increase in ribosomal density towards the end of the coding region for at least two of them. Read-through analysis did not reveal any increase in read-through of a premature stop codon by the mutant strain. Conclusion The ribosomal protein rpS9 appears to be involved in the translation of many mRNAs, since altering its C terminus led to a significant change in ribosomal association of many mRNAs. We did not find strong correlations between these changes and several physical features of the mRNA, yet future studies with advanced tools may allow such correlations to be determined. Importantly, our results indicate an accumulation of ribosomes towards the end of the coding regions of some mRNAs. This suggests an involvement of S9 in ribosomal dissociation during translation termination.

  4. Yeast polypeptide exit tunnel ribosomal proteins L17, L35 and L37 are necessary to recruit late-assembling factors required for 27SB pre-rRNA processing.

    Science.gov (United States)

    Gamalinda, Michael; Jakovljevic, Jelena; Babiano, Reyes; Talkish, Jason; de la Cruz, Jesús; Woolford, John L

    2013-02-01

    Ribosome synthesis involves the coordinated folding and processing of pre-rRNAs with assembly of ribosomal proteins. In eukaryotes, these events are facilitated by trans-acting factors that propel ribosome maturation from the nucleolus to the cytoplasm. However, there is a gap in understanding how ribosomal proteins configure pre-ribosomes in vivo to enable processing to occur. Here, we have examined the role of adjacent yeast r-proteins L17, L35 and L37 in folding and processing of pre-rRNAs, and binding of other proteins within assembling ribosomes. These three essential ribosomal proteins, which surround the polypeptide exit tunnel, are required for 60S subunit formation as a consequence of their role in removal of the ITS2 spacer from 27SB pre-rRNA. L17-, L35- and L37-depleted cells exhibit turnover of aberrant pre-60S assembly intermediates. Although the structure of ITS2 does not appear to be grossly affected in their absence, these three ribosomal proteins are necessary for efficient recruitment of factors required for 27SB pre-rRNA processing, namely, Nsa2 and Nog2, which associate with pre-60S ribosomal particles containing 27SB pre-rRNAs. Altogether, these data support that L17, L35 and L37 are specifically required for a recruiting step immediately preceding removal of ITS2.

  5. Methylation of miRNA genes and oncogenesis.

    Science.gov (United States)

    Loginov, V I; Rykov, S V; Fridman, M V; Braga, E A

    2015-02-01

    Interaction between microRNA (miRNA) and messenger RNA of target genes at the posttranscriptional level provides fine-tuned dynamic regulation of cell signaling pathways. Each miRNA can be involved in regulating hundreds of protein-coding genes, and, conversely, a number of different miRNAs usually target a structural gene. Epigenetic gene inactivation associated with methylation of promoter CpG-islands is common to both protein-coding genes and miRNA genes. Here, data on functions of miRNAs in development of tumor-cell phenotype are reviewed. Genomic organization of promoter CpG-islands of the miRNA genes located in inter- and intragenic areas is discussed. The literature and our own results on frequency of CpG-island methylation in miRNA genes from tumors are summarized, and data regarding a link between such modification and changed activity of miRNA genes and, consequently, protein-coding target genes are presented. Moreover, the impact of miRNA gene methylation on key oncogenetic processes as well as affected signaling pathways is discussed.

  6. Dinoflagellate phylogeny as inferred from heat shock protein 90 and ribosomal gene sequences.

    Directory of Open Access Journals (Sweden)

    Mona Hoppenrath

    2010-10-01

    Full Text Available Interrelationships among dinoflagellates in molecular phylogenies are largely unresolved, especially in the deepest branches. Ribosomal DNA (rDNA sequences provide phylogenetic signals only at the tips of the dinoflagellate tree. Two reasons for the poor resolution of deep dinoflagellate relationships using rDNA sequences are (1 most sites are relatively conserved and (2 there are different evolutionary rates among sites in different lineages. Therefore, alternative molecular markers are required to address the deeper phylogenetic relationships among dinoflagellates. Preliminary evidence indicates that the heat shock protein 90 gene (Hsp90 will provide an informative marker, mainly because this gene is relatively long and appears to have relatively uniform rates of evolution in different lineages.We more than doubled the previous dataset of Hsp90 sequences from dinoflagellates by generating additional sequences from 17 different species, representing seven different orders. In order to concatenate the Hsp90 data with rDNA sequences, we supplemented the Hsp90 sequences with three new SSU rDNA sequences and five new LSU rDNA sequences. The new Hsp90 sequences were generated, in part, from four additional heterotrophic dinoflagellates and the type species for six different genera. Molecular phylogenetic analyses resulted in a paraphyletic assemblage near the base of the dinoflagellate tree consisting of only athecate species. However, Noctiluca was never part of this assemblage and branched in a position that was nested within other lineages of dinokaryotes. The phylogenetic trees inferred from Hsp90 sequences were consistent with trees inferred from rDNA sequences in that the backbone of the dinoflagellate clade was largely unresolved.The sequence conservation in both Hsp90 and rDNA sequences and the poor resolution of the deepest nodes suggests that dinoflagellates reflect an explosive radiation in morphological diversity in their recent

  7. Developmental regulation of Xenopus 5S RNA genes

    International Nuclear Information System (INIS)

    Wormington, W.M.; Schlissel, M.; Brown, D.D.

    1983-01-01

    In this paper it is demonstrated that the actively transcribed fraction of somatic 5S RNA genes in somatic-cell chromatin is complexed stably with all required factors, so that the addition of only purified RNA polymerase III is needed to support somatic 5S RNA synthesis in vitro. Oocyte 5S RNA genes in somatic-cell chromatin appear to lack these factors, since their activation in salt-washed somatic-cell chromatin depends on exogeneous transciption factors in addition to RNA polymerase III. The developmental control of 5S RNA genes is established over a period beginning with the onset of 5S RNA synthesis in late blastula embryos, and this control is reproduced in vitro using chromatin templates isolated from appropriate stages. We propose that a decreasing concentration of the 5S-specific transcription factor during embryogenesis contributes to the inactivation of oocyte 5S RNA genes. 12 references, 4 figures, 1 table

  8. Common changes in global gene expression induced by RNA polymerase inhibitors in Shigella flexneri.

    Directory of Open Access Journals (Sweden)

    Hua Fu

    Full Text Available Characterization of expression profile of organisms in response to antimicrobials provides important information on the potential mechanism of action of the drugs. The special expression signature can be used to predict whether other drugs act on the same target. Here, the common response of Shigella flexneri to two inhibitors of RNA polymerase was examined using gene expression profiling. Consistent with similar effects of the two drugs, the gene expression profiles indicated that responses of the bacteria to these drugs were roughly the same, with 225 genes affected commonly. Of them, 88 were induced and 137 were repressed. Real-time PCR was performed for selected genes to verify the microarray results. Analysis of the expression data revealed that more than 30% of the plasmid-encoded genes on the array were up-regulated by the antibiotics including virF regulon, other virulence-related genes, and genes responsible for plasmid replication, maintenance, and transfer. In addition, some chromosome-encoded genes involved in virulence and genes acquired from horizontal transfer were also significantly up-regulated. However, the expression of genes encoding the beta-subunit of RNA polymerase was increased moderately. The repressed genes include those that code for products associated with the ribosome, citrate cycle, glycolysis, thiamine biosynthesis, purine metabolism, fructose metabolism, mannose metabolism, and cold shock proteins. This study demonstrates that the two antibiotics induce rapid cessation of RNA synthesis resulting in inhibition of translation components. It also indicates that the production of virulence factors involved in intercellular dissemination, tissue invasion and inflammatory destruction may be enhanced through derepressing horizontal transfer genes by the drugs.

  9. Free-Energy Landscape of Reverse tRNA Translocation through the Ribosome Analyzed by Electron Microscopy Density Maps and Molecular Dynamics Simulations

    Science.gov (United States)

    Ishida, Hisashi; Matsumoto, Atsushi

    2014-01-01

    To understand the mechanism of reverse tRNA translocation in the ribosome, all-atom molecular dynamics simulations of the ribosome-tRNAs-mRNA-EFG complex were performed. The complex at the post-translocational state was directed towards the translocational and pre-translocational states by fitting the complex into cryo-EM density maps. Between a series of the fitting simulations, umbrella sampling simulations were performed to obtain the free-energy landscape. Multistep structural changes, such as a ratchet-like motion and rotation of the head of the small subunit were observed. The free-energy landscape showed that there were two main free-energy barriers: one between the post-translocational and intermediate states, and the other between the pre-translocational and intermediate states. The former corresponded to a clockwise rotation, which was coupled to the movement of P-tRNA over the P/E-gate made of G1338, A1339 and A790 in the small subunit. The latter corresponded to an anticlockwise rotation of the head, which was coupled to the location of the two tRNAs in the hybrid state. This indicates that the coupled motion of the head rotation and tRNA translocation plays an important role in opening and closing of the P/E-gate during the ratchet-like movement in the ribosome. Conformational change of EF-G was interpreted to be the result of the combination of the external motion by L12 around an axis passing near the sarcin-ricin loop, and internal hinge-bending motion. These motions contributed to the movement of domain IV of EF-G to maintain its interaction with A/P-tRNA. PMID:24999999

  10. Free-energy landscape of reverse tRNA translocation through the ribosome analyzed by electron microscopy density maps and molecular dynamics simulations.

    Directory of Open Access Journals (Sweden)

    Hisashi Ishida

    Full Text Available To understand the mechanism of reverse tRNA translocation in the ribosome, all-atom molecular dynamics simulations of the ribosome-tRNAs-mRNA-EFG complex were performed. The complex at the post-translocational state was directed towards the translocational and pre-translocational states by fitting the complex into cryo-EM density maps. Between a series of the fitting simulations, umbrella sampling simulations were performed to obtain the free-energy landscape. Multistep structural changes, such as a ratchet-like motion and rotation of the head of the small subunit were observed. The free-energy landscape showed that there were two main free-energy barriers: one between the post-translocational and intermediate states, and the other between the pre-translocational and intermediate states. The former corresponded to a clockwise rotation, which was coupled to the movement of P-tRNA over the P/E-gate made of G1338, A1339 and A790 in the small subunit. The latter corresponded to an anticlockwise rotation of the head, which was coupled to the location of the two tRNAs in the hybrid state. This indicates that the coupled motion of the head rotation and tRNA translocation plays an important role in opening and closing of the P/E-gate during the ratchet-like movement in the ribosome. Conformational change of EF-G was interpreted to be the result of the combination of the external motion by L12 around an axis passing near the sarcin-ricin loop, and internal hinge-bending motion. These motions contributed to the movement of domain IV of EF-G to maintain its interaction with A/P-tRNA.

  11. Role of blood ribosomal protein S19 in coagulum resorption: a study using Gln137Glu-ribosomal protein S19 gene knock-in mouse.

    Science.gov (United States)

    Chen, Jun; Fujino, Rika; Zhao, Rui; Semba, Umeko; Araki, Kimi; Yamamoto, Tetsuro

    2014-11-01

    Sera of human, guinea pig or mouse contain a strong monocyte chemoattractant capacity that is attributed to the ribosomal protein S19 (RP S19) oligomers generated during blood coagulation. In contrast, sera prepared from Gln137Glu-RP S19 gene knock-in mice contained negligible chemoattractant capacity. When coagula that had been pre-formed from the blood of both the wild type and knock-in mice were intraperitoneally inserted into host mice, after 3 days of recovery, the knock-in mouse coagula remained larger than the wild type mouse coagula. The wild type mouse coagula were covered by multiple macrophage layers at the surface and were infiltrated inside by macrophages. Knock-in mouse coagula exhibited less macrophage involvement. When coagula of knock-in mice and coagula of knock-in mice containing C5a/RP S19, an artificial substitute of the RP S19 oligomers, were intraperitoneally inserted as pairs, the C5a/RP S19 containing coagulum was more rapidly absorbed, concomitant with increased macrophage involvement. Finally, when the knock-in mouse and wild type mouse coagula pairs were inserted into mice in which macrophages had been depleted using clodronate liposome, the size difference of recovered coagula was reversed. These results indicate the importance of the RP S19 oligomer-induced macrophage recruitment in coagulum resorption. © 2014 Japanese Society of Pathology and Wiley Publishing Asia Pty Ltd.

  12. Pseudogenes regulate parental gene expression via ceRNA network.

    Science.gov (United States)

    An, Yang; Furber, Kendra L; Ji, Shaoping

    2017-01-01

    The concept of competitive endogenous RNA (ceRNA) was first proposed by Salmena and colleagues. Evidence suggests that pseudogene RNAs can act as a 'sponge' through competitive binding of common miRNA, releasing or attenuating repression through sequestering miRNAs away from parental mRNA. In theory, ceRNAs refer to all transcripts such as mRNA, tRNA, rRNA, long non-coding RNA, pseudogene RNA and circular RNA, because all of them may become the targets of miRNA depending on spatiotemporal situation. As binding of miRNA to the target RNA is not 100% complementary, it is possible that one miRNA can bind to multiple target RNAs and vice versa. All RNAs crosstalk through competitively binding to miRNAvia miRNA response elements (MREs) contained within the RNA sequences, thus forming a complex regulatory network. The ratio of a subset of miRNAs to the corresponding number of MREs determines repression strength on a given mRNA translation or stability. An increase in pseudogene RNA level can sequester miRNA and release repression on the parental gene, leading to an increase in parental gene expression. A massive number of transcripts constitute a complicated network that regulates each other through this proposed mechanism, though some regulatory significance may be mild or even undetectable. It is possible that the regulation of gene and pseudogene expression occurring in this manor involves all RNAs bearing common MREs. In this review, we will primarily discuss how pseudogene transcripts regulate expression of parental genes via ceRNA network and biological significance of regulation. © 2016 The Authors. Journal of Cellular and Molecular Medicine published by John Wiley & Sons Ltd and Foundation for Cellular and Molecular Medicine.

  13. Employment of Near Full-Length Ribosome Gene TA-Cloning and Primer-Blast to Detect Multiple Species in a Natural Complex Microbial Community Using Species-Specific Primers Designed with Their Genome Sequences.

    Science.gov (United States)

    Zhang, Huimin; He, Hongkui; Yu, Xiujuan; Xu, Zhaohui; Zhang, Zhizhou

    2016-11-01

    It remains an unsolved problem to quantify a natural microbial community by rapidly and conveniently measuring multiple species with functional significance. Most widely used high throughput next-generation sequencing methods can only generate information mainly for genus-level taxonomic identification and quantification, and detection of multiple species in a complex microbial community is still heavily dependent on approaches based on near full-length ribosome RNA gene or genome sequence information. In this study, we used near full-length rRNA gene library sequencing plus Primer-Blast to design species-specific primers based on whole microbial genome sequences. The primers were intended to be specific at the species level within relevant microbial communities, i.e., a defined genomics background. The primers were tested with samples collected from the Daqu (also called fermentation starters) and pit mud of a traditional Chinese liquor production plant. Sixteen pairs of primers were found to be suitable for identification of individual species. Among them, seven pairs were chosen to measure the abundance of microbial species through quantitative PCR. The combination of near full-length ribosome RNA gene library sequencing and Primer-Blast may represent a broadly useful protocol to quantify multiple species in complex microbial population samples with species-specific primers.

  14. AtRH57, a DEAD-box RNA helicase, is involved in feedback inhibition of glucose-mediated abscisic acid accumulation during seedling development and additively affects pre-ribosomal RNA processing with high glucose.

    Science.gov (United States)

    Hsu, Yi-Feng; Chen, Yun-Chu; Hsiao, Yu-Chun; Wang, Bing-Jyun; Lin, Shih-Yun; Cheng, Wan-Hsing; Jauh, Guang-Yuh; Harada, John J; Wang, Co-Shine

    2014-01-01

    The Arabidopsis thaliana T-DNA insertion mutant rh57-1 exhibited hypersensitivity to glucose (Glc) and abscisic acid (ABA). The other two rh57 mutants also showed Glc hypersensitivity similar to rh57-1, strongly suggesting that the Glc-hypersensitive feature of these mutants results from mutation of AtRH57. rh57-1 and rh57-3 displayed severely impaired seedling growth when grown in Glc concentrations higher than 3%. The gene, AtRH57 (At3g09720), was expressed in all Arabidopsis organs and its transcript was significantly induced by ABA, high Glc and salt. The new AtRH57 belongs to class II DEAD-box RNA helicase gene family. Transient expression of AtRH57-EGFP (enhanced green fluorescent protein) in onion cells indicated that AtRH57 was localized in the nucleus and nucleolus. Purified AtRH57-His protein was shown to unwind double-stranded RNA independent of ATP in vitro. The ABA biosynthesis inhibitor fluridone profoundly redeemed seedling growth arrest mediated by sugar. rh57-1 showed increased ABA levels when exposed to high Glc. Quantitative real time polymerase chain reaction analysis showed that AtRH57 acts in a signaling network downstream of HXK1. A feedback inhibition of ABA accumulation mediated by AtRH57 exists within the sugar-mediated ABA signaling. AtRH57 mutation and high Glc conditions additively caused a severe defect in small ribosomal subunit formation. The accumulation of abnormal pre-rRNA and resistance to protein synthesis-related antibiotics were observed in rh57 mutants and in the wild-type Col-0 under high Glc conditions. These results suggested that AtRH57 plays an important role in rRNA biogenesis in Arabidopsis and participates in response to sugar involving Glc- and ABA signaling during germination and seedling growth. © 2013 The Authors The Plant Journal © 2013 John Wiley & Sons Ltd.

  15. Epigenetic silencing of nucleolar rRNA genes in Alzheimer's disease.

    Directory of Open Access Journals (Sweden)

    Maciej Pietrzak

    Full Text Available Ribosomal deficits are documented in mild cognitive impairment (MCI, which often represents an early stage Alzheimer's disease (AD, as well as in advanced AD. The nucleolar rRNA genes (rDNA, transcription of which is critical for ribosomal biogenesis, are regulated by epigenetic silencing including promoter CpG methylation.To assess whether CpG methylation of the rDNA promoter was dysregulated across the AD spectrum, we analyzed brain samples from 10 MCI-, 23 AD-, and, 24 age-matched control individuals using bisulfite mapping. The rDNA promoter became hypermethylated in cerebro-cortical samples from MCI and AD groups. In parietal cortex, the rDNA promoter was hypermethylated more in MCI than in advanced AD. The cytosine methylation of total genomic DNA was similar in AD, MCI, and control samples. Consistent with a notion that hypermethylation-mediated silencing of the nucleolar chromatin stabilizes rDNA loci, preventing their senescence-associated loss, genomic rDNA content was elevated in cerebrocortical samples from MCI and AD groups.In conclusion, rDNA hypermethylation could be a new epigenetic marker of AD. Moreover, silencing of nucleolar chromatin may occur during early stages of AD pathology and play a role in AD-related ribosomal deficits and, ultimately, dementia.

  16. A novel TBP-TAF complex on RNA polymerase II-transcribed snRNA genes.

    Science.gov (United States)

    Zaborowska, Justyna; Taylor, Alice; Roeder, Robert G; Murphy, Shona

    2012-01-01

    Initiation of transcription of most human genes transcribed by RNA polymerase II (RNAP II) requires the formation of a preinitiation complex comprising TFIIA, B, D, E, F, H and RNAP II. The general transcription factor TFIID is composed of the TATA-binding protein and up to 13 TBP-associated factors. During transcription of snRNA genes, RNAP II does not appear to make the transition to long-range productive elongation, as happens during transcription of protein-coding genes. In addition, recognition of the snRNA gene-type specific 3' box RNA processing element requires initiation from an snRNA gene promoter. These characteristics may, at least in part, be driven by factors recruited to the promoter. For example, differences in the complement of TAFs might result in differential recruitment of elongation and RNA processing factors. As precedent, it already has been shown that the promoters of some protein-coding genes do not recruit all the TAFs found in TFIID. Although TAF5 has been shown to be associated with RNAP II-transcribed snRNA genes, the full complement of TAFs associated with these genes has remained unclear. Here we show, using a ChIP and siRNA-mediated approach, that the TBP/TAF complex on snRNA genes differs from that found on protein-coding genes. Interestingly, the largest TAF, TAF1, and the core TAFs, TAF10 and TAF4, are not detected on snRNA genes. We propose that this snRNA gene-specific TAF subset plays a key role in gene type-specific control of expression.

  17. Gene conversion of ribosomal DNA in Nicotiana tabacum is associated with undermethylated, decondensed and probably active gene units.

    Science.gov (United States)

    Lim, K Y; Kovarik, A; Matýăsek, R; Bezdĕk, M; Lichtenstein, C P; Leitch, A R

    2000-06-01

    We examined the structure, intranuclear distribution and activity of ribosomal DNA (rDNA) in Nicotiana sylvestris (2n = 2x = 24) and N. tomentosiformis (2n = 2x = 24) and compared these with patterns in N. tabacum (tobacco, 2n = 4x = 48). We also examined a long-established N. tabacum culture, TBY-2. Nicotiana tabacum is an allotetraploid thought to be derived from ancestors of N. sylvestris (S-genome donor) and N. tomentosiformis (T-genome donor). Nicotiana sylvestris has three rDNA loci, one locus each on chromosomes 10, 11, and 12. In root-tip meristematic interphase cells, the site on chromosome 12 remains condensed and inactive, while the sites on chromosomes 10 and 11 show activity at the proximal end of the locus only. Nicotiana tomentosiformis has one major locus on chromosome 3 showing activity and a minor, inactive locus on chromosome 11. In N. tabacum cv. 095-55, there are four rDNA loci on T3, S10, S11/t and S12 (S11/t carries a small T-genome translocation). The locus on S12 remains condensed and inactive in root-tip meristematic cells while the others show activity, including decondensation at interphase and secondary constrictions at metaphase. Nicotiana tabacum DNA digested with methylcytosine-sensitive enzymes revealed a hybridisation pattern for rDNA that resembled that of N. tomentosiformis and not N. sylvestris. The data indicate that active, undermethylated genes are of the N. tomentosiformis type. Since S-genome chromosomes of N. tabacum show rDNA expression, the result indicates rDNA gene conversion of the active rDNA units on these chromosomes. Gene conversion in N. tabacum is consistent with the results of previous work. However, using primers specific for the S-genome rDNA intergenic sequences (IGS) in the polymerase chain reaction (PCR) show that rDNA gene conversion has not gone to completion in N. tabacum. Furthermore, using methylation-insensitive restriction enzymes we demonstrate that about 8% of the rDNA units remain of the N

  18. Nucleotide sequence of a human tRNA gene heterocluster

    International Nuclear Information System (INIS)

    Chang, Y.N.; Pirtle, I.L.; Pirtle, R.M.

    1986-01-01

    Leucine tRNA from bovine liver was used as a hybridization probe to screen a human gene library harbored in Charon-4A of bacteriophage lambda. The human DNA inserts from plaque-pure clones were characterized by restriction endonuclease mapping and Southern hybridization techniques, using both [3'- 32 P]-labeled bovine liver leucine tRNA and total tRNA as hybridization probes. An 8-kb Hind III fragment of one of these γ-clones was subcloned into the Hind III site of pBR322. Subsequent fine restriction mapping and DNA sequence analysis of this plasmid DNA indicated the presence of four tRNA genes within the 8-kb DNA fragment. A leucine tRNA gene with an anticodon of AAG and a proline tRNA gene with an anticodon of AGG are in a 1.6-kb subfragment. A threonine tRNA gene with an anticodon of UGU and an as yet unidentified tRNA gene are located in a 1.1-kb subfragment. These two different subfragments are separated by 2.8 kb. The coding regions of the three sequenced genes contain characteristic internal split promoter sequences and do not have intervening sequences. The 3'-flanking region of these three genes have typical RNA polymerase III termination sites of at least four consecutive T residues

  19. Identification and Removal of Contaminant Sequences From Ribosomal Gene Databases: Lessons From the Census of Deep Life.

    Science.gov (United States)

    Sheik, Cody S; Reese, Brandi Kiel; Twing, Katrina I; Sylvan, Jason B; Grim, Sharon L; Schrenk, Matthew O; Sogin, Mitchell L; Colwell, Frederick S

    2018-01-01

    Earth's subsurface environment is one of the largest, yet least studied, biomes on Earth, and many questions remain regarding what microorganisms are indigenous to the subsurface. Through the activity of the Census of Deep Life (CoDL) and the Deep Carbon Observatory, an open access 16S ribosomal RNA gene sequence database from diverse subsurface environments has been compiled. However, due to low quantities of biomass in the deep subsurface, the potential for incorporation of contaminants from reagents used during sample collection, processing, and/or sequencing is high. Thus, to understand the ecology of subsurface microorganisms (i.e., the distribution, richness, or survival), it is necessary to minimize, identify, and remove contaminant sequences that will skew the relative abundances of all taxa in the sample. In this meta-analysis, we identify putative contaminants associated with the CoDL dataset, recommend best practices for removing contaminants from samples, and propose a series of best practices for subsurface microbiology sampling. The most abundant putative contaminant genera observed, independent of evenness across samples, were Propionibacterium , Aquabacterium , Ralstonia , and Acinetobacter . While the top five most frequently observed genera were Pseudomonas , Propionibacterium , Acinetobacter , Ralstonia , and Sphingomonas . The majority of the most frequently observed genera (high evenness) were associated with reagent or potential human contamination. Additionally, in DNA extraction blanks, we observed potential archaeal contaminants, including methanogens, which have not been discussed in previous contamination studies. Such contaminants would directly affect the interpretation of subsurface molecular studies, as methanogenesis is an important subsurface biogeochemical process. Utilizing previously identified contaminant genera, we found that ∼27% of the total dataset were identified as contaminant sequences that likely originate from DNA

  20. MicroRNA and gene signature of severe cutaneous drug ...

    African Journals Online (AJOL)

    Purpose: To build a microRNA and gene signature of severe cutaneous adverse drug reactions (SCAR), including Stevens-Johnson syndrome (SJS) and toxic epidermal necrolysis (TEN). Methods: MicroRNA expression profiles were downloaded from miRNA expression profile of patients' skin suffering from TEN using an ...

  1. RNA Chimeras as a Gene Signature of Breast Cancer

    Science.gov (United States)

    2013-05-01

    www.plosone.org 11 August 2012 | Volume 7 | Issue 8 | e41659 Human genes Human ACTB mRNA: >gi|168480144|ref|NM_001101.3| Homo sapiens actin, beta...TCCCCCTTTTTTGTCCCCCAACTTGAGATGTATGAAGGCTTTTGGTCTCCCTGGGAGTGGGTGGAGGCAGCCAGGGCTTACCTGTACACTGACTTGAGACCAGTTGAATAAA AGTGCACACCTTAAAAATGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA Human GAPDH mRNA: >gi|83641890|ref|NM_002046.4| Homo sapiens ...Homo sapiens hypoxanthine phosphoribosyltransferase 1 (HPRT1), mRNA

  2. Bioinformatics analysis of RNA-seq data revealed critical genes in colon adenocarcinoma.

    Science.gov (United States)

    Xi, W-D; Liu, Y-J; Sun, X-B; Shan, J; Yi, L; Zhang, T-T

    2017-07-01

    RNA-seq data of colon adenocarcinoma (COAD) were analyzed with bioinformatics tools to discover critical genes in the disease. Relevant small molecule drugs, transcription factors (TFs) and microRNAs (miRNAs) were also investigated. RNA-seq data of COAD were downloaded from The Cancer Genome Atlas (TCGA). Differential analysis was performed with package edgeR. False positive discovery (FDR) 1 were set as the cut-offs to screen out differentially expressed genes (DEGs). Gene coexpression network was constructed with package Ebcoexpress. GO enrichment analysis was performed for the DEGs in the gene coexpression network with DAVID. Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analysis was also performed for the genes with KOBASS 2.0. Modules were identified with MCODE of Cytoscape. Relevant small molecules drugs were predicted by Connectivity map. Relevant miRNAs and TFs were searched by WebGestalt. A total of 457 DEGs, including 255 up-regulated and 202 down-regulated genes, were identified from 437 COAD and 39 control samples. A gene coexpression network was constructed containing 40 DEGs and 101 edges. The genes were mainly associated with collagen fibril organization, extracellular matrix organization and translation. Two modules were identified from the gene coexpression network, which were implicated in muscle contraction and extracellular matrix organization, respectively. Several critical genes were disclosed, such as MYH11, COL5A2 and ribosomal proteins. Nine relevant small molecule drugs were identified, such as scriptaid and STOCK1N-35874. Accordingly, a total of 17 TFs and 10 miRNAs related to COAD were acquired, such as ETS2, NFAT, AP4, miR-124A, MiR-9, miR-96 and let-7. Several critical genes and relevant drugs, TFs and miRNAs were revealed in COAD. These findings could advance the understanding of the disease and benefit therapy development.

  3. Transcription factor trapping by RNA in gene regulatory elements.

    Science.gov (United States)

    Sigova, Alla A; Abraham, Brian J; Ji, Xiong; Molinie, Benoit; Hannett, Nancy M; Guo, Yang Eric; Jangi, Mohini; Giallourakis, Cosmas C; Sharp, Phillip A; Young, Richard A

    2015-11-20

    Transcription factors (TFs) bind specific sequences in promoter-proximal and -distal DNA elements to regulate gene transcription. RNA is transcribed from both of these DNA elements, and some DNA binding TFs bind RNA. Hence, RNA transcribed from regulatory elements may contribute to stable TF occupancy at these sites. We show that the ubiquitously expressed TF Yin-Yang 1 (YY1) binds to both gene regulatory elements and their associated RNA species across the entire genome. Reduced transcription of regulatory elements diminishes YY1 occupancy, whereas artificial tethering of RNA enhances YY1 occupancy at these elements. We propose that RNA makes a modest but important contribution to the maintenance of certain TFs at gene regulatory elements and suggest that transcription of regulatory elements produces a positive-feedback loop that contributes to the stability of gene expression programs. Copyright © 2015, American Association for the Advancement of Science.

  4. Species-independent MicroRNA Gene Discovery

    KAUST Repository

    Kamanu, Timothy K.

    2012-01-01

    and other incurable diseases such as autism and Alzheimer’s. Functional miRNAs are excised from hairpin-like sequences that are known as miRNA genes. There are about 21,000 known miRNA genes, most of which have been determined using experimental methods. mi

  5. RNA-binding domain of the A protein component of the U1 small nuclear ribonucleoprotein analyzed by NMR spectroscopy is structurally similar to ribosomal proteins

    International Nuclear Information System (INIS)

    Hoffman, D.W.; Query, C.C.; Golden, B.L.; White, S.W.; Keene, J.D.

    1991-01-01

    An RNA recognition motif (RRM) of ∼80 amino acids constitutes the core of RNA-binding domains found in a large family of proteins involved in RNA processing. The U1 RNA-binding domain of the A protein component of the human U1 small nuclear ribonucleoprotein (RNP), which encompasses the RRM sequence, was analyzed by using NMR spectroscopy. The domain of the A protein is a highly stable monomer in solution consisting of four antiparallel β-strands and two α-helices. The highly conserved RNP1 and RNP2 consensus sequences, containing residues previously suggested to be involved in nucleic acid binding, are juxtaposed in adjacent β-strands. Conserved aromatic side chains that are critical for RNA binding are clustered on the surface to the molecule adjacent to a variable loop that influences recognition of specific RNA sequences. The secondary structure and topology of the RRM are similar to those of ribosomal proteins L12 and L30, suggesting a distant evolutionary relationship between these two types of RNA-associated proteins

  6. The Р60-S6K1 isoform of ribosomal protein S6 kinase 1 is a product of alternative mRNA translation

    Directory of Open Access Journals (Sweden)

    I. V. Zaiets

    2018-07-01

    Full Text Available Ribosomal protein S6 kinase 1 (S6K1 is a well-known downstream effector of mTORC1 (mechanistic target of rapamycin complex 1 participating primarily in the regulation of cell growth and metabolism. Deregulation of mTOR/S6K1 signaling can promote numerous human pathologies, including cancer, neurodegeneration, cardiovascular disease, and metabolic disorders. As existing data suggest, the S6K1 gene encodes several protein isoforms, including p85-S6K1, p70-S6K1, and p60-S6K1. The two of these isoforms, p85-S6K1 and p70-S6K1, were extensively studied to date. The origin and functional significance of the p60-S6K1 isoform remains a mystery, however, it was suggested that the isoform could be a product of alternative S6K1 mRNA translation. Herein we report the generation of HEK-293 cells exclusively expressing p60-S6K1 as a result of CRISPR/Cas9-mediated inactivation of p85/p70-S6K1 translation. Moreover, the generated modified cells displayed the elevated level of p60-S6K1 expression compared to that in wild-type HEK-293 cells. Our data confirm an assumption that p60-S6K1 is alternatively translated, most probably, from the common for both p70- and p85-S6K1 mRNA transcript and reveal a link between p60-S6K1 expression and such cellular processes as cell proliferation and motility. In addition, our findings indicate that the p60-S6K1 isoform of S6K1 may undergo a mode of regulation distinct from p70- and p85-S6K1 due to the absence of mTOR-regulated p60-S6K1 phosphorylation at T389 that is important for S6K1 activation.

  7. On the control of ribosomal protein biosynthesis in Escherichia coli

    International Nuclear Information System (INIS)

    Pichon, J.; Marvaldi, J.; Coeroli, C.; Cozzone, A.; Marchis-Mouren, G.

    1977-01-01

    The rate of individual ribosomal protein synthesis relative to total protein synthesis has been determined in Escherichia coli rel + and rel - cells, under valyl-tRNA deprivation. These strains have a temperature-sensitive valyl-tRNA synthetase. Starvation was obtained following transfer of the cells to non-permissive temperature. Ribosomal proteins were obtained by treatment of either total lysates of freeze-thawed lysozyme spheroplasts or ammonium sulphate precipitate of ribosomes, with acetic acid. Differential labelling of the ribosomal proteins was observed in both strains: proteins from the rel + strain appear more labelled than those from the rel - strain, the rate of labelling of individual proteins being about the same in both strains. Moreover ribosomal proteins were found as stable during starvation as total protein. It is thus concluded that in starving cells individual ribosomal proteins are not synthesized at equal rates. This indicates that the synthesis of ribosomal proteins is not only under the control of the rel gene

  8. The Proximity of Ribosomal Protein Genes to oriC Enhances Vibrio cholerae Fitness in the Absence of Multifork Replication.

    Science.gov (United States)

    Soler-Bistué, Alfonso; Timmermans, Michaël; Mazel, Didier

    2017-02-28

    Recent works suggest that bacterial gene order links chromosome structure to cell homeostasis. Comparative genomics showed that, in fast-growing bacteria, ribosomal protein genes (RP) locate near the replication origin ( oriC ). We recently showed that Vibrio cholerae employs this positional bias as a growth optimization strategy: under fast-growth conditions, multifork replication increases RP dosage and expression. However, RP location may provide advantages in a dosage-independent manner: for example, the physical proximity of the many ribosomal components, in the context of a crowded cytoplasm, may favor ribosome biogenesis. To uncover putative dosage-independent effects, we studied isogenic V. cholerae derivatives in which the major RP locus, S10-spc-α (S10), was relocated to alternative genomic positions. When bacteria grew fast, bacterial fitness was reduced according to the S10 relative distance to oriC The growth of wild-type V. cholerae could not be improved by additional copies of the locus, suggesting a physiologically optimized genomic location. Slow growth is expected to uncouple RP position from dosage, since multifork replication does not occur. Under these conditions, we detected a fitness impairment when S10 was far from oriC Deep sequencing followed by marker frequency analysis in the absence of multifork replication revealed an up to 30% S10 dosage reduction associated with its relocation that closely correlated with fitness alterations. Hence, the impact of S10 location goes beyond a growth optimization strategy during feast periods. RP location may be important during the whole life cycle of this pathogen. IMPORTANCE The role of gene order within the bacterial chromosome is poorly understood. In fast growers, the location of genes linked with the expression of genetic information (i.e., transcription and translation) is biased toward oriC It was proposed that the location of these genes helps to maximize their expression by recruiting

  9. Phylogeography, genetic variability and structure of Acanthamoeba metapopulations in Iran inferred by 18S ribosomal RNA sequences: A systematic review and meta-analysis.

    Science.gov (United States)

    Spotin, Adel; Moslemzadeh, Hamid Reza; Mahami-Oskouei, Mahmoud; Ahmadpour, Ehsan; Niyyati, Maryam; Hejazi, Seyed Hossein; Memari, Fatemeh; Noori, Jafar

    2017-09-01

    To verify phylogeography and genetic structure of Acanthamoeba populations among the Iranian clinical isolates and natural/artificial environments distributed in various regions of the country. We searched electronic databases including Medline, PubMed, Science Direct, Scopus and Google Scholar from 2005 to 2016. To explore the genetic variability of Acanthamoeba sp, 205 sequences were retrieved from keratitis patients, immunosuppressed cases and environmental sources as of various geographies of Iran. T4 genotype was the predominant strain in Iran, and the rare genotypes belonged to T2, T3, T5 (Acanthamoeba lenticulata), T6, T9, T11, T13 and T15 (Acanthamoeba jacobsi). A total of 47 unique haplotypes of T4 were identified. A parsimonious network of the sequence haplotypes demonstrated star-like feature containing haplogroups IR6 (34.1%) and IR7 (31.2%) as the most common haplotypes. In accordance with the analysis of molecular variance, the high value of haplotype diversity (0.612-0.848) of Acanthamoeba T4 represented genetic variability within populations. Neutrality indices of the 18S ribosomal RNA demonstrated negative values in all populations which represented a considerable divergence from neutrality. The majority of genetic diversity belonged to the infected contact lens and dust samples in immunodeficiency and ophthalmology wards, which indicated potential routes for exposure to a pathogenic Acanthamoeba sp. in at-risk individuals. A pairwise fixation index (F ST ) was from low to high values (0.02433-0.41892). The statistically F ST points out that T4 is genetically differentiated between north-west, north-south and central-south metapopulations, but not differentiated between west-central, west-south, central-south, and north-central isolates. An occurrence of IR6 and IR7 displays that possibly a gene flow of Acanthamoeba T4 occurred after the founder effect or bottleneck experience through ecological changes or host mobility. This is the first

  10. Detecting microRNA activity from gene expression data

    LENUS (Irish Health Repository)

    Madden, Stephen F

    2010-05-18

    Abstract Background MicroRNAs (miRNAs) are non-coding RNAs that regulate gene expression by binding to the messenger RNA (mRNA) of protein coding genes. They control gene expression by either inhibiting translation or inducing mRNA degradation. A number of computational techniques have been developed to identify the targets of miRNAs. In this study we used predicted miRNA-gene interactions to analyse mRNA gene expression microarray data to predict miRNAs associated with particular diseases or conditions. Results Here we combine correspondence analysis, between group analysis and co-inertia analysis (CIA) to determine which miRNAs are associated with differences in gene expression levels in microarray data sets. Using a database of miRNA target predictions from TargetScan, TargetScanS, PicTar4way PicTar5way, and miRanda and combining these data with gene expression levels from sets of microarrays, this method produces a ranked list of miRNAs associated with a specified split in samples. We applied this to three different microarray datasets, a papillary thyroid carcinoma dataset, an in-house dataset of lipopolysaccharide treated mouse macrophages, and a multi-tissue dataset. In each case we were able to identified miRNAs of biological importance. Conclusions We describe a technique to integrate gene expression data and miRNA target predictions from multiple sources.

  11. Detecting microRNA activity from gene expression data.

    LENUS (Irish Health Repository)

    Madden, Stephen F

    2010-01-01

    BACKGROUND: MicroRNAs (miRNAs) are non-coding RNAs that regulate gene expression by binding to the messenger RNA (mRNA) of protein coding genes. They control gene expression by either inhibiting translation or inducing mRNA degradation. A number of computational techniques have been developed to identify the targets of miRNAs. In this study we used predicted miRNA-gene interactions to analyse mRNA gene expression microarray data to predict miRNAs associated with particular diseases or conditions. RESULTS: Here we combine correspondence analysis, between group analysis and co-inertia analysis (CIA) to determine which miRNAs are associated with differences in gene expression levels in microarray data sets. Using a database of miRNA target predictions from TargetScan, TargetScanS, PicTar4way PicTar5way, and miRanda and combining these data with gene expression levels from sets of microarrays, this method produces a ranked list of miRNAs associated with a specified split in samples. We applied this to three different microarray datasets, a papillary thyroid carcinoma dataset, an in-house dataset of lipopolysaccharide treated mouse macrophages, and a multi-tissue dataset. In each case we were able to identified miRNAs of biological importance. CONCLUSIONS: We describe a technique to integrate gene expression data and miRNA target predictions from multiple sources.

  12. Variability in secondary structure of 18S ribosomal RNA as topological marker for identification of Paramecium species.

    Science.gov (United States)

    Shakoori, Farah R; Tasneem, Fareeda; Al-Ghanim, K; Mahboob, S; Al-Misned, F; Jahan, Nusrat; Shakoori, Abdul Rauf

    2014-12-01

    Besides cytological and molecular applications, Paramecium is being used in water quality assessment and for determination of saprobic levels. An unambiguous identification of these unicellular eukaryotes is not only essential, but its ecological diversity must also be explored in the local environment. 18SrRNA genes of all the strains of Paramecium species isolated from waste water were amplified, cloned and sequenced. Phylogenetic comparison of the nucleotide sequences of these strains with 23 closely related Paramecium species from GenBank Database enabled identification of Paramecium multimicronucleatum and Paramecium jenningsi. Some isolates did not show significant close association with other Paramecium species, and because of their unique position in the phylogenetic tree, they were considered new to the field. In the present report, these isolates are being designated as Paramecium caudatum pakistanicus. In this article, secondary structure of 18SrRNA has also been analyzed as an additional and perhaps more reliable topological marker for species discrimination and for determining possible phylogenetic relationship between the ciliate species. On the basis of comparison of secondary structure of 18SrRNA of various isolated Paramacium strains, and among Paramecium caudatum pakistanicus, Tetrahymena thermophila, Drosophila melanogaster, and Homo sapiens, it can be deduced that variable regions are more helpful in differentiating the species at interspecific level rather than at intraspecific level. It was concluded that V3 was the least variable region in all the organisms, V2 and V7 were the longest expansion segments of D. melanogaster and there was continuous mutational bias towards G.C base pairing in H. sapiens. © 2014 Wiley Periodicals, Inc.

  13. The Absence of the Transcription Factor Yrr1p, Identified from Comparative Genome Profiling, Increased Vanillin Tolerance Due to Enhancements of ABC Transporters Expressing, rRNA Processing and Ribosome Biogenesis in Saccharomyces cerevisiae.

    Science.gov (United States)

    Wang, Xinning; Liang, Zhenzhen; Hou, Jin; Shen, Yu; Bao, Xiaoming

    2017-01-01

    Enhancing the tolerance of Saccharomyces cerevisiae to inhibitors derived from lignocellulose is conducive to producing biofuel and chemicals using abundant lignocellulosic materials. Vanillin is a major type of phenolic inhibitor in lignocellulose hydrolysates for S. cerevisiae . In the present work, the factors beneficial to vanillin resistance in yeast were identified from the vanillin-resistant strain EMV-8, which was derived from strain NAN-27 by adaptive evolution. We found 450 SNPs and 44 genes with InDels in the vanillin-tolerant strain EMV-8 by comparing the genome sequences of EMV-8 and NAN-27. To investigate the effects of InDels, InDels were deleted in BY4741, respectively. We demonstrated that the deletion of YRR1 improved vanillin tolerance of strain. In the presence of 6 mM vanillin, deleting YRR1 increase the maximum specific growth rate and the vanillin consumption rate by 142 and 51%, respectively. The subsequent transcriptome analysis revealed that deleting YRR1 resulted in changed expression of over 200 genes in the presence of 5 mM vanillin. The most marked changes were the significant up-regulation of the dehydrogenase ADH7 , several ATP-binding cassette (ABC) transporters, and dozens of genes involved in ribosome biogenesis and rRNA processing. Coincidently, the crude enzyme solution of BY4741( yrr1 Δ) exhibited higher NADPH-dependent vanillin reduction activity than control. In addition, overexpressing the ABC transporter genes PDR5, YOR1 , and SNQ2 , as well as the RNA helicase gene DBP2 , increased the vanillin tolerance of strain. Interestingly, unlike the marked changes we mentioned above, under vanillin-free conditions, there are only limited transcriptional differences between wildtype and yrr1 Δ. This indicated that vanillin might act as an effector in Yrr1p-related regulatory processes. The new findings of the relationship between YRR1 and vanillin tolerance, as well as the contribution of rRNA processing and ribosome biogenesis to

  14. Origins of the plant chloroplasts and mitochondria based on comparisons of 5S ribosomal RNAs

    Science.gov (United States)

    Delihas, N.; Fox, G. E.

    1987-01-01

    In this paper, we provide macromolecular comparisons utilizing the 5S ribosomal RNA structure to suggest extant bacteria that are the likely descendants of chloroplast and mitochondria endosymbionts. The genetic stability and near universality of the 5S ribosomal gene allows for a useful means to study ancient evolutionary changes by macromolecular comparisons. The value in current and future ribosomal RNA comparisons is in fine tuning the assignment of ancestors to the organelles and in establishing extant species likely to be descendants of bacteria involved in presumed multiple endosymbiotic events.

  15. Dysregulation of RNA Mediated Gene Expression in Motor Neuron Diseases.

    Science.gov (United States)

    Gonçalves, Inês do Carmo G; Rehorst, Wiebke A; Kye, Min Jeong

    2016-01-01

    Recent findings indicate an important role for RNA-mediated gene expression in motor neuron diseases, including ALS (amyotrophic lateral sclerosis) and SMA (spinal muscular atrophy). ALS, also known as Lou Gehrig's disease, is an adult-onset progressive neurodegenerative disorder, whereby SMA or "children's Lou Gehrig's disease" is considered a pediatric neurodevelopmental disorder. Despite the difference in genetic causes, both ALS and SMA share common phenotypes; dysfunction/loss of motor neurons that eventually leads to muscle weakness and atrophy. With advanced techniques in molecular genetics and cell biology, current data suggest that these two distinct motor neuron diseases share more than phenotypes; ALS and SMA have similar cellular pathological mechanisms including mitochondrial dysfunction, oxidative stress and dysregulation in RNA-mediated gene expression. Here, we will discuss the current findings on these two diseases with specific focus on RNA-mediated gene regulation including miRNA expression, pre-mRNA processing and RNA binding proteins.

  16. Functional gene silencing mediated by chitosan/siRNA nanocomplexes

    Energy Technology Data Exchange (ETDEWEB)

    Ji, A M; Su, D; Che, O; Li, W S; Sun, L; Zhang, Z Y; Xu, F [Department of Pharmaceutical Science, Zhujiang Hospital, Southern Medical University, Guangzhou 510282 (China); Yang, B, E-mail: andrewfxu1998@gmail.co [Department of Chemistry, Indiana University-Bloomington, Bloomington, IN 47405 (United States)

    2009-10-07

    Chitosan/siRNA nanoparticles to knock down FHL2 gene expression were reported in this work. The physicochemical properties such as particle size, surface charge, morphology and complex stability of chitosan nanoparticle-incorporated siRNA were evaluated. Nanoparticles which were formulated with chitosan/siRNA exhibited irregular, lamellar and dendritic structures with a hydrodynamic radius size of about 148 nm and net positive charges with zeta-potential value of 58.5 mV. The knockdown effect of the chitosan/siRNA nanoparticles on gene expression in FHL2 over-expressed human colorectal cancer Lovo cells was investigated. The result showed that FHL2 siRNA formulated within chitosan nanoparticles could knock down about 69.6% FHL2 gene expression, which is very similar to the 68.8% reduced gene expression when siRNA was transfected with liposome Lipofectamine. Western analysis further showed significant FHL-2 protein expression reduced by the chitosan/siRNA nanoparticles. The results also showed that blocking FHL2 expression by siRNA could also inhibit the growth and proliferation of human colorectal cancer Lovo cells. The current results demonstrated that chitosan-based siRNA nanoparticles were a very efficient delivery system for siRNA in vivo as previously reported.

  17. Functional gene silencing mediated by chitosan/siRNA nanocomplexes

    International Nuclear Information System (INIS)

    Ji, A M; Su, D; Che, O; Li, W S; Sun, L; Zhang, Z Y; Xu, F; Yang, B

    2009-01-01

    Chitosan/siRNA nanoparticles to knock down FHL2 gene expression were reported in this work. The physicochemical properties such as particle size, surface charge, morphology and complex stability of chitosan nanoparticle-incorporated siRNA were evaluated. Nanoparticles which were formulated with chitosan/siRNA exhibited irregular, lamellar and dendritic structures with a hydrodynamic radius size of about 148 nm and net positive charges with zeta-potential value of 58.5 mV. The knockdown effect of the chitosan/siRNA nanoparticles on gene expression in FHL2 over-expressed human colorectal cancer Lovo cells was investigated. The result showed that FHL2 siRNA formulated within chitosan nanoparticles could knock down about 69.6% FHL2 gene expression, which is very similar to the 68.8% reduced gene expression when siRNA was transfected with liposome Lipofectamine. Western analysis further showed significant FHL-2 protein expression reduced by the chitosan/siRNA nanoparticles. The results also showed that blocking FHL2 expression by siRNA could also inhibit the growth and proliferation of human colorectal cancer Lovo cells. The current results demonstrated that chitosan-based siRNA nanoparticles were a very efficient delivery system for siRNA in vivo as previously reported.

  18. Evaluation of RNA extraction methods in rice and their application in expression analysis of resistance genes against Magnaporthe oryzae

    Directory of Open Access Journals (Sweden)

    Parisa Azizi

    2017-01-01

    Full Text Available Extraction of RNA of high quality and integrity is essential for gene expression studies and all downstream RNA-based techniques. The leaves of 16 merit Malaysian rice varieties were used to isolate total RNA using five different methods. The quantity, quality and integrity of extracted RNA were confirmed using three different means. The ratios of A260/280 ranged from 2.12 to 2.20. Electrophoresis (1.5% agarose gel was performed, illustrating intact and sharp bands representing the 28S, 18S, 5.8S and 5S ribosomal subunits of RNA, presenting intact RNA. RNA quality was verified using semi-quantitative polymerase chain reaction (sqPCR. The objective of this study was to identify different genes involved in the resistance of rice plants using high-quality RNA extracted 31 h after inoculation of Magnaporthe oryzae pathotype P7.2. The expression levels of eight blast resistance genes, Pikh, Pib, Pita, Pi21, Pi9, Os11gRGA8, OsWRKY22 and OsWRKY45, were evaluated by real-time PCR (RT-PCR. Real-time PCR was performed to identify candidate genes using RNA extracted by the TRIzol method, which showed the highest score compared with other methods in terms of RNA quantity, purity and integrity. In addition, the results of real-time PCR confirmed that the up-regulation of seven blast resistance genes may confer stronger resistance for the MR 276 variety against M. oryzae pathotype P7.2.

  19. Genome-wide comparative in silico analysis of the RNA helicase gene family in Zea mays and Glycine max: a comparison with Arabidopsis and Oryza sativa.

    Science.gov (United States)

    Xu, Ruirui; Zhang, Shizhong; Huang, Jinguang; Zheng, Chengchao

    2013-01-01

    RNA helicases are enzymes that are thought to unwind double-stranded RNA molecules in an energy-dependent fashion through the hydrolysis of NTP. RNA helicases are associated with all processes involving RNA molecules, including nuclear transcription, editing, splicing, ribosome biogenesis, RNA export, and organelle gene expression. The involvement of RNA helicase in response to stress and in plant growth and development has been reported previously. While their importance in Arabidopsis and Oryza sativa has been partially studied, the function of RNA helicase proteins is poorly understood in Zea mays and Glycine max. In this study, we identified a total of RNA helicase genes in Arabidopsis and other crop species genome by genome-wide comparative in silico analysis. We classified the RNA helicase genes into three subfamilies according to the structural features of the motif II region, such as DEAD-box, DEAH-box and DExD/H-box, and different species showed different patterns of alternative splicing. Secondly, chromosome location analysis showed that the RNA helicase protein genes were distributed across all chromosomes with different densities in the four species. Thirdly, phylogenetic tree analyses identified the relevant homologs of DEAD-box, DEAH-box and DExD/H-box RNA helicase proteins in each of the four species. Fourthly, microarray expression data showed that many of these predicted RNA helicase genes were expressed in different developmental stages and different tissues under normal growth conditions. Finally, real-time quantitative PCR analysis showed that the expression levels of 10 genes in Arabidopsis and 13 genes in Zea mays were in close agreement with the microarray expression data. To our knowledge, this is the first report of a comparative genome-wide analysis of the RNA helicase gene family in Arabidopsis, Oryza sativa, Zea mays and Glycine max. This study provides valuable information for understanding the classification and putative functions of

  20. Non-functional genes repaired at the RNA level.

    Science.gov (United States)

    Burger, Gertraud

    2016-01-01

    Genomes and genes continuously evolve. Gene sequences undergo substitutions, deletions or nucleotide insertions; mobile genetic elements invade genomes and interleave in genes; chromosomes break, even within genes, and pieces reseal in reshuffled order. To maintain functional gene products and assure an organism's survival, two principal strategies are used - either repair of the gene itself or of its product. I will introduce common types of gene aberrations and how gene function is restored secondarily, and then focus on systematically fragmented genes found in a poorly studied protist group, the diplonemids. Expression of their broken genes involves restitching of pieces at the RNA-level, and substantial RNA editing, to compensate for point mutations. I will conclude with thoughts on how such a grotesquely unorthodox system may have evolved, and why this group of organisms persists and thrives since tens of millions of years. Copyright © 2016 Académie des sciences. Published by Elsevier SAS. All rights reserved.

  1. Mutations in the gene for EF-G reduce the requirement for 4.5S RNA in the growth of E. coli

    DEFF Research Database (Denmark)

    Brown, S

    1987-01-01

    A general strategy is described for the isolation of suppressors of essential genes whose functions are unknown. This strategy was used to analyze the role of 4.5S RNA, an essential RNA of E. coli. In this strategy, the structural gene for 4.5S RNA is fused to the Ptac promoter in such a way...... that the strain becomes dependent upon inducers of lac for growth. Mutants mapping to fus, the structural gene for protein synthesis elongation factor G, appear as spontaneous, inducer-independent revertants. These mutants alter the intracellular distribution of 4.5S RNA such that it sediments at 70S or greater....... Furthermore, the increased sedimentation velocity is sensitive to the antibiotic puromycin. These results show that 4.5S RNA physically associates with the ribosome in performing its essential function, and that this association is mediated by elongation factor G....

  2. Accessibility of ribosomal genes to trimethyl psoralen in nuclei of Physarum polycephalum

    International Nuclear Information System (INIS)

    Judelson, H.S.; Vogt, V.M.

    1982-01-01

    The authors have probed the accessibility of the genes for rRNA in Physarum polycephalum by using the photoreactive DNA cross-linking agent 4,5',8-trimethyl psoralen. Nuclei isolated from actively growing Physarum were treated with trimethyl psoralen and irradiated with 360-nm light in order to form cross-links. The palindromic, extrachromosomal rDNA then was isolated, and the positions of cross-links were determined by electron microscopy of the DNA under totally denaturing conditions. The results indicate that the frequency of cross-linking, after correction for base sequence bias of the reaction, is up to sixfold higher in the transcribed regions than in the central or the terminal spacer regions. There is no detectable heterogeneity among the different rDNA molecules or between the halves of a single molecule. Cross-linked molecules invariably occur in a linear as opposed to a cruciform structure. The preferential cross-linking of the transcribed region is nearly eliminated in spherules, a dormant transcriptionally inactive form in the Physarum life cycle

  3. An elongated model of the Xenopus laevis transcription factor IIIA-5S ribosomal RNA complex derived from neutron scattering and hydrodynamic measurements

    International Nuclear Information System (INIS)

    Timmins, P.A.; Langowski, J.; Brown, R.S.

    1988-01-01

    The precise molecular composition of the Xenopus laevis TFIIIA-5S ribosomal RNA complex (7S particle) has been established from small angle neutron and dynamic light scattering. The molecular weight of the particle was found to be 95,700±10,000 and 86,700±9,000 daltons from these two methods respectively. The observed match point of 54.4% D 2 O obtained from contrast variation experiments indicates a 1:1 molar ratio. It is concluded that only a single molecule of TFIIIA, a zinc-finger protein, and of 5S RNA are present in this complex. A simple elongated cylindrical model with dimensions of 140 angstrom length and 59 angstrom diameter is compatible with the neutron results. A globular model can be excluded by the shallow nature of the neutron scattering curves. It is proposed that the observed difference of 15 angstrom in length between the 7S particle and isolated 5S RNA most likely indicates that part(s) of the protein protrudes from the end(s) of the RNA molecule. There is no biochemical evidence for any gross alteration in 5S RNA conformation upon binding to TFIIIA

  4. Use of tiling array data and RNA secondary structure predictions to identify noncoding RNA genes

    DEFF Research Database (Denmark)

    Weile, Christian; Gardner, Paul P; Hedegaard, Mads M

    2007-01-01

    neuroblastoma cell line SK-N-AS. Using this strategy, we identify thousands of human candidate RNA genes. To further verify the expression of these genes, we focused on candidate genes that had a stable hairpin structures or a high level of covariance. Using northern blotting, we verify the expression of 2 out...

  5. The interaction between endogenous 30S ribosomal subunit protein S11 and Cucumber mosaic virus LS2b protein affects viral replication, infection and gene silencing suppressor activity.

    Directory of Open Access Journals (Sweden)

    Ruilin Wang

    Full Text Available Cucumber mosaic virus (CMV is a model virus for plant-virus protein interaction and mechanism research because of its wide distribution, high-level of replication and simple genome structure. The 2b protein is a multifunctional protein encoded by CMV that suppresses RNA silencing-based antiviral defense and contributes to CMV virulence in host plants. In this report, 12 host proteins were identified as CMV LS2b binding partners using the yeast two-hybrid screen system from the Arabidopsis thaliana cDNA library. Among the host proteins, 30S ribosomal subunit protein S11 (RPS11 was selected for further studies. The interaction between LS2b and full-length RPS11 was confirmed using the yeast two-hybrid system. Bimolecular fluorescence complementation (BIFC assays observed by confocal laser microscopy and Glutathione S-transferase (GST pull-down assays were used to verify the interaction between endogenous NbRPS11 and viral CMVLS2b both in vivo and in vitro. TRV-based gene silencing vector was used to knockdown NbRPS11 transcription, and immunoblot analysis revealed a decline in infectious viral RNA replication and a decrease in CMV infection in RPS11 down-regulated Nicotiana benthamiana plants. Thus, the knockdown of RPS11 likely inhibited CMV replication and accumulation. The gene silencing suppressor activity of CMV2b protein was reduced by the RPS11 knockdown. This study demonstrated that the function of viral LS2b protein was remarkably affected by the interaction with host RPS11 protein.

  6. dPORE-miRNA: Polymorphic regulation of microRNA genes

    KAUST Repository

    Schmeier, Sebastian

    2011-02-04

    Background: MicroRNAs (miRNAs) are short non-coding RNA molecules that act as post-transcriptional regulators and affect the regulation of protein-coding genes. Mostly transcribed by PolII, miRNA genes are regulated at the transcriptional level similarly to protein-coding genes. In this study we focus on human miRNAs. These miRNAs are involved in a variety of pathways and can affect many diseases. Our interest is on possible deregulation of the transcription initiation of the miRNA encoding genes, which is facilitated by variations in the genomic sequence of transcriptional control regions (promoters). Methodology: Our aim is to provide an online resource to facilitate the investigation of the potential effects of single nucleotide polymorphisms (SNPs) on miRNA gene regulation. We analyzed SNPs overlapped with predicted transcription factor binding sites (TFBSs) in promoters of miRNA genes. We also accounted for the creation of novel TFBSs due to polymorphisms not present in the reference genome. The resulting changes in the original TFBSs and potential creation of new TFBSs were incorporated into the Dragon Database of Polymorphic Regulation of miRNA genes (dPORE-miRNA). Conclusions: The dPORE-miRNA database enables researchers to explore potential effects of SNPs on the regulation of miRNAs. dPORE-miRNA can be interrogated with regards to: a/miRNAs (their targets, or involvement in diseases, or biological pathways), b/SNPs, or c/transcription factors. dPORE-miRNA can be accessed at http://cbrc.kaust.edu.sa/dpore and http://apps.sanbi.ac.za/dpore/. Its use is free for academic and non-profit users. © 2011 Schmeier et al.

  7. dPORE-miRNA: Polymorphic regulation of microRNA genes

    KAUST Repository

    Schmeier, Sebastian; Schaefer, Ulf; MacPherson, Cameron R.; Bajic, Vladimir B.

    2011-01-01

    Background: MicroRNAs (miRNAs) are short non-coding RNA molecules that act as post-transcriptional regulators and affect the regulation of protein-coding genes. Mostly transcribed by PolII, miRNA genes are regulated at the transcriptional level similarly to protein-coding genes. In this study we focus on human miRNAs. These miRNAs are involved in a variety of pathways and can affect many diseases. Our interest is on possible deregulation of the transcription initiation of the miRNA encoding genes, which is facilitated by variations in the genomic sequence of transcriptional control regions (promoters). Methodology: Our aim is to provide an online resource to facilitate the investigation of the potential effects of single nucleotide polymorphisms (SNPs) on miRNA gene regulation. We analyzed SNPs overlapped with predicted transcription factor binding sites (TFBSs) in promoters of miRNA genes. We also accounted for the creation of novel TFBSs due to polymorphisms not present in the reference genome. The resulting changes in the original TFBSs and potential creation of new TFBSs were incorporated into the Dragon Database of Polymorphic Regulation of miRNA genes (dPORE-miRNA). Conclusions: The dPORE-miRNA database enables researchers to explore potential effects of SNPs on the regulation of miRNAs. dPORE-miRNA can be interrogated with regards to: a/miRNAs (their targets, or involvement in diseases, or biological pathways), b/SNPs, or c/transcription factors. dPORE-miRNA can be accessed at http://cbrc.kaust.edu.sa/dpore and http://apps.sanbi.ac.za/dpore/. Its use is free for academic and non-profit users. © 2011 Schmeier et al.

  8. The CCA-end of P-tRNA Contacts Both the Human RPL36AL and the A-site Bound Translation Termination Factor eRF1 at the Peptidyl Transferase Center of the Human 80S Ribosome.

    Science.gov (United States)

    Hountondji, Codjo; Bulygin, Konstantin; Créchet, Jean-Bernard; Woisard, Anne; Tuffery, Pierre; Nakayama, Jun-Ichi; Frolova, Ludmila; Nierhaus, Knud H; Karpova, Galina; Baouz, Soria

    2014-01-01

    We have demonstrated previously that the E-site specific protein RPL36AL present in human ribosomes can be crosslinked with the CCA-end of a P-tRNA in situ. Here we report the following: (i) We modeled RPL36AL into the structure of the archaeal ortholog RPL44E extracted from the known X-ray structure of the 50S subunit of Haloarcula marismortui. Superimposing the obtained RPL36AL structure with that of P/E tRNA observed in eukaryotic 80S ribosomes suggested that RPL36AL might in addition to its CCA neighbourhood interact with the inner site of the tRNA elbow similar to an interaction pattern known from tRNA•synthetase pairs. (ii) Accordingly, we detected that the isolated recombinant protein RPL36AL can form a tight binary complex with deacylated tRNA, and even tRNA fragments truncated at their CCA end showed a high affinity in the nanomolar range supporting a strong interaction outside the CCA end. (iii) We constructed programmed 80S complexes containing the termination factor eRF1 (stop codon UAA at the A-site) and a 2',3'-dialdehyde tRNA (tRNAox) analog at the P-site. Surprisingly, we observed a crosslinked ternary complex containing the tRNA, eRF1 and RPL36AL crosslinked both to the aldehyde groups of tRNAox at the 2'- and 3'-positions of the ultimate A. We also demonstrated that, upon binding to the ribosomal A-site, eRF1 induces an alternative conformation of the ribosome and/or the tRNA, leading to a novel crosslink of tRNAox to another large-subunit ribosomal protein (namely L37) rather than to RPL36AL, both ribosomal proteins being labeled in a mutually exclusive fashion. Since the human 80S ribosome in complex with P-site bound tRNAox and A-site bound eRF1 corresponds to the post-termination state of the ribosome, the results represent the first biochemical evidence for the positioning of the CCA-arm of the P-tRNA in close proximity to both RPL36AL and eRF1 at the end of the translation process.

  9. Intrinsic noise of microRNA-regulated genes and the ceRNA hypothesis.

    Directory of Open Access Journals (Sweden)

    Javad Noorbakhsh

    Full Text Available MicroRNAs are small noncoding RNAs that regulate genes post-transciptionally by binding and degrading target eukaryotic mRNAs. We use a quantitative model to study gene regulation by inhibitory microRNAs and compare it to gene regulation by prokaryotic small non-coding RNAs (sRNAs. Our model uses a combination of analytic techniques as well as computational simulations to calculate the mean-expression and noise profiles of genes regulated by both microRNAs and sRNAs. We find that despite very different molecular machinery and modes of action (catalytic vs stoichiometric, the mean expression levels and noise profiles of microRNA-regulated genes are almost identical to genes regulated by prokaryotic sRNAs. This behavior is extremely robust and persists across a wide range of biologically relevant parameters. We extend our model to study crosstalk between multiple mRNAs that are regulated by a single microRNA and show that noise is a sensitive measure of microRNA-mediated interaction between mRNAs. We conclude by discussing possible experimental strategies for uncovering the microRNA-mRNA interactions and testing the competing endogenous RNA (ceRNA hypothesis.

  10. Mutations in 23S rRNA gene associated with decreased susceptibility to tiamulin and valnemulin in Mycoplasma gallisepticum.

    Science.gov (United States)

    Li, Bei-Bei; Shen, Jian-Zhong; Cao, Xing-Yuan; Wang, Yang; Dai, Lei; Huang, Si-Yang; Wu, Cong-Ming

    2010-07-01

    Mycoplasma gallisepticum is a major etiological agent of chronic respiratory disease (CRD) in chickens and sinusitis in turkeys. The pleuromutilin antibiotics tiamulin and valnemulin are currently used in the treatment of M. gallisepticum infection. We studied the in vitro development of pleuromutilin resistance in M. gallisepticum and investigated the molecular mechanisms involved in this process. Pleuromutilin-resistant mutants were selected by serial passages of M. gallisepticum strains PG31 and S6 in broth medium containing subinhibitory concentrations of tiamulin or valnemulin. A portion of the gene encoding 23S rRNA gene (domain V) and the gene encoding ribosome protein L3 were amplified and sequenced. No mutation could be detected in ribosome protein L3. Mutations were found at nucleotide positions 2058, 2059, 2061, 2447 and 2503 of 23S rRNA gene (Escherichia coli numbering). Although a single mutation could cause elevation of tiamulin and valnemulin MICs, combinations of two or three mutations were necessary to produce high-level resistance. All the mutants were cross-resistant to lincomycin, chloramphenicol and florfenicol. Mutants with the A2058G or the A2059G mutation exhibited cross-resistance to macrolide antibiotics erythromycin, tilmicosin and tylosin.

  11. Characterization of three different clusters of 18S-26S ribosomal DNA genes in the sea urchin P. lividus: Genetic and epigenetic regulation synchronous to 5S rDNA.

    Science.gov (United States)

    Bellavia, Daniele; Dimarco, Eufrosina; Caradonna, Fabio

    2016-04-15

    We previously reported the characterization 5S ribosomal DNA (rDNA) clusters in the common sea urchin Paracentrotus lividus and demonstrated the presence of DNA methylation-dependent silencing of embryo specific 5S rDNA cluster in adult tissue. In this work, we show genetic and epigenetic characterization of 18S-26S rDNA clusters in this specie. The results indicate the presence of three different 18S-26S rDNA clusters with different Non-Transcribed Spacer (NTS) regions that have different chromosomal localizations. Moreover, we show that the two largest clusters are hyper-methylated in the promoter-containing NTS regions in adult tissues, as in the 5S rDNA. These findings demonstrate an analogous epigenetic regulation in small and large rDNA clusters and support the logical synchronism in building ribosomes. In fact, all the ribosomal RNA genes must be synchronously and equally transcribed to perform their unique final product. Copyright © 2016 Elsevier B.V. All rights reserved.

  12. Darwinian Evolution of Mutualistic RNA Replicators with Different Genes

    Science.gov (United States)

    Mizuuchi, R.; Ichihashi, N.

    2017-07-01

    We report a sustainable long-term replication and evolution of two distinct cooperative RNA replicators encoding different genes. One of the RNAs evolved to maintain or increase the cooperativity, despite selective advantage of selfish mutations.

  13. Evolutionary relationships between miRNA genes and their activity.

    Science.gov (United States)

    Zhu, Yan; Skogerbø, Geir; Ning, Qianqian; Wang, Zhen; Li, Biqing; Yang, Shuang; Sun, Hong; Li, Yixue

    2012-12-22

    The emergence of vertebrates is characterized by a strong increase in miRNA families. MicroRNAs interact broadly with many transcripts, and the evolution of such a system is intriguing. However, evolutionary questions concerning the origin of miRNA genes and their subsequent evolution remain unexplained. In order to systematically understand the evolutionary relationship between miRNAs gene and their function, we classified human known miRNAs into eight groups based on their evolutionary ages estimated by maximum parsimony method. New miRNA genes with new functional sequences accumulated more dynamically in vertebrates than that observed in Drosophila. Different levels of evolutionary selection were observed over miRNA gene sequences with different time of origin. Most genic miRNAs differ from their host genes in time of origin, there is no particular relationship between the age of a miRNA and the age of its host genes, genic miRNAs are mostly younger than the corresponding host genes. MicroRNAs originated over different time-scales are often predicted/verified to target the same or overlapping sets of genes, opening the possibility of substantial functional redundancy among miRNAs of different ages. Higher degree of tissue specificity and lower expression level was found in young miRNAs. Our data showed that compared with protein coding genes, miRNA genes are more dynamic in terms of emergence and decay. Evolution patterns are quite different between miRNAs of different ages. MicroRNAs activity is under tight control with well-regulated expression increased and targeting decreased over time. Our work calls attention to the study of miRNA activity with a consideration of their origin time.

  14. International interlaboratory study comparing single organism 16S rRNA gene sequencing data: Beyond consensus sequence comparisons

    Science.gov (United States)

    Olson, Nathan D.; Lund, Steven P.; Zook, Justin M.; Rojas-Cornejo, Fabiola; Beck, Brian; Foy, Carole; Huggett, Jim; Whale, Alexandra S.; Sui, Zhiwei; Baoutina, Anna; Dobeson, Michael; Partis, Lina; Morrow, Jayne B.

    2015-01-01

    This study presents the results from an interlaboratory sequencing study for which we developed a novel high-resolution method for comparing data from different sequencing platforms for a multi-copy, paralogous gene. The combination of PCR amplification and 16S ribosomal RNA gene (16S rRNA) sequencing has revolutionized bacteriology by enabling rapid identification, frequently without the need for culture. To assess variability between laboratories in sequencing 16S rRNA, six laboratories sequenced the gene encoding the 16S rRNA from Escherichia coli O157:H7 strain EDL933 and Listeria monocytogenes serovar 4b strain NCTC11994. Participants performed sequencing methods and protocols available in their laboratories: Sanger sequencing, Roche 454 pyrosequencing®, or Ion Torrent PGM®. The sequencing data were evaluated on three levels: (1) identity of biologically conserved position, (2) ratio of 16S rRNA gene copies featuring identified variants, and (3) the collection of variant combinations in a set of 16S rRNA gene copies. The same set of biologically conserved positions was identified for each sequencing method. Analytical methods using Bayesian and maximum likelihood statistics were developed to estimate variant copy ratios, which describe the ratio of nucleotides at each identified biologically variable position, as well as the likely set of variant combinations present in 16S rRNA gene copies. Our results indicate that estimated variant copy ratios at biologically variable positions were only reproducible for high throughput sequencing methods. Furthermore, the likely variant combination set was only reproducible with increased sequencing depth and longer read lengths. We also demonstrate novel methods for evaluating variable positions when comparing multi-copy gene sequence data from multiple laboratories generated using multiple sequencing technologies. PMID:27077030

  15. International interlaboratory study comparing single organism 16S rRNA gene sequencing data: Beyond consensus sequence comparisons

    Directory of Open Access Journals (Sweden)

    Nathan D. Olson

    2015-03-01

    Full Text Available This study presents the results from an interlaboratory sequencing study for which we developed a novel high-resolution method for comparing data from different sequencing platforms for a multi-copy, paralogous gene. The combination of PCR amplification and 16S ribosomal RNA gene (16S rRNA sequencing has revolutionized bacteriology by enabling rapid identification, frequently without the need for culture. To assess variability between laboratories in sequencing 16S rRNA, six laboratories sequenced the gene encoding the 16S rRNA from Escherichia coli O157:H7 strain EDL933 and Listeria monocytogenes serovar 4b strain NCTC11994. Participants performed sequencing methods and protocols available in their laboratories: Sanger sequencing, Roche 454 pyrosequencing®, or Ion Torrent PGM®. The sequencing data were evaluated on three levels: (1 identity of biologically conserved position, (2 ratio of 16S rRNA gene copies featuring identified variants, and (3 the collection of variant combinations in a set of 16S rRNA gene copies. The same set of biologically conserved positions was identified for each sequencing method. Analytical methods using Bayesian and maximum likelihood statistics were developed to estimate variant copy ratios, which describe the ratio of nucleotides at each identified biologically variable position, as well as the likely set of variant combinations present in 16S rRNA gene copies. Our results indicate that estimated variant copy ratios at biologically variable positions were only reproducible for high throughput sequencing methods. Furthermore, the likely variant combination set was only reproducible with increased sequencing depth and longer read lengths. We also demonstrate novel methods for evaluating variable positions when comparing multi-copy gene sequence data from multiple laboratories generated using multiple sequencing technologies.

  16. Yeast eIF4B binds to the head of the 40S ribosomal subunit and promotes mRNA recruitment through its N-terminal and internal repeat domains.

    Science.gov (United States)

    Walker, Sarah E; Zhou, Fujun; Mitchell, Sarah F; Larson, Victoria S; Valasek, Leos; Hinnebusch, Alan G; Lorsch, Jon R

    2013-02-01

    Eukaryotic translation initiation factor (eIF)4B stimulates recruitment of mRNA to the 43S ribosomal pre-initiation complex (PIC). Yeast eIF4B (yeIF4B), shown previously to bind single-stranded (ss) RNA, consists of an N-terminal domain (NTD), predicted to be unstructured in solution; an RNA-recognition motif (RRM); an unusual domain comprised of seven imperfect repeats of 26 amino acids; and a C-terminal domain. Although the mechanism of yeIF4B action has remained obscure, most models have suggested central roles for its RRM and ssRNA-binding activity. We have dissected the functions of yeIF4B's domains and show that the RRM and its ssRNA-binding activity are dispensable in vitro and in vivo. Instead, our data indicate that the 7-repeats and NTD are the most critical domains, which mediate binding of yeIF4B to the head of the 40S ribosomal subunit via interaction with Rps20. This interaction induces structural changes in the ribosome's mRNA entry channel that could facilitate mRNA loading. We also show that yeIF4B strongly promotes productive interaction of eIF4A with the 43S•mRNA PIC in a manner required for efficient mRNA recruitment.

  17. In vitro degradation of ribosomes.

    Science.gov (United States)

    Mora, G; Rivas, A

    1976-12-01

    The cytoplasmic ribosomes from Euglena gracilis var. bacillaris are found to be of two types taking into consideration their stability "in vitro". In the group of unstable ribosomes the large subunit is degraded. The other group apparently does not suffer any degradation under the conditions described. However the RNAs extracted from both types of ribosomes are degraded during sucrose density gradients. The degradation of the largest RNA species has been reported previously, but no comment has been made about the stability of the ribosome itself.

  18. Control of ribosome traffic by position-dependent choice of synonymous codons

    International Nuclear Information System (INIS)

    Mitarai, Namiko; Pedersen, Steen

    2013-01-01

    Messenger RNA (mRNA) encodes a sequence of amino acids by using codons. For most amino acids, there are multiple synonymous codons that can encode the amino acid. The translation speed can vary from one codon to another, thus there is room for changing the ribosome speed while keeping the amino acid sequence and hence the resulting protein. Recently, it has been noticed that the choice of the synonymous codon, via the resulting distribution of slow- and fast-translated codons, affects not only on the average speed of one ribosome translating the mRNA but also might have an effect on nearby ribosomes by affecting the appearance of ‘traffic jams’ where multiple ribosomes collide and form queues. To test this ‘context effect’ further, we here investigate the effect of the sequence of synonymous codons on the ribosome traffic by using a ribosome traffic model with codon-dependent rates, estimated from experiments. We compare the ribosome traffic on wild-type (WT) sequences and sequences where the synonymous codons were swapped randomly. By simulating translation of 87 genes, we demonstrate that the WT sequences, especially those with a high bias in codon usage, tend to have the ability to reduce ribosome collisions, hence optimizing the cellular investment in the translation apparatus. The magnitude of such reduction of the translation time might have a significant impact on the cellular growth rate and thereby have importance for the survival of the species. (paper)

  19. Nuclear pores and perinuclear expression sites of var and ribosomal DNA genes correspond to physically distinct regions in Plasmodium falciparum.

    Science.gov (United States)

    Guizetti, Julien; Martins, Rafael Miyazawa; Guadagnini, Stéphanie; Claes, Aurélie; Scherf, Artur

    2013-05-01

    The human malaria parasite Plasmodium falciparum modifies the erythrocyte it infects by exporting variant proteins to the host cell surface. The var gene family that codes for a large, variant adhesive surface protein called P. falciparum erythrocyte membrane protein 1 (PfEMP1) plays a particular role in this process, which is linked to pathogenesis and immune evasion. A single member of this gene family is highly transcribed while the other 59 members remain silenced. Importantly, var gene transcription occurs at a spatially restricted, but yet undefined, perinuclear site that is distinct from repressed var gene clusters. To advance our understanding of monoallelic expression, we investigated whether nuclear pores associate with the var gene expression site. To this end, we studied the nuclear pore organization during the asexual blood stage using a specific antibody directed against a subunit of the nuclear pore, P. falciparum Nup116 (PfNup116). Ring and schizont stage parasites showed highly polarized nuclear pore foci, whereas in trophozoite stage nuclear pores redistributed over the entire nuclear surface. Colocalization studies of var transcripts and anti-PfNup116 antibodies showed clear dissociation between nuclear pores and the var gene expression site in ring stage. Similar results were obtained for another differentially transcribed perinuclear gene family, the ribosomal DNA units. Furthermore, we show that in the poised state, the var gene locus is not physically linked to nuclear pores. Our results indicate that P. falciparum does form compartments of high transcriptional activity at the nuclear periphery which are, unlike the case in yeast, devoid of nuclear pores.

  20. New Partners in Regulation of Gene Expression: The Enhancer of Trithorax and Polycomb Corto Interacts with Methylated Ribosomal Protein L12 Via Its Chromodomain

    Science.gov (United States)

    Coléno-Costes, Anne; Jang, Suk Min; de Vanssay, Augustin; Rougeot, Julien; Bouceba, Tahar; Randsholt, Neel B.; Gibert, Jean-Michel; Le Crom, Stéphane; Mouchel-Vielh, Emmanuèle

    2012-01-01

    Chromodomains are found in many regulators of chromatin structure, and most of them recognize methylated lysines on histones. Here, we investigate the role of the Drosophila melanogaster protein Corto's chromodomain. The Enhancer of Trithorax and Polycomb Corto is involved in both silencing and activation of gene expression. Over-expression of the Corto chromodomain (CortoCD) in transgenic flies shows that it is a chromatin-targeting module, critical for Corto function. Unexpectedly, mass spectrometry analysis reveals that polypeptides pulled down by CortoCD from nuclear extracts correspond to ribosomal proteins. Furthermore, real-time interaction analyses demonstrate that CortoCD binds with high affinity RPL12 tri-methylated on lysine 3. Corto and RPL12 co-localize with active epigenetic marks on polytene chromosomes, suggesting that both are involved in fine-tuning transcription of genes in open chromatin. RNA–seq based transcriptomes of wing imaginal discs over-expressing either CortoCD or RPL12 reveal that both factors deregulate large sets of common genes, which are enriched in heat-response and ribosomal protein genes, suggesting that they could be implicated in dynamic coordination of ribosome biogenesis. Chromatin immunoprecipitation experiments show that Corto and RPL12 bind hsp70 and are similarly recruited on gene body after heat shock. Hence, Corto and RPL12 could be involved together in regulation of gene transcription. We discuss whether pseudo-ribosomal complexes composed of various ribosomal proteins might participate in regulation of gene expression in connection with chromatin regulators. PMID:23071455

  1. Thermodynamic control of small RNA-mediated gene silencing

    Directory of Open Access Journals (Sweden)

    Kumiko eUi-Tei

    2012-06-01

    Full Text Available Small interfering RNAs (siRNAs and microRNAs (miRNAs are crucial regulators of posttranscriptional gene silencing, which is referred to as RNA interference (RNAi or RNA silencing. In RNAi, siRNA loaded onto the RNA-induced silencing complex (RISC downregulates target gene expression by cleaving mRNA whose sequence is perfectly complementary to the siRNA guide strand. We previously showed that highly functional siRNAs possessed the following characteristics: A or U residues at nucleotide position 1 measured from the 5’ terminal, four to seven A/Us in positions 1–7, and G or C residues at position 19. This finding indicated that an RNA strand with a thermodynamically unstable 5’ terminal is easily retained in the RISC and functions as a guide strand. In addition, it is clear that unintended genes with complementarities only in the seed region (positions 2–8 are also downregulated by off-target effects. siRNA efficiency is mainly determined by the Watson-Crick base-pairing stability formed between the siRNA seed region and target mRNA. siRNAs with a low seed-target duplex melting temperature (Tm have little or no seed-dependent off-target activity. Thus, important parts of the RNA silencing machinery may be regulated by nucleotide base-pairing thermodynamic stability. A mechanistic understanding of thermodynamic control may enable an efficient target gene-specific RNAi for functional genomics and safe therapeutic applications.

  2. Mitochondrial tRNA gene translocations in highly eusocial bees

    Directory of Open Access Journals (Sweden)

    Daniela Silvestre

    2006-01-01

    Full Text Available Mitochondrial gene rearrangement events, especially involving tRNA genes, have been described more frequently as more complete mitochondrial genome sequences are becoming available. In the present work, we analyzed mitochondrial tRNA gene rearrangements between two bee species belonging to the tribes Apini and Meliponini within the "corbiculate Apidae". Eleven tRNA genes are in different genome positions or strands. The molecular events responsible for each translocation are explained. Considering the high number of rearrangements observed, the data presented here contradict the general rule of high gene order conservation among closely related organisms, and also represent a powerful molecular tool to help solve questions about phylogeny and evolution in bees.

  3. RNA.

    Science.gov (United States)

    Darnell, James E., Jr.

    1985-01-01

    Ribonucleic acid (RNA) converts genetic information into protein and usually must be processed to serve its function. RNA types, chemical structure, protein synthesis, translation, manufacture, and processing are discussed. Concludes that the first genes might have been spliced RNA and that humans might be closer than bacteria to primitive…

  4. The importance of ribosome production, and the 5S RNP-MDM2 pathway, in health and disease.

    Science.gov (United States)

    Pelava, Andria; Schneider, Claudia; Watkins, Nicholas J

    2016-08-15

    Ribosomes are abundant, large RNA-protein complexes that are the source of all protein synthesis in the cell. The production of ribosomes is an extremely energetically expensive cellular process that has long been linked to human health and disease. More recently, it has been shown that ribosome biogenesis is intimately linked to multiple cellular signalling pathways and that defects in ribosome production can lead to a wide variety of human diseases. Furthermore, changes in ribosome production in response to nutrient levels in the diet lead to metabolic re-programming of the liver. Reduced or abnormal ribosome production in response to cellular stress or mutations in genes encoding factors critical for ribosome biogenesis causes the activation of the tumour suppressor p53, which leads to re-programming of cellular transcription. The ribosomal assembly intermediate 5S RNP (ribonucleoprotein particle), containing RPL5, RPL11 and the 5S rRNA, accumulates when ribosome biogenesis is blocked. The excess 5S RNP binds to murine double minute 2 (MDM2), the main p53-suppressor in the cell, inhibiting its function and leading to p53 activation. Here, we discuss the involvement of ribosome biogenesis in the homoeostasis of p53 in the cell and in human health and disease. © 2016 The Author(s).

  5. Strategies for Improving siRNA-Induced Gene Silencing Efficiency.

    Science.gov (United States)

    Safari, Fatemeh; Rahmani Barouji, Solmaz; Tamaddon, Ali Mohammad

    2017-12-01

    Purpose: Human telomerase reverse transcriptase (hTERT) plays a crucial role in tumorigenesis and progression of cancers. Gene silencing of hTERT by short interfering RNA (siRNA) is considered as a promising strategy for cancer gene therapy. Various algorithms have been devised for designing a high efficient siRNA which is a significant issue in the clinical usage. Thereby, in the present study, the relation of siRNA designing criteria and the gene silencing efficiency was evaluated. Methods: The siRNA sequences were designed and characterized by using on line soft wares. Cationic co-polymer (polyethylene glycol-g-polyethylene imine (PEG-g-PEI)) was used for the construction of polyelectrolyte complexes (PECs) containing siRNAs. The cellular uptake of the PECs was evaluated. The gene silencing efficiency of different siRNA sequences was investigated and the effect of observing the rational designing on the functionality of siRNAs was assessed. Results: The size of PEG-g-PEI siRNA with N/P (Nitrogen/Phosphate) ratio of 2.5 was 114 ± 0.645 nm. The transfection efficiency of PECs was desirable (95.5% ± 2.4%.). The results of Real-Time PCR showed that main sequence (MS) reduced the hTERT expression up to 90% and control positive sequence (CPS) up to 63%. These findings demonstrated that the accessibility to the target site has priority than the other criteria such as sequence preferences and thermodynamic features. Conclusion: siRNA opens a hopeful window in cancer therapy which provides a convenient and tolerable therapeutic approach. Thereby, using the set of criteria and rational algorithms in the designing of siRNA remarkably affect the gene silencing efficiency.

  6. mRNA/microRNA gene expression profile in microsatellite unstable colorectal cancer

    Directory of Open Access Journals (Sweden)

    Calin George A

    2007-08-01

    Full Text Available Abstract Background Colorectal cancer develops through two main genetic instability pathways characterized by distinct pathologic features and clinical outcome. Results We investigated colon cancer samples (23 characterized by microsatellite stability, MSS, and 16 by high microsatellite instability, MSI-H for genome-wide expression of microRNA (miRNA and mRNA. Based on combined miRNA and mRNA gene expression, a molecular signature consisting of twenty seven differentially expressed genes, inclusive of 8 miRNAs, could correctly distinguish MSI-H versus MSS colon cancer samples. Among the differentially expressed miRNAs, various members of the oncogenic miR-17-92 family were significantly up-regulated in MSS cancers. The majority of protein coding genes were also up-regulated in MSS cancers. Their functional classification revealed that they were most frequently associated with cell cycle, DNA replication, recombination, repair, gastrointestinal disease and immune response. Conclusion This is the first report that indicates the existence of differences in miRNA expression between MSS versus MSI-H colorectal cancers. In addition, the work suggests that the combination of mRNA/miRNA expression signatures may represent a general approach for improving bio-molecular classification of human cancer.

  7. RNA preparation and characterization for gene expression studies

    DEFF Research Database (Denmark)

    Stangegaard, Michael

    2009-01-01

    Much information can be obtained from knowledge of the relative expression level of each gene in the transcriptome. With the current advances in technology as little as a single cell is required as starting material for gene expression experiments. The mRNA from a single cell may be linearly...

  8. Role of horizontal gene transfer as a control on the coevolution of ribosomal proteins and the genetic code

    Energy Technology Data Exchange (ETDEWEB)

    Woese, Carl R.; Goldenfeld, Nigel; Luthey-Schulten, Zaida

    2011-03-31

    Our main goal is to develop the conceptual and computational tools necessary to understand the evolution of the universal processes of translation and replication and to identify events of horizontal gene transfer that occurred within the components. We will attempt to uncover the major evolutionary transitions that accompanied the development of protein synthesis by the ribosome and associated components of the translation apparatus. Our project goes beyond standard genomic approaches to explore homologs that are represented at both the structure and sequence level. Accordingly, use of structural phylogenetic analysis allows us to probe further back into deep evolutionary time than competing approaches, permitting greater resolution of primitive folds and structures. Specifically, our work focuses on the elements of translation, ranging from the emergence of the canonical genetic code to the evolution of specific protein folds, mediated by the predominance of horizontal gene transfer in early life. A unique element of this study is the explicit accounting for the impact of phenotype selection on translation, through a coevolutionary control mechanism. Our work contributes to DOE mission objectives through: (1) sophisticated computer simulation of protein dynamics and evolution, and the further refinement of techniques for structural phylogeny, which complement sequence information, leading to improved annotation of genomic databases; (2) development of evolutionary approaches to exploring cellular function and machinery in an integrated way; and (3) documentation of the phenotype interaction with translation over evolutionary time, reflecting the system response to changing selection pressures through horizontal gene transfer.

  9. Cross-site comparison of ribosomal depletion kits for Illumina RNAseq library construction.

    Science.gov (United States)

    Herbert, Zachary T; Kershner, Jamie P; Butty, Vincent L; Thimmapuram, Jyothi; Choudhari, Sulbha; Alekseyev, Yuriy O; Fan, Jun; Podnar, Jessica W; Wilcox, Edward; Gipson, Jenny; Gillaspy, Allison; Jepsen, Kristen; BonDurant, Sandra Splinter; Morris, Krystalynne; Berkeley, Maura; LeClerc, Ashley; Simpson, Stephen D; Sommerville, Gary; Grimmett, Leslie; Adams, Marie; Levine, Stuart S

    2018-03-15

    Ribosomal RNA (rRNA) comprises at least 90% of total RNA extracted from mammalian tissue or cell line samples. Informative transcriptional profiling using massively parallel sequencing technologies requires either enrichment of mature poly-adenylated transcripts or targeted depletion of the rRNA fraction. The latter method is of particular interest because it is compatible with degraded samples such as those extracted from FFPE and also captures transcripts that are not poly-adenylated such as some non-coding RNAs. Here we provide a cross-site study that evaluates the performance of ribosomal RNA removal kits from Illumina, Takara/Clontech, Kapa Biosystems, Lexogen, New England Biolabs and Qiagen on intact and degraded RNA samples. We find that all of the kits are capable of performing significant ribosomal depletion, though there are differences in their ease of use. All kits were able to remove ribosomal RNA to below 20% with intact RNA and identify ~ 14,000 protein coding genes from the Universal Human Reference RNA sample at >1FPKM. Analysis of differentially detected genes between kits suggests that transcript length may be a key factor in library production efficiency. These results provide a roadmap for labs on the strengths of each of these methods and how best to utilize them.

  10. Internal ribosome entry site-mediated translation of a mammalian mRNA is regulated by amino acid availability

    NARCIS (Netherlands)

    Fernandez, J.; Yaman, I.; Mishra, R.; Merrick, W. C.; Snider, M. D.; Lamers, W. H.; Hatzoglou, M.

    2001-01-01

    The cationic amino acid transporter, Cat-1, facilitates the uptake of the essential amino acids arginine and lysine. Amino acid starvation causes accumulation and increased translation of cat-1 mRNA, resulting in a 58-fold increase in protein levels and increased arginine uptake. A bicistronic mRNA

  11. In Profile: Models of Ribosome Biogenesis Defects and Regulation of Protein Synthesis

    NARCIS (Netherlands)

    Essers, P.B.M.

    2013-01-01

    Ribosomes are the mediators of protein synthesis in the cell and therefore crucial to proper cell function. In addition, ribosomes are highly abundant, with ribosomal RNA making up 80% of the RNA in the cell. A large amount of resources go into maintaining this pool of ribosomes, so ribosome

  12. Aggregation of Ribosomal Protein S6 at Nucleolus Is Cell Cycle-Controlled and Its Function in Pre-rRNA Processing Is Phosphorylation Dependent.

    Science.gov (United States)

    Zhang, Duo; Chen, Hui-Peng; Duan, Hai-Feng; Gao, Li-Hua; Shao, Yong; Chen, Ke-Yan; Wang, You-Liang; Lan, Feng-Hua; Hu, Xian-Wen

    2016-07-01

    Ribosomal protein S6 (rpS6) has long been regarded as one of the primary r-proteins that functions in the early stage of 40S subunit assembly, but its actual role is still obscure. The correct forming of 18S rRNA is a key step in the nuclear synthesis of 40S subunit. In this study, we demonstrate that rpS6 participates in the processing of 30S pre-rRNA to 18S rRNA only when its C-terminal five serines are phosphorylated, however, the process of entering the nucleus and then targeting the nucleolus does not dependent its phosphorylation. Remarkably, we also find that the aggregation of rpS6 at the nucleolus correlates to the phasing of cell cycle, beginning to concentrate in the nucleolus at later S phase and disaggregate at M phase. J. Cell. Biochem. 117: 1649-1657, 2016. © 2015 Wiley Periodicals, Inc. © 2015 Wiley Periodicals, Inc.

  13. Paralogues of nuclear ribosomal genes conceal phylogenetic signals within the invasive Asian fish tapeworm lineage: evidence from next generation sequencing data

    Czech Academy of Sciences Publication Activity Database

    Brabec, Jan; Kuchta, Roman; Scholz, Tomáš; Littlewood, D. T. J.

    2016-01-01

    Roč. 46, č. 9 (2016), s. 555-562 ISSN 0020-7519 R&D Projects: GA MŠk(CZ) EE2.3.30.0032; GA ČR GA15-14198S Grant - others:GA MŠk(CZ) LM2010005 Institutional support: RVO:60077344 Keywords : Schyzocotyle acheilognathi * Asian fish tapeworm * Bothriocephalus acheilognathi * invasive parasite * mitochondrial genome * ribosomal RNA * illumina sequencing * phylogeny Subject RIV: EG - Zoology Impact factor: 3.730, year: 2016

  14. DISCRIMINATION 28S RIBOSOMAL GENE OF TREMATODE CERCARIAE IN SNAILS FROM CHIANG MAI PROVINCE, THAILAND.

    Science.gov (United States)

    Wongsawad, Chalobol; Wongsawad, Pheravut; Sukontason, Kom; Phalee, Anawat; Noikong-Phalee, Waraporn; Chai, Jong Yil

    2016-03-01

    Trematode cercariae are commonly found in many freshwater gastropods. These cercariae can serve to identify the occurrence of such trematodes as Centrocestus formosanus, Haplorchis taichui, Haplorchoides sp, and Stellantchasmus falcatus, which are important parasites in Chiang Mai Province, Thailand. As the species of these cercariae cannot be identified accurately based on morphology, this study employed sequencing of a fragment of 28S ribosomal DNA and phylogenetic analysis to identify the trematode cercariae found in freshwater gastropods in Chiang Mai Province. Eight types of trematode cercariae were identified, namely, distome cercaria (grouped with Philophthalmus spp clade), echinostome cercaria (grouped with Echinostoma spp clade), furcocercous cercaria (grouped with Posthodiplostomum sp/Alaria taxideae/Hysteromorpha triloba clade), monostome cercaria (grouped with Catatropis indicus clade), parapleurolophocercous cercaria (grouped with Haplorchoides sp clade), pleurolophocercous cercaria (grouped with Centrocestusformosanus clade), transversotrema cercaria (grouped with Transversotrema spp clade), and xiphidiocercaria (grouped with Prosthodendrium spp clade). These results provide important information that can be used for identifying these parasites in epidemiological surveys.

  15. DEAD-box helicase DDX27 regulates 3′ end formation of ribosomal 47S RNA and stably associates with the PeBoW-complex

    Energy Technology Data Exchange (ETDEWEB)

    Kellner, Markus; Rohrmoser, Michaela [Department of Molecular Epigenetics, Helmholtz Center Munich, Center for Integrated Protein Science Munich (CIPSM), Marchioninistr. 25, Munich 81377 (Germany); Forné, Ignasi [Adolf Butenandt Institute, Ludwig Maximilians University of Munich, Center for Integrated Protein Science Munich (CIPSM), Schillerstr. 44, Munich 80336 (Germany); Voss, Kirsten; Burger, Kaspar; Mühl, Bastian; Gruber-Eber, Anita [Department of Molecular Epigenetics, Helmholtz Center Munich, Center for Integrated Protein Science Munich (CIPSM), Marchioninistr. 25, Munich 81377 (Germany); Kremmer, Elisabeth [Institute of Molecular Immunology, Helmholtz Center Munich, Marchioninistr. 25, Munich 81377 (Germany); Imhof, Axel [Adolf Butenandt Institute, Ludwig Maximilians University of Munich, Center for Integrated Protein Science Munich (CIPSM), Schillerstr. 44, Munich 80336 (Germany); Eick, Dirk, E-mail: eick@helmholtz-muenchen.de [Department of Molecular Epigenetics, Helmholtz Center Munich, Center for Integrated Protein Science Munich (CIPSM), Marchioninistr. 25, Munich 81377 (Germany)

    2015-05-15

    PeBoW, a trimeric complex consisting of pescadillo (Pes1), block of proliferation (Bop1), and the WD repeat protein 12 (WDR12), is essential for processing and maturation of mammalian 5.8S and 28S ribosomal RNAs. Applying a mass spectrometric analysis, we identified the DEAD-box helicase DDX27 as stably associated factor of the PeBoW-complex. DDX27 interacts with the PeBoW-complex via an evolutionary conserved F×F motif in the N-terminal domain and is recruited to the nucleolus via its basic C-terminal domain. This recruitment is RNA-dependent and occurs independently of the PeBoW-complex. Interestingly, knockdown of DDX27, but not of Pes1, induces the accumulation of an extended form of the primary 47S rRNA. We conclude that DDX27 can interact specifically with the Pes1 and Bop1 but fulfils critical function(s) for proper 3′ end formation of 47S rRNA independently of the PeBoW-complex. - Highlights: • DEAD-box helicase DDX27 is a new constituent of the PeBoW-complex. • The N-terminal F×F motif of DDX27 interacts with the PeBoW components Pes1 and Bop1. • Nucleolar anchoring of DDX27 via its basic C-terminal domain is RNA dependent. • Knockdown of DDX27 induces a specific defect in 3′ end formation of 47S rRNA.

  16. Characterization of anti-P monoclonal antibodies directed against the ribosomal protein-RNA complex antigen and produced using Murphy Roths large autoimmune-prone mice.

    Science.gov (United States)

    Sato, H; Onozuka, M; Hagiya, A; Hoshino, S; Narita, I; Uchiumi, T

    2015-02-01

    Autoantibodies, including anti-ribosomal P proteins (anti-P), are thought to be produced by an antigen-driven immune response in systemic lupus erythematosus (SLE). To test this hypothesis, we reconstituted the ribosomal antigenic complex in vitro using human P0, phosphorylated P1 and P2 and a 28S rRNA fragment covering the P0 binding site, and immunized Murphy Roths large (MRL)/lrp lupus mice with this complex without any added adjuvant to generate anti-P antibodies. Using hybridoma technology, we subsequently obtained 34 clones, each producing an anti-P monoclonal antibody (mAb) that recognized the conserved C-terminal tail sequence common to all three P proteins. We also obtained two P0-specific monoclonal antibodies, but no antibody specific to P1, P2 or rRNA fragment. Two types of mAbs were found among these anti-P antibodies: one type (e.g. 9D5) reacted more strongly with the phosphorylated P1 and P2 than that with their non-phosphorylated forms, whereas the other type (e.g. 4H11) reacted equally with both phosphorylated and non-phosphorylated forms of P1/P2. Both 9D5 and 4H11 inhibited the ribosome/eukaryotic elongation factor-2 (eEF-2)-coupled guanosine triphosphate (GTP)ase activity. However, preincubation with a synthetic peptide corresponding to the C-terminal sequence common to all three P proteins, but not the peptide that lacked the last three C-terminal amino acids, mostly prevented the mAb-induced inhibition of GTPase activity. Thus, at least two types of anti-P were produced preferentially following the immunization of MRL mice with the reconstituted antigenic complex. Presence of multiple copies of the C-termini, particularly that of the last three C-terminal amino acid residues, in the antigenic complex appears to contribute to the immunogenic stimulus. © 2014 British Society for Immunology.

  17. Characterization of anti-P monoclonal antibodies directed against the ribosomal protein–RNA complex antigen and produced using Murphy Roths large autoimmune-prone mice

    Science.gov (United States)

    Sato, H; Onozuka, M; Hagiya, A; Hoshino, S; Narita, I; Uchiumi, T

    2015-01-01

    Autoantibodies, including anti-ribosomal P proteins (anti-P), are thought to be produced by an antigen-driven immune response in systemic lupus erythematosus (SLE). To test this hypothesis, we reconstituted the ribosomal antigenic complex in vitro using human P0, phosphorylated P1 and P2 and a 28S rRNA fragment covering the P0 binding site, and immunized Murphy Roths large (MRL)/lrp lupus mice with this complex without any added adjuvant to generate anti-P antibodies. Using hybridoma technology, we subsequently obtained 34 clones, each producing an anti-P monoclonal antibody (mAb) that recognized the conserved C-terminal tail sequence common to all three P proteins. We also obtained two P0-specific monoclonal antibodies, but no antibody specific to P1, P2 or rRNA fragment. Two types of mAbs were found among these anti-P antibodies: one type (e.g. 9D5) reacted more strongly with the phosphorylated P1 and P2 than that with their non-phosphorylated forms, whereas the other type (e.g. 4H11) reacted equally with both phosphorylated and non-phosphorylated forms of P1/P2. Both 9D5 and 4H11 inhibited the ribosome/eukaryotic elongation factor-2 (eEF-2)-coupled guanosine triphosphate (GTP)ase activity. However, preincubation with a synthetic peptide corresponding to the C-terminal sequence common to all three P proteins, but not the peptide that lacked the last three C-terminal amino acids, mostly prevented the mAb-induced inhibition of GTPase activity. Thus, at least two types of anti-P were produced preferentially following the immunization of MRL mice with the reconstituted antigenic complex. Presence of multiple copies of the C-termini, particularly that of the last three C-terminal amino acid residues, in the antigenic complex appears to contribute to the immunogenic stimulus. PMID:25255895

  18. Sequence analysis of ribosomal and mitochondrial genes of the giant liver fluke Fascioloides magna (Trematoda: Fasciolidae): intraspecific variation and differentiation from Fasciola hepatica

    Czech Academy of Sciences Publication Activity Database

    Kráľová-Hromadová, I.; Špakulová, M.; Horáčková, Eva; Turčeková, Ĺ.; Novobilský, A.; Beck, R.; Koudela, Břetislav; Marinculić, A.; Rajský, D.; Pybus, M.

    2008-01-01

    Roč. 94, č. 1 (2008), s. 58-67 ISSN 0022-3395 R&D Projects: GA ČR GD524/03/H133; GA AV ČR IAA6022404 Grant - others:Slovak Research and Development Agency(SK) APVV-51-062205 Institutional research plan: CEZ:AV0Z60220518 Keywords : Fascioloides magna * Fasciola hepatica * ribosomal genes * mitochondrial genes Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 1.165, year: 2008

  19. The Sporothrix schenckii Gene Encoding for the Ribosomal Protein L6 Has Constitutive and Stable Expression and Works as an Endogenous Control in Gene Expression Analysis

    Directory of Open Access Journals (Sweden)

    Elías Trujillo-Esquivel

    2017-09-01

    Full Text Available Sporothrix schenckii is one of the causative agents of sporotrichosis, a worldwide-distributed mycosis that affects humans and other mammals. The interest in basic and clinical features of this organism has significantly increased in the last years, yet little progress in molecular aspects has been reported. Gene expression analysis is a set of powerful tools that helps to assess the cell response to changes in the extracellular environment, the genetic networks controlling metabolic pathways, and the adaptation to different growth conditions. Most of the quantitative methodologies used nowadays require data normalization, and this is achieved measuring the expression of endogenous control genes. Reference genes, whose expression is assumed to suffer minimal changes regardless the cell morphology, the stage of the cell cycle or the presence of harsh extracellular conditions are commonly used as controls in Northern blotting assays, microarrays, and semi-quantitative or quantitative RT-PCR. Since the biology of the organisms is usually species specific, it is difficult to find a reliable group of universal genes that can be used as controls for data normalization in experiments addressing the gene expression, regardless the taxonomic classification of the organism under study. Here, we compared the transcriptional stability of the genes encoding for elongation factor 1A, Tfc1, a protein involved in transcription initiation on Pol III promoters, ribosomal protein L6, histone H2A, β-actin, β-tubulin, glyceraldehyde 3-phosphate dehydrogenase, UAF30, the upstream activating factor 30, and the transcription initiation factor TFIID subunit 10, during the fungal growth in different culture media and cell morphologies. Our results indicated that only the gene encoding for the ribosomal protein L6 showed a stable and constant expression. Furthermore, it displayed not transcriptional changes when S. schenckii infected larvae of Galleria mellonella or

  20. Short Hairpin RNA (shRNA): Design, Delivery, and Assessment of Gene Knockdown

    Science.gov (United States)

    Moore, Chris B.; Guthrie, Elizabeth H.; Huang, Max Tze-Han; Taxman, Debra J.

    2013-01-01

    Shortly after the cellular mechanism of RNA interference (RNAi) was first described, scientists began using this powerful technique to study gene function. This included designing better methods for the successful delivery of small interfering RNAs (siRNAs) and short hairpin RNAs (shRNAs) into mammalian cells. While the simplest method for RNAi is the cytosolic delivery of siRNA oligonucleotides, this technique is limited to cells capable of transfection and is primarily utilized during transient in vitro studies. The introduction of shRNA into mammalian cells through infection with viral vectors allows for stable integration of shRNA and long-term knockdown of the targeted gene; however, several challenges exist with the implementation of this technology. Here we describe some well-tested protocols which should increase the chances of successful design, delivery, and assessment of gene knockdown by shRNA. We provide suggestions for designing shRNA targets and controls, a protocol for sequencing through the secondary structure of the shRNA hairpin structure, and protocols for packaging and delivery of shRNA lentiviral particles. Using real-time PCR and functional assays we demonstrate the successful knockdown of ASC, an inflammatory adaptor molecule. These studies demonstrate the practicality of including two shRNAs with different efficacies of knockdown to provide an additional level of control and to verify dose dependency of functional effects. Along with the methods described here, as new techniques and algorithms are designed in the future, shRNA is likely to include further promising application and continue to be a critical component of gene discovery. PMID:20387148

  1. Control of ribosome formation in rat heart

    International Nuclear Information System (INIS)

    Russo, L.A.

    1987-01-01

    Diabetes of 9 days duration produced a 17% diminution in the rate of total protein synthesis in rat hearts perfused as Langendorff preparations supplied with glucose, plasma levels of amino acids, and 400 μU/ml insulin. This reduction was attributable to a decrease in efficiency of protein synthesis and total RNA content. Total messenger RNA content decreased in diabetic hearts in proportion to the reduction in total RNA. Diabetes also resulted in diminished ribosome content as reflected by the induction in total RNA. Ribosome production was investigated by monitoring incorporation of [ 3 H]phenylalanine into the proteins of cytoplasmic ribosomes. Rates of ribosome formation in diabetic hearts were as fast as control rates in the presence of insulin, and were faster than control rates in the absence of the hormone. These results indicated that ribosome content fell in diabetic hearts despite unchanged or faster rates of ribosome formation

  2. Absence of ribosomal DNA amplification in the meroistic (telotrophic) ovary of the large milkweed bug Oncopeltus fasciatus (Dallas) (Hemiptera: Lygaeidae)

    Science.gov (United States)

    1975-01-01

    In the typical meroistic insect ovary, the oocyte nucleus synthesizes little if any RNA. Nurse cells or trophocytes actively synthesize ribosomes which are transported to and accumulated by the oocyte. In the telotrophic ovary a morphological separation exists, the nurse cells being localized at the apical end of each ovariole and communicating with the ooocytes via nutritive cords. In order to determine whether the genes coding for ribosomal RNA (rRNA) are amplified in the telotrophic ovary of the milkweed bug Oncopeltus fasciatus, the percentages of the genome coding for ribosomal RNA in somatic cells, spermatogenic cells, ovarian follicles, and nurse cells were compared. The oocytes and most of the nurse cells of O. fasciatus are uninucleolate. DNA hybridizing with ribosomal RNA is localized in a satellite DNA, the density of which is 1.712 g/cm(-3). The density of main-band DNA is 1.694 g/cm(-3). The ribosomal DNA satellite accounts for approximately 0.2% of the DNA in somatic and gametogenic tissues of both males and females. RNA-DNA hybridization analysis demonstrates that approximately 0.03% of the DNA in somatic tissues, testis, ovarian follicles, and isolated nurse cells hybridizes with ribosomal RNA. The fact that the percentage of DNA hybridizing with rRNA is the same in somatic and in male and female gametogenic tissues indicates that amplification of ribosomal DNA does not occur in nurse cells and that if it occurs in oocytes, it represents less than a 50- fold increase in ribosomal DNA. An increase in total genome DNA accounted by polyploidization appears to provide for increasing the amount of ribosomal DNA in the nurse cells. PMID:1158969

  3. In silico analysis of miRNA-mediated gene regulation in OCA and OA genes.

    Science.gov (United States)

    Kamaraj, Balu; Gopalakrishnan, Chandrasekhar; Purohit, Rituraj

    2014-12-01

    Albinism is an autosomal recessive genetic disorder due to low secretion of melanin. The oculocutaneous albinism (OCA) and ocular albinism (OA) genes are responsible for melanin production and also act as a potential targets for miRNAs. The role of miRNA is to inhibit the protein synthesis partially or completely by binding with the 3'UTR of the mRNA thus regulating gene expression. In this analysis, we predicted the genetic variation that occurred in 3'UTR of the transcript which can be a reason for low melanin production thus causing albinism. The single nucleotide polymorphisms (SNPs) in 3'UTR cause more new binding sites for miRNA which binds with mRNA which leads to inhibit the translation process either partially or completely. The SNPs in the mRNA of OCA and OA genes can create new binding sites for miRNA which may control the gene expression and lead to hypopigmentation. We have developed a computational procedure to determine the SNPs in the 3'UTR region of mRNA of OCA (TYR, OCA2, TYRP1 and SLC45A2) and OA (GPR143) genes which will be a potential cause for albinism. We identified 37 SNPs in five genes that are predicted to create 87 new binding sites on mRNA, which may lead to abrogation of the translation process. Expression analysis confirms that these genes are highly expressed in skin and eye regions. It is well supported by enrichment analysis that these genes are mainly involved in eye pigmentation and melanin biosynthesis process. The network analysis also shows how the genes are interacting and expressing in a complex network. This insight provides clue to wet-lab researches to understand the expression pattern of OCA and OA genes and binding phenomenon of mRNA and miRNA upon mutation, which is responsible for inhibition of translation process at genomic levels.

  4. Down-Regulation of Gene Expression by RNA-Induced Gene Silencing

    Science.gov (United States)

    Travella, Silvia; Keller, Beat

    Down-regulation of endogenous genes via post-transcriptional gene silencing (PTGS) is a key to the characterization of gene function in plants. Many RNA-based silencing mechanisms such as post-transcriptional gene silencing, co-suppression, quelling, and RNA interference (RNAi) have been discovered among species of different kingdoms (plants, fungi, and animals). One of the most interesting discoveries was RNAi, a sequence-specific gene-silencing mechanism initiated by the introduction of double-stranded RNA (dsRNA), homologous in sequence to the silenced gene, which triggers degradation of mRNA. Infection of plants with modified viruses can also induce RNA silencing and is referred to as virus-induced gene silencing (VIGS). In contrast to insertional mutagenesis, these emerging new reverse genetic approaches represent a powerful tool for exploring gene function and for manipulating gene expression experimentally in cereal species such as barley and wheat. We examined how RNAi and VIGS have been used to assess gene function in barley and wheat, including molecular mechanisms involved in the process and available methodological elements, such as vectors, inoculation procedures, and analysis of silenced phenotypes.

  5. Radioactive probes for human gene localisation by in situ hybridisation

    International Nuclear Information System (INIS)

    Fennell, S.J.

    1980-07-01

    Radioactive probes of high specific activity have been used for human gene localisation on metaphase chromosome preparations. Human 5S ribosomal RNA was used as a model system, as a probe for the localisation of human 5S ribosomal genes. 125 I-labelled mouse 5S ribosomal RNA was used to study the 5S ribosomal gene content and arrangement in families with translocations on the long arm of chromosome 1 close to or containing the 5S ribosomal RNA locus, by in situ hybridisation to human metaphase chromosomes from peripheral blood cultures. This confirmed the chromosomal assignment of 5S ribosomal genes to 1q 42-43. In situ hybridisation probes were also prepared from recombinant plasmids containing Xenopus laevis oocyte 5S or 28S/18S gene sequences to give [ 3 H]-labelled cRNA and [ 3 H]-labelled nick-translated plasmid DNA. Studies on the kinetics of hybridisation of plasmid probes with and without ribosomal gene sequences questioned the role of plasmid DNA for amplification of signal during gene localisation. Gene localisation was obtained with nick-translated plasmid DNA containing the 28S/18S ribosomal DNA insert after short exposure times, but poor results were obtained using a [ 3 H]-labelled cRNA probe transcribed from the plasmid with the 5S gene insert. (author)

  6. High throughput 16S rRNA gene amplicon sequencing

    DEFF Research Database (Denmark)

    Nierychlo, Marta; Larsen, Poul; Jørgensen, Mads Koustrup

    S rRNA gene amplicon sequencing has been developed over the past few years and is now ready to use for more comprehensive studies related to plant operation and optimization thanks to short analysis time, low cost, high throughput, and high taxonomic resolution. In this study we show how 16S r......RNA gene amplicon sequencing can be used to reveal factors of importance for the operation of full-scale nutrient removal plants related to settling problems and floc properties. Using optimized DNA extraction protocols, indexed primers and our in-house Illumina platform, we prepared multiple samples...... be correlated to the presence of the species that are regarded as “strong” and “weak” floc formers. In conclusion, 16S rRNA gene amplicon sequencing provides a high throughput approach for a rapid and cheap community profiling of activated sludge that in combination with multivariate statistics can be used...

  7. Ancient Origin of the U2 Small Nuclear RNA Gene-Targeting Non-LTR Retrotransposons Utopia.

    Science.gov (United States)

    Kojima, Kenji K; Jurka, Jerzy

    2015-01-01

    Most non-long terminal repeat (non-LTR) retrotransposons encoding a restriction-like endonuclease show target-specific integration into repetitive sequences such as ribosomal RNA genes and microsatellites. However, only a few target-specific lineages of non-LTR retrotransposons are distributed widely and no lineage is found across the eukaryotic kingdoms. Here we report the most widely distributed lineage of target sequence-specific non-LTR retrotransposons, designated Utopia. Utopia is found in three supergroups of eukaryotes: Amoebozoa, SAR, and Opisthokonta. Utopia is inserted into a specific site of U2 small nuclear RNA genes with different strength of specificity for each family. Utopia families from oomycetes and wasps show strong target specificity while only a small number of Utopia copies from reptiles are flanked with U2 snRNA genes. Oomycete Utopia families contain an "archaeal" RNase H domain upstream of reverse transcriptase (RT), which likely originated from a plant RNase H gene. Analysis of Utopia from oomycetes indicates that multiple lineages of Utopia have been maintained inside of U2 genes with few copy numbers. Phylogenetic analysis of RT suggests the monophyly of Utopia, and it likely dates back to the early evolution of eukaryotes.

  8. cDNA, genomic sequence cloning and overexpression of ribosomal protein S25 gene (RPS25) from the Giant Panda.

    Science.gov (United States)

    Hao, Yan-Zhe; Hou, Wan-Ru; Hou, Yi-Ling; Du, Yu-Jie; Zhang, Tian; Peng, Zheng-Song

    2009-11-01

    RPS25 is a component of the 40S small ribosomal subunit encoded by RPS25 gene, which is specific to eukaryotes. Studies in reference to RPS25 gene from animals were handful. The Giant Panda (Ailuropoda melanoleuca), known as a "living fossil", are increasingly concerned by the world community. Studies on RPS25 of the Giant Panda could provide scientific data for inquiring into the hereditary traits of the gene and formulating the protective strategy for the Giant Panda. The cDNA of the RPS25 cloned from Giant Panda is 436 bp in size, containing an open reading frame of 378 bp encoding 125 amino acids. The length of the genomic sequence is 1,992 bp, which was found to possess four exons and three introns. Alignment analysis indicated that the nucleotide sequence of the coding sequence shows a high homology to those of Homo sapiens, Bos taurus, Mus musculus and Rattus norvegicus as determined by Blast analysis, 92.6, 94.4, 89.2 and 91.5%, respectively. Primary structure analysis revealed that the molecular weight of the putative RPS25 protein is 13.7421 kDa with a theoretical pI 10.12. Topology prediction showed there is one N-glycosylation site, one cAMP and cGMP-dependent protein kinase phosphorylation site, two Protein kinase C phosphorylation sites and one Tyrosine kinase phosphorylation site in the RPS25 protein of the Giant Panda. The RPS25 gene was overexpressed in E. coli BL21 and Western Blotting of the RPS25 protein was also done. The results indicated that the RPS25 gene can be really expressed in E. coli and the RPS25 protein fusioned with the N-terminally his-tagged form gave rise to the accumulation of an expected 17.4 kDa polypeptide. The cDNA and the genomic sequence of RPS25 were cloned successfully for the first time from the Giant Panda using RT-PCR technology and Touchdown-PCR, respectively, which were both sequenced and analyzed preliminarily; then the cDNA of the RPS25 gene was overexpressed in E. coli BL21 and immunoblotted, which is the first

  9. Dedifferentiation of tobacco cells is associated with ribosomal RNA gene hypomethylation, increased transcription, and chromatin alterations

    Czech Academy of Sciences Publication Activity Database

    Koukalová, Blažena; Fojtová, Miloslava; Lim, Yoong Kar; Fulneček, Jaroslav; Leitch, Rowland Andrew; Kovařík, Aleš

    2005-01-01

    Roč. 139, - (2005), s. 275-286 ISSN 0032-0889 Institutional research plan: CEZ:AV0Z50040507 Keywords : pluripotent tobacco cells * epigenetic changes Subject RIV: BO - Biophysics Impact factor: 6.114, year: 2005

  10. Analysis of Toxic and Non-Toxic Alexandrium (Dinophyceae) Species Using Ribosomal RNA Gene Sequences

    Science.gov (United States)

    1993-02-01

    Therriault, J.-C. (1988). Cladistic analysis of electrophoretic variants within the toxic dinoflagellate genus Protogonyaulax. Botanica Marina 31: 39- 51. 8... Botanica Marina 34: 575-587. Halegraeff, G. M., and Bolch, C.J. (1992). Transport of toxic dinoflagellate cysts via ship’s ballast water: implications...analysis of electrophoretic variants within the toxic dinoflagellate genus Protogonv-u.!a,. Botanica Marina 31: 39-51. Curran, J., Baillie, D.L

  11. The phylogeny of Myxosporea (Myxozoa) based on small subunit ribosomal RNA gene analysis

    Czech Academy of Sciences Publication Activity Database

    Fiala, Ivan

    2006-01-01

    Roč. 36, č. 14 (2006), s. 1521-1534 ISSN 0020-7519 R&D Projects: GA MŠk LC522 Grant - others:Grantová agentura Jihočeské univerzity(CZ) 58/2002//P-BF Institutional research plan: CEZ:AV0Z60220518 Keywords : Myxosporea * SSU rDNA * phylogeny Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.337, year: 2006

  12. The transcript release factor PTRF augments ribosomal gene transcription by facilitating reinitiation of RNA polymerase I

    Czech Academy of Sciences Publication Activity Database

    Jansa, Petr; Burek, C.; Sander, E. E.; Grummt, I.

    2001-01-01

    Roč. 29, č. 2 (2001), s. 423-429 ISSN 0305-1048 Institutional research plan: CEZ:AV0Z5052915 Keywords : rDNA transcription * PTRF * transcription reinitiation Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 6.373, year: 2001

  13. THE CLADOPHORA COMPLEX (CHLOROPHYTA) - NEW VIEWS BASED ON 18S RIBOSOMAL-RNA GENE-SEQUENCES

    NARCIS (Netherlands)

    BAKKER, FT; OLSEN, JL; STAM, WT; VANDENHOEK, C

    1994-01-01

    Evolutionary relationships among species traditionally ascribed to the Siphonocladales/Cladophorales have remained unclear due to a lack of phylogenetically informative characters and extensive morphological plasticity resulting in morphological convergence. This study explores some of the diversity

  14. A single mutation in the 15S rRNA gene confers nonsense suppressor activity and interacts with mRF1 the release factor in yeast mitochondria

    Directory of Open Access Journals (Sweden)

    Ali Gargouri

    2015-08-01

    Full Text Available We have determined the nucleotide sequence of the mim3-1 mitochondrial ribosomal suppressor, acting on ochre mitochondrial mutations and one frameshift mutation in Saccharomyces cerevisiae. The 15s rRNA suppressor gene contains a G633 to C transversion. Yeast mitochondrial G633 corresponds to G517 of the E.coli 15S rRNA, which is occupied by an invariant G in all known small rRNA sequences. Interestingly, this mutation has occurred at the same position as the known MSU1 mitochondrial suppressor which changes G633 to A. The suppressor mutation lies in a highly conserved region of the rRNA, known in E.coli as the 530-loop, interacting with the S4, S5 and S12 ribosomal proteins. We also show an interesting interaction between the mitochondrial mim3-1 and the nuclear nam3-1 suppressors, both of which have the same action spectrum on mitochondrial mutations: nam3-1 abolishes the suppressor effect when present with mim3-1 in the same haploid cell. We discuss these results in the light of the nature of Nam3, identified by [1] as the yeast mitochondrial translation release factor. A hypothetical mechanism of suppression by "ribosome shifting" is also discussed in view of the nature of mutations suppressed and not suppressed.

  15. Revealing pancrustacean relationships: Phylogenetic analysis of ribosomal protein genes places Collembola (springtails in a monophyletic Hexapoda and reinforces the discrepancy between mitochondrial and nuclear DNA markers

    Directory of Open Access Journals (Sweden)

    Mariën J

    2008-03-01

    Full Text Available Abstract Background In recent years, several new hypotheses on phylogenetic relations among arthropods have been proposed on the basis of DNA sequences. One of the challenged hypotheses is the monophyly of hexapods. This discussion originated from analyses based on mitochondrial DNA datasets that, due to an unusual positioning of Collembola, suggested that the hexapod body plan evolved at least twice. Here, we re-evaluate the position of Collembola using ribosomal protein gene sequences. Results In total 48 ribosomal proteins were obtained for the collembolan Folsomia candida. These 48 sequences were aligned with sequence data on 35 other ecdysozoans. Each ribosomal protein gene was available for 25% to 86% of the taxa. However, the total sequence information was unequally distributed over the taxa and ranged between 4% and 100%. A concatenated dataset was constructed (5034 inferred amino acids in length, of which ~66% of the positions were filled. Phylogenetic tree reconstructions, using Maximum Likelihood, Maximum Parsimony, and Bayesian methods, resulted in a topology that supports monophyly of Hexapoda. Conclusion Although ribosomal proteins in general may not evolve independently, they once more appear highly valuable for phylogenetic reconstruction. Our analyses clearly suggest that Hexapoda is monophyletic. This underpins the inconsistency between nuclear and mitochondrial datasets when analyzing pancrustacean relationships. Caution is needed when applying mitochondrial markers in deep phylogeny.

  16. Revealing pancrustacean relationships: phylogenetic analysis of ribosomal protein genes places Collembola (springtails) in a monophyletic Hexapoda and reinforces the discrepancy between mitochondrial and nuclear DNA markers.

    Science.gov (United States)

    Timmermans, M J T N; Roelofs, D; Mariën, J; van Straalen, N M

    2008-03-12

    In recent years, several new hypotheses on phylogenetic relations among arthropods have been proposed on the basis of DNA sequences. One of the challenged hypotheses is the monophyly of hexapods. This discussion originated from analyses based on mitochondrial DNA datasets that, due to an unusual positioning of Collembola, suggested that the hexapod body plan evolved at least twice. Here, we re-evaluate the position of Collembola using ribosomal protein gene sequences. In total 48 ribosomal proteins were obtained for the collembolan Folsomia candida. These 48 sequences were aligned with sequence data on 35 other ecdysozoans. Each ribosomal protein gene was available for 25% to 86% of the taxa. However, the total sequence information was unequally distributed over the taxa and ranged between 4% and 100%. A concatenated dataset was constructed (5034 inferred amino acids in length), of which ~66% of the positions were filled. Phylogenetic tree reconstructions, using Maximum Likelihood, Maximum Parsimony, and Bayesian methods, resulted in a topology that supports monophyly of Hexapoda. Although ribosomal proteins in general may not evolve independently, they once more appear highly valuable for phylogenetic reconstruction. Our analyses clearly suggest that Hexapoda is monophyletic. This underpins the inconsistency between nuclear and mitochondrial datasets when analyzing pancrustacean relationships. Caution is needed when applying mitochondrial markers in deep phylogeny.

  17. Ribosome evolution: Emergence of peptide synthesis machinery

    Indian Academy of Sciences (India)

    suggested the dynamic movement of ribosomal proteins. The L2 protein (a .... Such kinds of interactions are important in elucidating the evolution of RNA .... Tamura K 2009 Molecular handedness of life: significance of RNA aminoacylation.

  18. Identification of housekeeping genes as references for quantitative ...

    Indian Academy of Sciences (India)

    Navya

    2017-01-20

    Jan 20, 2017 ... approach to identify genes suited for normalization, applied to bladder and colon cancer ... Cloning of Atlantic halibut growth hormone receptor genes and .... messenger and ribosomal RNA content in rat mammary tumors.

  19. DAG1, no gene for RNA regulation?

    Science.gov (United States)

    Brancaccio, Andrea

    2012-04-10

    DAG1 encodes for a precursor protein that liberates the two subunits featured by the dystroglycan (DG) adhesion complex that are involved in an increasing number of cellular functions in a wide variety of cells and tissues. Aside from the proteolytic events producing the α and β subunits, especially the former undergoes extensive "post-production" modifications taking place within the ER/Golgi where its core protein is both N- and O-decorated with sugars. These post-translational events, that are mainly orchestrated by a plethora of certified, or putative, glycosyltransferases, prelude to the excocytosis-mediated trafficking and targeting of the DG complex to the plasma membrane. Extensive genetic and biochemical evidences have been accumulated so far on α-DG glycosylation, while little is know on possible regulatory events underlying the chromatine activation, transcription or post-transcription (splicing and escape from the nucleus) of DAG1 or of its mRNA. A scenario is envisaged in which cells would use a sort of preferential, and scarcely regulated, route for DAG1 activation, that would imply fast mRNA transcription, maturation and export to the cytosol, and would prelude to the multiple time-consuming enzymatic post-translational activities needed for its glycosylation. Such a provocative view might be helpful to trigger future work aiming at disclosing the complete molecular mechanisms underlying DAG1 activation and at improving our knowledge of any pre-translational step that is involved in dystroglycan regulation. Copyright © 2012 Elsevier B.V. All rights reserved.

  20. RNA interference: learning gene knock-down from cell physiology

    Directory of Open Access Journals (Sweden)

    Provenzano Maurizio

    2004-11-01

    Full Text Available Summary Over the past decade RNA interference (RNAi has emerged as a natural mechanism for silencing gene expression. This ancient cellular antiviral response can be exploited to allow specific inhibition of the function of any chosen target gene. RNAi is proving to be an invaluable research tool, allowing much more rapid characterization of the function of known genes. More importantly, RNAi technology considerably bolsters functional genomics to aid in the identification of novel genes involved in disease processes. This review briefly describes the molecular principles underlying the biology of RNAi phenomenon and discuss the main technical issues regarding optimization of RNAi experimental design.

  1. RNA interference: learning gene knock-down from cell physiology

    Science.gov (United States)

    Mocellin, Simone; Provenzano, Maurizio

    2004-01-01

    Over the past decade RNA interference (RNAi) has emerged as a natural mechanism for silencing gene expression. This ancient cellular antiviral response can be exploited to allow specific inhibition of the function of any chosen target gene. RNAi is proving to be an invaluable research tool, allowing much more rapid characterization of the function of known genes. More importantly, RNAi technology considerably bolsters functional genomics to aid in the identification of novel genes involved in disease processes. This review briefly describes the molecular principles underlying the biology of RNAi phenomenon and discuss the main technical issues regarding optimization of RNAi experimental design. PMID:15555080

  2. A new sequence data set of SSU rRNA gene for Scleractinia and its phylogenetic and ecological applications

    KAUST Repository

    Arrigoni, Roberto; Vacherie, Benoî t; Benzoni, Francesca; Stefani, Fabrizio; Karsenti, Eric; Jaillon, Olivier; Not, Fabrice; Nunes, Flavia; Payri, Claude; Wincker, Patrick; Barbe, Valé rie

    2016-01-01

    Scleractinian corals (i.e. hard corals) play a fundamental role in building and maintaining coral reefs, one of the most diverse ecosystems on Earth. Nevertheless, their phylogenies remain largely unresolved and little is known about dispersal and survival of their planktonic larval phase. The small subunit ribosomal RNA (SSU rRNA) is a commonly used gene for DNA barcoding in several metazoans, and small variable regions of SSU rRNA are widely adopted as barcode marker to investigate marine plankton community structure worldwide. Here, we provide a large sequence data set of the complete SSU rRNA gene from 298 specimens, representing all known extant reef coral families and a total of 106 genera. The secondary structure was extremely conserved within the order with few exceptions due to insertions or deletions occurring in the variable regions. Remarkable differences in SSU rRNA length and base composition were detected between and within acroporids (Acropora, Montipora, Isopora and Alveopora) compared to other corals. The V4 and V9 regions seem to be promising barcode loci because variation at commonly used barcode primer binding sites was extremely low, while their levels of divergence allowed families and genera to be distinguished. A time-calibrated phylogeny of Scleractinia is provided, and mutation rate heterogeneity is demonstrated across main lineages. The use of this data set as a valuable reference for investigating aspects of ecology, biology, molecular taxonomy and evolution of scleractinian corals is discussed.

  3. A new sequence data set of SSU rRNA gene for Scleractinia and its phylogenetic and ecological applications

    KAUST Repository

    Arrigoni, Roberto

    2016-11-27

    Scleractinian corals (i.e. hard corals) play a fundamental role in building and maintaining coral reefs, one of the most diverse ecosystems on Earth. Nevertheless, their phylogenies remain largely unresolved and little is known about dispersal and survival of their planktonic larval phase. The small subunit ribosomal RNA (SSU rRNA) is a commonly used gene for DNA barcoding in several metazoans, and small variable regions of SSU rRNA are widely adopted as barcode marker to investigate marine plankton community structure worldwide. Here, we provide a large sequence data set of the complete SSU rRNA gene from 298 specimens, representing all known extant reef coral families and a total of 106 genera. The secondary structure was extremely conserved within the order with few exceptions due to insertions or deletions occurring in the variable regions. Remarkable differences in SSU rRNA length and base composition were detected between and within acroporids (Acropora, Montipora, Isopora and Alveopora) compared to other corals. The V4 and V9 regions seem to be promising barcode loci because variation at commonly used barcode primer binding sites was extremely low, while their levels of divergence allowed families and genera to be distinguished. A time-calibrated phylogeny of Scleractinia is provided, and mutation rate heterogeneity is demonstrated across main lineages. The use of this data set as a valuable reference for investigating aspects of ecology, biology, molecular taxonomy and evolution of scleractinian corals is discussed.

  4. Crystal Structure of the 23S rRNA Fragment Specific to r-Protein L1 and Designed Model of the Ribosomal L1 Stalk from Haloarcula marismortui

    Directory of Open Access Journals (Sweden)

    Azat Gabdulkhakov

    2017-02-01

    Full Text Available The crystal structure of the 92-nucleotide L1-specific fragment of 23S rRNA from Haloarcula marismortui (Hma has been determined at 3.3 Å resolution. Similar to the corresponding bacterial rRNA fragments, this structure contains joined helix 76-77 topped by an approximately globular structure formed by the residual part of the L1 stalk rRNA. The position of HmaL1 relative to the rRNA was found by its docking to the rRNA fragment using the L1-rRNA complex from Thermus thermophilus as a guide model. In spite of the anomalous negative charge of the halophilic archaeal protein, the conformation of the HmaL1-rRNA interface appeared to be very close to that observed in all known L1-rRNA complexes. The designed structure of the L1 stalk was incorporated into the H. marismortui 50S ribosomal subunit. Comparison of relative positions of L1 stalks in 50S subunits from H. marismortui and T. thermophilus made it possible to reveal the site of inflection of rRNA during the ribosome function.

  5. Lack of WDR36 leads to preimplantation embryonic lethality in mice and delays the formation of small subunit ribosomal RNA in human cells in vitro.

    Science.gov (United States)

    Gallenberger, Martin; Meinel, Dominik M; Kroeber, Markus; Wegner, Michael; Milkereit, Philipp; Bösl, Michael R; Tamm, Ernst R

    2011-02-01

    Mutations in WD repeat domain 36 gene (WDR36) play a causative role in some forms of primary open-angle glaucoma, a leading cause of blindness worldwide. WDR36 is characterized by the presence of multiple WD40 repeats and shows homology to Utp21, an essential protein component of the yeast small subunit (SSU) processome required for maturation of 18S rRNA. To clarify the functional role of WDR36 in the mammalian organism, we generated and investigated mutant mice with a targeted deletion of Wdr36. In parallel experiments, we used RNA interference to deplete WDR36 mRNA in mouse embryos and cultured human trabecular meshwork (HTM-N) cells. Deletion of Wdr36 in the mouse caused preimplantation embryonic lethality, and essentially similar effects were observed when WDR36 mRNA was depleted in mouse embryos by RNA interference. Depletion of WDR36 mRNA in HTM-N cells caused apoptotic cell death and upregulation of mRNA for BAX, TP53 and CDKN1A. By immunocytochemistry, staining for WDR36 was observed in the nucleolus of cells, which co-localized with that of nucleolar proteins such as nucleophosmin and PWP2. In addition, recombinant and epitope-tagged WDR36 localized to the nucleolus of HTM-N cells. By northern blot analysis, a substantial decrease in 21S rRNA, the precursor of 18S rRNA, was observed following knockdown of WDR36. In addition, metabolic-labeling experiments consistently showed a delay of 18S rRNA maturation in WDR36-depleted cells. Our results provide evidence that WDR36 is an essential protein in mammalian cells which is involved in the nucleolar processing of SSU 18S rRNA.

  6. Phylogenetic Analysis of Pasteuria penetrans by 16S rRNA Gene Cloning and Sequencing.

    Science.gov (United States)

    Anderson, J M; Preston, J F; Dickson, D W; Hewlett, T E; Williams, N H; Maruniak, J E

    1999-09-01

    Pasteuria penetrans is an endospore-forming bacterial parasite of Meloidogyne spp. This organism is among the most promising agents for the biological control of root-knot nematodes. In order to establish the phylogenetic position of this species relative to other endospore-forming bacteria, the 16S ribosomal genes from two isolates of P. penetrans, P-20, which preferentially infects M. arenaria race 1, and P-100, which preferentially infects M. incognita and M. javanica, were PCR-amplified from a purified endospore extraction. Universal primers for the 16S rRNA gene were used to amplify DNA which was cloned, and a nucleotide sequence was obtained for 92% of the gene (1,390 base pairs) encoding the 16S rDNA from each isolate. Comparison of both isolates showed identical sequences that were compared to 16S rDNA sequences of 30 other endospore-forming bacteria obtained from GenBank. Parsimony analyses indicated that P. penetrans is a species within a clade that includes Alicyclobacillus acidocaldarius, A. cycloheptanicus, Sulfobacillus sp., Bacillus tusciae, B. schlegelii, and P. ramosa. Its closest neighbor is P. ramosa, a parasite of Daphnia spp. (water fleas). This study provided a genomic basis for the relationship of species assigned to the genus Pasteuria, and for comparison of species that are parasites of different phytopathogenic nematodes.

  7. miRNA-Processing Gene Methylation and Cancer Risk.

    Science.gov (United States)

    Joyce, Brian T; Zheng, Yinan; Zhang, Zhou; Liu, Lei; Kocherginsky, Masha; Murphy, Robert; Achenbach, Chad J; Musa, Jonah; Wehbe, Firas; Just, Allan; Shen, Jincheng; Vokonas, Pantel; Schwartz, Joel; Baccarelli, Andrea A; Hou, Lifang

    2018-05-01

    Background: Dysregulation of miRNA and methylation levels are epigenetic hallmarks of cancer, potentially linked via miRNA-processing genes. Studies have found genetic alterations to miRNA-processing genes in cancer cells and human population studies. Our objective was to prospectively examine changes in DNA methylation of miRNA-processing genes and their associations with cancer risk. Methods: We examined cohort data from the Department of Veterans' Affairs Normative Aging Study. Participants were assessed every 3 to 5 years starting in 1999 through 2013 including questionnaires, medical record review, and blood collection. Blood from 686 consenting participants was analyzed using the Illumina 450K BeadChip array to measure methylation at CpG sites throughout the genome. We selected 19 genes based on a literature review, with 519 corresponding CpG sites. We then used Cox proportional hazards models to examine associations with cancer incidence, and generalized estimating equations to examine associations with cancer prevalence. Associations at false discovery rate time to cancer development (positively for cg06751583, inversely for cg23230564 and cg21034183), whereas methylation of one CpG site ( DROSHA : cg16131300) was positively associated with cancer prevalence. Conclusions: DNA methylation of DROSHA , a key miRNA-processing gene, and TNRC6B may play a role in early carcinogenesis. Impact: Changes in miRNA processing may exert multiple effects on cancer development, including protecting against it via altered global miRNAs, and may be a useful early detection biomarker of cancer. Cancer Epidemiol Biomarkers Prev; 27(5); 550-7. ©2018 AACR . ©2018 American Association for Cancer Research.

  8. Ellagic Acid-Changed Epigenome of Ribosomal Genes and Condensed RPA194-Positive Regions of Nucleoli in Tumour Cells.

    Science.gov (United States)

    Legartová, S; Sbardella, G; Kozubek, S; Bártová, E

    2015-01-01

    We studied the effect of ellagic acid (EA) on the morphology of nucleoli and on the pattern of major proteins of the nucleolus. After EA treatment of HeLa cells, we observed condensation of nucleoli as documented by the pattern of argyrophilic nucleolar organizer regions (AgNORs). EA also induced condensation of RPA194-positive nucleolar regions, but no morphological changes were observed in nucleolar compartments positive for UBF1/2 proteins or fibrillarin. Studied morphological changes induced by EA were compared with the morphology of control, non-treated cells and with pronounced condensation of all nucleolar domains caused by actinomycin D (ACT-D) treatment. Similarly as ACT-D, but in a lesser extent, EA induced an increased number of 53BP1-positive DNA lesions. However, the main marker of DNA lesions, γH2AX, was not accumulated in body-like nuclear structures. An increased level of γH2AX was found by immunofluorescence and Western blots only after EA treatment. Intriguingly, the levels of fibrillarin, UBF1/2 and γH2AX were increased at the promoters of ribosomal genes, while 53BP1 and CARM1 levels were decreased by EA treatment at these genomic regions. In the entire genome, EA reduced H3R17 dimethylation. Taken together, ellagic acid is capable of significantly changing the nucleolar morphology and protein levels inside the nucleolus.

  9. An ancient spliceosomal intron in the ribosomal protein L7a gene (Rpl7a of Giardia lamblia

    Directory of Open Access Journals (Sweden)

    Gray Michael W

    2005-08-01

    Full Text Available Abstract Background Only one spliceosomal-type intron has previously been identified in the unicellular eukaryotic parasite, Giardia lamblia (a diplomonad. This intron is only 35 nucleotides in length and is unusual in possessing a non-canonical 5' intron boundary sequence, CT, instead of GT. Results We have identified a second spliceosomal-type intron in G. lamblia, in the ribosomal protein L7a gene (Rpl7a, that possesses a canonical GT 5' intron boundary sequence. A comparison of the two known Giardia intron sequences revealed extensive nucleotide identity at both the 5' and 3' intron boundaries, similar to the conserved sequence motifs recently identified at the boundaries of spliceosomal-type introns in Trichomonas vaginalis (a parabasalid. Based on these observations, we searched the partial G. lamblia genome sequence for these conserved features and identified a third spliceosomal intron, in an unassigned open reading frame. Our comprehensive analysis of the Rpl7a intron in other eukaryotic taxa demonstrates that it is evolutionarily conserved and is an ancient eukaryotic intron. Conclusion An analysis of the phylogenetic distribution and properties of the Rpl7a intron suggests its utility as a phylogenetic marker to evaluate particular eukaryotic groupings. Additionally, analysis of the G. lamblia introns has provided further insight into some of the conserved and unique features possessed by the recently identified spliceosomal introns in related organisms such as T. vaginalis and Carpediemonas membranifera.

  10. Discrimination between ovine Babesia and Theileria species in China based on the ribosomal protein S8 (RPS8) gene.

    Science.gov (United States)

    Tian, Zhancheng; Liu, Guangyuan; Yin, Hong; Luo, Jianxun; Guan, Guiquan; Luo, Jin; Xie, Junren; Zheng, Jinfeng; Yuan, Xiaosong; Wang, Fangfang; Shen, Hui; Tian, Meiyuan

    2013-10-18

    Ovine babesiosis and theileriosis are important hemoprotozoal diseases of sheep and goats in tropical and subtropical regions that lead to economic losses in these animals. PCR-restriction fragment length polymorphism (PCR-RFLP) is a reliable molecular diagnostic tool for discriminating Theileria or Babesia species in the same host. In this study, the DNA sequences of a ribosomal protein S8 (RPS8) gene from four species of piroplasms in China were used to develop a species-specific PCR-RFLP diagnostic tool. The sensitivity of the PCR assays was 0.1 pg DNA for B. motasi and 1 pg DNA for T. uilenbergi and 10 pg DNA for Babesia sp. Xinjiang-2005 and T. luwenshuni. The clear size difference of the PCR products allowed for a direct discrimination for B. motasi, Babesia sp. Xinjiang-2005 and ovine Theileria species (T. uilenbergi and T. luwenshuni), except that the mixed infection between T. uilenbergi and T. luwenshuni may be difficult to distinguish, simply after the electrophoretic separation of the amplification products. Further T. uilenbergi and T. luwenshuni diagnoses were made by digesting the PCR product with SacI. The established method could be applicable for the survey of parasite dynamics, and epidemiological studies as well as prevention and control of the disease. Copyright © 2013 Elsevier B.V. All rights reserved.

  11. LNA-antisense rivals siRNA for gene silencing

    DEFF Research Database (Denmark)

    Jepsen, Jan Stenvang; Wengel, Jesper; Stenvang, Jan

    2004-01-01

    Locked nucleic acid (LNA) is a class of nucleic acid analogs possessing unprecedented binding affinity toward complementary DNA and RNA while obeying the Watson-Crick base-pairing rules. For efficient gene silencing in vitro and in vivo, fully modified or chimeric LNA oligonucleotides have been a...

  12. Prokaryotic community profiling of local algae wastewaters using advanced 16S rRNA gene sequencing.

    Science.gov (United States)

    Limayem, Alya; Micciche, Andrew; Nayak, Bina; Mohapatra, Shyam

    2018-01-01

    Algae biomass-fed wastewaters are a promising source of lipid and bioenergy manufacture, revealing substantial end-product investment returns. However, wastewaters would contain lytic pathogens carrying drug resistance detrimental to algae yield and environmental safety. This study was conducted to simultaneously decipher through high-throughput advanced Illumina 16S ribosomal RNA (rRNA) gene sequencing, the cultivable and uncultivable bacterial community profile found in a single sample that was directly recovered from the local wastewater systems. Samples were collected from two previously documented sources including anaerobically digested (AD) municipal wastewater and swine wastewater with algae namely Chlorella spp. in addition to control samples, swine wastewater, and municipal wastewater without algae. Results indicated the presence of a significant level of Bacteria in all samples with an average of approximately 95.49% followed by Archaea 2.34%, in local wastewaters designed for algae cultivation. Taxonomic genus identification indicated the presence of Calothrix, Pseudomonas, and Clostridium as the most prevalent strains in both local municipal and swine wastewater samples containing algae with an average of 17.37, 12.19, and 7.84%, respectively. Interestingly, swine wastewater without algae displayed the lowest level of Pseudomonas strains algae indicates potential coexistence between these strains and algae microenvironment, suggesting further investigations. This finding was particularly relevant for the earlier documented adverse effects of some nosocomial Pseudomonas strains on algae growth and their multidrug resistance potential, requiring the development of targeted bioremediation with regard to the beneficial flora.

  13. Computational prediction of miRNA genes from small RNA sequencing data

    Directory of Open Access Journals (Sweden)

    Wenjing eKang

    2015-01-01

    Full Text Available Next-generation sequencing now for the first time allows researchers to gauge the depth and variation of entire transcriptomes. However, now as rare transcripts can be detected that are present in cells at single copies, more advanced computational tools are needed to accurately annotate and profile them. miRNAs are 22 nucleotide small RNAs (sRNAs that post-transcriptionally reduce the output of protein coding genes. They have established roles in numerous biological processes, including cancers and other diseases. During miRNA biogenesis, the sRNAs are sequentially cleaved from precursor molecules that have a characteristic hairpin RNA structure. The vast majority of new miRNA genes that are discovered are mined from small RNA sequencing (sRNA-seq, which can detect more than a billion RNAs in a single run. However, given that many of the detected RNAs are degradation products from all types of transcripts, the accurate identification of miRNAs remain a non-trivial computational problem. Here we review the tools available to predict animal miRNAs from sRNA sequencing data. We present tools for generalist and specialist use cases, including prediction from massively pooled data or in species without reference genome. We also present wet-lab methods used to validate predicted miRNAs, and approaches to computationally benchmark prediction accuracy. For each tool, we reference validation experiments and benchmarking efforts. Last, we discuss the future of the field.

  14. Roles of Prolyl Isomerases in RNA-Mediated Gene Expression

    Directory of Open Access Journals (Sweden)

    Roopa Thapar

    2015-05-01

    Full Text Available The peptidyl-prolyl cis-trans isomerases (PPIases that include immunophilins (cyclophilins and FKBPs and parvulins (Pin1, Par14, Par17 participate in cell signaling, transcription, pre-mRNA processing and mRNA decay. The human genome encodes 19 cyclophilins, 18 FKBPs and three parvulins. Immunophilins are receptors for the immunosuppressive drugs cyclosporin A, FK506, and rapamycin that are used in organ transplantation. Pin1 has also been targeted in the treatment of Alzheimer’s disease, asthma, and a number of cancers. While these PPIases are characterized as molecular chaperones, they also act in a nonchaperone manner to promote protein-protein interactions using surfaces outside their active sites. The immunosuppressive drugs act by a gain-of-function mechanism by promoting protein-protein interactions in vivo. Several immunophilins have been identified as components of the spliceosome and are essential for alternative splicing. Pin1 plays roles in transcription and RNA processing by catalyzing conformational changes in the RNA Pol II C-terminal domain. Pin1 also binds several RNA binding proteins such as AUF1, KSRP, HuR, and SLBP that regulate mRNA decay by remodeling mRNP complexes. The functions of ribonucleoprotein associated PPIases are largely unknown. This review highlights PPIases that play roles in RNA-mediated gene expression, providing insight into their structures, functions and mechanisms of action in mRNP remodeling in vivo.

  15. Fluctuations and synchrony of RNA synthesis in nucleoli.

    Science.gov (United States)

    Pliss, Artem; Kuzmin, Andrey N; Kachynski, Aliaksandr V; Baev, Alexander; Berezney, Ronald; Prasad, Paras N

    2015-06-01

    Ribosomal RNA (rRNA) sequences are synthesized at exceptionally high rates and, together with ribosomal proteins (r-proteins), are utilized as building blocks for the assembly of pre-ribosomal particles. Although it is widely acknowledged that tight regulation and coordination of rRNA and r-protein production are fundamentally important for the maintenance of cellular homeostasis, still little is known about the real-time kinetics of the ribosome component synthesis in individual cells. In this communication we introduce a label-free MicroRaman spectrometric approach for monitoring rRNA synthesis in live cultured cells. Remarkably high and rapid fluctuations of rRNA production rates were revealed by this technique. Strikingly, the changes in the rRNA output were synchronous for ribosomal genes located in separate nucleoli of the same cell. Our findings call for the development of new concepts to elucidate the coordination of ribosomal components production. In this regard, numerical modeling further demonstrated that the production of rRNA and r-proteins can be coordinated, regardless of the fluctuations in rRNA synthesis. Overall, our quantitative data reveal a spectacular interplay of inherently stochastic rates of RNA synthesis and the coordination of gene expression.

  16. NINJA-OPS: Fast Accurate Marker Gene Alignment Using Concatenated Ribosomes.

    Directory of Open Access Journals (Sweden)

    Gabriel A Al-Ghalith

    2016-01-01

    Full Text Available The explosion of bioinformatics technologies in the form of next generation sequencing (NGS has facilitated a massive influx of genomics data in the form of short reads. Short read mapping is therefore a fundamental component of next generation sequencing pipelines which routinely match these short reads against reference genomes for contig assembly. However, such techniques have seldom been applied to microbial marker gene sequencing studies, which have mostly relied on novel heuristic approaches. We propose NINJA Is Not Just Another OTU-Picking Solution (NINJA-OPS, or NINJA for short, a fast and highly accurate novel method enabling reference-based marker gene matching (picking Operational Taxonomic Units, or OTUs. NINJA takes advantage of the Burrows-Wheeler (BW alignment using an artificial reference chromosome composed of concatenated reference sequences, the "concatesome," as the BW input. Other features include automatic support for paired-end reads with arbitrary insert sizes. NINJA is also free and open source and implements several pre-filtering methods that elicit substantial speedup when coupled with existing tools. We applied NINJA to several published microbiome studies, obtaining accuracy similar to or better than previous reference-based OTU-picking methods while achieving an order of magnitude or more speedup and using a fraction of the memory footprint. NINJA is a complete pipeline that takes a FASTA-formatted input file and outputs a QIIME-formatted taxonomy-annotated BIOM file for an entire MiSeq run of human gut microbiome 16S genes in under 10 minutes on a dual-core laptop.

  17. 16S partial gene mitochondrial DNA and internal transcribed spacers ribosomal DNA as differential markers of Trichuris discolor populations.

    Science.gov (United States)

    Callejón, R; Halajian, A; de Rojas, M; Marrugal, A; Guevara, D; Cutillas, C

    2012-05-25

    Comparative morphological, biometrical and molecular studies of Trichuris discolor isolated from Bos taurus from Spain and Iran was carried out. Furthermore, Trichuris ovis isolated from B. taurus and Capra hircus from Spain has been, molecularly, analyzed. Morphological studies revealed clear differences between T. ovis and T. discolor isolated from B. taurus but differences were not observed between populations of T. discolor isolated from different geographical regions. Nevertheless, the molecular studies based on the amplification and sequencing of the internal transcribed spacers 1 and 2 ribosomal DNA and 16S partial gene mitochondrial DNA showed clear differences between both populations of T. discolor from Spain and Iran suggesting two cryptic species. Phylogenetic studies corroborated these data. Thus, phylogenetic trees based on ITS1, ITS2 and 16S partial gene sequences showed that individuals of T. discolor from B. taurus from Iran clustered together and separated, with high bootstrap values, of T. discolor isolated from B. taurus from Spain, while populations of T. ovis from B. taurus and C. hircus from Spain clustered together but separated with high bootstrap values of both populations of T. discolor. Furthermore, a comparative phylogenetic study has been carried out with the ITS1and ITS2 sequences of Trichuris species from different hosts. Three clades were observed: the first clustered all the species of Trichuris parasitizing herbivores (T. discolor, T. ovis, Trichuris leporis and Trichuris skrjabini), the second clustered all the species of Trichuris parasitizing omnivores (Trichuris trichiura and Trichuris suis) and finally, the third clustered species of Trichuris parasitizing carnivores (Trichuris muris, Trichuris arvicolae and Trichuris vulpis). Copyright © 2011 Elsevier B.V. All rights reserved.

  18. Development of a universal RNA beacon for exogenous gene detection.

    Science.gov (United States)

    Guo, Yuanjian; Lu, Zhongju; Cohen, Ira Stephen; Scarlata, Suzanne

    2015-05-01

    Stem cell therapy requires a nontoxic and high-throughput method to achieve a pure cell population to prevent teratomas that can occur if even one cell in the implant has not been transformed. A promising method to detect and separate cells expressing a particular gene is RNA beacon technology. However, developing a successful, specific beacon to a particular transfected gene can take months to develop and in some cases is impossible. Here, we report on an off-the-shelf universal beacon that decreases the time and cost of applying beacon technology to select any living cell population transfected with an exogenous gene. ©AlphaMed Press.

  19. Comparative effects of butyl benzyl phthalate (BBP) and di(2-ethylhexyl) phthalate (DEHP) on the aquatic larvae of Chironomus riparius based on gene expression assays related to the endocrine system, the stress response and ribosomes.

    Science.gov (United States)

    Planelló, Rosario; Herrero, Oscar; Martínez-Guitarte, José Luis; Morcillo, Gloria

    2011-09-01

    In this work, the effects of butyl benzyl phthalate (BBP) and di(2-ethylhexyl) phthalate (DEHP), two of the most extensively used phthalates, were studied in Chironomus riparius under acute short-term treatments, to compare their relative toxicities and identify genes sensitive to exposure. The ecotoxicity of these phthalates was assessed by analysis of the alterations in gene expression profiles of selected inducible and constitutive genes related to the endocrine system, the cellular stress response and the ribosomal machinery. Fourth instar larvae, a model system in aquatic toxicology, were experimentally exposed to five increasing concentrations (0.01, 0.1, 1, 10, and 100mg/L) of DEHP and BBP for 24h. Gene expression was analysed by the changes in levels of transcripts, using RT-PCR techniques with specific gene probes. The exposures to DEHP or BBP were able to rapidly induce the hsp70 gene in a concentration-dependent manner, whereas the cognate form hsc70 was not altered by either of these chemicals. Transcription of ribosomal RNA as a measure of cell viability, quantified by the levels of ITS2, was not affected by DEHP, but was slightly, yet significantly, downregulated by BBP at the highest concentrations tested. Finally, as these phthalates are classified as endocrine disruptor chemicals (EDCs), their potential effect on the ecdysone endocrine system was studied by analysing the two genes, EcR and usp, of the heterodimeric ecdysone receptor complex. It was found that BBP provoked the overexpression of the EcR gene, with significant increases from exposures of 0.1mg/L and above, while DEHP significantly decreased the activity of this gene at the highest concentration. These data are relevant as they show for the first time the ability of phthalates to interfere with endocrine marker genes in invertebrates, demonstrating their potential capacity to alter the ecdysone signalling pathway. Overall, the study clearly shows a differential gene-toxin interaction

  20. An intronic microRNA silences genes that are functionally antagonistic to its host gene.

    Science.gov (United States)

    Barik, Sailen

    2008-09-01

    MicroRNAs (miRNAs) are short noncoding RNAs that down-regulate gene expression by silencing specific target mRNAs. While many miRNAs are transcribed from their own genes, nearly half map within introns of 'host' genes, the significance of which remains unclear. We report that transcriptional activation of apoptosis-associated tyrosine kinase (AATK), essential for neuronal differentiation, also generates miR-338 from an AATK gene intron that silences a family of mRNAs whose protein products are negative regulators of neuronal differentiation. We conclude that an intronic miRNA, transcribed together with the host gene mRNA, may serve the interest of its host gene by silencing a cohort of genes that are functionally antagonistic to the host gene itself.

  1. High-Resolution Melting Curve Analysis of the 16S Ribosomal Gene to Detect and Identify Pathogenic and Saprophytic Leptospira Species in Colombian Isolates.

    Science.gov (United States)

    Peláez Sánchez, Ronald G; Quintero, Juan Álvaro López; Pereira, Martha María; Agudelo-Flórez, Piedad

    2017-05-01

    AbstractIt is important to identify the circulating Leptospira agent to enhance the performance of serodiagnostic tests by incorporating specific antigens of native species, develop vaccines that take into account the species/serovars circulating in different regions, and optimize prevention and control strategies. The objectives of this study were to develop a polymerase chain reaction (PCR)-high-resolution melting (HRM) assay for differentiating between species of the genus Leptospira and to verify its usefulness in identifying unknown samples to species level. A set of primers from the initial region of the 16S ribosomal gene was designed to detect and differentiate the 22 species of Leptospira . Eleven reference strains were used as controls to establish the reference species and differential melting curves. Twenty-five Colombian Leptospira isolates were studied to evaluate the usefulness of the PCR-HRM assay in identifying unknown samples to species level. This identification was confirmed by sequencing and phylogenetic analysis of the 16S ribosomal gene. Eleven Leptospira species were successfully identified, except for Leptospira meyeri / Leptospira yanagawae because the sequences were 100% identical. The 25 isolates from humans, animals, and environmental water sources were identified as Leptospira santarosai (twelve), Leptospira interrogans (nine), and L. meyeri / L. yanagawae (four). The species verification was 100% concordant between PCR-HRM and phylogenetic analysis of the 16S ribosomal gene. The PCR-HRM assay designed in this study is a useful tool for identifying Leptospira species from isolates.

  2. Karyotype characterization of Mugil incilis Hancock, 1830 (Mugiliformes: Mugilidae, including a description of an unusual co-localization of major and minor ribosomal genes in the family

    Directory of Open Access Journals (Sweden)

    Anne Kathrin Hett

    Full Text Available This study reports the description of the karyotype of Mugil incilis from Venezuela. The chromosome complement is composed of 48 acrocentric chromosomes, which uniformly decrease in size. Therefore, the homologues can not be clearly identified, with the exception of one of the largest chromosome pairs, classified as number 1, whose homologues may show a subcentromeric secondary constriction, and of chromosome pair number 24, which is considerably smaller than the others. C-banding showed heterochromatic blocks at the centromeric/pericentromeric regions of all chromosomes, which were more conspicuous on chromosomes 1, given the C-positive signals include the secondary constrictions. AgNO3 and fluorescent in situ hybridization (FISH with 45S rDNA demonstrated that the nucleolus organizer regions are indeed located on the secondary constrictions of chromosome pair number 1. FISH with 5S rDNA revealed that the minor ribosomal genes are located on this same chromosome pair, near the NORs, though signals are closer to the centromeres and of smaller size, compared to those of the major ribosomal gene clusters. This is the first description of co-localization of major and minor ribosomal genes in the family. Data are discussed from a cytotaxonomic and phylogenetic perspective.

  3. Transcriptional Regulation of Mouse Ribosomal RNA Synthesis by Pathways Involving Protein Kinase C, Calcium, Insulin and Serum

    Science.gov (United States)

    1992-05-08

    Southern California 1ha.iITRINUTIONI AVAILASILITY STATEMENT 12b. DITIUINCCD1 This document has been approved { OSRUTO for public release and sale ...and 500 gIl of CHCI3 : Isoamyl alcohol (24 : 1), and 2X with 1ml of CHCI 3 : Iso amyl alcohol (24 : 1). RNA was precipitated at -200C overnight in the...control. Plasmid constructions. Plasmids pMrA and pMrD (Kuhn and Grummt, 1987) were kind gifts of Dr. Ingrid Grummt. Plasmid p119 and p123 (Arnhiem

  4. Wheat-specific gene, ribosomal protein l21, used as the endogenous reference gene for qualitative and real-time quantitative polymerase chain reaction detection of transgenes.

    Science.gov (United States)

    Liu, Yi-Ke; Li, He-Ping; Huang, Tao; Cheng, Wei; Gao, Chun-Sheng; Zuo, Dong-Yun; Zhao, Zheng-Xi; Liao, Yu-Cai

    2014-10-29

    Wheat-specific ribosomal protein L21 (RPL21) is an endogenous reference gene suitable for genetically modified (GM) wheat identification. This taxon-specific RPL21 sequence displayed high homogeneity in different wheat varieties. Southern blots revealed 1 or 3 copies, and sequence analyses showed one amplicon in common wheat. Combined analyses with sequences from common wheat (AABBDD) and three diploid ancestral species, Triticum urartu (AA), Aegilops speltoides (BB), and Aegilops tauschii (DD), demonstrated the presence of this amplicon in the AA genome. Using conventional qualitative polymerase chain reaction (PCR), the limit of detection was 2 copies of wheat haploid genome per reaction. In the quantitative real-time PCR assay, limits of detection and quantification were about 2 and 8 haploid genome copies, respectively, the latter of which is 2.5-4-fold lower than other reported wheat endogenous reference genes. Construct-specific PCR assays were developed using RPL21 as an endogenous reference gene, and as little as 0.5% of GM wheat contents containing Arabidopsis NPR1 were properly quantified.

  5. Evaluation of the authenticity of a highly novel environmental sequence from boreal forest soil using ribosomal RNA secondary structure modeling

    Science.gov (United States)

    D.J. Glass; N. Takebayashi; L. Olson; D.L. Taylor

    2013-01-01

    The number of sequences from both formally described taxa and uncultured environmental DNA deposited in the International Nucleotide Sequence Databases has increased substantially over the last two decades. Although the majority of these sequences represent authentic gene copies, there is evidence of DNA artifacts in these databases as well. These include lab artifacts...

  6. Identification of EhTIF-IA: The putative E. histolytica orthologue of the human ribosomal RNA transcription initiation factor-IA.

    Science.gov (United States)

    Srivastava, Ankita; Bhattacharya, Alok; Bhattacharya, Sudha; Jhingan, Gagan Deep

    2016-03-01

    Initiation of rDNA transcription requires the assembly of a specific multi-protein complex at the rDNA promoter containing the RNA Pol I with auxiliary factors. One of these factors is known as Rrn3P in yeast and Transcription Initiation Factor IA (TIF-IA) in mammals. Rrn3p/TIF-IA serves as a bridge between RNA Pol I and the pre-initiation complex at the promoter. It is phosphorylated at multiple sites and is involved in regulation of rDNA transcription in a growth-dependent manner. In the early branching parasitic protist Entamoeba histolytica, the rRNA genes are present exclusively on circular extra chromosomal plasmids. The protein factors involved in regulation of rDNA transcription in E. histolytica are not known. We have identified the E. histolytica equivalent of TIF-1A (EhTIF-IA) by homology search within the database and was further cloned and expressed. Immuno-localization studies showed that EhTIF-IA co-localized partially with fibrillarin in the peripherally localized nucleolus. EhTIF-IA was shown to interact with the RNA Pol I-specific subunit RPA12 both in vivo and in vitro. Mass spectroscopy data identified RNA Pol I-specific subunits and other nucleolar proteins to be the interacting partners of EhTIF-IA. Our study demonstrates for the first time a conserved putative RNA Pol I transcription factor TIF-IA in E. histolytica.

  7. Using RNA-Seq Data to Evaluate Reference Genes Suitable for Gene Expression Studies in Soybean.

    Directory of Open Access Journals (Sweden)

    Aldrin Kay-Yuen Yim

    Full Text Available Differential gene expression profiles often provide important clues for gene functions. While reverse transcription quantitative real-time polymerase chain reaction (RT-qPCR is an important tool, the validity of the results depends heavily on the choice of proper reference genes. In this study, we employed new and published RNA-sequencing (RNA-Seq datasets (26 sequencing libraries in total to evaluate reference genes reported in previous soybean studies. In silico PCR showed that 13 out of 37 previously reported primer sets have multiple targets, and 4 of them have amplicons with different sizes. Using a probabilistic approach, we identified new and improved candidate reference genes. We further performed 2 validation tests (with 26 RNA samples on 8 commonly used reference genes and 7 newly identified candidates, using RT-qPCR. In general, the new candidate reference genes exhibited more stable expression levels under the tested experimental conditions. The three newly identified candidate reference genes Bic-C2, F-box protein2, and VPS-like gave the best overall performance, together with the commonly used ELF1b. It is expected that the proposed probabilistic model could serve as an important tool to identify stable reference genes when more soybean RNA-Seq data from different growth stages and treatments are used.

  8. Re-inspection of small RNA sequence datasets reveals several novel human miRNA genes.

    Directory of Open Access Journals (Sweden)

    Thomas Birkballe Hansen

    Full Text Available BACKGROUND: miRNAs are key players in gene expression regulation. To fully understand the complex nature of cellular differentiation or initiation and progression of disease, it is important to assess the expression patterns of as many miRNAs as possible. Thereby, identifying novel miRNAs is an essential prerequisite to make possible a comprehensive and coherent understanding of cellular biology. METHODOLOGY/PRINCIPAL FINDINGS: Based on two extensive, but previously published, small RNA sequence datasets from human embryonic stem cells and human embroid bodies, respectively [1], we identified 112 novel miRNA-like structures and were able to validate miRNA processing in 12 out of 17 investigated cases. Several miRNA candidates were furthermore substantiated by including additional available small RNA datasets, thereby demonstrating the power of combining datasets to identify miRNAs that otherwise may be assigned as experimental noise. CONCLUSIONS/SIGNIFICANCE: Our analysis highlights that existing datasets are not yet exhaustedly studied and continuous re-analysis of the available data is important to uncover all features of small RNA sequencing.

  9. 18S rRNA is a reliable normalisation gene for real time PCR based on influenza virus infected cells

    Directory of Open Access Journals (Sweden)

    Kuchipudi Suresh V

    2012-10-01

    Full Text Available Abstract Background One requisite of quantitative reverse transcription PCR (qRT-PCR is to normalise the data with an internal reference gene that is invariant regardless of treatment, such as virus infection. Several studies have found variability in the expression of commonly used housekeeping genes, such as beta-actin (ACTB and glyceraldehyde-3-phosphate dehydrogenase (GAPDH, under different experimental settings. However, ACTB and GAPDH remain widely used in the studies of host gene response to virus infections, including influenza viruses. To date no detailed study has been described that compares the suitability of commonly used housekeeping genes in influenza virus infections. The present study evaluated several commonly used housekeeping genes [ACTB, GAPDH, 18S ribosomal RNA (18S rRNA, ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide (ATP5B and ATP synthase, H+ transporting, mitochondrial Fo complex, subunit C1 (subunit 9 (ATP5G1] to identify the most stably expressed gene in human, pig, chicken and duck cells infected with a range of influenza A virus subtypes. Results The relative expression stability of commonly used housekeeping genes were determined in primary human bronchial epithelial cells (HBECs, pig tracheal epithelial cells (PTECs, and chicken and duck primary lung-derived cells infected with five influenza A virus subtypes. Analysis of qRT-PCR data from virus and mock infected cells using NormFinder and BestKeeper software programmes found that 18S rRNA was the most stable gene in HBECs, PTECs and avian lung cells. Conclusions Based on the presented data from cell culture models (HBECs, PTECs, chicken and duck lung cells infected with a range of influenza viruses, we found that 18S rRNA is the most stable reference gene for normalising qRT-PCR data. Expression levels of the other housekeeping genes evaluated in this study (including ACTB and GPADH were highly affected by influenza virus infection and

  10. Small RNA-Controlled Gene Regulatory Networks in Pseudomonas putida

    DEFF Research Database (Denmark)

    Bojanovic, Klara

    evolved numerous mechanisms to controlgene expression in response to specific environmental signals. In addition to two-component systems, small regulatory RNAs (sRNAs) have emerged as major regulators of gene expression. The majority of sRNAs bind to mRNA and regulate their expression. They often have...... multiple targets and are incorporated into large regulatory networks and the RNA chaper one Hfq in many cases facilitates interactions between sRNAs and their targets. Some sRNAs also act by binding to protein targets and sequestering their function. In this PhD thesis we investigated the transcriptional....... Detailed insights into the mechanisms through which P. putida responds to different stress conditions and increased understanding of bacterial adaptation in natural and industrial settings were gained. Additionally, we identified genome-wide transcription start sites, andmany regulatory RNA elements...

  11. Conservation of RNA sequence and cross-linking ability in ribosomes from a higher eukaryote: photochemical cross-linking of the anticodon of P site bound tRNA to the penultimate cytidine of the UACACACG sequence in Artemia salina 18S rRNA

    International Nuclear Information System (INIS)

    Ciesiolka, J.; Nurse, K.; Klein, J.; Ofengand, J.

    1985-01-01

    The complex of Artemia salina ribosomes and Escherichia coli acetylvalyl-tRNA could be cross-linked by irradiation with near-UV light. Cross-linking required the presence of the codon GUU, GUA being ineffective. The acetylvalyl group could be released from the cross-linked tRNA by treatment with puromycin, demonstrating that cross-linking had occurred at the P site. This was true both for pGUU- and also for poly(U2,G)-dependent cross-linking. All of the cross-linking was to the 18S rRNA of the small ribosomal subunit. Photolysis of the cross-link at 254 nm occurred with the same kinetics as that for the known cyclobutane dimer between this tRNA and Escherichia coli 16S rRNA. T1 RNase digestion of the cross-linked tRNA yielded an oligonucleotide larger in molecular weight than any from un-cross-linked rRNA or tRNA or from a prephotolyzed complex. Extended electrophoresis showed this material to consist of two oligomers of similar mobility, a faster one-third component and a slower two-thirds component. Each oligomer yielded two components on 254-nm photolysis. The slower band from each was the tRNA T1 oligomer CACCUCCCUVACAAGp, which includes the anticodon. The faster band was the rRNA 9-mer UACACACCGp and its derivative UACACACUG. Unexpectedly, the dephosphorylated and slower moving 9-mer was derived from the faster moving dimer. Deamination of the penultimate C to U is probably due to cyclobutane dimer formation and was evidence for that nucleotide being the site of cross-linking. Direct confirmation of the cross-linking site was obtained by Z-gel analysis

  12. Markerless Escherichia coli rrn Deletion Strains for Genetic Determination of Ribosomal Binding Sites

    DEFF Research Database (Denmark)

    Quan, Selwyn; Skovgaard, Ole; McLaughlin, Robert E

    2015-01-01

    Single-copy rrn strains facilitate genetic ribosomal studies in Escherichia coli. Consecutive markerless deletion of rrn operons resulted in slower growth upon inactivation of the fourth copy, which was reversed by supplying transfer RNA genes encoded in rrn operons in trans. Removal of the sixth...

  13. Dinucleotide controlled null models for comparative RNA gene prediction

    Directory of Open Access Journals (Sweden)

    Gesell Tanja

    2008-05-01

    Full Text Available Abstract Background Comparative prediction of RNA structures can be used to identify functional noncoding RNAs in genomic screens. It was shown recently by Babak et al. [BMC Bioinformatics. 8:33] that RNA gene prediction programs can be biased by the genomic dinucleotide content, in particular those programs using a thermodynamic folding model including stacking energies. As a consequence, there is need for dinucleotide-preserving control strategies to assess the significance of such predictions. While there have been randomization algorithms for single sequences for many years, the problem has remained challenging for multiple alignments and there is currently no algorithm available. Results We present a program called SISSIz that simulates multiple alignments of a given average dinucleotide content. Meeting additional requirements of an accurate null model, the randomized alignments are on average of the same sequence diversity and preserve local conservation and gap patterns. We make use of a phylogenetic substitution model that includes overlapping dependencies and site-specific rates. Using fast heuristics and a distance based approach, a tree is estimated under this model which is used to guide the simulations. The new algorithm is tested on vertebrate genomic alignments and the effect on RNA structure predictions is studied. In addition, we directly combined the new null model with the RNAalifold consensus folding algorithm giving a new variant of a thermodynamic structure based RNA gene finding program that is not biased by the dinucleotide content. Conclusion SISSIz implements an efficient algorithm to randomize multiple alignments preserving dinucleotide content. It can be used to get more accurate estimates of false positive rates of existing programs, to produce negative controls for the training of machine learning based programs, or as standalone RNA gene finding program. Other applications in comparative genomics that require

  14. Dinucleotide controlled null models for comparative RNA gene prediction.

    Science.gov (United States)

    Gesell, Tanja; Washietl, Stefan

    2008-05-27

    Comparative prediction of RNA structures can be used to identify functional noncoding RNAs in genomic screens. It was shown recently by Babak et al. [BMC Bioinformatics. 8:33] that RNA gene prediction programs can be biased by the genomic dinucleotide content, in particular those programs using a thermodynamic folding model including stacking energies. As a consequence, there is need for dinucleotide-preserving control strategies to assess the significance of such predictions. While there have been randomization algorithms for single sequences for many years, the problem has remained challenging for multiple alignments and there is currently no algorithm available. We present a program called SISSIz that simulates multiple alignments of a given average dinucleotide content. Meeting additional requirements of an accurate null model, the randomized alignments are on average of the same sequence diversity and preserve local conservation and gap patterns. We make use of a phylogenetic substitution model that includes overlapping dependencies and site-specific rates. Using fast heuristics and a distance based approach, a tree is estimated under this model which is used to guide the simulations. The new algorithm is tested on vertebrate genomic alignments and the effect on RNA structure predictions is studied. In addition, we directly combined the new null model with the RNAalifold consensus folding algorithm giving a new variant of a thermodynamic structure based RNA gene finding program that is not biased by the dinucleotide content. SISSIz implements an efficient algorithm to randomize multiple alignments preserving dinucleotide content. It can be used to get more accurate estimates of false positive rates of existing programs, to produce negative controls for the training of machine learning based programs, or as standalone RNA gene finding program. Other applications in comparative genomics that require randomization of multiple alignments can be considered. SISSIz

  15. Identification of putative noncoding RNA genes in the Burkholderia cenocepacia J2315 genome

    DEFF Research Database (Denmark)

    Coenye, T.; Drevinek, P.; Mahenthiralingam, E.

    2007-01-01

    Noncoding RNA (ncRNA) genes are not involved in the production of mRNA and proteins, but produce transcripts that function directly as structural or regulatory RNAs. In the present study, the presence of ncRNA genes in the genome of Burkholderia cenocepacia J2315 was evaluated by combining...

  16. Multiple independent insertions of 5S rRNA genes in the spliced-leader gene family of trypanosome species.

    Science.gov (United States)

    Beauparlant, Marc A; Drouin, Guy

    2014-02-01

    Analyses of the 5S rRNA genes found in the spliced-leader (SL) gene repeat units of numerous trypanosome species suggest that such linkages were not inherited from a common ancestor, but were the result of independent 5S rRNA gene insertions. In trypanosomes, 5S rRNA genes are found either in the tandemly repeated units coding for SL genes or in independent tandemly repeated units. Given that trypanosome species where 5S rRNA genes are within the tandemly repeated units coding for SL genes are phylogenetically related, one might hypothesize that this arrangement is the result of an ancestral insertion of 5S rRNA genes into the tandemly repeated SL gene family of trypanosomes. Here, we use the types of 5S rRNA genes found associated with SL genes, the flanking regions of the inserted 5S rRNA genes and the position of these insertions to show that most of the 5S rRNA genes found within SL gene repeat units of trypanosome species were not acquired from a common ancestor but are the results of independent insertions. These multiple 5S rRNA genes insertion events in trypanosomes are likely the result of frequent founder events in different hosts and/or geographical locations in species having short generation times.

  17. Ribosomal and hematopoietic defects in induced pluripotent stem cells derived from Diamond Blackfan anemia patients.

    Science.gov (United States)

    Garçon, Loïc; Ge, Jingping; Manjunath, Shwetha H; Mills, Jason A; Apicella, Marisa; Parikh, Shefali; Sullivan, Lisa M; Podsakoff, Gregory M; Gadue, Paul; French, Deborah L; Mason, Philip J; Bessler, Monica; Weiss, Mitchell J

    2013-08-08

    Diamond Blackfan anemia (DBA) is a congenital disorder with erythroid (Ery) hypoplasia and tissue morphogenic abnormalities. Most DBA cases are caused by heterozygous null mutations in genes encoding ribosomal proteins. Understanding how haploinsufficiency of these ubiquitous proteins causes DBA is hampered by limited availability of tissues from affected patients. We generated induced pluripotent stem cells (iPSCs) from fibroblasts of DBA patients carrying mutations in RPS19 and RPL5. Compared with controls, DBA fibroblasts formed iPSCs inefficiently, although we obtained 1 stable clone from each fibroblast line. RPS19-mutated iPSCs exhibited defects in 40S (small) ribosomal subunit assembly and production of 18S ribosomal RNA (rRNA). Upon induced differentiation, the mutant clone exhibited globally impaired hematopoiesis, with the Ery lineage affected most profoundly. RPL5-mutated iPSCs exhibited defective 60S (large) ribosomal subunit assembly, accumulation of 12S pre-rRNA, and impaired erythropoiesis. In both mutant iPSC lines, genetic correction of ribosomal protein deficiency via complementary DNA transfer into the "safe harbor" AAVS1 locus alleviated abnormalities in ribosome biogenesis and hematopoiesis. Our studies show that pathological features of DBA are recapitulated by iPSCs, provide a renewable source of cells to model various tissue defects, and demonstrate proof of principle for genetic correction strategies in patient stem cells.

  18. Decoding the principles underlying the frequency of association with nucleoli for RNA polymerase III–transcribed genes in budding yeast

    Science.gov (United States)

    Belagal, Praveen; Normand, Christophe; Shukla, Ashutosh; Wang, Renjie; Léger-Silvestre, Isabelle; Dez, Christophe; Bhargava, Purnima; Gadal, Olivier

    2016-01-01

    The association of RNA polymerase III (Pol III)–transcribed genes with nucleoli seems to be an evolutionarily conserved property of the spatial organization of eukaryotic genomes. However, recent studies of global chromosome architecture in budding yeast have challenged this view. We used live-cell imaging to determine the intranuclear positions of 13 Pol III–transcribed genes. The frequency of association with nucleolus and nuclear periphery depends on linear genomic distance from the tethering elements—centromeres or telomeres. Releasing the hold of the tethering elements by inactivating centromere attachment to the spindle pole body or changing the position of ribosomal DNA arrays resulted in the association of Pol III–transcribed genes with nucleoli. Conversely, ectopic insertion of a Pol III–transcribed gene in the vicinity of a centromere prevented its association with nucleolus. Pol III–dependent transcription was independent of the intranuclear position of the gene, but the nucleolar recruitment of Pol III–transcribed genes required active transcription. We conclude that the association of Pol III–transcribed genes with the nucleolus, when permitted by global chromosome architecture, provides nucleolar and/or nuclear peripheral anchoring points contributing locally to intranuclear chromosome organization. PMID:27559135

  19. Direct Regulation of tRNA and 5S rRNA Gene Transcription by Polo-like Kinase 1

    NARCIS (Netherlands)

    Fairley, Jennifer A.; Mitchell, Louise E.; Berg, Tracy; Kenneth, Niall S.; von Schubert, Conrad; Sillje, Herman H. W.; Medema, Rene H.; Nigg, Erich A.; White, Robert J.

    2012-01-01

    Polo-like kinase Plk1 controls numerous aspects of cell-cycle progression. We show that it associates with tRNA and 5S rRNA genes and regulates their transcription by RNA polymerase Ill (pol Ill) through direct binding and phosphorylation of transcription factor Brit During interphase, Plk1 promotes

  20. Ribosomal protein S14 transcripts are edited in Oenothera mitochondria.

    Science.gov (United States)

    Schuster, W; Unseld, M; Wissinger, B; Brennicke, A

    1990-01-01

    The gene encoding ribosomal protein S14 (rps14) in Oenothera mitochondria is located upstream of the cytochrome b gene (cob). Sequence analysis of independently derived cDNA clones covering the entire rps14 coding region shows two nucleotides edited from the genomic DNA to the mRNA derived sequences by C to U modifications. A third editing event occurs four nucleotides upstream of the AUG initiation codon and improves a potential ribosome binding site. A CGG codon specifying arginine in a position conserved in evolution between chloroplasts and E. coli as a UGG tryptophan codon is not edited in any of the cDNAs analysed. An inverted repeat 3' of an unidentified open reading frame is located upstream of the rps14 gene. The inverted repeat sequence is highly conserved at analogous regions in other Oenothera mitochondrial loci. Images PMID:2326162

  1. miRNA-mediated 'tug-of-war' model reveals ceRNA propensity of genes in cancers.

    Science.gov (United States)

    Swain, Arpit Chandan; Mallick, Bibekanand

    2018-06-01

    Competing endogenous RNA (ceRNA) are transcripts that cross-regulate each other at the post-transcriptional level by competing for shared microRNA response elements (MREs). These have been implicated in various biological processes impacting cell-fate decisions and diseases including cancer. There are several studies that predict possible ceRNA pairs by adopting various machine-learning and mathematical approaches; however, there is no method that enables us to gauge as well as compare the propensity of the ceRNA of a gene and precisely envisages which among a pair exerts a stronger pull on the shared miRNA pool. In this study, we developed a method that uses the 'tug of war of genes' concept to predict and quantify ceRNA potential of a gene for the shared miRNA pool in cancers based on a score represented by SoCeR (score of competing endogenous RNA). The method was executed on the RNA-Seq transcriptional profiles of genes and miRNA available at TCGA along with CLIP-supported miRNA-target sites to predict ceRNA in 32 cancer types which were validated with already reported cases. The proposed method can be used to determine the sequestering capability of the gene of interest as well as in ranking the probable ceRNA candidates of a gene. Finally, we developed standalone applications (SoCeR tool) to aid researchers in easier implementation of the method in analysing different data sets or diseases. © 2018 The Authors. Published by FEBS Press and John Wiley & Sons Ltd.

  2. Deletion analysis of the expression of rRNA genes and associated tRNA genes carried by a lambda transducing bacteriophage

    International Nuclear Information System (INIS)

    Morgan, E.A.; Nomura, M.

    1979-01-01

    Transducing phage lambda ilv5 carries genes for rRNA's, spacer tRNA's (tRNA 1 /sup Ile/ and tRNA/sub 1B//sup Ala/), and two other tRNA's (tRNA 1 /sup Asp/ and tRNA/sup Trp/). We have isolated a mutant of lambda ilv5, lambda ilv5su7, which carries an amber suppressor mutation in the tRNA/sup Trp/ gene. A series of deletion mutants were isolated from the lambda ilv5su7 phage. Genetic and biochemical analyses of these deletion mutants have confirmed our previous conclusion that the genes for tRNA 1 /sup Asp/ and tRNA/sup Trp/ located at the distal end of the rRNA operon (rrnC) are cotranscribed with other rRNA genes in that operon. In addition, these deletions were used to define roughly the physical location of the promoter(s) of the rRNA operon carried by the lambda ilv5su7 transducing phage

  3. The primary structure of L37--a rat ribosomal protein with a zinc finger-like motif.

    Science.gov (United States)

    Chan, Y L; Paz, V; Olvera, J; Wool, I G

    1993-04-30

    The amino acid sequence of the rat 60S ribosomal subunit protein L37 was deduced from the sequence of nucleotides in a recombinant cDNA. Ribosomal protein L37 has 96 amino acids, the NH2-terminal methionine is removed after translation of the mRNA, and has a molecular weight of 10,939. Ribosomal protein L37 has a single zinc finger-like motif of the C2-C2 type. Hybridization of the cDNA to digests of nuclear DNA suggests that there are 13 or 14 copies of the L37 gene. The mRNA for the protein is about 500 nucleotides in length. Rat L37 is related to Saccharomyces cerevisiae ribosomal protein YL35 and to Caenorhabditis elegans L37. We have identified in the data base a DNA sequence that encodes the chicken homolog of rat L37.

  4. Global Analysis of miRNA Gene Clusters and Gene Families Reveals Dynamic and Coordinated Expression

    Directory of Open Access Journals (Sweden)

    Li Guo

    2014-01-01

    Full Text Available To further understand the potential expression relationships of miRNAs in miRNA gene clusters and gene families, a global analysis was performed in 4 paired tumor (breast cancer and adjacent normal tissue samples using deep sequencing datasets. The compositions of miRNA gene clusters and families are not random, and clustered and homologous miRNAs may have close relationships with overlapped miRNA species. Members in the miRNA group always had various expression levels, and even some showed larger expression divergence. Despite the dynamic expression as well as individual difference, these miRNAs always indicated consistent or similar deregulation patterns. The consistent deregulation expression may contribute to dynamic and coordinated interaction between different miRNAs in regulatory network. Further, we found that those clustered or homologous miRNAs that were also identified as sense and antisense miRNAs showed larger expression divergence. miRNA gene clusters and families indicated important biological roles, and the specific distribution and expression further enrich and ensure the flexible and robust regulatory network.

  5. Interphase ribosomal RNA cistron staining in thyroid epithelial cells in Grave's disease, Hashimoto's thyroiditis and benign and malignant tumours of the thyroid gland

    OpenAIRE

    Mamaev, N N; Grynyeva, E N; Blagosklonnaya, Y V

    1996-01-01

    Aim—To evaluate the expression of ribosomal cistrons in human thyroid epithelial cells (TECs) of patients with Grave's disease, Hashimoto's thyroiditis and benign and malignant tumours of the thyroid gland.

  6. A distinct group of hepacivirus/pestivirus-like internal ribosomal entry sites in members of diverse picornavirus genera: evidence for modular exchange of functional noncoding RNA elements by recombination.

    Science.gov (United States)

    Hellen, Christopher U T; de Breyne, Sylvain

    2007-06-01

    The 5' untranslated regions (UTRs) of the RNA genomes of Flaviviridae of the Hepacivirus and Pestivirus genera contain internal ribosomal entry sites (IRESs) that are unrelated to the two principal classes of IRESs of Picornaviridae. The mechanism of translation initiation on hepacivirus/pestivirus (HP) IRESs, which involves factor-independent binding to ribosomal 40S subunits, also differs fundamentally from initiation on these picornavirus IRESs. Ribosomal binding to HP IRESs requires conserved sequences that form a pseudoknot and the adjacent IIId and IIIe domains; analogous elements do not occur in the two principal groups of picornavirus IRESs. Here, comparative sequence analysis was used to identify a subset of picornaviruses from multiple genera that contain 5' UTR sequences with significant similarities to HP IRESs. They are avian encephalomyelitis virus, duck hepatitis virus 1, duck picornavirus, porcine teschovirus, porcine enterovirus 8, Seneca Valley virus, and simian picornavirus. Their 5' UTRs are predicted to form several structures, in some of which the peripheral elements differ from the corresponding HP IRES elements but in which the core pseudoknot, domain IIId, and domain IIIe elements are all closely related. These findings suggest that HP-like IRESs have been exchanged between unrelated virus families by recombination and support the hypothesis that RNA viruses consist of modular coding and noncoding elements that can exchange and evolve independently.

  7. A Distinct Group of Hepacivirus/Pestivirus-Like Internal Ribosomal Entry Sites in Members of Diverse Picornavirus Genera: Evidence for Modular Exchange of Functional Noncoding RNA Elements by Recombination▿ †

    Science.gov (United States)

    Hellen, Christopher U. T.; de Breyne, Sylvain

    2007-01-01

    The 5′ untranslated regions (UTRs) of the RNA genomes of Flaviviridae of the Hepacivirus and Pestivirus genera contain internal ribosomal entry sites (IRESs) that are unrelated to the two principal classes of IRESs of Picornaviridae. The mechanism of translation initiation on hepacivirus/pestivirus (HP) IRESs, which involves factor-independent binding to ribosomal 40S subunits, also differs fundamentally from initiation on these picornavirus IRESs. Ribosomal binding to HP IRESs requires conserved sequences that form a pseudoknot and the adjacent IIId and IIIe domains; analogous elements do not occur in the two principal groups of picornavirus IRESs. Here, comparative sequence analysis was used to identify a subset of picornaviruses from multiple genera that contain 5′ UTR sequences with significant similarities to HP IRESs. They are avian encephalomyelitis virus, duck hepatitis virus 1, duck picornavirus, porcine teschovirus, porcine enterovirus 8, Seneca Valley virus, and simian picornavirus. Their 5′ UTRs are predicted to form several structures, in some of which the peripheral elements differ from the corresponding HP IRES elements but in which the core pseudoknot, domain IIId, and domain IIIe elements are all closely related. These findings suggest that HP-like IRESs have been exchanged between unrelated virus families by recombination and support the hypothesis that RNA viruses consist of modular coding and noncoding elements that can exchange and evolve independently. PMID:17392358

  8. Genome-Wide Identification of circRNAs in Pathogenic Basidiomycetous Yeast Cryptococcus neoformans Suggests Conserved circRNA Host Genes over Kingdoms

    Directory of Open Access Journals (Sweden)

    Liang Huo

    2018-02-01

    Full Text Available Circular RNAs (circRNAs, a novel class of ubiquitous and intriguing noncoding RNA, have been found in a number of eukaryotes but not yet basidiomycetes. In this study, we identified 73 circRNAs from 39.28 million filtered RNA reads from the basidiomycete Cryptococcus neoformans JEC21 using next-generation sequencing (NGS and the bioinformatics tool circular RNA identification (CIRI. Furthermore, mapping of newly found circRNAs to the genome showed that 73.97% of the circRNAs originated from exonic regions, whereas 20.55% were from intergenic regions and 5.48% were from intronic regions. Enrichment analysis of circRNA host genes was conducted based on the Gene Ontology and Kyoto Encyclopedia of Genes and Genomes pathway databases. The results reveal that host genes are mainly responsible for primary metabolism and, interestingly, ribosomal protein production. Furthermore, we uncovered a high-level circRNA that was a transcript from the guanosine triphosphate (GTPase gene CNM01190 (gene ID: 3255052 in our yeast. Coincidentally, YPT5, CNM01190′s ortholog of the GTPase in Schizosaccharomyces pombe, protists, and humans, has already been proven to generate circRNAs. Additionally, overexpression of RNA debranching enzyme DBR1 had varied influence on the expression of circRNAs, indicating that multiple circRNA biosynthesis pathways exist in C. neoformans. Our study provides evidence for the existence of stable circRNAs in the opportunistic human pathogen C. neoformans and raises a question regarding their role related to pathogenesis in this yeast.

  9. Ribosomal protein methyltransferases in the yeast Saccharomyces cerevisiae: Roles in ribosome biogenesis and translation.

    Science.gov (United States)

    Al-Hadid, Qais; White, Jonelle; Clarke, Steven

    2016-02-12

    A significant percentage of the methyltransferasome in Saccharomyces cerevisiae and higher eukaryotes is devoted to methylation of the translational machinery. Methylation of the RNA components of the translational machinery has been studied extensively and is important for structure stability, ribosome biogenesis, and translational fidelity. However, the functional effects of ribosomal protein methylation by their cognate methyltransferases are still largely unknown. Previous work has shown that the ribosomal protein Rpl3 methyltransferase, histidine protein methyltransferase 1 (Hpm1), is important for ribosome biogenesis and translation elongation fidelity. In this study, yeast strains deficient in each of the ten ribosomal protein methyltransferases in S. cerevisiae were examined for potential defects in ribosome biogenesis and translation. Like Hpm1-deficient cells, loss of four of the nine other ribosomal protein methyltransferases resulted in defects in ribosomal subunit synthesis. All of the mutant strains exhibited resistance to the ribosome inhibitors anisomycin and/or cycloheximide in plate assays, but not in liquid culture. Translational fidelity assays measuring stop codon readthrough, amino acid misincorporation, and programmed -1 ribosomal frameshifting, revealed that eight of the ten enzymes are important for translation elongation fidelity and the remaining two are necessary for translation termination efficiency. Altogether, these results demonstrate that ribosomal protein methyltransferases in S. cerevisiae play important roles in ribosome biogenesis and translation. Copyright © 2016 Elsevier Inc. All rights reserved.

  10. Lyme disease caused by Borrelia burgdorferi with two homeologous 16S rRNA genes: a case report

    Directory of Open Access Journals (Sweden)

    Lee SH

    2016-04-01

    Full Text Available Sin Hang Lee,1,21Pathology Department, Milford Hospital, Milford, CT, USA; 2Milford Molecular Diagnostics, Milford, CT, USA Abstract: Lyme disease (LD, the most common tick-borne disease in North America, is believed to be caused exclusively by Borrelia burgdorferi sensu stricto and is usually diagnosed by clinical evaluation and serologic assays. As reported previously in a peer-reviewed article, a 13-year-old boy living in the Northeast of the USA was initially diagnosed with LD based on evaluation of his clinical presentations and on serologic test results. The patient was treated with a course of oral doxycycline for 28 days, and the symptoms resolved. A year later, the boy developed a series of unusual symptoms and did not attend school for 1 year. A LD specialist reviewed the case and found the serologic test band patterns nondiagnostic of LD. The boy was admitted to a psychiatric hospital. After discharge from the psychiatric hospital, a polymerase chain reaction test performed in a winter month when the boy was 16 years old showed a low density of B. burgdorferi sensu lato in the blood of the patient, confirmed by partial 16S rRNA (ribosomal RNA gene sequencing. Subsequent DNA sequencing analysis presented in this report demonstrated that the spirochete isolate was a novel strain of B. burgdorferi with two homeologous 16S rRNA genes, which has never been reported in the world literature. This case report shows that direct DNA sequencing is a valuable tool for reliable molecular diagnosis of Lyme and related borrelioses, as well as for studies of the diversity of the causative agents of LD because LD patients infected by a rare or novel borrelial variant may produce an antibody pattern that can be different from the pattern characteristic of an infection caused by a typical B. burgdorferi sensu stricto strain. Keywords: Lyme disease, Borrelia burgdorferi, homeologous 16S rRNA genes, DNA sequencing

  11. Analysis of the complement and molecular evolution of tRNA genes in cow

    Directory of Open Access Journals (Sweden)

    Barris Wesley C

    2009-04-01

    Full Text Available Abstract Background Detailed information regarding the number and organization of transfer RNA (tRNA genes at the genome level is becoming readily available with the increase of DNA sequencing of whole genomes. However the identification of functional tRNA genes is challenging for species that have large numbers of repetitive elements containing tRNA derived sequences, such as Bos taurus. Reliable identification and annotation of entire sets of tRNA genes allows the evolution of tRNA genes to be understood on a genomic scale. Results In this study, we explored the B. taurus genome using bioinformatics and comparative genomics approaches to catalogue and analyze cow tRNA genes. The initial analysis of the cow genome using tRNAscan-SE identified 31,868 putative tRNA genes and 189,183 pseudogenes, where 28,830 of the 31,868 predicted tRNA genes were classified as repetitive elements by the RepeatMasker program. We then used comparative genomics to further discriminate between functional tRNA genes and tRNA-derived sequences for the remaining set of 3,038 putative tRNA genes. For our analysis, we used the human, chimpanzee, mouse, rat, horse, dog, chicken and fugu genomes to predict that the number of active tRNA genes in cow lies in the vicinity of 439. Of this set, 150 tRNA genes were 100% identical in their sequences across all nine vertebrate genomes studied. Using clustering analyses, we identified a new tRNA-GlyCCC subfamily present in all analyzed mammalian genomes. We suggest that this subfamily originated from an ancestral tRNA-GlyGCC gene via a point mutation prior to the radiation of the mammalian lineages. Lastly, in a separate analysis we created phylogenetic profiles for each putative cow tRNA gene using a representative set of genomes to gain an overview of common evolutionary histories of tRNA genes. Conclusion The use of a combination of bioinformatics and comparative genomics approaches has allowed the confident identification of a

  12. Mice with a Mutation in the Mdm2 Gene That Interferes with MDM2/Ribosomal Protein Binding Develop a Defect in Erythropoiesis.

    Directory of Open Access Journals (Sweden)

    Takuya Kamio

    Full Text Available MDM2, an E3 ubiquitin ligase, is an important negative regulator of tumor suppressor p53. In turn the Mdm2 gene is a transcriptional target of p53, forming a negative feedback loop that is important in cell cycle control. It has recently become apparent that the ubiquitination of p53 by MDM2 can be inhibited when certain ribosomal proteins, including RPL5 and RPL11, bind to MDM2. This inhibition, and the resulting increase in p53 levels has been proposed to be responsible for the red cell aplasia seen in Diamond-Blackfan anemia (DBA and in 5q- myelodysplastic syndrome (MDS. DBA and 5q- MDS are associated with inherited (DBA or acquired (5q- MDS haploinsufficiency of ribosomal proteins. A mutation in Mdm2 causing a C305F amino acid substitution blocks the binding of ribosomal proteins. Mice harboring this mutation (Mdm2C305F, retain a normal p53 response to DNA damage, but lack the p53 response to perturbations in ribosome biogenesis. While studying the interaction between RP haploinsufficiency and the Mdm2C305F mutation we noticed that Mdm2C305F homozygous mice had altered hematopoiesis. These mice developed a mild macrocytic anemia with reticulocytosis. In the bone marrow (BM, these mice showed a significant decrease in Ter119hi cells compared to wild type (WT littermates, while no decrease in the number of mature erythroid cells (Ter119hiCD71low was found in the spleen, which showed compensated bone marrow hematopoiesis. In methylcellulose cultures, BFU-E colonies from the mutant mice were slightly reduced in number and there was a significant reduction in CFU-E colony numbers in mutant mice compared with WT controls (p < 0.01. This erythropoietic defect was abrogated by concomitant p53 deficiency (Trp53ko/ko. Further investigation revealed that in Mdm2C305F animals, there was a decrease in Lin-Sca-1+c-Kit+ (LSK cells, accompanied by significant decreases in multipotent progenitor (MPP cells (p < 0.01. Competitive BM repopulation experiments

  13. Regulation of RNA-dependent RNA polymerase 1 and isochorismate synthase gene expression in Arabidopsis.

    Directory of Open Access Journals (Sweden)

    Lydia J R Hunter

    Full Text Available RNA-dependent RNA polymerases (RDRs function in anti-viral silencing in Arabidopsis thaliana and other plants. Salicylic acid (SA, an important defensive signal, increases RDR1 gene expression, suggesting that RDR1 contributes to SA-induced virus resistance. In Nicotiana attenuata RDR1 also regulates plant-insect interactions and is induced by another important signal, jasmonic acid (JA. Despite its importance in defense RDR1 regulation has not been investigated in detail.In Arabidopsis, SA-induced RDR1 expression was dependent on 'NON-EXPRESSER OF PATHOGENESIS-RELATED GENES 1', indicating regulation involves the same mechanism controlling many other SA- defense-related genes, including pathogenesis-related 1 (PR1. Isochorismate synthase 1 (ICS1 is required for SA biosynthesis. In defensive signal transduction RDR1 lies downstream of ICS1. However, supplying exogenous SA to ics1-mutant plants did not induce RDR1 or PR1 expression to the same extent as seen in wild type plants. Analysing ICS1 gene expression using transgenic plants expressing ICS1 promoter:reporter gene (β-glucuronidase constructs and by measuring steady-state ICS1 transcript levels showed that SA positively regulates ICS1. In contrast, ICS2, which is expressed at lower levels than ICS1, is unaffected by SA. The wound-response hormone JA affects expression of Arabidopsis RDR1 but jasmonate-induced expression is independent of CORONATINE-INSENSITIVE 1, which conditions expression of many other JA-responsive genes. Transiently increased RDR1 expression following tobacco mosaic virus inoculation was due to wounding and was not a direct effect of infection. RDR1 gene expression was induced by ethylene and by abscisic acid (an important regulator of drought resistance. However, rdr1-mutant plants showed normal responses to drought.RDR1 is regulated by a much broader range of phytohormones than previously thought, indicating that it plays roles beyond those already suggested in virus

  14. Mechanism of selective recruitment of RNA polymerases II and III to snRNA gene promoters.

    Science.gov (United States)

    Dergai, Oleksandr; Cousin, Pascal; Gouge, Jerome; Satia, Karishma; Praz, Viviane; Kuhlman, Tracy; Lhôte, Philippe; Vannini, Alessandro; Hernandez, Nouria

    2018-05-01

    RNA polymerase II (Pol II) small nuclear RNA (snRNA) promoters and type 3 Pol III promoters have highly similar structures; both contain an interchangeable enhancer and "proximal sequence element" (PSE), which recruits the SNAP complex (SNAPc). The main distinguishing feature is the presence, in the type 3 promoters only, of a TATA box, which determines Pol III specificity. To understand the mechanism by which the absence or presence of a TATA box results in specific Pol recruitment, we examined how SNAPc and general transcription factors required for Pol II or Pol III transcription of SNAPc-dependent genes (i.e., TATA-box-binding protein [TBP], TFIIB, and TFIIA for Pol II transcription and TBP and BRF2 for Pol III transcription) assemble to ensure specific Pol recruitment. TFIIB and BRF2 could each, in a mutually exclusive fashion, be recruited to SNAPc. In contrast, TBP-TFIIB and TBP-BRF2 complexes were not recruited unless a TATA box was present, which allowed selective and efficient recruitment of the TBP-BRF2 complex. Thus, TBP both prevented BRF2 recruitment to Pol II promoters and enhanced BRF2 recruitment to Pol III promoters. On Pol II promoters, TBP recruitment was separate from TFIIB recruitment and enhanced by TFIIA. Our results provide a model for specific Pol recruitment at SNAPc-dependent promoters. © 2018 Dergai et al.; Published by Cold Spring Harbor Laboratory Press.

  15. Isolation and identification of the immune-relevant ribosomal protein L10 (RPL10/QM-like gene) from the large yellow croaker Pseudosciaena crocea (Pisces: Sciaenidae).

    Science.gov (United States)

    Chen, X; Su, Y Q; Wang, J; Liu, M; Niu, S F; Zhong, S P; Qiu, F

    2012-10-15

    In order to investigate the immune role of ribosomal protein L10 (RPL10/QM-like gene) in marine fish, we challenged the large yellow croaker Pseudosciaena (= Larimichthys) crocea, the most important marine fish culture species in China, by injection with a mixture of the bacteria Vibrio harveyi and V. parahaemolyticus (3:1 in volume). Microarray analysis and real-time PCR were performed 24 and 48 h post-challenge to isolate and identify the QM-like gene from the gill P. crocea (designated PcQM). The expression level of the PcQM gene did not changed significantly at 24 h post-challenge, but was significantly downregulated at 48 h post-challenge, suggesting that the gene had an immune-modulatory effect in P. crocea. Full-length PcQM cDNA and genomic sequences were obtained by rapid amplification of cDNA ends (RACE)-PCR. The sequence of the PcQM gene clustered together with those of other QM-like genes from other aquatic organisms, indicating that the QM-like gene is highly conserved in teleosts.

  16. Several genes encoding ribosomal proteins are over-expressed in prostate-cancer cell lines: confirmation of L7a and L37 over-expression in prostate-cancer tissue samples.

    Science.gov (United States)

    Vaarala, M H; Porvari, K S; Kyllönen, A P; Mustonen, M V; Lukkarinen, O; Vihko, P T

    1998-09-25

    A cDNA library specific for mRNA over-expressed in prostate cancer was generated by subtractive hybridization of transcripts originating from prostatic hyperplasia and cancer tissues. cDNA encoding ribosomal proteins L4, L5, L7a, L23a, L30, L37, S14 and S18 was found to be present among 100 analyzed clones. Levels of ribosomal mRNA were significantly higher at least in one of the prostate-cancer cell lines, LNCaP, DU-145 and PC-3, than in hyperplastic tissue, as determined by slot-blot hybridization. Furthermore, L23a- and S14-transcript levels were significantly elevated in PC-3 cells as compared with those in the normal prostate epithelial cell line PrEC. Generally, dramatic changes in the mRNA content of the ribosomal proteins were not detected, the most evident over-expression being that of L37 mRNA, which was 3.4 times more abundant in LNCaP cells than in hyperplastic prostate tissue. The over-expression of L7a and L37 mRNA was confirmed in prostate-cancer tissue samples by in situ hybridization. Elevated cancer-related expression of L4 and L30 has not been reported, but levels of the other ribosomal proteins are known to be increased in several types of cancers. These results therefore suggest that prostate cancer is comparable with other types of cancers, in that a larger pool of some ribosomal proteins is gained during the transformation process, by an unknown mechanism.

  17. Expression Profiling of Ribosome Biogenesis Factors Reveals Nucleolin as a Novel Potential Marker to Predict Outcome in AML Patients.

    Directory of Open Access Journals (Sweden)

    Virginie Marcel

    Full Text Available Acute myeloid leukemia (AML is a heterogeneous disease. Prognosis is mainly influenced by patient age at diagnosis and cytogenetic alterations, two of the main factors currently used in AML patient risk stratification. However, additional criteria are required to improve the current risk classification and better adapt patient care. In neoplastic cells, ribosome biogenesis is increased to sustain the high proliferation rate and ribosome composition is altered to modulate specific gene expression driving tumorigenesis. Here, we investigated the usage of ribosome biogenesis factors as clinical markers in adult patients with AML. We showed that nucleoli, the nucleus compartments where ribosome production takes place, are modified in AML by analyzing a panel of AML and healthy donor cells using immunofluorescence staining. Using four AML series, including the TCGA dataset, altogether representing a total of about 270 samples, we showed that not all factors involved in ribosome biogenesis have clinical values although ribosome biogenesis is increased in AML. Interestingly, we identified the regulator of ribosome production nucleolin (NCL as over-expressed in AML blasts. Moreover, we found in two series that high NCL mRNA expression level was associated with a poor overall survival, particular in elderly patients. Multivariate analyses taking into account age and cytogenetic risk indicated that NCL expression in blast cells is an independent marker of reduced survival. Our study identifies NCL as a potential novel prognostic factor in AML. Altogether, our results suggest that the ribosome biogenesis pathway may be of interest as clinical markers in AML.

  18. Brain Gene Expression Signatures From Cerebrospinal Fluid Exosome RNA Profiling

    Science.gov (United States)

    Zanello, S. B.; Stevens, B.; Calvillo, E.; Tang, R.; Gutierrez Flores, B.; Hu, L.; Skog, J.; Bershad, E.

    2016-01-01

    While the Visual Impairment and Intracranial Pressure (VIIP) syndrome observations have focused on ocular symptoms, spaceflight has been also associated with a number of other performance and neurologic signs, such as headaches, cognitive changes, vertigo, nausea, sleep/circadian disruption and mood alterations, which, albeit likely multifactorial, can also result from elevation of intracranial pressure (ICP). We therefore hypothesize that these various symptoms are caused by disturbances in the neurophysiology of the brain structures and are correlated with molecular markers in the cerebrospinal fluid (CSF) as indicators of neurophysiological changes. Exosomes are 30-200 nm microvesicles shed into all biofluids, including blood, urine, and CSF, carrying a highly rich source of intact protein and RNA cargo. Exosomes have been identified in human CSF, and their proteome and RNA pool is a potential new reservoir for biomarker discovery in neurological disorders. The purpose of this study is to investigate changes in brain gene expression via exosome analysis in patients suffering from ICP elevation of varied severity (idiopathic intracranial hypertension -IIH), a condition which shares some of the neuroophthalmological features of VIIP, as a first step toward obtaining evidence suggesting that cognitive function and ICP levels can be correlated with biomarkers in the CSF. Our preliminary work, reported last year, validated the exosomal technology applicable to CSF analysis and demonstrated that it was possible to obtain gene expression evidence of inflammation processes in traumatic brain injury patients. We are now recruiting patients with suspected IIH requiring lumbar puncture at Baylor College of Medicine. Both CSF (5 ml) and human plasma (10 ml) are being collected in order to compare the pattern of differentially expressed genes observed in CSF and in blood. Since blood is much more accessible than CSF, we would like to determine whether plasma biomarkers for

  19. Small-angle X-ray titration study on the complex formation between 5-S RNA and the L18 protein of the Escherichia coli 50-S ribosome particle

    International Nuclear Information System (INIS)

    Oesterberg, R.; Garrett, A.

    1977-01-01

    The 5-S RNA (A) and the L 18 protein (B) from Escherichia coli ribosomes form one single AB complex in the concentration ranges supposed to prevail in vivo; at concentrations of L 18 higher than 40 mM there is some indication for a minor species, most probably an AB 2 species. This is indicated from the X-ray scattering titration data of the 5-S RNA/L 18 system recorded at 21 0 C in ribosomal reconstitution buffer. As a result of the 1 : 1 complex formation, there is a relatively small but defined increase in the radius of gyration from 3.61 to 3.85 nm. This result as well as the experimental scattering curve can be explained by models where it is assumed that the elongated L 18 model is quite far from the electron density centre and where protein L 18 interacts with one or both of the minor arms of the supposed Y-shaped 5-S RNA molecule. (orig.) [de

  20. Diamond Blackfan Anemia at the Crossroad between Ribosome Biogenesis and Heme Metabolism

    Directory of Open Access Journals (Sweden)

    Deborah Chiabrando

    2010-01-01

    Full Text Available Diamond-Blackfan anemia (DBA is a rare, pure red-cell aplasia that presents during infancy. Approximately 40% of cases are associated with other congenital defects, particularly malformations of the upper limb or craniofacial region. Mutations in the gene coding for the ribosomal protein RPS19 have been identified in 25% of patients with DBA, with resulting impairment of 18S rRNA processing and 40S ribosomal subunit formation. Moreover, mutations in other ribosomal protein coding genes account for about 25% of other DBA cases. Recently, the analysis of mice from which the gene coding for the heme exporter Feline Leukemia Virus subgroup C Receptor (FLVCR1 is deleted suggested that this gene may be involved in the pathogenesis of DBA. FLVCR1-null mice show a phenotype resembling that of DBA patients, including erythroid failure and malformations. Interestingly, some DBA patients have disease linkage to chromosome 1q31, where FLVCR1 is mapped. Moreover, it has been reported that cells from DBA patients express alternatively spliced isoforms of FLVCR1 which encode non-functional proteins. Herein, we review the known roles of RPS19 and FLVCR1 in ribosome function and heme metabolism respectively, and discuss how the deficiency of a ribosomal protein or of a heme exporter may result in the same phenotype.

  1. Use of bacterially expressed dsRNA to downregulate Entamoeba histolytica gene expression.

    Directory of Open Access Journals (Sweden)

    Carlos F Solis

    Full Text Available BACKGROUND: Modern RNA interference (RNAi methodologies using small interfering RNA (siRNA oligonucleotide duplexes or episomally synthesized hairpin RNA are valuable tools for the analysis of gene function in the protozoan parasite Entamoeba histolytica. However, these approaches still require time-consuming procedures including transfection and drug selection, or costly synthetic molecules. PRINCIPAL FINDINGS: Here we report an efficient and handy alter