TaxCollector: Modifying Current 16S rRNA Databases for the Rapid Classification at Six Taxonomic Levels

Directory of Open Access Journals (Sweden)

Eric W. Triplett

2010-07-01

Full Text Available The high level of conservation of 16S ribosomal RNA gene (16S rRNA in all Prokaryotes makes this gene an ideal tool for the rapid identification and classification of these microorganisms. Databases such as the Ribosomal Database Project II (RDP-II and the Greengenes Project offer access to sets of ribosomal RNA sequence databases useful in identification of microbes in a culture-independent analysis of microbial communities. However, these databases do not contain all of the taxonomic levels attached to the published names of the bacterial and archaeal sequences. TaxCollector is a set of scripts developed in Python language that attaches taxonomic information to all 16S rRNA sequences in the RDP-II and Greengenes databases. These modified databases are referred to as TaxCollector databases, which when used in conjunction with BLAST allow for rapid classification of sequences from any environmental or clinical source at six different taxonomic levels, from domain to species. The TaxCollector database prepared from the RDP-II database is an important component of a new 16S rRNA pipeline called PANGEA. The usefulness of TaxCollector databases is demonstrated with two very different datasets obtained using samples from a clinical setting and an agricultural soil. The six TaxCollector scripts are freely available on http://taxcollector.sourceforge.net and on http://www.microgator.org.

The primary structures of ribosomal proteins S14 and S16 from the archaebacterium Halobacterium marismortui. Comparison with eubacterial and eukaryotic ribosomal proteins.

Science.gov (United States)

Kimura, J; Kimura, M

1987-09-05

The amino acid sequences of two ribosomal proteins, S14 and S16, from the archaebacterium Halobacterium marismortui have been determined. Sequence data were obtained by the manual and solid-phase sequencing of peptides derived from enzymatic digestions with trypsin, chymotrypsin, pepsin, and Staphylococcus aureus protease as well as by chemical cleavage with cyanogen bromide. Proteins S14 and S16 contain 109 and 126 amino acid residues and have Mr values of 11,964 and 13,515, respectively. Comparison of the sequences with those of ribosomal proteins from other organisms demonstrates that S14 has a significant homology with the rat liver ribosomal protein S11 (36% identity) as well as with the Escherichia coli ribosomal protein S17 (37%), and that S16 is related to the yeast ribosomal protein YS22 (40%) and proteins S8 from E. coli (28%) and Bacillus stearothermophilus (30%). A comparison of the amino acid residues in the homologous regions of halophilic and nonhalophilic ribosomal proteins reveals that halophilic proteins have more glutamic acids, asparatic acids, prolines, and alanines, and less lysines, arginines, and isoleucines than their nonhalophilic counterparts. These amino acid substitutions probably contribute to the structural stability of halophilic ribosomal proteins.

Isolation of temperature-sensitive mutants of 16 S rRNA in Escherichia coli

DEFF Research Database (Denmark)

Triman, K; Becker, E; Dammel, C

1989-01-01

Temperature-sensitive mutants have been isolated following hydroxylamine mutagenesis of a plasmid containing Escherichia coli rRNA genes carrying selectable markers for spectinomycin resistance (U1192 in 16 S rRNA) and erythromycin resistance (G2058 in 23 S rRNA). These antibiotic resistance....... The mutations were localized by in vitro restriction fragment replacement followed by in vivo marker rescue and were identified by DNA sequence analysis. We report here seven single-base alterations in 16 S rRNA (A146, U153, A350, A359, A538, A1292 and U1293), five of which produce temperature......-sensitive spectinomycin resistance and two that produce unconditional loss of resistance. In each case, loss of ribosomal function can be accounted for by disruption of base-pairing in the secondary structure of 16 S rRNA. For the temperature-sensitive mutants, there is a lag period of about two generations between...

The ribosome structure controls and directs mRNA entry, translocation and exit dynamics

International Nuclear Information System (INIS)

Kurkcuoglu, Ozge; Doruker, Pemra; Jernigan, Robert L; Sen, Taner Z; Kloczkowski, Andrzej

2008-01-01

The protein-synthesizing ribosome undergoes large motions to effect the translocation of tRNAs and mRNA; here, the domain motions of this system are explored with a coarse-grained elastic network model using normal mode analysis. Crystal structures are used to construct various model systems of the 70S complex with/without tRNA, elongation factor Tu and the ribosomal proteins. Computed motions reveal the well-known ratchet-like rotational motion of the large subunits, as well as the head rotation of the small subunit and the high flexibility of the L1 and L7/L12 stalks, even in the absence of ribosomal proteins. This result indicates that these experimentally observed motions during translocation are inherently controlled by the ribosomal shape and only partially dependent upon GTP hydrolysis. Normal mode analysis further reveals the mobility of A- and P-tRNAs to increase in the absence of the E-tRNA. In addition, the dynamics of the E-tRNA is affected by the absence of the ribosomal protein L1. The mRNA in the entrance tunnel interacts directly with helicase proteins S3 and S4, which constrain the mRNA in a clamp-like fashion, as well as with protein S5, which likely orients the mRNA to ensure correct translation. The ribosomal proteins S7, S11 and S18 may also be involved in assuring translation fidelity by constraining the mRNA at the exit site of the channel. The mRNA also interacts with the 16S 3' end forming the Shine–Dalgarno complex at the initiation step; the 3' end may act as a 'hook' to reel in the mRNA to facilitate its exit

Retrieval of a million high-quality, full-length microbial 16S and 18S rRNA gene sequences without primer bias

DEFF Research Database (Denmark)

Karst, Søren Michael; Dueholm, Morten Simonsen; McIlroy, Simon Jon

2018-01-01

Small subunit ribosomal RNA (SSU rRNA) genes, 16S in bacteria and 18S in eukaryotes, have been the standard phylogenetic markers used to characterize microbial diversity and evolution for decades. However, the reference databases of full-length SSU rRNA gene sequences are skewed to well-studied e...

Oxidative damage of 18S and 5S ribosomal RNA in digestive gland of mussels exposed to trace metals.

Science.gov (United States)

Kournoutou, Georgia G; Giannopoulou, Panagiota C; Sazakli, Eleni; Leotsinidis, Michel; Kalpaxis, Dimitrios L

2017-11-01

Numerous studies have shown the ability of trace metals to accumulate in marine organisms and cause oxidative stress that leads to perturbations in many important intracellular processes, including protein synthesis. This study is mainly focused on the exploration of structural changes, like base modifications, scissions, and conformational changes, caused in 18S and 5S ribosomal RNA (rRNA) isolated from the mussel Mytilus galloprovincialis exposed to 40μg/L Cu, 30μg/L Hg, or 100μg/L Cd, for 5 or 15days. 18S rRNA and 5S rRNA are components of the small and large ribosomal subunit, respectively, found in complex with ribosomal proteins, translation factors and other auxiliary components (metal ions, toxins etc). 18S rRNA plays crucial roles in all stages of protein synthesis, while 5S rRNA serves as a master signal transducer between several functional regions of 28S rRNA. Therefore, structural changes in these ribosomal constituents could affect the basic functions of ribosomes and hence the normal metabolism of cells. Especially, 18S rRNA along with ribosomal proteins forms the decoding centre that ensures the correct codon-anticodon pairing. As exemplified by ELISA, primer extension analysis and DMS footprinting analysis, each metal caused oxidative damage to rRNA, depending on the nature of metal ion and the duration of exposure. Interestingly, exposure of mussels to Cu or Hg caused structural alterations in 5S rRNA, localized in paired regions and within loops A, B, C, and E, leading to a continuous progressive loss of the 5S RNA structural integrity. In contrast, structural impairments of 5S rRNA in mussels exposed to Cd were accumulating for the initial 5days, and then progressively decreased to almost the normal level by day 15, probably due to the parallel elevation of metallothionein content that depletes the pools of free Cd. Regions of interest in 18S rRNA, such as the decoding centre, sites implicated in the binding of tRNAs (A- and P-sites) or

Methyltransferase That Modifies Guanine 966 of the 16 S rRNA: FUNCTIONAL IDENTIFICATION AND TERTIARY STRUCTURE*

Science.gov (United States)

Lesnyak, Dmitry V.; Osipiuk, Jerzy; Skarina, Tatiana; Sergiev, Petr V.; Bogdanov, Alexey A.; Edwards, Aled; Savchenko, Alexei; Joachimiak, Andrzej; Dontsova, Olga A.

2010-01-01

N2-Methylguanine 966 is located in the loop of Escherichia coli 16 S rRNA helix 31, forming a part of the P-site tRNA-binding pocket. We found yhhF to be a gene encoding for m2G966 specific 16 S rRNA methyltransferase. Disruption of the yhhF gene by kanamycin resistance marker leads to a loss of modification at G966. The modification could be rescued by expression of recombinant protein from the plasmid carrying the yhhF gene. Moreover, purified m2G966 methyltransferase, in the presence of S-adenosylomethionine (AdoMet), is able to methylate 30 S ribosomal subunits that were purified from yhhF knock-out strain in vitro. The methylation is specific for G966 base of the 16 S rRNA. The m2G966 methyltransferase was crystallized, and its structure has been determined and refined to 2.05 Å. The structure closely resembles RsmC rRNA methyltransferase, specific for m2G1207 of the 16 S rRNA. Structural comparisons and analysis of the enzyme active site suggest modes for binding AdoMet and rRNA to m2G966 methyltransferase. Based on the experimental data and current nomenclature the protein expressed from the yhhF gene was renamed to RsmD. A model for interaction of RsmD with ribosome has been proposed. PMID:17189261

Methyltransferase that modifies guanine 966 of the 16 S rRNA: functional identification and tertiary structure.

Science.gov (United States)

Lesnyak, Dmitry V; Osipiuk, Jerzy; Skarina, Tatiana; Sergiev, Petr V; Bogdanov, Alexey A; Edwards, Aled; Savchenko, Alexei; Joachimiak, Andrzej; Dontsova, Olga A

2007-02-23

N(2)-Methylguanine 966 is located in the loop of Escherichia coli 16 S rRNA helix 31, forming a part of the P-site tRNA-binding pocket. We found yhhF to be a gene encoding for m(2)G966 specific 16 S rRNA methyltransferase. Disruption of the yhhF gene by kanamycin resistance marker leads to a loss of modification at G966. The modification could be rescued by expression of recombinant protein from the plasmid carrying the yhhF gene. Moreover, purified m(2)G966 methyltransferase, in the presence of S-adenosylomethionine (AdoMet), is able to methylate 30 S ribosomal subunits that were purified from yhhF knock-out strain in vitro. The methylation is specific for G966 base of the 16 S rRNA. The m(2)G966 methyltransferase was crystallized, and its structure has been determined and refined to 2.05A(.) The structure closely resembles RsmC rRNA methyltransferase, specific for m(2)G1207 of the 16 S rRNA. Structural comparisons and analysis of the enzyme active site suggest modes for binding AdoMet and rRNA to m(2)G966 methyltransferase. Based on the experimental data and current nomenclature the protein expressed from the yhhF gene was renamed to RsmD. A model for interaction of RsmD with ribosome has been proposed.

5S Ribosomal RNA Is an Essential Component of a Nascent Ribosomal Precursor Complex that Regulates the Hdm2-p53 Checkpoint

Directory of Open Access Journals (Sweden)

Giulio Donati

2013-07-01

Full Text Available Recently, we demonstrated that RPL5 and RPL11 act in a mutually dependent manner to inhibit Hdm2 and stabilize p53 following impaired ribosome biogenesis. Given that RPL5 and RPL11 form a preribosomal complex with noncoding 5S ribosomal RNA (rRNA and the three have been implicated in the p53 response, we reasoned they may be part of an Hdm2-inhibitory complex. Here, we show that small interfering RNAs directed against 5S rRNA have no effect on total or nascent levels of the noncoding rRNA, though they prevent the reported Hdm4 inhibition of p53. To achieve efficient inhibition of 5S rRNA synthesis, we targeted TFIIIA, a specific RNA polymerase III cofactor, which, like depletion of either RPL5 or RPL11, did not induce p53. Instead, 5S rRNA acts in a dependent manner with RPL5 and RPL11 to inhibit Hdm2 and stabilize p53. Moreover, depletion of any one of the three components abolished the binding of the other two to Hdm2, explaining their common dependence. Finally, we demonstrate that the RPL5/RPL11/5S rRNA preribosomal complex is redirected from assembly into nascent 60S ribosomes to Hdm2 inhibition as a consequence of impaired ribosome biogenesis. Thus, the activation of the Hdm2-inhibitory complex is not a passive but a regulated event, whose potential role in tumor suppression has been recently noted.

5S ribosomal RNA is an essential component of a nascent ribosomal precursor complex that regulates the Hdm2-p53 checkpoint.

Science.gov (United States)

Donati, Giulio; Peddigari, Suresh; Mercer, Carol A; Thomas, George

2013-07-11

Recently, we demonstrated that RPL5 and RPL11 act in a mutually dependent manner to inhibit Hdm2 and stabilize p53 following impaired ribosome biogenesis. Given that RPL5 and RPL11 form a preribosomal complex with noncoding 5S ribosomal RNA (rRNA) and the three have been implicated in the p53 response, we reasoned they may be part of an Hdm2-inhibitory complex. Here, we show that small interfering RNAs directed against 5S rRNA have no effect on total or nascent levels of the noncoding rRNA, though they prevent the reported Hdm4 inhibition of p53. To achieve efficient inhibition of 5S rRNA synthesis, we targeted TFIIIA, a specific RNA polymerase III cofactor, which, like depletion of either RPL5 or RPL11, did not induce p53. Instead, 5S rRNA acts in a dependent manner with RPL5 and RPL11 to inhibit Hdm2 and stabilize p53. Moreover, depletion of any one of the three components abolished the binding of the other two to Hdm2, explaining their common dependence. Finally, we demonstrate that the RPL5/RPL11/5S rRNA preribosomal complex is redirected from assembly into nascent 60S ribosomes to Hdm2 inhibition as a consequence of impaired ribosome biogenesis. Thus, the activation of the Hdm2-inhibitory complex is not a passive but a regulated event, whose potential role in tumor suppression has been recently noted. Copyright © 2013 The Authors. Published by Elsevier Inc. All rights reserved.

Biological significance of 5S rRNA import into human mitochondria: role of ribosomal protein MRP-L18

Science.gov (United States)

Smirnov, Alexandre; Entelis, Nina; Martin, Robert P.; Tarassov, Ivan

2011-01-01

5S rRNA is an essential component of ribosomes of all living organisms, the only known exceptions being mitochondrial ribosomes of fungi, animals, and some protists. An intriguing situation distinguishes mammalian cells: Although the mitochondrial genome contains no 5S rRNA genes, abundant import of the nuclear DNA-encoded 5S rRNA into mitochondria was reported. Neither the detailed mechanism of this pathway nor its rationale was clarified to date. In this study, we describe an elegant molecular conveyor composed of a previously identified human 5S rRNA import factor, rhodanese, and mitochondrial ribosomal protein L18, thanks to which 5S rRNA molecules can be specifically withdrawn from the cytosolic pool and redirected to mitochondria, bypassing the classic nucleolar reimport pathway. Inside mitochondria, the cytosolic 5S rRNA is shown to be associated with mitochondrial ribosomes. PMID:21685364

16S Ribosomal DNA Characterization of Nitrogen-Fixing Bacteria Isolated from Banana (Musa spp.) and Pineapple (Ananas comosus (L.) Merril)

Science.gov (United States)

Magalhães Cruz, Leonardo; Maltempi de Souza, Emanuel; Weber, Olmar Baler; Baldani, José Ivo; Döbereiner, Johanna; de Oliveira Pedrosa, Fábio

2001-01-01

Nitrogen-fixing bacteria isolated from banana (Musa spp.) and pineapple (Ananas comosus (L.) Merril) were characterized by amplified 16S ribosomal DNA restriction analysis and 16S rRNA sequence analysis. Herbaspirillum seropedicae, Herbaspirillum rubrisubalbicans, Burkholderia brasilensis, and Burkholderia tropicalis were identified. Eight other types were placed in close proximity to these genera and other alpha and beta Proteobacteria. PMID:11319127

Defining the structural requirements for a helix in 23 S ribosomal RNA that confers erythromycin resistance

DEFF Research Database (Denmark)

Douthwaite, S; Powers, T; Lee, J Y

1989-01-01

The helix spanning nucleotides 1198 to 1247 (helix 1200-1250) in Escherichia coli 23 S ribosomal RNA (rRNA) is functionally important in protein synthesis, and deletions in this region confer erythromycin resistance. In order to define the structural requirements for resistance, we have dissected...... deletion mutants show a sensitive phenotype. Deletions that extend into the base-pairing between GCC1208 and GGU1240 result in non-functional 23 S RNAs, which consequently do not confer resistance. A number of phylogenetically conserved nucleotides have been shown to be non-essential for 23 S RNA function....... However, removal of either these or non-conserved nucleotides from helix 1200-1250 measurably reduces the efficiency of 23 S RNA in forming functional ribosomes. We have used chemical probing and a modified primer extension method to investigate erythromycin binding to wild-type and resistant ribosomes...

Amplification and sequence analysis of partial bacterial 16S ribosomal RNA gene in gallbladder bile from patients with primary biliary cirrhosis.

Science.gov (United States)

Hiramatsu, K; Harada, K; Tsuneyama, K; Sasaki, M; Fujita, S; Hashimoto, T; Kaneko, S; Kobayashi, K; Nakanuma, Y

2000-07-01

The etiopathogenesis of bile duct lesion in primary biliary cirrhosis is unknown, though the participation of bacteria and/or their components and products is suspected. In this study, we tried to detect and identify bacteria in the bile of patients with primary biliary cirrhosis by polymerase chain reaction using universal bacterial primers of the 16S ribosomal RNA gene. Gallbladder bile samples from 15 patients with primary biliary cirrhosis, 5 with primary sclerosing cholangitis, 5 with hepatitis C virus-related liver cirrhosis, 11 with cholecystolithiasis, and from 12 normal adult gallbladders were used. In addition to the culture study, partial bacterial 16S ribosomal RNA gene was amplified by polymerase chain reaction (PCR) taking advantage of universal primers that can amplify the gene of almost all bacterial species, and the amplicons were cloned and sequenced. Sequence homology with specific bacterial species was analyzed by database research. Bacterial contamination at every step of the bile sampling, DNA extraction and PCR study was avoided. Furthermore, to confirm whether bacterial DNA is detectable in liver explants, the same analysis was performed using 10 liver explants of patients with primary biliary cirrhosis. In primary biliary cirrhosis, 75% (p<0.0001) of 100 clones were identified as so-called gram-positive cocci while these cocci were positive in only 5% in cholecystolithiasis (p<0.0001). In cholecystolithiasis gram-negative rods were predominant instead. One bacterial species detected in a normal adult was not related to those detected in primary biliary cirrhosis and cholecystolithiasis patients. No bacterial DNA was detected by PCR amplification in 10 liver explants of patients with primary biliary cirrhosis. The present results raise several possible roles of gram-positive bacteria in bile in the etiopathogenesis of primary biliary cirrhosis. However, these results could also reflect an epiphenomenon due to decreased bile flow in the

Mutational analysis of S12 protein and implications for the accuracy of decoding by the ribosome.

Science.gov (United States)

Sharma, Divya; Cukras, Anthony R; Rogers, Elizabeth J; Southworth, Daniel R; Green, Rachel

2007-12-07

The fidelity of aminoacyl-tRNA selection by the ribosome depends on a conformational switch in the decoding center of the small ribosomal subunit induced by cognate but not by near-cognate aminoacyl-tRNA. The aminoglycosides paromomycin and streptomycin bind to the decoding center and induce related structural rearrangements that explain their observed effects on miscoding. Structural and biochemical studies have identified ribosomal protein S12 (as well as specific nucleotides in 16S ribosomal RNA) as a critical molecular contributor in distinguishing between cognate and near-cognate tRNA species as well as in promoting more global rearrangements in the small subunit, referred to as "closure." Here we use a mutational approach to define contributions made by two highly conserved loops in S12 to the process of tRNA selection. Most S12 variant ribosomes tested display increased levels of fidelity (a "restrictive" phenotype). Interestingly, several variants, K42A and R53A, were substantially resistant to the miscoding effects of paromomycin. Further characterization of the compromised paromomycin response identified a probable second, fidelity-modulating binding site for paromomycin in the 16S ribosomal RNA that facilitates closure of the small subunit and compensates for defects associated with the S12 mutations.

18S Ribosomal RNA Evaluation as Preanalytical Quality Control for Animal DNA

Directory of Open Access Journals (Sweden)

Cory Ann Leonard

2016-01-01

Full Text Available The 18S ribosomal RNA (rRNA gene is present in all eukaryotic cells. In this study, we evaluated the use of this gene to verify the presence of PCR-amplifiable host (animal DNA as an indicator of sufficient sample quality for quantitative real-time PCR (qPCR analysis. We compared (i samples from various animal species, tissues, and sample types, including swabs; (ii multiple DNA extraction methods; and (iii both fresh and formalin-fixed paraffin-embedded (FFPE samples. Results showed that 18S ribosomal RNA gene amplification was possible from all tissue samples evaluated, including avian, reptile, and FFPE samples and most swab samples. A single swine rectal swab, which showed sufficient DNA quantity and the demonstrated lack of PCR inhibitors, nonetheless was negative by 18S qPCR. Such a sample specifically illustrates the improvement of determination of sample integrity afforded by inclusion of 18S rRNA gene qPCR analysis in addition to spectrophotometric analysis and the use of internal controls for PCR inhibition. Other possible applications for the described 18S rRNA qPCR are preselection of optimal tissue specimens for studies or preliminary screening of archived samples prior to acceptance for biobanking projects.

The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus.

Science.gov (United States)

Hori, H; Osawa, S; Murao, K; Ishikura, H

1980-01-01

The nucleotide sequence of ribosomal 5S RNA from Micrococcus lysodeikticus is pGUUACGGCGGCUAUAGCGUGGGGGAAACGCCCGGCCGUAUAUCGAACCCGGAAGCUAAGCCCCAUAGCGCCGAUGGUUACUGUAACCGGGAGGUUGUGGGAGAGUAGGUCGCCGCCGUGAOH. When compared to other 5S RNAs, the sequence homology is greatest with Thermus aquaticus, and these two 5S RNAs reveal several features intermediate between those of typical gram-positive bacteria and gram-negative bacteria. PMID:6780979

Detailed analysis of RNA-protein interactions within the bacterial ribosomal protein L5/5S rRNA complex.

Science.gov (United States)

Perederina, Anna; Nevskaya, Natalia; Nikonov, Oleg; Nikulin, Alexei; Dumas, Philippe; Yao, Min; Tanaka, Isao; Garber, Maria; Gongadze, George; Nikonov, Stanislav

2002-12-01

The crystal structure of ribosomal protein L5 from Thermus thermophilus complexed with a 34-nt fragment comprising helix III and loop C of Escherichia coli 5S rRNA has been determined at 2.5 A resolution. The protein specifically interacts with the bulged nucleotides at the top of loop C of 5S rRNA. The rRNA and protein contact surfaces are strongly stabilized by intramolecular interactions. Charged and polar atoms forming the network of conserved intermolecular hydrogen bonds are located in two narrow planar parallel layers belonging to the protein and rRNA, respectively. The regions, including these atoms conserved in Bacteria and Archaea, can be considered an RNA-protein recognition module. Comparison of the T. thermophilus L5 structure in the RNA-bound form with the isolated Bacillus stearothermophilus L5 structure shows that the RNA-recognition module on the protein surface does not undergo significant changes upon RNA binding. In the crystal of the complex, the protein interacts with another RNA molecule in the asymmetric unit through the beta-sheet concave surface. This protein/RNA interface simulates the interaction of L5 with 23S rRNA observed in the Haloarcula marismortui 50S ribosomal subunit.

Ribosomal proteins L11 and L10.(L12)4 and the antibiotic thiostrepton interact with overlapping regions of the 23 S rRNA backbone in the ribosomal GTPase centre

DEFF Research Database (Denmark)

Rosendahl, G; Douthwaite, S

1993-01-01

RNA, and to investigate how this interaction is influenced by other ribosomal components. Complexes were characterized in both naked 23 S rRNA and ribosomes from an E. coli L11-minus strain, before and after reconstitution with L11. The protein protects 17 riboses between positions 1058 and 1085 in the naked 23 S r......The Escherichia coli ribosomal protein (r-protein) L11 and its binding site on 23 S ribosomal RNA (rRNA) are associated with ribosomal hydrolysis of guanosine 5'-triphosphate (GTP). We have used hydroxyl radical footprinting to map the contacts between L11 and the backbone riboses in 23 S r......)4 and other proteins within the ribosome. The antibiotics thiostrepton and micrococcin inhibit the catalytic functions of this region by slotting in between the accessible loops and interacting with nucleotides there....

Problem-Based Test: Functional Analysis of Mutant 16S rRNAs

Science.gov (United States)

Szeberenyi, Jozsef

2010-01-01

Terms to be familiar with before you start to solve the test: ribosome, ribosomal subunits, antibiotics, point mutation, 16S, 5S, and 23S rRNA, Shine-Dalgarno sequence, mRNA, tRNA, palindrome, hairpin, restriction endonuclease, fMet-tRNA, peptidyl transferase, initiation, elongation, termination of translation, expression plasmid, transformation,…

The pre-existing population of 5S rRNA effects p53 stabilization during ribosome biogenesis inhibition.

Science.gov (United States)

Onofrillo, Carmine; Galbiati, Alice; Montanaro, Lorenzo; Derenzini, Massimo

2017-01-17

Pre-ribosomal complex RPL5/RPL11/5S rRNA (5S RNP) is considered the central MDM2 inhibitory complex that control p53 stabilization during ribosome biogenesis inhibition. Despite its role is well defined, the dynamic of 5S RNP assembly still requires further characterization. In the present work, we report that MDM2 inhibition is dependent by a pre-existing population of 5S rRNA.

Molecular characterization of 5S ribosomal RNA genes and transcripts in the protozoan parasite Leishmania major.

Science.gov (United States)

Moreno-Campos, Rodrigo; Florencio-Martínez, Luis E; Nepomuceno-Mejía, Tomás; Rojas-Sánchez, Saúl; Vélez-Ramírez, Daniel E; Padilla-Mejía, Norma E; Figueroa-Angulo, Elisa; Manning-Cela, Rebeca; Martínez-Calvillo, Santiago

2016-12-01

Eukaryotic 5S rRNA, synthesized by RNA polymerase III (Pol III), is an essential component of the large ribosomal subunit. Most organisms contain hundreds of 5S rRNA genes organized into tandem arrays. However, the genome of the protozoan parasite Leishmania major contains only 11 copies of the 5S rRNA gene, which are interspersed and associated with other Pol III-transcribed genes. Here we report that, in general, the number and order of the 5S rRNA genes is conserved between different species of Leishmania. While in most organisms 5S rRNA genes are normally associated with the nucleolus, combined fluorescent in situ hybridization and indirect immunofluorescence experiments showed that 5S rRNA genes are mainly located at the nuclear periphery in L. major. Similarly, the tandemly repeated 5S rRNA genes in Trypanosoma cruzi are dispersed throughout the nucleus. In contrast, 5S rRNA transcripts in L. major were localized within the nucleolus, and scattered throughout the cytoplasm, where mature ribosomes are located. Unlike other rRNA species, stable antisense RNA complementary to 5S rRNA is not detected in L. major.

Structural insights into methyltransferase KsgA function in 30S ribosomal subunit biogenesis.

Science.gov (United States)

Boehringer, Daniel; O'Farrell, Heather C; Rife, Jason P; Ban, Nenad

2012-03-23

The assembly of the ribosomal subunits is facilitated by ribosome biogenesis factors. The universally conserved methyltransferase KsgA modifies two adjacent adenosine residues in the 3'-terminal helix 45 of the 16 S ribosomal RNA (rRNA). KsgA recognizes its substrate adenosine residues only in the context of a near mature 30S subunit and is required for the efficient processing of the rRNA termini during ribosome biogenesis. Here, we present the cryo-EM structure of KsgA bound to a nonmethylated 30S ribosomal subunit. The structure reveals that KsgA binds to the 30S platform with the catalytic N-terminal domain interacting with substrate adenosine residues in helix 45 and the C-terminal domain making extensive contacts to helix 27 and helix 24. KsgA excludes the penultimate rRNA helix 44 from adopting its position in the mature 30S subunit, blocking the formation of the decoding site and subunit joining. We suggest that the activation of methyltransferase activity and subsequent dissociation of KsgA control conformational changes in helix 44 required for final rRNA processing and translation initiation.

Structural Insights into Methyltransferase KsgA Function in 30S Ribosomal Subunit Biogenesis*

Science.gov (United States)

Boehringer, Daniel; O'Farrell, Heather C.; Rife, Jason P.; Ban, Nenad

2012-01-01

The assembly of the ribosomal subunits is facilitated by ribosome biogenesis factors. The universally conserved methyltransferase KsgA modifies two adjacent adenosine residues in the 3′-terminal helix 45 of the 16 S ribosomal RNA (rRNA). KsgA recognizes its substrate adenosine residues only in the context of a near mature 30S subunit and is required for the efficient processing of the rRNA termini during ribosome biogenesis. Here, we present the cryo-EM structure of KsgA bound to a nonmethylated 30S ribosomal subunit. The structure reveals that KsgA binds to the 30S platform with the catalytic N-terminal domain interacting with substrate adenosine residues in helix 45 and the C-terminal domain making extensive contacts to helix 27 and helix 24. KsgA excludes the penultimate rRNA helix 44 from adopting its position in the mature 30S subunit, blocking the formation of the decoding site and subunit joining. We suggest that the activation of methyltransferase activity and subsequent dissociation of KsgA control conformational changes in helix 44 required for final rRNA processing and translation initiation. PMID:22308031

The SmpB C-terminal tail helps tmRNA to recognize and enter stalled ribosomes

Directory of Open Access Journals (Sweden)

Mickey R. Miller

2014-09-01

Full Text Available In bacteria, transfer-messenger RNA (tmRNA and SmpB comprise the most common and effective system for rescuing stalled ribosomes. Ribosomes stall on mRNA transcripts lacking stop codons and are rescued as the defective mRNA is swapped for the tmRNA template in a process known as trans-translation. The tmRNA–SmpB complex is recruited to the ribosome independent of a codon–anticodon interaction. Given that the ribosome uses robust discriminatory mechanisms to select against non-cognate tRNAs during canonical decoding, it has been hard to explain how this can happen. Recent structural and biochemical studies show that SmpB licenses tmRNA entry through its interactions with the decoding center and mRNA channel. In particular, the C-terminal tail of SmpB promotes both EFTu activation and accommodation of tmRNA, the former through interactions with 16S rRNA nucleotide G530 and the latter through interactions with the mRNA channel downstream of the A site. Here we present a detailed model of the earliest steps in trans-translation, and in light of these mechanistic considerations, revisit the question of how tmRNA preferentially reacts with stalled, non-translating ribosomes.

Assessing the 5S ribosomal RNA heterogeneity in Arabidopsis thaliana using short RNA next generation sequencing data.

Science.gov (United States)

Szymanski, Maciej; Karlowski, Wojciech M

2016-01-01

In eukaryotes, ribosomal 5S rRNAs are products of multigene families organized within clusters of tandemly repeated units. Accumulation of genomic data obtained from a variety of organisms demonstrated that the potential 5S rRNA coding sequences show a large number of variants, often incompatible with folding into a correct secondary structure. Here, we present results of an analysis of a large set of short RNA sequences generated by the next generation sequencing techniques, to address the problem of heterogeneity of the 5S rRNA transcripts in Arabidopsis and identification of potentially functional rRNA-derived fragments.

A ribosome without RNA

Directory of Open Access Journals (Sweden)

Harold S Bernhardt

2015-11-01

Full Text Available It was Francis Crick who first asked why the ribosome contains so much RNA, and discussed the implications of this for the direct flow of genetic information from DNA to protein. Remarkable advances in our understanding of the ribosome and protein synthesis, including the recent publication of two mammalian mitochondrial ribosome structures, have shed new light on this intriguing aspect of evolution in molecular biology. We examine here whether RNA is indispensable for coded protein synthesis, or whether an all-protein ‘ribosome’ (or ‘synthosome’ might be possible, with a protein enzyme catalyzing peptide synthesis, and release factor-like protein adaptors able to read a message composed of deoxyribonucleotides. We also compare the RNA world hypothesis with the alternative ‘proteins first’ hypothesis in terms of their different understandings of the evolution of the ribosome, and whether this might have been preceded by an ancestral form of nonribosomal peptide synthesis catalyzed by protein enzymes.

Sequence characterization of 5S ribosomal RNA from eight gram positive procaryotes

Science.gov (United States)

Woese, C. R.; Luehrsen, K. R.; Pribula, C. D.; Fox, G. E.

1976-01-01

Complete nucleotide sequences are presented for 5S rRNA from Bacillus subtilis, B. firmus, B. pasteurii, B. brevis, Lactobacillus brevis, and Streptococcus faecalis, and 5S rRNA oligonucleotide catalogs and partial sequence data are given for B. cereus and Sporosarcina ureae. These data demonstrate a striking consistency of 5S rRNA primary and secondary structure within a given bacterial grouping. An exception is B. brevis, in which the 5S rRNA sequence varies significantly from that of other bacilli in the tuned helix and the procaryotic loop. The localization of these variations suggests that B. brevis occupies an ecological niche that selects such changes. It is noted that this organism produces antibiotics which affect ribosome function.

Translational regulation of ribosomal protein S15 drives characteristic patterns of protein-mRNA epistasis.

Science.gov (United States)

Mallik, Saurav; Basu, Sudipto; Hait, Suman; Kundu, Sudip

2018-04-21

Do coding and regulatory segments of a gene co-evolve with each-other? Seeking answers to this question, here we analyze the case of Escherichia coli ribosomal protein S15, that represses its own translation by specifically binding its messenger RNA (rpsO mRNA) and stabilizing a pseudoknot structure at the upstream untranslated region, thus trapping the ribosome into an incomplete translation initiation complex. In the absence of S15, ribosomal protein S1 recognizes rpsO and promotes translation by melting this very pseudoknot. We employ a robust statistical method to detect signatures of positive epistasis between residue site pairs and find that biophysical constraints of translational regulation (S15-rpsO and S1-rpsO recognition, S15-mediated rpsO structural rearrangement, and S1-mediated melting) are strong predictors of positive epistasis. Transforming the epistatic pairs into a network, we find that signatures of two different, but interconnected regulatory cascades are imprinted in the sequence-space and can be captured in terms of two dense network modules that are sparsely connected to each other. This network topology further reflects a general principle of how functionally coupled components of biological networks are interconnected. These results depict a model case, where translational regulation drives characteristic residue-level epistasis-not only between a protein and its own mRNA but also between a protein and the mRNA of an entirely different protein. © 2018 Wiley Periodicals, Inc.

Interaction of tRNA with Eukaryotic Ribosome

Directory of Open Access Journals (Sweden)

Dmitri Graifer

2015-03-01

Full Text Available This paper is a review of currently available data concerning interactions of tRNAs with the eukaryotic ribosome at various stages of translation. These data include the results obtained by means of cryo-electron microscopy and X-ray crystallography applied to various model ribosomal complexes, site-directed cross-linking with the use of tRNA derivatives bearing chemically or photochemically reactive groups in the CCA-terminal fragment and chemical probing of 28S rRNA in the region of the peptidyl transferase center. Similarities and differences in the interactions of tRNAs with prokaryotic and eukaryotic ribosomes are discussed with concomitant consideration of the extent of resemblance between molecular mechanisms of translation in eukaryotes and bacteria.

Mutant forms of Escherichia coli protein L25 unable to bind to 5S rRNA are incorporated efficiently into the ribosome in vivo.

Science.gov (United States)

Anikaev, A Y; Korepanov, A P; Korobeinikova, A V; Kljashtorny, V G; Piendl, W; Nikonov, S V; Garber, M B; Gongadze, G M

2014-08-01

5S rRNA-binding ribosomal proteins of the L25 family are an evolutional acquisition of bacteria. Earlier we showed that (i) single replacements in the RNA-binding module of the protein of this family result in destabilization or complete impossibility to form a complex with 5S rRNA in vitro; (ii) ΔL25 ribosomes of Escherichia coli are less efficient in protein synthesis in vivo than the control ribosomes. In the present work, the efficiency of incorporation of the E. coli protein L25 with mutations in the 5S rRNA-binding region into the ribosome in vivo was studied. It was found that the mutations in L25 that abolish its ability to form the complex with free 5S rRNA do not prevent its correct and efficient incorporation into the ribosome. This is supported by the fact that even the presence of a very weakly retained mutant form of the protein in the ribosome has a positive effect on the activity of the translational machinery in vivo. All this suggests the existence of an alternative incorporation pathway for this protein into the ribosome, excluding the preliminary formation of the complex with 5S rRNA. At the same time, the stable L25-5S rRNA contact is important for the retention of the protein within the ribosome, and the conservative amino acid residues of the RNA-binding module play a key role in this.

Detailed analysis of RNA-protein interactions within the bacterial ribosomal protein L5/5S rRNA complex.

OpenAIRE

Perederina, Anna; Nevskaya, Natalia; Nikonov, Oleg; Nikulin, Alexei; Dumas, Philippe; Yao, Min; Tanaka, Isao; Garber, Maria; Gongadze, George; Nikonov, Stanislav

2002-01-01

The crystal structure of ribosomal protein L5 from Thermus thermophilus complexed with a 34-nt fragment comprising helix III and loop C of Escherichia coli 5S rRNA has been determined at 2.5 A resolution. The protein specifically interacts with the bulged nucleotides at the top of loop C of 5S rRNA. The rRNA and protein contact surfaces are strongly stabilized by intramolecular interactions. Charged and polar atoms forming the network of conserved intermolecular hydrogen bonds are located in ...

Cisplatin Targeting of Bacterial Ribosomal RNA Hairpins

Directory of Open Access Journals (Sweden)

Gayani N. P. Dedduwa-Mudalige

2015-09-01

Full Text Available Cisplatin is a clinically important chemotherapeutic agent known to target purine bases in nucleic acids. In addition to major deoxyribonucleic acid (DNA intrastrand cross-links, cisplatin also forms stable adducts with many types of ribonucleic acid (RNA including siRNA, spliceosomal RNAs, tRNA, and rRNA. All of these RNAs play vital roles in the cell, such as catalysis of protein synthesis by rRNA, and therefore serve as potential drug targets. This work focused on platination of two highly conserved RNA hairpins from E. coli ribosomes, namely pseudouridine-modified helix 69 from 23S rRNA and the 790 loop of helix 24 from 16S rRNA. RNase T1 probing, MALDI mass spectrometry, and dimethyl sulfate mapping revealed platination at GpG sites. Chemical probing results also showed platination-induced RNA structural changes. These findings reveal solvent and structural accessibility of sites within bacterial RNA secondary structures that are functionally significant and therefore viable targets for cisplatin as well as other classes of small molecules. Identifying target preferences at the nucleotide level, as well as determining cisplatin-induced RNA conformational changes, is important for the design of more potent drug molecules. Furthermore, the knowledge gained through studies of RNA-targeting by cisplatin is applicable to a broad range of organisms from bacteria to human.

Histone and ribosomal RNA repetitive gene clusters of the boll weevil are linked in a tandem array.

Science.gov (United States)

Roehrdanz, R; Heilmann, L; Senechal, P; Sears, S; Evenson, P

2010-08-01

Histones are the major protein component of chromatin structure. The histone family is made up of a quintet of proteins, four core histones (H2A, H2B, H3 & H4) and the linker histones (H1). Spacers are found between the coding regions. Among insects this quintet of genes is usually clustered and the clusters are tandemly repeated. Ribosomal DNA contains a cluster of the rRNA sequences 18S, 5.8S and 28S. The rRNA genes are separated by the spacers ITS1, ITS2 and IGS. This cluster is also tandemly repeated. We found that the ribosomal RNA repeat unit of at least two species of Anthonomine weevils, Anthonomus grandis and Anthonomus texanus (Coleoptera: Curculionidae), is interspersed with a block containing the histone gene quintet. The histone genes are situated between the rRNA 18S and 28S genes in what is known as the intergenic spacer region (IGS). The complete reiterated Anthonomus grandis histone-ribosomal sequence is 16,248 bp.

The use of 125iodine-labeled RNA for detection of the RNA binding to ribosomes

International Nuclear Information System (INIS)

Mori, Tomohiko; Fukuda, Mitsuru

1975-01-01

The in vitro labeling of RNA with radioactive iodine is the efficient method to obtain the RNA with high specific activity. The present paper reports on the application of this technique to the production of iodine-labeled RNA for use in the experiment of binding RNA to ribosomes. Tobacco mosaic virus (TMV) RNA was used as natural mRNA, and E. coli S-30 preparation was used as a source of ribosomes. The TMV-RNA was prepared by bentonite-phenol extraction from TMV, and the method used for the iodation of RNA was based on the procedure described by Getz et al. The iodine-labeled RNA was incubated in a cell-free protein synthesizing system (S-30) prepared from E. coli K-12. After the incubation, the reaction mixture was layered onto sucrose gradient, centrifuged, and fractionated into 18 fractions. Optical density at 260 nm was measured, and radioactivity was counted, for each fraction. The binding of mRNA to ribosomes occurred even at 0 deg C, and the occurrence of the nonspecific binding was also shown. Consequently, the specific binding, i.e. the formation of the initiation complex being involved in amino acid incorporation, may be estimated by subtracting the radioactivity associated with monosomes in the presence of both rRNA and ATA from that in the presence of rRNA only. It was shown that the iodine-labeled RNA can be used for the studies of binding RNA to ribosomes. (Kako, I.)

Molecular Characterization and Analysis of 16S Ribosomal DNA in Some Isolates of Demodex folicullorum.

Science.gov (United States)

Daneshparvar, Afrooz; Mowlavi, Gholamreza; Mirjalali, Hamed; Hajjaran, Homa; Mobedi, Iraj; Naddaf, Saeed Reza; Shidfar, Mohammadreza; Sadat Makki, Mahsa

2017-01-01

Demodicosis is one of the most prevalent skin diseases resulting from infestation by Demodex mites. This parasite usually inhabits in follicular infundibulum or sebaceous duct and transmits through close contact with an infested host. This study was carried from September 2014 to January 2016 at Tehran University of Medical Sciences, Tehran, Iran. DNA extraction and amplification of 16S ribosomal RNA was performed on four isolates, already obtained from four different patients and identified morphologically though clearing with 10% Potassium hydroxide (KOH) and microscopical examination. Amplified fragments from the isolates were compared with GeneBank database and phylogenetic analysis was carried out using MEGA6 software. A 390 bp fragment of 16S rDNA was obtained in all isolates and analysis of generated sequences showed high similarity with those submitted to GenBank, previously. Intra-species similarity and distance also showed 99.983% and 0.017, respectively, for the studied isolates. Multiple alignments of the isolates showed Single Nucleotide Polymorphisms (SNPs) in 16S rRNA fragment. Phylogenetic analysis revealed that all 4 isolates clustered with other D. folliculorum, recovered from GenBank database. Our accession numbers KF875587 and KF875589 showed more similarity together in comparison with two other studied isolates. Mitochondrial 16S rDNA is one of the most suitable molecular barcodes for identification D. folliculorum and this fragment can use for intra-species characterization of the most human-infected mites.

Molecular Characterization and Analysis of 16S Ribosomal DNA in some Isolates of Demodex folliculorum

Directory of Open Access Journals (Sweden)

Afrooz DANESHPARVAR

2017-06-01

Full Text Available Background: Demodicosis is one of the most prevalent skin diseases resulting from infestation by Demodex mites. This parasite usually inhabits in follicular infundibulum or sebaceous duct transmitted through close contact with an infested host.Methods: This study was carried from September 2014 to January 2016 at Tehran University of Medical Sciences, Tehran, Iran. DNA extraction and amplification of 16S ribosomal RNA was performed on four isolates, obtained from four patients and identified morphologically through clearing with 10% Potassium hydroxide (KOH and microscopical examination. Amplified fragments from the isolates were compared with GenBank database and phylogenetic analysis was carried out using MEGA6 software.Results: A 390 bp fragment of 16S rDNA was obtained in all isolates and analysis of generated sequences showed high similarity with those submitted to GenBank, previously. Intra-species similarity and distance also showed 99.983% and 0.017, respectively, for the studied isolates. Multiple alignments of the isolates showed Single Nucleotide Polymorphisms (SNPs in 16S rRNA fragment. Phylogenetic analysis revealed that all 4 isolates clustered with other D. folliculorum, recovered from GenBank database. Our accession numbers KF875587 and KF875589 showed more similarity together in comparison with two other studied isolates. Conclusion: Mitochondrial 16S rDNA is one of the most suitable molecular barcodes for identification D. folliculorum and this fragment can use for intra-species characterization of the most human-infected mites.

Crystal Structure of the Thermus thermophilus 16 S rRNA Methyltransferase RsmC in Complex with Cofactor and Substrate Guanosine

Energy Technology Data Exchange (ETDEWEB)

Demirci, H.; Gregory, S; Dahlberg, A; Jogl, G

2008-01-01

Post-transcriptional modification is a ubiquitous feature of ribosomal RNA in all kingdoms of life. Modified nucleotides are generally clustered in functionally important regions of the ribosome, but the functional contribution to protein synthesis is not well understood. Here we describe high resolution crystal structures for the N{sup 2}-guanine methyltransferase RsmC that modifies residue G1207 in 16 S rRNA near the decoding site of the 30 S ribosomal subunit. RsmC is a class I S-adenosyl-l-methionine-dependent methyltransferase composed of two methyltransferase domains. However, only one S-adenosyl-l-methionine molecule and one substrate molecule, guanosine, bind in the ternary complex. The N-terminal domain does not bind any cofactor. Two structures with bound S-adenosyl-l-methionine and S-adenosyl-l-homocysteine confirm that the cofactor binding mode is highly similar to other class I methyltransferases. Secondary structure elements of the N-terminal domain contribute to cofactor-binding interactions and restrict access to the cofactor-binding site. The orientation of guanosine in the active site reveals that G1207 has to disengage from its Watson-Crick base pairing interaction with C1051 in the 16 S rRNA and flip out into the active site prior to its modification. Inspection of the 30 S crystal structure indicates that access to G1207 by RsmC is incompatible with the native subunit structure, consistent with previous suggestions that this enzyme recognizes a subunit assembly intermediate.

A Listeria monocytogenes RNA helicase essential for growth and ribosomal maturation at low temperatures uses its C terminus for appropriate interaction with the ribosome.

Science.gov (United States)

Netterling, Sakura; Vaitkevicius, Karolis; Nord, Stefan; Johansson, Jörgen

2012-08-01

Listeria monocytogenes, a Gram-positive food-borne human pathogen, is able to grow at temperatures close to 0°C and is thus of great concern for the food industry. In this work, we investigated the physiological role of one DExD-box RNA helicase in Listeria monocytogenes. The RNA helicase Lmo1722 was required for optimal growth at low temperatures, whereas it was dispensable at 37°C. A Δlmo1722 strain was less motile due to downregulation of the major subunit of the flagellum, FlaA, caused by decreased flaA expression. By ribosomal fractionation experiments, it was observed that Lmo1722 was mainly associated with the 50S subunit of the ribosome. Absence of Lmo1722 decreased the fraction of 50S ribosomal subunits and mature 70S ribosomes and affected the processing of the 23S precursor rRNA. The ribosomal profile could be restored to wild-type levels in a Δlmo1722 strain expressing Lmo1722. Interestingly, the C-terminal part of Lmo1722 was redundant for low-temperature growth, motility, 23S rRNA processing, and appropriate ribosomal maturation. However, Lmo1722 lacking the C terminus showed a reduced affinity for the 50S and 70S fractions, suggesting that the C terminus is important for proper guidance of Lmo1722 to the 50S subunit. Taken together, our results show that the Listeria RNA helicase Lmo1722 is essential for growth at low temperatures, motility, and rRNA processing and is important for ribosomal maturation, being associated mainly with the 50S subunit of the ribosome.

5SRNAdb: an information resource for 5S ribosomal RNAs.

Science.gov (United States)

Szymanski, Maciej; Zielezinski, Andrzej; Barciszewski, Jan; Erdmann, Volker A; Karlowski, Wojciech M

2016-01-04

Ribosomal 5S RNA (5S rRNA) is the ubiquitous RNA component found in the large subunit of ribosomes in all known organisms. Due to its small size, abundance and evolutionary conservation 5S rRNA for many years now is used as a model molecule in studies on RNA structure, RNA-protein interactions and molecular phylogeny. 5SRNAdb (http://combio.pl/5srnadb/) is the first database that provides a high quality reference set of ribosomal 5S RNAs (5S rRNA) across three domains of life. Here, we give an overview of new developments in the database and associated web tools since 2002, including updates to database content, curation processes and user web interfaces. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

Bacterial Diversity Studies Using the 16S rRNA Gene Provide a Powerful Research-Based Curriculum for Molecular Biology Laboratory

Directory of Open Access Journals (Sweden)

Bryan E. Dutton

2002-12-01

Full Text Available We have developed a ten-week curriculum for molecular biology that uses 16S ribosomal RNA genes to characterize and compare novel bacteria from hot spring communities in Yellowstone National Park. The 16S rRNA approach bypasses selective culture-based methods. Our molecular biology course offered the opportunity for students to learn broadly applicable methods while contributing to a long-term research project. Specifically, students isolated and characterized clones that contained novel 16S rRNA inserts using restriction enzyme, DNA sequencing, and computer-based phylogenetic methods. In both classes, students retrieved novel bacterial 16S rRNA genes, several of which were most similar to Green Nonsulfur bacterial isolates. During class, we evaluated student performance and mastery of skills and concepts using quizzes, formal lab notebooks, and a broad project assignment. For this report, we also assessed student performance alongside data quality and discussed the significance, our goal being to improve both research and teaching methods.

Structural Studies of RNA Helicases Involved in Eukaryotic Pre-mRNA Splicing, Ribosome Biogenesis, and Translation Initiation

DEFF Research Database (Denmark)

He, Yangzi

and ligates the neighbouring exons to generate mature mRNAs. Prp43 is an RNA helicase of the DEAH/RHA family. In yeast, once mRNAs are released, Prp43 catalyzes the disassembly of spliceosomes. The 18S, 5.8S and 25S rRNAs are transcribed as a single polycistronic transcript—the 35S pre......-rRNA. It is nucleolytically cleaved and chemically modified to generate mature rRNAs, which assemble with ribosomal proteins to form the ribosome. Prp43 is required for the processing of the 18S rRNA. Using X-ray crystallography, I determined a high resolution structure of Prp43 bound to ADP, the first structure of a DEAH....../RHA helicase. It defined the conserved structural features of all DEAH/RHA helicases, and unveiled a novel nucleotide binding site. Additionally a preliminary low resolution structure of a ternary complex comprising Prp43, a non-hydrolyzable ATP analogue, and a single-stranded RNA, was obtained. The ribosome...

Identification and characterization of rhizospheric microbial diversity by 16S ribosomal RNA gene sequencing

Directory of Open Access Journals (Sweden)

Muhammad Naveed

2014-09-01

Full Text Available In the present study, samples of rhizosphere and root nodules were collected from different areas of Pakistan to isolate plant growth promoting rhizobacteria. Identification of bacterial isolates was made by 16S rRNA gene sequence analysis and taxonomical confirmation on EzTaxon Server. The identified bacterial strains were belonged to 5 genera i.e. Ensifer, Bacillus, Pseudomona, Leclercia and Rhizobium. Phylogenetic analysis inferred from 16S rRNA gene sequences showed the evolutionary relationship of bacterial strains with the respective genera. Based on phylogenetic analysis, some candidate novel species were also identified. The bacterial strains were also characterized for morphological, physiological, biochemical tests and glucose dehydrogenase (gdh gene that involved in the phosphate solublization using cofactor pyrroloquinolone quinone (PQQ. Seven rhizoshperic and 3 root nodulating stains are positive for gdh gene. Furthermore, this study confirms a novel association between microbes and their hosts like field grown crops, leguminous and non-leguminous plants. It was concluded that a diverse group of bacterial population exist in the rhizosphere and root nodules that might be useful in evaluating the mechanisms behind plant microbial interactions and strains QAU-63 and QAU-68 have sequence similarity of 97 and 95% which might be declared as novel after further taxonomic characterization.

rRNA maturation in yeast cells depleted of large ribosomal subunit proteins.

Directory of Open Access Journals (Sweden)

Gisela Pöll

Full Text Available The structural constituents of the large eukaryotic ribosomal subunit are 3 ribosomal RNAs, namely the 25S, 5.8S and 5S rRNA and about 46 ribosomal proteins (r-proteins. They assemble and mature in a highly dynamic process that involves more than 150 proteins and 70 small RNAs. Ribosome biogenesis starts in the nucleolus, continues in the nucleoplasm and is completed after nucleo-cytoplasmic translocation of the subunits in the cytoplasm. In this work we created 26 yeast strains, each of which conditionally expresses one of the large ribosomal subunit (LSU proteins. In vivo depletion of the analysed LSU r-proteins was lethal and led to destabilisation and degradation of the LSU and/or its precursors. Detailed steady state and metabolic pulse labelling analyses of rRNA precursors in these mutant strains showed that LSU r-proteins can be grouped according to their requirement for efficient progression of different steps of large ribosomal subunit maturation. Comparative analyses of the observed phenotypes and the nature of r-protein-rRNA interactions as predicted by current atomic LSU structure models led us to discuss working hypotheses on i how individual r-proteins control the productive processing of the major 5' end of 5.8S rRNA precursors by exonucleases Rat1p and Xrn1p, and ii the nature of structural characteristics of nascent LSUs that are required for cytoplasmic accumulation of nascent subunits but are nonessential for most of the nuclear LSU pre-rRNA processing events.

Cis-regulatory RNA elements that regulate specialized ribosome activity.

Science.gov (United States)

Xue, Shifeng; Barna, Maria

2015-01-01

Recent evidence has shown that the ribosome itself can play a highly regulatory role in the specialized translation of specific subpools of mRNAs, in particular at the level of ribosomal proteins (RP). However, the mechanism(s) by which this selection takes place has remained poorly understood. In our recent study, we discovered a combination of unique RNA elements in the 5'UTRs of mRNAs that allows for such control by the ribosome. These mRNAs contain a Translation Inhibitory Element (TIE) that inhibits general cap-dependent translation, and an Internal Ribosome Entry Site (IRES) that relies on a specific RP for activation. The unique combination of an inhibitor of general translation and an activator of specialized translation is key to ribosome-mediated control of gene expression. Here we discuss how these RNA regulatory elements provide a new level of control to protein expression and their implications for gene expression, organismal development and evolution.

Ribosomal studies on the 70S ribosome of E.coli by means of neutron scattering; Strukturuntersuchungen am 70S-Ribosom von E.coli unter Anwendung von Neutronenstreuung

Energy Technology Data Exchange (ETDEWEB)

Burkhardt, N. [GKSS-Forschungszentrum Geesthacht GmbH (Germany). Inst. fuer Werkstofforschung

1997-12-31

Ribosomes are ribonucleo-protein complexes, which catalyse proteinbiosynthesis in all living organisms. Currently, most of the structural models of the prokaryotic 70S ribosome rely on electron microscopy and describe mainly the outer shape of the particle. Neutron scattering can provide information on the internal structure of the ribosome. Parts of the structure can be contrasted for neutrons by means of an isotopic exchange of the naturally occurring hydrogen ({sup 1}H) for deuterium ({sup 2}H), allowing direct measurements in situ. Specifically deuterium-labeled ribosomes (E. coli) were prepared and analysed with neutron scattering. The biochemical methods were established and combined to a generally applicable preparation system. This allows labeling of all ribosomal components in any combination. A systematic analysis of the protein and RNA phases resulted in the development of a new model for the 70S ribosome. This model describes not only the outer shape of the particle, but displays also an experimentally determined internal protein-RNA distribution and the border of subunits for the first time (four-phase model; resolution: 50A). Models of the 70S ribosome from other studies were evaluated and ranked according to consistency with the measured scattering data. Applying a new neutron scattering technique of particular sensitivity, the proton-spin contrast-variation, single proteins could be measured and localized. The positions of the proteins S6 and S10 were determined, providing the first coordinates of protein mass centers within the 70S ribosome. (orig.) [Deutsch] Ribosomen sind Ribonukleinsaeure-Protein Komplexe, die in allen lebenden Organismen die Proteinbiosynthese katalysieren. Strukturmodelle fuer das prokaryontische 70S-Ribosom beruhen derzeit vorwiegend auf elektronenmikroskopischen Untersuchungen und beschreiben im wesentlichen die aeussere Oberflaeche des Partikels. Informationen ueber die innere Struktur des Ribosoms koennen Messungen mit

Ribosomal studies on the 70S ribosome of E.coli by means of neutron scattering; Strukturuntersuchungen am 70S-Ribosom von E.coli unter Anwendung von Neutronenstreuung

Energy Technology Data Exchange (ETDEWEB)

Burkhardt, N [GKSS-Forschungszentrum Geesthacht GmbH (Germany). Inst. fuer Werkstofforschung

1998-12-31

Ribosomes are ribonucleo-protein complexes, which catalyse proteinbiosynthesis in all living organisms. Currently, most of the structural models of the prokaryotic 70S ribosome rely on electron microscopy and describe mainly the outer shape of the particle. Neutron scattering can provide information on the internal structure of the ribosome. Parts of the structure can be contrasted for neutrons by means of an isotopic exchange of the naturally occurring hydrogen ({sup 1}H) for deuterium ({sup 2}H), allowing direct measurements in situ. Specifically deuterium-labeled ribosomes (E. coli) were prepared and analysed with neutron scattering. The biochemical methods were established and combined to a generally applicable preparation system. This allows labeling of all ribosomal components in any combination. A systematic analysis of the protein and RNA phases resulted in the development of a new model for the 70S ribosome. This model describes not only the outer shape of the particle, but displays also an experimentally determined internal protein-RNA distribution and the border of subunits for the first time (four-phase model; resolution: 50A). Models of the 70S ribosome from other studies were evaluated and ranked according to consistency with the measured scattering data. Applying a new neutron scattering technique of particular sensitivity, the proton-spin contrast-variation, single proteins could be measured and localized. The positions of the proteins S6 and S10 were determined, providing the first coordinates of protein mass centers within the 70S ribosome. (orig.) [Deutsch] Ribosomen sind Ribonukleinsaeure-Protein Komplexe, die in allen lebenden Organismen die Proteinbiosynthese katalysieren. Strukturmodelle fuer das prokaryontische 70S-Ribosom beruhen derzeit vorwiegend auf elektronenmikroskopischen Untersuchungen und beschreiben im wesentlichen die aeussere Oberflaeche des Partikels. Informationen ueber die innere Struktur des Ribosoms koennen Messungen mit

Structural basis for ribosome protein S1 interaction with RNA in trans-translation of Mycobacterium tuberculosis.

Science.gov (United States)

Fan, Yi; Dai, Yazhuang; Hou, Meijing; Wang, Huilin; Yao, Hongwei; Guo, Chenyun; Lin, Donghai; Liao, Xinli

2017-05-27

Ribosomal protein S1 (RpsA), the largest 30S protein in ribosome, plays a significant role in translation and trans-translation. In Mycobacterium tuberculosis, the C-terminus of RpsA is known as tuberculosis drug target of pyrazinoic acid, which inhibits the interaction between MtRpsA and tmRNA in trans-translation. However, the molecular mechanism underlying the interaction of MtRpsA with tmRNA remains unknown. We herein analyzed the interaction of the C-terminal domain of MtRpsA with three RNA fragments poly(A), sMLD and pre-sMLD. NMR titration analysis revealed that the RNA binding sites on MtRpsA CTD are mainly located in the β2, β3 and β5 strands and the adjacent L3 loop of the S1 domain. Fluorescence experiments determined the MtRpsA CTD binding to RNAs are in the micromolar affinity range. Sequence analysis also revealed conserved residues in the mapped RNA binding region. Residues L304, V305, G308, F310, H322, I323, R357 and I358 were verified to be the key residues influencing the interaction between MtRpsA CTD and pre-sMLD. Molecular docking further confirmed that the poly(A)-like sequence and sMLD of tmRNA are all involved in the protein-RNA interaction, through charged interaction and hydrogen bonds. The results will be beneficial for designing new anti-tuberculosis drugs. Copyright © 2017 Elsevier Inc. All rights reserved.

International interlaboratory study comparing single organism 16S rRNA gene sequencing data: Beyond consensus sequence comparisons

Science.gov (United States)

Olson, Nathan D.; Lund, Steven P.; Zook, Justin M.; Rojas-Cornejo, Fabiola; Beck, Brian; Foy, Carole; Huggett, Jim; Whale, Alexandra S.; Sui, Zhiwei; Baoutina, Anna; Dobeson, Michael; Partis, Lina; Morrow, Jayne B.

2015-01-01

This study presents the results from an interlaboratory sequencing study for which we developed a novel high-resolution method for comparing data from different sequencing platforms for a multi-copy, paralogous gene. The combination of PCR amplification and 16S ribosomal RNA gene (16S rRNA) sequencing has revolutionized bacteriology by enabling rapid identification, frequently without the need for culture. To assess variability between laboratories in sequencing 16S rRNA, six laboratories sequenced the gene encoding the 16S rRNA from Escherichia coli O157:H7 strain EDL933 and Listeria monocytogenes serovar 4b strain NCTC11994. Participants performed sequencing methods and protocols available in their laboratories: Sanger sequencing, Roche 454 pyrosequencing®, or Ion Torrent PGM®. The sequencing data were evaluated on three levels: (1) identity of biologically conserved position, (2) ratio of 16S rRNA gene copies featuring identified variants, and (3) the collection of variant combinations in a set of 16S rRNA gene copies. The same set of biologically conserved positions was identified for each sequencing method. Analytical methods using Bayesian and maximum likelihood statistics were developed to estimate variant copy ratios, which describe the ratio of nucleotides at each identified biologically variable position, as well as the likely set of variant combinations present in 16S rRNA gene copies. Our results indicate that estimated variant copy ratios at biologically variable positions were only reproducible for high throughput sequencing methods. Furthermore, the likely variant combination set was only reproducible with increased sequencing depth and longer read lengths. We also demonstrate novel methods for evaluating variable positions when comparing multi-copy gene sequence data from multiple laboratories generated using multiple sequencing technologies. PMID:27077030

International interlaboratory study comparing single organism 16S rRNA gene sequencing data: Beyond consensus sequence comparisons

Directory of Open Access Journals (Sweden)

Nathan D. Olson

2015-03-01

Full Text Available This study presents the results from an interlaboratory sequencing study for which we developed a novel high-resolution method for comparing data from different sequencing platforms for a multi-copy, paralogous gene. The combination of PCR amplification and 16S ribosomal RNA gene (16S rRNA sequencing has revolutionized bacteriology by enabling rapid identification, frequently without the need for culture. To assess variability between laboratories in sequencing 16S rRNA, six laboratories sequenced the gene encoding the 16S rRNA from Escherichia coli O157:H7 strain EDL933 and Listeria monocytogenes serovar 4b strain NCTC11994. Participants performed sequencing methods and protocols available in their laboratories: Sanger sequencing, Roche 454 pyrosequencing®, or Ion Torrent PGM®. The sequencing data were evaluated on three levels: (1 identity of biologically conserved position, (2 ratio of 16S rRNA gene copies featuring identified variants, and (3 the collection of variant combinations in a set of 16S rRNA gene copies. The same set of biologically conserved positions was identified for each sequencing method. Analytical methods using Bayesian and maximum likelihood statistics were developed to estimate variant copy ratios, which describe the ratio of nucleotides at each identified biologically variable position, as well as the likely set of variant combinations present in 16S rRNA gene copies. Our results indicate that estimated variant copy ratios at biologically variable positions were only reproducible for high throughput sequencing methods. Furthermore, the likely variant combination set was only reproducible with increased sequencing depth and longer read lengths. We also demonstrate novel methods for evaluating variable positions when comparing multi-copy gene sequence data from multiple laboratories generated using multiple sequencing technologies.

Chaperoning 5S RNA assembly.

Science.gov (United States)

Madru, Clément; Lebaron, Simon; Blaud, Magali; Delbos, Lila; Pipoli, Juliana; Pasmant, Eric; Réty, Stéphane; Leulliot, Nicolas

2015-07-01

In eukaryotes, three of the four ribosomal RNAs (rRNAs)—the 5.8S, 18S, and 25S/28S rRNAs—are processed from a single pre-rRNA transcript and assembled into ribosomes. The fourth rRNA, the 5S rRNA, is transcribed by RNA polymerase III and is assembled into the 5S ribonucleoprotein particle (RNP), containing ribosomal proteins Rpl5/uL18 and Rpl11/uL5, prior to its incorporation into preribosomes. In mammals, the 5S RNP is also a central regulator of the homeostasis of the tumor suppressor p53. The nucleolar localization of the 5S RNP and its assembly into preribosomes are performed by a specialized complex composed of Rpf2 and Rrs1 in yeast or Bxdc1 and hRrs1 in humans. Here we report the structural and functional characterization of the Rpf2-Rrs1 complex alone, in complex with the 5S RNA, and within pre-60S ribosomes. We show that the Rpf2-Rrs1 complex contains a specialized 5S RNA E-loop-binding module, contacts the Rpl5 protein, and also contacts the ribosome assembly factor Rsa4 and the 25S RNA. We propose that the Rpf2-Rrs1 complex establishes a network of interactions that guide the incorporation of the 5S RNP in preribosomes in the initial conformation prior to its rotation to form the central protuberance found in the mature large ribosomal subunit. © 2015 Madru et al.; Published by Cold Spring Harbor Laboratory Press.

Neighborhood of 16S rRNA nucleotides U788/U789 in the 30S ribosomal subunit determined by site-directed crosslinking.

OpenAIRE

Mundus, D; Wollenzien, P

1998-01-01

Site-specific photo crosslinking has been used to investigate the RNA neighborhood of 16S rRNA positions U788/ U789 in Escherichia coli 30S subunits. For these studies, site-specific psoralen (SSP) which contains a sulfhydryl group on a 17 A side chain was first added to nucleotides U788/U789 using a complementary guide DNA by annealing and phototransfer. Modified RNA was purified from the DNA and unmodified RNA. For some experiments, the SSP, which normally crosslinks at an 8 A distance, was...

Ribosomal studies on the 70S ribosome of E.coli by means of neutron scattering

International Nuclear Information System (INIS)

Burkhardt, N.

1997-01-01

Ribosomes are ribonucleo-protein complexes, which catalyse proteinbiosynthesis in all living organisms. Currently, most of the structural models of the prokaryotic 70S ribosome rely on electron microscopy and describe mainly the outer shape of the particle. Neutron scattering can provide information on the internal structure of the ribosome. Parts of the structure can be contrasted for neutrons by means of an isotopic exchange of the naturally occurring hydrogen ( 1 H) for deuterium ( 2 H), allowing direct measurements in situ. Specifically deuterium-labeled ribosomes (E. coli) were prepared and analysed with neutron scattering. The biochemical methods were established and combined to a generally applicable preparation system. This allows labeling of all ribosomal components in any combination. A systematic analysis of the protein and RNA phases resulted in the development of a new model for the 70S ribosome. This model describes not only the outer shape of the particle, but displays also an experimentally determined internal protein-RNA distribution and the border of subunits for the first time (four-phase model; resolution: 50A). Models of the 70S ribosome from other studies were evaluated and ranked according to consistency with the measured scattering data. Applying a new neutron scattering technique of particular sensitivity, the proton-spin contrast-variation, single proteins could be measured and localized. The positions of the proteins S6 and S10 were determined, providing the first coordinates of protein mass centers within the 70S ribosome. (orig.) [de

Translation initiation in bacterial polysomes through ribosome loading on a standby site on a highly translated mRNA

Science.gov (United States)

Andreeva, Irena

2018-01-01

During translation, consecutive ribosomes load on an mRNA and form a polysome. The first ribosome binds to a single-stranded mRNA region and moves toward the start codon, unwinding potential mRNA structures on the way. In contrast, the following ribosomes can dock at the start codon only when the first ribosome has vacated the initiation site. Here we show that loading of the second ribosome on a natural 38-nt-long 5′ untranslated region of lpp mRNA, which codes for the outer membrane lipoprotein from Escherichia coli, takes place before the leading ribosome has moved away from the start codon. The rapid formation of this standby complex depends on the presence of ribosomal proteins S1/S2 in the leading ribosome. The early recruitment of the second ribosome to the standby site before translation by the leading ribosome and the tight coupling between translation elongation by the first ribosome and the accommodation of the second ribosome can contribute to high translational efficiency of the lpp mRNA. PMID:29632209

Identification of pathogenic Nocardia species by reverse line blot hybridization targeting the 16S rRNA and 16S-23S rRNA gene spacer regions.

Science.gov (United States)

Xiao, Meng; Kong, Fanrong; Sorrell, Tania C; Cao, Yongyan; Lee, Ok Cha; Liu, Ying; Sintchenko, Vitali; Chen, Sharon C A

2010-02-01

Although 16S rRNA gene sequence analysis is employed most often for the definitive identification of Nocardia species, alternate molecular methods and polymorphisms in other gene targets have also enabled species determinations. We evaluated a combined Nocardia PCR-based reverse line blot (RLB) hybridization assay based on 16S and 16S-23S rRNA gene spacer region polymorphisms to identify 12 American Type Culture Collection and 123 clinical Nocardia isolates representing 14 species; results were compared with results from 16S rRNA gene sequencing. Thirteen 16S rRNA gene-based (two group-specific and 11 species-specific) and five 16S-23S spacer-targeted (two taxon-specific and three species-specific) probes were utilized. 16S rRNA gene-based probes correctly identified 124 of 135 isolates (sensitivity, 92%) but were unable to identify Nocardia paucivorans strains (n = 10 strains) and a Nocardia asteroides isolate with a novel 16S rRNA gene sequence. Nocardia farcinica and Nocardia cyriacigeorgica strains were identified by the sequential use of an N. farcinica-"negative" probe and a combined N. farcinica/N. cyriacigeorgica probe. The assay specificity was high (99%) except for weak cross-reactivity between the Nocardia brasiliensis probe with the Nocardia thailandica DNA product; however, cross-hybridization with closely related nontarget species may occur. The incorporation of 16S-23S rRNA gene spacer-based probes enabled the identification of all N. paucivorans strains. The overall sensitivity using both probe sets was >99%. Both N. farcinica-specific 16S-23S rRNA gene spacer-directed probes were required to identify all N. farcinica stains by using this probe set. The study demonstrates the utility of a combined PCR/RLB assay for the identification of clinically relevant Nocardia species and its potential for studying subtypes of N. farcinica. Where species assignment is ambiguous or not possible, 16S rRNA gene sequencing is recommended.

Ribosome dynamics and tRNA movement by time-resolved electron cryomicroscopy.

Science.gov (United States)

Fischer, Niels; Konevega, Andrey L; Wintermeyer, Wolfgang; Rodnina, Marina V; Stark, Holger

2010-07-15

The translocation step of protein synthesis entails large-scale rearrangements of the ribosome-transfer RNA (tRNA) complex. Here we have followed tRNA movement through the ribosome during translocation by time-resolved single-particle electron cryomicroscopy (cryo-EM). Unbiased computational sorting of cryo-EM images yielded 50 distinct three-dimensional reconstructions, showing the tRNAs in classical, hybrid and various novel intermediate states that provide trajectories and kinetic information about tRNA movement through the ribosome. The structures indicate how tRNA movement is coupled with global and local conformational changes of the ribosome, in particular of the head and body of the small ribosomal subunit, and show that dynamic interactions between tRNAs and ribosomal residues confine the path of the tRNAs through the ribosome. The temperature dependence of ribosome dynamics reveals a surprisingly flat energy landscape of conformational variations at physiological temperature. The ribosome functions as a Brownian machine that couples spontaneous conformational changes driven by thermal energy to directed movement.

rRNA:mRNA pairing alters the length and the symmetry of mRNA-protected fragments in ribosome profiling experiments

OpenAIRE

O?Connor, Patrick B. F.; Li, Gene-Wei; Weissman, Jonathan S.; Atkins, John F.; Baranov, Pavel V.

2013-01-01

Motivation: Ribosome profiling is a new technique that allows monitoring locations of translating ribosomes on mRNA at a whole transcriptome level. A recent ribosome profiling study demonstrated that internal Shine?Dalgarno (SD) sequences have a major global effect on translation rates in bacteria: ribosomes pause at SD sites in mRNA. Therefore, it is important to understand how SD sites effect mRNA movement through the ribosome and generation of ribosome footprints. Results: Here, we provide...

Mutations in ribosomal protein L3 and 23S ribosomal RNA at the peptidyl transferase centre are associated with reduced susceptibility to tiamulin in Brachyspira spp. isolates.

Science.gov (United States)

Pringle, Märit; Poehlsgaard, Jacob; Vester, Birte; Long, Katherine S

2004-12-01

The pleuromutilin antibiotic tiamulin binds to the ribosomal peptidyl transferase centre. Three groups of Brachyspira spp. isolates with reduced tiamulin susceptibility were analysed to define resistance mechanisms to the drug. Mutations were identified in genes encoding ribosomal protein L3 and 23S rRNA at positions proximal to the peptidyl transferase centre. In two groups of laboratory-selected mutants, mutations were found at nucleotide positions 2032, 2055, 2447, 2499, 2504 and 2572 of 23S rRNA (Escherichia coli numbering) and at amino acid positions 148 and 149 of ribosomal protein L3 (Brachyspira pilosicoli numbering). In a third group of clinical B. hyodysenteriae isolates, only a single mutation at amino acid 148 of ribosomal protein L3 was detected. Chemical footprinting experiments show a reduced binding of tiamulin to ribosomal subunits from mutants with decreased susceptibility to the drug. This reduction in drug binding is likely the resistance mechanism for these strains. Hence, the identified mutations located near the tiamulin binding site are predicted to be responsible for the resistance phenotype. The positions of the mutated residues relative to the bound drug advocate a model where the mutations affect tiamulin binding indirectly through perturbation of nucleotide U2504.

Crystallization of ribosomes from Thermus thermophilus

International Nuclear Information System (INIS)

Karpova, E.A.; Serdyuk, I.N.; Tarkhovskii, Yu.S.; Orlova, E.V.; Borovyagin, V.L.

1987-01-01

An understanding of the molecular bases of the process of protein biosynthesis on the ribosome requires a knowledge of its structure with high three-dimensional resolution involving the method of x-ray crystallographic analysis. The authors report on the production of crystals of the 70S ribosomes from a new source - the highly thermophilic bacterium Thermus thermophilus. Ribosomes for crystallization were obtained from Th. thermophilus strain HB8 by two washings in buffer with high ionic strength. The ribosome preparation was investigated for homogeneity by the method of high-speed sedimentation in a buffer containing 15 mM MgCl 2 , 50 mM NH 4 Cl, and 10 MM Tris-HCl, pH 7.5. Analysis showed that the preparation if homogeneous. The same preparation was investigated for intactness of ribosomal RNA by the method of gel electrophoresis in 2.75% acrylamide 0.5% agarose gel in a buffer containing 30 mM Tris, 30 mM NaH 2 PO 4 , 10 mM EDTA, 1-2% SDS, and 6 M urea. Analysis showed that the preparation possesses intact 16S and 23S RNA. The latter did not degrade, at least in a week of exposure of the ribosomes in buffer solution at 5 0 C. The ribosome preparation had no appreciable RNase activity, which was verified by incubating 4.5 micrograms of ribosomes with 3 micrograms of 14 C-labeled 16S rRna (50 0 C, 90 min) in a buffer containing 10 mM MgCl 2 , 100 mM NH 4 Cl, and 10 mM Tris-HCl, pH/sub 20 0 / 7.5. The incubated nonhydrolyzed RNA was precipitated with 5% trichloroacetic acid and applied on a GF/C filter. The radioactivity was determined in a toluene scintillator on an LS-100C counter

Synthesis and methylation of ribosomal RNA in HeLa cells infected with the herpes virus pseudorabies virus

International Nuclear Information System (INIS)

Furlong, J.C.; Kyriakidis, S.; Stevely, W.S.

1982-01-01

The effects of infection with the herpes virus pseudorabies virus on the metabolism of HeLa cell ribosomal RNA were examined. There is a decline both in the synthesis of nucleolar 45S ribosomal precursor RNA and in its processing to mature cytoplasmic RNA. The methylated oligonucleotides in the ribosomal RNA species were studied. The methylation of cytoplasmic ribosomal RNA was essentially unchanged. However there was some undermethylation of the nucleolar precursor. If undermethylated RNA does not mature then this may partly explain the reduced processing in the infected cells. (Author)

Eukaryotic 5S rRNA biogenesis

Science.gov (United States)

Ciganda, Martin; Williams, Noreen

2012-01-01

The ribosome is a large complex containing both protein and RNA which must be assembled in a precise manner to allow proper functioning in the critical role of protein synthesis. 5S rRNA is the smallest of the RNA components of the ribosome, and although it has been studied for decades, we still do not have a clear understanding of its function within the complex ribosome machine. It is the only RNA species that binds ribosomal proteins prior to its assembly into the ribosome. Its transport into the nucleolus requires this interaction. Here we present an overview of some of the key findings concerning the structure and function of 5S rRNA and how its association with specific proteins impacts its localization and function. PMID:21957041

Hierarchical recruitment of ribosomal proteins and assembly factors remodels nucleolar pre-60S ribosomes.

Science.gov (United States)

Biedka, Stephanie; Micic, Jelena; Wilson, Daniel; Brown, Hailey; Diorio-Toth, Luke; Woolford, John L

2018-04-24

Ribosome biogenesis involves numerous preribosomal RNA (pre-rRNA) processing events to remove internal and external transcribed spacer sequences, ultimately yielding three mature rRNAs. Removal of the internal transcribed spacer 2 spacer RNA is the final step in large subunit pre-rRNA processing and begins with endonucleolytic cleavage at the C 2 site of 27SB pre-rRNA. C 2 cleavage requires the hierarchical recruitment of 11 ribosomal proteins and 14 ribosome assembly factors. However, the function of these proteins in C 2 cleavage remained unclear. In this study, we have performed a detailed analysis of the effects of depleting proteins required for C 2 cleavage and interpreted these results using cryo-electron microscopy structures of assembling 60S subunits. This work revealed that these proteins are required for remodeling of several neighborhoods, including two major functional centers of the 60S subunit, suggesting that these remodeling events form a checkpoint leading to C 2 cleavage. Interestingly, when C 2 cleavage is directly blocked by depleting or inactivating the C 2 endonuclease, assembly progresses through all other subsequent steps. © 2018 Biedka et al.

Ribosomal RNA in the salivary gland of Sciara ocellaris during larval development

International Nuclear Information System (INIS)

Dessen, E.M.B.; Perondini, A.L.P.

1979-01-01

Ribosomal RNA in the salivary gland of Sciara ocellaris during larval development. The molecular weights of the precursor and of the 28S and 18S mature fractions of the ribosomal RNA estimated by poliacrilamid gel electrophoresis are 2.6 X 10 6 D, 1.4 X 10 6 D and 0.68 X 10 6 D, respectively. The in vivo processing of pre-rRNA is very fast since radioactivity could be detected in the mature fractions fifteen minutes after incorporation. The processing rate of salivary pre-rRNA increases after the stage of metamorphosis induction. The in vitro processing of the pre-rRNA is less rapid when compared to that in vivo, and no differences were found in RNAs [pt

Sequencing of 16S rRNA gene for id ntification of Sta h lococcus ...

African Journals Online (AJOL)

Asdmin

2014-01-15

Jan 15, 2014 ... as the type strains of a species of genus Trichoderma based on phylogenetic tree analysis together with the 18S rRNA gene sequence search in Ribosomal Database Project, small subunit rRNA and large subunit rRNA databases. The sequence was deposited in GenBank with the accession numbers.

The ribosome as a molecular machine: the mechanism of tRNA-mRNA movement in translocation.

Science.gov (United States)

Rodnina, Marina V; Wintermeyer, Wolfgang

2011-04-01

Translocation of tRNA and mRNA through the ribosome is one of the most dynamic events during protein synthesis. In the cell, translocation is catalysed by EF-G (elongation factor G) and driven by GTP hydrolysis. Major unresolved questions are: how the movement is induced and what the moving parts of the ribosome are. Recent progress in time-resolved cryoelectron microscopy revealed trajectories of tRNA movement through the ribosome. Driven by thermal fluctuations, the ribosome spontaneously samples a large number of conformational states. The spontaneous movement of tRNAs through the ribosome is loosely coupled to the motions within the ribosome. EF-G stabilizes conformational states prone to translocation and promotes a conformational rearrangement of the ribosome (unlocking) that accelerates the rate-limiting step of translocation: the movement of the tRNA anticodons on the small ribosomal subunit. EF-G acts as a Brownian ratchet providing directional bias for movement at the cost of GTP hydrolysis.

Mutation in ribosomal protein S5 leads to spectinomycin resistance in Neisseria gonorrhoeae.

Directory of Open Access Journals (Sweden)

Elena eIlina

2013-07-01

Full Text Available Spectinomycin remains a useful reserve option for therapy of gonorrhea. The emergence of multidrug-resistant Neisseria gonorrhoeae strains with decreased susceptibility to cefixime and to ceftriaxone makes it the only medicine still effective for treatment of gonorrhea infection in analogous cases. However, adoption of spectinomycin as a routinely used drug of choice was soon followed by reports of spectinomycin resistance. The main molecular mechanism of spectinomycin resistance in N. gonorrhoeae was C1192T substitution in 16S rRNA genes. Here we reported a Thr-24→Pro mutation in ribosomal protein S5 found in spectinomycin resistant clinical N. gonorrhoeae strain, which carried no changes in 16S rRNA. In a series of experiments, the transfer of rpsE gene allele encoding the mutant ribosomal protein S5 to the recipient N. gonorrhoeae strains was analyzed. The relatively high rate of transformation (ca. 10-5 CFUs indicates the possibility of spread of spectinonycin resistance within gonococcal population due to the horizontal gene transfer.

Naked mole-rat has increased translational fidelity compared with the mouse, as well as a unique 28S ribosomal RNA cleavage.

Science.gov (United States)

Azpurua, Jorge; Ke, Zhonghe; Chen, Iris X; Zhang, Quanwei; Ermolenko, Dmitri N; Zhang, Zhengdong D; Gorbunova, Vera; Seluanov, Andrei

2013-10-22

The naked mole-rat (Heterocephalus glaber) is a subterranean eusocial rodent with a markedly long lifespan and resistance to tumorigenesis. Multiple data implicate modulation of protein translation in longevity. Here we report that 28S ribosomal RNA (rRNA) of the naked mole-rat is processed into two smaller fragments of unequal size. The two breakpoints are located in the 28S rRNA divergent region 6 and excise a fragment of 263 nt. The excised fragment is unique to the naked mole-rat rRNA and does not show homology to other genomic regions. Because this hidden break site could alter ribosome structure, we investigated whether translation rate and amino acid incorporation fidelity were altered. We report that naked mole-rat fibroblasts have significantly increased translational fidelity despite having comparable translation rates with mouse fibroblasts. Although we cannot directly test whether the unique 28S rRNA structure contributes to the increased fidelity of translation, we speculate that it may change the folding or dynamics of the large ribosomal subunit, altering the rate of GTP hydrolysis and/or interaction of the large subunit with tRNA during accommodation, thus affecting the fidelity of protein synthesis. In summary, our results show that naked mole-rat cells produce fewer aberrant proteins, supporting the hypothesis that the more stable proteome of the naked mole-rat contributes to its longevity.

Advantages and Limitations of Ribosomal RNA PCR and DNA Sequencing for Identification of Bacteria in Cardiac Valves of Danish Patients

DEFF Research Database (Denmark)

Kemp, Michael; Bangsborg, Jette; Kjerulf, Anne

2013-01-01

of direct molecular identification should also address weaknesses, their relevance in the given setting, and possible improvements. In this study cardiac valves from 56 Danish patients referred for surgery for infective endocarditis were analysed by microscopy and culture as well as by PCR targeting part...... of the bacterial 16S rRNA gene followed by DNA sequencing of the PCR product. PCR and DNA sequencing identified significant bacteria in 49 samples from 43 patients, including five out of 13 culture-negative cases. No rare, exotic, or intracellular bacteria were identified. There was a general agreement between...... bacterial identity obtained by ribosomal PCR and DNA sequencing from the valves and bacterial isolates from blood culture. However, DNA sequencing of the 16S rRNA gene did not discriminate well among non-haemolytic streptococci, especially within the Streptococcus mitis group. Ribosomal PCR with subsequent...

Accuracy of taxonomy prediction for 16S rRNA and fungal ITS sequences

Directory of Open Access Journals (Sweden)

Robert C. Edgar

2018-04-01

Full Text Available Prediction of taxonomy for marker gene sequences such as 16S ribosomal RNA (rRNA is a fundamental task in microbiology. Most experimentally observed sequences are diverged from reference sequences of authoritatively named organisms, creating a challenge for prediction methods. I assessed the accuracy of several algorithms using cross-validation by identity, a new benchmark strategy which explicitly models the variation in distances between query sequences and the closest entry in a reference database. When the accuracy of genus predictions was averaged over a representative range of identities with the reference database (100%, 99%, 97%, 95% and 90%, all tested methods had ≤50% accuracy on the currently-popular V4 region of 16S rRNA. Accuracy was found to fall rapidly with identity; for example, better methods were found to have V4 genus prediction accuracy of ∼100% at 100% identity but ∼50% at 97% identity. The relationship between identity and taxonomy was quantified as the probability that a rank is the lowest shared by a pair of sequences with a given pair-wise identity. With the V4 region, 95% identity was found to be a twilight zone where taxonomy is highly ambiguous because the probabilities that the lowest shared rank between pairs of sequences is genus, family, order or class are approximately equal.

Diversity of Protease-Producing Bacillus spp. From Fresh Indonesian Tempeh Based on 16S rRNA Gene Sequence

Directory of Open Access Journals (Sweden)

Tati Barus

2017-01-01

Full Text Available Tempeh is a type of traditional fermented food in Indonesia. The fermentation can be performed by Rhizopus microsporus as a main microorganism. However, Bacillus spp. is found in abundance in tempeh production. Nevertheless, information regarding the diversity of Bacillus spp. in tempeh production has not been reported yet. Therefore, the aim of this investigation was to study the genetic diversity of Bacillus spp. in tempeh production based on the 16S ribosomal RNA sequence. In this study, about 22 of 24 fresh tempeh from Jakarta, Bogor, and Tangerang were used. A total of 52 protease-producing Bacillus spp. isolates were obtained. Based on 16S ribosomal RNA results, all 52 isolates were identified to be similar to B. pumilus, B. subtilis, B. megaterium, B. licheniformis, B. cereus, B. thuringiensis, B. amyloliquefaciens, Brevibacillus brevis, and Bacillus sp. All the identified isolates were divided into two large clusters: 1 a cluster of B. cereus, B. thuringiensis, Bacillus sp., and B. brevis and 2 a cluster of B. pumilus, B. subtilis, B. megaterium, B. licheniformis, and B. amyloliquefaciens. Information about the Bacillus spp. role in determining the quality of tempeh has not been reported and this is a preliminary study of Bacillus spp. from tempeh.

Genome-wide polysomal analysis of a yeast strain with mutated ribosomal protein S9

Directory of Open Access Journals (Sweden)

Arava Yoav

2007-08-01

Full Text Available Abstract Background The yeast ribosomal protein S9 (S9 is located at the entrance tunnel of the mRNA into the ribosome. It is known to play a role in accurate decoding and its bacterial homolog (S4 has recently been shown to be involved in opening RNA duplexes. Here we examined the effects of changing the C terminus of S9, which is rich in acidic amino acids and extends out of the ribosome surface. Results We performed a genome-wide analysis to reveal effects at the transcription and translation levels of all yeast genes. While negligible relative changes were observed in steady-state mRNA levels, a significant number of mRNAs appeared to have altered ribosomal density. Notably, 40% of the genes having reliable signals changed their ribosomal association by more than one ribosome. Yet, no general correlations with physical or functional features of the mRNA were observed. Ribosome Density Mapping (RDM along four of the mRNAs with increased association revealed an increase in ribosomal density towards the end of the coding region for at least two of them. Read-through analysis did not reveal any increase in read-through of a premature stop codon by the mutant strain. Conclusion The ribosomal protein rpS9 appears to be involved in the translation of many mRNAs, since altering its C terminus led to a significant change in ribosomal association of many mRNAs. We did not find strong correlations between these changes and several physical features of the mRNA, yet future studies with advanced tools may allow such correlations to be determined. Importantly, our results indicate an accumulation of ribosomes towards the end of the coding regions of some mRNAs. This suggests an involvement of S9 in ribosomal dissociation during translation termination.

Fluctuations between multiple EF-G-induced chimeric tRNA states during translocation on the ribosome

Science.gov (United States)

Adio, Sarah; Senyushkina, Tamara; Peske, Frank; Fischer, Niels; Wintermeyer, Wolfgang; Rodnina, Marina V.

2015-06-01

The coupled translocation of transfer RNA and messenger RNA through the ribosome entails large-scale structural rearrangements, including step-wise movements of the tRNAs. Recent structural work has visualized intermediates of translocation induced by elongation factor G (EF-G) with tRNAs trapped in chimeric states with respect to 30S and 50S ribosomal subunits. The functional role of the chimeric states is not known. Here we follow the formation of translocation intermediates by single-molecule fluorescence resonance energy transfer. Using EF-G mutants, a non-hydrolysable GTP analogue, and fusidic acid, we interfere with either translocation or EF-G release from the ribosome and identify several rapidly interconverting chimeric tRNA states on the reaction pathway. EF-G engagement prevents backward transitions early in translocation and increases the fraction of ribosomes that rapidly fluctuate between hybrid, chimeric and posttranslocation states. Thus, the engagement of EF-G alters the energetics of translocation towards a flat energy landscape, thereby promoting forward tRNA movement.

An automated procedure for covariation-based detection of RNA structure

Energy Technology Data Exchange (ETDEWEB)

Winker, S.; Overbeek, R.; Woese, C.R.; Olsen, G.J.; Pfluger, N.

1989-12-01

This paper summarizes our investigations into the computational detection of secondary and tertiary structure of ribosomal RNA. We have developed a new automated procedure that not only identifies potential bondings of secondary and tertiary structure, but also provides the covariation evidence that supports the proposed bondings, and any counter-evidence that can be detected in the known sequences. A small number of previously unknown bondings have been detected in individual RNA molecules (16S rRNA and 7S RNA) through the use of our automated procedure. Currently, we are systematically studying mitochondrial rRNA. Our goal is to detect tertiary structure within 16S rRNA and quaternary structure between 16S and 23S rRNA. Our ultimate hope is that automated covariation analysis will contribute significantly to a refined picture of ribosome structure. Our colleagues in biology have begun experiments to test certain hypotheses suggested by an examination of our program's output. These experiments involve sequencing key portions of the 23S ribosomal RNA for species in which the known 16S ribosomal RNA exhibits variation (from the dominant pattern) at the site of a proposed bonding. The hope is that the 23S ribosomal RNA of these species will exhibit corresponding complementary variation or generalized covariation. 24 refs.

An automated procedure for covariation-based detection of RNA structure

International Nuclear Information System (INIS)

Winker, S.; Overbeek, R.; Woese, C.R.; Olsen, G.J.; Pfluger, N.

1989-12-01

This paper summarizes our investigations into the computational detection of secondary and tertiary structure of ribosomal RNA. We have developed a new automated procedure that not only identifies potential bondings of secondary and tertiary structure, but also provides the covariation evidence that supports the proposed bondings, and any counter-evidence that can be detected in the known sequences. A small number of previously unknown bondings have been detected in individual RNA molecules (16S rRNA and 7S RNA) through the use of our automated procedure. Currently, we are systematically studying mitochondrial rRNA. Our goal is to detect tertiary structure within 16S rRNA and quaternary structure between 16S and 23S rRNA. Our ultimate hope is that automated covariation analysis will contribute significantly to a refined picture of ribosome structure. Our colleagues in biology have begun experiments to test certain hypotheses suggested by an examination of our program's output. These experiments involve sequencing key portions of the 23S ribosomal RNA for species in which the known 16S ribosomal RNA exhibits variation (from the dominant pattern) at the site of a proposed bonding. The hope is that the 23S ribosomal RNA of these species will exhibit corresponding complementary variation or generalized covariation. 24 refs

The complete structure of the chloroplast 70S ribosome in complex with translation factor pY.

Science.gov (United States)

Bieri, Philipp; Leibundgut, Marc; Saurer, Martin; Boehringer, Daniel; Ban, Nenad

2017-02-15

Chloroplasts are cellular organelles of plants and algae that are responsible for energy conversion and carbon fixation by the photosynthetic reaction. As a consequence of their endosymbiotic origin, they still contain their own genome and the machinery for protein biosynthesis. Here, we present the atomic structure of the chloroplast 70S ribosome prepared from spinach leaves and resolved by cryo-EM at 3.4 Å resolution. The complete structure reveals the features of the 4.5S rRNA, which probably evolved by the fragmentation of the 23S rRNA, and all five plastid-specific ribosomal proteins. These proteins, required for proper assembly and function of the chloroplast translation machinery, bind and stabilize rRNA including regions that only exist in the chloroplast ribosome. Furthermore, the structure reveals plastid-specific extensions of ribosomal proteins that extensively remodel the mRNA entry and exit site on the small subunit as well as the polypeptide tunnel exit and the putative binding site of the signal recognition particle on the large subunit. The translation factor pY, involved in light- and temperature-dependent control of protein synthesis, is bound to the mRNA channel of the small subunit and interacts with 16S rRNA nucleotides at the A-site and P-site, where it protects the decoding centre and inhibits translation by preventing tRNA binding. The small subunit is locked by pY in a non-rotated state, in which the intersubunit bridges to the large subunit are stabilized. © 2016 The Authors. Published under the terms of the CC BY NC ND 4.0 license.

Affinity labelling in situ of the bL12 protein on E. coli 70S ribosomes by means of a tRNA dialdehyde derivative.

Science.gov (United States)

Hountondji, Codjo; Créchet, Jean-Bernard; Le Caër, Jean-Pierre; Lancelot, Véronique; Cognet, Jean A H; Baouz, Soria

2017-12-01

In this report, we have used periodate-oxidized tRNA (tRNAox) as an affinity laleling reagent to demonstrate that: (i) the bL12 protein contacts the CCA-arm of P-site bound tRNA on the Escherichia coli 70S ribosomes; (ii) the stoichiometry of labelling is one molecule of tRNAox bound to one polypeptide chain of endogenous bL12; (iii) cross-linking in situ of bL12 with tRNAox on the ribosomes provokes the loss of activity; (iv) intact tRNA protects bL12 in the 70S ribosomes against cross-linking with tRNAox; (v) both tRNAox and pyridoxal 5'-phosphate (PLP) compete for the same or for proximal cross-linking site(s) on bL12 inside the ribosome; (vi) the stoichiometry of cross-linking of PLP to the recombinant E. coli bL12 protein is one molecule of PLP covalently bound per polypeptide chain; (vii) the amino acid residue of recombinant bL12 cross-linked with PLP is Lys-65; (viii) Lys-65 of E. coli bL12 corresponds to Lys-53 of eL42 which was previously shown to cross-link with P-site bound tRNAox on human 80S ribosomes in situ; (ix) finally, E. coli bL12 and human eL42 proteins display significant primary structure similarities, which argues for evolutionary conservation of these two proteins located at the tRNA-CCA binding site on eubacterial and eukaryal ribosomes. © The Authors 2017. Published by Oxford University Press on behalf of the Japanese Biochemical Society. All rights reserved.

Binding site of ribosomal proteins on prokaryotic 5S ribonucleic acids: a study with ribonucleases

DEFF Research Database (Denmark)

Douthwaite, S; Christensen, A; Garrett, R A

1982-01-01

The binding sites of ribosomal proteins L18 and L25 on 5S RNA from Escherichia coli were probed with ribonucleases A, T1, and T2 and a double helix specific cobra venom endonuclease. The results for the protein-RNA complexes, which were compared with those for the free RNA [Douthwaite, S...... stearothermophilus 5S RNA. Several protein-induced changes in the RNA structures were identified; some are possibly allosteric in nature. The two prokaryotic 5S RNAs were also incubated with total 50S subunit proteins from E. coli and B. stearothermophilus ribosomes. Homologous and heterologous reconstitution....... stearothermophilus 5S RNA, which may have been due to a third ribosomal protein L5....

A ribosomal RNA gene intergenic spacer based PCR and DGGE fingerprinting method for the analysis of specific rhizobial communities in soil

NARCIS (Netherlands)

de Oliveira, VM; Manfio, GP; Coutinho, HLD; Keijzer-Wolters, AC; van Elsas, JD

A direct molecular method for assessing the diversity of specific populations of rhizobia in soil, based on nested PCR amplification of 16S-23S ribosomal RNA gene (rDNA) intergenic spacer (IGS) sequences, was developed. Initial generic amplification of bacterial rDNA IGS sequences from soil DNA was

A ribosomal RNA gene intergenic spacer based PCR and DGGE fingerprinting method for the analysis of specific rhizobial communities in soil

NARCIS (Netherlands)

Oliveira, de V.M.; Manfio, G.P.; Coutinho, H.L.D.; Keijzer-Wolters, A.C.; Elsas, van J.D.

2006-01-01

A direct molecular method for assessing the diversity of specific populations of rhizobia in soil, based on nested PCR amplification of 16S-23S ribosomal RNA gene (rDNA) intergenic spacer (IGS) sequences, was developed. Initial generic amplification of bacterial rDNA IGS sequences from soil DNA was

Effect of primary and secondary radicals on chain breaks in ribosomal RNA in E. coli ribosomes

International Nuclear Information System (INIS)

Singh, H.; Bishop, J.

1984-01-01

It has been shown previously that, in dilute aerated solutions, ribosomes are inactivated by OH radicals and by secondary radicals produced from added alcohols (Singh and Vadasz 1983 a). In de-aerated solutions, both radicalH and e - sub(aq) also inactivate ribosomes (Singh and Vadasz 1983 b). The results of these studies and other on different systems (Adams et al. 1973, Aldrich and Cundall 1969, Dewey and Stein 1970, Masuda et al. 1971, Nabben et al. 1982, 1983, Samuni et al. 1980, Singh and Singh 1982) have shown that damage to biological systems occurs by diverse mechanisms. One of these mechanisms involves chain breaks in RNA (Pollard and Weller 1967). The purpose of this study was to determine which of the primary and secondary radicals cause chain breaks in ribosomal RNA (rRNA) within the ribosomes. (author)

16S Ribosomal Ribonucleic Acid Gene Polymerase Chain Reaction in the Diagnosis of Bloodstream Infections: A Systematic Review and Meta-Analysis.

Science.gov (United States)

Su, Guoming; Fu, Zhuqing; Hu, Liren; Wang, Yueying; Zhao, Zuguo; Yang, Weiqing

2015-01-01

We aim to evaluate the accuracy of the 16S ribosomal ribonucleic acid (rRNA) gene polymerase chain reaction (PCR) test in the diagnosis of bloodstream infections through a systematic review and meta-analysis. A computerized literature search was conducted to identify studies that assessed the diagnostic value of 16S rRNA gene PCR test for bloodstream infections. Study quality was assessed using the revised Quality Assessment of Diagnostic Accuracy Studies (QUADAS-2) tool. We calculated the sensitivity, specificity, positive likelihood ratio (PLR), negative likelihood ratio (NLR), diagnostic odds ratio (DOR) and their 95% confidence intervals (95% CI) for each study. Summary receiver operating characteristic (SROC) curve was used to summarize overall test performance. Statistical analysis was performed in Meta-DiSc 1.4 and Stata/SE 12.0 software. Twenty-eight studies were included in our meta-analysis. Using random-effect model analysis, the pooled sensitivity, specificity, PLR, NLR, and DOR were 0.87 (95% CI, 0.85-0.89), 0.94 (95% CI, 0.93-0.95), 12.65 (95% CI, 8.04-19.90), 0.14 (95% CI, 0.08-0.24), and 116.76 (95% CI, 52.02-262.05), respectively. The SROC curve indicated that the area under the curve (AUC) was 0.9690 and the maximum joint sensitivity and specificity (Q*) was 0.9183. In addition, heterogeneity was statistically significant but was not caused by the threshold effect. Existing data suggest that 16S rRNA gene PCR test is a practical tool for the rapid screening of sepsis. Further prospective studies are needed to assess the diagnostic value of PCR amplification and DNA microarray hybridization of 16S rRNA gene in the future.

Differentiation of Actinobacillus pleuropneumoniae strains by sequence analysis of 16S rDNA and ribosomal intergenic regions, and development of a species specific oligonucleotide for in situ detection

DEFF Research Database (Denmark)

Fussing, Vivian; Paster, Bruce J.; Dewhirst, Floyd E.

1998-01-01

. The larger RIS's were different between the 3 species tested. The sequence of the 16S ribosomal gene was determined for 8 serotypes of A. pleuropneumoniae. These sequences showed only minor base differences, indicating a close genetic relatedness of these serotypes within the species. An oligonucleotide DNA...... probe designed from the 16S rRNA gene sequence of A. pleuropneumoniae was specific for all strains of the target species and did not cross react with A. lignieresii, the closest known relative of A. pleuropneumoniae. This species-specific DNA probe labeled with fluorescein was used for in situ......The aims of this study were to characterize and determine intraspecies and interspecies relatedness of Actinobacillus pleuropneumoniae to Actinobacillus lignieresii and Actinobacillus suis by sequence analysis of the ribosomal operon and to find a species-specific area for in situ detection of A...

Spontaneous reverse movement of mRNA-bound tRNA through the ribosome.

Science.gov (United States)

Konevega, Andrey L; Fischer, Niels; Semenkov, Yuri P; Stark, Holger; Wintermeyer, Wolfgang; Rodnina, Marina V

2007-04-01

During the translocation step of protein synthesis, a complex of two transfer RNAs bound to messenger RNA (tRNA-mRNA) moves through the ribosome. The reaction is promoted by an elongation factor, called EF-G in bacteria, which, powered by GTP hydrolysis, induces an open, unlocked conformation of the ribosome that allows for spontaneous tRNA-mRNA movement. Here we show that, in the absence of EF-G, there is spontaneous backward movement, or retrotranslocation, of two tRNAs bound to mRNA. Retrotranslocation is driven by the gain in affinity when a cognate E-site tRNA moves into the P site, which compensates the affinity loss accompanying the movement of peptidyl-tRNA from the P to the A site. These results lend support to the diffusion model of tRNA movement during translocation. In the cell, tRNA movement is biased in the forward direction by EF-G, which acts as a Brownian ratchet and prevents backward movement.

5S ribosomal ribonucleic acid sequences in Bacteroides and Fusobacterium: evolutionary relationships within these genera and among eubacteria in general

Science.gov (United States)

Van den Eynde, H.; De Baere, R.; Shah, H. N.; Gharbia, S. E.; Fox, G. E.; Michalik, J.; Van de Peer, Y.; De Wachter, R.

1989-01-01

The 5S ribosomal ribonucleic acid (rRNA) sequences were determined for Bacteroides fragilis, Bacteroides thetaiotaomicron, Bacteroides capillosus, Bacteroides veroralis, Porphyromonas gingivalis, Anaerorhabdus furcosus, Fusobacterium nucleatum, Fusobacterium mortiferum, and Fusobacterium varium. A dendrogram constructed by a clustering algorithm from these sequences, which were aligned with all other hitherto known eubacterial 5S rRNA sequences, showed differences as well as similarities with respect to results derived from 16S rRNA analyses. In the 5S rRNA dendrogram, Bacteroides clustered together with Cytophaga and Fusobacterium, as in 16S rRNA analyses. Intraphylum relationships deduced from 5S rRNAs suggested that Bacteroides is specifically related to Cytophaga rather than to Fusobacterium, as was suggested by 16S rRNA analyses. Previous taxonomic considerations concerning the genus Bacteroides, based on biochemical and physiological data, were confirmed by the 5S rRNA sequence analysis.

Conservative fragments in bacterial 16S rRNA genes and primer design for 16S ribosomal DNA amplicons in metagenomic studies

KAUST Repository

Wang, Yong

2009-10-09

Bacterial 16S ribosomal DNA (rDNA) amplicons have been widely used in the classification of uncultured bacteria inhabiting environmental niches. Primers targeting conservative regions of the rDNAs are used to generate amplicons of variant regions that are informative in taxonomic assignment. One problem is that the percentage coverage and application scope of the primers used in previous studies are largely unknown. In this study, conservative fragments of available rDNA sequences were first mined and then used to search for candidate primers within the fragments by measuring the coverage rate defined as the percentage of bacterial sequences containing the target. Thirty predicted primers with a high coverage rate (>90%) were identified, which were basically located in the same conservative regions as known primers in previous reports, whereas 30% of the known primers were associated with a coverage rate of <90%. The application scope of the primers was also examined by calculating the percentages of failed detections in bacterial phyla. Primers A519-539, E969- 983, E1063-1081, U515 and E517, are highly recommended because of their high coverage in almost all phyla. As expected, the three predominant phyla, Firmicutes, Gemmatimonadetes and Proteobacteria, are best covered by the predicted primers. The primers recommended in this report shall facilitate a comprehensive and reliable survey of bacterial diversity in metagenomic studies. © 2009 Wang, Qian.

Clusters of basic amino acids contribute to RNA binding and nucleolar localization of ribosomal protein L22.

Directory of Open Access Journals (Sweden)

Jennifer L Houmani

Full Text Available The ribosomal protein L22 is a component of the 60S eukaryotic ribosomal subunit. As an RNA-binding protein, it has been shown to interact with both cellular and viral RNAs including 28S rRNA and the Epstein-Barr virus encoded RNA, EBER-1. L22 is localized to the cell nucleus where it accumulates in nucleoli. Although previous studies demonstrated that a specific amino acid sequence is required for nucleolar localization, the RNA-binding domain has not been identified. Here, we investigated the hypothesis that the nucleolar accumulation of L22 is linked to its ability to bind RNA. To address this hypothesis, mutated L22 proteins were generated to assess the contribution of specific amino acids to RNA binding and protein localization. Using RNA-protein binding assays, we demonstrate that basic amino acids 80-93 are required for high affinity binding of 28S rRNA and EBER-1 by L22. Fluorescence localization studies using GFP-tagged mutated L22 proteins further reveal that basic amino acids 80-93 are critical for nucleolar accumulation and for incorporation into ribosomes. Our data support the growing consensus that the nucleolar accumulation of ribosomal proteins may not be mediated by a defined localization signal, but rather by specific interaction with established nucleolar components such as rRNA.

Conservation of RNA sequence and cross-linking ability in ribosomes from a higher eukaryote: photochemical cross-linking of the anticodon of P site bound tRNA to the penultimate cytidine of the UACACACG sequence in Artemia salina 18S rRNA

International Nuclear Information System (INIS)

Ciesiolka, J.; Nurse, K.; Klein, J.; Ofengand, J.

1985-01-01

The complex of Artemia salina ribosomes and Escherichia coli acetylvalyl-tRNA could be cross-linked by irradiation with near-UV light. Cross-linking required the presence of the codon GUU, GUA being ineffective. The acetylvalyl group could be released from the cross-linked tRNA by treatment with puromycin, demonstrating that cross-linking had occurred at the P site. This was true both for pGUU- and also for poly(U2,G)-dependent cross-linking. All of the cross-linking was to the 18S rRNA of the small ribosomal subunit. Photolysis of the cross-link at 254 nm occurred with the same kinetics as that for the known cyclobutane dimer between this tRNA and Escherichia coli 16S rRNA. T1 RNase digestion of the cross-linked tRNA yielded an oligonucleotide larger in molecular weight than any from un-cross-linked rRNA or tRNA or from a prephotolyzed complex. Extended electrophoresis showed this material to consist of two oligomers of similar mobility, a faster one-third component and a slower two-thirds component. Each oligomer yielded two components on 254-nm photolysis. The slower band from each was the tRNA T1 oligomer CACCUCCCUVACAAGp, which includes the anticodon. The faster band was the rRNA 9-mer UACACACCGp and its derivative UACACACUG. Unexpectedly, the dephosphorylated and slower moving 9-mer was derived from the faster moving dimer. Deamination of the penultimate C to U is probably due to cyclobutane dimer formation and was evidence for that nucleotide being the site of cross-linking. Direct confirmation of the cross-linking site was obtained by Z-gel analysis

A computational investigation on the connection between dynamics properties of ribosomal proteins and ribosome assembly.

Directory of Open Access Journals (Sweden)

Brittany Burton

Full Text Available Assembly of the ribosome from its protein and RNA constituents has been studied extensively over the past 50 years, and experimental evidence suggests that prokaryotic ribosomal proteins undergo conformational changes during assembly. However, to date, no studies have attempted to elucidate these conformational changes. The present work utilizes computational methods to analyze protein dynamics and to investigate the linkage between dynamics and binding of these proteins during the assembly of the ribosome. Ribosomal proteins are known to be positively charged and we find the percentage of positive residues in r-proteins to be about twice that of the average protein: Lys+Arg is 18.7% for E. coli and 21.2% for T. thermophilus. Also, positive residues constitute a large proportion of RNA contacting residues: 39% for E. coli and 46% for T. thermophilus. This affirms the known importance of charge-charge interactions in the assembly of the ribosome. We studied the dynamics of three primary proteins from E. coli and T. thermophilus 30S subunits that bind early in the assembly (S15, S17, and S20 with atomic molecular dynamic simulations, followed by a study of all r-proteins using elastic network models. Molecular dynamics simulations show that solvent-exposed proteins (S15 and S17 tend to adopt more stable solution conformations than an RNA-embedded protein (S20. We also find protein residues that contact the 16S rRNA are generally more mobile in comparison with the other residues. This is because there is a larger proportion of contacting residues located in flexible loop regions. By the use of elastic network models, which are computationally more efficient, we show that this trend holds for most of the 30S r-proteins.

Novel mRNA-specific effects of ribosome drop-off on translation rate and polysome profile.

Directory of Open Access Journals (Sweden)

Pierre Bonnin

2017-05-01

Full Text Available The well established phenomenon of ribosome drop-off plays crucial roles in translational accuracy and nutrient starvation responses during protein translation. When cells are under stress conditions, such as amino acid starvation or aminoacyl-tRNA depletion due to a high level of recombinant protein expression, ribosome drop-off can substantially affect the efficiency of protein expression. Here we introduce a mathematical model that describes the effects of ribosome drop-off on the ribosome density along the mRNA and on the concomitant protein synthesis rate. Our results show that ribosome premature termination may lead to non-intuitive ribosome density profiles, such as a ribosome density which increases from the 5' to the 3' end. Importantly, the model predicts that the effects of ribosome drop-off on the translation rate are mRNA-specific, and we quantify their resilience to drop-off, showing that the mRNAs which present ribosome queues are much less affected by ribosome drop-off than those which do not. Moreover, among those mRNAs that do not present ribosome queues, resilience to drop-off correlates positively with the elongation rate, so that sequences using fast codons are expected to be less affected by ribosome drop-off. This result is consistent with a genome-wide analysis of S. cerevisiae, which reveals that under favourable growth conditions mRNAs coding for proteins involved in the translation machinery, known to be highly codon biased and using preferentially fast codons, are highly resilient to ribosome drop-off. Moreover, in physiological conditions, the translation rate of mRNAs coding for regulatory, stress-related proteins, is less resilient to ribosome drop-off. This model therefore allows analysis of variations in the translational efficiency of individual mRNAs by accounting for the full range of known ribosome behaviours, as well as explaining mRNA-specific variations in ribosome density emerging from ribosome profiling

Protein-protein interactions within late pre-40S ribosomes.

Directory of Open Access Journals (Sweden)

Melody G Campbell

2011-01-01

Full Text Available Ribosome assembly in eukaryotic organisms requires more than 200 assembly factors to facilitate and coordinate rRNA transcription, processing, and folding with the binding of the ribosomal proteins. Many of these assembly factors bind and dissociate at defined times giving rise to discrete assembly intermediates, some of which have been partially characterized with regards to their protein and RNA composition. Here, we have analyzed the protein-protein interactions between the seven assembly factors bound to late cytoplasmic pre-40S ribosomes using recombinant proteins in binding assays. Our data show that these factors form two modules: one comprising Enp1 and the export adaptor Ltv1 near the beak structure, and the second comprising the kinase Rio2, the nuclease Nob1, and a regulatory RNA binding protein Dim2/Pno1 on the front of the head. The GTPase-like Tsr1 and the universally conserved methylase Dim1 are also peripherally connected to this second module. Additionally, in an effort to further define the locations for these essential proteins, we have analyzed the interactions between these assembly factors and six ribosomal proteins: Rps0, Rps3, Rps5, Rps14, Rps15 and Rps29. Together, these results and previous RNA-protein crosslinking data allow us to propose a model for the binding sites of these seven assembly factors. Furthermore, our data show that the essential kinase Rio2 is located at the center of the pre-ribosomal particle and interacts, directly or indirectly, with every other assembly factor, as well as three ribosomal proteins required for cytoplasmic 40S maturation. These data suggest that Rio2 could play a central role in regulating cytoplasmic maturation steps.

The ribosome uses two active mechanisms to unwind messenger RNA during translation.

Science.gov (United States)

Qu, Xiaohui; Wen, Jin-Der; Lancaster, Laura; Noller, Harry F; Bustamante, Carlos; Tinoco, Ignacio

2011-07-06

The ribosome translates the genetic information encoded in messenger RNA into protein. Folded structures in the coding region of an mRNA represent a kinetic barrier that lowers the peptide elongation rate, as the ribosome must disrupt structures it encounters in the mRNA at its entry site to allow translocation to the next codon. Such structures are exploited by the cell to create diverse strategies for translation regulation, such as programmed frameshifting, the modulation of protein expression levels, ribosome localization and co-translational protein folding. Although strand separation activity is inherent to the ribosome, requiring no exogenous helicases, its mechanism is still unknown. Here, using a single-molecule optical tweezers assay on mRNA hairpins, we find that the translation rate of identical codons at the decoding centre is greatly influenced by the GC content of folded structures at the mRNA entry site. Furthermore, force applied to the ends of the hairpin to favour its unfolding significantly speeds translation. Quantitative analysis of the force dependence of its helicase activity reveals that the ribosome, unlike previously studied helicases, uses two distinct active mechanisms to unwind mRNA structure: it destabilizes the helical junction at the mRNA entry site by biasing its thermal fluctuations towards the open state, increasing the probability of the ribosome translocating unhindered; and it mechanically pulls apart the mRNA single strands of the closed junction during the conformational changes that accompany ribosome translocation. The second of these mechanisms ensures a minimal basal rate of translation in the cell; specialized, mechanically stable structures are required to stall the ribosome temporarily. Our results establish a quantitative mechanical basis for understanding the mechanism of regulation of the elongation rate of translation by structured mRNAs. ©2011 Macmillan Publishers Limited. All rights reserved

Modified nucleotides m2G966/m5C967 of Escherichia coli 16S rRNA are required for attenuation of tryptophan operon

Science.gov (United States)

Prokhorova, Irina V.; Osterman, Ilya A.; Burakovsky, Dmitry E.; Serebryakova, Marina V.; Galyamina, Maria A.; Pobeguts, Olga V.; Altukhov, Ilya; Kovalchuk, Sergey; Alexeev, Dmitry G.; Govorun, Vadim M.; Bogdanov, Alexey A.; Sergiev, Petr V.; Dontsova, Olga A.

2013-11-01

Ribosomes contain a number of modifications in rRNA, the function of which is unclear. Here we show - using proteomic analysis and dual fluorescence reporter in vivo assays - that m2G966 and m5C967 in 16S rRNA of Escherichia coli ribosomes are necessary for correct attenuation of tryptophan (trp) operon. Expression of trp operon is upregulated in the strain where RsmD and RsmB methyltransferases were deleted, which results in the lack of m2G966 and m5C967 modifications. The upregulation requires the trpL attenuator, but is independent of the promotor of trp operon, ribosome binding site of the trpE gene, which follows trp attenuator and even Trp codons in the trpL sequence. Suboptimal translation initiation efficiency in the rsmB/rsmD knockout strain is likely to cause a delay in translation relative to transcription which causes misregulation of attenuation control of trp operon.

Genetic characterization of human-pathogenic Cyclospora cayetanensis parasites from three endemic regions at the 18S ribosomal RNA locus.

Science.gov (United States)

Sulaiman, Irshad M; Ortega, Ynes; Simpson, Steven; Kerdahi, Khalil

2014-03-01

Cyclospora cayetanensis is an apicocomplexan parasite that infects the gastrointestinal tract and causes acute diarrheal disease in humans. In recent years, this human-pathogenic parasite has led to several foodborne outbreaks in the United States and Canada, mostly associated with imported produce. Understanding the biology and epidemiology of C. cayetanensis is difficult because little is known about its origin, possible zoonotic reservoirs, and genetic relationships with other coccidian parasites. Recently, we developed a 70kDa heat shock protein (HSP70) gene based nested PCR protocol for detection of C. cayetanensis parasite and sequenced the PCR products of 16 human isolates from Nepal, Mexico, and Peru. In this study, we have characterized the regions of 18S ribosomal RNA (rRNA) gene of 17 human C. cayetanensis isolates for molecular detection, and also to ascertain the genetic diversity of this parasite. The 18S rRNA primer sets were further tested by PCR amplification followed by nucleotide sequencing of the PCR amplified products of previously characterized C. cayetanensis isolates from three endemic regions at HSP70 locus. Although no genetic polymorphism was observed at the regions of HSP70 locus characterized in our previous study, the data analysis of this study revealed a minor genetic diversity at the 18S rRNA locus among the C. cayetanensis isolates. The 18S rRNA gene-based nested PCR protocol provides a useful genetic marker for the detection of C. cayetanensis parasite and confirms it as a genetically distinct species in genus Cyclospora. The results also supported lack of geographic segregation and existence of genetically homogeneous population for the C. cayetanensis parasites both at the HSP70 as well as at the18S rRNA loci. Published by Elsevier B.V.

Phylogenetic Analysis of Pasteuria penetrans by 16S rRNA Gene Cloning and Sequencing.

Science.gov (United States)

Anderson, J M; Preston, J F; Dickson, D W; Hewlett, T E; Williams, N H; Maruniak, J E

1999-09-01

Pasteuria penetrans is an endospore-forming bacterial parasite of Meloidogyne spp. This organism is among the most promising agents for the biological control of root-knot nematodes. In order to establish the phylogenetic position of this species relative to other endospore-forming bacteria, the 16S ribosomal genes from two isolates of P. penetrans, P-20, which preferentially infects M. arenaria race 1, and P-100, which preferentially infects M. incognita and M. javanica, were PCR-amplified from a purified endospore extraction. Universal primers for the 16S rRNA gene were used to amplify DNA which was cloned, and a nucleotide sequence was obtained for 92% of the gene (1,390 base pairs) encoding the 16S rDNA from each isolate. Comparison of both isolates showed identical sequences that were compared to 16S rDNA sequences of 30 other endospore-forming bacteria obtained from GenBank. Parsimony analyses indicated that P. penetrans is a species within a clade that includes Alicyclobacillus acidocaldarius, A. cycloheptanicus, Sulfobacillus sp., Bacillus tusciae, B. schlegelii, and P. ramosa. Its closest neighbor is P. ramosa, a parasite of Daphnia spp. (water fleas). This study provided a genomic basis for the relationship of species assigned to the genus Pasteuria, and for comparison of species that are parasites of different phytopathogenic nematodes.

Symportin 1 chaperones 5S RNP assembly during ribosome biogenesis by occupying an essential rRNA-binding site.

Science.gov (United States)

Calviño, Fabiola R; Kharde, Satyavati; Ori, Alessandro; Hendricks, Astrid; Wild, Klemens; Kressler, Dieter; Bange, Gert; Hurt, Ed; Beck, Martin; Sinning, Irmgard

2015-04-07

During 60S biogenesis, mature 5S RNP consisting of 5S RNA, RpL5 and RpL11, assembles into a pre-60S particle, where docking relies on RpL11 interacting with helix 84 (H84) of the 25S RNA. How 5S RNP is assembled for recruitment into the pre-60S is not known. Here we report the crystal structure of a ternary symportin Syo1-RpL5-N-RpL11 complex and provide biochemical and structural insights into 5S RNP assembly. Syo1 guards the 25S RNA-binding surface on RpL11 and competes with H84 for binding. Pull-down experiments show that H84 releases RpL11 from the ternary complex, but not in the presence of 5S RNA. Crosslinking mass spectrometry visualizes structural rearrangements on incorporation of 5S RNA into the Syo1-RpL5-RpL11 complex supporting the formation of a pre-5S RNP. Our data underline the dual role of Syo1 in ribosomal protein transport and as an assembly platform for 5S RNP.

Nuclear Export of Pre-Ribosomal Subunits Requires Dbp5, but Not as an RNA-Helicase as for mRNA Export.

Science.gov (United States)

Neumann, Bettina; Wu, Haijia; Hackmann, Alexandra; Krebber, Heike

2016-01-01

The DEAD-box RNA-helicase Dbp5/Rat8 is known for its function in nuclear mRNA export, where it displaces the export receptor Mex67 from the mRNA at the cytoplasmic side of the nuclear pore complex (NPC). Here we show that Dbp5 is also required for the nuclear export of both pre-ribosomal subunits. Yeast temperature-sensitive dbp5 mutants accumulate both ribosomal particles in their nuclei. Furthermore, Dbp5 genetically and physically interacts with known ribosomal transport factors such as Nmd3. Similar to mRNA export we show that also for ribosomal transport Dbp5 is required at the cytoplasmic side of the NPC. However, unlike its role in mRNA export, Dbp5 does not seem to undergo its ATPase cycle for this function, as ATPase-deficient dbp5 mutants that selectively inhibit mRNA export do not affect ribosomal transport. Furthermore, mutants of GLE1, the ATPase stimulating factor of Dbp5, show no major ribosomal export defects. Consequently, while Dbp5 uses its ATPase cycle to displace the export receptor Mex67 from the translocated mRNAs, Mex67 remains bound to ribosomal subunits upon transit to the cytoplasm, where it is detectable on translating ribosomes. Therefore, we propose a model, in which Dbp5 supports ribosomal transport by capturing ribosomal subunits upon their cytoplasmic appearance at the NPC, possibly by binding export factors such as Mex67. Thus, our findings reveal that although different ribonucleoparticles, mRNAs and pre-ribosomal subunits, use shared export factors, they utilize different transport mechanisms.

Critical 23S rRNA interactions for macrolide-dependent ribosome stalling on the ErmCL nascent peptide chain.

Science.gov (United States)

Koch, Miriam; Willi, Jessica; Pradère, Ugo; Hall, Jonathan; Polacek, Norbert

2017-06-20

The nascent peptide exit tunnel has recently been identified as a functional region of ribosomes contributing to translation regulation and co-translational protein folding. Inducible expression of the erm resistance genes depends on ribosome stalling at specific codons of an upstream open reading frame in the presence of an exit tunnel-bound macrolide antibiotic. The molecular basis for this translation arrest is still not fully understood. Here, we used a nucleotide analog interference approach to unravel important functional groups on 23S rRNA residues in the ribosomal exit tunnel for ribosome stalling on the ErmC leader peptide. By replacing single nucleobase functional groups or even single atoms we were able to demonstrate the importance of A2062, A2503 and U2586 for drug-dependent ribosome stalling. Our data show that the universally conserved A2062 and A2503 are capable of forming a non-Watson-Crick base pair that is critical for sensing and transmitting the stalling signal from the exit tunnel back to the peptidyl transferase center of the ribosome. The nucleobases of A2062, A2503 as well as U2586 do not contribute significantly to the overall mechanism of protein biosynthesis, yet their elaborate role for co-translational monitoring of nascent peptide chains inside the exit tunnel can explain their evolutionary conservation. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

Small-angle X-ray titration study on the complex formation between 5-S RNA and the L18 protein of the Escherichia coli 50-S ribosome particle

International Nuclear Information System (INIS)

Oesterberg, R.; Garrett, A.

1977-01-01

The 5-S RNA (A) and the L 18 protein (B) from Escherichia coli ribosomes form one single AB complex in the concentration ranges supposed to prevail in vivo; at concentrations of L 18 higher than 40 mM there is some indication for a minor species, most probably an AB 2 species. This is indicated from the X-ray scattering titration data of the 5-S RNA/L 18 system recorded at 21 0 C in ribosomal reconstitution buffer. As a result of the 1 : 1 complex formation, there is a relatively small but defined increase in the radius of gyration from 3.61 to 3.85 nm. This result as well as the experimental scattering curve can be explained by models where it is assumed that the elongated L 18 model is quite far from the electron density centre and where protein L 18 interacts with one or both of the minor arms of the supposed Y-shaped 5-S RNA molecule. (orig.) [de

Architecture of the E.coli 70S ribosome

DEFF Research Database (Denmark)

Burkhardt, N.; Diedrich, G.; Nierhaus, K.H.

1997-01-01

The 70S ribosome from E.coli was analysed by neutron scattering focusing on the shape and the internal protein-RNA-distribution of the complex. Measurements on selectively deuterated 70S particles and free 30S and 50S subunits applying conventional contrast variation and proton-spin contrast...

Time of action of 4.5 S RNA in Escherichia coli translation

DEFF Research Database (Denmark)

Brown, S

1989-01-01

A new class of suppressor mutants helps to define the role of 4.5 S RNA in translation. The suppressors reduce the requirement for 4.5 S RNA by increasing the intracellular concentration of uncharged tRNA. Suppression probably occurs by prolonging the period in which translating ribosomes have...... translocated but not yet released the uncharged tRNA, indicating that this is the point at which 4.5 S RNA enters translation. The release of 4.5 S RNA from polysomes is affected by antibiotics that inhibit protein synthesis. The antibiotic-sensitivity of this release indicates that 4.5 S RNA exits...... the ribosome following translocation and prior to release of protein synthesis elongation factor G. These results indicate that 4.5 S RNA acts immediately after ribosomal translocation. A model is proposed in which 4.5 S RNA stabilizes the post-translocation state by replacing 23 S ribosomal RNA as a binding...

Assembly of the 30S subunit from Escherichia coli ribosomes occurs via two assembly domains which are initiated by S4 and S7

International Nuclear Information System (INIS)

Nowotny, V.; Nierhaus, K.H.

1988-01-01

A protein which initiates assembly of ribosomes is defined as a protein which binds to the respective rRNA without cooperativity (i.e., without the help of other proteins) during the onset of assembly and is essential for the formation of active ribosomal subunits. The number of proteins binding without cooperativity was determined by monitoring the reconstitution output of active particles at various inputs of 16S rRNA, in the present of constant amounts of 30S-derived proteins (TP30): This showed that only two of the proteins of the 30S subunit are assembly-initiator proteins. These two proteins are still present on a LiCl core particle comprising 16S rRNA and 12 proteins (including minor proteins). The 12 proteins were isolated, and a series of reconstitution experiments at various levels of rRNA excess demonstrated that S4 and S7 are the initiator proteins. Pulse-chase experiments performed during the early assembly with 14 C- and 3 H-labeled TP30 and the determination of the 14 C/ 3 H ratio of the individual proteins within the assembled particles revealed a bilobal structure of the 30S assembly: A group of six proteins headed by S4 (namely, S4, S20, S16, S15, S6, and S18) resisted the chasing most efficiently (S4 assembly domain). None of the proteins depending on S7 during assembly were found in this group but rather in a second group with intermediate chasing stability [S7 assembly domain; consisting of S7, S9, (S8), S19, and S3]. A number of proteins could be fully chased during the early assembly and therefore represent late assembly proteins (S10, S5, S13, S2, S21, S1). These findings fit well with the 30S assembly map. These data, together with the assembly map, imply that S8 and S5 play an important role in the interconnection of the two assembly domains

Cryo-EM Structure of the Archaeal 50S Ribosomal Subunit in Complex with Initiation Factor 6 and Implications for Ribosome Evolution

Science.gov (United States)

Greber, Basil J.; Boehringer, Daniel; Godinic-Mikulcic, Vlatka; Crnkovic, Ana; Ibba, Michael; Weygand-Durasevic, Ivana; Ban, Nenad

2013-01-01

Translation of mRNA into proteins by the ribosome is universally conserved in all cellular life. The composition and complexity of the translation machinery differ markedly between the three domains of life. Organisms from the domain Archaea show an intermediate level of complexity, sharing several additional components of the translation machinery with eukaryotes that are absent in bacteria. One of these translation factors is initiation factor 6 (IF6), which associates with the large ribosomal subunit. We have reconstructed the 50S ribosomal subunit from the archaeon Methanothermobacter thermautotrophicus in complex with archaeal IF6 at 6.6 Å resolution using cryo-electron microscopy (EM). The structure provides detailed architectural insights into the 50S ribosomal subunit from a methanogenic archaeon through identification of the rRNA expansion segments and ribosomal proteins that are shared between this archaeal ribosome and eukaryotic ribosomes but are mostly absent in bacteria and in some archaeal lineages. Furthermore, the structure reveals that, in spite of highly divergent evolutionary trajectories of the ribosomal particle and the acquisition of novel functions of IF6 in eukaryotes, the molecular binding of IF6 on the ribosome is conserved between eukaryotes and archaea. The structure also provides a snapshot of the reductive evolution of the archaeal ribosome and offers new insights into the evolution of the translation system in archaea. PMID:22306461

Ribosome. The complete structure of the 55S mammalian mitochondrial ribosome.

Science.gov (United States)

Greber, Basil J; Bieri, Philipp; Leibundgut, Marc; Leitner, Alexander; Aebersold, Ruedi; Boehringer, Daniel; Ban, Nenad

2015-04-17

Mammalian mitochondrial ribosomes (mitoribosomes) synthesize mitochondrially encoded membrane proteins that are critical for mitochondrial function. Here we present the complete atomic structure of the porcine 55S mitoribosome at 3.8 angstrom resolution by cryo-electron microscopy and chemical cross-linking/mass spectrometry. The structure of the 28S subunit in the complex was resolved at 3.6 angstrom resolution by focused alignment, which allowed building of a detailed atomic structure including all of its 15 mitoribosomal-specific proteins. The structure reveals the intersubunit contacts in the 55S mitoribosome, the molecular architecture of the mitoribosomal messenger RNA (mRNA) binding channel and its interaction with transfer RNAs, and provides insight into the highly specialized mechanism of mRNA recruitment to the 28S subunit. Furthermore, the structure contributes to a mechanistic understanding of aminoglycoside ototoxicity. Copyright © 2015, American Association for the Advancement of Science.

The Structure of the RNA m5C Methyltransferase YebU from Escherichia coli Reveals a C-terminal RNA-recruiting PUA Domain

DEFF Research Database (Denmark)

Hallberg, B. Martin; Ericsson, Ulrika B.; Johnson, Kenneth A

2006-01-01

potential that differ from other RNA-MTase structures, suggesting that YebU interacts with its RNA target in a different manner. Docking of YebU onto the 30 S subunit indicates that the PUA and MTase domains make several contacts with 16 S rRNA as well as with the ribosomal protein S12. The ribosomal...... protein interactions would explain why the assembled 30 S subunit, and not naked 16 S rRNA, is the preferred substrate for YebU....... by X-ray crystallography, and we present a molecular model for how YebU specifically recognizes, binds and methylates its ribosomal substrate. The YebU protein has an N-terminal SAM-binding catalytic domain with structural similarity to the equivalent domains in several other m(5)C RNA MTases including...

Increased 5S rRNA oxidation in Alzheimer's disease.

Science.gov (United States)

Ding, Qunxing; Zhu, Haiyan; Zhang, Bing; Soriano, Augusto; Burns, Roxanne; Markesbery, William R

2012-01-01

It is widely accepted that oxidative stress is involved in neurodegenerative disorders such as Alzheimer's disease (AD). Ribosomal RNA (rRNA) is one of the most abundant molecules in most cells and is affected by oxidative stress in the human brain. Previous data have indicated that total rRNA levels were decreased in the brains of subjects with AD and mild cognitive impairment concomitant with an increase in rRNA oxidation. In addition, level of 5S rRNA, one of the essential components of the ribosome complex, was significantly lower in the inferior parietal lobule (IP) brain area of subjects with AD compared with control subjects. To further evaluate the alteration of 5S rRNA in neurodegenerative human brains, multiple brain regions from both AD and age-matched control subjects were used in this study, including IP, superior and middle temporal gyro, temporal pole, and cerebellum. Different molecular pools including 5S rRNA integrated into ribosome complexes, free 5S rRNA, cytoplasmic 5S rRNA, and nuclear 5S rRNA were studied. Free 5S rRNA levels were significantly decreased in the temporal pole region of AD subjects and the oxidation of ribosome-integrated and free 5S rRNA was significantly increased in multiple brain regions in AD subjects compared with controls. Moreover, a greater amount of oxidized 5S rRNA was detected in the cytoplasm and nucleus of AD subjects compared with controls. These results suggest that the increased oxidation of 5S rRNA, especially the oxidation of free 5S rRNA, may be involved in the neurodegeneration observed in AD.

Detection of Microbial 16S rRNA Gene in the Blood of Patients With Parkinson’s Disease

Directory of Open Access Journals (Sweden)

Yiwei Qian

2018-05-01

Full Text Available Emerging evidence suggests that the microbiota present in feces plays a role in Parkinson’s disease (PD. However, the alterations of the microbiome in the blood of PD patients remain unknown. To test this hypothesis, we conducted this case-control study to explore the microbiota compositions in the blood of Chinese PD patients. Microbiota communities in the blood of 45 patients and their healthy spouses were investigated using high-throughput Illumina HiSeq sequencing targeting the V3-V4 region of 16S ribosomal RNA (rRNA gene. The relationships between the microbiota in the blood and PD clinical characteristics were analyzed. No difference was detected in the structure and richness between PD patients and healthy controls. The following genera were enriched in the blood of PD patients: Isoptericola, Cloacibacterium, Enhydrobacter and Microbacterium; whereas genus Limnobacter was enriched in the healthy controls after adjusting for age, gender, body mass index (BMI and constipation. Additionally, the findings regarding these genera were validated in another independent group of 58 PD patients and 57 healthy controls using real-time PCR targeting genus-specific 16S rRNA genes. Furthermore, not only the genera Cloacibacterium and Isoptericola (which were identified as enriched in PD patients but also the genera Paludibacter and Saccharofermentans were positively associated with disease duration. Some specific genera in the blood were related to mood disorders. We believe this is the first report to provide direct evidence to support the hypothesis that the identified microbiota in the blood are associated with PD. Additionally, some microbiota in the blood are closely associated with the clinical characteristics of PD. Elucidating these differences in blood microbiomes will provide a foundation to improve our understanding of the role of microbiota in the pathogenesis of PD.

A comparison of structural and evolutionary attributes of Escherichia coli and Thermus thermophilus small ribosomal subunits: signatures of thermal adaptation.

Directory of Open Access Journals (Sweden)

Saurav Mallik

Full Text Available Here we compare the structural and evolutionary attributes of Thermus thermophilus and Escherichia coli small ribosomal subunits (SSU. Our results indicate that with few exceptions, thermophilic 16S ribosomal RNA (16S rRNA is densely packed compared to that of mesophilic at most of the analogous spatial regions. In addition, we have located species-specific cavity clusters (SSCCs in both species. E. coli SSCCs are numerous and larger compared to T. thermophilus SSCCs, which again indicates densely packed thermophilic 16S rRNA. Thermophilic ribosomal proteins (r-proteins have longer disordered regions than their mesophilic homologs and they experience larger disorder-to-order transitions during SSU-assembly. This is reflected in the predicted higher conformational changes of thermophilic r-proteins compared to their mesophilic homologs during SSU-assembly. This high conformational change of thermophilic r-proteins may help them to associate with the 16S ribosomal RNA with high complementary interfaces, larger interface areas, and denser molecular contacts, compared to those of mesophilic. Thus, thermophilic protein-rRNA interfaces are tightly associated with 16S rRNA than their mesophilic homologs. Densely packed 16S rRNA interior and tight protein-rRNA binding of T. thermophilus (compared to those of E. coli are likely the signatures of its thermal adaptation. We have found a linear correlation between the free energy of protein-RNA interface formation, interface size, and square of conformational changes, which is followed in both prokaryotic and eukaryotic SSU. Disorder is associated with high protein-RNA interface polarity. We have found an evolutionary tendency to maintain high polarity (thereby disorder at protein-rRNA interfaces, than that at rest of the protein structures. However, some proteins exhibit exceptions to this general trend.

How does a scanning ribosomal particle move along the 5'-untranslated region of eukaryotic mRNA? Brownian Ratchet model.

Science.gov (United States)

Spirin, Alexander S

2009-11-17

A model of the ATP-dependent unidirectional movement of the 43S ribosomal initiation complex (=40S ribosomal subunit + eIF1 + eIF1A + eIF2.GTP.Met-tRNA(i) + eIF3) during scanning of the 5'-untranslated region of eukaryotic mRNA is proposed. The model is based on the principles of molecular Brownian ratchet machines and explains several enigmatic data concerning the scanning complex. In this model, the one-dimensional diffusion of the ribosomal initiation complex along the mRNA chain is rectified into the net-unidirectional 5'-to-3' movement by the Feynman ratchet-and-pawl mechanism. The proposed mechanism is organized by the heterotrimeric protein eIF4F (=eIF4A + eIF4E + eIF4G), attached to the scanning ribosomal particle via eIF3, and the RNA-binding protein eIF4B that is postulated to play the role of the pawl. The energy for the useful work of the ratchet-and-pawl mechanism is supplied from ATP hydrolysis induced by the eIF4A subunit: ATP binding and its hydrolysis alternately change the affinities of eIF4A for eIF4B and for mRNA, resulting in the restriction of backward diffusional sliding of the 43S ribosomal complex along the mRNA chain, while stochastic movements ahead are allowed.

Prevalence of 16S rRNA methylase genes among b-lactamase ...

African Journals Online (AJOL)

2014-07-07

Jul 7, 2014 ... School of Life Sciences, Pondicherry University, Pondicherry, India ... Methods: To study co existence of 16S rRNA methylases (armA, rmtA, rmtB, rmtC, rmtD, and .... Isolates positive for bla or 16S rRNA methylase genes.

The nuclear 18S ribosomal RNA gene as a source of phylogenetic information in the genus Taenia.

Science.gov (United States)

Yan, Hongbin; Lou, Zhongzi; Li, Li; Ni, Xingwei; Guo, Aijiang; Li, Hongmin; Zheng, Yadong; Dyachenko, Viktor; Jia, Wanzhong

2013-03-01

Most species of the genus Taenia are of considerable medical and veterinary significance. In this study, complete nuclear 18S rRNA gene sequences were obtained from seven members of genus Taenia [Taenia multiceps, Taenia saginata, Taenia asiatica, Taenia solium, Taenia pisiformis, Taenia hydatigena, and Taenia taeniaeformis] and a phylogeny inferred using these sequences. Most of the variable sites fall within the variable regions, V1-V5. We show that sequences from the nuclear 18S ribosomal RNA gene have considerable promise as sources of phylogenetic information within the genus Taenia. Furthermore, given that almost all the variable sites lie within defined variable portions of that gene, it will be appropriate and economical to sequence only those regions for additional species of Taenia.

Evidence for rRNA 2'-O-methylation plasticity: Control of intrinsic translational capabilities of human ribosomes.

Science.gov (United States)

Erales, Jenny; Marchand, Virginie; Panthu, Baptiste; Gillot, Sandra; Belin, Stéphane; Ghayad, Sandra E; Garcia, Maxime; Laforêts, Florian; Marcel, Virginie; Baudin-Baillieu, Agnès; Bertin, Pierre; Couté, Yohann; Adrait, Annie; Meyer, Mélanie; Therizols, Gabriel; Yusupov, Marat; Namy, Olivier; Ohlmann, Théophile; Motorin, Yuri; Catez, Frédéric; Diaz, Jean-Jacques

2017-12-05

Ribosomal RNAs (rRNAs) are main effectors of messenger RNA (mRNA) decoding, peptide-bond formation, and ribosome dynamics during translation. Ribose 2'-O-methylation (2'-O-Me) is the most abundant rRNA chemical modification, and displays a complex pattern in rRNA. 2'-O-Me was shown to be essential for accurate and efficient protein synthesis in eukaryotic cells. However, whether rRNA 2'-O-Me is an adjustable feature of the human ribosome and a means of regulating ribosome function remains to be determined. Here we challenged rRNA 2'-O-Me globally by inhibiting the rRNA methyl-transferase fibrillarin in human cells. Using RiboMethSeq, a nonbiased quantitative mapping of 2'-O-Me, we identified a repertoire of 2'-O-Me sites subjected to variation and demonstrate that functional domains of ribosomes are targets of 2'-O-Me plasticity. Using the cricket paralysis virus internal ribosome entry site element, coupled to in vitro translation, we show that the intrinsic capability of ribosomes to translate mRNAs is modulated through a 2'-O-Me pattern and not by nonribosomal actors of the translational machinery. Our data establish rRNA 2'-O-Me plasticity as a mechanism providing functional specificity to human ribosomes.

16S/18S ribosomal DNA clone library analysis of rumen microbial diversity

International Nuclear Information System (INIS)

Wright, A.G.; Kiyoshi Tajima; Aminov, R.I.

2005-01-01

The rumen contains a complex ecosystem where billions of bacteria, archaea, protozoa and fungi reside. This diverse microbiota is well adapted to live in the rumen and play an important role in the digestion of feed and nutrient supply to the host in the form of microbial protein and volatile fatty acids. It is estimated that the rumen microbial population consists of about 10 6 protozoa/ml, 10 3 -10 7 fungi/ml, 10 10 bacteria/ml, and 10 9 methanogens/ml. To better understand the complex relationships in the rumen, it is necessary to gain an insight into the diversity of the rumen microbes and how the quantity and composition of rumen micro-organisms are altered by a number of different host factors such as age, genetics and diet. In the past, the diversity of micro-organisms from the digestive tracts of domesticated ruminants has been identified by classical microbiological techniques. However, given the fastidious growth requirements of rumen micro-organisms, it is reasonable to concede that the culture-dependent methods may select against some species, or taxonomic groups, leading researchers to underestimate the microbial diversity that is actually present in the rumen. In fact, it has been speculated that 90% of micro-organisms in nature have escaped traditional cultivation methods. Therefore, a major challenge in microbial ecology has been to assess the diversity and structure of natural microbial communities. The field of molecular biology has advanced with many innovative technological breakthroughs. The ability to extract and to isolate high-molecular weight DNA from rumen digesta, PCR amplify genes from specific microbial groups and obtain gene sequence data is now a routine event. The small subunit ribosomal RNA (SSU-rRNA) gene, called 16S in prokaryotes and 18S in eukaryotes, is the most widely used molecular marker to presumptively identify morphologically indistinguishable species, to infer their phylogenetic relationships, and to elucidate microbial

Proto-ribosome: a theoretical approach based on RNA relics

OpenAIRE

Demongeot, Jacques

2017-01-01

We describe in this paper, based on already published articles, a contribution to the theory postulating the existence of a proto-ribosome, which could have appeared early at the origin of life and we discuss the interest of this notion in an evolutionary perspective, taking into account the existence of possible RNA relics of this proto-ribosome.

Origins of the plant chloroplasts and mitochondria based on comparisons of 5S ribosomal RNAs

Science.gov (United States)

Delihas, N.; Fox, G. E.

1987-01-01

In this paper, we provide macromolecular comparisons utilizing the 5S ribosomal RNA structure to suggest extant bacteria that are the likely descendants of chloroplast and mitochondria endosymbionts. The genetic stability and near universality of the 5S ribosomal gene allows for a useful means to study ancient evolutionary changes by macromolecular comparisons. The value in current and future ribosomal RNA comparisons is in fine tuning the assignment of ancestors to the organelles and in establishing extant species likely to be descendants of bacteria involved in presumed multiple endosymbiotic events.

Prevalence of 16S rRNA methylase genes among β-lactamase ...

African Journals Online (AJOL)

Background: Co production of 16S rRNA methylases gene and β-Lactamase gene among Enterobacteriaceae isolates conferring resistance to both therapeutic options has serious implications for clinicians worldwide. Methods: To study co existence of 16S rRNA methylases (armA, rmtA, rmtB, rmtC, rmtD, and npmA) and ...

Crystal Structure of the 23S rRNA Fragment Specific to r-Protein L1 and Designed Model of the Ribosomal L1 Stalk from Haloarcula marismortui

Directory of Open Access Journals (Sweden)

Azat Gabdulkhakov

2017-02-01

Full Text Available The crystal structure of the 92-nucleotide L1-specific fragment of 23S rRNA from Haloarcula marismortui (Hma has been determined at 3.3 Å resolution. Similar to the corresponding bacterial rRNA fragments, this structure contains joined helix 76-77 topped by an approximately globular structure formed by the residual part of the L1 stalk rRNA. The position of HmaL1 relative to the rRNA was found by its docking to the rRNA fragment using the L1-rRNA complex from Thermus thermophilus as a guide model. In spite of the anomalous negative charge of the halophilic archaeal protein, the conformation of the HmaL1-rRNA interface appeared to be very close to that observed in all known L1-rRNA complexes. The designed structure of the L1 stalk was incorporated into the H. marismortui 50S ribosomal subunit. Comparison of relative positions of L1 stalks in 50S subunits from H. marismortui and T. thermophilus made it possible to reveal the site of inflection of rRNA during the ribosome function.

Yeast eIF4B binds to the head of the 40S ribosomal subunit and promotes mRNA recruitment through its N-terminal and internal repeat domains.

Science.gov (United States)

Walker, Sarah E; Zhou, Fujun; Mitchell, Sarah F; Larson, Victoria S; Valasek, Leos; Hinnebusch, Alan G; Lorsch, Jon R

2013-02-01

Eukaryotic translation initiation factor (eIF)4B stimulates recruitment of mRNA to the 43S ribosomal pre-initiation complex (PIC). Yeast eIF4B (yeIF4B), shown previously to bind single-stranded (ss) RNA, consists of an N-terminal domain (NTD), predicted to be unstructured in solution; an RNA-recognition motif (RRM); an unusual domain comprised of seven imperfect repeats of 26 amino acids; and a C-terminal domain. Although the mechanism of yeIF4B action has remained obscure, most models have suggested central roles for its RRM and ssRNA-binding activity. We have dissected the functions of yeIF4B's domains and show that the RRM and its ssRNA-binding activity are dispensable in vitro and in vivo. Instead, our data indicate that the 7-repeats and NTD are the most critical domains, which mediate binding of yeIF4B to the head of the 40S ribosomal subunit via interaction with Rps20. This interaction induces structural changes in the ribosome's mRNA entry channel that could facilitate mRNA loading. We also show that yeIF4B strongly promotes productive interaction of eIF4A with the 43S•mRNA PIC in a manner required for efficient mRNA recruitment.

High throughput 16S rRNA gene amplicon sequencing

DEFF Research Database (Denmark)

Nierychlo, Marta; Larsen, Poul; Jørgensen, Mads Koustrup

S rRNA gene amplicon sequencing has been developed over the past few years and is now ready to use for more comprehensive studies related to plant operation and optimization thanks to short analysis time, low cost, high throughput, and high taxonomic resolution. In this study we show how 16S r......RNA gene amplicon sequencing can be used to reveal factors of importance for the operation of full-scale nutrient removal plants related to settling problems and floc properties. Using optimized DNA extraction protocols, indexed primers and our in-house Illumina platform, we prepared multiple samples...... be correlated to the presence of the species that are regarded as “strong” and “weak” floc formers. In conclusion, 16S rRNA gene amplicon sequencing provides a high throughput approach for a rapid and cheap community profiling of activated sludge that in combination with multivariate statistics can be used...

Lyme disease caused by Borrelia burgdorferi with two homeologous 16S rRNA genes: a case report

Directory of Open Access Journals (Sweden)

Lee SH

2016-04-01

Full Text Available Sin Hang Lee,1,21Pathology Department, Milford Hospital, Milford, CT, USA; 2Milford Molecular Diagnostics, Milford, CT, USA Abstract: Lyme disease (LD, the most common tick-borne disease in North America, is believed to be caused exclusively by Borrelia burgdorferi sensu stricto and is usually diagnosed by clinical evaluation and serologic assays. As reported previously in a peer-reviewed article, a 13-year-old boy living in the Northeast of the USA was initially diagnosed with LD based on evaluation of his clinical presentations and on serologic test results. The patient was treated with a course of oral doxycycline for 28 days, and the symptoms resolved. A year later, the boy developed a series of unusual symptoms and did not attend school for 1 year. A LD specialist reviewed the case and found the serologic test band patterns nondiagnostic of LD. The boy was admitted to a psychiatric hospital. After discharge from the psychiatric hospital, a polymerase chain reaction test performed in a winter month when the boy was 16 years old showed a low density of B. burgdorferi sensu lato in the blood of the patient, confirmed by partial 16S rRNA (ribosomal RNA gene sequencing. Subsequent DNA sequencing analysis presented in this report demonstrated that the spirochete isolate was a novel strain of B. burgdorferi with two homeologous 16S rRNA genes, which has never been reported in the world literature. This case report shows that direct DNA sequencing is a valuable tool for reliable molecular diagnosis of Lyme and related borrelioses, as well as for studies of the diversity of the causative agents of LD because LD patients infected by a rare or novel borrelial variant may produce an antibody pattern that can be different from the pattern characteristic of an infection caused by a typical B. burgdorferi sensu stricto strain. Keywords: Lyme disease, Borrelia burgdorferi, homeologous 16S rRNA genes, DNA sequencing

Reconstruction of ribosomal RNA genes from metagenomic data.

Directory of Open Access Journals (Sweden)

Lu Fan

Full Text Available Direct sequencing of environmental DNA (metagenomics has a great potential for describing the 16S rRNA gene diversity of microbial communities. However current approaches using this 16S rRNA gene information to describe community diversity suffer from low taxonomic resolution or chimera problems. Here we describe a new strategy that involves stringent assembly and data filtering to reconstruct full-length 16S rRNA genes from metagenomicpyrosequencing data. Simulations showed that reconstructed 16S rRNA genes provided a true picture of the community diversity, had minimal rates of chimera formation and gave taxonomic resolution down to genus level. The strategy was furthermore compared to PCR-based methods to determine the microbial diversity in two marine sponges. This showed that about 30% of the abundant phylotypes reconstructed from metagenomic data failed to be amplified by PCR. Our approach is readily applicable to existing metagenomic datasets and is expected to lead to the discovery of new microbial phylotypes.

Myb-binding protein 1a (Mybbp1a) regulates levels and processing of pre-ribosomal RNA.

Science.gov (United States)

Hochstatter, Julia; Hölzel, Michael; Rohrmoser, Michaela; Schermelleh, Lothar; Leonhardt, Heinrich; Keough, Rebecca; Gonda, Thomas J; Imhof, Axel; Eick, Dirk; Längst, Gernot; Németh, Attila

2012-07-13

Ribosomal RNA gene transcription, co-transcriptional processing, and ribosome biogenesis are highly coordinated processes that are tightly regulated during cell growth. In this study we discovered that Mybbp1a is associated with both the RNA polymerase I complex and the ribosome biogenesis machinery. Using a reporter assay that uncouples transcription and RNA processing, we show that Mybbp1a represses rRNA gene transcription. In addition, overexpression of the protein reduces RNA polymerase I loading on endogenous rRNA genes as revealed by chromatin immunoprecipitation experiments. Accordingly, depletion of Mybbp1a results in an accumulation of the rRNA precursor in vivo but surprisingly also causes growth arrest of the cells. This effect can be explained by the observation that the modulation of Mybbp1a protein levels results in defects in pre-rRNA processing within the cell. Therefore, the protein may play a dual role in the rRNA metabolism, potentially linking and coordinating ribosomal DNA transcription and pre-rRNA processing to allow for the efficient synthesis of ribosomes.

Crystallization of the two-domain N-terminal fragment of the archaeal ribosomal protein L10(P0) in complex with a specific fragment of 23S rRNA

Science.gov (United States)

Kravchenko, O. V.; Mitroshin, I. V.; Gabdulkhakov, A. G.; Nikonov, S. V.; Garber, M. B.

2011-07-01

Lateral L12-stalk (P1-stalk in Archaea, P1/P2-stalk in eukaryotes) is an obligatory morphological element of large ribosomal subunits in all organisms studied. This stalk is composed of the complex of ribosomal proteins L10(P0) and L12(P1) and interacts with 23S rRNA through the protein L10(P0). L12(P1)-stalk is involved in the formation of GTPase center of the ribosome and plays an important role in the ribosome interaction with translation factors. High mobility of this stalk puts obstacles in determination of its structure within the intact ribosome. Crystals of a two-domain N-terminal fragment of ribosomal protein L10(P0) from the archaeon Methanococcus jannaschii in complex with a specific fragment of rRNA from the same organism have been obtained. The crystals diffract X-rays at 3.2 Å resolution.

Crystallization of the two-domain N-terminal fragment of the archaeal ribosomal protein L10(P0) in complex with a specific fragment of 23S rRNA

Energy Technology Data Exchange (ETDEWEB)

Kravchenko, O. V.; Mitroshin, I. V.; Gabdulkhakov, A. G.; Nikonov, S. V.; Garber, M. B., E-mail: garber@vega.protres.ru [Institute of Protein Research RAS (Russian Federation)

2011-07-15

Lateral L12-stalk (P1-stalk in Archaea, P1/P2-stalk in eukaryotes) is an obligatory morphological element of large ribosomal subunits in all organisms studied. This stalk is composed of the complex of ribosomal proteins L10(P0) and L12(P1) and interacts with 23S rRNA through the protein L10(P0). L12(P1)-stalk is involved in the formation of GTPase center of the ribosome and plays an important role in the ribosome interaction with translation factors. High mobility of this stalk puts obstacles in determination of its structure within the intact ribosome. Crystals of a two-domain N-terminal fragment of ribosomal protein L10(P0) from the archaeon Methanococcus jannaschii in complex with a specific fragment of rRNA from the same organism have been obtained. The crystals diffract X-rays at 3.2 Angstrom-Sign resolution.

Emergence of Tetracycline Resistance in Helicobacter pylori: Multiple Mutational Changes in 16S Ribosomal DNA and Other Genetic Loci

Science.gov (United States)

Dailidiene, Daiva; Bertoli, M. Teresita; Miciuleviciene, Jolanta; Mukhopadhyay, Asish K.; Dailide, Giedrius; Pascasio, Mario Alberto; Kupcinskas, Limas; Berg, Douglas E.

2002-01-01

Tetracycline is useful in combination therapies against the gastric pathogen Helicobacter pylori. We found 6 tetracycline-resistant (Tetr) strains among 159 clinical isolates (from El Salvador, Lithuania, and India) and obtained the following four results: (i) 5 of 6 Tetr isolates contained one or two nucleotide substitutions in one part of the primary tetracycline binding site in 16S rRNA (AGA965-967 [Escherichia coli coordinates] changed to gGA, AGc, guA, or gGc [lowercase letters are used to represent the base changes]), whereas the sixth (isolate Ind75) retained AGA965-967; (ii) PCR products containing mutant 16S ribosomal DNA (rDNA) alleles transformed recipient strains to Tetr phenotypes, but transformants containing alleles with single substitutions (gGA and AGc) were less resistant than their Tetr parents; (iii) each of 10 Tetr mutants of reference strain 26695 (in which mutations were induced with metronidazole, a mutagenic anti-H. pylori agent) contained the normal AGA965-967 sequence; and (iv) transformant derivatives of Ind75 and of one of the Tetr 26695 mutants that had acquired mutant rDNA alleles were resistant to tetracycline at levels higher than those to which either parent strain was resistant. Thus, tetracycline resistance in H. pylori results from an accumulation of changes that may affect tetracycline-ribosome affinity and/or other functions (perhaps porins or efflux pumps). We suggest that the rarity of tetracycline resistance among clinical isolates reflects this need for multiple mutations and perhaps also the deleterious effects of such mutations on fitness. Formally equivalent mutations with small but additive effects are postulated to contribute importantly to traits such as host specificity and virulence and to H. pylori's great genetic diversity. PMID:12435699

High-Resolution Analysis of Coronavirus Gene Expression by RNA Sequencing and Ribosome Profiling.

Science.gov (United States)

Irigoyen, Nerea; Firth, Andrew E; Jones, Joshua D; Chung, Betty Y-W; Siddell, Stuart G; Brierley, Ian

2016-02-01

Members of the family Coronaviridae have the largest genomes of all RNA viruses, typically in the region of 30 kilobases. Several coronaviruses, such as Severe acute respiratory syndrome-related coronavirus (SARS-CoV) and Middle East respiratory syndrome-related coronavirus (MERS-CoV), are of medical importance, with high mortality rates and, in the case of SARS-CoV, significant pandemic potential. Other coronaviruses, such as Porcine epidemic diarrhea virus and Avian coronavirus, are important livestock pathogens. Ribosome profiling is a technique which exploits the capacity of the translating ribosome to protect around 30 nucleotides of mRNA from ribonuclease digestion. Ribosome-protected mRNA fragments are purified, subjected to deep sequencing and mapped back to the transcriptome to give a global "snap-shot" of translation. Parallel RNA sequencing allows normalization by transcript abundance. Here we apply ribosome profiling to cells infected with Murine coronavirus, mouse hepatitis virus, strain A59 (MHV-A59), a model coronavirus in the same genus as SARS-CoV and MERS-CoV. The data obtained allowed us to study the kinetics of virus transcription and translation with exquisite precision. We studied the timecourse of positive and negative-sense genomic and subgenomic viral RNA production and the relative translation efficiencies of the different virus ORFs. Virus mRNAs were not found to be translated more efficiently than host mRNAs; rather, virus translation dominates host translation at later time points due to high levels of virus transcripts. Triplet phasing of the profiling data allowed precise determination of translated reading frames and revealed several translated short open reading frames upstream of, or embedded within, known virus protein-coding regions. Ribosome pause sites were identified in the virus replicase polyprotein pp1a ORF and investigated experimentally. Contrary to expectations, ribosomes were not found to pause at the ribosomal

High-Resolution Analysis of Coronavirus Gene Expression by RNA Sequencing and Ribosome Profiling.

Directory of Open Access Journals (Sweden)

Nerea Irigoyen

2016-02-01

Full Text Available Members of the family Coronaviridae have the largest genomes of all RNA viruses, typically in the region of 30 kilobases. Several coronaviruses, such as Severe acute respiratory syndrome-related coronavirus (SARS-CoV and Middle East respiratory syndrome-related coronavirus (MERS-CoV, are of medical importance, with high mortality rates and, in the case of SARS-CoV, significant pandemic potential. Other coronaviruses, such as Porcine epidemic diarrhea virus and Avian coronavirus, are important livestock pathogens. Ribosome profiling is a technique which exploits the capacity of the translating ribosome to protect around 30 nucleotides of mRNA from ribonuclease digestion. Ribosome-protected mRNA fragments are purified, subjected to deep sequencing and mapped back to the transcriptome to give a global "snap-shot" of translation. Parallel RNA sequencing allows normalization by transcript abundance. Here we apply ribosome profiling to cells infected with Murine coronavirus, mouse hepatitis virus, strain A59 (MHV-A59, a model coronavirus in the same genus as SARS-CoV and MERS-CoV. The data obtained allowed us to study the kinetics of virus transcription and translation with exquisite precision. We studied the timecourse of positive and negative-sense genomic and subgenomic viral RNA production and the relative translation efficiencies of the different virus ORFs. Virus mRNAs were not found to be translated more efficiently than host mRNAs; rather, virus translation dominates host translation at later time points due to high levels of virus transcripts. Triplet phasing of the profiling data allowed precise determination of translated reading frames and revealed several translated short open reading frames upstream of, or embedded within, known virus protein-coding regions. Ribosome pause sites were identified in the virus replicase polyprotein pp1a ORF and investigated experimentally. Contrary to expectations, ribosomes were not found to pause at the

Dwell-Time Distribution, Long Pausing and Arrest of Single-Ribosome Translation through the mRNA Duplex.

Science.gov (United States)

Xie, Ping

2015-10-09

Proteins in the cell are synthesized by a ribosome translating the genetic information encoded on the single-stranded messenger RNA (mRNA). It has been shown that the ribosome can also translate through the duplex region of the mRNA by unwinding the duplex. Here, based on our proposed model of the ribosome translation through the mRNA duplex we study theoretically the distribution of dwell times of the ribosome translation through the mRNA duplex under the effect of a pulling force externally applied to the ends of the mRNA to unzip the duplex. We provide quantitative explanations of the available single molecule experimental data on the distribution of dwell times with both short and long durations, on rescuing of the long paused ribosomes by raising the pulling force to unzip the duplex, on translational arrests induced by the mRNA duplex and Shine-Dalgarno(SD)-like sequence in the mRNA. The functional consequences of the pauses or arrests caused by the mRNA duplex and the SD sequence are discussed and compared with those obtained from other types of pausing, such as those induced by "hungry" codons or interactions of specific sequences in the nascent chain with the ribosomal exit tunnel.

Unexpected Diagnosis of Cerebral Toxoplasmosis by 16S and D2 Large-Subunit Ribosomal DNA PCR and Sequencing

DEFF Research Database (Denmark)

Kruse, Alexandra Yasmin Collin; Kvich, Lasse Andersson; Eickhardt-Dalbøge, Steffen Robert

2015-01-01

The protozoan parasite Toxoplasma gondii causes severe opportunistic infections. Here, we report an unexpected diagnosis of cerebral toxoplasmosis. T. gondii was diagnosed by 16S and D2 large-subunit (LSU) ribosomal DNA (rDNA) sequencing of a cerebral biopsy specimen and confirmed by T. gondii...

Identification of RNA species in the RNA-toxin complex and structure of the complex in Clostridium botulinum type E.

Science.gov (United States)

Kitamura, Masaru

2002-02-15

Clostridium botulinum type E toxin was isolated in the form of a complex with RNA(s) from bacterial cells. Characterization of the complexed RNA remains to be elucidated. The RNA is identified here as ribosomal RNA (rRNA) having 23S and 16S components. The RNA-toxin complexes were found to be made up of three types with different molecular sizes. The three types of RNA-toxin complex are toxin bound to both the 23S and 16S rRNA, toxin bound to the 16S rRNA and a small amount of 23S rRNA, and toxin bound only to the 16S rRNA. ©2002 Elsevier Science (USA).

Ribosomal protein L5 has a highly twisted concave surface and flexible arms responsible for rRNA binding.

OpenAIRE

Nakashima, T; Yao, M; Kawamura, S; Iwasaki, K; Kimura, M; Tanaka, I

2001-01-01

Ribosomal protein L5 is a 5S rRNA binding protein in the large subunit and plays an essential role in the promotion of a particular conformation of 5S rRNA. The crystal structure of the ribosomal protein L5 from Bacillus stearothermophilus has been determined at 1.8 A resolution. The molecule consists of a five-stranded antiparallel beta-sheet and four alpha-helices, which fold in a way that is topologically similar to the ribonucleoprotein (RNP) domain. The molecular shape and electrostatic ...

Restriction fragment length polymorphism (RFLP) analysis of PCR products amplified from 18S ribosomal RNA gene of Trypanosoma congolense

International Nuclear Information System (INIS)

Osanyo, A.; Majiwa, P.W.

2006-01-01

Oligonucleotide primers were designed from the conserved nucleotide sequences of 18S ribosomal RNA (18S rRNA) gene of protozoans: Trypanosoma brucei, Leishmania donovani, Triponema aequale and Lagenidium gigantum. The primers were used in polymerace chain reaction (PCR) to generate PCR products of approximately 1 Kb using genomic DNA from T. brucei and the four genotypic groups of T. congolense as template. The five PCR products so produced were digested with several restriction enzymes and hybridized to a DNA probe made from T. brucei PCR product of the same 18S rRNA gene region. Most restriction enzyme digests revealed polymorphism with respect to the location of their recognition sites on the five PCR products. The restriction fragment length polymorphism (RFLP) pattern observed indicate that the 18S rRNA gene sequences of trypanosomes: T. brucei and the four genotypes of T.congolence group are heterogeneous. The results further demonstrate that the region that was amplified can be used in specific identification of trypanosomes species and subspecies.(author)

Production of RNA-protein cross links in γ irradiated E. Coli ribosomes

International Nuclear Information System (INIS)

Ekert, Bernard; Giocanti, Nicole

1976-01-01

γ irradiation in de-aerated conditions of E. coli MRE 600 ribosomes, labelled with 14 C uracil, leads to a decrease of extractibility of 14 C RNA by lithium chloride 4 M-urea 8 M. On the other hand, the radioactivity of the protein fraction increases with irradiation. These results strongly suggest that RNA-protein cross links are formed in irradiated ribosomes [fr

The Complete Structure of the Mycobacterium smegmatis 70S Ribosome.

Science.gov (United States)

Hentschel, Jendrik; Burnside, Chloe; Mignot, Ingrid; Leibundgut, Marc; Boehringer, Daniel; Ban, Nenad

2017-07-05

The ribosome carries out the synthesis of proteins in every living cell. It consequently represents a frontline target in anti-microbial therapy. Tuberculosis ranks among the leading causes of death worldwide, due in large part to the combination of difficult-to-treat latency and antibiotic resistance. Here, we present the 3.3-Å cryo-EM structure of the 70S ribosome of Mycobacterium smegmatis, a close relative to the human pathogen Mycobacterium tuberculosis. The structure reveals two additional ribosomal proteins and localizes them to the vicinity of drug-target sites in both the catalytic center and the decoding site of the ribosome. Furthermore, we visualized actinobacterium-specific rRNA and protein expansions that extensively remodel the ribosomal surface with implications for polysome organization. Our results provide a foundation for understanding the idiosyncrasies of mycobacterial translation and reveal atomic details of the structure that will facilitate the design of anti-tubercular therapeutics. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

Genome-wide mRNA processing in methanogenic archaea reveals post-transcriptional regulation of ribosomal protein synthesis.

Science.gov (United States)

Qi, Lei; Yue, Lei; Feng, Deqin; Qi, Fengxia; Li, Jie; Dong, Xiuzhu

2017-07-07

Unlike stable RNAs that require processing for maturation, prokaryotic cellular mRNAs generally follow an 'all-or-none' pattern. Herein, we used a 5΄ monophosphate transcript sequencing (5΄P-seq) that specifically captured the 5΄-end of processed transcripts and mapped the genome-wide RNA processing sites (PSSs) in a methanogenic archaeon. Following statistical analysis and stringent filtration, we identified 1429 PSSs, among which 23.5% and 5.4% were located in 5΄ untranslated region (uPSS) and intergenic region (iPSS), respectively. A predominant uridine downstream PSSs served as a processing signature. Remarkably, 5΄P-seq detected overrepresented uPSS and iPSS in the polycistronic operons encoding ribosomal proteins, and the majority upstream and proximal ribosome binding sites, suggesting a regulatory role of processing on translation initiation. The processed transcripts showed increased stability and translation efficiency. Particularly, processing within the tricistronic transcript of rplA-rplJ-rplL enhanced the translation of rplL, which can provide a driving force for the 1:4 stoichiometry of L10 to L12 in the ribosome. Growth-associated mRNA processing intensities were also correlated with the cellular ribosomal protein levels, thereby suggesting that mRNA processing is involved in tuning growth-dependent ribosome synthesis. In conclusion, our findings suggest that mRNA processing-mediated post-transcriptional regulation is a potential mechanism of ribosomal protein synthesis and stoichiometry. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

[TYPING OF LEPTOSPIRA SPP. STRAINS BASED ON 16S rRNA].

Science.gov (United States)

Ostankova, Yu V; Semenov, A V; Stoyanova, N A; Tokarevich, N K; Lyubimova, N E; Petrova, O A; Ananina, Yu V; Petrov, E M

2016-01-01

Comparative typing of Leptospira spp. strain collection based on analysis of 16S RNA fragment. 2 pairs of primers were used for PCR, that jointly flank 1423b.p. sized fragment. Sequences of Leptospira spp. strain 16S rRNA, presented in the international database, were used for phylogenetic analysis. A high similarity, including interspecies, of the 16S fragment in Leptospira spp. strains was shown independently of the source, serovar and serogroup. Heterogeneity of the primary matrix, spontaneous mutations of hotspots and erroneous nucleotide couplings, characteristic for 16S sequence of pathogenic Leptospira spp. strains, are discussed. Molecular-genetic characteristic of certain reference Leptospira spp. strains by 16S sequence is obtained. Results of the studies give evidence on expedience of introduction into clinical practice of identification of Leptospira spp. by 16S sequence directly from the clinical material, that would allow to significantly reduce identification time, dismiss complex type-specific sera and other labor-intensive methods.

Simulating movement of tRNA through the ribosome during hybrid-state formation.

Science.gov (United States)

Whitford, Paul C; Sanbonmatsu, Karissa Y

2013-09-28

Biomolecular simulations provide a means for exploring the relationship between flexibility, energetics, structure, and function. With the availability of atomic models from X-ray crystallography and cryoelectron microscopy (cryo-EM), and rapid increases in computing capacity, it is now possible to apply molecular dynamics (MD) simulations to large biomolecular machines, and systematically partition the factors that contribute to function. A large biomolecular complex for which atomic models are available is the ribosome. In the cell, the ribosome reads messenger RNA (mRNA) in order to synthesize proteins. During this essential process, the ribosome undergoes a wide range of conformational rearrangements. One of the most poorly understood transitions is translocation: the process by which transfer RNA (tRNA) molecules move between binding sites inside of the ribosome. The first step of translocation is the adoption of a "hybrid" configuration by the tRNAs, which is accompanied by large-scale rotations in the ribosomal subunits. To illuminate the relationship between these rearrangements, we apply MD simulations using a multi-basin structure-based (SMOG) model, together with targeted molecular dynamics protocols. From 120 simulated transitions, we demonstrate the viability of a particular route during P/E hybrid-state formation, where there is asynchronous movement along rotation and tRNA coordinates. These simulations not only suggest an ordering of events, but they highlight atomic interactions that may influence the kinetics of hybrid-state formation. From these simulations, we also identify steric features (H74 and surrounding residues) encountered during the hybrid transition, and observe that flexibility of the single-stranded 3'-CCA tail is essential for it to reach the endpoint. Together, these simulations provide a set of structural and energetic signatures that suggest strategies for modulating the physical-chemical properties of protein synthesis by the

Phylogenetic systematics of Barn Owl (Tyto alba (Scopoli, 1769 complex inferred from mitochondrial rDNA (16S rRNA taxonomic implication

Directory of Open Access Journals (Sweden)

Mansour Aliabadian

2012-09-01

Full Text Available The Barn owl, Tyto alba (Scopoli, 1769, occurs worldwide and shows a considerable amount of morphological and geographical variations, leading to the recognition of many subspecies throughout the world. Yet, no comprehensive study has not been done on this species. Data from mitochondrial gene (16S Ribosomal RNA (16S with 569 bp length were analyzed for 41 individuals around the world. Maximum likelihood (ML, maximum parsimony (MP and Bayesian analysis showed two distinct clades including alba clad (old world and furcata clad (new world. The amount of genetic variation within each of these clades ranged from 0.5-1.7 but variation between clades was 3.7. This data may suggest that Barn owls of the Old World may be a separate species from those of the New World.

Phylogenetic diversity of lactic acid bacteria associated with paddy rice silage as determined by 16S ribosomal DNA analysis.

Science.gov (United States)

Ennahar, Saïd; Cai, Yimin; Fujita, Yasuhito

2003-01-01

A total of 161 low-G+C-content gram-positive bacteria isolated from whole-crop paddy rice silage were classified and subjected to phenotypic and genetic analyses. Based on morphological and biochemical characters, these presumptive lactic acid bacterium (LAB) isolates were divided into 10 groups that included members of the genera Enterococcus, Lactobacillus, Lactococcus, Leuconostoc, Pediococcus, and WEISSELLA: Analysis of the 16S ribosomal DNA (rDNA) was used to confirm the presence of the predominant groups indicated by phenotypic analysis and to determine the phylogenetic affiliation of representative strains. The virtually complete 16S rRNA gene was PCR amplified and sequenced. The sequences from the various LAB isolates showed high degrees of similarity to those of the GenBank reference strains (between 98.7 and 99.8%). Phylogenetic trees based on the 16S rDNA sequence displayed high consistency, with nodes supported by high bootstrap values. With the exception of one species, the genetic data was in agreement with the phenotypic identification. The prevalent LAB, predominantly homofermentative (66%), consisted of Lactobacillus plantarum (24%), Lactococcus lactis (22%), Leuconostoc pseudomesenteroides (20%), Pediococcus acidilactici (11%), Lactobacillus brevis (11%), Enterococcus faecalis (7%), Weissella kimchii (3%), and Pediococcus pentosaceus (2%). The present study, the first to fully document rice-associated LAB, showed a very diverse community of LAB with a relatively high number of species involved in the fermentation process of paddy rice silage. The comprehensive 16S rDNA-based approach to describing LAB community structure was valuable in revealing the large diversity of bacteria inhabiting paddy rice silage and enabling the future design of appropriate inoculants aimed at improving its fermentation quality.

The CCA-end of P-tRNA Contacts Both the Human RPL36AL and the A-site Bound Translation Termination Factor eRF1 at the Peptidyl Transferase Center of the Human 80S Ribosome.

Science.gov (United States)

Hountondji, Codjo; Bulygin, Konstantin; Créchet, Jean-Bernard; Woisard, Anne; Tuffery, Pierre; Nakayama, Jun-Ichi; Frolova, Ludmila; Nierhaus, Knud H; Karpova, Galina; Baouz, Soria

2014-01-01

We have demonstrated previously that the E-site specific protein RPL36AL present in human ribosomes can be crosslinked with the CCA-end of a P-tRNA in situ. Here we report the following: (i) We modeled RPL36AL into the structure of the archaeal ortholog RPL44E extracted from the known X-ray structure of the 50S subunit of Haloarcula marismortui. Superimposing the obtained RPL36AL structure with that of P/E tRNA observed in eukaryotic 80S ribosomes suggested that RPL36AL might in addition to its CCA neighbourhood interact with the inner site of the tRNA elbow similar to an interaction pattern known from tRNA•synthetase pairs. (ii) Accordingly, we detected that the isolated recombinant protein RPL36AL can form a tight binary complex with deacylated tRNA, and even tRNA fragments truncated at their CCA end showed a high affinity in the nanomolar range supporting a strong interaction outside the CCA end. (iii) We constructed programmed 80S complexes containing the termination factor eRF1 (stop codon UAA at the A-site) and a 2',3'-dialdehyde tRNA (tRNAox) analog at the P-site. Surprisingly, we observed a crosslinked ternary complex containing the tRNA, eRF1 and RPL36AL crosslinked both to the aldehyde groups of tRNAox at the 2'- and 3'-positions of the ultimate A. We also demonstrated that, upon binding to the ribosomal A-site, eRF1 induces an alternative conformation of the ribosome and/or the tRNA, leading to a novel crosslink of tRNAox to another large-subunit ribosomal protein (namely L37) rather than to RPL36AL, both ribosomal proteins being labeled in a mutually exclusive fashion. Since the human 80S ribosome in complex with P-site bound tRNAox and A-site bound eRF1 corresponds to the post-termination state of the ribosome, the results represent the first biochemical evidence for the positioning of the CCA-arm of the P-tRNA in close proximity to both RPL36AL and eRF1 at the end of the translation process.

The CRM domain: an RNA binding module derived from an ancient ribosome-associated protein.

Science.gov (United States)

Barkan, Alice; Klipcan, Larik; Ostersetzer, Oren; Kawamura, Tetsuya; Asakura, Yukari; Watkins, Kenneth P

2007-01-01

The CRS1-YhbY domain (also called the CRM domain) is represented as a stand-alone protein in Archaea and Bacteria, and in a family of single- and multidomain proteins in plants. The function of this domain is unknown, but structural data and the presence of the domain in several proteins known to interact with RNA have led to the proposal that it binds RNA. Here we describe a phylogenetic analysis of the domain, its incorporation into diverse proteins in plants, and biochemical properties of a prokaryotic and eukaryotic representative of the domain family. We show that a bacterial member of the family, Escherichia coli YhbY, is associated with pre-50S ribosomal subunits, suggesting that YhbY functions in ribosome assembly. GFP fused to a single-domain CRM protein from maize localizes to the nucleolus, suggesting that an analogous activity may have been retained in plants. We show further that an isolated maize CRM domain has RNA binding activity in vitro, and that a small motif shared with KH RNA binding domains, a conserved "GxxG" loop, contributes to its RNA binding activity. These and other results suggest that the CRM domain evolved in the context of ribosome function prior to the divergence of Archaea and Bacteria, that this function has been maintained in extant prokaryotes, and that the domain was recruited to serve as an RNA binding module during the evolution of plant genomes.

A one-step reaction for the rapid identification of Lactobacillus mindensis, Lactobacillus panis, Lactobacillus paralimentarius, Lactobacillus pontis and Lactobacillus frumenti using oligonucleotide primers designed from the 16S-23S rRNA intergenic sequences.

Science.gov (United States)

Ferchichi, M; Valcheva, R; Prévost, H; Onno, B; Dousset, X

2008-06-01

Species-specific primers targeting the 16S-23S ribosomal DNA (rDNA) intergenic spacer region (ISR) were designed to rapidly discriminate between Lactobacillus mindensis, Lactobacillus panis, Lactobacillus paralimentarius, Lactobacillus pontis and Lactobacillus frumenti species recently isolated from French sourdough. The 16S-23S ISRs were amplified using primers 16S/p2 and 23S/p7, which anneal to positions 1388-1406 of the 16S rRNA gene and to positions 207-189 of the 23S rRNA gene respectively, Escherichia coli numbering (GenBank accession number V00331). Clone libraries of the resulting amplicons were constructed using a pCR2.1 TA cloning kit and sequenced. Species-specific primers were designed based on the sequences obtained and were used to amplify the 16S-23S ISR in the Lactobacillus species considered. For all of them, two PCR amplicons, designated as small ISR (S-ISR) and large ISR (L-ISR), were obtained. The L-ISR is composed of the corresponding S-ISR, interrupted by a sequence containing tRNA(Ile) and tRNA(Ala) genes. Based on these sequences, species-specific primers were designed and proved to identify accurately the species considered among 30 reference Lactobacillus species tested. Designed species-specific primers enable a rapid and accurate identification of L. mindensis, L. paralimentarius, L. panis, L. pontis and L. frumenti species among other lactobacilli. The proposed method provides a powerful and convenient means of rapidly identifying some sourdough lactobacilli, which could be of help in large starter culture surveys.

The importance of ribosome production, and the 5S RNP-MDM2 pathway, in health and disease.

Science.gov (United States)

Pelava, Andria; Schneider, Claudia; Watkins, Nicholas J

2016-08-15

Ribosomes are abundant, large RNA-protein complexes that are the source of all protein synthesis in the cell. The production of ribosomes is an extremely energetically expensive cellular process that has long been linked to human health and disease. More recently, it has been shown that ribosome biogenesis is intimately linked to multiple cellular signalling pathways and that defects in ribosome production can lead to a wide variety of human diseases. Furthermore, changes in ribosome production in response to nutrient levels in the diet lead to metabolic re-programming of the liver. Reduced or abnormal ribosome production in response to cellular stress or mutations in genes encoding factors critical for ribosome biogenesis causes the activation of the tumour suppressor p53, which leads to re-programming of cellular transcription. The ribosomal assembly intermediate 5S RNP (ribonucleoprotein particle), containing RPL5, RPL11 and the 5S rRNA, accumulates when ribosome biogenesis is blocked. The excess 5S RNP binds to murine double minute 2 (MDM2), the main p53-suppressor in the cell, inhibiting its function and leading to p53 activation. Here, we discuss the involvement of ribosome biogenesis in the homoeostasis of p53 in the cell and in human health and disease. © 2016 The Author(s).

Identification of the RsmG methyltransferase target as 16S rRNA nucleotide G527 and characterization of Bacillus subtilis rsmG mutants

DEFF Research Database (Denmark)

Nishimura, Kenji; Johansen, Shanna K; Inaoka, Takashi

2007-01-01

The methyltransferase RsmG methylates the N7 position of nucleotide G535 in 16S rRNA of Bacillus subtilis (corresponding to G527 in Escherichia coli). Disruption of rsmG resulted in low-level resistance to streptomycin. A growth competition assay revealed that there are no differences in fitness...... between the rsmG mutant and parent strains under the various culture conditions examined. B. subtilis rsmG mutants emerged spontaneously at a relatively high frequency, 10(-6). Importantly, in the rsmG mutant background, high-level-streptomycin-resistant rpsL (encoding ribosomal protein S12) mutants...

Highly divergent 16S rRNA sequences in ribosomal operons of Scytonema hyalinum (Cyanobacteria)

Czech Academy of Sciences Publication Activity Database

Johansen, J. R.; Mareš, Jan; Pietrasiak, N.; Bohunická, Markéta; Zima, Jan; Štenclová, L.; Hauer, Tomáš

2017-01-01

Roč. 12, č. 10 (2017), č. článku e0186393. E-ISSN 1932-6203 R&D Projects: GA ČR(CZ) GA15-11912S Institutional support: RVO:67985939 Keywords : rRNA operon * heterogenita * Scytonema hyalinum Subject RIV: EF - Botanics OBOR OECD: Plant sciences, botany Impact factor: 2.806, year: 2016

The distribution, diversity, and importance of 16S rRNA gene introns in the order Thermoproteales.

Science.gov (United States)

Jay, Zackary J; Inskeep, William P

2015-07-09

Intron sequences are common in 16S rRNA genes of specific thermophilic lineages of Archaea, specifically the Thermoproteales (phylum Crenarchaeota). Environmental sequencing (16S rRNA gene and metagenome) from geothermal habitats in Yellowstone National Park (YNP) has expanded the available datasets for investigating 16S rRNA gene introns. The objectives of this study were to characterize and curate archaeal 16S rRNA gene introns from high-temperature habitats, evaluate the conservation and distribution of archaeal 16S rRNA introns in geothermal systems, and determine which "universal" archaeal 16S rRNA gene primers are impacted by the presence of intron sequences. Several new introns were identified and their insertion loci were constrained to thirteen locations across the 16S rRNA gene. Many of these introns encode homing endonucleases, although some introns were short or partial sequences. Pyrobaculum, Thermoproteus, and Caldivirga 16S rRNA genes contained the most abundant and diverse intron sequences. Phylogenetic analysis of introns revealed that sequences within the same locus are distributed biogeographically. The most diverse set of introns were observed in a high-temperature, circumneutral (pH 6) sulfur sediment environment, which also contained the greatest diversity of different Thermoproteales phylotypes. The widespread presence of introns in the Thermoproteales indicates a high probability of misalignments using different "universal" 16S rRNA primers employed in environmental microbial community analysis.

Resistance to linezolid in Staphylococcus spp. clinical isolates associated with ribosomal binding site modifications: novel mutation in domain V of 23S rRNA.

Science.gov (United States)

Musumeci, Rosario; Calaresu, Enrico; Gerosa, Jolanda; Oggioni, Davide; Bramati, Simone; Morelli, Patrizia; Mura, Ida; Piana, Andrea; Are, Bianca Maria; Cocuzza, Clementina Elvezia

2016-10-01

Linezolid is the main representative of the oxazolidinones, introduced in 2000 in clinical practice to treat severe Gram-positive infections. This compound inhibits protein synthesis by binding to the peptidyl transferase centre of the 50S bacterial ribosomal subunit. The aim of this study was to characterize 12 clinical strains of linezolid-resistant Staphylococcus spp. isolated in Northern Italy. All isolates of Staphylococcus spp. studied showed a multi-antibiotic resistance phenotype. In particular, all isolates showed the presence of the mecA gene associated with SSCmec types IVa, V or I. Mutations in domain V of 23S rRNA were shown to be the most prevalent mechanism of linezolid resistance: among these a new C2551T mutation was found in S. aureus, whilst the G2576T mutation was shown to be the most prevalent overall. Moreover, three S. epidermidis isolates were shown to have linezolid resistance associated only with alterations in both L3 and L4 ribosomal proteins. No strain was shown to harbor the previously described cfr gene. These results have shown how the clinical use of linezolid in Northern Italy has resulted in the selection of multiple antibiotic-resistant clinical isolates of Staphylococcus spp., with linezolid resistance in these strains being associated with mutations in 23S rRNA or ribosomal proteins L3 and L4.

Introducing W.A.T.E.R.S.: a workflow for the alignment, taxonomy, and ecology of ribosomal sequences.

Science.gov (United States)

Hartman, Amber L; Riddle, Sean; McPhillips, Timothy; Ludäscher, Bertram; Eisen, Jonathan A

2010-06-12

For more than two decades microbiologists have used a highly conserved microbial gene as a phylogenetic marker for bacteria and archaea. The small-subunit ribosomal RNA gene, also known as 16 S rRNA, is encoded by ribosomal DNA, 16 S rDNA, and has provided a powerful comparative tool to microbial ecologists. Over time, the microbial ecology field has matured from small-scale studies in a select number of environments to massive collections of sequence data that are paired with dozens of corresponding collection variables. As the complexity of data and tool sets have grown, the need for flexible automation and maintenance of the core processes of 16 S rDNA sequence analysis has increased correspondingly. We present WATERS, an integrated approach for 16 S rDNA analysis that bundles a suite of publicly available 16 S rDNA analysis software tools into a single software package. The "toolkit" includes sequence alignment, chimera removal, OTU determination, taxonomy assignment, phylogentic tree construction as well as a host of ecological analysis and visualization tools. WATERS employs a flexible, collection-oriented 'workflow' approach using the open-source Kepler system as a platform. By packaging available software tools into a single automated workflow, WATERS simplifies 16 S rDNA analyses, especially for those without specialized bioinformatics, programming expertise. In addition, WATERS, like some of the newer comprehensive rRNA analysis tools, allows researchers to minimize the time dedicated to carrying out tedious informatics steps and to focus their attention instead on the biological interpretation of the results. One advantage of WATERS over other comprehensive tools is that the use of the Kepler workflow system facilitates result interpretation and reproducibility via a data provenance sub-system. Furthermore, new "actors" can be added to the workflow as desired and we see WATERS as an initial seed for a sizeable and growing repository of interoperable

Deciphering the role of the Gag-Pol ribosomal frameshift signal in HIV-1 RNA genome packaging.

Science.gov (United States)

Nikolaitchik, Olga A; Hu, Wei-Shau

2014-04-01

A key step of retroviral replication is packaging of the viral RNA genome during virus assembly. Specific packaging is mediated by interactions between the viral protein Gag and elements in the viral RNA genome. In HIV-1, similar to most retroviruses, the packaging signal is located within the 5' untranslated region and extends into the gag-coding region. A recent study reported that a region including the Gag-Pol ribosomal frameshift signal plays an important role in HIV-1 RNA packaging; deletions or mutations that affect the RNA structure of this signal lead to drastic decreases (10- to 50-fold) in viral RNA packaging and virus titer. We examined here the role of the ribosomal frameshift signal in HIV-1 RNA packaging by studying the RNA packaging and virus titer in the context of proviruses. Three mutants with altered ribosomal frameshift signal, either through direct deletion of the signal, mutation of the 6U slippery sequence, or alterations of the secondary structure were examined. We found that RNAs from all three mutants were packaged efficiently, and they generate titers similar to that of a virus containing the wild-type ribosomal frameshift signal. We conclude that although the ribosomal frameshift signal plays an important role in regulating the replication cycle, this RNA element is not directly involved in regulating RNA encapsidation. To generate infectious viruses, HIV-1 must package viral RNA genome during virus assembly. The specific HIV-1 genome packaging is mediated by interactions between the structural protein Gag and elements near the 5' end of the viral RNA known as packaging signal. In this study, we examined whether the Gag-Pol ribosomal frameshift signal is important for HIV-1 RNA packaging as recently reported. Our results demonstrated that when Gag/Gag-Pol is supplied in trans, none of the tested ribosomal frameshift signal mutants has defects in RNA packaging or virus titer. These studies provide important information on how HIV-1

In situ DNA-RNA hybridization using in vitro 125I-labeled ribosomal RNA of higher plant

International Nuclear Information System (INIS)

Sato, Seiichi; Kikuchi, Tadatoshi; Ishida, M.R.; Tanaka, Ryuso.

1975-01-01

In situ hybridization using 125 I-labeled ribosomal RNA was applied to plant cells. Cytoplasmic 25 s rRNA, which was eluted from acrylamide gels after electrophoretic separation, was labeled in vitro with carrier-free 125 I and hybridized with the interphase nuclei in root tips of Vicia faba. In most of the preparations, the nucleoli were more heavily labeled than the other regions within nuclei, and several types of grain distribution were observed on the nucleoli. From these results, it was confirmed that in situ hybridization using 125 I-labeled rRNA can be used very effectively to detect the annealing sites of different molecular species of rRNA within the nuclei of plant cells, for which it is not as easy to obtain high specific radioactive rRNA in vivo as it is in the case of cultured animal cells. (auth.)

The importance of highly conserved nucleotides in the binding region of chloramphenicol at the peptidyl transfer centre of Escherichia coli 23S ribosomal RNA

DEFF Research Database (Denmark)

Vester, Birte; Garrett, Roger Antony

1988-01-01

in vivo on a plasmid-encoded rRNA (rrnB) operon and each one yielded dramatically altered phenotypes. Cells exhibiting A2060----C or A2450----C transversions were inviable and it was shown by inserting the mutated genes after a temperature-inducible promoter that the mutant RNAs were directly responsible...... into 50S subunits, but while the two lethal mutant RNAs were strongly selected against in 70S ribosomes, the plasmid-encoded A2503----C RNA was preferred over the chromosome-encoded RNA, contrary to current regulatory theories. The results establish the critical structural and functional importance...

Clinical identification of bacteria in human chronic wound infections: culturing vs. 16S ribosomal DNA sequencing

Directory of Open Access Journals (Sweden)

Rhoads Daniel D

2012-11-01

Full Text Available Abstract Background Chronic wounds affect millions of people and cost billions of dollars in the United States each year. These wounds harbor polymicrobial biofilm communities, which can be difficult to elucidate using culturing methods. Clinical molecular microbiological methods are increasingly being employed to investigate the microbiota of chronic infections, including wounds, as part of standard patient care. However, molecular testing is more sensitive than culturing, which results in markedly different results being reported to clinicians. This study compares the results of aerobic culturing and molecular testing (culture-free 16S ribosomal DNA sequencing, and it examines the relative abundance score that is generated by the molecular test and the usefulness of the relative abundance score in predicting the likelihood that the same organism would be detected by culture. Methods Parallel samples from 51 chronic wounds were studied using aerobic culturing and 16S DNA sequencing for the identification of bacteria. Results One hundred forty-five (145 unique genera were identified using molecular methods, and 68 of these genera were aerotolerant. Fourteen (14 unique genera were identified using aerobic culture methods. One-third (31/92 of the cultures were determined to be Staphylococcus aureus, Pseudomonas aeruginosa, and Enterococcus faecalis with higher relative abundance scores were more likely to be detected by culture as demonstrated with regression modeling. Conclusion Discordance between molecular and culture testing is often observed. However, culture-free 16S ribosomal DNA sequencing and its relative abundance score can provide clinicians with insight into which bacteria are most abundant in a sample and which are most likely to be detected by culture.

The Ribosomal RNA is a Useful Marker to Visualize Rhizobia Interacting with Legume Plants

Science.gov (United States)

Rinaudi, Luciana; Isola, Maria C.; Giordano, Walter

2004-01-01

Symbiosis between rhizobia and leguminous plants leads to the formation of nitrogen-fixing root nodules. In the present article, we recommend the use of the ribosomal RNA (rRNA) isolated from legume nodules in an experimental class with the purpose of introducing students to the structure of eukaryotic and prokaryotic ribosomes and of…

Phylogenetic relationships of true butterflies (Lepidoptera: Papilionoidea) inferred from COI, 16S rRNA and EF-1α sequences.

Science.gov (United States)

Kim, Man Il; Wan, Xinlong; Kim, Min Jee; Jeong, Heon Cheon; Ahn, Neung-Ho; Kim, Ki-Gyoung; Han, Yeon Soo; Kim, Iksoo

2010-11-01

The molecular phylogenetic relationships among true butterfly families (superfamily Papilionoidea) have been a matter of substantial controversy; this debate has led to several competing hypotheses. Two of the most compelling of those hypotheses involve the relationships of (Nymphalidae + Lycaenidae) + (Pieridae + Papilionidae) and (((Nymphalidae + Lycaenidae) + Pieridae) + Papilionidae). In this study, approximately 3,500 nucleotide sequences from cytochrome oxidase subunit I (COI), 16S ribosomal RNA (16S rRNA), and elongation factor-1 alpha (EF-1α) were sequenced from 83 species belonging to four true butterfly families, along with those of three outgroup species belonging to three lepidopteran superfamilies. These sequences were subjected to phylogenetic reconstruction via Bayesian Inference (BI), Maximum Likelihood (ML), and Maximum Parsimony (MP) algorithms. The monophyletic Pieridae and monophyletic Papilionidae evidenced good recovery in all analyses, but in some analyses, the monophylies of the Lycaenidae and Nymphalidae were hampered by the inclusion of single species of the lycaenid subfamily Miletinae and the nymphalid subfamily Danainae. Excluding those singletons, all phylogenetic analyses among the four true butterfly families clearly identified the Nymphalidae as the sister to the Lycaenidae and identified this group as a sister to the Pieridae, with the Papilionidae identified as the most basal linage to the true butterfly, thus supporting the hypothesis: (Papilionidae + (Pieridae + (Nymphalidae + Lycaenidae))).

Structure of Ribosomal Silencing Factor Bound to Mycobacterium tuberculosis Ribosome.

Science.gov (United States)

Li, Xiaojun; Sun, Qingan; Jiang, Cai; Yang, Kailu; Hung, Li-Wei; Zhang, Junjie; Sacchettini, James C

2015-10-06

The ribosomal silencing factor RsfS slows cell growth by inhibiting protein synthesis during periods of diminished nutrient availability. The crystal structure of Mycobacterium tuberculosis (Mtb) RsfS, together with the cryo-electron microscopy (EM) structure of the large subunit 50S of Mtb ribosome, reveals how inhibition of protein synthesis by RsfS occurs. RsfS binds to the 50S at L14, which, when occupied, blocks the association of the small subunit 30S. Although Mtb RsfS is a dimer in solution, only a single subunit binds to 50S. The overlap between the dimer interface and the L14 binding interface confirms that the RsfS dimer must first dissociate to a monomer in order to bind to L14. RsfS interacts primarily through electrostatic and hydrogen bonding to L14. The EM structure shows extended rRNA density that it is not found in the Escherichia coli ribosome, the most striking of these being the extended RNA helix of H54a. Copyright © 2015 Elsevier Ltd. All rights reserved.

Differential Regulation of rRNA and tRNA Transcription from the rRNA-tRNA Composite Operon in Escherichia coli.

Directory of Open Access Journals (Sweden)

Hiraku Takada

Full Text Available Escherichia coli contains seven rRNA operons, each consisting of the genes for three rRNAs (16S, 23S and 5S rRNA in this order and one or two tRNA genes in the spacer between 16S and 23S rRNA genes and one or two tRNA genes in the 3' proximal region. All of these rRNA and tRNA genes are transcribed from two promoters, P1 and P2, into single large precursors that are afterward processed to individual rRNAs and tRNAs by a set of RNases. In the course of Genomic SELEX screening of promoters recognized by RNA polymerase (RNAP holoenzyme containing RpoD sigma, a strong binding site was identified within 16S rRNA gene in each of all seven rRNA operons. The binding in vitro of RNAP RpoD holoenzyme to an internal promoter, referred to the promoter of riRNA (an internal RNA of the rRNA operon, within each 16S rRNA gene was confirmed by gel shift assay and AFM observation. Using this riRNA promoter within the rrnD operon as a representative, transcription in vitro was detected with use of the purified RpoD holoenzyme, confirming the presence of a constitutive promoter in this region. LacZ reporter assay indicated that this riRNA promoter is functional in vivo. The location of riRNA promoter in vivo as identified using a set of reporter plasmids agrees well with that identified in vitro. Based on transcription profile in vitro and Northern blot analysis in vivo, the majority of transcript initiated from this riRNA promoter was estimated to terminate near the beginning of 23S rRNA gene, indicating that riRNA leads to produce the spacer-coded tRNA. Under starved conditions, transcription of the rRNA operon is markedly repressed to reduce the intracellular level of ribosomes, but the levels of both riRNA and its processed tRNAGlu stayed unaffected, implying that riRNA plays a role in the continued steady-state synthesis of tRNAs from the spacers of rRNA operons. We then propose that the tRNA genes organized within the spacers of rRNA-tRNA composite operons

Bacteriological incidence in pneumonia patients with pulmonary emphysema: a bacterial floral analysis using the 16S ribosomal RNA gene in bronchoalveolar lavage fluid.

Science.gov (United States)

Naito, Keisuke; Yamasaki, Kei; Yatera, Kazuhiro; Akata, Kentaro; Noguchi, Shingo; Kawanami, Toshinori; Fukuda, Kazumasa; Kido, Takashi; Ishimoto, Hiroshi; Mukae, Hiroshi

2017-01-01

Pulmonary emphysema is an important radiological finding in chronic obstructive pulmonary disease patients, but bacteriological differences in pneumonia patients according to the severity of emphysematous changes have not been reported. Therefore, we evaluated the bacteriological incidence in the bronchoalveolar lavage fluid (BALF) of pneumonia patients using cultivation and a culture-independent molecular method. Japanese patients with community-acquired pneumonia (83) and healthcare-associated pneumonia (94) between April 2010 and February 2014 were evaluated. The BALF obtained from pneumonia lesions was evaluated by both cultivation and a molecular method. In the molecular method, ~600 base pairs of bacterial 16S ribosomal RNA genes in the BALF were amplified by polymerase chain reaction, and clone libraries were constructed. The nucleotide sequences of 96 randomly selected colonies were determined, and a homology search was performed to identify the bacterial species. A qualitative radiological evaluation of pulmonary emphysema based on chest computed tomography (CT) images was performed using the Goddard classification. The severity of pulmonary emphysema based on the Goddard classification was none in 47.4% (84/177), mild in 36.2% (64/177), moderate in 10.2% (18/177), and severe in 6.2% (11/177). Using the culture-independent molecular method, Moraxella catarrhalis was significantly more frequently detected in moderate or severe emphysema patients than in patients with no or mild emphysematous changes. The detection rates of Haemophilus influenzae and Pseudomonas aeruginosa were unrelated to the severity of pulmonary emphysematous changes, and Streptococcus species - except for the S. anginosus group and S. pneumoniae - were detected more frequently using the molecular method we used for the BALF of patients with pneumonia than using culture methods. Our findings suggest that M. catarrhalis is more frequently detected in pneumonia patients with moderate or

Testing the potential of a ribosomal 16S marker for DNA metabarcoding of insects

Directory of Open Access Journals (Sweden)

Vasco Elbrecht

2016-04-01

Full Text Available Cytochrome c oxidase I (COI is a powerful marker for DNA barcoding of animals, with good taxonomic resolution and a large reference database. However, when used for DNA metabarcoding, estimation of taxa abundances and species detection are limited due to primer bias caused by highly variable primer binding sites across the COI gene. Therefore, we explored the ability of the 16S ribosomal DNA gene as an alternative metabarcoding marker for species level assessments. Ten bulk samples, each containing equal amounts of tissue from 52 freshwater invertebrate taxa, were sequenced with the Illumina NextSeq 500 system. The 16S primers amplified three more insect species than the Folmer COI primers and amplified more equally, probably due to decreased primer bias. Estimation of biomass might be less biased with 16S than with COI, although variation in read abundances of two orders of magnitudes is still observed. According to these results, the marker choice depends on the scientific question. If the goal is to obtain a taxonomic identification at the species level, then COI is more appropriate due to established reference databases and known taxonomic resolution of this marker, knowing that a greater proportion of insects will be missed using COI Folmer primers. If the goal is to obtain a more comprehensive survey the 16S marker, which requires building a local reference database, or optimised degenerated COI primers could be more appropriate.

An elongated model of the Xenopus laevis transcription factor IIIA-5S ribosomal RNA complex derived from neutron scattering and hydrodynamic measurements

International Nuclear Information System (INIS)

Timmins, P.A.; Langowski, J.; Brown, R.S.

1988-01-01

The precise molecular composition of the Xenopus laevis TFIIIA-5S ribosomal RNA complex (7S particle) has been established from small angle neutron and dynamic light scattering. The molecular weight of the particle was found to be 95,700±10,000 and 86,700±9,000 daltons from these two methods respectively. The observed match point of 54.4% D 2 O obtained from contrast variation experiments indicates a 1:1 molar ratio. It is concluded that only a single molecule of TFIIIA, a zinc-finger protein, and of 5S RNA are present in this complex. A simple elongated cylindrical model with dimensions of 140 angstrom length and 59 angstrom diameter is compatible with the neutron results. A globular model can be excluded by the shallow nature of the neutron scattering curves. It is proposed that the observed difference of 15 angstrom in length between the 7S particle and isolated 5S RNA most likely indicates that part(s) of the protein protrudes from the end(s) of the RNA molecule. There is no biochemical evidence for any gross alteration in 5S RNA conformation upon binding to TFIIIA

Fluctuations in protein synthesis from a single RNA template: stochastic kinetics of ribosomes.

Science.gov (United States)

Garai, Ashok; Chowdhury, Debashish; Ramakrishnan, T V

2009-01-01

Proteins are polymerized by cyclic machines called ribosomes, which use their messenger RNA (mRNA) track also as the corresponding template, and the process is called translation. We explore, in depth and detail, the stochastic nature of the translation. We compute various distributions associated with the translation process; one of them--namely, the dwell time distribution--has been measured in recent single-ribosome experiments. The form of the distribution, which fits best with our simulation data, is consistent with that extracted from the experimental data. For our computations, we use a model that captures both the mechanochemistry of each individual ribosome and their steric interactions. We also demonstrate the effects of the sequence inhomogeneities of real genes on the fluctuations and noise in translation. Finally, inspired by recent advances in the experimental techniques of manipulating single ribosomes, we make theoretical predictions on the force-velocity relation for individual ribosomes. In principle, all our predictions can be tested by carrying out in vitro experiments.

The Complete Structure of the Mycobacterium smegmatis 70S Ribosome

Directory of Open Access Journals (Sweden)

Jendrik Hentschel

2017-07-01

Full Text Available The ribosome carries out the synthesis of proteins in every living cell. It consequently represents a frontline target in anti-microbial therapy. Tuberculosis ranks among the leading causes of death worldwide, due in large part to the combination of difficult-to-treat latency and antibiotic resistance. Here, we present the 3.3-Å cryo-EM structure of the 70S ribosome of Mycobacterium smegmatis, a close relative to the human pathogen Mycobacterium tuberculosis. The structure reveals two additional ribosomal proteins and localizes them to the vicinity of drug-target sites in both the catalytic center and the decoding site of the ribosome. Furthermore, we visualized actinobacterium-specific rRNA and protein expansions that extensively remodel the ribosomal surface with implications for polysome organization. Our results provide a foundation for understanding the idiosyncrasies of mycobacterial translation and reveal atomic details of the structure that will facilitate the design of anti-tubercular therapeutics.

Multiple effects of S13 in modulating the strength of intersubunit interactions in the ribosome during translation.

Science.gov (United States)

Cukras, Anthony R; Green, Rachel

2005-05-27

The ribosomal protein S13 is found in the head region of the small subunit, where it interacts with the central protuberance of the large ribosomal subunit and with the P site-bound tRNA through its extended C terminus. The bridging interactions between the large and small subunits are dynamic, and are thought to be critical in orchestrating the molecular motions of the translation cycle. S13 provides a direct link between the tRNA-binding site and the movements in the head of the small subunit seen during translocation, thereby providing a possible pathway of signal transduction. We have created and characterized an rpsM(S13)-deficient strain of Escherichia coli and have found significant defects in subunit association, initiation and translocation through in vitro assays of S13-deficient ribosomes. Targeted mutagenesis of specific bridge and tRNA contact elements in S13 provides evidence that these two interaction domains play critical roles in maintaining the fidelity of translation. This ribosomal protein thus appears to play a non-essential, yet important role by modulating subunit interactions in multiple steps of the translation cycle.

sORFs.org: a repository of small ORFs identified by ribosome profiling.

Science.gov (United States)

Olexiouk, Volodimir; Crappé, Jeroen; Verbruggen, Steven; Verhegen, Kenneth; Martens, Lennart; Menschaert, Gerben

2016-01-04

With the advent of ribosome profiling, a next generation sequencing technique providing a "snap-shot'' of translated mRNA in a cell, many short open reading frames (sORFs) with ribosomal activity were identified. Follow-up studies revealed the existence of functional peptides, so-called micropeptides, translated from these 'sORFs', indicating a new class of bio-active peptides. Over the last few years, several micropeptides exhibiting important cellular functions were discovered. However, ribosome occupancy does not necessarily imply an actual function of the translated peptide, leading to the development of various tools assessing the coding potential of sORFs. Here, we introduce sORFs.org (http://www.sorfs.org), a novel database for sORFs identified using ribosome profiling. Starting from ribosome profiling, sORFs.org identifies sORFs, incorporates state-of-the-art tools and metrics and stores results in a public database. Two query interfaces are provided, a default one enabling quick lookup of sORFs and a BioMart interface providing advanced query and export possibilities. At present, sORFs.org harbors 263 354 sORFs that demonstrate ribosome occupancy, originating from three different cell lines: HCT116 (human), E14_mESC (mouse) and S2 (fruit fly). sORFs.org aims to provide an extensive sORFs database accessible to researchers with limited bioinformatics knowledge, thus enabling easy integration into personal projects. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

A renaissance for the pioneering 16S rRNA gene

Energy Technology Data Exchange (ETDEWEB)

Tringe, Susannah; Hugenholtz, Philip

2008-09-07

Culture-independent molecular surveys using the 16S rRNA gene have become a mainstay for characterizing microbial community structure over the last quarter century. More recently this approach has been overshadowed by metagenomics, which provides a global overview of a community's functional potential rather than just an inventory of its inhabitants. However, the pioneering 16S rRNA gene is making a comeback in its own right thanks to a number of methodological advancements including higher resolution (more sequences), analysis of multiple related samples (e.g. spatial and temporal series) and improved metadata and use of metadata. The standard conclusion that microbial ecosystems are remarkably complex and diverse is now being replaced by detailed insights into microbial ecology and evolution based only on this one historically important marker gene.

High-resolution microscopy of active ribosomal genes and key members of the rRNA processing machinery inside nucleolus-like bodies of fully-grown mouse oocytes.

Science.gov (United States)

Shishova, Kseniya V; Khodarovich, Yuriy M; Lavrentyeva, Elena A; Zatsepina, Olga V

2015-10-01

Nucleolus-like bodies (NLBs) of fully-grown (germinal vesicle, GV) mammalian oocytes are traditionally considered as morphologically distinct entities, which, unlike normal nucleoli, contain transcribed ribosomal genes (rDNA) solely at their surface. In the current study, we for the first time showed that active ribosomal genes are present not only on the surface but also inside NLBs of the NSN-type oocytes. The "internal" rRNA synthesis was evidenced by cytoplasmic microinjections of BrUTP as precursor and by fluorescence in situ hybridization with a probe to the short-lived 5'ETS segment of the 47S pre-rRNA. We further showed that in the NLB mass of NSN-oocytes, distribution of active rDNA, RNA polymerase I (UBF) and rRNA processing (fibrillarin) protein factors, U3 snoRNA, pre-rRNAs and 18S/28S rRNAs is remarkably similar to that in somatic nucleoli capable to make pre-ribosomes. Overall, these observations support the occurrence of rDNA transcription, rRNA processing and pre-ribosome assembly in the NSN-type NLBs and so that their functional similarity to normal nucleoli. Unlike the NSN-type NLBs, the NLBs of more mature SN-oocytes do not contain transcribed rRNA genes, U3 snoRNA, pre-rRNAs, 18S and 28S rRNAs. These results favor the idea that in a process of transformation of NSN-oocytes to SN-oocytes, NLBs cease to produce pre-ribosomes and, moreover, lose their rRNAs. We also concluded that a denaturing fixative 70% ethanol used in the study to fix oocytes could be more appropriate for light microscopy analysis of nucleolar RNAs and proteins in mammalian fully-grown oocytes than a commonly used cross-linking aldehyde fixative, formalin. Copyright © 2015 Elsevier Inc. All rights reserved.

Utility of 16S rRNA PCR performed on clinical specimens in patient management

Directory of Open Access Journals (Sweden)

A. Akram

2017-04-01

Conclusions: Despite the low diagnostic yield, results of 16S rRNA PCR can still have a significant impact on patient management due to rationalization or cessation of the antimicrobial therapy. The yield of 16S rRNA PCR was highest for heart valves.

Inhibition of Escherichia coli precursor-16S rRNA processing by mouse intestinal contents

DEFF Research Database (Denmark)

Licht, Tine Rask; Tolker-Nielsen, Tim; Holmstrøm, Kim

1999-01-01

. We have applied fluorescence in situ hybridization of pre-16S rRNA to Escherichia coli cells growing in vitro in extracts from two different compartments of the mouse intestine: the caecal mucus layer, where E. coli grew rapidly, and the contents of the caecum, which supported much slower bacterial...... content of pre-16S rRNA than cultures of the same strain growing rapidly in rich media. We present results suggesting that the mouse intestinal contents contain an agent that inhibits the growth of E. coli by disturbing its ability to process pre-16S rRNA....

Fragmentation of the large subunit ribosomal RNA gene in oyster mitochondrial genomes

Directory of Open Access Journals (Sweden)

Milbury Coren A

2010-09-01

Full Text Available Abstract Background Discontinuous genes have been observed in bacteria, archaea, and eukaryotic nuclei, mitochondria and chloroplasts. Gene discontinuity occurs in multiple forms: the two most frequent forms result from introns that are spliced out of the RNA and the resulting exons are spliced together to form a single transcript, and fragmented gene transcripts that are not covalently attached post-transcriptionally. Within the past few years, fragmented ribosomal RNA (rRNA genes have been discovered in bilateral metazoan mitochondria, all within a group of related oysters. Results In this study, we have characterized this fragmentation with comparative analysis and experimentation. We present secondary structures, modeled using comparative sequence analysis of the discontinuous mitochondrial large subunit rRNA genes of the cupped oysters C. virginica, C. gigas, and C. hongkongensis. Comparative structure models for the large subunit rRNA in each of the three oyster species are generally similar to those for other bilateral metazoans. We also used RT-PCR and analyzed ESTs to determine if the two fragmented LSU rRNAs are spliced together. The two segments are transcribed separately, and not spliced together although they still form functional rRNAs and ribosomes. Conclusions Although many examples of discontinuous ribosomal genes have been documented in bacteria and archaea, as well as the nuclei, chloroplasts, and mitochondria of eukaryotes, oysters are some of the first characterized examples of fragmented bilateral animal mitochondrial rRNA genes. The secondary structures of the oyster LSU rRNA fragments have been predicted on the basis of previous comparative metazoan mitochondrial LSU rRNA structure models.

Structural and functional implications in the eubacterial ribosome as revealed by protein-rRNA and antibiotic contact sites.

Science.gov (United States)

Wittmann-Liebold, B; Uhlein, M; Urlaub, H; Müller, E C; Otto, A; Bischof, O

1995-01-01

Contact sites between protein and rRNA in 30S and 50S ribosomal subunits of Escherichia coli and Bacillus stearothermophilus were investigated at the molecular level using UV and 2-iminothiolane as cross-linkers. Thirteen ribosomal proteins (S3, S4, S7, S14, S17, L2, L4, L6, L14, L27, L28, L29, and L36) from these organisms were cross-linked in direct contact with the RNAs, and the peptide stretches as well as amino acids involved were identified. Further, the binding sites of puromycin and spiramycin were established at the peptide level in several proteins that were found to constitute the antibiotic-binding sites. Peptide stretches of puromycin binding were identified from proteins S7, S14, S18, L18, AND L29; those of spiramycin attachment were derived from proteins S12, S14, L17, L18, L27, and L35. Comparison of the RNA-peptide contact sites with the peptides identified for antibiotic binding and with those altered in antibiotic-resistant mutants clearly showed identical peptide areas to be involved and, hence, demonstrated the functional importance of these peptides. Further evidence for a functional implication of ribosomal proteins in the translational process came from complementation experiments in which protein L2 from Halobacterium marismortui was incorporated into the E. coli ribosomes that were active. The incorporated protein was present in 50S subunits and 70S particles, in disomes, and in higher polysomes. These results clearly demonstrate the functional implication of protein L2 in protein biosynthesis. Incorporation studies with a mutant of HmaL2 with a replacement of histidine-229 by glycine completely abolished the functional activity of the ribosome. Accordingly, protein L2 with histidine-229 is a crucial element of the translational machinery.

Ribosomal history reveals origins of modern protein synthesis.

Directory of Open Access Journals (Sweden)

Ajith Harish

Full Text Available The origin and evolution of the ribosome is central to our understanding of the cellular world. Most hypotheses posit that the ribosome originated in the peptidyl transferase center of the large ribosomal subunit. However, these proposals do not link protein synthesis to RNA recognition and do not use a phylogenetic comparative framework to study ribosomal evolution. Here we infer evolution of the structural components of the ribosome. Phylogenetic methods widely used in morphometrics are applied directly to RNA structures of thousands of molecules and to a census of protein structures in hundreds of genomes. We find that components of the small subunit involved in ribosomal processivity evolved earlier than the catalytic peptidyl transferase center responsible for protein synthesis. Remarkably, subunit RNA and proteins coevolved, starting with interactions between the oldest proteins (S12 and S17 and the oldest substructure (the ribosomal ratchet in the small subunit and ending with the rise of a modern multi-subunit ribosome. Ancestral ribonucleoprotein components show similarities to in vitro evolved RNA replicase ribozymes and protein structures in extant replication machinery. Our study therefore provides important clues about the chicken-or-egg dilemma associated with the central dogma of molecular biology by showing that ribosomal history is driven by the gradual structural accretion of protein and RNA structures. Most importantly, results suggest that functionally important and conserved regions of the ribosome were recruited and could be relics of an ancient ribonucleoprotein world.

Aggregation of Ribosomal Protein S6 at Nucleolus Is Cell Cycle-Controlled and Its Function in Pre-rRNA Processing Is Phosphorylation Dependent.

Science.gov (United States)

Zhang, Duo; Chen, Hui-Peng; Duan, Hai-Feng; Gao, Li-Hua; Shao, Yong; Chen, Ke-Yan; Wang, You-Liang; Lan, Feng-Hua; Hu, Xian-Wen

2016-07-01

Ribosomal protein S6 (rpS6) has long been regarded as one of the primary r-proteins that functions in the early stage of 40S subunit assembly, but its actual role is still obscure. The correct forming of 18S rRNA is a key step in the nuclear synthesis of 40S subunit. In this study, we demonstrate that rpS6 participates in the processing of 30S pre-rRNA to 18S rRNA only when its C-terminal five serines are phosphorylated, however, the process of entering the nucleus and then targeting the nucleolus does not dependent its phosphorylation. Remarkably, we also find that the aggregation of rpS6 at the nucleolus correlates to the phasing of cell cycle, beginning to concentrate in the nucleolus at later S phase and disaggregate at M phase. J. Cell. Biochem. 117: 1649-1657, 2016. © 2015 Wiley Periodicals, Inc. © 2015 Wiley Periodicals, Inc.

Morpholino spin-labeling for base-pair sequencing of a 3'-terminal RNA stem by proton homonuclear Overhauser enhancements: yeast ribosomal 5S RNA

International Nuclear Information System (INIS)

Lee, K.M.; Marshall, A.G.

1987-01-01

Base-pair sequences for 5S and 5.8S RNAs are not readily extracted from proton homonuclear nuclear Overhauser enhancement (NOE) connectivity experiments alone, due to extensive peak overlap in the downfield (11-15 ppm) proton NMR spectrum. In this paper, we introduce a new method for base-pair proton peak assignment for ribosomal RNAs, based upon the distance-dependent broadening of the resonances of base-pair protons spatially proximal to a paramagnetic group. Introduction of a nitroxide spin-label covalently attached to the 3'-terminal ribose provides an unequivocal starting point for base-pair hydrogen-bond proton NMR assignment. Subsequent NOE connectivities then establish the base-pair sequence for the terminal stem of a 5S RNA. Periodate oxidation of yeast 5S RNA, followed by reaction with 4-amino-2,2,6,6-tetramethylpiperidinyl-1-oxy (TEMPO-NH2) and sodium borohydride reduction, produces yeast 5S RNA specifically labeled with a paramagnetic nitroxide group at the 3'-terminal ribose. Comparison of the 500-MHz 1H NMR spectra of native and 3'-terminal spin-labeled yeast 5S RNA serves to identify the terminal base pair (G1 . C120) and its adjacent base pair (G2 . U119) on the basis of their proximity to the 3'-terminal spin-label. From that starting point, we have then identified (G . C, A . U, or G . U) and sequenced eight of the nine base pairs in the terminal helix via primary and secondary NOE's

Genotypic Characterization of Bradyrhizobium Strains Nodulating Endemic Woody Legumes of the Canary Islands by PCR-Restriction Fragment Length Polymorphism Analysis of Genes Encoding 16S rRNA (16S rDNA) and 16S-23S rDNA Intergenic Spacers, Repetitive Extragenic Palindromic PCR Genomic Fingerprinting, and Partial 16S rDNA Sequencing

Science.gov (United States)

Vinuesa, Pablo; Rademaker, Jan L. W.; de Bruijn, Frans J.; Werner, Dietrich

1998-01-01

We present a phylogenetic analysis of nine strains of symbiotic nitrogen-fixing bacteria isolated from nodules of tagasaste (Chamaecytisus proliferus) and other endemic woody legumes of the Canary Islands, Spain. These and several reference strains were characterized genotypically at different levels of taxonomic resolution by computer-assisted analysis of 16S ribosomal DNA (rDNA) PCR-restriction fragment length polymorphisms (PCR-RFLPs), 16S-23S rDNA intergenic spacer (IGS) RFLPs, and repetitive extragenic palindromic PCR (rep-PCR) genomic fingerprints with BOX, ERIC, and REP primers. Cluster analysis of 16S rDNA restriction patterns with four tetrameric endonucleases grouped the Canarian isolates with the two reference strains, Bradyrhizobium japonicum USDA 110spc4 and Bradyrhizobium sp. strain (Centrosema) CIAT 3101, resolving three genotypes within these bradyrhizobia. In the analysis of IGS RFLPs with three enzymes, six groups were found, whereas rep-PCR fingerprinting revealed an even greater genotypic diversity, with only two of the Canarian strains having similar fingerprints. Furthermore, we show that IGS RFLPs and even very dissimilar rep-PCR fingerprints can be clustered into phylogenetically sound groupings by combining them with 16S rDNA RFLPs in computer-assisted cluster analysis of electrophoretic patterns. The DNA sequence analysis of a highly variable 264-bp segment of the 16S rRNA genes of these strains was found to be consistent with the fingerprint-based classification. Three different DNA sequences were obtained, one of which was not previously described, and all belonged to the B. japonicum/Rhodopseudomonas rDNA cluster. Nodulation assays revealed that none of the Canarian isolates nodulated Glycine max or Leucaena leucocephala, but all nodulated Acacia pendula, C. proliferus, Macroptilium atropurpureum, and Vigna unguiculata. PMID:9603820

In situ hybridization of iodinated 5S and 18/25S RNA to Vicia faba metaphase chromosomes

International Nuclear Information System (INIS)

Schubert, I.; Baeumlein, H.; Wobus, U.

1978-01-01

In vitro labelled 125 I ribosomal RNA fractions (18/25S and 5S) were in situ hybridized to metaphase chromosomes of a reconstructed karyotype of Vicia faba (characterized by two translocations and one pericentric inversion, each being present homozygously). The sites of 18S and 25S RNA were found to be confined to the nucleolus organizing secondary constriction. Two loci of 5S RNA were recognized on the satellite of nucleolus bearing chromosome. Possible correlations between the location of ribosomal genes, heterochromatic G-bands and clusters of mutagen induced chromatid aberrations are discussed. (author)

tmRNA-mediated trans-translation as the major ribosome rescue system in a bacterial cell

Directory of Open Access Journals (Sweden)

Hyouta eHimeno

2014-04-01

Full Text Available tmRNA (transfer messenger RNA; also known as 10Sa RNA or SsrA RNA is a small RNA molecule that is conserved among bacteria. It has structural and functional similarities to tRNA: it has an upper half of the tRNA-like structure, its 5’ end is processed by RNase P, it has typical tRNA-specific base modifications, it is aminoacylated with alanine, it binds to EF-Tu after aminoacylation and it enters the ribosome with EF-Tu and GTP. However, tmRNA lacks an anticodon, and instead it has a coding sequence for a short peptide called tag-peptide. An elaborate interplay of actions of tmRNA as both tRNA and mRNA with the help of a tmRNA-binding protein, SmpB, facilitates trans-translation, which produces a single polypeptide from two mRNA molecules. Initially alanyl-tmRNA in complex with EF-Tu and SmpB enters the vacant A-site of the stalled ribosome like aminoacyl-tRNA but without a codon-anticodon interaction, and subsequently truncated mRNA is replaced with the tag-encoding region of tmRNA. During these processes, not only tmRNA but also SmpB structurally and functionally mimics both tRNA and mRNA. Thus trans-translation rescues the stalled ribosome, thereby allowing recycling of the ribosome. Since the tag-peptide serves as a target of AAA+ proteases, the trans-translation products are preferentially degraded so that they do not accumulate in the cell. Although alternative rescue systems have recently been revealed, trans-translation is the only system that universally exists in bacteria. Furthermore, it is unique in that it employs a small RNA and that it prevents accumulation of nonfunctional proteins from truncated mRNA in the cell. It might play the major role in rescuing the stalled translation in the bacterial cell.

The 5S RNP couples p53 homeostasis to ribosome biogenesis and nucleolar stress.

Science.gov (United States)

Sloan, Katherine E; Bohnsack, Markus T; Watkins, Nicholas J

2013-10-17

Several proto-oncogenes and tumor suppressors regulate the production of ribosomes. Ribosome biogenesis is a major consumer of cellular energy, and defects result in p53 activation via repression of mouse double minute 2 (MDM2) homolog by the ribosomal proteins RPL5 and RPL11. Here, we report that RPL5 and RPL11 regulate p53 from the context of a ribosomal subcomplex, the 5S ribonucleoprotein particle (RNP). We provide evidence that the third component of this complex, the 5S rRNA, is critical for p53 regulation. In addition, we show that the 5S RNP is essential for the activation of p53 by p14(ARF), a protein that is activated by oncogene overexpression. Our data show that the abundance of the 5S RNP, and therefore p53 levels, is determined by factors regulating 5S complex formation and ribosome integration, including the tumor suppressor PICT1. The 5S RNP therefore emerges as the critical coordinator of signaling pathways that couple cell proliferation with ribosome production. Copyright © 2013 The Authors. Published by Elsevier Inc. All rights reserved.

A renaissance for the pioneering 16S rRNA gene.

Science.gov (United States)

Tringe, Susannah G; Hugenholtz, Philip

2008-10-01

Culture-independent molecular surveys using the 16S rRNA gene have become a mainstay for characterizing microbial community structure over the past quarter century. More recently this approach has been overshadowed by metagenomics, which provides a global overview of a community's functional potential rather than just an inventory of its inhabitants. However, the pioneering 16S rRNA gene is making a comeback in its own right thanks to a number of methodological advancements including higher resolution (more sequences), analysis of multiple related samples (e.g. spatial and temporal series) and improved metadata, and use of metadata. The standard conclusion that microbial ecosystems are remarkably complex and diverse is now being replaced by detailed insights into microbial ecology and evolution based only on this one historically important marker gene.

Analysis of bacterial genetic diversity in biofloc by using ARDRA 16S-rRNA gene

Directory of Open Access Journals (Sweden)

, Widanarni

2015-05-01

Full Text Available ABSTRACT This study aimed to analyze the genetic diversity of bacteria associated in bioflocs using 16S-rRNA polymerase chain reaction (PCR with ARDRA technique. A total of 38 dominant bacterial isolates was obtained from bioflocs samples and of these isolates, 16S-rRNA gene was then isolated and amplified using PCR. The 16S-rRNA gene of the isolates was then cut using HaeIII (5’-GG↓CC and HhaI (5’-GCG↓C restriction enzymes resulting an ARDRA pattern which was further used as the binary data for the construction of phylogenetics tree that was used to estimate the group of bacteria. The result with HaeIII cut restriction enzyme from biofloc-associated bacteria gave 11 ARDRA patterns, while with the restriction enzyme HhaI gave eight ARDRA patterns. Phylogenetics of bacterial populations from biofloc-based cultivation system water consisted of at least 13 different bacterial species. Result of sequencing from two gene sample 16S-rRNA were identified as Microbacterium foliorumand and Pseudomonas putida. Keywords: bacterial diversity, ARDRA, biofloc, phylogeny  ABSTRAK Penelitian ini bertujuan untuk menganalisis keragaman genetika bakteri bioflok menggunakan metode polymerase chain reaction (PCR 16S-rRNA dengan teknik ARDRA. Sebanyak 38 isolat bakteri dominan yang diperoleh diamplifikasi gen 16S-rRNAnya dengan PCR, kemudian dipotong dengan enzim restriksi HaeIII (5’-GG↓CC dan HhaI (5’-GCG↓C. Pola ARDRA ini dijadikan data biner sebagai input untuk konstruksi pohon filogenetika yang dapat digunakan untuk memerkirakan jenis bakteri yang ada. Gen 16S-rRNA hasil PCR setelah dipotong dengan enzim restriksi HaeIII didapatkan 11 pola ARDRA, sedangkan dengan enzim restriksi HhaI menghasilkan delapan pola ARDRA. Berdasarkan pohon filogenetika, diketahui populasi bakteri pada air sistem budidaya bioflok sedikitnya terdiri atas 13 jenis bakteri. Berdasarkan sekuensing dari dua sampel gen 16S-rRNA teridentifikasi jenis bakteri Microbacterium

Effects of S-adenosylmethionine decarboxylase, polyamines, amino acids, and weak bases (amines and ammonia) on development and ribosomal RNA synthesis in Xenopus embryos.

Science.gov (United States)

Shiokawa, Koichiro; Aso, Mai; Kondo, Takeshi; Takai, Jun-Ichi; Yoshida, Junki; Mishina, Takamichi; Fuchimukai, Kota; Ogasawara, Tsukasa; Kariya, Taro; Tashiro, Kosuke; Igarashi, Kazuei

2010-02-01

We have been studying control mechanisms of gene expression in early embryogenesis in a South African clawed toad Xenopus laevis, especially during the period of midblastula transition (MBT), or the transition from the phase of active cell division (cleavage stage) to the phase of extensive morphogenesis (post-blastular stages). We first found that ribosomal RNA synthesis is initiated shortly after MBT in Xenopus embryos and those weak bases, such as amines and ammonium ion, selectively inhibit the initiation and subsequent activation of rRNA synthesis. We then found that rapidly labeled heterogeneous mRNA-like RNA is synthesized in embryos at pre-MBT stage. We then performed cloning and expression studies of several genes, such as those for activin receptors, follistatin and aldolases, and then reached the studies of S-adenosylmethionine decarboxylase (SAMDC), a key enzyme in polyamine metabolism. Here, we cloned a Xenopus SAMDC cDNA and performed experiments to overexpress the in vitro-synthesized SAMDC mRNA in Xenopus early embryos, and found that the maternally preset program of apoptosis occurs in cleavage stage embryos, which is executed when embryos reach the stage of MBT. In the present article, we first summarize results on SAMDC and the maternal program of apoptosis, and then describe our studies on small-molecular-weight substances like polyamines, amino acids, and amines in Xenopus embryos. Finally, we summarize our studies on weak bases, especially on ammonium ion, as the specific inhibitor of ribosomal RNA synthesis in Xenopus embryonic cells.

Ribosome-induced changes in elongation factor Tu conformation control GTP hydrolysis

DEFF Research Database (Denmark)

Villa, Elizabeth; Sengupta, Jayati; Trabuco, Leonard G.

2009-01-01

In translation, elongation factor Tu (EF-Tu) molecules deliver aminoacyl-tRNAs to the mRNA-programmed ribosome. The GTPase activity of EF-Tu is triggered by ribosome-induced conformational changes of the factor that play a pivotal role in the selection of the cognate aminoacyl-tRNAs. We present a 6.......7-A cryo-electron microscopy map of the aminoacyl-tRNA x EF-Tu x GDP x kirromycin-bound Escherichia coli ribosome, together with an atomic model of the complex obtained through molecular dynamics flexible fitting. The model reveals the conformational changes in the conserved GTPase switch regions...... of EF-Tu that trigger hydrolysis of GTP, along with key interactions, including those between the sarcin-ricin loop and the P loop of EF-Tu, and between the effector loop of EF-Tu and a conserved region of the 16S rRNA. Our data suggest that GTP hydrolysis on EF-Tu is controlled through a hydrophobic...

Mitochondrial 12S ribosomal RNA A1555G mutation associated with cardiomyopathy and hearing loss following high-dose chemotherapy and repeated aminoglycoside exposure

DEFF Research Database (Denmark)

Skou, Anne-Sofie; Tranebjærg, Lisbeth; Jensen, Tim

2014-01-01

A 19-month-old girl with the A1555G mitochondrial mutation in the 12S ribosomal RNA gene and acute myelogenous leukemia developed dilated cardiomyopathy and bilateral sensorineural hearing loss before undergoing allogeneic stem cell transplantation. She had received gentamicin during episodes of ...... of febrile neutropenia. Testing for the A1555G mutation is recommended in patients frequently treated with aminoglycosides....

Studies on the catalytic rate constant of ribosomal peptidyltransferase.

Science.gov (United States)

Synetos, D; Coutsogeorgopoulos, C

1987-02-20

A detailed kinetic analysis of a model reaction for the ribosomal peptidyltransferase is described, using fMet-tRNA or Ac-Phe-tRNA as the peptidyl donor and puromycin as the acceptor. The initiation complex (fMet-tRNA X AUG X 70 S ribosome) or (Ac-Phe-tRNA X poly(U) X 70 S ribosome) (complex C) is isolated and then reacted with excess puromycin (S) to give fMet-puromycin or Ac-Phe-puromycin. This reaction (puromycin reaction) is first order at all concentrations of S tested. An important asset of this kinetic analysis is the fact that the relationship between the first order rate constant kobs and [S] shows hyperbolic saturation and that the value of kobs at saturating [S] is a measure of the catalytic rate constant (k cat) of peptidyltransferase in the puromycin reaction. With fMet-tRNA as the donor, this kcat of peptidyltransferase is 8.3 min-1 when the 0.5 M NH4Cl ribosomal wash is present, compared to 3.8 min-1 in its absence. The kcat of peptidyltransferase is 2.0 min-1 when Ac-Phe-tRNA replaces fMet-tRNA in the presence of the ribosomal wash and decreases to 0.8 min-1 in its absence. This kinetic procedure is the best method available for evaluating changes in the activity of peptidyltransferase in vitro. The results suggest that peptidyltransferase is subjected to activation by the binding of fMet-tRNA to the 70 S initiation complex.

Mutations in domain II of 23 S rRNA facilitate translation of a 23 S rRNA-encoded pentapeptide conferring erythromycin resistance

DEFF Research Database (Denmark)

Dam, M; Douthwaite, S; Tenson, T

1996-01-01

Mutations in domain II of Escherichia coli 23 S rRNA that cause resistance to erythromycin do so in a manner fundamentally different from mutations at the drug binding site in domain V of the 23 S rRNA. The domain II mutations are located in a hairpin structure between nucleotides 1198 and 1247...... this hypothesis, a range of point mutations was generated in domain II of 23 S rRNA in the vicinity of the E-peptide open reading frame. We find a correlation between erythromycin resistance of the mutant clones and increased accessibility of the ribosome binding site of the E-peptide gene. Furthermore......, the erythromycin resistance determinant in the mutants was shown to be confined to a small 23 S rRNA segment containing the coding region and the ribosome binding site of the E-peptide open reading frame. It thus appears that the domain II mutations mediate erythromycin resistance by increasing expression...

Paenibacillus larvae 16S-23S rDNA intergenic transcribed spacer (ITS) regions: DNA fingerprinting and characterization.

Science.gov (United States)

Dingman, Douglas W

2012-07-01

Paenibacillus larvae is the causative agent of American foulbrood in honey bee (Apis mellifera) larvae. PCR amplification of the 16S-23S ribosomal DNA (rDNA) intergenic transcribed spacer (ITS) regions, and agarose gel electrophoresis of the amplified DNA, was performed using genomic DNA collected from 134 P. larvae strains isolated in Connecticut, six Northern Regional Research Laboratory stock strains, four strains isolated in Argentina, and one strain isolated in Chile. Following electrophoresis of amplified DNA, all isolates exhibited a common migratory profile (i.e., ITS-PCR fingerprint pattern) of six DNA bands. This profile represented a unique ITS-PCR DNA fingerprint that was useful as a fast, simple, and accurate procedure for identification of P. larvae. Digestion of ITS-PCR amplified DNA, using mung bean nuclease prior to electrophoresis, characterized only three of the six electrophoresis bands as homoduplex DNA and indicating three true ITS regions. These three ITS regions, DNA migratory band sizes of 915, 1010, and 1474 bp, signify a minimum of three types of rrn operons within P. larvae. DNA sequence analysis of ITS region DNA, using P. larvae NRRL B-3553, identified the 3' terminal nucleotides of the 16S rRNA gene, 5' terminal nucleotides of the 23S rRNA gene, and the complete DNA sequences of the 5S rRNA, tRNA(ala), and tRNA(ile) genes. Gene organization within the three rrn operon types was 16S-23S, 16S-tRNA(ala)-23S, and l6S-5S-tRNA(ile)-tRNA(ala)-23S and these operons were named rrnA, rrnF, and rrnG, respectively. The 23S rRNA gene was shown by I-CeuI digestion and pulsed-field gel electrophoresis of genomic DNA to be present as seven copies. This was suggestive of seven rrn operon copies within the P. larvae genome. Investigation of the 16S-23S rDNA regions of this bacterium has aided the development of a diagnostic procedure and has helped genomic mapping investigations via characterization of the ITS regions. Copyright © 2012 Elsevier Inc

How conserved are the conserved 16S-rRNA regions?

Directory of Open Access Journals (Sweden)

Marcel Martinez-Porchas

2017-02-01

Full Text Available The 16S rRNA gene has been used as master key for studying prokaryotic diversity in almost every environment. Despite the claim of several researchers to have the best universal primers, the reality is that no primer has been demonstrated to be truly universal. This suggests that conserved regions of the gene may not be as conserved as expected. The aim of this study was to evaluate the conservation degree of the so-called conserved regions flanking the hypervariable regions of the 16S rRNA gene. Data contained in SILVA database (release 123 were used for the study. Primers reported as matches of each conserved region were assembled to form contigs; sequences sizing 12 nucleotides (12-mers were extracted from these contigs and searched into the entire set of SILVA sequences. Frequency analysis shown that extreme regions, 1 and 10, registered the lowest frequencies. 12-mer frequencies revealed segments of contigs that were not as conserved as expected (≤90%. Fragments corresponding to the primer contigs 3, 4, 5b and 6a were recovered from all sequences in SILVA database. Nucleotide frequency analysis in each consensus demonstrated that only a small fraction of these so-called conserved regions is truly conserved in non-redundant sequences. It could be concluded that conserved regions of the 16S rRNA gene exhibit considerable variation that has to be considered when using this gene as biomarker.

High-Resolution Melting Curve Analysis of the 16S Ribosomal Gene to Detect and Identify Pathogenic and Saprophytic Leptospira Species in Colombian Isolates.

Science.gov (United States)

Peláez Sánchez, Ronald G; Quintero, Juan Álvaro López; Pereira, Martha María; Agudelo-Flórez, Piedad

2017-05-01

AbstractIt is important to identify the circulating Leptospira agent to enhance the performance of serodiagnostic tests by incorporating specific antigens of native species, develop vaccines that take into account the species/serovars circulating in different regions, and optimize prevention and control strategies. The objectives of this study were to develop a polymerase chain reaction (PCR)-high-resolution melting (HRM) assay for differentiating between species of the genus Leptospira and to verify its usefulness in identifying unknown samples to species level. A set of primers from the initial region of the 16S ribosomal gene was designed to detect and differentiate the 22 species of Leptospira . Eleven reference strains were used as controls to establish the reference species and differential melting curves. Twenty-five Colombian Leptospira isolates were studied to evaluate the usefulness of the PCR-HRM assay in identifying unknown samples to species level. This identification was confirmed by sequencing and phylogenetic analysis of the 16S ribosomal gene. Eleven Leptospira species were successfully identified, except for Leptospira meyeri / Leptospira yanagawae because the sequences were 100% identical. The 25 isolates from humans, animals, and environmental water sources were identified as Leptospira santarosai (twelve), Leptospira interrogans (nine), and L. meyeri / L. yanagawae (four). The species verification was 100% concordant between PCR-HRM and phylogenetic analysis of the 16S ribosomal gene. The PCR-HRM assay designed in this study is a useful tool for identifying Leptospira species from isolates.

The pleuromutilin drugs tiamulin and valnemulin bind to the RNA at the peptidyl transferase centre on the ribosome.

Science.gov (United States)

Poulsen, S M; Karlsson, M; Johansson, L B; Vester, B

2001-09-01

The pleuromutilin antibiotic derivatives, tiamulin and valnemulin, inhibit protein synthesis by binding to the 50S ribosomal subunit of bacteria. The action and binding site of tiamulin and valnemulin was further characterized on Escherichia coli ribosomes. It was revealed that these drugs are strong inhibitors of peptidyl transferase and interact with domain V of 23S RNA, giving clear chemical footprints at nucleotides A2058-9, U2506 and U2584-5. Most of these nucleotides are highly conserved phylogenetically and functionally important, and all of them are at or near the peptidyl transferase centre and have been associated with binding of several antibiotics. Competitive footprinting shows that tiamulin and valnemulin can bind concurrently with the macrolide erythromycin but compete with the macrolide carbomycin, which is a peptidyl transferase inhibitor. We infer from these and previous results that tiamulin and valnemulin interact with the rRNA in the peptidyl transferase slot on the ribosomes in which they prevent the correct positioning of the CCA-ends of tRNAs for peptide transfer.

Ribosomal protein L5 has a highly twisted concave surface and flexible arms responsible for rRNA binding.

Science.gov (United States)

Nakashima, T; Yao, M; Kawamura, S; Iwasaki, K; Kimura, M; Tanaka, I

2001-05-01

Ribosomal protein L5 is a 5S rRNA binding protein in the large subunit and plays an essential role in the promotion of a particular conformation of 5S rRNA. The crystal structure of the ribosomal protein L5 from Bacillus stearothermophilus has been determined at 1.8 A resolution. The molecule consists of a five-stranded antiparallel beta-sheet and four alpha-helices, which fold in a way that is topologically similar to the ribonucleoprotein (RNP) domain. The molecular shape and electrostatic representation suggest that the concave surface and loop regions are involved in 5S rRNA binding. To identify amino acid residues responsible for 5S rRNA binding, we made use of Ala-scanning mutagenesis of evolutionarily conserved amino acids occurring in the beta-strands and loop regions. The mutations of Asn37 at the beta1-strand and Gln63 at the loop between helix 2 and beta3-strand as well as that of Phe77 at the tip of the loop structure between the beta2- and beta3-strands caused a significant reduction in 5S rRNA binding. In addition, the mutations of Thr90 on the beta3-strand and Ile141 and Asp144 at the loop between beta4- and beta5-strands moderately reduced the 5S rRNA-binding affinity. Comparison of these results with the more recently analyzed structure of the 50S subunit from Haloarcula marismortui suggests that there are significant differences in the structure at N- and C-terminal regions and probably in the 5S rRNA binding.

The ribosome can prevent aggregation of partially folded protein intermediates: studies using the Escherichia coli ribosome.

Directory of Open Access Journals (Sweden)

Bani Kumar Pathak

Full Text Available BACKGROUND: Molecular chaperones that support de novo folding of proteins under non stress condition are classified as chaperone 'foldases' that are distinct from chaperone' holdases' that provide high affinity binding platform for unfolded proteins and prevent their aggregation specifically under stress conditions. Ribosome, the cellular protein synthesis machine can act as a foldase chaperone that can bind unfolded proteins and release them in folding competent state. The peptidyl transferase center (PTC located in the domain V of the 23S rRNA of Escherichia coli ribosome (bDV RNA is the chaperoning center of the ribosome. It has been proposed that via specific interactions between the RNA and refolding proteins, the chaperone provides information for the correct folding of unfolded polypeptide chains. RESULTS: We demonstrate using Escherichia coli ribosome and variants of its domain V RNA that the ribosome can bind to partially folded intermediates of bovine carbonic anhydrase II (BCAII and lysozyme and suppress aggregation during their refolding. Using mutants of domain V RNA we demonstrate that the time for which the chaperone retains the bound protein is an important factor in determining its ability to suppress aggregation and/or support reactivation of protein. CONCLUSION: The ribosome can behave like a 'holdase' chaperone and has the ability to bind and hold back partially folded intermediate states of proteins from participating in the aggregation process. Since the ribosome is an essential organelle that is present in large numbers in all living cells, this ability of the ribosome provides an energetically inexpensive way to suppress cellular aggregation. Further, this ability of the ribosome might also be crucial in the context that the ribosome is one of the first chaperones to be encountered by a large nascent polypeptide chains that have a tendency to form partially folded intermediates immediately following their synthesis.

Structure of the hepatitis C virus IRES bound to the human 80S ribosome: remodeling of the HCV IRES.

Science.gov (United States)

Boehringer, Daniel; Thermann, Rolf; Ostareck-Lederer, Antje; Lewis, Joe D; Stark, Holger

2005-11-01

Initiation of translation of the hepatitis C virus (HCV) polyprotein is driven by an internal ribosome entry site (IRES) RNA that bypasses much of the eukaryotic translation initiation machinery. Here, single-particle electron cryomicroscopy has been used to study the mechanism of HCV IRES-mediated initiation. A HeLa in vitro translation system was used to assemble human IRES-80S ribosome complexes under near physiological conditions; these were stalled before elongation. Domain 2 of the HCV IRES is bound to the tRNA exit site, touching the L1 stalk of the 60S subunit, suggesting a mechanism for the removal of the HCV IRES in the progression to elongation. Domain 3 of the HCV IRES positions the initiation codon in the ribosomal mRNA binding cleft by binding helix 28 at the head of the 40S subunit. The comparison with the previously published binary 40S-HCV IRES complex reveals structural rearrangements in the two pseudoknot structures of the HCV IRES in translation initiation.

5S rRNA gene arrangements in protists: a case of nonadaptive evolution.

Science.gov (United States)

Drouin, Guy; Tsang, Corey

2012-06-01

Given their high copy number and high level of expression, one might expect that both the sequence and organization of eukaryotic ribosomal RNA genes would be conserved during evolution. Although the organization of 18S, 5.8S and 28S ribosomal RNA genes is indeed relatively well conserved, that of 5S rRNA genes is much more variable. Here, we review the different types of 5S rRNA gene arrangements which have been observed in protists. This includes linkages to the other ribosomal RNA genes as well as linkages to ubiquitin, splice-leader, snRNA and tRNA genes. Mapping these linkages to independently derived phylogenies shows that these diverse linkages have repeatedly been gained and lost during evolution. This argues against such linkages being the primitive condition not only in protists but also in other eukaryote species. Because the only characteristic the diverse genes with which 5S rRNA genes are found linked with is that they are tandemly repeated, these arrangements are unlikely to provide any selective advantage. Rather, the observed high variability in 5S rRNA genes arrangements is likely the result of the fact that 5S rRNA genes contain internal promoters, that these genes are often transposed by diverse recombination mechanisms and that these new gene arrangements are rapidly homogenized by unequal crossingovers and/or by gene conversions events in species with short generation times and frequent founder events.

Cell Death-Associated Ribosomal RNA Cleavage in Postmortem Tissues and Its Forensic Applications.

Science.gov (United States)

Kim, Ji Yeon; Kim, Yunmi; Cha, Hyo Kyeong; Lim, Hye Young; Kim, Hyungsub; Chung, Sooyoung; Hwang, Juck-Joon; Park, Seong Hwan; Son, Gi Hoon

2017-06-30

Estimation of postmortem interval (PMI) is a key issue in the field of forensic pathology. With the availability of quantitative analysis of RNA levels in postmortem tissues, several studies have assessed the postmortem degradation of constitutively expressed RNA species to estimate PMI. However, conventional RNA quantification as well as biochemical and physiological changes employed thus far have limitations related to standardization or normalization. The present study focuses on an interesting feature of the subdomains of certain RNA species, in which they are site-specifically cleaved during apoptotic cell death. We found that the D8 divergent domain of ribosomal RNA (rRNA) bearing cell death-related cleavage sites was rapidly removed during postmortem RNA degradation. In contrast to the fragile domain, the 5' terminal region of 28S rRNA was remarkably stable during the postmortem period. Importantly, the differences in the degradation rates between the two domains in mammalian 28S rRNA were highly proportional to increasing PMI with a significant linear correlation observed in mice as well as human autopsy tissues. In conclusion, we demonstrate that comparison of the degradation rates between domains of a single RNA species provides quantitative information on postmortem degradation states, which can be applied for the estimation of PMI.

Automated insertion of sequences into a ribosomal RNA alignment: An application of computational linguistics in molecular biology

Energy Technology Data Exchange (ETDEWEB)

Taylor, Ronald C. [Case Western Reserve Univ., Cleveland, OH (United States)

1991-11-01

This thesis involved the construction of (1) a grammar that incorporates knowledge on base invariancy and secondary structure in a molecule and (2) a parser engine that uses the grammar to position bases into the structural subunits of the molecule. These concepts were combined with a novel pinning technique to form a tool that semi-automates insertion of a new species into the alignment for the 16S rRNA molecule (a component of the ribosome) maintained by Dr. Carl Woese`s group at the University of Illinois at Urbana. The tool was tested on species extracted from the alignment and on a group of entirely new species. The results were very encouraging, and the tool should be substantial aid to the curators of the 16S alignment. The construction of the grammar was itself automated, allowing application of the tool to alignments for other molecules. The logic programming language Prolog was used to construct all programs involved. The computational linguistics approach used here was found to be a useful way to attach the problem of insertion into an alignment.

Automated insertion of sequences into a ribosomal RNA alignment: An application of computational linguistics in molecular biology

Energy Technology Data Exchange (ETDEWEB)

Taylor, R.C.

1991-11-01

This thesis involved the construction of (1) a grammar that incorporates knowledge on base invariancy and secondary structure in a molecule and (2) a parser engine that uses the grammar to position bases into the structural subunits of the molecule. These concepts were combined with a novel pinning technique to form a tool that semi-automates insertion of a new species into the alignment for the 16S rRNA molecule (a component of the ribosome) maintained by Dr. Carl Woese's group at the University of Illinois at Urbana. The tool was tested on species extracted from the alignment and on a group of entirely new species. The results were very encouraging, and the tool should be substantial aid to the curators of the 16S alignment. The construction of the grammar was itself automated, allowing application of the tool to alignments for other molecules. The logic programming language Prolog was used to construct all programs involved. The computational linguistics approach used here was found to be a useful way to attach the problem of insertion into an alignment.

Inhibition by Siomycin and Thiostrepton of Both Aminoacyl-tRNA and Factor G Binding to Ribosomes

Science.gov (United States)

Ll, Juan Modole; Cabrer, Bartolomé; Parmeggiani, Andrea; Azquez, David V

1971-01-01

Siomycin, a peptide antibiotic that interacts with the 50S ribosomal subunit and inhibits binding of factor G, is shown also to inhibit binding of aminoacyl-tRNA; however, it does not impair binding of fMet-tRNA and completion of the initiation complex. Moreover, unlike other inhibitors of aminoacyl-tRNA binding (tetracycline, sparsomycin, and streptogramin A), siomycin completely abolishes the GTPase activity associated with the binding of aminoacyl-tRNA catalyzed by factor Tu. A single-site interaction of siomycin appears to be responsible for its effect on both the binding of the aminoacyl-tRNA-Tu-GTP complex and that of factor G. PMID:4331558

Improved Ribosome-Footprint and mRNA Measurements Provide Insights into Dynamics and Regulation of Yeast Translation

Science.gov (United States)

2016-02-11

unlimited. Improved Ribosome-Footprint and mRNA Measurements Provide Insights into Dynamics and Regulation of Yeast Translation The views, opinions and...into Dynamics and Regulation of Yeast Translation Report Title Ribosome-footprint profiling provides genome-wide snapshots of translation, but...tend to slow translation. With the improved mRNA measurements, the variation attributable to translational control in exponentially growing yeast was

Phylogenetic Diversity of Lactic Acid Bacteria Associated with Paddy Rice Silage as Determined by 16S Ribosomal DNA Analysis

OpenAIRE

Ennahar, Saïd; Cai, Yimin; Fujita, Yasuhito

2003-01-01

A total of 161 low-G+C-content gram-positive bacteria isolated from whole-crop paddy rice silage were classified and subjected to phenotypic and genetic analyses. Based on morphological and biochemical characters, these presumptive lactic acid bacterium (LAB) isolates were divided into 10 groups that included members of the genera Enterococcus, Lactobacillus, Lactococcus, Leuconostoc, Pediococcus, and Weissella. Analysis of the 16S ribosomal DNA (rDNA) was used to confirm the presence of the ...

Expedited quantification of mutant ribosomal RNA by binary deoxyribozyme (BiDz) sensors.

Science.gov (United States)

Gerasimova, Yulia V; Yakovchuk, Petro; Dedkova, Larisa M; Hecht, Sidney M; Kolpashchikov, Dmitry M

2015-10-01

Mutations in ribosomal RNA (rRNA) have traditionally been detected by the primer extension assay, which is a tedious and multistage procedure. Here, we describe a simple and straightforward fluorescence assay based on binary deoxyribozyme (BiDz) sensors. The assay uses two short DNA oligonucleotides that hybridize specifically to adjacent fragments of rRNA, one of which contains a mutation site. This hybridization results in the formation of a deoxyribozyme catalytic core that produces the fluorescent signal and amplifies it due to multiple rounds of catalytic action. This assay enables us to expedite semi-quantification of mutant rRNA content in cell cultures starting from whole cells, which provides information useful for optimization of culture preparation prior to ribosome isolation. The method requires less than a microliter of a standard Escherichia coli cell culture and decreases analysis time from several days (for primer extension assay) to 1.5 h with hands-on time of ∼10 min. It is sensitive to single-nucleotide mutations. The new assay simplifies the preliminary analysis of RNA samples and cells in molecular biology and cloning experiments and is promising in other applications where fast detection/quantification of specific RNA is required. © 2015 Gerasimova et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

Evidence for functional interaction between domains II and V of 23S ribosomal RNA from an erythromycin-resistant mutant

DEFF Research Database (Denmark)

Douthwaite, S; Prince, J B; Noller, H F

1985-01-01

A mutation affording low levels of erythromycin resistance has been obtained by in vitro hydroxylamine mutagenesis of a cloned ribosomal RNA operon from Escherichia coli. The site of the mutational event responsible for antibiotic resistance was localized to the gene region encoding domain II of ...

Characterization of hydrocortisone bioconversion and 16S RNA gene in Synechococcus nidulans cultures.

Science.gov (United States)

Rasoul-Amini, S; Ghasemi, Y; Morowvat, M H; Ghoshoon, M B; Raee, M J; Mosavi-Azam, S B; Montazeri-Najafabady, N; Nouri, F; Parvizi, R; Negintaji, N; Khoubani, S

2010-01-01

A unicellular cyanobacterium, Synechococcus nidulans (Pringsheim) Komárek, was isolated from paddy-fields and applied in the biotransformation experiment of hydrocortisone (1). This strain has not been previously tested for steroid bioconversion. Fermentation was carried out in BG-11 medium supplemented with 0.05% substrate at 25 degrees C for 14 days of incubation. The obtained products were chromatographically purified followed by their characterization using spectroscopic methods. 11beta,17beta-dihydroxyandrost-4-en-3-one (2), 11beta-hydroxyandrost-4-en-3,17-dione (3), and androst-4-ene-3,17-dione (4) were the main bioproducts in the hydrocortisone bioconversion. The observed bioreaction characteristics were the side chain degradation of the substrate to prepare compounds (2) and (3) following the 11beta-dehydroxylation for accumulation of the compound (4). Time course study showed the accumulation of the product (2) from the second day of the fermentation and compounds (3) and (4) from the third day. All the metabolites reached their maximum concentration in seven days. Cyanobacterial 16S rRNA gene was also amplified by PCR. Sequences were amplified using the universal prokaryotic primers which amplify a approximately 400-bp region of the 16S rRNA gene. PCR products were sequenced to confirm their authenticity as 16S rRNA gene of cyanobacteria. The result of PCR blasted with other sequenced cyanobacteria in NCBI showed 99% identity to the 16S small subunit rRNA of seven Synechococcus species.

A Novel Association between Two Trypanosome-Specific Factors and the Conserved L5-5S rRNA Complex

Science.gov (United States)

Ciganda, Martin; Prohaska, Kimberly; Hellman, Kristina; Williams, Noreen

2012-01-01

P34 and P37 are two previously identified RNA binding proteins in the flagellate protozoan Trypanosoma brucei. RNA interference studies have determined that the proteins are involved in and essential for ribosome biogenesis. The proteins interact with the 5S rRNA with nearly identical binding characteristics. We have shown that this interaction is achieved mainly through the LoopA region of the RNA, but P34 and P37 also protect the L5 binding site located on LoopC. We now provide evidence to show that these factors form a novel pre-ribosomal particle through interactions with both 5S rRNA and the L5 ribosomal protein. Further in silico and in vitro analysis of T. brucei L5 indicates a lower affinity for 5S rRNA than expected, based on other eukaryotic L5 proteins. We hypothesize that P34 and P37 complement L5 and bridge the interaction with 5S rRNA, stabilizing it and aiding in the early steps of ribosome biogenesis. PMID:22859981

The NBS1-Treacle complex controls ribosomal RNA transcription in response to DNA damage

DEFF Research Database (Denmark)

Larsen, Dorthe H; Hari, Flurina; Clapperton, Julie A

2014-01-01

Chromosome breakage elicits transient silencing of ribosomal RNA synthesis, but the mechanisms involved remained elusive. Here we discover an in trans signalling mechanism that triggers pan-nuclear silencing of rRNA transcription in response to DNA damage. This is associated with transient...... recruitment of the Nijmegen breakage syndrome protein 1 (NBS1), a central regulator of DNA damage responses, into the nucleoli. We further identify TCOF1 (also known as Treacle), a nucleolar factor implicated in ribosome biogenesis and mutated in Treacher Collins syndrome, as an interaction partner of NBS1...

Bacteriological incidence in pneumonia patients with pulmonary emphysema: a bacterial floral analysis using the 16S ribosomal RNA gene in bronchoalveolar lavage fluid

Directory of Open Access Journals (Sweden)

Naito K

2017-07-01

Full Text Available Keisuke Naito,1 Kei Yamasaki,1 Kazuhiro Yatera,1 Kentaro Akata,1 Shingo Noguchi,1 Toshinori Kawanami,1 Kazumasa Fukuda,2 Takashi Kido,1 Hiroshi Ishimoto,3 Hiroshi Mukae3 1Department of Respiratory Medicine, 2Department of Microbiology, University of Occupational and Environmental Health, Japan, Kitakyushu City, Fukuoka, 3Second Department of Internal Medicine, Nagasaki University School of Medicine, Nagasaki City, Nagasaki, Japan Abstract: Pulmonary emphysema is an important radiological finding in chronic obstructive pulmonary disease patients, but bacteriological differences in pneumonia patients according to the severity of emphysematous changes have not been reported. Therefore, we evaluated the bacteriological incidence in the bronchoalveolar lavage fluid (BALF of pneumonia patients using cultivation and a culture-independent molecular method. Japanese patients with community-acquired pneumonia (83 and healthcare-associated pneumonia (94 between April 2010 and February 2014 were evaluated. The BALF obtained from pneumonia lesions was evaluated by both cultivation and a molecular method. In the molecular method, ~600 base pairs of bacterial 16S ribosomal RNA genes in the BALF were amplified by polymerase chain reaction, and clone libraries were constructed. The nucleotide sequences of 96 randomly selected colonies were determined, and a homology search was performed to identify the bacterial species. A qualitative radiological evaluation of pulmonary emphysema based on chest computed tomography (CT images was performed using the Goddard classification. The severity of pulmonary emphysema based on the Goddard classification was none in 47.4% (84/177, mild in 36.2% (64/177, moderate in 10.2% (18/177, and severe in 6.2% (11/177. Using the culture-independent molecular method, Moraxella catarrhalis was significantly more frequently detected in moderate or severe emphysema patients than in patients with no or mild emphysematous changes. The

Restless 5S: the re-arrangement(s) and evolution of the nuclear ribosomal DNA in land plants.

Science.gov (United States)

Wicke, Susann; Costa, Andrea; Muñoz, Jesùs; Quandt, Dietmar

2011-11-01

Among eukaryotes two types of nuclear ribosomal DNA (nrDNA) organization have been observed. Either all components, i.e. the small ribosomal subunit, 5.8S, large ribosomal subunit, and 5S occur tandemly arranged or the 5S rDNA forms a separate cluster of its own. Generalizations based on data derived from just a few model organisms have led to a superimposition of structural and evolutionary traits to the entire plant kingdom asserting that plants generally possess separate arrays. This study reveals that plant nrDNA organization into separate arrays is not a distinctive feature, but rather assignable almost solely to seed plants. We show that early diverging land plants and presumably streptophyte algae share a co-localization of all rRNA genes within one repeat unit. This raises the possibility that the state of rDNA gene co-localization had occurred in their common ancestor. Separate rDNA arrays were identified for all basal seed plants and water ferns, implying at least two independent 5S rDNA transposition events during land plant evolution. Screening for 5S derived Cassandra transposable elements which might have played a role during the transposition events, indicated that this retrotransposon is absent in early diverging vascular plants including early fern lineages. Thus, Cassandra can be rejected as a primary mechanism for 5S rDNA transposition in water ferns. However, the evolution of Cassandra and other eukaryotic 5S derived elements might have been a side effect of the 5S rDNA cluster formation. Structural analysis of the intergenic spacers of the ribosomal clusters revealed that transposition events partially affect spacer regions and suggests a slightly different transcription regulation of 5S rDNA in early land plants. 5S rDNA upstream regulatory elements are highly divergent or absent from the LSU-5S spacers of most early divergent land plant lineages. Several putative scenarios and mechanisms involved in the concerted relocation of hundreds of 5S

Detecting 16S rRNA Methyltransferases in Enterobacteriaceae by Use of Arbekacin.

Science.gov (United States)

McGann, Patrick; Chahine, Sarah; Okafor, Darius; Ong, Ana C; Maybank, Rosslyn; Kwak, Yoon I; Wilson, Kerry; Zapor, Michael; Lesho, Emil; Hinkle, Mary

2016-01-01

16S rRNA methyltransferases confer resistance to most aminoglycosides, but discriminating their activity from that of aminoglycoside-modifying enzymes (AMEs) is challenging using phenotypic methods. We demonstrate that arbekacin, an aminoglycoside refractory to most AMEs, can rapidly detect 16S methyltransferase activity in Enterobacteriaceae with high specificity using the standard disk susceptibility test. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

The origin of the 5S ribosomal RNA molecule could have been caused by a single inverse duplication: strong evidence from its sequences.

Science.gov (United States)

Branciamore, Sergio; Di Giulio, Massimo

2012-04-01

The secondary structure of the 5S ribosomal RNA (5S rRNA) molecule shows a high degree of symmetry. In order to explain the origin of this symmetry, it has been conjectured that one half of the 5S rRNA molecule was its precursor and that an indirect duplication of this precursor created the other half and thus the current symmetry of the molecule. Here, we have subjected to an empirical test both the indirect duplication model, analysing a total of 684 5S rRNA sequences for complementarity between the two halves of the 5S rRNA, and the direct duplication model analysing in this case the similarity between the two halves of this molecule. In intra- and inter-molecule and intra- and inter-domain comparisons, we find a high statistical support to the hypothesis of a complementarity relationship between the two halves of the 5S rRNA molecule, denying vice versa the hypothesis of similarity between these halves. Therefore, these observations corroborate the indirect duplication model at the expense of the direct duplication model, as reason of the origin of the 5S rRNA molecule. More generally, we discuss and favour the hypothesis that all RNAs and proteins, which present symmetry, did so through gene duplication and not by gradualistic accumulation of few monomers or segments of molecule into a gradualistic growth process. This would be the consequence of the very high propensity that nucleic acids have to be subjected to duplications.

Involvement of ribosomal protein L6 in assembly of functional 50S ribosomal subunit in Escherichia coli cells

International Nuclear Information System (INIS)

Shigeno, Yuta; Uchiumi, Toshio; Nomura, Takaomi

2016-01-01

Ribosomal protein L6, an essential component of the large (50S) subunit, primarily binds to helix 97 of 23S rRNA and locates near the sarcin/ricin loop of helix 95 that directly interacts with GTPase translation factors. Although L6 is believed to play important roles in factor-dependent ribosomal function, crucial biochemical evidence for this hypothesis has not been obtained. We constructed and characterized an Escherichia coli mutant bearing a chromosomal L6 gene (rplF) disruption and carrying a plasmid with an arabinose-inducible L6 gene. Although this ΔL6 mutant grew more slowly than its wild-type parent, it proliferated in the presence of arabinose. Interestingly, cell growth in the absence of arabinose was biphasic. Early growth lasted only a few generations (LI-phase) and was followed by a suspension of growth for several hours (S-phase). This suspension was followed by a second growth phase (LII-phase). Cells harvested at both LI- and S-phases contained ribosomes with reduced factor-dependent GTPase activity and accumulated 50S subunit precursors (45S particles). The 45S particles completely lacked L6. Complete 50S subunits containing L6 were observed in all growth phases regardless of the L6-depleted condition, implying that the ΔL6 mutant escaped death because of a leaky expression of L6 from the complementing plasmid. We conclude that L6 is essential for the assembly of functional 50S subunits at the late stage. We thus established conditions for the isolation of L6-depleted 50S subunits, which are essential to study the role of L6 in translation. - Highlights: • We constructed an in vivo functional assay system for Escherichia coli ribosomal protein L6. • Growth of an E. coli ΔL6 mutant was biphasic when L6 levels were depleted. • The ΔL6 mutant accumulated 50S ribosomal subunit precursors that sedimented at 45S. • L6 is a key player in the late stage of E. coli 50S subunit assembly.

Involvement of ribosomal protein L6 in assembly of functional 50S ribosomal subunit in Escherichia coli cells

Energy Technology Data Exchange (ETDEWEB)

Shigeno, Yuta [Division of Applied Biology, Faculty of Textile Science and Technology, Shinshu University, Ueda 386-8567 (Japan); Uchiumi, Toshio [Department of Biology, Faculty of Science, Niigata University, Niigata 950-2181 (Japan); Nomura, Takaomi, E-mail: nomurat@shinshu-u.ac.jp [Division of Applied Biology, Faculty of Textile Science and Technology, Shinshu University, Ueda 386-8567 (Japan)

2016-04-22

Ribosomal protein L6, an essential component of the large (50S) subunit, primarily binds to helix 97 of 23S rRNA and locates near the sarcin/ricin loop of helix 95 that directly interacts with GTPase translation factors. Although L6 is believed to play important roles in factor-dependent ribosomal function, crucial biochemical evidence for this hypothesis has not been obtained. We constructed and characterized an Escherichia coli mutant bearing a chromosomal L6 gene (rplF) disruption and carrying a plasmid with an arabinose-inducible L6 gene. Although this ΔL6 mutant grew more slowly than its wild-type parent, it proliferated in the presence of arabinose. Interestingly, cell growth in the absence of arabinose was biphasic. Early growth lasted only a few generations (LI-phase) and was followed by a suspension of growth for several hours (S-phase). This suspension was followed by a second growth phase (LII-phase). Cells harvested at both LI- and S-phases contained ribosomes with reduced factor-dependent GTPase activity and accumulated 50S subunit precursors (45S particles). The 45S particles completely lacked L6. Complete 50S subunits containing L6 were observed in all growth phases regardless of the L6-depleted condition, implying that the ΔL6 mutant escaped death because of a leaky expression of L6 from the complementing plasmid. We conclude that L6 is essential for the assembly of functional 50S subunits at the late stage. We thus established conditions for the isolation of L6-depleted 50S subunits, which are essential to study the role of L6 in translation. - Highlights: • We constructed an in vivo functional assay system for Escherichia coli ribosomal protein L6. • Growth of an E. coli ΔL6 mutant was biphasic when L6 levels were depleted. • The ΔL6 mutant accumulated 50S ribosomal subunit precursors that sedimented at 45S. • L6 is a key player in the late stage of E. coli 50S subunit assembly.

Detection and characterization of Pasteuria 16S rRNA gene sequences from nematodes and soils.

Science.gov (United States)

Duan, Y P; Castro, H F; Hewlett, T E; White, J H; Ogram, A V

2003-01-01

Various bacterial species in the genus Pasteuria have great potential as biocontrol agents against plant-parasitic nematodes, although study of this important genus is hampered by the current inability to cultivate Pasteuria species outside their host. To aid in the study of this genus, an extensive 16S rRNA gene sequence phylogeny was constructed and this information was used to develop cultivation-independent methods for detection of Pasteuria in soils and nematodes. Thirty new clones of Pasteuria 16S rRNA genes were obtained directly from nematodes and soil samples. These were sequenced and used to construct an extensive phylogeny of this genus. These sequences were divided into two deeply branching clades within the low-G + C, Gram-positive division; some sequences appear to represent novel species within the genus Pasteuria. In addition, a surprising degree of 16S rRNA gene sequence diversity was observed within what had previously been designated a single strain of Pasteuria penetrans (P-20). PCR primers specific to Pasteuria 16S rRNA for detection of Pasteuria in soils were also designed and evaluated. Detection limits for soil DNA were 100-10,000 Pasteuria endospores (g soil)(-1).

Prokaryotic community profiling of local algae wastewaters using advanced 16S rRNA gene sequencing.

Science.gov (United States)

Limayem, Alya; Micciche, Andrew; Nayak, Bina; Mohapatra, Shyam

2018-01-01

Algae biomass-fed wastewaters are a promising source of lipid and bioenergy manufacture, revealing substantial end-product investment returns. However, wastewaters would contain lytic pathogens carrying drug resistance detrimental to algae yield and environmental safety. This study was conducted to simultaneously decipher through high-throughput advanced Illumina 16S ribosomal RNA (rRNA) gene sequencing, the cultivable and uncultivable bacterial community profile found in a single sample that was directly recovered from the local wastewater systems. Samples were collected from two previously documented sources including anaerobically digested (AD) municipal wastewater and swine wastewater with algae namely Chlorella spp. in addition to control samples, swine wastewater, and municipal wastewater without algae. Results indicated the presence of a significant level of Bacteria in all samples with an average of approximately 95.49% followed by Archaea 2.34%, in local wastewaters designed for algae cultivation. Taxonomic genus identification indicated the presence of Calothrix, Pseudomonas, and Clostridium as the most prevalent strains in both local municipal and swine wastewater samples containing algae with an average of 17.37, 12.19, and 7.84%, respectively. Interestingly, swine wastewater without algae displayed the lowest level of Pseudomonas strains algae indicates potential coexistence between these strains and algae microenvironment, suggesting further investigations. This finding was particularly relevant for the earlier documented adverse effects of some nosocomial Pseudomonas strains on algae growth and their multidrug resistance potential, requiring the development of targeted bioremediation with regard to the beneficial flora.

Diverse Regulators of Human Ribosome Biogenesis Discovered by Changes in Nucleolar Number

Directory of Open Access Journals (Sweden)

Katherine I. Farley-Barnes

2018-02-01

Full Text Available Ribosome biogenesis is a highly regulated, essential cellular process. Although studies in yeast have established some of the biological principles of ribosome biogenesis, many of the intricacies of its regulation in higher eukaryotes remain unknown. To understand how ribosome biogenesis is globally integrated in human cells, we conducted a genome-wide siRNA screen for regulators of nucleolar number. We found 139 proteins whose depletion changed the number of nucleoli per nucleus from 2–3 to only 1 in human MCF10A cells. Follow-up analyses on 20 hits found many (90% to be essential for the nucleolar functions of rDNA transcription (7, pre-ribosomal RNA (pre-rRNA processing (16, and/or global protein synthesis (14. This genome-wide analysis exploits the relationship between nucleolar number and function to discover diverse cellular pathways that regulate the making of ribosomes and paves the way for further exploration of the links between ribosome biogenesis and human disease.

The pleuromutilin drugs tiamulin and valnemulin bind to the RNA at the peptidyl transferase centre on the ribosome

DEFF Research Database (Denmark)

Poulsen, S M; Karlsson, M; Johansson, L B

2001-01-01

The pleuromutilin antibiotic derivatives, tiamulin and valnemulin, inhibit protein synthesis by binding to the 50S ribosomal subunit of bacteria. The action and binding site of tiamulin and valnemulin was further characterized on Escherichia coli ribosomes. It was revealed that these drugs...... centre and have been associated with binding of several antibiotics. Competitive footprinting shows that tiamulin and valnemulin can bind concurrently with the macrolide erythromycin but compete with the macrolide carbomycin, which is a peptidyl transferase inhibitor. We infer from these and previous...... results that tiamulin and valnemulin interact with the rRNA in the peptidyl transferase slot on the ribosomes in which they prevent the correct positioning of the CCA-ends of tRNAs for peptide transfer....

Variable Copy Number, Intra-Genomic Heterogeneities and Lateral Transfers of the 16S rRNA Gene in Pseudomonas

Science.gov (United States)

Bodilis, Josselin; Nsigue-Meilo, Sandrine; Besaury, Ludovic; Quillet, Laurent

2012-01-01

Even though the 16S rRNA gene is the most commonly used taxonomic marker in microbial ecology, its poor resolution is still not fully understood at the intra-genus level. In this work, the number of rRNA gene operons, intra-genomic heterogeneities and lateral transfers were investigated at a fine-scale resolution, throughout the Pseudomonas genus. In addition to nineteen sequenced Pseudomonas strains, we determined the 16S rRNA copy number in four other Pseudomonas strains by Southern hybridization and Pulsed-Field Gel Electrophoresis, and studied the intra-genomic heterogeneities by Denaturing Gradient Gel Electrophoresis and sequencing. Although the variable copy number (from four to seven) seems to be correlated with the evolutionary distance, some close strains in the P. fluorescens lineage showed a different number of 16S rRNA genes, whereas all the strains in the P. aeruginosa lineage displayed the same number of genes (four copies). Further study of the intra-genomic heterogeneities revealed that most of the Pseudomonas strains (15 out of 19 strains) had at least two different 16S rRNA alleles. A great difference (5 or 19 nucleotides, essentially grouped near the V1 hypervariable region) was observed only in two sequenced strains. In one of our strains studied (MFY30 strain), we found a difference of 12 nucleotides (grouped in the V3 hypervariable region) between copies of the 16S rRNA gene. Finally, occurrence of partial lateral transfers of the 16S rRNA gene was further investigated in 1803 full-length sequences of Pseudomonas available in the databases. Remarkably, we found that the two most variable regions (the V1 and V3 hypervariable regions) had probably been laterally transferred from another evolutionary distant Pseudomonas strain for at least 48.3 and 41.6% of the 16S rRNA sequences, respectively. In conclusion, we strongly recommend removing these regions of the 16S rRNA gene during the intra-genus diversity studies. PMID:22545126

Comparison of two approaches for the classification of 16S rRNA gene sequences.

Science.gov (United States)

Chatellier, Sonia; Mugnier, Nathalie; Allard, Françoise; Bonnaud, Bertrand; Collin, Valérie; van Belkum, Alex; Veyrieras, Jean-Baptiste; Emler, Stefan

2014-10-01

The use of 16S rRNA gene sequences for microbial identification in clinical microbiology is accepted widely, and requires databases and algorithms. We compared a new research database containing curated 16S rRNA gene sequences in combination with the lca (lowest common ancestor) algorithm (RDB-LCA) to a commercially available 16S rDNA Centroid approach. We used 1025 bacterial isolates characterized by biochemistry, matrix-assisted laser desorption/ionization time-of-flight MS and 16S rDNA sequencing. Nearly 80 % of isolates were identified unambiguously at the species level by both classification platforms used. The remaining isolates were mostly identified correctly at the genus level due to the limited resolution of 16S rDNA sequencing. Discrepancies between both 16S rDNA platforms were due to differences in database content and the algorithm used, and could amount to up to 10.5 %. Up to 1.4 % of the analyses were found to be inconclusive. It is important to realize that despite the overall good performance of the pipelines for analysis, some inconclusive results remain that require additional in-depth analysis performed using supplementary methods. © 2014 The Authors.

Metagenomic of Actinomycetes Based on 16S rRNA and nifH Genes in Soil and Roots of Four Indonesian Rice Cultivars Using PCR-DGGE

Directory of Open Access Journals (Sweden)

Mahyarudin

2015-07-01

Full Text Available The research was conducted to study the metagenomic of actinomycetes based on 16S ribosomal RNA (rRNA and bacterial nifH genes in soil and roots of four rice cultivars. The denaturing gradient gel electrophoresis profile based on 16S rRNA gene showed that the diversity of actinomycetes in roots was higher than soil samples. The profile also showed that the diversity of actinomycetes was similar in four varieties of rice plant and three types of agroecosystem. The profile was partially sequenced and compared to GenBank database indicating their identity with closely related microbes. The blast results showed that 17 bands were closely related ranging from 93% to 100% of maximum identity with five genera of actinomycetes, which is Geodermatophilus, Actinokineospora, Actinoplanes, Streptomyces and Kocuria. Our study found that Streptomyces species in soil and roots of rice plants were more varied than other genera, with a dominance of Streptomyces alboniger and Streptomyces acidiscabies in almost all the samples. Bacterial community analyses based on nifH gene denaturing gradient gel electrophoresis showed that diversity of bacteria in soils which have nifH gene was higher than that in rice plant roots. The profile also showed that the diversity of those bacteria was similar in four varieties of rice plant and three types of agroecosystem. Five bands were closely related with nifH gene from uncultured bacterium clone J50, uncultured bacterium clone clod-38, and uncultured bacterium clone BG2.37 with maximum identity 99%, 98%, and 92%, respectively. The diversity analysis based on 16S rRNA gene differed from nifH gene and may not correlate with each other. The findings indicated the diversity of actinomycetes and several bacterial genomes analyzed here have an ability to fix nitrogen in soil and roots of rice plant.

The functional half-life of an mRNA depends on the ribosome spacing in an early coding region

DEFF Research Database (Denmark)

Pedersen, Margit; Nissen, Søren; Mitarai, Namiko

2011-01-01

Bacterial mRNAs are translated by closely spaced ribosomes and degraded from the 5'-end, with half-lives of around 2 min at 37 °C in most cases. Ribosome-free or "naked" mRNA is known to be readily degraded, but the initial event that inactivates the mRNA functionally has not been fully described...

Yeast polypeptide exit tunnel ribosomal proteins L17, L35 and L37 are necessary to recruit late-assembling factors required for 27SB pre-rRNA processing.

Science.gov (United States)

Gamalinda, Michael; Jakovljevic, Jelena; Babiano, Reyes; Talkish, Jason; de la Cruz, Jesús; Woolford, John L

2013-02-01

Ribosome synthesis involves the coordinated folding and processing of pre-rRNAs with assembly of ribosomal proteins. In eukaryotes, these events are facilitated by trans-acting factors that propel ribosome maturation from the nucleolus to the cytoplasm. However, there is a gap in understanding how ribosomal proteins configure pre-ribosomes in vivo to enable processing to occur. Here, we have examined the role of adjacent yeast r-proteins L17, L35 and L37 in folding and processing of pre-rRNAs, and binding of other proteins within assembling ribosomes. These three essential ribosomal proteins, which surround the polypeptide exit tunnel, are required for 60S subunit formation as a consequence of their role in removal of the ITS2 spacer from 27SB pre-rRNA. L17-, L35- and L37-depleted cells exhibit turnover of aberrant pre-60S assembly intermediates. Although the structure of ITS2 does not appear to be grossly affected in their absence, these three ribosomal proteins are necessary for efficient recruitment of factors required for 27SB pre-rRNA processing, namely, Nsa2 and Nog2, which associate with pre-60S ribosomal particles containing 27SB pre-rRNAs. Altogether, these data support that L17, L35 and L37 are specifically required for a recruiting step immediately preceding removal of ITS2.

Cross-linking of L5 protein to 5 S RNA in rat liver 60-S subunits by ultraviolet irradiation

International Nuclear Information System (INIS)

Terao, K.; Uchiumi, T.; Ogata, K.

1980-01-01

After rat liver 60-S ribosomal subunits were irradiated with ultraviolet light at 254 nm, they were treated with EDTA and then subjected to sucrose density-gradient centrifugation to isolate 5 S RNA-protein complex. When 5 S RNA-protein was analyzed by SDS-acrylamide gel electrophoresis which dissociated noncovalent 5 S RNA-protein, two protein bands were observed. The one showed a slower mobility than the protein band (L5) of 5 S RNA-protein from non-irradiated 60 S subunit and the other showed the same mobility as L5 protein. Since the former band was shown to be specific to ultraviolet-irradiation, it was considered as cross-linked 5 S RNA-protein. After the two protein bands were iodinated with 125 I, labeled protein was extracted and treated with RNAase. Thereafter, it was analyzed by two-dimensional acrylamide gel electrophoresis, followed by autoradiography. The results indicate that the protein component of cross-linked 5 S RNA-protein is L5 protein (ribosomal protein); these proteins are designated according to the proposed uniform nomenclature. (Auth.)

The Human Microbiome and Understanding the 16S rRNA Gene in Translational Nursing Science.

Science.gov (United States)

Ames, Nancy J; Ranucci, Alexandra; Moriyama, Brad; Wallen, Gwenyth R

As more is understood regarding the human microbiome, it is increasingly important for nurse scientists and healthcare practitioners to analyze these microbial communities and their role in health and disease. 16S rRNA sequencing is a key methodology in identifying these bacterial populations that has recently transitioned from use primarily in research to having increased utility in clinical settings. The objectives of this review are to (a) describe 16S rRNA sequencing and its role in answering research questions important to nursing science; (b) provide an overview of the oral, lung, and gut microbiomes and relevant research; and (c) identify future implications for microbiome research and 16S sequencing in translational nursing science. Sequencing using the 16S rRNA gene has revolutionized research and allowed scientists to easily and reliably characterize complex bacterial communities. This type of research has recently entered the clinical setting, one of the best examples involving the use of 16S sequencing to identify resistant pathogens, thereby improving the accuracy of bacterial identification in infection control. Clinical microbiota research and related requisite methods are of particular relevance to nurse scientists-individuals uniquely positioned to utilize these techniques in future studies in clinical settings.

Phylogenetic relatedness determined between antibiotic resistance and 16S rRNA genes in actinobacteria.

Science.gov (United States)

Sagova-Mareckova, Marketa; Ulanova, Dana; Sanderova, Petra; Omelka, Marek; Kamenik, Zdenek; Olsovska, Jana; Kopecky, Jan

2015-04-01

Distribution and evolutionary history of resistance genes in environmental actinobacteria provide information on intensity of antibiosis and evolution of specific secondary metabolic pathways at a given site. To this day, actinobacteria producing biologically active compounds were isolated mostly from soil but only a limited range of soil environments were commonly sampled. Consequently, soil remains an unexplored environment in search for novel producers and related evolutionary questions. Ninety actinobacteria strains isolated at contrasting soil sites were characterized phylogenetically by 16S rRNA gene, for presence of erm and ABC transporter resistance genes and antibiotic production. An analogous analysis was performed in silico with 246 and 31 strains from Integrated Microbial Genomes (JGI_IMG) database selected by the presence of ABC transporter genes and erm genes, respectively. In the isolates, distances of erm gene sequences were significantly correlated to phylogenetic distances based on 16S rRNA genes, while ABC transporter gene distances were not. The phylogenetic distance of isolates was significantly correlated to soil pH and organic matter content of isolation sites. In the analysis of JGI_IMG datasets the correlation between phylogeny of resistance genes and the strain phylogeny based on 16S rRNA genes or five housekeeping genes was observed for both the erm genes and ABC transporter genes in both actinobacteria and streptomycetes. However, in the analysis of sequences from genomes where both resistance genes occurred together the correlation was observed for both ABC transporter and erm genes in actinobacteria but in streptomycetes only in the erm gene. The type of erm resistance gene sequences was influenced by linkage to 16S rRNA gene sequences and site characteristics. The phylogeny of ABC transporter gene was correlated to 16S rRNA genes mainly above the genus level. The results support the concept of new specific secondary metabolite

Globular conformation of some ribosomal proteins in solution

International Nuclear Information System (INIS)

Serdyuk, I.N.; Spirin, A.S.

1978-01-01

The possibility that such RNA-binding proteins of the 30 S subparticle as S4, S7, S8 and S16 exist in the form of compact globules in solution has been explored experimentally. These proteins have been studied in D 2 O solution by neutron scattering to measure their radii of gyration. This type of radiation using D 2 O as a solvent provides the maximum 'contrast', that is the maximum difference between the scattering of the protein and the solvent. It allowed measurements to be made using protein at <= 1.5 mg/ml. The radii of gyration for the ribosomal proteins S4, S7, S8 and S16 were found to be relatively small corresponding to the radii of gyration of compact globular proteins of the same molecular weights. (Auth.)

Biosynthesis of a hypermodified nucleotide in Saccharomyces carlsbergensis 17S and HeLa-cell 18S ribosomal ribonucleic acid.

Science.gov (United States)

Brand, R C; Klootwijk, J; Planta, R J; Maden, B E

1978-01-01

The biosynthesis of a hypermodified nucleotide, similar to or identical with 3-(3-amino-3-carboxypropyl)-1-methylpseudouridine monophosphate, present in Saccharomyces carlsbergensis 17S and HeLa-cell 18S rRNA, was investigated with respect to the sequence of reactions required for synthesis and their timing in ribosome maturation. In both yeast and HeLa cells methylation precedes attachment of the 3-amino-3-carboxypropyl group. In yeast the methylated precursor nucleotide was tentatively characterized as 1-methylpseudouridine. This precursor nucleotide was demonstrated in both 37S and most of the cytoplasmic 18S pre-rRNA (rRNA precursor) molecules. The synthesis of the hypermodified nucleotide is completed just before the final cleavage of 18S pre-rRNA to give 17S rRNA, so that the final addition of the 3-amino-3-carboxypropyl group is a cytoplasmic event. Comparable experiments with HeLa cells indicated that formation of 1-methylpseudouridine occurs at the level of 45S RNA and addition of the 3-amino-3-carboxypropyl group occurs in the cytoplasm on newly synthesized 18S RNA.

Polynucleotide probes that target a hypervariable region of 16S rRNA genes to identify bacterial isolates corresponding to bands of community fingerprints.

Science.gov (United States)

Heuer, H; Hartung, K; Wieland, G; Kramer, I; Smalla, K

1999-03-01

Temperature gradient gel electrophoresis (TGGE) is well suited for fingerprinting bacterial communities by separating PCR-amplified fragments of 16S rRNA genes (16S ribosomal DNA [rDNA]). A strategy was developed and was generally applicable for linking 16S rDNA from community fingerprints to pure culture isolates from the same habitat. For this, digoxigenin-labeled polynucleotide probes were generated by PCR, using bands excised from TGGE community fingerprints as a template, and applied in hybridizations with dot blotted 16S rDNA amplified from bacterial isolates. Within 16S rDNA, the hypervariable V6 region, corresponding to positions 984 to 1047 (Escherichia coli 16S rDNA sequence), which is a subset of the region used for TGGE (positions 968 to 1401), best met the criteria of high phylogenetic variability, required for sufficient probe specificity, and closely flanking conserved priming sites for amplification. Removal of flanking conserved bases was necessary to enable the differentiation of closely related species. This was achieved by 5' exonuclease digestion, terminated by phosphorothioate bonds which were synthesized into the primers. The remaining complementary strand was removed by single-strand-specific digestion. Standard hybridization with truncated probes allowed differentiation of bacteria which differed by only two bases within the probe target site and 1.2% within the complete 16S rDNA. However, a truncated probe, derived from an excised TGGE band of a rhizosphere community, hybridized with three phylogenetically related isolates with identical V6 sequences. Only one of the isolates comigrated with the excised band in TGGE, which was shown to be due to identical sequences, demonstrating the utility of a combined TGGE and V6 probe approach.

Heavy ion effects on yeast: Inhibition of ribosomal RNA synthesis

International Nuclear Information System (INIS)

Weber, K.J.; Schneider, E.; Kiefer, J.; Kraft, G.

1990-01-01

Diploid wild-type yeast cells were exposed to beams of heavy ions covering a wide range of linear energy transfer (LET) (43-13,700 keV/microns). Synthesis of ribosomal RNA (rRNA) was assessed as a functional measure of damage produced by particle radiation. An exponential decrease of relative rRNA synthesis with particle fluence was demonstrated in all cases. The inactivation cross sections derived were found to increase with LET over the entire range of LET studied. The corresponding values for relative biological effectiveness were slightly less than unity. Maximum cross sections measured were close to 1 micron 2, implying that some larger structure within the yeast nucleus (e.g., the nucleolus) might represent the target for an impairment of synthetic activity by very heavy ions rather than the genes coding for rRNA. Where tested, an oxygen effect for rRNA synthesis could not be demonstrated

Import of desired nucleic acid sequences using addressing motif of mitochondrial ribosomal 5S-rRNA for fluorescent in vivo hybridization of mitochondrial DNA and RNA.

Science.gov (United States)

Zelenka, Jaroslav; Alán, Lukáš; Jabůrek, Martin; Ježek, Petr

2014-04-01

Based on the matrix-addressing sequence of mitochondrial ribosomal 5S-rRNA (termed MAM), which is naturally imported into mitochondria, we have constructed an import system for in vivo targeting of mitochondrial DNA (mtDNA) or mt-mRNA, in order to provide fluorescence hybridization of the desired sequences. Thus DNA oligonucleotides were constructed, containing the 5'-flanked T7 RNA polymerase promoter. After in vitro transcription and fluorescent labeling with Alexa Fluor(®) 488 or 647 dye, we obtained the fluorescent "L-ND5 probe" containing MAM and exemplar cargo, i.e., annealing sequence to a short portion of ND5 mRNA and to the light-strand mtDNA complementary to the heavy strand nd5 mt gene (5'-end 21 base pair sequence). For mitochondrial in vivo fluorescent hybridization, HepG2 cells were treated with dequalinium micelles, containing the fluorescent probes, bringing the probes proximally to the mitochondrial outer membrane and to the natural import system. A verification of import into the mitochondrial matrix of cultured HepG2 cells was provided by confocal microscopy colocalizations. Transfections using lipofectamine or probes without 5S-rRNA addressing MAM sequence or with MAM only were ineffective. Alternatively, the same DNA oligonucleotides with 5'-CACC overhang (substituting T7 promoter) were transcribed from the tetracycline-inducible pENTRH1/TO vector in human embryonic kidney T-REx®-293 cells, while mitochondrial matrix localization after import of the resulting unlabeled RNA was detected by PCR. The MAM-containing probe was then enriched by three-order of magnitude over the natural ND5 mRNA in the mitochondrial matrix. In conclusion, we present a proof-of-principle for mitochondrial in vivo hybridization and mitochondrial nucleic acid import.

MMB-GUI: a fast morphing method demonstrates a possible ribosomal tRNA translocation trajectory.

Science.gov (United States)

Tek, Alex; Korostelev, Andrei A; Flores, Samuel Coulbourn

2016-01-08

Easy-to-use macromolecular viewers, such as UCSF Chimera, are a standard tool in structural biology. They allow rendering and performing geometric operations on large complexes, such as viruses and ribosomes. Dynamical simulation codes enable modeling of conformational changes, but may require considerable time and many CPUs. There is an unmet demand from structural and molecular biologists for software in the middle ground, which would allow visualization combined with quick and interactive modeling of conformational changes, even of large complexes. This motivates MMB-GUI. MMB uses an internal-coordinate, multiscale approach, yielding as much as a 2000-fold speedup over conventional simulation methods. We use Chimera as an interactive graphical interface to control MMB. We show how this can be used for morphing of macromolecules that can be heterogeneous in biopolymer type, sequence, and chain count, accurately recapitulating structural intermediates. We use MMB-GUI to create a possible trajectory of EF-G mediated gate-passing translocation in the ribosome, with all-atom structures. This shows that the GUI makes modeling of large macromolecules accessible to a wide audience. The morph highlights similarities in tRNA conformational changes as tRNA translocates from A to P and from P to E sites and suggests that tRNA flexibility is critical for translocation completion. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

Mapping posttranscriptional modifications in 5S ribosomal RNA by MALDI mass spectrometry

DEFF Research Database (Denmark)

Kirpekar, F; Douthwaite, S; Roepstorff, P

2000-01-01

RNases in parallel combined with further fragmentation by Post Source Decay (PSD). This approach allows fast and sensitive screening of a purified RNA for posttranscriptional modification, and has been applied on 5S rRNA from two thermophilic microorganisms, the bacterium Bacillus stearothermophilus...... that is clearly conserved with respect to both sequence and position in B. stearothermophilus and H. halobium and to some degree also in H. marismortui. However, no analogous modification was identified in the latter three organisms. We further find that the 5' end of H. halobium 5S rRNA is dephosphorylated......, in contrast to the other 5S rRNA species investigated. The method additionally gives an immediate indication of whether the expected RNA sequence is in agreement with the observed fragment masses. Discrepancies with two of the published 5S rRNA sequences were identified and are reported here....

The Response of a 16S Ribosomal RNA Gene Fragment Amplified Community to Lead, Zinc, and Copper Pollution in a Shanghai Field Trial

Directory of Open Access Journals (Sweden)

Shumeng Kou

2018-03-01

Full Text Available Industrial and agricultural activities have caused extensive metal contamination of land throughout China and across the globe. The pervasive nature of metal pollution can be harmful to human health and can potentially cause substantial negative impact to the biosphere. To investigate the impact of anthropogenic metal pollution found in high concentrations in industrial, agricultural, and urban environments, 16S ribosomal RNA gene amplicon sequencing was used to track change in the amplified microbial community after metal contamination in a large-scale field experiment in Shanghai. A total of 1,566 operational taxonomic units (OTUs identified from 448,108 sequences gathered from 20 plots treated as controls or with lead, zinc, copper, or all three metals. Constrained Analysis of Principal Coordinates ordination did not separate control and lead treatment but could separate control/lead, zinc, copper, and three metal treatment. DESeq2 was applied to identify 93 significantly differentially abundant OTUs varying in 211 pairwise instances between the treatments. Differentially abundant OTUs representing genera or species belonging to the phyla Chloroflexi, Cyanobacteria, Firmicutes, Latescibacteria, and Planctomycetes were almost universally reduced in abundance due to zinc, copper, or three metal treatment; with three metal treatment abolishing the detection of some OTUs, such as Leptolyngbya, Desmonostoc muscorum, and Microcoleus steenstrupii. The greatest increases due to metal treatment were observed in Bacteroidetes, Actinobacteria, Chlamydiae, Nitrospirae, and Proteobacteria (α, β, δ, and γ; the most (relative abundant being uncharacterized species within the genera Methylobacillus, Solirubrobacter, and Ohtaekwangia. Three metal treatment alone resulted in identification of 22 OTUs (genera or species which were not detected in control soil, notably including Yonghaparkia alkaliphila, Pedobacter steynii, Pseudolabrys taiwanensis

The Response of a 16S Ribosomal RNA Gene Fragment Amplified Community to Lead, Zinc, and Copper Pollution in a Shanghai Field Trial.

Science.gov (United States)

Kou, Shumeng; Vincent, Gilles; Gonzalez, Emmanuel; Pitre, Frederic E; Labrecque, Michel; Brereton, Nicholas J B

2018-01-01

Industrial and agricultural activities have caused extensive metal contamination of land throughout China and across the globe. The pervasive nature of metal pollution can be harmful to human health and can potentially cause substantial negative impact to the biosphere. To investigate the impact of anthropogenic metal pollution found in high concentrations in industrial, agricultural, and urban environments, 16S ribosomal RNA gene amplicon sequencing was used to track change in the amplified microbial community after metal contamination in a large-scale field experiment in Shanghai. A total of 1,566 operational taxonomic units (OTUs) identified from 448,108 sequences gathered from 20 plots treated as controls or with lead, zinc, copper, or all three metals. Constrained Analysis of Principal Coordinates ordination did not separate control and lead treatment but could separate control/lead, zinc, copper, and three metal treatment. DESeq2 was applied to identify 93 significantly differentially abundant OTUs varying in 211 pairwise instances between the treatments. Differentially abundant OTUs representing genera or species belonging to the phyla Chloroflexi, Cyanobacteria, Firmicutes, Latescibacteria, and Planctomycetes were almost universally reduced in abundance due to zinc, copper, or three metal treatment; with three metal treatment abolishing the detection of some OTUs, such as Leptolyngbya , Desmonostoc muscorum , and Microcoleus steenstrupii . The greatest increases due to metal treatment were observed in Bacteroidetes, Actinobacteria, Chlamydiae, Nitrospirae, and Proteobacteria (α, β, δ, and γ); the most (relative) abundant being uncharacterized species within the genera Methylobacillus , Solirubrobacter , and Ohtaekwangia . Three metal treatment alone resulted in identification of 22 OTUs (genera or species) which were not detected in control soil, notably including Yonghaparkia alkaliphila , Pedobacter steynii , Pseudolabrys taiwanensis , Methylophilus

Intrinsic challenges in ancient microbiome reconstruction using 16S rRNA gene amplification.

Science.gov (United States)

Ziesemer, Kirsten A; Mann, Allison E; Sankaranarayanan, Krithivasan; Schroeder, Hannes; Ozga, Andrew T; Brandt, Bernd W; Zaura, Egija; Waters-Rist, Andrea; Hoogland, Menno; Salazar-García, Domingo C; Aldenderfer, Mark; Speller, Camilla; Hendy, Jessica; Weston, Darlene A; MacDonald, Sandy J; Thomas, Gavin H; Collins, Matthew J; Lewis, Cecil M; Hofman, Corinne; Warinner, Christina

2015-11-13

To date, characterization of ancient oral (dental calculus) and gut (coprolite) microbiota has been primarily accomplished through a metataxonomic approach involving targeted amplification of one or more variable regions in the 16S rRNA gene. Specifically, the V3 region (E. coli 341-534) of this gene has been suggested as an excellent candidate for ancient DNA amplification and microbial community reconstruction. However, in practice this metataxonomic approach often produces highly skewed taxonomic frequency data. In this study, we use non-targeted (shotgun metagenomics) sequencing methods to better understand skewed microbial profiles observed in four ancient dental calculus specimens previously analyzed by amplicon sequencing. Through comparisons of microbial taxonomic counts from paired amplicon (V3 U341F/534R) and shotgun sequencing datasets, we demonstrate that extensive length polymorphisms in the V3 region are a consistent and major cause of differential amplification leading to taxonomic bias in ancient microbiome reconstructions based on amplicon sequencing. We conclude that systematic amplification bias confounds attempts to accurately reconstruct microbiome taxonomic profiles from 16S rRNA V3 amplicon data generated using universal primers. Because in silico analysis indicates that alternative 16S rRNA hypervariable regions will present similar challenges, we advocate for the use of a shotgun metagenomics approach in ancient microbiome reconstructions.

Potential pitfalls of modelling ribosomal RNA data in phylogenetic tree reconstruction: evidence from case studies in the Metazoa.

Science.gov (United States)

Letsch, Harald O; Kjer, Karl M

2011-05-27

Failure to account for covariation patterns in helical regions of ribosomal RNA (rRNA) genes has the potential to misdirect the estimation of the phylogenetic signal of the data. Furthermore, the extremes of length variation among taxa, combined with regional substitution rate variation can mislead the alignment of rRNA sequences and thus distort subsequent tree reconstructions. However, recent developments in phylogenetic methodology now allow a comprehensive integration of secondary structures in alignment and tree reconstruction analyses based on rRNA sequences, which has been shown to correct some of these problems. Here, we explore the potentials of RNA substitution models and the interactions of specific model setups with the inherent pattern of covariation in rRNA stems and substitution rate variation among loop regions. We found an explicit impact of RNA substitution models on tree reconstruction analyses. The application of specific RNA models in tree reconstructions is hampered by interaction between the appropriate modelling of covarying sites in stem regions, and excessive homoplasy in some loop regions. RNA models often failed to recover reasonable trees when single-stranded regions are excessively homoplastic, because these regions contribute a greater proportion of the data when covarying sites are essentially downweighted. In this context, the RNA6A model outperformed all other models, including the more parametrized RNA7 and RNA16 models. Our results depict a trade-off between increased accuracy in estimation of interdependencies in helical regions with the risk of magnifying positions lacking phylogenetic signal. We can therefore conclude that caution is warranted when applying rRNA covariation models, and suggest that loop regions be independently screened for phylogenetic signal, and eliminated when they are indistinguishable from random noise. In addition to covariation and homoplasy, other factors, like non-stationarity of substitution rates

A comparative study of ribosomal proteins: linkage between amino acid distribution and ribosomal assembly

International Nuclear Information System (INIS)

Lott, Brittany Burton; Wang, Yongmei; Nakazato, Takuya

2013-01-01

Assembly of the ribosome from its protein and RNA constituents must occur quickly and efficiently in order to synthesize the proteins necessary for all cellular activity. Since the early 1960’s, certain characteristics of possible assembly pathways have been elucidated, yet the mechanisms that govern the precise recognition events remain unclear. We utilize a comparative analysis to investigate the amino acid composition of ribosomal proteins (r-proteins) with respect to their role in the assembly process. We compared small subunit (30S) r-protein sequences to those of other housekeeping proteins from 560 bacterial species and searched for correlations between r-protein amino acid content and factors such as assembly binding order, environmental growth temperature, protein size, and contact with ribosomal RNA (rRNA) in the 30S complex. We find r-proteins have a significantly high percent of positive residues, which are highly represented at rRNA contact sites. An inverse correlation between the percent of positive residues and r-protein size was identified and is mainly due to the content of Lysine residues, rather than Arginine. Nearly all r-proteins carry a net positive charge, but no statistical correlation between the net charge and the binding order was detected. Thermophilic (high-temperature) r-proteins contain increased Arginine, Isoleucine, and Tyrosine, and decreased Serine and Threonine compared to mesophilic (lower-temperature), reflecting a known distinction between thermophiles and mesophiles, possibly to account for protein thermostability. However, this difference in amino acid content does not extend to rRNA contact sites, as the proportions of thermophilic and mesophilic contact residues are not significantly different. Given the significantly higher level of positively charged residues in r-proteins and at contact sites, we conclude that ribosome assembly relies heavily on an electrostatic component of interaction. However, the binding order of

16S rRNA gene sequence and phylogenetic tree of lactobacillus ...

African Journals Online (AJOL)

... processed by denaturing gradient gel electrophoresis (DGGE). Phylogenetic tree was constructed with the sequences of the V2-V3 region of 16S rRNA gene. Results show two distinct divisions among the Lactobacillus species. The study presents a new understanding of the nature of the Lactobacillus vaginal microbiota ...

Ribosomal protein methyltransferases in the yeast Saccharomyces cerevisiae: Roles in ribosome biogenesis and translation.

Science.gov (United States)

Al-Hadid, Qais; White, Jonelle; Clarke, Steven

2016-02-12

A significant percentage of the methyltransferasome in Saccharomyces cerevisiae and higher eukaryotes is devoted to methylation of the translational machinery. Methylation of the RNA components of the translational machinery has been studied extensively and is important for structure stability, ribosome biogenesis, and translational fidelity. However, the functional effects of ribosomal protein methylation by their cognate methyltransferases are still largely unknown. Previous work has shown that the ribosomal protein Rpl3 methyltransferase, histidine protein methyltransferase 1 (Hpm1), is important for ribosome biogenesis and translation elongation fidelity. In this study, yeast strains deficient in each of the ten ribosomal protein methyltransferases in S. cerevisiae were examined for potential defects in ribosome biogenesis and translation. Like Hpm1-deficient cells, loss of four of the nine other ribosomal protein methyltransferases resulted in defects in ribosomal subunit synthesis. All of the mutant strains exhibited resistance to the ribosome inhibitors anisomycin and/or cycloheximide in plate assays, but not in liquid culture. Translational fidelity assays measuring stop codon readthrough, amino acid misincorporation, and programmed -1 ribosomal frameshifting, revealed that eight of the ten enzymes are important for translation elongation fidelity and the remaining two are necessary for translation termination efficiency. Altogether, these results demonstrate that ribosomal protein methyltransferases in S. cerevisiae play important roles in ribosome biogenesis and translation. Copyright © 2016 Elsevier Inc. All rights reserved.

The Conserved RNA Exonuclease Rexo5 Is Required for 3′ End Maturation of 28S rRNA, 5S rRNA, and snoRNAs

Directory of Open Access Journals (Sweden)

Stefanie Gerstberger

2017-10-01

Full Text Available Non-coding RNA biogenesis in higher eukaryotes has not been fully characterized. Here, we studied the Drosophila melanogaster Rexo5 (CG8368 protein, a metazoan-specific member of the DEDDh 3′-5′ single-stranded RNA exonucleases, by genetic, biochemical, and RNA-sequencing approaches. Rexo5 is required for small nucleolar RNA (snoRNA and rRNA biogenesis and is essential in D. melanogaster. Loss-of-function mutants accumulate improperly 3′ end-trimmed 28S rRNA, 5S rRNA, and snoRNA precursors in vivo. Rexo5 is ubiquitously expressed at low levels in somatic metazoan cells but extremely elevated in male and female germ cells. Loss of Rexo5 leads to increased nucleolar size, genomic instability, defective ribosome subunit export, and larval death. Loss of germline expression compromises gonadal growth and meiotic entry during germline development.

Recognition determinants for proteins and antibiotics within 23S rRNA

DEFF Research Database (Denmark)

Douthwaite, Stephen Roger; Voldborg, Bjørn Gunnar Rude; Hansen, Lykke Haastrup

1995-01-01

Ribosomal RNAs fold into phylogenetically conserved secondary and tertiary structures that determine their function in protein synthesis. We have investigated Escherichia coli 23S rRNA to identify structural elements that interact with antibiotic and protein ligands. Using a combination of molecu......Ribosomal RNAs fold into phylogenetically conserved secondary and tertiary structures that determine their function in protein synthesis. We have investigated Escherichia coli 23S rRNA to identify structural elements that interact with antibiotic and protein ligands. Using a combination......-proteins L10.(L12)4 and L11 and is inhibited by interaction with the antibiotic thiostrepton. The peptidyltransferase center within domain V is inhibited by macrolide, lincosamide, and streptogramin B antibiotics, which interact with the rRNA around nucleotide A2058. Drug resistance is conferred by mutations...

Pre-45s rRNA promotes colon cancer and is associated with poor survival of CRC patients.

Science.gov (United States)

Tsoi, H; Lam, K C; Dong, Y; Zhang, X; Lee, C K; Zhang, J; Ng, S C; Ng, S S M; Zheng, S; Chen, Y; Fang, J; Yu, J

2017-11-02

One characteristic of cancer cells is the abnormally high rate of cell metabolism to sustain their enhanced proliferation. However, the behind mechanism of this phenomenon is still elusive. Here we find that enhanced precursor 45s ribosomal RNA (pre-45s rRNA) is one of the core mechanisms in promoting the pathogenesis of colorectal cancer (CRC). Pre-45s rRNA expression is significantly higher in primary CRC tumor tissues samples and cancer cell lines compared with the non-tumorous colon tissues, and is associated with tumor sizes. Knockdown of pre-45s rRNA inhibits G1/S cell-cycle transition by stabilizing p53 through inducing murine double minute 2 (MDM2) and ribosomal protein L11 (RpL11) interaction. In addition, we revealed that high rate of cancer cell metabolism triggers the passive release of calcium ion from endoplasmic reticulum to the cytoplasm. The elevated calcium ion in the cytoplasm activates the signaling cascade of calcium/calmodulin-dependent protein kinase II, ribosomal S6 kinase (S6K) and ribosomal S6K (CaMKII-S6K-UBF). The activated UBF promotes the transcription of rDNA, which therefore increases pre-45s rRNA. Disruption of CaMKII-S6K-UBF axis by either RNAi or pharmaceutical approaches leads to reduction of pre-45s rRNA expression, which subsequently suppresses cell proliferation in colon cancer cells by causing cell-cycle arrest. Knockdown of APC activates CaMKII-S6K-UBF cascade and thus enhances pre-45s rRNA expression. Moreover, the high expression level of pre-45s rRNA is associated with poor survival of CRC patients in two independent cohorts. Our study identifies a novel mechanism in CRC pathogenesis mediated by pre-45s rRNA and a prognostic factor of pre-45s rRNA in CRC patients.

Mycobacterial RNA isolation optimized for non-coding RNA: high fidelity isolation of 5S rRNA from Mycobacterium bovis BCG reveals novel post-transcriptional processing and a complete spectrum of modified ribonucleosides.

Science.gov (United States)

Hia, Fabian; Chionh, Yok Hian; Pang, Yan Ling Joy; DeMott, Michael S; McBee, Megan E; Dedon, Peter C

2015-03-11

A major challenge in the study of mycobacterial RNA biology is the lack of a comprehensive RNA isolation method that overcomes the unusual cell wall to faithfully yield the full spectrum of non-coding RNA (ncRNA) species. Here, we describe a simple and robust procedure optimized for the isolation of total ncRNA, including 5S, 16S and 23S ribosomal RNA (rRNA) and tRNA, from mycobacteria, using Mycobacterium bovis BCG to illustrate the method. Based on a combination of mechanical disruption and liquid and solid-phase technologies, the method produces all major species of ncRNA in high yield and with high integrity, enabling direct chemical and sequence analysis of the ncRNA species. The reproducibility of the method with BCG was evident in bioanalyzer electrophoretic analysis of isolated RNA, which revealed quantitatively significant differences in the ncRNA profiles of exponentially growing and non-replicating hypoxic bacilli. The method also overcame an historical inconsistency in 5S rRNA isolation, with direct sequencing revealing a novel post-transcriptional processing of 5S rRNA to its functional form and with chemical analysis revealing seven post-transcriptional ribonucleoside modifications in the 5S rRNA. This optimized RNA isolation procedure thus provides a means to more rigorously explore the biology of ncRNA species in mycobacteria. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

A Sensitive and Specific PCR Based Method for Identification of Cryptosporidium Sp. Using New Primers from 18S Ribosomal RNA

Directory of Open Access Journals (Sweden)

M Heydarnezhadi

2011-09-01

Full Text Available Background: The main goal of the present study was to develop a new sensitive and specific PCR based method for Identification of Cryptosporidium sp. using novel primers from 18S ribosomal RNA. Cryptosporidi­osis in high-risk host groups particularly in neonates and immuno-compromised individuals may result in death. To the best of our knowledge this is the first study regarding develop a new PCR based method to diagnose the cryptosporidiosis in Iran.Methods: A total of 850 human fecal samples from patients clinically suspected to cryptosporidiosis and 100 healthy and diarrheic cattle stool specimens were collected. The simplified formol-ether concentration method was carried out for all samples. They were then examined microscopically by modified Ziehl-Neel­sen staining method. Total DNA was extracted by QIA amp DNA stool mini kit was carried out by using designed prim­ers.Results: Twenty nine cases of cryptosporidiosis infection in human and 30 samples from cattle microscopi­cally were posi­tive. The described primary and nested PCR method could detect all Cryptospori­dium positive samples from human and cattle. Regards to suspected negative samples in pri­mary PCR examination, the Nested PCR could ap­prove two more positive results. Furthermore, Nested PCR analysis was able to detect one more case which was nega­tive in both microscopically examination and primary PCR. Specificity of the test was 100%. Sensitivity of Nested PCR in comparison to our gold standard; microscopy after Ridley concentration modified ziehl-Neelsen, was 100 %.Conclusion: Our developed PCR based method by using new primers devised from 18S ribosomal RNA revealed the ability for identification of the Cryptosporidium species such as C. parvum and C. huminis with high specificity and sensitivity.

DEAD-box helicase DDX27 regulates 3′ end formation of ribosomal 47S RNA and stably associates with the PeBoW-complex

Energy Technology Data Exchange (ETDEWEB)

Kellner, Markus; Rohrmoser, Michaela [Department of Molecular Epigenetics, Helmholtz Center Munich, Center for Integrated Protein Science Munich (CIPSM), Marchioninistr. 25, Munich 81377 (Germany); Forné, Ignasi [Adolf Butenandt Institute, Ludwig Maximilians University of Munich, Center for Integrated Protein Science Munich (CIPSM), Schillerstr. 44, Munich 80336 (Germany); Voss, Kirsten; Burger, Kaspar; Mühl, Bastian; Gruber-Eber, Anita [Department of Molecular Epigenetics, Helmholtz Center Munich, Center for Integrated Protein Science Munich (CIPSM), Marchioninistr. 25, Munich 81377 (Germany); Kremmer, Elisabeth [Institute of Molecular Immunology, Helmholtz Center Munich, Marchioninistr. 25, Munich 81377 (Germany); Imhof, Axel [Adolf Butenandt Institute, Ludwig Maximilians University of Munich, Center for Integrated Protein Science Munich (CIPSM), Schillerstr. 44, Munich 80336 (Germany); Eick, Dirk, E-mail: eick@helmholtz-muenchen.de [Department of Molecular Epigenetics, Helmholtz Center Munich, Center for Integrated Protein Science Munich (CIPSM), Marchioninistr. 25, Munich 81377 (Germany)

2015-05-15

PeBoW, a trimeric complex consisting of pescadillo (Pes1), block of proliferation (Bop1), and the WD repeat protein 12 (WDR12), is essential for processing and maturation of mammalian 5.8S and 28S ribosomal RNAs. Applying a mass spectrometric analysis, we identified the DEAD-box helicase DDX27 as stably associated factor of the PeBoW-complex. DDX27 interacts with the PeBoW-complex via an evolutionary conserved F×F motif in the N-terminal domain and is recruited to the nucleolus via its basic C-terminal domain. This recruitment is RNA-dependent and occurs independently of the PeBoW-complex. Interestingly, knockdown of DDX27, but not of Pes1, induces the accumulation of an extended form of the primary 47S rRNA. We conclude that DDX27 can interact specifically with the Pes1 and Bop1 but fulfils critical function(s) for proper 3′ end formation of 47S rRNA independently of the PeBoW-complex. - Highlights: • DEAD-box helicase DDX27 is a new constituent of the PeBoW-complex. • The N-terminal F×F motif of DDX27 interacts with the PeBoW components Pes1 and Bop1. • Nucleolar anchoring of DDX27 via its basic C-terminal domain is RNA dependent. • Knockdown of DDX27 induces a specific defect in 3′ end formation of 47S rRNA.

Intra-Genomic Heterogeneity in 16S rRNA Genes in Strictly Anaerobic Clinical Isolates from Periodontal Abscesses.

Science.gov (United States)

Chen, Jiazhen; Miao, Xinyu; Xu, Meng; He, Junlin; Xie, Yi; Wu, Xingwen; Chen, Gang; Yu, Liying; Zhang, Wenhong

2015-01-01

Members of the genera Prevotella, Veillonella and Fusobacterium are the predominant culturable obligate anaerobic bacteria isolated from periodontal abscesses. When determining the cumulative number of clinical anaerobic isolates from periodontal abscesses, ambiguous or overlapping signals were frequently encountered in 16S rRNA gene sequencing chromatograms, resulting in ambiguous identifications. With the exception of the genus Veillonella, the high intra-chromosomal heterogeneity of rrs genes has not been reported. The 16S rRNA genes of 138 clinical, strictly anaerobic isolates and one reference strain were directly sequenced, and the chromatograms were carefully examined. Gene cloning was performed for 22 typical isolates with doublet sequencing signals for the 16S rRNA genes, and four copies of the rrs-ITS genes of 9 Prevotella intermedia isolates were separately amplified by PCR, sequenced and compared. Five conserved housekeeping genes, hsp60, recA, dnaJ, gyrB1 and rpoB from 89 clinical isolates of Prevotella were also amplified by PCR and sequenced for identification and phylogenetic analysis along with 18 Prevotella reference strains. Heterogeneity of 16S rRNA genes was apparent in clinical, strictly anaerobic oral bacteria, particularly in the genera Prevotella and Veillonella. One hundred out of 138 anaerobic strains (72%) had intragenomic nucleotide polymorphisms (SNPs) in multiple locations, and 13 strains (9.4%) had intragenomic insertions or deletions in the 16S rRNA gene. In the genera Prevotella and Veillonella, 75% (67/89) and 100% (19/19) of the strains had SNPs in the 16S rRNA gene, respectively. Gene cloning and separate amplifications of four copies of the rrs-ITS genes confirmed that 2 to 4 heterogeneous 16S rRNA copies existed. Sequence alignment of five housekeeping genes revealed that intra-species nucleotide similarities were very high in the genera Prevotella, ranging from 94.3-100%. However, the inter-species similarities were

mRNA decapping enzyme from ribosomes of Saccharomyces cerevisiae

International Nuclear Information System (INIS)

Stevens, A.

1980-01-01

By use of [ 3 H]methyl-5'-capped [ 14 C]mRNA from yeast as a substrate, a decapping enzyme activity has been detected in enzyme fractions derived from a high salt wash of ribosomes of Saccharomyces cerevisiae. The product of the decapping reaction is [ 3 H]m 7 GDP. That the enzyme is not a non-specific pyrophosphatase is suggested by the finding that the diphosphate product, m 7 GpppA(G), and UDP-glucose are not hydrolyzed

Secondary structure of prokaryotic 5S ribosomal ribonucleic acids: a study with ribonucleases

DEFF Research Database (Denmark)

Douthwaite, S; Garrett, R A

1981-01-01

The structures of 5S ribosomal RNAs from Escherichia coli and Bacillus stearothermophilus were examined by using ribonucleases A, T1, and T2 and a double helix specific cobra venom ribonuclease. By using both 5' and 3'-32P-end labeling methods and selecting for digested but intact 5S RNA molecules...... evidence for three of the helical regions of the Fox and Woese model of 5S RNA [Fox, G. E., & Woese, C. (1975) Nature (London) 256, 505] and support other important structural features which include a nucleotide looped out from a helical region which has been proposed as a recognition site for protein L18....

Defining reference sequences for Nocardia species by similarity and clustering analyses of 16S rRNA gene sequence data.

Directory of Open Access Journals (Sweden)

Manal Helal

Full Text Available BACKGROUND: The intra- and inter-species genetic diversity of bacteria and the absence of 'reference', or the most representative, sequences of individual species present a significant challenge for sequence-based identification. The aims of this study were to determine the utility, and compare the performance of several clustering and classification algorithms to identify the species of 364 sequences of 16S rRNA gene with a defined species in GenBank, and 110 sequences of 16S rRNA gene with no defined species, all within the genus Nocardia. METHODS: A total of 364 16S rRNA gene sequences of Nocardia species were studied. In addition, 110 16S rRNA gene sequences assigned only to the Nocardia genus level at the time of submission to GenBank were used for machine learning classification experiments. Different clustering algorithms were compared with a novel algorithm or the linear mapping (LM of the distance matrix. Principal Components Analysis was used for the dimensionality reduction and visualization. RESULTS: The LM algorithm achieved the highest performance and classified the set of 364 16S rRNA sequences into 80 clusters, the majority of which (83.52% corresponded with the original species. The most representative 16S rRNA sequences for individual Nocardia species have been identified as 'centroids' in respective clusters from which the distances to all other sequences were minimized; 110 16S rRNA gene sequences with identifications recorded only at the genus level were classified using machine learning methods. Simple kNN machine learning demonstrated the highest performance and classified Nocardia species sequences with an accuracy of 92.7% and a mean frequency of 0.578. CONCLUSION: The identification of centroids of 16S rRNA gene sequence clusters using novel distance matrix clustering enables the identification of the most representative sequences for each individual species of Nocardia and allows the quantitation of inter- and intra

Characterisation of the human uterine microbiome in non-pregnant women through deep sequencing of the V1-2 region of the 16S rRNA gene

Directory of Open Access Journals (Sweden)

Hans Verstraelen

2016-01-01

Full Text Available Background. It is widely assumed that the uterine cavity in non-pregnant women is physiologically sterile, also as a premise to the long-held view that human infants develop in a sterile uterine environment, though likely reflecting under-appraisal of the extent of the human bacterial metacommunity. In an exploratory study, we aimed to investigate the putative presence of a uterine microbiome in a selected series of non-pregnant women through deep sequencing of the V1-2 hypervariable region of the 16S ribosomal RNA (rRNA gene.Methods. Nineteen women with various reproductive conditions, including subfertility, scheduled for hysteroscopy and not showing uterine anomalies were recruited. Subjects were highly diverse with regard to demographic and medical history and included nulliparous and parous women. Endometrial tissue and mucus harvesting was performed by use of a transcervical device designed to obtain endometrial biopsy, while avoiding cervicovaginal contamination. Bacteria were targeted by use of a barcoded Illumina MiSeq paired-end sequencing method targeting the 16S rRNA gene V1-2 region, yielding an average of 41,194 reads per sample after quality filtering. Taxonomic annotation was pursued by comparison with sequences available through the Ribosomal Database Project and the NCBI database.Results. Out of 183 unique 16S rRNA gene amplicon sequences, 15 phylotypes were present in all samples. In some 90% of the women included, community architecture was fairly similar inasmuch B. xylanisolvens, B. thetaiotaomicron, B. fragilis and an undetermined Pelomonas taxon constituted over one third of the endometrial bacterial community. On the singular phylotype level, six women showed predominance of L. crispatus or L. iners in the presence of the Bacteroides core. Two endometrial communities were highly dissimilar, largely lacking the Bacteroides core, one dominated by L. crispatus and another consisting of a highly diverse community, including

SINA: accurate high-throughput multiple sequence alignment of ribosomal RNA genes.

Science.gov (United States)

Pruesse, Elmar; Peplies, Jörg; Glöckner, Frank Oliver

2012-07-15

In the analysis of homologous sequences, computation of multiple sequence alignments (MSAs) has become a bottleneck. This is especially troublesome for marker genes like the ribosomal RNA (rRNA) where already millions of sequences are publicly available and individual studies can easily produce hundreds of thousands of new sequences. Methods have been developed to cope with such numbers, but further improvements are needed to meet accuracy requirements. In this study, we present the SILVA Incremental Aligner (SINA) used to align the rRNA gene databases provided by the SILVA ribosomal RNA project. SINA uses a combination of k-mer searching and partial order alignment (POA) to maintain very high alignment accuracy while satisfying high throughput performance demands. SINA was evaluated in comparison with the commonly used high throughput MSA programs PyNAST and mothur. The three BRAliBase III benchmark MSAs could be reproduced with 99.3, 97.6 and 96.1 accuracy. A larger benchmark MSA comprising 38 772 sequences could be reproduced with 98.9 and 99.3% accuracy using reference MSAs comprising 1000 and 5000 sequences. SINA was able to achieve higher accuracy than PyNAST and mothur in all performed benchmarks. Alignment of up to 500 sequences using the latest SILVA SSU/LSU Ref datasets as reference MSA is offered at http://www.arb-silva.de/aligner. This page also links to Linux binaries, user manual and tutorial. SINA is made available under a personal use license.

Transcript levels, alternative splicing and proteolytic cleavage of TFIIIA control 5S rRNA accumulation during Arabidopsis thaliana development.

Science.gov (United States)

Layat, Elodie; Cotterell, Sylviane; Vaillant, Isabelle; Yukawa, Yasushi; Tutois, Sylvie; Tourmente, Sylvette

2012-07-01

Ribosome biogenesis is critical for eukaryotic cells and requires coordinated synthesis of the protein and rRNA moieties of the ribosome, which are therefore highly regulated. 5S ribosomal RNA, an essential component of the large ribosomal subunit, is transcribed by RNA polymerase III and specifically requires transcription factor IIIA (TFIIIA). To obtain insight into the regulation of 5S rRNA transcription, we have investigated the expression of 5S rRNA and the exon-skipped (ES) and exon-including (EI) TFIIIA transcripts, two transcript isoforms that result from alternative splicing of the TFIIIA gene, and TFIIIA protein amounts with respect to requirements for 5S rRNA during development. We show that 5S rRNA quantities are regulated through distinct but complementary mechanisms operating through transcriptional and post-transcriptional control of TFIIIA transcripts as well as at the post-translational level through proteolytic cleavage of the TFIIIA protein. During the reproductive phase, high expression of the TFIIIA gene together with low proteolytic cleavage contributes to accumulation of functional, full-length TFIIIA protein, and results in 5S rRNA accumulation in the seed. In contrast, just after germination, the levels of TFIIIA-encoding transcripts are low and stable. Full-length TFIIIA protein is undetectable, and the level of 5S rRNA stored in the embryo progressively decreases. After day 4, in correlation with the reorganization of 5S rDNA chromatin to a mature state, full-length TFIIIA protein with transcriptional activity accumulates and permits de novo transcription of 5S rRNA. © 2012 The Authors. The Plant Journal © 2012 Blackwell Publishing Ltd.

Mapping posttranscriptional modifications in 5S ribosomal RNA by MALDI mass spectrometry.

Science.gov (United States)

Kirpekar, F; Douthwaite, S; Roepstorff, P

2000-02-01

We present a method to screen RNA for posttranscriptional modifications based on Matrix Assisted Laser Desorption/Ionization mass spectrometry (MALDI-MS). After the RNA is digested to completion with a nucleotide-specific RNase, the fragments are analyzed by mass spectrometry. A comparison of the observed mass data with the data predicted from the gene sequence identifies fragments harboring modified nucleotides. Fragments larger than dinucleotides were valuable for the identification of posttranscriptional modifications. A more refined mapping of RNA modifications can be obtained by using two RNases in parallel combined with further fragmentation by Post Source Decay (PSD). This approach allows fast and sensitive screening of a purified RNA for posttranscriptional modification, and has been applied on 5S rRNA from two thermophilic microorganisms, the bacterium Bacillus stearothermophilus and the archaeon Sulfolobus acidocaldarius, as well as the halophile archaea Halobacterium halobium and Haloarcula marismortui. One S. acidocaldarius posttranscriptional modification was identified and was further characterized by PSD as a methylation of cytidine32. The modified C is located in a region that is clearly conserved with respect to both sequence and position in B. stearothermophilus and H. halobium and to some degree also in H. marismortui. However, no analogous modification was identified in the latter three organisms. We further find that the 5' end of H. halobium 5S rRNA is dephosphorylated, in contrast to the other 5S rRNA species investigated. The method additionally gives an immediate indication of whether the expected RNA sequence is in agreement with the observed fragment masses. Discrepancies with two of the published 5S rRNA sequences were identified and are reported here.

Synthetic peptides and ribosomal proteins as substrate for 60S ribosomal protein kinase from yeast cells

DEFF Research Database (Denmark)

Grankowski, N; Gasior, E; Issinger, O G

1993-01-01

Kinetic studies on the 60S protein kinase were conducted with synthetic peptides and ribosomal proteins as substrate. Peptide RRREEESDDD proved to be the best synthetic substrate for this enzyme. The peptide has a sequence of amino acids which most closely resembles the structure of potential...... phosphorylation sites in natural substrates, i.e., acidic ribosomal proteins. The superiority of certain kinetic parameters for 60S kinase obtained with the native whole 80S ribosomes over those of the isolated fraction of acidic ribosomal proteins indicates that the affinity of 60S kinase to the specific protein...

Ribosomal protein S14 transcripts are edited in Oenothera mitochondria.

Science.gov (United States)

Schuster, W; Unseld, M; Wissinger, B; Brennicke, A

1990-01-01

The gene encoding ribosomal protein S14 (rps14) in Oenothera mitochondria is located upstream of the cytochrome b gene (cob). Sequence analysis of independently derived cDNA clones covering the entire rps14 coding region shows two nucleotides edited from the genomic DNA to the mRNA derived sequences by C to U modifications. A third editing event occurs four nucleotides upstream of the AUG initiation codon and improves a potential ribosome binding site. A CGG codon specifying arginine in a position conserved in evolution between chloroplasts and E. coli as a UGG tryptophan codon is not edited in any of the cDNAs analysed. An inverted repeat 3' of an unidentified open reading frame is located upstream of the rps14 gene. The inverted repeat sequence is highly conserved at analogous regions in other Oenothera mitochondrial loci. Images PMID:2326162

Characterization of a Novel Association between Two Trypanosome-Specific Proteins and 5S rRNA

Science.gov (United States)

Ciganda, Martin; Williams, Noreen

2012-01-01

P34 and P37 are two previously identified RNA binding proteins in the flagellate protozoan Trypanosoma brucei. RNA interference studies have determined that the proteins are essential and are involved in ribosome biogenesis. Here, we show that these proteins interact in vitro with the 5S rRNA with nearly identical binding characteristics in the absence of other cellular factors. The T. brucei 5S rRNA has a complex secondary structure and presents four accessible loops (A to D) for interactions with RNA-binding proteins. In other eukaryotes, loop C is bound by the L5 ribosomal protein and loop A mainly by TFIIIA. The binding of P34 and P37 to T. brucei 5S rRNA involves the LoopA region of the RNA, but these proteins also protect the L5 binding site located on LoopC. PMID:22253864

Cryo-EM structures of the 80S ribosomes from human parasites Trichomonas vaginalis and Toxoplasma gondii

Institute of Scientific and Technical Information of China (English)

Zhifei Li; Qiang Guo; Lvqin Zheng; Yongsheng Ji; Yi-Ting Xie; De-Hua Lai; Zhao-Rong Lun; Xun Suo; Ning Gao

2017-01-01

As an indispensable molecular machine universal in all living organisms,the ribosome has been selected by evolution to be the natural target of many antibiotics and small-molecule inhibitors.High-resolution structures of pathogen ribosomes are crucial for understanding the general and unique aspects of translation control in disease-causing microbes.With cryo-electron microscopy technique,we have determined structures of the cytosolic ribosomes from two human parasites,Trichomonas vaginalis and Toxoplasma gondii,at resolution of 3.2-3.4,(A).Although the ribosomal proteins from both pathogens are typical members of eukaryotic families,with a co-evolution pattern between certain species-specific insertions/extensions and neighboring ribosomal RNA (rRNA) expansion segments,the sizes of their rRNAs are sharply different.Very interestingly,rRNAs of T.vaginalis are in size comparable to prokaryotic counterparts,with nearly all the eukaryote-specific rRNA expansion segments missing.These structures facilitate the dissection of evolution path for ribosomal proteins and RNAs,and may aid in design of novel translation inhibitors.

Identification of a Recently Active Mammalian SINE Derived from Ribosomal RNA

Science.gov (United States)

Longo, Mark S.; Brown, Judy D.; Zhang, Chu; O’Neill, Michael J.; O’Neill, Rachel J.

2015-01-01

Complex eukaryotic genomes are riddled with repeated sequences whose derivation does not coincide with phylogenetic history and thus is often unknown. Among such sequences, the capacity for transcriptional activity coupled with the adaptive use of reverse transcription can lead to a diverse group of genomic elements across taxa, otherwise known as selfish elements or mobile elements. Short interspersed nuclear elements (SINEs) are nonautonomous mobile elements found in eukaryotic genomes, typically derived from cellular RNAs such as tRNAs, 7SL or 5S rRNA. Here, we identify and characterize a previously unknown SINE derived from the 3′-end of the large ribosomal subunit (LSU or 28S rDNA) and transcribed via RNA polymerase III. This new element, SINE28, is represented in low-copy numbers in the human reference genome assembly, wherein we have identified 27 discrete loci. Phylogenetic analysis indicates these elements have been transpositionally active within primate lineages as recently as 6 MYA while modern humans still carry transcriptionally active copies. Moreover, we have identified SINE28s in all currently available assembled mammalian genome sequences. Phylogenetic comparisons indicate that these elements are frequently rederived from the highly conserved LSU rRNA sequences in a lineage-specific manner. We propose that this element has not been previously recognized as a SINE given its high identity to the canonical LSU, and that SINE28 likely represents one of possibly many unidentified, active transposable elements within mammalian genomes. PMID:25637222

DNA sequencing reveals limited heterogeneity in the 16S rRNA gene from the rrnB operon among five Mycoplasma hominis isolates

DEFF Research Database (Denmark)

Mygind, T; Birkelund, Svend; Christiansen, Gunna

1998-01-01

To investigate the intraspecies heterogeneity within the 16S rRNA gene of Mycoplasma hominis, five isolates with diverse antigenic profiles, variable/identical P120 hypervariable domains, and different 16S rRNA gene RFLP patterns were analysed. The 16S rRNA gene from the rrnB operon was amplified...... by PCR and the PCR products were sequenced. Three isolates had identical 16S rRNA sequences and two isolates had sequences that differed from the others by only one nucleotide....

Partial Sequencing of 16S rRNA Gene of Selected Staphylococcus aureus Isolates and its Antibiotic Resistance

Directory of Open Access Journals (Sweden)

Harsi Dewantari Kusumaningrum

2016-08-01

Full Text Available The choice of primer used in 16S rRNA sequencing for identification of Staphylococcus species found in food is important. This study aimed to characterize Staphylococcus aureus isolates by partial sequencing based on 16S rRNA gene employing primers 16sF, 63F or 1387R. The isolates were isolated from milk, egg dishes and chicken dishes and selected based on the presence of sea gene that responsible for formation of enterotoxin-A. Antibiotic susceptibility of the isolates towards six antibiotics was also tested. The use of 16sF resulted generally in higher identity percentage and query coverage compared to the sequencing by 63F or 1387R. BLAST results of all isolates, sequenced by 16sF, showed 99% homology to complete genome of four S. aureus strains, with different characteristics on enterotoxin production and antibiotic resistance. Considering that all isolates were carrying sea gene, indicated by the occurence of 120 bp amplicon after PCR amplification using primer SEA1/SEA2,  the isolates were most in agreeing to S. aureus subsp. aureus ST288. This study indicated that 4 out of 8 selected isolates were resistant towards streptomycin. The 16S rRNA gene sequencing using 16sF is useful for identification of S. aureus. However, additional analysis such as PCR employing specific gene target, should give a valuable supplementary information, when specific characteristic is expected.

Highly divergent 16S rRNA sequences in ribosomal operons of Scytonema hyalinum (Cyanobacteria)

Czech Academy of Sciences Publication Activity Database

Johansen, J. R.; Mareš, Jan; Pietrasiak, N.; Bohunická, M.; Zima Jr., J.; Štenclová, Lenka; Hauer, T.

2017-01-01

Roč. 12, č. 10 (2017), č. článku e0186393. E-ISSN 1932-6203 Institutional support: RVO:60077344 Keywords : rRNA operon * heterogenita * Scytonema hyalinum Subject RIV: EF - Botanics OBOR OECD: Microbiology Impact factor: 2.806, year: 2016

The use of 16s rDNA methods in soil microbial ecology Uso de métodos 16S rDNA em ecologia microbiana do solo

Directory of Open Access Journals (Sweden)

Andrew Macrae

2000-06-01

Full Text Available New and exciting molecular methods, many using the 16S small sub-unit ribosomal nucleic acid molecule, are opening the microbial "black box" in soil. These studies have added much to our knowledge of microbial diversity in soils, and are beginning to advance our understanding of the relationship between this diversity and its function in soil processes. Over the next few years, the knowledge gained from molecular studies will, we hope, lead to improvements in sustainable land management and sustainable exploitation of soil genetic resources. As we enter the third millenium, it is appropriate to review the application of 16S rDNA methods to soil microbiology. This review examines 16S ribosomal DNA (rDNA methods and their application to soil. It mentions their limits and suggests how they may be applied in the future.Novas e excitantes técnicas moleculares muitas usando a fração 16S da subunidade menor da molécula de ácido nucleico ribossomal, estão abrindo a "caixa-preta" da microbiologia do solo. Esses estudos têm acrescentado muito ao nosso conhecimento acerca da diversidade microbiana no solo, e começam a avançar nosso entendimento sobre a relação entre essa diversidade a sua função nos processos no solo. Ao longo dos próximos anos, o conhecimento obtido a partir de técnicas moleculares irão, esperamos, levar a melhoramentos do manejo de áreas sustentáveis da exploração dos recursos genéticos do solo. Com a chegada do terceiro milênio, é apropriado revermos a aplicação das técnicas da fração 16S do rDNA em microbiologia de solo. Esta revisão examina aplicações das técnicas da fração 16S do DNA (RNA no solo, menciona seus limites e sugere como elas poderão ser usadas no futuro.

Novel Accurate Bacterial Discrimination by MALDI-Time-of-Flight MS Based on Ribosomal Proteins Coding in S10-spc-alpha Operon at Strain Level S10-GERMS

Science.gov (United States)

Tamura, Hiroto; Hotta, Yudai; Sato, Hiroaki

2013-08-01

Matrix-assisted laser-desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) is one of the most widely used mass-based approaches for bacterial identification and classification because of the simple sample preparation and extremely rapid analysis within a few minutes. To establish the accurate MALDI-TOF MS bacterial discrimination method at strain level, the ribosomal subunit proteins coded in the S 10-spc-alpha operon, which encodes half of the ribosomal subunit protein and is highly conserved in eubacterial genomes, were selected as reliable biomarkers. This method, named the S10-GERMS method, revealed that the strains of genus Pseudomonas were successfully identified and discriminated at species and strain levels, respectively; therefore, the S10-GERMS method was further applied to discriminate the pathovar of P. syringae. The eight selected biomarkers (L24, L30, S10, S12, S14, S16, S17, and S19) suggested the rapid discrimination of P. syringae at the strain (pathovar) level. The S10-GERMS method appears to be a powerful tool for rapid and reliable bacterial discrimination and successful phylogenetic characterization. In this article, an overview of the utilization of results from the S10-GERMS method is presented, highlighting the characterization of the Lactobacillus casei group and discrimination of the bacteria of genera Bacillus and Sphingopyxis despite only two and one base difference in the 16S rRNA gene sequence, respectively.

Diversity of 23S rRNA genes within individual prokaryotic genomes.

Directory of Open Access Journals (Sweden)

Anna Pei

Full Text Available BACKGROUND: The concept of ribosomal constraints on rRNA genes is deduced primarily based on the comparison of consensus rRNA sequences between closely related species, but recent advances in whole-genome sequencing allow evaluation of this concept within organisms with multiple rRNA operons. METHODOLOGY/PRINCIPAL FINDINGS: Using the 23S rRNA gene as an example, we analyzed the diversity among individual rRNA genes within a genome. Of 184 prokaryotic species containing multiple 23S rRNA genes, diversity was observed in 113 (61.4% genomes (mean 0.40%, range 0.01%-4.04%. Significant (1.17%-4.04% intragenomic variation was found in 8 species. In 5 of the 8 species, the diversity in the primary structure had only minimal effect on the secondary structure (stem versus loop transition. In the remaining 3 species, the diversity significantly altered local secondary structure, but the alteration appears minimized through complex rearrangement. Intervening sequences (IVS, ranging between 9 and 1471 nt in size, were found in 7 species. IVS in Deinococcus radiodurans and Nostoc sp. encode transposases. T. tengcongensis was the only species in which intragenomic diversity >3% was observed among 4 paralogous 23S rRNA genes. CONCLUSIONS/SIGNIFICANCE: These findings indicate tight ribosomal constraints on individual 23S rRNA genes within a genome. Although classification using primary 23S rRNA sequences could be erroneous, significant diversity among paralogous 23S rRNA genes was observed only once in the 184 species analyzed, indicating little overall impact on the mainstream of 23S rRNA gene-based prokaryotic taxonomy.

Direct crosslinking of the antitumor antibiotic sparsomycin, and its derivatives, to A2602 in the peptidyl transferase center of 23S-like rRNA within ribosome-tRNA complexes

DEFF Research Database (Denmark)

Porse, B T; Kirillov, S V; Awayez, M J

1999-01-01

of action was investigated by inducing a crosslink between sparsomycin and bacterial, archaeal, and eukaryotic ribosomes complexed with P-site-bound tRNA, on irradiating with low energy ultraviolet light (at 365 nm). The crosslink was localized exclusively to the universally conserved nucleotide A2602...

Repeated reunions and splits feature the highly dynamic evolution of 5S and 35S ribosomal RNA genes (rDNA) in the Asteraceae family.

Science.gov (United States)

Garcia, Sònia; Panero, José L; Siroky, Jiri; Kovarik, Ales

2010-08-16

In flowering plants and animals the most common ribosomal RNA genes (rDNA) organisation is that in which 35S (encoding 18S-5.8S-26S rRNA) and 5S genes are physically separated occupying different chromosomal loci. However, recent observations established that both genes have been unified to a single 35S-5S unit in the genus Artemisia (Asteraceae), a genomic arrangement typical of primitive eukaryotes such as yeast, among others. Here we aim to reveal the origin, distribution and mechanisms leading to the linked organisation of rDNA in the Asteraceae by analysing unit structure (PCR, Southern blot, sequencing), gene copy number (quantitative PCR) and chromosomal position (FISH) of 5S and 35S rRNA genes in approximately 200 species representing the family diversity and other closely related groups. Dominant linked rDNA genotype was found within three large groups in subfamily Asteroideae: tribe Anthemideae (93% of the studied cases), tribe Gnaphalieae (100%) and in the "Heliantheae alliance" (23%). The remaining five tribes of the Asteroideae displayed canonical non linked arrangement of rDNA, as did the other groups in the Asteraceae. Nevertheless, low copy linked genes were identified among several species that amplified unlinked units. The conserved position of functional 5S insertions downstream from the 26S gene suggests a unique, perhaps retrotransposon-mediated integration event at the base of subfamily Asteroideae. Further evolution likely involved divergence of 26S-5S intergenic spacers, amplification and homogenisation of units across the chromosomes and concomitant elimination of unlinked arrays. However, the opposite trend, from linked towards unlinked arrangement was also surmised in few species indicating possible reversibility of these processes. Our results indicate that nearly 25% of Asteraceae species may have evolved unusual linked arrangement of rRNA genes. Thus, in plants, fundamental changes in intrinsic structure of rDNA units, their copy

Comparative performance of the 16S rRNA gene in DNA barcoding of amphibians

Directory of Open Access Journals (Sweden)

Chiari Ylenia

2005-03-01

Full Text Available Abstract Background Identifying species of organisms by short sequences of DNA has been in the center of ongoing discussions under the terms DNA barcoding or DNA taxonomy. A C-terminal fragment of the mitochondrial gene for cytochrome oxidase subunit I (COI has been proposed as universal marker for this purpose among animals. Results Herein we present experimental evidence that the mitochondrial 16S rRNA gene fulfills the requirements for a universal DNA barcoding marker in amphibians. In terms of universality of priming sites and identification of major vertebrate clades the studied 16S fragment is superior to COI. Amplification success was 100% for 16S in a subset of fresh and well-preserved samples of Madagascan frogs, while various combination of COI primers had lower success rates.COI priming sites showed high variability among amphibians both at the level of groups and closely related species, whereas 16S priming sites were highly conserved among vertebrates. Interspecific pairwise 16S divergences in a test group of Madagascan frogs were at a level suitable for assignment of larval stages to species (1–17%, with low degrees of pairwise haplotype divergence within populations (0–1%. Conclusion We strongly advocate the use of 16S rRNA as standard DNA barcoding marker for vertebrates to complement COI, especially if samples a priori could belong to various phylogenetically distant taxa and false negatives would constitute a major problem.

Ribosomal synthesis of polylysine from individual lysyl-tRNA/sup Lys/ in the absence of a template

International Nuclear Information System (INIS)

Yusupova, G.Z.; Remme, Y.L.; Belitsina, N.B.; Spirin, A.S.

1987-01-01

Earlier studies showed that ribosomes of Escherichia coli, in the absence of a template, can synthesize oligolysine, using lysyl-tRNA as a substrate. The authors present results on the use of preparations of individual lysyl-tRNA/sup Lys/ and phenylalanyl-tRNA/sup Phe/ in a system of templateless peptide synthesis. For these studies, the authors used ribosomes of E. coli MRE 600, washed four times with 1 M NH 4 Cl with 10 MM MgCl 2 . The purified ribosomes were stored at -70 0 C in standard buffer, containing 20 mM Tris-HCl, 100 mM NH 4 Cl, 10 mM MgCl 2 , 0.1 mM ethylenediamine tetraacetate (EDTA), and 10% glycerin, pH/sub 37 0 C/7.6. A preparation of [ 14 C]lysyl-tRNA/sup Lys/ was produced by affinity chromatography on immobilized factor EF-T/sub u/ from Thermus thermophilus HB8. The elongation factor EF-T/sub u/ from T. thermophilus and immobilized on BrCN-activated Sepharose 4B. The initial preparation of total tRNA of E. coli, enzymatically acylated by [ 14 C]lysine (348 Ci/mole, Amersham), was produced as described earlier. The degree of aminoacylation was 52-59 pmoles [ 14 C]lysine per unit of A 260 of tRNA

DNA sequencing reveals limited heterogeneity in the 16S rRNA gene from the rrnB operon among five Mycoplasma hominis isolates

DEFF Research Database (Denmark)

Mygind, T; Birkelund, Svend; Christiansen, Gunna

1998-01-01

To investigate the intraspecies heterogeneity within the 16S rRNA gene of Mycoplasma hominis, five isolates with diverse antigenic profiles, variable/identical P120 hypervariable domains, and different 16S rRNA gene RFLP patterns were analysed. The 16S rRNA gene from the rrnB operon was amplified...

Quantitative 16S rDNA-targeted polymerase chain reaction and oligonucleotide hybridization for the detection of Paenibacillus azotofixans in soil and the wheat rhizosphere

NARCIS (Netherlands)

Rosado, A.S.; Seldin, L.; Wolters, A.; Elsas, van J.D.

1996-01-01

A molecular method for the detection of Paenibacillus azotofixans in soil and the wheat rhizosphere was developed. The system consisted of polymerase chain reaction (PCR) amplification of part of the variable V1 to V4 regions of the 16S ribosomal RNA gene, followed by hybridization with a specific

Identification of active methanotrophs in a landfill cover soil through detection of expression of 16S rRNA and functional genes.

Science.gov (United States)

Chen, Yin; Dumont, Marc G; Cébron, Aurélie; Murrell, J Colin

2007-11-01

Active methanotrophs in a landfill soil were revealed by detecting the 16S rRNA of methanotrophs and the mRNA transcripts of key genes involved in methane oxidation. New 16S rRNA primers targeting type I and type II methanotrophs were designed and optimized for analysis by denaturing gradient gel electrophoresis. Direct extraction of RNA from soil enabled the analysis of the expression of the functional genes: mmoX, pmoA and mxaF, which encode subunits of soluble methane monooxygenase, particulate methane monooxygenase and methanol dehydrogenase respectively. The 16S rRNA polymerase chain reaction (PCR) primers for type I methanotrophs detected Methylomonas, Methylosarcina and Methylobacter sequences from both soil DNA and cDNA which was generated from RNA extracted directly from the landfill cover soil. The 16S rRNA primers for type II methanotrophs detected primarily Methylocella and some Methylocystis 16S rRNA genes. Phylogenetic analysis of mRNA recovered from the soil indicated that Methylobacter, Methylosarcina, Methylomonas, Methylocystis and Methylocella were actively expressing genes involved in methane and methanol oxidation. Transcripts of pmoA but not mmoX were readily detected by reverse transcription polymerase chain reaction (RT-PCR), indicating that particulate methane monooxygenase may be largely responsible for methane oxidation in situ.

Inhibition of peptide bond formation by pleuromutilins: the structure of the 50S ribosomal subunit from Deinococcus radiodurans in complex with tiamulin.

Science.gov (United States)

Schlünzen, Frank; Pyetan, Erez; Fucini, Paola; Yonath, Ada; Harms, Jörg M

2004-12-01

Tiamulin, a prominent member of the pleuromutilin class of antibiotics, is a potent inhibitor of protein synthesis in bacteria. Up to now the effect of pleuromutilins on the ribosome has not been determined on a molecular level. The 3.5 A structure of the 50S ribosomal subunit from Deinococcus radiodurans in complex with tiamulin provides for the first time a detailed picture of its interactions with the 23S rRNA, thus explaining the molecular mechanism of the antimicrobial activity of the pleuromutilin class of antibiotics. Our results show that tiamulin is located within the peptidyl transferase center (PTC) of the 50S ribosomal subunit with its tricyclic mutilin core positioned in a tight pocket at the A-tRNA binding site. Also, the extension, which protrudes from its mutilin core, partially overlaps with the P-tRNA binding site. Thereby, tiamulin directly inhibits peptide bond formation. Comparison of the tiamulin binding site with other PTC targeting drugs, like chloramphenicol, clindamycin and streptogramins, may facilitate the design of modified or hybridized drugs that extend the applicability of this class of antibiotics.

Biphasic character of ribosomal translocation and non-Michaelis-Menten kinetics of translation

Science.gov (United States)

Xie, Ping

2014-12-01

We study theoretically the kinetics of mRNA translocation in the wild-type (WT) Escherichia coli ribosome, which is composed of a small 30 S and large 50 S subunit, and the ribosomes with mutations to some intersubunit bridges such as B1a, B4, B7a, and B8. The theoretical results reproduce well the available in vitro experimental data on the biphasic kinetics of the forward mRNA translocation catalyzed by elongation factor G (EF-G) hydrolyzing GTP, which can be best fit by the sum of two exponentials, and the monophasic kinetics of the spontaneous reverse mRNA translocation in the absence of the elongation factor, which can be best fit by a single-exponential function, in both the WT and mutant ribosomes. We show that both the mutation-induced increase in the maximal rate of the slow phase for the forward mRNA translocation and that in the rate of the spontaneous reverse mRNA translocation result from a reduction in the intrinsic energy barrier to resist the rotational movements between the two subunits, giving the same degree of increase in the two rates. The mutation-induced increase in the maximal rate of the fast phase for the forward mRNA translocation results mainly from the increase in the rate of the ribosomal unlocking, a conformational change in the ribosome that widens the mRNA channel for the mRNA translocation to take place, which could be partly due to the effect of the mutation on the intrasubunit 30S head rotation. Moreover, we study the translation rate of the WT and mutant ribosomes. It is shown that the translation rate versus the concentration of EF-G-GTP does not follow the Michaelis-Menten (MM) kinetics, which is in sharp contrast to the general property of other enzymes that the rate of the enzymatic reaction versus the concentration of a substrate follows the MM kinetics. The physical origin of this non-MM kinetics for the ribosome is revealed.

Kinetic pathway of 40S ribosomal subunit recruitment to hepatitis C virus internal ribosome entry site.

Science.gov (United States)

Fuchs, Gabriele; Petrov, Alexey N; Marceau, Caleb D; Popov, Lauren M; Chen, Jin; O'Leary, Seán E; Wang, Richard; Carette, Jan E; Sarnow, Peter; Puglisi, Joseph D

2015-01-13

Translation initiation can occur by multiple pathways. To delineate these pathways by single-molecule methods, fluorescently labeled ribosomal subunits are required. Here, we labeled human 40S ribosomal subunits with a fluorescent SNAP-tag at ribosomal protein eS25 (RPS25). The resulting ribosomal subunits could be specifically labeled in living cells and in vitro. Using single-molecule Förster resonance energy transfer (FRET) between RPS25 and domain II of the hepatitis C virus (HCV) internal ribosome entry site (IRES), we measured the rates of 40S subunit arrival to the HCV IRES. Our data support a single-step model of HCV IRES recruitment to 40S subunits, irreversible on the initiation time scale. We furthermore demonstrated that after binding, the 40S:HCV IRES complex is conformationally dynamic, undergoing slow large-scale rearrangements. Addition of translation extracts suppresses these fluctuations, funneling the complex into a single conformation on the 80S assembly pathway. These findings show that 40S:HCV IRES complex formation is accompanied by dynamic conformational rearrangements that may be modulated by initiation factors.

The first report: An analysis of bacterial flora of the first voided urine specimens of patients with male urethritis using the 16S ribosomal RNA gene-based clone library method.

Science.gov (United States)

You, Chunlin; Hamasuna, Ryoichi; Ogawa, Midori; Fukuda, Kazumasa; Hachisuga, Toru; Matsumoto, Tetsuro; Taniguchi, Hatsumi

2016-06-01

To analyse the bacterial flora of urine from patients with male urethritis using the clone library method. Urine specimens from patients with urethritis were used. The bacterial flora was analysed according to the 16S ribosomal RNA gene-based clone library method. In addition, Neisseria gonorrhoeae, Chlamydia trachomatis, Mycoplasma genitalium, Mycoplasma hominis, Ureaplasma urealyticum or Ureaplasma parvum were detected by the conventional PCR methods (TMA or real-time PCR) and data from the clone library and conventional PCR methods were compared. Among 58 urine specimens, 38 were successfully analysed using the clone library method. From the specimens, 2427 clones were evaluated and 95 bacterial phylotypes were detected. N. gonorrhoeae was detected from 6 specimens and as the predominant bacterial species in 5 specimens. M. genitalium was detected from 5 specimens and as the predominant bacterial species in 3 specimens. C. trachomatis was detected from 15 specimens using the TMA method, but was detected from only 1 specimen using the clone library method. U. parvum was detected from only 2 specimens using the clone library method. In addition, Haemophilus influenzae and Neisseria meningitidis were also detected in 8 and 1 specimens, respectively. Gardnerella vaginalis, which is a potential pathogen for bacterial vaginitis in women, was detected in 10 specimens. The clone library method can detect the occupancy rate of each bacteria species among the bacterial flora and may be a new method for bacterial analyses in male urethritis. Copyright © 2016 Elsevier Ltd. All rights reserved.

Phylogenetic inference of Coxiella burnetii by 16S rRNA gene sequencing.

Directory of Open Access Journals (Sweden)

Heather P McLaughlin

Full Text Available Coxiella burnetii is a human pathogen that causes the serious zoonotic disease Q fever. It is ubiquitous in the environment and due to its wide host range, long-range dispersal potential and classification as a bioterrorism agent, this microorganism is considered an HHS Select Agent. In the event of an outbreak or intentional release, laboratory strain typing methods can contribute to epidemiological investigations, law enforcement investigation and the public health response by providing critical information about the relatedness between C. burnetii isolates collected from different sources. Laboratory cultivation of C. burnetii is both time-consuming and challenging. Availability of strain collections is often limited and while several strain typing methods have been described over the years, a true gold-standard method is still elusive. Building upon epidemiological knowledge from limited, historical strain collections and typing data is essential to more accurately infer C. burnetii phylogeny. Harmonization of auspicious high-resolution laboratory typing techniques is critical to support epidemiological and law enforcement investigation. The single nucleotide polymorphism (SNP -based genotyping approach offers simplicity, rapidity and robustness. Herein, we demonstrate SNPs identified within 16S rRNA gene sequences can differentiate C. burnetii strains. Using this method, 55 isolates were assigned to six groups based on six polymorphisms. These 16S rRNA SNP-based genotyping results were largely congruent with those obtained by analyzing restriction-endonuclease (RE-digested DNA separated by SDS-PAGE and by the high-resolution approach based on SNPs within multispacer sequence typing (MST loci. The SNPs identified within the 16S rRNA gene can be used as targets for the development of additional SNP-based genotyping assays for C. burnetii.

The rRNA evolution and procaryotic phylogeny

Science.gov (United States)

Fox, G. E.

1986-01-01

Studies of ribosomal RNA primary structure allow reconstruction of phylogenetic trees for prokaryotic organisms. Such studies reveal major dichotomy among the bacteria that separates them into eubacteria and archaebacteria. Both groupings are further segmented into several major divisions. The results obtained from 5S rRNA sequences are essentially the same as those obtained with the 16S rRNA data. In the case of Gram negative bacteria the ribosomal RNA sequencing results can also be directly compared with hybridization studies and cytochrome c sequencing studies. There is again excellent agreement among the several methods. It seems likely then that the overall picture of microbial phylogeny that is emerging from the RNA sequence studies is a good approximation of the true history of these organisms. The RNA data allow examination of the evolutionary process in a semi-quantitative way. The secondary structures of these RNAs are largely established. As a result it is possible to recognize examples of local structural evolution. Evolutionary pathways accounting for these events can be proposed and their probability can be assessed.

Detection of Aspergillus fumigatus pulmonary fungal infections in mice with 99mTc-labeled MORF oligomers targeting ribosomal RNA

International Nuclear Information System (INIS)

Wang Yuzhen; Chen Ling; Liu Xinrong; Cheng Dengfeng; Liu Guozheng; Liu Yuxia; Dou Shuping; Hnatowich, Donald J.; Rusckowski, Mary

2013-01-01

Purpose: Invasive aspergillosis is a major cause of infectious morbidity and mortality in immunocompromised patients. The fungus Aspergillus fumigatus (A. fumigatus) is the primary causative agent of invasive aspergillosis. However, A. fumigatus infections remain difficult to diagnose particularly in the early stages due to the lack of a rapid, sensitive and specific diagnostic approach. In this study, we investigated 99m Tc labeled MORF oligomers targeting fungal ribosomal RNA (rRNA) for the imaging detection of fungal infections. Procedures: Three phosphorodiamidate morpholino (MORF) oligomer (a DNA analogue) probes were designed: AGEN, complementary to a sequence of the fungal 28S ribosomal RNA (rRNA) of Aspergillus, as a genus-specific probe; AFUM, complementary to the 28S rRNA sequence of A. fumigatus, as a fungus species-specific probe; and cMORF, irrelevant to all fungal species, as a control probe. The probes were conjugated with Alexa Fluor 633 carboxylic acid succinimidyl ester (AF633) for fluorescence imaging or with NHS-mercaptoacetyl triglycine (NHS-MAG3) for nuclear imaging with 99m Tc and then evaluated in vitro and in vivo. Results: The specific binding of AGEN and AFUM to fungal total RNA was confirmed by dot blot hybridization while specific binding of AGEN and AFUM in fixed and live A. fumigatus was demonstrated by both fluorescent in situ hybridization (FISH) analysis and accumulation in live cells. SPECT imaging of BALB/c mice with pulmonary A. fumigatus infections and administered 99m Tc labeled AGEN and AFUM showed immediate and obvious accumulation in the infected lungs, while no significant accumulation of the control 99m Tc-cMORF in the infected lung was observed. Compared to non-infected mice, with sacrifice at 1 h, the accumulation of 99m Tc-AGEN and 99m Tc-AFUM in the lungs of mice infected with A. fumigatus was 2 and 2.7 fold higher respectively. Conclusions: In vivo targeting fungal ribosomal RNA with 99m Tc labeled MORF probes AGEN

Molecular evolution of the mitochondrial 12S rRNA in Ungulata (mammalia).

Science.gov (United States)

Douzery, E; Catzeflis, F M

1995-11-01

The complete 12S rRNA gene has been sequenced in 4 Ungulata (hoofed eutherians) and 1 marsupial and compared to 38 available mammalian sequences in order to investigate the molecular evolution of the mitochondrial small-subunit ribosomal RNA molecule. Ungulata were represented by one artiodactyl (the collared peccary, Tayassu tajacu, suborder Suiformes), two perissodactyls (the Grevy's zebra, Equus grevyi, suborder Hippomorpha; the white rhinoceros, Ceratotherium simum, suborder Ceratomorpha), and one hyracoid (the tree hyrax, Dendrohyrax dorsalis). The fifth species was a marsupial, the eastern gray kangaroo (Macropus giganteus). Several transition/transversion biases characterized the pattern of changes between mammalian 12S rRNA molecules. A bias toward transitions was found among 12S rRNA sequences of Ungulata, illustrating the general bias exhibited by ribosomal and protein-encoding genes of the mitochondrial genome. The derivation of a mammalian 12S rRNA secondary structure model from the comparison of 43 eutherian and marsupial sequences evidenced a pronounced bias against transversions in stems. Moreover, transversional compensatory changes were rare events within double-stranded regions of the ribosomal RNA. Evolutionary characteristics of the 12S rRNA were compared with those of the nuclear 18S and 28S rRNAs. From a phylogenetic point of view, transitions, transversions and indels in stems as well as transversional and indels events in loops gave congruent results for comparisons within orders. Some compensatory changes in double-stranded regions and some indels in single-stranded regions also constituted diagnostic events. The 12S rRNA molecule confirmed the monophyly of infraorder Pecora and order Cetacea and demonstrated the monophyly of the suborder Ruminantia was not supported and the branching pattern between Cetacea and the artiodacytyl suborders Ruminantia and Suiformes was not established. The monophyly of the order Perissodactyla was evidenced

16S rRNA Gene Sequence Analysis of Drinking Water Using RNA and DNA Extracts as Targets for Clone Library Development

Science.gov (United States)

The bacterial composition of chlorinated drinking water was analyzed using 16S rRNA gene clone libraries derived from DNA extracts of 12 samples and compared to clone libraries previously generated using RNA extracts from the same samples. Phylogenetic analysis of 761 DNA-based ...

The AAA-ATPase NVL2 is a component of pre-ribosomal particles that interacts with the DExD/H-box RNA helicase DOB1

International Nuclear Information System (INIS)

Nagahama, Masami; Yamazoe, Takeshi; Hara, Yoshimitsu; Tani, Katsuko; Tsuji, Akihiko; Tagaya, Mitsuo

2006-01-01

Nuclear VCP/p97-like protein 2 (NVL2) is a member of the chaperone-like AAA-ATPase family with two conserved ATP-binding modules. Our previous studies have shown that NVL2 is localized to the nucleolus by interacting with ribosomal protein L5 and may participate in ribosome synthesis, a process involving various non-ribosomal factors including chaperones and RNA helicases. Here, we show that NVL2 is associated with pre-ribosomal particles in the nucleus. Moreover, we used yeast two-hybrid and co-immunoprecipitation assays to identify an NVL2-interacting protein that could yield insights into NVL2 function in ribosome biogenesis. We found that NVL2 interacts with DOB1, a DExD/H-box RNA helicase, whose yeast homologue functions in a late stage of the 60S subunit synthesis. DOB1 can interact with a second ATP-binding module mutant of NVL2, which shows a dominant negative effect on ribosome synthesis. In contrast, it cannot interact with a first ATP-binding module mutant, which does not show the dominant negative effect. When the dominant negative mutant of NVL2 was overexpressed in cells, DOB1 appeared to remain associated with nuclear pre-ribosomal particles. Such accumulation was not observed upon overexpression of wild-type NVL2 or a nondominant-negative mutant. Taken together, our results suggest that NVL2 might regulate the association/dissociation reaction of DOB1 with pre-ribosomal particles by acting as a molecular chaperone

Improved group-specific primers based on the full SILVA 16S rRNA gene reference database.

Science.gov (United States)

Pfeiffer, Stefan; Pastar, Milica; Mitter, Birgit; Lippert, Kathrin; Hackl, Evelyn; Lojan, Paul; Oswald, Andreas; Sessitsch, Angela

2014-08-01

Quantitative PCR (qPCR) and community fingerprinting methods, such as the Terminal Restriction Fragment Length Polymorphism (T-RFLP) analysis,are well-suited techniques for the examination of microbial community structures. The use of phylum and class-specific primers can provide enhanced sensitivity and phylogenetic resolution as compared with domain-specific primers. To date, several phylum- and class-specific primers targeting the 16S ribosomal RNA gene have been published. However, many of these primers exhibit low discriminatory power against non-target bacteria in PCR. In this study, we evaluated the precision of certain published primers in silico and via specific PCR. We designed new qPCR and T-RFLP primer pairs (for the classes Alphaproteobacteria and Betaproteobacteria, and the phyla Bacteroidetes, Firmicutes and Actinobacteria) by combining the sequence information from a public dataset (SILVA SSU Ref 102 NR) with manual primer design. We evaluated the primer pairs via PCR using isolates of the above-mentioned groups and via screening of clone libraries from environmental soil samples and human faecal samples. As observed through theoretical and practical evaluation, the primers developed in this study showed a higher level of precision than previously published primers, thus allowing a deeper insight into microbial community dynamics.

Bacterial community composition of South China Sea sediments through pyrosequencing-based analysis of 16S rRNA genes.

Science.gov (United States)

Zhu, Daochen; Tanabe, Shoko-Hosoi; Yang, Chong; Zhang, Weimin; Sun, Jianzhong

2013-01-01

Subseafloor sediments accumulate large amounts of organic and inorganic materials that contain a highly diverse microbial ecosystem. The aim of this study was to survey the bacterial community of subseafloor sediments from the South China Sea. Pyrosequencing of over 265,000 amplicons of the V3 hypervariable region of the 16S ribosomal RNA gene was performed on 16 sediment samples collected from multiple locations in the northern region of the South China Sea from depths ranging from 35 to 4000 m. A total of 9,726 operational taxonomic units (OTUs; between 695 and 2819 unique OTUs per sample) at 97% sequence similarity level were generated. In total, 40 bacterial phyla including 22 formally described phyla and 18 candidate phyla, with Proteobacteria, Firmicutes, Planctomycetes, Actinobacteria and Chloroflexi being most diverse, were identified. The most abundant phylotype, accounting for 42.6% of all sequences, belonged to Gammaproteobacteria, which possessed absolute predominance in the samples analyzed. Among the 18 candidate phyla, 12 were found for the first time in the South China Sea. This study provided a novel insight into the composition of bacterial communities of the South China Sea subseafloor. Furthermore, abundances and community similarity analysis showed that the compositions of the bacterial communities are very similar at phylum level at different depths from 35-4000 m.

Bacterial community composition of South China Sea sediments through pyrosequencing-based analysis of 16S rRNA genes.

Directory of Open Access Journals (Sweden)

Daochen Zhu

Full Text Available BACKGROUND: Subseafloor sediments accumulate large amounts of organic and inorganic materials that contain a highly diverse microbial ecosystem. The aim of this study was to survey the bacterial community of subseafloor sediments from the South China Sea. METHODOLOGY/PRINCIPAL FINDINGS: Pyrosequencing of over 265,000 amplicons of the V3 hypervariable region of the 16S ribosomal RNA gene was performed on 16 sediment samples collected from multiple locations in the northern region of the South China Sea from depths ranging from 35 to 4000 m. A total of 9,726 operational taxonomic units (OTUs; between 695 and 2819 unique OTUs per sample at 97% sequence similarity level were generated. In total, 40 bacterial phyla including 22 formally described phyla and 18 candidate phyla, with Proteobacteria, Firmicutes, Planctomycetes, Actinobacteria and Chloroflexi being most diverse, were identified. The most abundant phylotype, accounting for 42.6% of all sequences, belonged to Gammaproteobacteria, which possessed absolute predominance in the samples analyzed. Among the 18 candidate phyla, 12 were found for the first time in the South China Sea. CONCLUSIONS: This study provided a novel insight into the composition of bacterial communities of the South China Sea subseafloor. Furthermore, abundances and community similarity analysis showed that the compositions of the bacterial communities are very similar at phylum level at different depths from 35-4000 m.

Transcriptional activation of ribosomal RNA genes during compensatory renal hypertrophy

International Nuclear Information System (INIS)

Ouellette, A.J.; Moonka, R.; Zelenetz, A.; Malt, R.A.

1986-01-01

The overall rate of rDNA transcription increases by 50% during the first 24 hours of compensatory renal hypertrophy in the mouse. To study mechanisms of ribosome accumulation after uninephrectomy, transcription rates were measured in isolated kidneys by transcriptional runoff. 32 P-labeled nascent transcripts were hybridized to blots containing linearized, denatured cloned rDNA, and hybridization was quantitated autoradiographically and by direct counting. Overall transcriptional activity of rDNA was increased by 30% above control levels at 6 hrs after nephrectomy and by 50% at 12, 18, and 24 hrs after operation. Hybridizing RNA was insensitive to inhibiby alpha-amanitin, and no hybridization was detected to vector DNA. Thus, accelerated rDNA transcription is one regulatory element in the accretion of ribosomes in renal growth, and the regulatory event is an early event. Mechanisms of activation may include enhanced transcription of active genes or induction of inactive DNA

The primary structures of ribosomal proteins L16, L23 and L33 from the archaebacterium Halobacterium marismortui.

Science.gov (United States)

Hatakeyama, T; Hatakeyama, T; Kimura, M

1988-11-21

The complete amino acid sequences of ribosomal proteins L16, L23 and L33 from the archaebacterium Halobacterium marismortui were determined. The sequences were established by manual sequencing of peptides produced with several proteases as well as by cleavage with dilute HCl. Proteins L16, L23 and L33 consist of 119, 154 and 69 amino acid residues, and their molecular masses are 13,538, 16,812 and 7620 Da, respectively. The comparison of their sequences with those of ribosomal proteins from other organisms revealed that L23 and L33 are related to eubacterial ribosomal proteins from Escherichia coli and Bacillus stearothermophilus, while protein L16 was found to be homologous to a eukaryotic ribosomal protein from yeast. These results provide information about the special phylogenetic position of archaebacteria.

Control of ribosome formation in rat heart

International Nuclear Information System (INIS)

Russo, L.A.

1987-01-01

Diabetes of 9 days duration produced a 17% diminution in the rate of total protein synthesis in rat hearts perfused as Langendorff preparations supplied with glucose, plasma levels of amino acids, and 400 μU/ml insulin. This reduction was attributable to a decrease in efficiency of protein synthesis and total RNA content. Total messenger RNA content decreased in diabetic hearts in proportion to the reduction in total RNA. Diabetes also resulted in diminished ribosome content as reflected by the induction in total RNA. Ribosome production was investigated by monitoring incorporation of [ 3 H]phenylalanine into the proteins of cytoplasmic ribosomes. Rates of ribosome formation in diabetic hearts were as fast as control rates in the presence of insulin, and were faster than control rates in the absence of the hormone. These results indicated that ribosome content fell in diabetic hearts despite unchanged or faster rates of ribosome formation