WorldWideScience

Sample records for ribosomal phosphoprotein pfp0

  1. The activity of the acidic phosphoproteins from the 80 S rat liver ribosome.

    Science.gov (United States)

    MacConnell, W P; Kaplan, N O

    1982-05-25

    The selective removal of acidic phosphoproteins from the 80 S rat liver ribosome was accomplished by successive alcohol extractions at low salt concentration. The resulting core ribosomes lost over 90% of their translation activity and were unable to support the elongation factor 2 GTPase reaction. Both activities were partially restored when the dialyzed extracts were added back to the core ribosome. The binding of labeled adenosine diphosphoribosyl-elongation factor 2 to ribosomes was also affected by extraction and could be reconstituted, although not to the same extent as the GTPase activity associated with elongation factor 2 in the presence of the ribosome. The alcohol extracts of the 80 S ribosome contained mostly phosphoproteins P1 and P2 which could be dephosphorylated and rephosphorylated in solution by alkaline phosphatase and protein kinase, respectively. Dephosphorylation of the P1/P2 mixture in the extracts caused a decrease in the ability of these proteins to reactivate the polyphenylalanine synthesis activity of the core ribosome. However, treatment of the dephosphorylated proteins with the catalytic subunit of 3':5'-cAMP-dependent protein kinase in the presence of ATP reactivated the proteins when compared to the activity of the native extracts. Rabbit antisera raised against the alcohol-extracted proteins were capable of impairing both the polyphenylalanine synthesis reaction and the elongation factor 2-dependent GTPase reaction in the intact ribosomes.

  2. Journal of Biosciences | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    The ribosomal phosphoprotein P0 of the human malarial parasite Plasmodium falciparum (PfP0) has been identified as a protective surface protein. In Drosophila, P0 protein functions in the nucleus. The ribosomal function of P0 is mediated at the stalk of the large ribosomal subunit at the GTPase centre, where the ...

  3. Baculovirus-mediated expression and isolation of human ribosomal phosphoprotein P0 carrying a GST-tag in a functional state

    International Nuclear Information System (INIS)

    Abo, Yohichi; Hagiya, Akiko; Naganuma, Takao; Tohkairin, Yukiko; Shiomi, Kunihiro; Kajiura, Zenta; Hachimori, Akira; Uchiumi, Toshio; Nakagaki, Masao

    2004-01-01

    We constructed an overexpression system for human ribosomal phosphoprotein P0, together with P1 and P2, which is crucially important for translation. Genes for these proteins, fused with the glutathione S-transferase (GST)-tag at the N-terminus, were inserted into baculovirus and introduced to insect cells. The fusion proteins, but not the proteins without the tag, were efficiently expressed into cells as soluble forms. The fusion protein GST.P0 as well as GST.P1/GST.P2 was phosphorylated in cells as detected by incorporation of 32 P and reactivity with monoclonal anti-phosphoserine antibody. GST.P0 expressed in insect cells, but not the protein obtained in Escherichia coli, had the ability to form a complex with P1 and P2 proteins and to bind to 28S rRNA. Moreover, the GST.P0-P1-P2 complex participated in high eEF-2-dependent GTPase activity. Baculovirus expression systems appear to provide recombinant human P0 samples that can be used for studies on the structure and function

  4. Hypoxic stress-induced changes in ribosomes of maize seedling roots

    International Nuclear Information System (INIS)

    Bailey-Serres, J.; Freeling, M.

    1990-01-01

    The hypoxic stress response of Zea mays L. seedling roots involves regulation of gene expression at transcriptional and posttranscriptional levels. We investigated the effect of hypoxia on the translational machinery of seedling roots. The levels of monoribosomes and ribosomal subunits increased dramatically within 1 hour of stress. Prolonged hypoxia resulted in continued accumulation of nontranslating ribosomes, as well as increased levels of small polyribosomes. The return of seedlings to normal aerobic conditions resulted in recovery of normal polyribosome levels. Comparison of ribosomal proteins from control and hypoxic roots revealed differences in quantity and electrophoretic mobility. In vivo labeling of roots with [ 35 S]methionine revealed variations in newly synthesized ribosomal proteins. In vivo labeling of roots with [ 32 P]orthophosphate revealed a major reduction in the phosphorylation of a 31 kilodalton ribosomal protein in hypoxic stressed roots. In vitro phosphorylation of ribosomal proteins by endogenous kinases was used to probe for differences in ribosome structure and composition. The patterns of in vitro kinased phosphoproteins of ribosomes from control and hypoxic roots were not identical. Variation in phosphoproteins of polyribosomes from control and hypoxic roots, as well as among polyribosomes from hypoxic roots were observed. These results indicate that modification of the translational machinery occurs in response to hypoxic stress

  5. PFP dangerous waste training plan

    International Nuclear Information System (INIS)

    Khojandi, J.

    1996-01-01

    This document establishes the minimum training requirements for the Plutonium Finishing Plant (PFP) personnel who are responsible for management of dangerous waste. The training plan outlines training requirements for handling of solid dangerous waste during generator accumulation and liquid dangerous waste during treatment and storage operations. The implementation of this training plan will ensure the PFP facility compliance with the training plan requirements of Dangerous Waste Regulation. Chapter 173-303-330. Washington Administrative Code (WAC). The requirements for such compliance is described in Section 11.0 of WHC-CM-7-5 Environmental Compliance Manual

  6. PFP requirements development planning guide

    International Nuclear Information System (INIS)

    SINCLAIR, J.C.

    1999-01-01

    The PFP Requirements Development Planning Guide presents the strategy and process used for the identification, allocation, and maintenance of requirements within the Plutonium Finishing Plant (PFP) integrated project baseline. Future revisions to this document will be included as attachments (e.g., results of the PFP Requirements Analysis attributable to this approach). This document is intended be a Project-owned management tool. As such, this document will periodically require revisions resulting from improvements of the information, processes, and techniques as now described. Future updates may be made to this document by PFP management and final approval of the content will be accomplished in a Baseline Change Request as it impacts the Multi-Year Work Plan, or baseline information managed in the Hanford Site Systems Engineering Baseline

  7. Properties of the malarial proteins Pf2, Pf9 and PfP0, which support ...

    Indian Academy of Sciences (India)

    Properties of the malarial proteins Pf2, Pf9 and PfP0, which support their roles as immune targets. Antibodies raised to each of these proteins (or purified from immune adults) inhibit the growth of Plasmodium falciparum at the red cell invasion step. The proteins are localized on the parasite cell surface. Each protein is ...

  8. PFP Wastewater Sampling Facility

    International Nuclear Information System (INIS)

    Hirzel, D.R.

    1995-01-01

    This test report documents the results obtained while conducting operational testing of the sampling equipment in the 225-WC building, the PFP Wastewater Sampling Facility. The Wastewater Sampling Facility houses equipment to sample and monitor the PFP's liquid effluents before discharging the stream to the 200 Area Treated Effluent Disposal Facility (TEDF). The majority of the streams are not radioactive and discharges from the PFP Heating, Ventilation, and Air Conditioning (HVAC). The streams that might be contaminated are processed through the Low Level Waste Treatment Facility (LLWTF) before discharging to TEDF. The sampling equipment consists of two flow-proportional composite samplers, an ultrasonic flowmeter, pH and conductivity monitors, chart recorder, and associated relays and current isolators to interconnect the equipment to allow proper operation. Data signals from the monitors are received in the 234-5Z Shift Office which contains a chart recorder and alarm annunciator panel. The data signals are also duplicated and sent to the TEDF control room through the Local Control Unit (LCU). Performing the OTP has verified the operability of the PFP wastewater sampling system. This Operability Test Report documents the acceptance of the sampling system for use

  9. PFP functional development planning guide

    International Nuclear Information System (INIS)

    SINCLAIR, J.C.

    1999-01-01

    The PFP Functional Development Planning Guide presents the strategy and process used for the identification, development, and analysis of functions (activities) necessary to satisfy the requirements within the Plutonium Finishing Plant (PFP) integrated project baseline. The functional analysis will provide the basis for the development of a function driven work breakdown structure. Future revisions to this document will include as attachments the results of the PFP Functional Analysis resulting from this approach. This document is intended be a Project-owned management tool. As such, the guide will periodically require revisions resulting from improvements of the information, processes, and techniques as now described

  10. PFP supply fan motor starters

    International Nuclear Information System (INIS)

    Keck, R.D.

    1995-01-01

    The Plutonium Finishing Plant (PFP) is currently stabilizing about 25 kg of Pu sludge; upon completion of this task, PFP will be maintained in a safe standby condition to await decision from the PFP NEPA review. It can take about 10 years to initiate and complete terminal cleanout after this; the facility will then be decommissioned and decontaminated. The 234-5Z ventilation system must continue to operate until terminal cleanout. Part of the ventilation system is the seismic fan shutdown system which shuts down the ventilation supply fans in case of strong earthquake. This document presents criteria for installing solid state, reduced voltage motor starters and isolation contactors for the 8 main ventilation supply fans. The isolation contactors will shutdown the supply fans in event of earthquake

  11. Medicago PhosphoProtein Database: a repository for Medicago truncatula phosphoprotein data

    Directory of Open Access Journals (Sweden)

    Christopher M. Rose

    2012-06-01

    Full Text Available The ability of legume crops to fix atmospheric nitrogen via a symbiotic association with soil rhizobia makes them an essential component of many agricultural systems. Initiation of this symbiosis requires protein phosphorylation-mediated signaling in response to rhizobial signals named Nod factors. Medicago truncatula (Medicago is the model system for studying legume biology, making the study of its phosphoproteome essential. Here, we describe the Medicago Phosphoprotein Database (http://phospho.medicago.wisc.edu, a repository built to house phosphoprotein, phosphopeptide, and phosphosite data specific to Medicago. Currently, the Medicago Phosphoprotein Database holds 3,457 unique phosphopeptides that contain 3,404 non-redundant sites of phosphorylation on 829 proteins. Through the web-based interface, users are allowed to browse identified proteins or search for proteins of interest. Furthermore, we allow users to conduct BLAST searches of the database using both peptide sequences and phosphorylation motifs as queries. The data contained within the database are available for download to be investigated at the user’s discretion. The Medicago Phosphoprotein Database will be updated continually with novel phosphoprotein and phosphopeptide identifications, with the intent of constructing an unparalleled compendium of large-scale Medicago phosphorylation data.

  12. Plutonium Finishing Plant (PFP) hazards assessment

    International Nuclear Information System (INIS)

    Campbell, L.R.

    1998-01-01

    This report documents the hazards assessment for the Plutonium Finishing Plant (PFP) located on the US Department of Energy (DOE) Hanford Site. This hazards assessment was conducted to provide the emergency planning technical basis for the PFP. DOE Orders require an emergency planning hazards assessment for each facility that has the potential to reach or exceed the lowest level emergency classification

  13. High knee abduction moments are common risk factors for patellofemoral pain (PFP) and anterior cruciate ligament (ACL) injury in girls: is PFP itself a predictor for subsequent ACL injury?

    Science.gov (United States)

    Myer, Gregory D; Ford, Kevin R; Di Stasi, Stephanie L; Foss, Kim D Barber; Micheli, Lyle J; Hewett, Timothy E

    2015-01-01

    Identifying risk factors for knee pain and anterior cruciate ligament (ACL) injury can be an important step in the injury prevention cycle. We evaluated two unique prospective cohorts with similar populations and methodologies to compare the incidence rates and risk factors associated with patellofemoral pain (PFP) and ACL injury. The 'PFP cohort' consisted of 240 middle and high school female athletes. They were evaluated by a physician and underwent anthropometric assessment, strength testing and three-dimensional landing biomechanical analyses prior to their basketball season. 145 of these athletes met inclusion for surveillance of incident (new) PFP by certified athletic trainers during their competitive season. The 'ACL cohort' included 205 high school female volleyball, soccer and basketball athletes who underwent the same anthropometric, strength and biomechanical assessment prior to their competitive season and were subsequently followed up for incidence of ACL injury. A one-way analysis of variance was used to evaluate potential group (incident PFP vs ACL injured) differences in anthropometrics, strength and landing biomechanics. Knee abduction moment (KAM) cut-scores that provided the maximal sensitivity and specificity for prediction of PFP or ACL injury risk were also compared between the cohorts. KAM during landing above 15.4 Nm was associated with a 6.8% risk to develop PFP compared to a 2.9% risk if below the PFP risk threshold in our sample. Likewise, a KAM above 25.3 Nm was associated with a 6.8% risk for subsequent ACL injury compared to a 0.4% risk if below the established ACL risk threshold. The ACL-injured athletes initiated landing with a greater knee abduction angle and a reduced hamstrings-to-quadriceps strength ratio relative to the incident PFP group. Also, when comparing across cohorts, the athletes who suffered ACL injury also had lower hamstring/quadriceps ratio than the players in the PFP sample (p15 Nm of knee abduction load

  14. System Design Description PFP Thermal Stabilization

    International Nuclear Information System (INIS)

    RISENMAY, H.R.

    2000-01-01

    The purpose of this document is to provide a system design description (SDD) and design basis for the Plutonium Finishing Plant (PFP) Thermal Stabilization project. The chief objective of the SDD is to document the Structures, Systems, and Components (SSCs) that establish and maintain the facility Safety Envelope necessary for normal safe operation of the facility; as identified in the FSAR, the OSRs, and Safety Assessment Documents (SADs). This safety equipment documentation should satisfy guidelines for the SDD given in WHC-SD-CP-TI-18 1, Criteria for Identification and Control of Equipment Necessary for Preservation of the Safety Envelope and Safe Operation of PFP. The basis for operational, alarm response, maintenance, and surveillance procedures are also identified and justified in this document. This document and its appendices address the following elements of the PFP Thermal Stabilization project: Functional and design requirements; Design description; Safety Envelope Analysis; Safety Equipment Class; and Operational, maintenance and surveillance procedures

  15. PFP issues/assumptions development and management planning guide

    International Nuclear Information System (INIS)

    SINCLAIR, J.C.

    1999-01-01

    The PFP Issues/Assumptions Development and Management Planning Guide presents the strategy and process used for the identification, allocation, and maintenance of an Issues/Assumptions Management List for the Plutonium Finishing Plant (PFP) integrated project baseline. Revisions to this document will include, as attachments, the most recent version of the Issues/Assumptions Management List, both open and current issues/assumptions (Appendix A), and closed or historical issues/assumptions (Appendix B). This document is intended be a Project-owned management tool. As such, this document will periodically require revisions resulting from improvements of the information, processes, and techniques as now described. Revisions that suggest improved processes will only require PFP management approval

  16. PFP deactivation project management plan

    International Nuclear Information System (INIS)

    Bogen, D.M.

    1997-01-01

    This document identifies the overall approach for deactivation of the Plutonium Finishing Plant (PFP) Complex, excluding the vaults, and includes a draft set of End Point Criteria for all buildings being deactivated

  17. PFP solution stabilization

    International Nuclear Information System (INIS)

    Aftanas, B.L.

    1996-01-01

    This Functional Design Criteria (FDC) addresses remediation of the plutonium-bearing solutions currently in inventory at the Plutonium Finishing Plant (PFP). The recommendation from the Environmental Impact Statement (EIS) is that the solutions be treated thermally and stabilized as a solid for long term storage. For solutions which are not discardable, the baseline plan is to utilize a denitration process to stabilize the solutions prior to packaging for storage

  18. Evidence for phosphoprotein phosphatase in Streptomyces granaticolor

    Czech Academy of Sciences Publication Activity Database

    Bobek, J.; Hercík, K.; Dobrová, Zuzana; Branny, Pavel; Nádvorník, Richard; Janeček, Jiří

    2000-01-01

    Roč. 45, č. 4 (2000), s. 310-312 ISSN 0015-5632 R&D Projects: GA ČR GA204/99/1534 Institutional research plan: CEZ:AV0Z5020903 Keywords : streptomycetes * phosphoprotein phosphatase Subject RIV: EE - Microbiology, Virology Impact factor: 0.752, year: 2000

  19. PFP Interface identification and management planning guide

    International Nuclear Information System (INIS)

    SINCLAIR, J.C.

    1999-01-01

    The purpose of-this planning guide is to present the process used to identify, document, and control PFP Stabilization and Deactivation Project interfaces. Revisions to this document will include, as attachments, the most recent version of the Project Interface Management List. A preliminary Interface Management List is included in Appendix A. This document is intended be a Project owned management tool. As such, this document will periodically require revisions resulting from improvements of the information, processes, and techniques as now described. For most revisions that suggest improved processes, PFP management approval is all that will be required

  20. Technical Basis Document for PFP Area Monitoring Dosimetry Program

    CERN Document Server

    Cooper, J R

    2000-01-01

    This document describes the phantom dosimetry used for the PFP Area Monitoring program and establishes the basis for the Plutonium Finishing Plant's (PFP) area monitoring dosimetry program in accordance with the following requirements: Title 10, Code of Federal Regulations (CFR), part 835, ''Occupational Radiation Protection'' Part 835.403; Hanford Site Radiological Control Manual (HSRCM-1), Part 514; HNF-PRO-382, Area Dosimetry Program; and PNL-MA-842, Hanford External Dosimetry Technical Basis Manual.

  1. PFP total operating efficiency calculation and basis of estimate

    International Nuclear Information System (INIS)

    SINCLAIR, J.C.

    1999-01-01

    The purpose of the Plutonium Finishing Plant (PFP) Total Operating Efficiency Calculation and Basis of Estimate document is to provide the calculated value and basis of estimate for the Total Operating Efficiency (TOE) for the material stabilization operations to be conducted in 234-52 Building. This information will be used to support both the planning and execution of the Plutonium Finishing Plant (PFP) Stabilization and Deactivation Project's (hereafter called the Project) resource-loaded, integrated schedule

  2. Technical Basis Document for PFP Area Monitoring Dosimetry Program

    International Nuclear Information System (INIS)

    COOPER, J.R.

    2000-01-01

    This document describes the phantom dosimetry used for the PFP Area Monitoring program and establishes the basis for the Plutonium Finishing Plant's (PFP) area monitoring dosimetry program in accordance with the following requirements: Title 10, Code of Federal Regulations (CFR), part 835, ''Occupational Radiation Protection'' Part 835.403; Hanford Site Radiological Control Manual (HSRCM-1), Part 514; HNF-PRO-382, Area Dosimetry Program; and PNL-MA-842, Hanford External Dosimetry Technical Basis Manual

  3. Plutonium Finishing Plant (PFP) Treatment and Storage Unit Waste Analysis Plan

    International Nuclear Information System (INIS)

    PRIGNANO, A.L.

    2000-01-01

    The purpose of this waste analysis plan (WAP) is to document waste analysis activities associated with the Plutonium Finishing Plant Treatment and Storage Unit (PFP Treatment and Storage Unit) to comply with Washington Administrative Code (WAC) 173-303-300(1), (2), (4)(a) and (5). The PFP Treatment and Storage Unit is an interim status container management unit for plutonium bearing mixed waste radiologically managed as transuranic (TRU) waste. TRU mixed (TRUM) waste managed at the PFP Treatment and Storage Unit is destined for the Waste Isolation Pilot Plant (WIPP) and therefore is not subject to land disposal restrictions [WAC 173-303-140 and 40 CFR 268]. The PFP Treatment and Storage Unit is located in the 200 West Area of the Hanford Facility, Richland Washington (Figure 1). Because dangerous waste does not include source, special nuclear, and by-product material components of mixed waste, radionuclides are not within the scope of this documentation. The information on radionuclides is provided only for general knowledge

  4. PFP Emergency Lighting Study

    International Nuclear Information System (INIS)

    BUSCH, M.S.

    2000-01-01

    NFPA 101, section 5-9 mandates that, where required by building classification, all designated emergency egress routes be provided with adequate emergency lighting in the event of a normal lighting outage. Emergency lighting is to be arranged so that egress routes are illuminated to an average of 1.0 footcandle with a minimum at any point of 0.1 footcandle, as measured at floor level. These levels are permitted to drop to 60% of their original value over the required 90 minute emergency lighting duration after a power outage. The Plutonium Finishing Plant (PFP) has two designations for battery powered egress lights ''Emergency Lights'' are those battery powered lights required by NFPA 101 to provide lighting along officially designated egress routes in those buildings meeting the correct occupancy requirements. Emergency Lights are maintained on a monthly basis by procedure ZSR-12N-001. ''Backup Lights'' are battery powered lights not required by NFPA, but installed in areas where additional light may be needed. The Backup Light locations were identified by PFP Safety and Engineering based on several factors. (1) General occupancy and type of work in the area. Areas occupied briefly during a shiftly surveillance do not require backup lighting while a room occupied fairly frequently or for significant lengths of time will need one or two Backup lights to provide general illumination of the egress points. (2) Complexity of the egress routes. Office spaces with a standard hallway/room configuration will not require Backup Lights while a large room with several subdivisions or irregularly placed rooms, doors, and equipment will require Backup Lights to make egress safer. (3) Reasonable balance between the safety benefits of additional lighting and the man-hours/exposure required for periodic light maintenance. In some plant areas such as building 236-Z, the additional maintenance time and risk of contamination do not warrant having Backup Lights installed in all rooms

  5. PFP: Automated prediction of gene ontology functional annotations with confidence scores using protein sequence data.

    Science.gov (United States)

    Hawkins, Troy; Chitale, Meghana; Luban, Stanislav; Kihara, Daisuke

    2009-02-15

    Protein function prediction is a central problem in bioinformatics, increasing in importance recently due to the rapid accumulation of biological data awaiting interpretation. Sequence data represents the bulk of this new stock and is the obvious target for consideration as input, as newly sequenced organisms often lack any other type of biological characterization. We have previously introduced PFP (Protein Function Prediction) as our sequence-based predictor of Gene Ontology (GO) functional terms. PFP interprets the results of a PSI-BLAST search by extracting and scoring individual functional attributes, searching a wide range of E-value sequence matches, and utilizing conventional data mining techniques to fill in missing information. We have shown it to be effective in predicting both specific and low-resolution functional attributes when sufficient data is unavailable. Here we describe (1) significant improvements to the PFP infrastructure, including the addition of prediction significance and confidence scores, (2) a thorough benchmark of performance and comparisons to other related prediction methods, and (3) applications of PFP predictions to genome-scale data. We applied PFP predictions to uncharacterized protein sequences from 15 organisms. Among these sequences, 60-90% could be annotated with a GO molecular function term at high confidence (>or=80%). We also applied our predictions to the protein-protein interaction network of the Malaria plasmodium (Plasmodium falciparum). High confidence GO biological process predictions (>or=90%) from PFP increased the number of fully enriched interactions in this dataset from 23% of interactions to 94%. Our benchmark comparison shows significant performance improvement of PFP relative to GOtcha, InterProScan, and PSI-BLAST predictions. This is consistent with the performance of PFP as the overall best predictor in both the AFP-SIG '05 and CASP7 function (FN) assessments. PFP is available as a web service at http://dragon.bio.purdue.edu/pfp

  6. Technical Basis Document for PFP Area Monitoring Dosimetry Program

    Energy Technology Data Exchange (ETDEWEB)

    COOPER, J.R.

    2000-04-17

    This document describes the phantom dosimetry used for the PFP Area Monitoring program and establishes the basis for the Plutonium Finishing Plant's (PFP) area monitoring dosimetry program in accordance with the following requirements: Title 10, Code of Federal Regulations (CFR), part 835, ''Occupational Radiation Protection'' Part 835.403; Hanford Site Radiological Control Manual (HSRCM-1), Part 514; HNF-PRO-382, Area Dosimetry Program; and PNL-MA-842, Hanford External Dosimetry Technical Basis Manual.

  7. Project plan remove special nuclear material from PFP project plutonium finishing plant

    International Nuclear Information System (INIS)

    BARTLETT, W.D.

    1999-01-01

    This plan presents the overall objectives, description, justification and planning for the Plutonium Finishing Plant (PFP) Remove Special Nuclear Material (SNM) Materials. The intent of this plan is to describe how this project will be managed and integrated with other facility stabilization and deactivation activities. This plan supplements the overall integrated plan presented in the Plutonium Finishing Plant Integrated Project Management Plan (IPMP), HNF-3617, Rev. 0. This project plan is the top-level definitive project management document for PFP Remove SNM Materials project. It specifies the technical, schedule, requirements and the cost baselines to manage the execution of the Remove SNM Materials project. Any deviations to the document must be authorized through the appropriate change control process

  8. PFP Interface identification and management planning guide; TOPICAL

    International Nuclear Information System (INIS)

    SINCLAIR, J.C.

    1999-01-01

    The purpose of-this planning guide is to present the process used to identify, document, and control PFP Stabilization and Deactivation Project interfaces. Revisions to this document will include, as attachments, the most recent version of the Project Interface Management List. A preliminary Interface Management List is included in Appendix A. This document is intended be a Project owned management tool. As such, this document will periodically require revisions resulting from improvements of the information, processes, and techniques as now described. For most revisions that suggest improved processes, PFP management approval is all that will be required

  9. PFP total process throughput calculation and basis of estimate

    International Nuclear Information System (INIS)

    SINCLAIR, J.C.

    1999-01-01

    The PFP Process Throughput Calculation and Basis of Estimate document provides the calculated value and basis of estimate for process throughput associated with material stabilization operations conducted in 234-52 Building. The process throughput data provided reflects the best estimates of material processing rates consistent with experience at the Plutonium Finishing Plant (PFP) and other U.S. Department of Energy (DOE) sites. The rates shown reflect demonstrated capacity during ''full'' operation. They do not reflect impacts of building down time. Therefore, these throughput rates need to have a Total Operating Efficiency (TOE) factor applied

  10. Project plan remove special nuclear material from PFP project plutonium finishing plant; TOPICAL

    International Nuclear Information System (INIS)

    BARTLETT, W.D.

    1999-01-01

    This plan presents the overall objectives, description, justification and planning for the Plutonium Finishing Plant (PFP) Remove Special Nuclear Material (SNM) Materials. The intent of this plan is to describe how this project will be managed and integrated with other facility stabilization and deactivation activities. This plan supplements the overall integrated plan presented in the Plutonium Finishing Plant Integrated Project Management Plan (IPMP), HNF-3617,Rev. 0. This project plan is the top-level definitive project management document for PFP Remove SNM Materials project. It specifies the technical, schedule, requirements and the cost baselines to manage the execution of the Remove SNM Materials project. Any deviations to the document must be authorized through the appropriate change control process

  11. A portrait of tissue phosphoprotein stability in the clinical tissue procurement process.

    Science.gov (United States)

    Espina, Virginia; Edmiston, Kirsten H; Heiby, Michael; Pierobon, Mariaelena; Sciro, Manuela; Merritt, Barbara; Banks, Stacey; Deng, Jianghong; VanMeter, Amy J; Geho, David H; Pastore, Lucia; Sennesh, Joel; Petricoin, Emanuel F; Liotta, Lance A

    2008-10-01

    Little is known about the preanalytical fluctuations of phosphoproteins during tissue procurement for molecular profiling. This information is crucial to establish guidelines for the reliable measurement of these analytes. To develop phosphoprotein profiles of tissue subjected to the trauma of excision, we measured the fidelity of 53 signal pathway phosphoproteins over time in tissue specimens procured in a community clinical practice. This information provides strategies for potential surrogate markers of stability and the design of phosphoprotein preservative/fixation solutions. Eleven different specimen collection time course experiments revealed augmentation (+/-20% from the time 0 sample) of signal pathway phosphoprotein levels as well as decreases over time independent of tissue type, post-translational modification, and protein subcellular location (tissues included breast, colon, lung, ovary, and uterus (endometrium/myometrium) and metastatic melanoma). Comparison across tissue specimens showed an >20% decrease of protein kinase B (AKT) Ser-473 (p 20% increases within 90-min postprocurement. Endothelial nitric-oxide synthase Ser-1177 did not change over the time period evaluated with breast or leiomyoma tissue. Treatment with phosphatase or kinase inhibitors alone revealed that tissue kinase pathways are active ex vivo. Combinations of kinase and phosphatase inhibitors appeared to stabilize proteins that exhibited increases in the presence of phosphatase inhibitors alone (ATF-2 Thr-71, SAPK/JNK Thr-183/Tyr-185, STAT1 Tyr-701, JAK1 Tyr-1022/1023, and PAK1/PAK2 Ser-199/204/192/197). This time course study 1) establishes the dynamic nature of specific phosphoproteins in excised tissue, 2) demonstrates augmented phosphorylation in the presence of phosphatase inhibitors, 3) shows that kinase inhibitors block the upsurge in phosphorylation of phosphoproteins, 4) provides a rational strategy for room temperature preservation of proteins, and 5) constitutes a

  12. Anticipated Radiological Dose to Worker for Plutonium Stabilization and Handling at PFP - Project W-460

    International Nuclear Information System (INIS)

    WEISS, E.V.

    2000-01-01

    This report provides estimates of the expected whole body and extremity radiological dose, expressed as dose equivalent (DE), to workers conducting planned plutonium (Pu) stabilization processes at the Hanford Site Plutonium Finishing Plant (PFP). The report is based on a time and motion dose study commissioned for Project W-460, Plutonium Stabilization and Handling, to provide personnel exposure estimates for construction work in the PFP storage vault area plus operation of stabilization and packaging equipment at PFP

  13. Anticipated Radiological Dose to Worker for Plutonium Stabilization and Handling at PFP - Project W-460

    CERN Document Server

    Weiss, E V

    2000-01-01

    This report provides estimates of the expected whole body and extremity radiological dose, expressed as dose equivalent (DE), to workers conducting planned plutonium (Pu) stabilization processes at the Hanford Site Plutonium Finishing Plant (PFP). The report is based on a time and motion dose study commissioned for Project W-460, Plutonium Stabilization and Handling, to provide personnel exposure estimates for construction work in the PFP storage vault area plus operation of stabilization and packaging equipment at PFP.

  14. Plutonium Finishing Plan (PFP) Treatment and Storage Unit Interim Status Closure Plan

    International Nuclear Information System (INIS)

    PRIGNANO, A.L.

    2000-01-01

    This document describes the planned activities and performance standards for closing the Plutonium Finishing Plant (PFP) Treatment and Storage Unit. The PFP Treatment and Storage Unit is located within the 234-52 Building in the 200 West Area of the Hanford Facility. Although this document is prepared based upon Title 40 Code of Federal Regulations (CFR), Part 265, Subpart G requirements, closure of the unit will comply with Washington Administrative Code (WAC) 173-303-610 regulations pursuant to Section 5.3 of the Hanford Federal Facility Agreement and Consent Order (Tri-Party Agreement) Action Plan (Ecology et al. 1996). Because the PFP Treatment and Storage Unit manages transuranic mixed (TRUM) waste, there are many controls placed on management of the waste. Based on the many controls placed on management of TRUM waste, releases of TRUM waste are not anticipated to occur in the PFP Treatment and Storage Unit. Because the intention is to clean close the PFP Treatment and Storage Unit, postclosure activities are not applicable to this closure plan. To clean close the unit, it will be demonstrated that dangerous waste has not been left onsite at levels above the closure performance standard for removal and decontamination. If it is determined that clean closure is not possible or is environmentally impractical, the closure plan will be modified to address required postclosure activities. The PFP Treatment and Storage Unit will be operated to immobilize and/or repackage plutonium-bearing waste in a glovebox process. The waste to be processed is in a solid physical state (chunks and coarse powder) and will be sealed into and out of the glovebox in closed containers. The containers of immobilized waste will be stored in the glovebox and in additional permitted storage locations at PFP. The waste will be managed to minimize the potential for spills outside the glovebox, and to preclude spills from reaching soil. Containment surfaces will be maintained to ensure

  15. The effect of complexing phosphoproteins to decalcified collagen on in vitro calcification.

    Science.gov (United States)

    Endo, A; Glimcher, M J

    1989-01-01

    Decalcified samples of chicken bone containing phosphoproteins of varying concentrations were used to assess the effect of phosphoproteins and of protein-bound Ser(P) and Thr(P) in the in vitro nucleation of a Ca-P solid phase from metastable solutions of Ca and P. Phosphoproteins of bone as well as the phosphoproteins from egg yolk (phosvitin) were used. Increasing concentrations of phosphoprotein [as measured by the amount of protein bound Ser(P) and Thr(P)] in the decalcified bone particles significantly reduced the time required for nucleation to occur after exposure to metastable solutions of Ca and P (decreased operational lag times). Treatment with wheat germ acid phosphatase markedly reduced the concentration of Ser(P) and Thr(P) in the decalcified bone samples and in the decalcified bone collagen samples complexed with phosphoproteins (almost to zero). The loss of the organic phosphate groups significantly increased the operational lag time, but did not abolish nucleation of apatite crystals by the bone collagen fibrils essentially devoid of Ser(P) and Thr(P). Bone phosphoproteins were not specific; substitution of phosvitin for bone phosphoproteins as complexes with bone collagen also proved to be effective facilitators of nucleation, which was interesting since both types of phosphoproteins have certain common chemical and structural characteristics. Noncollagenous components other than phosphoproteins were present in the decalcified bone samples. However, the marked dependence of the lag time on the Ser(P) and Thr(P) concentrations and the very marked diminution in the efficacy of the nucleation phenomenon as a result of treatment with wheat germ acid phosphatase, clearly suggests that the organic phosphate residues of the phosphoproteins play a direct and significant role in the process of in vitro nucleation of a solid phase of Ca and P (apatite) by bone collagen, and by implication, possibly in in vivo mineralization as well.

  16. Plutonium Finishing Plant (PFP) Final Safety Analysis Report (FSAR) [SEC 1 THRU 11

    Energy Technology Data Exchange (ETDEWEB)

    ULLAH, M K

    2001-02-26

    The Plutonium Finishing Plant (PFP) is located on the US Department of Energy (DOE) Hanford Site in south central Washington State. The DOE Richland Operations (DOE-RL) Project Hanford Management Contract (PHMC) is with Fluor Hanford Inc. (FH). Westinghouse Safety Management Systems (WSMS) provides management support to the PFP facility. Since 1991, the mission of the PFP has changed from plutonium material processing to preparation for decontamination and decommissioning (D and D). The PFP is in transition between its previous mission and the proposed D and D mission. The objective of the transition is to place the facility into a stable state for long-term storage of plutonium materials before final disposition of the facility. Accordingly, this update of the Final Safety Analysis Report (FSAR) reflects the current status of the buildings, equipment, and operations during this transition. The primary product of the PFP was plutonium metal in the form of 2.2-kg, cylindrical ingots called buttoms. Plutonium nitrate was one of several chemical compounds containing plutonium that were produced as an intermediate processing product. Plutonium recovery was performed at the Plutonium Reclamation Facility (PRF) and plutonium conversion (from a nitrate form to a metal form) was performed at the Remote Mechanical C (RMC) Line as the primary processes. Plutonium oxide was also produced at the Remote Mechanical A (RMA) Line. Plutonium processed at the PFP contained both weapons-grade and fuels-grade plutonium materials. The capability existed to process both weapons-grade and fuels-grade material through the PRF and only weapons-grade material through the RMC Line although fuels-grade material was processed through the line before 1984. Amounts of these materials exist in storage throughout the facility in various residual forms left from previous years of operations.

  17. Phosphoprotein phosphatase of bovine spleen cell nuclei: physicochemical properties

    International Nuclear Information System (INIS)

    Rezyapkin, V.I.; Leonova, L.E.; Komkova, A.I.

    1986-01-01

    The physicochemical properties of phosphoprotein phosphatase (EC 1.3.1.16) from bovine spleen cell nuclei were studied. The enzyme possesses broad substrate specificity and catalyzes the dephosphorylation of phosphocasein, ATP, ADP, and p-nitrophenyl phosphate (pNPP). K/sub m/ for ATP, ADP, and pNPP are equal to 0.44, 0.43, and 1.25 mM, respectively. M/sub r/ of the enzyme, according to the data of gel filtraction of Sephadex G-75 and electrophoresis in polyacrylamide gel of various concentrations is ∼ 33,000. In electrophoresis in the presence of SDS, two protein bands with M/sub r/ 12,000 and 18,000 are detected. In the enzyme molecule, acid amino acid residues predominate; two free SH groups and two disulfide bridges are detected. Phosphoprotein phosphatase is a glycoprotein, containing ∼ 22% carbonhydrates. The protein possesses a supplementary absorption maximum at 560 nm. Ammonium molybdate is a competitive inhibitor with K/sub i/ 0.37 μM, while sodium fluoride is a noncompetitive inhibitor with K/sub i/ 1.3 mM. Incubation in the presence of 2 mM phenylmethylsulfonyl fluoride for 25 h leads to a loss of ∼ 46% of the enzymatic activity. Ammonium molybdate, sodium fluoride, and PMSF are reversible inhibitors. Modifications of the SH groups, NH 2 groups, and histidine leads to a decrease in the enzymatic activity. Incubation of phosphoprotein phosphatase with [γ- 32 P]ATP leads to the incorporation of 0.33 mole 33 P per mole of the enzyme. The mechanism of hydrolysis of the phosphodiester bond, catalyzed by the enzyme, is discussed

  18. Definition and means of maintaining the criticality detectors and alarms portion of the PFP safety envelope

    International Nuclear Information System (INIS)

    White, W.F.

    1997-01-01

    The Criticality Alarm System (CAS) provides continuous detection for high radiation (criticality) events and automatically initiates an evacuation signal to affected personnel. The Safety Envelope (SE) for PFP includes the necessary equipment and the required procedures to ensure the CAS is capable of performing its intended function. This document provides the definition and means of maintaining the SE for PFP related to the CAS. This document also identifies and provides a justification for those portions of the CAS excluded from the PFP Safety Envelope

  19. Phosphoproteins in extracellular vesicles as candidate markers for breast cancer.

    Science.gov (United States)

    Chen, I-Hsuan; Xue, Liang; Hsu, Chuan-Chih; Paez, Juan Sebastian Paez; Pan, Li; Andaluz, Hillary; Wendt, Michael K; Iliuk, Anton B; Zhu, Jian-Kang; Tao, W Andy

    2017-03-21

    The state of protein phosphorylation can be a key determinant of cellular physiology such as early-stage cancer, but the development of phosphoproteins in biofluids for disease diagnosis remains elusive. Here we demonstrate a strategy to isolate and identify phosphoproteins in extracellular vesicles (EVs) from human plasma as potential markers to differentiate disease from healthy states. We identified close to 10,000 unique phosphopeptides in EVs isolated from small volumes of plasma samples. Using label-free quantitative phosphoproteomics, we identified 144 phosphoproteins in plasma EVs that are significantly higher in patients diagnosed with breast cancer compared with healthy controls. Several biomarkers were validated in individual patients using paralleled reaction monitoring for targeted quantitation. This study demonstrates that the development of phosphoproteins in plasma EV as disease biomarkers is highly feasible and may transform cancer screening and monitoring.

  20. In-depth performance evaluation of PFP and ESG sequence-based function prediction methods in CAFA 2011 experiment

    Directory of Open Access Journals (Sweden)

    Chitale Meghana

    2013-02-01

    Full Text Available Abstract Background Many Automatic Function Prediction (AFP methods were developed to cope with an increasing growth of the number of gene sequences that are available from high throughput sequencing experiments. To support the development of AFP methods, it is essential to have community wide experiments for evaluating performance of existing AFP methods. Critical Assessment of Function Annotation (CAFA is one such community experiment. The meeting of CAFA was held as a Special Interest Group (SIG meeting at the Intelligent Systems in Molecular Biology (ISMB conference in 2011. Here, we perform a detailed analysis of two sequence-based function prediction methods, PFP and ESG, which were developed in our lab, using the predictions submitted to CAFA. Results We evaluate PFP and ESG using four different measures in comparison with BLAST, Prior, and GOtcha. In addition to the predictions submitted to CAFA, we further investigate performance of a different scoring function to rank order predictions by PFP as well as PFP/ESG predictions enriched with Priors that simply adds frequently occurring Gene Ontology terms as a part of predictions. Prediction accuracies of each method were also evaluated separately for different functional categories. Successful and unsuccessful predictions by PFP and ESG are also discussed in comparison with BLAST. Conclusion The in-depth analysis discussed here will complement the overall assessment by the CAFA organizers. Since PFP and ESG are based on sequence database search results, our analyses are not only useful for PFP and ESG users but will also shed light on the relationship of the sequence similarity space and functions that can be inferred from the sequences.

  1. Plutonium Finishing Plant (PFP) Criticality Alarm System Commercial Grade Item (CGI) Critical Characteristics

    International Nuclear Information System (INIS)

    WHITE, W.F.

    1999-01-01

    This document specifies the critical characteristics for Commercial Grade Items (CGI) procured for PFP's criticality alarm system as required by HNF-PRO-268 and HNF-PRO-1819. These are the minimum specifications that the equipment must meet in order to properly perform its safety function. There may be several manufacturers or models that meet the critical characteristics for any one item. PFP's Criticality Alarm System includes the nine criticality alarm system panels and their associated hardware. This includes all parts up to the first breaker in the electrical distribution system. Specific system boundaries and justifications are contained in HNF-SD-CP-SDD-003, ''Definition and Means of Maintaining the Criticality Detectors and Alarms Portion of the PFP Safety Envelope.'' The procurement requirements associated with the system necessitates procurement of some system equipment as Commercial Grade Items in accordance with HNF-PRO-268, ''Control of Purchased Items and Services.''

  2. Engineering work plan for PFP criticality alarm panel first unit re-build

    International Nuclear Information System (INIS)

    Clem, W.E.

    1994-01-01

    This document describes the first step in increasing the quality, reliability, and ease of maintenance of the nine Criticality Alarm Panels (CAP) at PFP. Development control practices and guidelines of WHC-CM-6-1, EP-2.4 and WHC-IP-1026, EPG-2.4 are applied to develop a prototype of a replacement Criticality Alarm Panel (CAP) with facility-use potential. During the development of the prototype CAP, the design requirements of all of PFP's nine CAPs are considered to develop standardized hardware and detailed design drawings that are tailored to PFP maintenance needs. Increased quality and reliability is achieved through quality hardware, proven technology and design techniques, and the use of the Class 1E workmanship standards of WHC-CM-8-1. The end result of the work described by this work plan is a verified/read-to-install replacement for CAP Z4 and verified/released H-2 drawings that are formatted such that they can easily be replicated when producing design drawings for the other eight CAPs

  3. Unphosphorylated rhabdoviridae phosphoproteins form elongated dimers in solution.

    Science.gov (United States)

    Gerard, Francine C A; Ribeiro, Euripedes de Almeida; Albertini, Aurélie A V; Gutsche, Irina; Zaccai, Guiseppe; Ruigrok, Rob W H; Jamin, Marc

    2007-09-11

    The phosphoprotein (P) is an essential component of the replication machinery of rabies virus (RV) and vesicular stomatitis virus (VSV), and the oligomerization of P, potentially controlled by phosphorylation, is required for its function. Up to now the stoichiometry of phosphoprotein oligomers has been controversial. Size exclusion chromatography combined with detection by multiangle laser light scattering shows that the recombinant unphosphorylated phosphoproteins from VSV and from RV exist as dimers in solution. Hydrodynamic analysis indicates that the dimers are highly asymmetric, with a Stokes radius of 4.8-5.3 nm and a frictional ratio larger than 1.7. Small-angle neutron scattering experiments confirm the dimeric state and the asymmetry of the structure and yield a radius of gyration of about 5.3 nm and a cross-sectional radius of gyration of about 1.6-1.8 nm. Similar hydrodynamic properties and molecular dimensions were obtained with a variant of VSV phosphoprotein in which Ser60 and Thr62 are substituted by Asp residues and which has been reported previously to mimic phosphorylation by inducing oligomerization and activating transcription. Here, we show that this mutant also forms a dimer with hydrodynamic properties and molecular dimensions similar to those of the wild type protein. However, incubation at 30 degrees C for several hours induced self-assembly of both wild type and mutant proteins, leading to the formation of irregular filamentous structures.

  4. Plutonium Finishing Plant (PFP) Waste Composition and High Efficiency Particulate Air Filter Loading

    Energy Technology Data Exchange (ETDEWEB)

    ZIMMERMAN, B.D.

    2000-12-11

    This analysis evaluates the effect of the Plutonium Finishing Plant (PFP) waste isotopic composition on Tank Farms Final Safety Analysis Report (FSAR) accidents involving high-efficiency particulate air (HEPA) filter failure in Double-Contained Receiver Tanks (DCRTs). The HEPA Filter Failure--Exposure to High Temperature or Pressure, and Steam Intrusion From Interfacing Systems accidents are considered. The analysis concludes that dose consequences based on the PFP waste isotopic composition are bounded by previous FSAR analyses. This supports USQD TF-00-0768.

  5. CSER 99-001: PFP LAB Dentirating calciner

    International Nuclear Information System (INIS)

    MILLER, E.M.; DOBBIN, K.D.

    1999-01-01

    A criticality safety evaluation report was prepared for the Plutonium Finishing Plant (PFP) laboratory denigrating calciner, located in Glovebox 188-1, that converts Pu(NO 3 ) 4 solutions to the high fired stable oxide PuO 2 . Fissile mass limits and volume limits are set for the glovebox for testing operations and training operators using only nitric acid feed to a plutonium oxide bed in the calciner

  6. A New Property of Conjugated Polymer PFP: Catalytic Degradation of Methylene Blue Aqueous Solution

    Institute of Scientific and Technical Information of China (English)

    2005-01-01

    A new property of conjugated polymer poly(furancarbinol-co-phenol)(PFP) was studied.The target copolymer was used as a catalyst after proper heating treatment. And dye methylene blue (MB) could be fully degraded and largely mineralized on PFP, under natural light or even in dark, in a few minutes. Furthermore, the catalytic activity could be preserved after several runs and the catalyst was readily separated. The effect of calcination temperature was also observed.

  7. Engineering report (conceptual design) PFP solution stabilization

    Energy Technology Data Exchange (ETDEWEB)

    Witt, J.B.

    1997-07-17

    This Engineering Report (Conceptual Design) addresses remediation of the plutonium-bearing solutions currently in inventory at the Plutonium Finishing Plant (PFP). The recommendation from the Environmental Impact Statement (EIS) is that the solutions be treated thermally and stabilized as a solid for long term storage. For solutions which are not discardable, the baseline plan is to utilize a denitration process to stabilize the solutions prior to packaging for storage.

  8. Engineering report (conceptual design) PFP solution stabilization

    International Nuclear Information System (INIS)

    Witt, J.B.

    1997-01-01

    This Engineering Report (Conceptual Design) addresses remediation of the plutonium-bearing solutions currently in inventory at the Plutonium Finishing Plant (PFP). The recommendation from the Environmental Impact Statement (EIS) is that the solutions be treated thermally and stabilized as a solid for long term storage. For solutions which are not discardable, the baseline plan is to utilize a denitration process to stabilize the solutions prior to packaging for storage

  9. Inhibition of hydroxyapatite growth by casein, a potential salivary phosphoprotein homologue.

    Science.gov (United States)

    Romero, Maria J R H; Nakashima, Syozi; Nikaido, Toru; Ichinose, Shizuko; Sadr, Alireza; Tagami, Junji

    2015-08-01

    Salivary phosphoproteins are essential in tooth mineral regulation but are often overlooked in vitro. This study aimed to evaluate the effect of casein, as a salivary phosphoprotein homologue, on the deposition and growth of hydroxyapatite (HA) on tooth surfaces. Hydroxyapatite growth was quantified using seeded crystal systems. Artificial saliva (AS) containing HA powder and 0, 10, 20, 50, or 100 μg ml(-1) of casein, or 100 μg ml(-1) of dephosphorylated casein (Dcasein), was incubated for 0-8 h at 37°C, pH 7.2. Calcium concentrations were measured using atomic absorption spectroscopy (AAS). Surface precipitation of HA on bovine enamel and dentine blocks, incubated in similar conditions for 7 d, was examined using field emission scanning electron microscopy (FE-SEM) and transmission electron microscopy (TEM) with selected area electron diffraction (SAED). Casein adsorption was assessed using modified Lowry assays and zeta-potential measurements. The AAS results revealed a concentration-dependent inhibition of calcium consumption. Hydroxyapatite precipitation occurred when no casein was present, whereas precipitation of HA was apparently completely inhibited in casein-containing groups. Adsorption data demonstrated increasingly negative zeta-potential with increased casein concentration and an affinity constant similar to proline-rich proteins with Langmuir modelling. Casein inhibited the deposition and growth of HA primarily through the binding of esterized phosphate to HA active sites, indicating its potential as a mineral-regulating salivary phosphoprotein homologue in vitro. © 2015 Eur J Oral Sci.

  10. System design description PFP thermal stabilization

    International Nuclear Information System (INIS)

    RISENMAY, H.R.

    1998-01-01

    The purpose of this document is to provide a system design description and design basis for the Plutonium Finishing P1ant (PFP) Thermal Stabilization project. The sources of material for this project are residues scraped from glovebox floors and materials already stored in vault storage that need further stabilizing to meet the 3013 storage requirements. Stabilizing this material will promote long term storage and reduced worker exposure. This document addresses: function design, equipment, and safety requirements for thermal stabilization of plutonium residues and oxides

  11. Project Plan For Remove Special Nuclear Material (SNM) from Plutonium Finishing Plant (PFP) Project

    International Nuclear Information System (INIS)

    BARTLETT, W.D.

    1999-01-01

    This plan presents the overall objectives, description, justification and planning for the Plutonium Finishing Plant (PFP) Remove SNM Materials. The intent of this plan is to describe how this project will be managed and integrated with other facility stabilization and deactivation activities. This plan supplements the overall integrated plan presented in the Plutonium Finishing Plant Integrated Project Management Plan (IPMP), HNF-3617. This project plan is the top-level definitive project management document for the PFP Remove SNM Materials project. It specifies the technical, schedule, requirements and the cost baseline to manage the execution of the Remove SNM Materials project. Any deviation to the document must be authorized through the appropriate change control process. The Remove SNM Materials project provides the necessary support and controls required for DOE-HQ, DOE-RL, BWHC, and other DOE Complex Contractors the path forward to negotiate shipped/receiver agreements, schedule shipments, and transfer material out of PFP to enable final deactivation

  12. 12th International Conference on Second Messengers and Phosphoproteins

    Czech Academy of Sciences Publication Activity Database

    Tuháčková, Zdena

    2004-01-01

    Roč. 32, č. 3 (2004), s. 89-91 ISSN 1211-2526. [International conference on second messengers and phosphoproteins /12./. Montreal, 03.08.2004-07.08.2004] R&D Projects: GA ČR GA301/04/0550; GA AV ČR KSK5020115 Institutional research plan: CEZ:AV0Z5052915 Keywords : MTOR -PI3-K signalling * p70 S 6 kinase * v-Src Subject RIV: CE - Biochemistry

  13. IDENTIFICATION AND FUNCTIONAL ANNOTATION OF APOPLASTIC PHOSPHOPROTEINS OF HIPPOPHAE RHAMNOIDES SEEDLINGS

    Directory of Open Access Journals (Sweden)

    Ravi Gupta

    2016-12-01

    Full Text Available Phosphorylation is a reversible switch that regulates the biological activities of the proteins. Although there are ample of reports on the plant phosphoproteome analysis, phosphorylation status of apoplastic proteins has not been investigated profoundly. Here a shotgun proteomics approach was used to identify the phosphoproteins from the apoplast of the Hippophae rhamnoides (Seabuckthorn. A total of 123 phosphoproteins were identified using an SYNAPT G2 quadrupole time-of-flight mass spectrometer (Q-ToF-MS. Functional annotation of the identified phosphoproteins using PANTHER, Gene ontology, and KEGG programs showed that the majority of proteins were associated with the transporter, nucleic acid binding and amino acid metabolic activities. Prediction of secretory nature of the identified proteins using SignalP and SecretomeP servers showed that 56 % of the proteins were secretory, while rest of the 44 % of the proteins were non-secretory. PhosPhAt 4.0 detected 534 putative phosphorylation sites in the 75 unique Arabidopsis annotated proteins, wherein 195 (36% were on the serine residue, 196 (37% were on the threonine residue and 143 (27% were detected on the tyrosine residue. Taken together, our results provide the first insight into the phosphorylation-mediated regulation of apoplastic proteins by cellular processes, which would be helpful in an in-depth understanding of the apoplastic signaling

  14. Phosphoproteins in extracellular vesicles as candidate markers for breast cancer

    OpenAIRE

    Chen, I-Hsuan; Xue, Liang; Hsu, Chuan-Chih; Paez, Juan Sebastian Paez; Pan, Li; Andaluz, Hillary; Wendt, Michael K.; Iliuk, Anton B.; Zhu, Jian-Kang; Tao, W. Andy

    2017-01-01

    Protein phosphorylation is a major regulatory mechanism for many cellular functions, but no phosphoprotein in biofluids has been developed for disease diagnosis because of the presence of active phosphatases. This study presents a general strategy to isolate and identify phosphoproteins in extracellular vesicles (EVs) from human plasma as potential markers to differentiate disease from healthy states. We identified close to 10,000 unique phosphopeptides in EVs from small volumes of plasma sam...

  15. 1999 Annual Cathodic Protection Survey Report for PFP

    International Nuclear Information System (INIS)

    BOWMAN, T.J.

    2000-01-01

    This cathodic protection (CP) report documents the results of the 1999 annual CP survey of the underground piping within PFP property. An annual survey of CP systems is required by Washington Administrative Code (WAC). A spreadsheet to document the 1999 annual survey polarization data is included in this report. Graphs are included to trend the cathodic voltages and the polarization voltages at each test station on PFP property. The trending spans from 1994 to 1999. Graphs are also included to trend voltage and amperage outputs of each rectifier during the annual surveys. During the annual survey, resistance testing between the underground piping was conducted at each test station. The testing showed that all piping (with test leads into the test stations) was continuous with every pipe represented in the test stations. The resistance data is not documented in this report but can be accessed in work package 22-99-01003. During the annual survey, the wiring configurations of anode junction boxes AJB(R45-1) and AJB(45-1) were documented. The sketches can be accessed from the JCS work record of work package 22-99-01003. Analysis, conclusions, and recommendations of the 1999 annual CP survey results are included in this report

  16. PFP vault operations containers for Plutonium Handling and Storage Critical Characteristics

    International Nuclear Information System (INIS)

    BONADIE, E.P.

    2000-01-01

    This document specifies the critical characteristics for containers procured for Plutonium Finishing Plant's (PFP's) Vault Operations system as required by HNF-PRO-268 and HNF-PRO-1819. These are the minimum specifications that the equipment must meet in order to perform its safety function

  17. Operability test procedure for PFP wastewater sampling facility

    International Nuclear Information System (INIS)

    Hirzel, D.R.

    1995-01-01

    Document provides instructions for performing the Operability Test of the 225-WC Wastewater Sampling Station which monitors the discharge to the Treated Effluent Disposal Facility from the Plutonium Finishing Plant. This Operability Test Procedure (OTP) has been prepared to verify correct configuration and performance of the PFP Wastewater sampling system installed in Building 225-WC located outside the perimeter fence southeast of the Plutonium Finishing Plant (PFP). The objective of this test is to ensure the equipment in the sampling facility operates in a safe and reliable manner. The sampler consists of two Manning Model S-5000 units which are rate controlled by the Milltronics Ultrasonic flowmeter at manhole No.C4 and from a pH measuring system with the sensor in the stream adjacent to the sample point. The intent of the dual sampling system is to utilize one unit to sample continuously at a rate proportional to the wastewater flow rate so that the aggregate tests are related to the overall flow and thereby eliminate isolated analyses. The second unit will only operate during a high or low pH excursion of the stream (hence the need for a pH control). The major items in this OTP include testing of the Manning Sampler System and associated equipment including the pH measuring and control system, the conductivity monitor, and the flow meter

  18. Plutonium Finishing Plant (PFP) Standards/Requirements Identification Document (S/RID)

    Energy Technology Data Exchange (ETDEWEB)

    Maddox, B.S.

    1996-01-01

    This Standards/Requirements Identification Document (S/RID) sets forth the Environmental Safety and Health (ESH) standards/requirements for the Plutonium Finishing Plant (PFP). This S/RID is applicable to the appropriate life cycle phases of design, construction, operation, and preparation for decommissioning. These standards/requirements are adequate to ensure the protection of the health and safety of workers, the public, and the environment.

  19. Plutonium Finishing Plant (PFP) Standards/Requirements Identification Document (S/RID)

    International Nuclear Information System (INIS)

    Maddox, B.S.

    1996-01-01

    This Standards/Requirements Identification Document (S/RID) sets forth the Environmental Safety and Health (ESH) standards/requirements for the Plutonium Finishing Plant (PFP). This S/RID is applicable to the appropriate life cycle phases of design, construction, operation, and preparation for decommissioning. These standards/requirements are adequate to ensure the protection of the health and safety of workers, the public, and the environment

  20. Peak pressures from hydrogen deflagrations in the PFP thermal stabilization glovebox

    International Nuclear Information System (INIS)

    Van Keuren, J.C.

    1998-01-01

    This document describes the calculations of the peak pressures due to hydrogen deflagrations in the glovebox used for thermal stabilization (glovebox HC-21A) in PFP. Two calculations were performed. The first considered the burning of hydrogen released from a 7 inch Pu can in the Inert Atmosphere Confinement (IAC) section of the glovebox. The peak pressure increase was 12400 Pa (1.8 psi). The second calculation considered burning of the hydrogen from 25 g of plutonium hydride in the airlock leading to the main portion of the glovebox. Since the glovebox door exposes most of the airlock when open, the deflagration was assumed to pressurize the entire glovebox. The peak pressure increase was 3860 Pa (0.56 psi)

  1. HANFORD PLUTONIUM FINISHG PLAN (PFP) COMPLETES PLUTONIUM STABILIZATION KEY SAFETY ISSUES CLOSED

    International Nuclear Information System (INIS)

    GERBER, M.S.

    2004-01-01

    A long and intense effort to stabilize and repackage nearly 18 metric tons (MT) of plutonium-bearing leftovers from defense production and nuclear experiments concluded successfully in February, bringing universal congratulations to the Department of Energy's Hanford Site in southeast Washington State. The victorious stabilization and packaging endeavor at the Plutonium Finishing Plant (PFP), managed and operated by prime contractor Fluor Hanford, Inc., finished ahead of all milestones in Hanford's cleanup agreement with regulators, and before deadlines set by the Defense Nuclear Facilities Safety Board (DNFSB), a part of the federal Executive Branch that oversees special nuclear materials. The PFP stabilization and packaging project also completed under budget for its four-year tenure, and has been nominated for a DOE Secretarial Award. It won the Project of the Year Award in the local chapter competition of the Project Management Institute, and is being considered for awards at the regional and national level

  2. The subcellular distribution of the human ribosomal "stalk" components: P1, P2 and P0 proteins

    DEFF Research Database (Denmark)

    Tchórzewski, Marek; Krokowski, Dawid; Rzeski, Wojciech

    2003-01-01

    The ribosomal "stalk" structure is a distinct lateral protuberance located on the large ribosomal subunit in prokaryotic, as well as in eukaryotic cells. In eukaryotes, this ribosomal structure is composed of the acidic ribosomal P proteins, forming two hetero-dimers (P1/P2) attached...

  3. Crystallization of ribosomes from Thermus thermophilus

    International Nuclear Information System (INIS)

    Karpova, E.A.; Serdyuk, I.N.; Tarkhovskii, Yu.S.; Orlova, E.V.; Borovyagin, V.L.

    1987-01-01

    An understanding of the molecular bases of the process of protein biosynthesis on the ribosome requires a knowledge of its structure with high three-dimensional resolution involving the method of x-ray crystallographic analysis. The authors report on the production of crystals of the 70S ribosomes from a new source - the highly thermophilic bacterium Thermus thermophilus. Ribosomes for crystallization were obtained from Th. thermophilus strain HB8 by two washings in buffer with high ionic strength. The ribosome preparation was investigated for homogeneity by the method of high-speed sedimentation in a buffer containing 15 mM MgCl 2 , 50 mM NH 4 Cl, and 10 MM Tris-HCl, pH 7.5. Analysis showed that the preparation if homogeneous. The same preparation was investigated for intactness of ribosomal RNA by the method of gel electrophoresis in 2.75% acrylamide 0.5% agarose gel in a buffer containing 30 mM Tris, 30 mM NaH 2 PO 4 , 10 mM EDTA, 1-2% SDS, and 6 M urea. Analysis showed that the preparation possesses intact 16S and 23S RNA. The latter did not degrade, at least in a week of exposure of the ribosomes in buffer solution at 5 0 C. The ribosome preparation had no appreciable RNase activity, which was verified by incubating 4.5 micrograms of ribosomes with 3 micrograms of 14 C-labeled 16S rRna (50 0 C, 90 min) in a buffer containing 10 mM MgCl 2 , 100 mM NH 4 Cl, and 10 mM Tris-HCl, pH/sub 20 0 / 7.5. The incubated nonhydrolyzed RNA was precipitated with 5% trichloroacetic acid and applied on a GF/C filter. The radioactivity was determined in a toluene scintillator on an LS-100C counter

  4. Electrophoretic demonstration of glycoproteins, lipoproteins, and phosphoproteins in human and bovine enamel

    DEFF Research Database (Denmark)

    Kirkeby, S; Moe, D; Bøg-Hansen, T C

    1990-01-01

    Enamel proteins from fully mineralized human molars and from bovine tooth germs were separated by electrophoresis. The gels were stained for detection of glycoproteins, lipoproteins, and phosphoproteins. Glycoproteins were shown by periodic acid-Schiff staining and lectin blotting. In mature human...... enamel a number of high molecular weight proteins could be demonstrated after ethylenediaminetetra-acetic acid demineralization and subsequent Triton X-100 extraction. These proteins are suggested to be lipoproteins. Phosphoproteins could only be visualized in enamel matrix from the tooth germs....

  5. PFP Commercial Grade Food Pack Cans for Plutonium Handling and Storage Critical Characteristics

    International Nuclear Information System (INIS)

    BONADIE, E.P.

    1999-01-01

    This document specifies the critical characteristics for Commercial Grade Items (CGI) procured for PFP's Vault Operations system as required by HNF-PRO-268 and HNF-PRO-1819. These are the minimum specifications that the equipment must meet in order to perform its safety function

  6. Time and Temperature Test Results for PFP Thermal Stabilization Furnaces

    International Nuclear Information System (INIS)

    COMPTON, J.A.

    2000-01-01

    The national standard for plutonium storage acceptability (standard DOE-STD-3013-99, generally known as ''the 3013 standard'') has been revised to clarify the requirement for processes that will produce acceptable storage materials. The 3013 standard (Reference 1) now states that ''Oxides shall be stabilized by heating the material in an oxidizing atmosphere to a Material Temperature of at least 950 C (1742 F) for not less than 2 hours.'' The process currently in use for producing stable oxides for storage at the Plutonium Finishing Plant (PFP) heats a furnace atmosphere to 1000 C and holds it there for 2 hours. The temperature of the material being stabilized is not measured directly during this process. The Plutonium Process Support Laboratories (PPSL) were requested to demonstrate that the process currently in use at PFP is an acceptable method of producing stable plutonium dioxide consistently. A spare furnace identical to the production furnaces was set up and tested under varying conditions with non-radioactive surrogate materials. Reference 2 was issued to guide the testing program. The process currently in use at the PFP for stabilizing plutonium-bearing powders was shown to heat all the material in the furnace to at least 950 C for at least 2 hours. The current process will work for (1) relatively pure plutonium dioxide, (2) dioxide powders mixed with up to 20 weight percent magnesium oxide, and (3) dioxide powders with up to 11 weight percent magnesium oxide and 20 weight percent magnesium nitrate hexahydrate. Time and temperature data were also consistent with a successful demonstration for a mixture containing 10 weight percent each of sodium and potassium chloride; however, the molten chloride salts destroyed the thermocouples in the powder and temperature data were unavailable for part of that run. These results assume that the current operating limits of no more than 2500 grams per furnace charge and a powder height of no more than 1.5 inches remain

  7. Crystallization of the two-domain N-terminal fragment of the archaeal ribosomal protein L10(P0) in complex with a specific fragment of 23S rRNA

    Science.gov (United States)

    Kravchenko, O. V.; Mitroshin, I. V.; Gabdulkhakov, A. G.; Nikonov, S. V.; Garber, M. B.

    2011-07-01

    Lateral L12-stalk (P1-stalk in Archaea, P1/P2-stalk in eukaryotes) is an obligatory morphological element of large ribosomal subunits in all organisms studied. This stalk is composed of the complex of ribosomal proteins L10(P0) and L12(P1) and interacts with 23S rRNA through the protein L10(P0). L12(P1)-stalk is involved in the formation of GTPase center of the ribosome and plays an important role in the ribosome interaction with translation factors. High mobility of this stalk puts obstacles in determination of its structure within the intact ribosome. Crystals of a two-domain N-terminal fragment of ribosomal protein L10(P0) from the archaeon Methanococcus jannaschii in complex with a specific fragment of rRNA from the same organism have been obtained. The crystals diffract X-rays at 3.2 Å resolution.

  8. Crystallization of the two-domain N-terminal fragment of the archaeal ribosomal protein L10(P0) in complex with a specific fragment of 23S rRNA

    Energy Technology Data Exchange (ETDEWEB)

    Kravchenko, O. V.; Mitroshin, I. V.; Gabdulkhakov, A. G.; Nikonov, S. V.; Garber, M. B., E-mail: garber@vega.protres.ru [Institute of Protein Research RAS (Russian Federation)

    2011-07-15

    Lateral L12-stalk (P1-stalk in Archaea, P1/P2-stalk in eukaryotes) is an obligatory morphological element of large ribosomal subunits in all organisms studied. This stalk is composed of the complex of ribosomal proteins L10(P0) and L12(P1) and interacts with 23S rRNA through the protein L10(P0). L12(P1)-stalk is involved in the formation of GTPase center of the ribosome and plays an important role in the ribosome interaction with translation factors. High mobility of this stalk puts obstacles in determination of its structure within the intact ribosome. Crystals of a two-domain N-terminal fragment of ribosomal protein L10(P0) from the archaeon Methanococcus jannaschii in complex with a specific fragment of rRNA from the same organism have been obtained. The crystals diffract X-rays at 3.2 Angstrom-Sign resolution.

  9. The Phosphorylation of Ribosomal Protein in Lemna minor

    Science.gov (United States)

    Trewavas, A.

    1973-01-01

    Sterile cultures of Lemna minor have been labeled with 32P1, and the ribosomal proteins have been examined for radioactivity. In relatively short term labeling a radioactive protein was found which ran as a single component in both urea/acetic acid and sodium lauryl sulfate gel electrophoresis. Acid hydrolysis of the labeled protein permitted the isolation of serine phosphate. After labeling to equilibrium with 32P1, calculation indicated only 0.6 to 0.75 atom of this protein phosphorus per ribosome. The phosphorylated protein is found in both polysomes and “derived” monomers and appears to be located in the ribosomal small subunit. Its apparent molecular weight is 42,000. Addition of growth-inhibiting concentrations of abscisic acid does not alter the apparent degree of labeling of this protein in 5 hours, but after 24 hours of treatment the total protein phosphorus was reduced from 0.75 atom of phosphorus per ribosome to 0.36 atom of phosphorus per ribosome. PMID:16658405

  10. Walkdown procedure: Seismic adequacy review of safety class 3 ampersand 4 commodities in 2736-Z ampersand ZB buildings at PFP facility

    International Nuclear Information System (INIS)

    Ocoma, E.C.

    1995-01-01

    Seismic evaluation of existing safety class (SC) 3 and non-SC 4 commodities at the Plutonium Finishing Plant (PFP) is integrated into an area walkdown program. Field walkdowns of potential PFP seismic deficiencies associated with structural failure and falling will be performed using the DOE SQUG/EPRI methodology. Potential proximity interactions are also addressed. Objective of the walkdown is to qualify as much of the equipment as practical and to identify candidates for further evaluation

  11. CSER 00-006 Storage of Plutonium Residue Containers in 55 Gallon Drums at the PFP

    Energy Technology Data Exchange (ETDEWEB)

    DOBBIN, K.D.

    2000-05-24

    This criticality safety evaluation report (CSER) provides the required limit set and controls for safe transit and storage of these drums in the 234-5Z Building at the PFP. A mass limit of 200 g of plutonium or fissile equivalent per drum is acceptable

  12. Proteomic analysis of phosphoproteins sensitive to a phosphatidylinositol 3-kinase inhibitor, ZSTK474, by using SELDI-TOF MS

    Directory of Open Access Journals (Sweden)

    Yamori Takao

    2009-03-01

    Full Text Available Abstract Background Phosphoproteins play important roles in a vast series of biological processes. Recent proteomic technologies offer the comprehensive analyses of phosphoproteins. Recently, we demonstrated that surface-enhanced laser desorption/ionization time of flight mass (SELDI-TOF MS would detect phosphoproteins quantitatively, which was a new application of SELDI-TOF MS. Results We combined immobilized metal affinity chromatography (IMAC with SELDI-TOF MS. After SELDI-TOF MS analysis of IMAC-enrichment phosphoproteins from A549 cancer cells, a series of protein peaks at 12.9, 12.8, 12.7 and 12.6 kDa was obtained in a mass spectrum. The peak intensities of these proteins decreased after a phosphatase treatment and, interestingly, they also decreased when the cells were pre-treated with a novel phosphatidylinositol 3-kinase (PI3K inhibitor, ZSTK474, suggesting that these proteins were ZSTK474-sensitive phosphoproteins. Identity of the phosphoproteins, which were predicted as the multi-phosphorylated forms of 4E-binding protein 1 (4E-BP1 with the aid of TagIdent algorithm, was confirmed by immunoprecipitation and subsequent SELDI-TOF MS analysis. 4E-BP1 is a downstream component of the PI3K/Akt/mTOR pathway and it regulates protein synthesis. We also investigated the effect of ZSTK474 on 4E-BP1 phosphorylation using phospho-specific antibodies. ZSTK474, which have little inhibitory activity for mTOR, inhibited phosphorylation of Ser65, Thr70 and Thr37/46 in 4E-BP1. In contrast, rapamycin, an inhibitor of mTOR, blocked phosphorylation only of Ser65 and Thr70. These results suggest that ZSTK474 and rapamycin inhibited the phosphorylation of 4E-BP1 in a different manner. Conclusion We identified a group of ZSTK474-sensitive phosphoproteins as the multi-phosphorylated form of 4E-BP1 by combining IMAC, SELDI-TOF MS and antibodies.

  13. Definition and means of maintaining the process vacuum liquid detection interlock systems portion of the PFP safety envelope

    International Nuclear Information System (INIS)

    LINTHO, J.E.

    2003-01-01

    The purpose of this document is to record the technical evaluation of the Technical Safety Requirements described in the Plutonium Finishing Plant (PFP) Safety Technical Requirements, HNF-SD-CP-OSR-010/Rev.1, Section 3.1.1, ''Criticality Prevention System.'' This document also defines the Safety Envelope (SE) for the liquid detection interlock system in the Process Vacuum System. The SE is derived FR-om information in the Plutonium Finishing Plant Final Safety Analysis Report (PFP FSAR), HNF-SD-CP-SAR-021, Rev 4, and the Criticality Safety Analysis Report (CSAR) for the 26-inch Hg Vacuum System, WHC-SD-SQA-CSA-20159, Rev 0-A. This document, with its appendices, provides the following: (1) The system functional requirements for determining system operability (Section 3). (2) Evaluations of equipment to determine the safety envelope boundary for the system (Section 4 list of SE boundary drawings). (3) A list of the safety envelope equipment (Appendix B). (4) Functional requirements for the individual safety envelope equipment, including appropriate set points and process parameters (Section 4). (5) A list of the operational and surveillance procedures necessary to operate and maintain the system equipment within the safety envelope (Sections 5 and 6 and Appendix A)

  14. Collaborative Negotiations: A Successful Approach for Negotiation Compliance Milestones for the transition of the PFP Hanford Nuclear Reservation

    International Nuclear Information System (INIS)

    HOPKINS, A.M.

    2003-01-01

    The new approach to negotiations was termed collaborative (win-win) rather than positional (win-lose). Collaborative negotiations were conducted to establish milestones for the decommissioning of the Plutonium Finishing Plant, PFP

  15. Artificial intelligence and distance learning philosophy in support of PfP mandate

    OpenAIRE

    Antoliš, Krunoslav

    2003-01-01

    Computers have long been utilised in the legal environment. The main use of computers however, has merely been to automate office tasks. More exciting is the prospect of using artificial intelligence (AI) technology to create computers that can emulate the substantive legal jobs performed by lawyers, to create computers that can autonomously reason with the law to determine legal solutions, for example: structuring and support of Partnership for Peace (PfP) mandate. Such attempts have not bee...

  16. Pre-crisis mouse cells show strain-specific covariation in the amount of 54-kilodalton phosphoprotein and in susceptibility to transformation by simian virus 40.

    Science.gov (United States)

    Chen, S; Blanck, G; Pollack, R E

    1983-09-01

    We have used several inbred mouse strains to examine the role of the 54-kilodalton (kDa) cellular phosphoprotein in transformation by the papovavirus simian virus 40. We have measured the endogenous 54-kDa phosphoprotein in cells obtained from these inbred mouse strains. To study the effect of passage, cell cultures were measured for amount of the 54-kDa phosphoprotein at the 2nd and 12th passages. In the absence of any transforming agent, the amount of endogenous 54-kDa phosphoprotein in early pre-crisis mouse cells varied in a strain-specific way. Transformation frequency varied coordinately with endogenous 54-kDa expression. Mouse strains whose cells produced a high level of endogenous 54-kDa phosphoprotein on passage did not further increase its expression after simian virus 40 transformation.

  17. Female PFP patients present alterations in eccentric muscle activity but not the temporal order of activation of the vastus lateralis muscle during the single leg triple hop test.

    Science.gov (United States)

    Kalytczak, Marcelo Martins; Lucareli, Paulo Roberto Garcia; Dos Reis, Amir Curcio; Bley, André Serra; Biasotto-Gonzalez, Daniela Aparecida; Correa, João Carlos Ferrari; Politti, Fabiano

    2018-04-07

    This study aimed to compare the concentric and eccentric activity and the temporal order of peak activity of the hip and knee muscles between women with patellofemoral pain (PFP) and healthy women during the single leg triple hop test (SLTHT). Electromyographic (EMG) and Kinematic data were collected from 14 healthy women (CG) and 14 women diagnosed with PFP (PFG) during a single session of the single leg triple hop test. Integral surface electromyography (iEMG) data of the hip and knee muscles in eccentric and concentric phases and the length of time that each muscle needed to reach the maximal peak of muscle activity were calculated. The iEMG in the eccentric phase was significantly higher (p < 0.05) than the concentric phase, for the gluteus maximus and gluteus medius muscles (CG and PFG) and for the vastus lateralis muscle (PFG). The vastus lateralis muscle was the first muscle to reach the highest peak of activity in the PFG, and the third to reach this peak in the CG. In the present study, the activity of the vastus lateralis muscle during the eccentric phase of the jump was greater than concentric phase, as a temporal anticipation of its peak in activity among women with PFP. Copyright © 2018 Elsevier B.V. All rights reserved.

  18. Interface Control Document Between the Double Shell Tanks (DST) System and the Plutonium Finishing Plan (PFP)

    International Nuclear Information System (INIS)

    MAY, T.H.

    1999-01-01

    This document identifies the requirements and responsibilities for all parties to support waste transfer from the Plutonium Finishing Plant (PFP) facility to the Double-Shell Tank (DST) System of the River Protection Project (RPP). This Interface Control Document (ICD) will not attempt to control the physical portion of this interface because the physical equipment making up this interface, and any associated interface requirements, are already in place, operational and governed by existing operating specifications and other documentation. The PFP and DST Systems have a direct physical interface (the waste transfer pipeline) that travels between the 241-2 Building (TK-D5) and DST SY-102 via 244-TX double-contained receiver tank (DCRT). The purpose of the ICD process is to formalize working agreements between the RPP DST System and organization/companies internal and external to RPP. This ICD has been developed as part of the requirements basis for design of the DST System to support the Phase I Privatization effort

  19. Ribosomal protein methyltransferases in the yeast Saccharomyces cerevisiae: Roles in ribosome biogenesis and translation.

    Science.gov (United States)

    Al-Hadid, Qais; White, Jonelle; Clarke, Steven

    2016-02-12

    A significant percentage of the methyltransferasome in Saccharomyces cerevisiae and higher eukaryotes is devoted to methylation of the translational machinery. Methylation of the RNA components of the translational machinery has been studied extensively and is important for structure stability, ribosome biogenesis, and translational fidelity. However, the functional effects of ribosomal protein methylation by their cognate methyltransferases are still largely unknown. Previous work has shown that the ribosomal protein Rpl3 methyltransferase, histidine protein methyltransferase 1 (Hpm1), is important for ribosome biogenesis and translation elongation fidelity. In this study, yeast strains deficient in each of the ten ribosomal protein methyltransferases in S. cerevisiae were examined for potential defects in ribosome biogenesis and translation. Like Hpm1-deficient cells, loss of four of the nine other ribosomal protein methyltransferases resulted in defects in ribosomal subunit synthesis. All of the mutant strains exhibited resistance to the ribosome inhibitors anisomycin and/or cycloheximide in plate assays, but not in liquid culture. Translational fidelity assays measuring stop codon readthrough, amino acid misincorporation, and programmed -1 ribosomal frameshifting, revealed that eight of the ten enzymes are important for translation elongation fidelity and the remaining two are necessary for translation termination efficiency. Altogether, these results demonstrate that ribosomal protein methyltransferases in S. cerevisiae play important roles in ribosome biogenesis and translation. Copyright © 2016 Elsevier Inc. All rights reserved.

  20. Water bath and air bath calorimeter qualification for measuring 3013 containers of plutonium oxide at the Hanford Plutonium Finishing Plant (PFP)

    International Nuclear Information System (INIS)

    WELSH, T.L.

    2003-01-01

    The purpose of this paper is to present qualification data generated from water and air-bath calorimeters measuring radioactive decay heat from plutonium oxide in DOE STD-3013-2000 (3013) containers at the Hanford Plutonium Finishing Plant (PFP). Published data concerning air and water bath calorimeters and especially 3013-qualified calorimeters is minimal at best. This paper will address the data from the measurement/qualification test plan, the heat standards used, and the calorimeter precision and accuracy results. The 3013 package is physically larger than earlier plutonium oxide storage containers, thereby necessitating a larger measurement chamber. To accommodate the measurements of the 3013 containers at PFP, Los Alamos National Laboratory (LANL) supplied a water bath dual-chambered unit and the Savannah River Technology Center (SRTC) provided two air-bath calorimeters. Both types of Calorimeters were installed in the analytical laboratory at PFP. The larger 3013 containers presented a new set of potential measurement problems: longer counting times, heat conductivity through a much larger container mass and wall thickness, and larger amounts of copper shot to assist sample thermal conductivity. These potential problems were addressed and included in the measurement/qualification test plan

  1. Neuron-Like Networks Between Ribosomal Proteins Within the Ribosome

    Science.gov (United States)

    Poirot, Olivier; Timsit, Youri

    2016-05-01

    From brain to the World Wide Web, information-processing networks share common scale invariant properties. Here, we reveal the existence of neural-like networks at a molecular scale within the ribosome. We show that with their extensions, ribosomal proteins form complex assortative interaction networks through which they communicate through tiny interfaces. The analysis of the crystal structures of 50S eubacterial particles reveals that most of these interfaces involve key phylogenetically conserved residues. The systematic observation of interactions between basic and aromatic amino acids at the interfaces and along the extension provides new structural insights that may contribute to decipher the molecular mechanisms of signal transmission within or between the ribosomal proteins. Similar to neurons interacting through “molecular synapses”, ribosomal proteins form a network that suggest an analogy with a simple molecular brain in which the “sensory-proteins” innervate the functional ribosomal sites, while the “inter-proteins” interconnect them into circuits suitable to process the information flow that circulates during protein synthesis. It is likely that these circuits have evolved to coordinate both the complex macromolecular motions and the binding of the multiple factors during translation. This opens new perspectives on nanoscale information transfer and processing.

  2. Combined use of nuclear phosphoprotein c-Myc and cellular phosphoprotein p53 for hepatocellular carcinoma detection in high-risk chronic hepatitis C patients.

    Science.gov (United States)

    Attallah, A M; El-Far, M; Abdelrazek, M A; Omran, M M; Attallah, A A; Elkhouly, A A; Elkenawy, H M; Farid, K

    2017-10-01

    Hepatocellular carcinoma (HCC) is a multistage process resulting from various genetic changes. We aimed to determine nuclear phosphoprotein c-Myc and cellular phosphoprotein p53 expression and to evaluate their importance in HCC diagnosis. One hundred and twenty chronic hepatitis C (CHC) patients (60 non-HCC CHC patients and 60 HCC patients who had a single small (c-Myc and p53 were identified in liver tissues and serum samples using immunostaining, western blot and ELISA. Immunohistochemical detection of c-Myc and p53 with monospecific antibodies revealed intense and diffuse cytoplasmic staining patterns. Accumulated mutant proteins, released from tumour cells into the extracellular serum, were detected at 62 KDa, for c-Myc, and 53 KDa, for p53, using western blotting. In contrast to alpha feto-protein, there was a significant increase (p c-Myc (86.7% vs. 6.7%) and p53 (78.3% vs. 8.3%) in the malignant vs. non-malignant patients. The parallel combination of c-Myc and p53 reach the absolute sensitivity (100%), for more accurate and reliable HCC detection (specificity was 87%). c-Myc and p53 are potential HCC diagnostic biomarkers, and convenient combinations of them could improve diagnostic accuracy of HCC.

  3. Structural dissection of human metapneumovirus phosphoprotein using small angle x-ray scattering.

    Science.gov (United States)

    Renner, Max; Paesen, Guido C; Grison, Claire M; Granier, Sébastien; Grimes, Jonathan M; Leyrat, Cédric

    2017-11-01

    The phosphoprotein (P) is the main and essential cofactor of the RNA polymerase (L) of non-segmented, negative-strand RNA viruses. P positions the viral polymerase onto its nucleoprotein-RNA template and acts as a chaperone of the nucleoprotein (N), thereby preventing nonspecific encapsidation of cellular RNAs. The phosphoprotein of human metapneumovirus (HMPV) forms homotetramers composed of a stable oligomerization domain (P core ) flanked by large intrinsically disordered regions (IDRs). Here we combined x-ray crystallography of P core with small angle x-ray scattering (SAXS)-based ensemble modeling of the full-length P protein and several of its fragments to provide a structural description of P that captures its dynamic character, and highlights the presence of varyingly stable structural elements within the IDRs. We discuss the implications of the structural properties of HMPV P for the assembly and functioning of the viral transcription/replication machinery.

  4. Addendum 2 to CSER 79-002: Extension of the 150 gram fissile limit used in room 187 of PFP

    International Nuclear Information System (INIS)

    Friar, D.E.

    1994-01-01

    The PFP operating organization requests that the limit set permitting 150 grams fissile be extended to the Hoods 4 and 5 of Room 187. The request for the limit change is explained in the attached request for analysis

  5. Functional enrichment analyses and construction of functional similarity networks with high confidence function prediction by PFP

    Directory of Open Access Journals (Sweden)

    Kihara Daisuke

    2010-05-01

    Full Text Available Abstract Background A new paradigm of biological investigation takes advantage of technologies that produce large high throughput datasets, including genome sequences, interactions of proteins, and gene expression. The ability of biologists to analyze and interpret such data relies on functional annotation of the included proteins, but even in highly characterized organisms many proteins can lack the functional evidence necessary to infer their biological relevance. Results Here we have applied high confidence function predictions from our automated prediction system, PFP, to three genome sequences, Escherichia coli, Saccharomyces cerevisiae, and Plasmodium falciparum (malaria. The number of annotated genes is increased by PFP to over 90% for all of the genomes. Using the large coverage of the function annotation, we introduced the functional similarity networks which represent the functional space of the proteomes. Four different functional similarity networks are constructed for each proteome, one each by considering similarity in a single Gene Ontology (GO category, i.e. Biological Process, Cellular Component, and Molecular Function, and another one by considering overall similarity with the funSim score. The functional similarity networks are shown to have higher modularity than the protein-protein interaction network. Moreover, the funSim score network is distinct from the single GO-score networks by showing a higher clustering degree exponent value and thus has a higher tendency to be hierarchical. In addition, examining function assignments to the protein-protein interaction network and local regions of genomes has identified numerous cases where subnetworks or local regions have functionally coherent proteins. These results will help interpreting interactions of proteins and gene orders in a genome. Several examples of both analyses are highlighted. Conclusion The analyses demonstrate that applying high confidence predictions from PFP

  6. Identification of nuclear phosphoproteins as novel tobacco markers in mouse lung tissue following short-term exposure to tobacco smoke

    Directory of Open Access Journals (Sweden)

    Kanako Niimori-Kita

    2014-01-01

    Full Text Available Smoking is a risk factor for lung diseases, including chronic obstructive pulmonary disease and lung cancer. However, the molecular mechanisms mediating the progression of these diseases remain unclear. Therefore, we sought to identify signaling pathways activated by tobacco-smoke exposure, by analyzing nuclear phosphoprotein expression using phosphoproteomic analysis of lung tissue from mice exposed to tobacco smoke. Sixteen mice were exposed to tobacco smoke for 1 or 7 days, and the expression of phosphorylated peptides was analyzed by mass spectrometry. A total of 253 phosphoproteins were identified, including FACT complex subunit SPT16 in the 1-day exposure group, keratin type 1 cytoskeletal 18 (K18, and adipocyte fatty acid-binding protein, in the 7-day exposure group, and peroxiredoxin-1 (OSF3 and spectrin β chain brain 1 (SPTBN1, in both groups. Semi-quantitative analysis of the identified phosphoproteins revealed that 33 proteins were significantly differentially expressed between the control and exposed groups. The identified phosphoproteins were classified according to their biological functions. We found that the identified proteins were related to inflammation, regeneration, repair, proliferation, differentiation, morphogenesis, and response to stress and nicotine. In conclusion, we identified proteins, including OSF3 and SPTBN1, as candidate tobacco smoke-exposure markers; our results provide insights into the mechanisms of tobacco smoke-induced diseases.

  7. Characterization of the interactions between the nucleoprotein and the phosphoprotein of Henipavirus.

    Science.gov (United States)

    Habchi, Johnny; Blangy, Stéphanie; Mamelli, Laurent; Jensen, Malene Ringkjøbing; Blackledge, Martin; Darbon, Hervé; Oglesbee, Michael; Shu, Yaoling; Longhi, Sonia

    2011-04-15

    The Henipavirus genome is encapsidated by the nucleoprotein (N) within a helical nucleocapsid that recruits the polymerase complex via the phosphoprotein (P). In a previous study, we reported that in henipaviruses, the N-terminal domain of the phosphoprotein and the C-terminal domain of the nucleoprotein (N(TAIL)) are both intrinsically disordered. Here we show that Henipavirus N(TAIL) domains are also disordered in the context of full-length nucleoproteins. We also report the cloning, purification, and characterization of the C-terminal X domains (P(XD)) of Henipavirus phosphoproteins. Using isothermal titration calorimetry, we show that N(TAIL) and P(XD) form a 1:1 stoichiometric complex that is stable under NaCl concentrations as high as 1 M and has a K(D) in the μM range. Using far-UV circular dichroism and nuclear magnetic resonance, we show that P(XD) triggers an increase in the α-helical content of N(TAIL). Using fluorescence spectroscopy, we show that P(XD) has no impact on the chemical environment of a Trp residue introduced at position 527 of the Henipavirus N(TAIL) domain, thus arguing for the lack of stable contacts between the C termini of N(TAIL) and P(XD). Finally, we present a tentative structural model of the N(TAIL)-P(XD) interaction in which a short, order-prone region of N(TAIL) (α-MoRE; amino acids 473-493) adopts an α-helical conformation and is embedded between helices α2 and α3 of P(XD), leading to a relatively small interface dominated by hydrophobic contacts. The present results provide the first detailed experimental characterization of the N-P interaction in henipaviruses and designate the N(TAIL)-P(XD) interaction as a valuable target for rational antiviral approaches.

  8. Sustained mitogen-activated protein kinase activation reprograms defense metabolism and phosphoprotein profile in Arabidopsis thaliana.

    Directory of Open Access Journals (Sweden)

    Ines eLassowskat

    2014-10-01

    Full Text Available Mitogen-activated protein kinases (MAPKs target a variety of protein substrates to regulate cellular signaling processes in eukaryotes. In plants, the number of identified MAPK substrates that control plant defense responses is still limited. Here, we generated transgenic Arabidopsis thaliana plants with an inducible system to simulate in vivo activation of two stress-activated MAPKs, MPK3 and MPK6. Metabolome analysis revealed that this artificial MPK3/6 activation (without any exposure to pathogens or other stresses is sufficient to drive the production of major defense-related metabolites, including various camalexin, indole glucosinolate and agmatine derivatives. An accompanying (phosphoproteome analysis led to detection of hundreds of potential phosphoproteins downstream of MPK3/6 activation. Besides known MAPK substrates, many candidates on this list possess typical MAPK-targeted phosphosites and in many cases, the corresponding phosphopeptides were detected by mass spectrometry. Notably, several of these putative phosphoproteins have been reported to be associated with the biosynthesis of antimicrobial defense substances (e.g. WRKY transcription factors and proteins encoded by the genes from the PEN pathway required for penetration resistance to filamentous pathogens. Thus, this work provides an inventory of candidate phosphoproteins, including putative direct MAPK substrates, for future analysis of MAPK-mediated defense control. (Proteomics data are available with the identifier PXD001252 via ProteomeXchange, http://proteomecentral.proteomexchange.org.

  9. The Ulip family phosphoproteins--common and specific properties.

    Science.gov (United States)

    Byk, T; Ozon, S; Sobel, A

    1998-05-15

    The search for intracellular phosphoproteins implicated in the regulation of neuronal differentiation led to the identification of Ulip1, a mammalian protein related to the Caenorhabditis elegans unc-33 gene product [Byk, T., Dobransky, T., Cifuentes-Diaz, C. & Sobel, A. (1996) J. Neurosc. 16, 688-701]. The expression level and phosphorylation pattern of Ulip1 were shown to be strongly regulated during development and neuronal differentiation. We have isolated three additional complete coding sequences for members of the Ulip family in the mouse, Ulips 2-4, all preferentially expressed in the nervous system. Furthermore, two Ulip sequences, Ulips A and Ulips B, could be identified in C. elegans. The Ulip family is highly conserved throughout evolution (more than 96 % for Ulips 1-3 and 92.5 % for Ulip4 between mouse and human) and the various members of the family within a single species display about 75% similarity. Sequence comparisons further reveal several highly similar domains and subdomains, including a 32-amino-acid region highly conserved from a bacterial hydantoinase to human Ulips. Two-dimensional immunoblot analysis of in vitro translated Ulips 1-4 demonstrates the existence, for each Ulip protein, of several, most probably differentially phosphorylated forms, in agreement with the presence of conserved phosphorylation consensus sites within their sequences. The expression of Ulips 1-4 mRNAs is differentially regulated during development and nerve-growth-factor-induced neuronal differentiation of PC12 cells. Our results indicate a differential, possibly complementary role of phosphoproteins of the highly conserved Ulip family in the control of neuronal differentiation, in relation with the development and plasticity of the nervous system.

  10. 5S rRNA and ribosome.

    Science.gov (United States)

    Gongadze, G M

    2011-12-01

    5S rRNA is an integral component of the ribosome of all living organisms. It is known that the ribosome without 5S rRNA is functionally inactive. However, the question about the specific role of this RNA in functioning of the translation apparatus is still open. This review presents a brief history of the discovery of 5S rRNA and studies of its origin and localization in the ribosome. The previously expressed hypotheses about the role of this RNA in the functioning of the ribosome are discussed considering the unique location of 5S rRNA in the ribosome and its intermolecular contacts. Based on analysis of the current data on ribosome structure and its functional complexes, the role of 5S rRNA as an intermediary between ribosome functional domains is discussed.

  11. In vitro degradation of ribosomes.

    Science.gov (United States)

    Mora, G; Rivas, A

    1976-12-01

    The cytoplasmic ribosomes from Euglena gracilis var. bacillaris are found to be of two types taking into consideration their stability "in vitro". In the group of unstable ribosomes the large subunit is degraded. The other group apparently does not suffer any degradation under the conditions described. However the RNAs extracted from both types of ribosomes are degraded during sucrose density gradients. The degradation of the largest RNA species has been reported previously, but no comment has been made about the stability of the ribosome itself.

  12. Studies on the catalytic rate constant of ribosomal peptidyltransferase.

    Science.gov (United States)

    Synetos, D; Coutsogeorgopoulos, C

    1987-02-20

    A detailed kinetic analysis of a model reaction for the ribosomal peptidyltransferase is described, using fMet-tRNA or Ac-Phe-tRNA as the peptidyl donor and puromycin as the acceptor. The initiation complex (fMet-tRNA X AUG X 70 S ribosome) or (Ac-Phe-tRNA X poly(U) X 70 S ribosome) (complex C) is isolated and then reacted with excess puromycin (S) to give fMet-puromycin or Ac-Phe-puromycin. This reaction (puromycin reaction) is first order at all concentrations of S tested. An important asset of this kinetic analysis is the fact that the relationship between the first order rate constant kobs and [S] shows hyperbolic saturation and that the value of kobs at saturating [S] is a measure of the catalytic rate constant (k cat) of peptidyltransferase in the puromycin reaction. With fMet-tRNA as the donor, this kcat of peptidyltransferase is 8.3 min-1 when the 0.5 M NH4Cl ribosomal wash is present, compared to 3.8 min-1 in its absence. The kcat of peptidyltransferase is 2.0 min-1 when Ac-Phe-tRNA replaces fMet-tRNA in the presence of the ribosomal wash and decreases to 0.8 min-1 in its absence. This kinetic procedure is the best method available for evaluating changes in the activity of peptidyltransferase in vitro. The results suggest that peptidyltransferase is subjected to activation by the binding of fMet-tRNA to the 70 S initiation complex.

  13. PFP Commercial Grade Food Pack Cans for Plutonium Handling and Storage Critical Characteristics

    International Nuclear Information System (INIS)

    BONADIE, E.P.

    1999-01-01

    This document specifies the critical characteristics for Commercial Grade Items (CGI) procured for PFP's Vault Operations system as required by HNF-PRO-268 and HNF-PRO-1819. These are the minimum specifications that the equipment must meet in order to perform its safety function. The changes in these specifications have no detrimental effect on the descriptions and parameters related to handling plutonium solids in the authorization basis. Because no parameters or sequences exceed the limits described in the authorization bases, no accident or abnormal conditions are affected. The specifications prescribed in this critical characteristics document do not represent an unreviewed safety question

  14. Evaluation of Need and Location for a Thermogravimetric Analyzer in the Plutonium Finishing Plant (PFP) Materials Stabilization

    International Nuclear Information System (INIS)

    WILLIS, H.T.

    2000-01-01

    This plan provides an analysis for locating a TGA to support PFP Thermal Stabilization processes. The scope of this document is to evaluate the need for, and location for, installation of a TGA system as a supplement to the SFE equipment for moisture measurement in pure oxides. A location assessment for the SFE equipment was previously performed (HNF 1999). Based on that assessment, co-location of the TGA system with the SFE system is the preferred option. This would enable thermally stabilized material to be analyzed for residual moisture by either the TGA system or SFE system or both This evaluation considers glovebox locations in the PFP 234-52 Building Analytical Laboratory or operating areas for the installation of the TGA system and it's supporting equipment. This evaluation considers using existing gloveboxes along with an alternative of adding a new glovebox to existing process lines. The location evaluation criteria focuses mainly on glovebox size, with qualitative consideration of relative cost and schedule impacts associated with system implementation, radiological control, and interaction with other laboratory operations and processes. In addition, the possible co-location of a TGA furnace system with the SFE system was considered

  15. Structure of Vibrio cholerae ribosome hibernation promoting factor

    International Nuclear Information System (INIS)

    De Bari, Heather; Berry, Edward A.

    2013-01-01

    The X-ray crystal structure of ribosome hibernation promoting factor from V. cholerae has been determined at 2.0 Å resolution. The crystal was phased by two-wavelength MAD using cocrystallized cobalt. The X-ray crystal structure of ribosome hibernation promoting factor (HPF) from Vibrio cholerae is presented at 2.0 Å resolution. The crystal was phased by two-wavelength MAD using cocrystallized cobalt. The asymmetric unit contained two molecules of HPF linked by four Co atoms. The metal-binding sites observed in the crystal are probably not related to biological function. The structure of HPF has a typical β–α–β–β–β–α fold consistent with previous structures of YfiA and HPF from Escherichia coli. Comparison of the new structure with that of HPF from E. coli bound to the Thermus thermophilus ribosome [Polikanov et al. (2012 ▶), Science, 336, 915–918] shows that no significant structural changes are induced in HPF by binding

  16. Ribosomal studies on the 70S ribosome of E.coli by means of neutron scattering

    International Nuclear Information System (INIS)

    Burkhardt, N.

    1997-01-01

    Ribosomes are ribonucleo-protein complexes, which catalyse proteinbiosynthesis in all living organisms. Currently, most of the structural models of the prokaryotic 70S ribosome rely on electron microscopy and describe mainly the outer shape of the particle. Neutron scattering can provide information on the internal structure of the ribosome. Parts of the structure can be contrasted for neutrons by means of an isotopic exchange of the naturally occurring hydrogen ( 1 H) for deuterium ( 2 H), allowing direct measurements in situ. Specifically deuterium-labeled ribosomes (E. coli) were prepared and analysed with neutron scattering. The biochemical methods were established and combined to a generally applicable preparation system. This allows labeling of all ribosomal components in any combination. A systematic analysis of the protein and RNA phases resulted in the development of a new model for the 70S ribosome. This model describes not only the outer shape of the particle, but displays also an experimentally determined internal protein-RNA distribution and the border of subunits for the first time (four-phase model; resolution: 50A). Models of the 70S ribosome from other studies were evaluated and ranked according to consistency with the measured scattering data. Applying a new neutron scattering technique of particular sensitivity, the proton-spin contrast-variation, single proteins could be measured and localized. The positions of the proteins S6 and S10 were determined, providing the first coordinates of protein mass centers within the 70S ribosome. (orig.) [de

  17. Detection and Quantification of Ribosome Inhibition by Aminoglycoside Antibiotics in Living Bacteria Using an Orthogonal Ribosome-Controlled Fluorescent Reporter.

    Science.gov (United States)

    Huang, Shijie; Zhu, Xuechen; Melançon, Charles E

    2016-01-15

    The ribosome is the quintessential antibacterial drug target, with many structurally and mechanistically distinct classes of antibacterial agents acting by inhibiting ribosome function. Detecting and quantifying ribosome inhibition by small molecules and investigating their binding modes and mechanisms of action are critical to antibacterial drug discovery and development efforts. To develop a ribosome inhibition assay that is operationally simple, yet provides direct information on the drug target and the mechanism of action, we have developed engineered E. coli strains harboring an orthogonal ribosome-controlled green fluorescent protein (GFP) reporter that produce fluorescent signal when the orthogonal ribosome is inhibited. As a proof of concept, we demonstrate that these strains, when coexpressing homogeneous populations of aminoglycoside resistant ribosomes, act as sensitive and quantitative detectors of ribosome inhibition by a set of 12 structurally diverse aminoglycoside antibiotics. We suggest that this strategy can be extended to quantifying ribosome inhibition by other drug classes.

  18. The ribosome can prevent aggregation of partially folded protein intermediates: studies using the Escherichia coli ribosome.

    Directory of Open Access Journals (Sweden)

    Bani Kumar Pathak

    Full Text Available BACKGROUND: Molecular chaperones that support de novo folding of proteins under non stress condition are classified as chaperone 'foldases' that are distinct from chaperone' holdases' that provide high affinity binding platform for unfolded proteins and prevent their aggregation specifically under stress conditions. Ribosome, the cellular protein synthesis machine can act as a foldase chaperone that can bind unfolded proteins and release them in folding competent state. The peptidyl transferase center (PTC located in the domain V of the 23S rRNA of Escherichia coli ribosome (bDV RNA is the chaperoning center of the ribosome. It has been proposed that via specific interactions between the RNA and refolding proteins, the chaperone provides information for the correct folding of unfolded polypeptide chains. RESULTS: We demonstrate using Escherichia coli ribosome and variants of its domain V RNA that the ribosome can bind to partially folded intermediates of bovine carbonic anhydrase II (BCAII and lysozyme and suppress aggregation during their refolding. Using mutants of domain V RNA we demonstrate that the time for which the chaperone retains the bound protein is an important factor in determining its ability to suppress aggregation and/or support reactivation of protein. CONCLUSION: The ribosome can behave like a 'holdase' chaperone and has the ability to bind and hold back partially folded intermediate states of proteins from participating in the aggregation process. Since the ribosome is an essential organelle that is present in large numbers in all living cells, this ability of the ribosome provides an energetically inexpensive way to suppress cellular aggregation. Further, this ability of the ribosome might also be crucial in the context that the ribosome is one of the first chaperones to be encountered by a large nascent polypeptide chains that have a tendency to form partially folded intermediates immediately following their synthesis.

  19. One-Step Preservation of Phosphoproteins and Tissue Morphology at Room Temperature for Diagnostic and Research Specimens

    Science.gov (United States)

    Mueller, Claudius; Edmiston, Kirsten H.; Carpenter, Calvin; Gaffney, Eoin; Ryan, Ciara; Ward, Ronan; White, Susan; Memeo, Lorenzo; Colarossi, Cristina; Petricoin, Emanuel F.; Liotta, Lance A.; Espina, Virginia

    2011-01-01

    Background There is an urgent need to measure phosphorylated cell signaling proteins in cancer tissue for the individualization of molecular targeted kinase inhibitor therapy. However, phosphoproteins fluctuate rapidly following tissue procurement. Snap-freezing preserves phosphoproteins, but is unavailable in most clinics and compromises diagnostic morphology. Formalin fixation preserves tissue histomorphology, but penetrates tissue slowly, and is unsuitable for stabilizing phosphoproteins. We originated and evaluated a novel one-step biomarker and histology preservative (BHP) chemistry that stabilizes signaling protein phosphorylation and retains formalin-like tissue histomorphology with equivalent immunohistochemistry in a single paraffin block. Results Total protein yield extracted from BHP-fixed, routine paraffin-embedded mouse liver was 100% compared to snap-frozen tissue. The abundance of 14 phosphorylated proteins was found to be stable over extended fixation times in BHP fixed paraffin embedded human colon mucosa. Compared to matched snap-frozen tissue, 8 phosphoproteins were equally preserved in mouse liver, while AMPKβ1 Ser108 was slightly elevated after BHP fixation. More than 25 tissues from mouse, cat and human specimens were evaluated for preservation of histomorphology. Selected tissues were evaluated in a multi-site, independent pathology review. Tissue fixed with BHP showed equivalent preservation of cytoplasmic and membrane cytomorphology, with significantly better nuclear chromatin preservation by BHP compared to formalin. Immunohistochemical staining of 13 non-phosphorylated proteins, including estrogen receptor alpha, progesterone receptor, Ki-67 and Her2, was equal to or stronger in BHP compared to formalin. BHP demonstrated significantly improved immunohistochemical detection of phosphorylated proteins ERK Thr202/Tyr204, GSK3-α/β Ser21/Ser9, p38-MAPK Thr180/Tyr182, eIF4G Ser1108 and Acetyl-CoA Carboxylase Ser79. Conclusion In a single

  20. One-step preservation of phosphoproteins and tissue morphology at room temperature for diagnostic and research specimens.

    Directory of Open Access Journals (Sweden)

    Claudius Mueller

    Full Text Available BACKGROUND: There is an urgent need to measure phosphorylated cell signaling proteins in cancer tissue for the individualization of molecular targeted kinase inhibitor therapy. However, phosphoproteins fluctuate rapidly following tissue procurement. Snap-freezing preserves phosphoproteins, but is unavailable in most clinics and compromises diagnostic morphology. Formalin fixation preserves tissue histomorphology, but penetrates tissue slowly, and is unsuitable for stabilizing phosphoproteins. We originated and evaluated a novel one-step biomarker and histology preservative (BHP chemistry that stabilizes signaling protein phosphorylation and retains formalin-like tissue histomorphology with equivalent immunohistochemistry in a single paraffin block. RESULTS: Total protein yield extracted from BHP-fixed, routine paraffin-embedded mouse liver was 100% compared to snap-frozen tissue. The abundance of 14 phosphorylated proteins was found to be stable over extended fixation times in BHP fixed paraffin embedded human colon mucosa. Compared to matched snap-frozen tissue, 8 phosphoproteins were equally preserved in mouse liver, while AMPKβ1 Ser108 was slightly elevated after BHP fixation. More than 25 tissues from mouse, cat and human specimens were evaluated for preservation of histomorphology. Selected tissues were evaluated in a multi-site, independent pathology review. Tissue fixed with BHP showed equivalent preservation of cytoplasmic and membrane cytomorphology, with significantly better nuclear chromatin preservation by BHP compared to formalin. Immunohistochemical staining of 13 non-phosphorylated proteins, including estrogen receptor alpha, progesterone receptor, Ki-67 and Her2, was equal to or stronger in BHP compared to formalin. BHP demonstrated significantly improved immunohistochemical detection of phosphorylated proteins ERK Thr202/Tyr204, GSK3-α/β Ser21/Ser9, p38-MAPK Thr180/Tyr182, eIF4G Ser1108 and Acetyl-CoA Carboxylase Ser79

  1. Performance of VITEK mass spectrometry V3.0 for rapid identification of clinical Aspergillus fumigatus in different culture conditions based on ribosomal proteins

    Directory of Open Access Journals (Sweden)

    Zhou L

    2017-12-01

    Full Text Available Longrong Zhou, Yongquan Chen, Yuanhong Xu Department of Clinical Laboratory, The First Affiliated Hospital of Anhui Medical University, Anhui, Hefei, People’s Republic of China Abstract: Fast and accurate discrimination of Aspergillus fumigatus is significant, since misidentification may lead to inappropriate clinical therapy. This study assessed VITEK mass spectrometry (MS V3.0 for A. fumigatus identification using extracted fungal ribosomal proteins. A total of 52 isolates preliminarily identified as A. fumigatus by traditional morphological methods were inoculated in three different culture media and cultured at two different temperatures. The specific spectral fingerprints of different culture time points (48, 72, 96, and 120 h were obtained. Of all strains, 88.5% (46/52 were discriminated as A. fumigatus, while the remaining 11.5% (6/52 produced results inconsistent with morphological analysis. Molecular sequencing, as a reference method for species identification, was used to validate the morphological analysis and matrix-assisted laser desorption/ionization time of flight MS. Chi-square tests (Χ2 test, P=0.05 demonstrated that the culture medium and incubation temperature had no effects on identification accuracy; however, identification accuracy of the strains in the 48-h group was lower than that in other groups. In addition, we found that ribosomal proteins extracted from A. fumigatus can be stored in different environments for at least 1 week, with their profiles remaining stable and strain identification results showing no change. This is beneficial for medical institutions with no mass spectrometer at hand. Overall, this study showed the powerful ability of VITEK MS V 3.0 in identifying A. fumigatus. Keywords: VITEK MS V 3.0, Aspergillus fumigatus, identification, ribosomal protein, spectral fingerprints, fungal, matrix assisted laser desorption ionization-time of flight mass spectrometry, MALDI-TOF MS

  2. A ribosome without RNA

    Directory of Open Access Journals (Sweden)

    Harold S Bernhardt

    2015-11-01

    Full Text Available It was Francis Crick who first asked why the ribosome contains so much RNA, and discussed the implications of this for the direct flow of genetic information from DNA to protein. Remarkable advances in our understanding of the ribosome and protein synthesis, including the recent publication of two mammalian mitochondrial ribosome structures, have shed new light on this intriguing aspect of evolution in molecular biology. We examine here whether RNA is indispensable for coded protein synthesis, or whether an all-protein ‘ribosome’ (or ‘synthosome’ might be possible, with a protein enzyme catalyzing peptide synthesis, and release factor-like protein adaptors able to read a message composed of deoxyribonucleotides. We also compare the RNA world hypothesis with the alternative ‘proteins first’ hypothesis in terms of their different understandings of the evolution of the ribosome, and whether this might have been preceded by an ancestral form of nonribosomal peptide synthesis catalyzed by protein enzymes.

  3. A Listeria monocytogenes RNA helicase essential for growth and ribosomal maturation at low temperatures uses its C terminus for appropriate interaction with the ribosome.

    Science.gov (United States)

    Netterling, Sakura; Vaitkevicius, Karolis; Nord, Stefan; Johansson, Jörgen

    2012-08-01

    Listeria monocytogenes, a Gram-positive food-borne human pathogen, is able to grow at temperatures close to 0°C and is thus of great concern for the food industry. In this work, we investigated the physiological role of one DExD-box RNA helicase in Listeria monocytogenes. The RNA helicase Lmo1722 was required for optimal growth at low temperatures, whereas it was dispensable at 37°C. A Δlmo1722 strain was less motile due to downregulation of the major subunit of the flagellum, FlaA, caused by decreased flaA expression. By ribosomal fractionation experiments, it was observed that Lmo1722 was mainly associated with the 50S subunit of the ribosome. Absence of Lmo1722 decreased the fraction of 50S ribosomal subunits and mature 70S ribosomes and affected the processing of the 23S precursor rRNA. The ribosomal profile could be restored to wild-type levels in a Δlmo1722 strain expressing Lmo1722. Interestingly, the C-terminal part of Lmo1722 was redundant for low-temperature growth, motility, 23S rRNA processing, and appropriate ribosomal maturation. However, Lmo1722 lacking the C terminus showed a reduced affinity for the 50S and 70S fractions, suggesting that the C terminus is important for proper guidance of Lmo1722 to the 50S subunit. Taken together, our results show that the Listeria RNA helicase Lmo1722 is essential for growth at low temperatures, motility, and rRNA processing and is important for ribosomal maturation, being associated mainly with the 50S subunit of the ribosome.

  4. The ribosomal protein Rpl22 controls ribosome composition by directly repressing expression of its own paralog, Rpl22l1.

    Directory of Open Access Journals (Sweden)

    Monique N O'Leary

    Full Text Available Most yeast ribosomal protein genes are duplicated and their characterization has led to hypotheses regarding the existence of specialized ribosomes with different subunit composition or specifically-tailored functions. In yeast, ribosomal protein genes are generally duplicated and evidence has emerged that paralogs might have specific roles. Unlike yeast, most mammalian ribosomal proteins are thought to be encoded by a single gene copy, raising the possibility that heterogenous populations of ribosomes are unique to yeast. Here, we examine the roles of the mammalian Rpl22, finding that Rpl22(-/- mice have only subtle phenotypes with no significant translation defects. We find that in the Rpl22(-/- mouse there is a compensatory increase in Rpl22-like1 (Rpl22l1 expression and incorporation into ribosomes. Consistent with the hypothesis that either ribosomal protein can support translation, knockdown of Rpl22l1 impairs growth of cells lacking Rpl22. Mechanistically, Rpl22 regulates Rpl22l1 directly by binding to an internal hairpin structure and repressing its expression. We propose that ribosome specificity may exist in mammals, providing evidence that one ribosomal protein can influence composition of the ribosome by regulating its own paralog.

  5. Synthetic peptides and ribosomal proteins as substrate for 60S ribosomal protein kinase from yeast cells

    DEFF Research Database (Denmark)

    Grankowski, N; Gasior, E; Issinger, O G

    1993-01-01

    Kinetic studies on the 60S protein kinase were conducted with synthetic peptides and ribosomal proteins as substrate. Peptide RRREEESDDD proved to be the best synthetic substrate for this enzyme. The peptide has a sequence of amino acids which most closely resembles the structure of potential...... phosphorylation sites in natural substrates, i.e., acidic ribosomal proteins. The superiority of certain kinetic parameters for 60S kinase obtained with the native whole 80S ribosomes over those of the isolated fraction of acidic ribosomal proteins indicates that the affinity of 60S kinase to the specific protein...

  6. Adenovirus type 2 endopeptidase: an unusual phosphoprotein enzyme matured by autocatalysis

    Energy Technology Data Exchange (ETDEWEB)

    Chatterjee, P.K.; Flint, S.J.

    1987-02-01

    A 19-kDa protein, present in low copy number in purified adenovirus type 2, has been characterized. Several criteria were used to establish that this protein is neither a degradation product of the known structural proteins of the virion nor a minor, unusually modified, form of protein VII. This 19-kDa protein, unlike other virion proteins, possesses alkali-resistant phosphoamino acids. Analysis by partial proteolysis indicated that it is related to a 23-kDa phosphoprotein present in H2ts-1 virions assembled in infected cells maintained at 39/sup 0/C. Affinity labeling with (/sup 3/H)diisopropyl fluorophosphate showed that the 19-kDa protein contains the active site for a serine protease. The authors, therefore, conclude that the 19-kDa protein is the active form of the adenovirus-encoded endopeptidase, defined by the H2ts-1 mutation, and is synthesized as a 23-kDa precursor that appears to mature by autocatalysis.

  7. The PAXgene(® tissue system preserves phosphoproteins in human tissue specimens and enables comprehensive protein biomarker research.

    Directory of Open Access Journals (Sweden)

    Sibylle Gündisch

    Full Text Available Precise quantitation of protein biomarkers in clinical tissue specimens is a prerequisite for accurate and effective diagnosis, prognosis, and personalized medicine. Although progress is being made, protein analysis from formalin-fixed and paraffin-embedded tissues is still challenging. In previous reports, we showed that the novel formalin-free tissue preservation technology, the PAXgene Tissue System, allows the extraction of intact and immunoreactive proteins from PAXgene-fixed and paraffin-embedded (PFPE tissues. In the current study, we focused on the analysis of phosphoproteins and the applicability of two-dimensional gel electrophoresis (2D-PAGE and enzyme-linked immunosorbent assay (ELISA to the analysis of a variety of malignant and non-malignant human tissues. Using western blot analysis, we found that phosphoproteins are quantitatively preserved in PFPE tissues, and signal intensities are comparable to that in paired, frozen tissues. Furthermore, proteins extracted from PFPE samples are suitable for 2D-PAGE and can be quantified by ELISA specific for denatured proteins. In summary, the PAXgene Tissue System reliably preserves phosphoproteins in human tissue samples, even after prolonged fixation or stabilization times, and is compatible with methods for protein analysis such as 2D-PAGE and ELISA. We conclude that the PAXgene Tissue System has the potential to serve as a versatile tissue fixative for modern pathology.

  8. Analysis of the protein-protein interactions between the human acidic ribosomal P-proteins: evaluation by the two hybrid system

    DEFF Research Database (Denmark)

    Tchórzewski, M; Boldyreff, B; Issinger, O

    2000-01-01

    The surface acidic ribosomal proteins (P-proteins), together with ribosomal core protein P0 form a multimeric lateral protuberance on the 60 S ribosomal subunit. This structure, also called stalk, is important for efficient translational activity of the ribosome. In order to shed more light...... forms the 60 S ribosomal stalk: P0-(P1/P2)(2). Additionally, mutual interactions among human and yeast P-proteins were analyzed. Heterodimer formation could be observed between human P2 and yeast P1 proteins....

  9. Structure of Ribosomal Silencing Factor Bound to Mycobacterium tuberculosis Ribosome.

    Science.gov (United States)

    Li, Xiaojun; Sun, Qingan; Jiang, Cai; Yang, Kailu; Hung, Li-Wei; Zhang, Junjie; Sacchettini, James C

    2015-10-06

    The ribosomal silencing factor RsfS slows cell growth by inhibiting protein synthesis during periods of diminished nutrient availability. The crystal structure of Mycobacterium tuberculosis (Mtb) RsfS, together with the cryo-electron microscopy (EM) structure of the large subunit 50S of Mtb ribosome, reveals how inhibition of protein synthesis by RsfS occurs. RsfS binds to the 50S at L14, which, when occupied, blocks the association of the small subunit 30S. Although Mtb RsfS is a dimer in solution, only a single subunit binds to 50S. The overlap between the dimer interface and the L14 binding interface confirms that the RsfS dimer must first dissociate to a monomer in order to bind to L14. RsfS interacts primarily through electrostatic and hydrogen bonding to L14. The EM structure shows extended rRNA density that it is not found in the Escherichia coli ribosome, the most striking of these being the extended RNA helix of H54a. Copyright © 2015 Elsevier Ltd. All rights reserved.

  10. Ribosomal studies on the 70S ribosome of E.coli by means of neutron scattering; Strukturuntersuchungen am 70S-Ribosom von E.coli unter Anwendung von Neutronenstreuung

    Energy Technology Data Exchange (ETDEWEB)

    Burkhardt, N. [GKSS-Forschungszentrum Geesthacht GmbH (Germany). Inst. fuer Werkstofforschung

    1997-12-31

    Ribosomes are ribonucleo-protein complexes, which catalyse proteinbiosynthesis in all living organisms. Currently, most of the structural models of the prokaryotic 70S ribosome rely on electron microscopy and describe mainly the outer shape of the particle. Neutron scattering can provide information on the internal structure of the ribosome. Parts of the structure can be contrasted for neutrons by means of an isotopic exchange of the naturally occurring hydrogen ({sup 1}H) for deuterium ({sup 2}H), allowing direct measurements in situ. Specifically deuterium-labeled ribosomes (E. coli) were prepared and analysed with neutron scattering. The biochemical methods were established and combined to a generally applicable preparation system. This allows labeling of all ribosomal components in any combination. A systematic analysis of the protein and RNA phases resulted in the development of a new model for the 70S ribosome. This model describes not only the outer shape of the particle, but displays also an experimentally determined internal protein-RNA distribution and the border of subunits for the first time (four-phase model; resolution: 50A). Models of the 70S ribosome from other studies were evaluated and ranked according to consistency with the measured scattering data. Applying a new neutron scattering technique of particular sensitivity, the proton-spin contrast-variation, single proteins could be measured and localized. The positions of the proteins S6 and S10 were determined, providing the first coordinates of protein mass centers within the 70S ribosome. (orig.) [Deutsch] Ribosomen sind Ribonukleinsaeure-Protein Komplexe, die in allen lebenden Organismen die Proteinbiosynthese katalysieren. Strukturmodelle fuer das prokaryontische 70S-Ribosom beruhen derzeit vorwiegend auf elektronenmikroskopischen Untersuchungen und beschreiben im wesentlichen die aeussere Oberflaeche des Partikels. Informationen ueber die innere Struktur des Ribosoms koennen Messungen mit

  11. Ribosomal studies on the 70S ribosome of E.coli by means of neutron scattering; Strukturuntersuchungen am 70S-Ribosom von E.coli unter Anwendung von Neutronenstreuung

    Energy Technology Data Exchange (ETDEWEB)

    Burkhardt, N [GKSS-Forschungszentrum Geesthacht GmbH (Germany). Inst. fuer Werkstofforschung

    1998-12-31

    Ribosomes are ribonucleo-protein complexes, which catalyse proteinbiosynthesis in all living organisms. Currently, most of the structural models of the prokaryotic 70S ribosome rely on electron microscopy and describe mainly the outer shape of the particle. Neutron scattering can provide information on the internal structure of the ribosome. Parts of the structure can be contrasted for neutrons by means of an isotopic exchange of the naturally occurring hydrogen ({sup 1}H) for deuterium ({sup 2}H), allowing direct measurements in situ. Specifically deuterium-labeled ribosomes (E. coli) were prepared and analysed with neutron scattering. The biochemical methods were established and combined to a generally applicable preparation system. This allows labeling of all ribosomal components in any combination. A systematic analysis of the protein and RNA phases resulted in the development of a new model for the 70S ribosome. This model describes not only the outer shape of the particle, but displays also an experimentally determined internal protein-RNA distribution and the border of subunits for the first time (four-phase model; resolution: 50A). Models of the 70S ribosome from other studies were evaluated and ranked according to consistency with the measured scattering data. Applying a new neutron scattering technique of particular sensitivity, the proton-spin contrast-variation, single proteins could be measured and localized. The positions of the proteins S6 and S10 were determined, providing the first coordinates of protein mass centers within the 70S ribosome. (orig.) [Deutsch] Ribosomen sind Ribonukleinsaeure-Protein Komplexe, die in allen lebenden Organismen die Proteinbiosynthese katalysieren. Strukturmodelle fuer das prokaryontische 70S-Ribosom beruhen derzeit vorwiegend auf elektronenmikroskopischen Untersuchungen und beschreiben im wesentlichen die aeussere Oberflaeche des Partikels. Informationen ueber die innere Struktur des Ribosoms koennen Messungen mit

  12. Differential Stoichiometry among Core Ribosomal Proteins

    Directory of Open Access Journals (Sweden)

    Nikolai Slavov

    2015-11-01

    Full Text Available Understanding the regulation and structure of ribosomes is essential to understanding protein synthesis and its dysregulation in disease. While ribosomes are believed to have a fixed stoichiometry among their core ribosomal proteins (RPs, some experiments suggest a more variable composition. Testing such variability requires direct and precise quantification of RPs. We used mass spectrometry to directly quantify RPs across monosomes and polysomes of mouse embryonic stem cells (ESC and budding yeast. Our data show that the stoichiometry among core RPs in wild-type yeast cells and ESC depends both on the growth conditions and on the number of ribosomes bound per mRNA. Furthermore, we find that the fitness of cells with a deleted RP-gene is inversely proportional to the enrichment of the corresponding RP in polysomes. Together, our findings support the existence of ribosomes with distinct protein composition and physiological function.

  13. A photoaffinity scan maps regions of the p85 SH2 domain involved in phosphoprotein binding.

    Science.gov (United States)

    Williams, K P; Shoelson, S E

    1993-03-15

    Src homology 2 (SH2) domains are modular phosphotyrosine binding pockets found within a wide variety of cytoplasmic signaling molecules. Here we develop a new approach to analyzing protein-protein interfaces termed photoaffinity scanning, and apply the method to map regions of the phosphatidylinositol 3-kinase p85 SH2 domain that participate in phospho-protein binding. Each residue except phosphotyrosine (pY) within a tightly binding, IRS-1-derived phosphopeptide (GNGDpYMPMSPKS) was substituted with the photoactive amino acid, benzoylphenylalanine (Bpa). Whereas most substitutions had little effect on binding affinity, Bpa substitution of either Met (+1 and +3 with respect to pY) reduced affinity 50-100-fold to confirm their importance in the pYMXM recognition motif. In three cases photolysis of SH2 domain/Bpa phosphopeptide complexes led to cross-linking of > 50% of the SH2 domain; cross-link positions were identified by microsequence, amino acid composition, and electrospray mass spectrometric analyses. Bpa-1 cross-links within alpha-helix I, whereas Bpa+1 and Bpa+4 cross-link the SH2 domain within the flexible loop C-terminal to alpha-helix II. Moreover, cross-linking at any position prevents SH2 domain cleavage at a trypsin-sensitive site within the flexible loop between beta-strands 1 and 2. Therefore, at least three distinct SH2 regions in addition to the beta-sheet participate in phosphoprotein binding; the loop cross-linked by phosphopeptide residues C-terminal to pY appears to confer specificity to the phosphoprotein/SH2 domain interaction.

  14. Haloperidol Regulates the State of Phosphorylation of Ribosomal Protein S6 via Activation of PKA and Phosphorylation of DARPP-32

    Science.gov (United States)

    Valjent, Emmanuel; Bertran-Gonzalez, Jesus; Bowling, Heather; Lopez, Sébastien; Santini, Emanuela; Matamales, Miriam; Bonito-Oliva, Alessandra; Hervé, Denis; Hoeffer, Charles; Klann, Eric; Girault, Jean-Antoine; Fisone, Gilberto

    2011-01-01

    Administration of typical antipsychotic drugs, such as haloperidol, promotes cAMP-dependent signaling in the medium spiny neurons (MSNs) of the striatum. In this study, we have examined the effect of haloperidol on the state of phosphorylation of the ribosomal protein S6 (rpS6), a component of the small 40S ribosomal subunit. We found that haloperidol increases the phosphorylation of rpS6 at the dual site Ser235/236, which is involved in the regulation of mRNA translation. This effect was exerted in the MSNs of the indirect pathway, which express specifically dopamine D2 receptors (D2Rs) and adenosine A2 receptors (A2ARs). The effect of haloperidol was decreased by blockade of A2ARs or by genetic attenuation of the Gαolf protein, which couples A2ARs to activation of adenylyl cyclase. Moreover, stimulation of cAMP-dependent protein kinase A (PKA) increased Ser235/236 phosphorylation in cultured striatal neurons. The ability of haloperidol to promote rpS6 phosphorylation was abolished in knock-in mice deficient for PKA activation of the protein phosphatase-1 inhibitor, dopamine- and cAMP-regulated phosphoprotein of 32 kDa. In contrast, pharmacological or genetic inactivation of p70 rpS6 kinase 1, or extracellular signal-regulated kinases did not affect haloperidol-induced rpS6 phosphorylation. These results identify PKA as a major rpS6 kinase in neuronal cells and suggest that regulation of protein synthesis through rpS6 may be a potential target of antipsychotic drugs. PMID:21814187

  15. Control of ribosome formation in rat heart

    International Nuclear Information System (INIS)

    Russo, L.A.

    1987-01-01

    Diabetes of 9 days duration produced a 17% diminution in the rate of total protein synthesis in rat hearts perfused as Langendorff preparations supplied with glucose, plasma levels of amino acids, and 400 μU/ml insulin. This reduction was attributable to a decrease in efficiency of protein synthesis and total RNA content. Total messenger RNA content decreased in diabetic hearts in proportion to the reduction in total RNA. Diabetes also resulted in diminished ribosome content as reflected by the induction in total RNA. Ribosome production was investigated by monitoring incorporation of [ 3 H]phenylalanine into the proteins of cytoplasmic ribosomes. Rates of ribosome formation in diabetic hearts were as fast as control rates in the presence of insulin, and were faster than control rates in the absence of the hormone. These results indicated that ribosome content fell in diabetic hearts despite unchanged or faster rates of ribosome formation

  16. Cryo-EM structure of the archaeal 50S ribosomal subunit in complex with initiation factor 6 and implications for ribosome evolution

    DEFF Research Database (Denmark)

    Greber, Basil J; Boehringer, Daniel; Godinic-Mikulcic, Vlatka

    2012-01-01

    additional components of the translation machinery with eukaryotes that are absent in bacteria. One of these translation factors is initiation factor 6 (IF6), which associates with the large ribosomal subunit. We have reconstructed the 50S ribosomal subunit from the archaeon Methanothermobacter...... between this archaeal ribosome and eukaryotic ribosomes but are mostly absent in bacteria and in some archaeal lineages. Furthermore, the structure reveals that, in spite of highly divergent evolutionary trajectories of the ribosomal particle and the acquisition of novel functions of IF6 in eukaryotes......, the molecular binding of IF6 on the ribosome is conserved between eukaryotes and archaea. The structure also provides a snapshot of the reductive evolution of the archaeal ribosome and offers new insights into the evolution of the translation system in archaea....

  17. Kinetic pathway of 40S ribosomal subunit recruitment to hepatitis C virus internal ribosome entry site.

    Science.gov (United States)

    Fuchs, Gabriele; Petrov, Alexey N; Marceau, Caleb D; Popov, Lauren M; Chen, Jin; O'Leary, Seán E; Wang, Richard; Carette, Jan E; Sarnow, Peter; Puglisi, Joseph D

    2015-01-13

    Translation initiation can occur by multiple pathways. To delineate these pathways by single-molecule methods, fluorescently labeled ribosomal subunits are required. Here, we labeled human 40S ribosomal subunits with a fluorescent SNAP-tag at ribosomal protein eS25 (RPS25). The resulting ribosomal subunits could be specifically labeled in living cells and in vitro. Using single-molecule Förster resonance energy transfer (FRET) between RPS25 and domain II of the hepatitis C virus (HCV) internal ribosome entry site (IRES), we measured the rates of 40S subunit arrival to the HCV IRES. Our data support a single-step model of HCV IRES recruitment to 40S subunits, irreversible on the initiation time scale. We furthermore demonstrated that after binding, the 40S:HCV IRES complex is conformationally dynamic, undergoing slow large-scale rearrangements. Addition of translation extracts suppresses these fluctuations, funneling the complex into a single conformation on the 80S assembly pathway. These findings show that 40S:HCV IRES complex formation is accompanied by dynamic conformational rearrangements that may be modulated by initiation factors.

  18. Cryo-EM Structure of the Archaeal 50S Ribosomal Subunit in Complex with Initiation Factor 6 and Implications for Ribosome Evolution

    Science.gov (United States)

    Greber, Basil J.; Boehringer, Daniel; Godinic-Mikulcic, Vlatka; Crnkovic, Ana; Ibba, Michael; Weygand-Durasevic, Ivana; Ban, Nenad

    2013-01-01

    Translation of mRNA into proteins by the ribosome is universally conserved in all cellular life. The composition and complexity of the translation machinery differ markedly between the three domains of life. Organisms from the domain Archaea show an intermediate level of complexity, sharing several additional components of the translation machinery with eukaryotes that are absent in bacteria. One of these translation factors is initiation factor 6 (IF6), which associates with the large ribosomal subunit. We have reconstructed the 50S ribosomal subunit from the archaeon Methanothermobacter thermautotrophicus in complex with archaeal IF6 at 6.6 Å resolution using cryo-electron microscopy (EM). The structure provides detailed architectural insights into the 50S ribosomal subunit from a methanogenic archaeon through identification of the rRNA expansion segments and ribosomal proteins that are shared between this archaeal ribosome and eukaryotic ribosomes but are mostly absent in bacteria and in some archaeal lineages. Furthermore, the structure reveals that, in spite of highly divergent evolutionary trajectories of the ribosomal particle and the acquisition of novel functions of IF6 in eukaryotes, the molecular binding of IF6 on the ribosome is conserved between eukaryotes and archaea. The structure also provides a snapshot of the reductive evolution of the archaeal ribosome and offers new insights into the evolution of the translation system in archaea. PMID:22306461

  19. PLUTONIUM FINISHING PLANT (PFP) 241-Z LIQUID WASTE TREATMENT FACILITY DEACTIVATION AND DEMOLITION

    International Nuclear Information System (INIS)

    JOHNSTON GA

    2008-01-01

    Fluor Hanford, Inc. (FH) is proud to submit the Plutonium Finishing Plant (PFP) 241-Z liquid Waste Treatment Facility Deactivation and Demolition (D and D) Project for consideration by the Project Management Institute as Project of the Year for 2008. The decommissioning of the 241-Z Facility presented numerous challenges, many of which were unique with in the Department of Energy (DOE) Complex. The majority of the project budget and schedule was allocated for cleaning out five below-grade tank vaults. These highly contaminated, confined spaces also presented significant industrial safety hazards that presented some of the most hazardous work environments on the Hanford Site. The 241-Z D and D Project encompassed diverse tasks: cleaning out and stabilizing five below-grade tank vaults (also called cells), manually size-reducing and removing over three tons of process piping from the vaults, permanently isolating service utilities, removing a large contaminated chemical supply tank, stabilizing and removing plutonium-contaminated ventilation ducts, demolishing three structures to grade, and installing an environmental barrier on the demolition site . All of this work was performed safely, on schedule, and under budget. During the deactivation phase of the project between November 2005 and February 2007, workers entered the highly contaminated confined-space tank vaults 428 times. Each entry (or 'dive') involved an average of three workers, thus equaling approximately 1,300 individual confined -space entries. Over the course of the entire deactivation and demolition period, there were no recordable injuries and only one minor reportable skin contamination. The 241-Z D and D Project was decommissioned under the provisions of the 'Hanford Federal Facility Agreement and Consent Order' (the Tri-Party Agreement or TPA), the 'Resource Conservation and Recovery Act of 1976' (RCRA), and the 'Comprehensive Environmental Response, Compensation, and Liability Act of 1980

  20. Ribosomal history reveals origins of modern protein synthesis.

    Directory of Open Access Journals (Sweden)

    Ajith Harish

    Full Text Available The origin and evolution of the ribosome is central to our understanding of the cellular world. Most hypotheses posit that the ribosome originated in the peptidyl transferase center of the large ribosomal subunit. However, these proposals do not link protein synthesis to RNA recognition and do not use a phylogenetic comparative framework to study ribosomal evolution. Here we infer evolution of the structural components of the ribosome. Phylogenetic methods widely used in morphometrics are applied directly to RNA structures of thousands of molecules and to a census of protein structures in hundreds of genomes. We find that components of the small subunit involved in ribosomal processivity evolved earlier than the catalytic peptidyl transferase center responsible for protein synthesis. Remarkably, subunit RNA and proteins coevolved, starting with interactions between the oldest proteins (S12 and S17 and the oldest substructure (the ribosomal ratchet in the small subunit and ending with the rise of a modern multi-subunit ribosome. Ancestral ribonucleoprotein components show similarities to in vitro evolved RNA replicase ribozymes and protein structures in extant replication machinery. Our study therefore provides important clues about the chicken-or-egg dilemma associated with the central dogma of molecular biology by showing that ribosomal history is driven by the gradual structural accretion of protein and RNA structures. Most importantly, results suggest that functionally important and conserved regions of the ribosome were recruited and could be relics of an ancient ribonucleoprotein world.

  1. Test plan for N2 HEPA filters assembly shop stock used on PFP E4 exhaust system

    International Nuclear Information System (INIS)

    DICK, J.D.

    1999-01-01

    At Plutonium Finishing Plant (PFP) and Plutonium Reclamation Facility (PRF) Self-contained HEPA filters, encased in wooden frames and boxes, are installed in the E4 Exhaust Ventilation System to provide confinement of radioactive releases to the environment and confinement of radioactive contamination within designated zones inside the facility. Recently during the routine testing in-leakage was discovered downstream of the Self-contained HEPA filters boxes. This Test Plan describes the approach to conduct investigation of the root causes for the in-leakage of HEPA filters

  2. PLUTONIUM FINISHING PLANT (PFP) SUB-GRADE EE/CA EVALUATION OF ALTERNATIVES: A NEW MODEL

    International Nuclear Information System (INIS)

    HOPKINS, A.M.

    2007-01-01

    An engineering evaluation/cost analysis (EE/CA) was performed at the Hanford Site's Plutonium Finishing Plant (PFP). The purpose of the EVCA was to identify the sub-grade items to be evaluated; determine the Comprehensive Environmental Response, Compensation, and Liability Act of 1980 (CERCLA) hazardous substances through process history and available data; evaluate these hazards; and as necessary, identify the available alternatives to reduce the risk associated with the contaminants. The sub-grade EWCA considered four alternatives for an interim removal action: (1) No Action; (2) Surveillance and Maintenance (S and M); (3) Stabilize and Leave in Place (Stabilization); and (4) Remove, Treat and Dispose (RTD). Each alternative was evaluated against the CERCLA criteria for effectiveness, implementability, and cost

  3. Post-transcriptional regulation of ribosome biogenesis in yeast

    Directory of Open Access Journals (Sweden)

    Isabelle C. Kos-Braun

    2017-05-01

    Full Text Available Most microorganisms are exposed to the constantly and often rapidly changing environment. As such they evolved mechanisms to balance their metabolism and energy expenditure with the resources available to them. When resources become scarce or conditions turn out to be unfavourable for growth, cells reduce their metabolism and energy usage to survive. One of the major energy consuming processes in the cell is ribosome biogenesis. Unsurprisingly, cells encountering adverse conditions immediately shut down production of new ribosomes. It is well established that nutrient depletion leads to a rapid repression of transcription of the genes encoding ribosomal proteins, ribosome biogenesis factors as well as ribosomal RNA (rRNA. However, if pre-rRNA processing and ribosome assembly are regulated post-transcriptionally remains largely unclear. We have recently uncovered that the yeast Saccharomyces cerevisiae rapidly switches between two alternative pre-rRNA processing pathways depending on the environmental conditions. Our findings reveal a new level of complexity in the regulation of ribosome biogenesis.

  4. Ribosomal Antibiotics: Contemporary Challenges

    Directory of Open Access Journals (Sweden)

    Tamar Auerbach-Nevo

    2016-06-01

    Full Text Available Most ribosomal antibiotics obstruct distinct ribosomal functions. In selected cases, in addition to paralyzing vital ribosomal tasks, some ribosomal antibiotics are involved in cellular regulation. Owing to the global rapid increase in the appearance of multi-drug resistance in pathogenic bacterial strains, and to the extremely slow progress in developing new antibiotics worldwide, it seems that, in addition to the traditional attempts at improving current antibiotics and the intensive screening for additional natural compounds, this field should undergo substantial conceptual revision. Here, we highlight several contemporary issues, including challenging the common preference of broad-range antibiotics; the marginal attention to alterations in the microbiome population resulting from antibiotics usage, and the insufficient awareness of ecological and environmental aspects of antibiotics usage. We also highlight recent advances in the identification of species-specific structural motifs that may be exploited for the design and the creation of novel, environmental friendly, degradable, antibiotic types, with a better distinction between pathogens and useful bacterial species in the microbiome. Thus, these studies are leading towards the design of “pathogen-specific antibiotics,” in contrast to the current preference of broad range antibiotics, partially because it requires significant efforts in speeding up the discovery of the unique species motifs as well as the clinical pathogen identification.

  5. Effect of primary and secondary radicals on chain breaks in ribosomal RNA in E. coli ribosomes

    International Nuclear Information System (INIS)

    Singh, H.; Bishop, J.

    1984-01-01

    It has been shown previously that, in dilute aerated solutions, ribosomes are inactivated by OH radicals and by secondary radicals produced from added alcohols (Singh and Vadasz 1983 a). In de-aerated solutions, both radicalH and e - sub(aq) also inactivate ribosomes (Singh and Vadasz 1983 b). The results of these studies and other on different systems (Adams et al. 1973, Aldrich and Cundall 1969, Dewey and Stein 1970, Masuda et al. 1971, Nabben et al. 1982, 1983, Samuni et al. 1980, Singh and Singh 1982) have shown that damage to biological systems occurs by diverse mechanisms. One of these mechanisms involves chain breaks in RNA (Pollard and Weller 1967). The purpose of this study was to determine which of the primary and secondary radicals cause chain breaks in ribosomal RNA (rRNA) within the ribosomes. (author)

  6. Placeholder factors in ribosome biogenesis: please, pave my way

    Directory of Open Access Journals (Sweden)

    Francisco J. Espinar-Marchena

    2017-04-01

    Full Text Available The synthesis of cytoplasmic eukaryotic ribosomes is an extraordinarily energy-demanding cellular activity that occurs progressively from the nucleolus to the cytoplasm. In the nucleolus, precursor rRNAs associate with a myriad of trans-acting factors and some ribosomal proteins to form pre-ribosomal particles. These factors include snoRNPs, nucleases, ATPases, GTPases, RNA helicases, and a vast list of proteins with no predicted enzymatic activity. Their coordinate activity orchestrates in a spatiotemporal manner the modification and processing of precursor rRNAs, the rearrangement reactions required for the formation of productive RNA folding intermediates, the ordered assembly of the ribosomal proteins, and the export of pre-ribosomal particles to the cytoplasm; thus, providing speed, directionality and accuracy to the overall process of formation of translation-competent ribosomes. Here, we review a particular class of trans-acting factors known as “placeholders”. Placeholder factors temporarily bind selected ribosomal sites until these have achieved a structural context that is appropriate for exchanging the placeholder with another site-specific binding factor. By this strategy, placeholders sterically prevent premature recruitment of subsequently binding factors, premature formation of structures, avoid possible folding traps, and act as molecular clocks that supervise the correct progression of pre-ribosomal particles into functional ribosomal subunits. We summarize the current understanding of those factors that delay the assembly of distinct ribosomal proteins or subsequently bind key sites in pre-ribosomal particles. We also discuss recurrent examples of RNA-protein and protein-protein mimicry between rRNAs and/or factors, which have clear functional implications for the ribosome biogenesis pathway.

  7. Purification and partial characterization of analogous 26-kDa rat submandibular and parotid gland integral membrane phosphoproteins that may have a role in exocytosis.

    Science.gov (United States)

    Quissell, D O; Deisher, L M

    1992-04-01

    Rat submandibular and parotid gland exocytosis is primarily controlled by beta-adrenergic receptor stimulation. Although its precise role in the regulation of salivary gland exocytosis is not fully understood, protein phosphorylation, mediated by the activation of cAMP-dependent protein kinase, may be directly involved. Previous studies suggest that analogous 26-kDa integral membrane phosphoproteins may play a direct role in regulating exocytosis. Studies were here undertaken to purify and partially characterize both phosphoproteins. After endogenous phosphorylation with 32P, subcellular fraction and solubilization of the microsomal fraction in n-octyl beta-glucopyranoside, the 26-kDa integral membrane phosphoproteins were purified by high performance liquid chromatography (HPLC), followed by sodium dodecyl sulphate-polyacrylamide gel electrophoresis and electroelution of the proteins. Amino acid analysis indicated a significant number of serine amino acids: N-terminal sequence data demonstrated a high level of homology; and trypsin digestion followed by reversed-phase HPLC indicated the possibility of multiple phosphorylation sites.

  8. Protein-protein interactions within late pre-40S ribosomes.

    Directory of Open Access Journals (Sweden)

    Melody G Campbell

    2011-01-01

    Full Text Available Ribosome assembly in eukaryotic organisms requires more than 200 assembly factors to facilitate and coordinate rRNA transcription, processing, and folding with the binding of the ribosomal proteins. Many of these assembly factors bind and dissociate at defined times giving rise to discrete assembly intermediates, some of which have been partially characterized with regards to their protein and RNA composition. Here, we have analyzed the protein-protein interactions between the seven assembly factors bound to late cytoplasmic pre-40S ribosomes using recombinant proteins in binding assays. Our data show that these factors form two modules: one comprising Enp1 and the export adaptor Ltv1 near the beak structure, and the second comprising the kinase Rio2, the nuclease Nob1, and a regulatory RNA binding protein Dim2/Pno1 on the front of the head. The GTPase-like Tsr1 and the universally conserved methylase Dim1 are also peripherally connected to this second module. Additionally, in an effort to further define the locations for these essential proteins, we have analyzed the interactions between these assembly factors and six ribosomal proteins: Rps0, Rps3, Rps5, Rps14, Rps15 and Rps29. Together, these results and previous RNA-protein crosslinking data allow us to propose a model for the binding sites of these seven assembly factors. Furthermore, our data show that the essential kinase Rio2 is located at the center of the pre-ribosomal particle and interacts, directly or indirectly, with every other assembly factor, as well as three ribosomal proteins required for cytoplasmic 40S maturation. These data suggest that Rio2 could play a central role in regulating cytoplasmic maturation steps.

  9. Definition and means of maintaining the criticality detectors and alarms portion of the PFP safety envelope

    Energy Technology Data Exchange (ETDEWEB)

    White, W.F.

    1997-05-13

    The purpose of this document is to provide the definition and means of maintaining the Safety Envelope (SE) related to the Criticality Alarm System (CAS). This document provides amplification of the Limiting Condition for Operation (LCO) described in the Plutonium Finishing Plant (PFP) Operational Safety Requirements (OSR), WHC-SD-CP-OSR-010, Rev. 0, 1994, Section 3.1.2, Criticality Detectors and Alarms. This document, with its appendices, provides the following: (1) System functional requirements for determining system operability (Section 3); (2) A list of annotated system block diagrams which indicate the safety envelope boundaries (Appendix C); (3) A list of the Safety Class 1 and 2 Safety Envelope (SC-1/2 SE) equipment for input into the Master Component Index (Appendix B); (4) Functional requirements for individual SC-1/2 SE components, including appropriate setpoints and process parameters (Section 6 and Appendix A); (5) A list of the operational, maintenance and surveillance procedures necessary to operate and maintain the SC-1/2 SE components as required by the LCO (Section 6 and Appendix A).

  10. Definition and Means of Maintaining the Criticality Prevention Design Features Portion of the PFP Safety Envelope

    International Nuclear Information System (INIS)

    RAMBLE, A.L.

    2000-01-01

    The purpose of this document is to record the technical evaluation of the Operational Safety Requirements described in the Plutonium Finishing Plant Final (PFP) Operational Safety Requirements, WHC-SD-CP-OSR-010. Rev. 0-N , Section 3.1.1, ''Criticality Prevention System.'' This document, with its appendices, provides the following: (1) The results of a review of Criticality Safety Analysis Reports (CSAR), later called Criticality Safety Evaluation Reports (CSER), and Criticality Prevention Specifications (CPS) to determine which equipment or components analyzed in the CSER or CPS are considered as one of the two unlikely, independent, and concurrent changes before a criticality accident is possible. (2) Evaluations of equipment or components to determine the safety boundary for the system (Section 4). (3) A list of essential drawings that show the safety system or component (Appendix A). (4) A list of the safety envelope (SE) equipment (Appendix B). (5) Functional requirements for the individual safety envelope equipment (Sections 3 and 4). (6) A list of the operational and surveillance procedures necessary to maintain the system equipment within the safety envelope (Section 5)

  11. Definition and means of maintaining the criticality detectors and alarms portion of the PFP safety envelope

    International Nuclear Information System (INIS)

    White, W.F.

    1997-01-01

    The purpose of this document is to provide the definition and means of maintaining the Safety Envelope (SE) related to the Criticality Alarm System (CAS). This document provides amplification of the Limiting Condition for Operation (LCO) described in the Plutonium Finishing Plant (PFP) Operational Safety Requirements (OSR), WHC-SD-CP-OSR-010, Rev. 0, 1994, Section 3.1.2, Criticality Detectors and Alarms. This document, with its appendices, provides the following: (1) System functional requirements for determining system operability (Section 3); (2) A list of annotated system block diagrams which indicate the safety envelope boundaries (Appendix C); (3) A list of the Safety Class 1 and 2 Safety Envelope (SC-1/2 SE) equipment for input into the Master Component Index (Appendix B); (4) Functional requirements for individual SC-1/2 SE components, including appropriate setpoints and process parameters (Section 6 and Appendix A); (5) A list of the operational, maintenance and surveillance procedures necessary to operate and maintain the SC-1/2 SE components as required by the LCO (Section 6 and Appendix A)

  12. Evaluation of the Magnesium Hydroxide Treatment Process for Stabilizing PFP Plutonium/Nitric Acid Solutions

    Energy Technology Data Exchange (ETDEWEB)

    Gerber, Mark A.; Schmidt, Andrew J.; Delegard, Calvin H.; Silvers, Kurt L.; Baker, Aaron B.; Gano, Susan R.; Thornton, Brenda M.

    2000-09-28

    This document summarizes an evaluation of the magnesium hydroxide [Mg(OH)2] process to be used at the Hanford Plutonium Finishing Plant (PFP) for stabilizing plutonium/nitric acid solutions to meet the goal of stabilizing the plutonium in an oxide form suitable for storage under DOE-STD-3013-99. During the treatment process, nitric acid solutions bearing plutonium nitrate are neutralized with Mg(OH)2 in an air sparge reactor. The resulting slurry, containing plutonium hydroxide, is filtered and calcined. The process evaluation included a literature review and extensive laboratory- and bench-scale testing. The testing was conducted using cerium as a surrogate for plutonium to identify and quantify the effects of key processing variables on processing time (primarily neutralization and filtration time) and calcined product properties.

  13. Nuclear criticality safety: general. 6. Application of Fixed Neutron Absorbers in the New Hanford PFP Horizontal Rack Design

    International Nuclear Information System (INIS)

    Lan, J.S.; Miller, E.M.; Toffer, H.; Mo, B.S.

    2001-01-01

    The Hanford Plutonium Finishing Plant (PFP) is currently in a waste cleanup and plutonium stabilization mode. Plutonium-bearing materials are processed through thermal treatment, creating forms of oxides suitable for long-term storage. Stabilized materials at PFP are stored in a variety of cans such as the bag-less transfer cans (BTCs), which are ultimately contained in the U.S. Department of Energy (DOE) 3013 can; both cans are larger than previously used plutonium storage containers and hold more plutonium. To compensate for the increased plutonium loadings, added engineered safety features were considered in the storage facilities. The vaults in PFP, subdivided into concrete-walled cubicles, will contain both new and older cans. The DOE 3013 and BTC cans may be loaded with up to 4.4 kg of plutonium as a compound (mostly oxide). New racks that store cans horizontally are being constructed to hold both new and older containers. The loading objective is to accommodate 70 kg of plutonium per cubicle. Two design analysis approaches for the new racks were considered. The first approach incorporated neutron absorption provided by the structural materials of the rack and the cans in determining a safe configuration. A rack loading arrangement was determined as shown in Fig. 1 and specified in Table I. This approach provides compliance with criticality control requirements; however, added administrative controls were needed to accommodate a sufficient number of cans in specific locations to achieve 70 kg of plutonium per cubicle. The 4.4-kg plutonium container can be placed only in predetermined locations. The second approach evaluated the addition of a fixed neutron absorber plate along the back wall of the cubicle (Fig. 1). The location of the special plate facilitates installation of the racks and provides additional criticality safety margin beyond the first approach. Its presence permits loading of racks with up to 4.4-kg plutonium cans in any storage locations

  14. COLLABORATIVE NEGOTIATIONS A SUCCESSFUL APPROACH FOR NEGOTIATING COMPLIANCE MILESTONES FOR THE TRANSITION OF THE PLUTONIUM FINISHING PLANT (PFP), HANFORD NUCLEAR RESERVATION, AND HANFORD, WASHINGTON

    International Nuclear Information System (INIS)

    Hebdon, J.; Yerxa, J.; Romine, L.; Hopkins, AM; Piippo, R.; Cusack, L.; Bond, R.; Wang, Oliver; Willis, D.

    2003-01-01

    The Hanford Nuclear Reservation is a former U. S. Department of Energy Defense Production Site. The site is currently listed on the National Priorities List of the Comprehensive Environmental Response Compensation and Liability Act of 1980 (CERCLA) and is undergoing cleanup and environmental restoration. The PFP is a former Plutonium metal production facility. The operating mission of the PFP ended with a DOE Headquarters shutdown letter in October of 1996. Generally, the receipt of a shutdown letter initiates the start of Transition (as the first step of Decommissioning) of a facility. The Hanford site is subject to the Hanford Federal Facilities Compliance Act and Consent Order (HFFCCO), an order on consent signed by the DOE, the U. S. Environmental Protection Agency, (EPA) and the Washington Department of Ecology (WDOE). Under the HFFCCO, negotiations for transition milestones begin within six months after the issuance of a shutdown order. In the case of the PFP, the Nuclear Materials disposition and stabilization activities, a DOE responsibility, were necessary as precursor activities to Transition. This situation precipitated a crisis in the negotiations between the agencies, and formal negotiations initiated in 1997 ended in failure. The negotiations reached impasse on several key regulatory and operational issues. The 1997 negotiation was characterized by a strongly positional style. DOE and the regulatory personnel took hard lines early in the negotiations and were unable to move to resolution of key issues after a year and a half. This resulted in unhappy stakeholders, poor publicity and work delays as well as wounded relationships between DOE and the regulatory community. In the 2000-2001 PFP negotiations, a completely different approach was suggested and eventually initiated: Collaborative Negotiations. The collaborative negotiation style resulted in agreement between the agencies on all key issues within 6 months of initiation. All parties were very

  15. COLLABORATIVE NEGOTIATIONS A SUCCESSFUL APPROACH FOR NEGOTIATING COMPLIANCE MILESTONES FOR THE TRANSITION OF THE PLUTONIUM FINISHING PLANT (PFP), HANFORD NUCLEAR RESERVATION, AND HANFORD, WASHINGTON

    Energy Technology Data Exchange (ETDEWEB)

    Hebdon, J.; Yerxa, J.; Romine, L.; Hopkins, AM; Piippo, R.; Cusack, L.; Bond, R.; Wang, Oliver; Willis, D.

    2003-02-27

    The Hanford Nuclear Reservation is a former U. S. Department of Energy Defense Production Site. The site is currently listed on the National Priorities List of the Comprehensive Environmental Response Compensation and Liability Act of 1980 (CERCLA) and is undergoing cleanup and environmental restoration. The PFP is a former Plutonium metal production facility. The operating mission of the PFP ended with a DOE Headquarters shutdown letter in October of 1996. Generally, the receipt of a shutdown letter initiates the start of Transition (as the first step of Decommissioning) of a facility. The Hanford site is subject to the Hanford Federal Facilities Compliance Act and Consent Order (HFFCCO), an order on consent signed by the DOE, the U. S. Environmental Protection Agency, (EPA) and the Washington Department of Ecology (WDOE). Under the HFFCCO, negotiations for transition milestones begin within six months after the issuance of a shutdown order. In the case of the PFP, the Nuclear Materials disposition and stabilization activities, a DOE responsibility, were necessary as precursor activities to Transition. This situation precipitated a crisis in the negotiations between the agencies, and formal negotiations initiated in 1997 ended in failure. The negotiations reached impasse on several key regulatory and operational issues. The 1997 negotiation was characterized by a strongly positional style. DOE and the regulatory personnel took hard lines early in the negotiations and were unable to move to resolution of key issues after a year and a half. This resulted in unhappy stakeholders, poor publicity and work delays as well as wounded relationships between DOE and the regulatory community. In the 2000-2001 PFP negotiations, a completely different approach was suggested and eventually initiated: Collaborative Negotiations. The collaborative negotiation style resulted in agreement between the agencies on all key issues within 6 months of initiation. All parties were very

  16. Defective ribosome assembly in Shwachman-Diamond syndrome.

    Science.gov (United States)

    Wong, Chi C; Traynor, David; Basse, Nicolas; Kay, Robert R; Warren, Alan J

    2011-10-20

    Shwachman-Diamond syndrome (SDS), a recessive leukemia predisposition disorder characterized by bone marrow failure, exocrine pancreatic insufficiency, skeletal abnormalities and poor growth, is caused by mutations in the highly conserved SBDS gene. Here, we test the hypothesis that defective ribosome biogenesis underlies the pathogenesis of SDS. We create conditional mutants in the essential SBDS ortholog of the ancient eukaryote Dictyostelium discoideum using temperature-sensitive, self-splicing inteins, showing that mutant cells fail to grow at the restrictive temperature because ribosomal subunit joining is markedly impaired. Remarkably, wild type human SBDS complements the growth and ribosome assembly defects in mutant Dictyostelium cells, but disease-associated human SBDS variants are defective. SBDS directly interacts with the GTPase elongation factor-like 1 (EFL1) on nascent 60S subunits in vivo and together they catalyze eviction of the ribosome antiassociation factor eukaryotic initiation factor 6 (eIF6), a prerequisite for the translational activation of ribosomes. Importantly, lymphoblasts from SDS patients harbor a striking defect in ribosomal subunit joining whose magnitude is inversely proportional to the level of SBDS protein. These findings in Dictyostelium and SDS patient cells provide compelling support for the hypothesis that SDS is a ribosomopathy caused by corruption of an essential cytoplasmic step in 60S subunit maturation.

  17. Disposal of TRU Waste from the PFP in pipe overpack containers to WIPP Including New Security Requirements

    International Nuclear Information System (INIS)

    HOPKINS, A.M.

    2003-01-01

    The Department of Energy is responsible for the safe management and cleanup of the DOE complex. As part of the cleanup and closure of the Plutonium Finishing Plant (PFP) located on the Hanford site, the nuclear material inventory was reviewed to determine the appropriate disposition path. Based on the nuclear material characteristics, the material was designated for stabilization and packaging for long term storage and transfer to the Savannah River Site, or a decision for discard was made. The discarded material was designated as waste material and slated for disposal to the Waste Isolation Pilot Plant (WIPP). Prior to preparing any residue wastes for disposal at the WIPP, several major activities need to be completed. As detailed a processing history as possible of the material including origin of the waste must be researched and documented. A technical basis for termination of safeguards on the material must be prepared and approved. Utilizing process knowledge and processing history, the material must be characterized, sampling requirements determined, acceptable knowledge package and waste designation completed prior to disposal. All of these activities involve several organizations including the contractor, DOE, state representatives and other regulators such as EPA. At PFP, a process has been developed for meeting the many, varied requirements and successfully used to prepare several residue waste streams including Rocky Flats incinerator ash, hanford incinerator ash and Sand, Slag and Crucible (SS and C) material for disposal. These waste residues are packed into Pipe Overpack Containers for shipment to the WIPP

  18. Emerging functions of ribosomal proteins in gene-specific transcription and translation

    International Nuclear Information System (INIS)

    Lindstroem, Mikael S.

    2009-01-01

    Ribosomal proteins have remained highly conserved during evolution presumably reflecting often critical functions in ribosome biogenesis or mature ribosome function. In addition, several ribosomal proteins possess distinct extra-ribosomal functions in apoptosis, DNA repair and transcription. An increasing number of ribosomal proteins have been shown to modulate the trans-activation function of important regulatory proteins such as NF-κB, p53, c-Myc and nuclear receptors. Furthermore, a subset of ribosomal proteins can bind directly to untranslated regions of mRNA resulting in transcript-specific translational control outside of the ribosome itself. Collectively, these findings suggest that ribosomal proteins may have a wider functional repertoire within the cell than previously thought. The future challenge is to identify and validate these novel functions in the background of an often essential primary function in ribosome biogenesis and cell growth.

  19. PLUTONIUM FINISHING PLANT (PFP) 241-Z LIQUID WASTE TREATMENT FACILITY DEACTIVATION AND DEMOLITION

    Energy Technology Data Exchange (ETDEWEB)

    JOHNSTON GA

    2008-01-15

    Fluor Hanford, Inc. (FH) is proud to submit the Plutonium Finishing Plant (PFP) 241-Z liquid Waste Treatment Facility Deactivation and Demolition (D&D) Project for consideration by the Project Management Institute as Project of the Year for 2008. The decommissioning of the 241-Z Facility presented numerous challenges, many of which were unique with in the Department of Energy (DOE) Complex. The majority of the project budget and schedule was allocated for cleaning out five below-grade tank vaults. These highly contaminated, confined spaces also presented significant industrial safety hazards that presented some of the most hazardous work environments on the Hanford Site. The 241-Z D&D Project encompassed diverse tasks: cleaning out and stabilizing five below-grade tank vaults (also called cells), manually size-reducing and removing over three tons of process piping from the vaults, permanently isolating service utilities, removing a large contaminated chemical supply tank, stabilizing and removing plutonium-contaminated ventilation ducts, demolishing three structures to grade, and installing an environmental barrier on the demolition site . All of this work was performed safely, on schedule, and under budget. During the deactivation phase of the project between November 2005 and February 2007, workers entered the highly contaminated confined-space tank vaults 428 times. Each entry (or 'dive') involved an average of three workers, thus equaling approximately 1,300 individual confined -space entries. Over the course of the entire deactivation and demolition period, there were no recordable injuries and only one minor reportable skin contamination. The 241-Z D&D Project was decommissioned under the provisions of the 'Hanford Federal Facility Agreement and Consent Order' (the Tri-Party Agreement or TPA), the 'Resource Conservation and Recovery Act of 1976' (RCRA), and the 'Comprehensive Environmental Response, Compensation, and

  20. CSER 94-014: Storage of metal-fuel loaded EBR-II casks in concrete vault on PFP grounds

    International Nuclear Information System (INIS)

    Hess, A.L.

    1994-01-01

    A criticality safety evaluation is presented to permit EBR-2 spent fuel casks loaded with metallic fuel rods to be stored in an 8-ft diameter, cylindrical concrete vault inside the PFP security perimeter. The specific transfer of three casks with Pu alloy fuel from the Los Alamos Molten Plutonium Reactor Experiment from the burial grounds to the vault is thus covered. Up to seven casks may be emplaced in the casing with 30 inches center to center spacing. Criticality safety is assured by definitive packaging rules which keep the fissile medium dry and at a low effective volumetric density

  1. Performance of VITEK mass spectrometry V3.0 for rapid identification of clinical Aspergillus fumigatus in different culture conditions based on ribosomal proteins.

    Science.gov (United States)

    Zhou, Longrong; Chen, Yongquan; Xu, Yuanhong

    2017-01-01

    Fast and accurate discrimination of Aspergillus fumigatus is significant, since misidentification may lead to inappropriate clinical therapy. This study assessed VITEK mass spectrometry (MS) V3.0 for A. fumigatus identification using extracted fungal ribosomal proteins. A total of 52 isolates preliminarily identified as A. fumigatus by traditional morphological methods were inoculated in three different culture media and cultured at two different temperatures. The specific spectral fingerprints of different culture time points (48, 72, 96, and 120 h) were obtained. Of all strains, 88.5% (46/52) were discriminated as A. fumigatus , while the remaining 11.5% (6/52) produced results inconsistent with morphological analysis. Molecular sequencing, as a reference method for species identification, was used to validate the morphological analysis and matrix-assisted laser desorption/ionization time of flight MS. Chi-square tests ( χ 2 test, P =0.05) demonstrated that the culture medium and incubation temperature had no effects on identification accuracy; however, identification accuracy of the strains in the 48-h group was lower than that in other groups. In addition, we found that ribosomal proteins extracted from A. fumigatus can be stored in different environments for at least 1 week, with their profiles remaining stable and strain identification results showing no change. This is beneficial for medical institutions with no mass spectrometer at hand. Overall, this study showed the powerful ability of VITEK MS V 3.0 in identifying A. fumigatus .

  2. Cloning of a cDNA encoding a novel human nuclear phosphoprotein belonging to the WD-40 family

    DEFF Research Database (Denmark)

    Honoré, B; Leffers, H; Madsen, Peder

    1994-01-01

    We have cloned and expressed in vaccinia virus a cDNA encoding an ubiquitous 501-amino-acid (aa) phosphoprotein that corresponds to protein IEF SSP 9502 (79,400 Da, pI 4.5) in the master 2-D-gel keratinocyte protein database [Celis et al., Electrophoresis 14 (1993) 1091-1198]. The deduced aa...

  3. Eukaryotic ribosome display with in situ DNA recovery.

    Science.gov (United States)

    He, Mingyue; Edwards, Bryan M; Kastelic, Damjana; Taussig, Michael J

    2012-01-01

    Ribosome display is a cell-free display technology for in vitro selection and optimisation of proteins from large diversified libraries. It operates through the formation of stable protein-ribosome-mRNA (PRM) complexes and selection of ligand-binding proteins, followed by DNA recovery from the selected genetic information. Both prokaryotic and eukaryotic ribosome display systems have been developed. In this chapter, we describe the eukaryotic rabbit reticulocyte method in which a distinct in situ single-primer RT-PCR procedure is used to recover DNA from the selected PRM complexes without the need for prior disruption of the ribosome.

  4. Heterogeneous Ribosomes Preferentially Translate Distinct Subpools of mRNAs Genome-wide.

    Science.gov (United States)

    Shi, Zhen; Fujii, Kotaro; Kovary, Kyle M; Genuth, Naomi R; Röst, Hannes L; Teruel, Mary N; Barna, Maria

    2017-07-06

    Emerging studies have linked the ribosome to more selective control of gene regulation. However, an outstanding question is whether ribosome heterogeneity at the level of core ribosomal proteins (RPs) exists and enables ribosomes to preferentially translate specific mRNAs genome-wide. Here, we measured the absolute abundance of RPs in translating ribosomes and profiled transcripts that are enriched or depleted from select subsets of ribosomes within embryonic stem cells. We find that heterogeneity in RP composition endows ribosomes with differential selectivity for translating subpools of transcripts, including those controlling metabolism, cell cycle, and development. As an example, mRNAs enriched in binding to RPL10A/uL1-containing ribosomes are shown to require RPL10A/uL1 for their efficient translation. Within several of these transcripts, this level of regulation is mediated, at least in part, by internal ribosome entry sites. Together, these results reveal a critical functional link between ribosome heterogeneity and the post-transcriptional circuitry of gene expression. Copyright © 2017 Elsevier Inc. All rights reserved.

  5. Effect of sodium fluoride on the amount of polyribosomes, single ribosomes and ribosomal subunits in a cellular slime mold, Dictyostelium discoideum

    Energy Technology Data Exchange (ETDEWEB)

    Sameshima, M; Ito, K; Iwabuchi, M

    1972-01-01

    In the slime mold, Dictyostelium discoideum, when the rate of protein synthesis was decreased by NaF, free 80-S ribosomes accumulated at the expense of polyribosomes, while 60-S and 40-S ribosomal subunits remained almost constant. The same level of ribosomal subunits was also maintained in cells after incubation with cycloheximide or at the stationary phase of growth.

  6. Addendum 1 to CSER 96-025: PFP storage of 9.25/9.5 inch tall, 4.4 kg Pu cans on existing Vault 4 pedestals

    International Nuclear Information System (INIS)

    Hillesland, K.E.

    1997-01-01

    A nuclear criticality safety analysis has been performed to increase the approved plutonium mass limit for cans stored in Vault number-sign 4 cubicles at PFP. The original CSER 96-025 accommodated the storage of 4.4 kg of plutonium in PuO, (5.0 kg PuO,) in Vault number-sign 4 by requiring that half the cubicles be left vacant. This addendum allows for all the cubicles to be used, but with a fissile plutonium mass limit of 58 kg per cubicle. A mass limit for each cubical allows for storage of a larger number of cans if some have less than the 4.4 kg Pu limit per can. The highest k., calculated is 0.932 + 0.003 when an overbatched can is present in every fourth cubicle. This is below the criticality safety limit of kff 0.935, and consequently, an increase of plutonium mass to 4.4 kg per can is within acceptable safety limits for the given mass limit

  7. Ribosome dynamics and tRNA movement by time-resolved electron cryomicroscopy.

    Science.gov (United States)

    Fischer, Niels; Konevega, Andrey L; Wintermeyer, Wolfgang; Rodnina, Marina V; Stark, Holger

    2010-07-15

    The translocation step of protein synthesis entails large-scale rearrangements of the ribosome-transfer RNA (tRNA) complex. Here we have followed tRNA movement through the ribosome during translocation by time-resolved single-particle electron cryomicroscopy (cryo-EM). Unbiased computational sorting of cryo-EM images yielded 50 distinct three-dimensional reconstructions, showing the tRNAs in classical, hybrid and various novel intermediate states that provide trajectories and kinetic information about tRNA movement through the ribosome. The structures indicate how tRNA movement is coupled with global and local conformational changes of the ribosome, in particular of the head and body of the small ribosomal subunit, and show that dynamic interactions between tRNAs and ribosomal residues confine the path of the tRNAs through the ribosome. The temperature dependence of ribosome dynamics reveals a surprisingly flat energy landscape of conformational variations at physiological temperature. The ribosome functions as a Brownian machine that couples spontaneous conformational changes driven by thermal energy to directed movement.

  8. Differential expression of proteins and phosphoproteins during larval metamorphosis of the polychaete Capitella sp. I

    Directory of Open Access Journals (Sweden)

    Qian Pei-Yuan

    2011-09-01

    Full Text Available Abstract Background The spontaneous metamorphosis of the polychaete Capitella sp. I larvae into juveniles requires minor morphological changes, including segment formation, body elongation, and loss of cilia. In this study, we investigated changes in the expression patterns of both proteins and phosphoproteins during the transition from larvae to juveniles in this species. We used two-dimensional gel electrophoresis (2-DE followed by multiplex fluorescent staining and MALDI-TOF mass spectrometry analysis to identify the differentially expressed proteins as well as the protein and phosphoprotein profiles of both competent larvae and juveniles. Results Twenty-three differentially expressed proteins were identified in the two developmental stages. Expression patterns of two of those proteins were examined at the protein level by Western blot analysis while seven were further studied at the mRNA level by real-time PCR. Results showed that proteins related to cell division, cell migration, energy storage and oxidative stress were plentifully expressed in the competent larvae; in contrast, proteins involved in oxidative metabolism and transcriptional regulation were abundantly expressed in the juveniles. Conclusion It is likely that these differentially expressed proteins are involved in regulating the larval metamorphosis process and can be used as protein markers for studying molecular mechanisms associated with larval metamorphosis in polychaetes.

  9. A computational investigation on the connection between dynamics properties of ribosomal proteins and ribosome assembly.

    Directory of Open Access Journals (Sweden)

    Brittany Burton

    Full Text Available Assembly of the ribosome from its protein and RNA constituents has been studied extensively over the past 50 years, and experimental evidence suggests that prokaryotic ribosomal proteins undergo conformational changes during assembly. However, to date, no studies have attempted to elucidate these conformational changes. The present work utilizes computational methods to analyze protein dynamics and to investigate the linkage between dynamics and binding of these proteins during the assembly of the ribosome. Ribosomal proteins are known to be positively charged and we find the percentage of positive residues in r-proteins to be about twice that of the average protein: Lys+Arg is 18.7% for E. coli and 21.2% for T. thermophilus. Also, positive residues constitute a large proportion of RNA contacting residues: 39% for E. coli and 46% for T. thermophilus. This affirms the known importance of charge-charge interactions in the assembly of the ribosome. We studied the dynamics of three primary proteins from E. coli and T. thermophilus 30S subunits that bind early in the assembly (S15, S17, and S20 with atomic molecular dynamic simulations, followed by a study of all r-proteins using elastic network models. Molecular dynamics simulations show that solvent-exposed proteins (S15 and S17 tend to adopt more stable solution conformations than an RNA-embedded protein (S20. We also find protein residues that contact the 16S rRNA are generally more mobile in comparison with the other residues. This is because there is a larger proportion of contacting residues located in flexible loop regions. By the use of elastic network models, which are computationally more efficient, we show that this trend holds for most of the 30S r-proteins.

  10. Phosphorylation of acidic ribosomal proteins from rabbit reticulocytes by a ribosome-associated casein kinase

    DEFF Research Database (Denmark)

    Issinger, O G

    1977-01-01

    Two acidic proteins from 80-S ribosomes were isolated and purified to homogeneity. The purified acidic proteins could be phosphorylated by casein kinase using [gamma-32P]ATP and [gamma-32P]GTP as a phosphoryl donor. The proteins became phosphorylated in situ, too. Sodium dodecyl sulfate polyacryl......Two acidic proteins from 80-S ribosomes were isolated and purified to homogeneity. The purified acidic proteins could be phosphorylated by casein kinase using [gamma-32P]ATP and [gamma-32P]GTP as a phosphoryl donor. The proteins became phosphorylated in situ, too. Sodium dodecyl sulfate...

  11. On the control of ribosomal protein biosynthesis in Escherichia coli

    International Nuclear Information System (INIS)

    Pichon, J.; Marvaldi, J.; Coeroli, C.; Cozzone, A.; Marchis-Mouren, G.

    1977-01-01

    The rate of individual ribosomal protein synthesis relative to total protein synthesis has been determined in Escherichia coli rel + and rel - cells, under valyl-tRNA deprivation. These strains have a temperature-sensitive valyl-tRNA synthetase. Starvation was obtained following transfer of the cells to non-permissive temperature. Ribosomal proteins were obtained by treatment of either total lysates of freeze-thawed lysozyme spheroplasts or ammonium sulphate precipitate of ribosomes, with acetic acid. Differential labelling of the ribosomal proteins was observed in both strains: proteins from the rel + strain appear more labelled than those from the rel - strain, the rate of labelling of individual proteins being about the same in both strains. Moreover ribosomal proteins were found as stable during starvation as total protein. It is thus concluded that in starving cells individual ribosomal proteins are not synthesized at equal rates. This indicates that the synthesis of ribosomal proteins is not only under the control of the rel gene

  12. Structure of the C-terminal domain of lettuce necrotic yellows virus phosphoprotein.

    Science.gov (United States)

    Martinez, Nicolas; Ribeiro, Euripedes A; Leyrat, Cédric; Tarbouriech, Nicolas; Ruigrok, Rob W H; Jamin, Marc

    2013-09-01

    Lettuce necrotic yellows virus (LNYV) is a prototype of the plant-adapted cytorhabdoviruses. Through a meta-prediction of disorder, we localized a folded C-terminal domain in the amino acid sequence of its phosphoprotein. This domain consists of an autonomous folding unit that is monomeric in solution. Its structure, solved by X-ray crystallography, reveals a lollipop-shaped structure comprising five helices. The structure is different from that of the corresponding domains of other Rhabdoviridae, Filoviridae, and Paramyxovirinae; only the overall topology of the polypeptide chain seems to be conserved, suggesting that this domain evolved under weak selective pressure and varied in size by the acquisition or loss of functional modules.

  13. In Profile: Models of Ribosome Biogenesis Defects and Regulation of Protein Synthesis

    NARCIS (Netherlands)

    Essers, P.B.M.

    2013-01-01

    Ribosomes are the mediators of protein synthesis in the cell and therefore crucial to proper cell function. In addition, ribosomes are highly abundant, with ribosomal RNA making up 80% of the RNA in the cell. A large amount of resources go into maintaining this pool of ribosomes, so ribosome

  14. The primary structures of ribosomal proteins S14 and S16 from the archaebacterium Halobacterium marismortui. Comparison with eubacterial and eukaryotic ribosomal proteins.

    Science.gov (United States)

    Kimura, J; Kimura, M

    1987-09-05

    The amino acid sequences of two ribosomal proteins, S14 and S16, from the archaebacterium Halobacterium marismortui have been determined. Sequence data were obtained by the manual and solid-phase sequencing of peptides derived from enzymatic digestions with trypsin, chymotrypsin, pepsin, and Staphylococcus aureus protease as well as by chemical cleavage with cyanogen bromide. Proteins S14 and S16 contain 109 and 126 amino acid residues and have Mr values of 11,964 and 13,515, respectively. Comparison of the sequences with those of ribosomal proteins from other organisms demonstrates that S14 has a significant homology with the rat liver ribosomal protein S11 (36% identity) as well as with the Escherichia coli ribosomal protein S17 (37%), and that S16 is related to the yeast ribosomal protein YS22 (40%) and proteins S8 from E. coli (28%) and Bacillus stearothermophilus (30%). A comparison of the amino acid residues in the homologous regions of halophilic and nonhalophilic ribosomal proteins reveals that halophilic proteins have more glutamic acids, asparatic acids, prolines, and alanines, and less lysines, arginines, and isoleucines than their nonhalophilic counterparts. These amino acid substitutions probably contribute to the structural stability of halophilic ribosomal proteins.

  15. Clinical application for the preservation of phospho-proteins through in-situ tissue stabilization

    Directory of Open Access Journals (Sweden)

    Ding Wei

    2010-11-01

    Full Text Available Abstract Background Protein biomarkers will play a pivotal role in the future of personalized medicine for both diagnosis and treatment decision-making. While the results of several pre-clinical and small-scale clinical studies have demonstrated the value of protein biomarkers, there have been significant challenges to translating these findings into routine clinical care. Challenges to the use of protein biomarkers include inter-sample variability introduced by differences in post-collection handling and ex vivo degradation of proteins and protein modifications. Results In this report, we re-create laboratory and clinical scenarios for sample collection and test the utility of a new tissue stabilization technique in preserving proteins and protein modifications. In the laboratory setting, tissue stabilization with the Denator Stabilizor T1 resulted in a significantly higher yield of phospho-protein when compared to standard snap freeze preservation. Furthermore, in a clinical scenario, tissue stabilization at collection resulted in a higher yield of total phospho-protein, total phospho-tyrosine, pErkT202/Y204 and pAktS473 when compared to standard methods. Tissue stabilization did not have a significant effect on other post-translational modifications such as acetylation and glycosylation, which are more stable ex-vivo. Tissue stabilization did decrease total RNA quantity and quality. Conclusion Stabilization at the time of collection offers the potential to better preserve tissue protein and protein modification levels, as well as reduce the variability related to tissue processing delays that are often associated with clinical samples.

  16. Plan for the Initiation of HA-211 Furnace Operations at the Plutonium Finishing Plan (PFP)

    International Nuclear Information System (INIS)

    WILLIS, H.T.

    2000-01-01

    This plan provides a phased approach authorizing the use of three additional muffle furnaces for thermal stabilization. Achievement of Thermal Stabilization mission elements require the installation and startup of three additional muffle furnaces for the thermal stabilization of plutonium and plutonium bearing materials at the Plutonium Finishing Plant (PFP). The release to operate these additional furnaces will require an Activity Based Startup Review. The conduct of the Activity Based Startup Review (ABSR) was approved by Fluor Daniel Hanford on October 15, 1999. This plan has been developed with the objective of identifying those activities needed to guide the controlled startup of five furnaces from authorization to unrestricted operations by adding the HA-211 furnaces in an orderly and safe manner after the approval to Startup has been given

  17. Ribosomes slide on lysine-encoding homopolymeric A stretches

    Science.gov (United States)

    Koutmou, Kristin S; Schuller, Anthony P; Brunelle, Julie L; Radhakrishnan, Aditya; Djuranovic, Sergej; Green, Rachel

    2015-01-01

    Protein output from synonymous codons is thought to be equivalent if appropriate tRNAs are sufficiently abundant. Here we show that mRNAs encoding iterated lysine codons, AAA or AAG, differentially impact protein synthesis: insertion of iterated AAA codons into an ORF diminishes protein expression more than insertion of synonymous AAG codons. Kinetic studies in E. coli reveal that differential protein production results from pausing on consecutive AAA-lysines followed by ribosome sliding on homopolymeric A sequence. Translation in a cell-free expression system demonstrates that diminished output from AAA-codon-containing reporters results from premature translation termination on out of frame stop codons following ribosome sliding. In eukaryotes, these premature termination events target the mRNAs for Nonsense-Mediated-Decay (NMD). The finding that ribosomes slide on homopolymeric A sequences explains bioinformatic analyses indicating that consecutive AAA codons are under-represented in gene-coding sequences. Ribosome ‘sliding’ represents an unexpected type of ribosome movement possible during translation. DOI: http://dx.doi.org/10.7554/eLife.05534.001 PMID:25695637

  18. [Identification of Clonorchis sinensis metacercariae based on PCR targeting ribosomal DNA ITS regions and COX1 gene].

    Science.gov (United States)

    Yang, Qing-Li; Shen, Ji-Qing; Jiang, Zhi-Hua; Yang, Yi-Chao; Li, Hong-Mei; Chen, Ying-Dan; Zhou, Xiao-Nong

    2014-06-01

    To identify Clonorchis sinensis metacercariae using PCR targeting ribosomal DNA ITS region and COX1 gene. Pseudorasbora parva were collected from Hengxian County of Guangxi at the end of May 2013. Single metacercaria of C. sinensis and other trematodes were separated from muscle tissue of P. parva by digestion method. Primers targeting ribosomal DNA ITS region and COX1 gene of C. sinensis were designed for PCR and the universal primers were used as control. The sensitivity and specificity of the PCR detection were analyzed. C. sinensis metacercariae at different stages were identified by PCR. DNA from single C. sinensis metacercaria was detected by PCR targeting ribosomal DNA ITS region and COX1 gene. The specific amplicans have sizes of 437/549, 156/249 and 195/166 bp, respectively. The ratio of the two positive numbers in PCR with universal primers and specific primers targeting C. sinensis ribosomal DNA ITS1 and ITS2 regions was 0.905 and 0.952, respectively. The target gene fragments were amplified by PCR using COX1 gene-specific primers. The PCR with specific primers did not show any non-specific amplification. However, the PCR with universal primers targeting ribosomal DNA ITS regions performed serious non-specific amplification. C. sinensis metacercariae at different stages are identified by morphological observation and PCR method. Species-specific primers targeting ribosomal DNA ITS region show higher sensitivity and specificity than the universal primers. PCR targeting COX1 gene shows similar sensitivity and specificity to PCR with specific primers targeting ribosomal DNA ITS regions.

  19. Complete nuclear ribosomal DNA sequence amplification and molecular analyses of Bangia (Bangiales, Rhodophyta) from China

    Science.gov (United States)

    Xu, Jiajie; Jiang, Bo; Chai, Sanming; He, Yuan; Zhu, Jianyi; Shen, Zonggen; Shen, Songdong

    2016-09-01

    Filamentous Bangia, which are distributed extensively throughout the world, have simple and similar morphological characteristics. Scientists can classify these organisms using molecular markers in combination with morphology. We successfully sequenced the complete nuclear ribosomal DNA, approximately 13 kb in length, from a marine Bangia population. We further analyzed the small subunit ribosomal DNA gene (nrSSU) and the internal transcribed spacer (ITS) sequence regions along with nine other marine, and two freshwater Bangia samples from China. Pairwise distances of the nrSSU and 5.8S ribosomal DNA gene sequences show the marine samples grouping together with low divergences (00.003; 0-0.006, respectively) from each other, but high divergences (0.123-0.126; 0.198, respectively) from freshwater samples. An exception is the marine sample collected from Weihai, which shows high divergence from both other marine samples (0.063-0.065; 0.129, respectively) and the freshwater samples (0.097; 0.120, respectively). A maximum likelihood phylogenetic tree based on a combined SSU-ITS dataset with maximum likelihood method shows the samples divided into three clades, with the two marine sample clades containing Bangia spp. from North America, Europe, Asia, and Australia; and one freshwater clade, containing Bangia atropurpurea from North America and China.

  20. The BRCT domain is a phospho-protein binding domain.

    Science.gov (United States)

    Yu, Xiaochun; Chini, Claudia Christiano Silva; He, Miao; Mer, Georges; Chen, Junjie

    2003-10-24

    The carboxyl-terminal domain (BRCT) of the Breast Cancer Gene 1 (BRCA1) protein is an evolutionarily conserved module that exists in a large number of proteins from prokaryotes to eukaryotes. Although most BRCT domain-containing proteins participate in DNA-damage checkpoint or DNA-repair pathways, or both, the function of the BRCT domain is not fully understood. We show that the BRCA1 BRCT domain directly interacts with phosphorylated BRCA1-Associated Carboxyl-terminal Helicase (BACH1). This specific interaction between BRCA1 and phosphorylated BACH1 is cell cycle regulated and is required for DNA damage-induced checkpoint control during the transition from G2 to M phase of the cell cycle. Further, we show that two other BRCT domains interact with their respective physiological partners in a phosphorylation-dependent manner. Thirteen additional BRCT domains also preferentially bind phospho-peptides rather than nonphosphorylated control peptides. These data imply that the BRCT domain is a phospho-protein binding domain involved in cell cycle control.

  1. The Unexplored Mechanisms and Regulatory Functions of Ribosomal Translocation

    Science.gov (United States)

    Alejo, Jose Luis

    In every cell, protein synthesis is carried out by the ribosome, a complex macromolecular RNA-protein assembly. Decades of structural and kinetic studies have increased our understanding of ribosome initiation, decoding, translocation and termination. Yet, the underlying mechanism of these fundamental processes has yet to be fully delineated. Hence, the molecular basis of regulation remains obscure. Here, single-molecule fluorescence methods are applied to decipher the mechanism and regulatory roles of the multi-step process of directional substrate translocation on the ribosome that accompanies every round of protein synthesis. In Chapter 1, single-molecule fluorescence resonance energy transfer (smFRET) is introduced as a tool for studying bacterial ribosome translocation. Chapter 2 details the experimental methods. In Chapter 3, the elongation factor G(EF-G)-catalyzed movement of substrates through the ribosome is examined from several perspectives or signals reporting on various degrees of freedom of ribosome dynamics. Two ribosomal states interconvert in the presence of EF-G(GDP), displaying novel head domain motions, until relocking takes place. In Chapter 4, in order to test if the mentioned fluctuations leading to relocking are correlated to the engagement of the P-site by the peptidyl-tRNA, the translocation of miscoded tRNAs is studied. Severe defects in the relocking stages of translocation reveal the correlation between this new stage of translocation and P-site tRNA engagement.

  2. The Integrated Safety Management System Verification Enhancement Review of the Plutonium Finishing Plant (PFP)

    International Nuclear Information System (INIS)

    BRIGGS, C.R.

    2000-01-01

    The primary purpose of the verification enhancement review was for the DOE Richland Operations Office (RL) to verify contractor readiness for the independent DOE Integrated Safety Management System Verification (ISMSV) on the Plutonium Finishing Plant (PFP). Secondary objectives included: (1) to reinforce the engagement of management and to gauge management commitment and accountability; (2) to evaluate the ''value added'' benefit of direct public involvement; (3) to evaluate the ''value added'' benefit of direct worker involvement; (4) to evaluate the ''value added'' benefit of the panel-to-panel review approach; and, (5) to evaluate the utility of the review's methodology/adaptability to periodic assessments of ISM status. The review was conducted on December 6-8, 1999, and involved the conduct of two-hour interviews with five separate panels of individuals with various management and operations responsibilities related to PFP. A semi-structured interview process was employed by a team of five ''reviewers'' who directed open-ended questions to the panels which focused on: (1) evidence of management commitment, accountability, and involvement; and, (2) consideration and demonstration of stakeholder (including worker) information and involvement opportunities. The purpose of a panel-to-panel dialogue approach was to better spotlight: (1) areas of mutual reinforcement and alignment that could serve as good examples of the management commitment and accountability aspects of ISMS implementation, and, (2) areas of potential discrepancy that could provide opportunities for improvement. In summary, the Review Team found major strengths to include: (1) the use of multi-disciplinary project work teams to plan and do work; (2) the availability and broad usage of multiple tools to help with planning and integrating work; (3) senior management presence and accessibility; (4) the institutionalization of worker involvement; (5) encouragement of self-reporting and self

  3. Differential expression of proteins and phosphoproteins during larval metamorphosis of the polychaete Capitella sp. I

    KAUST Repository

    Chandramouli, Kondethimmanahalli

    2011-09-03

    Background: The spontaneous metamorphosis of the polychaete Capitella sp. I larvae into juveniles requires minor morphological changes, including segment formation, body elongation, and loss of cilia. In this study, we investigated changes in the expression patterns of both proteins and phosphoproteins during the transition from larvae to juveniles in this species. We used two-dimensional gel electrophoresis (2-DE) followed by multiplex fluorescent staining and MALDI-TOF mass spectrometry analysis to identify the differentially expressed proteins as well as the protein and phosphoprotein profiles of both competent larvae and juveniles.Results: Twenty-three differentially expressed proteins were identified in the two developmental stages. Expression patterns of two of those proteins were examined at the protein level by Western blot analysis while seven were further studied at the mRNA level by real-time PCR. Results showed that proteins related to cell division, cell migration, energy storage and oxidative stress were plentifully expressed in the competent larvae; in contrast, proteins involved in oxidative metabolism and transcriptional regulation were abundantly expressed in the juveniles.Conclusion: It is likely that these differentially expressed proteins are involved in regulating the larval metamorphosis process and can be used as protein markers for studying molecular mechanisms associated with larval metamorphosis in polychaetes. © 2011 Chandramouli et al; licensee BioMed Central Ltd.

  4. Differential expression of proteins and phosphoproteins during larval metamorphosis of the polychaete Capitella sp. I

    KAUST Repository

    Chandramouli, Kondethimmanahalli; Soo, Lisa; Qian, Pei-Yuan

    2011-01-01

    Background: The spontaneous metamorphosis of the polychaete Capitella sp. I larvae into juveniles requires minor morphological changes, including segment formation, body elongation, and loss of cilia. In this study, we investigated changes in the expression patterns of both proteins and phosphoproteins during the transition from larvae to juveniles in this species. We used two-dimensional gel electrophoresis (2-DE) followed by multiplex fluorescent staining and MALDI-TOF mass spectrometry analysis to identify the differentially expressed proteins as well as the protein and phosphoprotein profiles of both competent larvae and juveniles.Results: Twenty-three differentially expressed proteins were identified in the two developmental stages. Expression patterns of two of those proteins were examined at the protein level by Western blot analysis while seven were further studied at the mRNA level by real-time PCR. Results showed that proteins related to cell division, cell migration, energy storage and oxidative stress were plentifully expressed in the competent larvae; in contrast, proteins involved in oxidative metabolism and transcriptional regulation were abundantly expressed in the juveniles.Conclusion: It is likely that these differentially expressed proteins are involved in regulating the larval metamorphosis process and can be used as protein markers for studying molecular mechanisms associated with larval metamorphosis in polychaetes. © 2011 Chandramouli et al; licensee BioMed Central Ltd.

  5. Phosphoric acid as a matrix additive for MALDI MS analysis of phosphopeptides and phosphoproteins

    DEFF Research Database (Denmark)

    Kjellström, Sven; Jensen, Ole Nørregaard

    2004-01-01

    Phosphopeptides are often detected with low efficiency by MALDI MS analysis of peptide mixtures. In an effort to improve the phosphopeptide ion response in MALDI MS, we investigated the effects of adding low concentrations of organic and inorganic acids during peptide sample preparation in 2,5-di...... acid to 2,5-DHB were also observed in LC-MALDI-MS analysis of tryptic phosphopeptides of B. subtilis PrkC phosphoprotein. Finally, the mass resolution of MALDI mass spectra of intact proteins was significantly improved by using phosphoric acid in 2,5-DHB matrix....

  6. Unstable structure of ribosomal particles synthesized in. gamma. -irradiated Escherichia coli

    Energy Technology Data Exchange (ETDEWEB)

    Fujita, H; Morita, K [National Inst. of Radiological Sciences, Chiba (Japan)

    1975-06-01

    Stability of Escherichia coli ribosomes newly synthesized after ..gamma..-irradiation was compared with that of normal ribosomes. The ribosomal particles around 70-S synthesized in irradiated cells were more sensitive to digestion by pancreatic ribonuclease A. A larger number of the salt-unstable '50-S' precursor particles existed in the extract from irradiated cells than in the extract from unirradiated cells. These facts suggest that ribosomal particles, synthesized during an earlier stage in irradiated cells, maintain an incomplete structure even though they are not distinguishable from normal ribosomes by means of sucrose density-gradient centrifugation.

  7. Label-Free Quantitation of Ribosomal Proteins from Bacillus subtilis for Antibiotic Research.

    Science.gov (United States)

    Schäkermann, Sina; Prochnow, Pascal; Bandow, Julia E

    2017-01-01

    Current research is focusing on ribosome heterogeneity as a response to changing environmental conditions and stresses, such as antibiotic stress. Altered stoichiometry and composition of ribosomal proteins as well as association of additional protein factors are mechanisms for shaping the protein expression profile or hibernating ribosomes. Here, we present a method for the isolation of ribosomes to analyze antibiotic-induced changes in the composition of ribosomes in Bacillus subtilis or other bacteria. Ribosomes and associated proteins are isolated by ultracentrifugation and proteins are identified and quantified using label-free mass spectrometry.

  8. A comparative study of ribosomal proteins: linkage between amino acid distribution and ribosomal assembly

    International Nuclear Information System (INIS)

    Lott, Brittany Burton; Wang, Yongmei; Nakazato, Takuya

    2013-01-01

    Assembly of the ribosome from its protein and RNA constituents must occur quickly and efficiently in order to synthesize the proteins necessary for all cellular activity. Since the early 1960’s, certain characteristics of possible assembly pathways have been elucidated, yet the mechanisms that govern the precise recognition events remain unclear. We utilize a comparative analysis to investigate the amino acid composition of ribosomal proteins (r-proteins) with respect to their role in the assembly process. We compared small subunit (30S) r-protein sequences to those of other housekeeping proteins from 560 bacterial species and searched for correlations between r-protein amino acid content and factors such as assembly binding order, environmental growth temperature, protein size, and contact with ribosomal RNA (rRNA) in the 30S complex. We find r-proteins have a significantly high percent of positive residues, which are highly represented at rRNA contact sites. An inverse correlation between the percent of positive residues and r-protein size was identified and is mainly due to the content of Lysine residues, rather than Arginine. Nearly all r-proteins carry a net positive charge, but no statistical correlation between the net charge and the binding order was detected. Thermophilic (high-temperature) r-proteins contain increased Arginine, Isoleucine, and Tyrosine, and decreased Serine and Threonine compared to mesophilic (lower-temperature), reflecting a known distinction between thermophiles and mesophiles, possibly to account for protein thermostability. However, this difference in amino acid content does not extend to rRNA contact sites, as the proportions of thermophilic and mesophilic contact residues are not significantly different. Given the significantly higher level of positively charged residues in r-proteins and at contact sites, we conclude that ribosome assembly relies heavily on an electrostatic component of interaction. However, the binding order of

  9. Architecture of the large subunit of the mammalian mitochondrial ribosome.

    Science.gov (United States)

    Greber, Basil J; Boehringer, Daniel; Leitner, Alexander; Bieri, Philipp; Voigts-Hoffmann, Felix; Erzberger, Jan P; Leibundgut, Marc; Aebersold, Ruedi; Ban, Nenad

    2014-01-23

    Mitochondrial ribosomes synthesize a number of highly hydrophobic proteins encoded on the genome of mitochondria, the organelles in eukaryotic cells that are responsible for energy conversion by oxidative phosphorylation. The ribosomes in mammalian mitochondria have undergone massive structural changes throughout their evolution, including ribosomal RNA shortening and acquisition of mitochondria-specific ribosomal proteins. Here we present the three-dimensional structure of the 39S large subunit of the porcine mitochondrial ribosome determined by cryo-electron microscopy at 4.9 Å resolution. The structure, combined with data from chemical crosslinking and mass spectrometry experiments, reveals the unique features of the 39S subunit at near-atomic resolution and provides detailed insight into the architecture of the polypeptide exit site. This region of the mitochondrial ribosome has been considerably remodelled compared to its bacterial counterpart, providing a specialized platform for the synthesis and membrane insertion of the highly hydrophobic protein components of the respiratory chain.

  10. Hierarchical recruitment of ribosomal proteins and assembly factors remodels nucleolar pre-60S ribosomes.

    Science.gov (United States)

    Biedka, Stephanie; Micic, Jelena; Wilson, Daniel; Brown, Hailey; Diorio-Toth, Luke; Woolford, John L

    2018-04-24

    Ribosome biogenesis involves numerous preribosomal RNA (pre-rRNA) processing events to remove internal and external transcribed spacer sequences, ultimately yielding three mature rRNAs. Removal of the internal transcribed spacer 2 spacer RNA is the final step in large subunit pre-rRNA processing and begins with endonucleolytic cleavage at the C 2 site of 27SB pre-rRNA. C 2 cleavage requires the hierarchical recruitment of 11 ribosomal proteins and 14 ribosome assembly factors. However, the function of these proteins in C 2 cleavage remained unclear. In this study, we have performed a detailed analysis of the effects of depleting proteins required for C 2 cleavage and interpreted these results using cryo-electron microscopy structures of assembling 60S subunits. This work revealed that these proteins are required for remodeling of several neighborhoods, including two major functional centers of the 60S subunit, suggesting that these remodeling events form a checkpoint leading to C 2 cleavage. Interestingly, when C 2 cleavage is directly blocked by depleting or inactivating the C 2 endonuclease, assembly progresses through all other subsequent steps. © 2018 Biedka et al.

  11. gamma. radiation effect on the functional properties of the cotton ribosomes

    Energy Technology Data Exchange (ETDEWEB)

    Ibragimov, A P; Safarov, Sh

    1973-01-01

    A study is made of the action of radiation on the functional properties of ribosomes in irradiated organisms and on isolated ribosomes exposed to different doses. With increase in dose there occurs a reduction in the incorporation of labelled amino acids by the ribosomes released from irradiated sprouts and also during irradiation of isolated ribosomes. The study covered the functional activity of ribosomes irradiated at different doses with the use of synthetic poly-U and poly-A matrices synthesizing polyphenylalanine and polylysine, depending on the irradiation dose. The inhibition of the activity of the protein synthesis system at high doses is due to structural and functional changes in ribosomes and also to disturbance in the biosynthesis and functions of the messenger RNA.

  12. Structure of the C-Terminal Domain of Lettuce Necrotic Yellows Virus Phosphoprotein

    Science.gov (United States)

    Martinez, Nicolas; Ribeiro, Euripedes A.; Leyrat, Cédric; Tarbouriech, Nicolas; Ruigrok, Rob W. H.

    2013-01-01

    Lettuce necrotic yellows virus (LNYV) is a prototype of the plant-adapted cytorhabdoviruses. Through a meta-prediction of disorder, we localized a folded C-terminal domain in the amino acid sequence of its phosphoprotein. This domain consists of an autonomous folding unit that is monomeric in solution. Its structure, solved by X-ray crystallography, reveals a lollipop-shaped structure comprising five helices. The structure is different from that of the corresponding domains of other Rhabdoviridae, Filoviridae, and Paramyxovirinae; only the overall topology of the polypeptide chain seems to be conserved, suggesting that this domain evolved under weak selective pressure and varied in size by the acquisition or loss of functional modules. PMID:23785215

  13. Interaction of tRNA with Eukaryotic Ribosome

    Directory of Open Access Journals (Sweden)

    Dmitri Graifer

    2015-03-01

    Full Text Available This paper is a review of currently available data concerning interactions of tRNAs with the eukaryotic ribosome at various stages of translation. These data include the results obtained by means of cryo-electron microscopy and X-ray crystallography applied to various model ribosomal complexes, site-directed cross-linking with the use of tRNA derivatives bearing chemically or photochemically reactive groups in the CCA-terminal fragment and chemical probing of 28S rRNA in the region of the peptidyl transferase center. Similarities and differences in the interactions of tRNAs with prokaryotic and eukaryotic ribosomes are discussed with concomitant consideration of the extent of resemblance between molecular mechanisms of translation in eukaryotes and bacteria.

  14. Macrolide antibiotic interaction and resistance on the bacterial ribosome.

    Science.gov (United States)

    Poehlsgaard, Jacob; Douthwaite, Stephen

    2003-02-01

    Our understanding of the fine structure of many antibiotic target sites has reached a new level of enlightenment in the last couple of years due to the advent, by X-ray crystallography, of high-resolution structures of the bacterial ribosome. Many classes of clinically useful antibiotics bind to the ribosome to inhibit bacterial protein synthesis. Macrolide, lincosamide and streptogramin B (MLSB) antibiotics form one of the largest groups, and bind to the same site on the 50S ribosomal subunit. Here, we review the molecular details of the ribosomal MLSB site to put into perspective the main points from a wealth of biochemical and genetic data that have been collected over several decades. The information is now available to understand, at atomic resolution, how macrolide antibiotics interact with their ribosomal target, how the target is altered to confer resistance, and in which directions we need to look if we are to rationally design better drugs to overcome the extant resistance mechanisms.

  15. Cis-regulatory RNA elements that regulate specialized ribosome activity.

    Science.gov (United States)

    Xue, Shifeng; Barna, Maria

    2015-01-01

    Recent evidence has shown that the ribosome itself can play a highly regulatory role in the specialized translation of specific subpools of mRNAs, in particular at the level of ribosomal proteins (RP). However, the mechanism(s) by which this selection takes place has remained poorly understood. In our recent study, we discovered a combination of unique RNA elements in the 5'UTRs of mRNAs that allows for such control by the ribosome. These mRNAs contain a Translation Inhibitory Element (TIE) that inhibits general cap-dependent translation, and an Internal Ribosome Entry Site (IRES) that relies on a specific RP for activation. The unique combination of an inhibitor of general translation and an activator of specialized translation is key to ribosome-mediated control of gene expression. Here we discuss how these RNA regulatory elements provide a new level of control to protein expression and their implications for gene expression, organismal development and evolution.

  16. Yeast ribosomal proteins

    International Nuclear Information System (INIS)

    Otaka, E.; Kobata, K.

    1978-01-01

    The cytoplasmic 80s ribosomal proteins from the cells of yeast Saccharomyces cerevisiae were analyzed by SDS two-dimensional polyacrylamide gel electrophoresis. Seventyfour proteins were identified and consecutively numbered from 1 to 74. Upon oxidation of the 80s proteins with performic acid, ten proteins (no. 15, 20, 35, 40, 44, 46, 49, 51, 54 and 55) were dislocated on the gel without change of the total number of protein spots. Five proteins (no. 8, 14, 16, 36 and 74) were phosphorylated in vivo as seen in 32 P-labelling experiments. The large and small subunits separated in low magnesium medium were analyzed by the above gel electrophoresis. At least forty-five and twenty-eight proteins were assumed to be in the large and small subunits, respectively. All proteins found in the 80s ribosomes, except for no. 3, were detected in either subunit without appearance of new spots. The acidic protein no. 3 seems to be lost during subunit dissociation. (orig.) [de

  17. Absence of ribosomal DNA amplification in the meroistic (telotrophic) ovary of the large milkweed bug Oncopeltus fasciatus (Dallas) (Hemiptera: Lygaeidae)

    Science.gov (United States)

    1975-01-01

    In the typical meroistic insect ovary, the oocyte nucleus synthesizes little if any RNA. Nurse cells or trophocytes actively synthesize ribosomes which are transported to and accumulated by the oocyte. In the telotrophic ovary a morphological separation exists, the nurse cells being localized at the apical end of each ovariole and communicating with the ooocytes via nutritive cords. In order to determine whether the genes coding for ribosomal RNA (rRNA) are amplified in the telotrophic ovary of the milkweed bug Oncopeltus fasciatus, the percentages of the genome coding for ribosomal RNA in somatic cells, spermatogenic cells, ovarian follicles, and nurse cells were compared. The oocytes and most of the nurse cells of O. fasciatus are uninucleolate. DNA hybridizing with ribosomal RNA is localized in a satellite DNA, the density of which is 1.712 g/cm(-3). The density of main-band DNA is 1.694 g/cm(-3). The ribosomal DNA satellite accounts for approximately 0.2% of the DNA in somatic and gametogenic tissues of both males and females. RNA-DNA hybridization analysis demonstrates that approximately 0.03% of the DNA in somatic tissues, testis, ovarian follicles, and isolated nurse cells hybridizes with ribosomal RNA. The fact that the percentage of DNA hybridizing with rRNA is the same in somatic and in male and female gametogenic tissues indicates that amplification of ribosomal DNA does not occur in nurse cells and that if it occurs in oocytes, it represents less than a 50- fold increase in ribosomal DNA. An increase in total genome DNA accounted by polyploidization appears to provide for increasing the amount of ribosomal DNA in the nurse cells. PMID:1158969

  18. Trapping the ribosome to control gene expression.

    Science.gov (United States)

    Boehringer, Daniel; Ban, Nenad

    2007-09-21

    Protein synthesis is often regulated by structured mRNAs that interact with ribosomes. In this issue of Cell, Marzi et al. (2007) provide insights into the autoregulation of protein S15 by visualizing the folded repressor mRNA on the ribosome stalled in the preinitiation state. These results have implications for our understanding of the mechanism of translation initiation in general.

  19. Total Measurement Uncertainty for the Plutonium Finishing Plant (PFP) Segmented Gamma Scan Assay System

    CERN Document Server

    Fazzari, D M

    2001-01-01

    This report presents the results of an evaluation of the Total Measurement Uncertainty (TMU) for the Canberra manufactured Segmented Gamma Scanner Assay System (SGSAS) as employed at the Hanford Plutonium Finishing Plant (PFP). In this document, TMU embodies the combined uncertainties due to all of the individual random and systematic sources of measurement uncertainty. It includes uncertainties arising from corrections and factors applied to the analysis of transuranic waste to compensate for inhomogeneities and interferences from the waste matrix and radioactive components. These include uncertainty components for any assumptions contained in the calibration of the system or computation of the data. Uncertainties are propagated at 1 sigma. The final total measurement uncertainty value is reported at the 95% confidence level. The SGSAS is a gamma assay system that is used to assay plutonium and uranium waste. The SGSAS system can be used in a stand-alone mode to perform the NDA characterization of a containe...

  20. Studies of the effects of ultraviolet radiation on the structural integrities of ribosomal RNA components of the Escherichia coli 50S ribosomal subunit

    International Nuclear Information System (INIS)

    Gorelic, L.; Parker, D.

    1978-01-01

    The effects of 254-nm radiation on the structural integrities of free and 50S ribosome-bound 5S and 23S ribosomal ribonucleic acids (rRNA) have been elucidated. Irradiation of aqueous solutions of Escherichia coli 50S ribosomes with 253.7-nm radiation results in the formation of single-strand breaks in double-stranded regions of the 23S rRNA component, but not in rRNA chain scission, and destabilization of the secondary structure of the 23S rRNA toward denaturation. The minimum doses of 253.7-nm radiation required for the first detection of the two effects are 7 x 10 19 quanta for the production of single-strand breaks in double-stranded regions of the 23S rRNA, and 19 quanta for destabilization of the 23S rRNA secondary structure. Free 23S rRNA is resistant toward photoinduced chain breakage at doses of 253.7-nm radiation up to at least 2.3 x 10 20 and is much less sensitive toward destabilization of secondary structure than ribosome-bound 23S rRNA. In contrast to the photosensitivity of 50S ribosome-bound 23S rRNA toward chain breakage, 50S ribosome-bound 5S rRNA is resistant toward chain breakage at doses of 253.7-nm radiation up to at least 2.3 x 10 20 quanta. Ribosome-bound 5S and 23S rRNA are also not photosensitive toward intermolecular 5S/23S rRNA cross-linkage

  1. cDNA, genomic sequence cloning and analysis of the ribosomal ...

    African Journals Online (AJOL)

    Ribosomal protein L37A (RPL37A) is a component of 60S large ribosomal subunit encoded by the RPL37A gene, which belongs to the family of ribosomal L37AE proteins, located in the cytoplasm. The complementary deoxyribonucleic acid (cDNA) and the genomic sequence of RPL37A were cloned successfully from giant ...

  2. Emergence of robust growth laws from optimal regulation of ribosome synthesis.

    Science.gov (United States)

    Scott, Matthew; Klumpp, Stefan; Mateescu, Eduard M; Hwa, Terence

    2014-08-22

    Bacteria must constantly adapt their growth to changes in nutrient availability; yet despite large-scale changes in protein expression associated with sensing, adaptation, and processing different environmental nutrients, simple growth laws connect the ribosome abundance and the growth rate. Here, we investigate the origin of these growth laws by analyzing the features of ribosomal regulation that coordinate proteome-wide expression changes with cell growth in a variety of nutrient conditions in the model organism Escherichia coli. We identify supply-driven feedforward activation of ribosomal protein synthesis as the key regulatory motif maximizing amino acid flux, and autonomously guiding a cell to achieve optimal growth in different environments. The growth laws emerge naturally from the robust regulatory strategy underlying growth rate control, irrespective of the details of the molecular implementation. The study highlights the interplay between phenomenological modeling and molecular mechanisms in uncovering fundamental operating constraints, with implications for endogenous and synthetic design of microorganisms. © 2014 The Authors. Published under the terms of the CC BY 4.0 license.

  3. Crystallization and preliminary crystallographic studies of L30e, a ribosomal protein from Methanocaldococcus jannaschii (MJ1044)

    International Nuclear Information System (INIS)

    Rangarajan, Sarani; Jeyakanthan, Jeyaraman; Mridula, Palappetty; Sakamoto, Keiko; Kitamura, Yoshiaki; Agari, Yoshihiro; Shinkai, Akeo; Ebihara, Akio; Kuramitsu, Seiki; Yokoyama, Shigeyuki; Sekar, Kanagaraj

    2008-01-01

    The ribosomal protein (L30e) from M. jannaschii was cloned from the gene MJ1044, expressed, purified and crystallized. The crystal belongs to the primitive tetragonal space group P4 3 and diffracted to 1.9 Å resolution. In view of the biological significance of understanding the ribosomal machinery of both prokaryotes and eukaryotes, the L30e ribosomal protein from Methanocaldococcus jannaschii was cloned, overexpressed, purified and crystallized using the microbatch-under-oil method with the crystallization conditions 40% PEG 400, 0.1 M MES pH 6.0 and 5% PEG 3000 at 291 K. A diffraction-quality crystal (0.20 × 0.20 × 0.35 mm) was obtained that belonged to the primitive tetragonal space group P4 3 , with unit-cell parameters a = 46.1, b = 46.1, c = 98.5 Å, and diffracted to a resolution of 1.9 Å. Preliminary calculations reveal that the asymmetric unit contains two monomers with a Matthews coefficient (V M ) of 2.16 Å 3 Da −1

  4. Control of ribosome traffic by position-dependent choice of synonymous codons

    DEFF Research Database (Denmark)

    Mitarai, Namiko; Pedersen, Steen

    2013-01-01

    Messenger RNA (mRNA) encodes a sequence of amino acids by using codons. For most amino acids, there are multiple synonymous codons that can encode the amino acid. The translation speed can vary from one codon to another, thus there is room for changing the ribosome speed while keeping the amino...... acid sequence and hence the resulting protein. Recently, it has been noticed that the choice of the synonymous codon, via the resulting distribution of slow- and fast-translated codons, affects not only on the average speed of one ribosome translating the mRNA but also might have an effect on nearby...... ribosomes by affecting the appearance of 'traffic jams' where multiple ribosomes collide and form queues. To test this 'context effect' further, we here investigate the effect of the sequence of synonymous codons on the ribosome traffic by using a ribosome traffic model with codon-dependent rates, estimated...

  5. Charge Segregation and Low Hydrophobicity Are Key Features of Ribosomal Proteins from Different Organisms*

    Science.gov (United States)

    Fedyukina, Daria V.; Jennaro, Theodore S.; Cavagnero, Silvia

    2014-01-01

    Ribosomes are large and highly charged macromolecular complexes consisting of RNA and proteins. Here, we address the electrostatic and nonpolar properties of ribosomal proteins that are important for ribosome assembly and interaction with other cellular components and may influence protein folding on the ribosome. We examined 50 S ribosomal subunits from 10 species and found a clear distinction between the net charge of ribosomal proteins from halophilic and non-halophilic organisms. We found that ∼67% ribosomal proteins from halophiles are negatively charged, whereas only up to ∼15% of ribosomal proteins from non-halophiles share this property. Conversely, hydrophobicity tends to be lower for ribosomal proteins from halophiles than for the corresponding proteins from non-halophiles. Importantly, the surface electrostatic potential of ribosomal proteins from all organisms, especially halophiles, has distinct positive and negative regions across all the examined species. Positively and negatively charged residues of ribosomal proteins tend to be clustered in buried and solvent-exposed regions, respectively. Hence, the majority of ribosomal proteins is characterized by a significant degree of intramolecular charge segregation, regardless of the organism of origin. This key property enables the ribosome to accommodate proteins within its complex scaffold regardless of their overall net charge. PMID:24398678

  6. GTPases and the origin of the ribosome

    Directory of Open Access Journals (Sweden)

    Smith Temple F

    2010-05-01

    Full Text Available Abstract Background This paper is an attempt to trace the evolution of the ribosome through the evolution of the universal P-loop GTPases that are involved with the ribosome in translation and with the attachment of the ribosome to the membrane. The GTPases involved in translation in Bacteria/Archaea are the elongation factors EFTu/EF1, the initiation factors IF2/aeIF5b + aeIF2, and the elongation factors EFG/EF2. All of these GTPases also contain the OB fold also found in the non GTPase IF1 involved in initiation. The GTPase involved in the signal recognition particle in most Bacteria and Archaea is SRP54. Results 1 The Elongation Factors of the Archaea based on structural considerations of the domains have the following evolutionary path: EF1→ aeIF2 → EF2. The evolution of the aeIF5b was a later event; 2 the Elongation Factors of the Bacteria based on the topological considerations of the GTPase domain have a similar evolutionary path: EFTu→ IF→2→EFG. These evolutionary sequences reflect the evolution of the LSU followed by the SSU to form the ribosome; 3 the OB-fold IF1 is a mimic of an ancient tRNA minihelix. Conclusion The evolution of translational GTPases of both the Archaea and Bacteria point to the evolution of the ribosome. The elongation factors, EFTu/EF1, began as a Ras-like GTPase bringing the activated minihelix tRNA to the Large Subunit Unit. The initiation factors and elongation factor would then have evolved from the EFTu/EF1 as the small subunit was added to the evolving ribosome. The SRP has an SRP54 GTPase and a specific RNA fold in its RNA component similar to the PTC. We consider the SRP to be a remnant of an ancient form of an LSU bound to a membrane. Reviewers This article was reviewed by George Fox, Leonid Mirny and Chris Sander.

  7. Modulation of cellular phosphoprotein profiles in transformation and redifferentiation of murine and embryonic fibroblastic cells

    International Nuclear Information System (INIS)

    Chakrabarty, Subhas; Brattain, M.G.

    1985-01-01

    Cellular phosphoprotein profiles from normal mouse embryonic fibroblast AKR-2B cells were compared to those of their permanently, chemically transformed malignant counterparts AKR-MCA cells, and AKR-2B cells reversibly transformed by transforming growth factor (AKR-TGF). Similar 32 P-phosphorylation profiles were observed for both the AKR-TGF and AKR-MCA cells which were distinct from that of the normal AKR-2B cells. Dimethylformamide (DMF)-induced differentiation of the AKR-MCA cells resulted in restoration of the normal AKR-2B phosphorylation profile to the malignant AKR-MCA cells. (author)

  8. A dynamic ribosomal biogenesis response is not required for IGF-1-mediated hypertrophy of human primary myotubes.

    Science.gov (United States)

    Crossland, Hannah; Timmons, James A; Atherton, Philip J

    2017-12-01

    Increased ribosomal DNA transcription has been proposed to limit muscle protein synthesis, making ribosome biogenesis central to skeletal muscle hypertrophy. We examined the relationship between ribosomal RNA (rRNA) production and IGF-1-mediated myotube hypertrophy in vitro Primary skeletal myotubes were treated with IGF-1 (50 ng/ml) with or without 0.5 µM CX-5461 (CX), an inhibitor of RNA polymerase I. Myotube diameter, total protein, and RNA and DNA levels were measured along with markers of RNA polymerase I regulatory factors and regulators of protein synthesis. CX treatment reduced 45S pre-rRNA expression (-64 ± 5% vs. IGF-1; P IGF-1; P IGF-1-treated myotubes. IGF-1-mediated increases in myotube diameter (1.27 ± 0.09-fold, P IGF-1 treatment did not prevent early increases in AKT (+203 ± 39% vs. CX; P IGF-1, myotube diameter and protein accretion were sustained. Thus, while ribosome biogenesis represents a potential site for the regulation of skeletal muscle protein synthesis and muscle mass, it does not appear to be a prerequisite for IGF-1-induced myotube hypertrophy in vitro. -Crossland, H., Timmons, J. A., Atherton, P. J. A dynamic ribosomal biogenesis response is not required for IGF-1-mediated hypertrophy of human primary myotubes. © The Author(s).

  9. Ribosomal trafficking is reduced in Schwann cells following induction of myelination

    Directory of Open Access Journals (Sweden)

    James M. Love

    2015-08-01

    Full Text Available Local synthesis of proteins within the Schwann cell periphery is extremely important for efficient process extension and myelination, when cells undergo dramatic changes in polarity and geometry. Still, it is unclear how ribosomal distributions are developed and maintained within Schwann cell projections to sustain local translation. In this multi-disciplinary study, we expressed a plasmid encoding a fluorescently labeled ribosomal subunit (L4-GFP in cultured primary rat Schwann cells. This enabled the generation of high-resolution, quantitative data on ribosomal distributions and trafficking dynamics within Schwann cells during early stages of myelination, induced by ascorbic acid treatment. Ribosomes were distributed throughout Schwann cell projections, with ~2-3 bright clusters along each projection. Clusters emerged within 1 day of culture and were maintained throughout early stages of myelination. Three days after induction of myelination, net ribosomal movement remained anterograde (directed away from the Schwann cell body, but ribosomal velocity decreased to about half the levels of the untreated group. Statistical and modeling analysis provided additional insight into key factors underlying ribosomal trafficking. Multiple regression analysis indicated that net transport at early time points was dependent on anterograde velocity, but shifted to dependence on anterograde duration at later time points. A simple, data-driven rate kinetics model suggested that the observed decrease in net ribosomal movement was primarily dictated by an increased conversion of anterograde particles to stationary particles, rather than changes in other directional parameters. These results reveal the strength of a combined experimental and theoretical approach in examining protein localization and transport, and provide evidence of an early establishment of ribosomal populations within Schwann cell projections with a reduction in trafficking following

  10. Expanding the ribosomal universe.

    Science.gov (United States)

    Dinman, Jonathan D; Kinzy, Terri Goss

    2009-12-09

    In this issue of Structure, Taylor et al. (2009) present the most complete model of an eukaryotic ribosome to date. This achievement represents a critical milestone along the path to structurally defining the unique aspects of the eukaryotic protein synthetic machinery.

  11. The Complete Structure of the Mycobacterium smegmatis 70S Ribosome

    Directory of Open Access Journals (Sweden)

    Jendrik Hentschel

    2017-07-01

    Full Text Available The ribosome carries out the synthesis of proteins in every living cell. It consequently represents a frontline target in anti-microbial therapy. Tuberculosis ranks among the leading causes of death worldwide, due in large part to the combination of difficult-to-treat latency and antibiotic resistance. Here, we present the 3.3-Å cryo-EM structure of the 70S ribosome of Mycobacterium smegmatis, a close relative to the human pathogen Mycobacterium tuberculosis. The structure reveals two additional ribosomal proteins and localizes them to the vicinity of drug-target sites in both the catalytic center and the decoding site of the ribosome. Furthermore, we visualized actinobacterium-specific rRNA and protein expansions that extensively remodel the ribosomal surface with implications for polysome organization. Our results provide a foundation for understanding the idiosyncrasies of mycobacterial translation and reveal atomic details of the structure that will facilitate the design of anti-tubercular therapeutics.

  12. The Complete Structure of the Mycobacterium smegmatis 70S Ribosome.

    Science.gov (United States)

    Hentschel, Jendrik; Burnside, Chloe; Mignot, Ingrid; Leibundgut, Marc; Boehringer, Daniel; Ban, Nenad

    2017-07-05

    The ribosome carries out the synthesis of proteins in every living cell. It consequently represents a frontline target in anti-microbial therapy. Tuberculosis ranks among the leading causes of death worldwide, due in large part to the combination of difficult-to-treat latency and antibiotic resistance. Here, we present the 3.3-Å cryo-EM structure of the 70S ribosome of Mycobacterium smegmatis, a close relative to the human pathogen Mycobacterium tuberculosis. The structure reveals two additional ribosomal proteins and localizes them to the vicinity of drug-target sites in both the catalytic center and the decoding site of the ribosome. Furthermore, we visualized actinobacterium-specific rRNA and protein expansions that extensively remodel the ribosomal surface with implications for polysome organization. Our results provide a foundation for understanding the idiosyncrasies of mycobacterial translation and reveal atomic details of the structure that will facilitate the design of anti-tubercular therapeutics. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

  13. Control of ribosome traffic by position-dependent choice of synonymous codons

    International Nuclear Information System (INIS)

    Mitarai, Namiko; Pedersen, Steen

    2013-01-01

    Messenger RNA (mRNA) encodes a sequence of amino acids by using codons. For most amino acids, there are multiple synonymous codons that can encode the amino acid. The translation speed can vary from one codon to another, thus there is room for changing the ribosome speed while keeping the amino acid sequence and hence the resulting protein. Recently, it has been noticed that the choice of the synonymous codon, via the resulting distribution of slow- and fast-translated codons, affects not only on the average speed of one ribosome translating the mRNA but also might have an effect on nearby ribosomes by affecting the appearance of ‘traffic jams’ where multiple ribosomes collide and form queues. To test this ‘context effect’ further, we here investigate the effect of the sequence of synonymous codons on the ribosome traffic by using a ribosome traffic model with codon-dependent rates, estimated from experiments. We compare the ribosome traffic on wild-type (WT) sequences and sequences where the synonymous codons were swapped randomly. By simulating translation of 87 genes, we demonstrate that the WT sequences, especially those with a high bias in codon usage, tend to have the ability to reduce ribosome collisions, hence optimizing the cellular investment in the translation apparatus. The magnitude of such reduction of the translation time might have a significant impact on the cellular growth rate and thereby have importance for the survival of the species. (paper)

  14. Using the Ribodeblur pipeline to recover A-sites from yeast ribosome profiling data.

    Science.gov (United States)

    Wang, Hao; Kingsford, Carl; McManus, C Joel

    2018-03-15

    Ribosome profiling has emerged as a powerful technique to study mRNA translation. Ribosome profiling has the potential to determine the relative quantities and locations of ribosomes on mRNA genome wide. Taking full advantage of this approach requires accurate measurement of ribosome locations. However, experimental inconsistencies often obscure the positional information encoded in ribosome profiling data. Here, we describe the Ribodeblur pipeline, a computational analysis tool that uses a maximum likelihood framework to infer ribosome positions from heterogeneous datasets. Ribodeblur is simple to install, and can be run on an average modern Mac or Linux-based laptop. We detail the process of applying the pipeline to high-coverage ribosome profiling data in yeast, and discuss important considerations for potential extension to other organisms. Copyright © 2018 Elsevier Inc. All rights reserved.

  15. Genes Involved in Human Ribosome Biogenesis areTranscriptionally Upregulated in Colorectal Cancer

    DEFF Research Database (Denmark)

    Mansilla, Francisco; Lamy, Philippe; Ørntoft, Torben Falck

    2009-01-01

    Microarray gene expression profiling comprising 168 colorectal adenocarcinomas and 10 normal mucosas showed that over 79% of the genes involved in human ribosome biogenesis are significantly upregulated (log2>0.5, p<10-3) when compared to normal mucosa. Overexpression was independent of microsate......Microarray gene expression profiling comprising 168 colorectal adenocarcinomas and 10 normal mucosas showed that over 79% of the genes involved in human ribosome biogenesis are significantly upregulated (log2>0.5, p... of microsatellite status. The promoters of the genes studied showed a significant enrichment for several transcription factor binding sites. There was a significant correlation between the number of binding site targets for these transcription factors and the observed gene transcript upregulation. The upregulation...

  16. Expression of ribosomal genes in pea cotyledons at the initial stages of germination

    International Nuclear Information System (INIS)

    Gumilevskaya, N.A.; Chumikhina, L.V.; Akhmatova, A.T.; Kretovich, V.L.

    1986-01-01

    The time of appearance of newly synthesized rRNAs and ribosomal proteins (r-proteins) in the ribosomes of pea cotyledons (Pisum sativum L.) during germination was investigated. The ribosomal fraction was isolated and analyzed according to the method of germination of the embryo in the presence of labeled precursors or after pulse labeling of the embryos at different stages of germination. For the identification of newly synthesized rRNAs in the ribosomes we estimated the relative stability of labeled RNAs to the action of RNase, the sedimentation rate, the ability to be methylated in vivo in the presence of [ 14 C]CH 3 -methionine, and the localization in the subunits of dissociated ribosomes. The presence of newly synthesized r-proteins in the ribosomes was judged on the basis of the electrophoretic similarity in SDS-disc electrophoresis of labeled polypeptides of purified ribosome preparations and of genuine r-proteins, as well as according to the localization of labeled proteins in the subunits of the dissociated ribosomes. It was shown that the expression of the ribosomal genes in highly specialized cells of pea cotyledons that have completed their growth occurs at very early stages of germination

  17. Could a Proto-Ribosome Emerge Spontaneously in the Prebiotic World?

    Directory of Open Access Journals (Sweden)

    Ilana C. Agmon

    2016-12-01

    Full Text Available An indispensable prerequisite for establishing a scenario of life emerging by natural processes is the requirement that the first simple proto-molecules could have had a realistic probability of self-assembly from random molecular polymers in the prebiotic world. The vestige of the proto-ribosome, which is believed to be still embedded in the contemporary ribosome, is used to assess the feasibility of such spontaneous emergence. Three concentric structural elements of different magnitudes, having a dimeric nature derived from the symmetrical region of the ribosomal large subunit, were suggested to constitute the vestige of the proto-ribosome. It is assumed to have materialized spontaneously in the prebiotic world, catalyzing non-coded peptide bond formation and simple elongation. Probabilistic and energetic considerations are applied in order to evaluate the suitability of the three contenders for being the initial proto-ribosome. The analysis points to the simplest proto-ribosome, comprised of a dimer of tRNA-like molecules presently embedded in the core of the symmetrical region, as the only one having a realistic statistical likelihood of spontaneous emergence from random RNA chains. Hence it offers a feasible starting point for a continuous evolutionary path from the prebiotic matter, through natural processes, into the intricate modern translation system.

  18. Phosphorylation of ribosomal proteins induced by auxins in maize embryonic tissues

    International Nuclear Information System (INIS)

    Perez, L.; Aguilar, R.; Mendez, A.P.; de Jimenez, E.S.

    1990-01-01

    The effect of auxin on ribosomal protein phosphorylation of germinating maize (Zea mays) tissues was investigated. Two-dimensional gel electrophoresis and autoradiography of [ 32 P] ribosomal protein patterns for natural and synthetic auxin-treated tissues were performed. Both the rate of 32 P incorporation and the electrophoretic patterns were dependent on 32 P pulse length, suggesting that active protein phosphorylation-dephosphorylation occurred in small and large subunit proteins, in control as well as in auxin-treated tissues. The effect of ribosomal protein phosphorylation on in vitro translation was tested. Measurements of poly(U) translation rates as a function of ribosome concentration provided apparent K m values significantly different for auxin-treated and nontreated tissues. These findings suggest that auxin might exert some kind of translational control by regulating the phosphorylated status of ribosomal proteins

  19. CSER 00-003: Criticality Safety Evaluation report for PFP Magnesium Hydroxide Precipitation Process for Plutonium Stabilization Glovebox 3

    International Nuclear Information System (INIS)

    LAN, J.S.

    2000-01-01

    This Criticality Safety Evaluation Report analyzes the stabilization of plutonium/uranium solutions in Glovebox 3 using the magnesium hydroxide precipitation process at PFP. The process covered are the receipt of diluted plutonium solutions into three precipitation tanks, the precipitation of plutonium from the solution, the filtering of the plutonium precipitate from the solution, the scraping of the precipitate from the filter into boats, and the initial drying of the precipitated slurry on a hot plate. A batch (up to 2.5 kg) is brought into the glovebox as plutonium nitrate, processed, and is then removed in boats for further processing. This CSER establishes limits for the magnesium hydroxide precipitation process in Glovebox 3 to maintain criticality safety while handling fissionable material

  20. Plan for the Startup of HA-21I Furnace Operations at the Plutonium Finishing Plant (PFP)

    International Nuclear Information System (INIS)

    WILLIS, H.T.

    2000-01-01

    Achievement of Thermal Stabilization mission elements require the installation and startup of three additional muffle furnaces for the thermal stabilization of plutonium and plutonium bearing materials at the Plutonium Finishing Plant (PFP). The release to operate these additional furnaces will require an Activity Based Startup Review. The conduct of the Activity Based Startup Review (ABSR) was approved by Fluor Daniel Hanford on October 15, 1999. This plan has been developed with the objective of identifying those activities needed to guide the controlled startup of five furnaces from authorization to unrestricted operations by adding the HA-211 furnaces in an orderly and safe manner after the approval to Startup has been given. The Startup Plan provides a phased approach that bridges the activities between the completion of the Activity Based Startup Review authorizing the use of the three additional furnaces and the unrestricted operation of the five thermal stabilization muffle furnaces. The four phases are: (1) the initiation of five furnace operations using three empty (simulated full) boat charges from HA-211 and two full charges from HC-21C; (2) three furnace operations (one full charge from HA-211 and two full charges from HC-21C); (3) four furnace operations (two full charges from HA-211 and two full charges from HC-21C); and (4) integrated five furnace operations and unrestricted operations. Phase 1 of the Plan will be considered as the cold runs. This Plan also provides management oversight and administrative controls that are to be implemented until unrestricted operations are authorized. It also provides a formal review process for ensuring that all preparations needed for full five furnace operations are completed and formally reviewed prior to proceeding to the increased activity levels associated with five furnace operations. Specific objectives include: (1) To ensure that activities are conducted in a safe manner. (2) To provide supplemental

  1. Trans-kingdom mimicry underlies ribosome customization by a poxvirus kinase.

    Science.gov (United States)

    Jha, Sujata; Rollins, Madeline G; Fuchs, Gabriele; Procter, Dean J; Hall, Elizabeth A; Cozzolino, Kira; Sarnow, Peter; Savas, Jeffrey N; Walsh, Derek

    2017-06-29

    Ribosomes have the capacity to selectively control translation through changes in their composition that enable recognition of specific RNA elements. However, beyond differential subunit expression during development, evidence for regulated ribosome specification within individual cells has remained elusive. Here we report that a poxvirus kinase phosphorylates serine/threonine residues in the human small ribosomal subunit protein, receptor for activated C kinase (RACK1), that are not phosphorylated in uninfected cells or cells infected by other viruses. These modified residues cluster in an extended loop in RACK1, phosphorylation of which selects for translation of viral or reporter mRNAs with 5' untranslated regions that contain adenosine repeats, so-called polyA-leaders. Structural and phylogenetic analyses revealed that although RACK1 is highly conserved, this loop is variable and contains negatively charged amino acids in plants, in which these leaders act as translational enhancers. Phosphomimetics and inter-species chimaeras have shown that negative charge in the RACK1 loop dictates ribosome selectivity towards viral RNAs. By converting human RACK1 to a charged, plant-like state, poxviruses remodel host ribosomes so that adenosine repeats erroneously generated by slippage of the viral RNA polymerase confer a translational advantage. Our findings provide insight into ribosome customization through trans-kingdom mimicry and the mechanics of species-specific leader activity that underlie poxvirus polyA-leaders.

  2. Miscoding-induced stalling of substrate translocation on the bacterial ribosome.

    Science.gov (United States)

    Alejo, Jose L; Blanchard, Scott C

    2017-10-10

    Directional transit of the ribosome along the messenger RNA (mRNA) template is a key determinant of the rate and processivity of protein synthesis. Imaging of the multistep translocation mechanism using single-molecule FRET has led to the hypothesis that substrate movements relative to the ribosome resolve through relatively long-lived late intermediates wherein peptidyl-tRNA enters the P site of the small ribosomal subunit via reversible, swivel-like motions of the small subunit head domain within the elongation factor G (GDP)-bound ribosome complex. Consistent with translocation being rate-limited by recognition and productive engagement of peptidyl-tRNA within the P site, we now show that base-pairing mismatches between the peptidyl-tRNA anticodon and the mRNA codon dramatically delay this rate-limiting, intramolecular process. This unexpected relationship between aminoacyl-tRNA decoding and translocation suggests that miscoding antibiotics may impact protein synthesis by impairing the recognition of peptidyl-tRNA in the small subunit P site during EF-G-catalyzed translocation. Strikingly, we show that elongation factor P (EF-P), traditionally known to alleviate ribosome stalling at polyproline motifs, can efficiently rescue translocation defects arising from miscoding. These findings help reveal the nature and origin of the rate-limiting steps in substrate translocation on the bacterial ribosome and indicate that EF-P can aid in resuming translation elongation stalled by miscoding errors.

  3. Structure based hypothesis of a mitochondrial ribosome rescue mechanism

    Directory of Open Access Journals (Sweden)

    Huynen Martijn A

    2012-05-01

    Full Text Available Abstract Background mtRF1 is a vertebrate mitochondrial protein with an unknown function that arose from a duplication of the mitochondrial release factor mtRF1a. To elucidate the function of mtRF1, we determined the positions that are conserved among mtRF1 sequences but that are different in their mtRF1a paralogs. We subsequently modeled the 3D structure of mtRF1a and mtRF1 bound to the ribosome, highlighting the structural implications of these differences to derive a hypothesis for the function of mtRF1. Results Our model predicts, in agreement with the experimental data, that the 3D structure of mtRF1a allows it to recognize the stop codons UAA and UAG in the A-site of the ribosome. In contrast, we show that mtRF1 likely can only bind the ribosome when the A-site is devoid of mRNA. Furthermore, while mtRF1a will adopt its catalytic conformation, in which it functions as a peptidyl-tRNA hydrolase in the ribosome, only upon binding of a stop codon in the A-site, mtRF1 appears specifically adapted to assume this extended, peptidyl-tRNA hydrolyzing conformation in the absence of mRNA in the A-site. Conclusions We predict that mtRF1 specifically recognizes ribosomes with an empty A-site and is able to function as a peptidyl-tRNA hydrolase in those situations. Stalled ribosomes with empty A-sites that still contain a tRNA bound to a peptide chain can result from the translation of truncated, stop-codon less mRNAs. We hypothesize that mtRF1 recycles such stalled ribosomes, performing a function that is analogous to that of tmRNA in bacteria. Reviewers This article was reviewed by Dr. Eugene Koonin, Prof. Knud H. Nierhaus (nominated by Dr. Sarah Teichmann and Dr. Shamil Sunyaev.

  4. ALARA Design Review for the Resumption of the Plutonium Finishing Plant (PFP) Cementation Process Project Activities

    CERN Document Server

    Dayley, L

    2000-01-01

    The requirements for the performance of radiological design reviews are codified in 10CFR835, Occupational Radiation Protection. The basic requirements for the performance of ALARA design reviews are presented in the Hanford Site Radiological Control Manual (HSRCM). The HSRCM has established trigger levels requiring radiological reviews of non-routine or complex work activities. These requirements are implemented in site procedures HNF-PRO-1622 and 1623. HNF-PRO-1622 Radiological Design Review Process requires that ''radiological design reviews [be performed] of new facilities and equipment and modifications of existing facilities and equipment''. In addition, HNF-PRO-1623 Radiological Work Planning Process requires a formal ALARA Review for planned activities that are estimated to exceed 1 person-rem total Dose Equivalent (DE). The purpose of this review is to validate that the original design for the PFP Cementation Process ensures that the principles of ALARA (As Low As Reasonably Achievable) were included...

  5. Novel mRNA-specific effects of ribosome drop-off on translation rate and polysome profile.

    Directory of Open Access Journals (Sweden)

    Pierre Bonnin

    2017-05-01

    Full Text Available The well established phenomenon of ribosome drop-off plays crucial roles in translational accuracy and nutrient starvation responses during protein translation. When cells are under stress conditions, such as amino acid starvation or aminoacyl-tRNA depletion due to a high level of recombinant protein expression, ribosome drop-off can substantially affect the efficiency of protein expression. Here we introduce a mathematical model that describes the effects of ribosome drop-off on the ribosome density along the mRNA and on the concomitant protein synthesis rate. Our results show that ribosome premature termination may lead to non-intuitive ribosome density profiles, such as a ribosome density which increases from the 5' to the 3' end. Importantly, the model predicts that the effects of ribosome drop-off on the translation rate are mRNA-specific, and we quantify their resilience to drop-off, showing that the mRNAs which present ribosome queues are much less affected by ribosome drop-off than those which do not. Moreover, among those mRNAs that do not present ribosome queues, resilience to drop-off correlates positively with the elongation rate, so that sequences using fast codons are expected to be less affected by ribosome drop-off. This result is consistent with a genome-wide analysis of S. cerevisiae, which reveals that under favourable growth conditions mRNAs coding for proteins involved in the translation machinery, known to be highly codon biased and using preferentially fast codons, are highly resilient to ribosome drop-off. Moreover, in physiological conditions, the translation rate of mRNAs coding for regulatory, stress-related proteins, is less resilient to ribosome drop-off. This model therefore allows analysis of variations in the translational efficiency of individual mRNAs by accounting for the full range of known ribosome behaviours, as well as explaining mRNA-specific variations in ribosome density emerging from ribosome profiling

  6. Mechanism of recycling of post-termination ribosomal complexes in ...

    Indian Academy of Sciences (India)

    Madhu

    all pathway of ribosome recycling in eubacteria with especial reference to the important role of the initiation factor ... [Seshadri A and Varshney U 2006 Mechanism of recycling of post-termination ribosomal complexes in eubacteria: a new role of initiation factor 3 .... RRF binding results in a remarkable conformational change.

  7. Expression of protein-coding genes embedded in ribosomal DNA

    DEFF Research Database (Denmark)

    Johansen, Steinar D; Haugen, Peik; Nielsen, Henrik

    2007-01-01

    Ribosomal DNA (rDNA) is a specialised chromosomal location that is dedicated to high-level transcription of ribosomal RNA genes. Interestingly, rDNAs are frequently interrupted by parasitic elements, some of which carry protein genes. These are non-LTR retrotransposons and group II introns that e...... in the nucleolus....

  8. Computational resources for ribosome profiling: from database to Web server and software.

    Science.gov (United States)

    Wang, Hongwei; Wang, Yan; Xie, Zhi

    2017-08-14

    Ribosome profiling is emerging as a powerful technique that enables genome-wide investigation of in vivo translation at sub-codon resolution. The increasing application of ribosome profiling in recent years has achieved remarkable progress toward understanding the composition, regulation and mechanism of translation. This benefits from not only the awesome power of ribosome profiling but also an extensive range of computational resources available for ribosome profiling. At present, however, a comprehensive review on these resources is still lacking. Here, we survey the recent computational advances guided by ribosome profiling, with a focus on databases, Web servers and software tools for storing, visualizing and analyzing ribosome profiling data. This review is intended to provide experimental and computational biologists with a reference to make appropriate choices among existing resources for the question at hand. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  9. Diverse Regulators of Human Ribosome Biogenesis Discovered by Changes in Nucleolar Number

    Directory of Open Access Journals (Sweden)

    Katherine I. Farley-Barnes

    2018-02-01

    Full Text Available Ribosome biogenesis is a highly regulated, essential cellular process. Although studies in yeast have established some of the biological principles of ribosome biogenesis, many of the intricacies of its regulation in higher eukaryotes remain unknown. To understand how ribosome biogenesis is globally integrated in human cells, we conducted a genome-wide siRNA screen for regulators of nucleolar number. We found 139 proteins whose depletion changed the number of nucleoli per nucleus from 2–3 to only 1 in human MCF10A cells. Follow-up analyses on 20 hits found many (90% to be essential for the nucleolar functions of rDNA transcription (7, pre-ribosomal RNA (pre-rRNA processing (16, and/or global protein synthesis (14. This genome-wide analysis exploits the relationship between nucleolar number and function to discover diverse cellular pathways that regulate the making of ribosomes and paves the way for further exploration of the links between ribosome biogenesis and human disease.

  10. Ribosomal proteins L11 and L10.(L12)4 and the antibiotic thiostrepton interact with overlapping regions of the 23 S rRNA backbone in the ribosomal GTPase centre

    DEFF Research Database (Denmark)

    Rosendahl, G; Douthwaite, S

    1993-01-01

    RNA, and to investigate how this interaction is influenced by other ribosomal components. Complexes were characterized in both naked 23 S rRNA and ribosomes from an E. coli L11-minus strain, before and after reconstitution with L11. The protein protects 17 riboses between positions 1058 and 1085 in the naked 23 S r......The Escherichia coli ribosomal protein (r-protein) L11 and its binding site on 23 S ribosomal RNA (rRNA) are associated with ribosomal hydrolysis of guanosine 5'-triphosphate (GTP). We have used hydroxyl radical footprinting to map the contacts between L11 and the backbone riboses in 23 S r......)4 and other proteins within the ribosome. The antibiotics thiostrepton and micrococcin inhibit the catalytic functions of this region by slotting in between the accessible loops and interacting with nucleotides there....

  11. Photoaffinity labeling of rat liver ribosomes by N-(2-Nitro-4-azidobenzoyl)puromycin

    International Nuclear Information System (INIS)

    Boehm, H.; Stahl, J.; Bielka, H.

    1979-01-01

    N-(2-nitro-4-azidobenzoyl)-[ 3 H]puromycin (NAB-puromycin) was synthesized as a photoreactive derivative of puromycin in order to detect ribosomal proteins located near the peptidyltransferase centre of rat liver ribosomes. Irradiation of ribosome-NAB-puromycin complexes leads to covalent attachment of the affinity label to proteins of the large ribosomal subunit, in particular to proteins L28/29, and, to a somewhat lower extent, to proteins L4, L6, L10 and L24. The results are discussed in the light of earlier studies performed with other affinity labels that attacked the peptidyltransferase region of rat liver ribosomes. (author)

  12. In vivo labelling of functional ribosomes reveals spatial regulation during starvation in Podospora anserina

    Directory of Open Access Journals (Sweden)

    Silar Philippe

    2000-11-01

    Full Text Available Abstract Background To date, in eukaryotes, ribosomal protein expression is known to be regulated at the transcriptional and/or translational levels. But other forms of regulation may be possible. Results Here, we report the successful tagging of functional ribosomal particles with a S7-GFP chimaeric protein, making it possible to observe in vivo ribosome dynamics in the filamentous fungus Podospora anserina. Microscopic observations revealed a novel kind of ribosomal protein regulation during the passage between cell growth and stationary phases, with a transient accumulation of ribosomal proteins and/or ribosome subunits in the nucleus, possibly the nucleolus, being observed at the beginning of stationary phase. Conclusion Nuclear sequestration can be another level of ribosomal protein regulation in eukaryotic cells.This may contribute to the regulation of cell growth and division.

  13. In vivo labelling of functional ribosomes reveals spatial regulation during starvation in Podospora anserina

    Science.gov (United States)

    Lalucque, Hervé; Silar, Philippe

    2000-01-01

    Background To date, in eukaryotes, ribosomal protein expression is known to be regulated at the transcriptional and/or translational levels. But other forms of regulation may be possible. Results Here, we report the successful tagging of functional ribosomal particles with a S7-GFP chimaeric protein, making it possible to observe in vivo ribosome dynamics in the filamentous fungus Podospora anserina. Microscopic observations revealed a novel kind of ribosomal protein regulation during the passage between cell growth and stationary phases, with a transient accumulation of ribosomal proteins and/or ribosome subunits in the nucleus, possibly the nucleolus, being observed at the beginning of stationary phase. Conclusion Nuclear sequestration can be another level of ribosomal protein regulation in eukaryotic cells.This may contribute to the regulation of cell growth and division. PMID:11112985

  14. Dietary ascorbic acid normalizes ribosomal efficiency for collagen production in skin of streptozotocin-induced diabetic rats

    International Nuclear Information System (INIS)

    Schneir, M.; Imberman, M.; Ramamurthy, N.; Golub, L.

    1987-01-01

    The objective of this study was to quantify the contribution of both ribosome amount and ribosomal efficiency to decreased collagen production in skin of diabetic rats and diabetic rats treated with dietary ascorbic acid. Male Sprague-Dawley rats were distributed equally into the following categories: non-diabetic controls; diabetics; ascorbic acid-treated diabetics. On day-20, all rats were injected with ( 3 H)proline and killed after 2 h. Absolute rate of collagen production, ribosome content, and ribosomal efficiency of collagen production were quantified. Also ribosomal efficiency was quantified for ribosomes in sucrose-gradient fractionated post-mitochondrial supernatants. The results indicate that decreased ribosomal efficiency was responsible for 70% of the decreased collagen production with 30% caused by decreased ribosome content, when measured for total skin or sucrose gradient-isolated ribosomes. At both levels of analysis, ascorbic acid treatment normalized ribosomal efficiency, indicating diabetes-mediated decreased ribosomal efficiency for collagen production is related to a co-translational event, such as procollagen underhydroxylation

  15. Differential antibiotic sensitivity determined by the large ribosomal subunit in thermophilic archaea.

    OpenAIRE

    Ruggero, D; Londei, P

    1996-01-01

    Hybrid ribosomes obtained by mixing the ribosomal subunits of the extremely thermophilic archaea Sulfolobus solfataricus and Desulfurococcus mobilis were tested for their sensitivity to selected antibiotics. It is shown that structural differences in the large ribosomal subunits determine qualitatively and quantitatively the patterns of response to alpha-sarcin and paromomycin in these species.

  16. The 1.8-Å resolution crystal structure of YDR533Cp from Saccharomyces cerevisiae: A member of the DJ-1/ThiJ/PfpI superfamily

    Science.gov (United States)

    Wilson, Mark A.; Amour, Courtney V. St.; Collins, Jennifer L.; Ringe, Dagmar; Petsko, Gregory A.

    2004-01-01

    The yeast gene YDR533C encodes a protein belonging to the DJ-1/ThiJ/PfpI superfamily. This family includes the human protein DJ-1, which is mutated in autosomal recessive early-onset Parkinson's disease. The function of DJ-1 and its yeast homologue YDR533Cp is unknown. We report here the crystal structure of YDR533Cp at 1.8-Å resolution. The structure indicates that the closest relative to YDR533Cp is the Escherichia coli heat shock protein Hsp31 (YedU), which has both chaperone and protease activity. As expected, the overall fold of the core domain of YDR533Cp is also similar to that of DJ-1 and the bacterial protease PfpI. YDR533Cp contains a possible catalytic triad analogous to that of Hsp31 and an additional domain that is present in Hsp31 but is not seen in DJ-1 and other members of the family. The cysteine in this triad (Cys-138) is oxidized in this crystal structure, similar to modifications seen in the corresponding cysteine in the crystal structure of DJ-1. YDR533Cp appears to be a dimer both in solution and the crystal, but this dimer is formed by a different interface than that found in Hsp31 or other members of the superfamily. PMID:14745011

  17. Pulsed-field profile diversities of Salmonella Enteritidis, S. Infantis, and S. Corvallis in Japan.

    Science.gov (United States)

    Murakami, Koichi; Noda, Tamie; Onozuka, Daisuke; Kimura, Hirokazu; Fujimoto, Shuji

    2017-08-16

    The diversity of pulsed-field profiles (PFPs) within non-typhoidal Salmonella subtypes influences epidemiological analyses of Salmonella outbreaks. Therefore, determining the PFP diversity of each Salmonella serovar is important when evaluating current circulating strains. This study examined the PFP diversity of three important public health Salmonella enterica subspecies enterica serovars, S . Enteritidis (n=177), S . Infantis (n=205), and S . Corvallis (n=90), using pulsed-field gel electrophoresis. Isolates were collected from several sources, primarily from chicken-derived samples, in the Kyushu-Okinawa region of Japan between 1989 and 2005. S . Enteritidis isolates displayed 51 distinct PFPs (E-PFPs), with 92 (52.0%) and 32 (18.1%) isolates displaying types E-PFP1 and E-PFP10, respectively. The 205 S . Infantis isolates showed 54 distinct PFPs (I-PFPs), with 87 (42.4%) and 36 (17.6%) isolates being I-PFP4 and I-PFP2, respectively. I-PFP18 was the dominant I-PFP of layer chicken isolates across a 5-year period. Fourteen distinct S . Corvallis PFPs were detected. Simpson's index results for the genetic diversities of S . Enteritidis, S . Infantis, and S . Corvallis isolates were 0.70, 0.79, and 0.78, respectively. None of the E-PFPs or I-PFPs of layer chicken isolates overlapped with those of broiler chicken isolates, and the dominant clonal lines existed for >10 years. In conclusion, limited PFP diversities were detected amongst S . Enteritidis, S. Infantis, and S. Corvallis isolates of primarily chicken-derived origins in the Kyushu-Okinawa region of Japan. Therefore, it is important to take into account these limitations in PFP diversities in epidemiological analyses of Salmonella outbreaks.

  18. Genome-wide polysomal analysis of a yeast strain with mutated ribosomal protein S9

    Directory of Open Access Journals (Sweden)

    Arava Yoav

    2007-08-01

    Full Text Available Abstract Background The yeast ribosomal protein S9 (S9 is located at the entrance tunnel of the mRNA into the ribosome. It is known to play a role in accurate decoding and its bacterial homolog (S4 has recently been shown to be involved in opening RNA duplexes. Here we examined the effects of changing the C terminus of S9, which is rich in acidic amino acids and extends out of the ribosome surface. Results We performed a genome-wide analysis to reveal effects at the transcription and translation levels of all yeast genes. While negligible relative changes were observed in steady-state mRNA levels, a significant number of mRNAs appeared to have altered ribosomal density. Notably, 40% of the genes having reliable signals changed their ribosomal association by more than one ribosome. Yet, no general correlations with physical or functional features of the mRNA were observed. Ribosome Density Mapping (RDM along four of the mRNAs with increased association revealed an increase in ribosomal density towards the end of the coding region for at least two of them. Read-through analysis did not reveal any increase in read-through of a premature stop codon by the mutant strain. Conclusion The ribosomal protein rpS9 appears to be involved in the translation of many mRNAs, since altering its C terminus led to a significant change in ribosomal association of many mRNAs. We did not find strong correlations between these changes and several physical features of the mRNA, yet future studies with advanced tools may allow such correlations to be determined. Importantly, our results indicate an accumulation of ribosomes towards the end of the coding regions of some mRNAs. This suggests an involvement of S9 in ribosomal dissociation during translation termination.

  19. Ribosomal RNA in the salivary gland of Sciara ocellaris during larval development

    International Nuclear Information System (INIS)

    Dessen, E.M.B.; Perondini, A.L.P.

    1979-01-01

    Ribosomal RNA in the salivary gland of Sciara ocellaris during larval development. The molecular weights of the precursor and of the 28S and 18S mature fractions of the ribosomal RNA estimated by poliacrilamid gel electrophoresis are 2.6 X 10 6 D, 1.4 X 10 6 D and 0.68 X 10 6 D, respectively. The in vivo processing of pre-rRNA is very fast since radioactivity could be detected in the mature fractions fifteen minutes after incorporation. The processing rate of salivary pre-rRNA increases after the stage of metamorphosis induction. The in vitro processing of the pre-rRNA is less rapid when compared to that in vivo, and no differences were found in RNAs [pt

  20. Proto-ribosome: a theoretical approach based on RNA relics

    OpenAIRE

    Demongeot, Jacques

    2017-01-01

    We describe in this paper, based on already published articles, a contribution to the theory postulating the existence of a proto-ribosome, which could have appeared early at the origin of life and we discuss the interest of this notion in an evolutionary perspective, taking into account the existence of possible RNA relics of this proto-ribosome.

  1. The structure of the nucleoprotein binding domain of lyssavirus phosphoprotein reveals a structural relationship between the N-RNA binding domains of Rhabdoviridae and Paramyxoviridae.

    Science.gov (United States)

    Delmas, Olivier; Assenberg, Rene; Grimes, Jonathan M; Bourhy, Hervé

    2010-01-01

    The phosphoprotein P of non-segmented negative-sense RNA viruses is an essential component of the replication and transcription complex and acts as a co-factor for the viral RNA-dependent RNA polymerase. P recruits the viral polymerase to the nucleoprotein-bound viral RNA (N-RNA) via an interaction between its C-terminal domain and the N-RNA complex. We have obtained the structure of the C-terminal domain of P of Mokola virus (MOKV), a lyssavirus that belongs to the Rhabdoviridae family and mapped at the amino acid level the crucial positions involved in interaction with N and in the formation of the viral replication complex. Comparison of the N-RNA binding domains of P solved to date suggests that the N-RNA binding domains are structurally conserved among paramyxoviruses and rhabdoviruses in spite of low sequence conservation. We also review the numerous other functions of this domain and more generally of the phosphoprotein.

  2. History and stabilization of the Plutonium Finishing Plant (PFP) complex, Hanford Site

    Energy Technology Data Exchange (ETDEWEB)

    Gerber, M.S., Fluor Daniel Hanford

    1997-02-18

    The 231-Z Isolation Building or Plutonium Metallurgy Building is located in the Hanford Site`s 200 West Area, approximately 300 yards north of the Plutonium Finishing Plant (PFP) (234-5 Building). When the Hanford Engineer Works (HEW) built it in 1944 to contain the final step for processing plutonium, it was called the Isolation Building. At that time, HEW used a bismuth phosphate radiochemical separations process to make `AT solution,` which was then dried and shipped to Los Alamos, New Mexico. (AT solution is a code name used during World War II for the final HEW product.) The process was carried out first in T Plant and the 224-T Bulk Reduction Building and B Plant and the 224-B Bulk Reduction Building. The 224-T and -B processes produced a concentrated plutonium nitrate stream, which then was sent in 8-gallon batches to the 231-Z Building for final purification. In the 231-Z Building, the plutonium nitrate solution underwent peroxide `strikes` (additions of hydrogen peroxide to further separate the plutonium from its carrier solutions), to form the AT solution. The AT solution was dried and shipped to the Los Alamos Site, where it was made into metallic plutonium and then into weapons hemispheres.` The 231-Z Building began `hot` operations (operations using radioactive materials) with regular runs of plutonium nitrate on January 16, 1945.

  3. Involvement of ribosomal protein L6 in assembly of functional 50S ribosomal subunit in Escherichia coli cells

    International Nuclear Information System (INIS)

    Shigeno, Yuta; Uchiumi, Toshio; Nomura, Takaomi

    2016-01-01

    Ribosomal protein L6, an essential component of the large (50S) subunit, primarily binds to helix 97 of 23S rRNA and locates near the sarcin/ricin loop of helix 95 that directly interacts with GTPase translation factors. Although L6 is believed to play important roles in factor-dependent ribosomal function, crucial biochemical evidence for this hypothesis has not been obtained. We constructed and characterized an Escherichia coli mutant bearing a chromosomal L6 gene (rplF) disruption and carrying a plasmid with an arabinose-inducible L6 gene. Although this ΔL6 mutant grew more slowly than its wild-type parent, it proliferated in the presence of arabinose. Interestingly, cell growth in the absence of arabinose was biphasic. Early growth lasted only a few generations (LI-phase) and was followed by a suspension of growth for several hours (S-phase). This suspension was followed by a second growth phase (LII-phase). Cells harvested at both LI- and S-phases contained ribosomes with reduced factor-dependent GTPase activity and accumulated 50S subunit precursors (45S particles). The 45S particles completely lacked L6. Complete 50S subunits containing L6 were observed in all growth phases regardless of the L6-depleted condition, implying that the ΔL6 mutant escaped death because of a leaky expression of L6 from the complementing plasmid. We conclude that L6 is essential for the assembly of functional 50S subunits at the late stage. We thus established conditions for the isolation of L6-depleted 50S subunits, which are essential to study the role of L6 in translation. - Highlights: • We constructed an in vivo functional assay system for Escherichia coli ribosomal protein L6. • Growth of an E. coli ΔL6 mutant was biphasic when L6 levels were depleted. • The ΔL6 mutant accumulated 50S ribosomal subunit precursors that sedimented at 45S. • L6 is a key player in the late stage of E. coli 50S subunit assembly.

  4. Involvement of ribosomal protein L6 in assembly of functional 50S ribosomal subunit in Escherichia coli cells

    Energy Technology Data Exchange (ETDEWEB)

    Shigeno, Yuta [Division of Applied Biology, Faculty of Textile Science and Technology, Shinshu University, Ueda 386-8567 (Japan); Uchiumi, Toshio [Department of Biology, Faculty of Science, Niigata University, Niigata 950-2181 (Japan); Nomura, Takaomi, E-mail: nomurat@shinshu-u.ac.jp [Division of Applied Biology, Faculty of Textile Science and Technology, Shinshu University, Ueda 386-8567 (Japan)

    2016-04-22

    Ribosomal protein L6, an essential component of the large (50S) subunit, primarily binds to helix 97 of 23S rRNA and locates near the sarcin/ricin loop of helix 95 that directly interacts with GTPase translation factors. Although L6 is believed to play important roles in factor-dependent ribosomal function, crucial biochemical evidence for this hypothesis has not been obtained. We constructed and characterized an Escherichia coli mutant bearing a chromosomal L6 gene (rplF) disruption and carrying a plasmid with an arabinose-inducible L6 gene. Although this ΔL6 mutant grew more slowly than its wild-type parent, it proliferated in the presence of arabinose. Interestingly, cell growth in the absence of arabinose was biphasic. Early growth lasted only a few generations (LI-phase) and was followed by a suspension of growth for several hours (S-phase). This suspension was followed by a second growth phase (LII-phase). Cells harvested at both LI- and S-phases contained ribosomes with reduced factor-dependent GTPase activity and accumulated 50S subunit precursors (45S particles). The 45S particles completely lacked L6. Complete 50S subunits containing L6 were observed in all growth phases regardless of the L6-depleted condition, implying that the ΔL6 mutant escaped death because of a leaky expression of L6 from the complementing plasmid. We conclude that L6 is essential for the assembly of functional 50S subunits at the late stage. We thus established conditions for the isolation of L6-depleted 50S subunits, which are essential to study the role of L6 in translation. - Highlights: • We constructed an in vivo functional assay system for Escherichia coli ribosomal protein L6. • Growth of an E. coli ΔL6 mutant was biphasic when L6 levels were depleted. • The ΔL6 mutant accumulated 50S ribosomal subunit precursors that sedimented at 45S. • L6 is a key player in the late stage of E. coli 50S subunit assembly.

  5. Senescent changes in the ribosomes of animal cells in vivo and in vitro

    Science.gov (United States)

    Miquel, J.; Johnson, J. E., Jr.

    1979-01-01

    The paper examines RNA-ribosomal changes observed in protozoa and fixed postmitotic cells, as well as the characteristics of intermitotic cells. Attention is given to a discussion of the implications of the reported ribosomal changes as to the senescent deterioration of protein synthesis and physiological functions. A survey of the literature suggests that, while the data on ribosomal change in dividing cells both in vivo and in vitro are inconclusive, there is strong histological and biochemical evidence in favor of some degree of quantitative ribosomal loss in fixed postmitotic cells. Since these decreases in ribosomes are demonstrated in differential cells from nematodes, insects and mammals, they may represent a universal manifestation of cytoplasmic senescence in certain types of fixed postmitotic animal cells. The observed variability in ribosomal loss for cells belonging to the same type suggests that this involution phenomenon is rather related to the wear and tear suffered by a particular cell.

  6. DNA replication stress restricts ribosomal DNA copy number.

    Science.gov (United States)

    Salim, Devika; Bradford, William D; Freeland, Amy; Cady, Gillian; Wang, Jianmin; Pruitt, Steven C; Gerton, Jennifer L

    2017-09-01

    Ribosomal RNAs (rRNAs) in budding yeast are encoded by ~100-200 repeats of a 9.1kb sequence arranged in tandem on chromosome XII, the ribosomal DNA (rDNA) locus. Copy number of rDNA repeat units in eukaryotic cells is maintained far in excess of the requirement for ribosome biogenesis. Despite the importance of the repeats for both ribosomal and non-ribosomal functions, it is currently not known how "normal" copy number is determined or maintained. To identify essential genes involved in the maintenance of rDNA copy number, we developed a droplet digital PCR based assay to measure rDNA copy number in yeast and used it to screen a yeast conditional temperature-sensitive mutant collection of essential genes. Our screen revealed that low rDNA copy number is associated with compromised DNA replication. Further, subculturing yeast under two separate conditions of DNA replication stress selected for a contraction of the rDNA array independent of the replication fork blocking protein, Fob1. Interestingly, cells with a contracted array grew better than their counterparts with normal copy number under conditions of DNA replication stress. Our data indicate that DNA replication stresses select for a smaller rDNA array. We speculate that this liberates scarce replication factors for use by the rest of the genome, which in turn helps cells complete DNA replication and continue to propagate. Interestingly, tumors from mini chromosome maintenance 2 (MCM2)-deficient mice also show a loss of rDNA repeats. Our data suggest that a reduction in rDNA copy number may indicate a history of DNA replication stress, and that rDNA array size could serve as a diagnostic marker for replication stress. Taken together, these data begin to suggest the selective pressures that combine to yield a "normal" rDNA copy number.

  7. DNA replication stress restricts ribosomal DNA copy number

    Science.gov (United States)

    Salim, Devika; Bradford, William D.; Freeland, Amy; Cady, Gillian; Wang, Jianmin

    2017-01-01

    Ribosomal RNAs (rRNAs) in budding yeast are encoded by ~100–200 repeats of a 9.1kb sequence arranged in tandem on chromosome XII, the ribosomal DNA (rDNA) locus. Copy number of rDNA repeat units in eukaryotic cells is maintained far in excess of the requirement for ribosome biogenesis. Despite the importance of the repeats for both ribosomal and non-ribosomal functions, it is currently not known how “normal” copy number is determined or maintained. To identify essential genes involved in the maintenance of rDNA copy number, we developed a droplet digital PCR based assay to measure rDNA copy number in yeast and used it to screen a yeast conditional temperature-sensitive mutant collection of essential genes. Our screen revealed that low rDNA copy number is associated with compromised DNA replication. Further, subculturing yeast under two separate conditions of DNA replication stress selected for a contraction of the rDNA array independent of the replication fork blocking protein, Fob1. Interestingly, cells with a contracted array grew better than their counterparts with normal copy number under conditions of DNA replication stress. Our data indicate that DNA replication stresses select for a smaller rDNA array. We speculate that this liberates scarce replication factors for use by the rest of the genome, which in turn helps cells complete DNA replication and continue to propagate. Interestingly, tumors from mini chromosome maintenance 2 (MCM2)-deficient mice also show a loss of rDNA repeats. Our data suggest that a reduction in rDNA copy number may indicate a history of DNA replication stress, and that rDNA array size could serve as a diagnostic marker for replication stress. Taken together, these data begin to suggest the selective pressures that combine to yield a “normal” rDNA copy number. PMID:28915237

  8. DNA replication stress restricts ribosomal DNA copy number.

    Directory of Open Access Journals (Sweden)

    Devika Salim

    2017-09-01

    Full Text Available Ribosomal RNAs (rRNAs in budding yeast are encoded by ~100-200 repeats of a 9.1kb sequence arranged in tandem on chromosome XII, the ribosomal DNA (rDNA locus. Copy number of rDNA repeat units in eukaryotic cells is maintained far in excess of the requirement for ribosome biogenesis. Despite the importance of the repeats for both ribosomal and non-ribosomal functions, it is currently not known how "normal" copy number is determined or maintained. To identify essential genes involved in the maintenance of rDNA copy number, we developed a droplet digital PCR based assay to measure rDNA copy number in yeast and used it to screen a yeast conditional temperature-sensitive mutant collection of essential genes. Our screen revealed that low rDNA copy number is associated with compromised DNA replication. Further, subculturing yeast under two separate conditions of DNA replication stress selected for a contraction of the rDNA array independent of the replication fork blocking protein, Fob1. Interestingly, cells with a contracted array grew better than their counterparts with normal copy number under conditions of DNA replication stress. Our data indicate that DNA replication stresses select for a smaller rDNA array. We speculate that this liberates scarce replication factors for use by the rest of the genome, which in turn helps cells complete DNA replication and continue to propagate. Interestingly, tumors from mini chromosome maintenance 2 (MCM2-deficient mice also show a loss of rDNA repeats. Our data suggest that a reduction in rDNA copy number may indicate a history of DNA replication stress, and that rDNA array size could serve as a diagnostic marker for replication stress. Taken together, these data begin to suggest the selective pressures that combine to yield a "normal" rDNA copy number.

  9. γ-irradiated ribosomes from Micrococcus radiodurans in a cell-free protein synthesizing system

    International Nuclear Information System (INIS)

    Suessmuth, R.; Widmann, A.

    1979-01-01

    γ-irradiation inactivation of isolated ribosomes of Micrococcus radiodurans was studied by examining poly U directed synthesis of polyphenylalanine. Ribosomes of M. radiodurans did not show significant γ-radiation sensitivity up to a dose of approx. 11.6 k Gy. Cells of M. radiodurans take up more magnesium than E. coli cells under the same conditions. The magnesium content of ribosomes of M. radiodurans was 18% higher than that of E.coli ribosomes. A possible relation between Mg 2+ -content and γ-resistance is discussed. (orig.) [de

  10. A Numbers Game: Ribosome Densities, Bacterial Growth, and Antibiotic-Mediated Stasis and Death

    Directory of Open Access Journals (Sweden)

    Bruce R. Levin

    2017-02-01

    Full Text Available We postulate that the inhibition of growth and low rates of mortality of bacteria exposed to ribosome-binding antibiotics deemed bacteriostatic can be attributed almost uniquely to these drugs reducing the number of ribosomes contributing to protein synthesis, i.e., the number of effective ribosomes. We tested this hypothesis with Escherichia coli K-12 MG1655 and constructs that had been deleted for 1 to 6 of the 7 rRNA (rrn operons. In the absence of antibiotics, constructs with fewer rrn operons have lower maximum growth rates and longer lag phases than those with more ribosomal operons. In the presence of the ribosome-binding “bacteriostatic” antibiotics tetracycline, chloramphenicol, and azithromycin, E. coli strains with 1 and 2 rrn operons are killed at a substantially higher rate than those with more rrn operons. This increase in the susceptibility of E. coli with fewer rrn operons to killing by ribosome-targeting bacteriostatic antibiotics is not reflected in their greater sensitivity to killing by the bactericidal antibiotic ciprofloxacin, which does not target ribosomes, but also to killing by gentamicin, which does. Finally, when such strains are exposed to these ribosome-targeting bacteriostatic antibiotics, the time before these bacteria start to grow again when the drugs are removed, referred to as the post-antibiotic effect (PAE, is markedly greater for constructs with fewer rrn operons than for those with more rrn operons. We interpret the results of these other experiments reported here as support for the hypothesis that the reduction in the effective number of ribosomes due to binding to these structures provides a sufficient explanation for the action of bacteriostatic antibiotics that target these structures.

  11. Remodeling of ribosomal genes in somatic cells by Xenopus egg extract

    DEFF Research Database (Denmark)

    Østrup, Olga; Hyttel, Poul; Klærke, Dan Arne

    2011-01-01

    Extracts from Xenopus eggs can reprogram gene expression in somatic nuclei, however little is known about the earliest processes associated with the switch in the transcriptional program. We show here that an early reprogramming event is the remodeling of ribosomal chromatin and gene expression....... This occurs within hours of extract treatment and is distinct from a stress response. Egg extract elicits remodeling of the nuclear envelope, chromatin and nucleolus. Nucleolar remodeling involves a rapid and stable decrease in ribosomal gene transcription, and promoter targeting of the nucleolar remodeling...... and elicits a stress-type nuclear response. Thus, an early event of Xenopus egg extract-mediated nuclear reprogramming is the remodeling of ribosomal genes involving nucleolar remodeling complex. Condition-specific and rapid silencing of ribosomal genes may serve as a sensitive marker for evaluation...

  12. Understanding Biases in Ribosome Profiling Experiments Reveals Signatures of Translation Dynamics in Yeast.

    Directory of Open Access Journals (Sweden)

    Jeffrey A Hussmann

    2015-12-01

    Full Text Available Ribosome profiling produces snapshots of the locations of actively translating ribosomes on messenger RNAs. These snapshots can be used to make inferences about translation dynamics. Recent ribosome profiling studies in yeast, however, have reached contradictory conclusions regarding the average translation rate of each codon. Some experiments have used cycloheximide (CHX to stabilize ribosomes before measuring their positions, and these studies all counterintuitively report a weak negative correlation between the translation rate of a codon and the abundance of its cognate tRNA. In contrast, some experiments performed without CHX report strong positive correlations. To explain this contradiction, we identify unexpected patterns in ribosome density downstream of each type of codon in experiments that use CHX. These patterns are evidence that elongation continues to occur in the presence of CHX but with dramatically altered codon-specific elongation rates. The measured positions of ribosomes in these experiments therefore do not reflect the amounts of time ribosomes spend at each position in vivo. These results suggest that conclusions from experiments in yeast using CHX may need reexamination. In particular, we show that in all such experiments, codons decoded by less abundant tRNAs were in fact being translated more slowly before the addition of CHX disrupted these dynamics.

  13. YbxF, a protein associated with exponential-phase ribosomes in Bacillus subtilis

    Czech Academy of Sciences Publication Activity Database

    Sojka, Luděk; Fučík, Vladimír; Krásný, Libor; Barvík, I.; Jonák, Jiří

    2007-01-01

    Roč. 189, č. 13 (2007), s. 4809-4814 ISSN 0021-9193 R&D Projects: GA AV ČR IAA5052206 Institutional research plan: CEZ:AV0Z50520514 Keywords : ybxF * ymxC * ribosomes * Bacillus subtilis * GFP * growth phase Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 4.013, year: 2007

  14. Linezolid-Dependent Function and Structure Adaptation of Ribosomes in a Staphylococcus epidermidis Strain Exhibiting Linezolid Dependence

    Science.gov (United States)

    Kokkori, Sofia; Apostolidi, Maria; Tsakris, Athanassios; Pournaras, Spyros

    2014-01-01

    Linezolid-dependent growth was recently reported in Staphylococcus epidermidis clinical strains carrying mutations associated with linezolid resistance. To investigate this unexpected behavior at the molecular level, we isolated active ribosomes from one of the linezolid-dependent strains and we compared them with ribosomes isolated from a wild-type strain. Both strains were grown in the absence and presence of linezolid. Detailed biochemical and structural analyses revealed essential differences in the function and structure of isolated ribosomes which were assembled in the presence of linezolid. The catalytic activity of peptidyltransferase was found to be significantly higher in the ribosomes derived from the linezolid-dependent strain. Interestingly, the same ribosomes exhibited an abnormal ribosomal subunit dissociation profile on a sucrose gradient in the absence of linezolid, but the profile was restored after treatment of the ribosomes with an excess of the antibiotic. Our study suggests that linezolid most likely modified the ribosomal assembly procedure, leading to a new functional ribosomal population active only in the presence of linezolid. Therefore, the higher growth rate of the partially linezolid-dependent strains could be attributed to the functional and structural adaptations of ribosomes to linezolid. PMID:24890589

  15. The ribosome uses two active mechanisms to unwind messenger RNA during translation.

    Science.gov (United States)

    Qu, Xiaohui; Wen, Jin-Der; Lancaster, Laura; Noller, Harry F; Bustamante, Carlos; Tinoco, Ignacio

    2011-07-06

    The ribosome translates the genetic information encoded in messenger RNA into protein. Folded structures in the coding region of an mRNA represent a kinetic barrier that lowers the peptide elongation rate, as the ribosome must disrupt structures it encounters in the mRNA at its entry site to allow translocation to the next codon. Such structures are exploited by the cell to create diverse strategies for translation regulation, such as programmed frameshifting, the modulation of protein expression levels, ribosome localization and co-translational protein folding. Although strand separation activity is inherent to the ribosome, requiring no exogenous helicases, its mechanism is still unknown. Here, using a single-molecule optical tweezers assay on mRNA hairpins, we find that the translation rate of identical codons at the decoding centre is greatly influenced by the GC content of folded structures at the mRNA entry site. Furthermore, force applied to the ends of the hairpin to favour its unfolding significantly speeds translation. Quantitative analysis of the force dependence of its helicase activity reveals that the ribosome, unlike previously studied helicases, uses two distinct active mechanisms to unwind mRNA structure: it destabilizes the helical junction at the mRNA entry site by biasing its thermal fluctuations towards the open state, increasing the probability of the ribosome translocating unhindered; and it mechanically pulls apart the mRNA single strands of the closed junction during the conformational changes that accompany ribosome translocation. The second of these mechanisms ensures a minimal basal rate of translation in the cell; specialized, mechanically stable structures are required to stall the ribosome temporarily. Our results establish a quantitative mechanical basis for understanding the mechanism of regulation of the elongation rate of translation by structured mRNAs. ©2011 Macmillan Publishers Limited. All rights reserved

  16. Further characterization of ribosome binding to thylakoid membranes

    International Nuclear Information System (INIS)

    Hurewitz, J.; Jagendorf, A.T.

    1987-01-01

    Previous work indicated more polysomes bound to pea (Pisum sativum cv Progress No. 9) thylakoids in light than in the dark, in vivo. With isolated intact chloroplasts incubated in darkness, addition of MgATP had no effect but 24 to 74% more RNA was thylakoid-bound at pH 8.3 than at pH 7. Thus, the major effect of light on ribosome-binding in vivo may be due to higher stroma pH. In isolated pea chloroplasts, initiation inhibitors (pactamycin and kanamycin) decreased the extent of RNA binding, and elongation inhibitors (lincomycin and streptomycin) increased it. Thus, cycling of ribosomes is controlled by translation, initiation, and termination. Bound RNA accounted for 19 to 24% of the total chloroplast RNA and the incorporation of [ 3 H]leucine into thylakoids was proportional to the amount of this bound RNA. These data support the concept that stroma ribosomes are recruited into thylakoid polysomes, which are active in synthesizing thylakoid proteins

  17. The N-terminal sequence of ribosomal protein L10 from the archaebacterium Halobacterium marismortui and its relationship to eubacterial protein L6 and other ribosomal proteins.

    Science.gov (United States)

    Dijk, J; van den Broek, R; Nasiulas, G; Beck, A; Reinhardt, R; Wittmann-Liebold, B

    1987-08-01

    The amino-terminal sequence of ribosomal protein L10 from Halobacterium marismortui has been determined up to residue 54, using both a liquid- and a gas-phase sequenator. The two sequences are in good agreement. The protein is clearly homologous to protein HcuL10 from the related strain Halobacterium cutirubrum. Furthermore, a weaker but distinct homology to ribosomal protein L6 from Escherichia coli and Bacillus stearothermophilus can be detected. In addition to 7 identical amino acids in the first 36 residues in all four sequences a number of conservative replacements occurs, of mainly hydrophobic amino acids. In this common region the pattern of conserved amino acids suggests the presence of a beta-alpha fold as it occurs in ribosomal proteins L12 and L30. Furthermore, several potential cases of homology to other ribosomal components of the three ur-kingdoms have been found.

  18. Ribosomes: Ribozymes that Survived Evolution Pressures but Is Paralyzed by Tiny Antibiotics

    Science.gov (United States)

    Yonath, Ada

    An impressive number of crystal structures of ribosomes, the universal cellular machines that translate the genetic code into proteins, emerged during the last decade. The determination of ribosome high resolution structure, which was widely considered formidable, led to novel insights into the ribosomal function, namely, fidelity, catalytic mechanism, and polymerize activities. They also led to suggestions concerning its origin and shed light on the action, selectivity and synergism of ribosomal antibiotics; illuminated mechanisms acquiring bacterial resistance and provided structural information for drug improvement and design. These studies required the pioneering and implementation of advanced technologies, which directly influenced the remarkable increase of the number of structures deposited in the Protein Data Bank.

  19. Multiperspective smFRET reveals rate-determining late intermediates of ribosomal translocation.

    Science.gov (United States)

    Wasserman, Michael R; Alejo, Jose L; Altman, Roger B; Blanchard, Scott C

    2016-04-01

    Directional translocation of the ribosome through the mRNA open reading frame is a critical determinant of translational fidelity. This process entails a complex interplay of large-scale conformational changes within the actively translating particle, which together coordinate the movement of tRNA and mRNA substrates with respect to the large and small ribosomal subunits. Using pre-steady state, single-molecule fluorescence resonance energy transfer imaging, we tracked the nature and timing of these conformational events within the Escherichia coli ribosome from five structural perspectives. Our investigations revealed direct evidence of structurally and kinetically distinct late intermediates during substrate movement, whose resolution determines the rate of translocation. These steps involve intramolecular events within the EF-G-GDP-bound ribosome, including exaggerated, reversible fluctuations of the small-subunit head domain, which ultimately facilitate peptidyl-tRNA's movement into its final post-translocation position.

  20. Purification and properties of a ribosomal casein kinase from rabbit reticulocytes

    DEFF Research Database (Denmark)

    Issinger, O G

    1977-01-01

    A casein kinase was isolated and purifed from rabbit reticulocytes. About 90% of the enzyme activity co-sedimented with the ribosomal fraction, whereas about 10% of the enzyme activity was found in the ribosome-free supernatant. Both casein kinases (the ribosome-bound enzyme as well as the free...... suggested that the casein kinase is a dimer composed of subunits of identical molecular weight. The enzyme utilizes GTP as well as ATP as a phosphoryl donor. It preferentially phosphorylates acidic proteins, in particular the model substrates casein and phosvitin. Casein kinase is cyclic AMP...

  1. Pulsed-field profile diversities of Salmonella Enteritidis, S. Infantis, and S. Corvallis in Japan

    Directory of Open Access Journals (Sweden)

    Koichi Murakami

    2017-10-01

    Full Text Available The diversity of pulsed-field profiles (PFPs within non-typhoidal Salmonella subtypes influences epidemiological analyses of Salmonella outbreaks. Therefore, determining the PFP diversity of each Salmonella serovar is important when evaluating current circulating strains. This study examined the PFP diversity of three important public health Salmonella enterica subspecies enterica serovars, S. Enteritidis (n=177, S. Infantis (n=205, and S. Corvallis (n=90, using pulsed-field gel electrophoresis. Isolates were collected from several sources, primarily from chicken-derived samples, in the Kyushu-Okinawa region of Japan between 1989 and 2005. S. Enteritidis isolates displayed 51 distinct PFPs (E-PFPs, with 92 (52.0% and 32 (18.1% isolates displaying types EPFP1 and E-PFP10, respectively. The 205 S. Infantis isolates showed 54 distinct PFPs (I-PFPs, with 87 (42.4% and 36 (17.6% isolates being I-PFP4 and I-PFP2, respectively. I-PFP18 was the dominant I-PFP of layer chicken isolates across a 5-year period. Fourteen distinct S. Corvallis PFPs were detected. Simpson’s index results for the genetic diversities of S. Enteritidis, S. Infantis, and S. Corvallis isolates were 0.70, 0.79, and 0.78, respectively. None of the EPFPs or I-PFPs of layer chicken isolates overlapped with those of broiler chicken isolates, and the dominant clonal lines existed for >10 years. In conclusion, limited PFP diversities were detected amongst S. Enteritidis, S. Infantis, and S. Corvallis isolates of primarily chicken-derived origins in the Kyushu-Okinawa region of Japan. Therefore, it is important to take into account these limitations in PFP diversities in epidemiological analyses of Salmonella outbreaks.

  2. Simulation and analysis of single-ribosome translation

    International Nuclear Information System (INIS)

    Tinoco, Ignacio Jr; Wen, Jin-Der

    2009-01-01

    In the cell, proteins are synthesized by ribosomes in a multi-step process called translation. The ribosome translocates along the messenger RNA to read the codons that encode the amino acid sequence of a protein. Elongation factors, including EF-G and EF-Tu, are used to catalyze the process. Recently, we have shown that translation can be followed at the single-molecule level using optical tweezers; this technique allows us to study the kinetics of translation by measuring the lifetime the ribosome spends at each codon. Here, we analyze the data from single-molecule experiments and fit the data with simple kinetic models. We also simulate the translation kinetics based on a multi-step mechanism from ensemble kinetic measurements. The mean lifetimes from the simulation were consistent with our experimental single-molecule measurements. We found that the calculated lifetime distributions were fit in general by equations with up to five rate-determining steps. Two rate-determining steps were only obtained at low concentrations of elongation factors. These analyses can be used to design new single-molecule experiments to better understand the kinetics and mechanism of translation

  3. Comparative profiling of sarcoplasmic phosphoproteins in ovine muscle with different color stability.

    Science.gov (United States)

    Li, Meng; Li, Zheng; Li, Xin; Xin, Jianzeng; Wang, Ying; Li, Guixia; Wu, Liguo; Shen, Qingwu W; Zhang, Dequan

    2018-02-01

    The phosphorylation of sarcoplasmic proteins in postmortem muscles was investigated in relationship to color stability in the present study. Although no difference was observed in the global phosphorylation level of sarcoplasmic proteins, difference was determined in the phosphorylation levels of individual protein bands from muscles with different color stability. Correlation analysis and liquid chromatography - tandem mass spectrometry (LC-MS/MS) identification of phosphoproteins showed that most of the color stability-related proteins were glycolytic enzymes. Interestingly, the phosphorylation level of myoglobin was inversely related to meat color stability. As the phosphorylation of myoglobin increased, color stability based on a ∗ value decreased and metMb content increased. In summary, the study revealed that protein phosphorylation might play a role in the regulation of meat color stability probably by regulating glycolysis and the redox stability of myoglobin, which might be affected by the phosphorylation of myoglobin. Copyright © 2017 Elsevier Ltd. All rights reserved.

  4. Translation initiation in bacterial polysomes through ribosome loading on a standby site on a highly translated mRNA

    Science.gov (United States)

    Andreeva, Irena

    2018-01-01

    During translation, consecutive ribosomes load on an mRNA and form a polysome. The first ribosome binds to a single-stranded mRNA region and moves toward the start codon, unwinding potential mRNA structures on the way. In contrast, the following ribosomes can dock at the start codon only when the first ribosome has vacated the initiation site. Here we show that loading of the second ribosome on a natural 38-nt-long 5′ untranslated region of lpp mRNA, which codes for the outer membrane lipoprotein from Escherichia coli, takes place before the leading ribosome has moved away from the start codon. The rapid formation of this standby complex depends on the presence of ribosomal proteins S1/S2 in the leading ribosome. The early recruitment of the second ribosome to the standby site before translation by the leading ribosome and the tight coupling between translation elongation by the first ribosome and the accommodation of the second ribosome can contribute to high translational efficiency of the lpp mRNA. PMID:29632209

  5. The ribosome as a molecular machine: the mechanism of tRNA-mRNA movement in translocation.

    Science.gov (United States)

    Rodnina, Marina V; Wintermeyer, Wolfgang

    2011-04-01

    Translocation of tRNA and mRNA through the ribosome is one of the most dynamic events during protein synthesis. In the cell, translocation is catalysed by EF-G (elongation factor G) and driven by GTP hydrolysis. Major unresolved questions are: how the movement is induced and what the moving parts of the ribosome are. Recent progress in time-resolved cryoelectron microscopy revealed trajectories of tRNA movement through the ribosome. Driven by thermal fluctuations, the ribosome spontaneously samples a large number of conformational states. The spontaneous movement of tRNAs through the ribosome is loosely coupled to the motions within the ribosome. EF-G stabilizes conformational states prone to translocation and promotes a conformational rearrangement of the ribosome (unlocking) that accelerates the rate-limiting step of translocation: the movement of the tRNA anticodons on the small ribosomal subunit. EF-G acts as a Brownian ratchet providing directional bias for movement at the cost of GTP hydrolysis.

  6. Structural basis for precursor protein-directed ribosomal peptide macrocyclization

    Science.gov (United States)

    Li, Kunhua; Condurso, Heather L.; Li, Gengnan; Ding, Yousong; Bruner, Steven D.

    2016-01-01

    Macrocyclization is a common feature of natural product biosynthetic pathways including the diverse family of ribosomal peptides. Microviridins are architecturally complex cyanobacterial ribosomal peptides whose members target proteases with potent reversible inhibition. The product structure is constructed by three macrocyclizations catalyzed sequentially by two members of the ATP-grasp family, a unique strategy for ribosomal peptide macrocyclization. Here, we describe the detailed structural basis for the enzyme-catalyzed macrocyclizations in the microviridin J pathway of Microcystis aeruginosa. The macrocyclases, MdnC and MdnB, interact with a conserved α-helix of the precursor peptide using a novel precursor peptide recognition mechanism. The results provide insight into the unique protein/protein interactions key to the chemistry, suggest an origin of the natural combinatorial synthesis of microviridin peptides and provide a framework for future engineering efforts to generate designed compounds. PMID:27669417

  7. Structural basis for precursor protein-directed ribosomal peptide macrocyclization.

    Science.gov (United States)

    Li, Kunhua; Condurso, Heather L; Li, Gengnan; Ding, Yousong; Bruner, Steven D

    2016-11-01

    Macrocyclization is a common feature of natural product biosynthetic pathways including the diverse family of ribosomal peptides. Microviridins are architecturally complex cyanobacterial ribosomal peptides that target proteases with potent reversible inhibition. The product structure is constructed via three macrocyclizations catalyzed sequentially by two members of the ATP-grasp family, a unique strategy for ribosomal peptide macrocyclization. Here we describe in detail the structural basis for the enzyme-catalyzed macrocyclizations in the microviridin J pathway of Microcystis aeruginosa. The macrocyclases MdnC and MdnB interact with a conserved α-helix of the precursor peptide using a novel precursor-peptide recognition mechanism. The results provide insight into the unique protein-protein interactions that are key to the chemistry, suggest an origin for the natural combinatorial synthesis of microviridin peptides, and provide a framework for future engineering efforts to generate designed compounds.

  8. The complete structure of the large subunit of the mammalian mitochondrial ribosome.

    Science.gov (United States)

    Greber, Basil J; Boehringer, Daniel; Leibundgut, Marc; Bieri, Philipp; Leitner, Alexander; Schmitz, Nikolaus; Aebersold, Ruedi; Ban, Nenad

    2014-11-13

    Mitochondrial ribosomes (mitoribosomes) are extensively modified ribosomes of bacterial descent specialized for the synthesis and insertion of membrane proteins that are critical for energy conversion and ATP production inside mitochondria. Mammalian mitoribosomes, which comprise 39S and 28S subunits, have diverged markedly from the bacterial ribosomes from which they are derived, rendering them unique compared to bacterial, eukaryotic cytosolic and fungal mitochondrial ribosomes. We have previously determined at 4.9 Å resolution the architecture of the porcine (Sus scrofa) 39S subunit, which is highly homologous to the human mitoribosomal large subunit. Here we present the complete atomic structure of the porcine 39S large mitoribosomal subunit determined in the context of a stalled translating mitoribosome at 3.4 Å resolution by cryo-electron microscopy and chemical crosslinking/mass spectrometry. The structure reveals the locations and the detailed folds of 50 mitoribosomal proteins, shows the highly conserved mitoribosomal peptidyl transferase active site in complex with its substrate transfer RNAs, and defines the path of the nascent chain in mammalian mitoribosomes along their idiosyncratic exit tunnel. Furthermore, we present evidence that a mitochondrial tRNA has become an integral component of the central protuberance of the 39S subunit where it architecturally substitutes for the absence of the 5S ribosomal RNA, a ubiquitous component of all cytoplasmic ribosomes.

  9. Organization of proteins in mammalian mitochondrial ribosomes: accessibility to lactoperoxidase-catalyzed radioiodination

    International Nuclear Information System (INIS)

    Denslow, N.D.; O'Brien, T.W.

    1984-01-01

    To assess the relative exposure of individual ribosomal proteins (r-proteins) in the large and small subunits of the bovine mitochondrial ribosome, double label iodination technique was used. Regions of r-proteins exposed in purified ribosomal subunits were labeled with 131 I using the lactoperoxidase-catalyzed iodination system, and additional reactive groups available upon denaturing the r-proteins in urea were labeled with 125 I using the chloramine-T mediated reaction. The ratio of 131 I to 125 I incorporated into individual proteins under these conditions is representative of the degree of exposure for each of the proteins in the subunits. In this manner, the r-proteins have been grouped into 3 classes depending on their degree of exposure: high exposure, intermediate exposure, and essentially buried. While both subunits have a few proteins in the highly exposed group, and a large number of proteins in the intermediate exposure group, only the large ribosomal subunit has an appreciable number of proteins which appear essentially buried. The more buried proteins may serve mainly structural roles, perhaps acting as assembly proteins, since many from this group bind to ribosomal RNA. The more superficially disposed proteins may comprise binding sites for macromolecules that interact with ribosomes during protein synthesis, as well as stabilizing the association of the large and small subribosomal particles

  10. Molecular dynamics simulation of ribosome jam

    KAUST Repository

    Matsumoto, Shigenori; Takagi, Fumiko; Shimada, Takashi; Ito, Nobuyasu

    2011-01-01

    We propose a coarse-grained molecular dynamics model of ribosome molecules to study the dependence of translation process on environmental parameters. We found the model exhibits traffic jam property, which is consistent with an ASEP model. We

  11. Complete amino acid sequences of the ribosomal proteins L25, L29 and L31 from the archaebacterium Halobacterium marismortui.

    Science.gov (United States)

    Hatakeyama, T; Kimura, M

    1988-03-15

    Ribosomal proteins were extracted from 50S ribosomal subunits of the archaebacterium Halobacterium marismortui by decreasing the concentration of Mg2+ and K+, and the proteins were separated and purified by ion-exchange column chromatography on DEAE-cellulose. Ten proteins were purified to homogeneity and three of these proteins were subjected to sequence analysis. The complete amino acid sequences of the ribosomal proteins L25, L29 and L31 were established by analyses of the peptides obtained by enzymatic digestion with trypsin, Staphylococcus aureus protease, chymotrypsin and lysylendopeptidase. Proteins L25, L29 and L31 consist of 84, 115 and 95 amino acid residues with the molecular masses of 9472 Da, 12293 Da and 10418 Da respectively. A comparison of their sequences with those of other large-ribosomal-subunit proteins from other organisms revealed that protein L25 from H. marismortui is homologous to protein L23 from Escherichia coli (34.6%), Bacillus stearothermophilus (41.8%), and tobacco chloroplasts (16.3%) as well as to protein L25 from yeast (38.0%). Proteins L29 and L31 do not appear to be homologous to any other ribosomal proteins whose structures are so far known.

  12. Mutations in ribosomal protein L3 and 23S ribosomal RNA at the peptidyl transferase centre are associated with reduced susceptibility to tiamulin in Brachyspira spp. isolates.

    Science.gov (United States)

    Pringle, Märit; Poehlsgaard, Jacob; Vester, Birte; Long, Katherine S

    2004-12-01

    The pleuromutilin antibiotic tiamulin binds to the ribosomal peptidyl transferase centre. Three groups of Brachyspira spp. isolates with reduced tiamulin susceptibility were analysed to define resistance mechanisms to the drug. Mutations were identified in genes encoding ribosomal protein L3 and 23S rRNA at positions proximal to the peptidyl transferase centre. In two groups of laboratory-selected mutants, mutations were found at nucleotide positions 2032, 2055, 2447, 2499, 2504 and 2572 of 23S rRNA (Escherichia coli numbering) and at amino acid positions 148 and 149 of ribosomal protein L3 (Brachyspira pilosicoli numbering). In a third group of clinical B. hyodysenteriae isolates, only a single mutation at amino acid 148 of ribosomal protein L3 was detected. Chemical footprinting experiments show a reduced binding of tiamulin to ribosomal subunits from mutants with decreased susceptibility to the drug. This reduction in drug binding is likely the resistance mechanism for these strains. Hence, the identified mutations located near the tiamulin binding site are predicted to be responsible for the resistance phenotype. The positions of the mutated residues relative to the bound drug advocate a model where the mutations affect tiamulin binding indirectly through perturbation of nucleotide U2504.

  13. Ribosome Profiling Reveals Pervasive Translation Outside of Annotated Protein-Coding Genes

    Directory of Open Access Journals (Sweden)

    Nicholas T. Ingolia

    2014-09-01

    Full Text Available Ribosome profiling suggests that ribosomes occupy many regions of the transcriptome thought to be noncoding, including 5′ UTRs and long noncoding RNAs (lncRNAs. Apparent ribosome footprints outside of protein-coding regions raise the possibility of artifacts unrelated to translation, particularly when they occupy multiple, overlapping open reading frames (ORFs. Here, we show hallmarks of translation in these footprints: copurification with the large ribosomal subunit, response to drugs targeting elongation, trinucleotide periodicity, and initiation at early AUGs. We develop a metric for distinguishing between 80S footprints and nonribosomal sources using footprint size distributions, which validates the vast majority of footprints outside of coding regions. We present evidence for polypeptide production beyond annotated genes, including the induction of immune responses following human cytomegalovirus (HCMV infection. Translation is pervasive on cytosolic transcripts outside of conserved reading frames, and direct detection of this expanded universe of translated products enables efforts at understanding how cells manage and exploit its consequences.

  14. Hip and knee strength is not affected in 12-16 year old adolescents with patellofemoral pain--a cross-sectional population-based study.

    Directory of Open Access Journals (Sweden)

    Camilla Rams Rathleff

    Full Text Available BACKGROUND: One of the rationales behind using strength training in the treatment of adolescents with Patellofemoral Pain (PFP is that reduced strength of the lower extremity is a risk factor for PFP and a common deficit. This rationale is based on research conducted on adolescents >15 years of age but has never been investigated among young adolescents with PFP. OBJECTIVES: To compare isometric muscle strength of the lower extremity among adolescents with PFP compared to age- and gender-matched pain-free adolescents. METHODS: In 2011 a population-based cohort (APA2011-cohort consisting of 768 adolescents aged 12-15 years from 8 local schools was formed. In September 2012, all adolescents who reported knee pain in September 2011 were offered a clinical examination if they still had knee pain. From these, 20 adolescents (16 females were diagnosed with PFP. Pain-free adolescents from the APA2011-cohort (n = 20 were recruited on random basis as age- and gender-matched pairs. Primary outcome was isometric knee extension strength normalized to body weight (%BW and blinded towards subject information. Secondary outcomes included knee flexion, hip abduction/adduction and hip internal/external rotation strength. Demographic data included Knee Injury and Osteoarthritis Outcome Score (KOOS and symptom duration. RESULTS: Adolescents with PFP reported long symptom duration and significantly worse KOOS scores compared to pain-free adolescents. There were no significant differences in isometric knee extension strength (Δ0.3% BW, p = 0.97, isometric knee flexion strength (Δ0.4% BW, p = 0.84 or different measures of hip strength (Δ0.4 to 1.1% BW, p>0.35. CONCLUSION: Young symptomatic adolescents with PFP between 12 and 16 years of age did not have decreased isometric muscle strength of the knee and hip. These results question the rationale of targeting strength deficits in the treatment of adolescents with PFP. However, strength training may

  15. Ribosome slowed by mutation to streptomycin resistance. [Escherichia coli

    Energy Technology Data Exchange (ETDEWEB)

    Galas, D J; Branscomb, E W

    1976-08-12

    The effect of mutation to streptomycin resistance on the speed of polypeptide elongation in Escherichia coli was investigated. Translation speed was determined by measuring the time required for the first newly synthesized ..beta..-galactosidase molecules to appear after induction of the lactose operon. The results showed that ribosome speed is not a fixed parameter inherent to the protein synthetic apparatus, but a variable determined by the kinetics of translation and ultimately by the structure of the ribosome. (HLW)

  16. Ribosomal stress induces L11- and p53-dependent apoptosis in mouse pluripotent stem cells.

    Science.gov (United States)

    Morgado-Palacin, Lucia; Llanos, Susana; Serrano, Manuel

    2012-02-01

    Ribosome biogenesis is the most demanding energetic process in proliferating cells and it is emerging as a critical sensor of cellular homeostasis. Upon disturbance of ribosome biogenesis, specific free ribosomal proteins, most notably L11, bind and inhibit Mdm2, resulting in activation of the tumor suppressor p53. This pathway has been characterized in somatic and cancer cells, but its function in embryonic pluripotent cells has remained unexplored. Here, we show that treatment with low doses of Actinomycin D or depletion of ribosomal protein L37, two well-established inducers of ribosomal stress, activate p53 in an L11-dependent manner in mouse embryonic stem cells (ESCs) and in induced pluripotent stem cells (iPSCs). Activation of p53 results in transcriptional induction of p53 targets, including p21, Mdm2, Pidd, Puma, Noxa and Bax. Finally, ribosomal stress elicits L11- and p53-dependent apoptosis in ESCs/iPSCs. These results extend to pluripotent cells the functionality of the ribosomal stress pathway and we speculate that this could be a relevant cellular checkpoint during early embryogenesis.

  17. ABC-F Proteins Mediate Antibiotic Resistance through Ribosomal Protection.

    Science.gov (United States)

    Sharkey, Liam K R; Edwards, Thomas A; O'Neill, Alex J

    2016-03-22

    Members of the ABC-F subfamily of ATP-binding cassette proteins mediate resistance to a broad array of clinically important antibiotic classes that target the ribosome of Gram-positive pathogens. The mechanism by which these proteins act has been a subject of long-standing controversy, with two competing hypotheses each having gained considerable support: antibiotic efflux versus ribosomal protection. Here, we report on studies employing a combination of bacteriological and biochemical techniques to unravel the mechanism of resistance of these proteins, and provide several lines of evidence that together offer clear support to the ribosomal protection hypothesis. Of particular note, we show that addition of purified ABC-F proteins to anin vitrotranslation assay prompts dose-dependent rescue of translation, and demonstrate that such proteins are capable of displacing antibiotic from the ribosomein vitro To our knowledge, these experiments constitute the first direct evidence that ABC-F proteins mediate antibiotic resistance through ribosomal protection.IMPORTANCEAntimicrobial resistance ranks among the greatest threats currently facing human health. Elucidation of the mechanisms by which microorganisms resist the effect of antibiotics is central to understanding the biology of this phenomenon and has the potential to inform the development of new drugs capable of blocking or circumventing resistance. Members of the ABC-F family, which includelsa(A),msr(A),optr(A), andvga(A), collectively yield resistance to a broader range of clinically significant antibiotic classes than any other family of resistance determinants, although their mechanism of action has been controversial since their discovery 25 years ago. Here we present the first direct evidence that proteins of the ABC-F family act to protect the bacterial ribosome from antibiotic-mediated inhibition. Copyright © 2016 Sharkey et al.

  18. Fluctuations in protein synthesis from a single RNA template: stochastic kinetics of ribosomes.

    Science.gov (United States)

    Garai, Ashok; Chowdhury, Debashish; Ramakrishnan, T V

    2009-01-01

    Proteins are polymerized by cyclic machines called ribosomes, which use their messenger RNA (mRNA) track also as the corresponding template, and the process is called translation. We explore, in depth and detail, the stochastic nature of the translation. We compute various distributions associated with the translation process; one of them--namely, the dwell time distribution--has been measured in recent single-ribosome experiments. The form of the distribution, which fits best with our simulation data, is consistent with that extracted from the experimental data. For our computations, we use a model that captures both the mechanochemistry of each individual ribosome and their steric interactions. We also demonstrate the effects of the sequence inhomogeneities of real genes on the fluctuations and noise in translation. Finally, inspired by recent advances in the experimental techniques of manipulating single ribosomes, we make theoretical predictions on the force-velocity relation for individual ribosomes. In principle, all our predictions can be tested by carrying out in vitro experiments.

  19. Amino acid sequences of ribosomal proteins S11 from Bacillus stearothermophilus and S19 from Halobacterium marismortui. Comparison of the ribosomal protein S11 family.

    Science.gov (United States)

    Kimura, M; Kimura, J; Hatakeyama, T

    1988-11-21

    The complete amino acid sequences of ribosomal proteins S11 from the Gram-positive eubacterium Bacillus stearothermophilus and of S19 from the archaebacterium Halobacterium marismortui have been determined. A search for homologous sequences of these proteins revealed that they belong to the ribosomal protein S11 family. Homologous proteins have previously been sequenced from Escherichia coli as well as from chloroplast, yeast and mammalian ribosomes. A pairwise comparison of the amino acid sequences showed that Bacillus protein S11 shares 68% identical residues with S11 from Escherichia coli and a slightly lower homology (52%) with the homologous chloroplast protein. The halophilic protein S19 is more related to the eukaryotic (45-49%) than to the eubacterial counterparts (35%).

  20. The ribosome-associated complex antagonizes prion formation in yeast.

    Science.gov (United States)

    Amor, Alvaro J; Castanzo, Dominic T; Delany, Sean P; Selechnik, Daniel M; van Ooy, Alex; Cameron, Dale M

    2015-01-01

    The number of known fungal proteins capable of switching between alternative stable conformations is steadily increasing, suggesting that a prion-like mechanism may be broadly utilized as a means to propagate altered cellular states. To gain insight into the mechanisms by which cells regulate prion formation and toxicity we examined the role of the yeast ribosome-associated complex (RAC) in modulating both the formation of the [PSI(+)] prion - an alternative conformer of Sup35 protein - and the toxicity of aggregation-prone polypeptides. The Hsp40 RAC chaperone Zuo1 anchors the RAC to ribosomes and stimulates the ATPase activity of the Hsp70 chaperone Ssb. We found that cells lacking Zuo1 are sensitive to over-expression of some aggregation-prone proteins, including the Sup35 prion domain, suggesting that co-translational protein misfolding increases in Δzuo1 strains. Consistent with this finding, Δzuo1 cells exhibit higher frequencies of spontaneous and induced prion formation. Cells expressing mutant forms of Zuo1 lacking either a C-terminal charged region required for ribosome association, or the J-domain responsible for Ssb ATPase stimulation, exhibit similarly high frequencies of prion formation. Our findings are consistent with a role for the RAC in chaperoning nascent Sup35 to regulate folding of the N-terminal prion domain as it emerges from the ribosome.

  1. Protein folding on the ribosome studied using NMR spectroscopy

    Science.gov (United States)

    Waudby, Christopher A.; Launay, Hélène; Cabrita, Lisa D.; Christodoulou, John

    2013-01-01

    NMR spectroscopy is a powerful tool for the investigation of protein folding and misfolding, providing a characterization of molecular structure, dynamics and exchange processes, across a very wide range of timescales and with near atomic resolution. In recent years NMR methods have also been developed to study protein folding as it might occur within the cell, in a de novo manner, by observing the folding of nascent polypeptides in the process of emerging from the ribosome during synthesis. Despite the 2.3 MDa molecular weight of the bacterial 70S ribosome, many nascent polypeptides, and some ribosomal proteins, have sufficient local flexibility that sharp resonances may be observed in solution-state NMR spectra. In providing information on dynamic regions of the structure, NMR spectroscopy is therefore highly complementary to alternative methods such as X-ray crystallography and cryo-electron microscopy, which have successfully characterized the rigid core of the ribosome particle. However, the low working concentrations and limited sample stability associated with ribosome–nascent chain complexes means that such studies still present significant technical challenges to the NMR spectroscopist. This review will discuss the progress that has been made in this area, surveying all NMR studies that have been published to date, and with a particular focus on strategies for improving experimental sensitivity. PMID:24083462

  2. Differences in a ribosomal DNA sequence of Strongylus species allows identification of single eggs.

    Science.gov (United States)

    Campbell, A J; Gasser, R B; Chilton, N B

    1995-03-01

    In the current study, molecular techniques were evaluated for the species identification of individual strongyle eggs. Adult worms of Strongylus edentatus, S. equinus and S. vulgaris were collected at necropsy from horses from Australia and the U.S.A. Genomic DNA was isolated and a ribosomal transcribed spacer (ITS-2) amplified and sequenced using polymerase chain reaction (PCR) techniques. The length of the ITS-2 sequence of S. edentatus, S. equinus and S. vulgaris ranged between 217 and 235 nucleotides. Extensive sequence analysis demonstrated a low degree (0-0.9%) of intraspecific variation in the ITS-2 for the Strongylus species examined, whereas the levels of interspecific differences (13-29%) were significantly greater. Interspecific differences in the ITS-2 sequences allowed unequivocal species identification of single worms and eggs using PCR-linked restriction fragment length polymorphism. These results demonstrate the potential of the ribosomal spacers as genetic markers for species identification of single strongyle eggs from horse faeces.

  3. sORFs.org: a repository of small ORFs identified by ribosome profiling.

    Science.gov (United States)

    Olexiouk, Volodimir; Crappé, Jeroen; Verbruggen, Steven; Verhegen, Kenneth; Martens, Lennart; Menschaert, Gerben

    2016-01-04

    With the advent of ribosome profiling, a next generation sequencing technique providing a "snap-shot'' of translated mRNA in a cell, many short open reading frames (sORFs) with ribosomal activity were identified. Follow-up studies revealed the existence of functional peptides, so-called micropeptides, translated from these 'sORFs', indicating a new class of bio-active peptides. Over the last few years, several micropeptides exhibiting important cellular functions were discovered. However, ribosome occupancy does not necessarily imply an actual function of the translated peptide, leading to the development of various tools assessing the coding potential of sORFs. Here, we introduce sORFs.org (http://www.sorfs.org), a novel database for sORFs identified using ribosome profiling. Starting from ribosome profiling, sORFs.org identifies sORFs, incorporates state-of-the-art tools and metrics and stores results in a public database. Two query interfaces are provided, a default one enabling quick lookup of sORFs and a BioMart interface providing advanced query and export possibilities. At present, sORFs.org harbors 263 354 sORFs that demonstrate ribosome occupancy, originating from three different cell lines: HCT116 (human), E14_mESC (mouse) and S2 (fruit fly). sORFs.org aims to provide an extensive sORFs database accessible to researchers with limited bioinformatics knowledge, thus enabling easy integration into personal projects. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  4. The importance of ribosome production, and the 5S RNP-MDM2 pathway, in health and disease.

    Science.gov (United States)

    Pelava, Andria; Schneider, Claudia; Watkins, Nicholas J

    2016-08-15

    Ribosomes are abundant, large RNA-protein complexes that are the source of all protein synthesis in the cell. The production of ribosomes is an extremely energetically expensive cellular process that has long been linked to human health and disease. More recently, it has been shown that ribosome biogenesis is intimately linked to multiple cellular signalling pathways and that defects in ribosome production can lead to a wide variety of human diseases. Furthermore, changes in ribosome production in response to nutrient levels in the diet lead to metabolic re-programming of the liver. Reduced or abnormal ribosome production in response to cellular stress or mutations in genes encoding factors critical for ribosome biogenesis causes the activation of the tumour suppressor p53, which leads to re-programming of cellular transcription. The ribosomal assembly intermediate 5S RNP (ribonucleoprotein particle), containing RPL5, RPL11 and the 5S rRNA, accumulates when ribosome biogenesis is blocked. The excess 5S RNP binds to murine double minute 2 (MDM2), the main p53-suppressor in the cell, inhibiting its function and leading to p53 activation. Here, we discuss the involvement of ribosome biogenesis in the homoeostasis of p53 in the cell and in human health and disease. © 2016 The Author(s).

  5. The nuclear import of ribosomal proteins is regulated by mTOR

    Science.gov (United States)

    Kazyken, Dubek; Kaz, Yelimbek; Kiyan, Vladimir; Zhylkibayev, Assylbek A.; Chen, Chien-Hung; Agarwal, Nitin K.; Sarbassov, Dos D.

    2014-01-01

    Mechanistic target of rapamycin (mTOR) is a central component of the essential signaling pathway that regulates cell growth and proliferation by controlling anabolic processes in cells. mTOR exists in two distinct mTOR complexes known as mTORC1 and mTORC2 that reside mostly in cytoplasm. In our study, the biochemical characterization of mTOR led to discovery of its novel localization on nuclear envelope where it associates with a critical regulator of nuclear import Ran Binding Protein 2 (RanBP2). We show that association of mTOR with RanBP2 is dependent on the mTOR kinase activity that regulates the nuclear import of ribosomal proteins. The mTOR kinase inhibitors within thirty minutes caused a substantial decrease of ribosomal proteins in the nuclear but not cytoplasmic fraction. Detection of a nuclear accumulation of the GFP-tagged ribosomal protein rpL7a also indicated its dependence on the mTOR kinase activity. The nuclear abundance of ribosomal proteins was not affected by inhibition of mTOR Complex 1 (mTORC1) by rapamycin or deficiency of mTORC2, suggesting a distinctive role of the nuclear envelope mTOR complex in the nuclear import. Thus, we identified that mTOR in association with RanBP2 mediates the active nuclear import of ribosomal proteins. PMID:25294810

  6. 5SRNAdb: an information resource for 5S ribosomal RNAs.

    Science.gov (United States)

    Szymanski, Maciej; Zielezinski, Andrzej; Barciszewski, Jan; Erdmann, Volker A; Karlowski, Wojciech M

    2016-01-04

    Ribosomal 5S RNA (5S rRNA) is the ubiquitous RNA component found in the large subunit of ribosomes in all known organisms. Due to its small size, abundance and evolutionary conservation 5S rRNA for many years now is used as a model molecule in studies on RNA structure, RNA-protein interactions and molecular phylogeny. 5SRNAdb (http://combio.pl/5srnadb/) is the first database that provides a high quality reference set of ribosomal 5S RNAs (5S rRNA) across three domains of life. Here, we give an overview of new developments in the database and associated web tools since 2002, including updates to database content, curation processes and user web interfaces. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  7. The Arabidopsis TOR Kinase Specifically Regulates the Expression of Nuclear Genes Coding for Plastidic Ribosomal Proteins and the Phosphorylation of the Cytosolic Ribosomal Protein S6.

    Science.gov (United States)

    Dobrenel, Thomas; Mancera-Martínez, Eder; Forzani, Céline; Azzopardi, Marianne; Davanture, Marlène; Moreau, Manon; Schepetilnikov, Mikhail; Chicher, Johana; Langella, Olivier; Zivy, Michel; Robaglia, Christophe; Ryabova, Lyubov A; Hanson, Johannes; Meyer, Christian

    2016-01-01

    Protein translation is an energy consuming process that has to be fine-tuned at both the cell and organism levels to match the availability of resources. The target of rapamycin kinase (TOR) is a key regulator of a large range of biological processes in response to environmental cues. In this study, we have investigated the effects of TOR inactivation on the expression and regulation of Arabidopsis ribosomal proteins at different levels of analysis, namely from transcriptomic to phosphoproteomic. TOR inactivation resulted in a coordinated down-regulation of the transcription and translation of nuclear-encoded mRNAs coding for plastidic ribosomal proteins, which could explain the chlorotic phenotype of the TOR silenced plants. We have identified in the 5' untranslated regions (UTRs) of this set of genes a conserved sequence related to the 5' terminal oligopyrimidine motif, which is known to confer translational regulation by the TOR kinase in other eukaryotes. Furthermore, the phosphoproteomic analysis of the ribosomal fraction following TOR inactivation revealed a lower phosphorylation of the conserved Ser240 residue in the C-terminal region of the 40S ribosomal protein S6 (RPS6). These results were confirmed by Western blot analysis using an antibody that specifically recognizes phosphorylated Ser240 in RPS6. Finally, this antibody was used to follow TOR activity in plants. Our results thus uncover a multi-level regulation of plant ribosomal genes and proteins by the TOR kinase.

  8. An unusual internal ribosomal entry site of inverted symmetry directs expression of a potato leafroll polerovirus replication-associated protein

    Science.gov (United States)

    Jaag, Hannah Miriam; Kawchuk, Lawrence; Rohde, Wolfgang; Fischer, Rainer; Emans, Neil; Prüfer, Dirk

    2003-01-01

    Potato leafroll polerovirus (PLRV) genomic RNA acts as a polycistronic mRNA for the production of proteins P0, P1, and P2 translated from the 5′-proximal half of the genome. Within the P1 coding region we identified a 5-kDa replication-associated protein 1 (Rap1) essential for viral multiplication. An internal ribosome entry site (IRES) with unusual structure and location was identified that regulates Rap1 translation. Core structural elements for internal ribosome entry include a conserved AUG codon and a downstream GGAGAGAGAGG motif with inverted symmetry. Reporter gene expression in potato protoplasts confirmed the internal ribosome entry function. Unlike known IRES motifs, the PLRV IRES is located completely within the coding region of Rap1 at the center of the PLRV genome. PMID:12835413

  9. The amino terminal end determines the stability and assembling capacity of eukaryotic ribosomal stalk proteins P1 and P2.

    Science.gov (United States)

    Camargo, Hendricka; Nusspaumer, Gretel; Abia, David; Briceño, Verónica; Remacha, Miguel; Ballesta, Juan P G

    2011-05-01

    The eukaryotic ribosomal proteins P1 and P2 bind to protein P0 through their N-terminal domain to form the essential ribosomal stalk. A mutational analysis points to amino acids at positions 2 and 3 as determinants for the drastic difference of Saccharomyces cerevisiae P1 and P2 half-life, and suggest different degradation mechanisms for each protein type. Moreover, the capacity to form P1/P2 heterodimers is drastically affected by mutations in the P2β four initial amino acids, while these mutations have no effect on P1β. Binding of P2β and, to a lesser extent, P1β to the ribosome is also seriously affected showing the high relevance of the amino acids in the first turn of the NTD α-helix 1 for the stalk assembly. The negative effect of some mutations on ribosome binding can be reversed by the presence of the second P1/P2 couple in the ribosome, indicating a stabilizing structural influence between the two heterodimers. Unexpectedly, some mutations totally abolish heterodimer formation but allow significant ribosome binding and, therefore, a previous P1 and P2 association seems not to be an absolute requirement for stalk assembly. Homology modeling of the protein complexes suggests that the mutated residues can affect the overall protein conformation. © The Author(s) 2011. Published by Oxford University Press.

  10. Ribosomal synthesis of polylysine from individual lysyl-tRNA/sup Lys/ in the absence of a template

    International Nuclear Information System (INIS)

    Yusupova, G.Z.; Remme, Y.L.; Belitsina, N.B.; Spirin, A.S.

    1987-01-01

    Earlier studies showed that ribosomes of Escherichia coli, in the absence of a template, can synthesize oligolysine, using lysyl-tRNA as a substrate. The authors present results on the use of preparations of individual lysyl-tRNA/sup Lys/ and phenylalanyl-tRNA/sup Phe/ in a system of templateless peptide synthesis. For these studies, the authors used ribosomes of E. coli MRE 600, washed four times with 1 M NH 4 Cl with 10 MM MgCl 2 . The purified ribosomes were stored at -70 0 C in standard buffer, containing 20 mM Tris-HCl, 100 mM NH 4 Cl, 10 mM MgCl 2 , 0.1 mM ethylenediamine tetraacetate (EDTA), and 10% glycerin, pH/sub 37 0 C/7.6. A preparation of [ 14 C]lysyl-tRNA/sup Lys/ was produced by affinity chromatography on immobilized factor EF-T/sub u/ from Thermus thermophilus HB8. The elongation factor EF-T/sub u/ from T. thermophilus and immobilized on BrCN-activated Sepharose 4B. The initial preparation of total tRNA of E. coli, enzymatically acylated by [ 14 C]lysine (348 Ci/mole, Amersham), was produced as described earlier. The degree of aminoacylation was 52-59 pmoles [ 14 C]lysine per unit of A 260 of tRNA

  11. Translation activity of chimeric ribosomes composed of Escherichia coli and Bacillus subtilis or Geobacillus stearothermophilus subunits

    Directory of Open Access Journals (Sweden)

    Sayaka Tsuji

    2017-07-01

    Full Text Available Ribosome composition, consisting of rRNA and ribosomal proteins, is highly conserved among a broad range of organisms. However, biochemical studies focusing on ribosomal subunit exchangeability between organisms remain limited. In this study, we show that chimeric ribosomes, composed of Escherichia coli and Bacillus subtilis or E. coli and Geobacillus stearothermophilus subunits, are active for β-galactosidase translation in a highly purified E. coli translation system. Activities of the chimeric ribosomes showed only a modest decrease when using E. coli 30 S subunits, indicating functional conservation of the 50 S subunit between these bacterial species.

  12. Human nucleolus organizers on nonhomologous chromosomes can share the same ribosomal gene variants.

    Science.gov (United States)

    Krystal, M; D'Eustachio, P; Ruddle, F H; Arnheim, N

    1981-01-01

    The distributions of three human ribosomal gene polymorphisms among individual chromosomes containing nucleolus organizers were analyzed by using mouse--human hybrid cells. Different nucleolus organizers can contain the same variant, suggesting the occurrence of genetic exchanges among ribosomal gene clusters on nonhomologous chromosomes. Such exchanges appear to occur less frequently in mice. This difference is discussed in terms of the nucleolar organization and chromosomal location of ribosomal gene clusters in humans and mice. Images PMID:6272316

  13. Characterization of Anti-Citrinin Specific ScFvs Selected from Non-Immunized Mouse Splenocytes by Eukaryotic Ribosome Display.

    Directory of Open Access Journals (Sweden)

    Haiwei Cheng

    Full Text Available Single chain variable fragments (scFvs against citrinin (CIT were selected from a scFv library constructed from the splenocytes of non-immunized mice by an improved eukaryotic ribosome display technology in this study. Bovine serum albumin (BSA/ CIT-BSA and ovalbumin (OVA/ CIT-OVA were used as the antigens to select specific anti-CIT scFvs. Eukaryotic in situ RT-PCR method was used to recover the selected mRNA after every affinity selection. After six rounds of ribosome display, expression vector pTIG-TRX carrying specific scFv DNAs were constructed and transformed into Escherichia coli BL21 (DE3 for protein expression. Thirteen positive clones were selected out of which three (designated 23, 68 and 109 showed high binding activity and specificity to CIT by indirect ELISA, while no clone showed binding activity with carrier proteins. The three scFvs showed high specificity to CIT and the cross reactivity with other mycotoxins was below 0.01% as determined by indirect competitive ELISA. These specific scFvs offer a potential novel immunoassay method for CIT residues. This study confirmed the effectiveness of the improved eukaryotic ribosome display system and could be used as a reference for the selection of scFvs specific to other small molecules using ribosome display.

  14. Multi-perspective smFRET reveals rate-determining late intermediates of ribosomal translocation

    Science.gov (United States)

    Wasserman, Michael R.; Alejo, Jose L.; Altman, Roger B.; Blanchard, Scott C.

    2016-01-01

    Directional translocation of the ribosome through the messenger RNA open reading frame is a critical determinant of translational fidelity. This process entails a complex interplay of large-scale conformational changes within the actively translating particle, which together coordinate the movement of transfer and messenger RNA substrates with respect to the large and small ribosomal subunits. Using pre-steady state, single-molecule fluorescence resonance energy transfer imaging, we have tracked the nature and timing of these conformational events within the Escherichia coli ribosome from five structural perspectives. Our investigations reveal direct evidence of structurally and kinetically distinct, late intermediates during substrate movement, whose resolution is rate-determining to the translocation mechanism. These steps involve intra-molecular events within the EFG(GDP)-bound ribosome, including exaggerated, reversible fluctuations of the small subunit head domain, which ultimately facilitate peptidyl-tRNA’s movement into its final post-translocation position. PMID:26926435

  15. Site-specific fluorescent labeling of nascent proteins on the translating ribosome.

    Science.gov (United States)

    Saraogi, Ishu; Zhang, Dawei; Chandrasekaran, Sandhya; Shan, Shu-ou

    2011-09-28

    As newly synthesized proteins emerge from the ribosome, they interact with a variety of cotranslational cellular machineries that facilitate their proper folding, maturation, and localization. These interactions are essential for proper function of the cell, and the ability to study these events is crucial to understanding cellular protein biogenesis. To this end, we have developed a highly efficient method to generate ribosome-nascent chain complexes (RNCs) site-specifically labeled with a fluorescent dye on the nascent polypeptide. The fluorescent RNC provides real-time, quantitative information on its cotranslational interaction with the signal recognition particle and will be a valuable tool in elucidating the role of the translating ribosome in numerous biochemical pathways.

  16. Potential roles for ubiquitin and the proteasome during ribosome biogenesis

    Czech Academy of Sciences Publication Activity Database

    Stavreva, D. A.; Kawasaki, M.; Dundr, M.; Koberna, Karel; Müller, W. G.; Tsujimura-Takahashi, T.; Komatsu, W.; Hayano, T.; Isobe, T.; Raška, Ivan; Misteli, T.; Takahashi, N.; McNally, J. G.

    2006-01-01

    Roč. 26, č. 13 (2006), s. 5131-5145 ISSN 0270-7306 R&D Projects: GA MŠk(CZ) LC535; GA ČR(CZ) GA304/05/0374; GA ČR(CZ) GA304/04/0692 Grant - others:NIH(US) Intramural Research Program; Ministry of Education(JP) Pioneer Research grant Institutional research plan: CEZ:AV0Z50110509 Keywords : the role of the ubikvitin * proteasome system in ribosome biogenesis Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 6.773, year: 2006

  17. The use of 125iodine-labeled RNA for detection of the RNA binding to ribosomes

    International Nuclear Information System (INIS)

    Mori, Tomohiko; Fukuda, Mitsuru

    1975-01-01

    The in vitro labeling of RNA with radioactive iodine is the efficient method to obtain the RNA with high specific activity. The present paper reports on the application of this technique to the production of iodine-labeled RNA for use in the experiment of binding RNA to ribosomes. Tobacco mosaic virus (TMV) RNA was used as natural mRNA, and E. coli S-30 preparation was used as a source of ribosomes. The TMV-RNA was prepared by bentonite-phenol extraction from TMV, and the method used for the iodation of RNA was based on the procedure described by Getz et al. The iodine-labeled RNA was incubated in a cell-free protein synthesizing system (S-30) prepared from E. coli K-12. After the incubation, the reaction mixture was layered onto sucrose gradient, centrifuged, and fractionated into 18 fractions. Optical density at 260 nm was measured, and radioactivity was counted, for each fraction. The binding of mRNA to ribosomes occurred even at 0 deg C, and the occurrence of the nonspecific binding was also shown. Consequently, the specific binding, i.e. the formation of the initiation complex being involved in amino acid incorporation, may be estimated by subtracting the radioactivity associated with monosomes in the presence of both rRNA and ATA from that in the presence of rRNA only. It was shown that the iodine-labeled RNA can be used for the studies of binding RNA to ribosomes. (Kako, I.)

  18. Thermus Thermophilus as a Model System for the Study of Ribosomal Antibiotic Resistance

    Science.gov (United States)

    Gregory, Steven T.

    2018-03-01

    Ribosomes are the intracellular ribonucleoprotein machines responsible for the translation of mRNA sequence into protein sequence. As an essential cell component, the ribosome is the target of numerous antibiotics that bind to critical functional sites to impair protein synthesis. Mutations causing resistance to antibiotics arise in antibiotic binding sites, and an understanding of the basis of resistance will be an essential component of efforts to develop new antibiotics by rational drug design. We have identified a number of antibiotic-resistance mutations in ribosomal genes of the thermophilic bacterium Thermus thermophilus. This species offers two primary advantages for examining the structural basis of antibiotic-resistance, in particular, its potential for genetic manipulation and the suitability of its ribosomes for analysis by X-ray crystallography. Mutations we have identified in this organism are in many instances identical to those found in other bacterial species, including important pathogens, a result of the extreme conservation of ribosome functional sites. Here I summarize the advantages of this organism as a model system to study antibiotic-resistance mechanisms at the molecular level.

  19. The 5S RNP couples p53 homeostasis to ribosome biogenesis and nucleolar stress.

    Science.gov (United States)

    Sloan, Katherine E; Bohnsack, Markus T; Watkins, Nicholas J

    2013-10-17

    Several proto-oncogenes and tumor suppressors regulate the production of ribosomes. Ribosome biogenesis is a major consumer of cellular energy, and defects result in p53 activation via repression of mouse double minute 2 (MDM2) homolog by the ribosomal proteins RPL5 and RPL11. Here, we report that RPL5 and RPL11 regulate p53 from the context of a ribosomal subcomplex, the 5S ribonucleoprotein particle (RNP). We provide evidence that the third component of this complex, the 5S rRNA, is critical for p53 regulation. In addition, we show that the 5S RNP is essential for the activation of p53 by p14(ARF), a protein that is activated by oncogene overexpression. Our data show that the abundance of the 5S RNP, and therefore p53 levels, is determined by factors regulating 5S complex formation and ribosome integration, including the tumor suppressor PICT1. The 5S RNP therefore emerges as the critical coordinator of signaling pathways that couple cell proliferation with ribosome production. Copyright © 2013 The Authors. Published by Elsevier Inc. All rights reserved.

  20. rRNA maturation in yeast cells depleted of large ribosomal subunit proteins.

    Directory of Open Access Journals (Sweden)

    Gisela Pöll

    Full Text Available The structural constituents of the large eukaryotic ribosomal subunit are 3 ribosomal RNAs, namely the 25S, 5.8S and 5S rRNA and about 46 ribosomal proteins (r-proteins. They assemble and mature in a highly dynamic process that involves more than 150 proteins and 70 small RNAs. Ribosome biogenesis starts in the nucleolus, continues in the nucleoplasm and is completed after nucleo-cytoplasmic translocation of the subunits in the cytoplasm. In this work we created 26 yeast strains, each of which conditionally expresses one of the large ribosomal subunit (LSU proteins. In vivo depletion of the analysed LSU r-proteins was lethal and led to destabilisation and degradation of the LSU and/or its precursors. Detailed steady state and metabolic pulse labelling analyses of rRNA precursors in these mutant strains showed that LSU r-proteins can be grouped according to their requirement for efficient progression of different steps of large ribosomal subunit maturation. Comparative analyses of the observed phenotypes and the nature of r-protein-rRNA interactions as predicted by current atomic LSU structure models led us to discuss working hypotheses on i how individual r-proteins control the productive processing of the major 5' end of 5.8S rRNA precursors by exonucleases Rat1p and Xrn1p, and ii the nature of structural characteristics of nascent LSUs that are required for cytoplasmic accumulation of nascent subunits but are nonessential for most of the nuclear LSU pre-rRNA processing events.

  1. Proximal mechanics during stair ascent are more discriminate of females with patellofemoral pain than distal mechanics.

    Science.gov (United States)

    de Oliveira Silva, Danilo; Barton, Christian John; Pazzinatto, Marcella Ferraz; Briani, Ronaldo Valdir; de Azevedo, Fábio Mícolis

    2016-06-01

    Several hypotheses have been proposed to explain the pathomechanisms underlying patellofemoral pain (PFP). Concurrent evaluation of lower limb mechanics in the same PFP population is needed to determine which may be more important to target during rehabilitation. This study aimed to investigate possible differences in rearfoot eversion, hip adduction, and knee flexion during stair ascent; the relationship between these variables; and the discriminatory capability of each in identifying females with PFP. Thirty-six females with PFP and 31 asymptomatic controls underwent three-dimensional kinematic analyses during stair ascent. Between-group comparisons were made for peak rearfoot eversion, hip adduction, and knee flexion. Pearson's correlation coefficients were calculated to evaluate relationships among these parameters. Receiver operating characteristic curves were applied to identify the discriminatory capability of each. Females with PFP ascended stairs with reduced peak knee flexion, greater peak hip adduction and peak rearfoot eversion. Peak hip adduction (>10.6°; sensitivity=67%, specificity=77%) discriminated females with PFP more effectively than rearfoot eversion (>5.0°; sensitivity=58%, specificity=67%). Reduced peak hip adduction was found to be associated with reduced peak knee flexion (r=0.54, p=0.002) in females with PFP. These findings indicate that proximal, local, and distal kinematics should be considered in PFP management, but proximally targeted interventions may be most important. The relationship of reduced knee flexion with reduced hip adduction also indicates a possible compensatory strategy to reduce patellofemoral joint stress, and this may need to be addressed during rehabilitation. Copyright © 2016 Elsevier Ltd. All rights reserved.

  2. Evidence for rRNA 2'-O-methylation plasticity: Control of intrinsic translational capabilities of human ribosomes.

    Science.gov (United States)

    Erales, Jenny; Marchand, Virginie; Panthu, Baptiste; Gillot, Sandra; Belin, Stéphane; Ghayad, Sandra E; Garcia, Maxime; Laforêts, Florian; Marcel, Virginie; Baudin-Baillieu, Agnès; Bertin, Pierre; Couté, Yohann; Adrait, Annie; Meyer, Mélanie; Therizols, Gabriel; Yusupov, Marat; Namy, Olivier; Ohlmann, Théophile; Motorin, Yuri; Catez, Frédéric; Diaz, Jean-Jacques

    2017-12-05

    Ribosomal RNAs (rRNAs) are main effectors of messenger RNA (mRNA) decoding, peptide-bond formation, and ribosome dynamics during translation. Ribose 2'-O-methylation (2'-O-Me) is the most abundant rRNA chemical modification, and displays a complex pattern in rRNA. 2'-O-Me was shown to be essential for accurate and efficient protein synthesis in eukaryotic cells. However, whether rRNA 2'-O-Me is an adjustable feature of the human ribosome and a means of regulating ribosome function remains to be determined. Here we challenged rRNA 2'-O-Me globally by inhibiting the rRNA methyl-transferase fibrillarin in human cells. Using RiboMethSeq, a nonbiased quantitative mapping of 2'-O-Me, we identified a repertoire of 2'-O-Me sites subjected to variation and demonstrate that functional domains of ribosomes are targets of 2'-O-Me plasticity. Using the cricket paralysis virus internal ribosome entry site element, coupled to in vitro translation, we show that the intrinsic capability of ribosomes to translate mRNAs is modulated through a 2'-O-Me pattern and not by nonribosomal actors of the translational machinery. Our data establish rRNA 2'-O-Me plasticity as a mechanism providing functional specificity to human ribosomes.

  3. Expression, purification, and characterization of a dentin phosphoprotein produced by Escherichia coli, and its odontoblastic differentiation effects on human dental pulp cells.

    Science.gov (United States)

    Yun, Ye-Rang; Jeon, Eunyi; Lee, Sujin; Kang, Wonmo; Kim, Sang-Gi; Kim, Hae-Won; Suh, Chang Kook; Jang, Jun-Hyeog

    2012-08-01

    To investigate the functions of recombinant human dentin phosphoprotein (rhDPP), we examined cell adhesion, viability and the odontoblastic differentiation activity of human dental pulp cells (hDPCs). Firstly, rhDPP was constructed using pBAD-HisA plasmid in Escherichia coli. Cell adhesion and viability of hDPCs by rhDPP was examined using a crystal violet assay and a MTT assay, ALP, mineralization activity and odontoblastic differentiation-related mRNA levels of hDPCs were measured to elucidate the odontoblastic differentiation effect of rhDPP on hDPCs. Initially, rhDPP significantly and dose-dependently increased hDPCs adhesion versus the untreated control (p < 0.05). Cell viability was also significantly increased by rhDPP at 5 days (p < 0.001). Furthermore, the odontoblastic differentiation effect of rhDPP was verified by measuring ALP activity, mineralization activity and the mRNA levels of odontoblastic differentiation markers. Taken together, rhDPP is expected to play an important role on hDPCs, thereby suggesting its potential use for tooth repair and regeneration.

  4. High-Resolution Analysis of Coronavirus Gene Expression by RNA Sequencing and Ribosome Profiling.

    Science.gov (United States)

    Irigoyen, Nerea; Firth, Andrew E; Jones, Joshua D; Chung, Betty Y-W; Siddell, Stuart G; Brierley, Ian

    2016-02-01

    Members of the family Coronaviridae have the largest genomes of all RNA viruses, typically in the region of 30 kilobases. Several coronaviruses, such as Severe acute respiratory syndrome-related coronavirus (SARS-CoV) and Middle East respiratory syndrome-related coronavirus (MERS-CoV), are of medical importance, with high mortality rates and, in the case of SARS-CoV, significant pandemic potential. Other coronaviruses, such as Porcine epidemic diarrhea virus and Avian coronavirus, are important livestock pathogens. Ribosome profiling is a technique which exploits the capacity of the translating ribosome to protect around 30 nucleotides of mRNA from ribonuclease digestion. Ribosome-protected mRNA fragments are purified, subjected to deep sequencing and mapped back to the transcriptome to give a global "snap-shot" of translation. Parallel RNA sequencing allows normalization by transcript abundance. Here we apply ribosome profiling to cells infected with Murine coronavirus, mouse hepatitis virus, strain A59 (MHV-A59), a model coronavirus in the same genus as SARS-CoV and MERS-CoV. The data obtained allowed us to study the kinetics of virus transcription and translation with exquisite precision. We studied the timecourse of positive and negative-sense genomic and subgenomic viral RNA production and the relative translation efficiencies of the different virus ORFs. Virus mRNAs were not found to be translated more efficiently than host mRNAs; rather, virus translation dominates host translation at later time points due to high levels of virus transcripts. Triplet phasing of the profiling data allowed precise determination of translated reading frames and revealed several translated short open reading frames upstream of, or embedded within, known virus protein-coding regions. Ribosome pause sites were identified in the virus replicase polyprotein pp1a ORF and investigated experimentally. Contrary to expectations, ribosomes were not found to pause at the ribosomal

  5. High-Resolution Analysis of Coronavirus Gene Expression by RNA Sequencing and Ribosome Profiling.

    Directory of Open Access Journals (Sweden)

    Nerea Irigoyen

    2016-02-01

    Full Text Available Members of the family Coronaviridae have the largest genomes of all RNA viruses, typically in the region of 30 kilobases. Several coronaviruses, such as Severe acute respiratory syndrome-related coronavirus (SARS-CoV and Middle East respiratory syndrome-related coronavirus (MERS-CoV, are of medical importance, with high mortality rates and, in the case of SARS-CoV, significant pandemic potential. Other coronaviruses, such as Porcine epidemic diarrhea virus and Avian coronavirus, are important livestock pathogens. Ribosome profiling is a technique which exploits the capacity of the translating ribosome to protect around 30 nucleotides of mRNA from ribonuclease digestion. Ribosome-protected mRNA fragments are purified, subjected to deep sequencing and mapped back to the transcriptome to give a global "snap-shot" of translation. Parallel RNA sequencing allows normalization by transcript abundance. Here we apply ribosome profiling to cells infected with Murine coronavirus, mouse hepatitis virus, strain A59 (MHV-A59, a model coronavirus in the same genus as SARS-CoV and MERS-CoV. The data obtained allowed us to study the kinetics of virus transcription and translation with exquisite precision. We studied the timecourse of positive and negative-sense genomic and subgenomic viral RNA production and the relative translation efficiencies of the different virus ORFs. Virus mRNAs were not found to be translated more efficiently than host mRNAs; rather, virus translation dominates host translation at later time points due to high levels of virus transcripts. Triplet phasing of the profiling data allowed precise determination of translated reading frames and revealed several translated short open reading frames upstream of, or embedded within, known virus protein-coding regions. Ribosome pause sites were identified in the virus replicase polyprotein pp1a ORF and investigated experimentally. Contrary to expectations, ribosomes were not found to pause at the

  6. 5S Ribosomal RNA Is an Essential Component of a Nascent Ribosomal Precursor Complex that Regulates the Hdm2-p53 Checkpoint

    Directory of Open Access Journals (Sweden)

    Giulio Donati

    2013-07-01

    Full Text Available Recently, we demonstrated that RPL5 and RPL11 act in a mutually dependent manner to inhibit Hdm2 and stabilize p53 following impaired ribosome biogenesis. Given that RPL5 and RPL11 form a preribosomal complex with noncoding 5S ribosomal RNA (rRNA and the three have been implicated in the p53 response, we reasoned they may be part of an Hdm2-inhibitory complex. Here, we show that small interfering RNAs directed against 5S rRNA have no effect on total or nascent levels of the noncoding rRNA, though they prevent the reported Hdm4 inhibition of p53. To achieve efficient inhibition of 5S rRNA synthesis, we targeted TFIIIA, a specific RNA polymerase III cofactor, which, like depletion of either RPL5 or RPL11, did not induce p53. Instead, 5S rRNA acts in a dependent manner with RPL5 and RPL11 to inhibit Hdm2 and stabilize p53. Moreover, depletion of any one of the three components abolished the binding of the other two to Hdm2, explaining their common dependence. Finally, we demonstrate that the RPL5/RPL11/5S rRNA preribosomal complex is redirected from assembly into nascent 60S ribosomes to Hdm2 inhibition as a consequence of impaired ribosome biogenesis. Thus, the activation of the Hdm2-inhibitory complex is not a passive but a regulated event, whose potential role in tumor suppression has been recently noted.

  7. 5S ribosomal RNA is an essential component of a nascent ribosomal precursor complex that regulates the Hdm2-p53 checkpoint.

    Science.gov (United States)

    Donati, Giulio; Peddigari, Suresh; Mercer, Carol A; Thomas, George

    2013-07-11

    Recently, we demonstrated that RPL5 and RPL11 act in a mutually dependent manner to inhibit Hdm2 and stabilize p53 following impaired ribosome biogenesis. Given that RPL5 and RPL11 form a preribosomal complex with noncoding 5S ribosomal RNA (rRNA) and the three have been implicated in the p53 response, we reasoned they may be part of an Hdm2-inhibitory complex. Here, we show that small interfering RNAs directed against 5S rRNA have no effect on total or nascent levels of the noncoding rRNA, though they prevent the reported Hdm4 inhibition of p53. To achieve efficient inhibition of 5S rRNA synthesis, we targeted TFIIIA, a specific RNA polymerase III cofactor, which, like depletion of either RPL5 or RPL11, did not induce p53. Instead, 5S rRNA acts in a dependent manner with RPL5 and RPL11 to inhibit Hdm2 and stabilize p53. Moreover, depletion of any one of the three components abolished the binding of the other two to Hdm2, explaining their common dependence. Finally, we demonstrate that the RPL5/RPL11/5S rRNA preribosomal complex is redirected from assembly into nascent 60S ribosomes to Hdm2 inhibition as a consequence of impaired ribosome biogenesis. Thus, the activation of the Hdm2-inhibitory complex is not a passive but a regulated event, whose potential role in tumor suppression has been recently noted. Copyright © 2013 The Authors. Published by Elsevier Inc. All rights reserved.

  8. Ribosomal mutations promote the evolution of antibiotic resistance in a multidrug environment.

    Science.gov (United States)

    Gomez, James E; Kaufmann-Malaga, Benjamin B; Wivagg, Carl N; Kim, Peter B; Silvis, Melanie R; Renedo, Nikolai; Ioerger, Thomas R; Ahmad, Rushdy; Livny, Jonathan; Fishbein, Skye; Sacchettini, James C; Carr, Steven A; Hung, Deborah T

    2017-02-21

    Antibiotic resistance arising via chromosomal mutations is typically specific to a particular antibiotic or class of antibiotics. We have identified mutations in genes encoding ribosomal components in Mycobacterium smegmatis that confer resistance to several structurally and mechanistically unrelated classes of antibiotics and enhance survival following heat shock and membrane stress. These mutations affect ribosome assembly and cause large-scale transcriptomic and proteomic changes, including the downregulation of the catalase KatG, an activating enzyme required for isoniazid sensitivity, and upregulation of WhiB7, a transcription factor involved in innate antibiotic resistance. Importantly, while these ribosomal mutations have a fitness cost in antibiotic-free medium, in a multidrug environment they promote the evolution of high-level, target-based resistance. Further, suppressor mutations can then be easily acquired to restore wild-type growth. Thus, ribosomal mutations can serve as stepping-stones in an evolutionary path leading to the emergence of high-level, multidrug resistance.

  9. Dual binding mode of the nascent polypeptide-associated complex reveals a novel universal adapter site on the ribosome.

    Science.gov (United States)

    Pech, Markus; Spreter, Thomas; Beckmann, Roland; Beatrix, Birgitta

    2010-06-18

    Nascent polypeptide-associated complex (NAC) was identified in eukaryotes as the first cytosolic factor that contacts the nascent polypeptide chain emerging from the ribosome. NAC is present as a homodimer in archaea and as a highly conserved heterodimer in eukaryotes. Mutations in NAC cause severe embryonically lethal phenotypes in mice, Drosophila melanogaster, and Caenorhabditis elegans. In the yeast Saccharomyces cerevisiae NAC is quantitatively associated with ribosomes. Here we show that NAC contacts several ribosomal proteins. The N terminus of betaNAC, however, specifically contacts near the tunnel exit ribosomal protein Rpl31, which is unique to eukaryotes and archaea. Moreover, the first 23 amino acids of betaNAC are sufficient to direct an otherwise non-associated protein to the ribosome. In contrast, alphaNAC (Egd2p) contacts Rpl17, the direct neighbor of Rpl31 at the ribosomal tunnel exit site. Rpl31 was also recently identified as a contact site for the SRP receptor and the ribosome-associated complex. Furthermore, in Escherichia coli peptide deformylase (PDF) interacts with the corresponding surface area on the eubacterial ribosome. In addition to the previously identified universal adapter site represented by Rpl25/Rpl35, we therefore refer to Rpl31/Rpl17 as a novel universal docking site for ribosome-associated factors on the eukaryotic ribosome.

  10. Biphasic character of ribosomal translocation and non-Michaelis-Menten kinetics of translation

    Science.gov (United States)

    Xie, Ping

    2014-12-01

    We study theoretically the kinetics of mRNA translocation in the wild-type (WT) Escherichia coli ribosome, which is composed of a small 30 S and large 50 S subunit, and the ribosomes with mutations to some intersubunit bridges such as B1a, B4, B7a, and B8. The theoretical results reproduce well the available in vitro experimental data on the biphasic kinetics of the forward mRNA translocation catalyzed by elongation factor G (EF-G) hydrolyzing GTP, which can be best fit by the sum of two exponentials, and the monophasic kinetics of the spontaneous reverse mRNA translocation in the absence of the elongation factor, which can be best fit by a single-exponential function, in both the WT and mutant ribosomes. We show that both the mutation-induced increase in the maximal rate of the slow phase for the forward mRNA translocation and that in the rate of the spontaneous reverse mRNA translocation result from a reduction in the intrinsic energy barrier to resist the rotational movements between the two subunits, giving the same degree of increase in the two rates. The mutation-induced increase in the maximal rate of the fast phase for the forward mRNA translocation results mainly from the increase in the rate of the ribosomal unlocking, a conformational change in the ribosome that widens the mRNA channel for the mRNA translocation to take place, which could be partly due to the effect of the mutation on the intrasubunit 30S head rotation. Moreover, we study the translation rate of the WT and mutant ribosomes. It is shown that the translation rate versus the concentration of EF-G-GTP does not follow the Michaelis-Menten (MM) kinetics, which is in sharp contrast to the general property of other enzymes that the rate of the enzymatic reaction versus the concentration of a substrate follows the MM kinetics. The physical origin of this non-MM kinetics for the ribosome is revealed.

  11. Ribosome evolution: Emergence of peptide synthesis machinery

    Indian Academy of Sciences (India)

    suggested the dynamic movement of ribosomal proteins. The L2 protein (a .... Such kinds of interactions are important in elucidating the evolution of RNA .... Tamura K 2009 Molecular handedness of life: significance of RNA aminoacylation.

  12. Is there a channel in the ribosome for nascent peptide. Labellimg of translating ribosomes with atomar tritium

    Energy Technology Data Exchange (ETDEWEB)

    Kolb, V A; Kammer, A A; Spirin, A S

    1987-01-01

    The method of tritium bombardment was applied to investigate exposure of growing peptide on the surface of ribsome E.coli. Distribution of radioactivity by fractions is presented. Tritium inclusion in all the aminoacid residues of heteropeptide testifies to its exposure on the surface of the ribosome.

  13. The 70S ribosome modulates the ATPase activity of Escherichia coli YchF.

    Science.gov (United States)

    Becker, Marion; Gzyl, Katherine E; Altamirano, Alvin M; Vuong, Anthony; Urban, Kirstin; Wieden, Hans-Joachim

    2012-10-01

    YchF is one of two universally conserved GTPases with unknown cellular function. As a first step toward elucidating YchF's cellular role, we performed a detailed biochemical characterization of the protein from Escherichia coli. Our data from fluorescence titrations not only confirmed the surprising finding that YchFE.coli binds adenine nucleotides more efficiently than guanine nucleotides, but also provides the first evidence suggesting that YchF assumes two distinct conformational states (ATP- and ADP-bound) consistent with the functional cycle of a typical GTPase. Based on an in vivo pull-down experiment using a His-tagged variant of YchF from E. coli (YchFE.coli), we were able to isolate a megadalton complex containing the 70S ribosome. Based on this finding, we report the successful reconstitution of a YchF•70S complex in vitro, revealing an affinity (KD) of the YchFE.coli•ADPNP complex for 70S ribosomes of 3 μM. The in vitro reconstitution data also suggests that the identity of the nucleotide-bound state of YchF (ADP or ATP) modulates its affinity for 70S ribosomes. A detailed Michaelis-Menten analysis of YchF's catalytic activity in the presence and the absence of the 70S ribosome and its subunits revealed for the first time that the 70S ribosome is able to stimulate YchF's ATPase activity (~10-fold), confirming the ribosome as part of the functional cycle of YchF. Our findings taken together with previously reported data for the human homolog of YchF (hOLA1) indicate a high level of evolutionary conservation in the enzymatic properties of YchF and suggest that the ribosome is the main functional partner of YchF not only in bacteria.

  14. Structural insights into methyltransferase KsgA function in 30S ribosomal subunit biogenesis.

    Science.gov (United States)

    Boehringer, Daniel; O'Farrell, Heather C; Rife, Jason P; Ban, Nenad

    2012-03-23

    The assembly of the ribosomal subunits is facilitated by ribosome biogenesis factors. The universally conserved methyltransferase KsgA modifies two adjacent adenosine residues in the 3'-terminal helix 45 of the 16 S ribosomal RNA (rRNA). KsgA recognizes its substrate adenosine residues only in the context of a near mature 30S subunit and is required for the efficient processing of the rRNA termini during ribosome biogenesis. Here, we present the cryo-EM structure of KsgA bound to a nonmethylated 30S ribosomal subunit. The structure reveals that KsgA binds to the 30S platform with the catalytic N-terminal domain interacting with substrate adenosine residues in helix 45 and the C-terminal domain making extensive contacts to helix 27 and helix 24. KsgA excludes the penultimate rRNA helix 44 from adopting its position in the mature 30S subunit, blocking the formation of the decoding site and subunit joining. We suggest that the activation of methyltransferase activity and subsequent dissociation of KsgA control conformational changes in helix 44 required for final rRNA processing and translation initiation.

  15. Structural Insights into Methyltransferase KsgA Function in 30S Ribosomal Subunit Biogenesis*

    Science.gov (United States)

    Boehringer, Daniel; O'Farrell, Heather C.; Rife, Jason P.; Ban, Nenad

    2012-01-01

    The assembly of the ribosomal subunits is facilitated by ribosome biogenesis factors. The universally conserved methyltransferase KsgA modifies two adjacent adenosine residues in the 3′-terminal helix 45 of the 16 S ribosomal RNA (rRNA). KsgA recognizes its substrate adenosine residues only in the context of a near mature 30S subunit and is required for the efficient processing of the rRNA termini during ribosome biogenesis. Here, we present the cryo-EM structure of KsgA bound to a nonmethylated 30S ribosomal subunit. The structure reveals that KsgA binds to the 30S platform with the catalytic N-terminal domain interacting with substrate adenosine residues in helix 45 and the C-terminal domain making extensive contacts to helix 27 and helix 24. KsgA excludes the penultimate rRNA helix 44 from adopting its position in the mature 30S subunit, blocking the formation of the decoding site and subunit joining. We suggest that the activation of methyltransferase activity and subsequent dissociation of KsgA control conformational changes in helix 44 required for final rRNA processing and translation initiation. PMID:22308031

  16. Three-dimensional crystals of ribosomes and their subunits from eu- and archaebacteria.

    Science.gov (United States)

    Glotz, C; Müssig, J; Gewitz, H S; Makowski, I; Arad, T; Yonath, A; Wittmann, H G

    1987-11-01

    Ordered three-dimensional crystals of 70S ribosomes as well as of 30S and 50S ribosomal subunits from various bacteria (E. coli, Bacillus stearothermophilus, Thermus thermophilus and Halobacterium marismortui) have been grown by vapour diffusion in hanging drops using mono- and polyalcohols. A new compact crystal form of 50S subunits has been obtained, and it is suitable for crystallographic studies at medium resolution. In addition, from one crystal form large crystals could be grown in X-ray capillaries. In all cases the crystals were obtained from functionally active ribosomal particles, and the particles from dissolved crystals retained their integrity and biological activity.

  17. Solution and crystallographic structures of the central region of the phosphoprotein from human metapneumovirus.

    Directory of Open Access Journals (Sweden)

    Cedric Leyrat

    Full Text Available Human metapneumovirus (HMPV of the family Paramyxoviridae is a major cause of respiratory illness worldwide. Phosphoproteins (P from Paramyxoviridae are essential co-factors of the viral RNA polymerase that form tetramers and possess long intrinsically disordered regions (IDRs. We located the central region of HMPV P (P(ced which is involved in tetramerization using disorder analysis and modeled its 3D structure ab initio using Rosetta fold-and-dock. We characterized the solution-structure of P(ced using small angle X-ray scattering (SAXS and carried out direct fitting to the scattering data to filter out incorrect models. Molecular dynamics simulations (MDS and ensemble optimization were employed to select correct models and capture the dynamic character of P(ced. Our analysis revealed that oligomerization involves a compact central core located between residues 169-194 (P(core, that is surrounded by flexible regions with α-helical propensity. We crystallized this fragment and solved its structure at 3.1 Å resolution by molecular replacement, using the folded core from our SAXS-validated ab initio model. The RMSD between modeled and experimental tetramers is as low as 0.9 Å, demonstrating the accuracy of the approach. A comparison of the structure of HMPV P to existing mononegavirales P(ced structures suggests that P(ced evolved under weak selective pressure. Finally, we discuss the advantages of using SAXS in combination with ab initio modeling and MDS to solve the structure of small, homo-oligomeric protein complexes.

  18. Remodeling of ribosomal genes in somatic cells by Xenopus egg extract

    Energy Technology Data Exchange (ETDEWEB)

    Ostrup, Olga, E-mail: osvarcova@gmail.com [Institute of Basic Animal and Veterinary Sciences, Faculty of Life Sciences, University of Copenhagen, Frederiksberg C (Denmark); Stem Cell Epigenetics Laboratory, Institute of Basic Medical Sciences, Faculty of Medicine, University of Oslo, Oslo (Norway); Norwegian Center for Stem Cell Research, Oslo (Norway); Hyttel, Poul; Klaerke, Dan A. [Institute of Basic Animal and Veterinary Sciences, Faculty of Life Sciences, University of Copenhagen, Frederiksberg C (Denmark); Collas, Philippe, E-mail: philc@medisin.uio.no [Stem Cell Epigenetics Laboratory, Institute of Basic Medical Sciences, Faculty of Medicine, University of Oslo, Oslo (Norway); Norwegian Center for Stem Cell Research, Oslo (Norway)

    2011-09-02

    Highlights: {yields} Xenopus egg extract remodels nuclei and alter cell growth characteristics. {yields} Ribosomal genes are reprogrammed within 6 h after extract exposure. {yields} rDNA reprogramming involves promoter targeting of SNF2H remodeling complex. {yields} Xenopus egg extract does not initiate stress-related response in somatic cells. {yields} Aza-cytidine elicits a stress-induced response in reprogrammed cells. -- Abstract: Extracts from Xenopus eggs can reprogram gene expression in somatic nuclei, however little is known about the earliest processes associated with the switch in the transcriptional program. We show here that an early reprogramming event is the remodeling of ribosomal chromatin and gene expression. This occurs within hours of extract treatment and is distinct from a stress response. Egg extract elicits remodeling of the nuclear envelope, chromatin and nucleolus. Nucleolar remodeling involves a rapid and stable decrease in ribosomal gene transcription, and promoter targeting of the nucleolar remodeling complex component SNF2H without affecting occupancy of the transcription factor UBF and the stress silencers SUV39H1 and SIRT1. During this process, nucleolar localization of UBF and SIRT1 is not altered. On contrary, azacytidine pre-treatment has an adverse effect on rDNA remodeling induced by extract and elicits a stress-type nuclear response. Thus, an early event of Xenopus egg extract-mediated nuclear reprogramming is the remodeling of ribosomal genes involving nucleolar remodeling complex. Condition-specific and rapid silencing of ribosomal genes may serve as a sensitive marker for evaluation of various reprogramming methods.

  19. Diamond Blackfan Anemia at the Crossroad between Ribosome Biogenesis and Heme Metabolism

    Directory of Open Access Journals (Sweden)

    Deborah Chiabrando

    2010-01-01

    Full Text Available Diamond-Blackfan anemia (DBA is a rare, pure red-cell aplasia that presents during infancy. Approximately 40% of cases are associated with other congenital defects, particularly malformations of the upper limb or craniofacial region. Mutations in the gene coding for the ribosomal protein RPS19 have been identified in 25% of patients with DBA, with resulting impairment of 18S rRNA processing and 40S ribosomal subunit formation. Moreover, mutations in other ribosomal protein coding genes account for about 25% of other DBA cases. Recently, the analysis of mice from which the gene coding for the heme exporter Feline Leukemia Virus subgroup C Receptor (FLVCR1 is deleted suggested that this gene may be involved in the pathogenesis of DBA. FLVCR1-null mice show a phenotype resembling that of DBA patients, including erythroid failure and malformations. Interestingly, some DBA patients have disease linkage to chromosome 1q31, where FLVCR1 is mapped. Moreover, it has been reported that cells from DBA patients express alternatively spliced isoforms of FLVCR1 which encode non-functional proteins. Herein, we review the known roles of RPS19 and FLVCR1 in ribosome function and heme metabolism respectively, and discuss how the deficiency of a ribosomal protein or of a heme exporter may result in the same phenotype.

  20. Structural and functional organization of ribosomal genes within the mammalian cell nucleolus.

    Science.gov (United States)

    Derenzini, Massimo; Pasquinelli, Gianandrea; O'Donohue, Marie-Françoise; Ploton, Dominique; Thiry, Marc

    2006-02-01

    Data on the in situ structural-functional organization of ribosomal genes in the mammalian cell nucleolus are reviewed here. Major findings on chromatin structure in situ come from investigations carried out using the Feulgen-like osmium ammine reaction as a highly specific electron-opaque DNA tracer. Intranucleolar chromatin shows three different levels of organization: compact clumps, fibers ranging from 11 to 30 nm, and loose agglomerates of extended DNA filaments. Both clumps and fibers of chromatin exhibit a nucleosomal organization that is lacking in the loose agglomerates of extended DNA filaments. In fact, these filaments constantly show a thickness of 2-3 nm, the same as a DNA double-helix molecule. The loose agglomerates of DNA filaments are located in the fibrillar centers, the interphase counterpart of metaphase NORs, therefore being constituted by ribosomal DNA. The extended, non-nucleosomal configuration of this rDNA has been shown to be independent of transcriptional activity and characterizes ribosome genes that are either transcribed or transcriptionally silent. Data reviewed are consistent with a model of control for ribosome gene activity that is not mediated by changes in chromatin structure. The presence of rDNA in mammalian cells always structurally ready for transcription might facilitate a more rapid adjustment of the ribosome production in response to the metabolic needs of the cell.

  1. A streamlined ribosome profiling protocol for the characterization of microorganisms

    DEFF Research Database (Denmark)

    Latif, Haythem; Szubin, Richard; Tan, Justin

    2015-01-01

    Ribosome profiling is a powerful tool for characterizing in vivo protein translation at the genome scale, with multiple applications ranging from detailed molecular mechanisms to systems-level predictive modeling. Though highly effective, this intricate technique has yet to become widely used...... in the microbial research community. Here we present a streamlined ribosome profiling protocol with reduced barriers to entry for microbial characterization studies. Our approach provides simplified alternatives during harvest, lysis, and recovery of monosomes and also eliminates several time-consuming steps...

  2. Is The Ribosome Targeted By Adaptive Mutations

    DEFF Research Database (Denmark)

    Jimenez Fernandez, Alicia; Molin, Søren; Johansen, Helle Krogh

    2015-01-01

    Introduction: RNA polymerase and ribosomes, composing the macromolecular synthesis machinery (MMSM), carry out the central processes of transcription and translation, but are usually seen as mechanical elements with no regulatory function. Extensive investigations of gene regulation and the high ...

  3. Simulating movement of tRNA through the ribosome during hybrid-state formation.

    Science.gov (United States)

    Whitford, Paul C; Sanbonmatsu, Karissa Y

    2013-09-28

    Biomolecular simulations provide a means for exploring the relationship between flexibility, energetics, structure, and function. With the availability of atomic models from X-ray crystallography and cryoelectron microscopy (cryo-EM), and rapid increases in computing capacity, it is now possible to apply molecular dynamics (MD) simulations to large biomolecular machines, and systematically partition the factors that contribute to function. A large biomolecular complex for which atomic models are available is the ribosome. In the cell, the ribosome reads messenger RNA (mRNA) in order to synthesize proteins. During this essential process, the ribosome undergoes a wide range of conformational rearrangements. One of the most poorly understood transitions is translocation: the process by which transfer RNA (tRNA) molecules move between binding sites inside of the ribosome. The first step of translocation is the adoption of a "hybrid" configuration by the tRNAs, which is accompanied by large-scale rotations in the ribosomal subunits. To illuminate the relationship between these rearrangements, we apply MD simulations using a multi-basin structure-based (SMOG) model, together with targeted molecular dynamics protocols. From 120 simulated transitions, we demonstrate the viability of a particular route during P/E hybrid-state formation, where there is asynchronous movement along rotation and tRNA coordinates. These simulations not only suggest an ordering of events, but they highlight atomic interactions that may influence the kinetics of hybrid-state formation. From these simulations, we also identify steric features (H74 and surrounding residues) encountered during the hybrid transition, and observe that flexibility of the single-stranded 3'-CCA tail is essential for it to reach the endpoint. Together, these simulations provide a set of structural and energetic signatures that suggest strategies for modulating the physical-chemical properties of protein synthesis by the

  4. Dynamic enzyme docking to the ribosome coordinates N-terminal processing with polypeptide folding.

    Science.gov (United States)

    Sandikci, Arzu; Gloge, Felix; Martinez, Michael; Mayer, Matthias P; Wade, Rebecca; Bukau, Bernd; Kramer, Günter

    2013-07-01

    Newly synthesized polypeptides undergo various cotranslational maturation steps, including N-terminal enzymatic processing, chaperone-assisted folding and membrane targeting, but the spatial and temporal coordination of these steps is unclear. We show that Escherichia coli methionine aminopeptidase (MAP) associates with ribosomes through a charged loop that is crucial for nascent-chain processing and cell viability. MAP competes with peptide deformylase (PDF), the first enzyme to act on nascent chains, for binding sites at the ribosomal tunnel exit. PDF has extremely fast association and dissociation kinetics, which allows it to frequently sample ribosomes and ensure the processing of nascent chains after their emergence. Premature recruitment of the chaperone trigger factor, or polypeptide folding, negatively affect processing efficiency. Thus, the fast ribosome association kinetics of PDF and MAP are crucial for the temporal separation of nascent-chain processing from later maturation events, including chaperone recruitment and folding.

  5. rRNA:mRNA pairing alters the length and the symmetry of mRNA-protected fragments in ribosome profiling experiments

    OpenAIRE

    O?Connor, Patrick B. F.; Li, Gene-Wei; Weissman, Jonathan S.; Atkins, John F.; Baranov, Pavel V.

    2013-01-01

    Motivation: Ribosome profiling is a new technique that allows monitoring locations of translating ribosomes on mRNA at a whole transcriptome level. A recent ribosome profiling study demonstrated that internal Shine?Dalgarno (SD) sequences have a major global effect on translation rates in bacteria: ribosomes pause at SD sites in mRNA. Therefore, it is important to understand how SD sites effect mRNA movement through the ribosome and generation of ribosome footprints. Results: Here, we provide...

  6. Molecular mechanism and structure of Trigger Factor bound to the translating ribosome

    Science.gov (United States)

    Merz, Frieder; Boehringer, Daniel; Schaffitzel, Christiane; Preissler, Steffen; Hoffmann, Anja; Maier, Timm; Rutkowska, Anna; Lozza, Jasmin; Ban, Nenad; Bukau, Bernd; Deuerling, Elke

    2008-01-01

    Ribosome-associated chaperone Trigger Factor (TF) initiates folding of newly synthesized proteins in bacteria. Here, we pinpoint by site-specific crosslinking the sequence of molecular interactions of Escherichia coli TF and nascent chains during translation. Furthermore, we provide the first full-length structure of TF associated with ribosome–nascent chain complexes by using cryo-electron microscopy. In its active state, TF arches over the ribosomal exit tunnel accepting nascent chains in a protective void. The growing nascent chain initially follows a predefined path through the entire interior of TF in an unfolded conformation, and even after folding into a domain it remains accommodated inside the protective cavity of ribosome-bound TF. The adaptability to accept nascent chains of different length and folding states may explain how TF is able to assist co-translational folding of all kinds of nascent polypeptides during ongoing synthesis. Moreover, we suggest a model of how TF's chaperoning function can be coordinated with the co-translational processing and membrane targeting of nascent polypeptides by other ribosome-associated factors. PMID:18497744

  7. Acrolein preferentially damages nucleolus eliciting ribosomal stress and apoptosis in human cancer cells.

    Science.gov (United States)

    Wang, Hsiang-Tsui; Chen, Tzu-Ying; Weng, Ching-Wen; Yang, Chun-Hsiang; Tang, Moon-Shong

    2016-12-06

    Acrolein (Acr) is a potent cytotoxic and DNA damaging agent which is ubiquitous in the environment and abundant in tobacco smoke. Acr is also an active cytotoxic metabolite of the anti-cancer drugs cyclophosphamide and ifosfamide. The mechanisms via which Acr exerts its anti-cancer activity and cytotoxicity are not clear. In this study, we found that Acr induces cytotoxicity and cell death in human cancer cells with different activities of p53. Acr preferentially binds nucleolar ribosomal DNA (rDNA) to form Acr-deoxyguanosine adducts, and induces oxidative damage to both rDNA and ribosomal RNA (rRNA). Acr triggers ribosomal stress responses, inhibits rRNA synthesis, reduces RNA polymerase I binding to the promoter of rRNA gene, disrupts nucleolar integrity, and impairs ribosome biogenesis and polysome formation. Acr causes an increase in MDM2 levels and phosphorylation of MDM2 in A549 and HeLa cells which are p53 active and p53 inactive, respectively. It enhances the binding of ribosomal protein RPL11 to MDM2 and reduces the binding of p53 and E2F-1 to MDM2 resulting in stabilization/activation of p53 in A549 cells and degradation of E2F-1 in A549 and HeLa cells. We propose that Acr induces ribosomal stress which leads to activation of MDM2 and RPL11-MDM2 binding, consequently, activates p53 and enhances E2F-1 degradation, and that taken together these two processes induce apoptosis and cell death.

  8. Ribosomal proteins as biomarkers for bacterial identification by mass spectrometry in the clinical microbiology laboratory.

    Science.gov (United States)

    Suarez, Stéphanie; Ferroni, Agnès; Lotz, Aurélie; Jolley, Keith A; Guérin, Philippe; Leto, Julie; Dauphin, Brunhilde; Jamet, Anne; Maiden, Martin C J; Nassif, Xavier; Armengaud, Jean

    2013-09-01

    Whole-cell matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS) is a rapid method for identification of microorganisms that is increasingly used in microbiology laboratories. This identification is based on the comparison of the tested isolate mass spectrum with reference databases. Using Neisseria meningitidis as a model organism, we showed that in one of the available databases, the Andromas database, 10 of the 13 species-specific biomarkers correspond to ribosomal proteins. Remarkably, one biomarker, ribosomal protein L32, was subject to inter-strain variability. The analysis of the ribosomal protein patterns of 100 isolates for which whole genome sequences were available, confirmed the presence of inter-strain variability in the molecular weight of 29 ribosomal proteins, thus establishing a correlation between the sequence type (ST) and/or clonal complex (CC) of each strain and its ribosomal protein pattern. Since the molecular weight of three of the variable ribosomal proteins (L30, L31 and L32) was included in the spectral window observed by MALDI-TOF MS in clinical microbiology, i.e., 3640-12000 m/z, we were able by analyzing the molecular weight of these three ribosomal proteins to classify each strain in one of six subgroups, each of these subgroups corresponding to specific STs and/or CCs. Their detection by MALDI-TOF allows therefore a quick typing of N. meningitidis isolates. © 2013 Elsevier B.V. All rights reserved.

  9. Proteome distribution between nucleoplasm and nucleolus and its relation to ribosome biogenesis in Arabidopsis thaliana.

    Science.gov (United States)

    Palm, Denise; Simm, Stefan; Darm, Katrin; Weis, Benjamin L; Ruprecht, Maike; Schleiff, Enrico; Scharf, Christian

    2016-01-01

    Ribosome biogenesis is an essential process initiated in the nucleolus. In eukaryotes, multiple ribosome biogenesis factors (RBFs) can be found in the nucleolus, the nucleus and in the cytoplasm. They act in processing, folding and modification of the pre-ribosomal (r)RNAs, incorporation of ribosomal proteins (RPs), export of pre-ribosomal particles to the cytoplasm, and quality control mechanisms. Ribosome biogenesis is best established for Saccharomyces cerevisiae. Plant ortholog assignment to yeast RBFs revealed the absence of about 30% of the yeast RBFs in plants. In turn, few plant specific proteins have been identified by biochemical experiments to act in plant ribosome biogenesis. Nevertheless, a complete inventory of plant RBFs has not been established yet. We analyzed the proteome of the nucleus and nucleolus of Arabidopsis thaliana and the post-translational modifications of these proteins. We identified 1602 proteins in the nucleolar and 2544 proteins in the nuclear fraction with an overlap of 1429 proteins. For a randomly selected set of proteins identified by the proteomic approach we confirmed the localization inferred from the proteomics data by the localization of GFP fusion proteins. We assigned the identified proteins to various complexes and functions and found about 519 plant proteins that have a potential to act as a RBFs, but which have not been experimentally characterized yet. Last, we compared the distribution of RBFs and RPs in the various fractions with the distribution established for yeast.

  10. Pioglitazone enhances mitochondrial biogenesis and ribosomal protein biosynthesis in skeletal muscle in polycystic ovary syndrome

    DEFF Research Database (Denmark)

    Skov, Vibe; Glintborg, Dorte; Knudsen, Steen

    2008-01-01

    indicate that pioglitazone therapy restores insulin sensitivity, in part, by a coordinated upregulation of genes involved in mitochondrial OXPHOS and ribosomal protein biosynthesis in muscle in PCOS. These transcriptional effects of pioglitazone may contribute to prevent the onset of type 2 diabetes...... by changes in the transcriptional profile of muscle favoring insulin sensitivity. Using Affymetrix microarrays, we examined the effect of pioglitazone (30 mg/day for 16 weeks) on gene expression in skeletal muscle of 10 obese women with PCOS metabolically characterized by a euglycemic-hyperinsulinemic clamp...... Annotator and Pathway Profiler (GenMAPP 2.1) and Gene Set Enrichment Analysis (GSEA 2.0.1) revealed a significant upregulation of genes representing mitochondrial oxidative phosphorylation (OXPHOS), ribosomal proteins, mRNA processing reactome, translation factors, and proteasome degradation in PCOS after...

  11. Increased expression of Golgi phosphoprotein-3 is associated with tumor aggressiveness and poor prognosis of prostate cancer

    Directory of Open Access Journals (Sweden)

    Hua Xing

    2012-09-01

    Full Text Available Abstract Background To investigate the expression of Golgi phosphoprotein-3 (GOLPH3 in prostate cancer and determine its prognostic value. Methods Immunohistochemical staining for GOLPH3 was performed on tissue microarrays of 342 prostate patients. The correlation between GOLPH3 expression with its clinicopathologic factors was also analyzed in order to determine its prognostic significance. Results GOLPH3 expression of normal prostate tissues, benign prostate hyperplasia, high-grade prostatic intraepithelial neoplasia, and hormone-dependent prostate cancer (HDPC did not show any statistically significant difference. In contrast, statistically significant difference was reported in moderate/intense GOLPH3 expression in cases diagnosed with HDPC and castration resistant prostate cancer (CRPC (P P = 0.012, higher Gleason score (P = 0.017, bone metastasis (P = 0.024, higher baseline prostate-specific antigen (PSA (P = 0.038, and higher PSA nadir (P = 0.032. A significantly negative correlation was found between moderate/intense GOLPH3 expression and disease-free survival (DFS (HR = 0.28, P = 0.012 and overall survival (OS (HR = 0.42, P = 0.027. Univariated analysis indicated that moderate/intense GOLPH3 expression created a significantly prognostic impact in patients with CRPC. On the other hand, multivariate analysis indicated that GOLPH3 was a significantly independent prognostic factor of DFS (P = 0.027 in all prostate cancer patients. Conclusions In this study, it was discovered that the overexpression of GOLPH3 is associated with the transition of prostate cancer from hormone sensitive phase to hormone refractory phase. GOLPH3 might be an important prognostic factor of DFS and OS in patients with prostate cancer. In totality, GOLPH3 could be used as a novel candidate in devising a more effective therapeutic strategy to tackle CRPC. Virtual slides The virtual slide(s for this article can be found here

  12. Toxicity of ricin A chain is reduced in mammalian cells by inhibiting its interaction with the ribosome

    Energy Technology Data Exchange (ETDEWEB)

    Jetzt, Amanda E. [Department of Animal Sciences, Rutgers, The State University of New Jersey, New Brunswick, NJ 08901-8520 (United States); Li, Xiao-Ping; Tumer, Nilgun E. [Department of Plant Biology and Pathology, Rutgers, The State University of New Jersey, New Brunswick, NJ 08901-8520 (United States); Cohick, Wendie S., E-mail: cohick@aesop.rutgers.edu [Department of Animal Sciences, Rutgers, The State University of New Jersey, New Brunswick, NJ 08901-8520 (United States)

    2016-11-01

    Ricin is a potent ribotoxin that is considered a bioterror threat due to its ease of isolation and possibility of aerosolization. In yeast, mutation of arginine residues away from the active site results in a ricin toxin A chain (RTA) variant that is unable to bind the ribosome and exhibits reduced cytotoxicity. The goal of the present work was to determine if these residues contribute to ribosome binding and cytotoxicity of RTA in mammalian cells. The RTA mutant R193A/R235A did not interact with mammalian ribosomes, while a G212E variant with a point mutation near its active site bound ribosomes similarly to wild-type (WT) RTA. R193A/R235A retained full catalytic activity on naked RNA but had reduced activity on mammalian ribosomes. To determine the effect of this mutant in intact cells, pre R193A/R235A containing a signal sequence directing it to the endoplasmic reticulum and mature R193A/R235A that directly targeted cytosolic ribosomes were each expressed. Depurination and protein synthesis inhibition were reduced by both pre- and mature R193A/R235A relative to WT. Protein synthesis inhibition was reduced to a greater extent by R193A/R235A than by G212E. Pre R193A/R235A caused a greater reduction in caspase activation and loss of mitochondrial membrane potential than G212E relative to WT RTA. These findings indicate that an RTA variant with reduced ribosome binding is less toxic than a variant with less catalytic activity but normal ribosome binding activity. The toxin-ribosome interaction represents a novel target for the development of therapeutics to prevent or treat ricin intoxication. - Highlights: • Arginines 193 and 235 of RTA are critical for binding to the mammalian ribosome. • R193A/R235A has full catalytic activity on RNA but not on mammalian ribosomes. • R193A/R235A is less toxic than a mutant that targets the active site. • The toxin-ribosome interaction is a therapeutic target for ricin intoxication.

  13. Generation of monoclonal antibodies for the assessment of protein purification by recombinant ribosomal coupling

    DEFF Research Database (Denmark)

    Kristensen, Janni; Sperling-Petersen, Hans Uffe; Mortensen, Kim Kusk

    2005-01-01

    We recently described a conceptually novel method for the purification of recombinant proteins with a propensity to form inclusion bodies in the cytoplasm of Escherichia coli. Recombinant proteins were covalently coupled to the E. coli ribosome by fusing them to ribosomal protein 23 (rpL23...... therefore purified rpL23-GFP-His, rpL23-His and GFP from E. coli recombinants using affinity, ion exchange and hydrophobic interaction chromatography. These proteins could be purified with yields of 150, 150 and 1500 microg per gram cellular wet weight, respectively. However, rpL23-GFP-His could only...... proteolytic cleavage sites. We conclude that the generated antibodies can be used to evaluate ribosomal coupling of recombinant target proteins as well as the efficiency of their separation from the ribosome....

  14. Influence of the dietary protein deficiency on the activities of ribosomes and polysome patterns in muscle and liver of rats

    International Nuclear Information System (INIS)

    Goto, Akihiko; Kametaka, Masao

    1975-01-01

    A group of rats weighing about 120 g were killed at the beginning of the experiment and after 10 days on the 20% casein diet (C-0 and C-10 groups), and another group of rats were killed after 1,2 and 10 days on the protein-free diet (PF-1, PF-2 and PF-10 groups). From muscle and the liver of each group ribosomes were prepared, and the protein synthesis activity and the polysome patterns were investigated. The activity of polysome fractionated into each size was also measured. Muscle ribosome activity in PF-1, PF-2 and PF-10 groups decreased to about 60%, 40% and 40% of that in C groups, respectively, and this decrease was due to a fall in activity of prolysome itself rather than disaggregation of polysome. Liver ribosome activity in PF-1, PF-2 and PF-10 groups were reduced to about 95%, 90% and 65% of that in C groups, respectively. These alterations in PF-1 and PF-2 groups seemed to be in part related to changes in polysome pattern, whereas ribosome activity in PF-10 group was reduced without changes in polysome pattern. (auth.)

  15. Cryo-EM structures of the 80S ribosomes from human parasites Trichomonas vaginalis and Toxoplasma gondii

    Institute of Scientific and Technical Information of China (English)

    Zhifei Li; Qiang Guo; Lvqin Zheng; Yongsheng Ji; Yi-Ting Xie; De-Hua Lai; Zhao-Rong Lun; Xun Suo; Ning Gao

    2017-01-01

    As an indispensable molecular machine universal in all living organisms,the ribosome has been selected by evolution to be the natural target of many antibiotics and small-molecule inhibitors.High-resolution structures of pathogen ribosomes are crucial for understanding the general and unique aspects of translation control in disease-causing microbes.With cryo-electron microscopy technique,we have determined structures of the cytosolic ribosomes from two human parasites,Trichomonas vaginalis and Toxoplasma gondii,at resolution of 3.2-3.4,(A).Although the ribosomal proteins from both pathogens are typical members of eukaryotic families,with a co-evolution pattern between certain species-specific insertions/extensions and neighboring ribosomal RNA (rRNA) expansion segments,the sizes of their rRNAs are sharply different.Very interestingly,rRNAs of T.vaginalis are in size comparable to prokaryotic counterparts,with nearly all the eukaryote-specific rRNA expansion segments missing.These structures facilitate the dissection of evolution path for ribosomal proteins and RNAs,and may aid in design of novel translation inhibitors.

  16. Evidence for alteration of the membrane-bound ribosomes in Micrococcus luteus cells exposed to lead

    Energy Technology Data Exchange (ETDEWEB)

    Barrow, W; Himmel, M; Squire, P G; Tornabene, T G

    1978-01-01

    Micrococcus luteus cells exposed to Pb(NO/sub 3/)/sub 2/ contained cytosol ribosomal particles and disaggregated membranal ribosomal particles as determined by ultracentrifugation and spectral studies. Approximately 60% of the membrane ribosome fraction from lead exposed cells had a sedimentation value of 8.4S. Cytosol ribosome from lead exposed cells as well as membranal and cytosol ribosomes from control cells were comparable by their contents of predominantly the 70S type with the 50S and 100S present in relatively small amounts. The lead content of the 8.4S components was more than 200 times higher than the components with higher sedimentation coefficients from lead exposed cells and approximately 650 times more than that of control cell ribosomes. The cells exposed to lead, however, showed no adverse effects from the lead in respect to their growth rates and cellular yields. These results indicate that lead is interacting only at specific sites of the membrane and is inducing events initiated only in strategic cellular regions. These data further substantiate that subtle changes do occur in lead exposed cells that show no obvious effects. It is assumed that these minor alterations are, in toto, biologically significant. 24 references, 2 figures, 1 table.

  17. Assembly constraints drive co-evolution among ribosomal constituents.

    Science.gov (United States)

    Mallik, Saurav; Akashi, Hiroshi; Kundu, Sudip

    2015-06-23

    Ribosome biogenesis, a central and essential cellular process, occurs through sequential association and mutual co-folding of protein-RNA constituents in a well-defined assembly pathway. Here, we construct a network of co-evolving nucleotide/amino acid residues within the ribosome and demonstrate that assembly constraints are strong predictors of co-evolutionary patterns. Predictors of co-evolution include a wide spectrum of structural reconstitution events, such as cooperativity phenomenon, protein-induced rRNA reconstitutions, molecular packing of different rRNA domains, protein-rRNA recognition, etc. A correlation between folding rate of small globular proteins and their topological features is known. We have introduced an analogous topological characteristic for co-evolutionary network of ribosome, which allows us to differentiate between rRNA regions subjected to rapid reconstitutions from those hindered by kinetic traps. Furthermore, co-evolutionary patterns provide a biological basis for deleterious mutation sites and further allow prediction of potential antibiotic targeting sites. Understanding assembly pathways of multicomponent macromolecules remains a key challenge in biophysics. Our study provides a 'proof of concept' that directly relates co-evolution to biophysical interactions during multicomponent assembly and suggests predictive power to identify candidates for critical functional interactions as well as for assembly-blocking antibiotic target sites. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  18. Sublethal effects of imidacloprid on targeting muscle and ribosomal protein related genes in the honey bee Apis mellifera L.

    Science.gov (United States)

    Wu, Yan-Yan; Luo, Qi-Hua; Hou, Chun-Sheng; Wang, Qiang; Dai, Ping-Li; Gao, Jing; Liu, Yong-Jun; Diao, Qing-Yun

    2017-11-21

    A sublethal concentration of imidacloprid can cause chronic toxicity in bees and can impact the behavior of honey bees. The nectar- and water-collecting, and climbing abilities of bees are crucial to the survival of the bees and the execution of responsibilities in bee colonies. Besides behavioral impact, data on the molecular mechanisms underlying the toxicity of imidacloprid, especially by the way of RNA-seq at the transcriptomic level, are limited. We treated Apis mellifera L. with sublethal concentrations of imidacloprid (0.1, 1 and 10 ppb) and determined the effect on behaviors and the transcriptomic changes. The sublethal concentrations of imidacloprid had a limited impact on the survival and syrup consumption of bees, but caused a significant increase in water consumption. Moreover, the climbing ability was significantly impaired by 10 ppb imidacloprid at 8 d. In the RNA-seq analysis, gene ontology (GO) term enrichment indicated a significant down-regulation of muscle-related genes, which might contribute to the impairment in climbing ability of bees. The enriched GO terms were attributed to the up-regulated ribosomal protein genes. Considering the ribosomal and extra-ribosomal functions of the ribosomal proteins, we hypothesized that imidacloprid also causes cell dysfunction. Our findings further enhance the understanding of imidacloprid sublethal toxicity.

  19. Interaction of pleuromutilin derivatives with the ribosomal peptidyl transferase center

    DEFF Research Database (Denmark)

    Long, K. S.; Hansen, L. K.; Jakobsen, L.

    2006-01-01

    Tiamulin is a pleuromutilin antibiotic that is used in veterinary medicine. The recently published crystal structure of a tiamulin-50S ribosomal subunit complex provides detailed information about how this drug targets the peptidyl transferase center of the ribosome. To promote rational design...... mutant strain is resistant to tiamulin and pleuromutilin, but not valnemulin, implying that valnemulin is better able to withstand an altered rRNA binding surface around the mutilin core. This is likely due to additional interactions made between the valnemulin side chain extension and the rRNA binding...

  20. Production of RNA-protein cross links in γ irradiated E. Coli ribosomes

    International Nuclear Information System (INIS)

    Ekert, Bernard; Giocanti, Nicole

    1976-01-01

    γ irradiation in de-aerated conditions of E. coli MRE 600 ribosomes, labelled with 14 C uracil, leads to a decrease of extractibility of 14 C RNA by lithium chloride 4 M-urea 8 M. On the other hand, the radioactivity of the protein fraction increases with irradiation. These results strongly suggest that RNA-protein cross links are formed in irradiated ribosomes [fr

  1. Effects of Purple-fleshed Sweet Potato (Ipomoera batatas Cultivar Ayamurasaki) Powder Addition on Color and Texture Properties and Sensory Characteristics of Cooked Pork Sausages during Storage

    Science.gov (United States)

    Jin, Sang-Keun; Kim, Yeong-Jung; Park, Jae Hong; Hur, In-Chul; Nam, Sang-Hae; Shin, Daekeun

    2012-01-01

    This study was conducted to evaluate the effects of adding purple-fleshed sweet potato (PFP) powder on the texture properties and sensory characteristics of cooked pork sausage. Sodium nitrite alone and sodium nitrite in combination with PFP were added to five different treatments sausages (CON (control) = 0.01% sodium nitrite, SP25 = 0.005% sodium nitrite and 0.25% purple-fleshed sweet potato powder combination, SP50 = 0.005% sodium nitrite and 0.5% purple-fleshed sweet potato powder combination, PP25 = 0.25% purple-fleshed sweet potato powder, PP50 = 0.5% purple-fleshed sweet potato powder). The sausages were cooked to 74°C, stored at 4°C for 6 wks, and used for chemical analysis, textural properties, and a sensory evaluation on 0, 2, 4 and 6 wks of storage, respectively. Similar CIE a* and b* values were determined in sausages from CON, SP25 and SP50 at the end of storage, and they were higher in CIE a* but lower in CIE b* than that of the PP25 and PP50 sausages. Significant differences were observed for brittleness and hardness when PFP was added to the sausages but were not confirmed after 4 wks of storage. The objective color score was influenced by adding PFP; however, the effect was not dose dependent. In overall acceptability, panelists favored the CON, SP25, SP50, and PP50 sausages but did not prefer PP25 sausages at the end of storage. Therefore, adding PFP to cooked pork sausages improved color and texture properties and sensory characteristics, but further study is needed to determine the proper ratio of sodium nitrite and PFP. PMID:25049698

  2. Ribosomal binding region for the antibiotic tiamulin: stoichiometry, subunit location, and affinity for various analogs.

    Science.gov (United States)

    Högenauer, G; Ruf, C

    1981-01-01

    Equilibrium dialysis experiments with a highly purified preparation of labeled tiamulin, a semisynthetic derivative of the antibiotic pleuromutilin, and Escherichia coli ribosomes allowed the determination of two binding sites for the drug. The binding reaction showed a cooperative effect. Of the two subunits, the 50S particle was able to bind the antibiotic in a 1:1 stoichiometry. Hence, the 50S subunit contributed predominantly to the binding energy which held the antibiotic to the ribosomes. The 30S subunit, showing no strong affinity for the drug, may be needed for the generation of the second binding site in the 70S particle. If depleted of ammonium ions, 70S ribosomes lost their binding capacity for the antibiotic. The attachment sites for tiamulin could be restored by heating the ribosomes to 40 degrees C in the presence of either ammonium ions or the antibiotic. Other pleuromutilin derivatives displaced labeled tiamulin from its ribosomal binding sites. By quantifying this competition, the relative affinity of various pleuromutilin derivatives for E. coli ribosomes was determined. The binding correlated with the minimal inhibitory concentrations of these compounds against E. coli. When compared with the minimal inhibitory concentrations of these compounds against E. coli. When compared with the minimal inhibitory concentrations against E. coli. When compared with the minimal inhibitory concentrations against Staphylococcus aureus, the correlation was less strict, but the same trend prevailed. These results suggest that the antibacterial activities of various pleuromutilin derivatives on a given test organism are mainly determined by the strength of binding to the ribosomes within the bacterial cell. PMID:6751216

  3. Binding of Signal Recognition Particle Gives Ribosome/Nascent Chain Complexes a Competitive Advantage in Endoplasmic Reticulum Membrane Interaction

    Science.gov (United States)

    Neuhof, Andrea; Rolls, Melissa M.; Jungnickel, Berit; Kalies, Kai-Uwe; Rapoport, Tom A.

    1998-01-01

    Most secretory and membrane proteins are sorted by signal sequences to the endoplasmic reticulum (ER) membrane early during their synthesis. Targeting of the ribosome-nascent chain complex (RNC) involves the binding of the signal sequence to the signal recognition particle (SRP), followed by an interaction of ribosome-bound SRP with the SRP receptor. However, ribosomes can also independently bind to the ER translocation channel formed by the Sec61p complex. To explain the specificity of membrane targeting, it has therefore been proposed that nascent polypeptide-associated complex functions as a cytosolic inhibitor of signal sequence- and SRP-independent ribosome binding to the ER membrane. We report here that SRP-independent binding of RNCs to the ER membrane can occur in the presence of all cytosolic factors, including nascent polypeptide-associated complex. Nontranslating ribosomes competitively inhibit SRP-independent membrane binding of RNCs but have no effect when SRP is bound to the RNCs. The protective effect of SRP against ribosome competition depends on a functional signal sequence in the nascent chain and is also observed with reconstituted proteoliposomes containing only the Sec61p complex and the SRP receptor. We conclude that cytosolic factors do not prevent the membrane binding of ribosomes. Instead, specific ribosome targeting to the Sec61p complex is provided by the binding of SRP to RNCs, followed by an interaction with the SRP receptor, which gives RNC–SRP complexes a selective advantage in membrane targeting over nontranslating ribosomes. PMID:9436994

  4. The Circadian Clock Modulates Global Daily Cycles of mRNA Ribosome Loading[OPEN

    Science.gov (United States)

    Missra, Anamika; Ernest, Ben; Jia, Qidong; Ke, Kenneth

    2015-01-01

    Circadian control of gene expression is well characterized at the transcriptional level, but little is known about diel or circadian control of translation. Genome-wide translation state profiling of mRNAs in Arabidopsis thaliana seedlings grown in long day was performed to estimate ribosome loading per mRNA. The experiments revealed extensive translational regulation of key biological processes. Notably, translation of mRNAs for ribosomal proteins and mitochondrial respiration peaked at night. Central clock mRNAs are among those subject to fluctuations in ribosome loading. There was no consistent phase relationship between peak translation states and peak transcript levels. The overlay of distinct transcriptional and translational cycles can be expected to alter the waveform of the protein synthesis rate. Plants that constitutively overexpress the clock gene CCA1 showed phase shifts in peak translation, with a 6-h delay from midnight to dawn or from noon to evening being particularly common. Moreover, cycles of ribosome loading that were detected under continuous light in the wild type collapsed in the CCA1 overexpressor. Finally, at the transcript level, the CCA1-ox strain adopted a global pattern of transcript abundance that was broadly correlated with the light-dark environment. Altogether, these data demonstrate that gene-specific diel cycles of ribosome loading are controlled in part by the circadian clock. PMID:26392078

  5. Photoaffinity labeling of the pactamycin binding site on eubacterial ribosomes

    International Nuclear Information System (INIS)

    Tejedor, F.; Amils, R.; Ballesta, J.P.

    1985-01-01

    Pactamycin, an inhibitor of the initial steps of protein synthesis, has an acetophenone group in its chemical structure that makes the drug a potentially photoreactive molecule. In addition, the presence of a phenolic residue makes it easily susceptible to radioactive labeling. Through iodination, one radioactive derivative of pactamycin has been obtained with biological activities similar to the unmodified drug when tested on in vivo and cell-free systems. With the use of [ 125 I]iodopactamycin, ribosomes of Escherichia coli have been photolabeled under conditions that preserve the activity of the particles and guarantee the specificity of the binding sites. Under these conditions, RNA is preferentially labeled when free, small ribosomal subunits are photolabeled, but proteins are the main target in the whole ribosome. This indicates that an important conformational change takes place in the binding site on association of the two subunits. The major labeled proteins are S2, S4, S18, S21, and L13. These proteins in the pactamycin binding site are probably related to the initiation step of protein synthesis

  6. Synthesis and methylation of ribosomal RNA in HeLa cells infected with the herpes virus pseudorabies virus

    International Nuclear Information System (INIS)

    Furlong, J.C.; Kyriakidis, S.; Stevely, W.S.

    1982-01-01

    The effects of infection with the herpes virus pseudorabies virus on the metabolism of HeLa cell ribosomal RNA were examined. There is a decline both in the synthesis of nucleolar 45S ribosomal precursor RNA and in its processing to mature cytoplasmic RNA. The methylated oligonucleotides in the ribosomal RNA species were studied. The methylation of cytoplasmic ribosomal RNA was essentially unchanged. However there was some undermethylation of the nucleolar precursor. If undermethylated RNA does not mature then this may partly explain the reduced processing in the infected cells. (Author)

  7. Insertion of the Biogenesis Factor Rei1 Probes the Ribosomal Tunnel during 60S Maturation.

    Science.gov (United States)

    Greber, Basil Johannes; Gerhardy, Stefan; Leitner, Alexander; Leibundgut, Marc; Salem, Michèle; Boehringer, Daniel; Leulliot, Nicolas; Aebersold, Ruedi; Panse, Vikram Govind; Ban, Nenad

    2016-01-14

    Eukaryotic ribosome biogenesis depends on several hundred assembly factors to produce functional 40S and 60S ribosomal subunits. The final phase of 60S subunit biogenesis is cytoplasmic maturation, which includes the proofreading of functional centers of the 60S subunit and the release of several ribosome biogenesis factors. We report the cryo-electron microscopy (cryo-EM) structure of the yeast 60S subunit in complex with the biogenesis factors Rei1, Arx1, and Alb1 at 3.4 Å resolution. In addition to the network of interactions formed by Alb1, the structure reveals a mechanism for ensuring the integrity of the ribosomal polypeptide exit tunnel. Arx1 probes the entire set of inner-ring proteins surrounding the tunnel exit, and the C terminus of Rei1 is deeply inserted into the ribosomal tunnel, where it forms specific contacts along almost its entire length. We provide genetic and biochemical evidence that failure to insert the C terminus of Rei1 precludes subsequent steps of 60S maturation. Copyright © 2016 Elsevier Inc. All rights reserved.

  8. Ribosomal and hematopoietic defects in induced pluripotent stem cells derived from Diamond Blackfan anemia patients.

    Science.gov (United States)

    Garçon, Loïc; Ge, Jingping; Manjunath, Shwetha H; Mills, Jason A; Apicella, Marisa; Parikh, Shefali; Sullivan, Lisa M; Podsakoff, Gregory M; Gadue, Paul; French, Deborah L; Mason, Philip J; Bessler, Monica; Weiss, Mitchell J

    2013-08-08

    Diamond Blackfan anemia (DBA) is a congenital disorder with erythroid (Ery) hypoplasia and tissue morphogenic abnormalities. Most DBA cases are caused by heterozygous null mutations in genes encoding ribosomal proteins. Understanding how haploinsufficiency of these ubiquitous proteins causes DBA is hampered by limited availability of tissues from affected patients. We generated induced pluripotent stem cells (iPSCs) from fibroblasts of DBA patients carrying mutations in RPS19 and RPL5. Compared with controls, DBA fibroblasts formed iPSCs inefficiently, although we obtained 1 stable clone from each fibroblast line. RPS19-mutated iPSCs exhibited defects in 40S (small) ribosomal subunit assembly and production of 18S ribosomal RNA (rRNA). Upon induced differentiation, the mutant clone exhibited globally impaired hematopoiesis, with the Ery lineage affected most profoundly. RPL5-mutated iPSCs exhibited defective 60S (large) ribosomal subunit assembly, accumulation of 12S pre-rRNA, and impaired erythropoiesis. In both mutant iPSC lines, genetic correction of ribosomal protein deficiency via complementary DNA transfer into the "safe harbor" AAVS1 locus alleviated abnormalities in ribosome biogenesis and hematopoiesis. Our studies show that pathological features of DBA are recapitulated by iPSCs, provide a renewable source of cells to model various tissue defects, and demonstrate proof of principle for genetic correction strategies in patient stem cells.

  9. Comparison of phosphorylation of ribosomal proteins from HeLa and Krebs II ascites-tumour cells by cyclic AMP-dependent and cyclic GMP-dependent protein kinases

    DEFF Research Database (Denmark)

    Issinger, O G; Beier, H; Speichermann, N

    1980-01-01

    Phosphorylation of eukaryotic ribosomal proteins in vitro by essentially homogeneous preparations of cyclic AMP-dependent protein kinase catalytic subunit and cyclic GMP-dependent protein kinase was compared. Each protein kinase was added at a concentration of 30nM. Ribosomal proteins were...... by the cyclic AMP-dependent enzyme. Between 0.1 and 0.2 mol of phosphate was incorporated/mol of these phosphorylated proteins. With the exception of protein S7, the same proteins were also major substrates for the cyclic GMP-dependent protein kinase. Time courses of the phosphorylation of individual proteins...... from the small and large ribosomal subunits in the presence of either protein kinase suggested four types of phosphorylation reactions: (1) proteins S2, S10 and L5 were preferably phosphorylated by the cyclic GMP-dependent protein kinase; (2) proteins S3 and L6 were phosphorylated at very similar rates...

  10. The ribosome structure controls and directs mRNA entry, translocation and exit dynamics

    International Nuclear Information System (INIS)

    Kurkcuoglu, Ozge; Doruker, Pemra; Jernigan, Robert L; Sen, Taner Z; Kloczkowski, Andrzej

    2008-01-01

    The protein-synthesizing ribosome undergoes large motions to effect the translocation of tRNAs and mRNA; here, the domain motions of this system are explored with a coarse-grained elastic network model using normal mode analysis. Crystal structures are used to construct various model systems of the 70S complex with/without tRNA, elongation factor Tu and the ribosomal proteins. Computed motions reveal the well-known ratchet-like rotational motion of the large subunits, as well as the head rotation of the small subunit and the high flexibility of the L1 and L7/L12 stalks, even in the absence of ribosomal proteins. This result indicates that these experimentally observed motions during translocation are inherently controlled by the ribosomal shape and only partially dependent upon GTP hydrolysis. Normal mode analysis further reveals the mobility of A- and P-tRNAs to increase in the absence of the E-tRNA. In addition, the dynamics of the E-tRNA is affected by the absence of the ribosomal protein L1. The mRNA in the entrance tunnel interacts directly with helicase proteins S3 and S4, which constrain the mRNA in a clamp-like fashion, as well as with protein S5, which likely orients the mRNA to ensure correct translation. The ribosomal proteins S7, S11 and S18 may also be involved in assuring translation fidelity by constraining the mRNA at the exit site of the channel. The mRNA also interacts with the 16S 3' end forming the Shine–Dalgarno complex at the initiation step; the 3' end may act as a 'hook' to reel in the mRNA to facilitate its exit

  11. The architecture of mammalian ribosomal protein promoters

    Directory of Open Access Journals (Sweden)

    Perry Robert P

    2005-02-01

    Full Text Available Abstract Background Mammalian ribosomes contain 79 different proteins encoded by widely scattered single copy genes. Coordinate expression of these genes at transcriptional and post-transcriptional levels is required to ensure a roughly equimolar accumulation of ribosomal proteins. To date, detailed studies of only a very few ribosomal protein (rp promoters have been made. To elucidate the general features of rp promoter architecture, I made a detailed sequence comparison of the promoter regions of the entire set of orthologous human and mouse rp genes. Results A striking evolutionarily conserved feature of most rp genes is the separation by an intron of the sequences involved in transcriptional and translational regulation from the sequences with protein encoding function. Another conserved feature is the polypyrimidine initiator, which conforms to the consensus (Y2C+1TY(T2(Y3. At least 60 % of the rp promoters contain a largely conserved TATA box or A/T-rich motif, which should theoretically have TBP-binding capability. A remarkably high proportion of the promoters contain conserved binding sites for transcription factors that were previously implicated in rp gene expression, namely upstream GABP and Sp1 sites and downstream YY1 sites. Over 80 % of human and mouse rp genes contain a transposable element residue within 900 bp of 5' flanking sequence; very little sequence identity between human and mouse orthologues was evident more than 200 bp upstream of the transcriptional start point. Conclusions This analysis has provided some valuable insights into the general architecture of mammalian rp promoters and has identified parameters that might coordinately regulate the transcriptional activity of certain subsets of rp genes.

  12. A new version of the RDP (Ribosomal Database Project)

    Science.gov (United States)

    Maidak, B. L.; Cole, J. R.; Parker, C. T. Jr; Garrity, G. M.; Larsen, N.; Li, B.; Lilburn, T. G.; McCaughey, M. J.; Olsen, G. J.; Overbeek, R.; hide

    1999-01-01

    The Ribosomal Database Project (RDP-II), previously described by Maidak et al. [ Nucleic Acids Res. (1997), 25, 109-111], is now hosted by the Center for Microbial Ecology at Michigan State University. RDP-II is a curated database that offers ribosomal RNA (rRNA) nucleotide sequence data in aligned and unaligned forms, analysis services, and associated computer programs. During the past two years, data alignments have been updated and now include >9700 small subunit rRNA sequences. The recent development of an ObjectStore database will provide more rapid updating of data, better data accuracy and increased user access. RDP-II includes phylogenetically ordered alignments of rRNA sequences, derived phylogenetic trees, rRNA secondary structure diagrams, and various software programs for handling, analyzing and displaying alignments and trees. The data are available via anonymous ftp (ftp.cme.msu. edu) and WWW (http://www.cme.msu.edu/RDP). The WWW server provides ribosomal probe checking, approximate phylogenetic placement of user-submitted sequences, screening for possible chimeric rRNA sequences, automated alignment, and a suggested placement of an unknown sequence on an existing phylogenetic tree. Additional utilities also exist at RDP-II, including distance matrix, T-RFLP, and a Java-based viewer of the phylogenetic trees that can be used to create subtrees.

  13. Combined Effect of the Cfr Methyltransferase and Ribosomal Protein L3 Mutations on Resistance to Ribosome-Targeting Antibiotics.

    Science.gov (United States)

    Pakula, Kevin K; Hansen, Lykke H; Vester, Birte

    2017-09-01

    Several groups of antibiotics inhibit bacterial growth by binding to bacterial ribosomes. Mutations in ribosomal protein L3 have been associated with resistance to linezolid and tiamulin, which both bind at the peptidyl transferase center in the ribosome. Resistance to these and other antibiotics also occurs through methylation of 23S rRNA at position A2503 by the methyltransferase Cfr. The mutations in L3 and the cfr gene have been found together in clinical isolates, raising the question of whether they have a combined effect on antibiotic resistance or growth. We transformed a plasmid-borne cfr gene into a uL3-depleted Escherichia coli strain containing either wild-type L3 or L3 with one of seven mutations, G147R, Q148F, N149S, N149D, N149R, Q150L, or T151P, expressed from plasmid-carried rplC genes. The L3 mutations are well tolerated, with small to moderate growth rate decreases. The presence of Cfr has a very minor influence on the growth rate. The resistance of the transformants to linezolid, tiamulin, florfenicol, and Synercid (a combination of quinupristin and dalfopristin [Q-D]) was measured by MIC assays. The resistance from Cfr was, in all cases, stronger than the effects of the L3 mutations, but various effects were obtained with the combinations of Cfr and L3 mutations ranging from a synergistic to an antagonistic effect. Linezolid and tiamulin susceptibility varied greatly among the L3 mutations, while no significant effects on florfenicol and Q-D susceptibility were seen. This study underscores the complex interplay between various resistance mechanisms and cross-resistance, even from antibiotics with overlapping binding sites. Copyright © 2017 American Society for Microbiology.

  14. Ribosome-induced changes in elongation factor Tu conformation control GTP hydrolysis

    DEFF Research Database (Denmark)

    Villa, Elizabeth; Sengupta, Jayati; Trabuco, Leonard G.

    2009-01-01

    In translation, elongation factor Tu (EF-Tu) molecules deliver aminoacyl-tRNAs to the mRNA-programmed ribosome. The GTPase activity of EF-Tu is triggered by ribosome-induced conformational changes of the factor that play a pivotal role in the selection of the cognate aminoacyl-tRNAs. We present a 6.......7-A cryo-electron microscopy map of the aminoacyl-tRNA x EF-Tu x GDP x kirromycin-bound Escherichia coli ribosome, together with an atomic model of the complex obtained through molecular dynamics flexible fitting. The model reveals the conformational changes in the conserved GTPase switch regions...... of EF-Tu that trigger hydrolysis of GTP, along with key interactions, including those between the sarcin-ricin loop and the P loop of EF-Tu, and between the effector loop of EF-Tu and a conserved region of the 16S rRNA. Our data suggest that GTP hydrolysis on EF-Tu is controlled through a hydrophobic...

  15. Nuclear Export of Pre-Ribosomal Subunits Requires Dbp5, but Not as an RNA-Helicase as for mRNA Export.

    Science.gov (United States)

    Neumann, Bettina; Wu, Haijia; Hackmann, Alexandra; Krebber, Heike

    2016-01-01

    The DEAD-box RNA-helicase Dbp5/Rat8 is known for its function in nuclear mRNA export, where it displaces the export receptor Mex67 from the mRNA at the cytoplasmic side of the nuclear pore complex (NPC). Here we show that Dbp5 is also required for the nuclear export of both pre-ribosomal subunits. Yeast temperature-sensitive dbp5 mutants accumulate both ribosomal particles in their nuclei. Furthermore, Dbp5 genetically and physically interacts with known ribosomal transport factors such as Nmd3. Similar to mRNA export we show that also for ribosomal transport Dbp5 is required at the cytoplasmic side of the NPC. However, unlike its role in mRNA export, Dbp5 does not seem to undergo its ATPase cycle for this function, as ATPase-deficient dbp5 mutants that selectively inhibit mRNA export do not affect ribosomal transport. Furthermore, mutants of GLE1, the ATPase stimulating factor of Dbp5, show no major ribosomal export defects. Consequently, while Dbp5 uses its ATPase cycle to displace the export receptor Mex67 from the translocated mRNAs, Mex67 remains bound to ribosomal subunits upon transit to the cytoplasm, where it is detectable on translating ribosomes. Therefore, we propose a model, in which Dbp5 supports ribosomal transport by capturing ribosomal subunits upon their cytoplasmic appearance at the NPC, possibly by binding export factors such as Mex67. Thus, our findings reveal that although different ribonucleoparticles, mRNAs and pre-ribosomal subunits, use shared export factors, they utilize different transport mechanisms.

  16. Pactamycin binding site on archaebacterial and eukaryotic ribosomes

    International Nuclear Information System (INIS)

    Tejedor, F.; Amils, R.; Ballesta, J.P.G.

    1987-01-01

    The presence of a photoreactive acetophenone group in the protein synthesis inhibitor pactamycin and the possibility of obtaining active iodinated derivatives that retain full biological activity allow the antibiotic binding site on Saccharomyces cerevisiae and archaebacterium Sulfolobus solfataricus ribosomes to be photoaffinity labeled. Four major labeled proteins have been identified in the yeast ribosomes, i.e., YS10, YS18, YS21/24, and YS30, while proteins AL1a, AS10/L8, AS18/20, and AS21/22 appeared as radioactive spots in S. solfataricus. There seems to be a correlation between some of the proteins labeled in yeast and those previously reported in Escherichia coli indicating that the pactamycin binding sites of both species, which are in the small subunit close to the initiation factors and mRNA binding sites, must have similar characteristics

  17. Ribosome-catalyzed formation of an abnormal peptide analogue

    International Nuclear Information System (INIS)

    Roesser, J.R.; Chorghade, M.S.; Hecht, S.M.

    1986-01-01

    The peptidyl-tRNA analogue N-(chloracetyl) phenylalanyl-tRNA/sup Phe/ was prepared by chemical aminoacylation and prebound to the P site of Escherichia coli ribosomes in response to poly(uridylic acid). Admixture of phenylalanyl-tRNA/sup Phe/ to the A site resulted in the formation of two dipeptides, one of which was found by displacement of chloride ion from the peptidyl-tRNA. This constitutes the first example of ribosome-mediated formation of a peptide of altered connectivity and suggests a need for revision of the current model of peptide bond formation. Also suggested by the present finding is the feasibility of utilizing tRNAs to prepare polypeptides of altered connectivity in an in vitro protein biosynthesizing system. [ 32 P]-oligo(rA), [ 3 H]- and [ 14 C] phenylalanines were used in the assay of the peptidye-tRNA analogue

  18. Mutational analysis of S12 protein and implications for the accuracy of decoding by the ribosome.

    Science.gov (United States)

    Sharma, Divya; Cukras, Anthony R; Rogers, Elizabeth J; Southworth, Daniel R; Green, Rachel

    2007-12-07

    The fidelity of aminoacyl-tRNA selection by the ribosome depends on a conformational switch in the decoding center of the small ribosomal subunit induced by cognate but not by near-cognate aminoacyl-tRNA. The aminoglycosides paromomycin and streptomycin bind to the decoding center and induce related structural rearrangements that explain their observed effects on miscoding. Structural and biochemical studies have identified ribosomal protein S12 (as well as specific nucleotides in 16S ribosomal RNA) as a critical molecular contributor in distinguishing between cognate and near-cognate tRNA species as well as in promoting more global rearrangements in the small subunit, referred to as "closure." Here we use a mutational approach to define contributions made by two highly conserved loops in S12 to the process of tRNA selection. Most S12 variant ribosomes tested display increased levels of fidelity (a "restrictive" phenotype). Interestingly, several variants, K42A and R53A, were substantially resistant to the miscoding effects of paromomycin. Further characterization of the compromised paromomycin response identified a probable second, fidelity-modulating binding site for paromomycin in the 16S ribosomal RNA that facilitates closure of the small subunit and compensates for defects associated with the S12 mutations.

  19. Dwell-Time Distribution, Long Pausing and Arrest of Single-Ribosome Translation through the mRNA Duplex.

    Science.gov (United States)

    Xie, Ping

    2015-10-09

    Proteins in the cell are synthesized by a ribosome translating the genetic information encoded on the single-stranded messenger RNA (mRNA). It has been shown that the ribosome can also translate through the duplex region of the mRNA by unwinding the duplex. Here, based on our proposed model of the ribosome translation through the mRNA duplex we study theoretically the distribution of dwell times of the ribosome translation through the mRNA duplex under the effect of a pulling force externally applied to the ends of the mRNA to unzip the duplex. We provide quantitative explanations of the available single molecule experimental data on the distribution of dwell times with both short and long durations, on rescuing of the long paused ribosomes by raising the pulling force to unzip the duplex, on translational arrests induced by the mRNA duplex and Shine-Dalgarno(SD)-like sequence in the mRNA. The functional consequences of the pauses or arrests caused by the mRNA duplex and the SD sequence are discussed and compared with those obtained from other types of pausing, such as those induced by "hungry" codons or interactions of specific sequences in the nascent chain with the ribosomal exit tunnel.

  20. The potential role of ribosomal protein S5 on cell cycle arrest and initiation of murine erythroleukemia cell differentiation.

    Science.gov (United States)

    Matragkou, Christina N; Papachristou, Eleni T; Tezias, Sotirios S; Tsiftsoglou, Asterios S; Choli-Papadopoulou, Theodora; Vizirianakis, Ioannis S

    2008-07-01

    Evidence now exists to indicate that some ribosomal proteins besides being structural components of the ribosomal subunits are involved in the regulation of cell differentiation and apoptosis. As we have shown earlier, initiation of erythroid differentiation of murine erythroleukemia (MEL) cells is associated with transcriptional inactivation of genes encoding ribosomal RNAs and ribosomal proteins S5 (RPS5) and L35a. In this study, we extended these observations and investigated whether transfection of MEL cells with RPS5 cDNA affects the onset of initiation of erythroid maturation and their entrance in cell cycle arrest. Stably transfected MEL cloned cells (MEL-C14 and MEL-C56) were established and assessed for their capacity to produce RPS5 RNA transcript and its translated product. The impact of RPS5 cDNA transfection on the RPS5 gene expression patterns and the accumulation of RPS5 protein in inducible transfected MEL cells were correlated with their ability to: (a) initiate differentiation, (b) enter cell cycle arrest at G(1)/G(0) phase, and (c) modulate the level of cyclin-dependent kinases CDK2, CDK4, and CDK6. The data presented indicate that deregulation of RPS5 gene expression (constitutive expression) affects RPS5 protein level and delays both the onset of initiation of erythroid maturation and entrance in cell cycle arrest in inducer-treated MEL cells. 2008 Wiley-Liss, Inc.

  1. The Potential of Targeting Ribosome Biogenesis in High-Grade Serous Ovarian Cancer

    Directory of Open Access Journals (Sweden)

    Shunfei Yan

    2017-01-01

    Full Text Available Overall survival for patients with ovarian cancer (OC has shown little improvement for decades meaning new therapeutic options are critical. OC comprises multiple histological subtypes, of which the most common and aggressive subtype is high-grade serous ovarian cancer (HGSOC. HGSOC is characterized by genomic structural variations with relatively few recurrent somatic mutations or dominantly acting oncogenes that can be targeted for the development of novel therapies. However, deregulation of pathways controlling homologous recombination (HR and ribosome biogenesis has been observed in a high proportion of HGSOC, raising the possibility that targeting these basic cellular processes may provide improved patient outcomes. The poly (ADP-ribose polymerase (PARP inhibitor olaparib has been approved to treat women with defects in HR due to germline BRCA mutations. Recent evidence demonstrated the efficacy of targeting ribosome biogenesis with the specific inhibitor of ribosomal RNA synthesis, CX-5461 in v-myc avian myelocytomatosis viral oncogene homolog (MYC-driven haematological and prostate cancers. CX-5461 has now progressed to a phase I clinical trial in patients with haematological malignancies and phase I/II trial in breast cancer. Here we review the currently available targeted therapies for HGSOC and discuss the potential of targeting ribosome biogenesis as a novel therapeutic approach against HGSOC.

  2. Cross-site comparison of ribosomal depletion kits for Illumina RNAseq library construction.

    Science.gov (United States)

    Herbert, Zachary T; Kershner, Jamie P; Butty, Vincent L; Thimmapuram, Jyothi; Choudhari, Sulbha; Alekseyev, Yuriy O; Fan, Jun; Podnar, Jessica W; Wilcox, Edward; Gipson, Jenny; Gillaspy, Allison; Jepsen, Kristen; BonDurant, Sandra Splinter; Morris, Krystalynne; Berkeley, Maura; LeClerc, Ashley; Simpson, Stephen D; Sommerville, Gary; Grimmett, Leslie; Adams, Marie; Levine, Stuart S

    2018-03-15

    Ribosomal RNA (rRNA) comprises at least 90% of total RNA extracted from mammalian tissue or cell line samples. Informative transcriptional profiling using massively parallel sequencing technologies requires either enrichment of mature poly-adenylated transcripts or targeted depletion of the rRNA fraction. The latter method is of particular interest because it is compatible with degraded samples such as those extracted from FFPE and also captures transcripts that are not poly-adenylated such as some non-coding RNAs. Here we provide a cross-site study that evaluates the performance of ribosomal RNA removal kits from Illumina, Takara/Clontech, Kapa Biosystems, Lexogen, New England Biolabs and Qiagen on intact and degraded RNA samples. We find that all of the kits are capable of performing significant ribosomal depletion, though there are differences in their ease of use. All kits were able to remove ribosomal RNA to below 20% with intact RNA and identify ~ 14,000 protein coding genes from the Universal Human Reference RNA sample at >1FPKM. Analysis of differentially detected genes between kits suggests that transcript length may be a key factor in library production efficiency. These results provide a roadmap for labs on the strengths of each of these methods and how best to utilize them.

  3. The complete structure of the chloroplast 70S ribosome in complex with translation factor pY.

    Science.gov (United States)

    Bieri, Philipp; Leibundgut, Marc; Saurer, Martin; Boehringer, Daniel; Ban, Nenad

    2017-02-15

    Chloroplasts are cellular organelles of plants and algae that are responsible for energy conversion and carbon fixation by the photosynthetic reaction. As a consequence of their endosymbiotic origin, they still contain their own genome and the machinery for protein biosynthesis. Here, we present the atomic structure of the chloroplast 70S ribosome prepared from spinach leaves and resolved by cryo-EM at 3.4 Å resolution. The complete structure reveals the features of the 4.5S rRNA, which probably evolved by the fragmentation of the 23S rRNA, and all five plastid-specific ribosomal proteins. These proteins, required for proper assembly and function of the chloroplast translation machinery, bind and stabilize rRNA including regions that only exist in the chloroplast ribosome. Furthermore, the structure reveals plastid-specific extensions of ribosomal proteins that extensively remodel the mRNA entry and exit site on the small subunit as well as the polypeptide tunnel exit and the putative binding site of the signal recognition particle on the large subunit. The translation factor pY, involved in light- and temperature-dependent control of protein synthesis, is bound to the mRNA channel of the small subunit and interacts with 16S rRNA nucleotides at the A-site and P-site, where it protects the decoding centre and inhibits translation by preventing tRNA binding. The small subunit is locked by pY in a non-rotated state, in which the intersubunit bridges to the large subunit are stabilized. © 2016 The Authors. Published under the terms of the CC BY NC ND 4.0 license.

  4. Age-related differences in foot mobility in individuals with patellofemoral pain.

    Science.gov (United States)

    Tan, Jade M; Crossley, Kay M; Vicenzino, Bill; Menz, Hylton B; Munteanu, Shannon E; Collins, Natalie J

    2018-01-01

    Age-related changes in midfoot mobility have the potential to influence success with foot orthoses intervention in people with patellofemoral pain (PFP). The aim of this study was to determine whether older people with PFP demonstrate less foot mobility than younger adults with PFP. One hundred ninety four participants (113 (58%) women, age 32 ± 7 years, BMI 25 ± 4.9 kg/m 2 ) with PFP (≥ 6 weeks duration) were included, with foot mobility quantified using reliable and valid methods. K-means cluster analysis classified participants into three homogenous groups based on age. After cluster formation, univariate analyses of co-variance (covariates: sex, weight) were used to compare midfoot height mobility, midfoot width mobility, and foot mobility magnitude between age groups (significance level 0.05). Cluster analysis revealed three distinct age groups: 18-29 years ( n  = 70); 30-39 years ( n  = 101); and 40-50 years ( n  = 23). There was a significant main effect for age for midfoot height mobility ( p  mobility magnitude ( p  = 0.006). Post-hoc analyses revealed that midfoot height mobility differed across all three groups (moderate to large effect sizes), and that foot mobility magnitude was significantly less in those aged 40-50 years compared to those aged 18-25 years (moderate effect size). There were no significant main effects for age for midfoot width mobility ( p  > 0.05). Individuals with PFP aged 40-50 years have less foot mobility than younger adults with PFP. These findings may have implications for evaluation and treatment of older individuals with PFP.

  5. Insulin receptors mediate growth effects in cultured fetal neurons. II. Activation of a protein kinase that phosphorylates ribosomal protein S6

    International Nuclear Information System (INIS)

    Heidenreich, K.A.; Toledo, S.P.

    1989-01-01

    As an initial attempt to identify early steps in insulin action that may be involved in the growth responses of neurons to insulin, we investigated whether insulin receptor activation increases the phosphorylation of ribosomal protein S6 in cultured fetal neurons and whether activation of a protein kinase is involved in this process. When neurons were incubated for 2 h with 32Pi, the addition of insulin (100 ng/ml) for the final 30 min increased the incorporation of 32Pi into a 32K microsomal protein. The incorporation of 32Pi into the majority of other neuronal proteins was unaltered by the 30-min exposure to insulin. Cytosolic extracts from insulin-treated neurons incubated in the presence of exogenous rat liver 40S ribosomes and [gamma-32P]ATP displayed a 3- to 8-fold increase in the phosphorylation of ribosomal protein S6 compared to extracts from untreated cells. Inclusion of cycloheximide during exposure of the neurons to insulin did not inhibit the increased cytosolic kinase activity. Activation of S6 kinase activity by insulin was dose dependent (seen at insulin concentration as low as 0.1 ng/ml) and reached a maximum after 20 min of incubation. Addition of phosphatidylserine, diolein, and Ca2+ to the in vitro kinase reaction had no effect on the phosphorylation of ribosomal protein S6. Likewise, treatment of neurons with (Bu)2cAMP did not alter the phosphorylation of ribosomal protein S6 by neuronal cytosolic extracts. We conclude that insulin activates a cytosolic protein kinase that phosphorylates ribosomal S6 in neurons and is distinct from protein kinase-C and cAMP-dependent protein kinase. Stimulation of this kinase may play a role in insulin signal transduction in neurons

  6. Probing the structure of ribosome assembly intermediates in vivo using DMS and hydroxyl radical footprinting.

    Science.gov (United States)

    Hulscher, Ryan M; Bohon, Jen; Rappé, Mollie C; Gupta, Sayan; D'Mello, Rhijuta; Sullivan, Michael; Ralston, Corie Y; Chance, Mark R; Woodson, Sarah A

    2016-07-01

    The assembly of the Escherichia coli ribosome has been widely studied and characterized in vitro. Despite this, ribosome biogenesis in living cells is only partly understood because assembly is coupled with transcription, modification and processing of the pre-ribosomal RNA. We present a method for footprinting and isolating pre-rRNA as it is synthesized in E. coli cells. Pre-rRNA synthesis is synchronized by starvation, followed by nutrient upshift. RNA synthesized during outgrowth is metabolically labeled to facilitate isolation of recent transcripts. Combining this technique with two in vivo RNA probing methods, hydroxyl radical and DMS footprinting, allows the structure of nascent RNA to be probed over time. Together, these can be used to determine changes in the structures of ribosome assembly intermediates as they fold in vivo. Copyright © 2016 Elsevier Inc. All rights reserved.

  7. Genome-Scale Analysis of Translation Elongation with a Ribosome Flow Model

    Science.gov (United States)

    Meilijson, Isaac; Kupiec, Martin; Ruppin, Eytan

    2011-01-01

    We describe the first large scale analysis of gene translation that is based on a model that takes into account the physical and dynamical nature of this process. The Ribosomal Flow Model (RFM) predicts fundamental features of the translation process, including translation rates, protein abundance levels, ribosomal densities and the relation between all these variables, better than alternative (‘non-physical’) approaches. In addition, we show that the RFM can be used for accurate inference of various other quantities including genes' initiation rates and translation costs. These quantities could not be inferred by previous predictors. We find that increasing the number of available ribosomes (or equivalently the initiation rate) increases the genomic translation rate and the mean ribosome density only up to a certain point, beyond which both saturate. Strikingly, assuming that the translation system is tuned to work at the pre-saturation point maximizes the predictive power of the model with respect to experimental data. This result suggests that in all organisms that were analyzed (from bacteria to Human), the global initiation rate is optimized to attain the pre-saturation point. The fact that similar results were not observed for heterologous genes indicates that this feature is under selection. Remarkably, the gap between the performance of the RFM and alternative predictors is strikingly large in the case of heterologous genes, testifying to the model's promising biotechnological value in predicting the abundance of heterologous proteins before expressing them in the desired host. PMID:21909250

  8. The measles virus phosphoprotein interacts with the linker domain of STAT1

    International Nuclear Information System (INIS)

    Devaux, Patricia; Priniski, Lauren; Cattaneo, Roberto

    2013-01-01

    The measles virus (MV) phosphoprotein (P) and V proteins block the interferon (IFN) response by impeding phosphorylation of the signal transducer and activator of transcription 1 (STAT1) by the Janus kinase 1 (JAK1). We characterized how STAT1 mutants interact with P and JAK1 phosphorylation. Certain mutants of the linker, the Src-homology 2 domain (SH2), or the transactivation domain had reduced or abolished phosphorylation through JAK1 after IFN treatment. Other mutants, mainly localized in the linker, failed to interact with P as documented by the lack of interference with nuclear translocation. Thus the functional footprint of P on STAT1 localizes mainly to the linker domain; there is also some overlap with the STAT1 phosphorylation functional footprint on the SH2 domain. Based on these observations, we discuss how the MV-P might operate to inhibit the JAK/STAT pathway. - Highlights: • Residue in the linker and SH2 domains of STAT1 are important for MV-P interaction. • Residue in the linker and SH2 domains of STAT1 are important for STAT1 phosphorylation. • Residues interferring with both functions have similar location on STAT1. • The viral P and V proteins may operate in concert to inhibit the JAK/STAT pathway

  9. The measles virus phosphoprotein interacts with the linker domain of STAT1

    Energy Technology Data Exchange (ETDEWEB)

    Devaux, Patricia, E-mail: devaux.patricia@mayo.edu; Priniski, Lauren; Cattaneo, Roberto

    2013-09-15

    The measles virus (MV) phosphoprotein (P) and V proteins block the interferon (IFN) response by impeding phosphorylation of the signal transducer and activator of transcription 1 (STAT1) by the Janus kinase 1 (JAK1). We characterized how STAT1 mutants interact with P and JAK1 phosphorylation. Certain mutants of the linker, the Src-homology 2 domain (SH2), or the transactivation domain had reduced or abolished phosphorylation through JAK1 after IFN treatment. Other mutants, mainly localized in the linker, failed to interact with P as documented by the lack of interference with nuclear translocation. Thus the functional footprint of P on STAT1 localizes mainly to the linker domain; there is also some overlap with the STAT1 phosphorylation functional footprint on the SH2 domain. Based on these observations, we discuss how the MV-P might operate to inhibit the JAK/STAT pathway. - Highlights: • Residue in the linker and SH2 domains of STAT1 are important for MV-P interaction. • Residue in the linker and SH2 domains of STAT1 are important for STAT1 phosphorylation. • Residues interferring with both functions have similar location on STAT1. • The viral P and V proteins may operate in concert to inhibit the JAK/STAT pathway.

  10. Cross-linking of streptomycin to the 16S ribosomal RNA of Escherichia coli

    International Nuclear Information System (INIS)

    Gravel, M.; Melancon, P.; Barkier-Gingras, L.

    1987-01-01

    [ 3 H]Dihydrostreptomycin was cross-linked to the 30S ribosomal subunit from Escherichia coli with the bifunctional reagent nitrogen mustard. The cross-linking primarily involved the 16S RNA. To localize the site of cross-linking of streptomycin to the 16S RNA, the authors hybridized RNA labeled with streptomycin to restriction fragments of the 16S RNA gene. Labeled RNA hybridized to DNA fragments corresponding to bases 892-917 and bases 1394-1415. These two segments of the ribosomal RNA must by juxtaposed in the ribosome, since there is a single binding site for streptomycin. This region has been implicated both in the decoding site and in the binding of initiation factor IF-3, indicating its functional importance

  11. Origins of the plant chloroplasts and mitochondria based on comparisons of 5S ribosomal RNAs

    Science.gov (United States)

    Delihas, N.; Fox, G. E.

    1987-01-01

    In this paper, we provide macromolecular comparisons utilizing the 5S ribosomal RNA structure to suggest extant bacteria that are the likely descendants of chloroplast and mitochondria endosymbionts. The genetic stability and near universality of the 5S ribosomal gene allows for a useful means to study ancient evolutionary changes by macromolecular comparisons. The value in current and future ribosomal RNA comparisons is in fine tuning the assignment of ancestors to the organelles and in establishing extant species likely to be descendants of bacteria involved in presumed multiple endosymbiotic events.

  12. Plastid ribosome pausing is induced by multiple features and is linked to protein complex assembly

    DEFF Research Database (Denmark)

    Gawroński, Piotr; Jensen, Poul Erik; Karpinski, Stanislaw

    2018-01-01

    Many mRNAs contain pause sites that briefly interrupt the progress of translation. Specific features that induce ribosome pausing have been described; however, their individual contributions to pause-site formation, and the overall biological significance of ribosome pausing, remain largely uncle...

  13. The Test-Retest Reliability OfTthe Onset Of Core And Vasti Eectromyographic Activity While Ascending And Descending Stairs In Healthy Controls Aand patellofemoral Pain Patients

    Directory of Open Access Journals (Sweden)

    Mohammad-Ali Sanjari

    2011-02-01

    Full Text Available Backgroundentity.It is hypothesized to result from abnormal patellar tracking caused by altered motorcontrol. Deficit in neuromotor control of the core may be a remote contributing factor to thedevelopment of PFP. Application of reliable EMG measures would be helpful to handle thistheory. Therefore, the purpose of this study was to determine the test-retest reliability of thecore and vasti EMG onsets, while ascending/descending stairs.: Patellofemoral pain (PFP is a common affliction and complex clinicalMethodsand Core EMG onsets during stair stepping were assessed two times a day. Intraclass correlationcoefficients (ICCs and standard errors of measurement (SEMs were calculated.: Ten males with PFP and ten healthy controls participated in this study. VastiResultsonsets of control cases (ICC 3,1 ≥ 0.70 except Quadratus Lumborum (QL which showeda moderate reliability (ICC for ascending=0.59 and for descending = 0.61. In controls,Vasti in both tasks showed the highest absolute reliability. During ascending, highreliability (ICC ≥ 0.70 in PFP group was demonstrated for all EMG onsets except Gluteusmaximus (GMAX and QL which showed a moderate reliability (ICC = 0.69 and 0.63 respectively.In this group while descending stairs, all EMG onsets showed high relativereliability (ICC ≥ 0.70. Moderate to high absolute reliability was obtained for onset timeswhile ascending/descending stairs in PFP group.: During both ascending/descending, high reliability was found for all EMGConclusionreliability.: Most EMG onsets during stair scending/descending had moderate to high

  14. Myb-binding protein 1a (Mybbp1a) regulates levels and processing of pre-ribosomal RNA.

    Science.gov (United States)

    Hochstatter, Julia; Hölzel, Michael; Rohrmoser, Michaela; Schermelleh, Lothar; Leonhardt, Heinrich; Keough, Rebecca; Gonda, Thomas J; Imhof, Axel; Eick, Dirk; Längst, Gernot; Németh, Attila

    2012-07-13

    Ribosomal RNA gene transcription, co-transcriptional processing, and ribosome biogenesis are highly coordinated processes that are tightly regulated during cell growth. In this study we discovered that Mybbp1a is associated with both the RNA polymerase I complex and the ribosome biogenesis machinery. Using a reporter assay that uncouples transcription and RNA processing, we show that Mybbp1a represses rRNA gene transcription. In addition, overexpression of the protein reduces RNA polymerase I loading on endogenous rRNA genes as revealed by chromatin immunoprecipitation experiments. Accordingly, depletion of Mybbp1a results in an accumulation of the rRNA precursor in vivo but surprisingly also causes growth arrest of the cells. This effect can be explained by the observation that the modulation of Mybbp1a protein levels results in defects in pre-rRNA processing within the cell. Therefore, the protein may play a dual role in the rRNA metabolism, potentially linking and coordinating ribosomal DNA transcription and pre-rRNA processing to allow for the efficient synthesis of ribosomes.

  15. Expression of the double-stranded RNA of the soybean pod borer Leguminivora glycinivorella (Lepidoptera: Tortricidae) ribosomal protein P0 gene enhances the resistance of transgenic soybean plants.

    Science.gov (United States)

    Meng, Fanli; Li, Yang; Zang, Zhenyuan; Li, Na; Ran, Ruixue; Cao, Yingxue; Li, Tianyu; Zhou, Quan; Li, Wenbin

    2017-12-01

    The soybean pod borer [SPB; Leguminivora glycinivorella (Matsumura) (Lepidoptera: Tortricidae)] is the most important soybean pest in northeastern Asia. Silencing genes using plant-mediated RNA-interference is a promising strategy for controlling SPB infestations. The ribosomal protein P0 is important for protein translation and DNA repair in the SPB. Thus, transferring P0 double-stranded RNA (dsRNA) into plants may help prevent SPB-induced damage. We investigated the effects of SpbP0 dsRNA injections and SpbP0 dsRNA-expressing transgenic soybean plants on the SPB. Larval mortality rates were greater for SpbP0 dsRNA-injected larvae (96%) than for the control larvae (31%) at 14 days after injections. Transgenic T 2 soybean plants expressing SpbP0 dsRNA sustained less damage from SPB larvae than control plants. In addition, the expression level of the SpbP0 gene decreased and the mortality rate increased when SPB larvae were fed on T 3 transgenic soybean pods. Moreover, the surviving larvae were deformed and exhibited inhibited growth. Silencing SpbP0 expression is lethal to the SPB. Transgenic soybean plants expressing SpbP0 dsRNA are more resistant to the SPB than wild-type plants. Thus, SpbP0 dsRNA-expressing transgenic plants may be useful for controlling insect pests. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

  16. Control of Ribosome Synthesis in Escherichia coli

    DEFF Research Database (Denmark)

    Molin, Søren; Meyenburg, K. von; Måløe, O.

    1977-01-01

    The rate of ribosome synthesis and accumulation in Escherichia coli during the transition after an energy source shift-down was analyzed. The shift was imposed on cultures of stringent and relaxed strains growing in glucose minimal medium by the addition of the glucose analogue {alpha...... and to estimate the transcription time for the rRNA operon under different conditions. In steady states of growth with growth rates ranging from 0.75 to 2.3 doublings/h, as well as during the transition after a shift-down, the transcription time of the rRNA operon was constant. The rate of synthesis of r......RNA correlated during this transition – in contrast to the rate of accumulation (M. T. Hansen et al., J. Bacteriol. 122: 585-591, 1975) – with the ppGpp pool in the same way as has been observed during partial amino acid starvation....

  17. Kinase-Mediated Regulation of 40S Ribosome Assembly in Human Breast Cancer

    Science.gov (United States)

    2017-02-01

    and will assess if this resistance involves gain-of-function mutations in Ltv1, and if resistance can be overcome with drugs that direct...ribosome assembly factor Ltv1 in both yeast and TNBC cells, and that selective knockdown or silencing of CK1δ, or forced expression of Ltv1 mutant that...cannot be phosphorylated by CK1δ, blocks ribosome assembly in yeast and compromises the growth and survival of TNBC cells. Further, we have shown that

  18. The Ribosomal RNA is a Useful Marker to Visualize Rhizobia Interacting with Legume Plants

    Science.gov (United States)

    Rinaudi, Luciana; Isola, Maria C.; Giordano, Walter

    2004-01-01

    Symbiosis between rhizobia and leguminous plants leads to the formation of nitrogen-fixing root nodules. In the present article, we recommend the use of the ribosomal RNA (rRNA) isolated from legume nodules in an experimental class with the purpose of introducing students to the structure of eukaryotic and prokaryotic ribosomes and of…

  19. Molecular interactions within the halophilic, thermophilic, and mesophilic prokaryotic ribosomal complexes: clues to environmental adaptation.

    Science.gov (United States)

    Mallik, Saurav; Kundu, Sudip

    2015-01-01

    Using the available crystal structures of 50S ribosomal subunits from three prokaryotic species: Escherichia coli (mesophilic), Thermus thermophilus (thermophilic), and Haloarcula marismortui (halophilic), we have analyzed different structural features of ribosomal RNAs (rRNAs), proteins, and of their interfaces. We have correlated these structural features with the environmental adaptation strategies of the corresponding species. While dense intra-rRNA packing is observed in thermophilic, loose intra-rRNA packing is observed in halophilic (both compared to mesophilic). Interestingly, protein-rRNA interfaces of both the extremophiles are densely packed compared to that of the mesophilic. The intersubunit bridge regions are almost devoid of cavities, probably ensuring the proper formation of each bridge (by not allowing any loosely packed region nearby). During rRNA binding, the ribosomal proteins experience some structural transitions. Here, we have analyzed the intrinsically disordered and ordered regions of the ribosomal proteins, which are subjected to such transitions. The intrinsically disordered and disorder-to-order transition sites of the thermophilic and mesophilic ribosomal proteins are simultaneously (i) highly conserved and (ii) slowly evolving compared to rest of the protein structure. Although high conservation is observed at such sites of halophilic ribosomal proteins, but slow rate of evolution is absent. Such differences between thermophilic, mesophilic, and halophilic can be explained from their environmental adaptation strategy. Interestingly, a universal biophysical principle evident by a linear relationship between the free energy of interface formation, interface area, and structural changes of r-proteins during assembly is always maintained, irrespective of the environmental conditions.

  20. Defining the bacteroides ribosomal binding site.

    Science.gov (United States)

    Wegmann, Udo; Horn, Nikki; Carding, Simon R

    2013-03-01

    The human gastrointestinal tract, in particular the colon, hosts a vast number of commensal microorganisms. Representatives of the genus Bacteroides are among the most abundant bacterial species in the human colon. Bacteroidetes diverged from the common line of eubacterial descent before other eubacterial groups. As a result, they employ unique transcription initiation signals and, because of this uniqueness, they require specific genetic tools. Although some tools exist, they are not optimal for studying the roles and functions of these bacteria in the human gastrointestinal tract. Focusing on translation initiation signals in Bacteroides, we created a series of expression vectors allowing for different levels of protein expression in this genus, and we describe the use of pepI from Lactobacillus delbrueckii subsp. lactis as a novel reporter gene for Bacteroides. Furthermore, we report the identification of the 3' end of the 16S rRNA of Bacteroides ovatus and analyze in detail its ribosomal binding site, thus defining a core region necessary for efficient translation, which we have incorporated into the design of our expression vectors. Based on the sequence logo information from the 5' untranslated region of other Bacteroidales ribosomal protein genes, we conclude that our findings are relevant to all members of this order.

  1. Klebsazolicin inhibits 70S ribosome by obstructing the peptide exit tunnel

    Energy Technology Data Exchange (ETDEWEB)

    Metelev, Mikhail; Osterman, Ilya A.; Ghilarov, Dmitry; Khabibullina, Nelli F.; Yakimov, Alexander; Shabalin, Konstantin; Utkina, Irina; Travin, Dmitry Y.; Komarova, Ekaterina S.; Serebryakova, Marina; Artamonova, Tatyana; Khodorkovskii, Mikhail; Konevega, Andrey L.; Sergiev, Petr V.; Severinov, Konstantin; Polikanov, Yury S.

    2017-08-28

    Whereas screening of the small-molecule metabolites produced by most cultivatable microorganisms often results in the rediscovery of known compounds, genome-mining programs allow researchers to harness much greater chemical diversity, and result in the discovery of new molecular scaffolds. Here we report the genome-guided identification of a new antibiotic, klebsazolicin (KLB), from Klebsiella pneumoniae that inhibits the growth of sensitive cells by targeting ribosomes. A ribosomally synthesized post-translationally modified peptide (RiPP), KLB is characterized by the presence of a unique N-terminal amidine ring that is essential for its activity. Biochemical in vitro studies indicate that KLB inhibits ribosomes by interfering with translation elongation. Structural analysis of the ribosome–KLB complex showed that the compound binds in the peptide exit tunnel overlapping with the binding sites of macrolides or streptogramin-B. KLB adopts a compact conformation and largely obstructs the tunnel. Engineered KLB fragments were observed to retain in vitro activity, and thus have the potential to serve as a starting point for the development of new bioactive compounds.

  2. Detection of protein-protein interactions by ribosome display and protein in situ immobilisation.

    Science.gov (United States)

    He, Mingyue; Liu, Hong; Turner, Martin; Taussig, Michael J

    2009-12-31

    We describe a method for identification of protein-protein interactions by combining two cell-free protein technologies, namely ribosome display and protein in situ immobilisation. The method requires only PCR fragments as the starting material, the target proteins being made through cell-free protein synthesis, either associated with their encoding mRNA as ribosome complexes or immobilised on a solid surface. The use of ribosome complexes allows identification of interacting protein partners from their attached coding mRNA. To demonstrate the procedures, we have employed the lymphocyte signalling proteins Vav1 and Grb2 and confirmed the interaction between Grb2 and the N-terminal SH3 domain of Vav1. The method has promise for library screening of pairwise protein interactions, down to the analytical level of individual domain or motif mapping.

  3. The SmpB C-terminal tail helps tmRNA to recognize and enter stalled ribosomes

    Directory of Open Access Journals (Sweden)

    Mickey R. Miller

    2014-09-01

    Full Text Available In bacteria, transfer-messenger RNA (tmRNA and SmpB comprise the most common and effective system for rescuing stalled ribosomes. Ribosomes stall on mRNA transcripts lacking stop codons and are rescued as the defective mRNA is swapped for the tmRNA template in a process known as trans-translation. The tmRNA–SmpB complex is recruited to the ribosome independent of a codon–anticodon interaction. Given that the ribosome uses robust discriminatory mechanisms to select against non-cognate tRNAs during canonical decoding, it has been hard to explain how this can happen. Recent structural and biochemical studies show that SmpB licenses tmRNA entry through its interactions with the decoding center and mRNA channel. In particular, the C-terminal tail of SmpB promotes both EFTu activation and accommodation of tmRNA, the former through interactions with 16S rRNA nucleotide G530 and the latter through interactions with the mRNA channel downstream of the A site. Here we present a detailed model of the earliest steps in trans-translation, and in light of these mechanistic considerations, revisit the question of how tmRNA preferentially reacts with stalled, non-translating ribosomes.

  4. Which patellofemoral joint imaging features are associated with patellofemoral pain? Systematic review and meta-analysis.

    Science.gov (United States)

    Drew, B T; Redmond, A C; Smith, T O; Penny, F; Conaghan, P G

    2016-02-01

    To review the association between patellofemoral joint (PFJ) imaging features and patellofemoral pain (PFP). A systematic review of the literature from AMED, CiNAHL, Cochrane Central Register of Controlled Trials (CENTRAL), MEDLINE, PEDro, EMBASE and SPORTDiscus was undertaken from their inception to September 2014. Studies were eligible if they used magnetic resonance imaging (MRI), computed tomography (CT), ultrasound (US) or X-ray (XR) to compare PFJ features between a PFP group and an asymptomatic control group in people patellofemoral contact area. Limited evidence was found to support the association of other imaging features with PFP. A sensitivity analysis showed an increase in the SMD for patella bisect offset at 0° knee flexion (1.91; 95% CI: 1.31, 2.52) and patella tilt at 0° knee flexion (0.99; 95% CI: 0.47, 1.52) under full weight bearing. Certain PFJ imaging features were associated with PFP. Future interventional strategies may be targeted at these features. CRD 42014009503. Copyright © 2015 The Authors. Published by Elsevier Ltd.. All rights reserved.

  5. Initial bridges between two ribosomal subunits are formed within 9.4 milliseconds, as studied by time-resolved cryo-EM.

    Science.gov (United States)

    Shaikh, Tanvir R; Yassin, Aymen S; Lu, Zonghuan; Barnard, David; Meng, Xing; Lu, Toh-Ming; Wagenknecht, Terence; Agrawal, Rajendra K

    2014-07-08

    Association of the two ribosomal subunits during the process of translation initiation is a crucial step of protein synthesis. The two subunits (30S and 50S) of the bacterial 70S ribosome are held together by 12 dynamic bridges involving RNA-RNA, RNA-protein, and protein-protein interactions. The process of bridge formation, such as whether all these bridges are formed simultaneously or in a sequential order, is poorly understood. To understand such processes, we have developed and implemented a class of microfluidic devices that mix two components to completion within 0.4 ms and spray the mixture in the form of microdroplets onto an electron microscopy grid, yielding a minimum reaction time of 9.4 ms before cryofixation. Using these devices, we have obtained cryo-EM data corresponding to reaction times of 9.4 and 43 ms and have determined 3D structures of ribosomal subunit association intermediates. Molecular analyses of the cryo-EM maps reveal that eight intersubunit bridges (bridges B1a, B1b, B2a, B2b, B3, B7a, B7b, and B8) form within 9.4 ms, whereas the remaining four bridges (bridges B2c, B4, B5, and B6) take longer than 43 ms to form, suggesting that bridges are formed in a stepwise fashion. Our approach can be used to characterize sequences of various dynamic functional events on complex macromolecular assemblies such as ribosomes.

  6. Fluctuations between multiple EF-G-induced chimeric tRNA states during translocation on the ribosome

    Science.gov (United States)

    Adio, Sarah; Senyushkina, Tamara; Peske, Frank; Fischer, Niels; Wintermeyer, Wolfgang; Rodnina, Marina V.

    2015-06-01

    The coupled translocation of transfer RNA and messenger RNA through the ribosome entails large-scale structural rearrangements, including step-wise movements of the tRNAs. Recent structural work has visualized intermediates of translocation induced by elongation factor G (EF-G) with tRNAs trapped in chimeric states with respect to 30S and 50S ribosomal subunits. The functional role of the chimeric states is not known. Here we follow the formation of translocation intermediates by single-molecule fluorescence resonance energy transfer. Using EF-G mutants, a non-hydrolysable GTP analogue, and fusidic acid, we interfere with either translocation or EF-G release from the ribosome and identify several rapidly interconverting chimeric tRNA states on the reaction pathway. EF-G engagement prevents backward transitions early in translocation and increases the fraction of ribosomes that rapidly fluctuate between hybrid, chimeric and posttranslocation states. Thus, the engagement of EF-G alters the energetics of translocation towards a flat energy landscape, thereby promoting forward tRNA movement.

  7. Structure of the quaternary complex between SRP, SR, and translocon bound to the translating ribosome.

    Science.gov (United States)

    Jomaa, Ahmad; Fu, Yu-Hsien Hwang; Boehringer, Daniel; Leibundgut, Marc; Shan, Shu-Ou; Ban, Nenad

    2017-05-19

    During co-translational protein targeting, the signal recognition particle (SRP) binds to the translating ribosome displaying the signal sequence to deliver it to the SRP receptor (SR) on the membrane, where the signal peptide is transferred to the translocon. Using electron cryo-microscopy, we have determined the structure of a quaternary complex of the translating Escherichia coli ribosome, the SRP-SR in the 'activated' state and the translocon. Our structure, supported by biochemical experiments, reveals that the SRP RNA adopts a kinked and untwisted conformation to allow repositioning of the 'activated' SRP-SR complex on the ribosome. In addition, we observe the translocon positioned through interactions with the SR in the vicinity of the ribosome exit tunnel where the signal sequence is extending beyond its hydrophobic binding groove of the SRP M domain towards the translocon. Our study provides new insights into the mechanism of signal sequence transfer from the SRP to the translocon.

  8. Isometric strength ratios of the hip musculature in females with patellofemoral pain: a comparison to pain-free controls.

    Science.gov (United States)

    Magalhães, Eduardo; Silva, Ana Paula M C C; Sacramento, Sylvio N; Martin, RobRoy L; Fukuda, Thiago Y

    2013-08-01

    The purpose of the study was to compare hip agonist-antagonist isometric strength ratios between females with patellofemoral pain (PFP) syndrome and pain-free control group. One hundred and twenty females between 15 and 40 years of age (control group: n = 60; PFP group: n = 60) participated in the study. Hip adductor, abductor, medial rotator, lateral rotator, flexor, and extensor isometric strength were measured using a hand-held dynamometer. Comparisons in the hip adductor/abductor and medial/lateral rotator and flexor/extensor strength ratios were made between groups using independent t-tests. Group comparisons also were made between the anteromedial hip complex (adductor, medial rotator, and flexor musculature) and posterolateral hip complex (abductor, lateral rotator, and extensor musculature). On average, the hip adductor/abductor isometric strength ratio in the PFP group was 23% higher when compared with the control group (p = 0.01). The anteromedial/posterolateral complex ratio also was significantly higher in the PFP group (average 8%; p = 0.04). No significant group differences were found for the medial/lateral rotator ratio and flexor/extensor strength ratios. The results of this study demonstrate that females with PFP have altered hip strength ratios when compared with asymptomatic controls. These strength imbalances may explain the tendency of females with PFP to demonstrate kinematic tendencies that increase loading on the patellofemoral joint (i.e., dynamic knee valgus).

  9. Validity of the German Version of the Continuous-Scale Physical Functional Performance 10 Test

    Directory of Open Access Journals (Sweden)

    Irene Härdi

    2017-01-01

    Full Text Available Background. The Continuous-Scale Physical Functional Performance 10 Test (CS-PFP 10 quantitatively assesses physical functional performance in older adults who have a broad range of physical functional ability. This study assessed the validity and reliability of the CS-PFP 10 German version. Methods. Forward-translations and backtranslations as well as cultural adaptions of the test were conducted. Participants were German-speaking Swiss community-dwelling adults aged 64 and older. Concurrent validity was assessed using Pearson correlation coefficients between CS-PFP 10 and gait velocity, Timed Up and Go Test, hand grip strength, SF-36 physical function domain, and Freiburger Physical Activity Questionnaire. Internal consistency was calculated by Cronbach’s alpha. Results. Backtranslation and cultural adaptions were accepted by the CS-PFP 10 developer. CS-PFP 10 total score and subscores (upper body strength, upper body flexibility, lower body strength, balance and coordination, and endurance correlated significantly with all measures of physical function tested. Internal consistency was high (Cronbach’s alpha 0.95–0.98. Conclusion. The CS-PFP 10 German version is valid and reliable for measuring physical functional performance in German-speaking Swiss community-dwelling older adults. Quantifying physical function is essential for clinical practice and research and provides meaningful insight into physical functional performance of older adults. This trial is registered with ClinicalTrials.gov NCT01539200.

  10. Deficiency of vasodilator-stimulated phosphoprotein (VASP increases blood-brain-barrier damage and edema formation after ischemic stroke in mice.

    Directory of Open Access Journals (Sweden)

    Peter Kraft

    2010-12-01

    Full Text Available Stroke-induced brain edema formation is a frequent cause of secondary infarct growth and deterioration of neurological function. The molecular mechanisms underlying edema formation after stroke are largely unknown. Vasodilator-stimulated phosphoprotein (VASP is an important regulator of actin dynamics and stabilizes endothelial barriers through interaction with cell-cell contacts and focal adhesion sites. Hypoxia has been shown to foster vascular leakage by downregulation of VASP in vitro but the significance of VASP for regulating vascular permeability in the hypoxic brain in vivo awaits clarification.Focal cerebral ischemia was induced in Vasp(-/- mice and wild-type (WT littermates by transient middle cerebral artery occlusion (tMCAO. Evan's Blue tracer was applied to visualize the extent of blood-brain-barrier (BBB damage. Brain edema formation and infarct volumes were calculated from 2,3,5-triphenyltetrazolium chloride (TTC-stained brain slices. Both mouse groups were carefully controlled for anatomical and physiological parameters relevant for edema formation and stroke outcome. BBB damage (p0.05 towards worse neurological outcomes.Our study identifies VASP as critical regulator of BBB maintenance during acute ischemic stroke. Therapeutic modulation of VASP or VASP-dependent signalling pathways could become a novel strategy to combat excessive edema formation in ischemic brain damage.

  11. Radioactive Air Emissions Notice of Construction for the Magnesium Hydroxide Precipitation Process at the Plutonium Finishing Plant (PFP)

    International Nuclear Information System (INIS)

    JANSKY, M.T.

    1999-01-01

    The following description and any attachments and references are provided to the Washington State Department of Health (WDOH), Division of Radiation Protection, Air Emissions and Defense Waste (WAC) 246-247, Radiation Protection-Air Emissions. The WAC 246-247-060, ''Applications, registration, and licensing'', states ''This section describes the information requirements for approval to construct, modify, and operate an emission unit. Any NOC requires the submittal of information listed in Appendix A.'' Appendix A (WAC 246-247-1 10) lists the requirements that must be addressed. Additionally, the following description, attachments and references are provided to the US Environmental Protection Agency (EPA) as an NOC, in accordance with Title 40, Code of Federal Regulations (CFR), Part 61, ''National Emission Standards for Hazardous Air Pollutants.'' The information required for submittal to the EPA is specified in 40 CFR 61.07. The potential emissions from this activity are estimated to provide greater than 0.1 millirem per year total effective dose equivalent (TEDE) to the hypothetical offsite maximally exposed individual (MEI), and commencement is needed within a short time. Therefore, this application also is intended to provide notification of the anticipated date of initial startup in accordance with the requirement listed in 40 CFR 61.09(a)(1), and it is requested that approval of this application also will constitute EPA acceptance of this initial startup notification. Written notification of the actual date of initial startup, in accordance with the requirement listed in 40 CFR 61.09(a)(2) will be provided at a later date. This NOC covers the activities associated with the Construction and operation activities involving the magnesium hydroxide precipitation process of plutonium solutions within the Plutonium Finishing Plant (PFP)

  12. Suboptimal T-cell receptor signaling compromises protein translation, ribosome biogenesis, and proliferation of mouse CD8 T cells.

    Science.gov (United States)

    Tan, Thomas C J; Knight, John; Sbarrato, Thomas; Dudek, Kate; Willis, Anne E; Zamoyska, Rose

    2017-07-25

    Global transcriptomic and proteomic analyses of T cells have been rich sources of unbiased data for understanding T-cell activation. Lack of full concordance of these datasets has illustrated that important facets of T-cell activation are controlled at the level of translation. We undertook translatome analysis of CD8 T-cell activation, combining polysome profiling and microarray analysis. We revealed that altering T-cell receptor stimulation influenced recruitment of mRNAs to heavy polysomes and translation of subsets of genes. A major pathway that was compromised, when TCR signaling was suboptimal, was linked to ribosome biogenesis, a rate-limiting factor in both cell growth and proliferation. Defective TCR signaling affected transcription and processing of ribosomal RNA precursors, as well as the translation of specific ribosomal proteins and translation factors. Mechanistically, IL-2 production was compromised in weakly stimulated T cells, affecting the abundance of Myc protein, a known regulator of ribosome biogenesis. Consequently, weakly activated T cells showed impaired production of ribosomes and a failure to maintain proliferative capacity after stimulation. We demonstrate that primary T cells respond to various environmental cues by regulating ribosome biogenesis and mRNA translation at multiple levels to sustain proliferation and differentiation.

  13. (Brassicaceae) based on nuclear ribosomal ITS DNA sequences

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Genetics; Volume 93; Issue 2. Phylogeny and biogeography of Alyssum (Brassicaceae) based on nuclear ribosomal ITS DNA sequences. Yan Li Yan Kong Zhe Zhang Yanqiang Yin Bin Liu Guanghui Lv Xiyong Wang. Research Article Volume 93 Issue 2 August 2014 pp 313-323 ...

  14. Architecture of the E.coli 70S ribosome

    DEFF Research Database (Denmark)

    Burkhardt, N.; Diedrich, G.; Nierhaus, K.H.

    1997-01-01

    The 70S ribosome from E.coli was analysed by neutron scattering focusing on the shape and the internal protein-RNA-distribution of the complex. Measurements on selectively deuterated 70S particles and free 30S and 50S subunits applying conventional contrast variation and proton-spin contrast...

  15. Fanconi anemia protein, FANCG, is a phosphoprotein and is upregulated with FANCA after TNF-alpha treatment.

    Science.gov (United States)

    Futaki, M; Watanabe, S; Kajigaya, S; Liu, J M

    2001-02-23

    Fanconi anemia (FA) is a genetic syndrome characterized by bone marrow failure, birth defects, and a predisposition to malignancy. At this time, six FA genes have been identified, and several gene products have been found to interact in a protein complex. FA cells appear to overexpress the proinflammatory cytokine, tumor necrosis factor-alpha (TNF-alpha). We therefore examined the effects of TNF-alpha on the regulation of FA complementation group proteins, FANCG and FANCA. We found that treatment with TNF-alpha induced FANCG protein expression. FANCA was induced concurrently with FANCG, and the FANCA/FANCG complex was increased in the nucleus following TNF-alpha treatment. Inactivation of inhibitory kappa B kinase-2 modulated the expression of FANCG. We also found that both nuclear and cytoplasmic FANCG fractions were phosphorylated. These results show that FANCG is a phosphoprotein and suggest that the cellular accumulation of FA proteins is subject to regulation by TNF-alpha signaling.

  16. p53- and ERK7-dependent ribosome surveillance response regulates Drosophila insulin-like peptide secretion.

    Directory of Open Access Journals (Sweden)

    Kiran Hasygar

    2014-11-01

    Full Text Available Insulin-like signalling is a conserved mechanism that coordinates animal growth and metabolism with nutrient status. In Drosophila, insulin-producing median neurosecretory cells (IPCs regulate larval growth by secreting insulin-like peptides (dILPs in a diet-dependent manner. Previous studies have shown that nutrition affects dILP secretion through humoral signals derived from the fat body. Here we uncover a novel mechanism that operates cell autonomously in the IPCs to regulate dILP secretion. We observed that impairment of ribosome biogenesis specifically in the IPCs strongly inhibits dILP secretion, which consequently leads to reduced body size and a delay in larval development. This response is dependent on p53, a known surveillance factor for ribosome biogenesis. A downstream effector of this growth inhibitory response is an atypical MAP kinase ERK7 (ERK8/MAPK15, which is upregulated in the IPCs following impaired ribosome biogenesis as well as starvation. We show that ERK7 is sufficient and essential to inhibit dILP secretion upon impaired ribosome biogenesis, and it acts epistatically to p53. Moreover, we provide evidence that p53 and ERK7 contribute to the inhibition of dILP secretion upon starvation. Thus, we conclude that a cell autonomous ribosome surveillance response, which leads to upregulation of ERK7, inhibits dILP secretion to impede tissue growth under limiting dietary conditions.

  17. Organization of Replication of Ribosomal DNA in Saccharomyces cerevisiae

    NARCIS (Netherlands)

    Linskens, Maarten H.K.; Huberman, Joel A.

    1988-01-01

    Using recently developed replicon mapping techniques, we have analyzed the replication of the ribosomal DNA in Saccharomyces cerevisiae. The results show that (i) the functional origin of replication colocalizes with an autonomously replicating sequence element previously mapped to the

  18. Ribosomal DNA internal transcribed spacer 1 and internal ...

    African Journals Online (AJOL)

    USER

    2010-07-26

    Jul 26, 2010 ... in some East Asian countries such as China, Korea and. *Corresponding author. E-mail: soonkwan@kangwon.ac.kr. Tel: +82 33 250 6476. Fax: +82 33 250 6470. Abbreviations: nrDNA, Nuclear ribosomal DNA; ITS, internal transcribed spacer; PCR, polymerase chain reaction; BLAST, basic local alignment ...

  19. Reaction of some macrolide antibiotics with the ribosome. Labeling of the binding site components

    International Nuclear Information System (INIS)

    Tejedor, F.; Ballesta, J.P.

    1986-01-01

    Radioactive carbomycin A, niddamycin, tylosin, and spiramycin, but not erythromycin, can be covalently bound to Escherichia coli ribosomes by incubation at 37 degrees C. The incorporation of radioactivity into the particles is inhibited by SH- and activated double bond containing compounds but not by amino groups, suggesting that the reactions may take place by addition to the double bond present in the reactive antibiotics. This thermic reaction must be different from the photoreaction described for some of these macrolides [Tejedor, F., and Ballesta, J. P. G. (1985) Biochemistry 24, 467-472] since tylosin, which is not photoincorporated, is thermically bound to ribosomes. Most of the radioactivity is incorporated into the ribosomal proteins. Two-dimensional gel electrophoresis of proteins labeled by carbomycin A, niddamycin, and tylosin indicates that about 40% of the radioactivity is bound to protein L27; the rest is distributed among several other proteins such as L8, L2, and S12, to differing extents depending on the drug used. These results indicate, in accordance with previous data, that protein L27 plays an important role in the macrolide binding site, confirming that these drugs bind near the peptidyl transferase center of the ribosome

  20. Expression Profiling of Ribosome Biogenesis Factors Reveals Nucleolin as a Novel Potential Marker to Predict Outcome in AML Patients.

    Directory of Open Access Journals (Sweden)

    Virginie Marcel

    Full Text Available Acute myeloid leukemia (AML is a heterogeneous disease. Prognosis is mainly influenced by patient age at diagnosis and cytogenetic alterations, two of the main factors currently used in AML patient risk stratification. However, additional criteria are required to improve the current risk classification and better adapt patient care. In neoplastic cells, ribosome biogenesis is increased to sustain the high proliferation rate and ribosome composition is altered to modulate specific gene expression driving tumorigenesis. Here, we investigated the usage of ribosome biogenesis factors as clinical markers in adult patients with AML. We showed that nucleoli, the nucleus compartments where ribosome production takes place, are modified in AML by analyzing a panel of AML and healthy donor cells using immunofluorescence staining. Using four AML series, including the TCGA dataset, altogether representing a total of about 270 samples, we showed that not all factors involved in ribosome biogenesis have clinical values although ribosome biogenesis is increased in AML. Interestingly, we identified the regulator of ribosome production nucleolin (NCL as over-expressed in AML blasts. Moreover, we found in two series that high NCL mRNA expression level was associated with a poor overall survival, particular in elderly patients. Multivariate analyses taking into account age and cytogenetic risk indicated that NCL expression in blast cells is an independent marker of reduced survival. Our study identifies NCL as a potential novel prognostic factor in AML. Altogether, our results suggest that the ribosome biogenesis pathway may be of interest as clinical markers in AML.

  1. Predicting the dynamics of bacterial growth inhibition by ribosome-targeting antibiotics

    Science.gov (United States)

    Greulich, Philip; Doležal, Jakub; Scott, Matthew; Evans, Martin R.; Allen, Rosalind J.

    2017-12-01

    Understanding how antibiotics inhibit bacteria can help to reduce antibiotic use and hence avoid antimicrobial resistance—yet few theoretical models exist for bacterial growth inhibition by a clinically relevant antibiotic treatment regimen. In particular, in the clinic, antibiotic treatment is time-dependent. Here, we use a theoretical model, previously applied to steady-state bacterial growth, to predict the dynamical response of a bacterial cell to a time-dependent dose of ribosome-targeting antibiotic. Our results depend strongly on whether the antibiotic shows reversible transport and/or low-affinity ribosome binding (‘low-affinity antibiotic’) or, in contrast, irreversible transport and/or high affinity ribosome binding (‘high-affinity antibiotic’). For low-affinity antibiotics, our model predicts that growth inhibition depends on the duration of the antibiotic pulse, and can show a transient period of very fast growth following removal of the antibiotic. For high-affinity antibiotics, growth inhibition depends on peak dosage rather than dose duration, and the model predicts a pronounced post-antibiotic effect, due to hysteresis, in which growth can be suppressed for long times after the antibiotic dose has ended. These predictions are experimentally testable and may be of clinical significance.

  2. The primary structure of L37--a rat ribosomal protein with a zinc finger-like motif.

    Science.gov (United States)

    Chan, Y L; Paz, V; Olvera, J; Wool, I G

    1993-04-30

    The amino acid sequence of the rat 60S ribosomal subunit protein L37 was deduced from the sequence of nucleotides in a recombinant cDNA. Ribosomal protein L37 has 96 amino acids, the NH2-terminal methionine is removed after translation of the mRNA, and has a molecular weight of 10,939. Ribosomal protein L37 has a single zinc finger-like motif of the C2-C2 type. Hybridization of the cDNA to digests of nuclear DNA suggests that there are 13 or 14 copies of the L37 gene. The mRNA for the protein is about 500 nucleotides in length. Rat L37 is related to Saccharomyces cerevisiae ribosomal protein YL35 and to Caenorhabditis elegans L37. We have identified in the data base a DNA sequence that encodes the chicken homolog of rat L37.

  3. Genome-wide mRNA processing in methanogenic archaea reveals post-transcriptional regulation of ribosomal protein synthesis.

    Science.gov (United States)

    Qi, Lei; Yue, Lei; Feng, Deqin; Qi, Fengxia; Li, Jie; Dong, Xiuzhu

    2017-07-07

    Unlike stable RNAs that require processing for maturation, prokaryotic cellular mRNAs generally follow an 'all-or-none' pattern. Herein, we used a 5΄ monophosphate transcript sequencing (5΄P-seq) that specifically captured the 5΄-end of processed transcripts and mapped the genome-wide RNA processing sites (PSSs) in a methanogenic archaeon. Following statistical analysis and stringent filtration, we identified 1429 PSSs, among which 23.5% and 5.4% were located in 5΄ untranslated region (uPSS) and intergenic region (iPSS), respectively. A predominant uridine downstream PSSs served as a processing signature. Remarkably, 5΄P-seq detected overrepresented uPSS and iPSS in the polycistronic operons encoding ribosomal proteins, and the majority upstream and proximal ribosome binding sites, suggesting a regulatory role of processing on translation initiation. The processed transcripts showed increased stability and translation efficiency. Particularly, processing within the tricistronic transcript of rplA-rplJ-rplL enhanced the translation of rplL, which can provide a driving force for the 1:4 stoichiometry of L10 to L12 in the ribosome. Growth-associated mRNA processing intensities were also correlated with the cellular ribosomal protein levels, thereby suggesting that mRNA processing is involved in tuning growth-dependent ribosome synthesis. In conclusion, our findings suggest that mRNA processing-mediated post-transcriptional regulation is a potential mechanism of ribosomal protein synthesis and stoichiometry. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  4. Bactobolin resistance is conferred by mutations in the L2 ribosomal protein.

    Science.gov (United States)

    Chandler, Josephine R; Truong, Thao T; Silva, Patricia M; Seyedsayamdost, Mohammad R; Carr, Gavin; Radey, Matthew; Jacobs, Michael A; Sims, Elizabeth H; Clardy, Jon; Greenberg, E Peter

    2012-12-18

    Burkholderia thailandensis produces a family of polyketide-peptide molecules called bactobolins, some of which are potent antibiotics. We found that growth of B. thailandensis at 30°C versus that at 37°C resulted in increased production of bactobolins. We purified the three most abundant bactobolins and determined their activities against a battery of bacteria and mouse fibroblasts. Two of the three compounds showed strong activities against both bacteria and fibroblasts. The third analog was much less potent in both assays. These results suggested that the target of bactobolins might be conserved across bacteria and mammalian cells. To learn about the mechanism of bactobolin activity, we isolated four spontaneous bactobolin-resistant Bacillus subtilis mutants. We used genomic sequencing technology to show that each of the four resistant variants had mutations in rplB, which codes for the 50S ribosome-associated L2 protein. Ectopic expression of a mutant rplB gene in wild-type B. subtilis conferred bactobolin resistance. Finally, the L2 mutations did not confer resistance to other antibiotics known to interfere with ribosome function. Our data indicate that bactobolins target the L2 protein or a nearby site and that this is not the target of other antibiotics. We presume that the mammalian target of bactobolins involves the eukaryotic homolog of L2 (L8e). Currently available antibiotics target surprisingly few cellular functions, and there is a need to identify novel antibiotic targets. We have been interested in the Burkholderia thailandensis bactobolins, and we sought to learn about the target of bactobolin activity by mapping spontaneous resistance mutations in the bactobolin-sensitive Bacillus subtilis. Our results indicate that the bactobolin target is the 50S ribosome-associated L2 protein or a region of the ribosome affected by L2. Bactobolin-resistant mutants are not resistant to other known ribosome inhibitors. Our evidence indicates that bactobolins

  5. Short interfering RNAs targeting a vampire-bat related rabies virus phosphoprotein mRNA.

    Science.gov (United States)

    Ono, Ekaterina Alexandrovna Durymanova; Taniwaki, Sueli Akemi; Brandão, Paulo

    The aim of this study was to assess the in vitro and in vivo effects of short-interfering RNAs (siRNAs) against rabies virus phosphoprotein (P) mRNA in a post-infection treatment for rabies as an extension of a previous report (Braz J Microbiol. 2013 Nov 15;44(3):879-82). To this end, rabies virus strain RABV-4005 (related to the Desmodus rotundus vampire bat) were used to inoculate BHK-21 cells and mice, and the transfection with each of the siRNAs was made with Lipofectamine-2000™. In vitro results showed that siRNA 360 was able to inhibit the replication of strain RABV-4005 with a 1log decrease in virus titter and 5.16-fold reduction in P mRNA, 24h post-inoculation when compared to non-treated cells. In vivo, siRNA 360 was able to induce partial protection, but with no significant difference when compared to non-treated mice. These results indicate that, despite the need for improvement for in vivo applications, P mRNA might be a target for an RNAi-based treatment for rabies. Copyright © 2017 Sociedade Brasileira de Microbiologia. Published by Elsevier Editora Ltda. All rights reserved.

  6. Resistance to Linezolid Caused by Modifications at Its Binding Site on the Ribosome

    DEFF Research Database (Denmark)

    Long, Katherine S.; Vester, Birte

    2012-01-01

    Linezolid is an oxazolidinone antibiotic in clinical use for the treatment of serious infections of resistant Gram-positive bacteria. It inhibits protein synthesis by binding to the peptidyl transferase center on the ribosome. Almost all known resistance mechanisms involve small alterations...... to the linezolid binding site, so this review will therefore focus on the various changes that can adversely affect drug binding and confer resistance. High-resolution structures of linezolid bound to the 50S ribosomal subunit show that it binds in a deep cleft that is surrounded by 23S rRNA nucleotides. Mutation...... of 23S rRNA has for some time been established as a linezolid resistance mechanism. Although ribosomal proteins L3 and L4 are located further away from the bound drug, mutations in specific regions of these proteins are increasingly being associated with linezolid resistance. However, very little...

  7. Functional Dynamics within the Human Ribosome Regulate the Rate of Active Protein Synthesis.

    Science.gov (United States)

    Ferguson, Angelica; Wang, Leyi; Altman, Roger B; Terry, Daniel S; Juette, Manuel F; Burnett, Benjamin J; Alejo, Jose L; Dass, Randall A; Parks, Matthew M; Vincent, C Theresa; Blanchard, Scott C

    2015-11-05

    The regulation of protein synthesis contributes to gene expression in both normal physiology and disease, yet kinetic investigations of the human translation mechanism are currently lacking. Using single-molecule fluorescence imaging methods, we have quantified the nature and timing of structural processes in human ribosomes during single-turnover and processive translation reactions. These measurements reveal that functional complexes exhibit dynamic behaviors and thermodynamic stabilities distinct from those observed for bacterial systems. Structurally defined sub-states of pre- and post-translocation complexes were sensitive to specific inhibitors of the eukaryotic ribosome, demonstrating the utility of this platform to probe drug mechanism. The application of three-color single-molecule fluorescence resonance energy transfer (smFRET) methods further revealed a long-distance allosteric coupling between distal tRNA binding sites within ribosomes bearing three tRNAs, which contributed to the rate of processive translation. Copyright © 2015 Elsevier Inc. All rights reserved.

  8. On the intracellular trafficking of mouse S5 ribosomal protein from cytoplasm to nucleoli.

    Science.gov (United States)

    Matragkou, Ch; Papachristou, H; Karetsou, Z; Papadopoulos, G; Papamarcaki, T; Vizirianakis, I S; Tsiftsoglou, A S; Choli-Papadopoulou, T

    2009-10-09

    The non-ribosomal functions of mammalian ribosomal proteins have recently attracted worldwide attention. The mouse ribosomal protein S5 (rpS5) derived from ribosomal material is an assembled non-phosphorylated protein. The free form of rpS5 protein, however, undergoes phosphorylation. In this study, we have (a) investigated the potential role of phosphorylation in rpS5 protein transport into the nucleus and then into nucleoli and (b) determined which of the domains of rpS5 are involved in this intracellular trafficking. In vitro PCR mutagenesis of mouse rpS5 cDNA, complemented by subsequent cloning and expression of rpS5 truncated recombinant forms, produced in fusion with green fluorescent protein, permitted the investigation of rpS5 intracellular trafficking in HeLa cells using confocal microscopy complemented by Western blot analysis. Our results indicate the following: (a) rpS5 protein enters the nucleus via the region 38-50 aa that forms a random coil as revealed by molecular dynamic simulation. (b) Immunoprecipitation of rpS5 with casein kinase II and immobilized metal affinity chromatography analysis complemented by in vitro kinase assay revealed that phosphorylation of rpS5 seems to be indispensable for its transport from nucleus to nucleoli; upon entering the nucleus, Thr-133 phosphorylation triggers Ser-24 phosphorylation by casein kinase II, thus promoting entrance of rpS5 into the nucleoli. Another important role of rpS5 N-terminal region is proposed to be the regulation of protein's cellular level. The repetitively co-appearance of a satellite C-terminal band below the entire rpS5 at the late stationary phase, and not at the early logarithmic phase, of cell growth suggests a specific degradation balancing probably the unassembled ribosomal protein molecules with those that are efficiently assembled to ribosomal subunits. Overall, these data provide new insights on the structural and functional domains within the rpS5 molecule that contribute to its

  9. Distinct roles for the IIId2 sub-domain in pestivirus and picornavirus internal ribosome entry sites

    DEFF Research Database (Denmark)

    Willcocks, Margaret M.; Zaini, Salmah; Chamond, Nathalie

    2017-01-01

    Viral internal ribosomes entry site (IRES) elements coordinate the recruitment of the host translation machinery to direct the initiation of viral protein synthesis. Within hepatitis C virus (HCV)-like IRES elements, the sub-domain IIId(1) is crucial for recruiting the 40S ribosomal subunit...

  10. The ribosome biogenesis factor Nol11 is required for optimal rDNA transcription and craniofacial development in Xenopus.

    Directory of Open Access Journals (Sweden)

    John N Griffin

    2015-03-01

    Full Text Available The production of ribosomes is ubiquitous and fundamental to life. As such, it is surprising that defects in ribosome biogenesis underlie a growing number of symptomatically distinct inherited disorders, collectively called ribosomopathies. We previously determined that the nucleolar protein, NOL11, is essential for optimal pre-rRNA transcription and processing in human tissue culture cells. However, the role of NOL11 in the development of a multicellular organism remains unknown. Here, we reveal a critical function for NOL11 in vertebrate ribosome biogenesis and craniofacial development. Nol11 is strongly expressed in the developing cranial neural crest (CNC of both amphibians and mammals, and knockdown of Xenopus nol11 results in impaired pre-rRNA transcription and processing, increased apoptosis, and abnormal development of the craniofacial cartilages. Inhibition of p53 rescues this skeletal phenotype, but not the underlying ribosome biogenesis defect, demonstrating an evolutionarily conserved control mechanism through which ribosome-impaired craniofacial cells are removed. Excessive activation of this mechanism impairs craniofacial development. Together, our findings reveal a novel requirement for Nol11 in craniofacial development, present the first frog model of a ribosomopathy, and provide further insight into the clinically important relationship between specific ribosome biogenesis proteins and craniofacial cell survival.

  11. Binding site of ribosomal proteins on prokaryotic 5S ribonucleic acids: a study with ribonucleases

    DEFF Research Database (Denmark)

    Douthwaite, S; Christensen, A; Garrett, R A

    1982-01-01

    The binding sites of ribosomal proteins L18 and L25 on 5S RNA from Escherichia coli were probed with ribonucleases A, T1, and T2 and a double helix specific cobra venom endonuclease. The results for the protein-RNA complexes, which were compared with those for the free RNA [Douthwaite, S...... stearothermophilus 5S RNA. Several protein-induced changes in the RNA structures were identified; some are possibly allosteric in nature. The two prokaryotic 5S RNAs were also incubated with total 50S subunit proteins from E. coli and B. stearothermophilus ribosomes. Homologous and heterologous reconstitution....... stearothermophilus 5S RNA, which may have been due to a third ribosomal protein L5....

  12. Non-canonical ribosomal DNA segments in the human genome, and nucleoli functioning.

    Science.gov (United States)

    Kupriyanova, Natalia S; Netchvolodov, Kirill K; Sadova, Anastasia A; Cherepanova, Marina D; Ryskov, Alexei P

    2015-11-10

    Ribosomal DNA (rDNA) in the human genome is represented by tandem repeats of 43 kb nucleotide sequences that form nucleoli organizers (NORs) on each of five pairs of acrocentric chromosomes. RDNA-similar segments of different lengths are also present on (NOR)(-) chromosomes. Many of these segments contain nucleotide substitutions, supplementary microsatellite clusters, and extended deletions. Recently, it was shown that, in addition to ribosome biogenesis, nucleoli exhibit additional functions, such as cell-cycle regulation and response to stresses. In particular, several stress-inducible loci located in the ribosomal intergenic spacer (rIGS) produce stimuli-specific noncoding nucleolus RNAs. By mapping the 5'/3' ends of the rIGS segments scattered throughout (NOR)(-) chromosomes, we discovered that the bonds in the rIGS that were most often susceptible to disruption in the rIGS were adjacent to, or overlapped with stimuli-specific inducible loci. This suggests the interconnection of the two phenomena - nucleoli functioning and the scattering of rDNA-like sequences on (NOR)(-) chromosomes. Copyright © 2015 Elsevier B.V. All rights reserved.

  13. Ribosome. The complete structure of the 55S mammalian mitochondrial ribosome.

    Science.gov (United States)

    Greber, Basil J; Bieri, Philipp; Leibundgut, Marc; Leitner, Alexander; Aebersold, Ruedi; Boehringer, Daniel; Ban, Nenad

    2015-04-17

    Mammalian mitochondrial ribosomes (mitoribosomes) synthesize mitochondrially encoded membrane proteins that are critical for mitochondrial function. Here we present the complete atomic structure of the porcine 55S mitoribosome at 3.8 angstrom resolution by cryo-electron microscopy and chemical cross-linking/mass spectrometry. The structure of the 28S subunit in the complex was resolved at 3.6 angstrom resolution by focused alignment, which allowed building of a detailed atomic structure including all of its 15 mitoribosomal-specific proteins. The structure reveals the intersubunit contacts in the 55S mitoribosome, the molecular architecture of the mitoribosomal messenger RNA (mRNA) binding channel and its interaction with transfer RNAs, and provides insight into the highly specialized mechanism of mRNA recruitment to the 28S subunit. Furthermore, the structure contributes to a mechanistic understanding of aminoglycoside ototoxicity. Copyright © 2015, American Association for the Advancement of Science.

  14. Structural Disorder within Paramyxoviral Nucleoproteins and Phosphoproteins in Their Free and Bound Forms: From Predictions to Experimental Assessment

    Directory of Open Access Journals (Sweden)

    Johnny Habchi

    2015-07-01

    Full Text Available We herein review available computational and experimental data pointing to the abundance of structural disorder within the nucleoprotein (N and phosphoprotein (P from three paramyxoviruses, namely the measles (MeV, Nipah (NiV and Hendra (HeV viruses. We provide a detailed molecular description of the mechanisms governing the disorder-to-order transition that the intrinsically disordered C-terminal domain (NTAIL of their N proteins undergoes upon binding to the C-terminal X domain (PXD of the homologous P proteins. We also show that NTAIL–PXD complexes are “fuzzy”, i.e., they possess a significant residual disorder, and discuss the possible functional significance of this fuzziness. Finally, we emphasize the relevance of N–P interactions involving intrinsically disordered proteins as promising targets for new antiviral approaches, and end up summarizing the general functional advantages of disorder for viruses.

  15. Phosphorylation of ribosomal proteins influences subunit association and translation of poly (U) in Streptomyces coelicolor

    Czech Academy of Sciences Publication Activity Database

    Mikulík, Karel; Bobek, Jan; Ziková, Alice; Smětáková, Magdalena; Bezoušková, Silvia

    2011-01-01

    Roč. 7, č. 3 (2011), s. 817-823 ISSN 1742-206X R&D Projects: GA ČR GAP302/10/0468; GA ČR GA303/09/0475; GA ČR GA310/07/1009; GA AV ČR(CZ) IAA500110805 Institutional research plan: CEZ:AV0Z50200510 Keywords : ESCHERICHIA-COLI RIBOSOME * ELONGATION-FACTOR-G * MESSENGER-RNA Subject RIV: EE - Microbiology, Virology Impact factor: 3.534, year: 2011

  16. Tumor-adjacent tissue co-expression profile analysis reveals pro-oncogenic ribosomal gene signature for prognosis of resectable hepatocellular carcinoma.

    Science.gov (United States)

    Grinchuk, Oleg V; Yenamandra, Surya P; Iyer, Ramakrishnan; Singh, Malay; Lee, Hwee Kuan; Lim, Kiat Hon; Chow, Pierce Kah-Hoe; Kuznetsov, Vladamir A

    2018-01-01

    Currently, molecular markers are not used when determining the prognosis and treatment strategy for patients with hepatocellular carcinoma (HCC). In the present study, we proposed that the identification of common pro-oncogenic pathways in primary tumors (PT) and adjacent non-malignant tissues (AT) typically used to predict HCC patient risks may result in HCC biomarker discovery. We examined the genome-wide mRNA expression profiles of paired PT and AT samples from 321 HCC patients. The workflow integrated differentially expressed gene selection, gene ontology enrichment, computational classification, survival predictions, image analysis and experimental validation methods. We developed a 24-ribosomal gene-based HCC classifier (RGC), which is prognostically significant in both PT and AT. The RGC gene overexpression in PT was associated with a poor prognosis in the training (hazard ratio = 8.2, P = 9.4 × 10 -6 ) and cross-cohort validation (hazard ratio = 2.63, P = 0.004) datasets. The multivariate survival analysis demonstrated the significant and independent prognostic value of the RGC. The RGC displayed a significant prognostic value in AT of the training (hazard ratio = 5.0, P = 0.03) and cross-validation (hazard ratio = 1.9, P = 0.03) HCC groups, confirming the accuracy and robustness of the RGC. Our experimental and bioinformatics analyses suggested a key role for c-MYC in the pro-oncogenic pattern of ribosomal biogenesis co-regulation in PT and AT. Microarray, quantitative RT-PCR and quantitative immunohistochemical studies of the PT showed that DKK1 in PT is the perspective biomarker for poor HCC outcomes. The common co-transcriptional pattern of ribosome biogenesis genes in PT and AT from HCC patients suggests a new scalable prognostic system, as supported by the model of tumor-like metabolic redirection/assimilation in non-malignant AT. The RGC, comprising 24 ribosomal genes, is introduced as a robust and reproducible prognostic model for

  17. Deciphering the role of the Gag-Pol ribosomal frameshift signal in HIV-1 RNA genome packaging.

    Science.gov (United States)

    Nikolaitchik, Olga A; Hu, Wei-Shau

    2014-04-01

    A key step of retroviral replication is packaging of the viral RNA genome during virus assembly. Specific packaging is mediated by interactions between the viral protein Gag and elements in the viral RNA genome. In HIV-1, similar to most retroviruses, the packaging signal is located within the 5' untranslated region and extends into the gag-coding region. A recent study reported that a region including the Gag-Pol ribosomal frameshift signal plays an important role in HIV-1 RNA packaging; deletions or mutations that affect the RNA structure of this signal lead to drastic decreases (10- to 50-fold) in viral RNA packaging and virus titer. We examined here the role of the ribosomal frameshift signal in HIV-1 RNA packaging by studying the RNA packaging and virus titer in the context of proviruses. Three mutants with altered ribosomal frameshift signal, either through direct deletion of the signal, mutation of the 6U slippery sequence, or alterations of the secondary structure were examined. We found that RNAs from all three mutants were packaged efficiently, and they generate titers similar to that of a virus containing the wild-type ribosomal frameshift signal. We conclude that although the ribosomal frameshift signal plays an important role in regulating the replication cycle, this RNA element is not directly involved in regulating RNA encapsidation. To generate infectious viruses, HIV-1 must package viral RNA genome during virus assembly. The specific HIV-1 genome packaging is mediated by interactions between the structural protein Gag and elements near the 5' end of the viral RNA known as packaging signal. In this study, we examined whether the Gag-Pol ribosomal frameshift signal is important for HIV-1 RNA packaging as recently reported. Our results demonstrated that when Gag/Gag-Pol is supplied in trans, none of the tested ribosomal frameshift signal mutants has defects in RNA packaging or virus titer. These studies provide important information on how HIV-1

  18. Molecular dynamics simulation of ribosome jam

    KAUST Repository

    Matsumoto, Shigenori

    2011-09-01

    We propose a coarse-grained molecular dynamics model of ribosome molecules to study the dependence of translation process on environmental parameters. We found the model exhibits traffic jam property, which is consistent with an ASEP model. We estimated the influence of the temperature and concentration of molecules on the hopping probability used in the ASEP model. Our model can also treat environmental effects on the translation process that cannot be explained by such cellular automaton models. © 2010 Elsevier B.V. All rights reserved.

  19. A conserved chloramphenicol binding site at the entrance to the ribosomal peptide exit tunnel

    DEFF Research Database (Denmark)

    Long, Katherine S; Porse, Bo T

    2003-01-01

    , of E.coli 23S rRNA and G2084 (2058 in E.coli numbering) in domain V of H.halobium 23S rRNA. The modification sites overlap with a portion of the macrolide binding site and cluster at the entrance to the peptide exit tunnel. The data correlate with the recently reported chloramphenicol binding site...... on an archaeal ribosome and suggest that a similar binding site is present on the E.coli ribosome....

  20. Staphylococcus aureus and Escherichia coli have disparate dependences on KsgA for growth and ribosome biogenesis

    Directory of Open Access Journals (Sweden)

    O’Farrell Heather C

    2012-10-01

    Full Text Available Abstract Background The KsgA methyltransferase has been conserved throughout evolution, methylating two adenosines in the small subunit rRNA in all three domains of life as well as in eukaryotic organelles that contain ribosomes. Understanding of KsgA’s important role in ribosome biogenesis has been recently expanded in Escherichia coli; these studies help explain why KsgA is so highly conserved and also suggest KsgA’s potential as an antimicrobial drug target. Results We have analyzed KsgA’s contribution to ribosome biogenesis and cell growth in Staphylococcus aureus. We found that deletion of ksgA in S. aureus led to a cold-sensitive growth phenotype, although KsgA was not as critical for ribosome biogenesis as it was shown to be in E. coli. Additionally, the ksgA knockout strain showed an increased sensitivity to aminoglycoside antibiotics. Overexpression of a catalytically inactive KsgA mutant was deleterious in the knockout strain but not the wild-type strain; this negative phenotype disappeared at low temperature. Conclusions This work extends the study of KsgA, allowing comparison of this aspect of ribosome biogenesis between a Gram-negative and a Gram-positive organism. Our results in S. aureus are in contrast to results previously described in E. coli, where the catalytically inactive protein showed a negative phenotype in the presence or absence of endogenous KsgA.

  1. Fluoride or/and aluminum induced toxicity in guinea pig teeth with the low expression of dentine phosphoprotein.

    Science.gov (United States)

    Han, Tianlong; Wang, Min; Cao, Chunfang; Chen, Huacheng; Zhang, Guanghe; Wang, Liping; Wang, Jundong

    2017-08-01

    This study investigated the damage and expression of dentine phosphoprotein (DPP) in guinea pig teeth by the administration of fluoride (F) or/and aluminum (Al). Fifty-two guinea pigs were divided randomly into four groups (control, F, Al, and F+Al). F (150 mg NaF/L) or/and Al (300 mg AlCl 3 /L) were added in their drinking water for 90 days. The levels of F ion, dentine sialophosphoprotein (DSPP) gene, and DPP protein in incisor and molar were determined, respectively. The results showed that the concentrations of F ion in F and F+Al groups were increased significantly. F induced the mottled enamel and irregular abrasion of teeth, which might occur as a consequence of depressed DSPP mRNA and DPP protein expression. Both the gene and protein expressions showed obvious decrease induced by Al, especially by F. There were no synergistic effects between F and Al, instead, Al inhibited the toxicity of F. © 2017 Wiley Periodicals, Inc.

  2. The primary structures of ribosomal proteins L16, L23 and L33 from the archaebacterium Halobacterium marismortui.

    Science.gov (United States)

    Hatakeyama, T; Hatakeyama, T; Kimura, M

    1988-11-21

    The complete amino acid sequences of ribosomal proteins L16, L23 and L33 from the archaebacterium Halobacterium marismortui were determined. The sequences were established by manual sequencing of peptides produced with several proteases as well as by cleavage with dilute HCl. Proteins L16, L23 and L33 consist of 119, 154 and 69 amino acid residues, and their molecular masses are 13,538, 16,812 and 7620 Da, respectively. The comparison of their sequences with those of ribosomal proteins from other organisms revealed that L23 and L33 are related to eubacterial ribosomal proteins from Escherichia coli and Bacillus stearothermophilus, while protein L16 was found to be homologous to a eukaryotic ribosomal protein from yeast. These results provide information about the special phylogenetic position of archaebacteria.

  3. Simultaneous Binding of Multiple EF-Tu Copies to Translating Ribosomes in Live Escherichia coli.

    Science.gov (United States)

    Mustafi, Mainak; Weisshaar, James C

    2018-01-16

    In bacteria, elongation factor Tu is a translational cofactor that forms ternary complexes with aminoacyl-tRNA (aa-tRNA) and GTP. Binding of a ternary complex to one of four flexible L7/L12 units on the ribosome tethers a charged tRNA in close proximity to the ribosomal A site. Two sequential tests for a match between the aa-tRNA anticodon and the current mRNA codon then follow. Because one elongation cycle can occur in as little as 50 ms and the vast majority of aa-tRNA copies are not cognate with the current mRNA codon, this testing must occur rapidly. We present a single-molecule localization and tracking study of fluorescently labeled EF-Tu in live Escherichia coli Imaging at 2 ms/frame distinguishes 60% slowly diffusing EF-Tu copies (assigned as transiently bound to translating ribosome) from 40% rapidly diffusing copies (assigned as a mixture of free ternary complexes and free EF-Tu). Combining these percentages with copy number estimates, we infer that the four L7/L12 sites are essentially saturated with ternary complexes in vivo. The results corroborate an earlier inference that all four sites can simultaneously tether ternary complexes near the A site, creating a high local concentration that may greatly enhance the rate of testing of aa-tRNAs. Our data and a combinatorial argument both suggest that the initial recognition test for a codon-anticodon match occurs in less than 1 to 2 ms per aa-tRNA copy. The results refute a recent study (A. Plochowietz, I. Farrell, Z. Smilansky, B. S. Cooperman, and A. N. Kapanidis, Nucleic Acids Res 45:926-937, 2016, https://doi.org/10.1093/nar/gkw787) of tRNA diffusion in E. coli that inferred that aa-tRNAs arrive at the ribosomal A site as bare monomers, not as ternary complexes. IMPORTANCE Ribosomes catalyze translation of the mRNA codon sequence into the corresponding sequence of amino acids within the nascent polypeptide chain. Polypeptide elongation can be as fast as 50 ms per added amino acid. Each amino acid

  4. Altered Machinery of Protein Synthesis in Alzheimer's: From the Nucleolus to the Ribosome.

    Science.gov (United States)

    Hernández-Ortega, Karina; Garcia-Esparcia, Paula; Gil, Laura; Lucas, José J; Ferrer, Isidre

    2016-09-01

    Ribosomes and protein synthesis have been reported to be altered in the cerebral cortex at advanced stages of Alzheimer's disease (AD). Modifications in the hippocampus with disease progression have not been assessed. Sixty-seven cases including middle-aged (MA) and AD stages I-VI were analyzed. Nucleolar chaperones nucleolin, nucleophosmin and nucleoplasmin 3, and upstream binding transcription factor RNA polymerase I gene (UBTF) mRNAs are abnormally regulated and their protein levels reduced in AD. Histone modifications dimethylated histone H3K9 (H3K9me2) and acetylated histone H3K12 (H3K12ac) are decreased in CA1. Nuclear tau declines in CA1 and dentate gyrus (DG), and practically disappears in neurons with neurofibrillary tangles. Subunit 28 ribosomal RNA (28S rRNA) expression is altered in CA1 and DG in AD. Several genes encoding ribosomal proteins are abnormally regulated and protein levels of translation initiation factors eIF2α, eIF3η and eIF5, and elongation factor eEF2, are altered in the CA1 region in AD. These findings show alterations in the protein synthesis machinery in AD involving the nucleolus, nucleus and ribosomes in the hippocampus in AD some of them starting at first stages (I-II) preceding neuron loss. These changes may lie behind reduced numbers of dendritic branches and reduced synapses of CA1 and DG neurons which cause hippocampal atrophy. © 2015 International Society of Neuropathology.

  5. IRESPred: Web Server for Prediction of Cellular and Viral Internal Ribosome Entry Site (IRES)

    Science.gov (United States)

    Kolekar, Pandurang; Pataskar, Abhijeet; Kulkarni-Kale, Urmila; Pal, Jayanta; Kulkarni, Abhijeet

    2016-01-01

    Cellular mRNAs are predominantly translated in a cap-dependent manner. However, some viral and a subset of cellular mRNAs initiate their translation in a cap-independent manner. This requires presence of a structured RNA element, known as, Internal Ribosome Entry Site (IRES) in their 5′ untranslated regions (UTRs). Experimental demonstration of IRES in UTR remains a challenging task. Computational prediction of IRES merely based on sequence and structure conservation is also difficult, particularly for cellular IRES. A web server, IRESPred is developed for prediction of both viral and cellular IRES using Support Vector Machine (SVM). The predictive model was built using 35 features that are based on sequence and structural properties of UTRs and the probabilities of interactions between UTR and small subunit ribosomal proteins (SSRPs). The model was found to have 75.51% accuracy, 75.75% sensitivity, 75.25% specificity, 75.75% precision and Matthews Correlation Coefficient (MCC) of 0.51 in blind testing. IRESPred was found to perform better than the only available viral IRES prediction server, VIPS. The IRESPred server is freely available at http://bioinfo.net.in/IRESPred/. PMID:27264539

  6. Ribosomal RNA: a key to phylogeny

    Science.gov (United States)

    Olsen, G. J.; Woese, C. R.

    1993-01-01

    As molecular phylogeny increasingly shapes our understanding of organismal relationships, no molecule has been applied to more questions than have ribosomal RNAs. We review this role of the rRNAs and some of the insights that have been gained from them. We also offer some of the practical considerations in extracting the phylogenetic information from the sequences. Finally, we stress the importance of comparing results from multiple molecules, both as a method for testing the overall reliability of the organismal phylogeny and as a method for more broadly exploring the history of the genome.

  7. Nuclear ribosomal internal transcribed spacer (ITS) region as a universal DNA barcode marker for Fungi.

    Science.gov (United States)

    Schoch, Conrad L; Seifert, Keith A; Huhndorf, Sabine; Robert, Vincent; Spouge, John L; Levesque, C André; Chen, Wen

    2012-04-17

    Six DNA regions were evaluated as potential DNA barcodes for Fungi, the second largest kingdom of eukaryotic life, by a multinational, multilaboratory consortium. The region of the mitochondrial cytochrome c oxidase subunit 1 used as the animal barcode was excluded as a potential marker, because it is difficult to amplify in fungi, often includes large introns, and can be insufficiently variable. Three subunits from the nuclear ribosomal RNA cistron were compared together with regions of three representative protein-coding genes (largest subunit of RNA polymerase II, second largest subunit of RNA polymerase II, and minichromosome maintenance protein). Although the protein-coding gene regions often had a higher percent of correct identification compared with ribosomal markers, low PCR amplification and sequencing success eliminated them as candidates for a universal fungal barcode. Among the regions of the ribosomal cistron, the internal transcribed spacer (ITS) region has the highest probability of successful identification for the broadest range of fungi, with the most clearly defined barcode gap between inter- and intraspecific variation. The nuclear ribosomal large subunit, a popular phylogenetic marker in certain groups, had superior species resolution in some taxonomic groups, such as the early diverging lineages and the ascomycete yeasts, but was otherwise slightly inferior to the ITS. The nuclear ribosomal small subunit has poor species-level resolution in fungi. ITS will be formally proposed for adoption as the primary fungal barcode marker to the Consortium for the Barcode of Life, with the possibility that supplementary barcodes may be developed for particular narrowly circumscribed taxonomic groups.

  8. Implementation of communication-mediating domains for non-ribosomal peptide production in Saccharomyces cerevisiae

    DEFF Research Database (Denmark)

    Siewers, Verena; San-Bento, Rita; Nielsen, Jens

    2010-01-01

    Saccharomyces cerevisiae has in several cases been proven to be a suitable host for the production of natural products and was recently exploited for the production of non-ribosomal peptides. Synthesis of non-ribosomal peptides (NRPs) is mediated by NRP synthetases (NRPSs), modular enzymes, which...... are often organized in enzyme complexes. In these complexes, partner NRPSs interact via communication-mediating domains (COM domains). In order to test whether functional interaction between separate NRPS modules is possible in yeast we constructed a yeast strain expressing two modules with compatible COM...

  9. Ribosomal protein S14 transcripts are edited in Oenothera mitochondria.

    Science.gov (United States)

    Schuster, W; Unseld, M; Wissinger, B; Brennicke, A

    1990-01-01

    The gene encoding ribosomal protein S14 (rps14) in Oenothera mitochondria is located upstream of the cytochrome b gene (cob). Sequence analysis of independently derived cDNA clones covering the entire rps14 coding region shows two nucleotides edited from the genomic DNA to the mRNA derived sequences by C to U modifications. A third editing event occurs four nucleotides upstream of the AUG initiation codon and improves a potential ribosome binding site. A CGG codon specifying arginine in a position conserved in evolution between chloroplasts and E. coli as a UGG tryptophan codon is not edited in any of the cDNAs analysed. An inverted repeat 3' of an unidentified open reading frame is located upstream of the rps14 gene. The inverted repeat sequence is highly conserved at analogous regions in other Oenothera mitochondrial loci. Images PMID:2326162

  10. Free and membrane-bound ribosomes and polysomes in hippocampal neurons during a learning experiment.

    Science.gov (United States)

    Wenzel, J; David, H; Pohle, W; Marx, I; Matthies, H

    1975-01-24

    The ribosomes of the CA1 and CA3 pyramidal cells of hipocampus were investigated by morphometric methods after the acquisition of a shock-motivated brightness discrimination in rats. A significant increase in the total number of ribosomes was observed in CA1 cells of trained animals and in CA3 cells of both active controls and trained rats. A significant increase in membrane-bound ribosomes was obtained in CA1 and CA3 cells after training only. The results confirm the suggestion of an increased protein synthesis in hippocampal neurons during and after the acquisition of a brightness discrimination, as we have concluded from out previous investigations on the incorporation of labeled amino acids under identical experimental conditions. The results lead to the assumption that the protein synthesis in some neuronal cells may probably differ not only quantitatively, but also qualitatively in trained and untrained animals.

  11. Salmonella Enterica Serovar Typhimurium BipA Exhibits Two Distinct Ribosome Binding Modes

    Energy Technology Data Exchange (ETDEWEB)

    deLivron, M.; Robinson, V

    2008-01-01

    BipA is a highly conserved prokaryotic GTPase that functions to influence numerous cellular processes in bacteria. In Escherichia coli and Salmonella enterica serovar Typhimurium, BipA has been implicated in controlling bacterial motility, modulating attachment and effacement processes, and upregulating the expression of virulence genes and is also responsible for avoidance of host defense mechanisms. In addition, BipA is thought to be involved in bacterial stress responses, such as those associated with virulence, temperature, and symbiosis. Thus, BipA is necessary for securing bacterial survival and successful invasion of the host. Steady-state kinetic analysis and pelleting assays were used to assess the GTPase and ribosome-binding properties of S. enterica BipA. Under normal bacterial growth, BipA associates with the ribosome in the GTP-bound state. However, using sucrose density gradients, we demonstrate that the association of BipA and the ribosome is altered under stress conditions in bacteria similar to those experienced during virulence. The data show that this differential binding is brought about by the presence of ppGpp, an alarmone that signals the onset of stress-related events in bacteria.

  12. Critical 23S rRNA interactions for macrolide-dependent ribosome stalling on the ErmCL nascent peptide chain.

    Science.gov (United States)

    Koch, Miriam; Willi, Jessica; Pradère, Ugo; Hall, Jonathan; Polacek, Norbert

    2017-06-20

    The nascent peptide exit tunnel has recently been identified as a functional region of ribosomes contributing to translation regulation and co-translational protein folding. Inducible expression of the erm resistance genes depends on ribosome stalling at specific codons of an upstream open reading frame in the presence of an exit tunnel-bound macrolide antibiotic. The molecular basis for this translation arrest is still not fully understood. Here, we used a nucleotide analog interference approach to unravel important functional groups on 23S rRNA residues in the ribosomal exit tunnel for ribosome stalling on the ErmC leader peptide. By replacing single nucleobase functional groups or even single atoms we were able to demonstrate the importance of A2062, A2503 and U2586 for drug-dependent ribosome stalling. Our data show that the universally conserved A2062 and A2503 are capable of forming a non-Watson-Crick base pair that is critical for sensing and transmitting the stalling signal from the exit tunnel back to the peptidyl transferase center of the ribosome. The nucleobases of A2062, A2503 as well as U2586 do not contribute significantly to the overall mechanism of protein biosynthesis, yet their elaborate role for co-translational monitoring of nascent peptide chains inside the exit tunnel can explain their evolutionary conservation. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  13. Mutational synergism between p-fluorophenylalaline and UV in Coprinus lagopus

    International Nuclear Information System (INIS)

    Talmud, P.J.

    1977-01-01

    The amino acid analogue p-fluorophenylalanine (PFP) is mutagenic to Coprinus lagopus due to its incorporation into proteins. Spontaneous mutations, PFP and UV mutagenesis and PFP/UV synergism have been studied in a UV resistant strain and in two complementing UV sensitive mutant strains. By comparison to the UV resistant strain, one UV sensitive strain shows normal spontaneous mutations, 1.4% PFP-induced mutations and 50-fold UV mutagenesis. The second UV sensitive strain has 19-fold spontaneous mutation frequency and slightly elevated UV mutagenesis. In all 3 strains the PFP/UV synergism is comparable (4-5 times the arithmetic expected). The results indicate that PFP mutagenesis is due to the incorporation of PFP into enzymes normally functioning in the organism but which also participate in UV repair mechanisms. A model is proposed for UV repair which is based on a PFP sensitive excision repair system of at least two enzymes, an alternative 'error-proof' pathway which is not susceptible to PFP and an 'error-prone' pathway which is responsible for UV mutagenesis and is susceptible to PFP as shown by the PFP/UV synergism. Because PFP is given before UV treatment, this implies a UV inducible cofactor and a PFP sensitive enzyme which only functions after UV activation

  14. Ribosome-Inactivating Proteins from Plants: A Historical Overview

    Directory of Open Access Journals (Sweden)

    Andrea Bolognesi

    2016-11-01

    Full Text Available This review provides a historical overview of the research on plant ribosome-inactivating proteins (RIPs, starting from the first studies at the end of eighteenth century involving the purification of abrin and ricin, as well as the immunological experiments of Paul Erlich. Interest in these plant toxins was revived in 1970 by the observation of their anticancer activity, which has given rise to a large amount of research contributing to the development of various scientific fields. Biochemistry analyses succeeded in identifying the enzymatic activity of RIPs and allowed for a better understanding of the ribosomal machinery. Studies on RIP/cell interactions were able to detail the endocytosis and intracellular routing of ricin, thus increasing our knowledge of how cells handle exogenous proteins. The identification of new RIPs and the finding that most RIPs are single-chain polypeptides, together with their genetic sequencing, has aided in the development of new phylogenetic theories. Overall, the biological properties of these proteins, including their abortifacient, anticancer, antiviral and neurotoxic activities, suggest that RIPs could be utilized in agriculture and in many biomedical fields, including clinical drug development.

  15. TIF-IA-dependent regulation of ribosome synthesis in drosophila muscle is required to maintain systemic insulin signaling and larval growth.

    Directory of Open Access Journals (Sweden)

    Abhishek Ghosh

    2014-10-01

    Full Text Available The conserved TOR kinase signaling network links nutrient availability to cell, tissue and body growth in animals. One important growth-regulatory target of TOR signaling is ribosome biogenesis. Studies in yeast and mammalian cell culture have described how TOR controls rRNA synthesis-a limiting step in ribosome biogenesis-via the RNA Polymerase I transcription factor TIF-IA. However, the contribution of TOR-dependent ribosome synthesis to tissue and body growth in animals is less clear. Here we show in Drosophila larvae that ribosome synthesis in muscle is required non-autonomously to maintain normal body growth and development. We find that amino acid starvation and TOR inhibition lead to reduced levels of TIF-IA, and decreased rRNA synthesis in larval muscle. When we mimic this decrease in muscle ribosome synthesis using RNAi-mediated knockdown of TIF-IA, we observe delayed larval development and reduced body growth. This reduction in growth is caused by lowered systemic insulin signaling via two endocrine responses: reduced expression of Drosophila insulin-like peptides (dILPs from the brain and increased expression of Imp-L2-a secreted factor that binds and inhibits dILP activity-from muscle. We also observed that maintaining TIF-IA levels in muscle could partially reverse the starvation-mediated suppression of systemic insulin signaling. Finally, we show that activation of TOR specifically in muscle can increase overall body size and this effect requires TIF-IA function. These data suggest that muscle ribosome synthesis functions as a nutrient-dependent checkpoint for overall body growth: in nutrient rich conditions, TOR is required to maintain levels of TIF-IA and ribosome synthesis to promote high levels of systemic insulin, but under conditions of starvation stress, reduced muscle ribosome synthesis triggers an endocrine response that limits systemic insulin signaling to restrict growth and maintain homeostasis.

  16. Nuclear ribosomal DNA diversity of a cotton pest ( Rotylenchulus ...

    African Journals Online (AJOL)

    The reniform nematode (Rotylenchulus reniformis) has emerged as a major cotton pest in the United States. A recent analysis of over 20 amphimictic populations of this pest from the US and three other countries has shown no sequence variation at the nuclear ribosomal internal transcribed spacer (ITS) despite the region's ...

  17. Characterization of the domains of E. coli initiation factor IF2 responsible for recognition of the ribosome

    DEFF Research Database (Denmark)

    Manuel Palacios Moreno, Juan; Andersen, Lars Dyrskjøt; Egebjerg Kristensen, Janni

    1999-01-01

    We have studied the interactions between the ribosome and the domains of Escherichia coli translation initiation factor 2, using an in vitro ribosomal binding assay with wild-type forms, N- and C-terminal truncated forms of IF2 as well as isolated structural domains. A deletion mutant of the factor...

  18. Characterization of the domains of E. coli initiation factor IF2 responsible for recognition of the ribosome

    DEFF Research Database (Denmark)

    Manuel Palacios Moreno, Juan; Andersen, Lars Dyrskjøt; Egebjerg Kristensen, Janni

    1999-01-01

    We have studied the interactions between the ribosome and the domains of Escherichia coli translation initiation factor 2, using an in vitro ribosomal binding assay with wild-type forms, N- and C-terminal truncated forms of IF2 as well as isolated structural domains. A deletion mutant of the fact...

  19. Project Management Plan to Maintain Safe and Compliant Conditions at the Plutonium Finishing Plant

    International Nuclear Information System (INIS)

    COX, G.J.

    1999-01-01

    This Project Management Plan presents the overall plan, description, mission, and workscope for the Plutonium Finishing Plant (PFP) maintain safe and compliant conditions project at PFP. This plan presents the overall description, mission, work scope, and planning for the Plutonium Finishing Plant (PFP) Maintain Safe and Compliant Conditions Project at PFP. This project includes all tasks required to maintain the safety boundary for the PFP Complex, except for the 2736-2 Vault Complex and the 234-52 vaults and vault-type rooms. The intent of this plan is to describe how this project will be managed and integrated with the stabilization, and deactivation activities. This plan supplements the overall integrated plan presented in the Plutonium Finishing Plant Integrated Project Management Plan (IPMP), HNF-3617, Rev. 0. This is the top-level definitive project management document that specifies the technical (work scope), schedule, and cost baselines that will manage the execution of this project. It describes the organizational approach and roles/responsibilities implemented to execute the project. This plan is under configuration management and any deviations must be authorized by appropriate change control action

  20. Expression of a ribosome inactivating protein (curcin 2) in Jatropha ...

    Indian Academy of Sciences (India)

    Unknown

    mechanisms employed by a number of higher-plant species involve defensive ... of RIPs in the same plant species. ..... Lam C J, Ryals J A, Ward E R and Dixon R A 1992 Emerging ... against insect pests and diseases of plants: ribosome in-.

  1. Ribosome-inhibiting proteins from in vitro cultures of Phytolacca dodecandra

    DEFF Research Database (Denmark)

    Thomsen, S.; Hansen, Harald S.; Nyman, U.

    1991-01-01

    Phytolacca dodecandra (L'Herit) grown in cell cultures was investigated for content of ribosome-inhibiting proteins, which was evaluated hy measuring inhibition of protein synthesis in a cell-free rat liver extract. Calli initiated from leaf, cotyledon, radicle, and hypocotyl and suspension cells...

  2. Evolutionary dynamics of a conserved sequence motif in the ribosomal genes of the ciliate Paramecium.

    Science.gov (United States)

    Catania, Francesco; Lynch, Michael

    2010-05-04

    In protozoa, the identification of preserved motifs by comparative genomics is often impeded by difficulties to generate reliable alignments for non-coding sequences. Moreover, the evolutionary dynamics of regulatory elements in 3' untranslated regions (both in protozoa and metazoa) remains a virtually unexplored issue. By screening Paramecium tetraurelia's 3' untranslated regions for 8-mers that were previously found to be preserved in mammalian 3' UTRs, we detect and characterize a motif that is distinctly conserved in the ribosomal genes of this ciliate. The motif appears to be conserved across Paramecium aurelia species but is absent from the ribosomal genes of four additional non-Paramecium species surveyed, including another ciliate, Tetrahymena thermophila. Motif-free ribosomal genes retain fewer paralogs in the genome and appear to be lost more rapidly relative to motif-containing genes. Features associated with the discovered preserved motif are consistent with this 8-mer playing a role in post-transcriptional regulation. Our observations 1) shed light on the evolution of a putative regulatory motif across large phylogenetic distances; 2) are expected to facilitate the understanding of the modulation of ribosomal genes expression in Paramecium; and 3) reveal a largely unexplored--and presumably not restricted to Paramecium--association between the presence/absence of a DNA motif and the evolutionary fate of its host genes.

  3. Selection of diethylstilbestrol-specific single-chain antibodies from a non-immunized mouse ribosome display library.

    Directory of Open Access Journals (Sweden)

    Yanan Sun

    Full Text Available Single chain variable fragments (scFvs against diethylstilbestrol (DES were selected from the splenocytes of non-immunized mice by ribosome display technology. A naive library was constructed and engineered to allow in vitro transcription and translation using an E. coli lysate system. Alternating selection in solution and immobilization in microtiter wells was used to pan mRNA-ribosome-antibody (ARM complexes. After seven rounds of ribosome display, the expression vector pTIG-TRX containing the selected specific scFv DNAs were transformed into Escherichia coli BL21 (DE3 for expression. Twenty-six positive clones were screened and five clones had high antibody affinity and specificity to DES as evidenced by indirect competitive ELISA. Sequence analysis showed that these five DES-specific scFvs had different amino acid sequences, but the CDRs were highly similar. Surface plasmon resonance (SPR analysis was used to determine binding kinetics of one clone (30-1. The measured K(D was 3.79 µM. These results indicate that ribosome display technology can be used to efficiently isolate hapten-specific antibody (Ab fragments from a naive library; this study provides a methodological framework for the development of novel immunoassays for multiple environmental pollutants with low molecular weight detection using recombinant antibodies.

  4. Improved Ribosome-Footprint and mRNA Measurements Provide Insights into Dynamics and Regulation of Yeast Translation

    Science.gov (United States)

    2016-02-11

    unlimited. Improved Ribosome-Footprint and mRNA Measurements Provide Insights into Dynamics and Regulation of Yeast Translation The views, opinions and...into Dynamics and Regulation of Yeast Translation Report Title Ribosome-footprint profiling provides genome-wide snapshots of translation, but...tend to slow translation. With the improved mRNA measurements, the variation attributable to translational control in exponentially growing yeast was

  5. De novo design and engineering of non-ribosomal peptide synthetases

    Science.gov (United States)

    Bozhüyük, Kenan A. J.; Fleischhacker, Florian; Linck, Annabell; Wesche, Frank; Tietze, Andreas; Niesert, Claus-Peter; Bode, Helge B.

    2018-03-01

    Peptides derived from non-ribosomal peptide synthetases (NRPSs) represent an important class of pharmaceutically relevant drugs. Methods to generate novel non-ribosomal peptides or to modify peptide natural products in an easy and predictable way are therefore of great interest. However, although the overall modular structure of NRPSs suggests the possibility of adjusting domain specificity and selectivity, only a few examples have been reported and these usually show a severe drop in production titre. Here we report a new strategy for the modification of NRPSs that uses defined exchange units (XUs) and not modules as functional units. XUs are fused at specific positions that connect the condensation and adenylation domains and respect the original specificity of the downstream module to enable the production of the desired peptides. We also present the use of internal condensation domains as an alternative to other peptide-chain-releasing domains for the production of cyclic peptides.

  6. Transcriptional activation of ribosomal RNA genes during compensatory renal hypertrophy

    International Nuclear Information System (INIS)

    Ouellette, A.J.; Moonka, R.; Zelenetz, A.; Malt, R.A.

    1986-01-01

    The overall rate of rDNA transcription increases by 50% during the first 24 hours of compensatory renal hypertrophy in the mouse. To study mechanisms of ribosome accumulation after uninephrectomy, transcription rates were measured in isolated kidneys by transcriptional runoff. 32 P-labeled nascent transcripts were hybridized to blots containing linearized, denatured cloned rDNA, and hybridization was quantitated autoradiographically and by direct counting. Overall transcriptional activity of rDNA was increased by 30% above control levels at 6 hrs after nephrectomy and by 50% at 12, 18, and 24 hrs after operation. Hybridizing RNA was insensitive to inhibiby alpha-amanitin, and no hybridization was detected to vector DNA. Thus, accelerated rDNA transcription is one regulatory element in the accretion of ribosomes in renal growth, and the regulatory event is an early event. Mechanisms of activation may include enhanced transcription of active genes or induction of inactive DNA

  7. Study of the binary mixtures of {monoglyme + (hexane, cyclohexane, octane, dodecane)} by ECM-average and PFP models

    International Nuclear Information System (INIS)

    Rivas, M.A.; Buep, A.H.; Iglesias, T.P.

    2015-01-01

    Highlights: • Polarization of the real mixture is less than that of the ideal mixture. • Molar excess volume does not exert the dominant effect on the polarization of the mixture. • Similar influence of molecular interactions on the behaviour of excess permittivity. • Excess molar volume is more influenced by the interactions than excess permittivity. - Abstract: Excess molar volumes and excess permittivity of binary mixtures involving monoglyme and alkanes, such as n-hexane, cyclohexane, n-octane and n-dodecane, were calculated from density and relative permittivity measurements for the entire composition range at several temperatures (288.15, 298.15 and 308.15) K and atmospheric pressure. The excess permittivity was calculated on the basis of a recent definition considering the ideal volume fraction. Empirical equations for describing the experimental data in terms of temperature and concentration are given. The experimental values of permittivity have been compared with those estimated by well-known models from literature. The results have indicated that better predictions are obtained when the volume change on mixing is incorporated in these calculations. The contribution of interactions to the excess permittivity was analysed by means of the ECM-average model. The Prigogine–Flory–Patterson (PFP) theory of the thermodynamics of solutions was used to shed light on the contribution of interactions to the excess molar volume. The work concludes with an interpretation of the information given by the theoretical models and the behaviour of both excess magnitudes

  8. Biological significance of 5S rRNA import into human mitochondria: role of ribosomal protein MRP-L18

    Science.gov (United States)

    Smirnov, Alexandre; Entelis, Nina; Martin, Robert P.; Tarassov, Ivan

    2011-01-01

    5S rRNA is an essential component of ribosomes of all living organisms, the only known exceptions being mitochondrial ribosomes of fungi, animals, and some protists. An intriguing situation distinguishes mammalian cells: Although the mitochondrial genome contains no 5S rRNA genes, abundant import of the nuclear DNA-encoded 5S rRNA into mitochondria was reported. Neither the detailed mechanism of this pathway nor its rationale was clarified to date. In this study, we describe an elegant molecular conveyor composed of a previously identified human 5S rRNA import factor, rhodanese, and mitochondrial ribosomal protein L18, thanks to which 5S rRNA molecules can be specifically withdrawn from the cytosolic pool and redirected to mitochondria, bypassing the classic nucleolar reimport pathway. Inside mitochondria, the cytosolic 5S rRNA is shown to be associated with mitochondrial ribosomes. PMID:21685364

  9. Hip rate of force development and strength are impaired in females with patellofemoral pain without signs of altered gluteus medius and maximus morphology.

    Science.gov (United States)

    Nunes, Guilherme S; Barton, Christian John; Serrão, Fábio Viadanna

    2018-02-01

    To compare rate of force development (RFD) and isometric muscle strength of the hip abductors and extensors; and the thickness and the amount of non-contractile tissue of the gluteus medius and maximus between females with and without patellofemoral pain (PFP). Cross-sectional study. Fifty-four physically active females (27 with PFP and 27 healthy individuals) were studied. Hip muscle isometric strength and RFD was evaluated using isokinetic dynamometry. RFD was measured until 30%, 60%, and 90% of the maximal isometric torque (MIT). Hip muscle morphology was evaluated using ultrasonography. The PFP group possessed slower RFD compared to the control group by 33% for hip abductors until 90%MIT (-0.23%/ms, 95%CI -0.44 to -0.02, ES=0.59); by 51% for hip extensors until 30%MIT (-0.42%/ms, 95%CI -0.66 to -0.18, ES=0.97); and by 55% for hip extensors until 60%MIT (-0.36%/ms, 95%CI -0.60 to -0.12, ES=0.81). The PFP group possessed reduced isometric torque compared to the control group by 10% for hip abduction (-16.0Nm/kg×100, 95% CI -30.2 to -1.9, ES=0.61) and by 15% for hip extension (-30.1Nm/kg×100, 95%CI -51.4 to -8.9, ES=0.76). No significant between group differences for the thickness and the amount of non-contractile tissue of the gluteus medius and maximus were identified. Females with PFP have deficits in isometric strength and RFD in hip abduction and extension. RFD deficits are greater than strength deficits which may highlight their potential importance. Hip muscle strength and RFD deficits do not appear to be explained by muscle thickness or proportion of non-contractile tissue of the gluteal musculature as measured by ultrasound. Copyright © 2017 Sports Medicine Australia. Published by Elsevier Ltd. All rights reserved.

  10. RIBOSOMAL COMPLEX IN PROPHYLAXIS AND TREATMENT OF ACUTE RESPIRATORY INFECTIONS IN CHILDREN

    Directory of Open Access Journals (Sweden)

    A.A. Alekseeva

    2010-01-01

    Full Text Available Acute respiratory infections (ARI are widespread in children regardless of age and region of living; they are characterized with big amount of infectious agents and absence of a trend to morbidity decrease. Drugs for nonspecific prophylaxis (immunostimulators and immunomodulatory agents are frequently used for prevention of ARI. There are plenty of immunomodulating agents; the wellstudied medication with systemic action with good efficacy and safety in pediatric practice is ribosomal-proteoglycan complex. The article presents the description of clinical experience of treatment with this complex in pediatric practice.Key words: children, acute respiratory infections, prophylaxis, treatment, ribosomal complex.(Voprosy sovremennoi pediatrii — Current Pediatrics. 2010;9(6:127-130

  11. Influence of hyperthermia on the phosphorylation of ribosomal protein S6 from human skin fibroblasts and meningioma cells

    DEFF Research Database (Denmark)

    Richter, W W; Zang, K D; Issinger, O G

    1983-01-01

    Skin fibroblasts and meningioma cells, derived from primary cultures of the same patients have been used to study the influence of hyperthermia on (i) cell morphology and (ii) phosphorylation pattern of ribosomal and ribosome-associated proteins. Incubation of tumour cells and fibroblasts up to 7...

  12. cDNA, genomic sequence cloning and overexpression of ribosomal ...

    African Journals Online (AJOL)

    RPS16 of eukaryote is a component of the 40S small ribosomal subunit encoded by RPS16 gene and is also a homolog of prokaryotic RPS9. The cDNA and genomic sequence of RPS16 was cloned successfully for the first time from the Giant Panda (Ailuropoda melanoleuca) using reverse transcription-polymerase chain ...

  13. A combined quantitative mass spectrometry and electron microscopy analysis of ribosomal 30S subunit assembly in E. coli.

    Science.gov (United States)

    Sashital, Dipali G; Greeman, Candacia A; Lyumkis, Dmitry; Potter, Clinton S; Carragher, Bridget; Williamson, James R

    2014-10-14

    Ribosome assembly is a complex process involving the folding and processing of ribosomal RNAs (rRNAs), concomitant binding of ribosomal proteins (r-proteins), and participation of numerous accessory cofactors. Here, we use a quantitative mass spectrometry/electron microscopy hybrid approach to determine the r-protein composition and conformation of 30S ribosome assembly intermediates in Escherichia coli. The relative timing of assembly of the 3' domain and the formation of the central pseudoknot (PK) structure depends on the presence of the assembly factor RimP. The central PK is unstable in the absence of RimP, resulting in the accumulation of intermediates in which the 3'-domain is unanchored and the 5'-domain is depleted for r-proteins S5 and S12 that contact the central PK. Our results reveal the importance of the cofactor RimP in central PK formation, and introduce a broadly applicable method for characterizing macromolecular assembly in cells.

  14. Cryo-EM structure of Hepatitis C virus IRES bound to the human ribosome at 3.9-Å resolution.

    Science.gov (United States)

    Quade, Nick; Boehringer, Daniel; Leibundgut, Marc; van den Heuvel, Joop; Ban, Nenad

    2015-07-08

    Hepatitis C virus (HCV), a widespread human pathogen, is dependent on a highly structured 5'-untranslated region of its mRNA, referred to as internal ribosome entry site (IRES), for the translation of all of its proteins. The HCV IRES initiates translation by directly binding to the small ribosomal subunit (40S), circumventing the need for many eukaryotic translation initiation factors required for mRNA scanning. Here we present the cryo-EM structure of the human 40S ribosomal subunit in complex with the HCV IRES at 3.9 Å resolution, determined by focused refinement of an 80S ribosome-HCV IRES complex. The structure reveals the molecular details of the interactions between the IRES and the 40S, showing that expansion segment 7 (ES7) of the 18S rRNA acts as a central anchor point for the HCV IRES. The structural data rationalizes previous biochemical and genetic evidence regarding the initiation mechanism of the HCV and other related IRESs.

  15. The NBS1-Treacle complex controls ribosomal RNA transcription in response to DNA damage

    DEFF Research Database (Denmark)

    Larsen, Dorthe H; Hari, Flurina; Clapperton, Julie A

    2014-01-01

    Chromosome breakage elicits transient silencing of ribosomal RNA synthesis, but the mechanisms involved remained elusive. Here we discover an in trans signalling mechanism that triggers pan-nuclear silencing of rRNA transcription in response to DNA damage. This is associated with transient...... recruitment of the Nijmegen breakage syndrome protein 1 (NBS1), a central regulator of DNA damage responses, into the nucleoli. We further identify TCOF1 (also known as Treacle), a nucleolar factor implicated in ribosome biogenesis and mutated in Treacher Collins syndrome, as an interaction partner of NBS1...

  16. Sulfur restriction extends fission yeast chronological lifespan through Ecl1 family genes by downregulation of ribosome.

    Science.gov (United States)

    Ohtsuka, Hokuto; Takinami, Masahiro; Shimasaki, Takafumi; Hibi, Takahide; Murakami, Hiroshi; Aiba, Hirofumi

    2017-07-01

    Nutritional restrictions such as calorie restrictions are known to increase the lifespan of various organisms. Here, we found that a restriction of sulfur extended the chronological lifespan (CLS) of the fission yeast Schizosaccharomyces pombe. The restriction decreased cellular size, RNA content, and ribosomal proteins and increased sporulation rate. These responses depended on Ecl1 family genes, the overexpression of which results in the extension of CLS. We also showed that the Zip1 transcription factor results in the sulfur restriction-dependent expression of the ecl1 + gene. We demonstrated that a decrease in ribosomal activity results in the extension of CLS. Based on these observations, we propose that sulfur restriction extends CLS through Ecl1 family genes in a ribosomal activity-dependent manner. © 2017 John Wiley & Sons Ltd.

  17. Purification, crystallization and preliminary X-ray diffraction study of human ribosomal protein L10 core domain

    International Nuclear Information System (INIS)

    Nishimura, Mitsuhiro; Kaminishi, Tatsuya; Kawazoe, Masahito; Shirouzu, Mikako; Takemoto, Chie; Yokoyama, Shigeyuki; Tanaka, Akiko; Sugano, Sumio; Yoshida, Takuya; Ohkubo, Tadayasu; Kobayashi, Yuji

    2007-01-01

    A truncated variant of human ribosomal protien L10 was prepared and crystallized. Diffraction data were collected to 2.5 Å resolution. Eukaryotic ribosomal protein L10 is an essential component of the large ribosomal subunit, which organizes the architecture of the aminoacyl-tRNA binding site. The human L10 protein is also called the QM protein and consists of 214 amino-acid residues. For crystallization, the L10 core domain (L10CD, Phe34–Glu182) was recombinantly expressed in Escherichia coli and purified to homogeneity. A hexagonal crystal of L10CD was obtained by the sitting-drop vapour-diffusion method. The L10CD crystal diffracted to 2.5 Å resolution and belongs to space group P3 1 21 or P3 2 21

  18. Early evolutionary colocalization of the nuclear ribosomal 5S and 45S gene families in seed plants: evidence from the living fossil gymnosperm Ginkgo biloba.

    Science.gov (United States)

    Galián, J A; Rosato, M; Rosselló, J A

    2012-06-01

    In seed plants, the colocalization of the 5S loci within the intergenic spacer (IGS) of the nuclear 45S tandem units is restricted to the phylogenetically derived Asteraceae family. However, fluorescent in situ hybridization (FISH) colocalization of both multigene families has also been observed in other unrelated seed plant lineages. Previous work has identified colocalization of 45S and 5S loci in Ginkgo biloba using FISH, but these observations have not been confirmed recently by sequencing a 1.8 kb IGS. In this work, we report the presence of the 45S-5S linkage in G. biloba, suggesting that in seed plants the molecular events leading to the restructuring of the ribosomal loci are much older than estimated previously. We obtained a 6.0 kb IGS fragment showing structural features of functional sequences, and a single copy of the 5S gene was inserted in the same direction of transcription as the ribosomal RNA genes. We also obtained a 1.8 kb IGS that was a truncate variant of the 6.0 kb IGS lacking the 5S gene. Several lines of evidence strongly suggest that the 1.8 kb variants are pseudogenes that are present exclusively on the satellite chromosomes bearing the 45S-5S genes. The presence of ribosomal IGS pseudogenes best reconciles contradictory results concerning the presence or absence of the 45S-5S linkage in Ginkgo. Our finding that both ribosomal gene families have been unified to a single 45S-5S unit in Ginkgo indicates that an accurate reassessment of the organization of rDNA genes in basal seed plants is necessary.

  19. Mechanistic insights into phosphoprotein-binding FHA domains.

    Science.gov (United States)

    Liang, Xiangyang; Van Doren, Steven R

    2008-08-01

    of FHA domains by a bioinformatics approach. The phosphopeptide-dependent dynamics of an FHA domain, SH2 domain, and PTB domain suggest a common theme: rigid, preformed binding surfaces support van der Waals contacts that provide favorable binding enthalpy. Despite the lack of pronounced conformational changes in FHA domains linked to binding events, more subtle adjustments may be possible. In the one FHA domain tested, phosphothreonine peptide binding is accompanied by increased flexibility just outside the binding site and increased rigidity across the beta-sandwich. The folding of the same FHA domain progresses through near-native intermediates that stabilize the recognition loops in the center of the phosphoprotein-binding surface; this may promote rigidity in the interface and affinity for targets phosphorylated on threonine.

  20. Cloning and characterization of DNA complementary to the canine distemper virus mRNA encoding matrix, phosphoprotein, and nucleocapsid protein

    International Nuclear Information System (INIS)

    Rozenblatt, S.; Eizenberg, O.; Englund, G.; Bellini, W.J.

    1985-01-01

    Double-stranded cDNA synthesized from total polyadenylate-containing mRNA, extracted from monkey kidney cells infected with canine distemper virus (CDV), has been cloned into the PstI site of Escherichia coli plasmid pBR322. Clones containing canine distemper virus DNA were identified by hybridization to a canine distemper virus-specific, 32 P-labeled cDNA. Four specific clones containing different classes of sequences have been identified. The cloned plasmids contain inserts of 800 (clone 44-80), 960 (clone 74-16), 1700 (clone 364), and 950 (clone 40-9) base pairs. The sizes of the mRNA species complementary to these inserts are 1500, 1850, 1850 and 2500 nucleotides, respectively, as determined by the Northern technique. Three of the cloned DNA fragments were further identified as the reverse transcripts of the mRNA coding for the matrix, phosphoprotein, and nucleocapsid protein of CDV

  1. Cloning and characterization of DNA complementary to the canine distemper virus mRNA encoding matrix, phosphoprotein, and nucleocapsid protein

    Energy Technology Data Exchange (ETDEWEB)

    Rozenblatt, S.; Eizenberg, O.; Englund, G.; Bellini, W.J.

    1985-02-01

    Double-stranded cDNA synthesized from total polyadenylate-containing mRNA, extracted from monkey kidney cells infected with canine distemper virus (CDV), has been cloned into the PstI site of Escherichia coli plasmid pBR322. Clones containing canine distemper virus DNA were identified by hybridization to a canine distemper virus-specific, /sup 32/P-labeled cDNA. Four specific clones containing different classes of sequences have been identified. The cloned plasmids contain inserts of 800 (clone 44-80), 960 (clone 74-16), 1700 (clone 364), and 950 (clone 40-9) base pairs. The sizes of the mRNA species complementary to these inserts are 1500, 1850, 1850 and 2500 nucleotides, respectively, as determined by the Northern technique. Three of the cloned DNA fragments were further identified as the reverse transcripts of the mRNA coding for the matrix, phosphoprotein, and nucleocapsid protein of CDV.

  2. Evolutionary dynamics of a conserved sequence motif in the ribosomal genes of the ciliate Paramecium

    Directory of Open Access Journals (Sweden)

    Lynch Michael

    2010-05-01

    Full Text Available Abstract Background In protozoa, the identification of preserved motifs by comparative genomics is often impeded by difficulties to generate reliable alignments for non-coding sequences. Moreover, the evolutionary dynamics of regulatory elements in 3' untranslated regions (both in protozoa and metazoa remains a virtually unexplored issue. Results By screening Paramecium tetraurelia's 3' untranslated regions for 8-mers that were previously found to be preserved in mammalian 3' UTRs, we detect and characterize a motif that is distinctly conserved in the ribosomal genes of this ciliate. The motif appears to be conserved across Paramecium aurelia species but is absent from the ribosomal genes of four additional non-Paramecium species surveyed, including another ciliate, Tetrahymena thermophila. Motif-free ribosomal genes retain fewer paralogs in the genome and appear to be lost more rapidly relative to motif-containing genes. Features associated with the discovered preserved motif are consistent with this 8-mer playing a role in post-transcriptional regulation. Conclusions Our observations 1 shed light on the evolution of a putative regulatory motif across large phylogenetic distances; 2 are expected to facilitate the understanding of the modulation of ribosomal genes expression in Paramecium; and 3 reveal a largely unexplored--and presumably not restricted to Paramecium--association between the presence/absence of a DNA motif and the evolutionary fate of its host genes.

  3. Linezolid-Dependent Function and Structure Adaptation of Ribosomes in a Staphylococcus epidermidis Strain Exhibiting Linezolid Dependence

    OpenAIRE

    Kokkori, Sofia; Apostolidi, Maria; Tsakris, Athanassios; Pournaras, Spyros; Stathopoulos, Constantinos; Dinos, George

    2014-01-01

    Linezolid-dependent growth was recently reported in Staphylococcus epidermidis clinical strains carrying mutations associated with linezolid resistance. To investigate this unexpected behavior at the molecular level, we isolated active ribosomes from one of the linezolid-dependent strains and we compared them with ribosomes isolated from a wild-type strain. Both strains were grown in the absence and presence of linezolid. Detailed biochemical and structural analyses revealed essential differe...

  4. A pulse radiolysis investigation of the interactions of drugs and dyes with macromolecules and ribosomes

    International Nuclear Information System (INIS)

    Phillips, G.O.; Power, D.M.; Davies, J.V.

    1975-01-01

    The reactions of hydrated electrons produced during pulse radiolysis have been utilized to investigate the binding of eleven penicillins and four cephalosporins to bovine serum albumin. A primary binding site exists in the serum albumin molecule, which results indicate to be a hydrophobic cleft in the surface of the molecule separated by a distance > 0.5 mm from a cationic amino acid residue, probably lysine. Interaction of drugs with this binding site leads to a conformational change in the protein resulting in a decrease in reactivity towards hydrated electrons. Interaction of cephalosporin C and 6-amino penicillanic acid with serum albumin involves another site which consists of a cationic amino acid residue separted from anionic residue by a distance >0.7nm. Drug binding at this site induces a conformational change in serum albumin leading to greatly increased reactivity towards hydrated electrons. This increase is associated with an increased availability of disulphide bridges. Cephalosporin C also binds hydrophobically to serum a;lbumin resulting in a decrease in reactivity towards esub(aq)sup(-); such binding can be prevented by palmitic acid. Recent data clearly indicate that the pulse radiolysis technique can be further extended to investigate the nature of the interactions of bacterial ribosome suspensions with amino-acridines. Ion binding between benzoflavine and ribosomes has been examined over a wide temperature range and the thermodynamic parameters governing the interaction have been evaluated. (author)

  5. Positive associations between upregulated levels of stress-induced phosphoprotein 1 and matrix metalloproteinase-9 in endometriosis/adenomyosis.

    Science.gov (United States)

    Wang, Hsin-Shih; Tsai, Chia-Lung; Chang, Pi-Yueh; Chao, Angel; Wu, Ren-Chin; Chen, Shun-Hua; Wang, Chin-Jung; Yen, Chih-Feng; Lee, Yun-Shien; Wang, Tzu-Hao

    2018-01-01

    Stress-induced phosphoprotein-1 (STIP1), an adaptor protein that coordinates the functions of HSP70 and HSP90 in protein folding, has been implicated in the development of human gynecologic malignancies. This case-control study investigates STIP1 serum levels and tissue expression in relation to endometriosis/adenomyosis in Taiwanese population. Female patients with surgically confirmed endometriosis/adenomyosis were compared with women free of endometriosis/adenomyosis. Serum STIP1 levels were measured using an enzyme-linked immunosorbent assay and surgical tissues were analyzed by immunohistochemistry. Both epithelial and stromal cells in surgical tissues of endometriosis and adenomyosis expressed STIP1 and MMP-9. Notably, MMP-9 expression was significantly decreased when STIP1 expression was knocked-down. In vitro experiments revealed that STIP1 was capable of binding to the MMP-9 promoter and enhanced its transcriptional expression. The preoperative serum STIP1 levels of patients with endometriosis/adenomyosis were significantly higher than those of the controls. In brief, our data suggest an association between STIP1 levels and endometriosis/adenomyosis.

  6. Alterations at the peptidyl transferase centre of the ribosome induced by the synergistic action of the streptogramins dalfopristin and quinupristin

    Directory of Open Access Journals (Sweden)

    Fucini Paola

    2004-04-01

    Full Text Available Abstract Background The bacterial ribosome is a primary target of several classes of antibiotics. Investigation of the structure of the ribosomal subunits in complex with different antibiotics can reveal the mode of inhibition of ribosomal protein synthesis. Analysis of the interactions between antibiotics and the ribosome permits investigation of the specific effect of modifications leading to antimicrobial resistances. Streptogramins are unique among the ribosome-targeting antibiotics because they consist of two components, streptogramins A and B, which act synergistically. Each compound alone exhibits a weak bacteriostatic activity, whereas the combination can act bactericidal. The streptogramins A display a prolonged activity that even persists after removal of the drug. However, the mode of activity of the streptogramins has not yet been fully elucidated, despite a plethora of biochemical and structural data. Results The investigation of the crystal structure of the 50S ribosomal subunit from Deinococcus radiodurans in complex with the clinically relevant streptogramins quinupristin and dalfopristin reveals their unique inhibitory mechanism. Quinupristin, a streptogramin B compound, binds in the ribosomal exit tunnel in a similar manner and position as the macrolides, suggesting a similar inhibitory mechanism, namely blockage of the ribosomal tunnel. Dalfopristin, the corresponding streptogramin A compound, binds close to quinupristin directly within the peptidyl transferase centre affecting both A- and P-site occupation by tRNA molecules. Conclusions The crystal structure indicates that the synergistic effect derives from direct interaction between both compounds and shared contacts with a single nucleotide, A2062. Upon binding of the streptogramins, the peptidyl transferase centre undergoes a significant conformational transition, which leads to a stable, non-productive orientation of the universally conserved U2585. Mutations of this r

  7. Inhibition of ribosomal RNA synthesis in yeast by ionizing radiations

    Energy Technology Data Exchange (ETDEWEB)

    Weber, K; Kiefer, J [Giessen Univ. (Germany, F.R.). Strahlenzentrum

    1984-12-01

    Synthesis of ribosomal RNA(r-RNA) was measured for 1 h after exposure of Saccharomyces cerevisiae to ..gamma..-rays, X-rays or ..cap alpha.. particles. ..gamma..- or X-ray induced transcription inhibition was always found to decrease exponentially with dose. D/sub 0/ values of 2150 or 1950 Gy were determined in wild-type cells, corresponding to a mean energy of about 60 eV per r-RNA gene. The finding of differential sensitivities of the two high molecular-weight r-RNA species which are cotranscribed from r-DNA is compatible with the existence of a transcription terminating mechanism. Cells from a mutant strain (rad-9), radiation sensitive to colony forming ability, showed an approximately equal sensitivity for transcription inhibition compared to the wild-type (D/sub 0/ (2095) = 2400 Gy). Inactivation of r-RNA synthesis in cells exposed to ..cap alpha..-particles at room-temperature showed a decreased sensitivity with higher particle fluences ('resistant tail'). This phenomenon was drastically reduced if the temperature during irradiation was lowered to 4/sup 0/C and completely abolished when dried cells were used. An inactivation cross-section for ..cap alpha..-particle induced transcription inhibition of about 0.02 ..mu..m/sup 2/ can be derived from the experimental data.

  8. Altering Knee Abduction Angular Impulse Using Wedged Insoles for Treatment of Patellofemoral Pain in Runners: A Six-Week Randomized Controlled Trial.

    Directory of Open Access Journals (Sweden)

    Ryan T Lewinson

    Full Text Available Determine if a change in internal knee abduction angular impulse (KAAI is related to pain reduction for runners with patellofemoral pain (PFP by comparing lateral and medial wedge insole interventions, and increased KAAI and decreased KAAI groups.Randomized controlled clinical trial (ClinicalTrials.gov ID# NCT01332110.Biomechanics laboratory and community.Thirty-six runners with physician-diagnosed PFP enrolled in the trial, and 27 were analyzed.Runners with PFP were randomly assigned to either an experimental 3 mm lateral wedge or control 6 mm medial wedge group. Participants completed a biomechanical gait analysis to quantify KAAIs with their assigned insole, and then used their assigned insole for six-weeks during their regular runs. Usual pain during running was measured at baseline and at six-week follow-up using a visual analog scale. Statistical tests were performed to identify differences between wedge types, differences between biomechanical response types (i.e. increase or decrease KAAI, as well as predictors of pain reduction.Percent change in KAAI relative to neutral, and % change in pain over six weeks.Clinically meaningful reductions in pain (>33% were measured for both footwear groups; however, no significant differences between footwear groups were found (p = 0.697. When participants were regrouped based on KAAI change (i.e., increase or decrease, again, no significant differences in pain reduction were noted (p = 0.146. Interestingly, when evaluating absolute change in KAAI, a significant relationship between absolute % change in KAAI and % pain reduction was observed (R2 = 0.21; p = 0.030, after adjusting for baseline pain levels.The greater the absolute % change in KAAI during running, the greater the % reduction in pain over six weeks, regardless of wedge type, and whether KAAIs increased or decreased. Lateral and medial wedge insoles were similar in effectiveness for treatment of PFP.Altering KAAI should be a focus of future

  9. Ribosomal proteins S12 and S13 function as control elements for translocation of the mRNA:tRNA complex.

    Science.gov (United States)

    Cukras, Anthony R; Southworth, Daniel R; Brunelle, Julie L; Culver, Gloria M; Green, Rachel

    2003-08-01

    Translocation of the mRNA:tRNA complex through the ribosome is promoted by elongation factor G (EF-G) during the translation cycle. Previous studies established that modification of ribosomal proteins with thiol-specific reagents promotes this event in the absence of EF-G. Here we identify two small subunit interface proteins S12 and S13 that are essential for maintenance of a pretranslocation state. Omission of these proteins using in vitro reconstitution procedures yields ribosomal particles that translate in the absence of enzymatic factors. Conversely, replacement of cysteine residues in these two proteins yields ribosomal particles that are refractive to stimulation with thiol-modifying reagents. These data support a model where S12 and S13 function as control elements for the more ancient rRNA- and tRNA-driven movements of translocation.

  10. Mice with a Mutation in the Mdm2 Gene That Interferes with MDM2/Ribosomal Protein Binding Develop a Defect in Erythropoiesis.

    Directory of Open Access Journals (Sweden)

    Takuya Kamio

    Full Text Available MDM2, an E3 ubiquitin ligase, is an important negative regulator of tumor suppressor p53. In turn the Mdm2 gene is a transcriptional target of p53, forming a negative feedback loop that is important in cell cycle control. It has recently become apparent that the ubiquitination of p53 by MDM2 can be inhibited when certain ribosomal proteins, including RPL5 and RPL11, bind to MDM2. This inhibition, and the resulting increase in p53 levels has been proposed to be responsible for the red cell aplasia seen in Diamond-Blackfan anemia (DBA and in 5q- myelodysplastic syndrome (MDS. DBA and 5q- MDS are associated with inherited (DBA or acquired (5q- MDS haploinsufficiency of ribosomal proteins. A mutation in Mdm2 causing a C305F amino acid substitution blocks the binding of ribosomal proteins. Mice harboring this mutation (Mdm2C305F, retain a normal p53 response to DNA damage, but lack the p53 response to perturbations in ribosome biogenesis. While studying the interaction between RP haploinsufficiency and the Mdm2C305F mutation we noticed that Mdm2C305F homozygous mice had altered hematopoiesis. These mice developed a mild macrocytic anemia with reticulocytosis. In the bone marrow (BM, these mice showed a significant decrease in Ter119hi cells compared to wild type (WT littermates, while no decrease in the number of mature erythroid cells (Ter119hiCD71low was found in the spleen, which showed compensated bone marrow hematopoiesis. In methylcellulose cultures, BFU-E colonies from the mutant mice were slightly reduced in number and there was a significant reduction in CFU-E colony numbers in mutant mice compared with WT controls (p < 0.01. This erythropoietic defect was abrogated by concomitant p53 deficiency (Trp53ko/ko. Further investigation revealed that in Mdm2C305F animals, there was a decrease in Lin-Sca-1+c-Kit+ (LSK cells, accompanied by significant decreases in multipotent progenitor (MPP cells (p < 0.01. Competitive BM repopulation experiments

  11. Identification and role of functionally important motifs in the 970 loop of Escherichia coli 16S ribosomal RNA.

    Science.gov (United States)

    Saraiya, Ashesh A; Lamichhane, Tek N; Chow, Christine S; SantaLucia, John; Cunningham, Philip R

    2008-02-22

    The 970 loop (helix 31) of Escherichia coli 16S ribosomal RNA contains two modified nucleotides, m(2)G966 and m(5)C967. Positions A964, A969, and C970 are conserved among the Bacteria, Archaea, and Eukarya. The nucleotides present at positions 965, 966, 967, 968, and 971, however, are only conserved and unique within each domain. All organisms contain a modified nucleoside at position 966, but the type of the modification is domain specific. Biochemical and structure studies have placed this loop near the P site and have shown it to be involved in the decoding process and in binding the antibiotic tetracycline. To identify the functional components of this ribosomal RNA hairpin, the eight nucleotides of the 970 loop of helix 31 were subjected to saturation mutagenesis and 107 unique functional mutants were isolated and analyzed. Nonrandom nucleotide distributions were observed at each mutated position among the functional isolates. Nucleotide identity at positions 966 and 969 significantly affects ribosome function. Ribosomes with single mutations of m(2)G966 or m(5)C967 produce more protein in vivo than do wild-type ribosomes. Overexpression of initiation factor 3 specifically restored wild-type levels of protein synthesis to the 966 and 967 mutants, suggesting that modification of these residues is important for initiation factor 3 binding and for the proper initiation of protein synthesis.

  12. Association between increase in vertical ground reaction force loading rate and pain level in women with patellofemoral pain after a patellofemoral joint loading protocol.

    Science.gov (United States)

    Briani, Ronaldo Valdir; Pazzinatto, Marcella Ferraz; Waiteman, Marina Cabral; de Oliveira Silva, Danilo; de Azevedo, Fábio Mícolis

    2018-04-11

    The etiology of patellofemoral pain (PFP) is thought to be the result of increased patellofemoral joint (PFJ) load and aberrant lower extremity mechanics, including altered vertical ground reaction forces (VGRF). However, few studies have investigated the association between an increase in pain and VGRF loading rates in the context of PFP. Thus, this study aimed to investigate the immediate effects of PFJ loading on pain and VGRF loading rate, and to see if there is a link between modification of both pain and VGRF loading rate during stair negotiation. Thirty-four women with PFP underwent VGRF analysis during stair negotiation under two conditions: with (condition 2) and without (condition 1) being previously submitted to a PFJ loading protocol in order to or not to exacerbate their knee pain, respectively. The VGRF loading rates were significantly higher in condition 2 (Mean ± standard deviation (SD)=4.0±0.6N/s) compared to condition 1 (Mean±SD=3.6±0.5N/s) during stair ascent and during stair descent (Mean±SD: condition 1=6.3±1.1N/s; condition 2=7.0±1.4N/s). In addition, VGRF loading rates were higher during stair descent compared to stair ascent in both conditions. There were significant correlations between the increase in pain and VGRF loading rate during both tasks. There seemed to be an important relation between the increase in pain and VGRF loading rates in women with PFP. Based on these findings, interventions aimed at reducing VGRF loading rates are important in the context of PFP. Copyright © 2018 Elsevier B.V. All rights reserved.

  13. Resistance to the peptidyl transferase inhibitor tiamulin caused by mutation of ribosomal protein l3.

    Science.gov (United States)

    Bøsling, Jacob; Poulsen, Susan M; Vester, Birte; Long, Katherine S

    2003-09-01

    The antibiotic tiamulin targets the 50S subunit of the bacterial ribosome and interacts at the peptidyl transferase center. Tiamulin-resistant Escherichia coli mutants were isolated in order to elucidate mechanisms of resistance to the drug. No mutations in the rRNA were selected as resistance determinants using a strain expressing only a plasmid-encoded rRNA operon. Selection in a strain with all seven chromosomal rRNA operons yielded a mutant with an A445G mutation in the gene coding for ribosomal protein L3, resulting in an Asn149Asp alteration. Complementation experiments and sequencing of transductants demonstrate that the mutation is responsible for the resistance phenotype. Chemical footprinting experiments show a reduced binding of tiamulin to mutant ribosomes. It is inferred that the L3 mutation, which points into the peptidyl transferase cleft, causes tiamulin resistance by alteration of the drug-binding site. This is the first report of a mechanism of resistance to tiamulin unveiled in molecular detail.

  14. Primary structures of ribosomal proteins from the archaebacterium Halobacterium marismortui and the eubacterium Bacillus stearothermophilus.

    Science.gov (United States)

    Arndt, E; Scholzen, T; Krömer, W; Hatakeyama, T; Kimura, M

    1991-06-01

    Approximately 40 ribosomal proteins from each Halobacterium marismortui and Bacillus stearothermophilus have been sequenced either by direct protein sequence analysis or by DNA sequence analysis of the appropriate genes. The comparison of the amino acid sequences from the archaebacterium H marismortui with the available ribosomal proteins from the eubacterial and eukaryotic kingdoms revealed four different groups of proteins: 24 proteins are related to both eubacterial as well as eukaryotic proteins. Eleven proteins are exclusively related to eukaryotic counterparts. For three proteins only eubacterial relatives-and for another three proteins no counterpart-could be found. The similarities of the halobacterial ribosomal proteins are in general somewhat higher to their eukaryotic than to their eubacterial counterparts. The comparison of B stearothermophilus proteins with their E coli homologues showed that the proteins evolved at different rates. Some proteins are highly conserved with 64-76% identity, others are poorly conserved with only 25-34% identical amino acid residues.

  15. Post-translational modification of ribosomally synthesized peptides by a radical SAM epimerase in Bacillus subtilis

    Science.gov (United States)

    Benjdia, Alhosna; Guillot, Alain; Ruffié, Pauline; Leprince, Jérôme; Berteau, Olivier

    2017-07-01

    Ribosomally synthesized peptides are built out of L-amino acids, whereas D-amino acids are generally the hallmark of non-ribosomal synthetic processes. Here we show that the model bacterium Bacillus subtilis is able to produce a novel type of ribosomally synthesized and post-translationally modified peptide that contains D-amino acids, and which we propose to call epipeptides. We demonstrate that a two [4Fe-4S]-cluster radical S-adenosyl-L-methionine (SAM) enzyme converts L-amino acids into their D-counterparts by catalysing Cα-hydrogen-atom abstraction and using a critical cysteine residue as the hydrogen-atom donor. Unexpectedly, these D-amino acid residues proved to be essential for the activity of a peptide that induces the expression of LiaRS, a major component of the bacterial cell envelope stress-response system. Present in B. subtilis and in several members of the human microbiome, these epipeptides and radical SAM epimerases broaden the landscape of peptidyl structures accessible to living organisms.

  16. Defining the structural requirements for a helix in 23 S ribosomal RNA that confers erythromycin resistance

    DEFF Research Database (Denmark)

    Douthwaite, S; Powers, T; Lee, J Y

    1989-01-01

    The helix spanning nucleotides 1198 to 1247 (helix 1200-1250) in Escherichia coli 23 S ribosomal RNA (rRNA) is functionally important in protein synthesis, and deletions in this region confer erythromycin resistance. In order to define the structural requirements for resistance, we have dissected...... deletion mutants show a sensitive phenotype. Deletions that extend into the base-pairing between GCC1208 and GGU1240 result in non-functional 23 S RNAs, which consequently do not confer resistance. A number of phylogenetically conserved nucleotides have been shown to be non-essential for 23 S RNA function....... However, removal of either these or non-conserved nucleotides from helix 1200-1250 measurably reduces the efficiency of 23 S RNA in forming functional ribosomes. We have used chemical probing and a modified primer extension method to investigate erythromycin binding to wild-type and resistant ribosomes...

  17. CSER 01-008 Canning of Thermally Stabilized Plutonium Oxide Powder in PFP Glovebox HC-21A

    International Nuclear Information System (INIS)

    ERICKSON, D.G.

    2001-01-01

    This document presents the analysis performed to support the canning operation in HC-21A. Most of the actual analysis was performed for the operation in HC-18M and HA-20MB, and is documented in HNF-2707 Rev I a (Erickson 2001a). This document will reference Erickson (2001a) as necessary to support the operation in HC-21A. The plutonium stabilization program at the Plutonium Finishing Plant (PFP) uses heat to convert plutonium-bearing materials into dry powder that is chemically stable for long term storage. The stabilized plutonium is transferred into one of several gloveboxes for the canning process, Gloveboxes HC-18M in Room 228'2, HA-20MB in Room 235B, and HC-21A in Room 230B are to be used for this process. This document presents the analysis performed to support the canning operation in HC-21A. Most of the actual analysis was performed for the operation in HC-I8M and HA-20MB, and is documented in HNF-2707 Rev l a (Erickson 2001a). This document will reference Erickson (2001a) as necessary to support the operation in HC-21A. Evaluation of this operation included normal, base cases, and contingencies. The base cases took the normal operations for each type of feed material and added the likely off-normal events. Each contingency is evaluated assuming the unlikely event happens to the conservative base case. Each contingency was shown to meet the double contingency requirement. That is, at least two unlikely, independent, and concurrent changes in process conditions are required before a criticality is possible

  18. Multiple effects of S13 in modulating the strength of intersubunit interactions in the ribosome during translation.

    Science.gov (United States)

    Cukras, Anthony R; Green, Rachel

    2005-05-27

    The ribosomal protein S13 is found in the head region of the small subunit, where it interacts with the central protuberance of the large ribosomal subunit and with the P site-bound tRNA through its extended C terminus. The bridging interactions between the large and small subunits are dynamic, and are thought to be critical in orchestrating the molecular motions of the translation cycle. S13 provides a direct link between the tRNA-binding site and the movements in the head of the small subunit seen during translocation, thereby providing a possible pathway of signal transduction. We have created and characterized an rpsM(S13)-deficient strain of Escherichia coli and have found significant defects in subunit association, initiation and translocation through in vitro assays of S13-deficient ribosomes. Targeted mutagenesis of specific bridge and tRNA contact elements in S13 provides evidence that these two interaction domains play critical roles in maintaining the fidelity of translation. This ribosomal protein thus appears to play a non-essential, yet important role by modulating subunit interactions in multiple steps of the translation cycle.

  19. The Ribosomal Protein uL22 Modulates the Shape of the Protein Exit Tunnel

    DEFF Research Database (Denmark)

    Wekselman, Itai; Zimmerman, Ella; Davidovich, Chen

    2017-01-01

    Erythromycin is a clinically useful antibiotic that binds to an rRNA pocket in the ribosomal exit tunnel. Commonly, resistance to erythromycin is acquired by alterations of rRNA nucleotides that interact with the drug. Mutations in the β hairpin of ribosomal protein uL22, which is rather distal...... of the β hairpin of the mutated uL22 toward the interior of the exit tunnel, triggering a cascade of structural alterations of rRNA nucleotides that propagate to the erythromycin binding pocket. Our findings support recent studies showing that the interactions between uL22 and specific sequences within...

  20. Isolation and characterization of an RIP (ribosome-inactivating protein)-like protein from tobacco with dual enzymatic activity.

    Science.gov (United States)

    Sharma, Neelam; Park, Sang-Wook; Vepachedu, Ramarao; Barbieri, Luigi; Ciani, Marialibera; Stirpe, Fiorenzo; Savary, Brett J; Vivanco, Jorge M

    2004-01-01

    Ribosome-inactivating proteins (RIPs) are N-glycosidases that remove a specific adenine from the sarcin/ricin loop of the large rRNA, thus arresting protein synthesis at the translocation step. In the present study, a protein termed tobacco RIP (TRIP) was isolated from tobacco (Nicotiana tabacum) leaves and purified using ion exchange and gel filtration chromatography in combination with yeast ribosome depurination assays. TRIP has a molecular mass of 26 kD as evidenced by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and showed strong N-glycosidase activity as manifested by the depurination of yeast rRNA. Purified TRIP showed immunoreactivity with antibodies of RIPs from Mirabilis expansa. TRIP released fewer amounts of adenine residues from ribosomal (Artemia sp. and rat ribosomes) and non-ribosomal substrates (herring sperm DNA, rRNA, and tRNA) compared with other RIPs. TRIP inhibited translation in wheat (Triticum aestivum) germ more efficiently than in rabbit reticulocytes, showing an IC50 at 30 ng in the former system. Antimicrobial assays using highly purified TRIP (50 microg mL(-1)) conducted against various fungi and bacterial pathogens showed the strongest inhibitory activity against Trichoderma reesei and Pseudomonas solancearum. A 15-amino acid internal polypeptide sequence of TRIP was identical with the internal sequences of the iron-superoxide dismutase (Fe-SOD) from wild tobacco (Nicotiana plumbaginifolia), Arabidopsis, and potato (Solanum tuberosum). Purified TRIP showed SOD activity, and Escherichia coli Fe-SOD was observed to have RIP activity too. Thus, TRIP may be considered a dual activity enzyme showing RIP-like activity and Fe-SOD characteristics.

  1. The pleuromutilin drugs tiamulin and valnemulin bind to the RNA at the peptidyl transferase centre on the ribosome

    DEFF Research Database (Denmark)

    Poulsen, S M; Karlsson, M; Johansson, L B

    2001-01-01

    The pleuromutilin antibiotic derivatives, tiamulin and valnemulin, inhibit protein synthesis by binding to the 50S ribosomal subunit of bacteria. The action and binding site of tiamulin and valnemulin was further characterized on Escherichia coli ribosomes. It was revealed that these drugs...... centre and have been associated with binding of several antibiotics. Competitive footprinting shows that tiamulin and valnemulin can bind concurrently with the macrolide erythromycin but compete with the macrolide carbomycin, which is a peptidyl transferase inhibitor. We infer from these and previous...... results that tiamulin and valnemulin interact with the rRNA in the peptidyl transferase slot on the ribosomes in which they prevent the correct positioning of the CCA-ends of tRNAs for peptide transfer....

  2. Sequence analysis and over-expression of ribosomal protein S28 ...

    African Journals Online (AJOL)

    RPS28 is a component of the 40S small ribosomal subunit encoded by RPS28 gene, which is specific to eukaryotes. The cDNA and the genomic sequence of RPS28 were cloned successfully from the Giant Panda using RT-PCR technology and Touchdown-PCR, respectively. Both sequences were analyzed preliminarily ...

  3. Mutant forms of Escherichia coli protein L25 unable to bind to 5S rRNA are incorporated efficiently into the ribosome in vivo.

    Science.gov (United States)

    Anikaev, A Y; Korepanov, A P; Korobeinikova, A V; Kljashtorny, V G; Piendl, W; Nikonov, S V; Garber, M B; Gongadze, G M

    2014-08-01

    5S rRNA-binding ribosomal proteins of the L25 family are an evolutional acquisition of bacteria. Earlier we showed that (i) single replacements in the RNA-binding module of the protein of this family result in destabilization or complete impossibility to form a complex with 5S rRNA in vitro; (ii) ΔL25 ribosomes of Escherichia coli are less efficient in protein synthesis in vivo than the control ribosomes. In the present work, the efficiency of incorporation of the E. coli protein L25 with mutations in the 5S rRNA-binding region into the ribosome in vivo was studied. It was found that the mutations in L25 that abolish its ability to form the complex with free 5S rRNA do not prevent its correct and efficient incorporation into the ribosome. This is supported by the fact that even the presence of a very weakly retained mutant form of the protein in the ribosome has a positive effect on the activity of the translational machinery in vivo. All this suggests the existence of an alternative incorporation pathway for this protein into the ribosome, excluding the preliminary formation of the complex with 5S rRNA. At the same time, the stable L25-5S rRNA contact is important for the retention of the protein within the ribosome, and the conservative amino acid residues of the RNA-binding module play a key role in this.

  4. The AAA-ATPase NVL2 is a component of pre-ribosomal particles that interacts with the DExD/H-box RNA helicase DOB1

    International Nuclear Information System (INIS)

    Nagahama, Masami; Yamazoe, Takeshi; Hara, Yoshimitsu; Tani, Katsuko; Tsuji, Akihiko; Tagaya, Mitsuo

    2006-01-01

    Nuclear VCP/p97-like protein 2 (NVL2) is a member of the chaperone-like AAA-ATPase family with two conserved ATP-binding modules. Our previous studies have shown that NVL2 is localized to the nucleolus by interacting with ribosomal protein L5 and may participate in ribosome synthesis, a process involving various non-ribosomal factors including chaperones and RNA helicases. Here, we show that NVL2 is associated with pre-ribosomal particles in the nucleus. Moreover, we used yeast two-hybrid and co-immunoprecipitation assays to identify an NVL2-interacting protein that could yield insights into NVL2 function in ribosome biogenesis. We found that NVL2 interacts with DOB1, a DExD/H-box RNA helicase, whose yeast homologue functions in a late stage of the 60S subunit synthesis. DOB1 can interact with a second ATP-binding module mutant of NVL2, which shows a dominant negative effect on ribosome synthesis. In contrast, it cannot interact with a first ATP-binding module mutant, which does not show the dominant negative effect. When the dominant negative mutant of NVL2 was overexpressed in cells, DOB1 appeared to remain associated with nuclear pre-ribosomal particles. Such accumulation was not observed upon overexpression of wild-type NVL2 or a nondominant-negative mutant. Taken together, our results suggest that NVL2 might regulate the association/dissociation reaction of DOB1 with pre-ribosomal particles by acting as a molecular chaperone

  5. The functional half-life of an mRNA depends on the ribosome spacing in an early coding region

    DEFF Research Database (Denmark)

    Pedersen, Margit; Nissen, Søren; Mitarai, Namiko

    2011-01-01

    Bacterial mRNAs are translated by closely spaced ribosomes and degraded from the 5'-end, with half-lives of around 2 min at 37 °C in most cases. Ribosome-free or "naked" mRNA is known to be readily degraded, but the initial event that inactivates the mRNA functionally has not been fully described...

  6. Affinity labelling of ribosomes from the livers of different vertebrates by 2-nitro-4-azidobenzoyl-Phe-tRNA

    International Nuclear Information System (INIS)

    Stahl, J.; Boehm, H.; Voderberg, M.

    1981-01-01

    Ribosomal protein L 10 from the livers of trout, hen, and rat was found to be the main target for 2-nitro-4-azidobenzoyl-Phe-tRNA in affinity labelling experiments. Therefore, despite somewhat different electrophoretic mobilities, this protein seems to be involved in the organization of the peptidyl transferase centre in ribosomes of various vertebrates. (author)

  7. MATHEMATICAL AND COMPUTATIONAL MODELLING OF RIBOSOMAL MOVEMENT AND PROTEIN SYNTHESIS: AN OVERVIEW

    Directory of Open Access Journals (Sweden)

    Tobias von der Haar

    2012-04-01

    Full Text Available Translation or protein synthesis consists of a complex system of chemical reactions, which ultimately result in decoding of the mRNA and the production of a protein. The complexity of this reaction system makes it difficult to quantitatively connect its input parameters (such as translation factor or ribosome concentrations, codon composition of the mRNA, or energy availability to output parameters (such as protein synthesis rates or ribosome densities on mRNAs. Mathematical and computational models of translation have now been used for nearly five decades to investigate translation, and to shed light on the relationship between the different reactions in the system. This review gives an overview over the principal approaches used in the modelling efforts, and summarises some of the major findings that were made.

  8. CLINICAL CASE OF TREATMENT WITH RIBOSOMAL COMPLEX IN CHILD WITH COMPROMISED IMMUNITY

    Directory of Open Access Journals (Sweden)

    A.A. Alekseeva

    2011-01-01

    Full Text Available The leading pathology in children is acute respiratory infections (ARI according to the expert data of WHO. The incidence of prolonged and recurrent types of ARI increases during recent years. Patients with these diseases subsequently form the group of children with compromised immunity. Immunogens and immunomodulators are the drugs of nonspecific prophylaxis which are used for the prevention of ARI. The group of bacterial immunomodulators is big but most well-studied systemic drug from this group is Ribomunyl. Ribosomal complex is effective and safe in pediatric practice. The article presents the clinical case of treatment with ribosomal complex in immunocompronised child with allergic pathology.Key words: children with compromised immunity, allergy, acute respiratory infections, treatment.(Voprosy sovremennoi pediatrii — Current Pediatrics. 2011; 10 (2: 211–215

  9. Resistance to Linezolid Caused by Modifications at Its Binding Site on the Ribosome

    Science.gov (United States)

    Long, Katherine S.

    2012-01-01

    Linezolid is an oxazolidinone antibiotic in clinical use for the treatment of serious infections of resistant Gram-positive bacteria. It inhibits protein synthesis by binding to the peptidyl transferase center on the ribosome. Almost all known resistance mechanisms involve small alterations to the linezolid binding site, so this review will therefore focus on the various changes that can adversely affect drug binding and confer resistance. High-resolution structures of linezolid bound to the 50S ribosomal subunit show that it binds in a deep cleft that is surrounded by 23S rRNA nucleotides. Mutation of 23S rRNA has for some time been established as a linezolid resistance mechanism. Although ribosomal proteins L3 and L4 are located further away from the bound drug, mutations in specific regions of these proteins are increasingly being associated with linezolid resistance. However, very little evidence has been presented to confirm this. Furthermore, recent findings on the Cfr methyltransferase underscore the modification of 23S rRNA as a highly effective and transferable form of linezolid resistance. On a positive note, detailed knowledge of the linezolid binding site has facilitated the design of a new generation of oxazolidinones that show improved properties against the known resistance mechanisms. PMID:22143525

  10. The ribosomal protein uL22 modulates the shape of the nascent protein exit tunnel

    DEFF Research Database (Denmark)

    Wekselman, I.; Zimmerman, E.; Davidovich, C.

    2017-01-01

    in the entrance of theribosomal exit tunnel and interferes with the progression of nas-cent chains. Commonly, resistance to erythromycin is acquiredby alterations of rRNA nucleotides that interact with the drug.Mutations in theb-hairpin of ribosomal protein uL22, which israther distal to the erythromycin binding...... to erythromycin binding pocket and increases its flexi-bility. Based on our results, we suggest a feasble mechanism thatexplains how nanscent proteins can be translated when ery-thromycin is bound to the ribosome. Furthermore, our findingssupport recent studies showing that the interactions betweenuL22...

  11. Ribosomal PCR and DNA sequencing for detection and identification of bacteria

    DEFF Research Database (Denmark)

    Jensen, Kristine Helander; Dargis, Rimtas; Christensen, Jens Jørgen

    2014-01-01

    -haemolytic streptococci, especially within the mitis group. The data show that ribosomal PCR with subsequent DNA sequencing of the PCR product is a most valuable supplement to culture for identifying bacterial agents of both acute and prolonged infections. However, some bacteria, including non-haemolytic streptococci...

  12. Computational discovery of specificity-conferring sites in non-ribosomal peptide synthetases

    DEFF Research Database (Denmark)

    Knudsen, Michael; Søndergaard, Dan Ariel; Tofting-Olesen, Claus

    2016-01-01

    Motivation: By using a class of large modular enzymes known as Non-Ribosomal Peptide Synthetases (NRPS), bacteria and fungi are capable of synthesizing a large variety of secondary metabolites, many of which are bioactive and have potential, pharmaceutical applications as e.g.~antibiotics. There ...

  13. The pre-existing population of 5S rRNA effects p53 stabilization during ribosome biogenesis inhibition.

    Science.gov (United States)

    Onofrillo, Carmine; Galbiati, Alice; Montanaro, Lorenzo; Derenzini, Massimo

    2017-01-17

    Pre-ribosomal complex RPL5/RPL11/5S rRNA (5S RNP) is considered the central MDM2 inhibitory complex that control p53 stabilization during ribosome biogenesis inhibition. Despite its role is well defined, the dynamic of 5S RNP assembly still requires further characterization. In the present work, we report that MDM2 inhibition is dependent by a pre-existing population of 5S rRNA.

  14. Stability of the 'L12 stalk' in ribosomes from mesophilic and (hyper)thermophilic Archaea and Bacteria.

    Science.gov (United States)

    Shcherbakov, D; Dontsova, M; Tribus, M; Garber, M; Piendl, W

    2006-01-01

    The ribosomal stalk complex, consisting of one molecule of L10 and four or six molecules of L12, is attached to 23S rRNA via protein L10. This complex forms the so-called 'L12 stalk' on the 50S ribosomal subunit. Ribosomal protein L11 binds to the same region of 23S rRNA and is located at the base of the 'L12 stalk'. The 'L12 stalk' plays a key role in the interaction of the ribosome with translation factors. In this study stalk complexes from mesophilic and (hyper)thermophilic species of the archaeal genus Methanococcus and from the Archaeon Sulfolobus solfataricus, as well as from the Bacteria Escherichia coli, Geobacillus stearothermophilus and Thermus thermophilus, were overproduced in E.coli and purified under non-denaturing conditions. Using filter-binding assays the affinities of the archaeal and bacterial complexes to their specific 23S rRNA target site were analyzed at different pH, ionic strength and temperature. Affinities of both archaeal and bacterial complexes for 23S rRNA vary by more than two orders of magnitude, correlating very well with the growth temperatures of the organisms. A cooperative effect of binding to 23S rRNA of protein L11 and the L10/L12(4) complex from mesophilic and thermophilic Archaea was shown to be temperature-dependent.

  15. The primary structure of rat liver ribosomal protein L37. Homology with yeast and bacterial ribosomal proteins.

    Science.gov (United States)

    Lin, A; McNally, J; Wool, I G

    1983-09-10

    The covalent structure of the rat liver 60 S ribosomal subunit protein L37 was determined. Twenty-four tryptic peptides were purified and the sequence of each was established; they accounted for all 111 residues of L37. The sequence of the first 30 residues of L37, obtained previously by automated Edman degradation of the intact protein, provided the alignment of the first 9 tryptic peptides. Three peptides (CN1, CN2, and CN3) were produced by cleavage of protein L37 with cyanogen bromide. The sequence of CN1 (65 residues) was established from the sequence of secondary peptides resulting from cleavage with trypsin and chymotrypsin. The sequence of CN1 in turn served to order tryptic peptides 1 through 14. The sequence of CN2 (15 residues) was determined entirely by a micromanual procedure and allowed the alignment of tryptic peptides 14 through 18. The sequence of the NH2-terminal 28 amino acids of CN3 (31 residues) was determined; in addition the complete sequences of the secondary tryptic and chymotryptic peptides were done. The sequence of CN3 provided the order of tryptic peptides 18 through 24. Thus the sequence of the three cyanogen bromide peptides also accounted for the 111 residues of protein L37. The carboxyl-terminal amino acids were identified after carboxypeptidase A treatment. There is a disulfide bridge between half-cystinyl residues at positions 40 and 69. Rat liver ribosomal protein L37 is homologous with yeast YP55 and with Escherichia coli L34. Moreover, there is a segment of 17 residues in rat L37 that occurs, albeit with modifications, in yeast YP55 and in E. coli S4, L20, and L34.

  16. Specific structural probing of plasmid-coded ribosomal RNAs from Escherichia coli

    DEFF Research Database (Denmark)

    Aagaard, C; Rosendahl, G; Dam, M

    1991-01-01

    The preferred method for construction and in vivo expression of mutagenised Escherichia coli ribosomal RNAs (rRNAs) is via high copy number plasmids. Transcription of wild-type rRNA from the seven chromosomal rrn operons in strains harbouring plasmid-coded mutant rRNAs leads to a heterogeneous...

  17. Loss of ribosomal protein L11 affects zebrafish embryonic development through a p53-dependent apoptotic response.

    Directory of Open Access Journals (Sweden)

    Anirban Chakraborty

    Full Text Available Ribosome is responsible for protein synthesis in all organisms and ribosomal proteins (RPs play important roles in the formation of a functional ribosome. L11 was recently shown to regulate p53 activity through a direct binding with MDM2 and abrogating the MDM2-induced p53 degradation in response to ribosomal stress. However, the studies were performed in cell lines and the significance of this tumor suppressor function of L11 has yet to be explored in animal models. To investigate the effects of the deletion of L11 and its physiological relevance to p53 activity, we knocked down the rpl11 gene in zebrafish and analyzed the p53 response. Contrary to the cell line-based results, our data indicate that an L11 deficiency in a model organism activates the p53 pathway. The L11-deficient embryos (morphants displayed developmental abnormalities primarily in the brain, leading to embryonic lethality within 6-7 days post fertilization. Extensive apoptosis was observed in the head region of the morphants, thus correlating the morphological defects with apparent cell death. A decrease in total abundance of genes involved in neural patterning of the brain was observed in the morphants, suggesting a reduction in neural progenitor cells. Upregulation of the genes involved in the p53 pathway were observed in the morphants. Simultaneous knockdown of the p53 gene rescued the developmental defects and apoptosis in the morphants. These results suggest that ribosomal dysfunction due to the loss of L11 activates a p53-dependent checkpoint response to prevent improper embryonic development.

  18. The nucleolar phosphoprotein B23 targets Newcastle disease virus matrix protein to the nucleoli and facilitates viral replication.

    Science.gov (United States)

    Duan, Zhiqiang; Chen, Jian; Xu, Haixu; Zhu, Jie; Li, Qunhui; He, Liang; Liu, Huimou; Hu, Shunlin; Liu, Xiufan

    2014-03-01

    The cellular nucleolar proteins are reported to facilitate the replication cycles of some human and animal viruses by interaction with viral proteins. In this study, a nucleolar phosphoprotein B23 was identified to interact with Newcastle disease virus (NDV) matrix (M) protein. We found that NDV M protein accumulated in the nucleolus by binding B23 early in infection, but resulted in the redistribution of B23 from the nucleoli to the nucleoplasm later in infection. In vitro binding studies utilizing deletion mutants indicated that amino acids 30-60 of M and amino acids 188-245 of B23 were required for binding. Furthermore, knockdown of B23 by siRNA or overexpression of B23 or M-binding B23-derived polypeptides remarkably reduced cytopathic effect and inhibited NDV replication. Collectively, we show that B23 facilitates NDV replication by targeting M to the nucleolus, demonstrating for the first time a direct role for nucleolar protein B23 in a paramyxovirus replication process. Copyright © 2014 Elsevier Inc. All rights reserved.

  19. Organization of Mitochondrial Gene Expression in Two Distinct Ribosome-Containing Assemblies

    Directory of Open Access Journals (Sweden)

    Kirsten Kehrein

    2015-02-01

    Full Text Available Mitochondria contain their own genetic system that provides subunits of the complexes driving oxidative phosphorylation. A quarter of the mitochondrial proteome participates in gene expression, but how all these factors are orchestrated and spatially organized is currently unknown. Here, we established a method to purify and analyze native and intact complexes of mitochondrial ribosomes. Quantitative mass spectrometry revealed extensive interactions of ribosomes with factors involved in all the steps of posttranscriptional gene expression. These interactions result in large expressosome-like assemblies that we termed mitochondrial organization of gene expression (MIOREX complexes. Superresolution microscopy revealed that most MIOREX complexes are evenly distributed throughout the mitochondrial network, whereas a subset is present as nucleoid-MIOREX complexes that unite the whole spectrum of organellar gene expression. Our work therefore provides a conceptual framework for the spatial organization of mitochondrial protein synthesis that likely developed to facilitate gene expression in the organelle.

  20. Structure of a prehandover mammalian ribosomal SRP·SRP receptor targeting complex.

    Science.gov (United States)

    Kobayashi, Kan; Jomaa, Ahmad; Lee, Jae Ho; Chandrasekar, Sowmya; Boehringer, Daniel; Shan, Shu-Ou; Ban, Nenad

    2018-04-20

    Signal recognition particle (SRP) targets proteins to the endoplasmic reticulum (ER). SRP recognizes the ribosome synthesizing a signal sequence and delivers it to the SRP receptor (SR) on the ER membrane followed by the transfer of the signal sequence to the translocon. Here, we present the cryo-electron microscopy structure of the mammalian translating ribosome in complex with SRP and SR in a conformation preceding signal sequence handover. The structure visualizes all eukaryotic-specific SRP and SR proteins and reveals their roles in stabilizing this conformation by forming a large protein assembly at the distal site of SRP RNA. We provide biochemical evidence that the guanosine triphosphate hydrolysis of SRP·SR is delayed at this stage, possibly to provide a time window for signal sequence handover to the translocon. Copyright © 2018 The Authors, some rights reserved; exclusive licensee American Association for the Advancement of Science. No claim to original U.S. Government Works.

  1. Evidence for ribosomal frameshifting and a novel overlapping gene in the genomes of insect-specific flaviviruses

    International Nuclear Information System (INIS)

    Firth, Andrew E.; Blitvich, Bradley J.; Wills, Norma M.; Miller, Cathy L.; Atkins, John F.

    2010-01-01

    Flaviviruses have a positive-sense, single-stranded RNA genome of ∼11 kb, encoding a large polyprotein that is cleaved to produce ∼10 mature proteins. Cell fusing agent virus, Kamiti River virus, Culex flavivirus and several recently discovered flaviviruses have no known vertebrate host and apparently infect only insects. We present compelling bioinformatic evidence for a 253-295 codon overlapping gene (designated fifo) conserved throughout these insect-specific flaviviruses and immunofluorescent detection of its product. Fifo overlaps the NS2A/NS2B coding sequence in the - 1/+ 2 reading frame and is most likely expressed as a trans-frame fusion protein via ribosomal frameshifting at a conserved GGAUUUY slippery heptanucleotide with 3'-adjacent RNA secondary structure (which stimulates efficient frameshifting in vitro). The discovery bears striking parallels to the recently discovered ribosomal frameshifting site in the NS2A coding sequence of the Japanese encephalitis serogroup of flaviviruses and suggests that programmed ribosomal frameshifting may be more widespread in flaviviruses than currently realized.

  2. Structures of the E. coli translating ribosome with SRP and its receptor and with the translocon.

    Science.gov (United States)

    Jomaa, Ahmad; Boehringer, Daniel; Leibundgut, Marc; Ban, Nenad

    2016-01-25

    Co-translational protein targeting to membranes is a universally conserved process. Central steps include cargo recognition by the signal recognition particle and handover to the Sec translocon. Here we present snapshots of key co-translational-targeting complexes solved by cryo-electron microscopy at near-atomic resolution, establishing the molecular contacts between the Escherichia coli translating ribosome, the signal recognition particle and the translocon. Our results reveal the conformational changes that regulate the latching of the signal sequence, the release of the heterodimeric domains of the signal recognition particle and its receptor, and the handover of the signal sequence to the translocon. We also observe that the signal recognition particle and the translocon insert-specific structural elements into the ribosomal tunnel to remodel it, possibly to sense nascent chains. Our work provides structural evidence for a conformational state of the signal recognition particle and its receptor primed for translocon binding to the ribosome-nascent chain complex.

  3. Translational profiling of B cells infected with the Epstein-Barr virus reveals 5' leader ribosome recruitment through upstream open reading frames.

    Science.gov (United States)

    Bencun, Maja; Klinke, Olaf; Hotz-Wagenblatt, Agnes; Klaus, Severina; Tsai, Ming-Han; Poirey, Remy; Delecluse, Henri-Jacques

    2018-04-06

    The Epstein-Barr virus (EBV) genome encodes several hundred transcripts. We have used ribosome profiling to characterize viral translation in infected cells and map new translation initiation sites. We show here that EBV transcripts are translated with highly variable efficiency, owing to variable transcription and translation rates, variable ribosome recruitment to the leader region and coverage by monosomes versus polysomes. Some transcripts were hardly translated, others mainly carried monosomes, showed ribosome accumulation in leader regions and most likely represent non-coding RNAs. A similar process was visible for a subset of lytic genes including the key transactivators BZLF1 and BRLF1 in cells infected with weakly replicating EBV strains. This suggests that ribosome trapping, particularly in the leader region, represents a new checkpoint for the repression of lytic replication. We could identify 25 upstream open reading frames (uORFs) located upstream of coding transcripts that displayed 5' leader ribosome trapping, six of which were located in the leader region shared by many latent transcripts. These uORFs repressed viral translation and are likely to play an important role in the regulation of EBV translation.

  4. A bifunctional archaeal protein that is a component of 30S ribosomal subunits and interacts with C/D box small RNAs

    Directory of Open Access Journals (Sweden)

    Andrea Ciammaruconi

    2008-01-01

    Full Text Available We have identified a novel archaeal protein that apparently plays two distinct roles in ribosome metabolism. It is a polypeptide of about 18 kDa (termed Rbp18 that binds free cytosolic C/D box sRNAs in vivo and in vitro and behaves as a structural ribosomal protein, specifically a component of the 30S ribosomal subunit. As Rbp18 is selectively present in Crenarcheota and highly thermophilic Euryarchaeota, we propose that it serves to protect C/D box sRNAs from degradation and perhaps to stabilize thermophilic 30S subunits.

  5. Combining metal oxide affinity chromatography (MOAC and selective mass spectrometry for robust identification of in vivo protein phosphorylation sites

    Directory of Open Access Journals (Sweden)

    Weckwerth Wolfram

    2005-11-01

    Full Text Available Abstract Background Protein phosphorylation is accepted as a major regulatory pathway in plants. More than 1000 protein kinases are predicted in the Arabidopsis proteome, however, only a few studies look systematically for in vivo protein phosphorylation sites. Owing to the low stoichiometry and low abundance of phosphorylated proteins, phosphorylation site identification using mass spectrometry imposes difficulties. Moreover, the often observed poor quality of mass spectra derived from phosphopeptides results frequently in uncertain database hits. Thus, several lines of evidence have to be combined for a precise phosphorylation site identification strategy. Results Here, a strategy is presented that combines enrichment of phosphoproteins using a technique termed metaloxide affinity chromatography (MOAC and selective ion trap mass spectrometry. The complete approach involves (i enrichment of proteins with low phosphorylation stoichiometry out of complex mixtures using MOAC, (ii gel separation and detection of phosphorylation using specific fluorescence staining (confirmation of enrichment, (iii identification of phosphoprotein candidates out of the SDS-PAGE using liquid chromatography coupled to mass spectrometry, and (iv identification of phosphorylation sites of these enriched proteins using automatic detection of H3PO4 neutral loss peaks and data-dependent MS3-fragmentation of the corresponding MS2-fragment. The utility of this approach is demonstrated by the identification of phosphorylation sites in Arabidopsis thaliana seed proteins. Regulatory importance of the identified sites is indicated by conservation of the detected sites in gene families such as ribosomal proteins and sterol dehydrogenases. To demonstrate further the wide applicability of MOAC, phosphoproteins were enriched from Chlamydomonas reinhardtii cell cultures. Conclusion A novel phosphoprotein enrichment procedure MOAC was applied to seed proteins of A. thaliana and to

  6. Genetic diversity of Entamoeba: Novel ribosomal lineages from cockroaches.

    Directory of Open Access Journals (Sweden)

    Tetsuro Kawano

    Full Text Available Our current taxonomic perspective on Entamoeba is largely based on small-subunit ribosomal RNA genes (SSU rDNA from Entamoeba species identified in vertebrate hosts with minor exceptions such as E. moshkovskii from sewage water and E. marina from marine sediment. Other Entamoeba species have also been morphologically identified and described from non-vertebrate species such as insects; however, their genetic diversity remains unknown. In order to further disclose the diversity of the genus, we investigated Entamoeba spp. in the intestines of three cockroach species: Periplaneta americana, Blaptica dubia, and Gromphadorhina oblongonota. We obtained 134 Entamoeba SSU rDNA sequences from 186 cockroaches by direct nested PCR using the DNA extracts of intestines from cockroaches, followed by scrutinized BLASTn screening and phylogenetic analyses. All the sequences identified in this study were distinct from those reported from known Entamoeba species, and considered as novel Entamoeba ribosomal lineages. Furthermore, they were positioned at the base of the clade of known Entamoeba species and displayed remarkable degree of genetic diversity comprising nine major groups in the three cockroach species. This is the first report of the diversity of SSU rDNA sequences from Entamoeba in non-vertebrate host species, and should help to understand the genetic diversity of the genus Entamoeba.

  7. The C-terminal helix of ribosomal P stalk recognizes a hydrophobic groove of elongation factor 2 in a novel fashion.

    Science.gov (United States)

    Tanzawa, Takehito; Kato, Koji; Girodat, Dylan; Ose, Toyoyuki; Kumakura, Yuki; Wieden, Hans-Joachim; Uchiumi, Toshio; Tanaka, Isao; Yao, Min

    2018-04-06

    Archaea and eukaryotes have ribosomal P stalks composed of anchor protein P0 and aP1 homodimers (archaea) or P1•P2 heterodimers (eukaryotes). These P stalks recruit translational GTPases to the GTPase-associated center in ribosomes to provide energy during translation. The C-terminus of the P stalk is known to selectively recognize GTPases. Here we investigated the interaction between the P stalk and elongation factor 2 by determining the structures of Pyrococcus horikoshii EF-2 (PhoEF-2) in the Apo-form, GDP-form, GMPPCP-form (GTP-form), and GMPPCP-form bound with 11 C-terminal residues of P1 (P1C11). Helical structured P1C11 binds to a hydrophobic groove between domain G and subdomain G' of PhoEF-2, where is completely different from that of aEF-1α in terms of both position and sequence, implying that such interaction characteristic may be requested by how GTPases perform their functions on the ribosome. Combining PhoEF-2 P1-binding assays with a structural comparison of current PhoEF-2 structures and molecular dynamics model of a P1C11-bound GDP form, the conformational changes of the P1C11-binding groove in each form suggest that in response to the translation process, the groove has three states: closed, open, and release for recruiting and releasing GTPases.

  8. Ribosomal frameshifting and transcriptional slippage: From genetic steganography and cryptography to adventitious use.

    Science.gov (United States)

    Atkins, John F; Loughran, Gary; Bhatt, Pramod R; Firth, Andrew E; Baranov, Pavel V

    2016-09-06

    Genetic decoding is not 'frozen' as was earlier thought, but dynamic. One facet of this is frameshifting that often results in synthesis of a C-terminal region encoded by a new frame. Ribosomal frameshifting is utilized for the synthesis of additional products, for regulatory purposes and for translational 'correction' of problem or 'savior' indels. Utilization for synthesis of additional products occurs prominently in the decoding of mobile chromosomal element and viral genomes. One class of regulatory frameshifting of stable chromosomal genes governs cellular polyamine levels from yeasts to humans. In many cases of productively utilized frameshifting, the proportion of ribosomes that frameshift at a shift-prone site is enhanced by specific nascent peptide or mRNA context features. Such mRNA signals, which can be 5' or 3' of the shift site or both, can act by pairing with ribosomal RNA or as stem loops or pseudoknots even with one component being 4 kb 3' from the shift site. Transcriptional realignment at slippage-prone sequences also generates productively utilized products encoded trans-frame with respect to the genomic sequence. This too can be enhanced by nucleic acid structure. Together with dynamic codon redefinition, frameshifting is one of the forms of recoding that enriches gene expression. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  9. Yeast polypeptide exit tunnel ribosomal proteins L17, L35 and L37 are necessary to recruit late-assembling factors required for 27SB pre-rRNA processing.

    Science.gov (United States)

    Gamalinda, Michael; Jakovljevic, Jelena; Babiano, Reyes; Talkish, Jason; de la Cruz, Jesús; Woolford, John L

    2013-02-01

    Ribosome synthesis involves the coordinated folding and processing of pre-rRNAs with assembly of ribosomal proteins. In eukaryotes, these events are facilitated by trans-acting factors that propel ribosome maturation from the nucleolus to the cytoplasm. However, there is a gap in understanding how ribosomal proteins configure pre-ribosomes in vivo to enable processing to occur. Here, we have examined the role of adjacent yeast r-proteins L17, L35 and L37 in folding and processing of pre-rRNAs, and binding of other proteins within assembling ribosomes. These three essential ribosomal proteins, which surround the polypeptide exit tunnel, are required for 60S subunit formation as a consequence of their role in removal of the ITS2 spacer from 27SB pre-rRNA. L17-, L35- and L37-depleted cells exhibit turnover of aberrant pre-60S assembly intermediates. Although the structure of ITS2 does not appear to be grossly affected in their absence, these three ribosomal proteins are necessary for efficient recruitment of factors required for 27SB pre-rRNA processing, namely, Nsa2 and Nog2, which associate with pre-60S ribosomal particles containing 27SB pre-rRNAs. Altogether, these data support that L17, L35 and L37 are specifically required for a recruiting step immediately preceding removal of ITS2.

  10. How does a scanning ribosomal particle move along the 5'-untranslated region of eukaryotic mRNA? Brownian Ratchet model.

    Science.gov (United States)

    Spirin, Alexander S

    2009-11-17

    A model of the ATP-dependent unidirectional movement of the 43S ribosomal initiation complex (=40S ribosomal subunit + eIF1 + eIF1A + eIF2.GTP.Met-tRNA(i) + eIF3) during scanning of the 5'-untranslated region of eukaryotic mRNA is proposed. The model is based on the principles of molecular Brownian ratchet machines and explains several enigmatic data concerning the scanning complex. In this model, the one-dimensional diffusion of the ribosomal initiation complex along the mRNA chain is rectified into the net-unidirectional 5'-to-3' movement by the Feynman ratchet-and-pawl mechanism. The proposed mechanism is organized by the heterotrimeric protein eIF4F (=eIF4A + eIF4E + eIF4G), attached to the scanning ribosomal particle via eIF3, and the RNA-binding protein eIF4B that is postulated to play the role of the pawl. The energy for the useful work of the ratchet-and-pawl mechanism is supplied from ATP hydrolysis induced by the eIF4A subunit: ATP binding and its hydrolysis alternately change the affinities of eIF4A for eIF4B and for mRNA, resulting in the restriction of backward diffusional sliding of the 43S ribosomal complex along the mRNA chain, while stochastic movements ahead are allowed.

  11. Distinct roles for the IIId2 sub-domain in pestivirus and picornavirus internal ribosome entry sites.

    Science.gov (United States)

    Willcocks, Margaret M; Zaini, Salmah; Chamond, Nathalie; Ulryck, Nathalie; Allouche, Delphine; Rajagopalan, Noemie; Davids, Nana A; Fahnøe, Ulrik; Hadsbjerg, Johanne; Rasmussen, Thomas Bruun; Roberts, Lisa O; Sargueil, Bruno; Belsham, Graham J; Locker, Nicolas

    2017-12-15

    Viral internal ribosomes entry site (IRES) elements coordinate the recruitment of the host translation machinery to direct the initiation of viral protein synthesis. Within hepatitis C virus (HCV)-like IRES elements, the sub-domain IIId(1) is crucial for recruiting the 40S ribosomal subunit. However, some HCV-like IRES elements possess an additional sub-domain, termed IIId2, whose function remains unclear. Herein, we show that IIId2 sub-domains from divergent viruses have different functions. The IIId2 sub-domain present in Seneca valley virus (SVV), a picornavirus, is dispensable for IRES activity, while the IIId2 sub-domains of two pestiviruses, classical swine fever virus (CSFV) and border disease virus (BDV), are required for 80S ribosomes assembly and IRES activity. Unlike in SVV, the deletion of IIId2 from the CSFV and BDV IRES elements impairs initiation of translation by inhibiting the assembly of 80S ribosomes. Consequently, this negatively affects the replication of CSFV and BDV. Finally, we show that the SVV IIId2 sub-domain is required for efficient viral RNA synthesis and growth of SVV, but not for IRES function. This study sheds light on the molecular evolution of viruses by clearly demonstrating that conserved RNA structures, within distantly related RNA viruses, have acquired different roles in the virus life cycles. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  12. Strengthening of the Hip and Core Versus Knee Muscles for the Treatment of Patellofemoral Pain: A Multicenter Randomized Controlled Trial

    Science.gov (United States)

    Ferber, Reed; Bolgla, Lori; Earl-Boehm, Jennifer E.; Emery, Carolyn; Hamstra-Wright, Karrie

    2015-01-01

    Context: Patellofemoral pain (PFP) is the most common injury in running and jumping athletes. Randomized controlled trials suggest that incorporating hip and core strengthening (HIP) with knee-focused rehabilitation (KNEE) improves PFP outcomes. However, no randomized controlled trials have, to our knowledge, directly compared HIP and KNEE programs. Objective: To compare PFP pain, function, hip- and knee-muscle strength, and core endurance between KNEE and HIP protocols after 6 weeks of rehabilitation. We hypothesized greater improvements in (1) pain and function, (2) hip strength and core endurance for patients with PFP involved in the HIP protocol, and (3) knee strength for patients involved in the KNEE protocol. Design: Randomized controlled clinical trial. Setting: Four clinical research laboratories in Calgary, Alberta; Chicago, Illinois; Milwaukee, Wisconsin; and Augusta, Georgia. Patients or Other Participants: Of 721 patients with PFP screened, 199 (27.6%) met the inclusion criteria (66 men [31.2%], 133 women [66.8%], age = 29.0 ± 7.1 years, height = 170.4 ± 9.4 cm, weight = 67.6 ± 13.5 kg). Intervention(s): Patients with PFP were randomly assigned to a 6-week KNEE or HIP protocol. Main Outcome Measure(s): Primary variables were self-reported visual analog scale and Anterior Knee Pain Scale measures, which were conducted weekly. Secondary variables were muscle strength and core endurance measured at baseline and at 6 weeks. Results: Compared with baseline, both the visual analog scale and the Anterior Knee Pain Scale improved for patients with PFP in both the HIP and KNEE protocols (P HIP protocol were reduced 1 week earlier than in the KNEE group. Both groups increased in strength (P HIP protocol gained more in hip-abductor (P = .01) and -extensor (P = .01) strength and posterior core endurance (P = .05) compared with the KNEE group. Conclusions: Both the HIP and KNEE rehabilitation protocols produced improvements in PFP, function, and strength over 6

  13. Halogenated benzimidazole inhibitors of phosphorylation, ''in vitro'' and ''in vivo'', of the surface acidic proteins of the yeast ribosomal 60S subunit by endogenous protein kinases CK-II and PK60S

    International Nuclear Information System (INIS)

    Szyszka, Ryszard; Boguszewska, Aleksandra; Grankowski, Nikodem; Shugar, David

    1996-01-01

    Several halogeno benzimidazoles and 2-azabenzimidazoles, previously shown to be relatively selective inhibitors of protein kinases CK-I and/or CK-II from various sources, including CK-II from yeast [Szyszka et al. (1995) Biochem. Biophys. Res. Commun. 208, 418-424] inhibit also the yeast ribosomal protein kinase PK60S. The most effective inhibitor of CK-II and PK60S was tetrabromo-2-azabenzimidazole (TetraBr-2-azaBz), which was competitive with respect to ATP (and GTP in the case of CK-II) with K i values of 0.7 μM for CK-II, and 0.1 μM for PK60S. PK60S phosphorylates only three (YP1β, YB1β', YP2α) out of five polypeptides of pp13 kDa acidic proteins of 60S subunit phosphorylated by CK-II [Szyszka et al. (1995) Acta Biochim. Polon. 42, 357-362]. Accordingly, TetraBr-azaBz inhibits phosphorylation only of these polypeptides, catalysed by PK60S. Addition of TetraBr-2Bz to cultures of yeast cells, at concentrations which were without effect on cell growth, led to inhibition of intracellular phosphorylation of ribosomal acidic proteins, paralleling that observed ''in vitro''. TetraBr-2-azaBz is shown to be a useful tool for studies on the intracellular regulation of phosphorylation of the ribosomal 60S acidic proteins, which are involved in formation of active ribosomes. (author). 36 refs, 4 figs, 2 tabs

  14. Detection of carriers and genetic counseling in duchenne muscular dystrophy by ribosomal protein synthesis.

    Science.gov (United States)

    Ionasescu, V; Zellweger, H; Burmeister, L

    1976-11-01

    The in vitro protein synthesis by polyribosomes extracted from biopsied muscle (vastus lateralis) was studied in 47 known carriers, 87 possible carriers and in 60 normal females. A significant increase in specific activity of monomeric ribosomes, total polyribosomes and collagen synthesis was found in 46 (97.8 per cent) known carriers and 47 (54 per cent) possible carriers of Duchenne muscular dytrophy. The latter showed an increase in ribosomal protein synthesis in 10 (52.6 per cent) of 19 mothers of isolated cases, 31 (53.3 per cent) of 58 sisters, and 6 (60 per cent) of other female relatives. Serum creatine phosphokinase was increased in 30 (63.8 per cent) of 47 known carriers.

  15. Nucleolar TRF2 attenuated nucleolus stress-induced HCC cell-cycle arrest by altering rRNA synthesis.

    Science.gov (United States)

    Yuan, Fuwen; Xu, Chenzhong; Li, Guodong; Tong, Tanjun

    2018-05-03

    The nucleolus is an important organelle that is responsible for the biogenesis of ribosome RNA (rRNA) and ribosomal subunits assembly. It is also deemed to be the center of metabolic control, considering the critical role of ribosomes in protein translation. Perturbations of rRNA synthesis are closely related to cell proliferation and tumor progression. Telomeric repeat-binding factor 2 (TRF2) is a member of shelterin complex that is responsible for telomere DNA protection. Interestingly, it was recently reported to localize in the nucleolus of human cells in a cell-cycle-dependent manner, while the underlying mechanism and its role on the nucleolus remained unclear. In this study, we found that nucleolar and coiled-body phosphoprotein 1 (NOLC1), a nucleolar protein that is responsible for the nucleolus construction and rRNA synthesis, interacted with TRF2 and mediated the shuttle of TRF2 between the nucleolus and nucleus. Abating the expression of NOLC1 decreased the nucleolar-resident TRF2. Besides, the nucleolar TRF2 could bind rDNA and promoted rRNA transcription. Furthermore, in hepatocellular carcinoma (HCC) cell lines HepG2 and SMMC7721, TRF2 overexpression participated in the nucleolus stress-induced rRNA inhibition and cell-cycle arrest.

  16. Influences of Patellofemoral Pain and Fatigue in Female Dancers during Ballet Jump-Landing.

    Science.gov (United States)

    Peng, H-T; Chen, W C; Kernozek, T W; Kim, K; Song, C-Y

    2015-08-01

    This study investigated the influence of patellofemoral pain (PFP) and fatigue on lower-extremity joint biomechanics in female dancers during consecutive simple ground échappé. 3-dimensional joint mechanics were analyzed from the no-fatigue to fatigue conditions. 2-way mixed ANOVAs were used to compare the differences of the kinematic and kinetic variables between groups and conditions. Group main effects were seen in increased jump height (p=0.03), peak vertical ground reaction force (p=0.01), knee joint power absorption (p=0.04), and patellofemoral joint stress (PFJS, p=0.04) for PFP group. Fatigue main effects were found for decreased jump height (pballet dancers with PFP sustained great ground impact and loads on the knee probably due to higher jump height compared to the controls. All dancers presented diminished knee joint loading for the protective mechanism and endurance of ankle joint musculature required for the dissipation of loads and displayed a distal-to-proximal dissipation strategy after fatigue. © Georg Thieme Verlag KG Stuttgart · New York.

  17. Clusters of basic amino acids contribute to RNA binding and nucleolar localization of ribosomal protein L22.

    Directory of Open Access Journals (Sweden)

    Jennifer L Houmani

    Full Text Available The ribosomal protein L22 is a component of the 60S eukaryotic ribosomal subunit. As an RNA-binding protein, it has been shown to interact with both cellular and viral RNAs including 28S rRNA and the Epstein-Barr virus encoded RNA, EBER-1. L22 is localized to the cell nucleus where it accumulates in nucleoli. Although previous studies demonstrated that a specific amino acid sequence is required for nucleolar localization, the RNA-binding domain has not been identified. Here, we investigated the hypothesis that the nucleolar accumulation of L22 is linked to its ability to bind RNA. To address this hypothesis, mutated L22 proteins were generated to assess the contribution of specific amino acids to RNA binding and protein localization. Using RNA-protein binding assays, we demonstrate that basic amino acids 80-93 are required for high affinity binding of 28S rRNA and EBER-1 by L22. Fluorescence localization studies using GFP-tagged mutated L22 proteins further reveal that basic amino acids 80-93 are critical for nucleolar accumulation and for incorporation into ribosomes. Our data support the growing consensus that the nucleolar accumulation of ribosomal proteins may not be mediated by a defined localization signal, but rather by specific interaction with established nucleolar components such as rRNA.

  18. Chlamydia abortus YhbZ, a truncated Obg family GTPase, associates with the Escherichia coli large ribosomal subunit.

    Science.gov (United States)

    Polkinghorne, Adam; Vaughan, Lloyd

    2011-01-01

    The stringent stress response is vital for bacterial survival under adverse environmental conditions. Obligate intracellular Chlamydia lack key stringent response proteins, but nevertheless can interrupt the cell cycle and enter stasis or persistence upon amino acid starvation. A possible key protein retained is YhbZ, a homologue of the ObgE guanosine triphosphatase (GTPase) superfamily connecting the stringent stress response to ribosome maturation. Curiously, chlamydial YhbZ lacks the ObgE C-terminal domain thought to be essential for binding the large ribosomal subunit. We expressed recombinant Chlamydia abortus YhbZ and showed it to be a functional GTPase, with similar activity to other Obg GTPase family members. As Chlamydia are resistant to genetic manipulation, we performed heterologous expression and gradient centrifugation experiments in Escherichia coli and found that, despite the missing C-terminal domain, C. abortus YhbZ co-fractionates with the E. coli 50S large ribosomal subunit. In addition, overexpression of chlamydial YhbZ in E. coli leads to growth defects and elongation, as reported for other Obg members. YhbZ did not complement an E. coli obgE temperature-sensitive mutant, indicating the C-terminal acidic domain may have an additional role. This data supports a role for YhbZ linking the chlamydial stress response to ribosome function and cellular growth. Copyright © 2010 Elsevier Ltd. All rights reserved.

  19. RINT-1 interacts with MSP58 within nucleoli and plays a role in ribosomal gene transcription

    International Nuclear Information System (INIS)

    Yang, Chuan-Pin; Kuo, Yu-Liang; Lee, Yi-Chao; Lee, Kuen-Haur; Chiang, Chi-Wu; Wang, Ju-Ming; Hsu, Che-Chia

    2016-01-01

    The nucleolus is the cellular site of ribosomal (r)DNA transcription and ribosome biogenesis. The 58-kDa microspherule protein (MSP58) is a nucleolar protein involved in rDNA transcription and cell proliferation. However, regulation of MSP58-mediated rDNA transcription remains unknown. Using a yeast two-hybrid system with MSP58 as bait, we isolated complementary (c)DNA encoding Rad50-interacting protein 1 (RINT-1), as a MSP58-binding protein. RINT-1 was implicated in the cell cycle checkpoint, membrane trafficking, Golgi apparatus and centrosome dynamic integrity, and telomere length control. Both in vitro and in vivo interaction assays showed that MSP58 directly interacts with RINT-1. Interestingly, microscopic studies revealed the co-localization of MSP58, RINT-1, and the upstream binding factor (UBF), a rRNA transcription factor, in the nucleolus. We showed that ectopic expression of MSP58 or RINT-1 resulted in decreased rRNA expression and rDNA promoter activity, whereas knockdown of MSP58 or RINT-1 by siRNA exerted the opposite effect. Coexpression of MSP58 and RINT-1 robustly decreased rRNA synthesis compared to overexpression of either protein alone, whereas depletion of RINT-1 from MSP58-transfected cells enhanced rRNA synthesis. We also found that MSP58, RINT-1, and the UBF were associated with the rDNA promoter using a chromatin immunoprecipitation assay. Because aberrant ribosome biogenesis contributes to neoplastic transformation, our results revealed a novel protein complex involved in the regulation of rRNA gene expression, suggesting a role for MSP58 and RINT-1 in cancer development. - Highlights: • RINT-1 is a novel MSP58-interacting protein. • RINT-1 is a nucleolar protein that suppresses ribosomal RNA gene transcription. • RINT-1 and MSP58 cooperate to suppress ribosomal RNA gene transcription. • RINT-1, MSP58, and UBF form a complex on the rDNA promoter.

  20. The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus.

    Science.gov (United States)

    Hori, H; Osawa, S; Murao, K; Ishikura, H

    1980-01-01

    The nucleotide sequence of ribosomal 5S RNA from Micrococcus lysodeikticus is pGUUACGGCGGCUAUAGCGUGGGGGAAACGCCCGGCCGUAUAUCGAACCCGGAAGCUAAGCCCCAUAGCGCCGAUGGUUACUGUAACCGGGAGGUUGUGGGAGAGUAGGUCGCCGCCGUGAOH. When compared to other 5S RNAs, the sequence homology is greatest with Thermus aquaticus, and these two 5S RNAs reveal several features intermediate between those of typical gram-positive bacteria and gram-negative bacteria. PMID:6780979