Cis-regulatory RNA elements that regulate specialized ribosome activity.

Science.gov (United States)

Xue, Shifeng; Barna, Maria

2015-01-01

Recent evidence has shown that the ribosome itself can play a highly regulatory role in the specialized translation of specific subpools of mRNAs, in particular at the level of ribosomal proteins (RP). However, the mechanism(s) by which this selection takes place has remained poorly understood. In our recent study, we discovered a combination of unique RNA elements in the 5'UTRs of mRNAs that allows for such control by the ribosome. These mRNAs contain a Translation Inhibitory Element (TIE) that inhibits general cap-dependent translation, and an Internal Ribosome Entry Site (IRES) that relies on a specific RP for activation. The unique combination of an inhibitor of general translation and an activator of specialized translation is key to ribosome-mediated control of gene expression. Here we discuss how these RNA regulatory elements provide a new level of control to protein expression and their implications for gene expression, organismal development and evolution.

Studies of the effects of ultraviolet radiation on the structural integrities of ribosomal RNA components of the Escherichia coli 50S ribosomal subunit

International Nuclear Information System (INIS)

Gorelic, L.; Parker, D.

1978-01-01

The effects of 254-nm radiation on the structural integrities of free and 50S ribosome-bound 5S and 23S ribosomal ribonucleic acids (rRNA) have been elucidated. Irradiation of aqueous solutions of Escherichia coli 50S ribosomes with 253.7-nm radiation results in the formation of single-strand breaks in double-stranded regions of the 23S rRNA component, but not in rRNA chain scission, and destabilization of the secondary structure of the 23S rRNA toward denaturation. The minimum doses of 253.7-nm radiation required for the first detection of the two effects are 7 x 10 19 quanta for the production of single-strand breaks in double-stranded regions of the 23S rRNA, and 19 quanta for destabilization of the 23S rRNA secondary structure. Free 23S rRNA is resistant toward photoinduced chain breakage at doses of 253.7-nm radiation up to at least 2.3 x 10 20 and is much less sensitive toward destabilization of secondary structure than ribosome-bound 23S rRNA. In contrast to the photosensitivity of 50S ribosome-bound 23S rRNA toward chain breakage, 50S ribosome-bound 5S rRNA is resistant toward chain breakage at doses of 253.7-nm radiation up to at least 2.3 x 10 20 quanta. Ribosome-bound 5S and 23S rRNA are also not photosensitive toward intermolecular 5S/23S rRNA cross-linkage

Nuclear Export of Pre-Ribosomal Subunits Requires Dbp5, but Not as an RNA-Helicase as for mRNA Export.

Science.gov (United States)

Neumann, Bettina; Wu, Haijia; Hackmann, Alexandra; Krebber, Heike

2016-01-01

The DEAD-box RNA-helicase Dbp5/Rat8 is known for its function in nuclear mRNA export, where it displaces the export receptor Mex67 from the mRNA at the cytoplasmic side of the nuclear pore complex (NPC). Here we show that Dbp5 is also required for the nuclear export of both pre-ribosomal subunits. Yeast temperature-sensitive dbp5 mutants accumulate both ribosomal particles in their nuclei. Furthermore, Dbp5 genetically and physically interacts with known ribosomal transport factors such as Nmd3. Similar to mRNA export we show that also for ribosomal transport Dbp5 is required at the cytoplasmic side of the NPC. However, unlike its role in mRNA export, Dbp5 does not seem to undergo its ATPase cycle for this function, as ATPase-deficient dbp5 mutants that selectively inhibit mRNA export do not affect ribosomal transport. Furthermore, mutants of GLE1, the ATPase stimulating factor of Dbp5, show no major ribosomal export defects. Consequently, while Dbp5 uses its ATPase cycle to displace the export receptor Mex67 from the translocated mRNAs, Mex67 remains bound to ribosomal subunits upon transit to the cytoplasm, where it is detectable on translating ribosomes. Therefore, we propose a model, in which Dbp5 supports ribosomal transport by capturing ribosomal subunits upon their cytoplasmic appearance at the NPC, possibly by binding export factors such as Mex67. Thus, our findings reveal that although different ribonucleoparticles, mRNAs and pre-ribosomal subunits, use shared export factors, they utilize different transport mechanisms.

Double mutation in eleusine indica alpha-tubulin increases the resistance of transgenic maize calli to dinitroaniline and phosphorothioamidate herbicides

Science.gov (United States)

Anthony; Hussey

1999-06-01

The repeated use of dinitroaniline herbicides on the cotton and soybean fields of the southern United States has resulted in the appearance of resistant biotypes of one of the world's worst weeds, Eleusine indica. Two biotypes have been characterized, a highly resistant (R) biotype and an intermediate resistant (I) biotype. In both cases the resistance has been attributed to a mutation in alpha-tubulin, a component of the alpha/beta tubulin dimer that is the major constituent of microtubules. We show here that the I-biotype mutation, like the R-biotype mutation shown in earlier work, can confer dinitroaniline resistance on transgenic maize calli. The level of resistance obtained is the same as that for E. indica I- or R-biotype seedlings. The combined I- and R-biotype mutations increase the herbicide tolerance of transgenic maize calli by a value close to the summation of the maximum herbicide tolerances of calli harbouring the single mutations. These data, taken together with the position of the two different mutations within the atomic structure of the alpha/beta tubulin dimer, imply that each mutation is likely to exert its effect by a different mechanism. These mechanisms may involve increasing the stability of microtubules against the depolymerizing effects of the herbicide or changing the conformation of the alpha/beta dimer so that herbicide binding is less effective, or a combination of both possibilities.

Evidence for rRNA 2'-O-methylation plasticity: Control of intrinsic translational capabilities of human ribosomes.

Science.gov (United States)

Erales, Jenny; Marchand, Virginie; Panthu, Baptiste; Gillot, Sandra; Belin, Stéphane; Ghayad, Sandra E; Garcia, Maxime; Laforêts, Florian; Marcel, Virginie; Baudin-Baillieu, Agnès; Bertin, Pierre; Couté, Yohann; Adrait, Annie; Meyer, Mélanie; Therizols, Gabriel; Yusupov, Marat; Namy, Olivier; Ohlmann, Théophile; Motorin, Yuri; Catez, Frédéric; Diaz, Jean-Jacques

2017-12-05

Ribosomal RNAs (rRNAs) are main effectors of messenger RNA (mRNA) decoding, peptide-bond formation, and ribosome dynamics during translation. Ribose 2'-O-methylation (2'-O-Me) is the most abundant rRNA chemical modification, and displays a complex pattern in rRNA. 2'-O-Me was shown to be essential for accurate and efficient protein synthesis in eukaryotic cells. However, whether rRNA 2'-O-Me is an adjustable feature of the human ribosome and a means of regulating ribosome function remains to be determined. Here we challenged rRNA 2'-O-Me globally by inhibiting the rRNA methyl-transferase fibrillarin in human cells. Using RiboMethSeq, a nonbiased quantitative mapping of 2'-O-Me, we identified a repertoire of 2'-O-Me sites subjected to variation and demonstrate that functional domains of ribosomes are targets of 2'-O-Me plasticity. Using the cricket paralysis virus internal ribosome entry site element, coupled to in vitro translation, we show that the intrinsic capability of ribosomes to translate mRNAs is modulated through a 2'-O-Me pattern and not by nonribosomal actors of the translational machinery. Our data establish rRNA 2'-O-Me plasticity as a mechanism providing functional specificity to human ribosomes.

Cross-linking of streptomycin to the 16S ribosomal RNA of Escherichia coli

International Nuclear Information System (INIS)

Gravel, M.; Melancon, P.; Barkier-Gingras, L.

1987-01-01

[ 3 H]Dihydrostreptomycin was cross-linked to the 30S ribosomal subunit from Escherichia coli with the bifunctional reagent nitrogen mustard. The cross-linking primarily involved the 16S RNA. To localize the site of cross-linking of streptomycin to the 16S RNA, the authors hybridized RNA labeled with streptomycin to restriction fragments of the 16S RNA gene. Labeled RNA hybridized to DNA fragments corresponding to bases 892-917 and bases 1394-1415. These two segments of the ribosomal RNA must by juxtaposed in the ribosome, since there is a single binding site for streptomycin. This region has been implicated both in the decoding site and in the binding of initiation factor IF-3, indicating its functional importance

The ribosome structure controls and directs mRNA entry, translocation and exit dynamics

International Nuclear Information System (INIS)

Kurkcuoglu, Ozge; Doruker, Pemra; Jernigan, Robert L; Sen, Taner Z; Kloczkowski, Andrzej

2008-01-01

The protein-synthesizing ribosome undergoes large motions to effect the translocation of tRNAs and mRNA; here, the domain motions of this system are explored with a coarse-grained elastic network model using normal mode analysis. Crystal structures are used to construct various model systems of the 70S complex with/without tRNA, elongation factor Tu and the ribosomal proteins. Computed motions reveal the well-known ratchet-like rotational motion of the large subunits, as well as the head rotation of the small subunit and the high flexibility of the L1 and L7/L12 stalks, even in the absence of ribosomal proteins. This result indicates that these experimentally observed motions during translocation are inherently controlled by the ribosomal shape and only partially dependent upon GTP hydrolysis. Normal mode analysis further reveals the mobility of A- and P-tRNAs to increase in the absence of the E-tRNA. In addition, the dynamics of the E-tRNA is affected by the absence of the ribosomal protein L1. The mRNA in the entrance tunnel interacts directly with helicase proteins S3 and S4, which constrain the mRNA in a clamp-like fashion, as well as with protein S5, which likely orients the mRNA to ensure correct translation. The ribosomal proteins S7, S11 and S18 may also be involved in assuring translation fidelity by constraining the mRNA at the exit site of the channel. The mRNA also interacts with the 16S 3' end forming the Shine–Dalgarno complex at the initiation step; the 3' end may act as a 'hook' to reel in the mRNA to facilitate its exit

Proto-ribosome: a theoretical approach based on RNA relics

OpenAIRE

Demongeot, Jacques

2017-01-01

We describe in this paper, based on already published articles, a contribution to the theory postulating the existence of a proto-ribosome, which could have appeared early at the origin of life and we discuss the interest of this notion in an evolutionary perspective, taking into account the existence of possible RNA relics of this proto-ribosome.

rRNA maturation in yeast cells depleted of large ribosomal subunit proteins.

Directory of Open Access Journals (Sweden)

Gisela Pöll

Full Text Available The structural constituents of the large eukaryotic ribosomal subunit are 3 ribosomal RNAs, namely the 25S, 5.8S and 5S rRNA and about 46 ribosomal proteins (r-proteins. They assemble and mature in a highly dynamic process that involves more than 150 proteins and 70 small RNAs. Ribosome biogenesis starts in the nucleolus, continues in the nucleoplasm and is completed after nucleo-cytoplasmic translocation of the subunits in the cytoplasm. In this work we created 26 yeast strains, each of which conditionally expresses one of the large ribosomal subunit (LSU proteins. In vivo depletion of the analysed LSU r-proteins was lethal and led to destabilisation and degradation of the LSU and/or its precursors. Detailed steady state and metabolic pulse labelling analyses of rRNA precursors in these mutant strains showed that LSU r-proteins can be grouped according to their requirement for efficient progression of different steps of large ribosomal subunit maturation. Comparative analyses of the observed phenotypes and the nature of r-protein-rRNA interactions as predicted by current atomic LSU structure models led us to discuss working hypotheses on i how individual r-proteins control the productive processing of the major 5' end of 5.8S rRNA precursors by exonucleases Rat1p and Xrn1p, and ii the nature of structural characteristics of nascent LSUs that are required for cytoplasmic accumulation of nascent subunits but are nonessential for most of the nuclear LSU pre-rRNA processing events.

The SmpB C-terminal tail helps tmRNA to recognize and enter stalled ribosomes

Directory of Open Access Journals (Sweden)

Mickey R. Miller

2014-09-01

Full Text Available In bacteria, transfer-messenger RNA (tmRNA and SmpB comprise the most common and effective system for rescuing stalled ribosomes. Ribosomes stall on mRNA transcripts lacking stop codons and are rescued as the defective mRNA is swapped for the tmRNA template in a process known as trans-translation. The tmRNA–SmpB complex is recruited to the ribosome independent of a codon–anticodon interaction. Given that the ribosome uses robust discriminatory mechanisms to select against non-cognate tRNAs during canonical decoding, it has been hard to explain how this can happen. Recent structural and biochemical studies show that SmpB licenses tmRNA entry through its interactions with the decoding center and mRNA channel. In particular, the C-terminal tail of SmpB promotes both EFTu activation and accommodation of tmRNA, the former through interactions with 16S rRNA nucleotide G530 and the latter through interactions with the mRNA channel downstream of the A site. Here we present a detailed model of the earliest steps in trans-translation, and in light of these mechanistic considerations, revisit the question of how tmRNA preferentially reacts with stalled, non-translating ribosomes.

Synthesis and methylation of ribosomal RNA in HeLa cells infected with the herpes virus pseudorabies virus

International Nuclear Information System (INIS)

Furlong, J.C.; Kyriakidis, S.; Stevely, W.S.

1982-01-01

The effects of infection with the herpes virus pseudorabies virus on the metabolism of HeLa cell ribosomal RNA were examined. There is a decline both in the synthesis of nucleolar 45S ribosomal precursor RNA and in its processing to mature cytoplasmic RNA. The methylated oligonucleotides in the ribosomal RNA species were studied. The methylation of cytoplasmic ribosomal RNA was essentially unchanged. However there was some undermethylation of the nucleolar precursor. If undermethylated RNA does not mature then this may partly explain the reduced processing in the infected cells. (Author)

Myb-binding protein 1a (Mybbp1a) regulates levels and processing of pre-ribosomal RNA.

Science.gov (United States)

Hochstatter, Julia; Hölzel, Michael; Rohrmoser, Michaela; Schermelleh, Lothar; Leonhardt, Heinrich; Keough, Rebecca; Gonda, Thomas J; Imhof, Axel; Eick, Dirk; Längst, Gernot; Németh, Attila

2012-07-13

Ribosomal RNA gene transcription, co-transcriptional processing, and ribosome biogenesis are highly coordinated processes that are tightly regulated during cell growth. In this study we discovered that Mybbp1a is associated with both the RNA polymerase I complex and the ribosome biogenesis machinery. Using a reporter assay that uncouples transcription and RNA processing, we show that Mybbp1a represses rRNA gene transcription. In addition, overexpression of the protein reduces RNA polymerase I loading on endogenous rRNA genes as revealed by chromatin immunoprecipitation experiments. Accordingly, depletion of Mybbp1a results in an accumulation of the rRNA precursor in vivo but surprisingly also causes growth arrest of the cells. This effect can be explained by the observation that the modulation of Mybbp1a protein levels results in defects in pre-rRNA processing within the cell. Therefore, the protein may play a dual role in the rRNA metabolism, potentially linking and coordinating ribosomal DNA transcription and pre-rRNA processing to allow for the efficient synthesis of ribosomes.

Ribosomal proteins S12 and S13 function as control elements for translocation of the mRNA:tRNA complex.

Science.gov (United States)

Cukras, Anthony R; Southworth, Daniel R; Brunelle, Julie L; Culver, Gloria M; Green, Rachel

2003-08-01

Translocation of the mRNA:tRNA complex through the ribosome is promoted by elongation factor G (EF-G) during the translation cycle. Previous studies established that modification of ribosomal proteins with thiol-specific reagents promotes this event in the absence of EF-G. Here we identify two small subunit interface proteins S12 and S13 that are essential for maintenance of a pretranslocation state. Omission of these proteins using in vitro reconstitution procedures yields ribosomal particles that translate in the absence of enzymatic factors. Conversely, replacement of cysteine residues in these two proteins yields ribosomal particles that are refractive to stimulation with thiol-modifying reagents. These data support a model where S12 and S13 function as control elements for the more ancient rRNA- and tRNA-driven movements of translocation.

Translation initiation in bacterial polysomes through ribosome loading on a standby site on a highly translated mRNA

Science.gov (United States)

Andreeva, Irena

2018-01-01

During translation, consecutive ribosomes load on an mRNA and form a polysome. The first ribosome binds to a single-stranded mRNA region and moves toward the start codon, unwinding potential mRNA structures on the way. In contrast, the following ribosomes can dock at the start codon only when the first ribosome has vacated the initiation site. Here we show that loading of the second ribosome on a natural 38-nt-long 5′ untranslated region of lpp mRNA, which codes for the outer membrane lipoprotein from Escherichia coli, takes place before the leading ribosome has moved away from the start codon. The rapid formation of this standby complex depends on the presence of ribosomal proteins S1/S2 in the leading ribosome. The early recruitment of the second ribosome to the standby site before translation by the leading ribosome and the tight coupling between translation elongation by the first ribosome and the accommodation of the second ribosome can contribute to high translational efficiency of the lpp mRNA. PMID:29632209

High-Resolution Analysis of Coronavirus Gene Expression by RNA Sequencing and Ribosome Profiling.

Science.gov (United States)

Irigoyen, Nerea; Firth, Andrew E; Jones, Joshua D; Chung, Betty Y-W; Siddell, Stuart G; Brierley, Ian

2016-02-01

Members of the family Coronaviridae have the largest genomes of all RNA viruses, typically in the region of 30 kilobases. Several coronaviruses, such as Severe acute respiratory syndrome-related coronavirus (SARS-CoV) and Middle East respiratory syndrome-related coronavirus (MERS-CoV), are of medical importance, with high mortality rates and, in the case of SARS-CoV, significant pandemic potential. Other coronaviruses, such as Porcine epidemic diarrhea virus and Avian coronavirus, are important livestock pathogens. Ribosome profiling is a technique which exploits the capacity of the translating ribosome to protect around 30 nucleotides of mRNA from ribonuclease digestion. Ribosome-protected mRNA fragments are purified, subjected to deep sequencing and mapped back to the transcriptome to give a global "snap-shot" of translation. Parallel RNA sequencing allows normalization by transcript abundance. Here we apply ribosome profiling to cells infected with Murine coronavirus, mouse hepatitis virus, strain A59 (MHV-A59), a model coronavirus in the same genus as SARS-CoV and MERS-CoV. The data obtained allowed us to study the kinetics of virus transcription and translation with exquisite precision. We studied the timecourse of positive and negative-sense genomic and subgenomic viral RNA production and the relative translation efficiencies of the different virus ORFs. Virus mRNAs were not found to be translated more efficiently than host mRNAs; rather, virus translation dominates host translation at later time points due to high levels of virus transcripts. Triplet phasing of the profiling data allowed precise determination of translated reading frames and revealed several translated short open reading frames upstream of, or embedded within, known virus protein-coding regions. Ribosome pause sites were identified in the virus replicase polyprotein pp1a ORF and investigated experimentally. Contrary to expectations, ribosomes were not found to pause at the ribosomal

High-Resolution Analysis of Coronavirus Gene Expression by RNA Sequencing and Ribosome Profiling.

Directory of Open Access Journals (Sweden)

Nerea Irigoyen

2016-02-01

Full Text Available Members of the family Coronaviridae have the largest genomes of all RNA viruses, typically in the region of 30 kilobases. Several coronaviruses, such as Severe acute respiratory syndrome-related coronavirus (SARS-CoV and Middle East respiratory syndrome-related coronavirus (MERS-CoV, are of medical importance, with high mortality rates and, in the case of SARS-CoV, significant pandemic potential. Other coronaviruses, such as Porcine epidemic diarrhea virus and Avian coronavirus, are important livestock pathogens. Ribosome profiling is a technique which exploits the capacity of the translating ribosome to protect around 30 nucleotides of mRNA from ribonuclease digestion. Ribosome-protected mRNA fragments are purified, subjected to deep sequencing and mapped back to the transcriptome to give a global "snap-shot" of translation. Parallel RNA sequencing allows normalization by transcript abundance. Here we apply ribosome profiling to cells infected with Murine coronavirus, mouse hepatitis virus, strain A59 (MHV-A59, a model coronavirus in the same genus as SARS-CoV and MERS-CoV. The data obtained allowed us to study the kinetics of virus transcription and translation with exquisite precision. We studied the timecourse of positive and negative-sense genomic and subgenomic viral RNA production and the relative translation efficiencies of the different virus ORFs. Virus mRNAs were not found to be translated more efficiently than host mRNAs; rather, virus translation dominates host translation at later time points due to high levels of virus transcripts. Triplet phasing of the profiling data allowed precise determination of translated reading frames and revealed several translated short open reading frames upstream of, or embedded within, known virus protein-coding regions. Ribosome pause sites were identified in the virus replicase polyprotein pp1a ORF and investigated experimentally. Contrary to expectations, ribosomes were not found to pause at the

Dwell-Time Distribution, Long Pausing and Arrest of Single-Ribosome Translation through the mRNA Duplex.

Science.gov (United States)

Xie, Ping

2015-10-09

Proteins in the cell are synthesized by a ribosome translating the genetic information encoded on the single-stranded messenger RNA (mRNA). It has been shown that the ribosome can also translate through the duplex region of the mRNA by unwinding the duplex. Here, based on our proposed model of the ribosome translation through the mRNA duplex we study theoretically the distribution of dwell times of the ribosome translation through the mRNA duplex under the effect of a pulling force externally applied to the ends of the mRNA to unzip the duplex. We provide quantitative explanations of the available single molecule experimental data on the distribution of dwell times with both short and long durations, on rescuing of the long paused ribosomes by raising the pulling force to unzip the duplex, on translational arrests induced by the mRNA duplex and Shine-Dalgarno(SD)-like sequence in the mRNA. The functional consequences of the pauses or arrests caused by the mRNA duplex and the SD sequence are discussed and compared with those obtained from other types of pausing, such as those induced by "hungry" codons or interactions of specific sequences in the nascent chain with the ribosomal exit tunnel.

A Listeria monocytogenes RNA helicase essential for growth and ribosomal maturation at low temperatures uses its C terminus for appropriate interaction with the ribosome.

Science.gov (United States)

Netterling, Sakura; Vaitkevicius, Karolis; Nord, Stefan; Johansson, Jörgen

2012-08-01

Listeria monocytogenes, a Gram-positive food-borne human pathogen, is able to grow at temperatures close to 0°C and is thus of great concern for the food industry. In this work, we investigated the physiological role of one DExD-box RNA helicase in Listeria monocytogenes. The RNA helicase Lmo1722 was required for optimal growth at low temperatures, whereas it was dispensable at 37°C. A Δlmo1722 strain was less motile due to downregulation of the major subunit of the flagellum, FlaA, caused by decreased flaA expression. By ribosomal fractionation experiments, it was observed that Lmo1722 was mainly associated with the 50S subunit of the ribosome. Absence of Lmo1722 decreased the fraction of 50S ribosomal subunits and mature 70S ribosomes and affected the processing of the 23S precursor rRNA. The ribosomal profile could be restored to wild-type levels in a Δlmo1722 strain expressing Lmo1722. Interestingly, the C-terminal part of Lmo1722 was redundant for low-temperature growth, motility, 23S rRNA processing, and appropriate ribosomal maturation. However, Lmo1722 lacking the C terminus showed a reduced affinity for the 50S and 70S fractions, suggesting that the C terminus is important for proper guidance of Lmo1722 to the 50S subunit. Taken together, our results show that the Listeria RNA helicase Lmo1722 is essential for growth at low temperatures, motility, and rRNA processing and is important for ribosomal maturation, being associated mainly with the 50S subunit of the ribosome.

Myc-nick: a cytoplasmic cleavage product of Myc that promotes alpha-tubulin acetylation and cell differentiation.

Science.gov (United States)

Conacci-Sorrell, Maralice; Ngouenet, Celine; Eisenman, Robert N

2010-08-06

The Myc oncoprotein family comprises transcription factors that control multiple cellular functions and are widely involved in oncogenesis. Here we report the identification of Myc-nick, a cytoplasmic form of Myc generated by calpain-dependent proteolysis at lysine 298 of full-length Myc. Myc-nick retains conserved Myc box regions but lacks nuclear localization signals and the bHLHZ domain essential for heterodimerization with Max and DNA binding. Myc-nick induces alpha-tubulin acetylation and altered cell morphology by recruiting histone acetyltransferase GCN5 to microtubules. During muscle differentiation, while the levels of full-length Myc diminish, Myc-nick and acetylated alpha-tubulin levels are increased. Ectopic expression of Myc-nick accelerates myoblast fusion, triggers the expression of myogenic markers, and permits Myc-deficient fibroblasts to transdifferentiate in response to MyoD. We propose that the cleavage of Myc by calpain abrogates the transcriptional inhibition of differentiation by full-length Myc and generates Myc-nick, a driver of cytoplasmic reorganization and differentiation. Copyright 2010 Elsevier Inc. All rights reserved.

Production of RNA-protein cross links in γ irradiated E. Coli ribosomes

International Nuclear Information System (INIS)

Ekert, Bernard; Giocanti, Nicole

1976-01-01

γ irradiation in de-aerated conditions of E. coli MRE 600 ribosomes, labelled with 14 C uracil, leads to a decrease of extractibility of 14 C RNA by lithium chloride 4 M-urea 8 M. On the other hand, the radioactivity of the protein fraction increases with irradiation. These results strongly suggest that RNA-protein cross links are formed in irradiated ribosomes [fr

Structural Studies of RNA Helicases Involved in Eukaryotic Pre-mRNA Splicing, Ribosome Biogenesis, and Translation Initiation

DEFF Research Database (Denmark)

He, Yangzi

and ligates the neighbouring exons to generate mature mRNAs. Prp43 is an RNA helicase of the DEAH/RHA family. In yeast, once mRNAs are released, Prp43 catalyzes the disassembly of spliceosomes. The 18S, 5.8S and 25S rRNAs are transcribed as a single polycistronic transcript—the 35S pre......-rRNA. It is nucleolytically cleaved and chemically modified to generate mature rRNAs, which assemble with ribosomal proteins to form the ribosome. Prp43 is required for the processing of the 18S rRNA. Using X-ray crystallography, I determined a high resolution structure of Prp43 bound to ADP, the first structure of a DEAH....../RHA helicase. It defined the conserved structural features of all DEAH/RHA helicases, and unveiled a novel nucleotide binding site. Additionally a preliminary low resolution structure of a ternary complex comprising Prp43, a non-hydrolyzable ATP analogue, and a single-stranded RNA, was obtained. The ribosome...

Simulating movement of tRNA through the ribosome during hybrid-state formation.

Science.gov (United States)

Whitford, Paul C; Sanbonmatsu, Karissa Y

2013-09-28

Biomolecular simulations provide a means for exploring the relationship between flexibility, energetics, structure, and function. With the availability of atomic models from X-ray crystallography and cryoelectron microscopy (cryo-EM), and rapid increases in computing capacity, it is now possible to apply molecular dynamics (MD) simulations to large biomolecular machines, and systematically partition the factors that contribute to function. A large biomolecular complex for which atomic models are available is the ribosome. In the cell, the ribosome reads messenger RNA (mRNA) in order to synthesize proteins. During this essential process, the ribosome undergoes a wide range of conformational rearrangements. One of the most poorly understood transitions is translocation: the process by which transfer RNA (tRNA) molecules move between binding sites inside of the ribosome. The first step of translocation is the adoption of a "hybrid" configuration by the tRNAs, which is accompanied by large-scale rotations in the ribosomal subunits. To illuminate the relationship between these rearrangements, we apply MD simulations using a multi-basin structure-based (SMOG) model, together with targeted molecular dynamics protocols. From 120 simulated transitions, we demonstrate the viability of a particular route during P/E hybrid-state formation, where there is asynchronous movement along rotation and tRNA coordinates. These simulations not only suggest an ordering of events, but they highlight atomic interactions that may influence the kinetics of hybrid-state formation. From these simulations, we also identify steric features (H74 and surrounding residues) encountered during the hybrid transition, and observe that flexibility of the single-stranded 3'-CCA tail is essential for it to reach the endpoint. Together, these simulations provide a set of structural and energetic signatures that suggest strategies for modulating the physical-chemical properties of protein synthesis by the

Novel mRNA-specific effects of ribosome drop-off on translation rate and polysome profile.

Directory of Open Access Journals (Sweden)

Pierre Bonnin

2017-05-01

Full Text Available The well established phenomenon of ribosome drop-off plays crucial roles in translational accuracy and nutrient starvation responses during protein translation. When cells are under stress conditions, such as amino acid starvation or aminoacyl-tRNA depletion due to a high level of recombinant protein expression, ribosome drop-off can substantially affect the efficiency of protein expression. Here we introduce a mathematical model that describes the effects of ribosome drop-off on the ribosome density along the mRNA and on the concomitant protein synthesis rate. Our results show that ribosome premature termination may lead to non-intuitive ribosome density profiles, such as a ribosome density which increases from the 5' to the 3' end. Importantly, the model predicts that the effects of ribosome drop-off on the translation rate are mRNA-specific, and we quantify their resilience to drop-off, showing that the mRNAs which present ribosome queues are much less affected by ribosome drop-off than those which do not. Moreover, among those mRNAs that do not present ribosome queues, resilience to drop-off correlates positively with the elongation rate, so that sequences using fast codons are expected to be less affected by ribosome drop-off. This result is consistent with a genome-wide analysis of S. cerevisiae, which reveals that under favourable growth conditions mRNAs coding for proteins involved in the translation machinery, known to be highly codon biased and using preferentially fast codons, are highly resilient to ribosome drop-off. Moreover, in physiological conditions, the translation rate of mRNAs coding for regulatory, stress-related proteins, is less resilient to ribosome drop-off. This model therefore allows analysis of variations in the translational efficiency of individual mRNAs by accounting for the full range of known ribosome behaviours, as well as explaining mRNA-specific variations in ribosome density emerging from ribosome profiling

Tubulin evolution in insects: gene duplication and subfunctionalization provide specialized isoforms in a functionally constrained gene family

Directory of Open Access Journals (Sweden)

Gadagkar Sudhindra R

2010-04-01

Full Text Available Abstract Background The completion of 19 insect genome sequencing projects spanning six insect orders provides the opportunity to investigate the evolution of important gene families, here tubulins. Tubulins are a family of eukaryotic structural genes that form microtubules, fundamental components of the cytoskeleton that mediate cell division, shape, motility, and intracellular trafficking. Previous in vivo studies in Drosophila find a stringent relationship between tubulin structure and function; small, biochemically similar changes in the major alpha 1 or testis-specific beta 2 tubulin protein render each unable to generate a motile spermtail axoneme. This has evolutionary implications, not a single non-synonymous substitution is found in beta 2 among 17 species of Drosophila and Hirtodrosophila flies spanning 60 Myr of evolution. This raises an important question, How do tubulins evolve while maintaining their function? To answer, we use molecular evolutionary analyses to characterize the evolution of insect tubulins. Results Sixty-six alpha tubulins and eighty-six beta tubulin gene copies were retrieved and subjected to molecular evolutionary analyses. Four ancient clades of alpha and beta tubulins are found in insects, a major isoform clade (alpha 1, beta 1 and three minor, tissue-specific clades (alpha 2-4, beta 2-4. Based on a Homarus americanus (lobster outgroup, these were generated through gene duplication events on major beta and alpha tubulin ancestors, followed by subfunctionalization in expression domain. Strong purifying selection acts on all tubulins, yet maximum pairwise amino acid distances between tubulin paralogs are large (0.464 substitutions/site beta tubulins, 0.707 alpha tubulins. Conversely orthologs, with the exception of reproductive tissue isoforms, show little sequence variation except in the last 15 carboxy terminus tail (CTT residues, which serve as sites for post-translational modifications (PTMs and interactions

Mass spectrometry identifies multiple organophosphorylated sites on tubulin

International Nuclear Information System (INIS)

Grigoryan, Hasmik; Schopfer, Lawrence M.; Peeples, Eric S.; Duysen, Ellen G.; Grigoryan, Marine; Thompson, Charles M.; Lockridge, Oksana

2009-01-01

Acute toxicity of organophosphorus poisons (OP) is explained by inhibition of acetylcholinesterase in nerve synapses. Low-dose effects are hypothesized to result from modification of other proteins, whose identity is not yet established. The goal of the present work was to obtain information that would make it possible to identify tubulin as a target of OP exposure. Tubulin was selected for study because live mice injected with a nontoxic dose of a biotinylated organophosphorus agent appeared to have OP-labeled tubulin in brain as determined by binding to avidin beads and mass spectrometry. The experiments with live mice were not conclusive because binding to avidin beads could be nonspecific. To be convincing, it is necessary to find and characterize the OP-labeled tubulin peptide. The search for OP-labeled tubulin peptides was begun by identifying residues capable of making a covalent bond with OP. Pure bovine tubulin (0.012 mM) was treated with 0.01-0.5 mM chlorpyrifos oxon for 24 h at 37 o C in pH 8.3 buffer. The identity of labeled amino acids and percent labeling was determined by mass spectrometry. Chlorpyrifos oxon bound covalently to tyrosines 83, 103, 108, 161, 224, 262, 272, 357, and 399 in bovine alpha tubulin, and to tyrosines 50, 51, 59, 106, 159, 281, 310, and 340 in bovine beta tubulin. The most reactive were tyrosine 83 in alpha and tyrosine 281 in beta tubulin. In the presence of 1 mM GTP, percent labeling increased 2-fold. Based on the crystal structure of the tubulin heterodimer (PDB 1jff) tyrosines 83 and 281 are well exposed to solvent. In conclusion seventeen tyrosines in tubulin have the potential to covalently bind chlorpyrifos oxon. These results will be useful when searching for OP-labeled tubulin in live animals.

Deciphering the role of the Gag-Pol ribosomal frameshift signal in HIV-1 RNA genome packaging.

Science.gov (United States)

Nikolaitchik, Olga A; Hu, Wei-Shau

2014-04-01

A key step of retroviral replication is packaging of the viral RNA genome during virus assembly. Specific packaging is mediated by interactions between the viral protein Gag and elements in the viral RNA genome. In HIV-1, similar to most retroviruses, the packaging signal is located within the 5' untranslated region and extends into the gag-coding region. A recent study reported that a region including the Gag-Pol ribosomal frameshift signal plays an important role in HIV-1 RNA packaging; deletions or mutations that affect the RNA structure of this signal lead to drastic decreases (10- to 50-fold) in viral RNA packaging and virus titer. We examined here the role of the ribosomal frameshift signal in HIV-1 RNA packaging by studying the RNA packaging and virus titer in the context of proviruses. Three mutants with altered ribosomal frameshift signal, either through direct deletion of the signal, mutation of the 6U slippery sequence, or alterations of the secondary structure were examined. We found that RNAs from all three mutants were packaged efficiently, and they generate titers similar to that of a virus containing the wild-type ribosomal frameshift signal. We conclude that although the ribosomal frameshift signal plays an important role in regulating the replication cycle, this RNA element is not directly involved in regulating RNA encapsidation. To generate infectious viruses, HIV-1 must package viral RNA genome during virus assembly. The specific HIV-1 genome packaging is mediated by interactions between the structural protein Gag and elements near the 5' end of the viral RNA known as packaging signal. In this study, we examined whether the Gag-Pol ribosomal frameshift signal is important for HIV-1 RNA packaging as recently reported. Our results demonstrated that when Gag/Gag-Pol is supplied in trans, none of the tested ribosomal frameshift signal mutants has defects in RNA packaging or virus titer. These studies provide important information on how HIV-1

Ribosomal RNA in the salivary gland of Sciara ocellaris during larval development

International Nuclear Information System (INIS)

Dessen, E.M.B.; Perondini, A.L.P.

1979-01-01

Ribosomal RNA in the salivary gland of Sciara ocellaris during larval development. The molecular weights of the precursor and of the 28S and 18S mature fractions of the ribosomal RNA estimated by poliacrilamid gel electrophoresis are 2.6 X 10 6 D, 1.4 X 10 6 D and 0.68 X 10 6 D, respectively. The in vivo processing of pre-rRNA is very fast since radioactivity could be detected in the mature fractions fifteen minutes after incorporation. The processing rate of salivary pre-rRNA increases after the stage of metamorphosis induction. The in vitro processing of the pre-rRNA is less rapid when compared to that in vivo, and no differences were found in RNAs [pt

5S Ribosomal RNA Is an Essential Component of a Nascent Ribosomal Precursor Complex that Regulates the Hdm2-p53 Checkpoint

Directory of Open Access Journals (Sweden)

Giulio Donati

2013-07-01

Full Text Available Recently, we demonstrated that RPL5 and RPL11 act in a mutually dependent manner to inhibit Hdm2 and stabilize p53 following impaired ribosome biogenesis. Given that RPL5 and RPL11 form a preribosomal complex with noncoding 5S ribosomal RNA (rRNA and the three have been implicated in the p53 response, we reasoned they may be part of an Hdm2-inhibitory complex. Here, we show that small interfering RNAs directed against 5S rRNA have no effect on total or nascent levels of the noncoding rRNA, though they prevent the reported Hdm4 inhibition of p53. To achieve efficient inhibition of 5S rRNA synthesis, we targeted TFIIIA, a specific RNA polymerase III cofactor, which, like depletion of either RPL5 or RPL11, did not induce p53. Instead, 5S rRNA acts in a dependent manner with RPL5 and RPL11 to inhibit Hdm2 and stabilize p53. Moreover, depletion of any one of the three components abolished the binding of the other two to Hdm2, explaining their common dependence. Finally, we demonstrate that the RPL5/RPL11/5S rRNA preribosomal complex is redirected from assembly into nascent 60S ribosomes to Hdm2 inhibition as a consequence of impaired ribosome biogenesis. Thus, the activation of the Hdm2-inhibitory complex is not a passive but a regulated event, whose potential role in tumor suppression has been recently noted.

5S ribosomal RNA is an essential component of a nascent ribosomal precursor complex that regulates the Hdm2-p53 checkpoint.

Science.gov (United States)

Donati, Giulio; Peddigari, Suresh; Mercer, Carol A; Thomas, George

2013-07-11

Recently, we demonstrated that RPL5 and RPL11 act in a mutually dependent manner to inhibit Hdm2 and stabilize p53 following impaired ribosome biogenesis. Given that RPL5 and RPL11 form a preribosomal complex with noncoding 5S ribosomal RNA (rRNA) and the three have been implicated in the p53 response, we reasoned they may be part of an Hdm2-inhibitory complex. Here, we show that small interfering RNAs directed against 5S rRNA have no effect on total or nascent levels of the noncoding rRNA, though they prevent the reported Hdm4 inhibition of p53. To achieve efficient inhibition of 5S rRNA synthesis, we targeted TFIIIA, a specific RNA polymerase III cofactor, which, like depletion of either RPL5 or RPL11, did not induce p53. Instead, 5S rRNA acts in a dependent manner with RPL5 and RPL11 to inhibit Hdm2 and stabilize p53. Moreover, depletion of any one of the three components abolished the binding of the other two to Hdm2, explaining their common dependence. Finally, we demonstrate that the RPL5/RPL11/5S rRNA preribosomal complex is redirected from assembly into nascent 60S ribosomes to Hdm2 inhibition as a consequence of impaired ribosome biogenesis. Thus, the activation of the Hdm2-inhibitory complex is not a passive but a regulated event, whose potential role in tumor suppression has been recently noted. Copyright © 2013 The Authors. Published by Elsevier Inc. All rights reserved.

The Ribosomal RNA is a Useful Marker to Visualize Rhizobia Interacting with Legume Plants

Science.gov (United States)

Rinaudi, Luciana; Isola, Maria C.; Giordano, Walter

2004-01-01

Symbiosis between rhizobia and leguminous plants leads to the formation of nitrogen-fixing root nodules. In the present article, we recommend the use of the ribosomal RNA (rRNA) isolated from legume nodules in an experimental class with the purpose of introducing students to the structure of eukaryotic and prokaryotic ribosomes and of…

Fluctuations in protein synthesis from a single RNA template: stochastic kinetics of ribosomes.

Science.gov (United States)

Garai, Ashok; Chowdhury, Debashish; Ramakrishnan, T V

2009-01-01

Proteins are polymerized by cyclic machines called ribosomes, which use their messenger RNA (mRNA) track also as the corresponding template, and the process is called translation. We explore, in depth and detail, the stochastic nature of the translation. We compute various distributions associated with the translation process; one of them--namely, the dwell time distribution--has been measured in recent single-ribosome experiments. The form of the distribution, which fits best with our simulation data, is consistent with that extracted from the experimental data. For our computations, we use a model that captures both the mechanochemistry of each individual ribosome and their steric interactions. We also demonstrate the effects of the sequence inhomogeneities of real genes on the fluctuations and noise in translation. Finally, inspired by recent advances in the experimental techniques of manipulating single ribosomes, we make theoretical predictions on the force-velocity relation for individual ribosomes. In principle, all our predictions can be tested by carrying out in vitro experiments.

Fluctuations between multiple EF-G-induced chimeric tRNA states during translocation on the ribosome

Science.gov (United States)

Adio, Sarah; Senyushkina, Tamara; Peske, Frank; Fischer, Niels; Wintermeyer, Wolfgang; Rodnina, Marina V.

2015-06-01

The coupled translocation of transfer RNA and messenger RNA through the ribosome entails large-scale structural rearrangements, including step-wise movements of the tRNAs. Recent structural work has visualized intermediates of translocation induced by elongation factor G (EF-G) with tRNAs trapped in chimeric states with respect to 30S and 50S ribosomal subunits. The functional role of the chimeric states is not known. Here we follow the formation of translocation intermediates by single-molecule fluorescence resonance energy transfer. Using EF-G mutants, a non-hydrolysable GTP analogue, and fusidic acid, we interfere with either translocation or EF-G release from the ribosome and identify several rapidly interconverting chimeric tRNA states on the reaction pathway. EF-G engagement prevents backward transitions early in translocation and increases the fraction of ribosomes that rapidly fluctuate between hybrid, chimeric and posttranslocation states. Thus, the engagement of EF-G alters the energetics of translocation towards a flat energy landscape, thereby promoting forward tRNA movement.

Ribosomal proteins L11 and L10.(L12)4 and the antibiotic thiostrepton interact with overlapping regions of the 23 S rRNA backbone in the ribosomal GTPase centre

DEFF Research Database (Denmark)

Rosendahl, G; Douthwaite, S

1993-01-01

RNA, and to investigate how this interaction is influenced by other ribosomal components. Complexes were characterized in both naked 23 S rRNA and ribosomes from an E. coli L11-minus strain, before and after reconstitution with L11. The protein protects 17 riboses between positions 1058 and 1085 in the naked 23 S r......The Escherichia coli ribosomal protein (r-protein) L11 and its binding site on 23 S ribosomal RNA (rRNA) are associated with ribosomal hydrolysis of guanosine 5'-triphosphate (GTP). We have used hydroxyl radical footprinting to map the contacts between L11 and the backbone riboses in 23 S r......)4 and other proteins within the ribosome. The antibiotics thiostrepton and micrococcin inhibit the catalytic functions of this region by slotting in between the accessible loops and interacting with nucleotides there....

Fragmentation of the large subunit ribosomal RNA gene in oyster mitochondrial genomes

Directory of Open Access Journals (Sweden)

Milbury Coren A

2010-09-01

Full Text Available Abstract Background Discontinuous genes have been observed in bacteria, archaea, and eukaryotic nuclei, mitochondria and chloroplasts. Gene discontinuity occurs in multiple forms: the two most frequent forms result from introns that are spliced out of the RNA and the resulting exons are spliced together to form a single transcript, and fragmented gene transcripts that are not covalently attached post-transcriptionally. Within the past few years, fragmented ribosomal RNA (rRNA genes have been discovered in bilateral metazoan mitochondria, all within a group of related oysters. Results In this study, we have characterized this fragmentation with comparative analysis and experimentation. We present secondary structures, modeled using comparative sequence analysis of the discontinuous mitochondrial large subunit rRNA genes of the cupped oysters C. virginica, C. gigas, and C. hongkongensis. Comparative structure models for the large subunit rRNA in each of the three oyster species are generally similar to those for other bilateral metazoans. We also used RT-PCR and analyzed ESTs to determine if the two fragmented LSU rRNAs are spliced together. The two segments are transcribed separately, and not spliced together although they still form functional rRNAs and ribosomes. Conclusions Although many examples of discontinuous ribosomal genes have been documented in bacteria and archaea, as well as the nuclei, chloroplasts, and mitochondria of eukaryotes, oysters are some of the first characterized examples of fragmented bilateral animal mitochondrial rRNA genes. The secondary structures of the oyster LSU rRNA fragments have been predicted on the basis of previous comparative metazoan mitochondrial LSU rRNA structure models.

Overexpressed HDAC8 in cervical cancer cells shows functional redundancy of tubulin deacetylation with HDAC6.

Science.gov (United States)

Vanaja, G R; Ramulu, Hemalatha Golaconda; Kalle, Arunasree M

2018-05-02

Histone deacetylases (HDACs) are involved in epigenetic gene regulation via deacetylation of acetylated lysine residues of both histone and non-histone proteins. Among the 18 HDACs identified in humans, HDAC8, a class I HDAC, is best understood structurally and enzymatically. However, its precise subcellular location, function in normal cellular physiology, its protein partners and substrates still remain elusive. The subcellular localization of HDAC8 was studied using immunofluorescence and confocal imaging. The binding parterns were identified employing immunoprecipitation (IP) followed by MALDI-TOF analysis and confirmed using in-silico protein-protein interaction studies, HPLC-based in vitro deacetylation assay, intrinsic fluorescence spectrophotometric analysis, Circular dichroism (CD) and Surface Plasmon Resonance (SPR). Functional characterization of the binding was carried out using immunoblot and knockdown by siRNA. Using one way ANOVA statistical significance (n = 3) was determined. Here, we show that HDAC8 and its phosphorylated form (pHDAC8) localized predominantly in the cytoplasm in cancerous, HeLa, and non-cancerous (normal), HEK293T, cells, although nucleolar localization was observed in HeLa cells. The study identified Alpha tubulin as a novel interacting partner of HDAC8. Further, the results indicated binding and deacetylation of tubulin at ac-lys40 by HDAC8. Knockdown of HDAC8 by siRNA, inhibition of HDAC8 and/or HDAC6 by PCI-34051 and tubastatin respectively, cell-migration, cell morphology and cell cycle analysis clearly explained HDAC8 as tubulin deacetylase in HeLa cells and HDAC6 in HEK 293 T cells. HDAC8 shows functional redundancy with HDAC6 when overexpressed in cervical cancer cells, HeLa, and deacetylaes ac-lys40 of alpha tubulin leading to cervical cancer proliferation and progression.

Evolutionary characterization and transcript profiling of β-tubulin genes in flax (Linum usitatissimum L.) during plant development.

Science.gov (United States)

Gavazzi, Floriana; Pigna, Gaia; Braglia, Luca; Gianì, Silvia; Breviario, Diego; Morello, Laura

2017-12-08

Microtubules, polymerized from alpha and beta-tubulin monomers, play a fundamental role in plant morphogenesis, determining the cell division plane, the direction of cell expansion and the deposition of cell wall material. During polarized pollen tube elongation, microtubules serve as tracks for vesicular transport and deposition of proteins/lipids at the tip membrane. Such functions are controlled by cortical microtubule arrays. Aim of this study was to first characterize the flax β-tubulin family by sequence and phylogenetic analysis and to investigate differential expression of β-tubulin genes possibly related to fibre elongation and to flower development. We report the cloning and characterization of the complete flax β-tubulin gene family: exon-intron organization, duplicated gene comparison, phylogenetic analysis and expression pattern during stem and hypocotyl elongation and during flower development. Sequence analysis of the fourteen expressed β-tubulin genes revealed that the recent whole genome duplication of the flax genome was followed by massive retention of duplicated tubulin genes. Expression analysis showed that β-tubulin mRNA profiles gradually changed along with phloem fibre development in both the stem and hypocotyl. In flowers, changes in relative tubulin transcript levels took place at anthesis in anthers, but not in carpels. Phylogenetic analysis supports the origin of extant plant β-tubulin genes from four ancestral genes pre-dating angiosperm separation. Expression analysis suggests that particular tubulin subpopulations are more suitable to sustain different microtubule functions such as cell elongation, cell wall thickening or pollen tube growth. Tubulin genes possibly related to different microtubule functions were identified as candidate for more detailed studies.

Molecular characterization of four beta-tubulin genes from dinitroaniline susceptible and resistant biotypes of Eleusine indica.

Science.gov (United States)

Yamamoto, E; Baird, W V

1999-01-01

Dinitroaniline herbicides are antimicrotubule drugs that bind to tubulins and inhibit polymerization. As a result of repeated application of dinitroaniline herbicides, resistant biotypes of goosegrass (Eleusine indica) developed in previously susceptible wild-type populations. We have previously reported that alpha-tubulin missense mutations correlate with dinitroaniline response phenotypes (Drp) (Plant Cell 10: 297-308, 1998). In order to ascertain associations of other tubulins with dinitroaniline resistance, four beta-tubulin cDNA classes (designated TUB1, TUB2, TUB3, and TUB4) were isolated from dinitroaniline-susceptible and -resistant biotypes. Sequence analysis of the four beta-tubulin cDNA classes identified no missense mutations. Identified nucleotide substitutions did not result in amino acid replacements. These results suggest that the molecular basis of dinitroaniline resistance in goosegrass differs from those of colchicine/dinitroaniline cross-resistant Chlamydomonas reinhardtii and benzimidazole-resistant fungi and yeast. Expression of the four beta-tubulins was highest in inflorescences. This is in contrast to alpha-tubulin TUA1 that is expressed predominantly in roots. Collectively, these results imply that beta-tubulin genes are not associated with dinitroaniline resistance in goosegrass. Phylogenetic analysis of the four beta-tubulins, together with three alpha-tubulins, suggests that the resistant biotype developed independently in multiple locations rather than spreading from one location.

tmRNA-mediated trans-translation as the major ribosome rescue system in a bacterial cell

Directory of Open Access Journals (Sweden)

Hyouta eHimeno

2014-04-01

Full Text Available tmRNA (transfer messenger RNA; also known as 10Sa RNA or SsrA RNA is a small RNA molecule that is conserved among bacteria. It has structural and functional similarities to tRNA: it has an upper half of the tRNA-like structure, its 5’ end is processed by RNase P, it has typical tRNA-specific base modifications, it is aminoacylated with alanine, it binds to EF-Tu after aminoacylation and it enters the ribosome with EF-Tu and GTP. However, tmRNA lacks an anticodon, and instead it has a coding sequence for a short peptide called tag-peptide. An elaborate interplay of actions of tmRNA as both tRNA and mRNA with the help of a tmRNA-binding protein, SmpB, facilitates trans-translation, which produces a single polypeptide from two mRNA molecules. Initially alanyl-tmRNA in complex with EF-Tu and SmpB enters the vacant A-site of the stalled ribosome like aminoacyl-tRNA but without a codon-anticodon interaction, and subsequently truncated mRNA is replaced with the tag-encoding region of tmRNA. During these processes, not only tmRNA but also SmpB structurally and functionally mimics both tRNA and mRNA. Thus trans-translation rescues the stalled ribosome, thereby allowing recycling of the ribosome. Since the tag-peptide serves as a target of AAA+ proteases, the trans-translation products are preferentially degraded so that they do not accumulate in the cell. Although alternative rescue systems have recently been revealed, trans-translation is the only system that universally exists in bacteria. Furthermore, it is unique in that it employs a small RNA and that it prevents accumulation of nonfunctional proteins from truncated mRNA in the cell. It might play the major role in rescuing the stalled translation in the bacterial cell.

Ribosomal protein L5 has a highly twisted concave surface and flexible arms responsible for rRNA binding.

Science.gov (United States)

Nakashima, T; Yao, M; Kawamura, S; Iwasaki, K; Kimura, M; Tanaka, I

2001-05-01

Ribosomal protein L5 is a 5S rRNA binding protein in the large subunit and plays an essential role in the promotion of a particular conformation of 5S rRNA. The crystal structure of the ribosomal protein L5 from Bacillus stearothermophilus has been determined at 1.8 A resolution. The molecule consists of a five-stranded antiparallel beta-sheet and four alpha-helices, which fold in a way that is topologically similar to the ribonucleoprotein (RNP) domain. The molecular shape and electrostatic representation suggest that the concave surface and loop regions are involved in 5S rRNA binding. To identify amino acid residues responsible for 5S rRNA binding, we made use of Ala-scanning mutagenesis of evolutionarily conserved amino acids occurring in the beta-strands and loop regions. The mutations of Asn37 at the beta1-strand and Gln63 at the loop between helix 2 and beta3-strand as well as that of Phe77 at the tip of the loop structure between the beta2- and beta3-strands caused a significant reduction in 5S rRNA binding. In addition, the mutations of Thr90 on the beta3-strand and Ile141 and Asp144 at the loop between beta4- and beta5-strands moderately reduced the 5S rRNA-binding affinity. Comparison of these results with the more recently analyzed structure of the 50S subunit from Haloarcula marismortui suggests that there are significant differences in the structure at N- and C-terminal regions and probably in the 5S rRNA binding.

Cisplatin Targeting of Bacterial Ribosomal RNA Hairpins

Directory of Open Access Journals (Sweden)

Gayani N. P. Dedduwa-Mudalige

2015-09-01

Full Text Available Cisplatin is a clinically important chemotherapeutic agent known to target purine bases in nucleic acids. In addition to major deoxyribonucleic acid (DNA intrastrand cross-links, cisplatin also forms stable adducts with many types of ribonucleic acid (RNA including siRNA, spliceosomal RNAs, tRNA, and rRNA. All of these RNAs play vital roles in the cell, such as catalysis of protein synthesis by rRNA, and therefore serve as potential drug targets. This work focused on platination of two highly conserved RNA hairpins from E. coli ribosomes, namely pseudouridine-modified helix 69 from 23S rRNA and the 790 loop of helix 24 from 16S rRNA. RNase T1 probing, MALDI mass spectrometry, and dimethyl sulfate mapping revealed platination at GpG sites. Chemical probing results also showed platination-induced RNA structural changes. These findings reveal solvent and structural accessibility of sites within bacterial RNA secondary structures that are functionally significant and therefore viable targets for cisplatin as well as other classes of small molecules. Identifying target preferences at the nucleotide level, as well as determining cisplatin-induced RNA conformational changes, is important for the design of more potent drug molecules. Furthermore, the knowledge gained through studies of RNA-targeting by cisplatin is applicable to a broad range of organisms from bacteria to human.

Validation of reference genes for quantitative real-time PCR in Périgord black truffle (Tuber melanosporum) developmental stages.

Science.gov (United States)

Zarivi, Osvaldo; Cesare, Patrizia; Ragnelli, Anna Maria; Aimola, Pierpaolo; Leonardi, Marco; Bonfigli, Antonella; Colafarina, Sabrina; Poma, Anna Maria; Miranda, Michele; Pacioni, Giovanni

2015-08-01

The symbiotic fungus Tuber melanosporum Vittad. (Périgord black truffle) belongs to the Ascomycota and forms mutualistic symbiosis with tree and shrub roots. This truffle has a high value in a global market and is cultivated in many countries of both hemispheres. The publication of the T. melanosporum genome has given researchers unique opportunities to learn more about the biology of the fungus. Real-time quantitative PCR (qRT-PCR) is a definitive technique for quantitating differences in transcriptional gene expression levels between samples. To facilitate gene expression studies and obtain more accurate qRT-PCR data, normalization relative to stable housekeeping genes is required. These housekeeping genes must show stable expression under given experimental conditions for the qRT-PCR results to be accurate. Unfortunately, there are no studies on the stability of housekeeping genes used in T. melanosporum development. In this study, we present a morphological and microscopical classification of the developmental stages of T. melanosporum fruit body, and investigate the expression levels of 12 candidate reference genes (18S rRNA; 5.8S rRNA; Elongation factor 1-alpha; Elongation factor 1-beta; α-tubulin; 60S ribosomal protein L29; β-tubulin; 40S ribosomal protein S1; 40S ribosomal protein S3; Glucose-6-phosphate dehydrogenase; β-actin; Ubiquitin-conjugating enzyme). To evaluate the suitability of these genes as endogenous controls, five software-based approaches and one web-based comprehensive tool (RefFinder) were used to analyze and rank the tested genes. We demonstrate here that the 18S rRNA gene shows the most stable expression during T. melanosporum development and that a set of three genes, 18S rRNA, Elongation factor 1-alpha and 40S ribosomal protein S3, is the most suitable to normalize qRT-PCR data from all the analyzed developmental stages; conversely, 18S rRNA, Glucose-6-phosphate dehydrogenase and Elongation factor 1-alpha are the most suitable

Biological significance of 5S rRNA import into human mitochondria: role of ribosomal protein MRP-L18

Science.gov (United States)

Smirnov, Alexandre; Entelis, Nina; Martin, Robert P.; Tarassov, Ivan

2011-01-01

5S rRNA is an essential component of ribosomes of all living organisms, the only known exceptions being mitochondrial ribosomes of fungi, animals, and some protists. An intriguing situation distinguishes mammalian cells: Although the mitochondrial genome contains no 5S rRNA genes, abundant import of the nuclear DNA-encoded 5S rRNA into mitochondria was reported. Neither the detailed mechanism of this pathway nor its rationale was clarified to date. In this study, we describe an elegant molecular conveyor composed of a previously identified human 5S rRNA import factor, rhodanese, and mitochondrial ribosomal protein L18, thanks to which 5S rRNA molecules can be specifically withdrawn from the cytosolic pool and redirected to mitochondria, bypassing the classic nucleolar reimport pathway. Inside mitochondria, the cytosolic 5S rRNA is shown to be associated with mitochondrial ribosomes. PMID:21685364

Distribution of protein and RNA in the 30S ribosomal subunit

International Nuclear Information System (INIS)

Ramakrishnan, V.

1986-01-01

In Escherichia coli, the small ribosomal subunit has a sedimentation coefficient of 30S, and consists of a 16S RNA molecule of 1541 nucleotides complexed with 21 proteins. Over the last few years, a controversy has emerged regarding the spatial distribution of RNA and protein in the 30S subunit. Contrast variation with neutron scattering was used to suggest that the RNA was located in a central core of the subunit and the proteins mainly in the periphery, with virtually no separation between the centers of mass of protein and RNA. However, these findings are incompatible with the results of efforts to locate individual ribosomal proteins by immune electron microscopy and triangulation with interprotein distance measurements. The conflict between these two views is resolved in this report of small-angle neutron scattering measurements on 30S subunits with and without protein S1, and on subunits reconstituted from deuterated 16S RNA and unlabeled proteins. The results show that (i) the proteins and RNA are intermingled, with neither component dominating at the core or the periphery, and (ii) the spatial distribution of protein and RNA is asymmetrical, with a separation between their centers of mass of about 25 angstroms

Alpha-momorcharin: a ribosome-inactivating protein from Momordica charantia, possessing DNA cleavage properties.

Science.gov (United States)

Wang, Shuzhen; Zheng, Yinzhen; Yan, Junjie; Zhu, Zhixuan; Wu, Zhihua; Ding, Yi

2013-11-01

Ribosome-inactivating proteins (RIPs) function to inhibit protein synthesis through the removal of specific adenine residues from eukaryotic ribosomal RNA and rending the 60S subunit unable to bind elongation factor 2. They have received much attention in biological and biomedical research due to their unique activities toward tumor cells, as well as the important roles in plant defense. Alpha-momorcharin (α-MC), a member of the type I family of RIPs, is rich in the seeds of Momordica charantia L. Previous studies demonstrated that α-MC is an effective antifungal and antibacterial protein. In this study, a detailed analysis of the DNase-like activity of α-MC was conducted. Results showed that the DNase-like activity toward plasmid DNA was time-dependent, temperature-related, and pH-stable. Moreover, a requirement for divalent metal ions in the catalytic domain of α-MC was confirmed. Additionally, Tyr(93) was found to be a critical residue for the DNase-like activity, while Tyr(134), Glu(183), Arg(186), and Trp(215) were activity-related residues. This study on the chemico-physical properties and mechanism of action of α-MC will improve its utilization in scientific research, as well as its potential industrial uses. These results may also assist in the characterization and elucidation of the DNase-like enzymatic properties of other RIPs.

Analysis of the 3’ untranslated regions of α-tubulin and S-crystallin mRNA and the identification of CPEB in dark- and light-adapted octopus retinas

Science.gov (United States)

Kelly, Shannan; Yamamoto, Hideki

2008-01-01

Purpose We previously reported the differential expression and translation of mRNA and protein in dark- and light-adapted octopus retinas, which may result from cytoplasmic polyadenylation element (CPE)–dependent mRNA masking and unmasking. Here we investigate the presence of CPEs in α-tubulin and S-crystallin mRNA and report the identification of cytoplasmic polyadenylation element binding protein (CPEB) in light- and dark-adapted octopus retinas. Methods 3’-RACE and sequencing were used to isolate and analyze the 3’-UTRs of α-tubulin and S-crystallin mRNA. Total retinal protein isolated from light- and dark-adapted octopus retinas was subjected to western blot analysis followed by CPEB antibody detection, PEP-171 inhibition of CPEB, and dephosphorylation of CPEB. Results The following CPE-like sequence was detected in the 3’-UTR of isolated long S-crystallin mRNA variants: UUUAACA. No CPE or CPE-like sequences were detected in the 3’-UTRs of α-tubulin mRNA or of the short S-crystallin mRNA variants. Western blot analysis detected CPEB as two putative bands migrating between 60-80 kDa, while a third band migrated below 30 kDa in dark- and light-adapted retinas. Conclusions The detection of CPEB and the identification of the putative CPE-like sequences in the S-crystallin 3’-UTR suggest that CPEB may be involved in the activation of masked S-crystallin mRNA, but not in the regulation of α-tubulin mRNA, resulting in increased S-crystallin protein synthesis in dark-adapted octopus retinas. PMID:18682811

Biosynthesis of ribosomal RNA in nucleoli regulates pluripotency and differentiation ability of pluripotent stem cells.

Science.gov (United States)

Watanabe-Susaki, Kanako; Takada, Hitomi; Enomoto, Kei; Miwata, Kyoko; Ishimine, Hisako; Intoh, Atsushi; Ohtaka, Manami; Nakanishi, Mahito; Sugino, Hiromu; Asashima, Makoto; Kurisaki, Akira

2014-12-01

Pluripotent stem cells have been shown to have unique nuclear properties, for example, hyperdynamic chromatin and large, condensed nucleoli. However, the contribution of the latter unique nucleolar character to pluripotency has not been well understood. Here, we show that fibrillarin (FBL), a critical methyltransferase for ribosomal RNA (rRNA) processing in nucleoli, is one of the proteins highly expressed in pluripotent embryonic stem (ES) cells. Stable expression of FBL in ES cells prolonged the pluripotent state of mouse ES cells cultured in the absence of leukemia inhibitory factor (LIF). Analyses using deletion mutants and a point mutant revealed that the methyltransferase activity of FBL regulates stem cell pluripotency. Knockdown of this gene led to significant delays in rRNA processing, growth inhibition, and apoptosis in mouse ES cells. Interestingly, both partial knockdown of FBL and treatment with actinomycin D, an inhibitor of rRNA synthesis, induced the expression of differentiation markers in the presence of LIF and promoted stem cell differentiation into neuronal lineages. Moreover, we identified p53 signaling as the regulatory pathway for pluripotency and differentiation of ES cells. These results suggest that proper activity of rRNA production in nucleoli is a novel factor for the regulation of pluripotency and differentiation ability of ES cells. © 2014 AlphaMed Press.

Detailed analysis of RNA-protein interactions within the bacterial ribosomal protein L5/5S rRNA complex.

Science.gov (United States)

Perederina, Anna; Nevskaya, Natalia; Nikonov, Oleg; Nikulin, Alexei; Dumas, Philippe; Yao, Min; Tanaka, Isao; Garber, Maria; Gongadze, George; Nikonov, Stanislav

2002-12-01

The crystal structure of ribosomal protein L5 from Thermus thermophilus complexed with a 34-nt fragment comprising helix III and loop C of Escherichia coli 5S rRNA has been determined at 2.5 A resolution. The protein specifically interacts with the bulged nucleotides at the top of loop C of 5S rRNA. The rRNA and protein contact surfaces are strongly stabilized by intramolecular interactions. Charged and polar atoms forming the network of conserved intermolecular hydrogen bonds are located in two narrow planar parallel layers belonging to the protein and rRNA, respectively. The regions, including these atoms conserved in Bacteria and Archaea, can be considered an RNA-protein recognition module. Comparison of the T. thermophilus L5 structure in the RNA-bound form with the isolated Bacillus stearothermophilus L5 structure shows that the RNA-recognition module on the protein surface does not undergo significant changes upon RNA binding. In the crystal of the complex, the protein interacts with another RNA molecule in the asymmetric unit through the beta-sheet concave surface. This protein/RNA interface simulates the interaction of L5 with 23S rRNA observed in the Haloarcula marismortui 50S ribosomal subunit.

5S ribosomal RNA database Y2K.

Science.gov (United States)

Szymanski, M; Barciszewska, M Z; Barciszewski, J; Erdmann, V A

2000-01-01

This paper presents the updated version (Y2K) of the database of ribosomal 5S ribonucleic acids (5S rRNA) and their genes (5S rDNA), http://rose.man/poznan.pl/5SData/index.html. This edition of the database contains 1985primary structures of 5S rRNA and 5S rDNA. They include 60 archaebacterial, 470 eubacterial, 63 plastid, nine mitochondrial and 1383 eukaryotic sequences. The nucleotide sequences of the 5S rRNAs or 5S rDNAs are divided according to the taxonomic position of the source organisms.

Clusters of basic amino acids contribute to RNA binding and nucleolar localization of ribosomal protein L22.

Directory of Open Access Journals (Sweden)

Jennifer L Houmani

Full Text Available The ribosomal protein L22 is a component of the 60S eukaryotic ribosomal subunit. As an RNA-binding protein, it has been shown to interact with both cellular and viral RNAs including 28S rRNA and the Epstein-Barr virus encoded RNA, EBER-1. L22 is localized to the cell nucleus where it accumulates in nucleoli. Although previous studies demonstrated that a specific amino acid sequence is required for nucleolar localization, the RNA-binding domain has not been identified. Here, we investigated the hypothesis that the nucleolar accumulation of L22 is linked to its ability to bind RNA. To address this hypothesis, mutated L22 proteins were generated to assess the contribution of specific amino acids to RNA binding and protein localization. Using RNA-protein binding assays, we demonstrate that basic amino acids 80-93 are required for high affinity binding of 28S rRNA and EBER-1 by L22. Fluorescence localization studies using GFP-tagged mutated L22 proteins further reveal that basic amino acids 80-93 are critical for nucleolar accumulation and for incorporation into ribosomes. Our data support the growing consensus that the nucleolar accumulation of ribosomal proteins may not be mediated by a defined localization signal, but rather by specific interaction with established nucleolar components such as rRNA.

Defining the structural requirements for a helix in 23 S ribosomal RNA that confers erythromycin resistance

DEFF Research Database (Denmark)

Douthwaite, S; Powers, T; Lee, J Y

1989-01-01

The helix spanning nucleotides 1198 to 1247 (helix 1200-1250) in Escherichia coli 23 S ribosomal RNA (rRNA) is functionally important in protein synthesis, and deletions in this region confer erythromycin resistance. In order to define the structural requirements for resistance, we have dissected...... deletion mutants show a sensitive phenotype. Deletions that extend into the base-pairing between GCC1208 and GGU1240 result in non-functional 23 S RNAs, which consequently do not confer resistance. A number of phylogenetically conserved nucleotides have been shown to be non-essential for 23 S RNA function....... However, removal of either these or non-conserved nucleotides from helix 1200-1250 measurably reduces the efficiency of 23 S RNA in forming functional ribosomes. We have used chemical probing and a modified primer extension method to investigate erythromycin binding to wild-type and resistant ribosomes...

Characterization of the Leptospira interrogans S10-spc-alpha operon

NARCIS (Netherlands)

Zuerner, R. L.; Hartskeerl, R. A.; van de Kemp, H.; Bal, A. E.

2000-01-01

A ribosomal protein gene cluster from the spirochaete Leptospira interrogans was characterized. This locus is homologous to the Escherichia coli S10, spc, and alpha operons. Analysis of L. interrogans RNA showed that the ribosomal protein genes within this cluster are co-transcribed, thus forming an

Improved Ribosome-Footprint and mRNA Measurements Provide Insights into Dynamics and Regulation of Yeast Translation

Science.gov (United States)

2016-02-11

unlimited. Improved Ribosome-Footprint and mRNA Measurements Provide Insights into Dynamics and Regulation of Yeast Translation The views, opinions and...into Dynamics and Regulation of Yeast Translation Report Title Ribosome-footprint profiling provides genome-wide snapshots of translation, but...tend to slow translation. With the improved mRNA measurements, the variation attributable to translational control in exponentially growing yeast was

Expedited quantification of mutant ribosomal RNA by binary deoxyribozyme (BiDz) sensors.

Science.gov (United States)

Gerasimova, Yulia V; Yakovchuk, Petro; Dedkova, Larisa M; Hecht, Sidney M; Kolpashchikov, Dmitry M

2015-10-01

Mutations in ribosomal RNA (rRNA) have traditionally been detected by the primer extension assay, which is a tedious and multistage procedure. Here, we describe a simple and straightforward fluorescence assay based on binary deoxyribozyme (BiDz) sensors. The assay uses two short DNA oligonucleotides that hybridize specifically to adjacent fragments of rRNA, one of which contains a mutation site. This hybridization results in the formation of a deoxyribozyme catalytic core that produces the fluorescent signal and amplifies it due to multiple rounds of catalytic action. This assay enables us to expedite semi-quantification of mutant rRNA content in cell cultures starting from whole cells, which provides information useful for optimization of culture preparation prior to ribosome isolation. The method requires less than a microliter of a standard Escherichia coli cell culture and decreases analysis time from several days (for primer extension assay) to 1.5 h with hands-on time of ∼10 min. It is sensitive to single-nucleotide mutations. The new assay simplifies the preliminary analysis of RNA samples and cells in molecular biology and cloning experiments and is promising in other applications where fast detection/quantification of specific RNA is required. © 2015 Gerasimova et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

Genome-wide mRNA processing in methanogenic archaea reveals post-transcriptional regulation of ribosomal protein synthesis.

Science.gov (United States)

Qi, Lei; Yue, Lei; Feng, Deqin; Qi, Fengxia; Li, Jie; Dong, Xiuzhu

2017-07-07

Unlike stable RNAs that require processing for maturation, prokaryotic cellular mRNAs generally follow an 'all-or-none' pattern. Herein, we used a 5΄ monophosphate transcript sequencing (5΄P-seq) that specifically captured the 5΄-end of processed transcripts and mapped the genome-wide RNA processing sites (PSSs) in a methanogenic archaeon. Following statistical analysis and stringent filtration, we identified 1429 PSSs, among which 23.5% and 5.4% were located in 5΄ untranslated region (uPSS) and intergenic region (iPSS), respectively. A predominant uridine downstream PSSs served as a processing signature. Remarkably, 5΄P-seq detected overrepresented uPSS and iPSS in the polycistronic operons encoding ribosomal proteins, and the majority upstream and proximal ribosome binding sites, suggesting a regulatory role of processing on translation initiation. The processed transcripts showed increased stability and translation efficiency. Particularly, processing within the tricistronic transcript of rplA-rplJ-rplL enhanced the translation of rplL, which can provide a driving force for the 1:4 stoichiometry of L10 to L12 in the ribosome. Growth-associated mRNA processing intensities were also correlated with the cellular ribosomal protein levels, thereby suggesting that mRNA processing is involved in tuning growth-dependent ribosome synthesis. In conclusion, our findings suggest that mRNA processing-mediated post-transcriptional regulation is a potential mechanism of ribosomal protein synthesis and stoichiometry. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

The NBS1-Treacle complex controls ribosomal RNA transcription in response to DNA damage

DEFF Research Database (Denmark)

Larsen, Dorthe H; Hari, Flurina; Clapperton, Julie A

2014-01-01

Chromosome breakage elicits transient silencing of ribosomal RNA synthesis, but the mechanisms involved remained elusive. Here we discover an in trans signalling mechanism that triggers pan-nuclear silencing of rRNA transcription in response to DNA damage. This is associated with transient...... recruitment of the Nijmegen breakage syndrome protein 1 (NBS1), a central regulator of DNA damage responses, into the nucleoli. We further identify TCOF1 (also known as Treacle), a nucleolar factor implicated in ribosome biogenesis and mutated in Treacher Collins syndrome, as an interaction partner of NBS1...

Down-regulated βIII-tubulin Expression Can Reverse Paclitaxel Resistance in A549/Taxol Cells Lines

Directory of Open Access Journals (Sweden)

Yinling ZHUO

2014-08-01

Full Text Available Background and objective Chemotherapy drug resistance is the primary causes of death in patients with pulmonary carcinoma which make tumor recurrence or metastasis. β-tubulin is the main cell targets of anti-microtubule drug. Increased expression of βIII-tubulin has been implicated in non-small cell lung cancer (NSCLC cell lines. To explore the relationship among the expression level of βIII-tubulin and the sensitivity of A549/Taxolcell lines to Taxol and cell cycles and cell apoptosis by RNA interference-mediated inhibition of βIII-tubulin in A549/Taxol cells. Methods Three pairs of siRNA targetd βIII-tubulin were designed and prepared, which were transfected into A549/Taxol cells using LipofectamineTM 2000. We detected the expression of βIII-tubulin mRNA using Real-time fluorescence qRT-PCR. Tedhen we selected the most efficient siRNA by the expression of βIII-tubulin mRNA in transfected group. βIII-tubulin protein level were mesured by Western blot. The taxol sensitivity in transfected group were evaluated by MTT assay. And the cell apoptosis and cell cycles were determined by flow cytometry. Results βIII-tubulin mRNA levels in A549/Taxol cells were significantly decreased in transfected grop by Real-time qRT-PCR than control groups. And βIII-tubulin siRNA-1 sequence showed the highest transfection efficiency, which was (87.73±4.87% (P<0.01; Western blot results showed that the expressional level of BIII tublin protein was significantly down-reulated in the transfectant cells than thant in the control cells. By MTT assay, we showed that the inhibition ratio of Taxol to A549/Taxol cells transfeced was higher than that of control group (51.77±4.60% (P<0.01. The early apoptosis rate of A549/Taxol cells in transfected group were significantly higher than that of control group (P<0.01; G2-M content in taxol group obviously increased than untreated samples by the cell cycle (P<0.05. Conclusion βIII-tubulin down-regulated significantly

The CRM domain: an RNA binding module derived from an ancient ribosome-associated protein.

Science.gov (United States)

Barkan, Alice; Klipcan, Larik; Ostersetzer, Oren; Kawamura, Tetsuya; Asakura, Yukari; Watkins, Kenneth P

2007-01-01

The CRS1-YhbY domain (also called the CRM domain) is represented as a stand-alone protein in Archaea and Bacteria, and in a family of single- and multidomain proteins in plants. The function of this domain is unknown, but structural data and the presence of the domain in several proteins known to interact with RNA have led to the proposal that it binds RNA. Here we describe a phylogenetic analysis of the domain, its incorporation into diverse proteins in plants, and biochemical properties of a prokaryotic and eukaryotic representative of the domain family. We show that a bacterial member of the family, Escherichia coli YhbY, is associated with pre-50S ribosomal subunits, suggesting that YhbY functions in ribosome assembly. GFP fused to a single-domain CRM protein from maize localizes to the nucleolus, suggesting that an analogous activity may have been retained in plants. We show further that an isolated maize CRM domain has RNA binding activity in vitro, and that a small motif shared with KH RNA binding domains, a conserved "GxxG" loop, contributes to its RNA binding activity. These and other results suggest that the CRM domain evolved in the context of ribosome function prior to the divergence of Archaea and Bacteria, that this function has been maintained in extant prokaryotes, and that the domain was recruited to serve as an RNA binding module during the evolution of plant genomes.

Nuclear γ-tubulin associates with nucleoli and interacts with tumor suppressor protein C53.

Science.gov (United States)

Hořejší, Barbora; Vinopal, Stanislav; Sládková, Vladimíra; Dráberová, Eduarda; Sulimenko, Vadym; Sulimenko, Tetyana; Vosecká, Věra; Philimonenko, Anatoly; Hozák, Pavel; Katsetos, Christos D; Dráber, Pavel

2012-01-01

γ-Tubulin is assumed to be a typical cytosolic protein necessary for nucleation of microtubules from microtubule organizing centers. Using immunolocalization and cell fractionation techniques in combination with siRNAi and expression of FLAG-tagged constructs, we have obtained evidence that γ-tubulin is also present in nucleoli of mammalian interphase cells of diverse cellular origins. Immunoelectron microscopy has revealed γ-tubulin localization outside fibrillar centers where transcription of ribosomal DNA takes place. γ-Tubulin was associated with nucleolar remnants after nuclear envelope breakdown and could be translocated to nucleoli during mitosis. Pretreatment of cells with leptomycin B did not affect the distribution of nuclear γ-tubulin, making it unlikely that rapid active transport via nuclear pores participates in the transport of γ-tubulin into the nucleus. This finding was confirmed by heterokaryon assay and time-lapse imaging of photoconvertible protein Dendra2 tagged to γ-tubulin. Immunoprecipitation from nuclear extracts combined with mass spectrometry revealed an association of γ-tubulin with tumor suppressor protein C53 located at multiple subcellular compartments including nucleoli. The notion of an interaction between γ-tubulin and C53 was corroborated by pull-down and co-immunoprecipitation experiments. Overexpression of γ-tubulin antagonized the inhibitory effect of C53 on DNA damage G(2) /M checkpoint activation. The combined results indicate that aside from its known role in microtubule nucleation, γ-tubulin may also have nuclear-specific function(s). Copyright © 2011 Wiley Periodicals, Inc.

Quantification of alpha-tubulin isotypes by sandwich ELISA with signal amplification through biotinyl-tyramide or immuno-PCR

Czech Academy of Sciences Publication Activity Database

Dráberová, Eduarda; Stegurová, Lucie; Sulimenko, Vadym; Hájková, Zuzana; Dráber, Petr; Dráber, Pavel

2013-01-01

Roč. 395, 1-2 (2013), s. 63-70 ISSN 0022-1759 R&D Projects: GA AV ČR KAN200520701; GA ČR GAP302/12/1673; GA ČR GPP302/11/P709; GA ČR GAP302/10/1759; GA ČR GA301/09/1826; GA MŠk(CZ) LD13015; GA MŠk LD12073 Institutional support: RVO:68378050 Keywords : alpha-tubulin isotypes * biotinyl-tyramide * ELISA * immuno-PCR * mast cells Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.005, year: 2013

18S Ribosomal RNA Evaluation as Preanalytical Quality Control for Animal DNA

Directory of Open Access Journals (Sweden)

Cory Ann Leonard

2016-01-01

Full Text Available The 18S ribosomal RNA (rRNA gene is present in all eukaryotic cells. In this study, we evaluated the use of this gene to verify the presence of PCR-amplifiable host (animal DNA as an indicator of sufficient sample quality for quantitative real-time PCR (qPCR analysis. We compared (i samples from various animal species, tissues, and sample types, including swabs; (ii multiple DNA extraction methods; and (iii both fresh and formalin-fixed paraffin-embedded (FFPE samples. Results showed that 18S ribosomal RNA gene amplification was possible from all tissue samples evaluated, including avian, reptile, and FFPE samples and most swab samples. A single swine rectal swab, which showed sufficient DNA quantity and the demonstrated lack of PCR inhibitors, nonetheless was negative by 18S qPCR. Such a sample specifically illustrates the improvement of determination of sample integrity afforded by inclusion of 18S rRNA gene qPCR analysis in addition to spectrophotometric analysis and the use of internal controls for PCR inhibition. Other possible applications for the described 18S rRNA qPCR are preselection of optimal tissue specimens for studies or preliminary screening of archived samples prior to acceptance for biobanking projects.

Effect of mutations in the A site of 16 S rRNA on aminoglycoside antibiotic-ribosome interaction

DEFF Research Database (Denmark)

Recht, M I; Douthwaite, S; Dahlquist, K D

1999-01-01

antibiotics, which also interact with this region of rRNA. Mutations of certain nucleotides in rRNA reduce aminoglycoside binding affinity, as previously demonstrated using a model RNA oligonucleotide system. Here, predictions from the oligonucleotide system were tested in the ribosome by mutation...... for the aminoglycoside paromomycin, whereas no discernible reduction in affinity was observed with 1406 mutant ribosomes. These data are consistent with prior NMR structural determination of aminoglycoside interaction with the decoding region, and further our understanding of how aminoglycoside resistance can...

Assessing the 5S ribosomal RNA heterogeneity in Arabidopsis thaliana using short RNA next generation sequencing data.

Science.gov (United States)

Szymanski, Maciej; Karlowski, Wojciech M

2016-01-01

In eukaryotes, ribosomal 5S rRNAs are products of multigene families organized within clusters of tandemly repeated units. Accumulation of genomic data obtained from a variety of organisms demonstrated that the potential 5S rRNA coding sequences show a large number of variants, often incompatible with folding into a correct secondary structure. Here, we present results of an analysis of a large set of short RNA sequences generated by the next generation sequencing techniques, to address the problem of heterogeneity of the 5S rRNA transcripts in Arabidopsis and identification of potentially functional rRNA-derived fragments.

The functional half-life of an mRNA depends on the ribosome spacing in an early coding region

DEFF Research Database (Denmark)

Pedersen, Margit; Nissen, Søren; Mitarai, Namiko

2011-01-01

Bacterial mRNAs are translated by closely spaced ribosomes and degraded from the 5'-end, with half-lives of around 2 min at 37 °C in most cases. Ribosome-free or "naked" mRNA is known to be readily degraded, but the initial event that inactivates the mRNA functionally has not been fully described...

Oxidative damage of 18S and 5S ribosomal RNA in digestive gland of mussels exposed to trace metals.

Science.gov (United States)

Kournoutou, Georgia G; Giannopoulou, Panagiota C; Sazakli, Eleni; Leotsinidis, Michel; Kalpaxis, Dimitrios L

2017-11-01

Numerous studies have shown the ability of trace metals to accumulate in marine organisms and cause oxidative stress that leads to perturbations in many important intracellular processes, including protein synthesis. This study is mainly focused on the exploration of structural changes, like base modifications, scissions, and conformational changes, caused in 18S and 5S ribosomal RNA (rRNA) isolated from the mussel Mytilus galloprovincialis exposed to 40μg/L Cu, 30μg/L Hg, or 100μg/L Cd, for 5 or 15days. 18S rRNA and 5S rRNA are components of the small and large ribosomal subunit, respectively, found in complex with ribosomal proteins, translation factors and other auxiliary components (metal ions, toxins etc). 18S rRNA plays crucial roles in all stages of protein synthesis, while 5S rRNA serves as a master signal transducer between several functional regions of 28S rRNA. Therefore, structural changes in these ribosomal constituents could affect the basic functions of ribosomes and hence the normal metabolism of cells. Especially, 18S rRNA along with ribosomal proteins forms the decoding centre that ensures the correct codon-anticodon pairing. As exemplified by ELISA, primer extension analysis and DMS footprinting analysis, each metal caused oxidative damage to rRNA, depending on the nature of metal ion and the duration of exposure. Interestingly, exposure of mussels to Cu or Hg caused structural alterations in 5S rRNA, localized in paired regions and within loops A, B, C, and E, leading to a continuous progressive loss of the 5S RNA structural integrity. In contrast, structural impairments of 5S rRNA in mussels exposed to Cd were accumulating for the initial 5days, and then progressively decreased to almost the normal level by day 15, probably due to the parallel elevation of metallothionein content that depletes the pools of free Cd. Regions of interest in 18S rRNA, such as the decoding centre, sites implicated in the binding of tRNAs (A- and P-sites) or

Mutant forms of Escherichia coli protein L25 unable to bind to 5S rRNA are incorporated efficiently into the ribosome in vivo.

Science.gov (United States)

Anikaev, A Y; Korepanov, A P; Korobeinikova, A V; Kljashtorny, V G; Piendl, W; Nikonov, S V; Garber, M B; Gongadze, G M

2014-08-01

5S rRNA-binding ribosomal proteins of the L25 family are an evolutional acquisition of bacteria. Earlier we showed that (i) single replacements in the RNA-binding module of the protein of this family result in destabilization or complete impossibility to form a complex with 5S rRNA in vitro; (ii) ΔL25 ribosomes of Escherichia coli are less efficient in protein synthesis in vivo than the control ribosomes. In the present work, the efficiency of incorporation of the E. coli protein L25 with mutations in the 5S rRNA-binding region into the ribosome in vivo was studied. It was found that the mutations in L25 that abolish its ability to form the complex with free 5S rRNA do not prevent its correct and efficient incorporation into the ribosome. This is supported by the fact that even the presence of a very weakly retained mutant form of the protein in the ribosome has a positive effect on the activity of the translational machinery in vivo. All this suggests the existence of an alternative incorporation pathway for this protein into the ribosome, excluding the preliminary formation of the complex with 5S rRNA. At the same time, the stable L25-5S rRNA contact is important for the retention of the protein within the ribosome, and the conservative amino acid residues of the RNA-binding module play a key role in this.

The pre-existing population of 5S rRNA effects p53 stabilization during ribosome biogenesis inhibition.

Science.gov (United States)

Onofrillo, Carmine; Galbiati, Alice; Montanaro, Lorenzo; Derenzini, Massimo

2017-01-17

Pre-ribosomal complex RPL5/RPL11/5S rRNA (5S RNP) is considered the central MDM2 inhibitory complex that control p53 stabilization during ribosome biogenesis inhibition. Despite its role is well defined, the dynamic of 5S RNP assembly still requires further characterization. In the present work, we report that MDM2 inhibition is dependent by a pre-existing population of 5S rRNA.

How does a scanning ribosomal particle move along the 5'-untranslated region of eukaryotic mRNA? Brownian Ratchet model.

Science.gov (United States)

Spirin, Alexander S

2009-11-17

A model of the ATP-dependent unidirectional movement of the 43S ribosomal initiation complex (=40S ribosomal subunit + eIF1 + eIF1A + eIF2.GTP.Met-tRNA(i) + eIF3) during scanning of the 5'-untranslated region of eukaryotic mRNA is proposed. The model is based on the principles of molecular Brownian ratchet machines and explains several enigmatic data concerning the scanning complex. In this model, the one-dimensional diffusion of the ribosomal initiation complex along the mRNA chain is rectified into the net-unidirectional 5'-to-3' movement by the Feynman ratchet-and-pawl mechanism. The proposed mechanism is organized by the heterotrimeric protein eIF4F (=eIF4A + eIF4E + eIF4G), attached to the scanning ribosomal particle via eIF3, and the RNA-binding protein eIF4B that is postulated to play the role of the pawl. The energy for the useful work of the ratchet-and-pawl mechanism is supplied from ATP hydrolysis induced by the eIF4A subunit: ATP binding and its hydrolysis alternately change the affinities of eIF4A for eIF4B and for mRNA, resulting in the restriction of backward diffusional sliding of the 43S ribosomal complex along the mRNA chain, while stochastic movements ahead are allowed.

A tubulin alpha 8 mouse knockout model indicates a likely role in spermatogenesis but not in brain development.

Directory of Open Access Journals (Sweden)

Christine P Diggle

Full Text Available Tubulin alpha 8 (Tuba8 is the most divergent member of the highly conserved alpha tubulin family, and uniquely lacks two key post-translational modification sites. It is abundantly expressed in testis and muscle, with lower levels in the brain. We previously identified homozygous hypomorphic TUBA8 mutations in human subjects with a polymicrogyria (PMG syndrome, suggesting its involvement in development of the cerebral cortex. We have now generated and characterized a Tuba8 knockout mouse model. Homozygous mice were confirmed to lack Tuba8 protein in the testis, but did not display PMG and appeared to be neurologically normal. In response to this finding, we re-analyzed the human PMG subjects using whole exome sequencing. This resulted in identification of an additional homozygous loss-of-function mutation in SNAP29, suggesting that SNAP29 deficiency, rather than TUBA8 deficiency, may underlie most or all of the neurodevelopmental anomalies in these subjects. Nonetheless, in the mouse brain, Tuba8 specifically localised to the cerebellar Purkinje cells, suggesting that the human mutations may affect or modify motor control. In the testis, Tuba8 localisation was cell-type specific. It was restricted to spermiogenesis with a strong acrosomal localization that was gradually replaced by cytoplasmic distribution and was absent from spermatozoa. Although the knockout mice were fertile, the localisation pattern indicated that Tuba8 may have a role in spermatid development during spermatogenesis, rather than as a component of the mature microtubule-rich flagellum itself.

Heavy ion effects on yeast: Inhibition of ribosomal RNA synthesis

International Nuclear Information System (INIS)

Weber, K.J.; Schneider, E.; Kiefer, J.; Kraft, G.

1990-01-01

Diploid wild-type yeast cells were exposed to beams of heavy ions covering a wide range of linear energy transfer (LET) (43-13,700 keV/microns). Synthesis of ribosomal RNA (rRNA) was assessed as a functional measure of damage produced by particle radiation. An exponential decrease of relative rRNA synthesis with particle fluence was demonstrated in all cases. The inactivation cross sections derived were found to increase with LET over the entire range of LET studied. The corresponding values for relative biological effectiveness were slightly less than unity. Maximum cross sections measured were close to 1 micron 2, implying that some larger structure within the yeast nucleus (e.g., the nucleolus) might represent the target for an impairment of synthetic activity by very heavy ions rather than the genes coding for rRNA. Where tested, an oxygen effect for rRNA synthesis could not be demonstrated

Processing of the 17-S Escherichia coli precursor RNA in the 27-S pre-ribosomal particle

Energy Technology Data Exchange (ETDEWEB)

Hayes, F; Vasseur, M [Institut de Biologie Physico-Chimique, 75 - Paris (France)

1976-01-01

An RNase activity probably involved in the maturation of 16-S pre-ribosomal RNA in Escherichia coli has been partially purified from crude cell extracts. When 27-S ribosome precursor particles are incubated with this enzyme preparation in vitro, their 17-S RNA is converted to a product with the same electrophoretic mobility as mature 16-S rRNA. FingerprS rRNA. Generation of the normal 5'-P terminus seems to require a factor present in cell extracts since incubation of the 27-S precursor particle in an extract obtained after centrifugation at 30,000 x g causes conversion of the 17-S RNA to a 16-S species containing both termini of mature 16-S rRNS. Preliminary experiments suggest that correct maturation of the 5' end of the 17-S precursor RNA requires a system in which protein synthesis can take place.

Differentiation of the mRNA transcripts originating from the alpha 1- and alpha 2-globin loci in normals and alpha-thalassemics.

OpenAIRE

Liebhaber, S A; Kan, Y W

1981-01-01

The alpha-globin polypeptide is encoded by two adjacent genes, alpha 1 and alpha 2. In the normal diploid state (alpha alpha/alpha alpha) all four alpha-globin genes are expressed. Loss or dysfunction of one or more of these genes leads to deficient alpha-globin production and results in alpha-thalassemia. We present a technique to differentially assess the steady-state levels of the alpha 1- and alpha-2-globin messenger RNA (mRNA) transcripts and thus delineate the relative level of expressi...

YB-1 promotes microtubule assembly in vitro through interaction with tubulin and microtubules

Directory of Open Access Journals (Sweden)

Baconnais Sonia

2008-09-01

Full Text Available Abstract Background YB-1 is a major regulator of gene expression in eukaryotic cells. In addition to its role in transcription, YB-1 plays a key role in translation and stabilization of mRNAs. Results We show here that YB-1 interacts with tubulin and microtubules and stimulates microtubule assembly in vitro. High resolution imaging via electron and atomic force microscopy revealed that microtubules assembled in the presence of YB-1 exhibited a normal single wall ultrastructure and indicated that YB-1 most probably coats the outer microtubule wall. Furthermore, we found that YB-1 also promotes the assembly of MAPs-tubulin and subtilisin-treated tubulin. Finally, we demonstrated that tubulin interferes with RNA:YB-1 complexes. Conclusion These results suggest that YB-1 may regulate microtubule assembly in vivo and that its interaction with tubulin may contribute to the control of mRNA translation.

Detailed analysis of RNA-protein interactions within the bacterial ribosomal protein L5/5S rRNA complex.

OpenAIRE

Perederina, Anna; Nevskaya, Natalia; Nikonov, Oleg; Nikulin, Alexei; Dumas, Philippe; Yao, Min; Tanaka, Isao; Garber, Maria; Gongadze, George; Nikonov, Stanislav

2002-01-01

The crystal structure of ribosomal protein L5 from Thermus thermophilus complexed with a 34-nt fragment comprising helix III and loop C of Escherichia coli 5S rRNA has been determined at 2.5 A resolution. The protein specifically interacts with the bulged nucleotides at the top of loop C of 5S rRNA. The rRNA and protein contact surfaces are strongly stabilized by intramolecular interactions. Charged and polar atoms forming the network of conserved intermolecular hydrogen bonds are located in ...

Molecular characterization of 5S ribosomal RNA genes and transcripts in the protozoan parasite Leishmania major.

Science.gov (United States)

Moreno-Campos, Rodrigo; Florencio-Martínez, Luis E; Nepomuceno-Mejía, Tomás; Rojas-Sánchez, Saúl; Vélez-Ramírez, Daniel E; Padilla-Mejía, Norma E; Figueroa-Angulo, Elisa; Manning-Cela, Rebeca; Martínez-Calvillo, Santiago

2016-12-01

Eukaryotic 5S rRNA, synthesized by RNA polymerase III (Pol III), is an essential component of the large ribosomal subunit. Most organisms contain hundreds of 5S rRNA genes organized into tandem arrays. However, the genome of the protozoan parasite Leishmania major contains only 11 copies of the 5S rRNA gene, which are interspersed and associated with other Pol III-transcribed genes. Here we report that, in general, the number and order of the 5S rRNA genes is conserved between different species of Leishmania. While in most organisms 5S rRNA genes are normally associated with the nucleolus, combined fluorescent in situ hybridization and indirect immunofluorescence experiments showed that 5S rRNA genes are mainly located at the nuclear periphery in L. major. Similarly, the tandemly repeated 5S rRNA genes in Trypanosoma cruzi are dispersed throughout the nucleus. In contrast, 5S rRNA transcripts in L. major were localized within the nucleolus, and scattered throughout the cytoplasm, where mature ribosomes are located. Unlike other rRNA species, stable antisense RNA complementary to 5S rRNA is not detected in L. major.

The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus.

Science.gov (United States)

Hori, H; Osawa, S; Murao, K; Ishikura, H

1980-01-01

The nucleotide sequence of ribosomal 5S RNA from Micrococcus lysodeikticus is pGUUACGGCGGCUAUAGCGUGGGGGAAACGCCCGGCCGUAUAUCGAACCCGGAAGCUAAGCCCCAUAGCGCCGAUGGUUACUGUAACCGGGAGGUUGUGGGAGAGUAGGUCGCCGCCGUGAOH. When compared to other 5S RNAs, the sequence homology is greatest with Thermus aquaticus, and these two 5S RNAs reveal several features intermediate between those of typical gram-positive bacteria and gram-negative bacteria. PMID:6780979

Histone and ribosomal RNA repetitive gene clusters of the boll weevil are linked in a tandem array.

Science.gov (United States)

Roehrdanz, R; Heilmann, L; Senechal, P; Sears, S; Evenson, P

2010-08-01

Histones are the major protein component of chromatin structure. The histone family is made up of a quintet of proteins, four core histones (H2A, H2B, H3 & H4) and the linker histones (H1). Spacers are found between the coding regions. Among insects this quintet of genes is usually clustered and the clusters are tandemly repeated. Ribosomal DNA contains a cluster of the rRNA sequences 18S, 5.8S and 28S. The rRNA genes are separated by the spacers ITS1, ITS2 and IGS. This cluster is also tandemly repeated. We found that the ribosomal RNA repeat unit of at least two species of Anthonomine weevils, Anthonomus grandis and Anthonomus texanus (Coleoptera: Curculionidae), is interspersed with a block containing the histone gene quintet. The histone genes are situated between the rRNA 18S and 28S genes in what is known as the intergenic spacer region (IGS). The complete reiterated Anthonomus grandis histone-ribosomal sequence is 16,248 bp.

mRNA decapping enzyme from ribosomes of Saccharomyces cerevisiae

International Nuclear Information System (INIS)

Stevens, A.

1980-01-01

By use of [ 3 H]methyl-5'-capped [ 14 C]mRNA from yeast as a substrate, a decapping enzyme activity has been detected in enzyme fractions derived from a high salt wash of ribosomes of Saccharomyces cerevisiae. The product of the decapping reaction is [ 3 H]m 7 GDP. That the enzyme is not a non-specific pyrophosphatase is suggested by the finding that the diphosphate product, m 7 GpppA(G), and UDP-glucose are not hydrolyzed

SINA: accurate high-throughput multiple sequence alignment of ribosomal RNA genes.

Science.gov (United States)

Pruesse, Elmar; Peplies, Jörg; Glöckner, Frank Oliver

2012-07-15

In the analysis of homologous sequences, computation of multiple sequence alignments (MSAs) has become a bottleneck. This is especially troublesome for marker genes like the ribosomal RNA (rRNA) where already millions of sequences are publicly available and individual studies can easily produce hundreds of thousands of new sequences. Methods have been developed to cope with such numbers, but further improvements are needed to meet accuracy requirements. In this study, we present the SILVA Incremental Aligner (SINA) used to align the rRNA gene databases provided by the SILVA ribosomal RNA project. SINA uses a combination of k-mer searching and partial order alignment (POA) to maintain very high alignment accuracy while satisfying high throughput performance demands. SINA was evaluated in comparison with the commonly used high throughput MSA programs PyNAST and mothur. The three BRAliBase III benchmark MSAs could be reproduced with 99.3, 97.6 and 96.1 accuracy. A larger benchmark MSA comprising 38 772 sequences could be reproduced with 98.9 and 99.3% accuracy using reference MSAs comprising 1000 and 5000 sequences. SINA was able to achieve higher accuracy than PyNAST and mothur in all performed benchmarks. Alignment of up to 500 sequences using the latest SILVA SSU/LSU Ref datasets as reference MSA is offered at http://www.arb-silva.de/aligner. This page also links to Linux binaries, user manual and tutorial. SINA is made available under a personal use license.

In situ DNA-RNA hybridization using in vitro 125I-labeled ribosomal RNA of higher plant

International Nuclear Information System (INIS)

Sato, Seiichi; Kikuchi, Tadatoshi; Ishida, M.R.; Tanaka, Ryuso.

1975-01-01

In situ hybridization using 125 I-labeled ribosomal RNA was applied to plant cells. Cytoplasmic 25 s rRNA, which was eluted from acrylamide gels after electrophoretic separation, was labeled in vitro with carrier-free 125 I and hybridized with the interphase nuclei in root tips of Vicia faba. In most of the preparations, the nucleoli were more heavily labeled than the other regions within nuclei, and several types of grain distribution were observed on the nucleoli. From these results, it was confirmed that in situ hybridization using 125 I-labeled rRNA can be used very effectively to detect the annealing sites of different molecular species of rRNA within the nuclei of plant cells, for which it is not as easy to obtain high specific radioactive rRNA in vivo as it is in the case of cultured animal cells. (auth.)

Ribosomal synthesis of polylysine from individual lysyl-tRNA/sup Lys/ in the absence of a template

International Nuclear Information System (INIS)

Yusupova, G.Z.; Remme, Y.L.; Belitsina, N.B.; Spirin, A.S.

1987-01-01

Earlier studies showed that ribosomes of Escherichia coli, in the absence of a template, can synthesize oligolysine, using lysyl-tRNA as a substrate. The authors present results on the use of preparations of individual lysyl-tRNA/sup Lys/ and phenylalanyl-tRNA/sup Phe/ in a system of templateless peptide synthesis. For these studies, the authors used ribosomes of E. coli MRE 600, washed four times with 1 M NH 4 Cl with 10 MM MgCl 2 . The purified ribosomes were stored at -70 0 C in standard buffer, containing 20 mM Tris-HCl, 100 mM NH 4 Cl, 10 mM MgCl 2 , 0.1 mM ethylenediamine tetraacetate (EDTA), and 10% glycerin, pH/sub 37 0 C/7.6. A preparation of [ 14 C]lysyl-tRNA/sup Lys/ was produced by affinity chromatography on immobilized factor EF-T/sub u/ from Thermus thermophilus HB8. The elongation factor EF-T/sub u/ from T. thermophilus and immobilized on BrCN-activated Sepharose 4B. The initial preparation of total tRNA of E. coli, enzymatically acylated by [ 14 C]lysine (348 Ci/mole, Amersham), was produced as described earlier. The degree of aminoacylation was 52-59 pmoles [ 14 C]lysine per unit of A 260 of tRNA

Mutations in ribosomal protein L3 and 23S ribosomal RNA at the peptidyl transferase centre are associated with reduced susceptibility to tiamulin in Brachyspira spp. isolates.

Science.gov (United States)

Pringle, Märit; Poehlsgaard, Jacob; Vester, Birte; Long, Katherine S

2004-12-01

The pleuromutilin antibiotic tiamulin binds to the ribosomal peptidyl transferase centre. Three groups of Brachyspira spp. isolates with reduced tiamulin susceptibility were analysed to define resistance mechanisms to the drug. Mutations were identified in genes encoding ribosomal protein L3 and 23S rRNA at positions proximal to the peptidyl transferase centre. In two groups of laboratory-selected mutants, mutations were found at nucleotide positions 2032, 2055, 2447, 2499, 2504 and 2572 of 23S rRNA (Escherichia coli numbering) and at amino acid positions 148 and 149 of ribosomal protein L3 (Brachyspira pilosicoli numbering). In a third group of clinical B. hyodysenteriae isolates, only a single mutation at amino acid 148 of ribosomal protein L3 was detected. Chemical footprinting experiments show a reduced binding of tiamulin to ribosomal subunits from mutants with decreased susceptibility to the drug. This reduction in drug binding is likely the resistance mechanism for these strains. Hence, the identified mutations located near the tiamulin binding site are predicted to be responsible for the resistance phenotype. The positions of the mutated residues relative to the bound drug advocate a model where the mutations affect tiamulin binding indirectly through perturbation of nucleotide U2504.

Translational regulation of ribosomal protein S15 drives characteristic patterns of protein-mRNA epistasis.

Science.gov (United States)

Mallik, Saurav; Basu, Sudipto; Hait, Suman; Kundu, Sudip

2018-04-21

Do coding and regulatory segments of a gene co-evolve with each-other? Seeking answers to this question, here we analyze the case of Escherichia coli ribosomal protein S15, that represses its own translation by specifically binding its messenger RNA (rpsO mRNA) and stabilizing a pseudoknot structure at the upstream untranslated region, thus trapping the ribosome into an incomplete translation initiation complex. In the absence of S15, ribosomal protein S1 recognizes rpsO and promotes translation by melting this very pseudoknot. We employ a robust statistical method to detect signatures of positive epistasis between residue site pairs and find that biophysical constraints of translational regulation (S15-rpsO and S1-rpsO recognition, S15-mediated rpsO structural rearrangement, and S1-mediated melting) are strong predictors of positive epistasis. Transforming the epistatic pairs into a network, we find that signatures of two different, but interconnected regulatory cascades are imprinted in the sequence-space and can be captured in terms of two dense network modules that are sparsely connected to each other. This network topology further reflects a general principle of how functionally coupled components of biological networks are interconnected. These results depict a model case, where translational regulation drives characteristic residue-level epistasis-not only between a protein and its own mRNA but also between a protein and the mRNA of an entirely different protein. © 2018 Wiley Periodicals, Inc.

Sequence characterization of 5S ribosomal RNA from eight gram positive procaryotes

Science.gov (United States)

Woese, C. R.; Luehrsen, K. R.; Pribula, C. D.; Fox, G. E.

1976-01-01

Complete nucleotide sequences are presented for 5S rRNA from Bacillus subtilis, B. firmus, B. pasteurii, B. brevis, Lactobacillus brevis, and Streptococcus faecalis, and 5S rRNA oligonucleotide catalogs and partial sequence data are given for B. cereus and Sporosarcina ureae. These data demonstrate a striking consistency of 5S rRNA primary and secondary structure within a given bacterial grouping. An exception is B. brevis, in which the 5S rRNA sequence varies significantly from that of other bacilli in the tuned helix and the procaryotic loop. The localization of these variations suggests that B. brevis occupies an ecological niche that selects such changes. It is noted that this organism produces antibiotics which affect ribosome function.

The ribosome can prevent aggregation of partially folded protein intermediates: studies using the Escherichia coli ribosome.

Directory of Open Access Journals (Sweden)

Bani Kumar Pathak

Full Text Available BACKGROUND: Molecular chaperones that support de novo folding of proteins under non stress condition are classified as chaperone 'foldases' that are distinct from chaperone' holdases' that provide high affinity binding platform for unfolded proteins and prevent their aggregation specifically under stress conditions. Ribosome, the cellular protein synthesis machine can act as a foldase chaperone that can bind unfolded proteins and release them in folding competent state. The peptidyl transferase center (PTC located in the domain V of the 23S rRNA of Escherichia coli ribosome (bDV RNA is the chaperoning center of the ribosome. It has been proposed that via specific interactions between the RNA and refolding proteins, the chaperone provides information for the correct folding of unfolded polypeptide chains. RESULTS: We demonstrate using Escherichia coli ribosome and variants of its domain V RNA that the ribosome can bind to partially folded intermediates of bovine carbonic anhydrase II (BCAII and lysozyme and suppress aggregation during their refolding. Using mutants of domain V RNA we demonstrate that the time for which the chaperone retains the bound protein is an important factor in determining its ability to suppress aggregation and/or support reactivation of protein. CONCLUSION: The ribosome can behave like a 'holdase' chaperone and has the ability to bind and hold back partially folded intermediate states of proteins from participating in the aggregation process. Since the ribosome is an essential organelle that is present in large numbers in all living cells, this ability of the ribosome provides an energetically inexpensive way to suppress cellular aggregation. Further, this ability of the ribosome might also be crucial in the context that the ribosome is one of the first chaperones to be encountered by a large nascent polypeptide chains that have a tendency to form partially folded intermediates immediately following their synthesis.

Control of ribosome formation in rat heart

International Nuclear Information System (INIS)

Russo, L.A.

1987-01-01

Diabetes of 9 days duration produced a 17% diminution in the rate of total protein synthesis in rat hearts perfused as Langendorff preparations supplied with glucose, plasma levels of amino acids, and 400 μU/ml insulin. This reduction was attributable to a decrease in efficiency of protein synthesis and total RNA content. Total messenger RNA content decreased in diabetic hearts in proportion to the reduction in total RNA. Diabetes also resulted in diminished ribosome content as reflected by the induction in total RNA. Ribosome production was investigated by monitoring incorporation of [ 3 H]phenylalanine into the proteins of cytoplasmic ribosomes. Rates of ribosome formation in diabetic hearts were as fast as control rates in the presence of insulin, and were faster than control rates in the absence of the hormone. These results indicated that ribosome content fell in diabetic hearts despite unchanged or faster rates of ribosome formation

Activation of ribosomal RNA genes in porcine embryos produced in vitro or by somatic cell nuclear transfer

DEFF Research Database (Denmark)

Bjerregaard, Bolette; Pedersen, Hanne Gervi; Jakobsen, Anne Sørig

2007-01-01

The onset of ribosomal RNA (rRNA) synthesis occurs during the second half of the third cell cycle, that is, at the four-cell stage, in porcine embryos developed in vivo. In the present study the onset of rRNA synthesis was investigated in porcine embryos produced in vitro (IVP) or by somatic cell...

Alpha-synuclein suppression by targeted small interfering RNA in the primate substantia nigra.

Directory of Open Access Journals (Sweden)

Alison L McCormack

Full Text Available The protein alpha-synuclein is involved in the pathogenesis of Parkinson's disease and other neurodegenerative disorders. Its toxic potential appears to be enhanced by increased protein expression, providing a compelling rationale for therapeutic strategies aimed at reducing neuronal alpha-synuclein burden. Here, feasibility and safety of alpha-synuclein suppression were evaluated by treating monkeys with small interfering RNA (siRNA directed against alpha-synuclein. The siRNA molecule was chemically modified to prevent degradation by exo- and endonucleases and directly infused into the left substantia nigra. Results compared levels of alpha-synuclein mRNA and protein in the infused (left vs. untreated (right hemisphere and revealed a significant 40-50% suppression of alpha-synuclein expression. These findings could not be attributable to non-specific effects of siRNA infusion since treatment of a separate set of animals with luciferase-targeting siRNA produced no changes in alpha-synuclein. Infusion with alpha-synuclein siRNA, while lowering alpha-synuclein expression, had no overt adverse consequences. In particular, it did not cause tissue inflammation and did not change (i the number and phenotype of nigral dopaminergic neurons, and (ii the concentrations of striatal dopamine and its metabolites. The data represent the first evidence of successful anti-alpha-synuclein intervention in the primate substantia nigra and support further development of RNA interference-based therapeutics.

Eigenvectors determination of the ribosome dynamics model during mRNA translation using the Kleene Star algorithm

Science.gov (United States)

Ernawati; Carnia, E.; Supriatna, A. K.

2018-03-01

Eigenvalues and eigenvectors in max-plus algebra have the same important role as eigenvalues and eigenvectors in conventional algebra. In max-plus algebra, eigenvalues and eigenvectors are useful for knowing dynamics of the system such as in train system scheduling, scheduling production systems and scheduling learning activities in moving classes. In the translation of proteins in which the ribosome move uni-directionally along the mRNA strand to recruit the amino acids that make up the protein, eigenvalues and eigenvectors are used to calculate protein production rates and density of ribosomes on the mRNA. Based on this, it is important to examine the eigenvalues and eigenvectors in the process of protein translation. In this paper an eigenvector formula is given for a ribosome dynamics during mRNA translation by using the Kleene star algorithm in which the resulting eigenvector formula is simpler and easier to apply to the system than that introduced elsewhere. This paper also discusses the properties of the matrix {B}λ \\otimes n of model. Among the important properties, it always has the same elements in the first column for n = 1, 2,… if the eigenvalue is the time of initiation, λ = τin , and the column is the eigenvector of the model corresponding to λ.

Post-transcriptional regulation of ribosome biogenesis in yeast

Directory of Open Access Journals (Sweden)

Isabelle C. Kos-Braun

2017-05-01

Full Text Available Most microorganisms are exposed to the constantly and often rapidly changing environment. As such they evolved mechanisms to balance their metabolism and energy expenditure with the resources available to them. When resources become scarce or conditions turn out to be unfavourable for growth, cells reduce their metabolism and energy usage to survive. One of the major energy consuming processes in the cell is ribosome biogenesis. Unsurprisingly, cells encountering adverse conditions immediately shut down production of new ribosomes. It is well established that nutrient depletion leads to a rapid repression of transcription of the genes encoding ribosomal proteins, ribosome biogenesis factors as well as ribosomal RNA (rRNA. However, if pre-rRNA processing and ribosome assembly are regulated post-transcriptionally remains largely unclear. We have recently uncovered that the yeast Saccharomyces cerevisiae rapidly switches between two alternative pre-rRNA processing pathways depending on the environmental conditions. Our findings reveal a new level of complexity in the regulation of ribosome biogenesis.

Cellular localization of transforming growth factor-alpha mRNA in rat forebrain.

Science.gov (United States)

Seroogy, K B; Lundgren, K H; Lee, D C; Guthrie, K M; Gall, C M

1993-05-01

The cellular localization of transforming growth factor-alpha (TGF alpha) mRNA in juvenile and adult rat forebrain was examined using in situ hybridization with a 35S-labeled cRNA probe. TGF alpha cRNA-labeled neuronal perikarya were distributed across many forebrain regions including the olfactory bulb, caudate-putamen, nucleus accumbens, olfactory tubercle, ventral pallidum, amygdala, hippocampal stratum granulosum and CA3 stratum pyramidale, and piriform, entorhinal, and retrosplenial cortices. TGF alpha cRNA-hybridizing cells were also localized to several thalamic nuclei and to the suprachiasmatic, dorsomedial, and ventromedial nuclei of the hypothalamus. In addition, labeled cells were present in regions of white matter including the corpus callosum, anterior commissure, internal and external capsules, optic tract, and lateral olfactory tract. Thus, both neurons and glia appear to synthesize TGF alpha in normal brain. Hybridization densities were greater in neuronal fields at 2 weeks of age compared with the adult, suggesting a role for TGF alpha in the development of several forebrain systems. Our results demonstrating the prominent and wide-spread expression of TGF alpha mRNA in forebrain, combined with the extremely low abundance of epidermal growth factor mRNA in brain, support the argument that TGF alpha is the principal endogenous ligand for the epidermal growth factor receptor in normal brain.

Nanoimages show disruption of tubulin polymerization by chlorpyrifos oxon: Implications for neurotoxicity

International Nuclear Information System (INIS)

Grigoryan, Hasmik; Lockridge, Oksana

2009-01-01

Organophosphorus agents cause cognitive deficits and depression in some people. We hypothesize that the mechanism by which organophosphorus agents cause these disorders is by modification of proteins in the brain. One such protein could be tubulin. Tubulin polymerizes to make the microtubules that transport cell components to nerve axons. The goal of the present work was to measure the effect of the organophosphorus agent chlorpyrifos oxon on tubulin polymerization. An additional goal was to identify the amino acids covalently modified by chlorpyrifos oxon in microtubule polymers and to compare them to the amino acids modified in unpolymerized tubulin dimers. Purified bovine tubulin (0.1 mM) was treated with 0.005-0.1 mM chlorpyrifos oxon for 30 min at room temperature and then polymerized by addition of 1 mM GTP to generate microtubules. Microtubules were visualized by atomic force microscopy. Chlorpyrifos oxon-modified residues were identified by tandem ion trap electrospray ionization and matrix-assisted laser desorption/ionization mass spectrometry of tryptic peptides. Nanoimaging showed that low concentrations (0.005 and 0.01 mM) of chlorpyrifos oxon yielded short, thin microtubules. A concentration of 0.025 mM stimulated polymerization, while high concentrations (0.05 and 0.1 mM) caused aggregation. Of the 17 tyrosines covalently modified by chlorpyrifos oxon in unpolymerized tubulin dimers, only 2 tyrosines were labeled in polymerized microtubules. The two labeled tyrosines in polymerized tubulin were Tyr 103 in EDAANNY*R of alpha tubulin, and Tyr 281 in GSQQY*R of beta tubulin. In conclusion, chlorpyrifos oxon binding to tubulin disrupts tubulin polymerization. These results may lead to an understanding of the neurotoxicity of organophosphorus agents.

The Circadian Clock Modulates Global Daily Cycles of mRNA Ribosome Loading[OPEN

Science.gov (United States)

Missra, Anamika; Ernest, Ben; Jia, Qidong; Ke, Kenneth

2015-01-01

Circadian control of gene expression is well characterized at the transcriptional level, but little is known about diel or circadian control of translation. Genome-wide translation state profiling of mRNAs in Arabidopsis thaliana seedlings grown in long day was performed to estimate ribosome loading per mRNA. The experiments revealed extensive translational regulation of key biological processes. Notably, translation of mRNAs for ribosomal proteins and mitochondrial respiration peaked at night. Central clock mRNAs are among those subject to fluctuations in ribosome loading. There was no consistent phase relationship between peak translation states and peak transcript levels. The overlay of distinct transcriptional and translational cycles can be expected to alter the waveform of the protein synthesis rate. Plants that constitutively overexpress the clock gene CCA1 showed phase shifts in peak translation, with a 6-h delay from midnight to dawn or from noon to evening being particularly common. Moreover, cycles of ribosome loading that were detected under continuous light in the wild type collapsed in the CCA1 overexpressor. Finally, at the transcript level, the CCA1-ox strain adopted a global pattern of transcript abundance that was broadly correlated with the light-dark environment. Altogether, these data demonstrate that gene-specific diel cycles of ribosome loading are controlled in part by the circadian clock. PMID:26392078

Ribosomal history reveals origins of modern protein synthesis.

Directory of Open Access Journals (Sweden)

Ajith Harish

Full Text Available The origin and evolution of the ribosome is central to our understanding of the cellular world. Most hypotheses posit that the ribosome originated in the peptidyl transferase center of the large ribosomal subunit. However, these proposals do not link protein synthesis to RNA recognition and do not use a phylogenetic comparative framework to study ribosomal evolution. Here we infer evolution of the structural components of the ribosome. Phylogenetic methods widely used in morphometrics are applied directly to RNA structures of thousands of molecules and to a census of protein structures in hundreds of genomes. We find that components of the small subunit involved in ribosomal processivity evolved earlier than the catalytic peptidyl transferase center responsible for protein synthesis. Remarkably, subunit RNA and proteins coevolved, starting with interactions between the oldest proteins (S12 and S17 and the oldest substructure (the ribosomal ratchet in the small subunit and ending with the rise of a modern multi-subunit ribosome. Ancestral ribonucleoprotein components show similarities to in vitro evolved RNA replicase ribozymes and protein structures in extant replication machinery. Our study therefore provides important clues about the chicken-or-egg dilemma associated with the central dogma of molecular biology by showing that ribosomal history is driven by the gradual structural accretion of protein and RNA structures. Most importantly, results suggest that functionally important and conserved regions of the ribosome were recruited and could be relics of an ancient ribonucleoprotein world.

Affinity labelling of ribosomes from the livers of different vertebrates by 2-nitro-4-azidobenzoyl-Phe-tRNA

International Nuclear Information System (INIS)

Stahl, J.; Boehm, H.; Voderberg, M.

1981-01-01

Ribosomal protein L 10 from the livers of trout, hen, and rat was found to be the main target for 2-nitro-4-azidobenzoyl-Phe-tRNA in affinity labelling experiments. Therefore, despite somewhat different electrophoretic mobilities, this protein seems to be involved in the organization of the peptidyl transferase centre in ribosomes of various vertebrates. (author)

Highly divergent 16S rRNA sequences in ribosomal operons of Scytonema hyalinum (Cyanobacteria.

Directory of Open Access Journals (Sweden)

Jeffrey R Johansen

Full Text Available A highly divergent 16S rRNA gene was found in one of the five ribosomal operons present in a species complex currently circumscribed as Scytonema hyalinum (Nostocales, Cyanobacteria using clone libraries. If 16S rRNA sequence macroheterogeneity among ribosomal operons due to insertions, deletions or truncation is excluded, the sequence heterogeneity observed in S. hyalinum was the highest observed in any prokaryotic species thus far (7.3-9.0%. The secondary structure of the 16S rRNA molecules encoded by the two divergent operons was nearly identical, indicating possible functionality. The 23S rRNA gene was examined for a few strains in this complex, and it was also found to be highly divergent from the gene in Type 2 operons (8.7%, and likewise had nearly identical secondary structure between the Type 1 and Type 2 operons. Furthermore, the 16S-23S ITS showed marked differences consistent between operons among numerous strains. Both operons have promoter sequences that satisfy consensus requirements for functional prokaryotic transcription initiation. Horizontal gene transfer from another unknown heterocytous cyanobacterium is considered the most likely explanation for the origin of this molecule, but does not explain the ultimate origin of this sequence, which is very divergent from all 16S rRNA sequences found thus far in cyanobacteria. The divergent sequence is highly conserved among numerous strains of S. hyalinum, suggesting adaptive advantage and selective constraint of the divergent sequence.

Control of Ribosome Synthesis in Escherichia coli

DEFF Research Database (Denmark)

Molin, Søren; Meyenburg, K. von; Måløe, O.

1977-01-01

The rate of ribosome synthesis and accumulation in Escherichia coli during the transition after an energy source shift-down was analyzed. The shift was imposed on cultures of stringent and relaxed strains growing in glucose minimal medium by the addition of the glucose analogue {alpha...... and to estimate the transcription time for the rRNA operon under different conditions. In steady states of growth with growth rates ranging from 0.75 to 2.3 doublings/h, as well as during the transition after a shift-down, the transcription time of the rRNA operon was constant. The rate of synthesis of r......RNA correlated during this transition – in contrast to the rate of accumulation (M. T. Hansen et al., J. Bacteriol. 122: 585-591, 1975) – with the ppGpp pool in the same way as has been observed during partial amino acid starvation....

Identification and role of functionally important motifs in the 970 loop of Escherichia coli 16S ribosomal RNA.

Science.gov (United States)

Saraiya, Ashesh A; Lamichhane, Tek N; Chow, Christine S; SantaLucia, John; Cunningham, Philip R

2008-02-22

The 970 loop (helix 31) of Escherichia coli 16S ribosomal RNA contains two modified nucleotides, m(2)G966 and m(5)C967. Positions A964, A969, and C970 are conserved among the Bacteria, Archaea, and Eukarya. The nucleotides present at positions 965, 966, 967, 968, and 971, however, are only conserved and unique within each domain. All organisms contain a modified nucleoside at position 966, but the type of the modification is domain specific. Biochemical and structure studies have placed this loop near the P site and have shown it to be involved in the decoding process and in binding the antibiotic tetracycline. To identify the functional components of this ribosomal RNA hairpin, the eight nucleotides of the 970 loop of helix 31 were subjected to saturation mutagenesis and 107 unique functional mutants were isolated and analyzed. Nonrandom nucleotide distributions were observed at each mutated position among the functional isolates. Nucleotide identity at positions 966 and 969 significantly affects ribosome function. Ribosomes with single mutations of m(2)G966 or m(5)C967 produce more protein in vivo than do wild-type ribosomes. Overexpression of initiation factor 3 specifically restored wild-type levels of protein synthesis to the 966 and 967 mutants, suggesting that modification of these residues is important for initiation factor 3 binding and for the proper initiation of protein synthesis.

Increased efficiency of exogenous messenger RNA translation in a Krebs ascites cell lysate.

Science.gov (United States)

Metafora, S; Terada, M; Dow, L W; Marks, P A; Bank, A

1972-05-01

Addition of a 0.5 M KCl wash fraction from rabbit reticulocyte ribosomes causes a 3- to 10-fold increase in the extent of translation of natural mRNAs by Krebs-cell lysates. In the presence of the wash fraction, 1 pmol of rabbit or mouse 10S RNA directs the incorporation of 80 pmol of leucine into rabbit globin. The addition of human 10S RNA results in the synthesis of equal amounts of human alpha and beta chains, identified by column chromatography. The stimulation by the wash fraction is almost completely dependent on added mammalian tRNA. In contrast to the wash fraction from rabbit reticulocytes, the wash fraction isolated from Krebs-cell ribosomes is inhibitory to both endogenous and exogenous mRNA translation. The stimulation by the wash fraction from rabbit ribosomes is not specific for globin mRNAs, but also increases endogenous, phage Qbeta, and viral RNA-directed protein synthesis.

A Deconvolution Protocol for ChIP-Seq Reveals Analogous Enhancer Structures on the Mouse and Human Ribosomal RNA Genes

Directory of Open Access Journals (Sweden)

Jean-Clement Mars

2018-01-01

Full Text Available The combination of Chromatin Immunoprecipitation and Massively Parallel Sequencing, or ChIP-Seq, has greatly advanced our genome-wide understanding of chromatin and enhancer structures. However, its resolution at any given genetic locus is limited by several factors. In applying ChIP-Seq to the study of the ribosomal RNA genes, we found that a major limitation to resolution was imposed by the underlying variability in sequence coverage that very often dominates the protein–DNA interaction profiles. Here, we describe a simple numerical deconvolution approach that, in large part, corrects for this variability, and significantly improves both the resolution and quantitation of protein–DNA interaction maps deduced from ChIP-Seq data. This approach has allowed us to determine the in vivo organization of the RNA polymerase I preinitiation complexes that form at the promoters and enhancers of the mouse (Mus musculus and human (Homo sapiens ribosomal RNA genes, and to reveal a phased binding of the HMG-box factor UBF across the rDNA. The data identify and map a “Spacer Promoter” and associated stalled polymerase in the intergenic spacer of the human ribosomal RNA genes, and reveal a very similar enhancer structure to that found in rodents and lower vertebrates.

FcepsilonRI-alpha siRNA inhibits the antigen-induced activation of mast cells.

Science.gov (United States)

Safaralizadeh, Reza; Soheili, Zahra-Soheila; Deezagi, Abdolkhaleg; Pourpak, Zahra; Samiei, Shahram; Moin, Mostafa

2009-12-01

FcepsilonRI, The high affinity receptor for IgE plays a critical role in triggering the allergic reactions. It is responsible for inducing mast cell degranulation and deliberation of allergy mediators when it is aggregated by allergen and IgE complexes. FcepsilonRI on the mast cells consists of three subunits; alpha chain directly binds IgE, beta chain and dimmer of gamma chains together mediate intracellular signaling. Cross-linking of IgE-bound FcepsilonRI on the surface of mast cells and basophils by the multivalent antigen induces release of chemical mediators. The present in vitro study was designed to investigate the effect of synthetic FcepsilonRI-alpha siRNA on the antigen-induced activation of MC/9 cells. MC/9 cells which are murine mast cells were transfected by FcepsilonRI-alpha siRNA and negative control siRNA. After 6 h, anti-DNP (Dinitrophenyl) IgE was used for the cells sensitization. Then the cells were challenged with Dinitrophenyl-Human Serum Albumin (DNP-HSA) for mast cell degranulation induction before collection of supernatants. The amount of mRNA and protein expression was measured by Real Time PCR and western blot analysis, respectively. Determination of the expression rate of FcepsilonRI-alpha on cell surface was achieved by flow cytometry. ELISA and spectrophotometry methods were used subsequently for measuring the effects of FcepsilonRI-alpha siRNA on antigen-induced histamine and beta-hexosaminidase release. FcepsilonRI-alpha siRNA treated cells showed significant decrease in FcepsilonRI-alpha mRNA and protein expression in comparison to control cells. FcepsilonRI-mediated mast cell release of beta-hexosaminidase and histamine were also inhibited. In this study it was shown that FcepsilonRI-alpha siRNA could suppress FcepsilonRI-alpha expression and inhibited degranulation and histamine release in antigen-stimulated MC/9 cells. In conclusion, knock-down of FcepsilonRI-alpha by siRNA could be a promising method for inhibition of the mast

Selective inhibition of precursor incorporation into ribosomal RNA in gamma-irradiated Tetrahymena pyriformis

International Nuclear Information System (INIS)

Ernst, S.G.; Oleinick, N.L.; Rustad, R.C.; Greenblatt, R.M.

1979-01-01

Sublethal doses of γ radiation are known to inhibit total RNA synthesis in the ciliate protozoan Tetrahymena. To determine if the synthesis of a particular class of RNA is preferentially inhibited, pulse-labeled RNA was isolated from normal exponentially growing cells, irradiated cells, and cells in which total RNA synthesis had recovered to the pre-irradiation level. The RNAs were analyzed by SDS-polyacrylamide gel electrphoresis and oligo(dT)-cellulose column chromatography. Inhibition of RNA synthesis primarily involves ribosomal RNA. However, radiation does not cause a delay in the processing of precursor rRNA or a preferential loss of either of the mature rRNAs. Following irradiation, poly(A)-containing RNA [poly(A+)RNA] is synthesized at a rate up to three times greater than the control rate. The elevated poly(A+)RNA synthesis occurs during the period of depressed rRNA synthesis and even after rRNA synthesis has recovered to its pre-irradiation rate. While the sizes of the total cellular ribonucleoside triphosphate pools are depressed in the irradiated cells, these pools probably do not represent the actual compartments containing the precursors for RNA synthesis, and the observed changes cannot explain the modifications in macromolecular synthesis in irradiated Tetrahymena. (Auth.)

Inhibition by Siomycin and Thiostrepton of Both Aminoacyl-tRNA and Factor G Binding to Ribosomes

Science.gov (United States)

Ll, Juan Modole; Cabrer, Bartolomé; Parmeggiani, Andrea; Azquez, David V

1971-01-01

Siomycin, a peptide antibiotic that interacts with the 50S ribosomal subunit and inhibits binding of factor G, is shown also to inhibit binding of aminoacyl-tRNA; however, it does not impair binding of fMet-tRNA and completion of the initiation complex. Moreover, unlike other inhibitors of aminoacyl-tRNA binding (tetracycline, sparsomycin, and streptogramin A), siomycin completely abolishes the GTPase activity associated with the binding of aminoacyl-tRNA catalyzed by factor Tu. A single-site interaction of siomycin appears to be responsible for its effect on both the binding of the aminoacyl-tRNA-Tu-GTP complex and that of factor G. PMID:4331558

An approach to analyse the specific impact of rapamycin on mRNA-ribosome association

Directory of Open Access Journals (Sweden)

Jaquier-Gubler Pascale

2008-08-01

Full Text Available Abstract Background Recent work, using both cell culture model systems and tumour derived cell lines, suggests that the differential recruitment into polysomes of mRNA populations may be sufficient to initiate and maintain tumour formation. Consequently, a major effort is underway to use high density microarray profiles to establish molecular fingerprints for cells exposed to defined drug regimes. The aim of these pharmacogenomic approaches is to provide new information on how drugs can impact on the translational read-out within a defined cellular background. Methods We describe an approach that permits the analysis of de-novo mRNA-ribosome association in-vivo during short drug exposures. It combines hypertonic shock, polysome fractionation and high-throughput analysis to provide a molecular phenotype of translationally responsive transcripts. Compared to previous translational profiling studies, the procedure offers increased specificity due to the elimination of the drugs secondary effects (e.g. on the transcriptional read-out. For this pilot "proof-of-principle" assay we selected the drug rapamycin because of its extensively studied impact on translation initiation. Results High throughput analysis on both the light and heavy polysomal fractions has identified mRNAs whose re-recruitment onto free ribosomes responded to short exposure to the drug rapamycin. The results of the microarray have been confirmed using real-time RT-PCR. The selective down-regulation of TOP transcripts is also consistent with previous translational profiling studies using this drug. Conclusion The technical advance outlined in this manuscript offers the possibility of new insights into mRNA features that impact on translation initiation and provides a molecular fingerprint for transcript-ribosome association in any cell type and in the presence of a range of drugs of interest. Such molecular phenotypes defined pre-clinically may ultimately impact on the evaluation of

Characterization of the regions from E. coli 16 S RNA covalently linked to ribosomal proteins S4 and S20 after ultraviolet irradiation

International Nuclear Information System (INIS)

Ehresmann, B.; Backendorf, C.; Ehresmann, C.; Ebel, J.P.

1977-01-01

The use of ultraviolet irradiation to form photochemical covalent bonds between the 16 S RNA and a ribosomal protein is a reliable method to check RNA regions which are interacting with the protein. This technique was successfully used to covalently link RNA or DNA and specific proteins in several cases. In the case of ribosome, it has been shown that the irradiation of 30 S and 50 S subunits using high doses of ultraviolet light allowed the covalent binding of almost all of the ribosomal proteins to the 16 S or 23 S RNAs. Using mild conditions, only proteins S7 and L4 could be covalently linked to the 16 S and 23 S RNAs, respectively, and the 16 S RNA region linked to protein S7 has now been characterized. The specificity of the photoreaction was demonstrated earlier and the tryptic peptides from proteins S4 and S7, photochemically linked to the 16 S RNA complexes, were identified. A report is presented on the sequences of the RNA regions which can be photochemically linked to proteins S4 and S7 after ultraviolet irradiation of the specific S4-16 S RNA and 20 S-16 S RNA complexes

Naked mole-rat has increased translational fidelity compared with the mouse, as well as a unique 28S ribosomal RNA cleavage.

Science.gov (United States)

Azpurua, Jorge; Ke, Zhonghe; Chen, Iris X; Zhang, Quanwei; Ermolenko, Dmitri N; Zhang, Zhengdong D; Gorbunova, Vera; Seluanov, Andrei

2013-10-22

The naked mole-rat (Heterocephalus glaber) is a subterranean eusocial rodent with a markedly long lifespan and resistance to tumorigenesis. Multiple data implicate modulation of protein translation in longevity. Here we report that 28S ribosomal RNA (rRNA) of the naked mole-rat is processed into two smaller fragments of unequal size. The two breakpoints are located in the 28S rRNA divergent region 6 and excise a fragment of 263 nt. The excised fragment is unique to the naked mole-rat rRNA and does not show homology to other genomic regions. Because this hidden break site could alter ribosome structure, we investigated whether translation rate and amino acid incorporation fidelity were altered. We report that naked mole-rat fibroblasts have significantly increased translational fidelity despite having comparable translation rates with mouse fibroblasts. Although we cannot directly test whether the unique 28S rRNA structure contributes to the increased fidelity of translation, we speculate that it may change the folding or dynamics of the large ribosomal subunit, altering the rate of GTP hydrolysis and/or interaction of the large subunit with tRNA during accommodation, thus affecting the fidelity of protein synthesis. In summary, our results show that naked mole-rat cells produce fewer aberrant proteins, supporting the hypothesis that the more stable proteome of the naked mole-rat contributes to its longevity.

Crystallization of ribosomes from Thermus thermophilus

International Nuclear Information System (INIS)

Karpova, E.A.; Serdyuk, I.N.; Tarkhovskii, Yu.S.; Orlova, E.V.; Borovyagin, V.L.

1987-01-01

An understanding of the molecular bases of the process of protein biosynthesis on the ribosome requires a knowledge of its structure with high three-dimensional resolution involving the method of x-ray crystallographic analysis. The authors report on the production of crystals of the 70S ribosomes from a new source - the highly thermophilic bacterium Thermus thermophilus. Ribosomes for crystallization were obtained from Th. thermophilus strain HB8 by two washings in buffer with high ionic strength. The ribosome preparation was investigated for homogeneity by the method of high-speed sedimentation in a buffer containing 15 mM MgCl 2 , 50 mM NH 4 Cl, and 10 MM Tris-HCl, pH 7.5. Analysis showed that the preparation if homogeneous. The same preparation was investigated for intactness of ribosomal RNA by the method of gel electrophoresis in 2.75% acrylamide 0.5% agarose gel in a buffer containing 30 mM Tris, 30 mM NaH 2 PO 4 , 10 mM EDTA, 1-2% SDS, and 6 M urea. Analysis showed that the preparation possesses intact 16S and 23S RNA. The latter did not degrade, at least in a week of exposure of the ribosomes in buffer solution at 5 0 C. The ribosome preparation had no appreciable RNase activity, which was verified by incubating 4.5 micrograms of ribosomes with 3 micrograms of 14 C-labeled 16S rRna (50 0 C, 90 min) in a buffer containing 10 mM MgCl 2 , 100 mM NH 4 Cl, and 10 mM Tris-HCl, pH/sub 20 0 / 7.5. The incubated nonhydrolyzed RNA was precipitated with 5% trichloroacetic acid and applied on a GF/C filter. The radioactivity was determined in a toluene scintillator on an LS-100C counter

High-resolution microscopy of active ribosomal genes and key members of the rRNA processing machinery inside nucleolus-like bodies of fully-grown mouse oocytes.

Science.gov (United States)

Shishova, Kseniya V; Khodarovich, Yuriy M; Lavrentyeva, Elena A; Zatsepina, Olga V

2015-10-01

Nucleolus-like bodies (NLBs) of fully-grown (germinal vesicle, GV) mammalian oocytes are traditionally considered as morphologically distinct entities, which, unlike normal nucleoli, contain transcribed ribosomal genes (rDNA) solely at their surface. In the current study, we for the first time showed that active ribosomal genes are present not only on the surface but also inside NLBs of the NSN-type oocytes. The "internal" rRNA synthesis was evidenced by cytoplasmic microinjections of BrUTP as precursor and by fluorescence in situ hybridization with a probe to the short-lived 5'ETS segment of the 47S pre-rRNA. We further showed that in the NLB mass of NSN-oocytes, distribution of active rDNA, RNA polymerase I (UBF) and rRNA processing (fibrillarin) protein factors, U3 snoRNA, pre-rRNAs and 18S/28S rRNAs is remarkably similar to that in somatic nucleoli capable to make pre-ribosomes. Overall, these observations support the occurrence of rDNA transcription, rRNA processing and pre-ribosome assembly in the NSN-type NLBs and so that their functional similarity to normal nucleoli. Unlike the NSN-type NLBs, the NLBs of more mature SN-oocytes do not contain transcribed rRNA genes, U3 snoRNA, pre-rRNAs, 18S and 28S rRNAs. These results favor the idea that in a process of transformation of NSN-oocytes to SN-oocytes, NLBs cease to produce pre-ribosomes and, moreover, lose their rRNAs. We also concluded that a denaturing fixative 70% ethanol used in the study to fix oocytes could be more appropriate for light microscopy analysis of nucleolar RNAs and proteins in mammalian fully-grown oocytes than a commonly used cross-linking aldehyde fixative, formalin. Copyright © 2015 Elsevier Inc. All rights reserved.

Structural basis for ribosome protein S1 interaction with RNA in trans-translation of Mycobacterium tuberculosis.

Science.gov (United States)

Fan, Yi; Dai, Yazhuang; Hou, Meijing; Wang, Huilin; Yao, Hongwei; Guo, Chenyun; Lin, Donghai; Liao, Xinli

2017-05-27

Ribosomal protein S1 (RpsA), the largest 30S protein in ribosome, plays a significant role in translation and trans-translation. In Mycobacterium tuberculosis, the C-terminus of RpsA is known as tuberculosis drug target of pyrazinoic acid, which inhibits the interaction between MtRpsA and tmRNA in trans-translation. However, the molecular mechanism underlying the interaction of MtRpsA with tmRNA remains unknown. We herein analyzed the interaction of the C-terminal domain of MtRpsA with three RNA fragments poly(A), sMLD and pre-sMLD. NMR titration analysis revealed that the RNA binding sites on MtRpsA CTD are mainly located in the β2, β3 and β5 strands and the adjacent L3 loop of the S1 domain. Fluorescence experiments determined the MtRpsA CTD binding to RNAs are in the micromolar affinity range. Sequence analysis also revealed conserved residues in the mapped RNA binding region. Residues L304, V305, G308, F310, H322, I323, R357 and I358 were verified to be the key residues influencing the interaction between MtRpsA CTD and pre-sMLD. Molecular docking further confirmed that the poly(A)-like sequence and sMLD of tmRNA are all involved in the protein-RNA interaction, through charged interaction and hydrogen bonds. The results will be beneficial for designing new anti-tuberculosis drugs. Copyright © 2017 Elsevier Inc. All rights reserved.

In Profile: Models of Ribosome Biogenesis Defects and Regulation of Protein Synthesis

NARCIS (Netherlands)

Essers, P.B.M.

2013-01-01

Ribosomes are the mediators of protein synthesis in the cell and therefore crucial to proper cell function. In addition, ribosomes are highly abundant, with ribosomal RNA making up 80% of the RNA in the cell. A large amount of resources go into maintaining this pool of ribosomes, so ribosome

Hierarchical recruitment of ribosomal proteins and assembly factors remodels nucleolar pre-60S ribosomes.

Science.gov (United States)

Biedka, Stephanie; Micic, Jelena; Wilson, Daniel; Brown, Hailey; Diorio-Toth, Luke; Woolford, John L

2018-04-24

Ribosome biogenesis involves numerous preribosomal RNA (pre-rRNA) processing events to remove internal and external transcribed spacer sequences, ultimately yielding three mature rRNAs. Removal of the internal transcribed spacer 2 spacer RNA is the final step in large subunit pre-rRNA processing and begins with endonucleolytic cleavage at the C 2 site of 27SB pre-rRNA. C 2 cleavage requires the hierarchical recruitment of 11 ribosomal proteins and 14 ribosome assembly factors. However, the function of these proteins in C 2 cleavage remained unclear. In this study, we have performed a detailed analysis of the effects of depleting proteins required for C 2 cleavage and interpreted these results using cryo-electron microscopy structures of assembling 60S subunits. This work revealed that these proteins are required for remodeling of several neighborhoods, including two major functional centers of the 60S subunit, suggesting that these remodeling events form a checkpoint leading to C 2 cleavage. Interestingly, when C 2 cleavage is directly blocked by depleting or inactivating the C 2 endonuclease, assembly progresses through all other subsequent steps. © 2018 Biedka et al.

Promoter-wide hypermethylation of the ribosomal RNA gene promoter in the suicide brain.

Directory of Open Access Journals (Sweden)

Patrick O McGowan

Full Text Available BACKGROUND: Alterations in gene expression in the suicide brain have been reported and for several genes DNA methylation as an epigenetic regulator is thought to play a role. rRNA genes, that encode ribosomal RNA, are the backbone of the protein synthesis machinery and levels of rRNA gene promoter methylation determine rRNA transcription. METHODOLOGY/PRINCIPAL FINDINGS: We test here by sodium bisulfite mapping of the rRNA promoter and quantitative real-time PCR of rRNA expression the hypothesis that epigenetic differences in critical loci in the brain are involved in the pathophysiology of suicide. Suicide subjects in this study were selected for a history of early childhood neglect/abuse, which is associated with decreased hippocampal volume and cognitive impairments. rRNA was significantly hypermethylated throughout the promoter and 5' regulatory region in the brain of suicide subjects, consistent with reduced rRNA expression in the hippocampus. This difference in rRNA methylation was not evident in the cerebellum and occurred in the absence of genome-wide changes in methylation, as assessed by nearest neighbor. CONCLUSIONS/SIGNIFICANCE: This is the first study to show aberrant regulation of the protein synthesis machinery in the suicide brain. The data implicate the epigenetic modulation of rRNA in the pathophysiology of suicide.

Cell Death-Associated Ribosomal RNA Cleavage in Postmortem Tissues and Its Forensic Applications.

Science.gov (United States)

Kim, Ji Yeon; Kim, Yunmi; Cha, Hyo Kyeong; Lim, Hye Young; Kim, Hyungsub; Chung, Sooyoung; Hwang, Juck-Joon; Park, Seong Hwan; Son, Gi Hoon

2017-06-30

Estimation of postmortem interval (PMI) is a key issue in the field of forensic pathology. With the availability of quantitative analysis of RNA levels in postmortem tissues, several studies have assessed the postmortem degradation of constitutively expressed RNA species to estimate PMI. However, conventional RNA quantification as well as biochemical and physiological changes employed thus far have limitations related to standardization or normalization. The present study focuses on an interesting feature of the subdomains of certain RNA species, in which they are site-specifically cleaved during apoptotic cell death. We found that the D8 divergent domain of ribosomal RNA (rRNA) bearing cell death-related cleavage sites was rapidly removed during postmortem RNA degradation. In contrast to the fragile domain, the 5' terminal region of 28S rRNA was remarkably stable during the postmortem period. Importantly, the differences in the degradation rates between the two domains in mammalian 28S rRNA were highly proportional to increasing PMI with a significant linear correlation observed in mice as well as human autopsy tissues. In conclusion, we demonstrate that comparison of the degradation rates between domains of a single RNA species provides quantitative information on postmortem degradation states, which can be applied for the estimation of PMI.

The pleuromutilin drugs tiamulin and valnemulin bind to the RNA at the peptidyl transferase centre on the ribosome.

Science.gov (United States)

Poulsen, S M; Karlsson, M; Johansson, L B; Vester, B

2001-09-01

The pleuromutilin antibiotic derivatives, tiamulin and valnemulin, inhibit protein synthesis by binding to the 50S ribosomal subunit of bacteria. The action and binding site of tiamulin and valnemulin was further characterized on Escherichia coli ribosomes. It was revealed that these drugs are strong inhibitors of peptidyl transferase and interact with domain V of 23S RNA, giving clear chemical footprints at nucleotides A2058-9, U2506 and U2584-5. Most of these nucleotides are highly conserved phylogenetically and functionally important, and all of them are at or near the peptidyl transferase centre and have been associated with binding of several antibiotics. Competitive footprinting shows that tiamulin and valnemulin can bind concurrently with the macrolide erythromycin but compete with the macrolide carbomycin, which is a peptidyl transferase inhibitor. We infer from these and previous results that tiamulin and valnemulin interact with the rRNA in the peptidyl transferase slot on the ribosomes in which they prevent the correct positioning of the CCA-ends of tRNAs for peptide transfer.

MMB-GUI: a fast morphing method demonstrates a possible ribosomal tRNA translocation trajectory.

Science.gov (United States)

Tek, Alex; Korostelev, Andrei A; Flores, Samuel Coulbourn

2016-01-08

Easy-to-use macromolecular viewers, such as UCSF Chimera, are a standard tool in structural biology. They allow rendering and performing geometric operations on large complexes, such as viruses and ribosomes. Dynamical simulation codes enable modeling of conformational changes, but may require considerable time and many CPUs. There is an unmet demand from structural and molecular biologists for software in the middle ground, which would allow visualization combined with quick and interactive modeling of conformational changes, even of large complexes. This motivates MMB-GUI. MMB uses an internal-coordinate, multiscale approach, yielding as much as a 2000-fold speedup over conventional simulation methods. We use Chimera as an interactive graphical interface to control MMB. We show how this can be used for morphing of macromolecules that can be heterogeneous in biopolymer type, sequence, and chain count, accurately recapitulating structural intermediates. We use MMB-GUI to create a possible trajectory of EF-G mediated gate-passing translocation in the ribosome, with all-atom structures. This shows that the GUI makes modeling of large macromolecules accessible to a wide audience. The morph highlights similarities in tRNA conformational changes as tRNA translocates from A to P and from P to E sites and suggests that tRNA flexibility is critical for translocation completion. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

Miscoding-induced stalling of substrate translocation on the bacterial ribosome.

Science.gov (United States)

Alejo, Jose L; Blanchard, Scott C

2017-10-10

Directional transit of the ribosome along the messenger RNA (mRNA) template is a key determinant of the rate and processivity of protein synthesis. Imaging of the multistep translocation mechanism using single-molecule FRET has led to the hypothesis that substrate movements relative to the ribosome resolve through relatively long-lived late intermediates wherein peptidyl-tRNA enters the P site of the small ribosomal subunit via reversible, swivel-like motions of the small subunit head domain within the elongation factor G (GDP)-bound ribosome complex. Consistent with translocation being rate-limited by recognition and productive engagement of peptidyl-tRNA within the P site, we now show that base-pairing mismatches between the peptidyl-tRNA anticodon and the mRNA codon dramatically delay this rate-limiting, intramolecular process. This unexpected relationship between aminoacyl-tRNA decoding and translocation suggests that miscoding antibiotics may impact protein synthesis by impairing the recognition of peptidyl-tRNA in the small subunit P site during EF-G-catalyzed translocation. Strikingly, we show that elongation factor P (EF-P), traditionally known to alleviate ribosome stalling at polyproline motifs, can efficiently rescue translocation defects arising from miscoding. These findings help reveal the nature and origin of the rate-limiting steps in substrate translocation on the bacterial ribosome and indicate that EF-P can aid in resuming translation elongation stalled by miscoding errors.

Affinity labelling in situ of the bL12 protein on E. coli 70S ribosomes by means of a tRNA dialdehyde derivative.

Science.gov (United States)

Hountondji, Codjo; Créchet, Jean-Bernard; Le Caër, Jean-Pierre; Lancelot, Véronique; Cognet, Jean A H; Baouz, Soria

2017-12-01

In this report, we have used periodate-oxidized tRNA (tRNAox) as an affinity laleling reagent to demonstrate that: (i) the bL12 protein contacts the CCA-arm of P-site bound tRNA on the Escherichia coli 70S ribosomes; (ii) the stoichiometry of labelling is one molecule of tRNAox bound to one polypeptide chain of endogenous bL12; (iii) cross-linking in situ of bL12 with tRNAox on the ribosomes provokes the loss of activity; (iv) intact tRNA protects bL12 in the 70S ribosomes against cross-linking with tRNAox; (v) both tRNAox and pyridoxal 5'-phosphate (PLP) compete for the same or for proximal cross-linking site(s) on bL12 inside the ribosome; (vi) the stoichiometry of cross-linking of PLP to the recombinant E. coli bL12 protein is one molecule of PLP covalently bound per polypeptide chain; (vii) the amino acid residue of recombinant bL12 cross-linked with PLP is Lys-65; (viii) Lys-65 of E. coli bL12 corresponds to Lys-53 of eL42 which was previously shown to cross-link with P-site bound tRNAox on human 80S ribosomes in situ; (ix) finally, E. coli bL12 and human eL42 proteins display significant primary structure similarities, which argues for evolutionary conservation of these two proteins located at the tRNA-CCA binding site on eubacterial and eukaryal ribosomes. © The Authors 2017. Published by Oxford University Press on behalf of the Japanese Biochemical Society. All rights reserved.

Ribosomal RNA and nucleolar proteins from the oocyte are to some degree used for embryonic nucleolar formation in cattle and pig

DEFF Research Database (Denmark)

Maddox-Hyttel, Poul; Svarcova, Olga; Laurincik, Josef

2007-01-01

The nucleolus is the site of ribosomal RNA (rRNA) and ribosome production. In the bovine primordial follicle oocyte, this organelle is inactive, but in the secondary follicle an active fibrillo-granular nucleolus develops and proteins involved in rDNA transcription (topoisomerase I, RNA polymerase...... I and upstream binding factor) and early (fibrillarin) or late rRNA processing (nucleolin and nucleophosmin) localize to it. At the end of the oocyte growth phase, the nucleolus is inactivated again and transforms into a solid remnant. The nucleolar remnant is dissolved when meiosis is resumed. Upon...... fertilization, structures resembling the nucleolar remnant, now referred to as nucleolus precursor bodies (NPBs), are established in the pronuclei. These entities are engaged in the re-establishment of fibrilo-granular nucleoli at the major activation of the embryonic genome. This nucleolar formation can...

The pleuromutilin drugs tiamulin and valnemulin bind to the RNA at the peptidyl transferase centre on the ribosome

DEFF Research Database (Denmark)

Poulsen, S M; Karlsson, M; Johansson, L B

2001-01-01

The pleuromutilin antibiotic derivatives, tiamulin and valnemulin, inhibit protein synthesis by binding to the 50S ribosomal subunit of bacteria. The action and binding site of tiamulin and valnemulin was further characterized on Escherichia coli ribosomes. It was revealed that these drugs...... centre and have been associated with binding of several antibiotics. Competitive footprinting shows that tiamulin and valnemulin can bind concurrently with the macrolide erythromycin but compete with the macrolide carbomycin, which is a peptidyl transferase inhibitor. We infer from these and previous...... results that tiamulin and valnemulin interact with the rRNA in the peptidyl transferase slot on the ribosomes in which they prevent the correct positioning of the CCA-ends of tRNAs for peptide transfer....

A review on architecture of the gag-pol ribosomal frameshifting RNA in human immunodeficiency virus: a variability survey of virus genotypes.

Science.gov (United States)

Qiao, Qi; Yan, Yanhua; Guo, Jinmei; Du, Shuqiang; Zhang, Jiangtao; Jia, Ruyue; Ren, Haimin; Qiao, Yuanbiao; Li, Qingshan

2017-06-01

Programmed '-1' ribosomal frameshifting is necessary for expressing the pol gene overlapped from a gag of human immunodeficiency virus. A viral RNA structure that requires base pairing across the overlapping sequence region suggests a mechanism of regulating ribosome and helicase traffic during expression. To get precise roles of an element around the frameshift site, a review on architecture of the frameshifting RNA is performed in combination of reported information with augments of a representative set of 19 viral samples. In spite of a different length for the viral RNAs, a canonical comparison on the element sequence allocation is performed for viewing variability associations between virus genotypes. Additionally, recent and historical insights recognized in frameshifting regulation are looked back as for indel and single nucleotide polymorphism of RNA. As specially noted, structural changes at a frameshift site, the spacer sequence, and a three-helix junction element, as well as two Watson-Crick base pairs near a bulge and a C-G pair close a loop, are the most vital strategies for the virus frameshifting regulations. All of structural changes, which are dependent upon specific sequence variations, facilitate an elucidation about the RNA element conformation-dependent mechanism for frameshifting. These facts on disrupting base pair interactions also allow solving the problem of competition between ribosome and helicase on a same RNA template, common to single-stranded RNA viruses. In a broad perspective, each new insight of frameshifting regulation in the competition systems introduced by the RNA element construct changes will offer a compelling target for antiviral therapy.

Selection of mRNA 5'-untranslated region sequence with high translation efficiency through ribosome display

International Nuclear Information System (INIS)

Mie, Masayasu; Shimizu, Shun; Takahashi, Fumio; Kobatake, Eiry

2008-01-01

The 5'-untranslated region (5'-UTR) of mRNAs functions as a translation enhancer, promoting translation efficiency. Many in vitro translation systems exhibit a reduced efficiency in protein translation due to decreased translation initiation. The use of a 5'-UTR sequence with high translation efficiency greatly enhances protein production in these systems. In this study, we have developed an in vitro selection system that favors 5'-UTRs with high translation efficiency using a ribosome display technique. A 5'-UTR random library, comprised of 5'-UTRs tagged with a His-tag and Renilla luciferase (R-luc) fusion, were in vitro translated in rabbit reticulocytes. By limiting the translation period, only mRNAs with high translation efficiency were translated. During translation, mRNA, ribosome and translated R-luc with His-tag formed ternary complexes. They were collected with translated His-tag using Ni-particles. Extracted mRNA from ternary complex was amplified using RT-PCR and sequenced. Finally, 5'-UTR with high translation efficiency was obtained from random 5'-UTR library

Ribosomal RNA gene sequences confirm that protistan endoparasite of larval cod Gadus morhua is Ichthyodinium sp

DEFF Research Database (Denmark)

Skovgaard, Alf; Meyer, Stefan; Overton, Julia Lynne

2010-01-01

An enigmatic protistan endoparasite found in eggs and larvae of cod Gadus morhua and turbot Psetta maxima was isolated from Baltic cod larvae, and DNA was extracted for sequencing of the parasite's small Subunit ribosomal RNA (SSU rRNA) gene. The endoparasite has previously been suggested...... to be related to Ichthyodinium chabelardi, a dinoflagellate-like protist that parasitizes yolk sacs of embryos and larvae of a variety of fish species. Comparison of a 1535 bp long fragment of the SSU rRNA gene of the cod endoparasite showed absolute identify with I. chabelardi, demonstrating that the 2...

In vitro degradation of ribosomes.

Science.gov (United States)

Mora, G; Rivas, A

1976-12-01

The cytoplasmic ribosomes from Euglena gracilis var. bacillaris are found to be of two types taking into consideration their stability "in vitro". In the group of unstable ribosomes the large subunit is degraded. The other group apparently does not suffer any degradation under the conditions described. However the RNAs extracted from both types of ribosomes are degraded during sucrose density gradients. The degradation of the largest RNA species has been reported previously, but no comment has been made about the stability of the ribosome itself.

Karyopherin alpha2 is essential for rRNA transcription and protein synthesis in proliferative keratinocytes.

Directory of Open Access Journals (Sweden)

Noriko Umegaki-Arao

Full Text Available Karyopherin proteins mediate nucleocytoplasmic trafficking and are critical for protein and RNA subcellular localization. Recent studies suggest KPNA2 expression is induced in tumor cells and is strongly associated with prognosis, although the precise roles and mechanisms of KPNA2 overexpression in proliferative disorders have not been defined. We found that KPNA2 expression is induced in various proliferative disorders of the skin such as psoriasis, Bowen's disease, actinic keratosis, squamous cell carcinoma, Paget's disease, Merkel cell carcinoma, and mycosis fungoides. siRNA-mediated KPNA suppression revealed that KPNA2 is essential for significant suppression of HaCaT proliferation under starvation conditions. Ribosomal RNA transcription and protein synthesis were suppressed by starvation combined with knockdown of KPNA (including KPNA2 expression. KPNA2 localized to the nucleolus and interacted with proteins associated with mRNA processing, ribonucleoprotein complex biogenesis, chromatin modification, and transcription, as demonstrated by tandem affinity purification and mass spectrometry. KPNA2 may be an important promoter of ribosomal RNA and protein synthesis in tumor cells.

Structure of Ribosomal Silencing Factor Bound to Mycobacterium tuberculosis Ribosome.

Science.gov (United States)

Li, Xiaojun; Sun, Qingan; Jiang, Cai; Yang, Kailu; Hung, Li-Wei; Zhang, Junjie; Sacchettini, James C

2015-10-06

The ribosomal silencing factor RsfS slows cell growth by inhibiting protein synthesis during periods of diminished nutrient availability. The crystal structure of Mycobacterium tuberculosis (Mtb) RsfS, together with the cryo-electron microscopy (EM) structure of the large subunit 50S of Mtb ribosome, reveals how inhibition of protein synthesis by RsfS occurs. RsfS binds to the 50S at L14, which, when occupied, blocks the association of the small subunit 30S. Although Mtb RsfS is a dimer in solution, only a single subunit binds to 50S. The overlap between the dimer interface and the L14 binding interface confirms that the RsfS dimer must first dissociate to a monomer in order to bind to L14. RsfS interacts primarily through electrostatic and hydrogen bonding to L14. The EM structure shows extended rRNA density that it is not found in the Escherichia coli ribosome, the most striking of these being the extended RNA helix of H54a. Copyright © 2015 Elsevier Ltd. All rights reserved.

Ribosomal studies on the 70S ribosome of E.coli by means of neutron scattering

International Nuclear Information System (INIS)

Burkhardt, N.

1997-01-01

Ribosomes are ribonucleo-protein complexes, which catalyse proteinbiosynthesis in all living organisms. Currently, most of the structural models of the prokaryotic 70S ribosome rely on electron microscopy and describe mainly the outer shape of the particle. Neutron scattering can provide information on the internal structure of the ribosome. Parts of the structure can be contrasted for neutrons by means of an isotopic exchange of the naturally occurring hydrogen ( 1 H) for deuterium ( 2 H), allowing direct measurements in situ. Specifically deuterium-labeled ribosomes (E. coli) were prepared and analysed with neutron scattering. The biochemical methods were established and combined to a generally applicable preparation system. This allows labeling of all ribosomal components in any combination. A systematic analysis of the protein and RNA phases resulted in the development of a new model for the 70S ribosome. This model describes not only the outer shape of the particle, but displays also an experimentally determined internal protein-RNA distribution and the border of subunits for the first time (four-phase model; resolution: 50A). Models of the 70S ribosome from other studies were evaluated and ranked according to consistency with the measured scattering data. Applying a new neutron scattering technique of particular sensitivity, the proton-spin contrast-variation, single proteins could be measured and localized. The positions of the proteins S6 and S10 were determined, providing the first coordinates of protein mass centers within the 70S ribosome. (orig.) [de

Engineered ribosomal RNA operon copy-number variants of E. coli reveal the evolutionary trade-offs shaping rRNA operon number

Science.gov (United States)

Gyorfy, Zsuzsanna; Draskovits, Gabor; Vernyik, Viktor; Blattner, Frederick F.; Gaal, Tamas; Posfai, Gyorgy

2015-01-01

Ribosomal RNA (rrn) operons, characteristically present in several copies in bacterial genomes (7 in E. coli), play a central role in cellular physiology. We investigated the factors determining the optimal number of rrn operons in E. coli by constructing isogenic variants with 5–10 operons. We found that the total RNA and protein content, as well as the size of the cells reflected the number of rrn operons. While growth parameters showed only minor differences, competition experiments revealed a clear pattern: 7–8 copies were optimal under conditions of fluctuating, occasionally rich nutrient influx and lower numbers were favored in stable, nutrient-limited environments. We found that the advantages of quick adjustment to nutrient availability, rapid growth and economic regulation of ribosome number all contribute to the selection of the optimal rrn operon number. Our results suggest that the wt rrn operon number of E. coli reflects the natural, ‘feast and famine’ life-style of the bacterium, however, different copy numbers might be beneficial under different environmental conditions. Understanding the impact of the copy number of rrn operons on the fitness of the cell is an important step towards the creation of functional and robust genomes, the ultimate goal of synthetic biology. PMID:25618851

Rationalization of paclitaxel insensitivity of yeast β-tubulin and human βIII-tubulin isotype using principal component analysis

Directory of Open Access Journals (Sweden)

Das Lalita

2012-08-01

Full Text Available Abstract Background The chemotherapeutic agent paclitaxel arrests cell division by binding to the hetero-dimeric protein tubulin. Subtle differences in tubulin sequences, across eukaryotes and among β-tubulin isotypes, can have profound impact on paclitaxel-tubulin binding. To capture the experimentally observed paclitaxel-resistance of human βIII tubulin isotype and yeast β-tubulin, within a common theoretical framework, we have performed structural principal component analyses of β-tubulin sequences across eukaryotes. Results The paclitaxel-resistance of human βIII tubulin isotype and yeast β-tubulin uniquely mapped on to the lowest two principal components, defining the paclitaxel-binding site residues of β-tubulin. The molecular mechanisms behind paclitaxel-resistance, mediated through key residues, were identified from structural consequences of characteristic mutations that confer paclitaxel-resistance. Specifically, Ala277 in βIII isotype was shown to be crucial for paclitaxel-resistance. Conclusions The present analysis captures the origin of two apparently unrelated events, paclitaxel-insensitivity of yeast tubulin and human βIII tubulin isotype, through two common collective sequence vectors.

Placeholder factors in ribosome biogenesis: please, pave my way

Directory of Open Access Journals (Sweden)

Francisco J. Espinar-Marchena

2017-04-01

Full Text Available The synthesis of cytoplasmic eukaryotic ribosomes is an extraordinarily energy-demanding cellular activity that occurs progressively from the nucleolus to the cytoplasm. In the nucleolus, precursor rRNAs associate with a myriad of trans-acting factors and some ribosomal proteins to form pre-ribosomal particles. These factors include snoRNPs, nucleases, ATPases, GTPases, RNA helicases, and a vast list of proteins with no predicted enzymatic activity. Their coordinate activity orchestrates in a spatiotemporal manner the modification and processing of precursor rRNAs, the rearrangement reactions required for the formation of productive RNA folding intermediates, the ordered assembly of the ribosomal proteins, and the export of pre-ribosomal particles to the cytoplasm; thus, providing speed, directionality and accuracy to the overall process of formation of translation-competent ribosomes. Here, we review a particular class of trans-acting factors known as “placeholders”. Placeholder factors temporarily bind selected ribosomal sites until these have achieved a structural context that is appropriate for exchanging the placeholder with another site-specific binding factor. By this strategy, placeholders sterically prevent premature recruitment of subsequently binding factors, premature formation of structures, avoid possible folding traps, and act as molecular clocks that supervise the correct progression of pre-ribosomal particles into functional ribosomal subunits. We summarize the current understanding of those factors that delay the assembly of distinct ribosomal proteins or subsequently bind key sites in pre-ribosomal particles. We also discuss recurrent examples of RNA-protein and protein-protein mimicry between rRNAs and/or factors, which have clear functional implications for the ribosome biogenesis pathway.

Archaeal origin of tubulin

Directory of Open Access Journals (Sweden)

Yutin Natalya

2012-03-01

Full Text Available Abstract Tubulins are a family of GTPases that are key components of the cytoskeleton in all eukaryotes and are distantly related to the FtsZ GTPase that is involved in cell division in most bacteria and many archaea. Among prokaryotes, bona fide tubulins have been identified only in bacteria of the genus Prosthecobacter. These bacterial tubulin genes appear to have been horizontally transferred from eukaryotes. Here we describe tubulins encoded in the genomes of thaumarchaeota of the genus Nitrosoarchaeum that we denote artubulins Phylogenetic analysis results are compatible with the origin of eukaryotic tubulins from artubulins. These findings expand the emerging picture of the origin of key components of eukaryotic functional systems from ancestral forms that are scattered among the extant archaea. Reviewers This article was reviewed by Gáspár Jékely and J. Peter Gogarten.

Combinations of ERK and p38 MAPK inhibitors ablate tumor necrosis factor-alpha (TNF-alpha ) mRNA induction. Evidence for selective destabilization of TNF-alpha transcripts.

Science.gov (United States)

Rutault, K; Hazzalin, C A; Mahadevan, L C

2001-03-02

Tumor necrosis factor-alpha (TNF-alpha) is a potent proinflammatory cytokine whose synthesis and secretion are implicated in diverse pathologies. Hence, inhibition of TNF-alpha transcription or translation and neutralization of its protein product represent major pharmaceutical strategies to control inflammation. We have studied the role of ERK and p38 mitogen-activated protein (MAP) kinase in controlling TNF-alpha mRNA levels in differentiated THP-1 cells and in freshly purified human monocytes. We show here that it is possible to produce virtually complete inhibition of lipopolysaccharide-stimulated TNF-alpha mRNA accumulation by using a combination of ERK and p38 MAP kinase inhibitors. Furthermore, substantial inhibition is achievable using combinations of 1 microm of each inhibitor, whereas inhibitors used individually are incapable of producing complete inhibition even at high concentrations. Finally, addressing mechanisms involved, we show that inhibition of p38 MAP kinase selectively destabilizes TNF-alpha transcripts but does not affect degradation of c-jun transcripts. These results impinge on the controversy in the literature surrounding the mode of action of MAP kinase inhibitors on TNF-alpha mRNA and suggest the use of combinations of MAP kinase inhibitors as an effective anti-inflammatory strategy.

The AAA-ATPase NVL2 is a component of pre-ribosomal particles that interacts with the DExD/H-box RNA helicase DOB1

International Nuclear Information System (INIS)

Nagahama, Masami; Yamazoe, Takeshi; Hara, Yoshimitsu; Tani, Katsuko; Tsuji, Akihiko; Tagaya, Mitsuo

2006-01-01

Nuclear VCP/p97-like protein 2 (NVL2) is a member of the chaperone-like AAA-ATPase family with two conserved ATP-binding modules. Our previous studies have shown that NVL2 is localized to the nucleolus by interacting with ribosomal protein L5 and may participate in ribosome synthesis, a process involving various non-ribosomal factors including chaperones and RNA helicases. Here, we show that NVL2 is associated with pre-ribosomal particles in the nucleus. Moreover, we used yeast two-hybrid and co-immunoprecipitation assays to identify an NVL2-interacting protein that could yield insights into NVL2 function in ribosome biogenesis. We found that NVL2 interacts with DOB1, a DExD/H-box RNA helicase, whose yeast homologue functions in a late stage of the 60S subunit synthesis. DOB1 can interact with a second ATP-binding module mutant of NVL2, which shows a dominant negative effect on ribosome synthesis. In contrast, it cannot interact with a first ATP-binding module mutant, which does not show the dominant negative effect. When the dominant negative mutant of NVL2 was overexpressed in cells, DOB1 appeared to remain associated with nuclear pre-ribosomal particles. Such accumulation was not observed upon overexpression of wild-type NVL2 or a nondominant-negative mutant. Taken together, our results suggest that NVL2 might regulate the association/dissociation reaction of DOB1 with pre-ribosomal particles by acting as a molecular chaperone

5SRNAdb: an information resource for 5S ribosomal RNAs.

Science.gov (United States)

Szymanski, Maciej; Zielezinski, Andrzej; Barciszewski, Jan; Erdmann, Volker A; Karlowski, Wojciech M

2016-01-04

Ribosomal 5S RNA (5S rRNA) is the ubiquitous RNA component found in the large subunit of ribosomes in all known organisms. Due to its small size, abundance and evolutionary conservation 5S rRNA for many years now is used as a model molecule in studies on RNA structure, RNA-protein interactions and molecular phylogeny. 5SRNAdb (http://combio.pl/5srnadb/) is the first database that provides a high quality reference set of ribosomal 5S RNAs (5S rRNA) across three domains of life. Here, we give an overview of new developments in the database and associated web tools since 2002, including updates to database content, curation processes and user web interfaces. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

Ribosomal studies on the 70S ribosome of E.coli by means of neutron scattering; Strukturuntersuchungen am 70S-Ribosom von E.coli unter Anwendung von Neutronenstreuung

Energy Technology Data Exchange (ETDEWEB)

Burkhardt, N. [GKSS-Forschungszentrum Geesthacht GmbH (Germany). Inst. fuer Werkstofforschung

1997-12-31

Ribosomes are ribonucleo-protein complexes, which catalyse proteinbiosynthesis in all living organisms. Currently, most of the structural models of the prokaryotic 70S ribosome rely on electron microscopy and describe mainly the outer shape of the particle. Neutron scattering can provide information on the internal structure of the ribosome. Parts of the structure can be contrasted for neutrons by means of an isotopic exchange of the naturally occurring hydrogen ({sup 1}H) for deuterium ({sup 2}H), allowing direct measurements in situ. Specifically deuterium-labeled ribosomes (E. coli) were prepared and analysed with neutron scattering. The biochemical methods were established and combined to a generally applicable preparation system. This allows labeling of all ribosomal components in any combination. A systematic analysis of the protein and RNA phases resulted in the development of a new model for the 70S ribosome. This model describes not only the outer shape of the particle, but displays also an experimentally determined internal protein-RNA distribution and the border of subunits for the first time (four-phase model; resolution: 50A). Models of the 70S ribosome from other studies were evaluated and ranked according to consistency with the measured scattering data. Applying a new neutron scattering technique of particular sensitivity, the proton-spin contrast-variation, single proteins could be measured and localized. The positions of the proteins S6 and S10 were determined, providing the first coordinates of protein mass centers within the 70S ribosome. (orig.) [Deutsch] Ribosomen sind Ribonukleinsaeure-Protein Komplexe, die in allen lebenden Organismen die Proteinbiosynthese katalysieren. Strukturmodelle fuer das prokaryontische 70S-Ribosom beruhen derzeit vorwiegend auf elektronenmikroskopischen Untersuchungen und beschreiben im wesentlichen die aeussere Oberflaeche des Partikels. Informationen ueber die innere Struktur des Ribosoms koennen Messungen mit

Ribosomal studies on the 70S ribosome of E.coli by means of neutron scattering; Strukturuntersuchungen am 70S-Ribosom von E.coli unter Anwendung von Neutronenstreuung

Energy Technology Data Exchange (ETDEWEB)

Burkhardt, N [GKSS-Forschungszentrum Geesthacht GmbH (Germany). Inst. fuer Werkstofforschung

1998-12-31

Ribosomes are ribonucleo-protein complexes, which catalyse proteinbiosynthesis in all living organisms. Currently, most of the structural models of the prokaryotic 70S ribosome rely on electron microscopy and describe mainly the outer shape of the particle. Neutron scattering can provide information on the internal structure of the ribosome. Parts of the structure can be contrasted for neutrons by means of an isotopic exchange of the naturally occurring hydrogen ({sup 1}H) for deuterium ({sup 2}H), allowing direct measurements in situ. Specifically deuterium-labeled ribosomes (E. coli) were prepared and analysed with neutron scattering. The biochemical methods were established and combined to a generally applicable preparation system. This allows labeling of all ribosomal components in any combination. A systematic analysis of the protein and RNA phases resulted in the development of a new model for the 70S ribosome. This model describes not only the outer shape of the particle, but displays also an experimentally determined internal protein-RNA distribution and the border of subunits for the first time (four-phase model; resolution: 50A). Models of the 70S ribosome from other studies were evaluated and ranked according to consistency with the measured scattering data. Applying a new neutron scattering technique of particular sensitivity, the proton-spin contrast-variation, single proteins could be measured and localized. The positions of the proteins S6 and S10 were determined, providing the first coordinates of protein mass centers within the 70S ribosome. (orig.) [Deutsch] Ribosomen sind Ribonukleinsaeure-Protein Komplexe, die in allen lebenden Organismen die Proteinbiosynthese katalysieren. Strukturmodelle fuer das prokaryontische 70S-Ribosom beruhen derzeit vorwiegend auf elektronenmikroskopischen Untersuchungen und beschreiben im wesentlichen die aeussere Oberflaeche des Partikels. Informationen ueber die innere Struktur des Ribosoms koennen Messungen mit

Studies on the catalytic rate constant of ribosomal peptidyltransferase.

Science.gov (United States)

Synetos, D; Coutsogeorgopoulos, C

1987-02-20

A detailed kinetic analysis of a model reaction for the ribosomal peptidyltransferase is described, using fMet-tRNA or Ac-Phe-tRNA as the peptidyl donor and puromycin as the acceptor. The initiation complex (fMet-tRNA X AUG X 70 S ribosome) or (Ac-Phe-tRNA X poly(U) X 70 S ribosome) (complex C) is isolated and then reacted with excess puromycin (S) to give fMet-puromycin or Ac-Phe-puromycin. This reaction (puromycin reaction) is first order at all concentrations of S tested. An important asset of this kinetic analysis is the fact that the relationship between the first order rate constant kobs and [S] shows hyperbolic saturation and that the value of kobs at saturating [S] is a measure of the catalytic rate constant (k cat) of peptidyltransferase in the puromycin reaction. With fMet-tRNA as the donor, this kcat of peptidyltransferase is 8.3 min-1 when the 0.5 M NH4Cl ribosomal wash is present, compared to 3.8 min-1 in its absence. The kcat of peptidyltransferase is 2.0 min-1 when Ac-Phe-tRNA replaces fMet-tRNA in the presence of the ribosomal wash and decreases to 0.8 min-1 in its absence. This kinetic procedure is the best method available for evaluating changes in the activity of peptidyltransferase in vitro. The results suggest that peptidyltransferase is subjected to activation by the binding of fMet-tRNA to the 70 S initiation complex.

Interactive domains in the molecular chaperone human alphaB crystallin modulate microtubule assembly and disassembly.

Directory of Open Access Journals (Sweden)

Joy G Ghosh

2007-06-01

Full Text Available Small heat shock proteins regulate microtubule assembly during cell proliferation and in response to stress through interactions that are poorly understood.Novel functions for five interactive sequences in the small heat shock protein and molecular chaperone, human alphaB crystallin, were investigated in the assembly/disassembly of microtubules and aggregation of tubulin using synthetic peptides and mutants of human alphaB crystallin.The interactive sequence (113FISREFHR(120 exposed on the surface of alphaB crystallin decreased microtubule assembly by approximately 45%. In contrast, the interactive sequences, (131LTITSSLSSDGV(142 and (156ERTIPITRE(164, corresponding to the beta8 strand and the C-terminal extension respectively, which are involved in complex formation, increased microtubule assembly by approximately 34-45%. The alphaB crystallin peptides, (113FISREFHR(120 and (156ERTIPITRE(164, inhibited microtubule disassembly by approximately 26-36%, and the peptides (113FISREFHR(120 and (131LTITSSLSSDGV(142 decreased the thermal aggregation of tubulin by approximately 42-44%. The (131LTITSSLSSDGV(142 and (156ERTIPITRE(164 peptides were more effective than the widely used anti-cancer drug, Paclitaxel, in modulating tubulinmicrotubule dynamics. Mutagenesis of these interactive sequences in wt human alphaB crystallin confirmed the effects of the alphaB crystallin peptides on microtubule assembly/disassembly and tubulin aggregation. The regulation of microtubule assembly by alphaB crystallin varied over a narrow range of concentrations. The assembly of microtubules was maximal at alphaB crystallin to tubulin molar ratios between 1:4 and 2:1, while molar ratios >2:1 inhibited microtubule assembly.Interactive sequences on the surface of human alphaB crystallin collectively modulate microtubule assembly through a dynamic subunit exchange mechanism that depends on the concentration and ratio of alphaB crystallin to tubulin. These are the first

Structural and functional implications in the eubacterial ribosome as revealed by protein-rRNA and antibiotic contact sites.

Science.gov (United States)

Wittmann-Liebold, B; Uhlein, M; Urlaub, H; Müller, E C; Otto, A; Bischof, O

1995-01-01

Contact sites between protein and rRNA in 30S and 50S ribosomal subunits of Escherichia coli and Bacillus stearothermophilus were investigated at the molecular level using UV and 2-iminothiolane as cross-linkers. Thirteen ribosomal proteins (S3, S4, S7, S14, S17, L2, L4, L6, L14, L27, L28, L29, and L36) from these organisms were cross-linked in direct contact with the RNAs, and the peptide stretches as well as amino acids involved were identified. Further, the binding sites of puromycin and spiramycin were established at the peptide level in several proteins that were found to constitute the antibiotic-binding sites. Peptide stretches of puromycin binding were identified from proteins S7, S14, S18, L18, AND L29; those of spiramycin attachment were derived from proteins S12, S14, L17, L18, L27, and L35. Comparison of the RNA-peptide contact sites with the peptides identified for antibiotic binding and with those altered in antibiotic-resistant mutants clearly showed identical peptide areas to be involved and, hence, demonstrated the functional importance of these peptides. Further evidence for a functional implication of ribosomal proteins in the translational process came from complementation experiments in which protein L2 from Halobacterium marismortui was incorporated into the E. coli ribosomes that were active. The incorporated protein was present in 50S subunits and 70S particles, in disomes, and in higher polysomes. These results clearly demonstrate the functional implication of protein L2 in protein biosynthesis. Incorporation studies with a mutant of HmaL2 with a replacement of histidine-229 by glycine completely abolished the functional activity of the ribosome. Accordingly, protein L2 with histidine-229 is a crucial element of the translational machinery.

16S Ribosomal DNA Characterization of Nitrogen-Fixing Bacteria Isolated from Banana (Musa spp.) and Pineapple (Ananas comosus (L.) Merril)

Science.gov (United States)

Magalhães Cruz, Leonardo; Maltempi de Souza, Emanuel; Weber, Olmar Baler; Baldani, José Ivo; Döbereiner, Johanna; de Oliveira Pedrosa, Fábio

2001-01-01

Nitrogen-fixing bacteria isolated from banana (Musa spp.) and pineapple (Ananas comosus (L.) Merril) were characterized by amplified 16S ribosomal DNA restriction analysis and 16S rRNA sequence analysis. Herbaspirillum seropedicae, Herbaspirillum rubrisubalbicans, Burkholderia brasilensis, and Burkholderia tropicalis were identified. Eight other types were placed in close proximity to these genera and other alpha and beta Proteobacteria. PMID:11319127

A computational investigation on the connection between dynamics properties of ribosomal proteins and ribosome assembly.

Directory of Open Access Journals (Sweden)

Brittany Burton

Full Text Available Assembly of the ribosome from its protein and RNA constituents has been studied extensively over the past 50 years, and experimental evidence suggests that prokaryotic ribosomal proteins undergo conformational changes during assembly. However, to date, no studies have attempted to elucidate these conformational changes. The present work utilizes computational methods to analyze protein dynamics and to investigate the linkage between dynamics and binding of these proteins during the assembly of the ribosome. Ribosomal proteins are known to be positively charged and we find the percentage of positive residues in r-proteins to be about twice that of the average protein: Lys+Arg is 18.7% for E. coli and 21.2% for T. thermophilus. Also, positive residues constitute a large proportion of RNA contacting residues: 39% for E. coli and 46% for T. thermophilus. This affirms the known importance of charge-charge interactions in the assembly of the ribosome. We studied the dynamics of three primary proteins from E. coli and T. thermophilus 30S subunits that bind early in the assembly (S15, S17, and S20 with atomic molecular dynamic simulations, followed by a study of all r-proteins using elastic network models. Molecular dynamics simulations show that solvent-exposed proteins (S15 and S17 tend to adopt more stable solution conformations than an RNA-embedded protein (S20. We also find protein residues that contact the 16S rRNA are generally more mobile in comparison with the other residues. This is because there is a larger proportion of contacting residues located in flexible loop regions. By the use of elastic network models, which are computationally more efficient, we show that this trend holds for most of the 30S r-proteins.

Potential pitfalls of modelling ribosomal RNA data in phylogenetic tree reconstruction: evidence from case studies in the Metazoa.

Science.gov (United States)

Letsch, Harald O; Kjer, Karl M

2011-05-27

Failure to account for covariation patterns in helical regions of ribosomal RNA (rRNA) genes has the potential to misdirect the estimation of the phylogenetic signal of the data. Furthermore, the extremes of length variation among taxa, combined with regional substitution rate variation can mislead the alignment of rRNA sequences and thus distort subsequent tree reconstructions. However, recent developments in phylogenetic methodology now allow a comprehensive integration of secondary structures in alignment and tree reconstruction analyses based on rRNA sequences, which has been shown to correct some of these problems. Here, we explore the potentials of RNA substitution models and the interactions of specific model setups with the inherent pattern of covariation in rRNA stems and substitution rate variation among loop regions. We found an explicit impact of RNA substitution models on tree reconstruction analyses. The application of specific RNA models in tree reconstructions is hampered by interaction between the appropriate modelling of covarying sites in stem regions, and excessive homoplasy in some loop regions. RNA models often failed to recover reasonable trees when single-stranded regions are excessively homoplastic, because these regions contribute a greater proportion of the data when covarying sites are essentially downweighted. In this context, the RNA6A model outperformed all other models, including the more parametrized RNA7 and RNA16 models. Our results depict a trade-off between increased accuracy in estimation of interdependencies in helical regions with the risk of magnifying positions lacking phylogenetic signal. We can therefore conclude that caution is warranted when applying rRNA covariation models, and suggest that loop regions be independently screened for phylogenetic signal, and eliminated when they are indistinguishable from random noise. In addition to covariation and homoplasy, other factors, like non-stationarity of substitution rates

Structure based hypothesis of a mitochondrial ribosome rescue mechanism

Directory of Open Access Journals (Sweden)

Huynen Martijn A

2012-05-01

Full Text Available Abstract Background mtRF1 is a vertebrate mitochondrial protein with an unknown function that arose from a duplication of the mitochondrial release factor mtRF1a. To elucidate the function of mtRF1, we determined the positions that are conserved among mtRF1 sequences but that are different in their mtRF1a paralogs. We subsequently modeled the 3D structure of mtRF1a and mtRF1 bound to the ribosome, highlighting the structural implications of these differences to derive a hypothesis for the function of mtRF1. Results Our model predicts, in agreement with the experimental data, that the 3D structure of mtRF1a allows it to recognize the stop codons UAA and UAG in the A-site of the ribosome. In contrast, we show that mtRF1 likely can only bind the ribosome when the A-site is devoid of mRNA. Furthermore, while mtRF1a will adopt its catalytic conformation, in which it functions as a peptidyl-tRNA hydrolase in the ribosome, only upon binding of a stop codon in the A-site, mtRF1 appears specifically adapted to assume this extended, peptidyl-tRNA hydrolyzing conformation in the absence of mRNA in the A-site. Conclusions We predict that mtRF1 specifically recognizes ribosomes with an empty A-site and is able to function as a peptidyl-tRNA hydrolase in those situations. Stalled ribosomes with empty A-sites that still contain a tRNA bound to a peptide chain can result from the translation of truncated, stop-codon less mRNAs. We hypothesize that mtRF1 recycles such stalled ribosomes, performing a function that is analogous to that of tmRNA in bacteria. Reviewers This article was reviewed by Dr. Eugene Koonin, Prof. Knud H. Nierhaus (nominated by Dr. Sarah Teichmann and Dr. Shamil Sunyaev.

Crystallization of the two-domain N-terminal fragment of the archaeal ribosomal protein L10(P0) in complex with a specific fragment of 23S rRNA

Science.gov (United States)

Kravchenko, O. V.; Mitroshin, I. V.; Gabdulkhakov, A. G.; Nikonov, S. V.; Garber, M. B.

2011-07-01

Lateral L12-stalk (P1-stalk in Archaea, P1/P2-stalk in eukaryotes) is an obligatory morphological element of large ribosomal subunits in all organisms studied. This stalk is composed of the complex of ribosomal proteins L10(P0) and L12(P1) and interacts with 23S rRNA through the protein L10(P0). L12(P1)-stalk is involved in the formation of GTPase center of the ribosome and plays an important role in the ribosome interaction with translation factors. High mobility of this stalk puts obstacles in determination of its structure within the intact ribosome. Crystals of a two-domain N-terminal fragment of ribosomal protein L10(P0) from the archaeon Methanococcus jannaschii in complex with a specific fragment of rRNA from the same organism have been obtained. The crystals diffract X-rays at 3.2 Å resolution.

Crystallization of the two-domain N-terminal fragment of the archaeal ribosomal protein L10(P0) in complex with a specific fragment of 23S rRNA

Energy Technology Data Exchange (ETDEWEB)

Kravchenko, O. V.; Mitroshin, I. V.; Gabdulkhakov, A. G.; Nikonov, S. V.; Garber, M. B., E-mail: garber@vega.protres.ru [Institute of Protein Research RAS (Russian Federation)

2011-07-15

Lateral L12-stalk (P1-stalk in Archaea, P1/P2-stalk in eukaryotes) is an obligatory morphological element of large ribosomal subunits in all organisms studied. This stalk is composed of the complex of ribosomal proteins L10(P0) and L12(P1) and interacts with 23S rRNA through the protein L10(P0). L12(P1)-stalk is involved in the formation of GTPase center of the ribosome and plays an important role in the ribosome interaction with translation factors. High mobility of this stalk puts obstacles in determination of its structure within the intact ribosome. Crystals of a two-domain N-terminal fragment of ribosomal protein L10(P0) from the archaeon Methanococcus jannaschii in complex with a specific fragment of rRNA from the same organism have been obtained. The crystals diffract X-rays at 3.2 Angstrom-Sign resolution.

Further characterization of ribosome binding to thylakoid membranes

International Nuclear Information System (INIS)

Hurewitz, J.; Jagendorf, A.T.

1987-01-01

Previous work indicated more polysomes bound to pea (Pisum sativum cv Progress No. 9) thylakoids in light than in the dark, in vivo. With isolated intact chloroplasts incubated in darkness, addition of MgATP had no effect but 24 to 74% more RNA was thylakoid-bound at pH 8.3 than at pH 7. Thus, the major effect of light on ribosome-binding in vivo may be due to higher stroma pH. In isolated pea chloroplasts, initiation inhibitors (pactamycin and kanamycin) decreased the extent of RNA binding, and elongation inhibitors (lincomycin and streptomycin) increased it. Thus, cycling of ribosomes is controlled by translation, initiation, and termination. Bound RNA accounted for 19 to 24% of the total chloroplast RNA and the incorporation of [ 3 H]leucine into thylakoids was proportional to the amount of this bound RNA. These data support the concept that stroma ribosomes are recruited into thylakoid polysomes, which are active in synthesizing thylakoid proteins

Control of ribosome traffic by position-dependent choice of synonymous codons

DEFF Research Database (Denmark)

Mitarai, Namiko; Pedersen, Steen

2013-01-01

Messenger RNA (mRNA) encodes a sequence of amino acids by using codons. For most amino acids, there are multiple synonymous codons that can encode the amino acid. The translation speed can vary from one codon to another, thus there is room for changing the ribosome speed while keeping the amino...... acid sequence and hence the resulting protein. Recently, it has been noticed that the choice of the synonymous codon, via the resulting distribution of slow- and fast-translated codons, affects not only on the average speed of one ribosome translating the mRNA but also might have an effect on nearby...... ribosomes by affecting the appearance of 'traffic jams' where multiple ribosomes collide and form queues. To test this 'context effect' further, we here investigate the effect of the sequence of synonymous codons on the ribosome traffic by using a ribosome traffic model with codon-dependent rates, estimated...

A comparative study of ribosomal proteins: linkage between amino acid distribution and ribosomal assembly

International Nuclear Information System (INIS)

Lott, Brittany Burton; Wang, Yongmei; Nakazato, Takuya

2013-01-01

Assembly of the ribosome from its protein and RNA constituents must occur quickly and efficiently in order to synthesize the proteins necessary for all cellular activity. Since the early 1960’s, certain characteristics of possible assembly pathways have been elucidated, yet the mechanisms that govern the precise recognition events remain unclear. We utilize a comparative analysis to investigate the amino acid composition of ribosomal proteins (r-proteins) with respect to their role in the assembly process. We compared small subunit (30S) r-protein sequences to those of other housekeeping proteins from 560 bacterial species and searched for correlations between r-protein amino acid content and factors such as assembly binding order, environmental growth temperature, protein size, and contact with ribosomal RNA (rRNA) in the 30S complex. We find r-proteins have a significantly high percent of positive residues, which are highly represented at rRNA contact sites. An inverse correlation between the percent of positive residues and r-protein size was identified and is mainly due to the content of Lysine residues, rather than Arginine. Nearly all r-proteins carry a net positive charge, but no statistical correlation between the net charge and the binding order was detected. Thermophilic (high-temperature) r-proteins contain increased Arginine, Isoleucine, and Tyrosine, and decreased Serine and Threonine compared to mesophilic (lower-temperature), reflecting a known distinction between thermophiles and mesophiles, possibly to account for protein thermostability. However, this difference in amino acid content does not extend to rRNA contact sites, as the proportions of thermophilic and mesophilic contact residues are not significantly different. Given the significantly higher level of positively charged residues in r-proteins and at contact sites, we conclude that ribosome assembly relies heavily on an electrostatic component of interaction. However, the binding order of

Ribosomal protein methyltransferases in the yeast Saccharomyces cerevisiae: Roles in ribosome biogenesis and translation.

Science.gov (United States)

Al-Hadid, Qais; White, Jonelle; Clarke, Steven

2016-02-12

A significant percentage of the methyltransferasome in Saccharomyces cerevisiae and higher eukaryotes is devoted to methylation of the translational machinery. Methylation of the RNA components of the translational machinery has been studied extensively and is important for structure stability, ribosome biogenesis, and translational fidelity. However, the functional effects of ribosomal protein methylation by their cognate methyltransferases are still largely unknown. Previous work has shown that the ribosomal protein Rpl3 methyltransferase, histidine protein methyltransferase 1 (Hpm1), is important for ribosome biogenesis and translation elongation fidelity. In this study, yeast strains deficient in each of the ten ribosomal protein methyltransferases in S. cerevisiae were examined for potential defects in ribosome biogenesis and translation. Like Hpm1-deficient cells, loss of four of the nine other ribosomal protein methyltransferases resulted in defects in ribosomal subunit synthesis. All of the mutant strains exhibited resistance to the ribosome inhibitors anisomycin and/or cycloheximide in plate assays, but not in liquid culture. Translational fidelity assays measuring stop codon readthrough, amino acid misincorporation, and programmed -1 ribosomal frameshifting, revealed that eight of the ten enzymes are important for translation elongation fidelity and the remaining two are necessary for translation termination efficiency. Altogether, these results demonstrate that ribosomal protein methyltransferases in S. cerevisiae play important roles in ribosome biogenesis and translation. Copyright © 2016 Elsevier Inc. All rights reserved.

Detection of Aspergillus fumigatus pulmonary fungal infections in mice with 99mTc-labeled MORF oligomers targeting ribosomal RNA

International Nuclear Information System (INIS)

Wang Yuzhen; Chen Ling; Liu Xinrong; Cheng Dengfeng; Liu Guozheng; Liu Yuxia; Dou Shuping; Hnatowich, Donald J.; Rusckowski, Mary

2013-01-01

Purpose: Invasive aspergillosis is a major cause of infectious morbidity and mortality in immunocompromised patients. The fungus Aspergillus fumigatus (A. fumigatus) is the primary causative agent of invasive aspergillosis. However, A. fumigatus infections remain difficult to diagnose particularly in the early stages due to the lack of a rapid, sensitive and specific diagnostic approach. In this study, we investigated 99m Tc labeled MORF oligomers targeting fungal ribosomal RNA (rRNA) for the imaging detection of fungal infections. Procedures: Three phosphorodiamidate morpholino (MORF) oligomer (a DNA analogue) probes were designed: AGEN, complementary to a sequence of the fungal 28S ribosomal RNA (rRNA) of Aspergillus, as a genus-specific probe; AFUM, complementary to the 28S rRNA sequence of A. fumigatus, as a fungus species-specific probe; and cMORF, irrelevant to all fungal species, as a control probe. The probes were conjugated with Alexa Fluor 633 carboxylic acid succinimidyl ester (AF633) for fluorescence imaging or with NHS-mercaptoacetyl triglycine (NHS-MAG3) for nuclear imaging with 99m Tc and then evaluated in vitro and in vivo. Results: The specific binding of AGEN and AFUM to fungal total RNA was confirmed by dot blot hybridization while specific binding of AGEN and AFUM in fixed and live A. fumigatus was demonstrated by both fluorescent in situ hybridization (FISH) analysis and accumulation in live cells. SPECT imaging of BALB/c mice with pulmonary A. fumigatus infections and administered 99m Tc labeled AGEN and AFUM showed immediate and obvious accumulation in the infected lungs, while no significant accumulation of the control 99m Tc-cMORF in the infected lung was observed. Compared to non-infected mice, with sacrifice at 1 h, the accumulation of 99m Tc-AGEN and 99m Tc-AFUM in the lungs of mice infected with A. fumigatus was 2 and 2.7 fold higher respectively. Conclusions: In vivo targeting fungal ribosomal RNA with 99m Tc labeled MORF probes AGEN

Cryo-EM Structure of the Archaeal 50S Ribosomal Subunit in Complex with Initiation Factor 6 and Implications for Ribosome Evolution

Science.gov (United States)

Greber, Basil J.; Boehringer, Daniel; Godinic-Mikulcic, Vlatka; Crnkovic, Ana; Ibba, Michael; Weygand-Durasevic, Ivana; Ban, Nenad

2013-01-01

Translation of mRNA into proteins by the ribosome is universally conserved in all cellular life. The composition and complexity of the translation machinery differ markedly between the three domains of life. Organisms from the domain Archaea show an intermediate level of complexity, sharing several additional components of the translation machinery with eukaryotes that are absent in bacteria. One of these translation factors is initiation factor 6 (IF6), which associates with the large ribosomal subunit. We have reconstructed the 50S ribosomal subunit from the archaeon Methanothermobacter thermautotrophicus in complex with archaeal IF6 at 6.6 Å resolution using cryo-electron microscopy (EM). The structure provides detailed architectural insights into the 50S ribosomal subunit from a methanogenic archaeon through identification of the rRNA expansion segments and ribosomal proteins that are shared between this archaeal ribosome and eukaryotic ribosomes but are mostly absent in bacteria and in some archaeal lineages. Furthermore, the structure reveals that, in spite of highly divergent evolutionary trajectories of the ribosomal particle and the acquisition of novel functions of IF6 in eukaryotes, the molecular binding of IF6 on the ribosome is conserved between eukaryotes and archaea. The structure also provides a snapshot of the reductive evolution of the archaeal ribosome and offers new insights into the evolution of the translation system in archaea. PMID:22306461

Free-Energy Landscape of Reverse tRNA Translocation through the Ribosome Analyzed by Electron Microscopy Density Maps and Molecular Dynamics Simulations

Science.gov (United States)

Ishida, Hisashi; Matsumoto, Atsushi

2014-01-01

To understand the mechanism of reverse tRNA translocation in the ribosome, all-atom molecular dynamics simulations of the ribosome-tRNAs-mRNA-EFG complex were performed. The complex at the post-translocational state was directed towards the translocational and pre-translocational states by fitting the complex into cryo-EM density maps. Between a series of the fitting simulations, umbrella sampling simulations were performed to obtain the free-energy landscape. Multistep structural changes, such as a ratchet-like motion and rotation of the head of the small subunit were observed. The free-energy landscape showed that there were two main free-energy barriers: one between the post-translocational and intermediate states, and the other between the pre-translocational and intermediate states. The former corresponded to a clockwise rotation, which was coupled to the movement of P-tRNA over the P/E-gate made of G1338, A1339 and A790 in the small subunit. The latter corresponded to an anticlockwise rotation of the head, which was coupled to the location of the two tRNAs in the hybrid state. This indicates that the coupled motion of the head rotation and tRNA translocation plays an important role in opening and closing of the P/E-gate during the ratchet-like movement in the ribosome. Conformational change of EF-G was interpreted to be the result of the combination of the external motion by L12 around an axis passing near the sarcin-ricin loop, and internal hinge-bending motion. These motions contributed to the movement of domain IV of EF-G to maintain its interaction with A/P-tRNA. PMID:24999999

Free-energy landscape of reverse tRNA translocation through the ribosome analyzed by electron microscopy density maps and molecular dynamics simulations.

Directory of Open Access Journals (Sweden)

Hisashi Ishida

Full Text Available To understand the mechanism of reverse tRNA translocation in the ribosome, all-atom molecular dynamics simulations of the ribosome-tRNAs-mRNA-EFG complex were performed. The complex at the post-translocational state was directed towards the translocational and pre-translocational states by fitting the complex into cryo-EM density maps. Between a series of the fitting simulations, umbrella sampling simulations were performed to obtain the free-energy landscape. Multistep structural changes, such as a ratchet-like motion and rotation of the head of the small subunit were observed. The free-energy landscape showed that there were two main free-energy barriers: one between the post-translocational and intermediate states, and the other between the pre-translocational and intermediate states. The former corresponded to a clockwise rotation, which was coupled to the movement of P-tRNA over the P/E-gate made of G1338, A1339 and A790 in the small subunit. The latter corresponded to an anticlockwise rotation of the head, which was coupled to the location of the two tRNAs in the hybrid state. This indicates that the coupled motion of the head rotation and tRNA translocation plays an important role in opening and closing of the P/E-gate during the ratchet-like movement in the ribosome. Conformational change of EF-G was interpreted to be the result of the combination of the external motion by L12 around an axis passing near the sarcin-ricin loop, and internal hinge-bending motion. These motions contributed to the movement of domain IV of EF-G to maintain its interaction with A/P-tRNA.

Multiperspective smFRET reveals rate-determining late intermediates of ribosomal translocation.

Science.gov (United States)

Wasserman, Michael R; Alejo, Jose L; Altman, Roger B; Blanchard, Scott C

2016-04-01

Directional translocation of the ribosome through the mRNA open reading frame is a critical determinant of translational fidelity. This process entails a complex interplay of large-scale conformational changes within the actively translating particle, which together coordinate the movement of tRNA and mRNA substrates with respect to the large and small ribosomal subunits. Using pre-steady state, single-molecule fluorescence resonance energy transfer imaging, we tracked the nature and timing of these conformational events within the Escherichia coli ribosome from five structural perspectives. Our investigations revealed direct evidence of structurally and kinetically distinct late intermediates during substrate movement, whose resolution determines the rate of translocation. These steps involve intramolecular events within the EF-G-GDP-bound ribosome, including exaggerated, reversible fluctuations of the small-subunit head domain, which ultimately facilitate peptidyl-tRNA's movement into its final post-translocation position.

The Unexplored Mechanisms and Regulatory Functions of Ribosomal Translocation

Science.gov (United States)

Alejo, Jose Luis

In every cell, protein synthesis is carried out by the ribosome, a complex macromolecular RNA-protein assembly. Decades of structural and kinetic studies have increased our understanding of ribosome initiation, decoding, translocation and termination. Yet, the underlying mechanism of these fundamental processes has yet to be fully delineated. Hence, the molecular basis of regulation remains obscure. Here, single-molecule fluorescence methods are applied to decipher the mechanism and regulatory roles of the multi-step process of directional substrate translocation on the ribosome that accompanies every round of protein synthesis. In Chapter 1, single-molecule fluorescence resonance energy transfer (smFRET) is introduced as a tool for studying bacterial ribosome translocation. Chapter 2 details the experimental methods. In Chapter 3, the elongation factor G(EF-G)-catalyzed movement of substrates through the ribosome is examined from several perspectives or signals reporting on various degrees of freedom of ribosome dynamics. Two ribosomal states interconvert in the presence of EF-G(GDP), displaying novel head domain motions, until relocking takes place. In Chapter 4, in order to test if the mentioned fluctuations leading to relocking are correlated to the engagement of the P-site by the peptidyl-tRNA, the translocation of miscoded tRNAs is studied. Severe defects in the relocking stages of translocation reveal the correlation between this new stage of translocation and P-site tRNA engagement.

Critical 23S rRNA interactions for macrolide-dependent ribosome stalling on the ErmCL nascent peptide chain.

Science.gov (United States)

Koch, Miriam; Willi, Jessica; Pradère, Ugo; Hall, Jonathan; Polacek, Norbert

2017-06-20

The nascent peptide exit tunnel has recently been identified as a functional region of ribosomes contributing to translation regulation and co-translational protein folding. Inducible expression of the erm resistance genes depends on ribosome stalling at specific codons of an upstream open reading frame in the presence of an exit tunnel-bound macrolide antibiotic. The molecular basis for this translation arrest is still not fully understood. Here, we used a nucleotide analog interference approach to unravel important functional groups on 23S rRNA residues in the ribosomal exit tunnel for ribosome stalling on the ErmC leader peptide. By replacing single nucleobase functional groups or even single atoms we were able to demonstrate the importance of A2062, A2503 and U2586 for drug-dependent ribosome stalling. Our data show that the universally conserved A2062 and A2503 are capable of forming a non-Watson-Crick base pair that is critical for sensing and transmitting the stalling signal from the exit tunnel back to the peptidyl transferase center of the ribosome. The nucleobases of A2062, A2503 as well as U2586 do not contribute significantly to the overall mechanism of protein biosynthesis, yet their elaborate role for co-translational monitoring of nascent peptide chains inside the exit tunnel can explain their evolutionary conservation. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

Yeast polypeptide exit tunnel ribosomal proteins L17, L35 and L37 are necessary to recruit late-assembling factors required for 27SB pre-rRNA processing.

Science.gov (United States)

Gamalinda, Michael; Jakovljevic, Jelena; Babiano, Reyes; Talkish, Jason; de la Cruz, Jesús; Woolford, John L

2013-02-01

Ribosome synthesis involves the coordinated folding and processing of pre-rRNAs with assembly of ribosomal proteins. In eukaryotes, these events are facilitated by trans-acting factors that propel ribosome maturation from the nucleolus to the cytoplasm. However, there is a gap in understanding how ribosomal proteins configure pre-ribosomes in vivo to enable processing to occur. Here, we have examined the role of adjacent yeast r-proteins L17, L35 and L37 in folding and processing of pre-rRNAs, and binding of other proteins within assembling ribosomes. These three essential ribosomal proteins, which surround the polypeptide exit tunnel, are required for 60S subunit formation as a consequence of their role in removal of the ITS2 spacer from 27SB pre-rRNA. L17-, L35- and L37-depleted cells exhibit turnover of aberrant pre-60S assembly intermediates. Although the structure of ITS2 does not appear to be grossly affected in their absence, these three ribosomal proteins are necessary for efficient recruitment of factors required for 27SB pre-rRNA processing, namely, Nsa2 and Nog2, which associate with pre-60S ribosomal particles containing 27SB pre-rRNAs. Altogether, these data support that L17, L35 and L37 are specifically required for a recruiting step immediately preceding removal of ITS2.

Comparison of 16S ribosomal RNA gene sequence analysis and conventional culture in the environmental survey of a hospital

OpenAIRE

Manaka, Akihiro; Tokue, Yutaka; Murakami, Masami

2017-01-01

Background Nosocomial infection is one of the most common complications within health care facilities. Certain studies have reported outbreaks resulting from contaminated hospital environments. Although the identification of bacteria in the environment can readily be achieved using culturing methods, these methods detect live bacteria. Sequencing of the 16S ribosomal RNA (16S rRNA) gene is recognized to be effective for bacterial identification. In this study, we surveyed wards where drug-res...

Yeast eIF4B binds to the head of the 40S ribosomal subunit and promotes mRNA recruitment through its N-terminal and internal repeat domains.

Science.gov (United States)

Walker, Sarah E; Zhou, Fujun; Mitchell, Sarah F; Larson, Victoria S; Valasek, Leos; Hinnebusch, Alan G; Lorsch, Jon R

2013-02-01

Eukaryotic translation initiation factor (eIF)4B stimulates recruitment of mRNA to the 43S ribosomal pre-initiation complex (PIC). Yeast eIF4B (yeIF4B), shown previously to bind single-stranded (ss) RNA, consists of an N-terminal domain (NTD), predicted to be unstructured in solution; an RNA-recognition motif (RRM); an unusual domain comprised of seven imperfect repeats of 26 amino acids; and a C-terminal domain. Although the mechanism of yeIF4B action has remained obscure, most models have suggested central roles for its RRM and ssRNA-binding activity. We have dissected the functions of yeIF4B's domains and show that the RRM and its ssRNA-binding activity are dispensable in vitro and in vivo. Instead, our data indicate that the 7-repeats and NTD are the most critical domains, which mediate binding of yeIF4B to the head of the 40S ribosomal subunit via interaction with Rps20. This interaction induces structural changes in the ribosome's mRNA entry channel that could facilitate mRNA loading. We also show that yeIF4B strongly promotes productive interaction of eIF4A with the 43S•mRNA PIC in a manner required for efficient mRNA recruitment.

Evidence for functional interaction between domains II and V of 23S ribosomal RNA from an erythromycin-resistant mutant

DEFF Research Database (Denmark)

Douthwaite, S; Prince, J B; Noller, H F

1985-01-01

A mutation affording low levels of erythromycin resistance has been obtained by in vitro hydroxylamine mutagenesis of a cloned ribosomal RNA operon from Escherichia coli. The site of the mutational event responsible for antibiotic resistance was localized to the gene region encoding domain II of ...

Diversity of ribosomal 16S DNA- and RNA-based bacterial community in an office building drinking water system.

Science.gov (United States)

Inkinen, J; Jayaprakash, B; Santo Domingo, J W; Keinänen-Toivola, M M; Ryu, H; Pitkänen, T

2016-06-01

Next-generation sequencing of 16S ribosomal RNA genes (rDNA) and ribosomal RNA (rRNA) was used to characterize water and biofilm microbiome collected from a drinking water distribution system of an office building after its first year of operation. The total bacterial community (rDNA) and active bacterial members (rRNA) sequencing databases were generated by Illumina MiSeq PE250 platform. As estimated by Chao1 index, species richness in cold water system was lower (180-260) in biofilms (Sphingomonas spp., Methylobacterium spp., Limnohabitans spp., Rhizobiales order) than in waters (250-580), (also Methylotenera spp.) (P = 0·005, n = 20). Similarly species richness (Chao1) was slightly higher (210-580) in rDNA libraries compared to rRNA libraries (150-400; P = 0·054, n = 24). Active Mycobacterium spp. was found in cross-linked polyethylene (PEX), but not in corresponding copper pipeline biofilm. Nonpathogenic Legionella spp. was found in rDNA libraries but not in rRNA libraries. Microbial communities differed between water and biofilms, between cold and hot water systems, locations in the building and between water rRNA and rDNA libraries, as shown by clear clusters in principal component analysis (PcoA). By using the rRNA method, we found that not all bacterial community members were active (e.g. Legionella spp.), whereas other members showed increased activity in some locations; for example, Pseudomonas spp. in hot water circulations' biofilm and order Rhizobiales and Limnohabitans spp. in stagnated locations' water and biofilm. rRNA-based methods may be better than rDNA-based methods for evaluating human health implications as rRNA methods can be used to describe the active bacterial fraction. This study indicates that copper as a pipeline material might have an adverse impact on the occurrence of Mycobacterium spp. The activity of Legionella spp. maybe questionable when detected solely by using DNA-based methods. © 2016 The Society for Applied

UPF201 Archaeal Specific Family Members Reveals Structural Similarity to RNA-Binding Proteins but Low Likelihood for RNA-Binding Function

Energy Technology Data Exchange (ETDEWEB)

Rao, K.N.; Swaminathan, S.; Burley, S. K.

2008-12-11

We have determined X-ray crystal structures of four members of an archaeal specific family of proteins of unknown function (UPF0201; Pfam classification: DUF54) to advance our understanding of the genetic repertoire of archaea. Despite low pairwise amino acid sequence identities (10-40%) and the absence of conserved sequence motifs, the three-dimensional structures of these proteins are remarkably similar to one another. Their common polypeptide chain fold, encompassing a five-stranded antiparallel {beta}-sheet and five {alpha}-helices, proved to be quite unexpectedly similar to that of the RRM-type RNA-binding domain of the ribosomal L5 protein, which is responsible for binding the 5S- rRNA. Structure-based sequence alignments enabled construction of a phylogenetic tree relating UPF0201 family members to L5 ribosomal proteins and other structurally similar RNA binding proteins, thereby expanding our understanding of the evolutionary purview of the RRM superfamily. Analyses of the surfaces of these newly determined UPF0201 structures suggest that they probably do not function as RNA binding proteins, and that this domain specific family of proteins has acquired a novel function in archaebacteria, which awaits experimental elucidation.

Advantages and Limitations of Ribosomal RNA PCR and DNA Sequencing for Identification of Bacteria in Cardiac Valves of Danish Patients

DEFF Research Database (Denmark)

Kemp, Michael; Bangsborg, Jette; Kjerulf, Anne

2013-01-01

of direct molecular identification should also address weaknesses, their relevance in the given setting, and possible improvements. In this study cardiac valves from 56 Danish patients referred for surgery for infective endocarditis were analysed by microscopy and culture as well as by PCR targeting part...... of the bacterial 16S rRNA gene followed by DNA sequencing of the PCR product. PCR and DNA sequencing identified significant bacteria in 49 samples from 43 patients, including five out of 13 culture-negative cases. No rare, exotic, or intracellular bacteria were identified. There was a general agreement between...... bacterial identity obtained by ribosomal PCR and DNA sequencing from the valves and bacterial isolates from blood culture. However, DNA sequencing of the 16S rRNA gene did not discriminate well among non-haemolytic streptococci, especially within the Streptococcus mitis group. Ribosomal PCR with subsequent...

On the control of ribosomal protein biosynthesis in Escherichia coli

International Nuclear Information System (INIS)

Pichon, J.; Marvaldi, J.; Coeroli, C.; Cozzone, A.; Marchis-Mouren, G.

1977-01-01

The rate of individual ribosomal protein synthesis relative to total protein synthesis has been determined in Escherichia coli rel + and rel - cells, under valyl-tRNA deprivation. These strains have a temperature-sensitive valyl-tRNA synthetase. Starvation was obtained following transfer of the cells to non-permissive temperature. Ribosomal proteins were obtained by treatment of either total lysates of freeze-thawed lysozyme spheroplasts or ammonium sulphate precipitate of ribosomes, with acetic acid. Differential labelling of the ribosomal proteins was observed in both strains: proteins from the rel + strain appear more labelled than those from the rel - strain, the rate of labelling of individual proteins being about the same in both strains. Moreover ribosomal proteins were found as stable during starvation as total protein. It is thus concluded that in starving cells individual ribosomal proteins are not synthesized at equal rates. This indicates that the synthesis of ribosomal proteins is not only under the control of the rel gene

Selection of reference genes for expression analysis using quantitative real-time PCR in the pea aphid, Acyrthosiphon pisum (Harris (Hemiptera, Aphidiae.

Directory of Open Access Journals (Sweden)

Chunxiao Yang

Full Text Available To facilitate gene expression study and obtain accurate qRT-PCR analysis, normalization relative to stable expressed housekeeping genes is required. In this study, expression profiles of 11 candidate reference genes, including actin (Actin, elongation factor 1 α (EF1A, TATA-box-binding protein (TATA, ribosomal protein L12 (RPL12, β-tubulin (Tubulin, NADH dehydrogenase (NADH, vacuolar-type H+-ATPase (v-ATPase, succinate dehydrogenase B (SDHB, 28S ribosomal RNA (28S, 16S ribosomal RNA (16S, and 18S ribosomal RNA (18S from the pea aphid Acyrthosiphon pisum, under different developmental stages and temperature conditions, were investigated. A total of four analytical tools, geNorm, Normfinder, BestKeeper, and the ΔCt method, were used to evaluate the suitability of these genes as endogenous controls. According to RefFinder, a web-based software tool which integrates all four above-mentioned algorithms to compare and rank the reference genes, SDHB, 16S, and NADH were the three most stable house-keeping genes under different developmental stages and temperatures. This work is intended to establish a standardized qRT-PCR protocol in pea aphid and serves as a starting point for the genomics and functional genomics research in this emerging insect model.

Diverse Regulators of Human Ribosome Biogenesis Discovered by Changes in Nucleolar Number

Directory of Open Access Journals (Sweden)

Katherine I. Farley-Barnes

2018-02-01

Full Text Available Ribosome biogenesis is a highly regulated, essential cellular process. Although studies in yeast have established some of the biological principles of ribosome biogenesis, many of the intricacies of its regulation in higher eukaryotes remain unknown. To understand how ribosome biogenesis is globally integrated in human cells, we conducted a genome-wide siRNA screen for regulators of nucleolar number. We found 139 proteins whose depletion changed the number of nucleoli per nucleus from 2–3 to only 1 in human MCF10A cells. Follow-up analyses on 20 hits found many (90% to be essential for the nucleolar functions of rDNA transcription (7, pre-ribosomal RNA (pre-rRNA processing (16, and/or global protein synthesis (14. This genome-wide analysis exploits the relationship between nucleolar number and function to discover diverse cellular pathways that regulate the making of ribosomes and paves the way for further exploration of the links between ribosome biogenesis and human disease.

Relative workload determines exercise-induced increases in PGC-1alpha mRNA

DEFF Research Database (Denmark)

Nordsborg, Nikolai Baastrup; Lundby, Carsten; Leick, Lotte

2010-01-01

INTRODUCTION:: The hypothesis that brief intermittent exercise induced increases in human skeletal muscle metabolic mRNA is dependent on relative workload was investigated. METHODS:: Trained (n=10) and untrained (n=8) subjects performed exhaustive intermittent cycling exercise (4x4 min @ 85% of VO2...... peak, interspersed by 3 min). Trained subjects also performed the intermittent exercise at the same absolute workload as untrained, corresponding to 70% of VO2 peak (n=6). RESULTS:: Exercise at 85% of VO2 peak elevated (P... and untrained, respectively. PGC-1alpha mRNA expression was increased (Pelevated (3.1+/-0.7 mM) and PGC-1alpha mRNA content was less (P

GDP-tubulin incorporation into growing microtubules modulates polymer stability.

Science.gov (United States)

Valiron, Odile; Arnal, Isabelle; Caudron, Nicolas; Job, Didier

2010-06-04

Microtubule growth proceeds through the endwise addition of nucleotide-bound tubulin dimers. The microtubule wall is composed of GDP-tubulin subunits, which are thought to come exclusively from the incorporation of GTP-tubulin complexes at microtubule ends followed by GTP hydrolysis within the polymer. The possibility of a direct GDP-tubulin incorporation into growing polymers is regarded as hardly compatible with recent structural data. Here, we have examined GTP-tubulin and GDP-tubulin incorporation into polymerizing microtubules using a minimal assembly system comprised of nucleotide-bound tubulin dimers, in the absence of free nucleotide. We find that GDP-tubulin complexes can efficiently co-polymerize with GTP-tubulin complexes during microtubule assembly. GDP-tubulin incorporation into microtubules occurs with similar efficiency during bulk microtubule assembly as during microtubule growth from seeds or centrosomes. Microtubules formed from GTP-tubulin/GDP-tubulin mixtures display altered microtubule dynamics, in particular a decreased shrinkage rate, apparently due to intrinsic modifications of the polymer disassembly properties. Thus, although microtubules polymerized from GTP-tubulin/GDP-tubulin mixtures or from homogeneous GTP-tubulin solutions are both composed of GDP-tubulin subunits, they have different dynamic properties, and this may reveal a novel form of microtubule "structural plasticity."

Qualitative determination of tubulin by radioimmunoassay

Energy Technology Data Exchange (ETDEWEB)

Joniau, M [Louvain Univ. (Belgium). Interdisciplinary Research Centre; Brabander, M de [Janssen Pharmaceutica, Beerse (Belgium). Lab. of Oncology; Mey, J de [Brussels Univ. (Belgium). Medische Stichting Koningin Elisabeth; Hoebeke, J [Brussels Univ. (Belgium). Lab. of Biochemical Pathology

1977-06-15

The use of an antiserum specific for tubulin in cytochemical studies was described previously. Here a report is presented on its application in a radioimmunoassay for tubulin useful in the concentration range of 0.5 to 20 ..mu..g tubulin/ml. The advantages of this technique over the classical colchicine binding assay are discussed in terms of sensitivity and nonsusceptibility to the degree of polymerization and thermal denaturation of tubulin allowing its application to cell culture homogenates.

Genome-wide polysomal analysis of a yeast strain with mutated ribosomal protein S9

Directory of Open Access Journals (Sweden)

Arava Yoav

2007-08-01

Full Text Available Abstract Background The yeast ribosomal protein S9 (S9 is located at the entrance tunnel of the mRNA into the ribosome. It is known to play a role in accurate decoding and its bacterial homolog (S4 has recently been shown to be involved in opening RNA duplexes. Here we examined the effects of changing the C terminus of S9, which is rich in acidic amino acids and extends out of the ribosome surface. Results We performed a genome-wide analysis to reveal effects at the transcription and translation levels of all yeast genes. While negligible relative changes were observed in steady-state mRNA levels, a significant number of mRNAs appeared to have altered ribosomal density. Notably, 40% of the genes having reliable signals changed their ribosomal association by more than one ribosome. Yet, no general correlations with physical or functional features of the mRNA were observed. Ribosome Density Mapping (RDM along four of the mRNAs with increased association revealed an increase in ribosomal density towards the end of the coding region for at least two of them. Read-through analysis did not reveal any increase in read-through of a premature stop codon by the mutant strain. Conclusion The ribosomal protein rpS9 appears to be involved in the translation of many mRNAs, since altering its C terminus led to a significant change in ribosomal association of many mRNAs. We did not find strong correlations between these changes and several physical features of the mRNA, yet future studies with advanced tools may allow such correlations to be determined. Importantly, our results indicate an accumulation of ribosomes towards the end of the coding regions of some mRNAs. This suggests an involvement of S9 in ribosomal dissociation during translation termination.

RPL41, a Small Ribosomal Peptide Deregulated in Tumors, Is Essential for Mitosis and Centrosome Integrity

Directory of Open Access Journals (Sweden)

Shan Wang

2010-03-01

Full Text Available Ribosomal large subunit protein RPL41 is a basic (positively charged peptide consisting of only 25 amino acids. An antisense-based functional screening revealed that the down-regulation of RPL41 led to an anchorage-independent growth of NIH3T3 cells in soft agar plates. RPL41 depletion with gene-specific small interfering RNA also resulted in malignant transformation of NIH3T3 cells including increased tumor growth in mice. RPL41 deletion was detected in 59% of tumor cell lines by fluorescence in situ hybridization analyses and RPL41 down-regulation in 75% of primary breast cancers by real-time quantitative reverse transcription-polymerase chain reaction. These studies suggest a tumor suppression role for RPL41. By mass spectrometry, RPL41 was associated with several cytoskeleton components including tubulin β, γ, and myosin IIA, which was confirmed by Western blot analysis on both cellular lysis and individually in vitro-expressed proteins. RPL41 also bound directly to polymerized tubulins. Cells overexpressing a GFP-RPL41 were resistant to nocodazole-induced microtubule depolymerization. A synthetic RPL41 induced cellular α-tubulin acetylation and G2/M cell cycle arrest. These results indicate a stabilizing role of RPL41 on microtubule. Microtubule spindles are essential for chromosome segregation during mitosis. Cells with RPL41 knock-down showed abnormal spindles, frequent failure of cytokinesis, and formation of polynuclear cells. In interphase cells, RPL41-depleted cells had premature splitting of centrosome. Our results provide evidence that RPL41 is a microtubule-associated protein essential for functional spindles and for the integrity of centrosome and that the abnormal mitosis and disrupted centrosome associated with the RPL41 down-regulation may be related to malignant transformation.

Cross-site comparison of ribosomal depletion kits for Illumina RNAseq library construction.

Science.gov (United States)

Herbert, Zachary T; Kershner, Jamie P; Butty, Vincent L; Thimmapuram, Jyothi; Choudhari, Sulbha; Alekseyev, Yuriy O; Fan, Jun; Podnar, Jessica W; Wilcox, Edward; Gipson, Jenny; Gillaspy, Allison; Jepsen, Kristen; BonDurant, Sandra Splinter; Morris, Krystalynne; Berkeley, Maura; LeClerc, Ashley; Simpson, Stephen D; Sommerville, Gary; Grimmett, Leslie; Adams, Marie; Levine, Stuart S

2018-03-15

Ribosomal RNA (rRNA) comprises at least 90% of total RNA extracted from mammalian tissue or cell line samples. Informative transcriptional profiling using massively parallel sequencing technologies requires either enrichment of mature poly-adenylated transcripts or targeted depletion of the rRNA fraction. The latter method is of particular interest because it is compatible with degraded samples such as those extracted from FFPE and also captures transcripts that are not poly-adenylated such as some non-coding RNAs. Here we provide a cross-site study that evaluates the performance of ribosomal RNA removal kits from Illumina, Takara/Clontech, Kapa Biosystems, Lexogen, New England Biolabs and Qiagen on intact and degraded RNA samples. We find that all of the kits are capable of performing significant ribosomal depletion, though there are differences in their ease of use. All kits were able to remove ribosomal RNA to below 20% with intact RNA and identify ~ 14,000 protein coding genes from the Universal Human Reference RNA sample at >1FPKM. Analysis of differentially detected genes between kits suggests that transcript length may be a key factor in library production efficiency. These results provide a roadmap for labs on the strengths of each of these methods and how best to utilize them.

Differential antibiotic sensitivity determined by the large ribosomal subunit in thermophilic archaea.

OpenAIRE

Ruggero, D; Londei, P

1996-01-01

Hybrid ribosomes obtained by mixing the ribosomal subunits of the extremely thermophilic archaea Sulfolobus solfataricus and Desulfurococcus mobilis were tested for their sensitivity to selected antibiotics. It is shown that structural differences in the large ribosomal subunits determine qualitatively and quantitatively the patterns of response to alpha-sarcin and paromomycin in these species.

Biochemical studies of mouse brain tubulin: colchicine binding (DEAE-cellulose filter) assay and subunits ( α and β) biosynthesis and degradation (in newborn brain)

Energy Technology Data Exchange (ETDEWEB)

Tse, Cek-Fyne [Univ. of Rochester, NY (United States)

1978-01-01

A DEAE-cellulose filter assay, measuring (³H)colchicine bound to colchicine binding protein (CBP) absorbed on filter discs, has been modified to include lM sucrose in the incubation medium for complexing colchicine to CBP in samples before applying the samples to filter discs (single point assay). Due to the much greater stability of colchicine binding capacity in the presence of lM sucrose, multiple time-point assays and least squares linear regression analysis were not necessary for accurate determination of CBP in hybrid mouse brain at different stages of development. The highest concentrations of CBP were observed in the 160,000g supernatant and pellet of newborn brain homogenate. Further studies of the modified filter assay documented that the assay has an overall counting efficiency of 27.3%, that DEAE-cellulose filters bind and retain all tubulin in the assay samples, and that one molecule of colchicine binds approximately one molecule of tubulin dimer. Therefore, millimoles of colchicine bound per milligram total protein can be used to calculate tubulin content. With this technique tubulin content of brain supernatant was found to be 11.9% for newborn, and 7.15% for 11 month old mice. Quantitative densitometry was also used to measure mouse brain supernatant actin content for these two stages. In vivo synthesis and degradation rates of tubulin ..cap alpha.. and ..beta.. subunits of two day mouse brain 100,000g supernatant were studied after intracerebral injection of (³H)leucine. Quantitative changes of the ratio of tritium specific activities of tubulin ..cap alpha.. and ..beta.. subunits with time were determined. The pattern of change was biphasic. During the first phase the ratio decreased; during the second phase the ratio increased continuously. An interpretation consistent with all the data in this study is that the ..cap alpha.. subunit is synthesized at a more rapid rate than the ..beta.. subunit. (ERB)

The CCA-end of P-tRNA Contacts Both the Human RPL36AL and the A-site Bound Translation Termination Factor eRF1 at the Peptidyl Transferase Center of the Human 80S Ribosome.

Science.gov (United States)

Hountondji, Codjo; Bulygin, Konstantin; Créchet, Jean-Bernard; Woisard, Anne; Tuffery, Pierre; Nakayama, Jun-Ichi; Frolova, Ludmila; Nierhaus, Knud H; Karpova, Galina; Baouz, Soria

2014-01-01

We have demonstrated previously that the E-site specific protein RPL36AL present in human ribosomes can be crosslinked with the CCA-end of a P-tRNA in situ. Here we report the following: (i) We modeled RPL36AL into the structure of the archaeal ortholog RPL44E extracted from the known X-ray structure of the 50S subunit of Haloarcula marismortui. Superimposing the obtained RPL36AL structure with that of P/E tRNA observed in eukaryotic 80S ribosomes suggested that RPL36AL might in addition to its CCA neighbourhood interact with the inner site of the tRNA elbow similar to an interaction pattern known from tRNA•synthetase pairs. (ii) Accordingly, we detected that the isolated recombinant protein RPL36AL can form a tight binary complex with deacylated tRNA, and even tRNA fragments truncated at their CCA end showed a high affinity in the nanomolar range supporting a strong interaction outside the CCA end. (iii) We constructed programmed 80S complexes containing the termination factor eRF1 (stop codon UAA at the A-site) and a 2',3'-dialdehyde tRNA (tRNAox) analog at the P-site. Surprisingly, we observed a crosslinked ternary complex containing the tRNA, eRF1 and RPL36AL crosslinked both to the aldehyde groups of tRNAox at the 2'- and 3'-positions of the ultimate A. We also demonstrated that, upon binding to the ribosomal A-site, eRF1 induces an alternative conformation of the ribosome and/or the tRNA, leading to a novel crosslink of tRNAox to another large-subunit ribosomal protein (namely L37) rather than to RPL36AL, both ribosomal proteins being labeled in a mutually exclusive fashion. Since the human 80S ribosome in complex with P-site bound tRNAox and A-site bound eRF1 corresponds to the post-termination state of the ribosome, the results represent the first biochemical evidence for the positioning of the CCA-arm of the P-tRNA in close proximity to both RPL36AL and eRF1 at the end of the translation process.

GTPases and the origin of the ribosome

Directory of Open Access Journals (Sweden)

Smith Temple F

2010-05-01

Full Text Available Abstract Background This paper is an attempt to trace the evolution of the ribosome through the evolution of the universal P-loop GTPases that are involved with the ribosome in translation and with the attachment of the ribosome to the membrane. The GTPases involved in translation in Bacteria/Archaea are the elongation factors EFTu/EF1, the initiation factors IF2/aeIF5b + aeIF2, and the elongation factors EFG/EF2. All of these GTPases also contain the OB fold also found in the non GTPase IF1 involved in initiation. The GTPase involved in the signal recognition particle in most Bacteria and Archaea is SRP54. Results 1 The Elongation Factors of the Archaea based on structural considerations of the domains have the following evolutionary path: EF1→ aeIF2 → EF2. The evolution of the aeIF5b was a later event; 2 the Elongation Factors of the Bacteria based on the topological considerations of the GTPase domain have a similar evolutionary path: EFTu→ IF→2→EFG. These evolutionary sequences reflect the evolution of the LSU followed by the SSU to form the ribosome; 3 the OB-fold IF1 is a mimic of an ancient tRNA minihelix. Conclusion The evolution of translational GTPases of both the Archaea and Bacteria point to the evolution of the ribosome. The elongation factors, EFTu/EF1, began as a Ras-like GTPase bringing the activated minihelix tRNA to the Large Subunit Unit. The initiation factors and elongation factor would then have evolved from the EFTu/EF1 as the small subunit was added to the evolving ribosome. The SRP has an SRP54 GTPase and a specific RNA fold in its RNA component similar to the PTC. We consider the SRP to be a remnant of an ancient form of an LSU bound to a membrane. Reviewers This article was reviewed by George Fox, Leonid Mirny and Chris Sander.

Ribosomal incorporation of backbone modified amino acids via an editing-deficient aminoacyl-tRNA synthetase.

Science.gov (United States)

Iqbal, Emil S; Dods, Kara K; Hartman, Matthew C T

2018-02-14

The ability to incorporate non-canonical amino acids (ncAA) using translation offers researchers the ability to extend the functionality of proteins and peptides for many applications including synthetic biology, biophysical and structural studies, and discovery of novel ligands. Here we describe the high promiscuity of an editing-deficient valine-tRNA synthetase (ValRS T222P). Using this enzyme, we demonstrate ribosomal translation of 11 ncAAs including those with novel side chains, α,α-disubstitutions, and cyclic β-amino acids.

Reconstruction of phylogenetic relationships in dermatomycete genus Trichophyton Malmsten 1848 based on ribosomal internal transcribed spacer region, partial 28S rRNA and beta-tubulin genes sequences.

Science.gov (United States)

Pchelin, Ivan M; Zlatogursky, Vasily V; Rudneva, Mariya V; Chilina, Galina A; Rezaei-Matehkolaei, Ali; Lavnikevich, Dmitry M; Vasilyeva, Natalya V; Taraskina, Anastasia E

2016-09-01

Trichophyton spp. are important causative agents of superficial mycoses. The phylogeny of the genus and accurate strain identification, based on the ribosomal ITS region sequencing, are still under development. The present work is aimed at (i) inferring the genus phylogeny from partial ITS, LSU and BT2 sequences (ii) description of ribosomal ITS region polymorphism in 15 strains of Trichophyton interdigitale. We performed DNA sequence-based species identification and phylogenetic analysis on 48 strains belonging to the genus Trichophyton. Phylogenetic relationships were inferred by maximum likelihood and Bayesian methods on concatenated ITS, LSU and BT2 sequences. Ribosomal ITS region polymorphisms were assessed directly on the alignment. By phylogenetic reconstruction, we reveal major anthropophilic and zoophilic species clusters in the genus Trichophyton. We describe several sequences of the ITS region of T. interdigitale, which do not fit in the traditional polymorphism scheme and propose emendations in this scheme for discrimination between ITS sequence types in T. interdigitale. The new polymorphism scheme will allow inclusion of a wider spectrum of isolates while retaining its explanatory power. This scheme was also found to be partially congruent with NTS typing technique. © 2016 Blackwell Verlag GmbH.

Biphasic character of ribosomal translocation and non-Michaelis-Menten kinetics of translation

Science.gov (United States)

Xie, Ping

2014-12-01

We study theoretically the kinetics of mRNA translocation in the wild-type (WT) Escherichia coli ribosome, which is composed of a small 30 S and large 50 S subunit, and the ribosomes with mutations to some intersubunit bridges such as B1a, B4, B7a, and B8. The theoretical results reproduce well the available in vitro experimental data on the biphasic kinetics of the forward mRNA translocation catalyzed by elongation factor G (EF-G) hydrolyzing GTP, which can be best fit by the sum of two exponentials, and the monophasic kinetics of the spontaneous reverse mRNA translocation in the absence of the elongation factor, which can be best fit by a single-exponential function, in both the WT and mutant ribosomes. We show that both the mutation-induced increase in the maximal rate of the slow phase for the forward mRNA translocation and that in the rate of the spontaneous reverse mRNA translocation result from a reduction in the intrinsic energy barrier to resist the rotational movements between the two subunits, giving the same degree of increase in the two rates. The mutation-induced increase in the maximal rate of the fast phase for the forward mRNA translocation results mainly from the increase in the rate of the ribosomal unlocking, a conformational change in the ribosome that widens the mRNA channel for the mRNA translocation to take place, which could be partly due to the effect of the mutation on the intrasubunit 30S head rotation. Moreover, we study the translation rate of the WT and mutant ribosomes. It is shown that the translation rate versus the concentration of EF-G-GTP does not follow the Michaelis-Menten (MM) kinetics, which is in sharp contrast to the general property of other enzymes that the rate of the enzymatic reaction versus the concentration of a substrate follows the MM kinetics. The physical origin of this non-MM kinetics for the ribosome is revealed.

Ribosome evolution: Emergence of peptide synthesis machinery

Indian Academy of Sciences (India)

suggested the dynamic movement of ribosomal proteins. The L2 protein (a .... Such kinds of interactions are important in elucidating the evolution of RNA .... Tamura K 2009 Molecular handedness of life: significance of RNA aminoacylation.

Phylogenetic evidence for the acquisition of ribosomal RNA introns subsequent to the divergence of some of the major Tetrahymena groups

DEFF Research Database (Denmark)

Sogin, M L; Ingold, A; Karlok, M

1986-01-01

. In an attempt to evaluate the evolutionary origins of the intervening sequences, we have now determined complete small subunit ribosomal RNA gene sequences from 13 species of Tetrahymena and the absolute number of nucleotide differences between the sequences was used to construct a phylogenetic tree...

Transcriptional switch from albumin to alpha-fetoprotein and changes in transcription of other genes during carbon tetrachloride induced liver regeneration

International Nuclear Information System (INIS)

Panduro, A.; Shalaby, F.; Weiner, F.R.; Biempica, L.; Zern, M.A.; Shafritz, D.A.

1986-01-01

During liver regeneration induced by CCl 4 administration to rats, changes in the relative transcription rates of albumin and alpha-fetoprotein genes have been measured in conjunction with other liver-specific and general cellular function genes. Within 24 h following CCl 4 administration, albumin gene transcription decreases by 85%, whereas alpha-fetoprotein transcription increases from undetectable levels to 50% of that observed for albumin. These changes precede maximal [ 3 H]thymidine incorporation into DNA which peaks at 48 h. Other genes related to liver-specific functions, such as ligandin, alpha 1-antitrypsin, and cytochrome P-450's, as well as general cellular genes pro alpha 1- and pro alpha 2-collagen, beta-actin, and alpha-tubulin, respond in kinetic patterns often distinct from each other and from albumin and alpha-fetoprotein. Changes in the steady-state levels of albumin and alpha-fetoprotein mRNA correlate with changes in transcription, but there is a lag in alpha-fetoprotein mRNA accumulation, which peaks at 72 h following CCl 4 administration. These studies indicate that reciprocal changes in albumin and alpha-fetoprotein gene transcription occur during CCl 4 -induced liver regeneration, leading to changes in the level of these specific mRNAs. These changes precede DNA synthesis and would appear to represent an alteration in differentiated function of hepatocytes in conjunction with the liver regenerative process

Identification of a Recently Active Mammalian SINE Derived from Ribosomal RNA

Science.gov (United States)

Longo, Mark S.; Brown, Judy D.; Zhang, Chu; O’Neill, Michael J.; O’Neill, Rachel J.

2015-01-01

Complex eukaryotic genomes are riddled with repeated sequences whose derivation does not coincide with phylogenetic history and thus is often unknown. Among such sequences, the capacity for transcriptional activity coupled with the adaptive use of reverse transcription can lead to a diverse group of genomic elements across taxa, otherwise known as selfish elements or mobile elements. Short interspersed nuclear elements (SINEs) are nonautonomous mobile elements found in eukaryotic genomes, typically derived from cellular RNAs such as tRNAs, 7SL or 5S rRNA. Here, we identify and characterize a previously unknown SINE derived from the 3′-end of the large ribosomal subunit (LSU or 28S rDNA) and transcribed via RNA polymerase III. This new element, SINE28, is represented in low-copy numbers in the human reference genome assembly, wherein we have identified 27 discrete loci. Phylogenetic analysis indicates these elements have been transpositionally active within primate lineages as recently as 6 MYA while modern humans still carry transcriptionally active copies. Moreover, we have identified SINE28s in all currently available assembled mammalian genome sequences. Phylogenetic comparisons indicate that these elements are frequently rederived from the highly conserved LSU rRNA sequences in a lineage-specific manner. We propose that this element has not been previously recognized as a SINE given its high identity to the canonical LSU, and that SINE28 likely represents one of possibly many unidentified, active transposable elements within mammalian genomes. PMID:25637222

Probing the structure of ribosome assembly intermediates in vivo using DMS and hydroxyl radical footprinting.

Science.gov (United States)

Hulscher, Ryan M; Bohon, Jen; Rappé, Mollie C; Gupta, Sayan; D'Mello, Rhijuta; Sullivan, Michael; Ralston, Corie Y; Chance, Mark R; Woodson, Sarah A

2016-07-01

The assembly of the Escherichia coli ribosome has been widely studied and characterized in vitro. Despite this, ribosome biogenesis in living cells is only partly understood because assembly is coupled with transcription, modification and processing of the pre-ribosomal RNA. We present a method for footprinting and isolating pre-rRNA as it is synthesized in E. coli cells. Pre-rRNA synthesis is synchronized by starvation, followed by nutrient upshift. RNA synthesized during outgrowth is metabolically labeled to facilitate isolation of recent transcripts. Combining this technique with two in vivo RNA probing methods, hydroxyl radical and DMS footprinting, allows the structure of nascent RNA to be probed over time. Together, these can be used to determine changes in the structures of ribosome assembly intermediates as they fold in vivo. Copyright © 2016 Elsevier Inc. All rights reserved.

Direct crosslinking of the antitumor antibiotic sparsomycin, and its derivatives, to A2602 in the peptidyl transferase center of 23S-like rRNA within ribosome-tRNA complexes

DEFF Research Database (Denmark)

Porse, B T; Kirillov, S V; Awayez, M J

1999-01-01

of action was investigated by inducing a crosslink between sparsomycin and bacterial, archaeal, and eukaryotic ribosomes complexed with P-site-bound tRNA, on irradiating with low energy ultraviolet light (at 365 nm). The crosslink was localized exclusively to the universally conserved nucleotide A2602...

Eukaryotic 5S rRNA biogenesis

Science.gov (United States)

Ciganda, Martin; Williams, Noreen

2012-01-01

The ribosome is a large complex containing both protein and RNA which must be assembled in a precise manner to allow proper functioning in the critical role of protein synthesis. 5S rRNA is the smallest of the RNA components of the ribosome, and although it has been studied for decades, we still do not have a clear understanding of its function within the complex ribosome machine. It is the only RNA species that binds ribosomal proteins prior to its assembly into the ribosome. Its transport into the nucleolus requires this interaction. Here we present an overview of some of the key findings concerning the structure and function of 5S rRNA and how its association with specific proteins impacts its localization and function. PMID:21957041

Structural insights into methyltransferase KsgA function in 30S ribosomal subunit biogenesis.

Science.gov (United States)

Boehringer, Daniel; O'Farrell, Heather C; Rife, Jason P; Ban, Nenad

2012-03-23

The assembly of the ribosomal subunits is facilitated by ribosome biogenesis factors. The universally conserved methyltransferase KsgA modifies two adjacent adenosine residues in the 3'-terminal helix 45 of the 16 S ribosomal RNA (rRNA). KsgA recognizes its substrate adenosine residues only in the context of a near mature 30S subunit and is required for the efficient processing of the rRNA termini during ribosome biogenesis. Here, we present the cryo-EM structure of KsgA bound to a nonmethylated 30S ribosomal subunit. The structure reveals that KsgA binds to the 30S platform with the catalytic N-terminal domain interacting with substrate adenosine residues in helix 45 and the C-terminal domain making extensive contacts to helix 27 and helix 24. KsgA excludes the penultimate rRNA helix 44 from adopting its position in the mature 30S subunit, blocking the formation of the decoding site and subunit joining. We suggest that the activation of methyltransferase activity and subsequent dissociation of KsgA control conformational changes in helix 44 required for final rRNA processing and translation initiation.

Structural Insights into Methyltransferase KsgA Function in 30S Ribosomal Subunit Biogenesis*

Science.gov (United States)

Boehringer, Daniel; O'Farrell, Heather C.; Rife, Jason P.; Ban, Nenad

2012-01-01

The assembly of the ribosomal subunits is facilitated by ribosome biogenesis factors. The universally conserved methyltransferase KsgA modifies two adjacent adenosine residues in the 3′-terminal helix 45 of the 16 S ribosomal RNA (rRNA). KsgA recognizes its substrate adenosine residues only in the context of a near mature 30S subunit and is required for the efficient processing of the rRNA termini during ribosome biogenesis. Here, we present the cryo-EM structure of KsgA bound to a nonmethylated 30S ribosomal subunit. The structure reveals that KsgA binds to the 30S platform with the catalytic N-terminal domain interacting with substrate adenosine residues in helix 45 and the C-terminal domain making extensive contacts to helix 27 and helix 24. KsgA excludes the penultimate rRNA helix 44 from adopting its position in the mature 30S subunit, blocking the formation of the decoding site and subunit joining. We suggest that the activation of methyltransferase activity and subsequent dissociation of KsgA control conformational changes in helix 44 required for final rRNA processing and translation initiation. PMID:22308031

Using the Ribodeblur pipeline to recover A-sites from yeast ribosome profiling data.

Science.gov (United States)

Wang, Hao; Kingsford, Carl; McManus, C Joel

2018-03-15

Ribosome profiling has emerged as a powerful technique to study mRNA translation. Ribosome profiling has the potential to determine the relative quantities and locations of ribosomes on mRNA genome wide. Taking full advantage of this approach requires accurate measurement of ribosome locations. However, experimental inconsistencies often obscure the positional information encoded in ribosome profiling data. Here, we describe the Ribodeblur pipeline, a computational analysis tool that uses a maximum likelihood framework to infer ribosome positions from heterogeneous datasets. Ribodeblur is simple to install, and can be run on an average modern Mac or Linux-based laptop. We detail the process of applying the pipeline to high-coverage ribosome profiling data in yeast, and discuss important considerations for potential extension to other organisms. Copyright © 2018 Elsevier Inc. All rights reserved.

Control of ribosome traffic by position-dependent choice of synonymous codons

International Nuclear Information System (INIS)

Mitarai, Namiko; Pedersen, Steen

2013-01-01

Messenger RNA (mRNA) encodes a sequence of amino acids by using codons. For most amino acids, there are multiple synonymous codons that can encode the amino acid. The translation speed can vary from one codon to another, thus there is room for changing the ribosome speed while keeping the amino acid sequence and hence the resulting protein. Recently, it has been noticed that the choice of the synonymous codon, via the resulting distribution of slow- and fast-translated codons, affects not only on the average speed of one ribosome translating the mRNA but also might have an effect on nearby ribosomes by affecting the appearance of ‘traffic jams’ where multiple ribosomes collide and form queues. To test this ‘context effect’ further, we here investigate the effect of the sequence of synonymous codons on the ribosome traffic by using a ribosome traffic model with codon-dependent rates, estimated from experiments. We compare the ribosome traffic on wild-type (WT) sequences and sequences where the synonymous codons were swapped randomly. By simulating translation of 87 genes, we demonstrate that the WT sequences, especially those with a high bias in codon usage, tend to have the ability to reduce ribosome collisions, hence optimizing the cellular investment in the translation apparatus. The magnitude of such reduction of the translation time might have a significant impact on the cellular growth rate and thereby have importance for the survival of the species. (paper)

Expression and localization of tubulin cofactors TBCD and TBCE in human gametes.

Science.gov (United States)

Jiménez-Moreno, Victoria; Agirregoitia, Ekaitz

2017-06-01

The tubulin cofactors TBCD and TBCE play an essential role in regulation of the microtubule dynamics in a wide variety of somatic cells, but little information is known about the expression of these cofactors in human sperm and oocytes. In this study, we focused on the investigation of the presence of, and the differential distribution of, the tubulin cofactors TBCD and TBCE in human sperm and during human oocyte maturation. We performed expression assays for TBCD and TBCE by reverse transcription-polymerase chain reaction (RT-PCR), western blot and immunofluorescence and verified the presence of both cofactors in human gametes. TBCD and TBCE were located mainly in the middle region and in the tail of the sperm while in the oocyte the localization was cytosolic. The mRNA of both tubulin cofactors were present in the human oocytes but not in sperm cells. This finding gives a first insight into where TBCD and TBCE could carry out their function in the continuous changes that the cytoskeleton experiences during gametogenesis and also prior to fertilization.

Antileishmanial activity and tubulin polymerization inhibition of podophyllotoxin derivatives on Leishmania infantum

Directory of Open Access Journals (Sweden)

José Miguel Escudero-Martínez

2017-12-01

Full Text Available Leishmania microtubules play an important role not only in cell division, but also in keeping the shape of the parasite and motility of its free-living stages. Microtubules result from the self-assembly of alpha and beta tubulins, two phylogenetically conserved and very abundant eukaryotic proteins in kinetoplastids. The colchicine binding domain has inspired the discovery and development of several drugs currently in clinical use against parasites. However, this domain is less conserved in kinetoplastids and may be selectively targeted by new compounds. This report shows the antileishmanial effect of several series of compounds (53, derived from podophyllotoxin (a natural cyclolignan isolated from rhizomes of Podophyllum spp. and podophyllic aldehyde, on a transgenic, fluorescence-emitting strain of Leishmania infantum. These compounds were tested on both promastigotes and amastigote-infected mouse splenocytes, and in mammalian – mouse non-infected splenocytes and liver HepG2 cells – in order to determine selective indexes of the drugs. Results obtained with podophyllotoxin derivatives showed that the hydroxyl group at position C-7α was a structural requisite to kill the parasites. On regards podophyllic aldehyde, derivatives with C9-aldehyde group integrated into a bicyclic heterostructure displayed more potent antileishmanial effects and were relatively safe for host cells. Docking studies of podophyllotoxin and podophyllic aldehyde derivatives showed that these compounds share a similar pattern of interaction at the colchicine site of Leishmania tubulin, thus pointing to a common mechanism of action. However, the results obtained suggested that despite tubulin is a remarkable target against leishmaniasis, there is a poor correlation between inhibition of tubulin polymerization and antileishmanial effect of many of the compounds tested, fact that points to alternative pathways to kill the parasites. Keywords: Leishmania, Tubulin, DNA

Ribosome-catalyzed formation of an abnormal peptide analogue

International Nuclear Information System (INIS)

Roesser, J.R.; Chorghade, M.S.; Hecht, S.M.

1986-01-01

The peptidyl-tRNA analogue N-(chloracetyl) phenylalanyl-tRNA/sup Phe/ was prepared by chemical aminoacylation and prebound to the P site of Escherichia coli ribosomes in response to poly(uridylic acid). Admixture of phenylalanyl-tRNA/sup Phe/ to the A site resulted in the formation of two dipeptides, one of which was found by displacement of chloride ion from the peptidyl-tRNA. This constitutes the first example of ribosome-mediated formation of a peptide of altered connectivity and suggests a need for revision of the current model of peptide bond formation. Also suggested by the present finding is the feasibility of utilizing tRNAs to prepare polypeptides of altered connectivity in an in vitro protein biosynthesizing system. [ 32 P]-oligo(rA), [ 3 H]- and [ 14 C] phenylalanines were used in the assay of the peptidye-tRNA analogue

Protein-protein interactions within late pre-40S ribosomes.

Directory of Open Access Journals (Sweden)

Melody G Campbell

2011-01-01

Full Text Available Ribosome assembly in eukaryotic organisms requires more than 200 assembly factors to facilitate and coordinate rRNA transcription, processing, and folding with the binding of the ribosomal proteins. Many of these assembly factors bind and dissociate at defined times giving rise to discrete assembly intermediates, some of which have been partially characterized with regards to their protein and RNA composition. Here, we have analyzed the protein-protein interactions between the seven assembly factors bound to late cytoplasmic pre-40S ribosomes using recombinant proteins in binding assays. Our data show that these factors form two modules: one comprising Enp1 and the export adaptor Ltv1 near the beak structure, and the second comprising the kinase Rio2, the nuclease Nob1, and a regulatory RNA binding protein Dim2/Pno1 on the front of the head. The GTPase-like Tsr1 and the universally conserved methylase Dim1 are also peripherally connected to this second module. Additionally, in an effort to further define the locations for these essential proteins, we have analyzed the interactions between these assembly factors and six ribosomal proteins: Rps0, Rps3, Rps5, Rps14, Rps15 and Rps29. Together, these results and previous RNA-protein crosslinking data allow us to propose a model for the binding sites of these seven assembly factors. Furthermore, our data show that the essential kinase Rio2 is located at the center of the pre-ribosomal particle and interacts, directly or indirectly, with every other assembly factor, as well as three ribosomal proteins required for cytoplasmic 40S maturation. These data suggest that Rio2 could play a central role in regulating cytoplasmic maturation steps.

Molecular cloning and functional analysis of a recombinant ribosome-inactivating protein (alpha-momorcharin) from Momordica charantia.

Science.gov (United States)

Wang, Shuzhen; Zhang, Yubo; Liu, Honggao; He, Ying; Yan, Junjie; Wu, Zhihua; Ding, Yi

2012-11-01

Alpha-momorcharin (α-MC), a member of the ribosome-inactivating protein (RIP) family, has been used not only as antiviral, antimicrobial, and antitumor agents, but also as toxicant to protozoa, insects, and fungi. In this study, we expressed the protein in Escherichia coli Rosetta (DE3) pLysS strain and purified it by nickel-nitrilotriacetic acid affinity chromatography. A total of 85 mg of homogeneous protein was obtained from 1 l culture supernatant of Rosetta (DE3) pLysS, showing a high recovery rate of 73.9%. Protein activity assay indicated that α-MC had both N-glycosidase activity and DNA-nuclease activity, the former releasing RIP diagnostic RNA fragment (Endo's fragment) from rice rRNAs and the latter converting supercoiled circular DNA of plasmid pET-32a(+) into linear conformations in a concentration-dependent manner. Specially, we found that α-MC could inhibit the mycelial growth of Fusarium solani and Fusarium oxysporum with IC(50) values of 6.23 and 4.15 μM, respectively. Results of optical microscopy and transmission electron microscopy demonstrated that α-MC caused extensive septum formation, loss of integrity of the cell wall, separation of the cytoplasm from the cell wall, deformation of cells with irregular budding sites, and apoptosis in F. solani. Moreover, α-MC was active against Pseudomonas aeruginosa with an IC(50) value of 0.59 μM. The α-MC protein carries a high potential for the design of new antifungal drugs or the development of transgenic crops resistant to pathogens.

Crystal Structure of the 23S rRNA Fragment Specific to r-Protein L1 and Designed Model of the Ribosomal L1 Stalk from Haloarcula marismortui

Directory of Open Access Journals (Sweden)

Azat Gabdulkhakov

2017-02-01

Full Text Available The crystal structure of the 92-nucleotide L1-specific fragment of 23S rRNA from Haloarcula marismortui (Hma has been determined at 3.3 Å resolution. Similar to the corresponding bacterial rRNA fragments, this structure contains joined helix 76-77 topped by an approximately globular structure formed by the residual part of the L1 stalk rRNA. The position of HmaL1 relative to the rRNA was found by its docking to the rRNA fragment using the L1-rRNA complex from Thermus thermophilus as a guide model. In spite of the anomalous negative charge of the halophilic archaeal protein, the conformation of the HmaL1-rRNA interface appeared to be very close to that observed in all known L1-rRNA complexes. The designed structure of the L1 stalk was incorporated into the H. marismortui 50S ribosomal subunit. Comparison of relative positions of L1 stalks in 50S subunits from H. marismortui and T. thermophilus made it possible to reveal the site of inflection of rRNA during the ribosome function.

Novel extraction strategy of ribosomal RNA and genomic DNA from cheese for PCR-based investigations.

Science.gov (United States)

Bonaïti, Catherine; Parayre, Sandrine; Irlinger, Françoise

2006-03-15

Cheese microorganisms, such as bacteria and fungi, constitute a complex ecosystem that plays a central role in cheeses ripening. The molecular study of cheese microbial diversity and activity is essential but the extraction of high quality nucleic acid may be problematic: the cheese samples are characterised by a strong buffering capacity which negatively influenced the yield of the extracted rRNA. The objective of this study is to develop an effective method for the direct and simultaneous isolation of yeast and bacterial ribosomal RNA and genomic DNA from the same cheese samples. DNA isolation was based on a protocol used for nucleic acids isolation from anaerobic digestor, without preliminary washing step with the combined use of the action of chaotropic agent (acid guanidinium thiocyanate), detergents (SDS, N-lauroylsarcosine), chelating agent (EDTA) and a mechanical method (bead beating system). The DNA purification was carried out by two washing steps of phenol-chloroform. RNA was isolated successfully after the second acid extraction step by recovering it from the phenolic phase of the first acid extraction. The novel method yielded pure preparation of undegraded RNA accessible for reverse transcription-PCR. The extraction protocol of genomic DNA and rRNA was applicable to complex ecosystem of different cheese matrices.

Binding site of ribosomal proteins on prokaryotic 5S ribonucleic acids: a study with ribonucleases

DEFF Research Database (Denmark)

Douthwaite, S; Christensen, A; Garrett, R A

1982-01-01

The binding sites of ribosomal proteins L18 and L25 on 5S RNA from Escherichia coli were probed with ribonucleases A, T1, and T2 and a double helix specific cobra venom endonuclease. The results for the protein-RNA complexes, which were compared with those for the free RNA [Douthwaite, S...... stearothermophilus 5S RNA. Several protein-induced changes in the RNA structures were identified; some are possibly allosteric in nature. The two prokaryotic 5S RNAs were also incubated with total 50S subunit proteins from E. coli and B. stearothermophilus ribosomes. Homologous and heterologous reconstitution....... stearothermophilus 5S RNA, which may have been due to a third ribosomal protein L5....

Connecting the kinetics and energy landscape of tRNA translocation on the ribosome.

Directory of Open Access Journals (Sweden)

Paul C Whitford

Full Text Available Functional rearrangements in biomolecular assemblies result from diffusion across an underlying energy landscape. While bulk kinetic measurements rely on discrete state-like approximations to the energy landscape, single-molecule methods can project the free energy onto specific coordinates. With measures of the diffusion, one may establish a quantitative bridge between state-like kinetic measurements and the continuous energy landscape. We used an all-atom molecular dynamics simulation of the 70S ribosome (2.1 million atoms; 1.3 microseconds to provide this bridge for specific conformational events associated with the process of tRNA translocation. Starting from a pre-translocation configuration, we identified sets of residues that collectively undergo rotary rearrangements implicated in ribosome function. Estimates of the diffusion coefficients along these collective coordinates for translocation were then used to interconvert between experimental rates and measures of the energy landscape. This analysis, in conjunction with previously reported experimental rates of translocation, provides an upper-bound estimate of the free-energy barriers associated with translocation. While this analysis was performed for a particular kinetic scheme of translocation, the quantitative framework is general and may be applied to energetic and kinetic descriptions that include any number of intermediates and transition states.

Differential Stoichiometry among Core Ribosomal Proteins

Directory of Open Access Journals (Sweden)

Nikolai Slavov

2015-11-01

Full Text Available Understanding the regulation and structure of ribosomes is essential to understanding protein synthesis and its dysregulation in disease. While ribosomes are believed to have a fixed stoichiometry among their core ribosomal proteins (RPs, some experiments suggest a more variable composition. Testing such variability requires direct and precise quantification of RPs. We used mass spectrometry to directly quantify RPs across monosomes and polysomes of mouse embryonic stem cells (ESC and budding yeast. Our data show that the stoichiometry among core RPs in wild-type yeast cells and ESC depends both on the growth conditions and on the number of ribosomes bound per mRNA. Furthermore, we find that the fitness of cells with a deleted RP-gene is inversely proportional to the enrichment of the corresponding RP in polysomes. Together, our findings support the existence of ribosomes with distinct protein composition and physiological function.

A new version of the RDP (Ribosomal Database Project)

Science.gov (United States)

Maidak, B. L.; Cole, J. R.; Parker, C. T. Jr; Garrity, G. M.; Larsen, N.; Li, B.; Lilburn, T. G.; McCaughey, M. J.; Olsen, G. J.; Overbeek, R.;

Chromophore-assisted light inactivation of pKi-67 leads to inhibition of ribosomal RNA synthesis.

Science.gov (United States)

Rahmanzadeh, R; Hüttmann, G; Gerdes, J; Scholzen, T

2007-06-01

Expression of the nuclear Ki-67 protein (pKi-67) is strongly associated with cell proliferation. For this reason, antibodies against this protein are widely used as prognostic tools for the assessment of cell proliferation in biopsies from cancer patients. Despite this broad application in histopathology, functional evidence for the physiological role of pKi-67 is still missing. Recently, we proposed a function of pKi-67 in the early steps of ribosomal RNA (rRNA) synthesis. Here, we have examined the involvement of pKi-67 in this process by photochemical inhibition using chromophore-assisted light inactivation (CALI). Anti-pKi-67 antibodies were labelled with the fluorochrome fluorescein 5(6)-isothiocyanate and were irradiated after binding to their target protein. Performing CALI in vitro on cell lysates led to specific cross-linking of pKi-67. Moreover, the upstream binding factor (UBF) necessary for rRNA transcription was also partly subjected to cross-link formation, indicating a close spatial proximity of UBF and pKi-67. CALI in living cells, using micro-injected antibody, caused a striking relocalization of UBF from foci within the nucleoli to spots located at the nucleolar rim or within the nucleoplasm. pKi-67-CALI resulted in dramatic inhibition of RNA polymerase I-dependent nucleolar rRNA synthesis, whereas RNA polymerase II-dependent nucleoplasmic RNA synthesis remained almost unaltered. Our data presented here argue for a crucial role of pKi-67 in RNA polymerase I-dependent nucleolar rRNA synthesis.

Small interfering RNA targeting HIF-1{alpha} reduces hypoxia-dependent transcription and radiosensitizes hypoxic HT 1080 human fibrosarcoma cells in vitro

Energy Technology Data Exchange (ETDEWEB)

Staab, Adrian [Wuerzburg Univ. (Germany). Dept. of Radiation Oncology; Paul Scherrer Institute (PSI), Villigen (Switzerland); Fleischer, Markus [Wuerzburg Univ. (Germany). Dept. of Radiation Oncology; Wuerzburg Univ. (Germany). Medical Clinic II; Loeffler, Juergen; Einsele, Herrmann [Wuerzburg Univ. (Germany). Medical Clinic II; Said, Harun M.; Katzer, Astrid; Flentje, Michael [Wuerzburg Univ. (Germany). Dept. of Radiation Oncology; Plathow, Christian [Freiburg Univ. (Germany). Dept. of Nuclear Medicine; Vordermark, Dirk [Wuerzburg Univ. (Germany). Dept. of Radiation Oncology; Halle-Wittenberg Univ. (Germany). Dept. of Radiation Oncology

2011-04-15

Background: Hypoxia inducible factor-1 has been identified as a potential target to overcome hypoxia-induced radioresistance The aim of the present study was to investigate whether selective HIF-1 inhibition via small interfering RNA (siRNA) targeting hypoxia-inducible factor 1{alpha} (HIF-1{alpha}) affects hypoxia-induced radioresistance in HT 1080 human fibrosarcoma cells. Material and Methods: HIF-1{alpha} expression in HT 1080 human fibrosarcoma cells in vitro was silenced using HIF-1{alpha} siRNA sequence primers. Quantitative real-time polymerase chain reaction assay was performed to quantify the mRNA expression of HIF-1{alpha}. HIF-1{alpha} protein levels were studied by Western blotting at 20% (air) or after 12 hours at 0.1% O{sub 2} (hypoxia). Cells were assayed for clonogenic survival after irradiation with 2, 5, or 10 Gy, under normoxic or hypoxic conditions in the presence of HIF-1{alpha}-targeted or control siRNA sequences. A modified oxygen enhancement ratio (OER') was calculated as the ratio of the doses to achieve the same survival at 0.1% O{sub 2} as at ambient oxygen tensions. OER' was obtained at cell survival levels of 50%, 37%, and 10%. Results: HIF-1{alpha}-targeted siRNA enhanced radiation treatment efficacy under severely hypoxic conditions compared to tumor cells treated with scrambled control siRNA. OER was reduced on all survival levels after treatment with HIF-1{alpha}-targeted siRNA, suggesting that inhibition of HIF-1 activation by using HIF-1{alpha}-targeted siRNA increases radiosensitivity of hypoxic tumor cells in vitro. Conclusion: Inhibition of HIF-1 activation by using HIF-1{alpha}-targeted siRNA clearly acts synergistically with radiotherapy and increase radiosensitivity of hypoxic cells in vitro. (orig.)

Eukaryotic ribosome display with in situ DNA recovery.

Science.gov (United States)

He, Mingyue; Edwards, Bryan M; Kastelic, Damjana; Taussig, Michael J

2012-01-01

Ribosome display is a cell-free display technology for in vitro selection and optimisation of proteins from large diversified libraries. It operates through the formation of stable protein-ribosome-mRNA (PRM) complexes and selection of ligand-binding proteins, followed by DNA recovery from the selected genetic information. Both prokaryotic and eukaryotic ribosome display systems have been developed. In this chapter, we describe the eukaryotic rabbit reticulocyte method in which a distinct in situ single-primer RT-PCR procedure is used to recover DNA from the selected PRM complexes without the need for prior disruption of the ribosome.

Tubulin polymerization-stimulating activity of Ganoderma triterpenoids.

Science.gov (United States)

Kohno, Toshitaka; Hai-Bang, Tran; Zhu, Qinchang; Amen, Yhiya; Sakamoto, Seiichi; Tanaka, Hiroyuki; Morimoto, Satoshi; Shimizu, Kuniyoshi

2017-04-01

Tubulin polymerization is an important target for anticancer therapies. Even though the potential of Ganoderma triterpenoids against various cancer targets had been well documented, studies on their tubulin polymerization-stimulating activity are scarce. This study was conducted to evaluate the effect of Ganoderma triterpenoids on tubulin polymerization. A total of twenty-four compounds were investigated using an in vitro tubulin polymerization assay. Results showed that most of the studied triterpenoids exhibited microtuble-stabilizing activity to different degrees. Among the investigated compounds, ganoderic acid T-Q, ganoderiol F, ganoderic acid S, ganodermanontriol and ganoderic acid TR were found to have the highest activities. A structure-activity relationship (SAR) analysis was performed. Extensive investigation of the SAR suggests the favorable structural features for the tubulin polymerization-stimulating activity of lanostane triterpenes. These findings would be helpful for further studies on the potential mechanisms of the anticancer activity of Ganoderma triterpenoids and give some indications on the design of tubulin-targeting anticancer agents.

Mutational analysis of S12 protein and implications for the accuracy of decoding by the ribosome.

Science.gov (United States)

Sharma, Divya; Cukras, Anthony R; Rogers, Elizabeth J; Southworth, Daniel R; Green, Rachel

2007-12-07

The fidelity of aminoacyl-tRNA selection by the ribosome depends on a conformational switch in the decoding center of the small ribosomal subunit induced by cognate but not by near-cognate aminoacyl-tRNA. The aminoglycosides paromomycin and streptomycin bind to the decoding center and induce related structural rearrangements that explain their observed effects on miscoding. Structural and biochemical studies have identified ribosomal protein S12 (as well as specific nucleotides in 16S ribosomal RNA) as a critical molecular contributor in distinguishing between cognate and near-cognate tRNA species as well as in promoting more global rearrangements in the small subunit, referred to as "closure." Here we use a mutational approach to define contributions made by two highly conserved loops in S12 to the process of tRNA selection. Most S12 variant ribosomes tested display increased levels of fidelity (a "restrictive" phenotype). Interestingly, several variants, K42A and R53A, were substantially resistant to the miscoding effects of paromomycin. Further characterization of the compromised paromomycin response identified a probable second, fidelity-modulating binding site for paromomycin in the 16S ribosomal RNA that facilitates closure of the small subunit and compensates for defects associated with the S12 mutations.

Trapping the ribosome to control gene expression.

Science.gov (United States)

Boehringer, Daniel; Ban, Nenad

2007-09-21

Protein synthesis is often regulated by structured mRNAs that interact with ribosomes. In this issue of Cell, Marzi et al. (2007) provide insights into the autoregulation of protein S15 by visualizing the folded repressor mRNA on the ribosome stalled in the preinitiation state. These results have implications for our understanding of the mechanism of translation initiation in general.

Ribosome profiling-guided depletion of an mRNA increases cell growth rate and protein secretion

DEFF Research Database (Denmark)

Beuchert Kallehauge, Thomas; Li, Shangzhong; Pedersen, Lasse Ebdrup

2017-01-01

Recombinant protein production coopts the host cell machinery to provide high protein yields of industrial enzymes or biotherapeutics. However, since protein translation is energetically expensive and tightly controlled, it is unclear if highly expressed recombinant genes are translated as effici......Recombinant protein production coopts the host cell machinery to provide high protein yields of industrial enzymes or biotherapeutics. However, since protein translation is energetically expensive and tightly controlled, it is unclear if highly expressed recombinant genes are translated...... as efficiently as host genes. Furthermore, it is unclear how the high expression impacts global translation. Here, we present the first genome-wide view of protein translation in an IgG-producing CHO cell line, measured with ribosome profiling. Through this we found that our recombinant mRNAs were translated...... as efficiently as the host cell transcriptome, and sequestered up to 15% of the total ribosome occupancy. During cell culture, changes in recombinant mRNA translation were consistent with changes in transcription, demonstrating that transcript levels influence specific productivity. Using this information, we...

Conservation of RNA sequence and cross-linking ability in ribosomes from a higher eukaryote: photochemical cross-linking of the anticodon of P site bound tRNA to the penultimate cytidine of the UACACACG sequence in Artemia salina 18S rRNA

International Nuclear Information System (INIS)

Ciesiolka, J.; Nurse, K.; Klein, J.; Ofengand, J.

1985-01-01

The complex of Artemia salina ribosomes and Escherichia coli acetylvalyl-tRNA could be cross-linked by irradiation with near-UV light. Cross-linking required the presence of the codon GUU, GUA being ineffective. The acetylvalyl group could be released from the cross-linked tRNA by treatment with puromycin, demonstrating that cross-linking had occurred at the P site. This was true both for pGUU- and also for poly(U2,G)-dependent cross-linking. All of the cross-linking was to the 18S rRNA of the small ribosomal subunit. Photolysis of the cross-link at 254 nm occurred with the same kinetics as that for the known cyclobutane dimer between this tRNA and Escherichia coli 16S rRNA. T1 RNase digestion of the cross-linked tRNA yielded an oligonucleotide larger in molecular weight than any from un-cross-linked rRNA or tRNA or from a prephotolyzed complex. Extended electrophoresis showed this material to consist of two oligomers of similar mobility, a faster one-third component and a slower two-thirds component. Each oligomer yielded two components on 254-nm photolysis. The slower band from each was the tRNA T1 oligomer CACCUCCCUVACAAGp, which includes the anticodon. The faster band was the rRNA 9-mer UACACACCGp and its derivative UACACACUG. Unexpectedly, the dephosphorylated and slower moving 9-mer was derived from the faster moving dimer. Deamination of the penultimate C to U is probably due to cyclobutane dimer formation and was evidence for that nucleotide being the site of cross-linking. Direct confirmation of the cross-linking site was obtained by Z-gel analysis

Molecular insight into γ-γ tubulin lateral interactions within the γ-tubulin ring complex (γ-TuRC)

Science.gov (United States)

Suri, Charu; Hendrickson, Triscia W.; Joshi, Harish C.; Naik, Pradeep Kumar

2014-09-01

γ-tubulin is essential for the nucleation and organization of mitotic microtubules in dividing cells. It is localized at the microtubule organizing centers and mitotic spindle fibres. The most well accepted hypothesis for the initiation of microtubule polymerization is that α/β-tubulin dimers add onto a γ-tubulin ring complex (γTuRC), in which adjacent γ-tubulin subunits bind to the underlying non-tubulin components of the γTuRC. This template thus determines the resulting microtubule lattice. In this study we use molecular modelling and molecular dynamics simulations, combined with computational MM-PBSA/MM-GBSA methods, to determine the extent of the lateral atomic interaction between two adjacent γ-tubulins within the γTuRC. To do this we simulated a γ-γ homodimer for 10 ns and calculated the ensemble average of binding free energies of -107.76 kcal/mol by the MM-PBSA method and of -87.12 kcal/mol by the MM-GBSA method. These highly favourable binding free energy values imply robust lateral interactions between adjacent γ-tubulin subunits in addition to their end-interactions longitudinally with other proteins of γTuRC. Although the functional reconstitution of γ-TuRC subunits and their stepwise in vitro assembly from purified components is not yet feasible, we nevertheless wanted to recognize hotspot amino acids responsible for key γ-γ interactions. Our free energy decomposition data from converting a compendium of amino acid residues identified an array of hotspot amino acids. A subset of such mutants can be expressed in vivo in living yeast. Because γTuRC is important for the growth of yeast, we could test whether this subset of the hotspot mutations support growth of yeast. Consistent with our model, γ-tubulin mutants that fall into our identified hotspot do not support yeast growth.

Fluctuations and synchrony of RNA synthesis in nucleoli.

Science.gov (United States)

Pliss, Artem; Kuzmin, Andrey N; Kachynski, Aliaksandr V; Baev, Alexander; Berezney, Ronald; Prasad, Paras N

2015-06-01

Ribosomal RNA (rRNA) sequences are synthesized at exceptionally high rates and, together with ribosomal proteins (r-proteins), are utilized as building blocks for the assembly of pre-ribosomal particles. Although it is widely acknowledged that tight regulation and coordination of rRNA and r-protein production are fundamentally important for the maintenance of cellular homeostasis, still little is known about the real-time kinetics of the ribosome component synthesis in individual cells. In this communication we introduce a label-free MicroRaman spectrometric approach for monitoring rRNA synthesis in live cultured cells. Remarkably high and rapid fluctuations of rRNA production rates were revealed by this technique. Strikingly, the changes in the rRNA output were synchronous for ribosomal genes located in separate nucleoli of the same cell. Our findings call for the development of new concepts to elucidate the coordination of ribosomal components production. In this regard, numerical modeling further demonstrated that the production of rRNA and r-proteins can be coordinated, regardless of the fluctuations in rRNA synthesis. Overall, our quantitative data reveal a spectacular interplay of inherently stochastic rates of RNA synthesis and the coordination of gene expression.

A ribosomal RNA gene intergenic spacer based PCR and DGGE fingerprinting method for the analysis of specific rhizobial communities in soil

NARCIS (Netherlands)

de Oliveira, VM; Manfio, GP; Coutinho, HLD; Keijzer-Wolters, AC; van Elsas, JD

A direct molecular method for assessing the diversity of specific populations of rhizobia in soil, based on nested PCR amplification of 16S-23S ribosomal RNA gene (rDNA) intergenic spacer (IGS) sequences, was developed. Initial generic amplification of bacterial rDNA IGS sequences from soil DNA was

A ribosomal RNA gene intergenic spacer based PCR and DGGE fingerprinting method for the analysis of specific rhizobial communities in soil

NARCIS (Netherlands)

Oliveira, de V.M.; Manfio, G.P.; Coutinho, H.L.D.; Keijzer-Wolters, A.C.; Elsas, van J.D.

2006-01-01

A direct molecular method for assessing the diversity of specific populations of rhizobia in soil, based on nested PCR amplification of 16S-23S ribosomal RNA gene (rDNA) intergenic spacer (IGS) sequences, was developed. Initial generic amplification of bacterial rDNA IGS sequences from soil DNA was

Assembly constraints drive co-evolution among ribosomal constituents.

Science.gov (United States)

Mallik, Saurav; Akashi, Hiroshi; Kundu, Sudip

2015-06-23

Ribosome biogenesis, a central and essential cellular process, occurs through sequential association and mutual co-folding of protein-RNA constituents in a well-defined assembly pathway. Here, we construct a network of co-evolving nucleotide/amino acid residues within the ribosome and demonstrate that assembly constraints are strong predictors of co-evolutionary patterns. Predictors of co-evolution include a wide spectrum of structural reconstitution events, such as cooperativity phenomenon, protein-induced rRNA reconstitutions, molecular packing of different rRNA domains, protein-rRNA recognition, etc. A correlation between folding rate of small globular proteins and their topological features is known. We have introduced an analogous topological characteristic for co-evolutionary network of ribosome, which allows us to differentiate between rRNA regions subjected to rapid reconstitutions from those hindered by kinetic traps. Furthermore, co-evolutionary patterns provide a biological basis for deleterious mutation sites and further allow prediction of potential antibiotic targeting sites. Understanding assembly pathways of multicomponent macromolecules remains a key challenge in biophysics. Our study provides a 'proof of concept' that directly relates co-evolution to biophysical interactions during multicomponent assembly and suggests predictive power to identify candidates for critical functional interactions as well as for assembly-blocking antibiotic target sites. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

Acrolein preferentially damages nucleolus eliciting ribosomal stress and apoptosis in human cancer cells.

Science.gov (United States)

Wang, Hsiang-Tsui; Chen, Tzu-Ying; Weng, Ching-Wen; Yang, Chun-Hsiang; Tang, Moon-Shong

2016-12-06

Acrolein (Acr) is a potent cytotoxic and DNA damaging agent which is ubiquitous in the environment and abundant in tobacco smoke. Acr is also an active cytotoxic metabolite of the anti-cancer drugs cyclophosphamide and ifosfamide. The mechanisms via which Acr exerts its anti-cancer activity and cytotoxicity are not clear. In this study, we found that Acr induces cytotoxicity and cell death in human cancer cells with different activities of p53. Acr preferentially binds nucleolar ribosomal DNA (rDNA) to form Acr-deoxyguanosine adducts, and induces oxidative damage to both rDNA and ribosomal RNA (rRNA). Acr triggers ribosomal stress responses, inhibits rRNA synthesis, reduces RNA polymerase I binding to the promoter of rRNA gene, disrupts nucleolar integrity, and impairs ribosome biogenesis and polysome formation. Acr causes an increase in MDM2 levels and phosphorylation of MDM2 in A549 and HeLa cells which are p53 active and p53 inactive, respectively. It enhances the binding of ribosomal protein RPL11 to MDM2 and reduces the binding of p53 and E2F-1 to MDM2 resulting in stabilization/activation of p53 in A549 cells and degradation of E2F-1 in A549 and HeLa cells. We propose that Acr induces ribosomal stress which leads to activation of MDM2 and RPL11-MDM2 binding, consequently, activates p53 and enhances E2F-1 degradation, and that taken together these two processes induce apoptosis and cell death.

Novel Accurate Bacterial Discrimination by MALDI-Time-of-Flight MS Based on Ribosomal Proteins Coding in S10-spc-alpha Operon at Strain Level S10-GERMS

Science.gov (United States)

Tamura, Hiroto; Hotta, Yudai; Sato, Hiroaki

2013-08-01

Matrix-assisted laser-desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) is one of the most widely used mass-based approaches for bacterial identification and classification because of the simple sample preparation and extremely rapid analysis within a few minutes. To establish the accurate MALDI-TOF MS bacterial discrimination method at strain level, the ribosomal subunit proteins coded in the S 10-spc-alpha operon, which encodes half of the ribosomal subunit protein and is highly conserved in eubacterial genomes, were selected as reliable biomarkers. This method, named the S10-GERMS method, revealed that the strains of genus Pseudomonas were successfully identified and discriminated at species and strain levels, respectively; therefore, the S10-GERMS method was further applied to discriminate the pathovar of P. syringae. The eight selected biomarkers (L24, L30, S10, S12, S14, S16, S17, and S19) suggested the rapid discrimination of P. syringae at the strain (pathovar) level. The S10-GERMS method appears to be a powerful tool for rapid and reliable bacterial discrimination and successful phylogenetic characterization. In this article, an overview of the utilization of results from the S10-GERMS method is presented, highlighting the characterization of the Lactobacillus casei group and discrimination of the bacteria of genera Bacillus and Sphingopyxis despite only two and one base difference in the 16S rRNA gene sequence, respectively.

Endogenous ribosomal frameshift signals operate as mRNA destabilizing elements through at least two molecular pathways in yeast.

Science.gov (United States)

Belew, Ashton T; Advani, Vivek M; Dinman, Jonathan D

2011-04-01

Although first discovered in viruses, previous studies have identified operational -1 ribosomal frameshifting (-1 RF) signals in eukaryotic genomic sequences, and suggested a role in mRNA stability. Here, four yeast -1 RF signals are shown to promote significant mRNA destabilization through the nonsense mediated mRNA decay pathway (NMD), and genetic evidence is presented suggesting that they may also operate through the no-go decay pathway (NGD) as well. Yeast EST2 mRNA is highly unstable and contains up to five -1 RF signals. Ablation of the -1 RF signals or of NMD stabilizes this mRNA, and changes in -1 RF efficiency have opposing effects on the steady-state abundance of the EST2 mRNA. These results demonstrate that endogenous -1 RF signals function as mRNA destabilizing elements through at least two molecular pathways in yeast. Consistent with current evolutionary theory, phylogenetic analyses suggest that -1 RF signals are rapidly evolving cis-acting regulatory elements. Identification of high confidence -1 RF signals in ∼10% of genes in all eukaryotic genomes surveyed suggests that -1 RF is a broadly used post-transcriptional regulator of gene expression.

Vitamin K3 disrupts the microtubule networks by binding to tubulin: a novel mechanism of its antiproliferative activity.

Science.gov (United States)

Acharya, Bipul R; Choudhury, Diptiman; Das, Amlan; Chakrabarti, Gopal

2009-07-28

Vitamin K3 (2-methyl-1,4-naphthoquinone), also known as menadione, is the synthetic precursor of all the naturally occurring vitamin K in the body. Vitamin K is necessary for the production of prothrombin and five other blood-clotting factors in humans. We have examined the effects of menadione on cellular microtubules ex vivo as well as its binding with purified tubulin and microtubules in vitro. Cell viability experiments using human cervical epithelial cancer cells (HeLa) and human oral epithelial cancer cells (KB) indicated that the IC(50) values for menadione are 25.6 +/- 0.6 and 64.3 +/- 0.36 microM, respectively, in those cells. Mendione arrests HeLa cells in mitosis. Immunofluorescence studies using an anti-alpha-tubulin antibody showed a significant irreversible depolymeriztion of the interphase microtubule network and spindle microtubule in a dose-dependent manner. In vitro polymerization of purified tubulin into microtubules is inhibited by menadione with an IC(50) value of 47 +/- 0.65 microM. The binding of menadione with tubulin was studied using menadione fluorescence and intrinsic tryptophan fluorescence of tubulin. Binding of menadione to tubulin is slow, taking 35 min for equilibration at 25 degrees C. The association reaction kinetics is biphasic in nature, and the association rate constants for fast and slow phases are 189.12 +/- 17 and 32.44 +/- 21 M(-1) s(-1) at 25 degrees C, respectively. The stoichiometry of menadione binding to tubulin is 1:1 (molar ratio) with a dissociation constant from 2.44 +/- 0.34 to 3.65 +/- 0.25 microM at 25 degrees C. Menadione competes for the colchicine binding site with a K(i) of 2.5 muM as determined from a modified Dixon plot. The obtained data suggested that menadione binds at the colchicine binding site to tubulin. Thus, we can conclude one novel mechanism of inhibition of cancer cell proliferation by menadione is through tubulin binding.

Expression of protein-coding genes embedded in ribosomal DNA

DEFF Research Database (Denmark)

Johansen, Steinar D; Haugen, Peik; Nielsen, Henrik

2007-01-01

Ribosomal DNA (rDNA) is a specialised chromosomal location that is dedicated to high-level transcription of ribosomal RNA genes. Interestingly, rDNAs are frequently interrupted by parasitic elements, some of which carry protein genes. These are non-LTR retrotransposons and group II introns that e...... in the nucleolus....

Evidence that the primary effect of phosphorylation of eukaryotic initiation factor 2(alpha) in rabbit reticulocyte lysate is inhibition of the release of eukaryotic initiation factor-2.GDP from 60 S ribosomal subunits

International Nuclear Information System (INIS)

Gross, M.; Redman, R.; Kaplansky, D.A.

1985-01-01

The phosphorylation of eukaryotic initiation factor (eIF) 2 alpha that occurs when rabbit reticulocyte lysate is incubated in the absence of hemin or with poly(I.C) causes inhibition of polypeptide chain initiation by preventing a separate factor (termed RF) from promoting the exchange of GTP for GDP on eIF-2. When lysate was incubated in the presence of hemin and [ 14 C] eIF-2 or [alpha- 32 P]GTP, the authors observed binding of eIF-2 and GDP or GTP to 60 S ribosomal subunits that was slightly greater than that bound to 40 S subunits and little binding to 80 S ribosomes. When incubation was in the absence of hemin or in the presence of hemin plus 0.1 microgram/ml poly(I.C), eIF-2 and GDP binding to 60 S subunits was increased 1.5- to 2-fold, that bound to 80 S ribosomes was almost as great as that bound to 60 S subunits, and that bound to 40 S subunits was unchanged. The data indicate that about 40% of the eIF-2 that becomes bound to 60 S subunits and 80 S ribosomes in the absence of hemin or with poly(I.C) is eIF-2(alpha-P) and suggest that the eIF-2 and GDP bound is probably in the form of a binary complex. The rate of turnover of GDP (presumably eIF-2.GDP) on 60 S subunits and 80 S ribosomes in the absence of hemin is reduced to less than 10% the control rate, because the dissociation of eIF-2.GDP is inhibited. Our findings suggest that eIF-2.GTP binding to and eIF-2.GDP release from 60 S subunits may normally occur and serve to promote subunit joining

The nuclear 18S ribosomal RNA gene as a source of phylogenetic information in the genus Taenia.

Science.gov (United States)

Yan, Hongbin; Lou, Zhongzi; Li, Li; Ni, Xingwei; Guo, Aijiang; Li, Hongmin; Zheng, Yadong; Dyachenko, Viktor; Jia, Wanzhong

2013-03-01

Most species of the genus Taenia are of considerable medical and veterinary significance. In this study, complete nuclear 18S rRNA gene sequences were obtained from seven members of genus Taenia [Taenia multiceps, Taenia saginata, Taenia asiatica, Taenia solium, Taenia pisiformis, Taenia hydatigena, and Taenia taeniaeformis] and a phylogeny inferred using these sequences. Most of the variable sites fall within the variable regions, V1-V5. We show that sequences from the nuclear 18S ribosomal RNA gene have considerable promise as sources of phylogenetic information within the genus Taenia. Furthermore, given that almost all the variable sites lie within defined variable portions of that gene, it will be appropriate and economical to sequence only those regions for additional species of Taenia.

Effects of S-adenosylmethionine decarboxylase, polyamines, amino acids, and weak bases (amines and ammonia) on development and ribosomal RNA synthesis in Xenopus embryos.

Science.gov (United States)

Shiokawa, Koichiro; Aso, Mai; Kondo, Takeshi; Takai, Jun-Ichi; Yoshida, Junki; Mishina, Takamichi; Fuchimukai, Kota; Ogasawara, Tsukasa; Kariya, Taro; Tashiro, Kosuke; Igarashi, Kazuei

2010-02-01

We have been studying control mechanisms of gene expression in early embryogenesis in a South African clawed toad Xenopus laevis, especially during the period of midblastula transition (MBT), or the transition from the phase of active cell division (cleavage stage) to the phase of extensive morphogenesis (post-blastular stages). We first found that ribosomal RNA synthesis is initiated shortly after MBT in Xenopus embryos and those weak bases, such as amines and ammonium ion, selectively inhibit the initiation and subsequent activation of rRNA synthesis. We then found that rapidly labeled heterogeneous mRNA-like RNA is synthesized in embryos at pre-MBT stage. We then performed cloning and expression studies of several genes, such as those for activin receptors, follistatin and aldolases, and then reached the studies of S-adenosylmethionine decarboxylase (SAMDC), a key enzyme in polyamine metabolism. Here, we cloned a Xenopus SAMDC cDNA and performed experiments to overexpress the in vitro-synthesized SAMDC mRNA in Xenopus early embryos, and found that the maternally preset program of apoptosis occurs in cleavage stage embryos, which is executed when embryos reach the stage of MBT. In the present article, we first summarize results on SAMDC and the maternal program of apoptosis, and then describe our studies on small-molecular-weight substances like polyamines, amino acids, and amines in Xenopus embryos. Finally, we summarize our studies on weak bases, especially on ammonium ion, as the specific inhibitor of ribosomal RNA synthesis in Xenopus embryonic cells.

Chaperoning 5S RNA assembly.

Science.gov (United States)

Madru, Clément; Lebaron, Simon; Blaud, Magali; Delbos, Lila; Pipoli, Juliana; Pasmant, Eric; Réty, Stéphane; Leulliot, Nicolas

2015-07-01

In eukaryotes, three of the four ribosomal RNAs (rRNAs)—the 5.8S, 18S, and 25S/28S rRNAs—are processed from a single pre-rRNA transcript and assembled into ribosomes. The fourth rRNA, the 5S rRNA, is transcribed by RNA polymerase III and is assembled into the 5S ribonucleoprotein particle (RNP), containing ribosomal proteins Rpl5/uL18 and Rpl11/uL5, prior to its incorporation into preribosomes. In mammals, the 5S RNP is also a central regulator of the homeostasis of the tumor suppressor p53. The nucleolar localization of the 5S RNP and its assembly into preribosomes are performed by a specialized complex composed of Rpf2 and Rrs1 in yeast or Bxdc1 and hRrs1 in humans. Here we report the structural and functional characterization of the Rpf2-Rrs1 complex alone, in complex with the 5S RNA, and within pre-60S ribosomes. We show that the Rpf2-Rrs1 complex contains a specialized 5S RNA E-loop-binding module, contacts the Rpl5 protein, and also contacts the ribosome assembly factor Rsa4 and the 25S RNA. We propose that the Rpf2-Rrs1 complex establishes a network of interactions that guide the incorporation of the 5S RNP in preribosomes in the initial conformation prior to its rotation to form the central protuberance found in the mature large ribosomal subunit. © 2015 Madru et al.; Published by Cold Spring Harbor Laboratory Press.

Absence of ribosomal DNA amplification in the meroistic (telotrophic) ovary of the large milkweed bug Oncopeltus fasciatus (Dallas) (Hemiptera: Lygaeidae)

Science.gov (United States)

1975-01-01

In the typical meroistic insect ovary, the oocyte nucleus synthesizes little if any RNA. Nurse cells or trophocytes actively synthesize ribosomes which are transported to and accumulated by the oocyte. In the telotrophic ovary a morphological separation exists, the nurse cells being localized at the apical end of each ovariole and communicating with the ooocytes via nutritive cords. In order to determine whether the genes coding for ribosomal RNA (rRNA) are amplified in the telotrophic ovary of the milkweed bug Oncopeltus fasciatus, the percentages of the genome coding for ribosomal RNA in somatic cells, spermatogenic cells, ovarian follicles, and nurse cells were compared. The oocytes and most of the nurse cells of O. fasciatus are uninucleolate. DNA hybridizing with ribosomal RNA is localized in a satellite DNA, the density of which is 1.712 g/cm(-3). The density of main-band DNA is 1.694 g/cm(-3). The ribosomal DNA satellite accounts for approximately 0.2% of the DNA in somatic and gametogenic tissues of both males and females. RNA-DNA hybridization analysis demonstrates that approximately 0.03% of the DNA in somatic tissues, testis, ovarian follicles, and isolated nurse cells hybridizes with ribosomal RNA. The fact that the percentage of DNA hybridizing with rRNA is the same in somatic and in male and female gametogenic tissues indicates that amplification of ribosomal DNA does not occur in nurse cells and that if it occurs in oocytes, it represents less than a 50- fold increase in ribosomal DNA. An increase in total genome DNA accounted by polyploidization appears to provide for increasing the amount of ribosomal DNA in the nurse cells. PMID:1158969

A unique enhancer boundary complex on the mouse ribosomal RNA genes persists after loss of Rrn3 or UBF and the inactivation of RNA polymerase I transcription.

Science.gov (United States)

Herdman, Chelsea; Mars, Jean-Clement; Stefanovsky, Victor Y; Tremblay, Michel G; Sabourin-Felix, Marianne; Lindsay, Helen; Robinson, Mark D; Moss, Tom

2017-07-01

Transcription of the several hundred of mouse and human Ribosomal RNA (rRNA) genes accounts for the majority of RNA synthesis in the cell nucleus and is the determinant of cytoplasmic ribosome abundance, a key factor in regulating gene expression. The rRNA genes, referred to globally as the rDNA, are clustered as direct repeats at the Nucleolar Organiser Regions, NORs, of several chromosomes, and in many cells the active repeats are transcribed at near saturation levels. The rDNA is also a hotspot of recombination and chromosome breakage, and hence understanding its control has broad importance. Despite the need for a high level of rDNA transcription, typically only a fraction of the rDNA is transcriptionally active, and some NORs are permanently silenced by CpG methylation. Various chromatin-remodelling complexes have been implicated in counteracting silencing to maintain rDNA activity. However, the chromatin structure of the active rDNA fraction is still far from clear. Here we have combined a high-resolution ChIP-Seq protocol with conditional inactivation of key basal factors to better understand what determines active rDNA chromatin. The data resolve questions concerning the interdependence of the basal transcription factors, show that preinitiation complex formation is driven by the architectural factor UBF (UBTF) independently of transcription, and that RPI termination and release corresponds with the site of TTF1 binding. They further reveal the existence of an asymmetric Enhancer Boundary Complex formed by CTCF and Cohesin and flanked upstream by phased nucleosomes and downstream by an arrested RNA Polymerase I complex. We find that the Enhancer Boundary Complex is the only site of active histone modification in the 45kbp rDNA repeat. Strikingly, it not only delimits each functional rRNA gene, but also is stably maintained after gene inactivation and the re-establishment of surrounding repressive chromatin. Our data define a poised state of rDNA chromatin

A unique enhancer boundary complex on the mouse ribosomal RNA genes persists after loss of Rrn3 or UBF and the inactivation of RNA polymerase I transcription.

Directory of Open Access Journals (Sweden)

Chelsea Herdman

2017-07-01

Full Text Available Transcription of the several hundred of mouse and human Ribosomal RNA (rRNA genes accounts for the majority of RNA synthesis in the cell nucleus and is the determinant of cytoplasmic ribosome abundance, a key factor in regulating gene expression. The rRNA genes, referred to globally as the rDNA, are clustered as direct repeats at the Nucleolar Organiser Regions, NORs, of several chromosomes, and in many cells the active repeats are transcribed at near saturation levels. The rDNA is also a hotspot of recombination and chromosome breakage, and hence understanding its control has broad importance. Despite the need for a high level of rDNA transcription, typically only a fraction of the rDNA is transcriptionally active, and some NORs are permanently silenced by CpG methylation. Various chromatin-remodelling complexes have been implicated in counteracting silencing to maintain rDNA activity. However, the chromatin structure of the active rDNA fraction is still far from clear. Here we have combined a high-resolution ChIP-Seq protocol with conditional inactivation of key basal factors to better understand what determines active rDNA chromatin. The data resolve questions concerning the interdependence of the basal transcription factors, show that preinitiation complex formation is driven by the architectural factor UBF (UBTF independently of transcription, and that RPI termination and release corresponds with the site of TTF1 binding. They further reveal the existence of an asymmetric Enhancer Boundary Complex formed by CTCF and Cohesin and flanked upstream by phased nucleosomes and downstream by an arrested RNA Polymerase I complex. We find that the Enhancer Boundary Complex is the only site of active histone modification in the 45kbp rDNA repeat. Strikingly, it not only delimits each functional rRNA gene, but also is stably maintained after gene inactivation and the re-establishment of surrounding repressive chromatin. Our data define a poised state

Melibiose permease and alpha-galactosidase of Escherichia coli: Identification by selective labeling using a T7 RNA polymerase/promoter expression system

International Nuclear Information System (INIS)

Pourcher, T.; Bassilana, M.; Sarkar, H.K.; Kaback, H.R.; Leblanc, G.

1990-01-01

Identification and selective labeling of the melibiose permease and alpha-galactosidase in Escherichia coli, which are encoded by the melB and melA genes, respectively, have been accomplished by selectively labeling the two gene products with a T7 RNA polymerase expression system. Following generation of a novel EcoRI restriction site in the intergenic sequence between the two genes of the mel operon by oligonucleotide-directed, site-specific mutagenesis, melA and melB were separately inserted into plasmid pT7-6 of the T7 expression system. Expression of melB was markedly enhanced by placing a strong, synthetic ribosome binding site at an optimal distance upstream from the initiation codon of melB. Expression of cloned gene products was characterized functionally and by performing autoradiographic analysis on total cell, inner membrane, and cytoplasmic proteins from cells pulse labeled with (35S)methionine in the presence of rifampicin and resolved by sodium dodecyl sulfate/polyacrylamide gel electrophoresis. The results first confirm that alpha-galactosidase is a cytoplasmic protein with an Mr of 50K; in contrast, the membrane-bound melibiose permease is identified as a protein with an apparent Mr of 39K, a value significantly higher than that of 30K previously suggested

Emerging functions of ribosomal proteins in gene-specific transcription and translation

International Nuclear Information System (INIS)

Lindstroem, Mikael S.

2009-01-01

Ribosomal proteins have remained highly conserved during evolution presumably reflecting often critical functions in ribosome biogenesis or mature ribosome function. In addition, several ribosomal proteins possess distinct extra-ribosomal functions in apoptosis, DNA repair and transcription. An increasing number of ribosomal proteins have been shown to modulate the trans-activation function of important regulatory proteins such as NF-κB, p53, c-Myc and nuclear receptors. Furthermore, a subset of ribosomal proteins can bind directly to untranslated regions of mRNA resulting in transcript-specific translational control outside of the ribosome itself. Collectively, these findings suggest that ribosomal proteins may have a wider functional repertoire within the cell than previously thought. The future challenge is to identify and validate these novel functions in the background of an often essential primary function in ribosome biogenesis and cell growth.

Simultaneous Binding of Multiple EF-Tu Copies to Translating Ribosomes in Live Escherichia coli.

Science.gov (United States)

Mustafi, Mainak; Weisshaar, James C

2018-01-16

In bacteria, elongation factor Tu is a translational cofactor that forms ternary complexes with aminoacyl-tRNA (aa-tRNA) and GTP. Binding of a ternary complex to one of four flexible L7/L12 units on the ribosome tethers a charged tRNA in close proximity to the ribosomal A site. Two sequential tests for a match between the aa-tRNA anticodon and the current mRNA codon then follow. Because one elongation cycle can occur in as little as 50 ms and the vast majority of aa-tRNA copies are not cognate with the current mRNA codon, this testing must occur rapidly. We present a single-molecule localization and tracking study of fluorescently labeled EF-Tu in live Escherichia coli Imaging at 2 ms/frame distinguishes 60% slowly diffusing EF-Tu copies (assigned as transiently bound to translating ribosome) from 40% rapidly diffusing copies (assigned as a mixture of free ternary complexes and free EF-Tu). Combining these percentages with copy number estimates, we infer that the four L7/L12 sites are essentially saturated with ternary complexes in vivo. The results corroborate an earlier inference that all four sites can simultaneously tether ternary complexes near the A site, creating a high local concentration that may greatly enhance the rate of testing of aa-tRNAs. Our data and a combinatorial argument both suggest that the initial recognition test for a codon-anticodon match occurs in less than 1 to 2 ms per aa-tRNA copy. The results refute a recent study (A. Plochowietz, I. Farrell, Z. Smilansky, B. S. Cooperman, and A. N. Kapanidis, Nucleic Acids Res 45:926-937, 2016, https://doi.org/10.1093/nar/gkw787) of tRNA diffusion in E. coli that inferred that aa-tRNAs arrive at the ribosomal A site as bare monomers, not as ternary complexes. IMPORTANCE Ribosomes catalyze translation of the mRNA codon sequence into the corresponding sequence of amino acids within the nascent polypeptide chain. Polypeptide elongation can be as fast as 50 ms per added amino acid. Each amino acid

Could a Proto-Ribosome Emerge Spontaneously in the Prebiotic World?

Directory of Open Access Journals (Sweden)

Ilana C. Agmon

2016-12-01

Full Text Available An indispensable prerequisite for establishing a scenario of life emerging by natural processes is the requirement that the first simple proto-molecules could have had a realistic probability of self-assembly from random molecular polymers in the prebiotic world. The vestige of the proto-ribosome, which is believed to be still embedded in the contemporary ribosome, is used to assess the feasibility of such spontaneous emergence. Three concentric structural elements of different magnitudes, having a dimeric nature derived from the symmetrical region of the ribosomal large subunit, were suggested to constitute the vestige of the proto-ribosome. It is assumed to have materialized spontaneously in the prebiotic world, catalyzing non-coded peptide bond formation and simple elongation. Probabilistic and energetic considerations are applied in order to evaluate the suitability of the three contenders for being the initial proto-ribosome. The analysis points to the simplest proto-ribosome, comprised of a dimer of tRNA-like molecules presently embedded in the core of the symmetrical region, as the only one having a realistic statistical likelihood of spontaneous emergence from random RNA chains. Hence it offers a feasible starting point for a continuous evolutionary path from the prebiotic matter, through natural processes, into the intricate modern translation system.

Ribosomal RNA: a key to phylogeny

Science.gov (United States)

Olsen, G. J.; Woese, C. R.

1993-01-01

As molecular phylogeny increasingly shapes our understanding of organismal relationships, no molecule has been applied to more questions than have ribosomal RNAs. We review this role of the rRNAs and some of the insights that have been gained from them. We also offer some of the practical considerations in extracting the phylogenetic information from the sequences. Finally, we stress the importance of comparing results from multiple molecules, both as a method for testing the overall reliability of the organismal phylogeny and as a method for more broadly exploring the history of the genome.

Noncanonical alpha/gamma Backbone Conformations in RNA and the Accuracy of Their Description by the AMBER Force Field

Czech Academy of Sciences Publication Activity Database

Zgarbová, M.; Jurečka, P.; Banáš, P.; Havrila, Marek; Šponer, Jiří; Otyepka, M.

2017-01-01

Roč. 121, č. 11 (2017), s. 2420-2433 ISSN 1520-6106 Institutional support: RVO:68081707 Keywords : molecular-dynamics simulations * sugar-phosphate backbone * free-energy landscape * ribosomal-rna Subject RIV: BO - Biophysics OBOR OECD: Physical chemistry Impact factor: 3.177, year: 2016

Murine elongation factor 1 alpha (EF-1 alpha) is posttranslationally modified by novel amide-linked ethanolamine-phosphoglycerol moieties. Addition of ethanolamine-phosphoglycerol to specific glutamic acid residues on EF-1 alpha

International Nuclear Information System (INIS)

Whiteheart, S.W.; Shenbagamurthi, P.; Chen, L.; Cotter, R.J.; Hart, G.W.

1989-01-01

Elongation Factor 1 alpha (EF-1 alpha), an important eukaryotic translation factor, transports charged aminoacyl-tRNA from the cytosol to the ribosomes during poly-peptide synthesis. Metabolic radiolabeling with [ 3 H] ethanolamine shows that, in all cells examined, EF-1 alpha is the major radiolabeled protein. Radiolabeled EF-1 alpha has an apparent Mr = 53,000 and a basic isoelectric point. It is cytosolic and does not contain N-linked oligosaccharides. Trypsin digestion of murine EF-1 alpha generated two major [ 3 H]ethanolamine-labeled peptides. Three peptides were sequenced and were identical to two distinct regions of the human EF-1 alpha protein. Blank sequencing cycles coinciding with glutamic acid in the human cDNA-derived sequence were also found to release [ 3 H]ethanolamine, and compositional analysis of these peptides confirmed the presence of glutamic acid. Dansylation analysis demonstrates that the amine group of the ethanolamine is blocked. These results indicate that EF-1 alpha is posttranslationally modified by the covalent attachment of ethanolamine via an amide bond to at least two specific glutamic acid residues (Glu-301 and Glu-374). The hydroxyl group of the attached ethanolamine was shown by mass spectrometry and compositional analysis, to be further modified by the addition of a phosphoglycerol unit. This novel posttranslational modification may represent an important alteration of EF-1 alpha, comparable to the regulatory effects of posttranslational methylation of EF-1 alpha lysine residues

Chromatin structure of ribosomal RNA genes in dipterans and its relationship to the location of nucleolar organizers.

Science.gov (United States)

Madalena, Christiane Rodriguez Gutierrez; Díez, José Luís; Gorab, Eduardo

2012-01-01

Nucleoli, nuclear organelles in which ribosomal RNA is synthesized and processed, emerge from nucleolar organizers (NORs) located in distinct chromosomal regions. In polytene nuclei of dipterans, nucleoli of some species can be observed under light microscopy exhibiting distinctive morphology: Drosophila and chironomid species display well-formed nucleoli in contrast to the fragmented and dispersed nucleoli seen in sciarid flies. The available data show no apparent relationship between nucleolar morphology and location of NORs in Diptera. The regulation of rRNA transcription involves controlling both the transcription rate per gene as well as the proportion of rRNA genes adopting a proper chromatin structure for transcription, since active and inactive rRNA gene copies coexist in NORs. Transcription units organized in nucleosomes and those lacking canonical nucleosomes can be analyzed by the method termed psoralen gel retarding assay (PGRA), allowing inferences on the ratio of active to inactive rRNA gene copies. In this work, possible connections between chromosomal location of NORs and proportion of active rRNA genes were studied in Drosophila melanogaster, and in chironomid and sciarid species. The data suggested a link between location of NORs and proportion of active rRNA genes since the copy number showing nucleosomal organization predominates when NORs are located in the pericentric heterochromatin. The results presented in this work are in agreement with previous data on the chromatin structure of rRNA genes from distantly related eukaryotes, as assessed by the PGRA.

Chromatin structure of ribosomal RNA genes in dipterans and its relationship to the location of nucleolar organizers.

Directory of Open Access Journals (Sweden)

Christiane Rodriguez Gutierrez Madalena

Full Text Available Nucleoli, nuclear organelles in which ribosomal RNA is synthesized and processed, emerge from nucleolar organizers (NORs located in distinct chromosomal regions. In polytene nuclei of dipterans, nucleoli of some species can be observed under light microscopy exhibiting distinctive morphology: Drosophila and chironomid species display well-formed nucleoli in contrast to the fragmented and dispersed nucleoli seen in sciarid flies. The available data show no apparent relationship between nucleolar morphology and location of NORs in Diptera. The regulation of rRNA transcription involves controlling both the transcription rate per gene as well as the proportion of rRNA genes adopting a proper chromatin structure for transcription, since active and inactive rRNA gene copies coexist in NORs. Transcription units organized in nucleosomes and those lacking canonical nucleosomes can be analyzed by the method termed psoralen gel retarding assay (PGRA, allowing inferences on the ratio of active to inactive rRNA gene copies. In this work, possible connections between chromosomal location of NORs and proportion of active rRNA genes were studied in Drosophila melanogaster, and in chironomid and sciarid species. The data suggested a link between location of NORs and proportion of active rRNA genes since the copy number showing nucleosomal organization predominates when NORs are located in the pericentric heterochromatin. The results presented in this work are in agreement with previous data on the chromatin structure of rRNA genes from distantly related eukaryotes, as assessed by the PGRA.

Structural and Functional Consequences of Increased Tubulin Glycosylation in Diabetes Mellitus

Science.gov (United States)

Williams, Stuart K.; Howarth, Nancy L.; Devenny, James J.; Bitensky, Mark W.

1982-11-01

The extent of in vitro nonenzymatic glycosylation of purified rat brain tubulin was dependent on time and glucose concentration. Tubulin glycosylation profoundly inhibited GTP-dependent tubulin polymerization. Electron microscopy and NaDodSO4/polyacrylamide gel electrophoresis showed that glycosylated tubulin forms high molecular weight amorphous aggregates that are not disrupted by detergents or reducing agents. The amount of covalently bound NaB3H4-reducible sugars in tubulin recovered from brain of streptozotocin-induced diabetic rats was dramatically increased as compared with tubulin recovered from normal rat brain. Moreover, tubulin recovered from diabetic rat brain exhibited less GTP-induced polymerization than tubulin from nondiabetic controls. The possible implications of these data for diabetic neuropathy are discussed.

Interaction of pleuromutilin derivatives with the ribosomal peptidyl transferase center

DEFF Research Database (Denmark)

Long, K. S.; Hansen, L. K.; Jakobsen, L.

2006-01-01

Tiamulin is a pleuromutilin antibiotic that is used in veterinary medicine. The recently published crystal structure of a tiamulin-50S ribosomal subunit complex provides detailed information about how this drug targets the peptidyl transferase center of the ribosome. To promote rational design...... mutant strain is resistant to tiamulin and pleuromutilin, but not valnemulin, implying that valnemulin is better able to withstand an altered rRNA binding surface around the mutilin core. This is likely due to additional interactions made between the valnemulin side chain extension and the rRNA binding...

Cryo-EM structures of the 80S ribosomes from human parasites Trichomonas vaginalis and Toxoplasma gondii

Institute of Scientific and Technical Information of China (English)

Zhifei Li; Qiang Guo; Lvqin Zheng; Yongsheng Ji; Yi-Ting Xie; De-Hua Lai; Zhao-Rong Lun; Xun Suo; Ning Gao

2017-01-01

As an indispensable molecular machine universal in all living organisms,the ribosome has been selected by evolution to be the natural target of many antibiotics and small-molecule inhibitors.High-resolution structures of pathogen ribosomes are crucial for understanding the general and unique aspects of translation control in disease-causing microbes.With cryo-electron microscopy technique,we have determined structures of the cytosolic ribosomes from two human parasites,Trichomonas vaginalis and Toxoplasma gondii,at resolution of 3.2-3.4,(A).Although the ribosomal proteins from both pathogens are typical members of eukaryotic families,with a co-evolution pattern between certain species-specific insertions/extensions and neighboring ribosomal RNA (rRNA) expansion segments,the sizes of their rRNAs are sharply different.Very interestingly,rRNAs of T.vaginalis are in size comparable to prokaryotic counterparts,with nearly all the eukaryote-specific rRNA expansion segments missing.These structures facilitate the dissection of evolution path for ribosomal proteins and RNAs,and may aid in design of novel translation inhibitors.

Prion protein inhibits microtubule assembly by inducing tubulin oligomerization

International Nuclear Information System (INIS)

Nieznanski, Krzysztof; Podlubnaya, Zoya A.; Nieznanska, Hanna

2006-01-01

A growing body of evidence points to an association of prion protein (PrP) with microtubular cytoskeleton. Recently, direct binding of PrP to tubulin has also been found. In this work, using standard light scattering measurements, sedimentation experiments, and electron microscopy, we show for First time the effect of a direct interaction between these proteins on tubulin polymerization. We demonstrate that full-length recombinant PrP induces a rapid increase in the turbidity of tubulin diluted below the critical concentration for microtubule assembly. This effect requires magnesium ions and is weakened by NaCl. Moreover, the PrP-induced light scattering structures of tubulin are cold-stable. In preparations of diluted tubulin incubated with PrP, electron microscopy revealed the presence of ∼50 nm disc-shaped structures not reported so far. These unique tubulin oligomers may form large aggregates. The effect of PrP is more pronounced under the conditions promoting microtubule formation. In these tubulin samples, PrP induces formation of the above oligomers associated with short protofilaments and sheets of protofilaments into aggregates. Noticeably, this is accompanied by a significant reduction of the number and length of microtubules. Hence, we postulate that prion protein may act as an inhibitor of microtubule assembly by inducing formation of stable tubulin oligomers

Symportin 1 chaperones 5S RNP assembly during ribosome biogenesis by occupying an essential rRNA-binding site.

Science.gov (United States)

Calviño, Fabiola R; Kharde, Satyavati; Ori, Alessandro; Hendricks, Astrid; Wild, Klemens; Kressler, Dieter; Bange, Gert; Hurt, Ed; Beck, Martin; Sinning, Irmgard

2015-04-07

During 60S biogenesis, mature 5S RNP consisting of 5S RNA, RpL5 and RpL11, assembles into a pre-60S particle, where docking relies on RpL11 interacting with helix 84 (H84) of the 25S RNA. How 5S RNP is assembled for recruitment into the pre-60S is not known. Here we report the crystal structure of a ternary symportin Syo1-RpL5-N-RpL11 complex and provide biochemical and structural insights into 5S RNP assembly. Syo1 guards the 25S RNA-binding surface on RpL11 and competes with H84 for binding. Pull-down experiments show that H84 releases RpL11 from the ternary complex, but not in the presence of 5S RNA. Crosslinking mass spectrometry visualizes structural rearrangements on incorporation of 5S RNA into the Syo1-RpL5-RpL11 complex supporting the formation of a pre-5S RNP. Our data underline the dual role of Syo1 in ribosomal protein transport and as an assembly platform for 5S RNP.

Differential expression of gamma-tubulin and class III beta-tubulin in medulloblastomas and human medulloblastoma cell lines

Czech Academy of Sciences Publication Activity Database

Caracciolo, V.; D´Agostino, L.; Dráberová, Eduarda; Sládková, Vladimíra; Crozier-Fitzgerald, C.; Agamanolis, D.P.; De Chadarévian, J.P.; Legido, A.; Giordano, A.; Dráber, Pavel; Katsetos, C.D.

2010-01-01

Roč. 223, č. 2 (2010), s. 519-529 ISSN 0021-9541 R&D Projects: GA AV ČR KAN200520701 Institutional research plan: CEZ:AV0Z50520514 Keywords : gamma-tubulin * beta III-tubulin * meduloblastoma Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.986, year: 2010

Journal of Biosciences | Indian Academy of Sciences

Indian Academy of Sciences (India)

RNA interference (RNAi)-mediated gene silencing was explored for the control of sap-sucking pest Bemisia tabaci, commonly known as whitefly. dsRNAs and siRNAs were synthesized from five different genes – actin ortholog, ADP/ATP translocase, -tubulin, ribosomal protein L9 (RPL9) and V-ATPase A subunit.

Mammalian peptidylglycine alpha-amidating monooxygenase (PAM) mRNA expression can be modulated by the La autoantigen

DEFF Research Database (Denmark)

Brenet, Fabienne; Dussault, Nadège; Borch, Jonas

2005-01-01

Peptidylglycine alpha-amidating monooxygenase (PAM; EC 1.14.17.3) catalyzes the COOH-terminal alpha-amidation of peptidylglycine substrates, yielding amidated products. We have previously reported a putative regulatory RNA binding protein (PAM mRNA-BP) that binds specifically to the 3' untranslated...... region (UTR) of PAM-mRNA. Here, the PAM mRNA-BP was isolated and revealed to be La protein using affinity purification onto a 3' UTR PAM RNA, followed by tandem mass spectrometry identification. We determined that the core binding sequence is approximately 15-nucleotides (nt) long and is located 471 nt...... downstream of the stop codon. Moreover, we identified the La autoantigen as a protein that specifically binds the 3' UTR of PAM mRNA in vivo and in vitro. Furthermore, La protein overexpression caused a nuclear retention of PAM mRNAs and resulted in the down-regulation of endogenous PAM activity. Most...

Trans-kingdom mimicry underlies ribosome customization by a poxvirus kinase.

Science.gov (United States)

Jha, Sujata; Rollins, Madeline G; Fuchs, Gabriele; Procter, Dean J; Hall, Elizabeth A; Cozzolino, Kira; Sarnow, Peter; Savas, Jeffrey N; Walsh, Derek

2017-06-29

Ribosomes have the capacity to selectively control translation through changes in their composition that enable recognition of specific RNA elements. However, beyond differential subunit expression during development, evidence for regulated ribosome specification within individual cells has remained elusive. Here we report that a poxvirus kinase phosphorylates serine/threonine residues in the human small ribosomal subunit protein, receptor for activated C kinase (RACK1), that are not phosphorylated in uninfected cells or cells infected by other viruses. These modified residues cluster in an extended loop in RACK1, phosphorylation of which selects for translation of viral or reporter mRNAs with 5' untranslated regions that contain adenosine repeats, so-called polyA-leaders. Structural and phylogenetic analyses revealed that although RACK1 is highly conserved, this loop is variable and contains negatively charged amino acids in plants, in which these leaders act as translational enhancers. Phosphomimetics and inter-species chimaeras have shown that negative charge in the RACK1 loop dictates ribosome selectivity towards viral RNAs. By converting human RACK1 to a charged, plant-like state, poxviruses remodel host ribosomes so that adenosine repeats erroneously generated by slippage of the viral RNA polymerase confer a translational advantage. Our findings provide insight into ribosome customization through trans-kingdom mimicry and the mechanics of species-specific leader activity that underlie poxvirus polyA-leaders.

Ribosome-induced changes in elongation factor Tu conformation control GTP hydrolysis

DEFF Research Database (Denmark)

Villa, Elizabeth; Sengupta, Jayati; Trabuco, Leonard G.

2009-01-01

In translation, elongation factor Tu (EF-Tu) molecules deliver aminoacyl-tRNAs to the mRNA-programmed ribosome. The GTPase activity of EF-Tu is triggered by ribosome-induced conformational changes of the factor that play a pivotal role in the selection of the cognate aminoacyl-tRNAs. We present a 6.......7-A cryo-electron microscopy map of the aminoacyl-tRNA x EF-Tu x GDP x kirromycin-bound Escherichia coli ribosome, together with an atomic model of the complex obtained through molecular dynamics flexible fitting. The model reveals the conformational changes in the conserved GTPase switch regions...... of EF-Tu that trigger hydrolysis of GTP, along with key interactions, including those between the sarcin-ricin loop and the P loop of EF-Tu, and between the effector loop of EF-Tu and a conserved region of the 16S rRNA. Our data suggest that GTP hydrolysis on EF-Tu is controlled through a hydrophobic...

Small-angle X-ray titration study on the complex formation between 5-S RNA and the L18 protein of the Escherichia coli 50-S ribosome particle

International Nuclear Information System (INIS)

Oesterberg, R.; Garrett, A.

1977-01-01

The 5-S RNA (A) and the L 18 protein (B) from Escherichia coli ribosomes form one single AB complex in the concentration ranges supposed to prevail in vivo; at concentrations of L 18 higher than 40 mM there is some indication for a minor species, most probably an AB 2 species. This is indicated from the X-ray scattering titration data of the 5-S RNA/L 18 system recorded at 21 0 C in ribosomal reconstitution buffer. As a result of the 1 : 1 complex formation, there is a relatively small but defined increase in the radius of gyration from 3.61 to 3.85 nm. This result as well as the experimental scattering curve can be explained by models where it is assumed that the elongated L 18 model is quite far from the electron density centre and where protein L 18 interacts with one or both of the minor arms of the supposed Y-shaped 5-S RNA molecule. (orig.) [de

Tubulin-isotype analysis of two grass species-resistant to dinitroaniline herbicides.

Science.gov (United States)

Waldin, T R; Ellis, J R; Hussey, P J

1992-09-01

Trifluralin-resistant biotypes of Eleusine indica (L.) Gaertn. (goosegrass) and Setaria viridis (L.) Beauv. (green foxtail) exhibit cross-resistance to other dinitroaniline herbicides. Since microtubules are considered the primary target site for dinitroaniline herbicides we investigated whether the differential sensitivity of resistant and susceptible biotypes of these species results from modified tubulin polypeptides. One-dimensional and two-dimensional polyacrylamide gel electrophoresis combined with immunoblotting using well-characterised anti-tubulin monoclonal antibodies were used to display the family of tubulin isotypes in each species. Seedlings of E. indica exhibited four β-tubulin isotypes and one α-tubulin isotype, whereas those of S. viridis exhibited two β-tubulin and two α-tubulin isotypes. Comparison of the susceptible and resistant biotypes within each species revealed no differences in electrophoretic properties of the multiple tubulin isotypes. These results provide no evidence that resistance to dinitroaniline herbicides is associated with a modified tubulin polypeptide in these biotypes of E. indica or S. viridis.

Effect of single base changes and the absence of modified bases in 16S RNA on the reconstitution and function of Escherichia coli 30S ribosomes

International Nuclear Information System (INIS)

Denman, R.; Krzyzosiak, W.; Nurse, K.; Ofengand, J.

1987-01-01

The gene coding for E. coli 16S rRNA was placed in pUC19 under the control of the strong class III T7 promoter, phi 10, by ligation of the 1490 bp BclI/BstEII fragment of the rrnB operon with appropriate synthetic oligodeoxynucleotides. Such constructs allowed efficient in vitro synthesis of full-length transcripts (up to 900 mol RNA/mol template) free of modified bases. The synthetic RNA could be assembled into 30S subunits upon addition of E. coli 30S ribosomal proteins. The particles co-sedimented with authentic 30S particles and were electron microscopically indistinguishable from them. Upon addition of 50S subunits, codon-dependent P-site binding of tRNA and codon-dependent polypeptide synthesis were >80% of 30S reconstituted from natural 16S RNA and >50% of isolated 30S. UV-induced crosslinking of P-site bound AcVal-tRNA to residue C 1400 was preserved. Changing C 1400 to A had little effect on reconstitution, P-site binding, or polypeptide synthesis. However, the substitution of C 1499 by G markedly inhibited assembly. The effect on P-site binding and polypeptide synthesis is under study. These results show (1) none of the modified bases of 16S RNA are essential for protein synthesis, (2) substitution of A for C 1400 has little functional effect, and (3) position 1400 may be important for ribosome assembly

gamma. radiation effect on the functional properties of the cotton ribosomes

Energy Technology Data Exchange (ETDEWEB)

Ibragimov, A P; Safarov, Sh

1973-01-01

A study is made of the action of radiation on the functional properties of ribosomes in irradiated organisms and on isolated ribosomes exposed to different doses. With increase in dose there occurs a reduction in the incorporation of labelled amino acids by the ribosomes released from irradiated sprouts and also during irradiation of isolated ribosomes. The study covered the functional activity of ribosomes irradiated at different doses with the use of synthetic poly-U and poly-A matrices synthesizing polyphenylalanine and polylysine, depending on the irradiation dose. The inhibition of the activity of the protein synthesis system at high doses is due to structural and functional changes in ribosomes and also to disturbance in the biosynthesis and functions of the messenger RNA.

Human histone deacetylase 6 shows strong preference for tubulin dimers over assembled microtubules

Czech Academy of Sciences Publication Activity Database

Škultétyová, Ĺubica; Ustinova, Kseniya; Kutil, Zsofia; Nováková, Zora; Pavlíček, Jiří; Mikesova, Jana; Trapl, Dalibor; Baranová, Petra; Havlínová, Barbora; Hubálek, Martin; Lánský, Zdeněk; Bařinka, Cyril

2017-01-01

Roč. 7, 2017 Sep 14 (2017), č. článku 11547. ISSN 2045-2322 R&D Projects: GA ČR GA15-19640S; GA ČR(CZ) GA15-17488S; GA MŠk(CZ) ED1.1.00/02.0109 Institutional support: RVO:86652036 ; RVO:61388963 Keywords : ALPHA-TUBULIN * IN-VIVO * MOLECULAR-BASIS * POSTTRANSLATIONAL MODIFICATION Subject RIV: CE - Biochemistry; CE - Biochemistry (UOCHB-X) OBOR OECD: Biochemistry and molecular biology; Biochemistry and molecular biology (UOCHB-X) Impact factor: 4.259, year: 2016

A dynamic ribosomal biogenesis response is not required for IGF-1-mediated hypertrophy of human primary myotubes.

Science.gov (United States)

Crossland, Hannah; Timmons, James A; Atherton, Philip J

2017-12-01

Increased ribosomal DNA transcription has been proposed to limit muscle protein synthesis, making ribosome biogenesis central to skeletal muscle hypertrophy. We examined the relationship between ribosomal RNA (rRNA) production and IGF-1-mediated myotube hypertrophy in vitro Primary skeletal myotubes were treated with IGF-1 (50 ng/ml) with or without 0.5 µM CX-5461 (CX), an inhibitor of RNA polymerase I. Myotube diameter, total protein, and RNA and DNA levels were measured along with markers of RNA polymerase I regulatory factors and regulators of protein synthesis. CX treatment reduced 45S pre-rRNA expression (-64 ± 5% vs. IGF-1; P IGF-1; P IGF-1-treated myotubes. IGF-1-mediated increases in myotube diameter (1.27 ± 0.09-fold, P IGF-1 treatment did not prevent early increases in AKT (+203 ± 39% vs. CX; P IGF-1, myotube diameter and protein accretion were sustained. Thus, while ribosome biogenesis represents a potential site for the regulation of skeletal muscle protein synthesis and muscle mass, it does not appear to be a prerequisite for IGF-1-induced myotube hypertrophy in vitro. -Crossland, H., Timmons, J. A., Atherton, P. J. A dynamic ribosomal biogenesis response is not required for IGF-1-mediated hypertrophy of human primary myotubes. © The Author(s).

The importance of highly conserved nucleotides in the binding region of chloramphenicol at the peptidyl transfer centre of Escherichia coli 23S ribosomal RNA

DEFF Research Database (Denmark)

Vester, Birte; Garrett, Roger Antony

1988-01-01

in vivo on a plasmid-encoded rRNA (rrnB) operon and each one yielded dramatically altered phenotypes. Cells exhibiting A2060----C or A2450----C transversions were inviable and it was shown by inserting the mutated genes after a temperature-inducible promoter that the mutant RNAs were directly responsible...... into 50S subunits, but while the two lethal mutant RNAs were strongly selected against in 70S ribosomes, the plasmid-encoded A2503----C RNA was preferred over the chromosome-encoded RNA, contrary to current regulatory theories. The results establish the critical structural and functional importance...

Photoaffinity studies of the tubulin-colchicine binding site

International Nuclear Information System (INIS)

Hahn, K.M.

1987-01-01

A variety of colchicine derivatives were synthesized and coupled with 3,3,3-trifluoro-2-diazapropionyl chloride (TFDP-Cl) to produce colchicine photoaffinity analogs for use in tubulin labelling studies. Photoaffinity analogs of allocolchicine and podophylotoxin were also made using the same photoreactive moiety. Several labels were found to be effective inhibitors of tubulin polymerization. The approximate tubulin binding constants of the labels, calculated from polymerization inhibition data, varied between 2.2 x 10 5 to 2.5 x 10 3 M -1 . The labels chosen for use in tubulin labelling experiments were (N-TFDP) deacetyl-thiocolchicine 1, (O-TFDP)thiocolchifoline 2, and (O-TFDP)-2-demethylthiocolchicine 3. Compound 1 was found to bind tubulin reversibly and to competitively inhibit colchicine binding. Methods for the incorporation of tritium and 14 C in these labels were developed. Conditions were found which caused labels to insert into solvent without photorearrangement of the colchicine skeleton. Catalytic base caused the α-diazo amide of 1 to rearrange to a triazole

Multi-perspective smFRET reveals rate-determining late intermediates of ribosomal translocation

Science.gov (United States)

Wasserman, Michael R.; Alejo, Jose L.; Altman, Roger B.; Blanchard, Scott C.

2016-01-01

Directional translocation of the ribosome through the messenger RNA open reading frame is a critical determinant of translational fidelity. This process entails a complex interplay of large-scale conformational changes within the actively translating particle, which together coordinate the movement of transfer and messenger RNA substrates with respect to the large and small ribosomal subunits. Using pre-steady state, single-molecule fluorescence resonance energy transfer imaging, we have tracked the nature and timing of these conformational events within the Escherichia coli ribosome from five structural perspectives. Our investigations reveal direct evidence of structurally and kinetically distinct, late intermediates during substrate movement, whose resolution is rate-determining to the translocation mechanism. These steps involve intra-molecular events within the EFG(GDP)-bound ribosome, including exaggerated, reversible fluctuations of the small subunit head domain, which ultimately facilitate peptidyl-tRNA’s movement into its final post-translocation position. PMID:26926435

Tubulin in vitro, in vivo and in silico

Science.gov (United States)

Mershin, Andreas

Tubulin, microtubules and associated proteins were studied theoretically, computationally and experimentally in vitro and in vivo in order to elucidate the possible role these play in cellular information processing and storage. Use of the electric dipole moment of tubulin as the basis for binary switches (biobits) in nanofabricated circuits was explored with surface plasmon resonance, refractometry and dielectric spectroscopy. The effects of burdening the microtubular cytoskeleton of olfactory associative memory neurons with excess microtubule associated protein TAU in Drosophila fruitflies were determined. To investigate whether tubulin may be used as the substrate for quantum computation as a bioqubit, suggestions for experimental detection of quantum coherence and entanglement among tubulin electric dipole moment states were developed.

Regression of hepatocarcinoma cells using RNA aptamer specific to alpha-fetoprotein

Energy Technology Data Exchange (ETDEWEB)

Lee, Young Ju [Department of Molecular Biology, Institute of Nanosensor and Biotechnology, Dankook University, Yongin 448-701 (Korea, Republic of); Lee, Seong-Wook, E-mail: SWL0208@dankook.ac.kr [Department of Molecular Biology, Institute of Nanosensor and Biotechnology, Dankook University, Yongin 448-701 (Korea, Republic of)

2012-01-06

Highlights: Black-Right-Pointing-Pointer Identification of RNA aptamer specific to AFP with high affinity. Black-Right-Pointing-Pointer Specific induction of HCC proliferation by AFP. Black-Right-Pointing-Pointer Efficient increase in oncogene expression by AFP. Black-Right-Pointing-Pointer Efficient inhibition of AFP-mediated HCC proliferation by the aptamer. Black-Right-Pointing-Pointer Efficient suppression of AFP-induced oncogene expression of by the aptamer. -- Abstract: Alpha-fetoprotein (AFP) is a cancer-associated fetal protein and has long been utilized as a serum fetal defect/tumor marker to monitor distress/disease progression. In addition, AFP is closely associated with the proliferation of hepatocellular carcinoma. Thus, direct targeting of AFP has been recommended for a therapeutic strategy against hepatocellular carcinoma. In this study, we developed and characterized an RNA aptamer that specifically bound to the alpha-fetoprotein using SELEX technology. The aptamer interacted with the AFP with a K{sub D} of {approx}33 nM. Importantly, the identified aptamer specifically and efficiently inhibited the AFP-mediated proliferation of hepatocarcinoma cells in a dose dependent manner. Moreover, the aptamer efficiently down-regulated AFP-induced expression of oncogenes in the cells. These results indicate that an AFP-specific RNA aptamer could be a useful therapeutic and diagnostic agent against AFP-related hepatocellular carcinoma.

Regression of hepatocarcinoma cells using RNA aptamer specific to alpha-fetoprotein

International Nuclear Information System (INIS)

Lee, Young Ju; Lee, Seong-Wook

2012-01-01

Highlights: ► Identification of RNA aptamer specific to AFP with high affinity. ► Specific induction of HCC proliferation by AFP. ► Efficient increase in oncogene expression by AFP. ► Efficient inhibition of AFP-mediated HCC proliferation by the aptamer. ► Efficient suppression of AFP-induced oncogene expression of by the aptamer. -- Abstract: Alpha-fetoprotein (AFP) is a cancer-associated fetal protein and has long been utilized as a serum fetal defect/tumor marker to monitor distress/disease progression. In addition, AFP is closely associated with the proliferation of hepatocellular carcinoma. Thus, direct targeting of AFP has been recommended for a therapeutic strategy against hepatocellular carcinoma. In this study, we developed and characterized an RNA aptamer that specifically bound to the alpha-fetoprotein using SELEX technology. The aptamer interacted with the AFP with a K D of ∼33 nM. Importantly, the identified aptamer specifically and efficiently inhibited the AFP-mediated proliferation of hepatocarcinoma cells in a dose dependent manner. Moreover, the aptamer efficiently down-regulated AFP-induced expression of oncogenes in the cells. These results indicate that an AFP-specific RNA aptamer could be a useful therapeutic and diagnostic agent against AFP-related hepatocellular carcinoma.

Origins of the plant chloroplasts and mitochondria based on comparisons of 5S ribosomal RNAs

Science.gov (United States)

Delihas, N.; Fox, G. E.

1987-01-01

In this paper, we provide macromolecular comparisons utilizing the 5S ribosomal RNA structure to suggest extant bacteria that are the likely descendants of chloroplast and mitochondria endosymbionts. The genetic stability and near universality of the 5S ribosomal gene allows for a useful means to study ancient evolutionary changes by macromolecular comparisons. The value in current and future ribosomal RNA comparisons is in fine tuning the assignment of ancestors to the organelles and in establishing extant species likely to be descendants of bacteria involved in presumed multiple endosymbiotic events.

Interactions between the cyclic AMP receptor protein and the alpha subunit of RNA polymerase at the Escherichia coli galactose operon P1 promoter.

Science.gov (United States)

Attey, A; Belyaeva, T; Savery, N; Hoggett, J; Fujita, N; Ishihama, A; Busby, S

1994-10-25

DNAase I footprinting has been used to study open complexes between Escherichia coli RNA polymerase and the galactose operon P1 promoter, both in the absence and the presence of CRP (the cyclic AMP receptor protein, a transcription activator). From the effects of deletion of the C-terminal part of the RNA polymerase alpha subunit, we deduce that alpha binds at the upstream end of both the binary RNA polymerase-galP1 and ternary RNA polymerase-CRP-galP1 complexes. Disruption of the alpha-upstream contact suppresses open complex formation at galP1 at lower temperatures. In ternary RNA polymerase-CRP-galP1 complexes, alpha appears to make direct contact with Activating Region 1 in CRP. DNAase I footprinting has been used to detect and quantify interactions between purified alpha and CRP bound at galP1.

Phospholipase C-{delta}{sub 1} regulates interleukin-1{beta} and tumor necrosis factor-{alpha} mRNA expression

Energy Technology Data Exchange (ETDEWEB)

Chung, Eric; Jakinovich, Paul; Bae, Aekyung [Department of Anesthesiology, Health Sciences Center L4 Rm 081, Stony Brook University, Stony Brook, NY 11794 (United States); Rebecchi, Mario, E-mail: Mario.rebecchi@SBUmed.org [Department of Anesthesiology, Health Sciences Center L4 Rm 081, Stony Brook University, Stony Brook, NY 11794 (United States)

2012-10-01

Phospholipase C-{delta}{sub 1} (PLC{delta}{sub 1}) is a widely expressed highly active PLC isoform, modulated by Ca{sup 2+} that appears to operate downstream from receptor signaling and has been linked to regulation of cytokine production. Here we investigated whether PLC{delta}{sub 1} modulated expression of the pro-inflammatory cytokines interleukin-1{beta} (IL-1{beta}), tumor necrosis factor-{alpha} (TNF-{alpha}) and interleukin-6 (IL-6) in rat C6 glioma cells. Expression of PLC{delta}{sub 1} was specifically suppressed by small interfering RNA (siRNA) and the effects on cytokine mRNA expression, stimulated by the Toll-like receptor (TLR) agonist, lipopolysaccharide (LPS), were examined. Real-time polymerase chain reaction (RT-PCR) results showed that PLC{delta}{sub 1} knockdown enhanced expression IL-1{beta} and tumor necrosis factor-{alpha} (TNF-{alpha}) mRNA by at least 100 fold after 4 h of LPS stimulation compared to control siRNA treatment. PLC{delta}{sub 1} knock down caused persistently high Nf{kappa}b levels at 4 h of LPS stimulation compared to control siRNA-treated cells. PLC{delta}{sub 1} knockdown was also associated with elevated nuclear levels of c-Jun after 30 min of LPS stimulation, but did not affect LPS-stimulated p38 or p42/44 MAPK phosphorylation, normally associated with TLR activation of cytokine gene expression; rather, enhanced protein kinase C (PKC) phosphorylation of cellular proteins was observed in the absence of LPS stimulation. An inhibitor of PKC, bisindolylmaleimide II (BIM), reversed phosphorylation, prevented elevation of nuclear c-Jun levels, and inhibited LPS-induced increases of IL-1{beta} and TNF-{alpha} mRNA's induced by PLC{delta}{sub 1} knockdown. Our results show that loss of PLC{delta}{sub 1} enhances PKC/c-Jun signaling and up-modulates pro-inflammatory cytokine gene transcription in concert with the TLR-stimulated p38MAPK/Nf{kappa}b pathway. Our findings are consistent with the idea that PLC{delta}{sub 1} is a

Viral kinetics of hepatitis C virus RNA in patients with chronic hepatitis C treated with 18 MU of interferon alpha daily

NARCIS (Netherlands)

Sentjens, Roel E.; Weegink, Christine J.; Beld, Marcel G.; Cooreman, Michel C.; Reesink, Henk W.

2002-01-01

BACKGROUND: A rapid decrease of hepatitis C virus (HCV) RNA is interferon (IFN) dose-dependent, and a 3-log decline of HCV-RNA is a strong predictor of sustained virological response. In this study, viral kinetics of HCV RNA in patients treated with 18 MU interferon alpha (IFN-alpha) daily for 2

Mixed heterolobosean and novel gregarine lineage genes from culture ATCC 50646: Long-branch artefacts, not lateral gene transfer, distort α-tubulin phylogeny.

Science.gov (United States)

Cavalier-Smith, Thomas

2015-04-01

Contradictory and confusing results can arise if sequenced 'monoprotist' samples really contain DNA of very different species. Eukaryote-wide phylogenetic analyses using five genes from the amoeboflagellate culture ATCC 50646 previously implied it was an undescribed percolozoan related to percolatean flagellates (Stephanopogon, Percolomonas). Contrastingly, three phylogenetic analyses of 18S rRNA alone, did not place it within Percolozoa, but as an isolated deep-branching excavate. I resolve that contradiction by sequence phylogenies for all five genes individually, using up to 652 taxa. Its 18S rRNA sequence (GQ377652) is near-identical to one from stained-glass windows, somewhat more distant from one from cooling-tower water, all three related to terrestrial actinocephalid gregarines Hoplorhynchus and Pyxinia. All four protein-gene sequences (Hsp90; α-tubulin; β-tubulin; actin) are from an amoeboflagellate heterolobosean percolozoan, not especially deeply branching. Contrary to previous conclusions from trees combining protein and rRNA sequences or rDNA trees including Eozoa only, this culture does not represent a major novel deep-branching eukaryote lineage distinct from Heterolobosea, and thus lacks special significance for deep eukaryote phylogeny, though the rDNA sequence is important for gregarine phylogeny. α-Tubulin trees for over 250 eukaryotes refute earlier suggestions of lateral gene transfer within eukaryotes, being largely congruent with morphology and other gene trees. Copyright © 2015. Published by Elsevier GmbH.

Determinants of RNA polymerase alpha subunit for interaction with beta, beta', and sigma subunits: hydroxyl-radical protein footprinting.

OpenAIRE

Heyduk, T; Heyduk, E; Severinov, K; Tang, H; Ebright, R H

1996-01-01

Escherichia coli RNA polymerase (RNAP) alpha subunit serves as the initiator for RNAP assembly, which proceeds according to the pathway 2 alpha-->alpha 2-->alpha 2 beta-->alpha 2 beta beta'-->alpha 2 beta beta' sigma. In this work, we have used hydroxyl-radical protein footprinting to define determinants of alpha for interaction with beta, beta', and sigma. Our results indicate that amino acids 30-75 of alpha are protected from hydroxyl-radical-mediated proteolysis upon interaction with beta ...

Resistance to linezolid in Staphylococcus spp. clinical isolates associated with ribosomal binding site modifications: novel mutation in domain V of 23S rRNA.

Science.gov (United States)

Musumeci, Rosario; Calaresu, Enrico; Gerosa, Jolanda; Oggioni, Davide; Bramati, Simone; Morelli, Patrizia; Mura, Ida; Piana, Andrea; Are, Bianca Maria; Cocuzza, Clementina Elvezia

2016-10-01

Linezolid is the main representative of the oxazolidinones, introduced in 2000 in clinical practice to treat severe Gram-positive infections. This compound inhibits protein synthesis by binding to the peptidyl transferase centre of the 50S bacterial ribosomal subunit. The aim of this study was to characterize 12 clinical strains of linezolid-resistant Staphylococcus spp. isolated in Northern Italy. All isolates of Staphylococcus spp. studied showed a multi-antibiotic resistance phenotype. In particular, all isolates showed the presence of the mecA gene associated with SSCmec types IVa, V or I. Mutations in domain V of 23S rRNA were shown to be the most prevalent mechanism of linezolid resistance: among these a new C2551T mutation was found in S. aureus, whilst the G2576T mutation was shown to be the most prevalent overall. Moreover, three S. epidermidis isolates were shown to have linezolid resistance associated only with alterations in both L3 and L4 ribosomal proteins. No strain was shown to harbor the previously described cfr gene. These results have shown how the clinical use of linezolid in Northern Italy has resulted in the selection of multiple antibiotic-resistant clinical isolates of Staphylococcus spp., with linezolid resistance in these strains being associated with mutations in 23S rRNA or ribosomal proteins L3 and L4.

-NH-dansyl isocolchicine exhibits a significantly improved tubulin-binding affinity and microtubule inhibition in comparison to isocolchicine by binding tubulin through its A and B rings.

Science.gov (United States)

Das, Lalita; Datta, Ajit B; Gupta, Suvroma; Poddar, Asim; Sengupta, Suparna; Janik, Mark E; Bhattacharyya, Bhabatarak

2005-03-08

Structure-activity relationship studies have established that the A and C rings of colchicine comprise the minimum structural feature necessary for high affinity drug-tubulin binding. Thus, colchicine acts as a bifunctional ligand by making two points of attachment to the protein. Furthermore, analogues belonging to the iso series of colchicine are virtually inactive in binding to tubulin and inhibiting microtubule assembly. In the present study, we found that the substitution of a hydrophobic dansyl group on the B-ring side chain (C7 position) of isocolchicine reverses the structural alterations at the C ring and the newly synthesized -NH-dansyl isocolchicine restores the lost biological activity of the compound. It inhibits microtubule assembly efficiently with an IC(50) value of 10 microM and competes with [(3)H]colchicine for binding to tubulin. Moreover, although -NH-dansyl colchicine binding to tubulin involves two steps, the -NH-dansyl isocolchicine-tubulin interaction has been found to occur via a one-step process. Also, the affinity constant of the -NH-dansyl isocolchicine-tubulin interaction is roughly only 3 times lower than that of the -NH-dansyl colchicine-tubulin interaction. These results suggest that the enhanced microtubule inhibitory ability of -NH-dansyl isocolchicine is therefore related to the affinity of the drug-tubulin interaction and not to any conformational changes upon binding tubulin. We also observed that the competition of -NH-dansyl isocolchicine with [(3)H]colchicine for binding to tubulin was dependent on the tubulin concentration. In conclusion, this paper for the first time indicates that a biologically active bifuntional colchicine analogue can be designed where the drug binds tubulin through its A and B rings, while the C ring remains inactive.

Restriction fragment length polymorphism (RFLP) analysis of PCR products amplified from 18S ribosomal RNA gene of Trypanosoma congolense

International Nuclear Information System (INIS)

Osanyo, A.; Majiwa, P.W.

2006-01-01

Oligonucleotide primers were designed from the conserved nucleotide sequences of 18S ribosomal RNA (18S rRNA) gene of protozoans: Trypanosoma brucei, Leishmania donovani, Triponema aequale and Lagenidium gigantum. The primers were used in polymerace chain reaction (PCR) to generate PCR products of approximately 1 Kb using genomic DNA from T. brucei and the four genotypic groups of T. congolense as template. The five PCR products so produced were digested with several restriction enzymes and hybridized to a DNA probe made from T. brucei PCR product of the same 18S rRNA gene region. Most restriction enzyme digests revealed polymorphism with respect to the location of their recognition sites on the five PCR products. The restriction fragment length polymorphism (RFLP) pattern observed indicate that the 18S rRNA gene sequences of trypanosomes: T. brucei and the four genotypes of T.congolence group are heterogeneous. The results further demonstrate that the region that was amplified can be used in specific identification of trypanosomes species and subspecies.(author)

β class II tubulin predominates in normal and tumor breast tissues

International Nuclear Information System (INIS)

Dozier, James H; Hiser, Laree; Davis, Jennifer A; Thomas, Nancy Stubbs; Tucci, Michelle A; Benghuzzi, Hamed A; Frankfurter, Anthony; Correia, John J; Lobert, Sharon

2003-01-01

Antimitotic chemotherapeutic agents target tubulin, the major protein in mitotic spindles. Tubulin isotype composition is thought to be both diagnostic of tumor progression and a determinant of the cellular response to chemotherapy. This implies that there is a difference in isotype composition between normal and tumor tissues. To determine whether such a difference occurs in breast tissues, total tubulin was fractionated from lysates of paired normal and tumor breast tissues, and the amounts of β-tubulin classes I + IV, II, and III were measured by competitive enzyme-linked immunosorbent assay (ELISA). Only primary tumor tissues, before chemotherapy, were examined. Her2/neu protein amplification occurs in about 30% of breast tumors and is considered a marker for poor prognosis. To gain insight into whether tubulin isotype levels might be correlated with prognosis, ELISAs were used to quantify Her2/neu protein levels in these tissues. β-Tubulin isotype distributions in normal and tumor breast tissues were similar. The most abundant β-tubulin isotypes in these tissues were β-tubulin classes II and I + IV. Her2/neu levels in tumor tissues were 5–30-fold those in normal tissues, although there was no correlation between the Her2/neu biomarker and tubulin isotype levels. These results suggest that tubulin isotype levels, alone or in combination with Her2/neu protein levels, might not be diagnostic of tumorigenesis in breast cancer. However, the presence of a broad distribution of these tubulin isotypes (for example, 40–75% β-tubulin class II) in breast tissue, in conjunction with other factors, might still be relevant to disease progression and cellular response to antimitotic drugs

p27Kip1 Modulates Axonal Transport by Regulating α-Tubulin Acetyltransferase 1 Stability

Directory of Open Access Journals (Sweden)

Giovanni Morelli

2018-05-01

Full Text Available Summary: The protein p27Kip1 plays roles that extend beyond cell-cycle regulation during cerebral cortex development, such as the regulation of neuronal migration and neurite branching via signaling pathways that converge on the actin and microtubule cytoskeletons. Microtubule-dependent transport is essential for the maturation of neurons and the establishment of neuronal connectivity though synapse formation and maintenance. Here, we show that p27Kip1 controls the transport of vesicles and organelles along the axon of mice cortical projection neurons in vitro. Moreover, suppression of the p27Kip1 ortholog, dacapo, in Drosophila melanogaster disrupts axonal transport in vivo, leading to the reduction of locomotor activity in third instar larvae and adult flies. At the molecular level, p27Kip1 stabilizes the α-tubulin acetyltransferase 1, thereby promoting the acetylation of microtubules, a post-translational modification required for proper axonal transport. : Morelli et al. report that p27Kip1/Dacapo modulates the acetylation of microtubules in axons via stabilization of ATAT1, the main α-tubulin acetyltransferase. Its conditional loss leads to the reduction of bidirectional axonal transport of vesicles and mitochondria in vitro in mice and in vivo in Drosophila. Keywords: p27Kip1, dacapo, acetylation, axonal transport, ATAT1, alpha-tubulin, HDAC6, Drosophila, mouse, cerebral cortex

Defective replication initiation results in locus specific chromosome breakage and a ribosomal RNA deficiency in yeast.

Directory of Open Access Journals (Sweden)

Joseph C Sanchez

2017-10-01

Full Text Available A form of dwarfism known as Meier-Gorlin syndrome (MGS is caused by recessive mutations in one of six different genes (ORC1, ORC4, ORC6, CDC6, CDT1, and MCM5. These genes encode components of the pre-replication complex, which assembles at origins of replication prior to S phase. Also, variants in two additional replication initiation genes have joined the list of causative mutations for MGS (Geminin and CDC45. The identity of the causative MGS genetic variants strongly suggests that some aspect of replication is amiss in MGS patients; however, little evidence has been obtained regarding what aspect of chromosome replication is faulty. Since the site of one of the missense mutations in the human ORC4 alleles is conserved between humans and yeast, we sought to determine in what way this single amino acid change affects the process of chromosome replication, by introducing the comparable mutation into yeast (orc4Y232C. We find that yeast cells with the orc4Y232C allele have a prolonged S-phase, due to compromised replication initiation at the ribosomal DNA (rDNA locus located on chromosome XII. The inability to initiate replication at the rDNA locus results in chromosome breakage and a severely reduced rDNA copy number in the survivors, presumably helping to ensure complete replication of chromosome XII. Although reducing rDNA copy number may help ensure complete chromosome replication, orc4Y232C cells struggle to meet the high demand for ribosomal RNA synthesis. This finding provides additional evidence linking two essential cellular pathways-DNA replication and ribosome biogenesis.

Defective replication initiation results in locus specific chromosome breakage and a ribosomal RNA deficiency in yeast.

Science.gov (United States)

Sanchez, Joseph C; Kwan, Elizabeth X; Pohl, Thomas J; Amemiya, Haley M; Raghuraman, M K; Brewer, Bonita J

2017-10-01

A form of dwarfism known as Meier-Gorlin syndrome (MGS) is caused by recessive mutations in one of six different genes (ORC1, ORC4, ORC6, CDC6, CDT1, and MCM5). These genes encode components of the pre-replication complex, which assembles at origins of replication prior to S phase. Also, variants in two additional replication initiation genes have joined the list of causative mutations for MGS (Geminin and CDC45). The identity of the causative MGS genetic variants strongly suggests that some aspect of replication is amiss in MGS patients; however, little evidence has been obtained regarding what aspect of chromosome replication is faulty. Since the site of one of the missense mutations in the human ORC4 alleles is conserved between humans and yeast, we sought to determine in what way this single amino acid change affects the process of chromosome replication, by introducing the comparable mutation into yeast (orc4Y232C). We find that yeast cells with the orc4Y232C allele have a prolonged S-phase, due to compromised replication initiation at the ribosomal DNA (rDNA) locus located on chromosome XII. The inability to initiate replication at the rDNA locus results in chromosome breakage and a severely reduced rDNA copy number in the survivors, presumably helping to ensure complete replication of chromosome XII. Although reducing rDNA copy number may help ensure complete chromosome replication, orc4Y232C cells struggle to meet the high demand for ribosomal RNA synthesis. This finding provides additional evidence linking two essential cellular pathways-DNA replication and ribosome biogenesis.

An automated procedure for covariation-based detection of RNA structure

International Nuclear Information System (INIS)

Winker, S.; Overbeek, R.; Woese, C.R.; Olsen, G.J.; Pfluger, N.

1989-12-01

This paper summarizes our investigations into the computational detection of secondary and tertiary structure of ribosomal RNA. We have developed a new automated procedure that not only identifies potential bondings of secondary and tertiary structure, but also provides the covariation evidence that supports the proposed bondings, and any counter-evidence that can be detected in the known sequences. A small number of previously unknown bondings have been detected in individual RNA molecules (16S rRNA and 7S RNA) through the use of our automated procedure. Currently, we are systematically studying mitochondrial rRNA. Our goal is to detect tertiary structure within 16S rRNA and quaternary structure between 16S and 23S rRNA. Our ultimate hope is that automated covariation analysis will contribute significantly to a refined picture of ribosome structure. Our colleagues in biology have begun experiments to test certain hypotheses suggested by an examination of our program's output. These experiments involve sequencing key portions of the 23S ribosomal RNA for species in which the known 16S ribosomal RNA exhibits variation (from the dominant pattern) at the site of a proposed bonding. The hope is that the 23S ribosomal RNA of these species will exhibit corresponding complementary variation or generalized covariation. 24 refs

An automated procedure for covariation-based detection of RNA structure

Energy Technology Data Exchange (ETDEWEB)

Winker, S.; Overbeek, R.; Woese, C.R.; Olsen, G.J.; Pfluger, N.

1989-12-01

This paper summarizes our investigations into the computational detection of secondary and tertiary structure of ribosomal RNA. We have developed a new automated procedure that not only identifies potential bondings of secondary and tertiary structure, but also provides the covariation evidence that supports the proposed bondings, and any counter-evidence that can be detected in the known sequences. A small number of previously unknown bondings have been detected in individual RNA molecules (16S rRNA and 7S RNA) through the use of our automated procedure. Currently, we are systematically studying mitochondrial rRNA. Our goal is to detect tertiary structure within 16S rRNA and quaternary structure between 16S and 23S rRNA. Our ultimate hope is that automated covariation analysis will contribute significantly to a refined picture of ribosome structure. Our colleagues in biology have begun experiments to test certain hypotheses suggested by an examination of our program's output. These experiments involve sequencing key portions of the 23S ribosomal RNA for species in which the known 16S ribosomal RNA exhibits variation (from the dominant pattern) at the site of a proposed bonding. The hope is that the 23S ribosomal RNA of these species will exhibit corresponding complementary variation or generalized covariation. 24 refs.

Centrobin–tubulin interaction is required for centriole elongation and stability

Science.gov (United States)

Gudi, Radhika; Zou, Chaozhong; Li, Jun

2011-01-01

Centrobin is a daughter centriole protein that is essential for centrosome duplication. However, the molecular mechanism by which centrobin functions during centriole duplication remains undefined. In this study, we show that centrobin interacts with tubulin directly, and centrobin–tubulin interaction is pivotal for the function of centrobin during centriole duplication. We found that centrobin is recruited to the centriole biogenesis site via its interaction with tubulins during the early stage of centriole biogenesis, and its recruitment is dependent on hSAS-6 but not centrosomal P4.1–associated protein (CPAP) and CP110. The function of centrobin is also required for the elongation of centrioles, which is likely mediated by its interaction with tubulin. Furthermore, disruption of centrobin–tubulin interaction led to destabilization of existing centrioles and the preformed procentriole-like structures induced by CPAP expression, indicating that centrobin–tubulin interaction is critical for the stability of centrioles. Together, our study demonstrates that centrobin facilitates the elongation and stability of centrioles via its interaction with tubulins. PMID:21576394

Is The Ribosome Targeted By Adaptive Mutations

DEFF Research Database (Denmark)

Jimenez Fernandez, Alicia; Molin, Søren; Johansen, Helle Krogh

2015-01-01

Introduction: RNA polymerase and ribosomes, composing the macromolecular synthesis machinery (MMSM), carry out the central processes of transcription and translation, but are usually seen as mechanical elements with no regulatory function. Extensive investigations of gene regulation and the high ...

Molecular interactions within the halophilic, thermophilic, and mesophilic prokaryotic ribosomal complexes: clues to environmental adaptation.

Science.gov (United States)

Mallik, Saurav; Kundu, Sudip

2015-01-01

Using the available crystal structures of 50S ribosomal subunits from three prokaryotic species: Escherichia coli (mesophilic), Thermus thermophilus (thermophilic), and Haloarcula marismortui (halophilic), we have analyzed different structural features of ribosomal RNAs (rRNAs), proteins, and of their interfaces. We have correlated these structural features with the environmental adaptation strategies of the corresponding species. While dense intra-rRNA packing is observed in thermophilic, loose intra-rRNA packing is observed in halophilic (both compared to mesophilic). Interestingly, protein-rRNA interfaces of both the extremophiles are densely packed compared to that of the mesophilic. The intersubunit bridge regions are almost devoid of cavities, probably ensuring the proper formation of each bridge (by not allowing any loosely packed region nearby). During rRNA binding, the ribosomal proteins experience some structural transitions. Here, we have analyzed the intrinsically disordered and ordered regions of the ribosomal proteins, which are subjected to such transitions. The intrinsically disordered and disorder-to-order transition sites of the thermophilic and mesophilic ribosomal proteins are simultaneously (i) highly conserved and (ii) slowly evolving compared to rest of the protein structure. Although high conservation is observed at such sites of halophilic ribosomal proteins, but slow rate of evolution is absent. Such differences between thermophilic, mesophilic, and halophilic can be explained from their environmental adaptation strategy. Interestingly, a universal biophysical principle evident by a linear relationship between the free energy of interface formation, interface area, and structural changes of r-proteins during assembly is always maintained, irrespective of the environmental conditions.

Expression and RNA Interference of Ribosomal Protein L5 Gene in Nilaparvata lugens (Hemiptera: Delphacidae).

Science.gov (United States)

Zhu, Jiajun; Hao, Peiying; Lu, Chaofeng; Ma, Yan; Feng, Yalin; Yu, Xiaoping

2017-05-01

The ribosomal proteins play important roles in the growth and development of organisms. This study aimed to explore the function of NlRPL5 (GenBank KX379234), a ribosomal protein L5 gene, in the brown planthopper Nilaparvata lugens. The open reading frame of NlRPL5 was cloned from N. lugens based on a previous transcriptome analysis. The results revealed that the open reading frame of NlRPL5 is of 900 bp, encoding 299 amino acid residues. The reverse transcription quantitative PCR results suggested that the expression of NlRPL5 gene was stronger in gravid females, but was relatively low in nymphs, males, and newly emerged females. The expression level of NlRPL5 in the ovary was about twofolds of that in the head, thorax, or fat body. RNAi of dsNlRPL5 resulted in a significant reduction of mRNA levels, ∼50% decrease in comparison with the dsGFP control at day 6. Treatment of dsNlRPL5 significantly restricted the ovarian development, and decreased the number of eggs laid on the rice (Oryza sativa) plants. This study provided a new clue for further study on the function and regulation mechanism of NlRPL5 in N. lugens. © The Author 2017. Published by Oxford University Press on behalf of the Entomological Society of America.

Ribosome. The complete structure of the 55S mammalian mitochondrial ribosome.

Science.gov (United States)

Greber, Basil J; Bieri, Philipp; Leibundgut, Marc; Leitner, Alexander; Aebersold, Ruedi; Boehringer, Daniel; Ban, Nenad

2015-04-17

Mammalian mitochondrial ribosomes (mitoribosomes) synthesize mitochondrially encoded membrane proteins that are critical for mitochondrial function. Here we present the complete atomic structure of the porcine 55S mitoribosome at 3.8 angstrom resolution by cryo-electron microscopy and chemical cross-linking/mass spectrometry. The structure of the 28S subunit in the complex was resolved at 3.6 angstrom resolution by focused alignment, which allowed building of a detailed atomic structure including all of its 15 mitoribosomal-specific proteins. The structure reveals the intersubunit contacts in the 55S mitoribosome, the molecular architecture of the mitoribosomal messenger RNA (mRNA) binding channel and its interaction with transfer RNAs, and provides insight into the highly specialized mechanism of mRNA recruitment to the 28S subunit. Furthermore, the structure contributes to a mechanistic understanding of aminoglycoside ototoxicity. Copyright © 2015, American Association for the Advancement of Science.

Architecture of the large subunit of the mammalian mitochondrial ribosome.

Science.gov (United States)

Greber, Basil J; Boehringer, Daniel; Leitner, Alexander; Bieri, Philipp; Voigts-Hoffmann, Felix; Erzberger, Jan P; Leibundgut, Marc; Aebersold, Ruedi; Ban, Nenad

2014-01-23

Mitochondrial ribosomes synthesize a number of highly hydrophobic proteins encoded on the genome of mitochondria, the organelles in eukaryotic cells that are responsible for energy conversion by oxidative phosphorylation. The ribosomes in mammalian mitochondria have undergone massive structural changes throughout their evolution, including ribosomal RNA shortening and acquisition of mitochondria-specific ribosomal proteins. Here we present the three-dimensional structure of the 39S large subunit of the porcine mitochondrial ribosome determined by cryo-electron microscopy at 4.9 Å resolution. The structure, combined with data from chemical crosslinking and mass spectrometry experiments, reveals the unique features of the 39S subunit at near-atomic resolution and provides detailed insight into the architecture of the polypeptide exit site. This region of the mitochondrial ribosome has been considerably remodelled compared to its bacterial counterpart, providing a specialized platform for the synthesis and membrane insertion of the highly hydrophobic protein components of the respiratory chain.

Ribosomal and hematopoietic defects in induced pluripotent stem cells derived from Diamond Blackfan anemia patients.

Science.gov (United States)

Garçon, Loïc; Ge, Jingping; Manjunath, Shwetha H; Mills, Jason A; Apicella, Marisa; Parikh, Shefali; Sullivan, Lisa M; Podsakoff, Gregory M; Gadue, Paul; French, Deborah L; Mason, Philip J; Bessler, Monica; Weiss, Mitchell J

2013-08-08

Diamond Blackfan anemia (DBA) is a congenital disorder with erythroid (Ery) hypoplasia and tissue morphogenic abnormalities. Most DBA cases are caused by heterozygous null mutations in genes encoding ribosomal proteins. Understanding how haploinsufficiency of these ubiquitous proteins causes DBA is hampered by limited availability of tissues from affected patients. We generated induced pluripotent stem cells (iPSCs) from fibroblasts of DBA patients carrying mutations in RPS19 and RPL5. Compared with controls, DBA fibroblasts formed iPSCs inefficiently, although we obtained 1 stable clone from each fibroblast line. RPS19-mutated iPSCs exhibited defects in 40S (small) ribosomal subunit assembly and production of 18S ribosomal RNA (rRNA). Upon induced differentiation, the mutant clone exhibited globally impaired hematopoiesis, with the Ery lineage affected most profoundly. RPL5-mutated iPSCs exhibited defective 60S (large) ribosomal subunit assembly, accumulation of 12S pre-rRNA, and impaired erythropoiesis. In both mutant iPSC lines, genetic correction of ribosomal protein deficiency via complementary DNA transfer into the "safe harbor" AAVS1 locus alleviated abnormalities in ribosome biogenesis and hematopoiesis. Our studies show that pathological features of DBA are recapitulated by iPSCs, provide a renewable source of cells to model various tissue defects, and demonstrate proof of principle for genetic correction strategies in patient stem cells.

A conserved chloramphenicol binding site at the entrance to the ribosomal peptide exit tunnel

DEFF Research Database (Denmark)

Long, Katherine S; Porse, Bo T

2003-01-01

, of E.coli 23S rRNA and G2084 (2058 in E.coli numbering) in domain V of H.halobium 23S rRNA. The modification sites overlap with a portion of the macrolide binding site and cluster at the entrance to the peptide exit tunnel. The data correlate with the recently reported chloramphenicol binding site...... on an archaeal ribosome and suggest that a similar binding site is present on the E.coli ribosome....

On the Spatial Organization of mRNA, Plasmids, and Ribosomes in a Bacterial Host Overexpressing Membrane Proteins.

Directory of Open Access Journals (Sweden)

Lieke A van Gijtenbeek

2016-12-01

Full Text Available By using fluorescence imaging, we provide a time-resolved single-cell view on coupled defects in transcription, translation, and growth during expression of heterologous membrane proteins in Lactococcus lactis. Transcripts encoding poorly produced membrane proteins accumulate in mRNA-dense bodies at the cell poles, whereas transcripts of a well-expressed homologous membrane protein show membrane-proximal localization in a translation-dependent fashion. The presence of the aberrant polar mRNA foci correlates with cessation of cell division, which is restored once these bodies are cleared. In addition, activation of the heat-shock response and a loss of nucleoid-occluded ribosomes are observed. We show that the presence of a native-like N-terminal domain is key to SRP-dependent membrane localization and successful production of membrane proteins. The work presented gives new insights and detailed understanding of aberrant membrane protein biogenesis, which can be used for strategies to optimize membrane protein production.

Mitochondrial 12S ribosomal RNA A1555G mutation associated with cardiomyopathy and hearing loss following high-dose chemotherapy and repeated aminoglycoside exposure

DEFF Research Database (Denmark)

Skou, Anne-Sofie; Tranebjærg, Lisbeth; Jensen, Tim

2014-01-01

A 19-month-old girl with the A1555G mitochondrial mutation in the 12S ribosomal RNA gene and acute myelogenous leukemia developed dilated cardiomyopathy and bilateral sensorineural hearing loss before undergoing allogeneic stem cell transplantation. She had received gentamicin during episodes of ...... of febrile neutropenia. Testing for the A1555G mutation is recommended in patients frequently treated with aminoglycosides....

A direct interaction between leucine-rich repeat kinase 2 and specific β-tubulin isoforms regulates tubulin acetylation.

Science.gov (United States)

Law, Bernard M H; Spain, Victoria A; Leinster, Veronica H L; Chia, Ruth; Beilina, Alexandra; Cho, Hyun J; Taymans, Jean-Marc; Urban, Mary K; Sancho, Rosa M; Blanca Ramírez, Marian; Biskup, Saskia; Baekelandt, Veerle; Cai, Huaibin; Cookson, Mark R; Berwick, Daniel C; Harvey, Kirsten

2014-01-10

Mutations in LRRK2, encoding the multifunctional protein leucine-rich repeat kinase 2 (LRRK2), are a common cause of Parkinson disease. LRRK2 has been suggested to influence the cytoskeleton as LRRK2 mutants reduce neurite outgrowth and cause an accumulation of hyperphosphorylated Tau. This might cause alterations in the dynamic instability of microtubules suggested to contribute to the pathogenesis of Parkinson disease. Here, we describe a direct interaction between LRRK2 and β-tubulin. This interaction is conferred by the LRRK2 Roc domain and is disrupted by the familial R1441G mutation and artificial Roc domain mutations that mimic autophosphorylation. LRRK2 selectively interacts with three β-tubulin isoforms: TUBB, TUBB4, and TUBB6, one of which (TUBB4) is mutated in the movement disorder dystonia type 4 (DYT4). Binding specificity is determined by lysine 362 and alanine 364 of β-tubulin. Molecular modeling was used to map the interaction surface to the luminal face of microtubule protofibrils in close proximity to the lysine 40 acetylation site in α-tubulin. This location is predicted to be poorly accessible within mature stabilized microtubules, but exposed in dynamic microtubule populations. Consistent with this finding, endogenous LRRK2 displays a preferential localization to dynamic microtubules within growth cones, rather than adjacent axonal microtubule bundles. This interaction is functionally relevant to microtubule dynamics, as mouse embryonic fibroblasts derived from LRRK2 knock-out mice display increased microtubule acetylation. Taken together, our data shed light on the nature of the LRRK2-tubulin interaction, and indicate that alterations in microtubule stability caused by changes in LRRK2 might contribute to the pathogenesis of Parkinson disease.

[Characterization of Black and Dichothrix Cyanobacteria Based on the 16S Ribosomal RNA Gene Sequence

Science.gov (United States)

Ortega, Maya

2010-01-01

My project focuses on characterizing different cyanobacteria in thrombolitic mats found on the island of Highborn Cay, Bahamas. Thrombolites are interesting ecosystems because of the ability of bacteria in these mats to remove carbon dioxide from the atmosphere and mineralize it as calcium carbonate. In the future they may be used as models to develop carbon sequestration technologies, which could be used as part of regenerative life systems in space. These thrombolitic communities are also significant because of their similarities to early communities of life on Earth. I targeted two cyanobacteria in my research, Dichothrix spp. and whatever black is, since they are believed to be important to carbon sequestration in these thrombolitic mats. The goal of my summer research project was to molecularly identify these two cyanobacteria. DNA was isolated from each organism through mat dissections and DNA extractions. I ran Polymerase Chain Reactions (PCR) to amplify the 16S ribosomal RNA (rRNA) gene in each cyanobacteria. This specific gene is found in almost all bacteria and is highly conserved, meaning any changes in the sequence are most likely due to evolution. As a result, the 16S rRNA gene can be used for bacterial identification of different species based on the sequence of their 16S rRNA gene. Since the exact sequence of the Dichothrix gene was unknown, I designed different primers that flanked the gene based on the known sequences from other taxonomically similar cyanobacteria. Once the 16S rRNA gene was amplified, I cloned the gene into specialized Escherichia coli cells and sent the gene products for sequencing. Once the sequence is obtained, it will be added to a genetic database for future reference to and classification of other Dichothrix sp.

The Ribosomal Protein uL22 Modulates the Shape of the Protein Exit Tunnel

DEFF Research Database (Denmark)

Wekselman, Itai; Zimmerman, Ella; Davidovich, Chen

2017-01-01

Erythromycin is a clinically useful antibiotic that binds to an rRNA pocket in the ribosomal exit tunnel. Commonly, resistance to erythromycin is acquired by alterations of rRNA nucleotides that interact with the drug. Mutations in the β hairpin of ribosomal protein uL22, which is rather distal...... of the β hairpin of the mutated uL22 toward the interior of the exit tunnel, triggering a cascade of structural alterations of rRNA nucleotides that propagate to the erythromycin binding pocket. Our findings support recent studies showing that the interactions between uL22 and specific sequences within...

Time of action of 4.5 S RNA in Escherichia coli translation

DEFF Research Database (Denmark)

Brown, S

1989-01-01

A new class of suppressor mutants helps to define the role of 4.5 S RNA in translation. The suppressors reduce the requirement for 4.5 S RNA by increasing the intracellular concentration of uncharged tRNA. Suppression probably occurs by prolonging the period in which translating ribosomes have...... translocated but not yet released the uncharged tRNA, indicating that this is the point at which 4.5 S RNA enters translation. The release of 4.5 S RNA from polysomes is affected by antibiotics that inhibit protein synthesis. The antibiotic-sensitivity of this release indicates that 4.5 S RNA exits...... the ribosome following translocation and prior to release of protein synthesis elongation factor G. These results indicate that 4.5 S RNA acts immediately after ribosomal translocation. A model is proposed in which 4.5 S RNA stabilizes the post-translocation state by replacing 23 S ribosomal RNA as a binding...

The importance of ribosome production, and the 5S RNP-MDM2 pathway, in health and disease.

Science.gov (United States)

Pelava, Andria; Schneider, Claudia; Watkins, Nicholas J

2016-08-15

Ribosomes are abundant, large RNA-protein complexes that are the source of all protein synthesis in the cell. The production of ribosomes is an extremely energetically expensive cellular process that has long been linked to human health and disease. More recently, it has been shown that ribosome biogenesis is intimately linked to multiple cellular signalling pathways and that defects in ribosome production can lead to a wide variety of human diseases. Furthermore, changes in ribosome production in response to nutrient levels in the diet lead to metabolic re-programming of the liver. Reduced or abnormal ribosome production in response to cellular stress or mutations in genes encoding factors critical for ribosome biogenesis causes the activation of the tumour suppressor p53, which leads to re-programming of cellular transcription. The ribosomal assembly intermediate 5S RNP (ribonucleoprotein particle), containing RPL5, RPL11 and the 5S rRNA, accumulates when ribosome biogenesis is blocked. The excess 5S RNP binds to murine double minute 2 (MDM2), the main p53-suppressor in the cell, inhibiting its function and leading to p53 activation. Here, we discuss the involvement of ribosome biogenesis in the homoeostasis of p53 in the cell and in human health and disease. © 2016 The Author(s).

The complete structure of the large subunit of the mammalian mitochondrial ribosome.

Science.gov (United States)

Greber, Basil J; Boehringer, Daniel; Leibundgut, Marc; Bieri, Philipp; Leitner, Alexander; Schmitz, Nikolaus; Aebersold, Ruedi; Ban, Nenad

2014-11-13

Mitochondrial ribosomes (mitoribosomes) are extensively modified ribosomes of bacterial descent specialized for the synthesis and insertion of membrane proteins that are critical for energy conversion and ATP production inside mitochondria. Mammalian mitoribosomes, which comprise 39S and 28S subunits, have diverged markedly from the bacterial ribosomes from which they are derived, rendering them unique compared to bacterial, eukaryotic cytosolic and fungal mitochondrial ribosomes. We have previously determined at 4.9 Å resolution the architecture of the porcine (Sus scrofa) 39S subunit, which is highly homologous to the human mitoribosomal large subunit. Here we present the complete atomic structure of the porcine 39S large mitoribosomal subunit determined in the context of a stalled translating mitoribosome at 3.4 Å resolution by cryo-electron microscopy and chemical crosslinking/mass spectrometry. The structure reveals the locations and the detailed folds of 50 mitoribosomal proteins, shows the highly conserved mitoribosomal peptidyl transferase active site in complex with its substrate transfer RNAs, and defines the path of the nascent chain in mammalian mitoribosomes along their idiosyncratic exit tunnel. Furthermore, we present evidence that a mitochondrial tRNA has become an integral component of the central protuberance of the 39S subunit where it architecturally substitutes for the absence of the 5S ribosomal RNA, a ubiquitous component of all cytoplasmic ribosomes.

Molecular phylogenetic studies on an unnamed bovine Babesia sp. based on small subunit ribosomal RNA gene sequences.

Science.gov (United States)

Luo, Jianxun; Yin, Hong; Liu, Zhijie; Yang, Dongying; Guan, Guiquan; Liu, Aihong; Ma, Miling; Dang, Shengzhi; Lu, Bingyi; Sun, Caiqin; Bai, Qi; Lu, Wenshun; Chen, Puyan

2005-10-10

The 18S small subunit ribosomal RNA (18S rRNA) gene of an unnamed Babesia species (designated B. U sp.) was sequenced and analyzed in an attempt to distinguish it from other Babesia species in China. The target DNA segment was amplified by polymerase chain reaction (PCR). The PCR product was ligated to the pGEM-T Easy vector for sequencing. It was found that the length of the 18S rRNA gene of all B. U sp. Kashi 1 and B. U sp. Kashi 2 was 1699 bp and 1689 bp. Two phylogenetic trees were, respectively, inferred based on 18S rRNA sequence of the Chinese bovine Babesia isolates and all of Babesia species available in GenBank. The first tree showed that B. U sp. was situated in the branch between B. major Yili and B. bovis Shannxian, and the second tree revealed that B. U sp. was confined to the same group as B. caballi. The percent identity of B. U sp. with other Chinese Babesia species was between 74.2 and 91.8, while the percent identity between two B. U sp. isolates was 99.7. These results demonstrated that this B. U sp. is different from other Babesia species, but that two B. U sp. isolates obtained with nymphal and adultal Hyalomma anatolicum anatolicum tick belong to the same species.

Improvement of heterologous protein production in Aspergillus oryzae by RNA interference with alpha-amylase genes.

Science.gov (United States)

Nemoto, Takashi; Maruyama, Jun-ichi; Kitamoto, Katsuhiko

2009-11-01

Aspergillus oryzae RIB40 has three alpha-amylase genes (amyA, amyB, and amyC), and secretes alpha-amylase abundantly. However, large amounts of endogenous secretory proteins such as alpha-amylase can compete with heterologous protein in the secretory pathway and decrease its production yields. In this study, we examined the effects of suppression of alpha-amylase on heterologous protein production in A. oryzae, using the bovine chymosin (CHY) as a reporter heterologous protein. The three alpha-amylase genes in A. oryzae have nearly identical DNA sequences from those promoters to the coding regions. Hence we performed silencing of alpha-amylase genes by RNA interference (RNAi) in the A. oryzae CHY producing strain. The silenced strains exhibited a reduction in alpha-amylase activity and an increase in CHY production in the culture medium. This result suggests that suppression of alpha-amylase is effective in heterologous protein production in A. oryzae.

The kinesin–tubulin complex: considerations in structural and functional complexity

Directory of Open Access Journals (Sweden)

Olmsted ZT

2015-02-01

Full Text Available Zachary T Olmsted, Andrew G Colliver, Janet L Paluh State University of New York Polytechnic Institute, Colleges of Nanoscale Science and Engineering, College of Nanoscale Science, Nanobioscience Constellation, Albany, NY, USA Abstract: The ability of cells to respond to external cues by appropriately manipulating their internal environment requires a dynamic microtubule cytoskeleton that is facilitated by associated kinesin motor interactions. The evolutionary adaptations of kinesins and tubulins when merged generate a highly adaptable communication and infrastructure cellular network that is important to understanding specialized cell functions, human disease, and disease therapies. Here, we review the state of the field in the complex relationship of kinesin–tubulin interactions. We propose 12 mechanistic specializations of kinesins. In one category, referred to as sortability, we describe how kinesin interactions with tubulin isoforms, isotypes, or posttranslationally modified tubulins contribute to diverse cellular roles. Fourteen kinesin families have previously been described. Here, we illustrate the great depth of functional complexity that is possible in members within a single kinesin family by mechanistic specialization through discussion of the well-studied Kinesin-14 family. This includes new roles of Kinesin-14 in regulating supramolecular structures such as the microtubule-organizing center γ-tubulin ring complex of centrosomes. We next explore the value of an improved mechanistic understanding of kinesin–tubulin interactions in regard to human development, disease mechanisms, and improving treatments that target kinesin–tubulin complexes. The ability to combine the current kinesin nomenclature along with a more precisely defined kinesin and tubulin molecular toolbox is needed to support more detailed exploration of kinesin–tubulin interaction mechanisms including functional uniqueness, redundancy, or adaptations to new

The N-terminal sequence of ribosomal protein L10 from the archaebacterium Halobacterium marismortui and its relationship to eubacterial protein L6 and other ribosomal proteins.

Science.gov (United States)

Dijk, J; van den Broek, R; Nasiulas, G; Beck, A; Reinhardt, R; Wittmann-Liebold, B

1987-08-01

The amino-terminal sequence of ribosomal protein L10 from Halobacterium marismortui has been determined up to residue 54, using both a liquid- and a gas-phase sequenator. The two sequences are in good agreement. The protein is clearly homologous to protein HcuL10 from the related strain Halobacterium cutirubrum. Furthermore, a weaker but distinct homology to ribosomal protein L6 from Escherichia coli and Bacillus stearothermophilus can be detected. In addition to 7 identical amino acids in the first 36 residues in all four sequences a number of conservative replacements occurs, of mainly hydrophobic amino acids. In this common region the pattern of conserved amino acids suggests the presence of a beta-alpha fold as it occurs in ribosomal proteins L12 and L30. Furthermore, several potential cases of homology to other ribosomal components of the three ur-kingdoms have been found.

Orsay virus utilizes ribosomal frameshifting to express a novel protein that is incorporated into virions

Energy Technology Data Exchange (ETDEWEB)

Jiang, Hongbing; Franz, Carl J.; Wu, Guang; Renshaw, Hilary; Zhao, Guoyan [Departments of Molecular Microbiology and Pathology and Immunology, Washington University in St. Louis School of Medicine, St. Louis, MO 63110 (United States); Firth, Andrew E. [Department of Pathology, University of Cambridge, Cambridge CB2 1QP (United Kingdom); Wang, David, E-mail: davewang@borcim.wustl.edu [Departments of Molecular Microbiology and Pathology and Immunology, Washington University in St. Louis School of Medicine, St. Louis, MO 63110 (United States)

2014-02-15

Orsay virus is the first identified virus that is capable of naturally infecting Caenorhabditis elegans. Although it is most closely related to nodaviruses, Orsay virus differs from nodaviruses in its genome organization. In particular, the Orsay virus RNA2 segment encodes a putative novel protein of unknown function, termed delta, which is absent from all known nodaviruses. Here we present evidence that Orsay virus utilizes a ribosomal frameshifting strategy to express a novel fusion protein from the viral capsid (alpha) and delta ORFs. Moreover, the fusion protein was detected in purified virus fractions, demonstrating that it is most likely incorporated into Orsay virions. Furthermore, N-terminal sequencing of both the fusion protein and the capsid protein demonstrated that these proteins must be translated from a non-canonical initiation site. While the function of the alpha–delta fusion remains cryptic, these studies provide novel insights into the fundamental properties of this new clade of viruses. - Highlights: • Orsay virus encodes a novel fusion protein by a ribosomal frameshifting mechanism. • Orsay capsid and fusion protein is translated from a non-canonical initiation site. • The fusion protein is likely incorporated into Orsay virions.

Distribution of tubulin, kinesin, and dynein in light- and dark-adapted octopus retinas.

Science.gov (United States)

Martinez, J M; Elfarissi, H; De Velasco, B; Ochoa, G H; Miller, A M; Clark, Y M; Matsumoto, B; Robles, L J

2000-01-01

Cephalopod retinas exhibit several responses to light and dark adaptation, including rhabdom size changes, photopigment movements, and pigment granule migration. Light- and dark-directed rearrangements of microfilament and microtubule cytoskeletal transport pathways could drive these changes. Recently, we localized actin-binding proteins in light-/dark-adapted octopus rhabdoms and suggested that actin cytoskeletal rearrangements bring about the formation and degradation of rhabdomere microvilli subsets. To determine if the microtubule cytoskeleton and associated motor proteins control the other light/dark changes, we used immunoblotting and immunocytochemical procedures to map the distribution of tubulin, kinesin, and dynein in dorsal and ventral halves of light- and dark-adapted octopus retinas. Immunoblots detected alpha- and beta-tubulin, dynein intermediate chain, and kinesin heavy chain in extracts of whole retinas. Epifluorescence and confocal microscopy showed that the tubulin proteins were distributed throughout the retina with more immunoreactivity in retinas exposed to light. Kinesin localization was heavy in the pigment layer of light- and dark-adapted ventral retinas but was less prominent in the dorsal region. Dynein distribution also varied in dorsal and ventral retinas with more immunoreactivity in light- and dark-adapted ventral retinas and confocal microscopy emphasized the granular nature of this labeling. We suggest that light may regulate the distribution of microtubule cytoskeletal proteins in the octopus retina and that position, dorsal versus ventral, also influences the distribution of motor proteins. The microtubule cytoskeleton is most likely involved in pigment granule migration in the light and dark and with the movement of transport vesicles from the photoreceptor inner segments to the rhabdoms.

Primary structure of the. cap alpha. -subunit of Na/sup +/, K/sup +/-ATPase. II. Isolation, reverse transcription, and cloning of messenger RNA

Energy Technology Data Exchange (ETDEWEB)

Petrukhin, K.E.; Broude, N.E.; Arsenyan, S.G.; Grishin, A.V.; Dzhandzhugazyan, K.N.; Modyanov, N.N.

1986-10-01

The messenger RNA coding the ..cap alpha..-subunit of Na/sup +/,K/sup +/-ATPase has been isolated from the outer medullary layer of porcine kidneys. The mRNA gives a specific hybridization band in the 25S-26S region with three oligonucleotide probes synthesized on the basis of information on the structure of three peptides isolated from a tryptic hydrolyzate of the ..cap alpha..-subunit of Na/sup +/,K/sup +/-ATPase. The translation of the mRNA in Xenopus laevis oocytes followed by immunochemical identification of the products of synthesis confirmed the presence of the mRNA of the ..cap alpha..-subunit of Na/sup +/,K/sup +/-ATPase in an enriched fraction of poly(A/sup +/)-RNA. This preparation has been used for the synthesis of cloning of double-stranded cDNA.

A gene encoding the major beta tubulin of the mitotic spindle in Physarum polycephalum plasmodia

Energy Technology Data Exchange (ETDEWEB)

Burland, T.G.; Paul, E.C.A.; Oetliker, M.; Dove, W.F.

1988-03-01

The multinucleate plasmodium of Physarum polycephalum is unusual among eucaryotic cells in that it uses tubulins only in mitotic-spindle microtubules; cytoskeletal, flagellar, and centriolar microtubules are absent in this cell type. The authors identified a ..beta..-tubulin cDNA clone, ..beta..105, which is shown to correspond to the transcript of the betC ..beta..-tubulin locus and to encode ..beta..2 tubulin, the ..beta.. tubulin expressed specifically in the plasmodium and used exclusively in the mitotic spindle. Physarum amoebae utilize tubulins in the cytoskeleton, centrioles, and flagella, in addition to the mitotic spindle. Sequence analysis shows that ..beta..2 tubulin is only 83% identical to the two ..beta.. tubulins expressed in amoebae. This compares with 70 to 83% identity between Physarum ..beta..2 tubulin and the ..beta.. tubulins of yeasts, fungi, alga, trypanosome, fruit fly, chicken, and mouse. On the other hand, Physarum ..beta..2 tubulin is no more similar to, for example, Aspergillus ..beta.. tubulins than it is to those of Drosophila melanogaster or mammals. Several eucaryotes express at least one widely diverged ..beta.. tubulin as well as one or more ..beta.. tubulins that conform more closely to a consensus ..beta..-tubulin sequence. The authors suggest that ..beta..-tubulins diverge more when their expression pattern is restricted, especially when this restriction results in their use in fewer functions. This divergence among ..beta.. tubulins could have resulted through neutral drift. For example, exclusive use of Physarum ..beta..2 tubulin in the spindle may have allowed more amino acid substitutions than would be functionally tolerable in the ..beta.. tubulins that are utilized in multiple microtubular organelles. Alternatively, restricted use of ..beta.. tubulins may allow positive selection to operate more freely to refine ..beta..-tubulin function.

Tubulin posttranslational modifications induced by cadmium in the sponge Clathrina clathrus

Energy Technology Data Exchange (ETDEWEB)

Ledda, F.D., E-mail: f.ledda@hotmail.it [Dipartimento di Scienze della Terra, dell’Ambiente e della Vita (DISTAV), Università di Genova, Corso Europa 26, I-16132 Genova (Italy); Dipartimento di Scienze della Natura e del Territorio (DIPNET), Università di Sassari, Via Muroni 25, I-07100 Sassari (Italy); Ramoino, P. [Dipartimento di Scienze della Terra, dell’Ambiente e della Vita (DISTAV), Università di Genova, Corso Europa 26, I-16132 Genova (Italy); Ravera, S. [Dipartimento di Farmacia (DIFAR), Viale Cembrano 4, I-16147 Genova (Italy); Perino, E. [Dipartimento di Scienze della Terra, dell’Ambiente e della Vita (DISTAV), Università di Genova, Corso Europa 26, I-16132 Genova (Italy); Bianchini, P. [Istituto Italiano di Tecnologia (IIT), Dipartimento di Nanofisica, Via Morego 30, I-16163 Genova (Italy); Diaspro, A. [Istituto Italiano di Tecnologia (IIT), Dipartimento di Nanofisica, Via Morego 30, I-16163 Genova (Italy); Dipartimento di Fisica (DIFI), Università di Genova, Via Dodecaneso 33, I-16146 Genova (Italy); Gallus, L.; Pronzato, R. [Dipartimento di Scienze della Terra, dell’Ambiente e della Vita (DISTAV), Università di Genova, Corso Europa 26, I-16132 Genova (Italy); Manconi, R. [Dipartimento di Scienze della Natura e del Territorio (DIPNET), Università di Sassari, Via Muroni 25, I-07100 Sassari (Italy)

2013-09-15

Highlights: •The effect of Cd{sup 2+} on Clathrina clathrus microtubule network was studied. •Cd{sup 2+} exposure increases acetylated and detyrosinated α-tubulin levels. •Microtubules enriched in acetylated/detyrosinated α-tubulin were resistant to cold. •Clathrina clathrus exposed to Cd{sup 2+} showed cytoplasmic microtubules with an enhanced stability. -- Abstract: As sessile filter feeders, sponges are exposed to environmental stress due to pollutants of both anthropogenic and natural origins and are able to accumulate harmful substances. Thus, sponges are considered a good tool for the biomonitoring of coastal areas. In this study, we used biochemical and immunocytochemical analyses to provide new data on the cadmium-related changes in sponge cells. In particular, we analyzed the effects of different concentrations of cadmium on the microtubule network in the calcisponge Clathrina clathrus. Quantitative densitometry of the immunoblots showed that, while the levels of α- and β-tubulin remained relatively constant in C. clathrus when exposed to 1 and 5 μM CdCl{sub 2}, there were progressive shifts in the levels of some tubulin isoforms. Exposure for 24 h to sublethal concentrations of cadmium reduced the level of tyrosinated α-tubulin and enhanced the levels of acetylated and detyrosinated α-tubulin relative to the levels in controls. Confocal microscopy analysis of immunolabeled tissue sections showed that the inhibitory effect of cadmium was associated with a decrease in the labeling of the cells with a monoclonal antibody that recognizes tyrosinated α-tubulin. By contrast, the reactivity with a monoclonal antibody that recognizes acetylated α-tubulin and with a polyclonal antibody specific for detyrosinated α-tubulin was enhanced at the same time points. Because the acetylation and detyrosination of α-tubulin occur on stable microtubules, the marked enhancement of α-tubulin acetylation and detyrosination in Cd{sup 2+}-treated cells

RINT-1 interacts with MSP58 within nucleoli and plays a role in ribosomal gene transcription

International Nuclear Information System (INIS)

Yang, Chuan-Pin; Kuo, Yu-Liang; Lee, Yi-Chao; Lee, Kuen-Haur; Chiang, Chi-Wu; Wang, Ju-Ming; Hsu, Che-Chia

2016-01-01

The nucleolus is the cellular site of ribosomal (r)DNA transcription and ribosome biogenesis. The 58-kDa microspherule protein (MSP58) is a nucleolar protein involved in rDNA transcription and cell proliferation. However, regulation of MSP58-mediated rDNA transcription remains unknown. Using a yeast two-hybrid system with MSP58 as bait, we isolated complementary (c)DNA encoding Rad50-interacting protein 1 (RINT-1), as a MSP58-binding protein. RINT-1 was implicated in the cell cycle checkpoint, membrane trafficking, Golgi apparatus and centrosome dynamic integrity, and telomere length control. Both in vitro and in vivo interaction assays showed that MSP58 directly interacts with RINT-1. Interestingly, microscopic studies revealed the co-localization of MSP58, RINT-1, and the upstream binding factor (UBF), a rRNA transcription factor, in the nucleolus. We showed that ectopic expression of MSP58 or RINT-1 resulted in decreased rRNA expression and rDNA promoter activity, whereas knockdown of MSP58 or RINT-1 by siRNA exerted the opposite effect. Coexpression of MSP58 and RINT-1 robustly decreased rRNA synthesis compared to overexpression of either protein alone, whereas depletion of RINT-1 from MSP58-transfected cells enhanced rRNA synthesis. We also found that MSP58, RINT-1, and the UBF were associated with the rDNA promoter using a chromatin immunoprecipitation assay. Because aberrant ribosome biogenesis contributes to neoplastic transformation, our results revealed a novel protein complex involved in the regulation of rRNA gene expression, suggesting a role for MSP58 and RINT-1 in cancer development. - Highlights: • RINT-1 is a novel MSP58-interacting protein. • RINT-1 is a nucleolar protein that suppresses ribosomal RNA gene transcription. • RINT-1 and MSP58 cooperate to suppress ribosomal RNA gene transcription. • RINT-1, MSP58, and UBF form a complex on the rDNA promoter.

Detection of protein-protein interactions by ribosome display and protein in situ immobilisation.

Science.gov (United States)

He, Mingyue; Liu, Hong; Turner, Martin; Taussig, Michael J

2009-12-31

We describe a method for identification of protein-protein interactions by combining two cell-free protein technologies, namely ribosome display and protein in situ immobilisation. The method requires only PCR fragments as the starting material, the target proteins being made through cell-free protein synthesis, either associated with their encoding mRNA as ribosome complexes or immobilised on a solid surface. The use of ribosome complexes allows identification of interacting protein partners from their attached coding mRNA. To demonstrate the procedures, we have employed the lymphocyte signalling proteins Vav1 and Grb2 and confirmed the interaction between Grb2 and the N-terminal SH3 domain of Vav1. The method has promise for library screening of pairwise protein interactions, down to the analytical level of individual domain or motif mapping.

Chromosomal organization of the ribosomal RNA genes in the genus Chironomus (Diptera, Chironomidae

Directory of Open Access Journals (Sweden)

Larisa Gunderina

2015-05-01

Full Text Available Chromosomal localization of ribosomal RNA coding genes has been studied by using FISH (fluorescence in situ hybridization in 21 species from the genus Chironomus Meigen, 1803. Analysis of the data has shown intra- and interspecific variation in number and location of 5.8S rDNA hybridization sites in 17 species from the subgenus Chironomus and 4 species from the subgenus Camptochironomus Kieffer, 1914. In the majority of studied species the location of rDNA sites coincided with the sites where active NORs (nucleolus organizer regions were found. The number of hybridization sites in karyotypes of studied chironomids varied from 1 to 6. More than half of the species possessed only one NOR (12 out of 21. Two rDNA hybridization sites were found in karyotypes of five species, three – in two species, and five and six sites – in one species each. NORs were found in all chromosomal arms of species from the subgenus Chironomus with one of them always located on arm G. On the other hand, no hybridization sites were found on arm G in four studied species from the subgenus Camptochironomus. Two species from the subgenus Chironomus – Ch. balatonicus Devai, Wuelker & Scholl, 1983 and Ch. “annularius” sensu Strenzke, 1959 – showed intraspecific variability in the number of hybridization signals. Possible mechanisms of origin of variability in number and location of rRNA genes in the karyotypes of species from the genus Chironomus are discussed.

Stability of the 'L12 stalk' in ribosomes from mesophilic and (hyper)thermophilic Archaea and Bacteria.

Science.gov (United States)

Shcherbakov, D; Dontsova, M; Tribus, M; Garber, M; Piendl, W

2006-01-01

The ribosomal stalk complex, consisting of one molecule of L10 and four or six molecules of L12, is attached to 23S rRNA via protein L10. This complex forms the so-called 'L12 stalk' on the 50S ribosomal subunit. Ribosomal protein L11 binds to the same region of 23S rRNA and is located at the base of the 'L12 stalk'. The 'L12 stalk' plays a key role in the interaction of the ribosome with translation factors. In this study stalk complexes from mesophilic and (hyper)thermophilic species of the archaeal genus Methanococcus and from the Archaeon Sulfolobus solfataricus, as well as from the Bacteria Escherichia coli, Geobacillus stearothermophilus and Thermus thermophilus, were overproduced in E.coli and purified under non-denaturing conditions. Using filter-binding assays the affinities of the archaeal and bacterial complexes to their specific 23S rRNA target site were analyzed at different pH, ionic strength and temperature. Affinities of both archaeal and bacterial complexes for 23S rRNA vary by more than two orders of magnitude, correlating very well with the growth temperatures of the organisms. A cooperative effect of binding to 23S rRNA of protein L11 and the L10/L12(4) complex from mesophilic and thermophilic Archaea was shown to be temperature-dependent.

A dominant mutation of TWISTED DWARF 1 encoding an alpha-tubulin protein causes severe dwarfism and right helical growth in rice.

Science.gov (United States)

Sunohara, Hidehiko; Kawai, Takayuki; Shimizu-Sato, Sae; Sato, Yutaka; Sato, Kanna; Kitano, Hidemi

2009-06-01

Dwarfism is a common type of mutation in many plant species. The pathways and factors regulating biosynthesis and signaling of several plant growth regulators have been clarified through analyses of dwarf mutants in rice, Arabidopsis, pea, and maize. However, the genetic mechanisms controlling dwarfism are not well characterized, and the causal genes underlying most dwarf mutants are still uncovered. Here, we report a dominant mutant, Twisted dwarf 1-1 (Tid1-1), showing dwarfism and twisted growth in rice. Tid1-1 exhibit right helical growth of the leaves and stem and shortening of the roots. They also show an increased number of cells in the shoot apical meristem. Cells in the leaves of Tid1-1 are often ill-shapen, possibly owing to irregular cell division. Cell elongation in roots is suppressed in the elongation zone, and cells in the root apical meristem are enlarged. Map-based cloning of TID1 revealed that it encodes an alpha-tubulin protein comprising microtubules and is an ortholog of Arabidopsis LEFTY genes. Our analysis of the Tid1-1 mutant revealed that the dynamics of microtubules affects not only anisotropic growth in both dicots and monocots, but also meristematic activity and gross plant morphology.

The Complete Structure of the Mycobacterium smegmatis 70S Ribosome

Directory of Open Access Journals (Sweden)

Jendrik Hentschel

2017-07-01

Full Text Available The ribosome carries out the synthesis of proteins in every living cell. It consequently represents a frontline target in anti-microbial therapy. Tuberculosis ranks among the leading causes of death worldwide, due in large part to the combination of difficult-to-treat latency and antibiotic resistance. Here, we present the 3.3-Å cryo-EM structure of the 70S ribosome of Mycobacterium smegmatis, a close relative to the human pathogen Mycobacterium tuberculosis. The structure reveals two additional ribosomal proteins and localizes them to the vicinity of drug-target sites in both the catalytic center and the decoding site of the ribosome. Furthermore, we visualized actinobacterium-specific rRNA and protein expansions that extensively remodel the ribosomal surface with implications for polysome organization. Our results provide a foundation for understanding the idiosyncrasies of mycobacterial translation and reveal atomic details of the structure that will facilitate the design of anti-tubercular therapeutics.

The Complete Structure of the Mycobacterium smegmatis 70S Ribosome.

Science.gov (United States)

Hentschel, Jendrik; Burnside, Chloe; Mignot, Ingrid; Leibundgut, Marc; Boehringer, Daniel; Ban, Nenad

2017-07-05

The ribosome carries out the synthesis of proteins in every living cell. It consequently represents a frontline target in anti-microbial therapy. Tuberculosis ranks among the leading causes of death worldwide, due in large part to the combination of difficult-to-treat latency and antibiotic resistance. Here, we present the 3.3-Å cryo-EM structure of the 70S ribosome of Mycobacterium smegmatis, a close relative to the human pathogen Mycobacterium tuberculosis. The structure reveals two additional ribosomal proteins and localizes them to the vicinity of drug-target sites in both the catalytic center and the decoding site of the ribosome. Furthermore, we visualized actinobacterium-specific rRNA and protein expansions that extensively remodel the ribosomal surface with implications for polysome organization. Our results provide a foundation for understanding the idiosyncrasies of mycobacterial translation and reveal atomic details of the structure that will facilitate the design of anti-tubercular therapeutics. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

Loss of tumorigenic potential by human lung tumor cells in the presence of antisense RNA specific to the ectopically synthesized alpha subunit of human chorionic gonadotropin.

Science.gov (United States)

Rivera, R T; Pasion, S G; Wong, D T; Fei, Y B; Biswas, D K

1989-06-01

A clonal strain of human lung tumor cells in culture (ChaGo), derived from a bronchogenic carcinoma, synthesizes and secretes large amounts of alpha (alpha) and a comparatively lower level of beta (beta) subunit of the glycoprotein hormone, human chorionic gonadotropin (HCG). ChaGo cells lost their characteristic anchorage-independent growth phenotype in the presence of anti-alpha-HCG antibody. The effect of the antibody was partially reversed by addition of alpha-HCG to the culture medium. ChaGo cells were transfected with an expression vector (pRSV-anti-alpha-HCG), that directs synthesis of RNA complementary to alpha-HCG mRNA. The transfectants produced alpha-HCG antisense RNA which was associated with the reduced level of alpha-HCG. Transfectants also displayed several altered phenotypic properties, including altered morphology, less mitosis, reduced growth rate, loss of anchorage-independent growth, and loss of tumorigenicity in nude mice. Treatment of transfectants with 8,bromo-cAMP resulted in increased accumulation of alpha-HCG mRNA, no change in the level of alpha-HCG antisense RNA, release of the inhibition of [3H]thymidine incorporation, and restoration of anchorage-independent growth phenotype. The overexpression of c-myc, observed in ChaGo cells, was unaffected by the reduced level of alpha-HCG. These results suggest that ectopic synthesis of the alpha subunit of HCG plays a functional role in the transformation of these human lung cells.

The Structure of the RNA m5C Methyltransferase YebU from Escherichia coli Reveals a C-terminal RNA-recruiting PUA Domain

DEFF Research Database (Denmark)

Hallberg, B. Martin; Ericsson, Ulrika B.; Johnson, Kenneth A

2006-01-01

potential that differ from other RNA-MTase structures, suggesting that YebU interacts with its RNA target in a different manner. Docking of YebU onto the 30 S subunit indicates that the PUA and MTase domains make several contacts with 16 S rRNA as well as with the ribosomal protein S12. The ribosomal...... protein interactions would explain why the assembled 30 S subunit, and not naked 16 S rRNA, is the preferred substrate for YebU....... by X-ray crystallography, and we present a molecular model for how YebU specifically recognizes, binds and methylates its ribosomal substrate. The YebU protein has an N-terminal SAM-binding catalytic domain with structural similarity to the equivalent domains in several other m(5)C RNA MTases including...

CRM1 and its ribosome export adaptor NMD3 localize to the nucleolus and affect rRNA synthesis.

Science.gov (United States)

Bai, Baoyan; Moore, Henna M; Laiho, Marikki

2013-01-01

CRM1 is an export factor that together with its adaptor NMD3 transports numerous cargo molecules from the nucleus to cytoplasm through the nuclear pore. Previous studies have suggested that CRM1 and NMD3 are detected in the nucleolus. However, their localization with subnucleolar domains or participation in the activities of the nucleolus are unclear. We demonstrate here biochemically and using imaging analyses that CRM1 and NMD3 co-localize with nucleolar marker proteins in the nucleolus. In particular, their nucleolar localization is markedly increased by inhibition of RNA polymerase I (Pol I) transcription by actinomycin D or by silencing Pol I catalytic subunit, RPA194. We show that CRM1 nucleolar localization is dependent on its activity and the expression of NMD3, whereas NMD3 nucleolar localization is independent of CRM1. This suggests that NMD3 provides nucleolar tethering of CRM1. While inhibition of CRM1 by leptomycin B inhibited processing of 28S ribosomal (r) RNA, depletion of NMD3 did not, suggesting that their effects on 28S rRNA processing are distinct. Markedly, depletion of NMD3 and inhibition of CRM1 reduced the rate of pre-47S rRNA synthesis. However, their inactivation did not lead to nucleolar disintegration, a hallmark of Pol I transcription stress, suggesting that they do not directly regulate transcription. These results indicate that CRM1 and NMD3 have complex functions in pathways that couple rRNA synthetic and processing engines and that the rRNA synthesis rate may be adjusted according to proficiency in rRNA processing and export.

Molecular phylogeny of diplomonads and enteromonads based on SSU rRNA, alpha-tubulin and HSP90 genes: Implications for the evolutionary history of the double karyomastigont of diplomonads

Directory of Open Access Journals (Sweden)

Roger Andrew J

2008-07-01

Full Text Available Abstract Background Fornicata is a relatively recently established group of protists that includes the diplokaryotic diplomonads (which have two similar nuclei per cell, and the monokaryotic enteromonads, retortamonads and Carpediemonas, with the more typical one nucleus per cell. The monophyly of the group was confirmed by molecular phylogenetic studies, but neither the internal phylogeny nor its position on the eukaryotic tree has been clearly resolved. Results Here we have introduced data for three genes (SSU rRNA, α-tubulin and HSP90 with a wide taxonomic sampling of Fornicata, including ten isolates of enteromonads, representing the genera Trimitus and Enteromonas, and a new undescribed enteromonad genus. The diplomonad sequences formed two main clades in individual gene and combined gene analyses, with Giardia (and Octomitus on one side of the basal divergence and Spironucleus, Hexamita and Trepomonas on the other. Contrary to earlier evolutionary scenarios, none of the studied enteromonads appeared basal to diplokaryotic diplomonads. Instead, the enteromonad isolates were all robustly situated within the second of the two diplomonad clades. Furthermore, our analyses suggested that enteromonads do not constitute a monophyletic group, and enteromonad monophyly was statistically rejected in 'approximately unbiased' tests of the combined gene data. Conclusion We suggest that all higher taxa intended to unite multiple enteromonad genera be abandoned, that Trimitus and Enteromonas be considered as part of Hexamitinae, and that the term 'enteromonads' be used in a strictly utilitarian sense. Our result suggests either that the diplokaryotic condition characteristic of diplomonads arose several times independently, or that the monokaryotic cell of enteromonads originated several times independently by secondary reduction from the diplokaryotic state. Both scenarios are evolutionarily complex. More comparative data on the similarity of the

Atomic resolution structure of cucurmosin, a novel type 1 ribosome-inactivating protein from the sarcocarp of Cucurbita moschata

Energy Technology Data Exchange (ETDEWEB)

Hou, Xiaomin; Meehan, Edward J.; Xie, Jieming; Huang, Mingdong; Chen, Minghuang; Chen, Liqing (UAH); (Fujian); (Chinese Aca. Sci.)

2008-10-27

A novel type 1 ribosome-inactivating protein (RIP) designated cucurmosin was isolated from the sarcocarp of Cucurbita moschata (pumpkin). Besides rRNA N-glycosidase activity, cucurmosin exhibits strong cytotoxicities to three cancer cell lines of both human and murine origins, but low toxicity to normal cells. Plant genomic DNA extracted from the tender leaves was amplified by PCR between primers based on the N-terminal sequence and X-ray sequence of the C-terminal. The complete mature protein sequence was obtained from N-terminal protein sequencing and partial DNA sequencing, confirmed by high resolution crystal structure analysis. The crystal structure of cucurmosin has been determined at 1.04 {angstrom}, a resolution that has never been achieved before for any RIP. The structure contains two domains: a large N-terminal domain composed of seven {alpha}-helices and eight {beta}-strands, and a smaller C-terminal domain consisting of three {alpha}-helices and two {beta}-strands. The high resolution structure established a glycosylation pattern of GlcNAc{sub 2}Man3Xyl. Asn225 was identified as a glycosylation site. Residues Tyr70, Tyr109, Glu158 and Arg161 define the active site of cucurmosin as an RNA N-glycosidase. The structural basis of cytotoxicity difference between cucurmosin and trichosanthin is discussed.

Cryo-EM structure of Hepatitis C virus IRES bound to the human ribosome at 3.9-Å resolution.

Science.gov (United States)

Quade, Nick; Boehringer, Daniel; Leibundgut, Marc; van den Heuvel, Joop; Ban, Nenad

2015-07-08

Hepatitis C virus (HCV), a widespread human pathogen, is dependent on a highly structured 5'-untranslated region of its mRNA, referred to as internal ribosome entry site (IRES), for the translation of all of its proteins. The HCV IRES initiates translation by directly binding to the small ribosomal subunit (40S), circumventing the need for many eukaryotic translation initiation factors required for mRNA scanning. Here we present the cryo-EM structure of the human 40S ribosomal subunit in complex with the HCV IRES at 3.9 Å resolution, determined by focused refinement of an 80S ribosome-HCV IRES complex. The structure reveals the molecular details of the interactions between the IRES and the 40S, showing that expansion segment 7 (ES7) of the 18S rRNA acts as a central anchor point for the HCV IRES. The structural data rationalizes previous biochemical and genetic evidence regarding the initiation mechanism of the HCV and other related IRESs.

Tubulin post-translational modifications in the primitive protist Trichomonas vaginalis.

Science.gov (United States)

Delgado-Viscogliosi, P; Brugerolle, G; Viscogliosi, E

1996-01-01

Using several specific monoclonal antibodies, we investigated the occurrence and distribution of different post-translationally modified tubulin during interphase and division of the primitive flagellated protist Trichomonas vaginalis. Immunoblotting and immunofluorescence experiments revealed that interphasic microtubular structures of T. vaginalis contained acetylated and glutamylated but non-tyrosinated and non-glycylated [Brugerolle and Adoutte, 1988: Bio Systems 21: 255-268] tubulin. Immunofluorescence studies performed on dividing cells showed that the extranuclear mitotic spindle (or paradesmosis) was acetylated and glutamylated, which contrast with the ephemeral nature of this structure. Newly formed short axostyles also contained acetylated and glutamylated tubulin suggesting that both post-translational modifications might take place very early after assembly of microtubular structures. Our results indicate that acetylation and glutamylation of tubulin appeared early in the history of eukaryotes and could reflect the occurrence of post-translational modifications of tubulin in the primitive eukaryotic cells. These cells probably had a highly ordered cross-linked microtubular cytoskeleton in which microtubules showed a low level of subunit exchange dynamics.

Disruption of Ttll5/stamp gene (tubulin tyrosine ligase-like protein 5/SRC-1 and TIF2-associated modulatory protein gene) in male mice causes sperm malformation and infertility.

Science.gov (United States)

Lee, Geun-Shik; He, Yuanzheng; Dougherty, Edward J; Jimenez-Movilla, Maria; Avella, Matteo; Grullon, Sean; Sharlin, David S; Guo, Chunhua; Blackford, John A; Awasthi, Smita; Zhang, Zhenhuan; Armstrong, Stephen P; London, Edra C; Chen, Weiping; Dean, Jurrien; Simons, S Stoney

2013-05-24

TTLL5/STAMP (tubulin tyrosine ligase-like family member 5) has multiple activities in cells. TTLL5 is one of 13 TTLLs, has polyglutamylation activity, augments the activity of p160 coactivators (SRC-1 and TIF2) in glucocorticoid receptor-regulated gene induction and repression, and displays steroid-independent growth activity with several cell types. To examine TTLL5/STAMP functions in whole animals, mice were prepared with an internal deletion that eliminated several activities of the Stamp gene. This mutation causes both reduced levels of STAMP mRNA and C-terminal truncation of STAMP protein. Homozygous targeted mutant (Stamp(tm/tm)) mice appear normal except for marked decreases in male fertility associated with defects in progressive sperm motility. Abnormal axonemal structures with loss of tubulin doublets occur in most Stamp(tm/tm) sperm tails in conjunction with substantial reduction in α-tubulin polyglutamylation, which closely correlates with the reduction in mutant STAMP mRNA. The axonemes in other structures appear unaffected. There is no obvious change in the organs for sperm development of WT versus Stamp(tm/tm) males despite the levels of WT STAMP mRNA in testes being 20-fold higher than in any other organ examined. This defect in male fertility is unrelated to other Ttll genes or 24 genes previously identified as important for sperm function. Thus, STAMP appears to participate in a unique, tissue-selective TTLL-mediated pathway for α-tubulin polyglutamylation that is required for sperm maturation and motility and may be relevant for male fertility.

Disruption of Ttll5/Stamp Gene (Tubulin Tyrosine Ligase-like Protein 5/SRC-1 and TIF2-associated Modulatory Protein Gene) in Male Mice Causes Sperm Malformation and Infertility*

Science.gov (United States)

Lee, Geun-Shik; He, Yuanzheng; Dougherty, Edward J.; Jimenez-Movilla, Maria; Avella, Matteo; Grullon, Sean; Sharlin, David S.; Guo, Chunhua; Blackford, John A.; Awasthi, Smita; Zhang, Zhenhuan; Armstrong, Stephen P.; London, Edra C.; Chen, Weiping; Dean, Jurrien; Simons, S. Stoney

2013-01-01

TTLL5/STAMP (tubulin tyrosine ligase-like family member 5) has multiple activities in cells. TTLL5 is one of 13 TTLLs, has polyglutamylation activity, augments the activity of p160 coactivators (SRC-1 and TIF2) in glucocorticoid receptor-regulated gene induction and repression, and displays steroid-independent growth activity with several cell types. To examine TTLL5/STAMP functions in whole animals, mice were prepared with an internal deletion that eliminated several activities of the Stamp gene. This mutation causes both reduced levels of STAMP mRNA and C-terminal truncation of STAMP protein. Homozygous targeted mutant (Stamptm/tm) mice appear normal except for marked decreases in male fertility associated with defects in progressive sperm motility. Abnormal axonemal structures with loss of tubulin doublets occur in most Stamptm/tm sperm tails in conjunction with substantial reduction in α-tubulin polyglutamylation, which closely correlates with the reduction in mutant STAMP mRNA. The axonemes in other structures appear unaffected. There is no obvious change in the organs for sperm development of WT versus Stamptm/tm males despite the levels of WT STAMP mRNA in testes being 20-fold higher than in any other organ examined. This defect in male fertility is unrelated to other Ttll genes or 24 genes previously identified as important for sperm function. Thus, STAMP appears to participate in a unique, tissue-selective TTLL-mediated pathway for α-tubulin polyglutamylation that is required for sperm maturation and motility and may be relevant for male fertility. PMID:23558686

The effect of tRNA levels on decoding times of mRNA codons.

Science.gov (United States)

Dana, Alexandra; Tuller, Tamir

2014-08-01

The possible effect of transfer ribonucleic acid (tRNA) concentrations on codons decoding time is a fundamental biomedical research question; however, due to a large number of variables affecting this process and the non-direct relation between them, a conclusive answer to this question has eluded so far researchers in the field. In this study, we perform a novel analysis of the ribosome profiling data of four organisms which enables ranking the decoding times of different codons while filtering translational phenomena such as experimental biases, extreme ribosomal pauses and ribosome traffic jams. Based on this filtering, we show for the first time that there is a significant correlation between tRNA concentrations and the codons estimated decoding time both in prokaryotes and in eukaryotes in natural conditions (-0.38 to -0.66, all P values decoding times are not correlated with aminoacyl-tRNA levels. The reported results support the conjecture that translation efficiency is directly influenced by the tRNA levels in the cell. Thus, they should help to understand the evolution of synonymous aspects of coding sequences via the adaptation of their codons to the tRNA pool. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

The complete structure of the chloroplast 70S ribosome in complex with translation factor pY.

Science.gov (United States)

Bieri, Philipp; Leibundgut, Marc; Saurer, Martin; Boehringer, Daniel; Ban, Nenad

2017-02-15

Chloroplasts are cellular organelles of plants and algae that are responsible for energy conversion and carbon fixation by the photosynthetic reaction. As a consequence of their endosymbiotic origin, they still contain their own genome and the machinery for protein biosynthesis. Here, we present the atomic structure of the chloroplast 70S ribosome prepared from spinach leaves and resolved by cryo-EM at 3.4 Å resolution. The complete structure reveals the features of the 4.5S rRNA, which probably evolved by the fragmentation of the 23S rRNA, and all five plastid-specific ribosomal proteins. These proteins, required for proper assembly and function of the chloroplast translation machinery, bind and stabilize rRNA including regions that only exist in the chloroplast ribosome. Furthermore, the structure reveals plastid-specific extensions of ribosomal proteins that extensively remodel the mRNA entry and exit site on the small subunit as well as the polypeptide tunnel exit and the putative binding site of the signal recognition particle on the large subunit. The translation factor pY, involved in light- and temperature-dependent control of protein synthesis, is bound to the mRNA channel of the small subunit and interacts with 16S rRNA nucleotides at the A-site and P-site, where it protects the decoding centre and inhibits translation by preventing tRNA binding. The small subunit is locked by pY in a non-rotated state, in which the intersubunit bridges to the large subunit are stabilized. © 2016 The Authors. Published under the terms of the CC BY NC ND 4.0 license.

TruSeq Stranded mRNA and Total RNA Sample Preparation Kits

Science.gov (United States)

Total RNA-Seq enabled by ribosomal RNA (rRNA) reduction is compatible with formalin-fixed paraffin embedded (FFPE) samples, which contain potentially critical biological information. The family of TruSeq Stranded Total RNA sample preparation kits provides a unique combination of unmatched data quality for both mRNA and whole-transcriptome analyses, robust interrogation of both standard and low-quality samples and workflows compatible with a wide range of study designs.

Resistance to the peptidyl transferase inhibitor tiamulin caused by mutation of ribosomal protein l3.

Science.gov (United States)

Bøsling, Jacob; Poulsen, Susan M; Vester, Birte; Long, Katherine S

2003-09-01

The antibiotic tiamulin targets the 50S subunit of the bacterial ribosome and interacts at the peptidyl transferase center. Tiamulin-resistant Escherichia coli mutants were isolated in order to elucidate mechanisms of resistance to the drug. No mutations in the rRNA were selected as resistance determinants using a strain expressing only a plasmid-encoded rRNA operon. Selection in a strain with all seven chromosomal rRNA operons yielded a mutant with an A445G mutation in the gene coding for ribosomal protein L3, resulting in an Asn149Asp alteration. Complementation experiments and sequencing of transductants demonstrate that the mutation is responsible for the resistance phenotype. Chemical footprinting experiments show a reduced binding of tiamulin to mutant ribosomes. It is inferred that the L3 mutation, which points into the peptidyl transferase cleft, causes tiamulin resistance by alteration of the drug-binding site. This is the first report of a mechanism of resistance to tiamulin unveiled in molecular detail.

Comparison of preribosomal RNA processing pathways in yeast, plant and human cells - focus on coordinated action of endo- and exoribonucleases.

Science.gov (United States)

Tomecki, Rafal; Sikorski, Pawel J; Zakrzewska-Placzek, Monika

2017-07-01

Proper regulation of ribosome biosynthesis is mandatory for cellular adaptation, growth and proliferation. Ribosome biogenesis is the most energetically demanding cellular process, which requires tight control. Abnormalities in ribosome production have severe consequences, including developmental defects in plants and genetic diseases (ribosomopathies) in humans. One of the processes occurring during eukaryotic ribosome biogenesis is processing of the ribosomal RNA precursor molecule (pre-rRNA), synthesized by RNA polymerase I, into mature rRNAs. It must not only be accurate but must also be precisely coordinated with other phenomena leading to the synthesis of functional ribosomes: RNA modification, RNA folding, assembly with ribosomal proteins and nucleocytoplasmic RNP export. A multitude of ribosome biogenesis factors ensure that these events take place in a correct temporal order. Among them are endo- and exoribonucleases involved in pre-rRNA processing. Here, we thoroughly present a wide spectrum of ribonucleases participating in rRNA maturation, focusing on their biochemical properties, regulatory mechanisms and substrate specificity. We also discuss cooperation between various ribonucleolytic activities in particular stages of pre-rRNA processing, delineating major similarities and differences between three representative groups of eukaryotes: yeast, plants and humans. © 2017 Federation of European Biochemical Societies.

Tubulin Inhibitor-Based Antibody-Drug Conjugates for Cancer Therapy

Directory of Open Access Journals (Sweden)

Hao Chen

2017-08-01

Full Text Available Antibody-drug conjugates (ADCs are a class of highly potent biopharmaceutical drugs generated by conjugating cytotoxic drugs with specific monoclonal antibodies through appropriate linkers. Specific antibodies used to guide potent warheads to tumor tissues can effectively reduce undesired side effects of the cytotoxic drugs. An in-depth understanding of antibodies, linkers, conjugation strategies, cytotoxic drugs, and their molecular targets has led to the successful development of several approved ADCs. These ADCs are powerful therapeutics for cancer treatment, enabling wider therapeutic windows, improved pharmacokinetic/pharmacodynamic properties, and enhanced efficacy. Since tubulin inhibitors are one of the most successful cytotoxic drugs in the ADC armamentarium, this review focuses on the progress in tubulin inhibitor-based ADCs, as well as lessons learned from the unsuccessful ADCs containing tubulin inhibitors. This review should be helpful to facilitate future development of new generations of tubulin inhibitor-based ADCs for cancer therapy.

Identification of a 48 kDa tubulin or tubulin-like C6/36 mosquito cells protein that binds dengue virus 2 using mass spectrometry

International Nuclear Information System (INIS)

Chee, H.-Y.; AbuBakar, Sazaly

2004-01-01

Binding of dengue virus 2 (DENV-2) to C6/36 mosquito cells protein was investigated. A 48 kDa DENV-2-binding C6/36 cells protein (D2BP) was detected in a virus overlay protein-binding assay. The binding occurred only to the C6/36 cells cytosolic protein fraction and it was inhibited by free D2BP. D2BP was shown to bind to DENV-2 E in the far-Western-binding studies and using mass spectrometry (MS) and MS/MS, peptide masses of the D2BP that matched to β-tubulin and α-tubulin chains were identified. These findings suggest that DENV-2 through DENV-2 E binds directly to a 48 kDa tubulin or tubulin-like protein of C6/36 mosquito cells

Morpholino spin-labeling for base-pair sequencing of a 3'-terminal RNA stem by proton homonuclear Overhauser enhancements: yeast ribosomal 5S RNA

International Nuclear Information System (INIS)

Lee, K.M.; Marshall, A.G.

1987-01-01

Base-pair sequences for 5S and 5.8S RNAs are not readily extracted from proton homonuclear nuclear Overhauser enhancement (NOE) connectivity experiments alone, due to extensive peak overlap in the downfield (11-15 ppm) proton NMR spectrum. In this paper, we introduce a new method for base-pair proton peak assignment for ribosomal RNAs, based upon the distance-dependent broadening of the resonances of base-pair protons spatially proximal to a paramagnetic group. Introduction of a nitroxide spin-label covalently attached to the 3'-terminal ribose provides an unequivocal starting point for base-pair hydrogen-bond proton NMR assignment. Subsequent NOE connectivities then establish the base-pair sequence for the terminal stem of a 5S RNA. Periodate oxidation of yeast 5S RNA, followed by reaction with 4-amino-2,2,6,6-tetramethylpiperidinyl-1-oxy (TEMPO-NH2) and sodium borohydride reduction, produces yeast 5S RNA specifically labeled with a paramagnetic nitroxide group at the 3'-terminal ribose. Comparison of the 500-MHz 1H NMR spectra of native and 3'-terminal spin-labeled yeast 5S RNA serves to identify the terminal base pair (G1 . C120) and its adjacent base pair (G2 . U119) on the basis of their proximity to the 3'-terminal spin-label. From that starting point, we have then identified (G . C, A . U, or G . U) and sequenced eight of the nine base pairs in the terminal helix via primary and secondary NOE's

Translation activity of chimeric ribosomes composed of Escherichia coli and Bacillus subtilis or Geobacillus stearothermophilus subunits

Directory of Open Access Journals (Sweden)

Sayaka Tsuji

2017-07-01

Full Text Available Ribosome composition, consisting of rRNA and ribosomal proteins, is highly conserved among a broad range of organisms. However, biochemical studies focusing on ribosomal subunit exchangeability between organisms remain limited. In this study, we show that chimeric ribosomes, composed of Escherichia coli and Bacillus subtilis or E. coli and Geobacillus stearothermophilus subunits, are active for β-galactosidase translation in a highly purified E. coli translation system. Activities of the chimeric ribosomes showed only a modest decrease when using E. coli 30 S subunits, indicating functional conservation of the 50 S subunit between these bacterial species.

Regular endurance training reduces the exercise induced HIF-1alpha and HIF-2alpha mRNA expression in human skeletal muscle in normoxic conditions

DEFF Research Database (Denmark)

Lundby, Carsten; Gassmann, Max; Pilegaard, Henriette

2005-01-01

and 2 (HIFs) are clearly related heterodimeric transcription factors that consist of an oxygen-depended alpha-subunit and a constitutive beta-subunit. With hypoxic exposure, HIF-1alpha and HIF-2alpha protein are stabilized. Upon heterodimerization, HIFs induce the transcription of a variety of genes......Regular exercise induces a variety of adaptive responses that enhance the oxidative and metabolic capacity of human skeletal muscle. Although the physiological adjustments of regular exercise have been known for decades, the underlying mechanisms are still unclear. The hypoxia inducible factors 1...... including erythropoietin (EPO), transferrin and its receptor, as well as vascular endothelial growth factor (VEGF) and its receptor. Considering that several of these genes are also induced with exercise, we tested the hypothesis that the mRNA level of HIF-1alpha and HIF-2alpha subunits increases...

Initiation of translation in bacteria by a structured eukaryotic IRES RNA.

Science.gov (United States)

Colussi, Timothy M; Costantino, David A; Zhu, Jianyu; Donohue, John Paul; Korostelev, Andrei A; Jaafar, Zane A; Plank, Terra-Dawn M; Noller, Harry F; Kieft, Jeffrey S

2015-03-05

The central dogma of gene expression (DNA to RNA to protein) is universal, but in different domains of life there are fundamental mechanistic differences within this pathway. For example, the canonical molecular signals used to initiate protein synthesis in bacteria and eukaryotes are mutually exclusive. However, the core structures and conformational dynamics of ribosomes that are responsible for the translation steps that take place after initiation are ancient and conserved across the domains of life. We wanted to explore whether an undiscovered RNA-based signal might be able to use these conserved features, bypassing mechanisms specific to each domain of life, and initiate protein synthesis in both bacteria and eukaryotes. Although structured internal ribosome entry site (IRES) RNAs can manipulate ribosomes to initiate translation in eukaryotic cells, an analogous RNA structure-based mechanism has not been observed in bacteria. Here we report our discovery that a eukaryotic viral IRES can initiate translation in live bacteria. We solved the crystal structure of this IRES bound to a bacterial ribosome to 3.8 Å resolution, revealing that despite differences between bacterial and eukaryotic ribosomes this IRES binds directly to both and occupies the space normally used by transfer RNAs. Initiation in both bacteria and eukaryotes depends on the structure of the IRES RNA, but in bacteria this RNA uses a different mechanism that includes a form of ribosome repositioning after initial recruitment. This IRES RNA bridges billions of years of evolutionary divergence and provides an example of an RNA structure-based translation initiation signal capable of operating in two domains of life.

Increased 5S rRNA oxidation in Alzheimer's disease.

Science.gov (United States)

Ding, Qunxing; Zhu, Haiyan; Zhang, Bing; Soriano, Augusto; Burns, Roxanne; Markesbery, William R

2012-01-01

It is widely accepted that oxidative stress is involved in neurodegenerative disorders such as Alzheimer's disease (AD). Ribosomal RNA (rRNA) is one of the most abundant molecules in most cells and is affected by oxidative stress in the human brain. Previous data have indicated that total rRNA levels were decreased in the brains of subjects with AD and mild cognitive impairment concomitant with an increase in rRNA oxidation. In addition, level of 5S rRNA, one of the essential components of the ribosome complex, was significantly lower in the inferior parietal lobule (IP) brain area of subjects with AD compared with control subjects. To further evaluate the alteration of 5S rRNA in neurodegenerative human brains, multiple brain regions from both AD and age-matched control subjects were used in this study, including IP, superior and middle temporal gyro, temporal pole, and cerebellum. Different molecular pools including 5S rRNA integrated into ribosome complexes, free 5S rRNA, cytoplasmic 5S rRNA, and nuclear 5S rRNA were studied. Free 5S rRNA levels were significantly decreased in the temporal pole region of AD subjects and the oxidation of ribosome-integrated and free 5S rRNA was significantly increased in multiple brain regions in AD subjects compared with controls. Moreover, a greater amount of oxidized 5S rRNA was detected in the cytoplasm and nucleus of AD subjects compared with controls. These results suggest that the increased oxidation of 5S rRNA, especially the oxidation of free 5S rRNA, may be involved in the neurodegeneration observed in AD.

Selection and validation of appropriate reference genes for quantitative real-time PCR analysis in Salvia hispanica.

Directory of Open Access Journals (Sweden)

Rahul Gopalam

Full Text Available Quantitative real-time polymerase chain reaction (qRT-PCR has become the most popular choice for gene expression studies. For accurate expression analysis, it is pertinent to select a stable reference gene to normalize the data. It is now known that the expression of internal reference genes varies considerably during developmental stages and under different experimental conditions. For Salvia hispanica, an economically important oilseed crop, there are no reports of stable reference genes till date. In this study, we chose 13 candidate reference genes viz. Actin11 (ACT, Elongation factor 1-alpha (EF1-α, Eukaryotic translation initiation factor 3E (ETIF3E, alpha tubulin (α-TUB, beta tubulin (β-TUB, Glyceraldehyde 3-phosphate dehydrogenase (GAPDH, Cyclophilin (CYP, Clathrin adaptor complex (CAC, Serine/threonine-protein phosphatase 2A (PP2A, FtsH protease (FtsH, 18S ribosomal RNA (18S rRNA, S-adenosyl methionine decarboxylase (SAMDC and Rubisco activase (RCA and the expression levels of these genes were assessed in a diverse set of tissue samples representing vegetative stages, reproductive stages and various abiotic stress treatments. Two of the widely used softwares, geNorm and Normfinder were used to evaluate the expression stabilities of these 13 candidate reference genes under different conditions. Results showed that GAPDH and CYP expression remain stable throughout in the different abiotic stress treatments, CAC and PP2A expression were relatively stable under reproductive stages and α-TUB, PP2A and ETIF3E were found to be stably expressed in vegetative stages. Further, the expression levels of Diacylglycerol acyltransferase (DGAT1, a key enzyme in triacylglycerol synthesis was analyzed to confirm the validity of reference genes identified in the study. This is the first systematic study of selection of reference genes in S. hispanica, and will benefit future expression studies in this crop.

Import of desired nucleic acid sequences using addressing motif of mitochondrial ribosomal 5S-rRNA for fluorescent in vivo hybridization of mitochondrial DNA and RNA.

Science.gov (United States)

Zelenka, Jaroslav; Alán, Lukáš; Jabůrek, Martin; Ježek, Petr

2014-04-01

Based on the matrix-addressing sequence of mitochondrial ribosomal 5S-rRNA (termed MAM), which is naturally imported into mitochondria, we have constructed an import system for in vivo targeting of mitochondrial DNA (mtDNA) or mt-mRNA, in order to provide fluorescence hybridization of the desired sequences. Thus DNA oligonucleotides were constructed, containing the 5'-flanked T7 RNA polymerase promoter. After in vitro transcription and fluorescent labeling with Alexa Fluor(®) 488 or 647 dye, we obtained the fluorescent "L-ND5 probe" containing MAM and exemplar cargo, i.e., annealing sequence to a short portion of ND5 mRNA and to the light-strand mtDNA complementary to the heavy strand nd5 mt gene (5'-end 21 base pair sequence). For mitochondrial in vivo fluorescent hybridization, HepG2 cells were treated with dequalinium micelles, containing the fluorescent probes, bringing the probes proximally to the mitochondrial outer membrane and to the natural import system. A verification of import into the mitochondrial matrix of cultured HepG2 cells was provided by confocal microscopy colocalizations. Transfections using lipofectamine or probes without 5S-rRNA addressing MAM sequence or with MAM only were ineffective. Alternatively, the same DNA oligonucleotides with 5'-CACC overhang (substituting T7 promoter) were transcribed from the tetracycline-inducible pENTRH1/TO vector in human embryonic kidney T-REx®-293 cells, while mitochondrial matrix localization after import of the resulting unlabeled RNA was detected by PCR. The MAM-containing probe was then enriched by three-order of magnitude over the natural ND5 mRNA in the mitochondrial matrix. In conclusion, we present a proof-of-principle for mitochondrial in vivo hybridization and mitochondrial nucleic acid import.

The primary structure of L37--a rat ribosomal protein with a zinc finger-like motif.

Science.gov (United States)

Chan, Y L; Paz, V; Olvera, J; Wool, I G

1993-04-30

The amino acid sequence of the rat 60S ribosomal subunit protein L37 was deduced from the sequence of nucleotides in a recombinant cDNA. Ribosomal protein L37 has 96 amino acids, the NH2-terminal methionine is removed after translation of the mRNA, and has a molecular weight of 10,939. Ribosomal protein L37 has a single zinc finger-like motif of the C2-C2 type. Hybridization of the cDNA to digests of nuclear DNA suggests that there are 13 or 14 copies of the L37 gene. The mRNA for the protein is about 500 nucleotides in length. Rat L37 is related to Saccharomyces cerevisiae ribosomal protein YL35 and to Caenorhabditis elegans L37. We have identified in the data base a DNA sequence that encodes the chicken homolog of rat L37.

RNA-binding domain of the A protein component of the U1 small nuclear ribonucleoprotein analyzed by NMR spectroscopy is structurally similar to ribosomal proteins

International Nuclear Information System (INIS)

Hoffman, D.W.; Query, C.C.; Golden, B.L.; White, S.W.; Keene, J.D.

1991-01-01

An RNA recognition motif (RRM) of ∼80 amino acids constitutes the core of RNA-binding domains found in a large family of proteins involved in RNA processing. The U1 RNA-binding domain of the A protein component of the human U1 small nuclear ribonucleoprotein (RNP), which encompasses the RRM sequence, was analyzed by using NMR spectroscopy. The domain of the A protein is a highly stable monomer in solution consisting of four antiparallel β-strands and two α-helices. The highly conserved RNP1 and RNP2 consensus sequences, containing residues previously suggested to be involved in nucleic acid binding, are juxtaposed in adjacent β-strands. Conserved aromatic side chains that are critical for RNA binding are clustered on the surface to the molecule adjacent to a variable loop that influences recognition of specific RNA sequences. The secondary structure and topology of the RRM are similar to those of ribosomal proteins L12 and L30, suggesting a distant evolutionary relationship between these two types of RNA-associated proteins

An elongated model of the Xenopus laevis transcription factor IIIA-5S ribosomal RNA complex derived from neutron scattering and hydrodynamic measurements

International Nuclear Information System (INIS)

Timmins, P.A.; Langowski, J.; Brown, R.S.

1988-01-01

The precise molecular composition of the Xenopus laevis TFIIIA-5S ribosomal RNA complex (7S particle) has been established from small angle neutron and dynamic light scattering. The molecular weight of the particle was found to be 95,700±10,000 and 86,700±9,000 daltons from these two methods respectively. The observed match point of 54.4% D 2 O obtained from contrast variation experiments indicates a 1:1 molar ratio. It is concluded that only a single molecule of TFIIIA, a zinc-finger protein, and of 5S RNA are present in this complex. A simple elongated cylindrical model with dimensions of 140 angstrom length and 59 angstrom diameter is compatible with the neutron results. A globular model can be excluded by the shallow nature of the neutron scattering curves. It is proposed that the observed difference of 15 angstrom in length between the 7S particle and isolated 5S RNA most likely indicates that part(s) of the protein protrudes from the end(s) of the RNA molecule. There is no biochemical evidence for any gross alteration in 5S RNA conformation upon binding to TFIIIA

Charge Segregation and Low Hydrophobicity Are Key Features of Ribosomal Proteins from Different Organisms*

Science.gov (United States)

Fedyukina, Daria V.; Jennaro, Theodore S.; Cavagnero, Silvia

2014-01-01

Ribosomes are large and highly charged macromolecular complexes consisting of RNA and proteins. Here, we address the electrostatic and nonpolar properties of ribosomal proteins that are important for ribosome assembly and interaction with other cellular components and may influence protein folding on the ribosome. We examined 50 S ribosomal subunits from 10 species and found a clear distinction between the net charge of ribosomal proteins from halophilic and non-halophilic organisms. We found that ∼67% ribosomal proteins from halophiles are negatively charged, whereas only up to ∼15% of ribosomal proteins from non-halophiles share this property. Conversely, hydrophobicity tends to be lower for ribosomal proteins from halophiles than for the corresponding proteins from non-halophiles. Importantly, the surface electrostatic potential of ribosomal proteins from all organisms, especially halophiles, has distinct positive and negative regions across all the examined species. Positively and negatively charged residues of ribosomal proteins tend to be clustered in buried and solvent-exposed regions, respectively. Hence, the majority of ribosomal proteins is characterized by a significant degree of intramolecular charge segregation, regardless of the organism of origin. This key property enables the ribosome to accommodate proteins within its complex scaffold regardless of their overall net charge. PMID:24398678

A distinct group of hepacivirus/pestivirus-like internal ribosomal entry sites in members of diverse picornavirus genera: evidence for modular exchange of functional noncoding RNA elements by recombination.

Science.gov (United States)

Hellen, Christopher U T; de Breyne, Sylvain

2007-06-01

The 5' untranslated regions (UTRs) of the RNA genomes of Flaviviridae of the Hepacivirus and Pestivirus genera contain internal ribosomal entry sites (IRESs) that are unrelated to the two principal classes of IRESs of Picornaviridae. The mechanism of translation initiation on hepacivirus/pestivirus (HP) IRESs, which involves factor-independent binding to ribosomal 40S subunits, also differs fundamentally from initiation on these picornavirus IRESs. Ribosomal binding to HP IRESs requires conserved sequences that form a pseudoknot and the adjacent IIId and IIIe domains; analogous elements do not occur in the two principal groups of picornavirus IRESs. Here, comparative sequence analysis was used to identify a subset of picornaviruses from multiple genera that contain 5' UTR sequences with significant similarities to HP IRESs. They are avian encephalomyelitis virus, duck hepatitis virus 1, duck picornavirus, porcine teschovirus, porcine enterovirus 8, Seneca Valley virus, and simian picornavirus. Their 5' UTRs are predicted to form several structures, in some of which the peripheral elements differ from the corresponding HP IRES elements but in which the core pseudoknot, domain IIId, and domain IIIe elements are all closely related. These findings suggest that HP-like IRESs have been exchanged between unrelated virus families by recombination and support the hypothesis that RNA viruses consist of modular coding and noncoding elements that can exchange and evolve independently.

Resistance to Linezolid Caused by Modifications at Its Binding Site on the Ribosome

DEFF Research Database (Denmark)

Long, Katherine S.; Vester, Birte

2012-01-01

Linezolid is an oxazolidinone antibiotic in clinical use for the treatment of serious infections of resistant Gram-positive bacteria. It inhibits protein synthesis by binding to the peptidyl transferase center on the ribosome. Almost all known resistance mechanisms involve small alterations...... to the linezolid binding site, so this review will therefore focus on the various changes that can adversely affect drug binding and confer resistance. High-resolution structures of linezolid bound to the 50S ribosomal subunit show that it binds in a deep cleft that is surrounded by 23S rRNA nucleotides. Mutation...... of 23S rRNA has for some time been established as a linezolid resistance mechanism. Although ribosomal proteins L3 and L4 are located further away from the bound drug, mutations in specific regions of these proteins are increasingly being associated with linezolid resistance. However, very little...

Architecture of the E.coli 70S ribosome

DEFF Research Database (Denmark)

Burkhardt, N.; Diedrich, G.; Nierhaus, K.H.

1997-01-01

The 70S ribosome from E.coli was analysed by neutron scattering focusing on the shape and the internal protein-RNA-distribution of the complex. Measurements on selectively deuterated 70S particles and free 30S and 50S subunits applying conventional contrast variation and proton-spin contrast...

Are Ichthyosporea animals or fungi? Bayesian phylogenetic analysis of elongation factor 1alpha of Ichthyophonus irregularis.

Science.gov (United States)

Ragan, Mark A; Murphy, Colleen A; Rand, Thomas G

2003-12-01

Ichthyosporea is a recently recognized group of morphologically simple eukaryotes, many of which cause disease in aquatic organisms. Ribosomal RNA sequence analyses place Ichthyosporea near the divergence of the animal and fungal lineages, but do not allow resolution of its exact phylogenetic position. Some of the best evidence for a specific grouping of animals and fungi (Opisthokonta) has come from elongation factor 1alpha, not only phylogenetic analysis of sequences but also the presence or absence of short insertions and deletions. We sequenced the EF-1alpha gene from the ichthyosporean parasite Ichthyophonus irregularis and determined its phylogenetic position using neighbor-joining, parsimony and Bayesian methods. We also sequenced EF-1alpha genes from four chytrids to provide broader representation within fungi. Sequence analyses and the presence of a characteristic 12 amino acid insertion strongly indicate that I. irregularis is a member of Opisthokonta, but do not resolve whether I. irregularis is a specific relative of animals or of fungi. However, the EF-1alpha of I. irregularis exhibits a two amino acid deletion heretofore reported only among fungi.

Isolation and characterization of an RIP (ribosome-inactivating protein)-like protein from tobacco with dual enzymatic activity.

Science.gov (United States)

Sharma, Neelam; Park, Sang-Wook; Vepachedu, Ramarao; Barbieri, Luigi; Ciani, Marialibera; Stirpe, Fiorenzo; Savary, Brett J; Vivanco, Jorge M

2004-01-01

Ribosome-inactivating proteins (RIPs) are N-glycosidases that remove a specific adenine from the sarcin/ricin loop of the large rRNA, thus arresting protein synthesis at the translocation step. In the present study, a protein termed tobacco RIP (TRIP) was isolated from tobacco (Nicotiana tabacum) leaves and purified using ion exchange and gel filtration chromatography in combination with yeast ribosome depurination assays. TRIP has a molecular mass of 26 kD as evidenced by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and showed strong N-glycosidase activity as manifested by the depurination of yeast rRNA. Purified TRIP showed immunoreactivity with antibodies of RIPs from Mirabilis expansa. TRIP released fewer amounts of adenine residues from ribosomal (Artemia sp. and rat ribosomes) and non-ribosomal substrates (herring sperm DNA, rRNA, and tRNA) compared with other RIPs. TRIP inhibited translation in wheat (Triticum aestivum) germ more efficiently than in rabbit reticulocytes, showing an IC50 at 30 ng in the former system. Antimicrobial assays using highly purified TRIP (50 microg mL(-1)) conducted against various fungi and bacterial pathogens showed the strongest inhibitory activity against Trichoderma reesei and Pseudomonas solancearum. A 15-amino acid internal polypeptide sequence of TRIP was identical with the internal sequences of the iron-superoxide dismutase (Fe-SOD) from wild tobacco (Nicotiana plumbaginifolia), Arabidopsis, and potato (Solanum tuberosum). Purified TRIP showed SOD activity, and Escherichia coli Fe-SOD was observed to have RIP activity too. Thus, TRIP may be considered a dual activity enzyme showing RIP-like activity and Fe-SOD characteristics.

Altered Machinery of Protein Synthesis in Alzheimer's: From the Nucleolus to the Ribosome.

Science.gov (United States)

Hernández-Ortega, Karina; Garcia-Esparcia, Paula; Gil, Laura; Lucas, José J; Ferrer, Isidre

2016-09-01

Ribosomes and protein synthesis have been reported to be altered in the cerebral cortex at advanced stages of Alzheimer's disease (AD). Modifications in the hippocampus with disease progression have not been assessed. Sixty-seven cases including middle-aged (MA) and AD stages I-VI were analyzed. Nucleolar chaperones nucleolin, nucleophosmin and nucleoplasmin 3, and upstream binding transcription factor RNA polymerase I gene (UBTF) mRNAs are abnormally regulated and their protein levels reduced in AD. Histone modifications dimethylated histone H3K9 (H3K9me2) and acetylated histone H3K12 (H3K12ac) are decreased in CA1. Nuclear tau declines in CA1 and dentate gyrus (DG), and practically disappears in neurons with neurofibrillary tangles. Subunit 28 ribosomal RNA (28S rRNA) expression is altered in CA1 and DG in AD. Several genes encoding ribosomal proteins are abnormally regulated and protein levels of translation initiation factors eIF2α, eIF3η and eIF5, and elongation factor eEF2, are altered in the CA1 region in AD. These findings show alterations in the protein synthesis machinery in AD involving the nucleolus, nucleus and ribosomes in the hippocampus in AD some of them starting at first stages (I-II) preceding neuron loss. These changes may lie behind reduced numbers of dendritic branches and reduced synapses of CA1 and DG neurons which cause hippocampal atrophy. © 2015 International Society of Neuropathology.

Senescent changes in the ribosomes of animal cells in vivo and in vitro

Science.gov (United States)

Miquel, J.; Johnson, J. E., Jr.

1979-01-01

The paper examines RNA-ribosomal changes observed in protozoa and fixed postmitotic cells, as well as the characteristics of intermitotic cells. Attention is given to a discussion of the implications of the reported ribosomal changes as to the senescent deterioration of protein synthesis and physiological functions. A survey of the literature suggests that, while the data on ribosomal change in dividing cells both in vivo and in vitro are inconclusive, there is strong histological and biochemical evidence in favor of some degree of quantitative ribosomal loss in fixed postmitotic cells. Since these decreases in ribosomes are demonstrated in differential cells from nematodes, insects and mammals, they may represent a universal manifestation of cytoplasmic senescence in certain types of fixed postmitotic animal cells. The observed variability in ribosomal loss for cells belonging to the same type suggests that this involution phenomenon is rather related to the wear and tear suffered by a particular cell.

Detection of beta-tubulin in the cytoplasm of the interphasic Entamoeba histolytica trophozoites.

Science.gov (United States)

Gómez-Conde, Eduardo; Vargas-Mejía, Miguel Ángel; Díaz-Orea, María Alicia; Hernández-Rivas, Rosaura; Cárdenas-Perea, María Elena; Guerrero-González, Tayde; González-Barrios, Juan Antonio; Montiel-Jarquín, Álvaro José

2016-08-01

It is known that the microtubules (MT) of Entamoeba histolytica trophozoites form an intranuclear mitotic spindle. However, electron microscopy studies and the employment of anti-beta-tubulin (β-tubulin) antibodies have not exhibited these cytoskeletal structures in the cytoplasm of these parasites. The purpose of this work was to detect β-tubulin in the cytoplasm of interphasic E. histolytica trophozoites. Activated or non-activated HMI-IMSS-strain E. histolytica trophozoites were used and cultured for 72 h at 37 °C in TYI-S-33 medium, and then these were incubated with the anti-β-tubulin antibody of E. histolytica. The anti-β-tubulin antibody reacted with the intranuclear mitotic spindle of E. histolytica-activated trophozoites as control. In contrast, in non-activated interphasic parasites, anti-β-tubulin antibody reacted with diverse puntiform structures in the cytoplasm and with ring-shaped structures localized in the cytoplasm, cellular membrane and endocytic stomas. In this work, for the first time, the presence of β-tubulin is shown in the cytoplasm of E. histolytica trophozoites. Copyright © 2016 Elsevier Inc. All rights reserved.

Attenuation of alpha2A-adrenergic receptor expression in neonatal rat brain by RNA interference or antisense oligonucleotide reduced anxiety in adulthood.

Science.gov (United States)

Shishkina, G T; Kalinina, T S; Dygalo, N N

2004-01-01

Brain alpha2-adrenergic receptors (alpha2-ARs) have been implicated in the regulation of anxiety, which is associated with stress. Environmental treatments during neonatal development could modulate the level of brain alpha2-AR expression and alter anxiety in adults, suggesting possible involvement of these receptors in early-life programming of anxiety state. The present study was undertaken to determine whether the reduction of the expression of A subtype of these receptors most abundant in the neonatal brain affects anxiety-related behavior in adulthood. We attenuated the expression of alpha2A-ARs during neonatal life by two different sequence specific approaches, antisense technology and RNA interference. Treatment of rats with the antisense oligodeoxynucleotide or short interfering RNA (siRNA) against alpha2A-ARs on the days 2-4 of their life, produced a marked acute decrease in the levels of both alpha2A-AR mRNA and [3H]RX821002 binding sites in the brainstem into which drugs were injected. The decrease of alpha2A-AR expression in the neonatal brainstem influenced the development of this receptor system in the brain regions as evidenced by the increased number of [3H]RX821002 binding sites in the hypothalamus of adult animals with both neonatal alpha2A-AR knockdown treatments; also in the frontal cortex of antisense-treated, and in the hippocampus of siRNA-treated adult rats. These adult animals also demonstrated a decreased anxiety in the elevated plus-maze as evidenced by an increased number of the open arm entries, greater proportion of time spent in the open arms, and more than a two-fold increase in the number of exploratory head dips. The results provide the first evidence that the reduction in the brain expression of a gene encoding for alpha2A-AR during neonatal life led to the long-term neurochemical and behavioral alterations. The data suggests that alterations in the expression of the receptor-specific gene during critical periods of brain

Multiple effects of S13 in modulating the strength of intersubunit interactions in the ribosome during translation.

Science.gov (United States)

Cukras, Anthony R; Green, Rachel

2005-05-27

The ribosomal protein S13 is found in the head region of the small subunit, where it interacts with the central protuberance of the large ribosomal subunit and with the P site-bound tRNA through its extended C terminus. The bridging interactions between the large and small subunits are dynamic, and are thought to be critical in orchestrating the molecular motions of the translation cycle. S13 provides a direct link between the tRNA-binding site and the movements in the head of the small subunit seen during translocation, thereby providing a possible pathway of signal transduction. We have created and characterized an rpsM(S13)-deficient strain of Escherichia coli and have found significant defects in subunit association, initiation and translocation through in vitro assays of S13-deficient ribosomes. Targeted mutagenesis of specific bridge and tRNA contact elements in S13 provides evidence that these two interaction domains play critical roles in maintaining the fidelity of translation. This ribosomal protein thus appears to play a non-essential, yet important role by modulating subunit interactions in multiple steps of the translation cycle.

Genetic variability of Echinococcus granulosus based on the mitochondrial 16S ribosomal RNA gene.

Science.gov (United States)

Wang, Ning; Wang, Jiahai; Hu, Dandan; Zhong, Xiuqin; Jiang, Zhongrong; Yang, Aiguo; Deng, Shijin; Guo, Li; Tsering, Dawa; Wang, Shuxian; Gu, Xiaobin; Peng, Xuerong; Yang, Guangyou

2015-06-01

Echinococcus granulosus is the etiological agent of cystic echinococcosis, a major zoonotic disease of both humans and animals. In this study, we assessed genetic variability and genetic structure of E. granulosus in the Tibet plateau, using the complete mitochondrial 16 S ribosomal RNA gene for the first time. We collected and sequenced 62 isolates of E. granulosus from 3 populations in the Tibet plateau. A BLAST analysis indicated that 61 isolates belonged to E. granulosus sensu stricto (genotypes G1-G3), while one isolate belonged to E. canadensis (genotype G6). We detected 16 haplotypes with a haplotype network revealing a star-like expansion, with the most common haplotype occupying the center of the network. Haplotype diversity and nucleotide diversity were low, while negative values were observed for Tajima's D and Fu's Fs. AMOVA results and Fst values revealed that the three geographic populations were not genetically differentiated. Our results suggest that a population bottleneck or population expansion has occurred in the past, and that this explains the low genetic variability of E. granulosus in the Tibet Plateau.

Association of ABCB1, β tubulin I, and III with multidrug resistance of MCF7/DOC subline from breast cancer cell line MCF7.

Science.gov (United States)

Li, Wentao; Zhai, Baoping; Zhi, Hui; Li, Yuhong; Jia, Linjiao; Ding, Chao; Zhang, Bin; You, Wei

2014-09-01

Docetaxel is a first-line chemotherapeutic agent for treating advanced breast cancer. The development of chemoresistance or multidrug resistance (MDR), however, results in breast cancer chemotherapy failure. This study aims to explore the molecular mechanisms underlying docetaxel-resistance in treatment of breast cancer. The docetaxel-resistant subline MCF7/DOC, derived from the parental sensitive breast cancer cell line MCF7, was established by intermittent exposure to moderate concentrations of docetaxel, followed by examination of its phenotypes. The MCF7/DOC subline showed cross resistance against paclitaxel, doxorubicin, methotrexate, and 5-Fu. Compared to the parental MCF7, MCF7/DOC cells were enlarged with heterogeneous sizes and a cobblestone and polygonal appearance. They were arrested at G2/M phase and proliferated slowly. The colony formation potential of MCF7/DOC in soft agar was significantly increased. MCF7/DOC cells showed reduced intracellular accumulation and increased efflux of rhodamine 123. The mRNA expression level of adenosine triphosphate binding cassette (ABC) transporter family, i.e., ABCB1, ABCC1, ABCC2, ABCG2, and β tubulin isotypes were characterized by quantitative PCR. High-level expression of ABCB1, βI, and βIII tubulin mRNA in MCF7/DOC was detected. Downregulation of ABCB1, βI, and βIII tubulin mediated by three combined siRNAs resulted in stronger growth inhibition of MCF7/DOC than inhibition of the expression of individual genes. ABCB1, βI, and βIII tubulin might contribute to the MDR of MCF7/DOC and be potential therapeutic targets for overcoming MDR of breast cancer.

A Distinct Group of Hepacivirus/Pestivirus-Like Internal Ribosomal Entry Sites in Members of Diverse Picornavirus Genera: Evidence for Modular Exchange of Functional Noncoding RNA Elements by Recombination▿ †

Science.gov (United States)

Hellen, Christopher U. T.; de Breyne, Sylvain

2007-01-01

The 5′ untranslated regions (UTRs) of the RNA genomes of Flaviviridae of the Hepacivirus and Pestivirus genera contain internal ribosomal entry sites (IRESs) that are unrelated to the two principal classes of IRESs of Picornaviridae. The mechanism of translation initiation on hepacivirus/pestivirus (HP) IRESs, which involves factor-independent binding to ribosomal 40S subunits, also differs fundamentally from initiation on these picornavirus IRESs. Ribosomal binding to HP IRESs requires conserved sequences that form a pseudoknot and the adjacent IIId and IIIe domains; analogous elements do not occur in the two principal groups of picornavirus IRESs. Here, comparative sequence analysis was used to identify a subset of picornaviruses from multiple genera that contain 5′ UTR sequences with significant similarities to HP IRESs. They are avian encephalomyelitis virus, duck hepatitis virus 1, duck picornavirus, porcine teschovirus, porcine enterovirus 8, Seneca Valley virus, and simian picornavirus. Their 5′ UTRs are predicted to form several structures, in some of which the peripheral elements differ from the corresponding HP IRES elements but in which the core pseudoknot, domain IIId, and domain IIIe elements are all closely related. These findings suggest that HP-like IRESs have been exchanged between unrelated virus families by recombination and support the hypothesis that RNA viruses consist of modular coding and noncoding elements that can exchange and evolve independently. PMID:17392358

Translation affects YoeB and MazF messenger RNA interferase activities by different mechanisms

DEFF Research Database (Denmark)

Christensen-Dalsgaard, Mikkel; Gerdes, Kenn

2008-01-01

Prokaryotic toxin-antitoxin loci encode mRNA cleaving enzymes that inhibit translation. Two types are known: those that cleave mRNA codons at the ribosomal A site and those that cleave any RNA site specifically. RelE of Escherichia coli cleaves mRNA at the ribosomal A site in vivo and in vitro bu...

Nuclear ribosomal internal transcribed spacer (ITS) region as a universal DNA barcode marker for Fungi.

Science.gov (United States)

Schoch, Conrad L; Seifert, Keith A; Huhndorf, Sabine; Robert, Vincent; Spouge, John L; Levesque, C André; Chen, Wen

2012-04-17

Six DNA regions were evaluated as potential DNA barcodes for Fungi, the second largest kingdom of eukaryotic life, by a multinational, multilaboratory consortium. The region of the mitochondrial cytochrome c oxidase subunit 1 used as the animal barcode was excluded as a potential marker, because it is difficult to amplify in fungi, often includes large introns, and can be insufficiently variable. Three subunits from the nuclear ribosomal RNA cistron were compared together with regions of three representative protein-coding genes (largest subunit of RNA polymerase II, second largest subunit of RNA polymerase II, and minichromosome maintenance protein). Although the protein-coding gene regions often had a higher percent of correct identification compared with ribosomal markers, low PCR amplification and sequencing success eliminated them as candidates for a universal fungal barcode. Among the regions of the ribosomal cistron, the internal transcribed spacer (ITS) region has the highest probability of successful identification for the broadest range of fungi, with the most clearly defined barcode gap between inter- and intraspecific variation. The nuclear ribosomal large subunit, a popular phylogenetic marker in certain groups, had superior species resolution in some taxonomic groups, such as the early diverging lineages and the ascomycete yeasts, but was otherwise slightly inferior to the ITS. The nuclear ribosomal small subunit has poor species-level resolution in fungi. ITS will be formally proposed for adoption as the primary fungal barcode marker to the Consortium for the Barcode of Life, with the possibility that supplementary barcodes may be developed for particular narrowly circumscribed taxonomic groups.

A comparison of structural and evolutionary attributes of Escherichia coli and Thermus thermophilus small ribosomal subunits: signatures of thermal adaptation.

Directory of Open Access Journals (Sweden)

Saurav Mallik

Full Text Available Here we compare the structural and evolutionary attributes of Thermus thermophilus and Escherichia coli small ribosomal subunits (SSU. Our results indicate that with few exceptions, thermophilic 16S ribosomal RNA (16S rRNA is densely packed compared to that of mesophilic at most of the analogous spatial regions. In addition, we have located species-specific cavity clusters (SSCCs in both species. E. coli SSCCs are numerous and larger compared to T. thermophilus SSCCs, which again indicates densely packed thermophilic 16S rRNA. Thermophilic ribosomal proteins (r-proteins have longer disordered regions than their mesophilic homologs and they experience larger disorder-to-order transitions during SSU-assembly. This is reflected in the predicted higher conformational changes of thermophilic r-proteins compared to their mesophilic homologs during SSU-assembly. This high conformational change of thermophilic r-proteins may help them to associate with the 16S ribosomal RNA with high complementary interfaces, larger interface areas, and denser molecular contacts, compared to those of mesophilic. Thus, thermophilic protein-rRNA interfaces are tightly associated with 16S rRNA than their mesophilic homologs. Densely packed 16S rRNA interior and tight protein-rRNA binding of T. thermophilus (compared to those of E. coli are likely the signatures of its thermal adaptation. We have found a linear correlation between the free energy of protein-RNA interface formation, interface size, and square of conformational changes, which is followed in both prokaryotic and eukaryotic SSU. Disorder is associated with high protein-RNA interface polarity. We have found an evolutionary tendency to maintain high polarity (thereby disorder at protein-rRNA interfaces, than that at rest of the protein structures. However, some proteins exhibit exceptions to this general trend.

Affinity Purification and Characterization of Functional Tubulin from Cell Suspension Cultures of Arabidopsis and Tobacco1

Science.gov (United States)

Fujita, Satoshi; Uchimura, Seiichi; Noguchi, Masahiro; Demura, Taku

2016-01-01

Microtubules assemble into several distinct arrays that play important roles in cell division and cell morphogenesis. To decipher the mechanisms that regulate the dynamics and organization of this versatile cytoskeletal component, it is essential to establish in vitro assays that use functional tubulin. Although plant tubulin has been purified previously from protoplasts by reversible taxol-induced polymerization, a simple and efficient purification method has yet to be developed. Here, we used a Tumor Overexpressed Gene (TOG) column, in which the tubulin-binding domains of a yeast (Saccharomyces cerevisiae) TOG homolog are immobilized on resin, to isolate functional plant tubulin. We found that several hundred micrograms of pure tubulin can readily be purified from cell suspension cultures of tobacco (Nicotiana tabacum) and Arabidopsis (Arabidopsis thaliana). The tubulin purified by the TOG column showed high assembly competence, partly because of low levels of polymerization-inhibitory phosphorylation of α-tubulin. Compared with porcine brain tubulin, Arabidopsis tubulin is highly dynamic in vitro at both the plus and minus ends, exhibiting faster shrinkage rates and more frequent catastrophe events, and exhibits frequent spontaneous nucleation. Furthermore, our study shows that an internal histidine tag in α-tubulin can be used to prepare particular isotypes and specifically engineered versions of α-tubulin. In contrast to previous studies of plant tubulin, our mass spectrometry and immunoblot analyses failed to detect posttranslational modification of the isolated Arabidopsis tubulin or detected only low levels of posttranslational modification. This novel technology can be used to prepare assembly-competent, highly dynamic pure tubulin from plant cell cultures. PMID:26747285

Suboptimal T-cell receptor signaling compromises protein translation, ribosome biogenesis, and proliferation of mouse CD8 T cells.

Science.gov (United States)

Tan, Thomas C J; Knight, John; Sbarrato, Thomas; Dudek, Kate; Willis, Anne E; Zamoyska, Rose

2017-07-25

Global transcriptomic and proteomic analyses of T cells have been rich sources of unbiased data for understanding T-cell activation. Lack of full concordance of these datasets has illustrated that important facets of T-cell activation are controlled at the level of translation. We undertook translatome analysis of CD8 T-cell activation, combining polysome profiling and microarray analysis. We revealed that altering T-cell receptor stimulation influenced recruitment of mRNAs to heavy polysomes and translation of subsets of genes. A major pathway that was compromised, when TCR signaling was suboptimal, was linked to ribosome biogenesis, a rate-limiting factor in both cell growth and proliferation. Defective TCR signaling affected transcription and processing of ribosomal RNA precursors, as well as the translation of specific ribosomal proteins and translation factors. Mechanistically, IL-2 production was compromised in weakly stimulated T cells, affecting the abundance of Myc protein, a known regulator of ribosome biogenesis. Consequently, weakly activated T cells showed impaired production of ribosomes and a failure to maintain proliferative capacity after stimulation. We demonstrate that primary T cells respond to various environmental cues by regulating ribosome biogenesis and mRNA translation at multiple levels to sustain proliferation and differentiation.

The role of upstream sequences in selecting the reading frame on tmRNA

Directory of Open Access Journals (Sweden)

Dewey Jonathan D

2008-06-01

Full Text Available Abstract Background tmRNA acts first as a tRNA and then as an mRNA to rescue stalled ribosomes in eubacteria. Two unanswered questions about tmRNA function remain: how does tmRNA, lacking an anticodon, bypass the decoding machinery and enter the ribosome? Secondly, how does the ribosome choose the proper codon to resume translation on tmRNA? According to the -1 triplet hypothesis, the answer to both questions lies in the unique properties of the three nucleotides upstream of the first tmRNA codon. These nucleotides assume an A-form conformation that mimics the codon-anticodon interaction, leading to recognition by the decoding center and choice of the reading frame. The -1 triplet hypothesis is important because it is the most credible model in which direct binding and recognition by the ribosome sets the reading frame on tmRNA. Results Conformational analysis predicts that 18 triplets cannot form the correct structure to function as the -1 triplet of tmRNA. We tested the tmRNA activity of all possible -1 triplet mutants using a genetic assay in Escherichia coli. While many mutants displayed reduced activity, our findings do not match the predictions of this model. Additional mutagenesis identified sequences further upstream that are required for tmRNA function. An immunoblot assay for translation of the tmRNA tag revealed that certain mutations in U85, A86, and the -1 triplet sequence result in improper selection of the first codon and translation in the wrong frame (-1 or +1 in vivo. Conclusion Our findings disprove the -1 triplet hypothesis. The -1 triplet is not required for accommodation of tmRNA into the ribosome, although it plays a minor role in frame selection. Our results strongly disfavor direct ribosomal recognition of the upstream sequence, instead supporting a model in which the binding of a separate ligand to A86 is primarily responsible for frame selection.

Cofactors in the RNA World

Science.gov (United States)

Ditzler, Mark A.

2014-01-01

RNA world theories figure prominently in many scenarios for the origin and early evolution of life. These theories posit that RNA molecules played a much larger role in ancient biology than they do now, acting both as the dominant biocatalysts and as the repository of genetic information. Many features of modern RNA biology are potential examples of molecular fossils from an RNA world, such as the pervasive involvement of nucleotides in coenzymes, the existence of natural aptamers that bind these coenzymes, the existence of natural ribozymes, a biosynthetic pathway in which deoxynucleotides are produced from ribonucleotides, and the central role of ribosomal RNA in protein synthesis in the peptidyl transferase center of the ribosome. Here, we uses both a top-down approach that evaluates RNA function in modern biology and a bottom-up approach that examines the capacities of RNA independent of modern biology. These complementary approaches exploit multiple in vitro evolution techniques coupled with high-throughput sequencing and bioinformatics analysis. Together these complementary approaches advance our understanding of the most primitive organisms, their early evolution, and their eventual transition to modern biochemistry.

Aggregation of Ribosomal Protein S6 at Nucleolus Is Cell Cycle-Controlled and Its Function in Pre-rRNA Processing Is Phosphorylation Dependent.

Science.gov (United States)

Zhang, Duo; Chen, Hui-Peng; Duan, Hai-Feng; Gao, Li-Hua; Shao, Yong; Chen, Ke-Yan; Wang, You-Liang; Lan, Feng-Hua; Hu, Xian-Wen

2016-07-01

Ribosomal protein S6 (rpS6) has long been regarded as one of the primary r-proteins that functions in the early stage of 40S subunit assembly, but its actual role is still obscure. The correct forming of 18S rRNA is a key step in the nuclear synthesis of 40S subunit. In this study, we demonstrate that rpS6 participates in the processing of 30S pre-rRNA to 18S rRNA only when its C-terminal five serines are phosphorylated, however, the process of entering the nucleus and then targeting the nucleolus does not dependent its phosphorylation. Remarkably, we also find that the aggregation of rpS6 at the nucleolus correlates to the phasing of cell cycle, beginning to concentrate in the nucleolus at later S phase and disaggregate at M phase. J. Cell. Biochem. 117: 1649-1657, 2016. © 2015 Wiley Periodicals, Inc. © 2015 Wiley Periodicals, Inc.

DNA replication initiator Cdc6 also regulates ribosomal DNA transcription initiation.

Science.gov (United States)

Huang, Shijiao; Xu, Xiaowei; Wang, Guopeng; Lu, Guoliang; Xie, Wenbing; Tao, Wei; Zhang, Hongyin; Jiang, Qing; Zhang, Chuanmao

2016-04-01

RNA-polymerase-I-dependent ribosomal DNA (rDNA) transcription is fundamental to rRNA processing, ribosome assembly and protein synthesis. However, how this process is initiated during the cell cycle is not fully understood. By performing a proteomic analysis of transcription factors that bind RNA polymerase I during rDNA transcription initiation, we identified that the DNA replication initiator Cdc6 interacts with RNA polymerase I and its co-factors, and promotes rDNA transcription in G1 phase in an ATPase-activity-dependent manner. We further showed that Cdc6 is targeted to the nucleolus during late mitosis and G1 phase in a manner that is dependent on B23 (also known as nucleophosmin, NPM1), and preferentially binds to the rDNA promoter through its ATP-binding domain. Overexpression of Cdc6 increases rDNA transcription, whereas knockdown of Cdc6 results in a decreased association of both RNA polymerase I and the RNA polymerase I transcription factor RRN3 with rDNA, and a reduction of rDNA transcription. Furthermore, depletion of Cdc6 impairs the interaction between RRN3 and RNA polymerase I. Taken together, our data demonstrate that Cdc6 also serves as a regulator of rDNA transcription initiation, and indicate a mechanism by which initiation of rDNA transcription and DNA replication can be coordinated in cells. © 2016. Published by The Company of Biologists Ltd.

Resistance to Linezolid Caused by Modifications at Its Binding Site on the Ribosome

Science.gov (United States)

Long, Katherine S.

2012-01-01

Linezolid is an oxazolidinone antibiotic in clinical use for the treatment of serious infections of resistant Gram-positive bacteria. It inhibits protein synthesis by binding to the peptidyl transferase center on the ribosome. Almost all known resistance mechanisms involve small alterations to the linezolid binding site, so this review will therefore focus on the various changes that can adversely affect drug binding and confer resistance. High-resolution structures of linezolid bound to the 50S ribosomal subunit show that it binds in a deep cleft that is surrounded by 23S rRNA nucleotides. Mutation of 23S rRNA has for some time been established as a linezolid resistance mechanism. Although ribosomal proteins L3 and L4 are located further away from the bound drug, mutations in specific regions of these proteins are increasingly being associated with linezolid resistance. However, very little evidence has been presented to confirm this. Furthermore, recent findings on the Cfr methyltransferase underscore the modification of 23S rRNA as a highly effective and transferable form of linezolid resistance. On a positive note, detailed knowledge of the linezolid binding site has facilitated the design of a new generation of oxazolidinones that show improved properties against the known resistance mechanisms. PMID:22143525

Ribosome stalling regulates IRES-mediated translation in eukaryotes, a parallel to prokaryotic attenuation

NARCIS (Netherlands)

Fernandez, James; Yaman, Ibrahim; Huang, Charles; Liu, Haiyan; Lopez, Alex B.; Komar, Anton A.; Caprara, Mark G.; Merrick, William C.; Snider, Martin D.; Kaufman, Randal J.; Lamers, Wouter H.; Hatzoglou, Maria

2005-01-01

It was previously shown that the mRNA for the cat-1 Arg/Lys transporter is translated from an internal ribosome entry site (IRES) that is regulated by cellular stress. Amino acid starvation stimulated cat-1 translation via a mechanism that requires translation of an ORF in the mRNA leader and

Origins and Early Evolution of the tRNA Molecule

Directory of Open Access Journals (Sweden)

Koji Tamura

2015-12-01

Full Text Available Modern transfer RNAs (tRNAs are composed of ~76 nucleotides and play an important role as “adaptor” molecules that mediate the translation of information from messenger RNAs (mRNAs. Many studies suggest that the contemporary full-length tRNA was formed by the ligation of half-sized hairpin-like RNAs. A minihelix (a coaxial stack of the acceptor stem on the T-stem of tRNA can function both in aminoacylation by aminoacyl tRNA synthetases and in peptide bond formation on the ribosome, indicating that it may be a vestige of the ancestral tRNA. The universal CCA-3′ terminus of tRNA is also a typical characteristic of the molecule. “Why CCA?” is the fundamental unanswered question, but several findings give a comprehensive picture of its origin. Here, the origins and early evolution of tRNA are discussed in terms of various perspectives, including nucleotide ligation, chiral selectivity of amino acids, genetic code evolution, and the organization of the ribosomal peptidyl transferase center (PTC. The proto-tRNA molecules may have evolved not only as adaptors but also as contributors to the composition of the ribosome.

Alterations of type IV collagen alpha chains in patients with chronic acquired glomerulopathies: mRNA levels, protein expression and urinary loss.

Science.gov (United States)

Sanna-Cherchi, Simone; Carnevali, Maria Luisa; Martorana, Davide; Cravedi, Paolo; Maggiore, Umberto; Alinovi, Rossella; Bovino, Achiropita; Mattei, Silvia; Orlandini, Guido; Gatti, Rita; Savi, Mario; Sado, Yoshikazu; Neri, Tauro M; Allegri, Landino

2007-01-01

Type IV collagen is a major structural component of the normal kidney glomerulus. However, its role in chronic acquired glomerulopathies has been only partially elucidated. Urinary levels of col(IV)alpha1, col(IV)alpha3 and col(IV)alpha5 collagen chains were analyzed in 107 patients with chronic acquired glomerulopathies. In a subgroup of 33 patients, tissue mRNA levels, protein expression and urinary excretion were evaluated for all col(IV)alpha chains, from col(IV)alpha1 to col(IV)alpha5. The renal specimens were examined to get a semiquantitative score of the acute and chronic activity of the histological lesions. Urines obtained from 13 healthy subjects and 10 normal renal tissue samples were used as controls. Urinary levels of col(IV)alpha1, col(IV)alpha3, col(IV)alpha5 chains were significantly higher in patients than in controls [p < 0.01 for all], while only col(IV)alpha1 and col(IV)alpha3 urinary excretion correlated with the degree of chronic histological damage [col(IV)alpha1 R = 0.44, p < 0.001; col(IV)alpha3: R = 0.47, p < 0.001]. Compared with controls, patients showed a renal expression of mRNA for col(IV)alpha5 chain significantly higher [p = 0.001], while having a significantly lower protein expression of col(IV)alpha3, col(IV)alpha4 and col(IV)alpha5 chains [p < 0.01 for all]. Patients with chronic acquired glomerulopathies show important alterations in the col(IV)alpha chain network mimicking some molecular features of the X-linked Alport's syndrome. Further studies are needed to show whether urinary levels of the col(IV)alpha chains may be used as markers for monitoring renal injury. Copyright 2007 S. Karger AG, Basel.

Genetic characterization of human-pathogenic Cyclospora cayetanensis parasites from three endemic regions at the 18S ribosomal RNA locus.

Science.gov (United States)

Sulaiman, Irshad M; Ortega, Ynes; Simpson, Steven; Kerdahi, Khalil

2014-03-01

Cyclospora cayetanensis is an apicocomplexan parasite that infects the gastrointestinal tract and causes acute diarrheal disease in humans. In recent years, this human-pathogenic parasite has led to several foodborne outbreaks in the United States and Canada, mostly associated with imported produce. Understanding the biology and epidemiology of C. cayetanensis is difficult because little is known about its origin, possible zoonotic reservoirs, and genetic relationships with other coccidian parasites. Recently, we developed a 70kDa heat shock protein (HSP70) gene based nested PCR protocol for detection of C. cayetanensis parasite and sequenced the PCR products of 16 human isolates from Nepal, Mexico, and Peru. In this study, we have characterized the regions of 18S ribosomal RNA (rRNA) gene of 17 human C. cayetanensis isolates for molecular detection, and also to ascertain the genetic diversity of this parasite. The 18S rRNA primer sets were further tested by PCR amplification followed by nucleotide sequencing of the PCR amplified products of previously characterized C. cayetanensis isolates from three endemic regions at HSP70 locus. Although no genetic polymorphism was observed at the regions of HSP70 locus characterized in our previous study, the data analysis of this study revealed a minor genetic diversity at the 18S rRNA locus among the C. cayetanensis isolates. The 18S rRNA gene-based nested PCR protocol provides a useful genetic marker for the detection of C. cayetanensis parasite and confirms it as a genetically distinct species in genus Cyclospora. The results also supported lack of geographic segregation and existence of genetically homogeneous population for the C. cayetanensis parasites both at the HSP70 as well as at the18S rRNA loci. Published by Elsevier B.V.

Characterization of anti-P monoclonal antibodies directed against the ribosomal protein-RNA complex antigen and produced using Murphy Roths large autoimmune-prone mice.

Science.gov (United States)

Sato, H; Onozuka, M; Hagiya, A; Hoshino, S; Narita, I; Uchiumi, T

2015-02-01

Autoantibodies, including anti-ribosomal P proteins (anti-P), are thought to be produced by an antigen-driven immune response in systemic lupus erythematosus (SLE). To test this hypothesis, we reconstituted the ribosomal antigenic complex in vitro using human P0, phosphorylated P1 and P2 and a 28S rRNA fragment covering the P0 binding site, and immunized Murphy Roths large (MRL)/lrp lupus mice with this complex without any added adjuvant to generate anti-P antibodies. Using hybridoma technology, we subsequently obtained 34 clones, each producing an anti-P monoclonal antibody (mAb) that recognized the conserved C-terminal tail sequence common to all three P proteins. We also obtained two P0-specific monoclonal antibodies, but no antibody specific to P1, P2 or rRNA fragment. Two types of mAbs were found among these anti-P antibodies: one type (e.g. 9D5) reacted more strongly with the phosphorylated P1 and P2 than that with their non-phosphorylated forms, whereas the other type (e.g. 4H11) reacted equally with both phosphorylated and non-phosphorylated forms of P1/P2. Both 9D5 and 4H11 inhibited the ribosome/eukaryotic elongation factor-2 (eEF-2)-coupled guanosine triphosphate (GTP)ase activity. However, preincubation with a synthetic peptide corresponding to the C-terminal sequence common to all three P proteins, but not the peptide that lacked the last three C-terminal amino acids, mostly prevented the mAb-induced inhibition of GTPase activity. Thus, at least two types of anti-P were produced preferentially following the immunization of MRL mice with the reconstituted antigenic complex. Presence of multiple copies of the C-termini, particularly that of the last three C-terminal amino acid residues, in the antigenic complex appears to contribute to the immunogenic stimulus. © 2014 British Society for Immunology.

Characterization of anti-P monoclonal antibodies directed against the ribosomal protein–RNA complex antigen and produced using Murphy Roths large autoimmune-prone mice

Science.gov (United States)

Sato, H; Onozuka, M; Hagiya, A; Hoshino, S; Narita, I; Uchiumi, T

2015-01-01

Autoantibodies, including anti-ribosomal P proteins (anti-P), are thought to be produced by an antigen-driven immune response in systemic lupus erythematosus (SLE). To test this hypothesis, we reconstituted the ribosomal antigenic complex in vitro using human P0, phosphorylated P1 and P2 and a 28S rRNA fragment covering the P0 binding site, and immunized Murphy Roths large (MRL)/lrp lupus mice with this complex without any added adjuvant to generate anti-P antibodies. Using hybridoma technology, we subsequently obtained 34 clones, each producing an anti-P monoclonal antibody (mAb) that recognized the conserved C-terminal tail sequence common to all three P proteins. We also obtained two P0-specific monoclonal antibodies, but no antibody specific to P1, P2 or rRNA fragment. Two types of mAbs were found among these anti-P antibodies: one type (e.g. 9D5) reacted more strongly with the phosphorylated P1 and P2 than that with their non-phosphorylated forms, whereas the other type (e.g. 4H11) reacted equally with both phosphorylated and non-phosphorylated forms of P1/P2. Both 9D5 and 4H11 inhibited the ribosome/eukaryotic elongation factor-2 (eEF-2)-coupled guanosine triphosphate (GTP)ase activity. However, preincubation with a synthetic peptide corresponding to the C-terminal sequence common to all three P proteins, but not the peptide that lacked the last three C-terminal amino acids, mostly prevented the mAb-induced inhibition of GTPase activity. Thus, at least two types of anti-P were produced preferentially following the immunization of MRL mice with the reconstituted antigenic complex. Presence of multiple copies of the C-termini, particularly that of the last three C-terminal amino acid residues, in the antigenic complex appears to contribute to the immunogenic stimulus. PMID:25255895

Regulatory RNPs: a novel class of ribonucleoproteins that potentially contribute to ribosome heterogeneity

Directory of Open Access Journals (Sweden)

Aaron R. Poole

2017-09-01

Full Text Available Many ribonucleoproteins (RNPs, which are comprised of noncoding RNA and associated proteins, are involved in essential cellular processes such as translation and pre-mRNA splicing. One class of RNP is the small Cajal body-specific RNP (scaRNP, which contributes to the biogenesis of small nuclear RNPs (snRNPs that are central components of the spliceosome. Three scaRNAs are internally processed, generating stable nucleolus-enriched RNAs of unknown function. Here, we provide data that show that these RNAs become part of RNPs we term regulatory RNPs (regRNPs. Most modifications within rRNA (predominantly pseudouridylation and ribose 2′-O-methylation are conducted by small nucleolar RNPs (snoRNPs, and we provide evidence that the activity of at least some of these snoRNPs is under the control of regRNPs. Because modifications within rRNA can vary in different physiological or pathological situations, rRNA modifications are thought to be the major source of ribosome heterogeneity. Our identification of regRNPs thus provides a potential mechanism for how ribosome heterogeneity may be accomplished. This work also provides additional functional connections between the Cajal body and the nucleolus.

Molecular phylogenetic and scanning electron microscopical analyses places the Choanephoraceae and the Gilbertellaceae in a monophyletic group within the Mucorales (Zygomycetes, Fungi).

Science.gov (United States)

Voigt, Kerstin; Olsson, L

2008-09-01

A multi-gene genealogy based on maximum parsimony and distance analyses of the exonic genes for actin (act) and translation elongation factor 1 alpha (tef), the nuclear genes for the small (18S) and large (28S) subunit ribosomal RNA (comprising 807, 1092, 1863, 389 characters, respectively) of all 50 genera of the Mucorales (Zygomycetes) suggests that the Choanephoraceae is a monophyletic group. The monotypic Gilbertellaceae appears in close phylogenetic relatedness to the Choanephoraceae. The monophyly of the Choanephoraceae has moderate to strong support (bootstrap proportions 67% and 96% in distance and maximum parsimony analyses, respectively), whereas the monophyly of the Choanephoraceae-Gilbertellaceae clade is supported by high bootstrap values (100% and 98%). This suggests that the two families can be joined into one family, which leads to the elimination of the Gilbertellaceae as a separate family. In order to test this hypothesis single-locus neighbor-joining analyses were performed on nuclear genes of the 18S, 5.8S, 28S and internal transcribed spacer (ITS) 1 ribosomal RNA and the translation elongation factor 1 alpha (tef) and beta tubulin (betatub) nucleotide sequences. The common monophyletic origin of the Choanephoraceae-Gilbertellaceae clade could be confirmed in all gene trees and by investigation of their ultrastructure. Sporangia with persistent, sutured walls splitting in half at maturity and ellipsoidal sporangiospores with striated ornamentations and polar ciliate appendages arising from spores in persistent sporangia and dehiscent sporangiola represent synapomorphic characters of this group. We discuss our data in the context of the historical development of their taxonomy and physiology and propose a reduction of the two families to one family, the Choanephoraceae sensu lato comprising species which are facultative plant pathogens and parasites, especially in subtropical to tropical regions.