WorldWideScience

Sample records for ribosomal phosphoprotein p1

  1. The activity of the acidic phosphoproteins from the 80 S rat liver ribosome.

    Science.gov (United States)

    MacConnell, W P; Kaplan, N O

    1982-05-25

    The selective removal of acidic phosphoproteins from the 80 S rat liver ribosome was accomplished by successive alcohol extractions at low salt concentration. The resulting core ribosomes lost over 90% of their translation activity and were unable to support the elongation factor 2 GTPase reaction. Both activities were partially restored when the dialyzed extracts were added back to the core ribosome. The binding of labeled adenosine diphosphoribosyl-elongation factor 2 to ribosomes was also affected by extraction and could be reconstituted, although not to the same extent as the GTPase activity associated with elongation factor 2 in the presence of the ribosome. The alcohol extracts of the 80 S ribosome contained mostly phosphoproteins P1 and P2 which could be dephosphorylated and rephosphorylated in solution by alkaline phosphatase and protein kinase, respectively. Dephosphorylation of the P1/P2 mixture in the extracts caused a decrease in the ability of these proteins to reactivate the polyphenylalanine synthesis activity of the core ribosome. However, treatment of the dephosphorylated proteins with the catalytic subunit of 3':5'-cAMP-dependent protein kinase in the presence of ATP reactivated the proteins when compared to the activity of the native extracts. Rabbit antisera raised against the alcohol-extracted proteins were capable of impairing both the polyphenylalanine synthesis reaction and the elongation factor 2-dependent GTPase reaction in the intact ribosomes.

  2. Baculovirus-mediated expression and isolation of human ribosomal phosphoprotein P0 carrying a GST-tag in a functional state

    International Nuclear Information System (INIS)

    Abo, Yohichi; Hagiya, Akiko; Naganuma, Takao; Tohkairin, Yukiko; Shiomi, Kunihiro; Kajiura, Zenta; Hachimori, Akira; Uchiumi, Toshio; Nakagaki, Masao

    2004-01-01

    We constructed an overexpression system for human ribosomal phosphoprotein P0, together with P1 and P2, which is crucially important for translation. Genes for these proteins, fused with the glutathione S-transferase (GST)-tag at the N-terminus, were inserted into baculovirus and introduced to insect cells. The fusion proteins, but not the proteins without the tag, were efficiently expressed into cells as soluble forms. The fusion protein GST.P0 as well as GST.P1/GST.P2 was phosphorylated in cells as detected by incorporation of 32 P and reactivity with monoclonal anti-phosphoserine antibody. GST.P0 expressed in insect cells, but not the protein obtained in Escherichia coli, had the ability to form a complex with P1 and P2 proteins and to bind to 28S rRNA. Moreover, the GST.P0-P1-P2 complex participated in high eEF-2-dependent GTPase activity. Baculovirus expression systems appear to provide recombinant human P0 samples that can be used for studies on the structure and function

  3. The subcellular distribution of the human ribosomal "stalk" components: P1, P2 and P0 proteins

    DEFF Research Database (Denmark)

    Tchórzewski, Marek; Krokowski, Dawid; Rzeski, Wojciech

    2003-01-01

    The ribosomal "stalk" structure is a distinct lateral protuberance located on the large ribosomal subunit in prokaryotic, as well as in eukaryotic cells. In eukaryotes, this ribosomal structure is composed of the acidic ribosomal P proteins, forming two hetero-dimers (P1/P2) attached...

  4. The amino terminal end determines the stability and assembling capacity of eukaryotic ribosomal stalk proteins P1 and P2.

    Science.gov (United States)

    Camargo, Hendricka; Nusspaumer, Gretel; Abia, David; Briceño, Verónica; Remacha, Miguel; Ballesta, Juan P G

    2011-05-01

    The eukaryotic ribosomal proteins P1 and P2 bind to protein P0 through their N-terminal domain to form the essential ribosomal stalk. A mutational analysis points to amino acids at positions 2 and 3 as determinants for the drastic difference of Saccharomyces cerevisiae P1 and P2 half-life, and suggest different degradation mechanisms for each protein type. Moreover, the capacity to form P1/P2 heterodimers is drastically affected by mutations in the P2β four initial amino acids, while these mutations have no effect on P1β. Binding of P2β and, to a lesser extent, P1β to the ribosome is also seriously affected showing the high relevance of the amino acids in the first turn of the NTD α-helix 1 for the stalk assembly. The negative effect of some mutations on ribosome binding can be reversed by the presence of the second P1/P2 couple in the ribosome, indicating a stabilizing structural influence between the two heterodimers. Unexpectedly, some mutations totally abolish heterodimer formation but allow significant ribosome binding and, therefore, a previous P1 and P2 association seems not to be an absolute requirement for stalk assembly. Homology modeling of the protein complexes suggests that the mutated residues can affect the overall protein conformation. © The Author(s) 2011. Published by Oxford University Press.

  5. Tobacco etch virus protein P1 traffics to the nucleolus and associates with the host 60S ribosomal subunits during infection.

    Science.gov (United States)

    Martínez, Fernando; Daròs, José-Antonio

    2014-09-01

    The genus Potyvirus comprises a large group of positive-strand RNA plant viruses whose genome encodes a large polyprotein processed by three viral proteinases. P1 protein, the most amino-terminal product of the polyprotein, is an accessory factor stimulating viral genome amplification whose role during infection is not well understood. We infected plants with Tobacco etch virus (TEV; genus Potyvirus) clones in which P1 was tagged with a fluorescent protein to track its expression and subcellular localization or with an affinity tag to identify host proteins involved in complexes in which P1 also takes part during infection. Our results showed that TEV P1 exclusively accumulates in infected cells at an early stage of infection and that the protein displays a dynamic subcellular localization, trafficking in and out of the nucleus and nucleolus during infection. Inside the nucleolus, P1 particularly targets the dense granular component. Consistently, we found functional nucleolar localization and nuclear export signals in TEV P1 sequence. Our results also indicated that TEV P1 physically interacts with the host 80S cytoplasmic ribosomes and specifically binds to the 60S ribosomal subunits during infection. In vitro translation assays of reporter proteins suggested that TEV P1 stimulates protein translation, particularly when driven from the TEV internal ribosome entry site. These in vitro assays also suggested that TEV helper-component proteinase (HC-Pro) inhibits protein translation. Based on these findings, we propose that TEV P1 stimulates translation of viral proteins in infected cells. In this work, we researched the role during infection of tobacco etch virus P1 protease. P1 is the most mysterious protein of potyviruses, a relevant group of RNA viruses infecting plants. Our experiments showed that the viral P1 protein exclusively accumulates in infected cells at an early stage of infection and moves in and out of the nucleus of infected cells, particularly

  6. Lassomycin, a ribosomally synthesized cyclic peptide, kills mycobacterium tuberculosis by targeting the ATP-dependent protease ClpC1P1P2.

    Science.gov (United States)

    Gavrish, Ekaterina; Sit, Clarissa S; Cao, Shugeng; Kandror, Olga; Spoering, Amy; Peoples, Aaron; Ling, Losee; Fetterman, Ashley; Hughes, Dallas; Bissell, Anthony; Torrey, Heather; Akopian, Tatos; Mueller, Andreas; Epstein, Slava; Goldberg, Alfred; Clardy, Jon; Lewis, Kim

    2014-04-24

    Languishing antibiotic discovery and flourishing antibiotic resistance have prompted the development of alternative untapped sources for antibiotic discovery, including previously uncultured bacteria. Here, we screen extracts from uncultured species against Mycobacterium tuberculosis and identify lassomycin, an antibiotic that exhibits potent bactericidal activity against both growing and dormant mycobacteria, including drug-resistant forms of M. tuberculosis, but little activity against other bacteria or mammalian cells. Lassomycin is a highly basic, ribosomally encoded cyclic peptide with an unusual structural fold that only partially resembles that of other lasso peptides. We show that lassomycin binds to a highly acidic region of the ClpC1 ATPase complex and markedly stimulates its ATPase activity without stimulating ClpP1P2-catalyzed protein breakdown, which is essential for viability of mycobacteria. This mechanism, uncoupling ATPase from proteolytic activity, accounts for the bactericidal activity of lassomycin. Copyright © 2014 Elsevier Ltd. All rights reserved.

  7. Evidence for phosphoprotein phosphatase in Streptomyces granaticolor

    Czech Academy of Sciences Publication Activity Database

    Bobek, J.; Hercík, K.; Dobrová, Zuzana; Branny, Pavel; Nádvorník, Richard; Janeček, Jiří

    2000-01-01

    Roč. 45, č. 4 (2000), s. 310-312 ISSN 0015-5632 R&D Projects: GA ČR GA204/99/1534 Institutional research plan: CEZ:AV0Z5020903 Keywords : streptomycetes * phosphoprotein phosphatase Subject RIV: EE - Microbiology, Virology Impact factor: 0.752, year: 2000

  8. Medicago PhosphoProtein Database: a repository for Medicago truncatula phosphoprotein data

    Directory of Open Access Journals (Sweden)

    Christopher M. Rose

    2012-06-01

    Full Text Available The ability of legume crops to fix atmospheric nitrogen via a symbiotic association with soil rhizobia makes them an essential component of many agricultural systems. Initiation of this symbiosis requires protein phosphorylation-mediated signaling in response to rhizobial signals named Nod factors. Medicago truncatula (Medicago is the model system for studying legume biology, making the study of its phosphoproteome essential. Here, we describe the Medicago Phosphoprotein Database (http://phospho.medicago.wisc.edu, a repository built to house phosphoprotein, phosphopeptide, and phosphosite data specific to Medicago. Currently, the Medicago Phosphoprotein Database holds 3,457 unique phosphopeptides that contain 3,404 non-redundant sites of phosphorylation on 829 proteins. Through the web-based interface, users are allowed to browse identified proteins or search for proteins of interest. Furthermore, we allow users to conduct BLAST searches of the database using both peptide sequences and phosphorylation motifs as queries. The data contained within the database are available for download to be investigated at the user’s discretion. The Medicago Phosphoprotein Database will be updated continually with novel phosphoprotein and phosphopeptide identifications, with the intent of constructing an unparalleled compendium of large-scale Medicago phosphorylation data.

  9. Hypoxic stress-induced changes in ribosomes of maize seedling roots

    International Nuclear Information System (INIS)

    Bailey-Serres, J.; Freeling, M.

    1990-01-01

    The hypoxic stress response of Zea mays L. seedling roots involves regulation of gene expression at transcriptional and posttranscriptional levels. We investigated the effect of hypoxia on the translational machinery of seedling roots. The levels of monoribosomes and ribosomal subunits increased dramatically within 1 hour of stress. Prolonged hypoxia resulted in continued accumulation of nontranslating ribosomes, as well as increased levels of small polyribosomes. The return of seedlings to normal aerobic conditions resulted in recovery of normal polyribosome levels. Comparison of ribosomal proteins from control and hypoxic roots revealed differences in quantity and electrophoretic mobility. In vivo labeling of roots with [ 35 S]methionine revealed variations in newly synthesized ribosomal proteins. In vivo labeling of roots with [ 32 P]orthophosphate revealed a major reduction in the phosphorylation of a 31 kilodalton ribosomal protein in hypoxic stressed roots. In vitro phosphorylation of ribosomal proteins by endogenous kinases was used to probe for differences in ribosome structure and composition. The patterns of in vitro kinased phosphoproteins of ribosomes from control and hypoxic roots were not identical. Variation in phosphoproteins of polyribosomes from control and hypoxic roots, as well as among polyribosomes from hypoxic roots were observed. These results indicate that modification of the translational machinery occurs in response to hypoxic stress

  10. Phosphoproteins in extracellular vesicles as candidate markers for breast cancer.

    Science.gov (United States)

    Chen, I-Hsuan; Xue, Liang; Hsu, Chuan-Chih; Paez, Juan Sebastian Paez; Pan, Li; Andaluz, Hillary; Wendt, Michael K; Iliuk, Anton B; Zhu, Jian-Kang; Tao, W Andy

    2017-03-21

    The state of protein phosphorylation can be a key determinant of cellular physiology such as early-stage cancer, but the development of phosphoproteins in biofluids for disease diagnosis remains elusive. Here we demonstrate a strategy to isolate and identify phosphoproteins in extracellular vesicles (EVs) from human plasma as potential markers to differentiate disease from healthy states. We identified close to 10,000 unique phosphopeptides in EVs isolated from small volumes of plasma samples. Using label-free quantitative phosphoproteomics, we identified 144 phosphoproteins in plasma EVs that are significantly higher in patients diagnosed with breast cancer compared with healthy controls. Several biomarkers were validated in individual patients using paralleled reaction monitoring for targeted quantitation. This study demonstrates that the development of phosphoproteins in plasma EV as disease biomarkers is highly feasible and may transform cancer screening and monitoring.

  11. Phosphoproteins in extracellular vesicles as candidate markers for breast cancer

    OpenAIRE

    Chen, I-Hsuan; Xue, Liang; Hsu, Chuan-Chih; Paez, Juan Sebastian Paez; Pan, Li; Andaluz, Hillary; Wendt, Michael K.; Iliuk, Anton B.; Zhu, Jian-Kang; Tao, W. Andy

    2017-01-01

    Protein phosphorylation is a major regulatory mechanism for many cellular functions, but no phosphoprotein in biofluids has been developed for disease diagnosis because of the presence of active phosphatases. This study presents a general strategy to isolate and identify phosphoproteins in extracellular vesicles (EVs) from human plasma as potential markers to differentiate disease from healthy states. We identified close to 10,000 unique phosphopeptides in EVs from small volumes of plasma sam...

  12. Unphosphorylated rhabdoviridae phosphoproteins form elongated dimers in solution.

    Science.gov (United States)

    Gerard, Francine C A; Ribeiro, Euripedes de Almeida; Albertini, Aurélie A V; Gutsche, Irina; Zaccai, Guiseppe; Ruigrok, Rob W H; Jamin, Marc

    2007-09-11

    The phosphoprotein (P) is an essential component of the replication machinery of rabies virus (RV) and vesicular stomatitis virus (VSV), and the oligomerization of P, potentially controlled by phosphorylation, is required for its function. Up to now the stoichiometry of phosphoprotein oligomers has been controversial. Size exclusion chromatography combined with detection by multiangle laser light scattering shows that the recombinant unphosphorylated phosphoproteins from VSV and from RV exist as dimers in solution. Hydrodynamic analysis indicates that the dimers are highly asymmetric, with a Stokes radius of 4.8-5.3 nm and a frictional ratio larger than 1.7. Small-angle neutron scattering experiments confirm the dimeric state and the asymmetry of the structure and yield a radius of gyration of about 5.3 nm and a cross-sectional radius of gyration of about 1.6-1.8 nm. Similar hydrodynamic properties and molecular dimensions were obtained with a variant of VSV phosphoprotein in which Ser60 and Thr62 are substituted by Asp residues and which has been reported previously to mimic phosphorylation by inducing oligomerization and activating transcription. Here, we show that this mutant also forms a dimer with hydrodynamic properties and molecular dimensions similar to those of the wild type protein. However, incubation at 30 degrees C for several hours induced self-assembly of both wild type and mutant proteins, leading to the formation of irregular filamentous structures.

  13. 12th International Conference on Second Messengers and Phosphoproteins

    Czech Academy of Sciences Publication Activity Database

    Tuháčková, Zdena

    2004-01-01

    Roč. 32, č. 3 (2004), s. 89-91 ISSN 1211-2526. [International conference on second messengers and phosphoproteins /12./. Montreal, 03.08.2004-07.08.2004] R&D Projects: GA ČR GA301/04/0550; GA AV ČR KSK5020115 Institutional research plan: CEZ:AV0Z5052915 Keywords : MTOR -PI3-K signalling * p70 S 6 kinase * v-Src Subject RIV: CE - Biochemistry

  14. A ribosome without RNA

    Directory of Open Access Journals (Sweden)

    Harold S Bernhardt

    2015-11-01

    Full Text Available It was Francis Crick who first asked why the ribosome contains so much RNA, and discussed the implications of this for the direct flow of genetic information from DNA to protein. Remarkable advances in our understanding of the ribosome and protein synthesis, including the recent publication of two mammalian mitochondrial ribosome structures, have shed new light on this intriguing aspect of evolution in molecular biology. We examine here whether RNA is indispensable for coded protein synthesis, or whether an all-protein ‘ribosome’ (or ‘synthosome’ might be possible, with a protein enzyme catalyzing peptide synthesis, and release factor-like protein adaptors able to read a message composed of deoxyribonucleotides. We also compare the RNA world hypothesis with the alternative ‘proteins first’ hypothesis in terms of their different understandings of the evolution of the ribosome, and whether this might have been preceded by an ancestral form of nonribosomal peptide synthesis catalyzed by protein enzymes.

  15. Phosphoprotein phosphatase of bovine spleen cell nuclei: physicochemical properties

    International Nuclear Information System (INIS)

    Rezyapkin, V.I.; Leonova, L.E.; Komkova, A.I.

    1986-01-01

    The physicochemical properties of phosphoprotein phosphatase (EC 1.3.1.16) from bovine spleen cell nuclei were studied. The enzyme possesses broad substrate specificity and catalyzes the dephosphorylation of phosphocasein, ATP, ADP, and p-nitrophenyl phosphate (pNPP). K/sub m/ for ATP, ADP, and pNPP are equal to 0.44, 0.43, and 1.25 mM, respectively. M/sub r/ of the enzyme, according to the data of gel filtraction of Sephadex G-75 and electrophoresis in polyacrylamide gel of various concentrations is ∼ 33,000. In electrophoresis in the presence of SDS, two protein bands with M/sub r/ 12,000 and 18,000 are detected. In the enzyme molecule, acid amino acid residues predominate; two free SH groups and two disulfide bridges are detected. Phosphoprotein phosphatase is a glycoprotein, containing ∼ 22% carbonhydrates. The protein possesses a supplementary absorption maximum at 560 nm. Ammonium molybdate is a competitive inhibitor with K/sub i/ 0.37 μM, while sodium fluoride is a noncompetitive inhibitor with K/sub i/ 1.3 mM. Incubation in the presence of 2 mM phenylmethylsulfonyl fluoride for 25 h leads to a loss of ∼ 46% of the enzymatic activity. Ammonium molybdate, sodium fluoride, and PMSF are reversible inhibitors. Modifications of the SH groups, NH 2 groups, and histidine leads to a decrease in the enzymatic activity. Incubation of phosphoprotein phosphatase with [γ- 32 P]ATP leads to the incorporation of 0.33 mole 33 P per mole of the enzyme. The mechanism of hydrolysis of the phosphodiester bond, catalyzed by the enzyme, is discussed

  16. The effect of complexing phosphoproteins to decalcified collagen on in vitro calcification.

    Science.gov (United States)

    Endo, A; Glimcher, M J

    1989-01-01

    Decalcified samples of chicken bone containing phosphoproteins of varying concentrations were used to assess the effect of phosphoproteins and of protein-bound Ser(P) and Thr(P) in the in vitro nucleation of a Ca-P solid phase from metastable solutions of Ca and P. Phosphoproteins of bone as well as the phosphoproteins from egg yolk (phosvitin) were used. Increasing concentrations of phosphoprotein [as measured by the amount of protein bound Ser(P) and Thr(P)] in the decalcified bone particles significantly reduced the time required for nucleation to occur after exposure to metastable solutions of Ca and P (decreased operational lag times). Treatment with wheat germ acid phosphatase markedly reduced the concentration of Ser(P) and Thr(P) in the decalcified bone samples and in the decalcified bone collagen samples complexed with phosphoproteins (almost to zero). The loss of the organic phosphate groups significantly increased the operational lag time, but did not abolish nucleation of apatite crystals by the bone collagen fibrils essentially devoid of Ser(P) and Thr(P). Bone phosphoproteins were not specific; substitution of phosvitin for bone phosphoproteins as complexes with bone collagen also proved to be effective facilitators of nucleation, which was interesting since both types of phosphoproteins have certain common chemical and structural characteristics. Noncollagenous components other than phosphoproteins were present in the decalcified bone samples. However, the marked dependence of the lag time on the Ser(P) and Thr(P) concentrations and the very marked diminution in the efficacy of the nucleation phenomenon as a result of treatment with wheat germ acid phosphatase, clearly suggests that the organic phosphate residues of the phosphoproteins play a direct and significant role in the process of in vitro nucleation of a solid phase of Ca and P (apatite) by bone collagen, and by implication, possibly in in vivo mineralization as well.

  17. Ribosomal Antibiotics: Contemporary Challenges

    Directory of Open Access Journals (Sweden)

    Tamar Auerbach-Nevo

    2016-06-01

    Full Text Available Most ribosomal antibiotics obstruct distinct ribosomal functions. In selected cases, in addition to paralyzing vital ribosomal tasks, some ribosomal antibiotics are involved in cellular regulation. Owing to the global rapid increase in the appearance of multi-drug resistance in pathogenic bacterial strains, and to the extremely slow progress in developing new antibiotics worldwide, it seems that, in addition to the traditional attempts at improving current antibiotics and the intensive screening for additional natural compounds, this field should undergo substantial conceptual revision. Here, we highlight several contemporary issues, including challenging the common preference of broad-range antibiotics; the marginal attention to alterations in the microbiome population resulting from antibiotics usage, and the insufficient awareness of ecological and environmental aspects of antibiotics usage. We also highlight recent advances in the identification of species-specific structural motifs that may be exploited for the design and the creation of novel, environmental friendly, degradable, antibiotic types, with a better distinction between pathogens and useful bacterial species in the microbiome. Thus, these studies are leading towards the design of “pathogen-specific antibiotics,” in contrast to the current preference of broad range antibiotics, partially because it requires significant efforts in speeding up the discovery of the unique species motifs as well as the clinical pathogen identification.

  18. Expanding the ribosomal universe.

    Science.gov (United States)

    Dinman, Jonathan D; Kinzy, Terri Goss

    2009-12-09

    In this issue of Structure, Taylor et al. (2009) present the most complete model of an eukaryotic ribosome to date. This achievement represents a critical milestone along the path to structurally defining the unique aspects of the eukaryotic protein synthetic machinery.

  19. The Ulip family phosphoproteins--common and specific properties.

    Science.gov (United States)

    Byk, T; Ozon, S; Sobel, A

    1998-05-15

    The search for intracellular phosphoproteins implicated in the regulation of neuronal differentiation led to the identification of Ulip1, a mammalian protein related to the Caenorhabditis elegans unc-33 gene product [Byk, T., Dobransky, T., Cifuentes-Diaz, C. & Sobel, A. (1996) J. Neurosc. 16, 688-701]. The expression level and phosphorylation pattern of Ulip1 were shown to be strongly regulated during development and neuronal differentiation. We have isolated three additional complete coding sequences for members of the Ulip family in the mouse, Ulips 2-4, all preferentially expressed in the nervous system. Furthermore, two Ulip sequences, Ulips A and Ulips B, could be identified in C. elegans. The Ulip family is highly conserved throughout evolution (more than 96 % for Ulips 1-3 and 92.5 % for Ulip4 between mouse and human) and the various members of the family within a single species display about 75% similarity. Sequence comparisons further reveal several highly similar domains and subdomains, including a 32-amino-acid region highly conserved from a bacterial hydantoinase to human Ulips. Two-dimensional immunoblot analysis of in vitro translated Ulips 1-4 demonstrates the existence, for each Ulip protein, of several, most probably differentially phosphorylated forms, in agreement with the presence of conserved phosphorylation consensus sites within their sequences. The expression of Ulips 1-4 mRNAs is differentially regulated during development and nerve-growth-factor-induced neuronal differentiation of PC12 cells. Our results indicate a differential, possibly complementary role of phosphoproteins of the highly conserved Ulip family in the control of neuronal differentiation, in relation with the development and plasticity of the nervous system.

  20. The Phosphorylation of Ribosomal Protein in Lemna minor

    Science.gov (United States)

    Trewavas, A.

    1973-01-01

    Sterile cultures of Lemna minor have been labeled with 32P1, and the ribosomal proteins have been examined for radioactivity. In relatively short term labeling a radioactive protein was found which ran as a single component in both urea/acetic acid and sodium lauryl sulfate gel electrophoresis. Acid hydrolysis of the labeled protein permitted the isolation of serine phosphate. After labeling to equilibrium with 32P1, calculation indicated only 0.6 to 0.75 atom of this protein phosphorus per ribosome. The phosphorylated protein is found in both polysomes and “derived” monomers and appears to be located in the ribosomal small subunit. Its apparent molecular weight is 42,000. Addition of growth-inhibiting concentrations of abscisic acid does not alter the apparent degree of labeling of this protein in 5 hours, but after 24 hours of treatment the total protein phosphorus was reduced from 0.75 atom of phosphorus per ribosome to 0.36 atom of phosphorus per ribosome. PMID:16658405

  1. In vitro degradation of ribosomes.

    Science.gov (United States)

    Mora, G; Rivas, A

    1976-12-01

    The cytoplasmic ribosomes from Euglena gracilis var. bacillaris are found to be of two types taking into consideration their stability "in vitro". In the group of unstable ribosomes the large subunit is degraded. The other group apparently does not suffer any degradation under the conditions described. However the RNAs extracted from both types of ribosomes are degraded during sucrose density gradients. The degradation of the largest RNA species has been reported previously, but no comment has been made about the stability of the ribosome itself.

  2. Analysis of the protein-protein interactions between the human acidic ribosomal P-proteins: evaluation by the two hybrid system

    DEFF Research Database (Denmark)

    Tchórzewski, M; Boldyreff, B; Issinger, O

    2000-01-01

    The surface acidic ribosomal proteins (P-proteins), together with ribosomal core protein P0 form a multimeric lateral protuberance on the 60 S ribosomal subunit. This structure, also called stalk, is important for efficient translational activity of the ribosome. In order to shed more light...... forms the 60 S ribosomal stalk: P0-(P1/P2)(2). Additionally, mutual interactions among human and yeast P-proteins were analyzed. Heterodimer formation could be observed between human P2 and yeast P1 proteins....

  3. Yeast ribosomal proteins

    International Nuclear Information System (INIS)

    Otaka, E.; Kobata, K.

    1978-01-01

    The cytoplasmic 80s ribosomal proteins from the cells of yeast Saccharomyces cerevisiae were analyzed by SDS two-dimensional polyacrylamide gel electrophoresis. Seventyfour proteins were identified and consecutively numbered from 1 to 74. Upon oxidation of the 80s proteins with performic acid, ten proteins (no. 15, 20, 35, 40, 44, 46, 49, 51, 54 and 55) were dislocated on the gel without change of the total number of protein spots. Five proteins (no. 8, 14, 16, 36 and 74) were phosphorylated in vivo as seen in 32 P-labelling experiments. The large and small subunits separated in low magnesium medium were analyzed by the above gel electrophoresis. At least forty-five and twenty-eight proteins were assumed to be in the large and small subunits, respectively. All proteins found in the 80s ribosomes, except for no. 3, were detected in either subunit without appearance of new spots. The acidic protein no. 3 seems to be lost during subunit dissociation. (orig.) [de

  4. The BRCT domain is a phospho-protein binding domain.

    Science.gov (United States)

    Yu, Xiaochun; Chini, Claudia Christiano Silva; He, Miao; Mer, Georges; Chen, Junjie

    2003-10-24

    The carboxyl-terminal domain (BRCT) of the Breast Cancer Gene 1 (BRCA1) protein is an evolutionarily conserved module that exists in a large number of proteins from prokaryotes to eukaryotes. Although most BRCT domain-containing proteins participate in DNA-damage checkpoint or DNA-repair pathways, or both, the function of the BRCT domain is not fully understood. We show that the BRCA1 BRCT domain directly interacts with phosphorylated BRCA1-Associated Carboxyl-terminal Helicase (BACH1). This specific interaction between BRCA1 and phosphorylated BACH1 is cell cycle regulated and is required for DNA damage-induced checkpoint control during the transition from G2 to M phase of the cell cycle. Further, we show that two other BRCT domains interact with their respective physiological partners in a phosphorylation-dependent manner. Thirteen additional BRCT domains also preferentially bind phospho-peptides rather than nonphosphorylated control peptides. These data imply that the BRCT domain is a phospho-protein binding domain involved in cell cycle control.

  5. A portrait of tissue phosphoprotein stability in the clinical tissue procurement process.

    Science.gov (United States)

    Espina, Virginia; Edmiston, Kirsten H; Heiby, Michael; Pierobon, Mariaelena; Sciro, Manuela; Merritt, Barbara; Banks, Stacey; Deng, Jianghong; VanMeter, Amy J; Geho, David H; Pastore, Lucia; Sennesh, Joel; Petricoin, Emanuel F; Liotta, Lance A

    2008-10-01

    Little is known about the preanalytical fluctuations of phosphoproteins during tissue procurement for molecular profiling. This information is crucial to establish guidelines for the reliable measurement of these analytes. To develop phosphoprotein profiles of tissue subjected to the trauma of excision, we measured the fidelity of 53 signal pathway phosphoproteins over time in tissue specimens procured in a community clinical practice. This information provides strategies for potential surrogate markers of stability and the design of phosphoprotein preservative/fixation solutions. Eleven different specimen collection time course experiments revealed augmentation (+/-20% from the time 0 sample) of signal pathway phosphoprotein levels as well as decreases over time independent of tissue type, post-translational modification, and protein subcellular location (tissues included breast, colon, lung, ovary, and uterus (endometrium/myometrium) and metastatic melanoma). Comparison across tissue specimens showed an >20% decrease of protein kinase B (AKT) Ser-473 (p 20% increases within 90-min postprocurement. Endothelial nitric-oxide synthase Ser-1177 did not change over the time period evaluated with breast or leiomyoma tissue. Treatment with phosphatase or kinase inhibitors alone revealed that tissue kinase pathways are active ex vivo. Combinations of kinase and phosphatase inhibitors appeared to stabilize proteins that exhibited increases in the presence of phosphatase inhibitors alone (ATF-2 Thr-71, SAPK/JNK Thr-183/Tyr-185, STAT1 Tyr-701, JAK1 Tyr-1022/1023, and PAK1/PAK2 Ser-199/204/192/197). This time course study 1) establishes the dynamic nature of specific phosphoproteins in excised tissue, 2) demonstrates augmented phosphorylation in the presence of phosphatase inhibitors, 3) shows that kinase inhibitors block the upsurge in phosphorylation of phosphoproteins, 4) provides a rational strategy for room temperature preservation of proteins, and 5) constitutes a

  6. Acidic ribosomal proteins and histone H3 from Leishmania present a high rate of divergence

    Directory of Open Access Journals (Sweden)

    Ysabel Montoya

    2000-08-01

    Full Text Available Another additional peculiarity in Leishmania will be discussed about of the amino acid divergence rate of three structural proteins: acidic ribosomal P1 and P2b proteins, and histone H3 by using multiple sequence alignment and dendrograms. These structural proteins present a high rate of divergence regarding to their homologous protein in Trypanosoma cruzi. At this regard, L. (V. peruviana P1 and T. cruzi P1 showed 57.4% of divergence rate. Likewise, L. (V. braziliensis histone H3 and acidic ribosomal P2 protein exhibited 31.8% and 41.7% respectively of rate of divergence in comparison with their homologous in T. cruzi.

  7. Dynamic modulation of phosphoprotein expression in ovarian cancer xenograft models

    International Nuclear Information System (INIS)

    Koussounadis, Antonis; Langdon, Simon P.; Um, Inhwa; Kay, Charlene; Francis, Kyle E.; Harrison, David J.; Smith, V. Anne

    2016-01-01

    The dynamic changes that occur in protein expression after treatment of a cancer in vivo are poorly described. In this study we measure the effect of chemotherapy over time on the expression of a panel of proteins in ovarian cancer xenograft models. The objective was to identify phosphoprotein and other protein changes indicative of pathway activation that might link with drug response. Two xenograft models, platinum-responsive OV1002 and platinum-unresponsive HOX424, were used. Treatments were carboplatin and carboplatin-paclitaxel. Expression of 49 proteins over 14 days post treatment was measured by quantitative immunofluorescence and analysed by AQUA. Carboplatin treatment in the platinum-sensitive OV1002 model triggered up-regulation of cell cycle, mTOR and DDR pathways, while at late time points WNT, invasion, EMT and MAPK pathways were modulated. Estrogen receptor-alpha (ESR1) and ERBB pathways were down-regulated early, within 24 h from treatment administration. Combined carboplatin-paclitaxel treatment triggered a more extensive response in the OV1002 model modulating expression of 23 of 49 proteins. Therefore the cell cycle and DDR pathways showed similar or more pronounced changes than with carboplatin alone. In addition to expression of pS6 and pERK increasing, components of the AKT pathway were modulated with pAKT increasing while its regulator PTEN was down-regulated early. WNT signaling, EMT and invasion markers were modulated at later time points. Additional pathways were also observed with the NFκB and JAK/STAT pathways being up-regulated. ESR1 was down-regulated as was HER4, while further protein members of the ERBB pathway were upregulated late. By contrast, in the carboplatin-unresponsive HOX 424 xenograft, carboplatin only modulated expression of MLH1 while carboplatin-paclitaxel treatment modulated ESR1 and pMET. Thirteen proteins were modulated by carboplatin and a more robust set of changes by carboplatin-paclitaxel. Early changes included

  8. Electrophoretic demonstration of glycoproteins, lipoproteins, and phosphoproteins in human and bovine enamel

    DEFF Research Database (Denmark)

    Kirkeby, S; Moe, D; Bøg-Hansen, T C

    1990-01-01

    Enamel proteins from fully mineralized human molars and from bovine tooth germs were separated by electrophoresis. The gels were stained for detection of glycoproteins, lipoproteins, and phosphoproteins. Glycoproteins were shown by periodic acid-Schiff staining and lectin blotting. In mature human...... enamel a number of high molecular weight proteins could be demonstrated after ethylenediaminetetra-acetic acid demineralization and subsequent Triton X-100 extraction. These proteins are suggested to be lipoproteins. Phosphoproteins could only be visualized in enamel matrix from the tooth germs....

  9. Neuron-Like Networks Between Ribosomal Proteins Within the Ribosome

    Science.gov (United States)

    Poirot, Olivier; Timsit, Youri

    2016-05-01

    From brain to the World Wide Web, information-processing networks share common scale invariant properties. Here, we reveal the existence of neural-like networks at a molecular scale within the ribosome. We show that with their extensions, ribosomal proteins form complex assortative interaction networks through which they communicate through tiny interfaces. The analysis of the crystal structures of 50S eubacterial particles reveals that most of these interfaces involve key phylogenetically conserved residues. The systematic observation of interactions between basic and aromatic amino acids at the interfaces and along the extension provides new structural insights that may contribute to decipher the molecular mechanisms of signal transmission within or between the ribosomal proteins. Similar to neurons interacting through “molecular synapses”, ribosomal proteins form a network that suggest an analogy with a simple molecular brain in which the “sensory-proteins” innervate the functional ribosomal sites, while the “inter-proteins” interconnect them into circuits suitable to process the information flow that circulates during protein synthesis. It is likely that these circuits have evolved to coordinate both the complex macromolecular motions and the binding of the multiple factors during translation. This opens new perspectives on nanoscale information transfer and processing.

  10. User's manual for THYDE-P1

    International Nuclear Information System (INIS)

    Asahi, Yoshiro

    1982-04-01

    THYDE-P1 is a computer code applicable to LWR (light water reactor) plant dynamics in response to various disturbances. This work is the user's mannual of THYDE-P1 (version SV02L03). The input requirements, steady state adjustment, execution of runs and output specifications are described. (author)

  11. Mechanistic insights into phosphoprotein-binding FHA domains.

    Science.gov (United States)

    Liang, Xiangyang; Van Doren, Steven R

    2008-08-01

    of FHA domains by a bioinformatics approach. The phosphopeptide-dependent dynamics of an FHA domain, SH2 domain, and PTB domain suggest a common theme: rigid, preformed binding surfaces support van der Waals contacts that provide favorable binding enthalpy. Despite the lack of pronounced conformational changes in FHA domains linked to binding events, more subtle adjustments may be possible. In the one FHA domain tested, phosphothreonine peptide binding is accompanied by increased flexibility just outside the binding site and increased rigidity across the beta-sandwich. The folding of the same FHA domain progresses through near-native intermediates that stabilize the recognition loops in the center of the phosphoprotein-binding surface; this may promote rigidity in the interface and affinity for targets phosphorylated on threonine.

  12. Crystallization of the two-domain N-terminal fragment of the archaeal ribosomal protein L10(P0) in complex with a specific fragment of 23S rRNA

    Science.gov (United States)

    Kravchenko, O. V.; Mitroshin, I. V.; Gabdulkhakov, A. G.; Nikonov, S. V.; Garber, M. B.

    2011-07-01

    Lateral L12-stalk (P1-stalk in Archaea, P1/P2-stalk in eukaryotes) is an obligatory morphological element of large ribosomal subunits in all organisms studied. This stalk is composed of the complex of ribosomal proteins L10(P0) and L12(P1) and interacts with 23S rRNA through the protein L10(P0). L12(P1)-stalk is involved in the formation of GTPase center of the ribosome and plays an important role in the ribosome interaction with translation factors. High mobility of this stalk puts obstacles in determination of its structure within the intact ribosome. Crystals of a two-domain N-terminal fragment of ribosomal protein L10(P0) from the archaeon Methanococcus jannaschii in complex with a specific fragment of rRNA from the same organism have been obtained. The crystals diffract X-rays at 3.2 Å resolution.

  13. Crystallization of the two-domain N-terminal fragment of the archaeal ribosomal protein L10(P0) in complex with a specific fragment of 23S rRNA

    Energy Technology Data Exchange (ETDEWEB)

    Kravchenko, O. V.; Mitroshin, I. V.; Gabdulkhakov, A. G.; Nikonov, S. V.; Garber, M. B., E-mail: garber@vega.protres.ru [Institute of Protein Research RAS (Russian Federation)

    2011-07-15

    Lateral L12-stalk (P1-stalk in Archaea, P1/P2-stalk in eukaryotes) is an obligatory morphological element of large ribosomal subunits in all organisms studied. This stalk is composed of the complex of ribosomal proteins L10(P0) and L12(P1) and interacts with 23S rRNA through the protein L10(P0). L12(P1)-stalk is involved in the formation of GTPase center of the ribosome and plays an important role in the ribosome interaction with translation factors. High mobility of this stalk puts obstacles in determination of its structure within the intact ribosome. Crystals of a two-domain N-terminal fragment of ribosomal protein L10(P0) from the archaeon Methanococcus jannaschii in complex with a specific fragment of rRNA from the same organism have been obtained. The crystals diffract X-rays at 3.2 Angstrom-Sign resolution.

  14. Structure of Ribosomal Silencing Factor Bound to Mycobacterium tuberculosis Ribosome.

    Science.gov (United States)

    Li, Xiaojun; Sun, Qingan; Jiang, Cai; Yang, Kailu; Hung, Li-Wei; Zhang, Junjie; Sacchettini, James C

    2015-10-06

    The ribosomal silencing factor RsfS slows cell growth by inhibiting protein synthesis during periods of diminished nutrient availability. The crystal structure of Mycobacterium tuberculosis (Mtb) RsfS, together with the cryo-electron microscopy (EM) structure of the large subunit 50S of Mtb ribosome, reveals how inhibition of protein synthesis by RsfS occurs. RsfS binds to the 50S at L14, which, when occupied, blocks the association of the small subunit 30S. Although Mtb RsfS is a dimer in solution, only a single subunit binds to 50S. The overlap between the dimer interface and the L14 binding interface confirms that the RsfS dimer must first dissociate to a monomer in order to bind to L14. RsfS interacts primarily through electrostatic and hydrogen bonding to L14. The EM structure shows extended rRNA density that it is not found in the Escherichia coli ribosome, the most striking of these being the extended RNA helix of H54a. Copyright © 2015 Elsevier Ltd. All rights reserved.

  15. 5S rRNA and ribosome.

    Science.gov (United States)

    Gongadze, G M

    2011-12-01

    5S rRNA is an integral component of the ribosome of all living organisms. It is known that the ribosome without 5S rRNA is functionally inactive. However, the question about the specific role of this RNA in functioning of the translation apparatus is still open. This review presents a brief history of the discovery of 5S rRNA and studies of its origin and localization in the ribosome. The previously expressed hypotheses about the role of this RNA in the functioning of the ribosome are discussed considering the unique location of 5S rRNA in the ribosome and its intermolecular contacts. Based on analysis of the current data on ribosome structure and its functional complexes, the role of 5S rRNA as an intermediary between ribosome functional domains is discussed.

  16. Structural dissection of human metapneumovirus phosphoprotein using small angle x-ray scattering.

    Science.gov (United States)

    Renner, Max; Paesen, Guido C; Grison, Claire M; Granier, Sébastien; Grimes, Jonathan M; Leyrat, Cédric

    2017-11-01

    The phosphoprotein (P) is the main and essential cofactor of the RNA polymerase (L) of non-segmented, negative-strand RNA viruses. P positions the viral polymerase onto its nucleoprotein-RNA template and acts as a chaperone of the nucleoprotein (N), thereby preventing nonspecific encapsidation of cellular RNAs. The phosphoprotein of human metapneumovirus (HMPV) forms homotetramers composed of a stable oligomerization domain (P core ) flanked by large intrinsically disordered regions (IDRs). Here we combined x-ray crystallography of P core with small angle x-ray scattering (SAXS)-based ensemble modeling of the full-length P protein and several of its fragments to provide a structural description of P that captures its dynamic character, and highlights the presence of varyingly stable structural elements within the IDRs. We discuss the implications of the structural properties of HMPV P for the assembly and functioning of the viral transcription/replication machinery.

  17. Combined use of nuclear phosphoprotein c-Myc and cellular phosphoprotein p53 for hepatocellular carcinoma detection in high-risk chronic hepatitis C patients.

    Science.gov (United States)

    Attallah, A M; El-Far, M; Abdelrazek, M A; Omran, M M; Attallah, A A; Elkhouly, A A; Elkenawy, H M; Farid, K

    2017-10-01

    Hepatocellular carcinoma (HCC) is a multistage process resulting from various genetic changes. We aimed to determine nuclear phosphoprotein c-Myc and cellular phosphoprotein p53 expression and to evaluate their importance in HCC diagnosis. One hundred and twenty chronic hepatitis C (CHC) patients (60 non-HCC CHC patients and 60 HCC patients who had a single small (c-Myc and p53 were identified in liver tissues and serum samples using immunostaining, western blot and ELISA. Immunohistochemical detection of c-Myc and p53 with monospecific antibodies revealed intense and diffuse cytoplasmic staining patterns. Accumulated mutant proteins, released from tumour cells into the extracellular serum, were detected at 62 KDa, for c-Myc, and 53 KDa, for p53, using western blotting. In contrast to alpha feto-protein, there was a significant increase (p c-Myc (86.7% vs. 6.7%) and p53 (78.3% vs. 8.3%) in the malignant vs. non-malignant patients. The parallel combination of c-Myc and p53 reach the absolute sensitivity (100%), for more accurate and reliable HCC detection (specificity was 87%). c-Myc and p53 are potential HCC diagnostic biomarkers, and convenient combinations of them could improve diagnostic accuracy of HCC.

  18. Inhibition of hydroxyapatite growth by casein, a potential salivary phosphoprotein homologue.

    Science.gov (United States)

    Romero, Maria J R H; Nakashima, Syozi; Nikaido, Toru; Ichinose, Shizuko; Sadr, Alireza; Tagami, Junji

    2015-08-01

    Salivary phosphoproteins are essential in tooth mineral regulation but are often overlooked in vitro. This study aimed to evaluate the effect of casein, as a salivary phosphoprotein homologue, on the deposition and growth of hydroxyapatite (HA) on tooth surfaces. Hydroxyapatite growth was quantified using seeded crystal systems. Artificial saliva (AS) containing HA powder and 0, 10, 20, 50, or 100 μg ml(-1) of casein, or 100 μg ml(-1) of dephosphorylated casein (Dcasein), was incubated for 0-8 h at 37°C, pH 7.2. Calcium concentrations were measured using atomic absorption spectroscopy (AAS). Surface precipitation of HA on bovine enamel and dentine blocks, incubated in similar conditions for 7 d, was examined using field emission scanning electron microscopy (FE-SEM) and transmission electron microscopy (TEM) with selected area electron diffraction (SAED). Casein adsorption was assessed using modified Lowry assays and zeta-potential measurements. The AAS results revealed a concentration-dependent inhibition of calcium consumption. Hydroxyapatite precipitation occurred when no casein was present, whereas precipitation of HA was apparently completely inhibited in casein-containing groups. Adsorption data demonstrated increasingly negative zeta-potential with increased casein concentration and an affinity constant similar to proline-rich proteins with Langmuir modelling. Casein inhibited the deposition and growth of HA primarily through the binding of esterized phosphate to HA active sites, indicating its potential as a mineral-regulating salivary phosphoprotein homologue in vitro. © 2015 Eur J Oral Sci.

  19. IDENTIFICATION AND FUNCTIONAL ANNOTATION OF APOPLASTIC PHOSPHOPROTEINS OF HIPPOPHAE RHAMNOIDES SEEDLINGS

    Directory of Open Access Journals (Sweden)

    Ravi Gupta

    2016-12-01

    Full Text Available Phosphorylation is a reversible switch that regulates the biological activities of the proteins. Although there are ample of reports on the plant phosphoproteome analysis, phosphorylation status of apoplastic proteins has not been investigated profoundly. Here a shotgun proteomics approach was used to identify the phosphoproteins from the apoplast of the Hippophae rhamnoides (Seabuckthorn. A total of 123 phosphoproteins were identified using an SYNAPT G2 quadrupole time-of-flight mass spectrometer (Q-ToF-MS. Functional annotation of the identified phosphoproteins using PANTHER, Gene ontology, and KEGG programs showed that the majority of proteins were associated with the transporter, nucleic acid binding and amino acid metabolic activities. Prediction of secretory nature of the identified proteins using SignalP and SecretomeP servers showed that 56 % of the proteins were secretory, while rest of the 44 % of the proteins were non-secretory. PhosPhAt 4.0 detected 534 putative phosphorylation sites in the 75 unique Arabidopsis annotated proteins, wherein 195 (36% were on the serine residue, 196 (37% were on the threonine residue and 143 (27% were detected on the tyrosine residue. Taken together, our results provide the first insight into the phosphorylation-mediated regulation of apoplastic proteins by cellular processes, which would be helpful in an in-depth understanding of the apoplastic signaling

  20. Sustained mitogen-activated protein kinase activation reprograms defense metabolism and phosphoprotein profile in Arabidopsis thaliana.

    Directory of Open Access Journals (Sweden)

    Ines eLassowskat

    2014-10-01

    Full Text Available Mitogen-activated protein kinases (MAPKs target a variety of protein substrates to regulate cellular signaling processes in eukaryotes. In plants, the number of identified MAPK substrates that control plant defense responses is still limited. Here, we generated transgenic Arabidopsis thaliana plants with an inducible system to simulate in vivo activation of two stress-activated MAPKs, MPK3 and MPK6. Metabolome analysis revealed that this artificial MPK3/6 activation (without any exposure to pathogens or other stresses is sufficient to drive the production of major defense-related metabolites, including various camalexin, indole glucosinolate and agmatine derivatives. An accompanying (phosphoproteome analysis led to detection of hundreds of potential phosphoproteins downstream of MPK3/6 activation. Besides known MAPK substrates, many candidates on this list possess typical MAPK-targeted phosphosites and in many cases, the corresponding phosphopeptides were detected by mass spectrometry. Notably, several of these putative phosphoproteins have been reported to be associated with the biosynthesis of antimicrobial defense substances (e.g. WRKY transcription factors and proteins encoded by the genes from the PEN pathway required for penetration resistance to filamentous pathogens. Thus, this work provides an inventory of candidate phosphoproteins, including putative direct MAPK substrates, for future analysis of MAPK-mediated defense control. (Proteomics data are available with the identifier PXD001252 via ProteomeXchange, http://proteomecentral.proteomexchange.org.

  1. Arithmetically Cohen-Macaulay sets of points in P^1 x P^1

    CERN Document Server

    Guardo, Elena

    2015-01-01

    This brief presents a solution to the interpolation problem for arithmetically Cohen-Macaulay (ACM) sets of points in the multiprojective space P^1 x P^1.  It collects the various current threads in the literature on this topic with the aim of providing a self-contained, unified introduction while also advancing some new ideas.  The relevant constructions related to multiprojective spaces are reviewed first, followed by the basic properties of points in P^1 x P^1, the bigraded Hilbert function, and ACM sets of points.  The authors then show how, using a combinatorial description of ACM points in P^1 x P^1, the bigraded Hilbert function can be computed and, as a result, solve the interpolation problem.  In subsequent chapters, they consider fat points and double points in P^1 x P^1 and demonstrate how to use their results to answer questions and problems of interest in commutative algebra.  Throughout the book, chapters end with a brief historical overview, citations of related results, and, where relevan...

  2. Control of ribosome formation in rat heart

    International Nuclear Information System (INIS)

    Russo, L.A.

    1987-01-01

    Diabetes of 9 days duration produced a 17% diminution in the rate of total protein synthesis in rat hearts perfused as Langendorff preparations supplied with glucose, plasma levels of amino acids, and 400 μU/ml insulin. This reduction was attributable to a decrease in efficiency of protein synthesis and total RNA content. Total messenger RNA content decreased in diabetic hearts in proportion to the reduction in total RNA. Diabetes also resulted in diminished ribosome content as reflected by the induction in total RNA. Ribosome production was investigated by monitoring incorporation of [ 3 H]phenylalanine into the proteins of cytoplasmic ribosomes. Rates of ribosome formation in diabetic hearts were as fast as control rates in the presence of insulin, and were faster than control rates in the absence of the hormone. These results indicated that ribosome content fell in diabetic hearts despite unchanged or faster rates of ribosome formation

  3. Co-Higgs bundles on P^1

    OpenAIRE

    Rayan, Steven

    2010-01-01

    Co-Higgs bundles are Higgs bundles in the sense of Simpson, but with Higgs fields that take values in the tangent bundle instead of the cotangent bundle. Given a vector bundle on P^1, we find necessary and sufficient conditions on its Grothendieck splitting for it to admit a stable Higgs field. We characterize the rank-2, odd-degree moduli space as a universal elliptic curve with a globally-defined equation. For ranks r=2,3,4, we explicitly verify the conjectural Betti numbers emerging from t...

  4. Ribosomal protein methyltransferases in the yeast Saccharomyces cerevisiae: Roles in ribosome biogenesis and translation.

    Science.gov (United States)

    Al-Hadid, Qais; White, Jonelle; Clarke, Steven

    2016-02-12

    A significant percentage of the methyltransferasome in Saccharomyces cerevisiae and higher eukaryotes is devoted to methylation of the translational machinery. Methylation of the RNA components of the translational machinery has been studied extensively and is important for structure stability, ribosome biogenesis, and translational fidelity. However, the functional effects of ribosomal protein methylation by their cognate methyltransferases are still largely unknown. Previous work has shown that the ribosomal protein Rpl3 methyltransferase, histidine protein methyltransferase 1 (Hpm1), is important for ribosome biogenesis and translation elongation fidelity. In this study, yeast strains deficient in each of the ten ribosomal protein methyltransferases in S. cerevisiae were examined for potential defects in ribosome biogenesis and translation. Like Hpm1-deficient cells, loss of four of the nine other ribosomal protein methyltransferases resulted in defects in ribosomal subunit synthesis. All of the mutant strains exhibited resistance to the ribosome inhibitors anisomycin and/or cycloheximide in plate assays, but not in liquid culture. Translational fidelity assays measuring stop codon readthrough, amino acid misincorporation, and programmed -1 ribosomal frameshifting, revealed that eight of the ten enzymes are important for translation elongation fidelity and the remaining two are necessary for translation termination efficiency. Altogether, these results demonstrate that ribosomal protein methyltransferases in S. cerevisiae play important roles in ribosome biogenesis and translation. Copyright © 2016 Elsevier Inc. All rights reserved.

  5. A photoaffinity scan maps regions of the p85 SH2 domain involved in phosphoprotein binding.

    Science.gov (United States)

    Williams, K P; Shoelson, S E

    1993-03-15

    Src homology 2 (SH2) domains are modular phosphotyrosine binding pockets found within a wide variety of cytoplasmic signaling molecules. Here we develop a new approach to analyzing protein-protein interfaces termed photoaffinity scanning, and apply the method to map regions of the phosphatidylinositol 3-kinase p85 SH2 domain that participate in phospho-protein binding. Each residue except phosphotyrosine (pY) within a tightly binding, IRS-1-derived phosphopeptide (GNGDpYMPMSPKS) was substituted with the photoactive amino acid, benzoylphenylalanine (Bpa). Whereas most substitutions had little effect on binding affinity, Bpa substitution of either Met (+1 and +3 with respect to pY) reduced affinity 50-100-fold to confirm their importance in the pYMXM recognition motif. In three cases photolysis of SH2 domain/Bpa phosphopeptide complexes led to cross-linking of > 50% of the SH2 domain; cross-link positions were identified by microsequence, amino acid composition, and electrospray mass spectrometric analyses. Bpa-1 cross-links within alpha-helix I, whereas Bpa+1 and Bpa+4 cross-link the SH2 domain within the flexible loop C-terminal to alpha-helix II. Moreover, cross-linking at any position prevents SH2 domain cleavage at a trypsin-sensitive site within the flexible loop between beta-strands 1 and 2. Therefore, at least three distinct SH2 regions in addition to the beta-sheet participate in phosphoprotein binding; the loop cross-linked by phosphopeptide residues C-terminal to pY appears to confer specificity to the phosphoprotein/SH2 domain interaction.

  6. Characterization of the interactions between the nucleoprotein and the phosphoprotein of Henipavirus.

    Science.gov (United States)

    Habchi, Johnny; Blangy, Stéphanie; Mamelli, Laurent; Jensen, Malene Ringkjøbing; Blackledge, Martin; Darbon, Hervé; Oglesbee, Michael; Shu, Yaoling; Longhi, Sonia

    2011-04-15

    The Henipavirus genome is encapsidated by the nucleoprotein (N) within a helical nucleocapsid that recruits the polymerase complex via the phosphoprotein (P). In a previous study, we reported that in henipaviruses, the N-terminal domain of the phosphoprotein and the C-terminal domain of the nucleoprotein (N(TAIL)) are both intrinsically disordered. Here we show that Henipavirus N(TAIL) domains are also disordered in the context of full-length nucleoproteins. We also report the cloning, purification, and characterization of the C-terminal X domains (P(XD)) of Henipavirus phosphoproteins. Using isothermal titration calorimetry, we show that N(TAIL) and P(XD) form a 1:1 stoichiometric complex that is stable under NaCl concentrations as high as 1 M and has a K(D) in the μM range. Using far-UV circular dichroism and nuclear magnetic resonance, we show that P(XD) triggers an increase in the α-helical content of N(TAIL). Using fluorescence spectroscopy, we show that P(XD) has no impact on the chemical environment of a Trp residue introduced at position 527 of the Henipavirus N(TAIL) domain, thus arguing for the lack of stable contacts between the C termini of N(TAIL) and P(XD). Finally, we present a tentative structural model of the N(TAIL)-P(XD) interaction in which a short, order-prone region of N(TAIL) (α-MoRE; amino acids 473-493) adopts an α-helical conformation and is embedded between helices α2 and α3 of P(XD), leading to a relatively small interface dominated by hydrophobic contacts. The present results provide the first detailed experimental characterization of the N-P interaction in henipaviruses and designate the N(TAIL)-P(XD) interaction as a valuable target for rational antiviral approaches.

  7. Phosphoric acid as a matrix additive for MALDI MS analysis of phosphopeptides and phosphoproteins

    DEFF Research Database (Denmark)

    Kjellström, Sven; Jensen, Ole Nørregaard

    2004-01-01

    Phosphopeptides are often detected with low efficiency by MALDI MS analysis of peptide mixtures. In an effort to improve the phosphopeptide ion response in MALDI MS, we investigated the effects of adding low concentrations of organic and inorganic acids during peptide sample preparation in 2,5-di...... acid to 2,5-DHB were also observed in LC-MALDI-MS analysis of tryptic phosphopeptides of B. subtilis PrkC phosphoprotein. Finally, the mass resolution of MALDI mass spectra of intact proteins was significantly improved by using phosphoric acid in 2,5-DHB matrix....

  8. Modulation of cellular phosphoprotein profiles in transformation and redifferentiation of murine and embryonic fibroblastic cells

    International Nuclear Information System (INIS)

    Chakrabarty, Subhas; Brattain, M.G.

    1985-01-01

    Cellular phosphoprotein profiles from normal mouse embryonic fibroblast AKR-2B cells were compared to those of their permanently, chemically transformed malignant counterparts AKR-MCA cells, and AKR-2B cells reversibly transformed by transforming growth factor (AKR-TGF). Similar 32 P-phosphorylation profiles were observed for both the AKR-TGF and AKR-MCA cells which were distinct from that of the normal AKR-2B cells. Dimethylformamide (DMF)-induced differentiation of the AKR-MCA cells resulted in restoration of the normal AKR-2B phosphorylation profile to the malignant AKR-MCA cells. (author)

  9. Trapping the ribosome to control gene expression.

    Science.gov (United States)

    Boehringer, Daniel; Ban, Nenad

    2007-09-21

    Protein synthesis is often regulated by structured mRNAs that interact with ribosomes. In this issue of Cell, Marzi et al. (2007) provide insights into the autoregulation of protein S15 by visualizing the folded repressor mRNA on the ribosome stalled in the preinitiation state. These results have implications for our understanding of the mechanism of translation initiation in general.

  10. Differential Stoichiometry among Core Ribosomal Proteins

    Directory of Open Access Journals (Sweden)

    Nikolai Slavov

    2015-11-01

    Full Text Available Understanding the regulation and structure of ribosomes is essential to understanding protein synthesis and its dysregulation in disease. While ribosomes are believed to have a fixed stoichiometry among their core ribosomal proteins (RPs, some experiments suggest a more variable composition. Testing such variability requires direct and precise quantification of RPs. We used mass spectrometry to directly quantify RPs across monosomes and polysomes of mouse embryonic stem cells (ESC and budding yeast. Our data show that the stoichiometry among core RPs in wild-type yeast cells and ESC depends both on the growth conditions and on the number of ribosomes bound per mRNA. Furthermore, we find that the fitness of cells with a deleted RP-gene is inversely proportional to the enrichment of the corresponding RP in polysomes. Together, our findings support the existence of ribosomes with distinct protein composition and physiological function.

  11. Differential expression of proteins and phosphoproteins during larval metamorphosis of the polychaete Capitella sp. I

    Directory of Open Access Journals (Sweden)

    Qian Pei-Yuan

    2011-09-01

    Full Text Available Abstract Background The spontaneous metamorphosis of the polychaete Capitella sp. I larvae into juveniles requires minor morphological changes, including segment formation, body elongation, and loss of cilia. In this study, we investigated changes in the expression patterns of both proteins and phosphoproteins during the transition from larvae to juveniles in this species. We used two-dimensional gel electrophoresis (2-DE followed by multiplex fluorescent staining and MALDI-TOF mass spectrometry analysis to identify the differentially expressed proteins as well as the protein and phosphoprotein profiles of both competent larvae and juveniles. Results Twenty-three differentially expressed proteins were identified in the two developmental stages. Expression patterns of two of those proteins were examined at the protein level by Western blot analysis while seven were further studied at the mRNA level by real-time PCR. Results showed that proteins related to cell division, cell migration, energy storage and oxidative stress were plentifully expressed in the competent larvae; in contrast, proteins involved in oxidative metabolism and transcriptional regulation were abundantly expressed in the juveniles. Conclusion It is likely that these differentially expressed proteins are involved in regulating the larval metamorphosis process and can be used as protein markers for studying molecular mechanisms associated with larval metamorphosis in polychaetes.

  12. Differential expression of proteins and phosphoproteins during larval metamorphosis of the polychaete Capitella sp. I

    KAUST Repository

    Chandramouli, Kondethimmanahalli

    2011-09-03

    Background: The spontaneous metamorphosis of the polychaete Capitella sp. I larvae into juveniles requires minor morphological changes, including segment formation, body elongation, and loss of cilia. In this study, we investigated changes in the expression patterns of both proteins and phosphoproteins during the transition from larvae to juveniles in this species. We used two-dimensional gel electrophoresis (2-DE) followed by multiplex fluorescent staining and MALDI-TOF mass spectrometry analysis to identify the differentially expressed proteins as well as the protein and phosphoprotein profiles of both competent larvae and juveniles.Results: Twenty-three differentially expressed proteins were identified in the two developmental stages. Expression patterns of two of those proteins were examined at the protein level by Western blot analysis while seven were further studied at the mRNA level by real-time PCR. Results showed that proteins related to cell division, cell migration, energy storage and oxidative stress were plentifully expressed in the competent larvae; in contrast, proteins involved in oxidative metabolism and transcriptional regulation were abundantly expressed in the juveniles.Conclusion: It is likely that these differentially expressed proteins are involved in regulating the larval metamorphosis process and can be used as protein markers for studying molecular mechanisms associated with larval metamorphosis in polychaetes. © 2011 Chandramouli et al; licensee BioMed Central Ltd.

  13. Differential expression of proteins and phosphoproteins during larval metamorphosis of the polychaete Capitella sp. I

    KAUST Repository

    Chandramouli, Kondethimmanahalli; Soo, Lisa; Qian, Pei-Yuan

    2011-01-01

    Background: The spontaneous metamorphosis of the polychaete Capitella sp. I larvae into juveniles requires minor morphological changes, including segment formation, body elongation, and loss of cilia. In this study, we investigated changes in the expression patterns of both proteins and phosphoproteins during the transition from larvae to juveniles in this species. We used two-dimensional gel electrophoresis (2-DE) followed by multiplex fluorescent staining and MALDI-TOF mass spectrometry analysis to identify the differentially expressed proteins as well as the protein and phosphoprotein profiles of both competent larvae and juveniles.Results: Twenty-three differentially expressed proteins were identified in the two developmental stages. Expression patterns of two of those proteins were examined at the protein level by Western blot analysis while seven were further studied at the mRNA level by real-time PCR. Results showed that proteins related to cell division, cell migration, energy storage and oxidative stress were plentifully expressed in the competent larvae; in contrast, proteins involved in oxidative metabolism and transcriptional regulation were abundantly expressed in the juveniles.Conclusion: It is likely that these differentially expressed proteins are involved in regulating the larval metamorphosis process and can be used as protein markers for studying molecular mechanisms associated with larval metamorphosis in polychaetes. © 2011 Chandramouli et al; licensee BioMed Central Ltd.

  14. Pre-crisis mouse cells show strain-specific covariation in the amount of 54-kilodalton phosphoprotein and in susceptibility to transformation by simian virus 40.

    Science.gov (United States)

    Chen, S; Blanck, G; Pollack, R E

    1983-09-01

    We have used several inbred mouse strains to examine the role of the 54-kilodalton (kDa) cellular phosphoprotein in transformation by the papovavirus simian virus 40. We have measured the endogenous 54-kDa phosphoprotein in cells obtained from these inbred mouse strains. To study the effect of passage, cell cultures were measured for amount of the 54-kDa phosphoprotein at the 2nd and 12th passages. In the absence of any transforming agent, the amount of endogenous 54-kDa phosphoprotein in early pre-crisis mouse cells varied in a strain-specific way. Transformation frequency varied coordinately with endogenous 54-kDa expression. Mouse strains whose cells produced a high level of endogenous 54-kDa phosphoprotein on passage did not further increase its expression after simian virus 40 transformation.

  15. Cloning of a cDNA encoding a novel human nuclear phosphoprotein belonging to the WD-40 family

    DEFF Research Database (Denmark)

    Honoré, B; Leffers, H; Madsen, Peder

    1994-01-01

    We have cloned and expressed in vaccinia virus a cDNA encoding an ubiquitous 501-amino-acid (aa) phosphoprotein that corresponds to protein IEF SSP 9502 (79,400 Da, pI 4.5) in the master 2-D-gel keratinocyte protein database [Celis et al., Electrophoresis 14 (1993) 1091-1198]. The deduced aa...

  16. Identification of nuclear phosphoproteins as novel tobacco markers in mouse lung tissue following short-term exposure to tobacco smoke

    Directory of Open Access Journals (Sweden)

    Kanako Niimori-Kita

    2014-01-01

    Full Text Available Smoking is a risk factor for lung diseases, including chronic obstructive pulmonary disease and lung cancer. However, the molecular mechanisms mediating the progression of these diseases remain unclear. Therefore, we sought to identify signaling pathways activated by tobacco-smoke exposure, by analyzing nuclear phosphoprotein expression using phosphoproteomic analysis of lung tissue from mice exposed to tobacco smoke. Sixteen mice were exposed to tobacco smoke for 1 or 7 days, and the expression of phosphorylated peptides was analyzed by mass spectrometry. A total of 253 phosphoproteins were identified, including FACT complex subunit SPT16 in the 1-day exposure group, keratin type 1 cytoskeletal 18 (K18, and adipocyte fatty acid-binding protein, in the 7-day exposure group, and peroxiredoxin-1 (OSF3 and spectrin β chain brain 1 (SPTBN1, in both groups. Semi-quantitative analysis of the identified phosphoproteins revealed that 33 proteins were significantly differentially expressed between the control and exposed groups. The identified phosphoproteins were classified according to their biological functions. We found that the identified proteins were related to inflammation, regeneration, repair, proliferation, differentiation, morphogenesis, and response to stress and nicotine. In conclusion, we identified proteins, including OSF3 and SPTBN1, as candidate tobacco smoke-exposure markers; our results provide insights into the mechanisms of tobacco smoke-induced diseases.

  17. Molecular dynamics simulation of ribosome jam

    KAUST Repository

    Matsumoto, Shigenori; Takagi, Fumiko; Shimada, Takashi; Ito, Nobuyasu

    2011-01-01

    We propose a coarse-grained molecular dynamics model of ribosome molecules to study the dependence of translation process on environmental parameters. We found the model exhibits traffic jam property, which is consistent with an ASEP model. We

  18. Ribosome evolution: Emergence of peptide synthesis machinery

    Indian Academy of Sciences (India)

    suggested the dynamic movement of ribosomal proteins. The L2 protein (a .... Such kinds of interactions are important in elucidating the evolution of RNA .... Tamura K 2009 Molecular handedness of life: significance of RNA aminoacylation.

  19. Is The Ribosome Targeted By Adaptive Mutations

    DEFF Research Database (Denmark)

    Jimenez Fernandez, Alicia; Molin, Søren; Johansen, Helle Krogh

    2015-01-01

    Introduction: RNA polymerase and ribosomes, composing the macromolecular synthesis machinery (MMSM), carry out the central processes of transcription and translation, but are usually seen as mechanical elements with no regulatory function. Extensive investigations of gene regulation and the high ...

  20. Proteomic analysis of phosphoproteins sensitive to a phosphatidylinositol 3-kinase inhibitor, ZSTK474, by using SELDI-TOF MS

    Directory of Open Access Journals (Sweden)

    Yamori Takao

    2009-03-01

    Full Text Available Abstract Background Phosphoproteins play important roles in a vast series of biological processes. Recent proteomic technologies offer the comprehensive analyses of phosphoproteins. Recently, we demonstrated that surface-enhanced laser desorption/ionization time of flight mass (SELDI-TOF MS would detect phosphoproteins quantitatively, which was a new application of SELDI-TOF MS. Results We combined immobilized metal affinity chromatography (IMAC with SELDI-TOF MS. After SELDI-TOF MS analysis of IMAC-enrichment phosphoproteins from A549 cancer cells, a series of protein peaks at 12.9, 12.8, 12.7 and 12.6 kDa was obtained in a mass spectrum. The peak intensities of these proteins decreased after a phosphatase treatment and, interestingly, they also decreased when the cells were pre-treated with a novel phosphatidylinositol 3-kinase (PI3K inhibitor, ZSTK474, suggesting that these proteins were ZSTK474-sensitive phosphoproteins. Identity of the phosphoproteins, which were predicted as the multi-phosphorylated forms of 4E-binding protein 1 (4E-BP1 with the aid of TagIdent algorithm, was confirmed by immunoprecipitation and subsequent SELDI-TOF MS analysis. 4E-BP1 is a downstream component of the PI3K/Akt/mTOR pathway and it regulates protein synthesis. We also investigated the effect of ZSTK474 on 4E-BP1 phosphorylation using phospho-specific antibodies. ZSTK474, which have little inhibitory activity for mTOR, inhibited phosphorylation of Ser65, Thr70 and Thr37/46 in 4E-BP1. In contrast, rapamycin, an inhibitor of mTOR, blocked phosphorylation only of Ser65 and Thr70. These results suggest that ZSTK474 and rapamycin inhibited the phosphorylation of 4E-BP1 in a different manner. Conclusion We identified a group of ZSTK474-sensitive phosphoproteins as the multi-phosphorylated form of 4E-BP1 by combining IMAC, SELDI-TOF MS and antibodies.

  1. An unusual internal ribosomal entry site of inverted symmetry directs expression of a potato leafroll polerovirus replication-associated protein

    Science.gov (United States)

    Jaag, Hannah Miriam; Kawchuk, Lawrence; Rohde, Wolfgang; Fischer, Rainer; Emans, Neil; Prüfer, Dirk

    2003-01-01

    Potato leafroll polerovirus (PLRV) genomic RNA acts as a polycistronic mRNA for the production of proteins P0, P1, and P2 translated from the 5′-proximal half of the genome. Within the P1 coding region we identified a 5-kDa replication-associated protein 1 (Rap1) essential for viral multiplication. An internal ribosome entry site (IRES) with unusual structure and location was identified that regulates Rap1 translation. Core structural elements for internal ribosome entry include a conserved AUG codon and a downstream GGAGAGAGAGG motif with inverted symmetry. Reporter gene expression in potato protoplasts confirmed the internal ribosome entry function. Unlike known IRES motifs, the PLRV IRES is located completely within the coding region of Rap1 at the center of the PLRV genome. PMID:12835413

  2. Synthetic peptides and ribosomal proteins as substrate for 60S ribosomal protein kinase from yeast cells

    DEFF Research Database (Denmark)

    Grankowski, N; Gasior, E; Issinger, O G

    1993-01-01

    Kinetic studies on the 60S protein kinase were conducted with synthetic peptides and ribosomal proteins as substrate. Peptide RRREEESDDD proved to be the best synthetic substrate for this enzyme. The peptide has a sequence of amino acids which most closely resembles the structure of potential...... phosphorylation sites in natural substrates, i.e., acidic ribosomal proteins. The superiority of certain kinetic parameters for 60S kinase obtained with the native whole 80S ribosomes over those of the isolated fraction of acidic ribosomal proteins indicates that the affinity of 60S kinase to the specific protein...

  3. Crystallization of ribosomes from Thermus thermophilus

    International Nuclear Information System (INIS)

    Karpova, E.A.; Serdyuk, I.N.; Tarkhovskii, Yu.S.; Orlova, E.V.; Borovyagin, V.L.

    1987-01-01

    An understanding of the molecular bases of the process of protein biosynthesis on the ribosome requires a knowledge of its structure with high three-dimensional resolution involving the method of x-ray crystallographic analysis. The authors report on the production of crystals of the 70S ribosomes from a new source - the highly thermophilic bacterium Thermus thermophilus. Ribosomes for crystallization were obtained from Th. thermophilus strain HB8 by two washings in buffer with high ionic strength. The ribosome preparation was investigated for homogeneity by the method of high-speed sedimentation in a buffer containing 15 mM MgCl 2 , 50 mM NH 4 Cl, and 10 MM Tris-HCl, pH 7.5. Analysis showed that the preparation if homogeneous. The same preparation was investigated for intactness of ribosomal RNA by the method of gel electrophoresis in 2.75% acrylamide 0.5% agarose gel in a buffer containing 30 mM Tris, 30 mM NaH 2 PO 4 , 10 mM EDTA, 1-2% SDS, and 6 M urea. Analysis showed that the preparation possesses intact 16S and 23S RNA. The latter did not degrade, at least in a week of exposure of the ribosomes in buffer solution at 5 0 C. The ribosome preparation had no appreciable RNase activity, which was verified by incubating 4.5 micrograms of ribosomes with 3 micrograms of 14 C-labeled 16S rRna (50 0 C, 90 min) in a buffer containing 10 mM MgCl 2 , 100 mM NH 4 Cl, and 10 mM Tris-HCl, pH/sub 20 0 / 7.5. The incubated nonhydrolyzed RNA was precipitated with 5% trichloroacetic acid and applied on a GF/C filter. The radioactivity was determined in a toluene scintillator on an LS-100C counter

  4. Comparative profiling of sarcoplasmic phosphoproteins in ovine muscle with different color stability.

    Science.gov (United States)

    Li, Meng; Li, Zheng; Li, Xin; Xin, Jianzeng; Wang, Ying; Li, Guixia; Wu, Liguo; Shen, Qingwu W; Zhang, Dequan

    2018-02-01

    The phosphorylation of sarcoplasmic proteins in postmortem muscles was investigated in relationship to color stability in the present study. Although no difference was observed in the global phosphorylation level of sarcoplasmic proteins, difference was determined in the phosphorylation levels of individual protein bands from muscles with different color stability. Correlation analysis and liquid chromatography - tandem mass spectrometry (LC-MS/MS) identification of phosphoproteins showed that most of the color stability-related proteins were glycolytic enzymes. Interestingly, the phosphorylation level of myoglobin was inversely related to meat color stability. As the phosphorylation of myoglobin increased, color stability based on a ∗ value decreased and metMb content increased. In summary, the study revealed that protein phosphorylation might play a role in the regulation of meat color stability probably by regulating glycolysis and the redox stability of myoglobin, which might be affected by the phosphorylation of myoglobin. Copyright © 2017 Elsevier Ltd. All rights reserved.

  5. Structure of the C-terminal domain of lettuce necrotic yellows virus phosphoprotein.

    Science.gov (United States)

    Martinez, Nicolas; Ribeiro, Euripedes A; Leyrat, Cédric; Tarbouriech, Nicolas; Ruigrok, Rob W H; Jamin, Marc

    2013-09-01

    Lettuce necrotic yellows virus (LNYV) is a prototype of the plant-adapted cytorhabdoviruses. Through a meta-prediction of disorder, we localized a folded C-terminal domain in the amino acid sequence of its phosphoprotein. This domain consists of an autonomous folding unit that is monomeric in solution. Its structure, solved by X-ray crystallography, reveals a lollipop-shaped structure comprising five helices. The structure is different from that of the corresponding domains of other Rhabdoviridae, Filoviridae, and Paramyxovirinae; only the overall topology of the polypeptide chain seems to be conserved, suggesting that this domain evolved under weak selective pressure and varied in size by the acquisition or loss of functional modules.

  6. Structure of the C-Terminal Domain of Lettuce Necrotic Yellows Virus Phosphoprotein

    Science.gov (United States)

    Martinez, Nicolas; Ribeiro, Euripedes A.; Leyrat, Cédric; Tarbouriech, Nicolas; Ruigrok, Rob W. H.

    2013-01-01

    Lettuce necrotic yellows virus (LNYV) is a prototype of the plant-adapted cytorhabdoviruses. Through a meta-prediction of disorder, we localized a folded C-terminal domain in the amino acid sequence of its phosphoprotein. This domain consists of an autonomous folding unit that is monomeric in solution. Its structure, solved by X-ray crystallography, reveals a lollipop-shaped structure comprising five helices. The structure is different from that of the corresponding domains of other Rhabdoviridae, Filoviridae, and Paramyxovirinae; only the overall topology of the polypeptide chain seems to be conserved, suggesting that this domain evolved under weak selective pressure and varied in size by the acquisition or loss of functional modules. PMID:23785215

  7. Clinical application for the preservation of phospho-proteins through in-situ tissue stabilization

    Directory of Open Access Journals (Sweden)

    Ding Wei

    2010-11-01

    Full Text Available Abstract Background Protein biomarkers will play a pivotal role in the future of personalized medicine for both diagnosis and treatment decision-making. While the results of several pre-clinical and small-scale clinical studies have demonstrated the value of protein biomarkers, there have been significant challenges to translating these findings into routine clinical care. Challenges to the use of protein biomarkers include inter-sample variability introduced by differences in post-collection handling and ex vivo degradation of proteins and protein modifications. Results In this report, we re-create laboratory and clinical scenarios for sample collection and test the utility of a new tissue stabilization technique in preserving proteins and protein modifications. In the laboratory setting, tissue stabilization with the Denator Stabilizor T1 resulted in a significantly higher yield of phospho-protein when compared to standard snap freeze preservation. Furthermore, in a clinical scenario, tissue stabilization at collection resulted in a higher yield of total phospho-protein, total phospho-tyrosine, pErkT202/Y204 and pAktS473 when compared to standard methods. Tissue stabilization did not have a significant effect on other post-translational modifications such as acetylation and glycosylation, which are more stable ex-vivo. Tissue stabilization did decrease total RNA quantity and quality. Conclusion Stabilization at the time of collection offers the potential to better preserve tissue protein and protein modification levels, as well as reduce the variability related to tissue processing delays that are often associated with clinical samples.

  8. Hunt for the 11P1 bound state of charmonium

    International Nuclear Information System (INIS)

    Porter, F.C.

    1982-02-01

    Using the Crystal Ball detector at SPEAR, we have looked for evidence of the isospin-violating decay psi' → π 01 P 1 , where 1 P 1 is the predicted spin-singlet p-wave bound state of charmonium. For a 1 P 1 state at the predicted mass (approx. 3520 MeV), we obtain the 95% confidence level limits: BR(psi' → π 01 P 1 ) 01 P 1 )BR( 1 P 1 → γn/sub c/ < 0.14%. These limits are compared with simple theoretical predictions

  9. Ribosomal studies on the 70S ribosome of E.coli by means of neutron scattering

    International Nuclear Information System (INIS)

    Burkhardt, N.

    1997-01-01

    Ribosomes are ribonucleo-protein complexes, which catalyse proteinbiosynthesis in all living organisms. Currently, most of the structural models of the prokaryotic 70S ribosome rely on electron microscopy and describe mainly the outer shape of the particle. Neutron scattering can provide information on the internal structure of the ribosome. Parts of the structure can be contrasted for neutrons by means of an isotopic exchange of the naturally occurring hydrogen ( 1 H) for deuterium ( 2 H), allowing direct measurements in situ. Specifically deuterium-labeled ribosomes (E. coli) were prepared and analysed with neutron scattering. The biochemical methods were established and combined to a generally applicable preparation system. This allows labeling of all ribosomal components in any combination. A systematic analysis of the protein and RNA phases resulted in the development of a new model for the 70S ribosome. This model describes not only the outer shape of the particle, but displays also an experimentally determined internal protein-RNA distribution and the border of subunits for the first time (four-phase model; resolution: 50A). Models of the 70S ribosome from other studies were evaluated and ranked according to consistency with the measured scattering data. Applying a new neutron scattering technique of particular sensitivity, the proton-spin contrast-variation, single proteins could be measured and localized. The positions of the proteins S6 and S10 were determined, providing the first coordinates of protein mass centers within the 70S ribosome. (orig.) [de

  10. The ribosome can prevent aggregation of partially folded protein intermediates: studies using the Escherichia coli ribosome.

    Directory of Open Access Journals (Sweden)

    Bani Kumar Pathak

    Full Text Available BACKGROUND: Molecular chaperones that support de novo folding of proteins under non stress condition are classified as chaperone 'foldases' that are distinct from chaperone' holdases' that provide high affinity binding platform for unfolded proteins and prevent their aggregation specifically under stress conditions. Ribosome, the cellular protein synthesis machine can act as a foldase chaperone that can bind unfolded proteins and release them in folding competent state. The peptidyl transferase center (PTC located in the domain V of the 23S rRNA of Escherichia coli ribosome (bDV RNA is the chaperoning center of the ribosome. It has been proposed that via specific interactions between the RNA and refolding proteins, the chaperone provides information for the correct folding of unfolded polypeptide chains. RESULTS: We demonstrate using Escherichia coli ribosome and variants of its domain V RNA that the ribosome can bind to partially folded intermediates of bovine carbonic anhydrase II (BCAII and lysozyme and suppress aggregation during their refolding. Using mutants of domain V RNA we demonstrate that the time for which the chaperone retains the bound protein is an important factor in determining its ability to suppress aggregation and/or support reactivation of protein. CONCLUSION: The ribosome can behave like a 'holdase' chaperone and has the ability to bind and hold back partially folded intermediate states of proteins from participating in the aggregation process. Since the ribosome is an essential organelle that is present in large numbers in all living cells, this ability of the ribosome provides an energetically inexpensive way to suppress cellular aggregation. Further, this ability of the ribosome might also be crucial in the context that the ribosome is one of the first chaperones to be encountered by a large nascent polypeptide chains that have a tendency to form partially folded intermediates immediately following their synthesis.

  11. Detection and Quantification of Ribosome Inhibition by Aminoglycoside Antibiotics in Living Bacteria Using an Orthogonal Ribosome-Controlled Fluorescent Reporter.

    Science.gov (United States)

    Huang, Shijie; Zhu, Xuechen; Melançon, Charles E

    2016-01-15

    The ribosome is the quintessential antibacterial drug target, with many structurally and mechanistically distinct classes of antibacterial agents acting by inhibiting ribosome function. Detecting and quantifying ribosome inhibition by small molecules and investigating their binding modes and mechanisms of action are critical to antibacterial drug discovery and development efforts. To develop a ribosome inhibition assay that is operationally simple, yet provides direct information on the drug target and the mechanism of action, we have developed engineered E. coli strains harboring an orthogonal ribosome-controlled green fluorescent protein (GFP) reporter that produce fluorescent signal when the orthogonal ribosome is inhibited. As a proof of concept, we demonstrate that these strains, when coexpressing homogeneous populations of aminoglycoside resistant ribosomes, act as sensitive and quantitative detectors of ribosome inhibition by a set of 12 structurally diverse aminoglycoside antibiotics. We suggest that this strategy can be extended to quantifying ribosome inhibition by other drug classes.

  12. The PAXgene(® tissue system preserves phosphoproteins in human tissue specimens and enables comprehensive protein biomarker research.

    Directory of Open Access Journals (Sweden)

    Sibylle Gündisch

    Full Text Available Precise quantitation of protein biomarkers in clinical tissue specimens is a prerequisite for accurate and effective diagnosis, prognosis, and personalized medicine. Although progress is being made, protein analysis from formalin-fixed and paraffin-embedded tissues is still challenging. In previous reports, we showed that the novel formalin-free tissue preservation technology, the PAXgene Tissue System, allows the extraction of intact and immunoreactive proteins from PAXgene-fixed and paraffin-embedded (PFPE tissues. In the current study, we focused on the analysis of phosphoproteins and the applicability of two-dimensional gel electrophoresis (2D-PAGE and enzyme-linked immunosorbent assay (ELISA to the analysis of a variety of malignant and non-malignant human tissues. Using western blot analysis, we found that phosphoproteins are quantitatively preserved in PFPE tissues, and signal intensities are comparable to that in paired, frozen tissues. Furthermore, proteins extracted from PFPE samples are suitable for 2D-PAGE and can be quantified by ELISA specific for denatured proteins. In summary, the PAXgene Tissue System reliably preserves phosphoproteins in human tissue samples, even after prolonged fixation or stabilization times, and is compatible with methods for protein analysis such as 2D-PAGE and ELISA. We conclude that the PAXgene Tissue System has the potential to serve as a versatile tissue fixative for modern pathology.

  13. Biochemical and immunological characterization of recombinant allergen Lol p 1.

    Science.gov (United States)

    Tamborini, E; Faccini, S; Lidholm, J; Svensson, M; Brandazza, A; Longhi, R; Groenlund, H; Sidoli, A; Arosio, P

    1997-11-01

    Pollen from perennial rye grass (Lolium perenne), a major cause of type-I allergy worldwide, contains a complex mixture of allergenic proteins among which Lol p 1 is one of the most important. We describe the expression, purification and characterization of a recombinant Lol p 1 overproduced in Escherichia coli. The recombinant allergen, expressed in high yields and purified in milligram amounts, bound to specific IgE antibodies from human sera, induced histamine release from sensitized human basophils, and elicited rabbit antisera that recognize specifically recombinant Lol p 1 and natural Lol p 1 of pollen extract. Recombinant Lol p 1 was used to develop ImmunoCAP assays for analysis of 150 sera that were Radioallergosorbent test positive to L. perenne pollen. In 130 of them (87%) the assay detected a significant level of IgE antibodies to Lol p 1, reaching on average 37% of the level obtained with a test for IgE to the whole grass pollen extract. To map epitopes on Lol p 1, we produced three deletion mutants [des-(116-240)-Lol p 1, des-(1-88)-Lol p 1 and des-(133-189)-Lol p 1], which were efficiently expressed in bacteria. These all showed a strong reactivity with the specific rabbit IgG antibodies, but lacked most or all the allergenic properties of recombinant Lol p 1. A study of the antigenic structure of Lol p 1 was performed using the three deletion mutants and a set of 17-18-residue overlapping synthetic peptides covering the whole allergen sequence. The results indicate that human IgE and rabbit IgG antibodies bind to distinct regions of Lol p 1, and that at least some important IgE epitopes are mainly conformational. The findings suggest that recombinant allergens constitute useful reagents for further development of serological diagnosis of allergy, and that it should be possible to produce immunogenic fragments of allergenic proteins without allergenic properties.

  14. The C-terminal helix of ribosomal P stalk recognizes a hydrophobic groove of elongation factor 2 in a novel fashion.

    Science.gov (United States)

    Tanzawa, Takehito; Kato, Koji; Girodat, Dylan; Ose, Toyoyuki; Kumakura, Yuki; Wieden, Hans-Joachim; Uchiumi, Toshio; Tanaka, Isao; Yao, Min

    2018-04-06

    Archaea and eukaryotes have ribosomal P stalks composed of anchor protein P0 and aP1 homodimers (archaea) or P1•P2 heterodimers (eukaryotes). These P stalks recruit translational GTPases to the GTPase-associated center in ribosomes to provide energy during translation. The C-terminus of the P stalk is known to selectively recognize GTPases. Here we investigated the interaction between the P stalk and elongation factor 2 by determining the structures of Pyrococcus horikoshii EF-2 (PhoEF-2) in the Apo-form, GDP-form, GMPPCP-form (GTP-form), and GMPPCP-form bound with 11 C-terminal residues of P1 (P1C11). Helical structured P1C11 binds to a hydrophobic groove between domain G and subdomain G' of PhoEF-2, where is completely different from that of aEF-1α in terms of both position and sequence, implying that such interaction characteristic may be requested by how GTPases perform their functions on the ribosome. Combining PhoEF-2 P1-binding assays with a structural comparison of current PhoEF-2 structures and molecular dynamics model of a P1C11-bound GDP form, the conformational changes of the P1C11-binding groove in each form suggest that in response to the translation process, the groove has three states: closed, open, and release for recruiting and releasing GTPases.

  15. The measles virus phosphoprotein interacts with the linker domain of STAT1

    International Nuclear Information System (INIS)

    Devaux, Patricia; Priniski, Lauren; Cattaneo, Roberto

    2013-01-01

    The measles virus (MV) phosphoprotein (P) and V proteins block the interferon (IFN) response by impeding phosphorylation of the signal transducer and activator of transcription 1 (STAT1) by the Janus kinase 1 (JAK1). We characterized how STAT1 mutants interact with P and JAK1 phosphorylation. Certain mutants of the linker, the Src-homology 2 domain (SH2), or the transactivation domain had reduced or abolished phosphorylation through JAK1 after IFN treatment. Other mutants, mainly localized in the linker, failed to interact with P as documented by the lack of interference with nuclear translocation. Thus the functional footprint of P on STAT1 localizes mainly to the linker domain; there is also some overlap with the STAT1 phosphorylation functional footprint on the SH2 domain. Based on these observations, we discuss how the MV-P might operate to inhibit the JAK/STAT pathway. - Highlights: • Residue in the linker and SH2 domains of STAT1 are important for MV-P interaction. • Residue in the linker and SH2 domains of STAT1 are important for STAT1 phosphorylation. • Residues interferring with both functions have similar location on STAT1. • The viral P and V proteins may operate in concert to inhibit the JAK/STAT pathway

  16. The measles virus phosphoprotein interacts with the linker domain of STAT1

    Energy Technology Data Exchange (ETDEWEB)

    Devaux, Patricia, E-mail: devaux.patricia@mayo.edu; Priniski, Lauren; Cattaneo, Roberto

    2013-09-15

    The measles virus (MV) phosphoprotein (P) and V proteins block the interferon (IFN) response by impeding phosphorylation of the signal transducer and activator of transcription 1 (STAT1) by the Janus kinase 1 (JAK1). We characterized how STAT1 mutants interact with P and JAK1 phosphorylation. Certain mutants of the linker, the Src-homology 2 domain (SH2), or the transactivation domain had reduced or abolished phosphorylation through JAK1 after IFN treatment. Other mutants, mainly localized in the linker, failed to interact with P as documented by the lack of interference with nuclear translocation. Thus the functional footprint of P on STAT1 localizes mainly to the linker domain; there is also some overlap with the STAT1 phosphorylation functional footprint on the SH2 domain. Based on these observations, we discuss how the MV-P might operate to inhibit the JAK/STAT pathway. - Highlights: • Residue in the linker and SH2 domains of STAT1 are important for MV-P interaction. • Residue in the linker and SH2 domains of STAT1 are important for STAT1 phosphorylation. • Residues interferring with both functions have similar location on STAT1. • The viral P and V proteins may operate in concert to inhibit the JAK/STAT pathway.

  17. Short interfering RNAs targeting a vampire-bat related rabies virus phosphoprotein mRNA.

    Science.gov (United States)

    Ono, Ekaterina Alexandrovna Durymanova; Taniwaki, Sueli Akemi; Brandão, Paulo

    The aim of this study was to assess the in vitro and in vivo effects of short-interfering RNAs (siRNAs) against rabies virus phosphoprotein (P) mRNA in a post-infection treatment for rabies as an extension of a previous report (Braz J Microbiol. 2013 Nov 15;44(3):879-82). To this end, rabies virus strain RABV-4005 (related to the Desmodus rotundus vampire bat) were used to inoculate BHK-21 cells and mice, and the transfection with each of the siRNAs was made with Lipofectamine-2000™. In vitro results showed that siRNA 360 was able to inhibit the replication of strain RABV-4005 with a 1log decrease in virus titter and 5.16-fold reduction in P mRNA, 24h post-inoculation when compared to non-treated cells. In vivo, siRNA 360 was able to induce partial protection, but with no significant difference when compared to non-treated mice. These results indicate that, despite the need for improvement for in vivo applications, P mRNA might be a target for an RNAi-based treatment for rabies. Copyright © 2017 Sociedade Brasileira de Microbiologia. Published by Elsevier Editora Ltda. All rights reserved.

  18. Adenovirus type 2 endopeptidase: an unusual phosphoprotein enzyme matured by autocatalysis

    Energy Technology Data Exchange (ETDEWEB)

    Chatterjee, P.K.; Flint, S.J.

    1987-02-01

    A 19-kDa protein, present in low copy number in purified adenovirus type 2, has been characterized. Several criteria were used to establish that this protein is neither a degradation product of the known structural proteins of the virion nor a minor, unusually modified, form of protein VII. This 19-kDa protein, unlike other virion proteins, possesses alkali-resistant phosphoamino acids. Analysis by partial proteolysis indicated that it is related to a 23-kDa phosphoprotein present in H2ts-1 virions assembled in infected cells maintained at 39/sup 0/C. Affinity labeling with (/sup 3/H)diisopropyl fluorophosphate showed that the 19-kDa protein contains the active site for a serine protease. The authors, therefore, conclude that the 19-kDa protein is the active form of the adenovirus-encoded endopeptidase, defined by the H2ts-1 mutation, and is synthesized as a 23-kDa precursor that appears to mature by autocatalysis.

  19. Immunological and biological properties of recombinant Lol p 1.

    Science.gov (United States)

    Boutin, Y; Lamontagne, P; Boulanger, J; Brunet, C; Hébert, J

    1997-03-01

    Current forms of allergy diagnosis and therapies are based on the use of natural allergenic extracts. Despite strong evidence that higher therapeutic efficacy may be achieved with purified allergens, the purification of multiple allergic components from extracts is a fastidious and sometimes an impossible task. However, the use of recombinant allergens may be an alternative to overcome this problem. In this study, we compared the immunological properties of recombinant (r) Lol p 1 with those of the natural protein. We cloned directly the gene encoding Lol p 1 from genomic DNA of ryegrass pollen. This gene was subcloned into the expression vector pMAL-c and expressed as fusion protein. Subsequently, rLol p 1 was cleaved from maltose-binding protein using factor Xa. Using binding inhibition and proliferative assays, we assessed the immunological properties of the recombinant allergens. The capacity of rLol p 1 to trigger basophil histamine release and to elicit a skin reaction was also assessed and compared to those of its natural counterpart. We found that the Lol p 1 gene has no introns since we amplified this gene directly from genomic DNA. We demonstrated that the binding sites of anti-Lol p 1 monoclonal antibody, specific human IgG and IgE antibody are well conserved on rLol p 1 as no difference in the binding inhibition profile was observed when using either natural or recombinant protein. At the T-cell level, rLol p 1 elicited a T-cell response in mice comparable to that observed with the natural protein. In addition, we demonstrated that the biological characteristics of rLol p 1 were comparable to those of the natural counterpart, in that rLol p 1 elicited a skin wheal reaction and induced basophil histamine release in grass-allergic patients only. The data indicate that natural Lol p 1 and rLol p 1 shared identical immunological and biological properties.

  20. Effect of primary and secondary radicals on chain breaks in ribosomal RNA in E. coli ribosomes

    International Nuclear Information System (INIS)

    Singh, H.; Bishop, J.

    1984-01-01

    It has been shown previously that, in dilute aerated solutions, ribosomes are inactivated by OH radicals and by secondary radicals produced from added alcohols (Singh and Vadasz 1983 a). In de-aerated solutions, both radicalH and e - sub(aq) also inactivate ribosomes (Singh and Vadasz 1983 b). The results of these studies and other on different systems (Adams et al. 1973, Aldrich and Cundall 1969, Dewey and Stein 1970, Masuda et al. 1971, Nabben et al. 1982, 1983, Samuni et al. 1980, Singh and Singh 1982) have shown that damage to biological systems occurs by diverse mechanisms. One of these mechanisms involves chain breaks in RNA (Pollard and Weller 1967). The purpose of this study was to determine which of the primary and secondary radicals cause chain breaks in ribosomal RNA (rRNA) within the ribosomes. (author)

  1. Regulation of the Src Kinase-associated Phosphoprotein 55 Homologue by the Protein Tyrosine Phosphatase PTP-PEST in the Control of Cell Motility*

    Science.gov (United States)

    Ayoub, Emily; Hall, Anita; Scott, Adam M.; Chagnon, Mélanie J.; Miquel, Géraldine; Hallé, Maxime; Noda, Masaharu; Bikfalvi, Andreas; Tremblay, Michel L.

    2013-01-01

    PTP-PEST is a cytosolic ubiquitous protein tyrosine phosphatase (PTP) that contains, in addition to its catalytic domain, several protein-protein interaction domains that allow it to interface with several signaling pathways. Among others, PTP-PEST is a key regulator of cellular motility and cytoskeleton dynamics. The complexity of the PTP-PEST interactome underscores the necessity to identify its interacting partners and physiological substrates in order to further understand its role in focal adhesion complex turnover and actin organization. Using a modified yeast substrate trapping two-hybrid system, we identified a cytosolic adaptor protein named Src kinase-associated phosphoprotein 55 homologue (SKAP-Hom) as a novel substrate of PTP-PEST. To confirm PTP-PEST interaction with SKAP-Hom, in vitro pull down assays were performed demonstrating that the PTP catalytic domain and Proline-rich 1 (P1) domain are respectively binding to the SKAP-Hom Y260 and Y297 residues and its SH3 domain. Subsequently, we generated and rescued SKAP-Hom-deficient mouse embryonic fibroblasts (MEFs) with WT SKAP-Hom, SKAP-Hom tyrosine mutants (Y260F, Y260F/Y297F), or SKAP-Hom SH3 domain mutant (W335K). Given the role of PTP-PEST, wound-healing and trans-well migration assays were performed using the generated lines. Indeed, SKAP-Hom-deficient MEFs showed a defect in migration compared with WT-rescued MEFs. Interestingly, the SH3 domain mutant-rescued MEFs showed an enhanced cell migration corresponding potentially with higher tyrosine phosphorylation levels of SKAP-Hom. These findings suggest a novel role of SKAP-Hom and its phosphorylation in the regulation of cellular motility. Moreover, these results open new avenues by which PTP-PEST regulates cellular migration, a hallmark of metastasis. PMID:23897807

  2. GTPases and the origin of the ribosome

    Directory of Open Access Journals (Sweden)

    Smith Temple F

    2010-05-01

    Full Text Available Abstract Background This paper is an attempt to trace the evolution of the ribosome through the evolution of the universal P-loop GTPases that are involved with the ribosome in translation and with the attachment of the ribosome to the membrane. The GTPases involved in translation in Bacteria/Archaea are the elongation factors EFTu/EF1, the initiation factors IF2/aeIF5b + aeIF2, and the elongation factors EFG/EF2. All of these GTPases also contain the OB fold also found in the non GTPase IF1 involved in initiation. The GTPase involved in the signal recognition particle in most Bacteria and Archaea is SRP54. Results 1 The Elongation Factors of the Archaea based on structural considerations of the domains have the following evolutionary path: EF1→ aeIF2 → EF2. The evolution of the aeIF5b was a later event; 2 the Elongation Factors of the Bacteria based on the topological considerations of the GTPase domain have a similar evolutionary path: EFTu→ IF→2→EFG. These evolutionary sequences reflect the evolution of the LSU followed by the SSU to form the ribosome; 3 the OB-fold IF1 is a mimic of an ancient tRNA minihelix. Conclusion The evolution of translational GTPases of both the Archaea and Bacteria point to the evolution of the ribosome. The elongation factors, EFTu/EF1, began as a Ras-like GTPase bringing the activated minihelix tRNA to the Large Subunit Unit. The initiation factors and elongation factor would then have evolved from the EFTu/EF1 as the small subunit was added to the evolving ribosome. The SRP has an SRP54 GTPase and a specific RNA fold in its RNA component similar to the PTC. We consider the SRP to be a remnant of an ancient form of an LSU bound to a membrane. Reviewers This article was reviewed by George Fox, Leonid Mirny and Chris Sander.

  3. Vasodilator-Stimulated Phosphoprotein Activity Is Required for Coxiella burnetii Growth in Human Macrophages.

    Directory of Open Access Journals (Sweden)

    Punsiri M Colonne

    2016-10-01

    Full Text Available Coxiella burnetii is an intracellular bacterial pathogen that causes human Q fever, an acute flu-like illness that can progress to chronic endocarditis and liver and bone infections. Humans are typically infected by aerosol-mediated transmission, and C. burnetii initially targets alveolar macrophages wherein the pathogen replicates in a phagolysosome-like niche known as the parasitophorous vacuole (PV. C. burnetii manipulates host cAMP-dependent protein kinase (PKA signaling to promote PV formation, cell survival, and bacterial replication. In this study, we identified the actin regulatory protein vasodilator-stimulated phosphoprotein (VASP as a PKA substrate that is increasingly phosphorylated at S157 and S239 during C. burnetii infection. Avirulent and virulent C. burnetii triggered increased levels of phosphorylated VASP in macrophage-like THP-1 cells and primary human alveolar macrophages, and this event required the Cα subunit of PKA. VASP phosphorylation also required bacterial protein synthesis and secretion of effector proteins via a type IV secretion system, indicating the pathogen actively triggers prolonged VASP phosphorylation. Optimal PV formation and intracellular bacterial replication required VASP activity, as siRNA-mediated depletion of VASP reduced PV size and bacterial growth. Interestingly, ectopic expression of a phospho-mimetic VASP (S239E mutant protein prevented optimal PV formation, whereas VASP (S157E mutant expression had no effect. VASP (S239E expression also prevented trafficking of bead-containing phagosomes to the PV, indicating proper VASP activity is critical for heterotypic fusion events that control PV expansion in macrophages. Finally, expression of dominant negative VASP (S157A in C. burnetii-infected cells impaired PV formation, confirming importance of the protein for proper infection. This study provides the first evidence of VASP manipulation by an intravacuolar bacterial pathogen via activation of PKA

  4. Solution and crystallographic structures of the central region of the phosphoprotein from human metapneumovirus.

    Directory of Open Access Journals (Sweden)

    Cedric Leyrat

    Full Text Available Human metapneumovirus (HMPV of the family Paramyxoviridae is a major cause of respiratory illness worldwide. Phosphoproteins (P from Paramyxoviridae are essential co-factors of the viral RNA polymerase that form tetramers and possess long intrinsically disordered regions (IDRs. We located the central region of HMPV P (P(ced which is involved in tetramerization using disorder analysis and modeled its 3D structure ab initio using Rosetta fold-and-dock. We characterized the solution-structure of P(ced using small angle X-ray scattering (SAXS and carried out direct fitting to the scattering data to filter out incorrect models. Molecular dynamics simulations (MDS and ensemble optimization were employed to select correct models and capture the dynamic character of P(ced. Our analysis revealed that oligomerization involves a compact central core located between residues 169-194 (P(core, that is surrounded by flexible regions with α-helical propensity. We crystallized this fragment and solved its structure at 3.1 Å resolution by molecular replacement, using the folded core from our SAXS-validated ab initio model. The RMSD between modeled and experimental tetramers is as low as 0.9 Å, demonstrating the accuracy of the approach. A comparison of the structure of HMPV P to existing mononegavirales P(ced structures suggests that P(ced evolved under weak selective pressure. Finally, we discuss the advantages of using SAXS in combination with ab initio modeling and MDS to solve the structure of small, homo-oligomeric protein complexes.

  5. Plasticity in Structural and Functional Interactions between the Phosphoprotein and Nucleoprotein of Measles Virus*

    Science.gov (United States)

    Shu, Yaoling; Habchi, Johnny; Costanzo, Stéphanie; Padilla, André; Brunel, Joanna; Gerlier, Denis; Oglesbee, Michael; Longhi, Sonia

    2012-01-01

    The measles virus (MeV) phosphoprotein (P) tethers the polymerase to the nucleocapsid template for transcription and genome replication. Binding of P to nucleocapsid is mediated by the X domain of P (XD) and a conserved sequence (Box-2) within the C-terminal domain of the nucleoprotein (NTAIL). XD binding induces NTAIL α-helical folding, which in turn has been proposed to stabilize the polymerase-nucleocapsid complex, with cycles of binding and release required for transcription and genome replication. The current work directly assessed the relationships among XD-induced NTAIL folding, XD-NTAIL binding affinity, and polymerase activity. Amino acid substitutions that abolished XD-induced NTAIL α-helical folding were created within Box-2 of Edmonston MeV NTAIL. Polymerase activity in minireplicons was maintained despite a 35-fold decrease in XD-NTAIL binding affinity or reduction/loss of XD-induced NTAIL alpha-helical folding. Recombinant infectious virus was recovered for all mutants, and transcriptase elongation rates remained within a 1.7-fold range of parent virus. Box-2 mutations did however impose a significant cost to infectivity, reflected in an increase in the amount of input genome required to match the infectivity of parent virus. Diminished infectivity could not be attributed to changes in virion protein composition or production of defective interfering particles, where changes from parent virus were within a 3-fold range. The results indicated that MeV polymerase activity, but not infectivity, tolerates amino acid changes in the XD-binding region of the nucleoprotein. Selectional pressure for conservation of the Box-2 sequence may thus reflect a role in assuring the fidelity of polymerase functions or the assembly of viral particles required for optimal infectivity. PMID:22318731

  6. Plasticity in structural and functional interactions between the phosphoprotein and nucleoprotein of measles virus.

    Science.gov (United States)

    Shu, Yaoling; Habchi, Johnny; Costanzo, Stéphanie; Padilla, André; Brunel, Joanna; Gerlier, Denis; Oglesbee, Michael; Longhi, Sonia

    2012-04-06

    The measles virus (MeV) phosphoprotein (P) tethers the polymerase to the nucleocapsid template for transcription and genome replication. Binding of P to nucleocapsid is mediated by the X domain of P (XD) and a conserved sequence (Box-2) within the C-terminal domain of the nucleoprotein (N(TAIL)). XD binding induces N(TAIL) α-helical folding, which in turn has been proposed to stabilize the polymerase-nucleocapsid complex, with cycles of binding and release required for transcription and genome replication. The current work directly assessed the relationships among XD-induced N(TAIL) folding, XD-N(TAIL) binding affinity, and polymerase activity. Amino acid substitutions that abolished XD-induced N(TAIL) α-helical folding were created within Box-2 of Edmonston MeV N(TAIL). Polymerase activity in minireplicons was maintained despite a 35-fold decrease in XD-N(TAIL) binding affinity or reduction/loss of XD-induced N(TAIL) alpha-helical folding. Recombinant infectious virus was recovered for all mutants, and transcriptase elongation rates remained within a 1.7-fold range of parent virus. Box-2 mutations did however impose a significant cost to infectivity, reflected in an increase in the amount of input genome required to match the infectivity of parent virus. Diminished infectivity could not be attributed to changes in virion protein composition or production of defective interfering particles, where changes from parent virus were within a 3-fold range. The results indicated that MeV polymerase activity, but not infectivity, tolerates amino acid changes in the XD-binding region of the nucleoprotein. Selectional pressure for conservation of the Box-2 sequence may thus reflect a role in assuring the fidelity of polymerase functions or the assembly of viral particles required for optimal infectivity.

  7. Characterization of a viral phosphoprotein binding site on the surface of the respiratory syncytial nucleoprotein.

    Science.gov (United States)

    Galloux, Marie; Tarus, Bogdan; Blazevic, Ilfad; Fix, Jenna; Duquerroy, Stéphane; Eléouët, Jean-François

    2012-08-01

    The human respiratory syncytial virus (HRSV) genome is composed of a negative-sense single-stranded RNA that is tightly associated with the nucleoprotein (N). This ribonucleoprotein (RNP) complex is the template for replication and transcription by the viral RNA-dependent RNA polymerase. RNP recognition by the viral polymerase involves a specific interaction between the C-terminal domain of the phosphoprotein (P) (P(CTD)) and N. However, the P binding region on N remains to be identified. In this study, glutathione S-transferase (GST) pulldown assays were used to identify the N-terminal core domain of HRSV N (N(NTD)) as a P binding domain. A biochemical characterization of the P(CTD) and molecular modeling of the N(NTD) allowed us to define four potential candidate pockets on N (pocket I [PI] to PIV) as hydrophobic sites surrounded by positively charged regions, which could constitute sites complementary to the P(CTD) interaction domain. The role of selected amino acids in the recognition of the N-RNA complex by P was first screened for by site-directed mutagenesis using a polymerase activity assay, based on an HRSV minigenome containing a luciferase reporter gene. When changed to Ala, most of the residues of PI were found to be critical for viral RNA synthesis, with the R132A mutant having the strongest effect. These mutations also reduced or abolished in vitro and in vivo P-N interactions, as determined by GST pulldown and immunoprecipitation experiments. The pocket formed by these residues is critical for P binding to the N-RNA complex, is specific for pneumovirus N proteins, and is clearly distinct from the P binding sites identified so far for other nonsegmented negative-strand viruses.

  8. Adjoint P1 equations solution for neutron slowing down

    International Nuclear Information System (INIS)

    Cardoso, Carlos Eduardo Santos; Martinez, Aquilino Senra; Silva, Fernando Carvalho da

    2002-01-01

    In some applications of perturbation theory, it is necessary know the adjoint neutron flux, which is obtained by the solution of adjoint neutron diffusion equation. However, the multigroup constants used for this are weighted in only the direct neutron flux, from the solution of direct P1 equations. In this work, the adjoint P1 equations are derived by the neutron transport equation, the reversion operators rules and analogies between direct and adjoint parameters. The direct and adjoint neutron fluxes resulting from the solution of P 1 equations were used to three different weighting processes, to obtain the macrogroup macroscopic cross sections. It was found out noticeable differences among them. (author)

  9. Kinetic pathway of 40S ribosomal subunit recruitment to hepatitis C virus internal ribosome entry site.

    Science.gov (United States)

    Fuchs, Gabriele; Petrov, Alexey N; Marceau, Caleb D; Popov, Lauren M; Chen, Jin; O'Leary, Seán E; Wang, Richard; Carette, Jan E; Sarnow, Peter; Puglisi, Joseph D

    2015-01-13

    Translation initiation can occur by multiple pathways. To delineate these pathways by single-molecule methods, fluorescently labeled ribosomal subunits are required. Here, we labeled human 40S ribosomal subunits with a fluorescent SNAP-tag at ribosomal protein eS25 (RPS25). The resulting ribosomal subunits could be specifically labeled in living cells and in vitro. Using single-molecule Förster resonance energy transfer (FRET) between RPS25 and domain II of the hepatitis C virus (HCV) internal ribosome entry site (IRES), we measured the rates of 40S subunit arrival to the HCV IRES. Our data support a single-step model of HCV IRES recruitment to 40S subunits, irreversible on the initiation time scale. We furthermore demonstrated that after binding, the 40S:HCV IRES complex is conformationally dynamic, undergoing slow large-scale rearrangements. Addition of translation extracts suppresses these fluctuations, funneling the complex into a single conformation on the 80S assembly pathway. These findings show that 40S:HCV IRES complex formation is accompanied by dynamic conformational rearrangements that may be modulated by initiation factors.

  10. System of adjoint P1 equations for neutron moderation

    International Nuclear Information System (INIS)

    Martinez, Aquilino Senra; Silva, Fernando Carvalho da; Cardoso, Carlos Eduardo Santos

    2000-01-01

    In some applications of perturbation theory, it is necessary know the adjoint neutron flux, which is obtained by the solution of adjoint neutron diffusion equation. However, the multigroup constants used for this are weighted in only the direct neutron flux, from the solution of direct P1 equations. In this work, this procedure is questioned and the adjoint P1 equations are derived by the neutron transport equation, the reversion operators rules and analogies between direct and adjoint parameters. (author)

  11. One-Step Preservation of Phosphoproteins and Tissue Morphology at Room Temperature for Diagnostic and Research Specimens

    Science.gov (United States)

    Mueller, Claudius; Edmiston, Kirsten H.; Carpenter, Calvin; Gaffney, Eoin; Ryan, Ciara; Ward, Ronan; White, Susan; Memeo, Lorenzo; Colarossi, Cristina; Petricoin, Emanuel F.; Liotta, Lance A.; Espina, Virginia

    2011-01-01

    Background There is an urgent need to measure phosphorylated cell signaling proteins in cancer tissue for the individualization of molecular targeted kinase inhibitor therapy. However, phosphoproteins fluctuate rapidly following tissue procurement. Snap-freezing preserves phosphoproteins, but is unavailable in most clinics and compromises diagnostic morphology. Formalin fixation preserves tissue histomorphology, but penetrates tissue slowly, and is unsuitable for stabilizing phosphoproteins. We originated and evaluated a novel one-step biomarker and histology preservative (BHP) chemistry that stabilizes signaling protein phosphorylation and retains formalin-like tissue histomorphology with equivalent immunohistochemistry in a single paraffin block. Results Total protein yield extracted from BHP-fixed, routine paraffin-embedded mouse liver was 100% compared to snap-frozen tissue. The abundance of 14 phosphorylated proteins was found to be stable over extended fixation times in BHP fixed paraffin embedded human colon mucosa. Compared to matched snap-frozen tissue, 8 phosphoproteins were equally preserved in mouse liver, while AMPKβ1 Ser108 was slightly elevated after BHP fixation. More than 25 tissues from mouse, cat and human specimens were evaluated for preservation of histomorphology. Selected tissues were evaluated in a multi-site, independent pathology review. Tissue fixed with BHP showed equivalent preservation of cytoplasmic and membrane cytomorphology, with significantly better nuclear chromatin preservation by BHP compared to formalin. Immunohistochemical staining of 13 non-phosphorylated proteins, including estrogen receptor alpha, progesterone receptor, Ki-67 and Her2, was equal to or stronger in BHP compared to formalin. BHP demonstrated significantly improved immunohistochemical detection of phosphorylated proteins ERK Thr202/Tyr204, GSK3-α/β Ser21/Ser9, p38-MAPK Thr180/Tyr182, eIF4G Ser1108 and Acetyl-CoA Carboxylase Ser79. Conclusion In a single

  12. One-step preservation of phosphoproteins and tissue morphology at room temperature for diagnostic and research specimens.

    Directory of Open Access Journals (Sweden)

    Claudius Mueller

    Full Text Available BACKGROUND: There is an urgent need to measure phosphorylated cell signaling proteins in cancer tissue for the individualization of molecular targeted kinase inhibitor therapy. However, phosphoproteins fluctuate rapidly following tissue procurement. Snap-freezing preserves phosphoproteins, but is unavailable in most clinics and compromises diagnostic morphology. Formalin fixation preserves tissue histomorphology, but penetrates tissue slowly, and is unsuitable for stabilizing phosphoproteins. We originated and evaluated a novel one-step biomarker and histology preservative (BHP chemistry that stabilizes signaling protein phosphorylation and retains formalin-like tissue histomorphology with equivalent immunohistochemistry in a single paraffin block. RESULTS: Total protein yield extracted from BHP-fixed, routine paraffin-embedded mouse liver was 100% compared to snap-frozen tissue. The abundance of 14 phosphorylated proteins was found to be stable over extended fixation times in BHP fixed paraffin embedded human colon mucosa. Compared to matched snap-frozen tissue, 8 phosphoproteins were equally preserved in mouse liver, while AMPKβ1 Ser108 was slightly elevated after BHP fixation. More than 25 tissues from mouse, cat and human specimens were evaluated for preservation of histomorphology. Selected tissues were evaluated in a multi-site, independent pathology review. Tissue fixed with BHP showed equivalent preservation of cytoplasmic and membrane cytomorphology, with significantly better nuclear chromatin preservation by BHP compared to formalin. Immunohistochemical staining of 13 non-phosphorylated proteins, including estrogen receptor alpha, progesterone receptor, Ki-67 and Her2, was equal to or stronger in BHP compared to formalin. BHP demonstrated significantly improved immunohistochemical detection of phosphorylated proteins ERK Thr202/Tyr204, GSK3-α/β Ser21/Ser9, p38-MAPK Thr180/Tyr182, eIF4G Ser1108 and Acetyl-CoA Carboxylase Ser79

  13. Ribosomal history reveals origins of modern protein synthesis.

    Directory of Open Access Journals (Sweden)

    Ajith Harish

    Full Text Available The origin and evolution of the ribosome is central to our understanding of the cellular world. Most hypotheses posit that the ribosome originated in the peptidyl transferase center of the large ribosomal subunit. However, these proposals do not link protein synthesis to RNA recognition and do not use a phylogenetic comparative framework to study ribosomal evolution. Here we infer evolution of the structural components of the ribosome. Phylogenetic methods widely used in morphometrics are applied directly to RNA structures of thousands of molecules and to a census of protein structures in hundreds of genomes. We find that components of the small subunit involved in ribosomal processivity evolved earlier than the catalytic peptidyl transferase center responsible for protein synthesis. Remarkably, subunit RNA and proteins coevolved, starting with interactions between the oldest proteins (S12 and S17 and the oldest substructure (the ribosomal ratchet in the small subunit and ending with the rise of a modern multi-subunit ribosome. Ancestral ribonucleoprotein components show similarities to in vitro evolved RNA replicase ribozymes and protein structures in extant replication machinery. Our study therefore provides important clues about the chicken-or-egg dilemma associated with the central dogma of molecular biology by showing that ribosomal history is driven by the gradual structural accretion of protein and RNA structures. Most importantly, results suggest that functionally important and conserved regions of the ribosome were recruited and could be relics of an ancient ribonucleoprotein world.

  14. Haloperidol Regulates the State of Phosphorylation of Ribosomal Protein S6 via Activation of PKA and Phosphorylation of DARPP-32

    Science.gov (United States)

    Valjent, Emmanuel; Bertran-Gonzalez, Jesus; Bowling, Heather; Lopez, Sébastien; Santini, Emanuela; Matamales, Miriam; Bonito-Oliva, Alessandra; Hervé, Denis; Hoeffer, Charles; Klann, Eric; Girault, Jean-Antoine; Fisone, Gilberto

    2011-01-01

    Administration of typical antipsychotic drugs, such as haloperidol, promotes cAMP-dependent signaling in the medium spiny neurons (MSNs) of the striatum. In this study, we have examined the effect of haloperidol on the state of phosphorylation of the ribosomal protein S6 (rpS6), a component of the small 40S ribosomal subunit. We found that haloperidol increases the phosphorylation of rpS6 at the dual site Ser235/236, which is involved in the regulation of mRNA translation. This effect was exerted in the MSNs of the indirect pathway, which express specifically dopamine D2 receptors (D2Rs) and adenosine A2 receptors (A2ARs). The effect of haloperidol was decreased by blockade of A2ARs or by genetic attenuation of the Gαolf protein, which couples A2ARs to activation of adenylyl cyclase. Moreover, stimulation of cAMP-dependent protein kinase A (PKA) increased Ser235/236 phosphorylation in cultured striatal neurons. The ability of haloperidol to promote rpS6 phosphorylation was abolished in knock-in mice deficient for PKA activation of the protein phosphatase-1 inhibitor, dopamine- and cAMP-regulated phosphoprotein of 32 kDa. In contrast, pharmacological or genetic inactivation of p70 rpS6 kinase 1, or extracellular signal-regulated kinases did not affect haloperidol-induced rpS6 phosphorylation. These results identify PKA as a major rpS6 kinase in neuronal cells and suggest that regulation of protein synthesis through rpS6 may be a potential target of antipsychotic drugs. PMID:21814187

  15. Phosphorylation of acidic ribosomal proteins from rabbit reticulocytes by a ribosome-associated casein kinase

    DEFF Research Database (Denmark)

    Issinger, O G

    1977-01-01

    Two acidic proteins from 80-S ribosomes were isolated and purified to homogeneity. The purified acidic proteins could be phosphorylated by casein kinase using [gamma-32P]ATP and [gamma-32P]GTP as a phosphoryl donor. The proteins became phosphorylated in situ, too. Sodium dodecyl sulfate polyacryl......Two acidic proteins from 80-S ribosomes were isolated and purified to homogeneity. The purified acidic proteins could be phosphorylated by casein kinase using [gamma-32P]ATP and [gamma-32P]GTP as a phosphoryl donor. The proteins became phosphorylated in situ, too. Sodium dodecyl sulfate...

  16. Genetic and evolutionary characterization of RABVs from China using the phosphoprotein gene.

    Science.gov (United States)

    Wang, Lihua; Wu, Hui; Tao, Xiaoyan; Li, Hao; Rayner, Simon; Liang, Guodong; Tang, Qing

    2013-01-07

    While the function of the phosphoprotein (P) gene of the rabies virus (RABV) has been well studied in laboratory adapted RABVs, the genetic diversity and evolution characteristics of the P gene of street RABVs remain unclear. The objective of the present study was to investigate the mutation and evolution of P genes in Chinese street RABVs. The P gene of 77 RABVs from brain samples of dogs and wild animals collected in eight Chinese provinces through 2003 to 2008 were sequenced. The open reading frame (ORF) of the P genes was 894 nucleotides (nt) in length, with 85-99% (80-89%) amino acid (nucleotide) identity compared with the laboratory RABVs and vaccine strains. Phylogenetic analysis based on the P gene revealed that Chinese RABVs strains could be divided into two distinct clades, and several RABV variants were found to co circulating in the same province. Two conserved (CD1, 2) and two variable (VD1, 2) domains were identified by comparing the deduced primary sequences of the encoded P proteins. Two sequence motifs, one believed to confer binding to the cytoplasmic dynein light chain LC8 and a lysine-rich sequence were conserved throughout the Chinese RABVs. In contrast, the isolates exhibited lower conservation of one phosphate acceptor and one internal translation initiation site identified in the P protein of the rabies challenge virus standard (CVS) strain. Bayesian coalescent analysis showed that the P gene in Chinese RABVs have a substitution rate (3.305x10(-4) substitutions per site per year) and evolution history (592 years ago) similar to values for the glycoprotein (G) and nucleoprotein (N) reported previously. Several substitutions were found in the P gene of Chinese RABVs strains compared to the laboratory adapted and vaccine strains, whether these variations could affect the biological characteristics of Chinese RABVs need to be further investigated. The substitution rate and evolution history of P gene is similar to G and N gene, combine the

  17. System of adjoint P1 equations for neutron moderation; Sistema de equacoes P1 adjuntas para a moderacao de neutrons

    Energy Technology Data Exchange (ETDEWEB)

    Martinez, Aquilino Senra; Silva, Fernando Carvalho da; Cardoso, Carlos Eduardo Santos [Universidade Federal, Rio de Janeiro, RJ (Brazil). Coordenacao dos Programas de Pos-graduacao de Engenharia. Programa de Engenharia Nuclear

    2000-07-01

    In some applications of perturbation theory, it is necessary know the adjoint neutron flux, which is obtained by the solution of adjoint neutron diffusion equation. However, the multigroup constants used for this are weighted in only the direct neutron flux, from the solution of direct P1 equations. In this work, this procedure is questioned and the adjoint P1 equations are derived by the neutron transport equation, the reversion operators rules and analogies between direct and adjoint parameters. (author)

  18. The ribosomal protein Rpl22 controls ribosome composition by directly repressing expression of its own paralog, Rpl22l1.

    Directory of Open Access Journals (Sweden)

    Monique N O'Leary

    Full Text Available Most yeast ribosomal protein genes are duplicated and their characterization has led to hypotheses regarding the existence of specialized ribosomes with different subunit composition or specifically-tailored functions. In yeast, ribosomal protein genes are generally duplicated and evidence has emerged that paralogs might have specific roles. Unlike yeast, most mammalian ribosomal proteins are thought to be encoded by a single gene copy, raising the possibility that heterogenous populations of ribosomes are unique to yeast. Here, we examine the roles of the mammalian Rpl22, finding that Rpl22(-/- mice have only subtle phenotypes with no significant translation defects. We find that in the Rpl22(-/- mouse there is a compensatory increase in Rpl22-like1 (Rpl22l1 expression and incorporation into ribosomes. Consistent with the hypothesis that either ribosomal protein can support translation, knockdown of Rpl22l1 impairs growth of cells lacking Rpl22. Mechanistically, Rpl22 regulates Rpl22l1 directly by binding to an internal hairpin structure and repressing its expression. We propose that ribosome specificity may exist in mammals, providing evidence that one ribosomal protein can influence composition of the ribosome by regulating its own paralog.

  19. Architecture of the large subunit of the mammalian mitochondrial ribosome.

    Science.gov (United States)

    Greber, Basil J; Boehringer, Daniel; Leitner, Alexander; Bieri, Philipp; Voigts-Hoffmann, Felix; Erzberger, Jan P; Leibundgut, Marc; Aebersold, Ruedi; Ban, Nenad

    2014-01-23

    Mitochondrial ribosomes synthesize a number of highly hydrophobic proteins encoded on the genome of mitochondria, the organelles in eukaryotic cells that are responsible for energy conversion by oxidative phosphorylation. The ribosomes in mammalian mitochondria have undergone massive structural changes throughout their evolution, including ribosomal RNA shortening and acquisition of mitochondria-specific ribosomal proteins. Here we present the three-dimensional structure of the 39S large subunit of the porcine mitochondrial ribosome determined by cryo-electron microscopy at 4.9 Å resolution. The structure, combined with data from chemical crosslinking and mass spectrometry experiments, reveals the unique features of the 39S subunit at near-atomic resolution and provides detailed insight into the architecture of the polypeptide exit site. This region of the mitochondrial ribosome has been considerably remodelled compared to its bacterial counterpart, providing a specialized platform for the synthesis and membrane insertion of the highly hydrophobic protein components of the respiratory chain.

  20. Placeholder factors in ribosome biogenesis: please, pave my way

    Directory of Open Access Journals (Sweden)

    Francisco J. Espinar-Marchena

    2017-04-01

    Full Text Available The synthesis of cytoplasmic eukaryotic ribosomes is an extraordinarily energy-demanding cellular activity that occurs progressively from the nucleolus to the cytoplasm. In the nucleolus, precursor rRNAs associate with a myriad of trans-acting factors and some ribosomal proteins to form pre-ribosomal particles. These factors include snoRNPs, nucleases, ATPases, GTPases, RNA helicases, and a vast list of proteins with no predicted enzymatic activity. Their coordinate activity orchestrates in a spatiotemporal manner the modification and processing of precursor rRNAs, the rearrangement reactions required for the formation of productive RNA folding intermediates, the ordered assembly of the ribosomal proteins, and the export of pre-ribosomal particles to the cytoplasm; thus, providing speed, directionality and accuracy to the overall process of formation of translation-competent ribosomes. Here, we review a particular class of trans-acting factors known as “placeholders”. Placeholder factors temporarily bind selected ribosomal sites until these have achieved a structural context that is appropriate for exchanging the placeholder with another site-specific binding factor. By this strategy, placeholders sterically prevent premature recruitment of subsequently binding factors, premature formation of structures, avoid possible folding traps, and act as molecular clocks that supervise the correct progression of pre-ribosomal particles into functional ribosomal subunits. We summarize the current understanding of those factors that delay the assembly of distinct ribosomal proteins or subsequently bind key sites in pre-ribosomal particles. We also discuss recurrent examples of RNA-protein and protein-protein mimicry between rRNAs and/or factors, which have clear functional implications for the ribosome biogenesis pathway.

  1. The architecture of mammalian ribosomal protein promoters

    Directory of Open Access Journals (Sweden)

    Perry Robert P

    2005-02-01

    Full Text Available Abstract Background Mammalian ribosomes contain 79 different proteins encoded by widely scattered single copy genes. Coordinate expression of these genes at transcriptional and post-transcriptional levels is required to ensure a roughly equimolar accumulation of ribosomal proteins. To date, detailed studies of only a very few ribosomal protein (rp promoters have been made. To elucidate the general features of rp promoter architecture, I made a detailed sequence comparison of the promoter regions of the entire set of orthologous human and mouse rp genes. Results A striking evolutionarily conserved feature of most rp genes is the separation by an intron of the sequences involved in transcriptional and translational regulation from the sequences with protein encoding function. Another conserved feature is the polypyrimidine initiator, which conforms to the consensus (Y2C+1TY(T2(Y3. At least 60 % of the rp promoters contain a largely conserved TATA box or A/T-rich motif, which should theoretically have TBP-binding capability. A remarkably high proportion of the promoters contain conserved binding sites for transcription factors that were previously implicated in rp gene expression, namely upstream GABP and Sp1 sites and downstream YY1 sites. Over 80 % of human and mouse rp genes contain a transposable element residue within 900 bp of 5' flanking sequence; very little sequence identity between human and mouse orthologues was evident more than 200 bp upstream of the transcriptional start point. Conclusions This analysis has provided some valuable insights into the general architecture of mammalian rp promoters and has identified parameters that might coordinately regulate the transcriptional activity of certain subsets of rp genes.

  2. Conjugation of nitrated acetaminophen to Der p1 amplifies peripheral blood monocyte response to Der p1.

    Directory of Open Access Journals (Sweden)

    Ryan G Thomas

    Full Text Available An association of acetaminophen use and asthma was observed in the International Study of Asthma and Allergies in Childhood study. However there are no clear mechanisms to explain an association between acetaminophen use and immunologic pathology. In acidic conditions like those in the stomach and inflamed airway, tyrosine residues are nitrated by nitrous and peroxynitrous acids. The resulting nitrotyrosine is structurally similar to 2,4-dinitrophenol and 2,4-dinitrochlorobenzene, known haptens that enhance immune responses by covalently binding proteins. Nitrated acetaminophen shares similar molecular structure.We hypothesized the acetaminophen phenol ring undergoes nitration under acidic conditions, producing 3-nitro-acetaminophen which augments allergic responses by acting as a hapten for environmental allergens.3-nitro-acetaminophen was formed from acetaminophen in the presence of acidified nitrite, purified by high performance liquid chromatography, and assayed by gas-chromatography mass spectrometry. Purified 3-nitro-acetaminophen was reacted with Dermatophagoides pteronyssinus (Der p1 and analyzed by mass spectrometry to identify the modification site. Human peripheral blood mononuclear cells proliferation response was measured in response to 3-nitro-acetaminophen and to 3-nitro-acetaminophen-modified Der p1.Acetaminophen was modified by nitrous acid forming 3-nitro-acetaminophen over a range of different acidic conditions consistent with airway inflammation and stomach acidity. The Der p1 protein-hapten adduct creation was confirmed by liquid chromatography-mass spectrometry proteomics modifying cysteine 132. Peripheral blood mononuclear cells exposed to 3-nitro-acetaminophen-modified Der p1 had increased proliferation and cytokine production compared to acetaminophen and Der p1 alone (n = 7; p < 0.05.These data suggests 3-nitro-acetaminophen formation and reaction with Der p1 provides a mechanism by which stomach acid or infection

  3. Molecular dynamics simulation of ribosome jam

    KAUST Repository

    Matsumoto, Shigenori

    2011-09-01

    We propose a coarse-grained molecular dynamics model of ribosome molecules to study the dependence of translation process on environmental parameters. We found the model exhibits traffic jam property, which is consistent with an ASEP model. We estimated the influence of the temperature and concentration of molecules on the hopping probability used in the ASEP model. Our model can also treat environmental effects on the translation process that cannot be explained by such cellular automaton models. © 2010 Elsevier B.V. All rights reserved.

  4. Ribosomal RNA: a key to phylogeny

    Science.gov (United States)

    Olsen, G. J.; Woese, C. R.

    1993-01-01

    As molecular phylogeny increasingly shapes our understanding of organismal relationships, no molecule has been applied to more questions than have ribosomal RNAs. We review this role of the rRNAs and some of the insights that have been gained from them. We also offer some of the practical considerations in extracting the phylogenetic information from the sequences. Finally, we stress the importance of comparing results from multiple molecules, both as a method for testing the overall reliability of the organismal phylogeny and as a method for more broadly exploring the history of the genome.

  5. Eukaryotic ribosome display with in situ DNA recovery.

    Science.gov (United States)

    He, Mingyue; Edwards, Bryan M; Kastelic, Damjana; Taussig, Michael J

    2012-01-01

    Ribosome display is a cell-free display technology for in vitro selection and optimisation of proteins from large diversified libraries. It operates through the formation of stable protein-ribosome-mRNA (PRM) complexes and selection of ligand-binding proteins, followed by DNA recovery from the selected genetic information. Both prokaryotic and eukaryotic ribosome display systems have been developed. In this chapter, we describe the eukaryotic rabbit reticulocyte method in which a distinct in situ single-primer RT-PCR procedure is used to recover DNA from the selected PRM complexes without the need for prior disruption of the ribosome.

  6. In Profile: Models of Ribosome Biogenesis Defects and Regulation of Protein Synthesis

    NARCIS (Netherlands)

    Essers, P.B.M.

    2013-01-01

    Ribosomes are the mediators of protein synthesis in the cell and therefore crucial to proper cell function. In addition, ribosomes are highly abundant, with ribosomal RNA making up 80% of the RNA in the cell. A large amount of resources go into maintaining this pool of ribosomes, so ribosome

  7. A computational investigation on the connection between dynamics properties of ribosomal proteins and ribosome assembly.

    Directory of Open Access Journals (Sweden)

    Brittany Burton

    Full Text Available Assembly of the ribosome from its protein and RNA constituents has been studied extensively over the past 50 years, and experimental evidence suggests that prokaryotic ribosomal proteins undergo conformational changes during assembly. However, to date, no studies have attempted to elucidate these conformational changes. The present work utilizes computational methods to analyze protein dynamics and to investigate the linkage between dynamics and binding of these proteins during the assembly of the ribosome. Ribosomal proteins are known to be positively charged and we find the percentage of positive residues in r-proteins to be about twice that of the average protein: Lys+Arg is 18.7% for E. coli and 21.2% for T. thermophilus. Also, positive residues constitute a large proportion of RNA contacting residues: 39% for E. coli and 46% for T. thermophilus. This affirms the known importance of charge-charge interactions in the assembly of the ribosome. We studied the dynamics of three primary proteins from E. coli and T. thermophilus 30S subunits that bind early in the assembly (S15, S17, and S20 with atomic molecular dynamic simulations, followed by a study of all r-proteins using elastic network models. Molecular dynamics simulations show that solvent-exposed proteins (S15 and S17 tend to adopt more stable solution conformations than an RNA-embedded protein (S20. We also find protein residues that contact the 16S rRNA are generally more mobile in comparison with the other residues. This is because there is a larger proportion of contacting residues located in flexible loop regions. By the use of elastic network models, which are computationally more efficient, we show that this trend holds for most of the 30S r-proteins.

  8. Defining the bacteroides ribosomal binding site.

    Science.gov (United States)

    Wegmann, Udo; Horn, Nikki; Carding, Simon R

    2013-03-01

    The human gastrointestinal tract, in particular the colon, hosts a vast number of commensal microorganisms. Representatives of the genus Bacteroides are among the most abundant bacterial species in the human colon. Bacteroidetes diverged from the common line of eubacterial descent before other eubacterial groups. As a result, they employ unique transcription initiation signals and, because of this uniqueness, they require specific genetic tools. Although some tools exist, they are not optimal for studying the roles and functions of these bacteria in the human gastrointestinal tract. Focusing on translation initiation signals in Bacteroides, we created a series of expression vectors allowing for different levels of protein expression in this genus, and we describe the use of pepI from Lactobacillus delbrueckii subsp. lactis as a novel reporter gene for Bacteroides. Furthermore, we report the identification of the 3' end of the 16S rRNA of Bacteroides ovatus and analyze in detail its ribosomal binding site, thus defining a core region necessary for efficient translation, which we have incorporated into the design of our expression vectors. Based on the sequence logo information from the 5' untranslated region of other Bacteroidales ribosomal protein genes, we conclude that our findings are relevant to all members of this order.

  9. Adjoint P1 equations solution for neutron slowing down; Solucao das equacoes P1 adjuntas para moderacao de neutrons

    Energy Technology Data Exchange (ETDEWEB)

    Cardoso, Carlos Eduardo Santos; Martinez, Aquilino Senra; Silva, Fernando Carvalho da [Universidade Federal, Rio de Janeiro, RJ (Brazil). Coordenacao dos Programas de Pos-graduacao de Engenharia. Programa de Engenharia Nuclear

    2002-07-01

    In some applications of perturbation theory, it is necessary know the adjoint neutron flux, which is obtained by the solution of adjoint neutron diffusion equation. However, the multigroup constants used for this are weighted in only the direct neutron flux, from the solution of direct P1 equations. In this work, the adjoint P1 equations are derived by the neutron transport equation, the reversion operators rules and analogies between direct and adjoint parameters. The direct and adjoint neutron fluxes resulting from the solution of P{sub 1} equations were used to three different weighting processes, to obtain the macrogroup macroscopic cross sections. It was found out noticeable differences among them. (author)

  10. Mechanism of recycling of post-termination ribosomal complexes in ...

    Indian Academy of Sciences (India)

    Madhu

    all pathway of ribosome recycling in eubacteria with especial reference to the important role of the initiation factor ... [Seshadri A and Varshney U 2006 Mechanism of recycling of post-termination ribosomal complexes in eubacteria: a new role of initiation factor 3 .... RRF binding results in a remarkable conformational change.

  11. Expression of protein-coding genes embedded in ribosomal DNA

    DEFF Research Database (Denmark)

    Johansen, Steinar D; Haugen, Peik; Nielsen, Henrik

    2007-01-01

    Ribosomal DNA (rDNA) is a specialised chromosomal location that is dedicated to high-level transcription of ribosomal RNA genes. Interestingly, rDNAs are frequently interrupted by parasitic elements, some of which carry protein genes. These are non-LTR retrotransposons and group II introns that e...... in the nucleolus....

  12. Proto-ribosome: a theoretical approach based on RNA relics

    OpenAIRE

    Demongeot, Jacques

    2017-01-01

    We describe in this paper, based on already published articles, a contribution to the theory postulating the existence of a proto-ribosome, which could have appeared early at the origin of life and we discuss the interest of this notion in an evolutionary perspective, taking into account the existence of possible RNA relics of this proto-ribosome.

  13. Observation of the 1P1 state of charmonium

    International Nuclear Information System (INIS)

    Armstrong, T.A.; Bettoni, D.; Bharadwaj, V.; Biino, C.; Borreani, G.; Broemmelsiek, D.; Buzzo, A.; Calabrese, R.; Ceccucci, A.; Cester, R.; Church, M.; Dalpiaz, P.; Dalpiaz, P.F.; Dibenedetto, R.; Dimitroyannis, D.; Fabbri, M.G.; Fast, J.; Gianoli, A.; Ginsburg, C.M.; Gollwitzer, K.; Hahn, A.; Hasan, M.; Hsueh, S.; Lewis, R.; Luppi, E.; Macri, M.; Majewska, A.M.; Mandelkern, M.; Marchetto, F.; Marinelli, M.; Marques, J.; Marsh, W.; Martini, M.; Masuzawa, M.; Menichetti, E.; Migliori, A.; Mussa, R.; Palestini, S.; Pallavicini, M.; Pastrone, N.; Patrignani, C.; Peoples, J. Jr.; Pesando, L.; Petrucci, F.; Pia, M.G.; Pordes, S.; Rapidis, P.; Ray, R.; Reid, J.; Rinaudo, G.; Roccuzzo, B.; Rosen, J.; Santroni, A.; Sarmiento, M.; Savrie, M.; Scalisi, A.; Schultz, J.; Seth, K.K.; Smith, A.; Smith, G.A.; Sozzi, M.; Trokenheim, S.; Weber, M.F.; Werkema, S.; Zhang, Y.; Zhao, J.; Zioulas, G.

    1992-01-01

    We have performed a search for the 1 P 1 state of charmonium resonantly formed in bar pp annihilations, close to the center of gravity of the 3 P J states. We report results from the study of the J/ψ+π 0 and J/ψ+2π final states. We have observed a statistically significant enhancement in the bar p+p→J/ψ+π 0 cross section at √s congruent 3526.2 MeV. This enhancement has the characteristics of a narrow resonance of mass, total width, and production cross section consistent with what is expected for the 1 P 1 state. In our search we have found no candidates for the reactions bar p+p→J/ψ+π 0 +π 0 and bar p+p→J/ψ+π + +π -

  14. The Complete Structure of the Mycobacterium smegmatis 70S Ribosome

    Directory of Open Access Journals (Sweden)

    Jendrik Hentschel

    2017-07-01

    Full Text Available The ribosome carries out the synthesis of proteins in every living cell. It consequently represents a frontline target in anti-microbial therapy. Tuberculosis ranks among the leading causes of death worldwide, due in large part to the combination of difficult-to-treat latency and antibiotic resistance. Here, we present the 3.3-Å cryo-EM structure of the 70S ribosome of Mycobacterium smegmatis, a close relative to the human pathogen Mycobacterium tuberculosis. The structure reveals two additional ribosomal proteins and localizes them to the vicinity of drug-target sites in both the catalytic center and the decoding site of the ribosome. Furthermore, we visualized actinobacterium-specific rRNA and protein expansions that extensively remodel the ribosomal surface with implications for polysome organization. Our results provide a foundation for understanding the idiosyncrasies of mycobacterial translation and reveal atomic details of the structure that will facilitate the design of anti-tubercular therapeutics.

  15. Macrolide antibiotic interaction and resistance on the bacterial ribosome.

    Science.gov (United States)

    Poehlsgaard, Jacob; Douthwaite, Stephen

    2003-02-01

    Our understanding of the fine structure of many antibiotic target sites has reached a new level of enlightenment in the last couple of years due to the advent, by X-ray crystallography, of high-resolution structures of the bacterial ribosome. Many classes of clinically useful antibiotics bind to the ribosome to inhibit bacterial protein synthesis. Macrolide, lincosamide and streptogramin B (MLSB) antibiotics form one of the largest groups, and bind to the same site on the 50S ribosomal subunit. Here, we review the molecular details of the ribosomal MLSB site to put into perspective the main points from a wealth of biochemical and genetic data that have been collected over several decades. The information is now available to understand, at atomic resolution, how macrolide antibiotics interact with their ribosomal target, how the target is altered to confer resistance, and in which directions we need to look if we are to rationally design better drugs to overcome the extant resistance mechanisms.

  16. Cis-regulatory RNA elements that regulate specialized ribosome activity.

    Science.gov (United States)

    Xue, Shifeng; Barna, Maria

    2015-01-01

    Recent evidence has shown that the ribosome itself can play a highly regulatory role in the specialized translation of specific subpools of mRNAs, in particular at the level of ribosomal proteins (RP). However, the mechanism(s) by which this selection takes place has remained poorly understood. In our recent study, we discovered a combination of unique RNA elements in the 5'UTRs of mRNAs that allows for such control by the ribosome. These mRNAs contain a Translation Inhibitory Element (TIE) that inhibits general cap-dependent translation, and an Internal Ribosome Entry Site (IRES) that relies on a specific RP for activation. The unique combination of an inhibitor of general translation and an activator of specialized translation is key to ribosome-mediated control of gene expression. Here we discuss how these RNA regulatory elements provide a new level of control to protein expression and their implications for gene expression, organismal development and evolution.

  17. The P1approximation in the transport of beta rays

    International Nuclear Information System (INIS)

    Legarda, F.; Idoeta, R.; Herranz, M.

    1994-01-01

    A validation test for the p1 approximation to the linear transport of electrons in planar geometry has been performed. The p1 approximation is shown to be a good option for the description of the transport of beta rays with endpoint energies between 400kev and 3.5Mev through aluminium foils . This approximation together with the use of only elastic interactions of electrons with atoms has found good agreement with experimental results . A calculation has been made of the fraction of transmitted electrons through foils, solving the transport equation for planar geometry in the p1 approximation and assuming that only elastic scattering processes take place. The boundary condition at the entrance of the foil was a collimated beta source, while at the end of the foil has been adopted a vaccum boundary condition.Sources considered are those for which experimental and calculated spectrum shapes are known to agree. The calculated fractional transmission through different absorber thicknesses is found to have an exponential shape . Besides this fact the attenuation coefficients found ,when compared with those empirically obtained, agree to within 5%. 1 fig.; 4 refs. (author)

  18. Structural Disorder within Paramyxoviral Nucleoproteins and Phosphoproteins in Their Free and Bound Forms: From Predictions to Experimental Assessment

    Directory of Open Access Journals (Sweden)

    Johnny Habchi

    2015-07-01

    Full Text Available We herein review available computational and experimental data pointing to the abundance of structural disorder within the nucleoprotein (N and phosphoprotein (P from three paramyxoviruses, namely the measles (MeV, Nipah (NiV and Hendra (HeV viruses. We provide a detailed molecular description of the mechanisms governing the disorder-to-order transition that the intrinsically disordered C-terminal domain (NTAIL of their N proteins undergoes upon binding to the C-terminal X domain (PXD of the homologous P proteins. We also show that NTAIL–PXD complexes are “fuzzy”, i.e., they possess a significant residual disorder, and discuss the possible functional significance of this fuzziness. Finally, we emphasize the relevance of N–P interactions involving intrinsically disordered proteins as promising targets for new antiviral approaches, and end up summarizing the general functional advantages of disorder for viruses.

  19. Cloning and characterization of DNA complementary to the canine distemper virus mRNA encoding matrix, phosphoprotein, and nucleocapsid protein

    International Nuclear Information System (INIS)

    Rozenblatt, S.; Eizenberg, O.; Englund, G.; Bellini, W.J.

    1985-01-01

    Double-stranded cDNA synthesized from total polyadenylate-containing mRNA, extracted from monkey kidney cells infected with canine distemper virus (CDV), has been cloned into the PstI site of Escherichia coli plasmid pBR322. Clones containing canine distemper virus DNA were identified by hybridization to a canine distemper virus-specific, 32 P-labeled cDNA. Four specific clones containing different classes of sequences have been identified. The cloned plasmids contain inserts of 800 (clone 44-80), 960 (clone 74-16), 1700 (clone 364), and 950 (clone 40-9) base pairs. The sizes of the mRNA species complementary to these inserts are 1500, 1850, 1850 and 2500 nucleotides, respectively, as determined by the Northern technique. Three of the cloned DNA fragments were further identified as the reverse transcripts of the mRNA coding for the matrix, phosphoprotein, and nucleocapsid protein of CDV

  20. Cloning and characterization of DNA complementary to the canine distemper virus mRNA encoding matrix, phosphoprotein, and nucleocapsid protein

    Energy Technology Data Exchange (ETDEWEB)

    Rozenblatt, S.; Eizenberg, O.; Englund, G.; Bellini, W.J.

    1985-02-01

    Double-stranded cDNA synthesized from total polyadenylate-containing mRNA, extracted from monkey kidney cells infected with canine distemper virus (CDV), has been cloned into the PstI site of Escherichia coli plasmid pBR322. Clones containing canine distemper virus DNA were identified by hybridization to a canine distemper virus-specific, /sup 32/P-labeled cDNA. Four specific clones containing different classes of sequences have been identified. The cloned plasmids contain inserts of 800 (clone 44-80), 960 (clone 74-16), 1700 (clone 364), and 950 (clone 40-9) base pairs. The sizes of the mRNA species complementary to these inserts are 1500, 1850, 1850 and 2500 nucleotides, respectively, as determined by the Northern technique. Three of the cloned DNA fragments were further identified as the reverse transcripts of the mRNA coding for the matrix, phosphoprotein, and nucleocapsid protein of CDV.

  1. Fanconi anemia protein, FANCG, is a phosphoprotein and is upregulated with FANCA after TNF-alpha treatment.

    Science.gov (United States)

    Futaki, M; Watanabe, S; Kajigaya, S; Liu, J M

    2001-02-23

    Fanconi anemia (FA) is a genetic syndrome characterized by bone marrow failure, birth defects, and a predisposition to malignancy. At this time, six FA genes have been identified, and several gene products have been found to interact in a protein complex. FA cells appear to overexpress the proinflammatory cytokine, tumor necrosis factor-alpha (TNF-alpha). We therefore examined the effects of TNF-alpha on the regulation of FA complementation group proteins, FANCG and FANCA. We found that treatment with TNF-alpha induced FANCG protein expression. FANCA was induced concurrently with FANCG, and the FANCA/FANCG complex was increased in the nucleus following TNF-alpha treatment. Inactivation of inhibitory kappa B kinase-2 modulated the expression of FANCG. We also found that both nuclear and cytoplasmic FANCG fractions were phosphorylated. These results show that FANCG is a phosphoprotein and suggest that the cellular accumulation of FA proteins is subject to regulation by TNF-alpha signaling.

  2. Control of Ribosome Synthesis in Escherichia coli

    DEFF Research Database (Denmark)

    Molin, Søren; Meyenburg, K. von; Måløe, O.

    1977-01-01

    The rate of ribosome synthesis and accumulation in Escherichia coli during the transition after an energy source shift-down was analyzed. The shift was imposed on cultures of stringent and relaxed strains growing in glucose minimal medium by the addition of the glucose analogue {alpha...... and to estimate the transcription time for the rRNA operon under different conditions. In steady states of growth with growth rates ranging from 0.75 to 2.3 doublings/h, as well as during the transition after a shift-down, the transcription time of the rRNA operon was constant. The rate of synthesis of r......RNA correlated during this transition – in contrast to the rate of accumulation (M. T. Hansen et al., J. Bacteriol. 122: 585-591, 1975) – with the ppGpp pool in the same way as has been observed during partial amino acid starvation....

  3. Topography and stoichiometry of acidic proteins in large ribosomal subunits from Artemia salina as determined by crosslinking

    International Nuclear Information System (INIS)

    Uchiumi, T.; Wahba, A.J.; Traut, R.R.

    1987-01-01

    The 60S subunits isolated from Artemia salina ribosomes were treated with the crosslinking reagent 2-iminothiolane under mild conditions. Proteins were extracted and fractions containing crosslinked acidic proteins were obtained by stepwise elution from CM-cellulose. Each fraction was analyzed by diagonal (two-dimensional nonreducing-reducing) NaDodSO 4 /polyacrylamide gel electrophoresis. Crosslinked proteins below the diagonal were radioiodinated and identified by two-dimensional acidic urea-NaDodSO 4 gel electrophoresis. Each of the acidic proteins P1 and P2 was crosslinked individually to the same third protein, PO. The fractions containing acidic proteins were also analyzed by two-dimensional nonequilibrium isoelectric focusing-NaDodSO 4 /polyacrylamide gel electrophoresis. Two crosslinked complexes were observed that coincide in isoelectric positions with monomeric P1 and P2, respectively. Both P1 and P2 appear to form crosslinked homodimers. These results suggest the presence in the 60S subunit of (P1) 2 and (P2) 2 dimers, each of which is anchored to PO. Protein PO appears to play the same role as L10 in Escherichia coli ribosomes and may form a pentameric complex with the two dimers in the 60S subunits

  4. Hierarchical recruitment of ribosomal proteins and assembly factors remodels nucleolar pre-60S ribosomes.

    Science.gov (United States)

    Biedka, Stephanie; Micic, Jelena; Wilson, Daniel; Brown, Hailey; Diorio-Toth, Luke; Woolford, John L

    2018-04-24

    Ribosome biogenesis involves numerous preribosomal RNA (pre-rRNA) processing events to remove internal and external transcribed spacer sequences, ultimately yielding three mature rRNAs. Removal of the internal transcribed spacer 2 spacer RNA is the final step in large subunit pre-rRNA processing and begins with endonucleolytic cleavage at the C 2 site of 27SB pre-rRNA. C 2 cleavage requires the hierarchical recruitment of 11 ribosomal proteins and 14 ribosome assembly factors. However, the function of these proteins in C 2 cleavage remained unclear. In this study, we have performed a detailed analysis of the effects of depleting proteins required for C 2 cleavage and interpreted these results using cryo-electron microscopy structures of assembling 60S subunits. This work revealed that these proteins are required for remodeling of several neighborhoods, including two major functional centers of the 60S subunit, suggesting that these remodeling events form a checkpoint leading to C 2 cleavage. Interestingly, when C 2 cleavage is directly blocked by depleting or inactivating the C 2 endonuclease, assembly progresses through all other subsequent steps. © 2018 Biedka et al.

  5. A comparative study of ribosomal proteins: linkage between amino acid distribution and ribosomal assembly

    International Nuclear Information System (INIS)

    Lott, Brittany Burton; Wang, Yongmei; Nakazato, Takuya

    2013-01-01

    Assembly of the ribosome from its protein and RNA constituents must occur quickly and efficiently in order to synthesize the proteins necessary for all cellular activity. Since the early 1960’s, certain characteristics of possible assembly pathways have been elucidated, yet the mechanisms that govern the precise recognition events remain unclear. We utilize a comparative analysis to investigate the amino acid composition of ribosomal proteins (r-proteins) with respect to their role in the assembly process. We compared small subunit (30S) r-protein sequences to those of other housekeeping proteins from 560 bacterial species and searched for correlations between r-protein amino acid content and factors such as assembly binding order, environmental growth temperature, protein size, and contact with ribosomal RNA (rRNA) in the 30S complex. We find r-proteins have a significantly high percent of positive residues, which are highly represented at rRNA contact sites. An inverse correlation between the percent of positive residues and r-protein size was identified and is mainly due to the content of Lysine residues, rather than Arginine. Nearly all r-proteins carry a net positive charge, but no statistical correlation between the net charge and the binding order was detected. Thermophilic (high-temperature) r-proteins contain increased Arginine, Isoleucine, and Tyrosine, and decreased Serine and Threonine compared to mesophilic (lower-temperature), reflecting a known distinction between thermophiles and mesophiles, possibly to account for protein thermostability. However, this difference in amino acid content does not extend to rRNA contact sites, as the proportions of thermophilic and mesophilic contact residues are not significantly different. Given the significantly higher level of positively charged residues in r-proteins and at contact sites, we conclude that ribosome assembly relies heavily on an electrostatic component of interaction. However, the binding order of

  6. Plasmid P1 replication: negative control by repeated DNA sequences.

    OpenAIRE

    Chattoraj, D; Cordes, K; Abeles, A

    1984-01-01

    The incompatibility locus, incA, of the unit-copy plasmid P1 is contained within a fragment that is essentially a set of nine 19-base-pair repeats. One or more copies of the fragment destabilizes the plasmid when present in trans. Here we show that extra copies of incA interfere with plasmid DNA replication and that a deletion of most of incA increases plasmid copy number. Thus, incA is not essential for replication but is required for its control. When cloned in a high-copy-number vector, pi...

  7. On the control of ribosomal protein biosynthesis in Escherichia coli

    International Nuclear Information System (INIS)

    Pichon, J.; Marvaldi, J.; Coeroli, C.; Cozzone, A.; Marchis-Mouren, G.

    1977-01-01

    The rate of individual ribosomal protein synthesis relative to total protein synthesis has been determined in Escherichia coli rel + and rel - cells, under valyl-tRNA deprivation. These strains have a temperature-sensitive valyl-tRNA synthetase. Starvation was obtained following transfer of the cells to non-permissive temperature. Ribosomal proteins were obtained by treatment of either total lysates of freeze-thawed lysozyme spheroplasts or ammonium sulphate precipitate of ribosomes, with acetic acid. Differential labelling of the ribosomal proteins was observed in both strains: proteins from the rel + strain appear more labelled than those from the rel - strain, the rate of labelling of individual proteins being about the same in both strains. Moreover ribosomal proteins were found as stable during starvation as total protein. It is thus concluded that in starving cells individual ribosomal proteins are not synthesized at equal rates. This indicates that the synthesis of ribosomal proteins is not only under the control of the rel gene

  8. Post-transcriptional regulation of ribosome biogenesis in yeast

    Directory of Open Access Journals (Sweden)

    Isabelle C. Kos-Braun

    2017-05-01

    Full Text Available Most microorganisms are exposed to the constantly and often rapidly changing environment. As such they evolved mechanisms to balance their metabolism and energy expenditure with the resources available to them. When resources become scarce or conditions turn out to be unfavourable for growth, cells reduce their metabolism and energy usage to survive. One of the major energy consuming processes in the cell is ribosome biogenesis. Unsurprisingly, cells encountering adverse conditions immediately shut down production of new ribosomes. It is well established that nutrient depletion leads to a rapid repression of transcription of the genes encoding ribosomal proteins, ribosome biogenesis factors as well as ribosomal RNA (rRNA. However, if pre-rRNA processing and ribosome assembly are regulated post-transcriptionally remains largely unclear. We have recently uncovered that the yeast Saccharomyces cerevisiae rapidly switches between two alternative pre-rRNA processing pathways depending on the environmental conditions. Our findings reveal a new level of complexity in the regulation of ribosome biogenesis.

  9. The Unexplored Mechanisms and Regulatory Functions of Ribosomal Translocation

    Science.gov (United States)

    Alejo, Jose Luis

    In every cell, protein synthesis is carried out by the ribosome, a complex macromolecular RNA-protein assembly. Decades of structural and kinetic studies have increased our understanding of ribosome initiation, decoding, translocation and termination. Yet, the underlying mechanism of these fundamental processes has yet to be fully delineated. Hence, the molecular basis of regulation remains obscure. Here, single-molecule fluorescence methods are applied to decipher the mechanism and regulatory roles of the multi-step process of directional substrate translocation on the ribosome that accompanies every round of protein synthesis. In Chapter 1, single-molecule fluorescence resonance energy transfer (smFRET) is introduced as a tool for studying bacterial ribosome translocation. Chapter 2 details the experimental methods. In Chapter 3, the elongation factor G(EF-G)-catalyzed movement of substrates through the ribosome is examined from several perspectives or signals reporting on various degrees of freedom of ribosome dynamics. Two ribosomal states interconvert in the presence of EF-G(GDP), displaying novel head domain motions, until relocking takes place. In Chapter 4, in order to test if the mentioned fluctuations leading to relocking are correlated to the engagement of the P-site by the peptidyl-tRNA, the translocation of miscoded tRNAs is studied. Severe defects in the relocking stages of translocation reveal the correlation between this new stage of translocation and P-site tRNA engagement.

  10. Cisplatin Targeting of Bacterial Ribosomal RNA Hairpins

    Directory of Open Access Journals (Sweden)

    Gayani N. P. Dedduwa-Mudalige

    2015-09-01

    Full Text Available Cisplatin is a clinically important chemotherapeutic agent known to target purine bases in nucleic acids. In addition to major deoxyribonucleic acid (DNA intrastrand cross-links, cisplatin also forms stable adducts with many types of ribonucleic acid (RNA including siRNA, spliceosomal RNAs, tRNA, and rRNA. All of these RNAs play vital roles in the cell, such as catalysis of protein synthesis by rRNA, and therefore serve as potential drug targets. This work focused on platination of two highly conserved RNA hairpins from E. coli ribosomes, namely pseudouridine-modified helix 69 from 23S rRNA and the 790 loop of helix 24 from 16S rRNA. RNase T1 probing, MALDI mass spectrometry, and dimethyl sulfate mapping revealed platination at GpG sites. Chemical probing results also showed platination-induced RNA structural changes. These findings reveal solvent and structural accessibility of sites within bacterial RNA secondary structures that are functionally significant and therefore viable targets for cisplatin as well as other classes of small molecules. Identifying target preferences at the nucleotide level, as well as determining cisplatin-induced RNA conformational changes, is important for the design of more potent drug molecules. Furthermore, the knowledge gained through studies of RNA-targeting by cisplatin is applicable to a broad range of organisms from bacteria to human.

  11. Organization of Replication of Ribosomal DNA in Saccharomyces cerevisiae

    NARCIS (Netherlands)

    Linskens, Maarten H.K.; Huberman, Joel A.

    1988-01-01

    Using recently developed replicon mapping techniques, we have analyzed the replication of the ribosomal DNA in Saccharomyces cerevisiae. The results show that (i) the functional origin of replication colocalizes with an autonomously replicating sequence element previously mapped to the

  12. Ribosome slowed by mutation to streptomycin resistance. [Escherichia coli

    Energy Technology Data Exchange (ETDEWEB)

    Galas, D J; Branscomb, E W

    1976-08-12

    The effect of mutation to streptomycin resistance on the speed of polypeptide elongation in Escherichia coli was investigated. Translation speed was determined by measuring the time required for the first newly synthesized ..beta..-galactosidase molecules to appear after induction of the lactose operon. The results showed that ribosome speed is not a fixed parameter inherent to the protein synthetic apparatus, but a variable determined by the kinetics of translation and ultimately by the structure of the ribosome. (HLW)

  13. Defective ribosome assembly in Shwachman-Diamond syndrome.

    Science.gov (United States)

    Wong, Chi C; Traynor, David; Basse, Nicolas; Kay, Robert R; Warren, Alan J

    2011-10-20

    Shwachman-Diamond syndrome (SDS), a recessive leukemia predisposition disorder characterized by bone marrow failure, exocrine pancreatic insufficiency, skeletal abnormalities and poor growth, is caused by mutations in the highly conserved SBDS gene. Here, we test the hypothesis that defective ribosome biogenesis underlies the pathogenesis of SDS. We create conditional mutants in the essential SBDS ortholog of the ancient eukaryote Dictyostelium discoideum using temperature-sensitive, self-splicing inteins, showing that mutant cells fail to grow at the restrictive temperature because ribosomal subunit joining is markedly impaired. Remarkably, wild type human SBDS complements the growth and ribosome assembly defects in mutant Dictyostelium cells, but disease-associated human SBDS variants are defective. SBDS directly interacts with the GTPase elongation factor-like 1 (EFL1) on nascent 60S subunits in vivo and together they catalyze eviction of the ribosome antiassociation factor eukaryotic initiation factor 6 (eIF6), a prerequisite for the translational activation of ribosomes. Importantly, lymphoblasts from SDS patients harbor a striking defect in ribosomal subunit joining whose magnitude is inversely proportional to the level of SBDS protein. These findings in Dictyostelium and SDS patient cells provide compelling support for the hypothesis that SDS is a ribosomopathy caused by corruption of an essential cytoplasmic step in 60S subunit maturation.

  14. Emerging functions of ribosomal proteins in gene-specific transcription and translation

    International Nuclear Information System (INIS)

    Lindstroem, Mikael S.

    2009-01-01

    Ribosomal proteins have remained highly conserved during evolution presumably reflecting often critical functions in ribosome biogenesis or mature ribosome function. In addition, several ribosomal proteins possess distinct extra-ribosomal functions in apoptosis, DNA repair and transcription. An increasing number of ribosomal proteins have been shown to modulate the trans-activation function of important regulatory proteins such as NF-κB, p53, c-Myc and nuclear receptors. Furthermore, a subset of ribosomal proteins can bind directly to untranslated regions of mRNA resulting in transcript-specific translational control outside of the ribosome itself. Collectively, these findings suggest that ribosomal proteins may have a wider functional repertoire within the cell than previously thought. The future challenge is to identify and validate these novel functions in the background of an often essential primary function in ribosome biogenesis and cell growth.

  15. Tetrahymena thermophila acidic ribosomal protein L37 contains an archaebacterial type of C-terminus

    DEFF Research Database (Denmark)

    Hansen, T S; Andreasen, P H; Dreisig, H

    1991-01-01

    We have cloned and characterized a Tetrahymena thermophila macronuclear gene (L37) encoding the acidic ribosomal protein (A-protein) L37. The gene contains a single intron located in the 3'-part of the coding region. Two major and three minor transcription start points (tsp) were mapped 39 to 63 ...... by protein sequencing. The T. thermophila L37 clearly belongs to the P1-type family of eukaryotic A-proteins, but the C-terminal region has the hallmarks of archaebacterial A-proteins.......We have cloned and characterized a Tetrahymena thermophila macronuclear gene (L37) encoding the acidic ribosomal protein (A-protein) L37. The gene contains a single intron located in the 3'-part of the coding region. Two major and three minor transcription start points (tsp) were mapped 39 to 63...... nucleotides upstream from the translational start codon. The uppermost tsp mapped to the first T in a putative T. thermophila RNA polymerase II initiator element, TATAA. The coding region of L37 predicts a protein of 109 amino acid (aa) residues. A substantial part of the deduced aa sequence was verified...

  16. Purification and partial characterization of analogous 26-kDa rat submandibular and parotid gland integral membrane phosphoproteins that may have a role in exocytosis.

    Science.gov (United States)

    Quissell, D O; Deisher, L M

    1992-04-01

    Rat submandibular and parotid gland exocytosis is primarily controlled by beta-adrenergic receptor stimulation. Although its precise role in the regulation of salivary gland exocytosis is not fully understood, protein phosphorylation, mediated by the activation of cAMP-dependent protein kinase, may be directly involved. Previous studies suggest that analogous 26-kDa integral membrane phosphoproteins may play a direct role in regulating exocytosis. Studies were here undertaken to purify and partially characterize both phosphoproteins. After endogenous phosphorylation with 32P, subcellular fraction and solubilization of the microsomal fraction in n-octyl beta-glucopyranoside, the 26-kDa integral membrane phosphoproteins were purified by high performance liquid chromatography (HPLC), followed by sodium dodecyl sulphate-polyacrylamide gel electrophoresis and electroelution of the proteins. Amino acid analysis indicated a significant number of serine amino acids: N-terminal sequence data demonstrated a high level of homology; and trypsin digestion followed by reversed-phase HPLC indicated the possibility of multiple phosphorylation sites.

  17. Study of TiO2(1 1 0)-p(1x1), p(1x2) and p(1x3) surface structures by impact collision ion scattering spectroscopy (ICISS)

    International Nuclear Information System (INIS)

    Asari, E.; Souda, R.

    2000-01-01

    The surface structure of TiO 2 (1 1 0)-p(1x1), p(1x2) and p(1x3) were studied using impact collision ion scattering spectroscopy (ICISS). We found that (i) the height of bridging oxygen for the p(1x1) is comparative to that of bulk structure, (ii) the p(1x2) surface has the added Ti 2 O 3 unit rows proposed by Onishi et al. and also the oxygen atoms rows between Ti 2 O 3 unit rows and (iii) the p(1x3) surface is constructed with the same added Ti 2 O 3 unit rows as that in the p(1x2) surface, but the bridging oxygen rows exist between the Ti 2 O 3 unit rows

  18. S-Nitrosation destabilizes glutathione transferase P1-1.

    Science.gov (United States)

    Balchin, David; Stoychev, Stoyan H; Dirr, Heini W

    2013-12-23

    Protein S-nitrosation is a post-translational modification that regulates the function of more than 500 human proteins. Despite its apparent physiological significance, S-nitrosation is poorly understood at a molecular level. Here, we investigated the effect of S-nitrosation on the activity, structure, stability, and dynamics of human glutathione transferase P1-1 (GSTP1-1), an important detoxification enzyme ubiquitous in aerobes. S-Nitrosation at Cys47 and Cys101 reduces the activity of the enzyme by 94%. Circular dichroism spectroscopy, acrylamide quenching, and amide hydrogen-deuterium exchange mass spectrometry experiments indicate that the loss of activity is caused by the introduction of local disorder at the active site of GSTP1-1. Furthermore, the modification destabilizes domain 1 of GSTP1-1 against denaturation, smoothing the unfolding energy landscape of the protein and introducing a refolding defect. In contrast, S-nitrosation at Cys101 alone introduces a refolding defect in domain 1 but compensates by stabilizing the domain kinetically. These data elucidate the physical basis for the regulation of GSTP1-1 by S-nitrosation and provide general insight into the consequences of S-nitrosation on protein stability and dynamics.

  19. Tetrahymena thermophila acidic ribosomal protein L37 contains an archaebacterial type of C-terminus.

    Science.gov (United States)

    Hansen, T S; Andreasen, P H; Dreisig, H; Højrup, P; Nielsen, H; Engberg, J; Kristiansen, K

    1991-09-15

    We have cloned and characterized a Tetrahymena thermophila macronuclear gene (L37) encoding the acidic ribosomal protein (A-protein) L37. The gene contains a single intron located in the 3'-part of the coding region. Two major and three minor transcription start points (tsp) were mapped 39 to 63 nucleotides upstream from the translational start codon. The uppermost tsp mapped to the first T in a putative T. thermophila RNA polymerase II initiator element, TATAA. The coding region of L37 predicts a protein of 109 amino acid (aa) residues. A substantial part of the deduced aa sequence was verified by protein sequencing. The T. thermophila L37 clearly belongs to the P1-type family of eukaryotic A-proteins, but the C-terminal region has the hallmarks of archaebacterial A-proteins.

  20. Secreted phosphoprotein 24 kD (Spp24) inhibits growth of human pancreatic cancer cells caused by BMP-2

    International Nuclear Information System (INIS)

    Li, Chen-Shuang; Tian, Haijun; Zou, Min; Zhao, Ke-Wei; Li, Yawei; Lao, Lifeng; Brochmann, Elsa J.; Duarte, M. Eugenia L.; Daubs, Michael D.; Zhou, Yan-Heng; Murray, Samuel S.; Wang, Jeffrey C.

    2015-01-01

    The emerging role of bone morphogenetic proteins (BMPs) in the initiation and progression of multiple cancers has drawn great attention in cancer research. In this study, we report that BMP-2 can promote the proliferation of the pancreatic tumor cell line, PANC-1. Secreted phosphoprotein 24 kD (Spp24), a BMP binding protein, did not affect the proliferation of the cells but promoted the apoptosis of the cells in vitro. In a xeneograft tumor model using PANC-1 cells, BMP-2 dramatically promoted tumor growth, while Spp24 not only abolished the effect of BMP-2, but also dramatically induced tumor shrinking when used alone. Activation of Smad1/5/8 participated in this process as demonstrated by immunohistochemical staining of phosphorylated Smad 1/5/8. We conclude that Spp24 can be developed into a therapeutic agent that could be employed in clinical situations where the inhibition of BMPs and related proteins is advantageous. - Highlights: • Spp24 effectively inhibited the in vivo tumor growth of PANC-1. • BMP-2 dramatically promoted tumor growth by promoting PANC-1 proliferation. • Spp24 abolished the tumor growth effect of BMP-2 by promoting PANC-1 apoptosis. • Spp24 may be a candidate as a therapeutic agent of pancreatic cancer.

  1. Positive associations between upregulated levels of stress-induced phosphoprotein 1 and matrix metalloproteinase-9 in endometriosis/adenomyosis.

    Science.gov (United States)

    Wang, Hsin-Shih; Tsai, Chia-Lung; Chang, Pi-Yueh; Chao, Angel; Wu, Ren-Chin; Chen, Shun-Hua; Wang, Chin-Jung; Yen, Chih-Feng; Lee, Yun-Shien; Wang, Tzu-Hao

    2018-01-01

    Stress-induced phosphoprotein-1 (STIP1), an adaptor protein that coordinates the functions of HSP70 and HSP90 in protein folding, has been implicated in the development of human gynecologic malignancies. This case-control study investigates STIP1 serum levels and tissue expression in relation to endometriosis/adenomyosis in Taiwanese population. Female patients with surgically confirmed endometriosis/adenomyosis were compared with women free of endometriosis/adenomyosis. Serum STIP1 levels were measured using an enzyme-linked immunosorbent assay and surgical tissues were analyzed by immunohistochemistry. Both epithelial and stromal cells in surgical tissues of endometriosis and adenomyosis expressed STIP1 and MMP-9. Notably, MMP-9 expression was significantly decreased when STIP1 expression was knocked-down. In vitro experiments revealed that STIP1 was capable of binding to the MMP-9 promoter and enhanced its transcriptional expression. The preoperative serum STIP1 levels of patients with endometriosis/adenomyosis were significantly higher than those of the controls. In brief, our data suggest an association between STIP1 levels and endometriosis/adenomyosis.

  2. Fluoride or/and aluminum induced toxicity in guinea pig teeth with the low expression of dentine phosphoprotein.

    Science.gov (United States)

    Han, Tianlong; Wang, Min; Cao, Chunfang; Chen, Huacheng; Zhang, Guanghe; Wang, Liping; Wang, Jundong

    2017-08-01

    This study investigated the damage and expression of dentine phosphoprotein (DPP) in guinea pig teeth by the administration of fluoride (F) or/and aluminum (Al). Fifty-two guinea pigs were divided randomly into four groups (control, F, Al, and F+Al). F (150 mg NaF/L) or/and Al (300 mg AlCl 3 /L) were added in their drinking water for 90 days. The levels of F ion, dentine sialophosphoprotein (DSPP) gene, and DPP protein in incisor and molar were determined, respectively. The results showed that the concentrations of F ion in F and F+Al groups were increased significantly. F induced the mottled enamel and irregular abrasion of teeth, which might occur as a consequence of depressed DSPP mRNA and DPP protein expression. Both the gene and protein expressions showed obvious decrease induced by Al, especially by F. There were no synergistic effects between F and Al, instead, Al inhibited the toxicity of F. © 2017 Wiley Periodicals, Inc.

  3. The nucleolar phosphoprotein B23 targets Newcastle disease virus matrix protein to the nucleoli and facilitates viral replication.

    Science.gov (United States)

    Duan, Zhiqiang; Chen, Jian; Xu, Haixu; Zhu, Jie; Li, Qunhui; He, Liang; Liu, Huimou; Hu, Shunlin; Liu, Xiufan

    2014-03-01

    The cellular nucleolar proteins are reported to facilitate the replication cycles of some human and animal viruses by interaction with viral proteins. In this study, a nucleolar phosphoprotein B23 was identified to interact with Newcastle disease virus (NDV) matrix (M) protein. We found that NDV M protein accumulated in the nucleolus by binding B23 early in infection, but resulted in the redistribution of B23 from the nucleoli to the nucleoplasm later in infection. In vitro binding studies utilizing deletion mutants indicated that amino acids 30-60 of M and amino acids 188-245 of B23 were required for binding. Furthermore, knockdown of B23 by siRNA or overexpression of B23 or M-binding B23-derived polypeptides remarkably reduced cytopathic effect and inhibited NDV replication. Collectively, we show that B23 facilitates NDV replication by targeting M to the nucleolus, demonstrating for the first time a direct role for nucleolar protein B23 in a paramyxovirus replication process. Copyright © 2014 Elsevier Inc. All rights reserved.

  4. Secreted phosphoprotein 24 kD (Spp24) inhibits growth of human pancreatic cancer cells caused by BMP-2

    Energy Technology Data Exchange (ETDEWEB)

    Li, Chen-Shuang [Department of Orthodontics, Peking University School and Hospital of Stomatology, Beijing (China); Tian, Haijun, E-mail: haijuntianmd@gmail.com [Department of Orthopaedic Surgery, Changzheng Hospital, Second Military Medical University, Shanghai (China); Department of Orthopaedic Surgery, University of California, Los Angeles, Los Angeles, CA (United States); Department of Surgery, Bethune School of Medics, Shijiazhuang (China); Zou, Min [Department of Orthodontics, School and Hospital of Stomatology, Xi' an Jiaotong University, Xi' an (China); Zhao, Ke-Wei [Research Service, VA Greater Los Angeles Healthcare System, North Hills, CA (United States); Li, Yawei; Lao, Lifeng [Department of Orthopaedic Surgery, University of California, Los Angeles, Los Angeles, CA (United States); Brochmann, Elsa J. [Research Service, VA Greater Los Angeles Healthcare System, North Hills, CA (United States); Geriatric Research, Education and Clinical Center, VA Greater Los Angeles Healthcare System, North Hills, CA (United States); Department of Medicine, University of California, Los Angeles, Los Angeles, CA (United States); Duarte, M. Eugenia L. [National Institute of Traumatology and Orthopaedics, Rio de Janeiro (Brazil); Daubs, Michael D. [Division of Orthopaedic Surgery, Department of Surgery, University of Nevada School of Medicine, Las Vegas, NV (United States); Zhou, Yan-Heng, E-mail: yanhengzhou@vip.163.com [Department of Orthodontics, Peking University School and Hospital of Stomatology, Beijing (China); Murray, Samuel S. [Research Service, VA Greater Los Angeles Healthcare System, North Hills, CA (United States); Geriatric Research, Education and Clinical Center, VA Greater Los Angeles Healthcare System, North Hills, CA (United States); Department of Medicine, University of California, Los Angeles, Los Angeles, CA (United States); Wang, Jeffrey C. [Department of Orthopaedic Surgery, University of Southern California, Los Angeles, CA (United States)

    2015-10-16

    The emerging role of bone morphogenetic proteins (BMPs) in the initiation and progression of multiple cancers has drawn great attention in cancer research. In this study, we report that BMP-2 can promote the proliferation of the pancreatic tumor cell line, PANC-1. Secreted phosphoprotein 24 kD (Spp24), a BMP binding protein, did not affect the proliferation of the cells but promoted the apoptosis of the cells in vitro. In a xeneograft tumor model using PANC-1 cells, BMP-2 dramatically promoted tumor growth, while Spp24 not only abolished the effect of BMP-2, but also dramatically induced tumor shrinking when used alone. Activation of Smad1/5/8 participated in this process as demonstrated by immunohistochemical staining of phosphorylated Smad 1/5/8. We conclude that Spp24 can be developed into a therapeutic agent that could be employed in clinical situations where the inhibition of BMPs and related proteins is advantageous. - Highlights: • Spp24 effectively inhibited the in vivo tumor growth of PANC-1. • BMP-2 dramatically promoted tumor growth by promoting PANC-1 proliferation. • Spp24 abolished the tumor growth effect of BMP-2 by promoting PANC-1 apoptosis. • Spp24 may be a candidate as a therapeutic agent of pancreatic cancer.

  5. Effect of sodium fluoride on the amount of polyribosomes, single ribosomes and ribosomal subunits in a cellular slime mold, Dictyostelium discoideum

    Energy Technology Data Exchange (ETDEWEB)

    Sameshima, M; Ito, K; Iwabuchi, M

    1972-01-01

    In the slime mold, Dictyostelium discoideum, when the rate of protein synthesis was decreased by NaF, free 80-S ribosomes accumulated at the expense of polyribosomes, while 60-S and 40-S ribosomal subunits remained almost constant. The same level of ribosomal subunits was also maintained in cells after incubation with cycloheximide or at the stationary phase of growth.

  6. Ribosome. The complete structure of the 55S mammalian mitochondrial ribosome.

    Science.gov (United States)

    Greber, Basil J; Bieri, Philipp; Leibundgut, Marc; Leitner, Alexander; Aebersold, Ruedi; Boehringer, Daniel; Ban, Nenad

    2015-04-17

    Mammalian mitochondrial ribosomes (mitoribosomes) synthesize mitochondrially encoded membrane proteins that are critical for mitochondrial function. Here we present the complete atomic structure of the porcine 55S mitoribosome at 3.8 angstrom resolution by cryo-electron microscopy and chemical cross-linking/mass spectrometry. The structure of the 28S subunit in the complex was resolved at 3.6 angstrom resolution by focused alignment, which allowed building of a detailed atomic structure including all of its 15 mitoribosomal-specific proteins. The structure reveals the intersubunit contacts in the 55S mitoribosome, the molecular architecture of the mitoribosomal messenger RNA (mRNA) binding channel and its interaction with transfer RNAs, and provides insight into the highly specialized mechanism of mRNA recruitment to the 28S subunit. Furthermore, the structure contributes to a mechanistic understanding of aminoglycoside ototoxicity. Copyright © 2015, American Association for the Advancement of Science.

  7. The Complete Structure of the Mycobacterium smegmatis 70S Ribosome.

    Science.gov (United States)

    Hentschel, Jendrik; Burnside, Chloe; Mignot, Ingrid; Leibundgut, Marc; Boehringer, Daniel; Ban, Nenad

    2017-07-05

    The ribosome carries out the synthesis of proteins in every living cell. It consequently represents a frontline target in anti-microbial therapy. Tuberculosis ranks among the leading causes of death worldwide, due in large part to the combination of difficult-to-treat latency and antibiotic resistance. Here, we present the 3.3-Å cryo-EM structure of the 70S ribosome of Mycobacterium smegmatis, a close relative to the human pathogen Mycobacterium tuberculosis. The structure reveals two additional ribosomal proteins and localizes them to the vicinity of drug-target sites in both the catalytic center and the decoding site of the ribosome. Furthermore, we visualized actinobacterium-specific rRNA and protein expansions that extensively remodel the ribosomal surface with implications for polysome organization. Our results provide a foundation for understanding the idiosyncrasies of mycobacterial translation and reveal atomic details of the structure that will facilitate the design of anti-tubercular therapeutics. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

  8. Ribosomes slide on lysine-encoding homopolymeric A stretches

    Science.gov (United States)

    Koutmou, Kristin S; Schuller, Anthony P; Brunelle, Julie L; Radhakrishnan, Aditya; Djuranovic, Sergej; Green, Rachel

    2015-01-01

    Protein output from synonymous codons is thought to be equivalent if appropriate tRNAs are sufficiently abundant. Here we show that mRNAs encoding iterated lysine codons, AAA or AAG, differentially impact protein synthesis: insertion of iterated AAA codons into an ORF diminishes protein expression more than insertion of synonymous AAG codons. Kinetic studies in E. coli reveal that differential protein production results from pausing on consecutive AAA-lysines followed by ribosome sliding on homopolymeric A sequence. Translation in a cell-free expression system demonstrates that diminished output from AAA-codon-containing reporters results from premature translation termination on out of frame stop codons following ribosome sliding. In eukaryotes, these premature termination events target the mRNAs for Nonsense-Mediated-Decay (NMD). The finding that ribosomes slide on homopolymeric A sequences explains bioinformatic analyses indicating that consecutive AAA codons are under-represented in gene-coding sequences. Ribosome ‘sliding’ represents an unexpected type of ribosome movement possible during translation. DOI: http://dx.doi.org/10.7554/eLife.05534.001 PMID:25695637

  9. Label-Free Quantitation of Ribosomal Proteins from Bacillus subtilis for Antibiotic Research.

    Science.gov (United States)

    Schäkermann, Sina; Prochnow, Pascal; Bandow, Julia E

    2017-01-01

    Current research is focusing on ribosome heterogeneity as a response to changing environmental conditions and stresses, such as antibiotic stress. Altered stoichiometry and composition of ribosomal proteins as well as association of additional protein factors are mechanisms for shaping the protein expression profile or hibernating ribosomes. Here, we present a method for the isolation of ribosomes to analyze antibiotic-induced changes in the composition of ribosomes in Bacillus subtilis or other bacteria. Ribosomes and associated proteins are isolated by ultracentrifugation and proteins are identified and quantified using label-free mass spectrometry.

  10. Cryo-EM structure of the archaeal 50S ribosomal subunit in complex with initiation factor 6 and implications for ribosome evolution

    DEFF Research Database (Denmark)

    Greber, Basil J; Boehringer, Daniel; Godinic-Mikulcic, Vlatka

    2012-01-01

    additional components of the translation machinery with eukaryotes that are absent in bacteria. One of these translation factors is initiation factor 6 (IF6), which associates with the large ribosomal subunit. We have reconstructed the 50S ribosomal subunit from the archaeon Methanothermobacter...... between this archaeal ribosome and eukaryotic ribosomes but are mostly absent in bacteria and in some archaeal lineages. Furthermore, the structure reveals that, in spite of highly divergent evolutionary trajectories of the ribosomal particle and the acquisition of novel functions of IF6 in eukaryotes......, the molecular binding of IF6 on the ribosome is conserved between eukaryotes and archaea. The structure also provides a snapshot of the reductive evolution of the archaeal ribosome and offers new insights into the evolution of the translation system in archaea....

  11. Interaction of tRNA with Eukaryotic Ribosome

    Directory of Open Access Journals (Sweden)

    Dmitri Graifer

    2015-03-01

    Full Text Available This paper is a review of currently available data concerning interactions of tRNAs with the eukaryotic ribosome at various stages of translation. These data include the results obtained by means of cryo-electron microscopy and X-ray crystallography applied to various model ribosomal complexes, site-directed cross-linking with the use of tRNA derivatives bearing chemically or photochemically reactive groups in the CCA-terminal fragment and chemical probing of 28S rRNA in the region of the peptidyl transferase center. Similarities and differences in the interactions of tRNAs with prokaryotic and eukaryotic ribosomes are discussed with concomitant consideration of the extent of resemblance between molecular mechanisms of translation in eukaryotes and bacteria.

  12. 5SRNAdb: an information resource for 5S ribosomal RNAs.

    Science.gov (United States)

    Szymanski, Maciej; Zielezinski, Andrzej; Barciszewski, Jan; Erdmann, Volker A; Karlowski, Wojciech M

    2016-01-04

    Ribosomal 5S RNA (5S rRNA) is the ubiquitous RNA component found in the large subunit of ribosomes in all known organisms. Due to its small size, abundance and evolutionary conservation 5S rRNA for many years now is used as a model molecule in studies on RNA structure, RNA-protein interactions and molecular phylogeny. 5SRNAdb (http://combio.pl/5srnadb/) is the first database that provides a high quality reference set of ribosomal 5S RNAs (5S rRNA) across three domains of life. Here, we give an overview of new developments in the database and associated web tools since 2002, including updates to database content, curation processes and user web interfaces. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  13. Structural basis for precursor protein-directed ribosomal peptide macrocyclization

    Science.gov (United States)

    Li, Kunhua; Condurso, Heather L.; Li, Gengnan; Ding, Yousong; Bruner, Steven D.

    2016-01-01

    Macrocyclization is a common feature of natural product biosynthetic pathways including the diverse family of ribosomal peptides. Microviridins are architecturally complex cyanobacterial ribosomal peptides whose members target proteases with potent reversible inhibition. The product structure is constructed by three macrocyclizations catalyzed sequentially by two members of the ATP-grasp family, a unique strategy for ribosomal peptide macrocyclization. Here, we describe the detailed structural basis for the enzyme-catalyzed macrocyclizations in the microviridin J pathway of Microcystis aeruginosa. The macrocyclases, MdnC and MdnB, interact with a conserved α-helix of the precursor peptide using a novel precursor peptide recognition mechanism. The results provide insight into the unique protein/protein interactions key to the chemistry, suggest an origin of the natural combinatorial synthesis of microviridin peptides and provide a framework for future engineering efforts to generate designed compounds. PMID:27669417

  14. Structural basis for precursor protein-directed ribosomal peptide macrocyclization.

    Science.gov (United States)

    Li, Kunhua; Condurso, Heather L; Li, Gengnan; Ding, Yousong; Bruner, Steven D

    2016-11-01

    Macrocyclization is a common feature of natural product biosynthetic pathways including the diverse family of ribosomal peptides. Microviridins are architecturally complex cyanobacterial ribosomal peptides that target proteases with potent reversible inhibition. The product structure is constructed via three macrocyclizations catalyzed sequentially by two members of the ATP-grasp family, a unique strategy for ribosomal peptide macrocyclization. Here we describe in detail the structural basis for the enzyme-catalyzed macrocyclizations in the microviridin J pathway of Microcystis aeruginosa. The macrocyclases MdnC and MdnB interact with a conserved α-helix of the precursor peptide using a novel precursor-peptide recognition mechanism. The results provide insight into the unique protein-protein interactions that are key to the chemistry, suggest an origin for the natural combinatorial synthesis of microviridin peptides, and provide a framework for future engineering efforts to generate designed compounds.

  15. Blocking S1P interaction with S1P1 receptor by a novel competitive S1P1-selective antagonist inhibits angiogenesis

    International Nuclear Information System (INIS)

    Fujii, Yasuyuki; Ueda, Yasuji; Ohtake, Hidenori; Ono, Naoya; Takayama, Tetsuo; Nakazawa, Kiyoshi; Igarashi, Yasuyuki; Goitsuka, Ryo

    2012-01-01

    Highlights: ► The effect of a newly developed S1P 1 -selective antagonist on angiogenic responses. ► S1P 1 is a critical component of VEGF-related angiogenic responses. ► S1P 1 -selective antagonist showed in vitro activity to inhibit angiogenesis. ► S1P 1 -selective antagonist showed in vivo activity to inhibit angiogenesis. ► The efficacy of S1P 1 -selective antagonist for anti-cancer therapies. -- Abstract: Sphingosine 1-phosphate receptor type 1 (S1P 1 ) was shown to be essential for vascular maturation during embryonic development and it has been demonstrated that substantial crosstalk exists between S1P 1 and other pro-angiogenic growth factors, such as vascular endothelial growth factor (VEGF) and basic fibroblast growth factor. We developed a novel S1P 1 -selective antagonist, TASP0277308, which is structurally unrelated to S1P as well as previously described S1P 1 antagonists. TASP0277308 inhibited S1P- as well as VEGF-induced cellular responses, including migration and proliferation of human umbilical vein endothelial cells. Furthermore, TASP0277308 effectively blocked a VEGF-induced tube formation in vitro and significantly suppressed tumor cell-induced angiogenesis in vivo. These findings revealed that S1P 1 is a critical component of VEGF-related angiogenic responses and also provide evidence for the efficacy of TASP0277308 for anti-cancer therapies.

  16. Detecting remote sequence homology in disordered proteins: discovery of conserved motifs in the N-termini of Mononegavirales phosphoproteins.

    Directory of Open Access Journals (Sweden)

    David Karlin

    Full Text Available Paramyxovirinae are a large group of viruses that includes measles virus and parainfluenza viruses. The viral Phosphoprotein (P plays a central role in viral replication. It is composed of a highly variable, disordered N-terminus and a conserved C-terminus. A second viral protein alternatively expressed, the V protein, also contains the N-terminus of P, fused to a zinc finger. We suspected that, despite their high variability, the N-termini of P/V might all be homologous; however, using standard approaches, we could previously identify sequence conservation only in some Paramyxovirinae. We now compared the N-termini using sensitive sequence similarity search programs, able to detect residual similarities unnoticeable by conventional approaches. We discovered that all Paramyxovirinae share a short sequence motif in their first 40 amino acids, which we called soyuz1. Despite its short length (11-16aa, several arguments allow us to conclude that soyuz1 probably evolved by homologous descent, unlike linear motifs. Conservation across such evolutionary distances suggests that soyuz1 plays a crucial role and experimental data suggest that it binds the viral nucleoprotein to prevent its illegitimate self-assembly. In some Paramyxovirinae, the N-terminus of P/V contains a second motif, soyuz2, which might play a role in blocking interferon signaling. Finally, we discovered that the P of related Mononegavirales contain similarly overlooked motifs in their N-termini, and that their C-termini share a previously unnoticed structural similarity suggesting a common origin. Our results suggest several testable hypotheses regarding the replication of Mononegavirales and suggest that disordered regions with little overall sequence similarity, common in viral and eukaryotic proteins, might contain currently overlooked motifs (intermediate in length between linear motifs and disordered domains that could be detected simply by comparing orthologous proteins.

  17. Interaction between the C-terminal domains of measles virus nucleoprotein and phosphoprotein: a tight complex implying one binding site.

    Science.gov (United States)

    Blocquel, David; Habchi, Johnny; Costanzo, Stéphanie; Doizy, Anthony; Oglesbee, Michael; Longhi, Sonia

    2012-10-01

    The intrinsically disordered C-terminal domain (N(TAIL) ) of the measles virus (MeV) nucleoprotein undergoes α-helical folding upon binding to the C-terminal X domain (XD) of the phosphoprotein. The N(TAIL) region involved in binding coupled to folding has been mapped to a conserved region (Box2) encompassing residues 489-506. In the previous studies published in this journal, we obtained experimental evidence supporting a K(D) for the N(TAIL) -XD binding reaction in the nM range and also showed that an additional N(TAIL) region (Box3, aa 517-525) plays a role in binding to XD. In striking contrast with these data, studies published in this journal by Kingston and coworkers pointed out a much less stable complex (K(D) in the μM range) and supported lack of involvement of Box3 in complex formation. The objective of this study was to critically re-evaluate the role of Box3 in N(TAIL) -XD binding. Since our previous studies relied on N(TAIL) -truncated forms possessing an irrelevant Flag sequence appended at their C-terminus, we, herein, generated an N(TAIL) devoid of Box3 and any additional C-terminal residues, as well as a form encompassing only residues 482-525. We then used isothermal titration calorimetry to characterize the binding reactions between XD and these N(TAIL) forms. Results effectively argue for the presence of a single XD-binding site located within Box2, in agreement with the results by Kingston et al., while providing clear experimental support for a high-affinity complex. Altogether, the present data provide mechanistic insights into the replicative machinery of MeV and clarify a hitherto highly debated point. Copyright © 2012 The Protein Society.

  18. Alterations in vasodilator-stimulated phosphoprotein (VASP) phosphorylation: associations with asthmatic phenotype, airway inflammation and β2-agonist use

    Science.gov (United States)

    Hastie, Annette T; Wu, Min; Foster, Gayle C; Hawkins, Gregory A; Batra, Vikas; Rybinski, Katherine A; Cirelli, Rosemary; Zangrilli, James G; Peters, Stephen P

    2006-01-01

    Background Vasodilator-stimulated phosphoprotein (VASP) mediates focal adhesion, actin filament binding and polymerization in a variety of cells, thereby inhibiting cell movement. Phosphorylation of VASP via cAMP and cGMP dependent protein kinases releases this "brake" on cell motility. Thus, phosphorylation of VASP may be necessary for epithelial cell repair of damage from allergen-induced inflammation. Two hypotheses were examined: (1) injury from segmental allergen challenge increases VASP phosphorylation in airway epithelium in asthmatic but not nonasthmatic normal subjects, (2) regular in vivo β2-agonist use increases VASP phosphorylation in asthmatic epithelium, altering cell adhesion. Methods Bronchial epithelium was obtained from asthmatic and non-asthmatic normal subjects before and after segmental allergen challenge, and after regularly inhaled albuterol, in three separate protocols. VASP phosphorylation was examined in Western blots of epithelial samples. DNA was obtained for β2-adrenergic receptor haplotype determination. Results Although VASP phosphorylation increased, it was not significantly greater after allergen challenge in asthmatics or normals. However, VASP phosphorylation in epithelium of nonasthmatic normal subjects was double that observed in asthmatic subjects, both at baseline and after challenge. Regularly inhaled albuterol significantly increased VASP phosphorylation in asthmatic subjects in both unchallenged and antigen challenged lung segment epithelium. There was also a significant increase in epithelial cells in the bronchoalveolar lavage of the unchallenged lung segment after regular inhalation of albuterol but not of placebo. The haplotypes of the β2-adrenergic receptor did not appear to associate with increased or decreased phosphorylation of VASP. Conclusion Decreased VASP phosphorylation was observed in epithelial cells of asthmatics compared to nonasthmatic normals, despite response to β-agonist. The decreased

  19. Alterations in vasodilator-stimulated phosphoprotein (VASP phosphorylation: associations with asthmatic phenotype, airway inflammation and β2-agonist use

    Directory of Open Access Journals (Sweden)

    Cirelli Rosemary

    2006-02-01

    Full Text Available Abstract Background Vasodilator-stimulated phosphoprotein (VASP mediates focal adhesion, actin filament binding and polymerization in a variety of cells, thereby inhibiting cell movement. Phosphorylation of VASP via cAMP and cGMP dependent protein kinases releases this "brake" on cell motility. Thus, phosphorylation of VASP may be necessary for epithelial cell repair of damage from allergen-induced inflammation. Two hypotheses were examined: (1 injury from segmental allergen challenge increases VASP phosphorylation in airway epithelium in asthmatic but not nonasthmatic normal subjects, (2 regular in vivo β2-agonist use increases VASP phosphorylation in asthmatic epithelium, altering cell adhesion. Methods Bronchial epithelium was obtained from asthmatic and non-asthmatic normal subjects before and after segmental allergen challenge, and after regularly inhaled albuterol, in three separate protocols. VASP phosphorylation was examined in Western blots of epithelial samples. DNA was obtained for β2-adrenergic receptor haplotype determination. Results Although VASP phosphorylation increased, it was not significantly greater after allergen challenge in asthmatics or normals. However, VASP phosphorylation in epithelium of nonasthmatic normal subjects was double that observed in asthmatic subjects, both at baseline and after challenge. Regularly inhaled albuterol significantly increased VASP phosphorylation in asthmatic subjects in both unchallenged and antigen challenged lung segment epithelium. There was also a significant increase in epithelial cells in the bronchoalveolar lavage of the unchallenged lung segment after regular inhalation of albuterol but not of placebo. The haplotypes of the β2-adrenergic receptor did not appear to associate with increased or decreased phosphorylation of VASP. Conclusion Decreased VASP phosphorylation was observed in epithelial cells of asthmatics compared to nonasthmatic normals, despite response to

  20. Differential expression of secreted phosphoprotein 1 in the motor cortex among primate species and during postnatal development and functional recovery.

    Directory of Open Access Journals (Sweden)

    Tatsuya Yamamoto

    Full Text Available We previously reported that secreted phosphoprotein 1 (SPP1 mRNA is expressed in neurons whose axons form the corticospinal tract (CST of the rhesus macaque, but not in the corresponding neurons of the marmoset and rat. This suggests that SPP1 expression is involved in the functional or structural specialization of highly developed corticospinal systems in certain primate species. To further examine this hypothesis, we evaluated the expression of SPP1 mRNA in the motor cortex from three viewpoints: species differences, postnatal development, and functional/structural changes of the CST after a lesion of the lateral CST (l-CST at the mid-cervical level. The density of SPP1-positive neurons in layer V of the primary motor cortex (M1 was much greater in species with highly developed corticospinal systems (i.e., rhesus macaque, capuchin monkey, and humans than in those with less developed corticospinal systems (i.e., squirrel monkey, marmoset, and rat. SPP1-positive neurons in the macaque monkey M1 increased logarithmically in layer V during postnatal development, following a time course consistent with the increase in conduction velocity of the CST. After an l-CST lesion, SPP1-positive neurons increased in layer V of the ventral premotor cortex, in which compensatory changes in CST function/structure may occur, which positively correlated with the extent of finger dexterity recovery. These results further support the concept that the expression of SPP1 may reflect functional or structural specialization of highly developed corticospinal systems in certain primate species.

  1. Protein-protein interactions within late pre-40S ribosomes.

    Directory of Open Access Journals (Sweden)

    Melody G Campbell

    2011-01-01

    Full Text Available Ribosome assembly in eukaryotic organisms requires more than 200 assembly factors to facilitate and coordinate rRNA transcription, processing, and folding with the binding of the ribosomal proteins. Many of these assembly factors bind and dissociate at defined times giving rise to discrete assembly intermediates, some of which have been partially characterized with regards to their protein and RNA composition. Here, we have analyzed the protein-protein interactions between the seven assembly factors bound to late cytoplasmic pre-40S ribosomes using recombinant proteins in binding assays. Our data show that these factors form two modules: one comprising Enp1 and the export adaptor Ltv1 near the beak structure, and the second comprising the kinase Rio2, the nuclease Nob1, and a regulatory RNA binding protein Dim2/Pno1 on the front of the head. The GTPase-like Tsr1 and the universally conserved methylase Dim1 are also peripherally connected to this second module. Additionally, in an effort to further define the locations for these essential proteins, we have analyzed the interactions between these assembly factors and six ribosomal proteins: Rps0, Rps3, Rps5, Rps14, Rps15 and Rps29. Together, these results and previous RNA-protein crosslinking data allow us to propose a model for the binding sites of these seven assembly factors. Furthermore, our data show that the essential kinase Rio2 is located at the center of the pre-ribosomal particle and interacts, directly or indirectly, with every other assembly factor, as well as three ribosomal proteins required for cytoplasmic 40S maturation. These data suggest that Rio2 could play a central role in regulating cytoplasmic maturation steps.

  2. A streamlined ribosome profiling protocol for the characterization of microorganisms

    DEFF Research Database (Denmark)

    Latif, Haythem; Szubin, Richard; Tan, Justin

    2015-01-01

    Ribosome profiling is a powerful tool for characterizing in vivo protein translation at the genome scale, with multiple applications ranging from detailed molecular mechanisms to systems-level predictive modeling. Though highly effective, this intricate technique has yet to become widely used...... in the microbial research community. Here we present a streamlined ribosome profiling protocol with reduced barriers to entry for microbial characterization studies. Our approach provides simplified alternatives during harvest, lysis, and recovery of monosomes and also eliminates several time-consuming steps...

  3. Interaction of pleuromutilin derivatives with the ribosomal peptidyl transferase center

    DEFF Research Database (Denmark)

    Long, K. S.; Hansen, L. K.; Jakobsen, L.

    2006-01-01

    Tiamulin is a pleuromutilin antibiotic that is used in veterinary medicine. The recently published crystal structure of a tiamulin-50S ribosomal subunit complex provides detailed information about how this drug targets the peptidyl transferase center of the ribosome. To promote rational design...... mutant strain is resistant to tiamulin and pleuromutilin, but not valnemulin, implying that valnemulin is better able to withstand an altered rRNA binding surface around the mutilin core. This is likely due to additional interactions made between the valnemulin side chain extension and the rRNA binding...

  4. Charge Segregation and Low Hydrophobicity Are Key Features of Ribosomal Proteins from Different Organisms*

    Science.gov (United States)

    Fedyukina, Daria V.; Jennaro, Theodore S.; Cavagnero, Silvia

    2014-01-01

    Ribosomes are large and highly charged macromolecular complexes consisting of RNA and proteins. Here, we address the electrostatic and nonpolar properties of ribosomal proteins that are important for ribosome assembly and interaction with other cellular components and may influence protein folding on the ribosome. We examined 50 S ribosomal subunits from 10 species and found a clear distinction between the net charge of ribosomal proteins from halophilic and non-halophilic organisms. We found that ∼67% ribosomal proteins from halophiles are negatively charged, whereas only up to ∼15% of ribosomal proteins from non-halophiles share this property. Conversely, hydrophobicity tends to be lower for ribosomal proteins from halophiles than for the corresponding proteins from non-halophiles. Importantly, the surface electrostatic potential of ribosomal proteins from all organisms, especially halophiles, has distinct positive and negative regions across all the examined species. Positively and negatively charged residues of ribosomal proteins tend to be clustered in buried and solvent-exposed regions, respectively. Hence, the majority of ribosomal proteins is characterized by a significant degree of intramolecular charge segregation, regardless of the organism of origin. This key property enables the ribosome to accommodate proteins within its complex scaffold regardless of their overall net charge. PMID:24398678

  5. Cryo-EM Structure of the Archaeal 50S Ribosomal Subunit in Complex with Initiation Factor 6 and Implications for Ribosome Evolution

    Science.gov (United States)

    Greber, Basil J.; Boehringer, Daniel; Godinic-Mikulcic, Vlatka; Crnkovic, Ana; Ibba, Michael; Weygand-Durasevic, Ivana; Ban, Nenad

    2013-01-01

    Translation of mRNA into proteins by the ribosome is universally conserved in all cellular life. The composition and complexity of the translation machinery differ markedly between the three domains of life. Organisms from the domain Archaea show an intermediate level of complexity, sharing several additional components of the translation machinery with eukaryotes that are absent in bacteria. One of these translation factors is initiation factor 6 (IF6), which associates with the large ribosomal subunit. We have reconstructed the 50S ribosomal subunit from the archaeon Methanothermobacter thermautotrophicus in complex with archaeal IF6 at 6.6 Å resolution using cryo-electron microscopy (EM). The structure provides detailed architectural insights into the 50S ribosomal subunit from a methanogenic archaeon through identification of the rRNA expansion segments and ribosomal proteins that are shared between this archaeal ribosome and eukaryotic ribosomes but are mostly absent in bacteria and in some archaeal lineages. Furthermore, the structure reveals that, in spite of highly divergent evolutionary trajectories of the ribosomal particle and the acquisition of novel functions of IF6 in eukaryotes, the molecular binding of IF6 on the ribosome is conserved between eukaryotes and archaea. The structure also provides a snapshot of the reductive evolution of the archaeal ribosome and offers new insights into the evolution of the translation system in archaea. PMID:22306461

  6. Nuclear ribosomal DNA diversity of a cotton pest ( Rotylenchulus ...

    African Journals Online (AJOL)

    The reniform nematode (Rotylenchulus reniformis) has emerged as a major cotton pest in the United States. A recent analysis of over 20 amphimictic populations of this pest from the US and three other countries has shown no sequence variation at the nuclear ribosomal internal transcribed spacer (ITS) despite the region's ...

  7. The ribosome-associated complex antagonizes prion formation in yeast.

    Science.gov (United States)

    Amor, Alvaro J; Castanzo, Dominic T; Delany, Sean P; Selechnik, Daniel M; van Ooy, Alex; Cameron, Dale M

    2015-01-01

    The number of known fungal proteins capable of switching between alternative stable conformations is steadily increasing, suggesting that a prion-like mechanism may be broadly utilized as a means to propagate altered cellular states. To gain insight into the mechanisms by which cells regulate prion formation and toxicity we examined the role of the yeast ribosome-associated complex (RAC) in modulating both the formation of the [PSI(+)] prion - an alternative conformer of Sup35 protein - and the toxicity of aggregation-prone polypeptides. The Hsp40 RAC chaperone Zuo1 anchors the RAC to ribosomes and stimulates the ATPase activity of the Hsp70 chaperone Ssb. We found that cells lacking Zuo1 are sensitive to over-expression of some aggregation-prone proteins, including the Sup35 prion domain, suggesting that co-translational protein misfolding increases in Δzuo1 strains. Consistent with this finding, Δzuo1 cells exhibit higher frequencies of spontaneous and induced prion formation. Cells expressing mutant forms of Zuo1 lacking either a C-terminal charged region required for ribosome association, or the J-domain responsible for Ssb ATPase stimulation, exhibit similarly high frequencies of prion formation. Our findings are consistent with a role for the RAC in chaperoning nascent Sup35 to regulate folding of the N-terminal prion domain as it emerges from the ribosome.

  8. Ribosomal DNA internal transcribed spacer 1 and internal ...

    African Journals Online (AJOL)

    USER

    2010-07-26

    Jul 26, 2010 ... in some East Asian countries such as China, Korea and. *Corresponding author. E-mail: soonkwan@kangwon.ac.kr. Tel: +82 33 250 6476. Fax: +82 33 250 6470. Abbreviations: nrDNA, Nuclear ribosomal DNA; ITS, internal transcribed spacer; PCR, polymerase chain reaction; BLAST, basic local alignment ...

  9. cDNA, genomic sequence cloning and overexpression of ribosomal ...

    African Journals Online (AJOL)

    RPS16 of eukaryote is a component of the 40S small ribosomal subunit encoded by RPS16 gene and is also a homolog of prokaryotic RPS9. The cDNA and genomic sequence of RPS16 was cloned successfully for the first time from the Giant Panda (Ailuropoda melanoleuca) using reverse transcription-polymerase chain ...

  10. (Brassicaceae) based on nuclear ribosomal ITS DNA sequences

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Genetics; Volume 93; Issue 2. Phylogeny and biogeography of Alyssum (Brassicaceae) based on nuclear ribosomal ITS DNA sequences. Yan Li Yan Kong Zhe Zhang Yanqiang Yin Bin Liu Guanghui Lv Xiyong Wang. Research Article Volume 93 Issue 2 August 2014 pp 313-323 ...

  11. Expression of a ribosome inactivating protein (curcin 2) in Jatropha ...

    Indian Academy of Sciences (India)

    Unknown

    mechanisms employed by a number of higher-plant species involve defensive ... of RIPs in the same plant species. ..... Lam C J, Ryals J A, Ward E R and Dixon R A 1992 Emerging ... against insect pests and diseases of plants: ribosome in-.

  12. Protein folding on the ribosome studied using NMR spectroscopy

    Science.gov (United States)

    Waudby, Christopher A.; Launay, Hélène; Cabrita, Lisa D.; Christodoulou, John

    2013-01-01

    NMR spectroscopy is a powerful tool for the investigation of protein folding and misfolding, providing a characterization of molecular structure, dynamics and exchange processes, across a very wide range of timescales and with near atomic resolution. In recent years NMR methods have also been developed to study protein folding as it might occur within the cell, in a de novo manner, by observing the folding of nascent polypeptides in the process of emerging from the ribosome during synthesis. Despite the 2.3 MDa molecular weight of the bacterial 70S ribosome, many nascent polypeptides, and some ribosomal proteins, have sufficient local flexibility that sharp resonances may be observed in solution-state NMR spectra. In providing information on dynamic regions of the structure, NMR spectroscopy is therefore highly complementary to alternative methods such as X-ray crystallography and cryo-electron microscopy, which have successfully characterized the rigid core of the ribosome particle. However, the low working concentrations and limited sample stability associated with ribosome–nascent chain complexes means that such studies still present significant technical challenges to the NMR spectroscopist. This review will discuss the progress that has been made in this area, surveying all NMR studies that have been published to date, and with a particular focus on strategies for improving experimental sensitivity. PMID:24083462

  13. Architecture of the E.coli 70S ribosome

    DEFF Research Database (Denmark)

    Burkhardt, N.; Diedrich, G.; Nierhaus, K.H.

    1997-01-01

    The 70S ribosome from E.coli was analysed by neutron scattering focusing on the shape and the internal protein-RNA-distribution of the complex. Measurements on selectively deuterated 70S particles and free 30S and 50S subunits applying conventional contrast variation and proton-spin contrast...

  14. Structure based hypothesis of a mitochondrial ribosome rescue mechanism

    Directory of Open Access Journals (Sweden)

    Huynen Martijn A

    2012-05-01

    Full Text Available Abstract Background mtRF1 is a vertebrate mitochondrial protein with an unknown function that arose from a duplication of the mitochondrial release factor mtRF1a. To elucidate the function of mtRF1, we determined the positions that are conserved among mtRF1 sequences but that are different in their mtRF1a paralogs. We subsequently modeled the 3D structure of mtRF1a and mtRF1 bound to the ribosome, highlighting the structural implications of these differences to derive a hypothesis for the function of mtRF1. Results Our model predicts, in agreement with the experimental data, that the 3D structure of mtRF1a allows it to recognize the stop codons UAA and UAG in the A-site of the ribosome. In contrast, we show that mtRF1 likely can only bind the ribosome when the A-site is devoid of mRNA. Furthermore, while mtRF1a will adopt its catalytic conformation, in which it functions as a peptidyl-tRNA hydrolase in the ribosome, only upon binding of a stop codon in the A-site, mtRF1 appears specifically adapted to assume this extended, peptidyl-tRNA hydrolyzing conformation in the absence of mRNA in the A-site. Conclusions We predict that mtRF1 specifically recognizes ribosomes with an empty A-site and is able to function as a peptidyl-tRNA hydrolase in those situations. Stalled ribosomes with empty A-sites that still contain a tRNA bound to a peptide chain can result from the translation of truncated, stop-codon less mRNAs. We hypothesize that mtRF1 recycles such stalled ribosomes, performing a function that is analogous to that of tmRNA in bacteria. Reviewers This article was reviewed by Dr. Eugene Koonin, Prof. Knud H. Nierhaus (nominated by Dr. Sarah Teichmann and Dr. Shamil Sunyaev.

  15. Computer program /P1-GAS/ calculates the P-0 and P-1 transfer matrices for neutron moderation in a monatomic gas

    Science.gov (United States)

    Collier, G.; Gibson, G.

    1968-01-01

    FORTRAN 4 program /P1-GAS/ calculates the P-O and P-1 transfer matrices for neutron moderation in a monatomic gas. The equations used are based on the conditions that there is isotropic scattering in the center-of-mass coordinate system, the scattering cross section is constant, and the target nuclear velocities satisfy a Maxwellian distribution.

  16. Specific binding of a naturally occurring amyloidogenic fragment of Streptococcus mutans adhesin P1 to intact P1 on the cell surface characterized by solid state NMR spectroscopy

    Energy Technology Data Exchange (ETDEWEB)

    Tang, Wenxing; Bhatt, Avni [University of Florida, Department of Biochemistry and Molecular Biology, College of Medicine (United States); Smith, Adam N. [University of Florida, Department of Chemistry, College of Liberal Arts and Sciences (United States); Crowley, Paula J.; Brady, L. Jeannine, E-mail: jbrady@dental.ufl.edu [University of Florida, Department of Oral Biology, College of Dentistry (United States); Long, Joanna R., E-mail: jrlong@ufl.edu [University of Florida, Department of Biochemistry and Molecular Biology, College of Medicine (United States)

    2016-02-15

    The P1 adhesin (aka Antigen I/II or PAc) of the cariogenic bacterium Streptococcus mutans is a cell surface-localized protein involved in sucrose-independent adhesion and colonization of the tooth surface. The immunoreactive and adhesive properties of S. mutans suggest an unusual functional quaternary ultrastructure comprised of intact P1 covalently attached to the cell wall and interacting with non-covalently associated proteolytic fragments thereof, particularly the ∼57-kDa C-terminal fragment C123 previously identified as Antigen II. S. mutans is capable of amyloid formation when grown in a biofilm and P1 is among its amyloidogenic proteins. The C123 fragment of P1 readily forms amyloid fibers in vitro suggesting it may play a role in the formation of functional amyloid during biofilm development. Using wild-type and P1-deficient strains of S. mutans, we demonstrate that solid state NMR (ssNMR) spectroscopy can be used to (1) globally characterize cell walls isolated from a Gram-positive bacterium and (2) characterize the specific binding of heterologously expressed, isotopically-enriched C123 to cell wall-anchored P1. Our results lay the groundwork for future high-resolution characterization of the C123/P1 ultrastructure and subsequent steps in biofilm formation via ssNMR spectroscopy, and they support an emerging model of S. mutans colonization whereby quaternary P1-C123 interactions confer adhesive properties important to binding to immobilized human salivary agglutinin.

  17. Specific binding of a naturally occurring amyloidogenic fragment of Streptococcus mutans adhesin P1 to intact P1 on the cell surface characterized by solid state NMR spectroscopy

    International Nuclear Information System (INIS)

    Tang, Wenxing; Bhatt, Avni; Smith, Adam N.; Crowley, Paula J.; Brady, L. Jeannine; Long, Joanna R.

    2016-01-01

    The P1 adhesin (aka Antigen I/II or PAc) of the cariogenic bacterium Streptococcus mutans is a cell surface-localized protein involved in sucrose-independent adhesion and colonization of the tooth surface. The immunoreactive and adhesive properties of S. mutans suggest an unusual functional quaternary ultrastructure comprised of intact P1 covalently attached to the cell wall and interacting with non-covalently associated proteolytic fragments thereof, particularly the ∼57-kDa C-terminal fragment C123 previously identified as Antigen II. S. mutans is capable of amyloid formation when grown in a biofilm and P1 is among its amyloidogenic proteins. The C123 fragment of P1 readily forms amyloid fibers in vitro suggesting it may play a role in the formation of functional amyloid during biofilm development. Using wild-type and P1-deficient strains of S. mutans, we demonstrate that solid state NMR (ssNMR) spectroscopy can be used to (1) globally characterize cell walls isolated from a Gram-positive bacterium and (2) characterize the specific binding of heterologously expressed, isotopically-enriched C123 to cell wall-anchored P1. Our results lay the groundwork for future high-resolution characterization of the C123/P1 ultrastructure and subsequent steps in biofilm formation via ssNMR spectroscopy, and they support an emerging model of S. mutans colonization whereby quaternary P1-C123 interactions confer adhesive properties important to binding to immobilized human salivary agglutinin

  18. Specific binding of a naturally occurring amyloidogenic fragment of Streptococcus mutans adhesin P1 to intact P1 on the cell surface characterized by solid state NMR spectroscopy.

    Science.gov (United States)

    Tang, Wenxing; Bhatt, Avni; Smith, Adam N; Crowley, Paula J; Brady, L Jeannine; Long, Joanna R

    2016-02-01

    The P1 adhesin (aka Antigen I/II or PAc) of the cariogenic bacterium Streptococcus mutans is a cell surface-localized protein involved in sucrose-independent adhesion and colonization of the tooth surface. The immunoreactive and adhesive properties of S. mutans suggest an unusual functional quaternary ultrastructure comprised of intact P1 covalently attached to the cell wall and interacting with non-covalently associated proteolytic fragments thereof, particularly the ~57-kDa C-terminal fragment C123 previously identified as Antigen II. S. mutans is capable of amyloid formation when grown in a biofilm and P1 is among its amyloidogenic proteins. The C123 fragment of P1 readily forms amyloid fibers in vitro suggesting it may play a role in the formation of functional amyloid during biofilm development. Using wild-type and P1-deficient strains of S. mutans, we demonstrate that solid state NMR (ssNMR) spectroscopy can be used to (1) globally characterize cell walls isolated from a Gram-positive bacterium and (2) characterize the specific binding of heterologously expressed, isotopically-enriched C123 to cell wall-anchored P1. Our results lay the groundwork for future high-resolution characterization of the C123/P1 ultrastructure and subsequent steps in biofilm formation via ssNMR spectroscopy, and they support an emerging model of S. mutans colonization whereby quaternary P1-C123 interactions confer adhesive properties important to binding to immobilized human salivary agglutinin.

  19. Differential antibiotic sensitivity determined by the large ribosomal subunit in thermophilic archaea.

    OpenAIRE

    Ruggero, D; Londei, P

    1996-01-01

    Hybrid ribosomes obtained by mixing the ribosomal subunits of the extremely thermophilic archaea Sulfolobus solfataricus and Desulfurococcus mobilis were tested for their sensitivity to selected antibiotics. It is shown that structural differences in the large ribosomal subunits determine qualitatively and quantitatively the patterns of response to alpha-sarcin and paromomycin in these species.

  20. cDNA, genomic sequence cloning and analysis of the ribosomal ...

    African Journals Online (AJOL)

    Ribosomal protein L37A (RPL37A) is a component of 60S large ribosomal subunit encoded by the RPL37A gene, which belongs to the family of ribosomal L37AE proteins, located in the cytoplasm. The complementary deoxyribonucleic acid (cDNA) and the genomic sequence of RPL37A were cloned successfully from giant ...

  1. DNA replication stress restricts ribosomal DNA copy number

    Science.gov (United States)

    Salim, Devika; Bradford, William D.; Freeland, Amy; Cady, Gillian; Wang, Jianmin

    2017-01-01

    Ribosomal RNAs (rRNAs) in budding yeast are encoded by ~100–200 repeats of a 9.1kb sequence arranged in tandem on chromosome XII, the ribosomal DNA (rDNA) locus. Copy number of rDNA repeat units in eukaryotic cells is maintained far in excess of the requirement for ribosome biogenesis. Despite the importance of the repeats for both ribosomal and non-ribosomal functions, it is currently not known how “normal” copy number is determined or maintained. To identify essential genes involved in the maintenance of rDNA copy number, we developed a droplet digital PCR based assay to measure rDNA copy number in yeast and used it to screen a yeast conditional temperature-sensitive mutant collection of essential genes. Our screen revealed that low rDNA copy number is associated with compromised DNA replication. Further, subculturing yeast under two separate conditions of DNA replication stress selected for a contraction of the rDNA array independent of the replication fork blocking protein, Fob1. Interestingly, cells with a contracted array grew better than their counterparts with normal copy number under conditions of DNA replication stress. Our data indicate that DNA replication stresses select for a smaller rDNA array. We speculate that this liberates scarce replication factors for use by the rest of the genome, which in turn helps cells complete DNA replication and continue to propagate. Interestingly, tumors from mini chromosome maintenance 2 (MCM2)-deficient mice also show a loss of rDNA repeats. Our data suggest that a reduction in rDNA copy number may indicate a history of DNA replication stress, and that rDNA array size could serve as a diagnostic marker for replication stress. Taken together, these data begin to suggest the selective pressures that combine to yield a “normal” rDNA copy number. PMID:28915237

  2. ABC-F Proteins Mediate Antibiotic Resistance through Ribosomal Protection.

    Science.gov (United States)

    Sharkey, Liam K R; Edwards, Thomas A; O'Neill, Alex J

    2016-03-22

    Members of the ABC-F subfamily of ATP-binding cassette proteins mediate resistance to a broad array of clinically important antibiotic classes that target the ribosome of Gram-positive pathogens. The mechanism by which these proteins act has been a subject of long-standing controversy, with two competing hypotheses each having gained considerable support: antibiotic efflux versus ribosomal protection. Here, we report on studies employing a combination of bacteriological and biochemical techniques to unravel the mechanism of resistance of these proteins, and provide several lines of evidence that together offer clear support to the ribosomal protection hypothesis. Of particular note, we show that addition of purified ABC-F proteins to anin vitrotranslation assay prompts dose-dependent rescue of translation, and demonstrate that such proteins are capable of displacing antibiotic from the ribosomein vitro To our knowledge, these experiments constitute the first direct evidence that ABC-F proteins mediate antibiotic resistance through ribosomal protection.IMPORTANCEAntimicrobial resistance ranks among the greatest threats currently facing human health. Elucidation of the mechanisms by which microorganisms resist the effect of antibiotics is central to understanding the biology of this phenomenon and has the potential to inform the development of new drugs capable of blocking or circumventing resistance. Members of the ABC-F family, which includelsa(A),msr(A),optr(A), andvga(A), collectively yield resistance to a broader range of clinically significant antibiotic classes than any other family of resistance determinants, although their mechanism of action has been controversial since their discovery 25 years ago. Here we present the first direct evidence that proteins of the ABC-F family act to protect the bacterial ribosome from antibiotic-mediated inhibition. Copyright © 2016 Sharkey et al.

  3. DNA replication stress restricts ribosomal DNA copy number.

    Science.gov (United States)

    Salim, Devika; Bradford, William D; Freeland, Amy; Cady, Gillian; Wang, Jianmin; Pruitt, Steven C; Gerton, Jennifer L

    2017-09-01

    Ribosomal RNAs (rRNAs) in budding yeast are encoded by ~100-200 repeats of a 9.1kb sequence arranged in tandem on chromosome XII, the ribosomal DNA (rDNA) locus. Copy number of rDNA repeat units in eukaryotic cells is maintained far in excess of the requirement for ribosome biogenesis. Despite the importance of the repeats for both ribosomal and non-ribosomal functions, it is currently not known how "normal" copy number is determined or maintained. To identify essential genes involved in the maintenance of rDNA copy number, we developed a droplet digital PCR based assay to measure rDNA copy number in yeast and used it to screen a yeast conditional temperature-sensitive mutant collection of essential genes. Our screen revealed that low rDNA copy number is associated with compromised DNA replication. Further, subculturing yeast under two separate conditions of DNA replication stress selected for a contraction of the rDNA array independent of the replication fork blocking protein, Fob1. Interestingly, cells with a contracted array grew better than their counterparts with normal copy number under conditions of DNA replication stress. Our data indicate that DNA replication stresses select for a smaller rDNA array. We speculate that this liberates scarce replication factors for use by the rest of the genome, which in turn helps cells complete DNA replication and continue to propagate. Interestingly, tumors from mini chromosome maintenance 2 (MCM2)-deficient mice also show a loss of rDNA repeats. Our data suggest that a reduction in rDNA copy number may indicate a history of DNA replication stress, and that rDNA array size could serve as a diagnostic marker for replication stress. Taken together, these data begin to suggest the selective pressures that combine to yield a "normal" rDNA copy number.

  4. DNA replication stress restricts ribosomal DNA copy number.

    Directory of Open Access Journals (Sweden)

    Devika Salim

    2017-09-01

    Full Text Available Ribosomal RNAs (rRNAs in budding yeast are encoded by ~100-200 repeats of a 9.1kb sequence arranged in tandem on chromosome XII, the ribosomal DNA (rDNA locus. Copy number of rDNA repeat units in eukaryotic cells is maintained far in excess of the requirement for ribosome biogenesis. Despite the importance of the repeats for both ribosomal and non-ribosomal functions, it is currently not known how "normal" copy number is determined or maintained. To identify essential genes involved in the maintenance of rDNA copy number, we developed a droplet digital PCR based assay to measure rDNA copy number in yeast and used it to screen a yeast conditional temperature-sensitive mutant collection of essential genes. Our screen revealed that low rDNA copy number is associated with compromised DNA replication. Further, subculturing yeast under two separate conditions of DNA replication stress selected for a contraction of the rDNA array independent of the replication fork blocking protein, Fob1. Interestingly, cells with a contracted array grew better than their counterparts with normal copy number under conditions of DNA replication stress. Our data indicate that DNA replication stresses select for a smaller rDNA array. We speculate that this liberates scarce replication factors for use by the rest of the genome, which in turn helps cells complete DNA replication and continue to propagate. Interestingly, tumors from mini chromosome maintenance 2 (MCM2-deficient mice also show a loss of rDNA repeats. Our data suggest that a reduction in rDNA copy number may indicate a history of DNA replication stress, and that rDNA array size could serve as a diagnostic marker for replication stress. Taken together, these data begin to suggest the selective pressures that combine to yield a "normal" rDNA copy number.

  5. Studies on the catalytic rate constant of ribosomal peptidyltransferase.

    Science.gov (United States)

    Synetos, D; Coutsogeorgopoulos, C

    1987-02-20

    A detailed kinetic analysis of a model reaction for the ribosomal peptidyltransferase is described, using fMet-tRNA or Ac-Phe-tRNA as the peptidyl donor and puromycin as the acceptor. The initiation complex (fMet-tRNA X AUG X 70 S ribosome) or (Ac-Phe-tRNA X poly(U) X 70 S ribosome) (complex C) is isolated and then reacted with excess puromycin (S) to give fMet-puromycin or Ac-Phe-puromycin. This reaction (puromycin reaction) is first order at all concentrations of S tested. An important asset of this kinetic analysis is the fact that the relationship between the first order rate constant kobs and [S] shows hyperbolic saturation and that the value of kobs at saturating [S] is a measure of the catalytic rate constant (k cat) of peptidyltransferase in the puromycin reaction. With fMet-tRNA as the donor, this kcat of peptidyltransferase is 8.3 min-1 when the 0.5 M NH4Cl ribosomal wash is present, compared to 3.8 min-1 in its absence. The kcat of peptidyltransferase is 2.0 min-1 when Ac-Phe-tRNA replaces fMet-tRNA in the presence of the ribosomal wash and decreases to 0.8 min-1 in its absence. This kinetic procedure is the best method available for evaluating changes in the activity of peptidyltransferase in vitro. The results suggest that peptidyltransferase is subjected to activation by the binding of fMet-tRNA to the 70 S initiation complex.

  6. A systems toxicology approach identifies Lyn as a key signaling phosphoprotein modulated by mercury in a B lymphocyte cell model

    Energy Technology Data Exchange (ETDEWEB)

    Caruso, Joseph A.; Stemmer, Paul M. [Institute of Environmental Health Sciences, Wayne State University, Detroit, MI (United States); Dombkowski, Alan [Department of Pediatrics, Wayne State University, Detroit, MI (United States); Caruthers, Nicholas J. [Institute of Environmental Health Sciences, Wayne State University, Detroit, MI (United States); Gill, Randall [Department of Immunology and Microbiology, Wayne State University, Detroit, MI (United States); Rosenspire, Allen J., E-mail: arosenspire@wayne.edu [Department of Immunology and Microbiology, Wayne State University, Detroit, MI (United States)

    2014-04-01

    Network and protein–protein interaction analyses of proteins undergoing Hg{sup 2+}-induced phosphorylation and dephosphorylation in Hg{sup 2+}-intoxicated mouse WEHI-231 B cells identified Lyn as the most interconnected node. Lyn is a Src family protein tyrosine kinase known to be intimately involved in the B cell receptor (BCR) signaling pathway. Under normal signaling conditions the tyrosine kinase activity of Lyn is controlled by phosphorylation, primarily of two well known canonical regulatory tyrosine sites, Y-397 and Y-508. However, Lyn has several tyrosine residues that have not yet been determined to play a major role under normal signaling conditions, but are potentially important sites for phosphorylation following mercury exposure. In order to determine how Hg{sup 2+} exposure modulates the phosphorylation of additional residues in Lyn, a targeted MS assay was developed. Initial mass spectrometric surveys of purified Lyn identified 7 phosphorylated tyrosine residues. A quantitative assay was developed from these results using the multiple reaction monitoring (MRM) strategy. WEHI-231 cells were treated with Hg{sup 2+}, pervanadate (a phosphatase inhibitor), or anti-Ig antibody (to stimulate the BCR). Results from these studies showed that the phosphoproteomic profile of Lyn after exposure of the WEHI-231 cells to a low concentration of Hg{sup 2+} closely resembled that of anti-Ig antibody stimulation, whereas exposure to higher concentrations of Hg{sup 2+} led to increases in the phosphorylation of Y-193/Y-194, Y-501 and Y-508 residues. These data indicate that mercury can disrupt a key regulatory signal transduction pathway in B cells and point to phospho-Lyn as a potential biomarker for mercury exposure. - Highlights: • Inorganic mercury (Hg{sup 2+}) induces changes in the WEHI-231 B cell phosphoproteome. • The B cell receptor (BCR) signaling pathway was the pathway most affected by Hg{sup 2+}. • The Src family phosphoprotein kinase Lyn was the

  7. Increased expression of Golgi phosphoprotein-3 is associated with tumor aggressiveness and poor prognosis of prostate cancer

    Directory of Open Access Journals (Sweden)

    Hua Xing

    2012-09-01

    Full Text Available Abstract Background To investigate the expression of Golgi phosphoprotein-3 (GOLPH3 in prostate cancer and determine its prognostic value. Methods Immunohistochemical staining for GOLPH3 was performed on tissue microarrays of 342 prostate patients. The correlation between GOLPH3 expression with its clinicopathologic factors was also analyzed in order to determine its prognostic significance. Results GOLPH3 expression of normal prostate tissues, benign prostate hyperplasia, high-grade prostatic intraepithelial neoplasia, and hormone-dependent prostate cancer (HDPC did not show any statistically significant difference. In contrast, statistically significant difference was reported in moderate/intense GOLPH3 expression in cases diagnosed with HDPC and castration resistant prostate cancer (CRPC (P P = 0.012, higher Gleason score (P = 0.017, bone metastasis (P = 0.024, higher baseline prostate-specific antigen (PSA (P = 0.038, and higher PSA nadir (P = 0.032. A significantly negative correlation was found between moderate/intense GOLPH3 expression and disease-free survival (DFS (HR = 0.28, P = 0.012 and overall survival (OS (HR = 0.42, P = 0.027. Univariated analysis indicated that moderate/intense GOLPH3 expression created a significantly prognostic impact in patients with CRPC. On the other hand, multivariate analysis indicated that GOLPH3 was a significantly independent prognostic factor of DFS (P = 0.027 in all prostate cancer patients. Conclusions In this study, it was discovered that the overexpression of GOLPH3 is associated with the transition of prostate cancer from hormone sensitive phase to hormone refractory phase. GOLPH3 might be an important prognostic factor of DFS and OS in patients with prostate cancer. In totality, GOLPH3 could be used as a novel candidate in devising a more effective therapeutic strategy to tackle CRPC. Virtual slides The virtual slide(s for this article can be found here

  8. Structure of the Paramyxovirus Parainfluenza Virus 5 Nucleoprotein in Complex with an Amino-Terminal Peptide of the Phosphoprotein

    Energy Technology Data Exchange (ETDEWEB)

    Aggarwal, Megha; Leser, George P.; Kors, Christopher A.; Lamb, Robert A.; Sundquist, Wesley I.

    2017-12-13

    Parainfluenza virus 5 (PIV5) belongs to the familyParamyxoviridae, which consists of enveloped viruses with a nonsegmented negative-strand RNA genome encapsidated by the nucleoprotein (N). Paramyxovirus replication is regulated by the phosphoprotein (P) through protein-protein interactions with N and the RNA polymerase (L). The chaperone activity of P is essential to maintain the unassembled RNA-free form of N in order to prevent nonspecific RNA binding and premature N oligomerization. Here, we determined the crystal structure of unassembled PIV5 N in complex with a P peptide (N0P) derived from the N terminus of P (P50) at 2.65 Å. The PIV5 N0P consists of two domains: an N-terminal domain (NTD) and a C-terminal domain (CTD) separated by a hinge region. The cleft at the hinge region of RNA-bound PIV5 N was previously shown to be an RNA binding site. The N0P structure shows that the P peptide binds to the CTD of N and extends toward the RNA binding site to inhibit N oligomerization and, hence, RNA binding. Binding of P peptide also keeps the PIV5 N in the open form. A molecular dynamics (MD) analysis of both the open and closed forms of N shows the flexibility of the CTD and the preference of the N protein to be in an open conformation. The gradual opening of the hinge region, to release the RNA, was also observed. Together, these results advance our knowledge of the conformational swapping of N required for the highly regulated paramyxovirus replication.

    IMPORTANCEParamyxovirus replication is regulated by the interaction of P with N and L proteins. Here, we report the crystal structure of unassembled parainfluenza virus 5 (PIV5) N chaperoned with P peptide. Our results provide a detailed understanding of the binding of P to N. The conformational switching of N between closed and open forms during its initial interaction with P, as well as

  9. Is there a channel in the ribosome for nascent peptide. Labellimg of translating ribosomes with atomar tritium

    Energy Technology Data Exchange (ETDEWEB)

    Kolb, V A; Kammer, A A; Spirin, A S

    1987-01-01

    The method of tritium bombardment was applied to investigate exposure of growing peptide on the surface of ribsome E.coli. Distribution of radioactivity by fractions is presented. Tritium inclusion in all the aminoacid residues of heteropeptide testifies to its exposure on the surface of the ribosome.

  10. The structure of the nucleoprotein binding domain of lyssavirus phosphoprotein reveals a structural relationship between the N-RNA binding domains of Rhabdoviridae and Paramyxoviridae.

    Science.gov (United States)

    Delmas, Olivier; Assenberg, Rene; Grimes, Jonathan M; Bourhy, Hervé

    2010-01-01

    The phosphoprotein P of non-segmented negative-sense RNA viruses is an essential component of the replication and transcription complex and acts as a co-factor for the viral RNA-dependent RNA polymerase. P recruits the viral polymerase to the nucleoprotein-bound viral RNA (N-RNA) via an interaction between its C-terminal domain and the N-RNA complex. We have obtained the structure of the C-terminal domain of P of Mokola virus (MOKV), a lyssavirus that belongs to the Rhabdoviridae family and mapped at the amino acid level the crucial positions involved in interaction with N and in the formation of the viral replication complex. Comparison of the N-RNA binding domains of P solved to date suggests that the N-RNA binding domains are structurally conserved among paramyxoviruses and rhabdoviruses in spite of low sequence conservation. We also review the numerous other functions of this domain and more generally of the phosphoprotein.

  11. DNA Binding by the Ribosomal DNA Transcription Factor Rrn3 Is Essential for Ribosomal DNA Transcription*

    Science.gov (United States)

    Stepanchick, Ann; Zhi, Huijun; Cavanaugh, Alice H.; Rothblum, Katrina; Schneider, David A.; Rothblum, Lawrence I.

    2013-01-01

    The human homologue of yeast Rrn3 is an RNA polymerase I-associated transcription factor that is essential for ribosomal DNA (rDNA) transcription. The generally accepted model is that Rrn3 functions as a bridge between RNA polymerase I and the transcription factors bound to the committed template. In this model Rrn3 would mediate an interaction between the mammalian Rrn3-polymerase I complex and SL1, the rDNA transcription factor that binds to the core promoter element of the rDNA. In the course of studying the role of Rrn3 in recruitment, we found that Rrn3 was in fact a DNA-binding protein. Analysis of the sequence of Rrn3 identified a domain with sequence similarity to the DNA binding domain of heat shock transcription factor 2. Randomization, or deletion, of the amino acids in this region in Rrn3, amino acids 382–400, abrogated its ability to bind DNA, indicating that this domain was an important contributor to DNA binding by Rrn3. Control experiments demonstrated that these mutant Rrn3 constructs were capable of interacting with both rpa43 and SL1, two other activities demonstrated to be essential for Rrn3 function. However, neither of these Rrn3 mutants was capable of functioning in transcription in vitro. Moreover, although wild-type human Rrn3 complemented a yeast rrn3-ts mutant, the DNA-binding site mutant did not. These results demonstrate that DNA binding by Rrn3 is essential for transcription by RNA polymerase I. PMID:23393135

  12. DNA binding by the ribosomal DNA transcription factor rrn3 is essential for ribosomal DNA transcription.

    Science.gov (United States)

    Stepanchick, Ann; Zhi, Huijun; Cavanaugh, Alice H; Rothblum, Katrina; Schneider, David A; Rothblum, Lawrence I

    2013-03-29

    The human homologue of yeast Rrn3 is an RNA polymerase I-associated transcription factor that is essential for ribosomal DNA (rDNA) transcription. The generally accepted model is that Rrn3 functions as a bridge between RNA polymerase I and the transcription factors bound to the committed template. In this model Rrn3 would mediate an interaction between the mammalian Rrn3-polymerase I complex and SL1, the rDNA transcription factor that binds to the core promoter element of the rDNA. In the course of studying the role of Rrn3 in recruitment, we found that Rrn3 was in fact a DNA-binding protein. Analysis of the sequence of Rrn3 identified a domain with sequence similarity to the DNA binding domain of heat shock transcription factor 2. Randomization, or deletion, of the amino acids in this region in Rrn3, amino acids 382-400, abrogated its ability to bind DNA, indicating that this domain was an important contributor to DNA binding by Rrn3. Control experiments demonstrated that these mutant Rrn3 constructs were capable of interacting with both rpa43 and SL1, two other activities demonstrated to be essential for Rrn3 function. However, neither of these Rrn3 mutants was capable of functioning in transcription in vitro. Moreover, although wild-type human Rrn3 complemented a yeast rrn3-ts mutant, the DNA-binding site mutant did not. These results demonstrate that DNA binding by Rrn3 is essential for transcription by RNA polymerase I.

  13. Photoaffinity labeling of rat liver ribosomes by N-(2-Nitro-4-azidobenzoyl)puromycin

    International Nuclear Information System (INIS)

    Boehm, H.; Stahl, J.; Bielka, H.

    1979-01-01

    N-(2-nitro-4-azidobenzoyl)-[ 3 H]puromycin (NAB-puromycin) was synthesized as a photoreactive derivative of puromycin in order to detect ribosomal proteins located near the peptidyltransferase centre of rat liver ribosomes. Irradiation of ribosome-NAB-puromycin complexes leads to covalent attachment of the affinity label to proteins of the large ribosomal subunit, in particular to proteins L28/29, and, to a somewhat lower extent, to proteins L4, L6, L10 and L24. The results are discussed in the light of earlier studies performed with other affinity labels that attacked the peptidyltransferase region of rat liver ribosomes. (author)

  14. Translation activity of chimeric ribosomes composed of Escherichia coli and Bacillus subtilis or Geobacillus stearothermophilus subunits

    Directory of Open Access Journals (Sweden)

    Sayaka Tsuji

    2017-07-01

    Full Text Available Ribosome composition, consisting of rRNA and ribosomal proteins, is highly conserved among a broad range of organisms. However, biochemical studies focusing on ribosomal subunit exchangeability between organisms remain limited. In this study, we show that chimeric ribosomes, composed of Escherichia coli and Bacillus subtilis or E. coli and Geobacillus stearothermophilus subunits, are active for β-galactosidase translation in a highly purified E. coli translation system. Activities of the chimeric ribosomes showed only a modest decrease when using E. coli 30 S subunits, indicating functional conservation of the 50 S subunit between these bacterial species.

  15. Unstable structure of ribosomal particles synthesized in. gamma. -irradiated Escherichia coli

    Energy Technology Data Exchange (ETDEWEB)

    Fujita, H; Morita, K [National Inst. of Radiological Sciences, Chiba (Japan)

    1975-06-01

    Stability of Escherichia coli ribosomes newly synthesized after ..gamma..-irradiation was compared with that of normal ribosomes. The ribosomal particles around 70-S synthesized in irradiated cells were more sensitive to digestion by pancreatic ribonuclease A. A larger number of the salt-unstable '50-S' precursor particles existed in the extract from irradiated cells than in the extract from unirradiated cells. These facts suggest that ribosomal particles, synthesized during an earlier stage in irradiated cells, maintain an incomplete structure even though they are not distinguishable from normal ribosomes by means of sucrose density-gradient centrifugation.

  16. The calculation of oscillator strengths for the 5s21S0→5s5p1,3P1 transitions in Cd-like ions

    International Nuclear Information System (INIS)

    Li Guangyuan

    1998-01-01

    The screened hydrogenic model is employed to calculate the oscillator strength of the 5s 2 1 S 0 -5s5p 1 P 1 resonance transition in Cd-like ions (Z = 48 -74). The expression for the oscillator strength of the 5s 2 1 S 0 -5s5p 3 P1 is given, with the introduction of the correctional coefficient K and the mixing angle in jj-coupling. The results are compared with that of other authors, and some discussions are also given

  17. Using the Ribodeblur pipeline to recover A-sites from yeast ribosome profiling data.

    Science.gov (United States)

    Wang, Hao; Kingsford, Carl; McManus, C Joel

    2018-03-15

    Ribosome profiling has emerged as a powerful technique to study mRNA translation. Ribosome profiling has the potential to determine the relative quantities and locations of ribosomes on mRNA genome wide. Taking full advantage of this approach requires accurate measurement of ribosome locations. However, experimental inconsistencies often obscure the positional information encoded in ribosome profiling data. Here, we describe the Ribodeblur pipeline, a computational analysis tool that uses a maximum likelihood framework to infer ribosome positions from heterogeneous datasets. Ribodeblur is simple to install, and can be run on an average modern Mac or Linux-based laptop. We detail the process of applying the pipeline to high-coverage ribosome profiling data in yeast, and discuss important considerations for potential extension to other organisms. Copyright © 2018 Elsevier Inc. All rights reserved.

  18. In vivo labelling of functional ribosomes reveals spatial regulation during starvation in Podospora anserina

    Directory of Open Access Journals (Sweden)

    Silar Philippe

    2000-11-01

    Full Text Available Abstract Background To date, in eukaryotes, ribosomal protein expression is known to be regulated at the transcriptional and/or translational levels. But other forms of regulation may be possible. Results Here, we report the successful tagging of functional ribosomal particles with a S7-GFP chimaeric protein, making it possible to observe in vivo ribosome dynamics in the filamentous fungus Podospora anserina. Microscopic observations revealed a novel kind of ribosomal protein regulation during the passage between cell growth and stationary phases, with a transient accumulation of ribosomal proteins and/or ribosome subunits in the nucleus, possibly the nucleolus, being observed at the beginning of stationary phase. Conclusion Nuclear sequestration can be another level of ribosomal protein regulation in eukaryotic cells.This may contribute to the regulation of cell growth and division.

  19. In vivo labelling of functional ribosomes reveals spatial regulation during starvation in Podospora anserina

    Science.gov (United States)

    Lalucque, Hervé; Silar, Philippe

    2000-01-01

    Background To date, in eukaryotes, ribosomal protein expression is known to be regulated at the transcriptional and/or translational levels. But other forms of regulation may be possible. Results Here, we report the successful tagging of functional ribosomal particles with a S7-GFP chimaeric protein, making it possible to observe in vivo ribosome dynamics in the filamentous fungus Podospora anserina. Microscopic observations revealed a novel kind of ribosomal protein regulation during the passage between cell growth and stationary phases, with a transient accumulation of ribosomal proteins and/or ribosome subunits in the nucleus, possibly the nucleolus, being observed at the beginning of stationary phase. Conclusion Nuclear sequestration can be another level of ribosomal protein regulation in eukaryotic cells.This may contribute to the regulation of cell growth and division. PMID:11112985

  20. Pactamycin binding site on archaebacterial and eukaryotic ribosomes

    International Nuclear Information System (INIS)

    Tejedor, F.; Amils, R.; Ballesta, J.P.G.

    1987-01-01

    The presence of a photoreactive acetophenone group in the protein synthesis inhibitor pactamycin and the possibility of obtaining active iodinated derivatives that retain full biological activity allow the antibiotic binding site on Saccharomyces cerevisiae and archaebacterium Sulfolobus solfataricus ribosomes to be photoaffinity labeled. Four major labeled proteins have been identified in the yeast ribosomes, i.e., YS10, YS18, YS21/24, and YS30, while proteins AL1a, AS10/L8, AS18/20, and AS21/22 appeared as radioactive spots in S. solfataricus. There seems to be a correlation between some of the proteins labeled in yeast and those previously reported in Escherichia coli indicating that the pactamycin binding sites of both species, which are in the small subunit close to the initiation factors and mRNA binding sites, must have similar characteristics

  1. Ribosome-catalyzed formation of an abnormal peptide analogue

    International Nuclear Information System (INIS)

    Roesser, J.R.; Chorghade, M.S.; Hecht, S.M.

    1986-01-01

    The peptidyl-tRNA analogue N-(chloracetyl) phenylalanyl-tRNA/sup Phe/ was prepared by chemical aminoacylation and prebound to the P site of Escherichia coli ribosomes in response to poly(uridylic acid). Admixture of phenylalanyl-tRNA/sup Phe/ to the A site resulted in the formation of two dipeptides, one of which was found by displacement of chloride ion from the peptidyl-tRNA. This constitutes the first example of ribosome-mediated formation of a peptide of altered connectivity and suggests a need for revision of the current model of peptide bond formation. Also suggested by the present finding is the feasibility of utilizing tRNAs to prepare polypeptides of altered connectivity in an in vitro protein biosynthesizing system. [ 32 P]-oligo(rA), [ 3 H]- and [ 14 C] phenylalanines were used in the assay of the peptidye-tRNA analogue

  2. Transcriptional activation of ribosomal RNA genes during compensatory renal hypertrophy

    International Nuclear Information System (INIS)

    Ouellette, A.J.; Moonka, R.; Zelenetz, A.; Malt, R.A.

    1986-01-01

    The overall rate of rDNA transcription increases by 50% during the first 24 hours of compensatory renal hypertrophy in the mouse. To study mechanisms of ribosome accumulation after uninephrectomy, transcription rates were measured in isolated kidneys by transcriptional runoff. 32 P-labeled nascent transcripts were hybridized to blots containing linearized, denatured cloned rDNA, and hybridization was quantitated autoradiographically and by direct counting. Overall transcriptional activity of rDNA was increased by 30% above control levels at 6 hrs after nephrectomy and by 50% at 12, 18, and 24 hrs after operation. Hybridizing RNA was insensitive to inhibiby alpha-amanitin, and no hybridization was detected to vector DNA. Thus, accelerated rDNA transcription is one regulatory element in the accretion of ribosomes in renal growth, and the regulatory event is an early event. Mechanisms of activation may include enhanced transcription of active genes or induction of inactive DNA

  3. Ribosomal protein S14 transcripts are edited in Oenothera mitochondria.

    Science.gov (United States)

    Schuster, W; Unseld, M; Wissinger, B; Brennicke, A

    1990-01-01

    The gene encoding ribosomal protein S14 (rps14) in Oenothera mitochondria is located upstream of the cytochrome b gene (cob). Sequence analysis of independently derived cDNA clones covering the entire rps14 coding region shows two nucleotides edited from the genomic DNA to the mRNA derived sequences by C to U modifications. A third editing event occurs four nucleotides upstream of the AUG initiation codon and improves a potential ribosome binding site. A CGG codon specifying arginine in a position conserved in evolution between chloroplasts and E. coli as a UGG tryptophan codon is not edited in any of the cDNAs analysed. An inverted repeat 3' of an unidentified open reading frame is located upstream of the rps14 gene. The inverted repeat sequence is highly conserved at analogous regions in other Oenothera mitochondrial loci. Images PMID:2326162

  4. Assembly constraints drive co-evolution among ribosomal constituents.

    Science.gov (United States)

    Mallik, Saurav; Akashi, Hiroshi; Kundu, Sudip

    2015-06-23

    Ribosome biogenesis, a central and essential cellular process, occurs through sequential association and mutual co-folding of protein-RNA constituents in a well-defined assembly pathway. Here, we construct a network of co-evolving nucleotide/amino acid residues within the ribosome and demonstrate that assembly constraints are strong predictors of co-evolutionary patterns. Predictors of co-evolution include a wide spectrum of structural reconstitution events, such as cooperativity phenomenon, protein-induced rRNA reconstitutions, molecular packing of different rRNA domains, protein-rRNA recognition, etc. A correlation between folding rate of small globular proteins and their topological features is known. We have introduced an analogous topological characteristic for co-evolutionary network of ribosome, which allows us to differentiate between rRNA regions subjected to rapid reconstitutions from those hindered by kinetic traps. Furthermore, co-evolutionary patterns provide a biological basis for deleterious mutation sites and further allow prediction of potential antibiotic targeting sites. Understanding assembly pathways of multicomponent macromolecules remains a key challenge in biophysics. Our study provides a 'proof of concept' that directly relates co-evolution to biophysical interactions during multicomponent assembly and suggests predictive power to identify candidates for critical functional interactions as well as for assembly-blocking antibiotic target sites. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  5. Photoaffinity labeling of the pactamycin binding site on eubacterial ribosomes

    International Nuclear Information System (INIS)

    Tejedor, F.; Amils, R.; Ballesta, J.P.

    1985-01-01

    Pactamycin, an inhibitor of the initial steps of protein synthesis, has an acetophenone group in its chemical structure that makes the drug a potentially photoreactive molecule. In addition, the presence of a phenolic residue makes it easily susceptible to radioactive labeling. Through iodination, one radioactive derivative of pactamycin has been obtained with biological activities similar to the unmodified drug when tested on in vivo and cell-free systems. With the use of [ 125 I]iodopactamycin, ribosomes of Escherichia coli have been photolabeled under conditions that preserve the activity of the particles and guarantee the specificity of the binding sites. Under these conditions, RNA is preferentially labeled when free, small ribosomal subunits are photolabeled, but proteins are the main target in the whole ribosome. This indicates that an important conformational change takes place in the binding site on association of the two subunits. The major labeled proteins are S2, S4, S18, S21, and L13. These proteins in the pactamycin binding site are probably related to the initiation step of protein synthesis

  6. Further characterization of ribosome binding to thylakoid membranes

    International Nuclear Information System (INIS)

    Hurewitz, J.; Jagendorf, A.T.

    1987-01-01

    Previous work indicated more polysomes bound to pea (Pisum sativum cv Progress No. 9) thylakoids in light than in the dark, in vivo. With isolated intact chloroplasts incubated in darkness, addition of MgATP had no effect but 24 to 74% more RNA was thylakoid-bound at pH 8.3 than at pH 7. Thus, the major effect of light on ribosome-binding in vivo may be due to higher stroma pH. In isolated pea chloroplasts, initiation inhibitors (pactamycin and kanamycin) decreased the extent of RNA binding, and elongation inhibitors (lincomycin and streptomycin) increased it. Thus, cycling of ribosomes is controlled by translation, initiation, and termination. Bound RNA accounted for 19 to 24% of the total chloroplast RNA and the incorporation of [ 3 H]leucine into thylakoids was proportional to the amount of this bound RNA. These data support the concept that stroma ribosomes are recruited into thylakoid polysomes, which are active in synthesizing thylakoid proteins

  7. Structure of Vibrio cholerae ribosome hibernation promoting factor

    International Nuclear Information System (INIS)

    De Bari, Heather; Berry, Edward A.

    2013-01-01

    The X-ray crystal structure of ribosome hibernation promoting factor from V. cholerae has been determined at 2.0 Å resolution. The crystal was phased by two-wavelength MAD using cocrystallized cobalt. The X-ray crystal structure of ribosome hibernation promoting factor (HPF) from Vibrio cholerae is presented at 2.0 Å resolution. The crystal was phased by two-wavelength MAD using cocrystallized cobalt. The asymmetric unit contained two molecules of HPF linked by four Co atoms. The metal-binding sites observed in the crystal are probably not related to biological function. The structure of HPF has a typical β–α–β–β–β–α fold consistent with previous structures of YfiA and HPF from Escherichia coli. Comparison of the new structure with that of HPF from E. coli bound to the Thermus thermophilus ribosome [Polikanov et al. (2012 ▶), Science, 336, 915–918] shows that no significant structural changes are induced in HPF by binding

  8. A new version of the RDP (Ribosomal Database Project)

    Science.gov (United States)

    Maidak, B. L.; Cole, J. R.; Parker, C. T. Jr; Garrity, G. M.; Larsen, N.; Li, B.; Lilburn, T. G.; McCaughey, M. J.; Olsen, G. J.; Overbeek, R.; hide

    1999-01-01

    The Ribosomal Database Project (RDP-II), previously described by Maidak et al. [ Nucleic Acids Res. (1997), 25, 109-111], is now hosted by the Center for Microbial Ecology at Michigan State University. RDP-II is a curated database that offers ribosomal RNA (rRNA) nucleotide sequence data in aligned and unaligned forms, analysis services, and associated computer programs. During the past two years, data alignments have been updated and now include >9700 small subunit rRNA sequences. The recent development of an ObjectStore database will provide more rapid updating of data, better data accuracy and increased user access. RDP-II includes phylogenetically ordered alignments of rRNA sequences, derived phylogenetic trees, rRNA secondary structure diagrams, and various software programs for handling, analyzing and displaying alignments and trees. The data are available via anonymous ftp (ftp.cme.msu. edu) and WWW (http://www.cme.msu.edu/RDP). The WWW server provides ribosomal probe checking, approximate phylogenetic placement of user-submitted sequences, screening for possible chimeric rRNA sequences, automated alignment, and a suggested placement of an unknown sequence on an existing phylogenetic tree. Additional utilities also exist at RDP-II, including distance matrix, T-RFLP, and a Java-based viewer of the phylogenetic trees that can be used to create subtrees.

  9. Simulation and analysis of single-ribosome translation

    International Nuclear Information System (INIS)

    Tinoco, Ignacio Jr; Wen, Jin-Der

    2009-01-01

    In the cell, proteins are synthesized by ribosomes in a multi-step process called translation. The ribosome translocates along the messenger RNA to read the codons that encode the amino acid sequence of a protein. Elongation factors, including EF-G and EF-Tu, are used to catalyze the process. Recently, we have shown that translation can be followed at the single-molecule level using optical tweezers; this technique allows us to study the kinetics of translation by measuring the lifetime the ribosome spends at each codon. Here, we analyze the data from single-molecule experiments and fit the data with simple kinetic models. We also simulate the translation kinetics based on a multi-step mechanism from ensemble kinetic measurements. The mean lifetimes from the simulation were consistent with our experimental single-molecule measurements. We found that the calculated lifetime distributions were fit in general by equations with up to five rate-determining steps. Two rate-determining steps were only obtained at low concentrations of elongation factors. These analyses can be used to design new single-molecule experiments to better understand the kinetics and mechanism of translation

  10. Detecção do vírus da cinomose canina por RT-PCR utilizando-se oligonucleotídeos para os genes da fosfoproteína, hemaglutinina e neuraminidase Detection of canine distemper virus by RT-PCR using oligonucleotides targeted to the phosphoprotein, hemagglutinin and neuraminidase genes

    Directory of Open Access Journals (Sweden)

    M. Pozza

    2007-10-01

    Full Text Available Empregou-se a técnica de reação em cadeia pela polimerase precedida de transcrição reversa para detecção do vírus da cinomose canina (CC. Para a padronização da técnica foram selecionados quatro pares de oligonucleotídeos (P1, P2, N1, H1, baseados em seqüências dos genes da fosfoproteína, neuraminidase e hemaglutinina, sendo utilizadas três cepas vacinais de vírus da CC como controles positivos. Foram analisadas três amostras isoladas de cães com cinomose e quatro amostras provenientes de cães com suspeita clínica de cinomose. Não houve amplificação nas amostras com suspeita clínica da doença. Os resultados obtidos com os oligonucleotídeos P1 e N1 foram superiores aos de H1. Os oligonucleotídeos P2 foram considerados inapropriados para a detecção do vírus da CC. Os amplicons obtidos com os oligonucleotídeos P1, N1 e H1 foram clivados com endonucleases de restrição, sendo os perfis das amostras virais comparados aos da amostra vacinal Lederle, utilizada como referência. Um padrão similar de restrição foi observado em todas as amostras analisadas.The reverse transcription-polymerase chain reaction was used to detect canine distemper virus (CDV. Four oligonucleotide pairs were selected (P1, P2, N1, H1, based on the sequences of the phosphoprotein, hemagglutinin and nuraminidase genes for assay standardization, and three CDV vaccine strains were used as positive controls. Three viral isolates from dogs with canine distemper and four samples from animals clinically suspected of distemper were analysed. No amplification was detected in suspected samples. Results obtained by using P1 and N1 oligonucleotides were superior to those with H1 ones. P2 oligonucleotides were considered inadequate for CDV detection. Amplicons resulting from amplification of P1, N1 and H1 oligonucleotides were submitted to cleavage by restriction endonucleases and restriction patterns of viral samples were compared to that of Lederle strain

  11. Heterogeneous Ribosomes Preferentially Translate Distinct Subpools of mRNAs Genome-wide.

    Science.gov (United States)

    Shi, Zhen; Fujii, Kotaro; Kovary, Kyle M; Genuth, Naomi R; Röst, Hannes L; Teruel, Mary N; Barna, Maria

    2017-07-06

    Emerging studies have linked the ribosome to more selective control of gene regulation. However, an outstanding question is whether ribosome heterogeneity at the level of core ribosomal proteins (RPs) exists and enables ribosomes to preferentially translate specific mRNAs genome-wide. Here, we measured the absolute abundance of RPs in translating ribosomes and profiled transcripts that are enriched or depleted from select subsets of ribosomes within embryonic stem cells. We find that heterogeneity in RP composition endows ribosomes with differential selectivity for translating subpools of transcripts, including those controlling metabolism, cell cycle, and development. As an example, mRNAs enriched in binding to RPL10A/uL1-containing ribosomes are shown to require RPL10A/uL1 for their efficient translation. Within several of these transcripts, this level of regulation is mediated, at least in part, by internal ribosome entry sites. Together, these results reveal a critical functional link between ribosome heterogeneity and the post-transcriptional circuitry of gene expression. Copyright © 2017 Elsevier Inc. All rights reserved.

  12. Porcine Circovirus-Like Virus P1 Inhibits Wnt Signaling Pathway in Vivo and in Vitro.

    Science.gov (United States)

    Zhu, Xuejiao; Wen, Libin; Sheng, Shaoyang; Wang, Wei; Xiao, Qi; Qu, Meng; Hu, Yiyi; Liu, Chuanmin; He, Kongwang

    2018-01-01

    Porcine circovirus-like virus P1 is an important pathogen of the current pig industry, the infection mechanism is not entirely clear. Wnt signaling pathway plays an important role in the growth of young animals and infection of some viruses. This study was designed to demonstrate the effects of P1 infection on the Wnt signaling pathway. In vivo experiments, we demonstrated the down-regulatory effects of P1 infection in piglets and mice on the downstream components expression levels of Wnt signaling pathway, and the effects of Wnt signaling pathway activation on the pathogenesis of P1. In vitro studies, we found P1 infection down-regulated protein level of β-catenin and mRNA level of mmp2, prevented the β-catenin from entering into nucleus, abolished the TCF/LEF promoter activity, proved that P1 could inhibit the activation of Wnt signaling pathway in vitro . Finally, we found that VP1 of P1 virus also had the inhibitory effects on Wnt signaling pathway in vitro , elucidated the mechanism of P1's inhibitory effects on the Wnt signaling pathway and offered the possibility that the suppression of Wnt signaling pathway was involved in the post-weaning multisystemic wasting syndrome (PMWS), laying a foundation for elucidating the pathogenesis of P1.

  13. Porcine Circovirus-Like Virus P1 Inhibits Wnt Signaling Pathway in Vivo and in Vitro

    Directory of Open Access Journals (Sweden)

    Xuejiao Zhu

    2018-03-01

    Full Text Available Porcine circovirus-like virus P1 is an important pathogen of the current pig industry, the infection mechanism is not entirely clear. Wnt signaling pathway plays an important role in the growth of young animals and infection of some viruses. This study was designed to demonstrate the effects of P1 infection on the Wnt signaling pathway. In vivo experiments, we demonstrated the down-regulatory effects of P1 infection in piglets and mice on the downstream components expression levels of Wnt signaling pathway, and the effects of Wnt signaling pathway activation on the pathogenesis of P1. In vitro studies, we found P1 infection down-regulated protein level of β-catenin and mRNA level of mmp2, prevented the β-catenin from entering into nucleus, abolished the TCF/LEF promoter activity, proved that P1 could inhibit the activation of Wnt signaling pathway in vitro. Finally, we found that VP1 of P1 virus also had the inhibitory effects on Wnt signaling pathway in vitro, elucidated the mechanism of P1’s inhibitory effects on the Wnt signaling pathway and offered the possibility that the suppression of Wnt signaling pathway was involved in the post-weaning multisystemic wasting syndrome (PMWS, laying a foundation for elucidating the pathogenesis of P1.

  14. Involvement of ribosomal protein L6 in assembly of functional 50S ribosomal subunit in Escherichia coli cells

    International Nuclear Information System (INIS)

    Shigeno, Yuta; Uchiumi, Toshio; Nomura, Takaomi

    2016-01-01

    Ribosomal protein L6, an essential component of the large (50S) subunit, primarily binds to helix 97 of 23S rRNA and locates near the sarcin/ricin loop of helix 95 that directly interacts with GTPase translation factors. Although L6 is believed to play important roles in factor-dependent ribosomal function, crucial biochemical evidence for this hypothesis has not been obtained. We constructed and characterized an Escherichia coli mutant bearing a chromosomal L6 gene (rplF) disruption and carrying a plasmid with an arabinose-inducible L6 gene. Although this ΔL6 mutant grew more slowly than its wild-type parent, it proliferated in the presence of arabinose. Interestingly, cell growth in the absence of arabinose was biphasic. Early growth lasted only a few generations (LI-phase) and was followed by a suspension of growth for several hours (S-phase). This suspension was followed by a second growth phase (LII-phase). Cells harvested at both LI- and S-phases contained ribosomes with reduced factor-dependent GTPase activity and accumulated 50S subunit precursors (45S particles). The 45S particles completely lacked L6. Complete 50S subunits containing L6 were observed in all growth phases regardless of the L6-depleted condition, implying that the ΔL6 mutant escaped death because of a leaky expression of L6 from the complementing plasmid. We conclude that L6 is essential for the assembly of functional 50S subunits at the late stage. We thus established conditions for the isolation of L6-depleted 50S subunits, which are essential to study the role of L6 in translation. - Highlights: • We constructed an in vivo functional assay system for Escherichia coli ribosomal protein L6. • Growth of an E. coli ΔL6 mutant was biphasic when L6 levels were depleted. • The ΔL6 mutant accumulated 50S ribosomal subunit precursors that sedimented at 45S. • L6 is a key player in the late stage of E. coli 50S subunit assembly.

  15. Involvement of ribosomal protein L6 in assembly of functional 50S ribosomal subunit in Escherichia coli cells

    Energy Technology Data Exchange (ETDEWEB)

    Shigeno, Yuta [Division of Applied Biology, Faculty of Textile Science and Technology, Shinshu University, Ueda 386-8567 (Japan); Uchiumi, Toshio [Department of Biology, Faculty of Science, Niigata University, Niigata 950-2181 (Japan); Nomura, Takaomi, E-mail: nomurat@shinshu-u.ac.jp [Division of Applied Biology, Faculty of Textile Science and Technology, Shinshu University, Ueda 386-8567 (Japan)

    2016-04-22

    Ribosomal protein L6, an essential component of the large (50S) subunit, primarily binds to helix 97 of 23S rRNA and locates near the sarcin/ricin loop of helix 95 that directly interacts with GTPase translation factors. Although L6 is believed to play important roles in factor-dependent ribosomal function, crucial biochemical evidence for this hypothesis has not been obtained. We constructed and characterized an Escherichia coli mutant bearing a chromosomal L6 gene (rplF) disruption and carrying a plasmid with an arabinose-inducible L6 gene. Although this ΔL6 mutant grew more slowly than its wild-type parent, it proliferated in the presence of arabinose. Interestingly, cell growth in the absence of arabinose was biphasic. Early growth lasted only a few generations (LI-phase) and was followed by a suspension of growth for several hours (S-phase). This suspension was followed by a second growth phase (LII-phase). Cells harvested at both LI- and S-phases contained ribosomes with reduced factor-dependent GTPase activity and accumulated 50S subunit precursors (45S particles). The 45S particles completely lacked L6. Complete 50S subunits containing L6 were observed in all growth phases regardless of the L6-depleted condition, implying that the ΔL6 mutant escaped death because of a leaky expression of L6 from the complementing plasmid. We conclude that L6 is essential for the assembly of functional 50S subunits at the late stage. We thus established conditions for the isolation of L6-depleted 50S subunits, which are essential to study the role of L6 in translation. - Highlights: • We constructed an in vivo functional assay system for Escherichia coli ribosomal protein L6. • Growth of an E. coli ΔL6 mutant was biphasic when L6 levels were depleted. • The ΔL6 mutant accumulated 50S ribosomal subunit precursors that sedimented at 45S. • L6 is a key player in the late stage of E. coli 50S subunit assembly.

  16. gamma. radiation effect on the functional properties of the cotton ribosomes

    Energy Technology Data Exchange (ETDEWEB)

    Ibragimov, A P; Safarov, Sh

    1973-01-01

    A study is made of the action of radiation on the functional properties of ribosomes in irradiated organisms and on isolated ribosomes exposed to different doses. With increase in dose there occurs a reduction in the incorporation of labelled amino acids by the ribosomes released from irradiated sprouts and also during irradiation of isolated ribosomes. The study covered the functional activity of ribosomes irradiated at different doses with the use of synthetic poly-U and poly-A matrices synthesizing polyphenylalanine and polylysine, depending on the irradiation dose. The inhibition of the activity of the protein synthesis system at high doses is due to structural and functional changes in ribosomes and also to disturbance in the biosynthesis and functions of the messenger RNA.

  17. Computational resources for ribosome profiling: from database to Web server and software.

    Science.gov (United States)

    Wang, Hongwei; Wang, Yan; Xie, Zhi

    2017-08-14

    Ribosome profiling is emerging as a powerful technique that enables genome-wide investigation of in vivo translation at sub-codon resolution. The increasing application of ribosome profiling in recent years has achieved remarkable progress toward understanding the composition, regulation and mechanism of translation. This benefits from not only the awesome power of ribosome profiling but also an extensive range of computational resources available for ribosome profiling. At present, however, a comprehensive review on these resources is still lacking. Here, we survey the recent computational advances guided by ribosome profiling, with a focus on databases, Web servers and software tools for storing, visualizing and analyzing ribosome profiling data. This review is intended to provide experimental and computational biologists with a reference to make appropriate choices among existing resources for the question at hand. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  18. Senescent changes in the ribosomes of animal cells in vivo and in vitro

    Science.gov (United States)

    Miquel, J.; Johnson, J. E., Jr.

    1979-01-01

    The paper examines RNA-ribosomal changes observed in protozoa and fixed postmitotic cells, as well as the characteristics of intermitotic cells. Attention is given to a discussion of the implications of the reported ribosomal changes as to the senescent deterioration of protein synthesis and physiological functions. A survey of the literature suggests that, while the data on ribosomal change in dividing cells both in vivo and in vitro are inconclusive, there is strong histological and biochemical evidence in favor of some degree of quantitative ribosomal loss in fixed postmitotic cells. Since these decreases in ribosomes are demonstrated in differential cells from nematodes, insects and mammals, they may represent a universal manifestation of cytoplasmic senescence in certain types of fixed postmitotic animal cells. The observed variability in ribosomal loss for cells belonging to the same type suggests that this involution phenomenon is rather related to the wear and tear suffered by a particular cell.

  19. Control of ribosome traffic by position-dependent choice of synonymous codons

    DEFF Research Database (Denmark)

    Mitarai, Namiko; Pedersen, Steen

    2013-01-01

    Messenger RNA (mRNA) encodes a sequence of amino acids by using codons. For most amino acids, there are multiple synonymous codons that can encode the amino acid. The translation speed can vary from one codon to another, thus there is room for changing the ribosome speed while keeping the amino...... acid sequence and hence the resulting protein. Recently, it has been noticed that the choice of the synonymous codon, via the resulting distribution of slow- and fast-translated codons, affects not only on the average speed of one ribosome translating the mRNA but also might have an effect on nearby...... ribosomes by affecting the appearance of 'traffic jams' where multiple ribosomes collide and form queues. To test this 'context effect' further, we here investigate the effect of the sequence of synonymous codons on the ribosome traffic by using a ribosome traffic model with codon-dependent rates, estimated...

  20. Genome-wide polysomal analysis of a yeast strain with mutated ribosomal protein S9

    Directory of Open Access Journals (Sweden)

    Arava Yoav

    2007-08-01

    Full Text Available Abstract Background The yeast ribosomal protein S9 (S9 is located at the entrance tunnel of the mRNA into the ribosome. It is known to play a role in accurate decoding and its bacterial homolog (S4 has recently been shown to be involved in opening RNA duplexes. Here we examined the effects of changing the C terminus of S9, which is rich in acidic amino acids and extends out of the ribosome surface. Results We performed a genome-wide analysis to reveal effects at the transcription and translation levels of all yeast genes. While negligible relative changes were observed in steady-state mRNA levels, a significant number of mRNAs appeared to have altered ribosomal density. Notably, 40% of the genes having reliable signals changed their ribosomal association by more than one ribosome. Yet, no general correlations with physical or functional features of the mRNA were observed. Ribosome Density Mapping (RDM along four of the mRNAs with increased association revealed an increase in ribosomal density towards the end of the coding region for at least two of them. Read-through analysis did not reveal any increase in read-through of a premature stop codon by the mutant strain. Conclusion The ribosomal protein rpS9 appears to be involved in the translation of many mRNAs, since altering its C terminus led to a significant change in ribosomal association of many mRNAs. We did not find strong correlations between these changes and several physical features of the mRNA, yet future studies with advanced tools may allow such correlations to be determined. Importantly, our results indicate an accumulation of ribosomes towards the end of the coding regions of some mRNAs. This suggests an involvement of S9 in ribosomal dissociation during translation termination.

  1. Human nucleolus organizers on nonhomologous chromosomes can share the same ribosomal gene variants.

    Science.gov (United States)

    Krystal, M; D'Eustachio, P; Ruddle, F H; Arnheim, N

    1981-01-01

    The distributions of three human ribosomal gene polymorphisms among individual chromosomes containing nucleolus organizers were analyzed by using mouse--human hybrid cells. Different nucleolus organizers can contain the same variant, suggesting the occurrence of genetic exchanges among ribosomal gene clusters on nonhomologous chromosomes. Such exchanges appear to occur less frequently in mice. This difference is discussed in terms of the nucleolar organization and chromosomal location of ribosomal gene clusters in humans and mice. Images PMID:6272316

  2. Including an Exam P/1 Prep Course in a Growing Actuarial Science Program

    Science.gov (United States)

    Wakefield, Thomas P.

    2014-01-01

    The purpose of this article is to describe the actuarial science program at our university and the development of a course to enhance students' problem solving skills while preparing them for Exam P/1 of the Society of Actuaries (SOA) and the Casualty Actuary Society (CAS). The Exam P/1 prep course, formally titled Mathematical Foundations of…

  3. Complete Genome Sequence of Methylobacterium populi P-1M, Isolated from Pink-Pigmented Household Biofilm

    OpenAIRE

    Morohoshi, Tomohiro; Ikeda, Tsukasa

    2016-01-01

    Methylobacterium populi P-1M is isolated from the pink-pigmented household biofilm. Here, we present the complete genome sequence of P-1M, consisting of one chromosome of 5,705,640?bp and five plasmids of 64,864?bp, 59,879?bp, 42,569?bp, 41,417?bp, and 29,506?bp.

  4. The primary structures of ribosomal proteins S14 and S16 from the archaebacterium Halobacterium marismortui. Comparison with eubacterial and eukaryotic ribosomal proteins.

    Science.gov (United States)

    Kimura, J; Kimura, M

    1987-09-05

    The amino acid sequences of two ribosomal proteins, S14 and S16, from the archaebacterium Halobacterium marismortui have been determined. Sequence data were obtained by the manual and solid-phase sequencing of peptides derived from enzymatic digestions with trypsin, chymotrypsin, pepsin, and Staphylococcus aureus protease as well as by chemical cleavage with cyanogen bromide. Proteins S14 and S16 contain 109 and 126 amino acid residues and have Mr values of 11,964 and 13,515, respectively. Comparison of the sequences with those of ribosomal proteins from other organisms demonstrates that S14 has a significant homology with the rat liver ribosomal protein S11 (36% identity) as well as with the Escherichia coli ribosomal protein S17 (37%), and that S16 is related to the yeast ribosomal protein YS22 (40%) and proteins S8 from E. coli (28%) and Bacillus stearothermophilus (30%). A comparison of the amino acid residues in the homologous regions of halophilic and nonhalophilic ribosomal proteins reveals that halophilic proteins have more glutamic acids, asparatic acids, prolines, and alanines, and less lysines, arginines, and isoleucines than their nonhalophilic counterparts. These amino acid substitutions probably contribute to the structural stability of halophilic ribosomal proteins.

  5. 5S ribosomal RNA database Y2K.

    Science.gov (United States)

    Szymanski, M; Barciszewska, M Z; Barciszewski, J; Erdmann, V A

    2000-01-01

    This paper presents the updated version (Y2K) of the database of ribosomal 5S ribonucleic acids (5S rRNA) and their genes (5S rDNA), http://rose.man/poznan.pl/5SData/index.html. This edition of the database contains 1985primary structures of 5S rRNA and 5S rDNA. They include 60 archaebacterial, 470 eubacterial, 63 plastid, nine mitochondrial and 1383 eukaryotic sequences. The nucleotide sequences of the 5S rRNAs or 5S rDNAs are divided according to the taxonomic position of the source organisms.

  6. mRNA decapping enzyme from ribosomes of Saccharomyces cerevisiae

    International Nuclear Information System (INIS)

    Stevens, A.

    1980-01-01

    By use of [ 3 H]methyl-5'-capped [ 14 C]mRNA from yeast as a substrate, a decapping enzyme activity has been detected in enzyme fractions derived from a high salt wash of ribosomes of Saccharomyces cerevisiae. The product of the decapping reaction is [ 3 H]m 7 GDP. That the enzyme is not a non-specific pyrophosphatase is suggested by the finding that the diphosphate product, m 7 GpppA(G), and UDP-glucose are not hydrolyzed

  7. Potential roles for ubiquitin and the proteasome during ribosome biogenesis

    Czech Academy of Sciences Publication Activity Database

    Stavreva, D. A.; Kawasaki, M.; Dundr, M.; Koberna, Karel; Müller, W. G.; Tsujimura-Takahashi, T.; Komatsu, W.; Hayano, T.; Isobe, T.; Raška, Ivan; Misteli, T.; Takahashi, N.; McNally, J. G.

    2006-01-01

    Roč. 26, č. 13 (2006), s. 5131-5145 ISSN 0270-7306 R&D Projects: GA MŠk(CZ) LC535; GA ČR(CZ) GA304/05/0374; GA ČR(CZ) GA304/04/0692 Grant - others:NIH(US) Intramural Research Program; Ministry of Education(JP) Pioneer Research grant Institutional research plan: CEZ:AV0Z50110509 Keywords : the role of the ubikvitin * proteasome system in ribosome biogenesis Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 6.773, year: 2006

  8. γ-irradiated ribosomes from Micrococcus radiodurans in a cell-free protein synthesizing system

    International Nuclear Information System (INIS)

    Suessmuth, R.; Widmann, A.

    1979-01-01

    γ-irradiation inactivation of isolated ribosomes of Micrococcus radiodurans was studied by examining poly U directed synthesis of polyphenylalanine. Ribosomes of M. radiodurans did not show significant γ-radiation sensitivity up to a dose of approx. 11.6 k Gy. Cells of M. radiodurans take up more magnesium than E. coli cells under the same conditions. The magnesium content of ribosomes of M. radiodurans was 18% higher than that of E.coli ribosomes. A possible relation between Mg 2+ -content and γ-resistance is discussed. (orig.) [de

  9. Ribosome dynamics and tRNA movement by time-resolved electron cryomicroscopy.

    Science.gov (United States)

    Fischer, Niels; Konevega, Andrey L; Wintermeyer, Wolfgang; Rodnina, Marina V; Stark, Holger

    2010-07-15

    The translocation step of protein synthesis entails large-scale rearrangements of the ribosome-transfer RNA (tRNA) complex. Here we have followed tRNA movement through the ribosome during translocation by time-resolved single-particle electron cryomicroscopy (cryo-EM). Unbiased computational sorting of cryo-EM images yielded 50 distinct three-dimensional reconstructions, showing the tRNAs in classical, hybrid and various novel intermediate states that provide trajectories and kinetic information about tRNA movement through the ribosome. The structures indicate how tRNA movement is coupled with global and local conformational changes of the ribosome, in particular of the head and body of the small ribosomal subunit, and show that dynamic interactions between tRNAs and ribosomal residues confine the path of the tRNAs through the ribosome. The temperature dependence of ribosome dynamics reveals a surprisingly flat energy landscape of conformational variations at physiological temperature. The ribosome functions as a Brownian machine that couples spontaneous conformational changes driven by thermal energy to directed movement.

  10. Ribosomes: Ribozymes that Survived Evolution Pressures but Is Paralyzed by Tiny Antibiotics

    Science.gov (United States)

    Yonath, Ada

    An impressive number of crystal structures of ribosomes, the universal cellular machines that translate the genetic code into proteins, emerged during the last decade. The determination of ribosome high resolution structure, which was widely considered formidable, led to novel insights into the ribosomal function, namely, fidelity, catalytic mechanism, and polymerize activities. They also led to suggestions concerning its origin and shed light on the action, selectivity and synergism of ribosomal antibiotics; illuminated mechanisms acquiring bacterial resistance and provided structural information for drug improvement and design. These studies required the pioneering and implementation of advanced technologies, which directly influenced the remarkable increase of the number of structures deposited in the Protein Data Bank.

  11. Expression of ribosomal genes in pea cotyledons at the initial stages of germination

    International Nuclear Information System (INIS)

    Gumilevskaya, N.A.; Chumikhina, L.V.; Akhmatova, A.T.; Kretovich, V.L.

    1986-01-01

    The time of appearance of newly synthesized rRNAs and ribosomal proteins (r-proteins) in the ribosomes of pea cotyledons (Pisum sativum L.) during germination was investigated. The ribosomal fraction was isolated and analyzed according to the method of germination of the embryo in the presence of labeled precursors or after pulse labeling of the embryos at different stages of germination. For the identification of newly synthesized rRNAs in the ribosomes we estimated the relative stability of labeled RNAs to the action of RNase, the sedimentation rate, the ability to be methylated in vivo in the presence of [ 14 C]CH 3 -methionine, and the localization in the subunits of dissociated ribosomes. The presence of newly synthesized r-proteins in the ribosomes was judged on the basis of the electrophoretic similarity in SDS-disc electrophoresis of labeled polypeptides of purified ribosome preparations and of genuine r-proteins, as well as according to the localization of labeled proteins in the subunits of the dissociated ribosomes. It was shown that the expression of the ribosomal genes in highly specialized cells of pea cotyledons that have completed their growth occurs at very early stages of germination

  12. Interaction between the P1 protein of Mycoplasma pneumoniae and receptors on HEp-2 cells

    DEFF Research Database (Denmark)

    Drasbek, Mette; Christiansen, Gunna; Drasbek, Kim Ryun

    2007-01-01

    The human pathogen Mycoplasma pneumoniae can cause atypical pneumonia through adherence to epithelial cells in the respiratory tract. The major immunogenic protein, P1, participates in the attachment of the bacteria to the host cells. To investigate the adhesion properties of P1, a recombinant...... protein (rP1-II) covering amino acids 1107-1518 of the P1 protein was produced. This protein inhibited the adhesion of M. pneumoniae to human HEp-2 cells, as visualized in a competitive-binding assay using immunofluorescence microscopy. Previous studies have shown that mAbs that recognize two epitopes...... overlapping synthetic peptides covering the whole of rP1-II were evaluated in the competitive-binding assay using immunofluorescence microscopy. A reduction in the number of M. pneumoniae microcolonies was seen, which was confirmed for five peptides using a POLARstar OPTIMA reader to measure fluorescence...

  13. Pathophysiological Consequences of a Break in S1P1-Dependent Homeostasis of Vascular Permeability Revealed by S1P1 Competitive Antagonism.

    Science.gov (United States)

    Bigaud, Marc; Dincer, Zuhal; Bollbuck, Birgit; Dawson, Janet; Beckmann, Nicolau; Beerli, Christian; Fishli-Cavelti, Gina; Nahler, Michaela; Angst, Daniela; Janser, Philipp; Otto, Heike; Rosner, Elisabeth; Hersperger, Rene; Bruns, Christian; Quancard, Jean

    2016-01-01

    Homeostasis of vascular barriers depends upon sphingosine 1-phosphate (S1P) signaling via the S1P1 receptor. Accordingly, S1P1 competitive antagonism is known to reduce vascular barrier integrity with still unclear pathophysiological consequences. This was explored in the present study using NIBR-0213, a potent and selective S1P1 competitive antagonist. NIBR-0213 was tolerated at the efficacious oral dose of 30 mg/kg BID in the rat adjuvant-induced arthritis (AiA) model, with no sign of labored breathing. However, it induced dose-dependent acute vascular pulmonary leakage and pleural effusion that fully resolved within 3-4 days, as evidenced by MRI monitoring. At the supra-maximal oral dose of 300 mg/kg QD, NIBR-0213 impaired lung function (with increased breathing rate and reduced tidal volume) within the first 24 hrs. Two weeks of NIBR-0213 oral dosing at 30, 100 and 300 mg/kg QD induced moderate pulmonary changes, characterized by alveolar wall thickening, macrophage accumulation, fibrosis, micro-hemorrhage, edema and necrosis. In addition to this picture of chronic inflammation, perivascular edema and myofiber degeneration observed in the heart were also indicative of vascular leakage and its consequences. Overall, these observations suggest that, in the rat, the lung is the main target organ for the S1P1 competitive antagonism-induced acute vascular leakage, which appears first as transient and asymptomatic but could lead, upon chronic dosing, to lung remodeling with functional impairments. Hence, this not only raises the question of organ specificity in the homeostasis of vascular barriers, but also provides insight into the pre-clinical evaluation of a potential safety window for S1P1 competitive antagonists as drug candidates.

  14. Antibodies to ribosomal P proteins of Trypanosoma cruzi in Chagas disease possess functional autoreactivity with heart tissue and differ from anti-P autoantibodies in lupus.

    Science.gov (United States)

    Kaplan, D; Ferrari, I; Bergami, P L; Mahler, E; Levitus, G; Chiale, P; Hoebeke, J; Van Regenmortel, M H; Levin, M J

    1997-09-16

    Anti-P antibodies present in sera from patients with chronic Chagas heart disease (cChHD) recognize peptide R13, EEEDDDMGFGLFD, which encompasses the C-terminal region of the Trypanosoma cruzi ribosomal P1 and P2 proteins. This peptide shares homology with the C-terminal region (peptide H13 EESDDDMGFGLFD) of the human ribosomal P proteins, which is in turn the target of anti-P autoantibodies in systemic lupus erythematosus (SLE), and with the acidic epitope, AESDE, of the second extracellular loop of the beta1-adrenergic receptor. Anti-P antibodies from chagasic patients showed a marked preference for recombinant parasite ribosomal P proteins and peptides, whereas anti-P autoantibodies from SLE reacted with human and parasite ribosomal P proteins and peptides to the same extent. A semi-quantitative estimation of the binding of cChHD anti-P antibodies to R13 and H13 using biosensor technology indicated that the average affinity constant was about 5 times higher for R13 than for H13. Competitive enzyme immunoassays demonstrated that cChHD anti-P antibodies bind to the acidic portions of peptide H13, as well as to peptide H26R, encompassing the second extracellular loop of the beta1 adrenoreceptor. Anti-P antibodies isolated from cChHD patients exert a positive chronotropic effect in vitro on cardiomyocytes from neonatal rats, which resembles closely that of anti-beta1 receptor antibodies isolated from the same patient. In contrast, SLE anti-P autoantibodies have no functional effect. Our results suggest that the adrenergic-stimulating activity of anti-P antibodies may be implicated in the induction of functional myocardial impairments observed in cChHD.

  15. Combined Effect of the Cfr Methyltransferase and Ribosomal Protein L3 Mutations on Resistance to Ribosome-Targeting Antibiotics.

    Science.gov (United States)

    Pakula, Kevin K; Hansen, Lykke H; Vester, Birte

    2017-09-01

    Several groups of antibiotics inhibit bacterial growth by binding to bacterial ribosomes. Mutations in ribosomal protein L3 have been associated with resistance to linezolid and tiamulin, which both bind at the peptidyl transferase center in the ribosome. Resistance to these and other antibiotics also occurs through methylation of 23S rRNA at position A2503 by the methyltransferase Cfr. The mutations in L3 and the cfr gene have been found together in clinical isolates, raising the question of whether they have a combined effect on antibiotic resistance or growth. We transformed a plasmid-borne cfr gene into a uL3-depleted Escherichia coli strain containing either wild-type L3 or L3 with one of seven mutations, G147R, Q148F, N149S, N149D, N149R, Q150L, or T151P, expressed from plasmid-carried rplC genes. The L3 mutations are well tolerated, with small to moderate growth rate decreases. The presence of Cfr has a very minor influence on the growth rate. The resistance of the transformants to linezolid, tiamulin, florfenicol, and Synercid (a combination of quinupristin and dalfopristin [Q-D]) was measured by MIC assays. The resistance from Cfr was, in all cases, stronger than the effects of the L3 mutations, but various effects were obtained with the combinations of Cfr and L3 mutations ranging from a synergistic to an antagonistic effect. Linezolid and tiamulin susceptibility varied greatly among the L3 mutations, while no significant effects on florfenicol and Q-D susceptibility were seen. This study underscores the complex interplay between various resistance mechanisms and cross-resistance, even from antibiotics with overlapping binding sites. Copyright © 2017 American Society for Microbiology.

  16. Ribosome-Inactivating Proteins from Plants: A Historical Overview

    Directory of Open Access Journals (Sweden)

    Andrea Bolognesi

    2016-11-01

    Full Text Available This review provides a historical overview of the research on plant ribosome-inactivating proteins (RIPs, starting from the first studies at the end of eighteenth century involving the purification of abrin and ricin, as well as the immunological experiments of Paul Erlich. Interest in these plant toxins was revived in 1970 by the observation of their anticancer activity, which has given rise to a large amount of research contributing to the development of various scientific fields. Biochemistry analyses succeeded in identifying the enzymatic activity of RIPs and allowed for a better understanding of the ribosomal machinery. Studies on RIP/cell interactions were able to detail the endocytosis and intracellular routing of ricin, thus increasing our knowledge of how cells handle exogenous proteins. The identification of new RIPs and the finding that most RIPs are single-chain polypeptides, together with their genetic sequencing, has aided in the development of new phylogenetic theories. Overall, the biological properties of these proteins, including their abortifacient, anticancer, antiviral and neurotoxic activities, suggest that RIPs could be utilized in agriculture and in many biomedical fields, including clinical drug development.

  17. Analysis of ribosomal protein gene structures: implications for intron evolution.

    Directory of Open Access Journals (Sweden)

    2006-03-01

    Full Text Available Many spliceosomal introns exist in the eukaryotic nuclear genome. Despite much research, the evolution of spliceosomal introns remains poorly understood. In this paper, we tried to gain insights into intron evolution from a novel perspective by comparing the gene structures of cytoplasmic ribosomal proteins (CRPs and mitochondrial ribosomal proteins (MRPs, which are held to be of archaeal and bacterial origin, respectively. We analyzed 25 homologous pairs of CRP and MRP genes that together had a total of 527 intron positions. We found that all 12 of the intron positions shared by CRP and MRP genes resulted from parallel intron gains and none could be considered to be "conserved," i.e., descendants of the same ancestor. This was supported further by the high frequency of proto-splice sites at these shared positions; proto-splice sites are proposed to be sites for intron insertion. Although we could not definitively disprove that spliceosomal introns were already present in the last universal common ancestor, our results lend more support to the idea that introns were gained late. At least, our results show that MRP genes were intronless at the time of endosymbiosis. The parallel intron gains between CRP and MRP genes accounted for 2.3% of total intron positions, which should provide a reliable estimate for future inferences of intron evolution.

  18. [Family of ribosomal proteins S1 contains unique conservative domain].

    Science.gov (United States)

    Deriusheva, E I; Machulin, A V; Selivanova, O M; Serdiuk, I N

    2010-01-01

    Different representatives of bacteria have different number of amino acid residues in the ribosomal proteins S1. This number varies from 111 (Spiroplasma kunkelii) to 863 a.a. (Treponema pallidum). Traditionally and for lack of this protein three-dimensional structure, its architecture is represented as repeating S1 domains. Number of these domains depends on the protein's length. Domain's quantity and its boundaries data are contained in the specialized databases, such as SMART, Pfam and PROSITE. However, for the same object these data may be very different. For search of domain's quantity and its boundaries, new approach, based on the analysis of dicted secondary structure (PsiPred), was used. This approach allowed us to reveal structural domains in amino acid sequences of S1 proteins and at that number varied from one to six. Alignment of S1 proteins, containing different domain's number, with the S1 RNAbinding domain of Escherichia coli PNPase elicited a fact that in family of ribosomal proteins SI one domain has maximal homology with S1 domain from PNPase. This conservative domain migrates along polypeptide chain and locates in proteins, containing different domain's number, according to specified pattern. In this domain as well in the S1 domain from PNPase, residues Phe-19, Phe-22, His-34, Asp-64 and Arg-68 are clustered on the surface and formed RNA binding site.

  19. Interaction of Pleuromutilin Derivatives with the Ribosomal Peptidyl Transferase Center

    Science.gov (United States)

    Long, Katherine S.; Hansen, Lykke H.; Jakobsen, Lene; Vester, Birte

    2006-01-01

    Tiamulin is a pleuromutilin antibiotic that is used in veterinary medicine. The recently published crystal structure of a tiamulin-50S ribosomal subunit complex provides detailed information about how this drug targets the peptidyl transferase center of the ribosome. To promote rational design of pleuromutilin-based drugs, the binding of the antibiotic pleuromutilin and three semisynthetic derivatives with different side chain extensions has been investigated using chemical footprinting. The nucleotides A2058, A2059, G2505, and U2506 are affected in all of the footprints, suggesting that the drugs are similarly anchored in the binding pocket by the common tricyclic mutilin core. However, varying effects are observed at U2584 and U2585, indicating that the side chain extensions adopt distinct conformations within the cavity and thereby affect the rRNA conformation differently. An Escherichia coli L3 mutant strain is resistant to tiamulin and pleuromutilin, but not valnemulin, implying that valnemulin is better able to withstand an altered rRNA binding surface around the mutilin core. This is likely due to additional interactions made between the valnemulin side chain extension and the rRNA binding site. The data suggest that pleuromutilin drugs with enhanced antimicrobial activity may be obtained by maximizing the number of interactions between the side chain moiety and the peptidyl transferase cavity. PMID:16569865

  20. Genetic diversity of Entamoeba: Novel ribosomal lineages from cockroaches.

    Directory of Open Access Journals (Sweden)

    Tetsuro Kawano

    Full Text Available Our current taxonomic perspective on Entamoeba is largely based on small-subunit ribosomal RNA genes (SSU rDNA from Entamoeba species identified in vertebrate hosts with minor exceptions such as E. moshkovskii from sewage water and E. marina from marine sediment. Other Entamoeba species have also been morphologically identified and described from non-vertebrate species such as insects; however, their genetic diversity remains unknown. In order to further disclose the diversity of the genus, we investigated Entamoeba spp. in the intestines of three cockroach species: Periplaneta americana, Blaptica dubia, and Gromphadorhina oblongonota. We obtained 134 Entamoeba SSU rDNA sequences from 186 cockroaches by direct nested PCR using the DNA extracts of intestines from cockroaches, followed by scrutinized BLASTn screening and phylogenetic analyses. All the sequences identified in this study were distinct from those reported from known Entamoeba species, and considered as novel Entamoeba ribosomal lineages. Furthermore, they were positioned at the base of the clade of known Entamoeba species and displayed remarkable degree of genetic diversity comprising nine major groups in the three cockroach species. This is the first report of the diversity of SSU rDNA sequences from Entamoeba in non-vertebrate host species, and should help to understand the genetic diversity of the genus Entamoeba.

  1. Isolation and Characterization of Pepper Genes Interacting with the CMV-P1 Helicase Domain.

    Directory of Open Access Journals (Sweden)

    Yoomi Choi

    Full Text Available Cucumber mosaic virus (CMV is a destructive pathogen affecting Capsicum annuum (pepper production. The pepper Cmr1 gene confers resistance to most CMV strains, but is overcome by CMV-P1 in a process dependent on the CMV-P1 RNA1 helicase domain (P1 helicase. Here, to identify host factors involved in CMV-P1 infection in pepper, a yeast two-hybrid library derived from a C. annuum 'Bukang' cDNA library was screened, producing a total of 76 potential clones interacting with the P1 helicase. Beta-galactosidase filter lift assay, PCR screening, and sequencing analysis narrowed the candidates to 10 genes putatively involved in virus infection. The candidate host genes were silenced in Nicotiana benthamiana plants that were then inoculated with CMV-P1 tagged with the green fluorescent protein (GFP. Plants silenced for seven of the genes showed development comparable to N. benthamiana wild type, whereas plants silenced for the other three genes showed developmental defects including stunting and severe distortion. Silencing formate dehydrogenase and calreticulin-3 precursor led to reduced virus accumulation. Formate dehydrogenase-silenced plants showed local infection in inoculated leaves, but not in upper (systemic leaves. In the calreticulin-3 precursor-silenced plants, infection was not observed in either the inoculated or the upper leaves. Our results demonstrate that formate dehydrogenase and calreticulin-3 precursor are required for CMV-P1 infection.

  2. Wavelengths of the Ni-like 4d1S0 - 4p1P1 x-ray laser line

    International Nuclear Information System (INIS)

    Li, Y.; Nilsen, J.; Dunn, J.; Osterheld, A.L.; Ryabtsev, A.; Churilov, S.

    1998-01-01

    We measure the wavelengths of the Ni-like 3d 9 4d 1 S 0 - 3d 9 4p 1 P 1 x-ray laser line in several low-Z Ni-like ions ranging from Y (Z=39) to Cd (Z=48). These wavelengths are compared with optimized level calculations using a multiconfiguration Dirac-Fock code. With the help of these results, we identify this line to very high accuracy in nonlasing plasmas from As (Z=33) to Mo (Z=42). Accurate values of these wavelengths are essential for performing plasma imaging and interferometry experiments with multilayer optics that use the x-ray laser to backlight other plasmas. These results also provide important atomic data that are currently missing about the energy of the 4d 1 S 0 level in the NiI sequence. copyright 1998 The American Physical Society

  3. Alignment creation in atomic ensembles by elastic electron scattering; the case of 138Ba(...6s6p 1P1) atoms

    International Nuclear Information System (INIS)

    Trajmar, S.; Kanik, I.; LeClair, L.R.; Khakoo, M.A.; Bray, I.; Fursa, D.; Csanak, G.

    1998-01-01

    We describe some of our results from a joint experimental and theoretical program concerning elastic electron scattering by 138 Ba(...6s6p 1 P 1 ) atoms. From the experimental results, we derived various scattering parameters and magnetic sublevel specific differential elastic scattering cross sections at impact energy (E 0 ) of 20.0 eV and at scattering angles (θ) of 10deg, 15deg, and 20deg. The same parameters and cross sections were calculated by the convergent close coupling (CCC) approximation and compared to the experimental results. An excellent agreement, found for the two sets of data, gave us confidence in the CCC method and allowed us to extend the angular and energy ranges for the purpose of generating integral elastic scattering cross sections needed for the deduction of the alignment creation cross sections. (J.P.N.)

  4. Solutions of system of P1 equations without use of auxiliary differential equations coupled

    International Nuclear Information System (INIS)

    Martinez, Aquilino Senra; Silva, Fernando Carvalho da; Cardoso, Carlos Eduardo Santos

    2000-01-01

    The system of P1 equations is composed by two equations coupled itself one for the neutron flux and other for the current. Usually this system is solved by definitions of two integrals parameters, which are named slowing down densities of the flux and the current. Hence, the system P1 can be change from integral to only two differential equations. However, there are two new differentials equations that may be solved with the initial system. The present work analyzes this procedure and studies a method, which solve the P1 equations directly, without definitions of slowing down densities. (author)

  5. Phylogenetic and functional analysis of the bacteriophage P1 single-stranded DNA-binding protein

    DEFF Research Database (Denmark)

    Bendtsen, Jannick Dyrløv; Nilsson, A.S.; Lehnherr, H.

    2002-01-01

    and does not represent a recent acquirement of the phage. The P1 and E. coli SSB proteins are fully functionally interchangeable. SSB-P1 is nonessential for phage growth in an exponentially growing E. coli host, and it is sufficient to promote bacterial growth in the absence of the E. coli SSB protein....... Expression studies showed that the P1 ssb gene is transcribed only, in an rpoS-independent fashion, during stationary-phase growth in E. coli. Mixed infection experiments demonstrated that a wild-type phage has a selective advantage over an ssb-null mutant when exposed to a bacterial host in the stationary...

  6. The N-terminal sequence of ribosomal protein L10 from the archaebacterium Halobacterium marismortui and its relationship to eubacterial protein L6 and other ribosomal proteins.

    Science.gov (United States)

    Dijk, J; van den Broek, R; Nasiulas, G; Beck, A; Reinhardt, R; Wittmann-Liebold, B

    1987-08-01

    The amino-terminal sequence of ribosomal protein L10 from Halobacterium marismortui has been determined up to residue 54, using both a liquid- and a gas-phase sequenator. The two sequences are in good agreement. The protein is clearly homologous to protein HcuL10 from the related strain Halobacterium cutirubrum. Furthermore, a weaker but distinct homology to ribosomal protein L6 from Escherichia coli and Bacillus stearothermophilus can be detected. In addition to 7 identical amino acids in the first 36 residues in all four sequences a number of conservative replacements occurs, of mainly hydrophobic amino acids. In this common region the pattern of conserved amino acids suggests the presence of a beta-alpha fold as it occurs in ribosomal proteins L12 and L30. Furthermore, several potential cases of homology to other ribosomal components of the three ur-kingdoms have been found.

  7. A Listeria monocytogenes RNA helicase essential for growth and ribosomal maturation at low temperatures uses its C terminus for appropriate interaction with the ribosome.

    Science.gov (United States)

    Netterling, Sakura; Vaitkevicius, Karolis; Nord, Stefan; Johansson, Jörgen

    2012-08-01

    Listeria monocytogenes, a Gram-positive food-borne human pathogen, is able to grow at temperatures close to 0°C and is thus of great concern for the food industry. In this work, we investigated the physiological role of one DExD-box RNA helicase in Listeria monocytogenes. The RNA helicase Lmo1722 was required for optimal growth at low temperatures, whereas it was dispensable at 37°C. A Δlmo1722 strain was less motile due to downregulation of the major subunit of the flagellum, FlaA, caused by decreased flaA expression. By ribosomal fractionation experiments, it was observed that Lmo1722 was mainly associated with the 50S subunit of the ribosome. Absence of Lmo1722 decreased the fraction of 50S ribosomal subunits and mature 70S ribosomes and affected the processing of the 23S precursor rRNA. The ribosomal profile could be restored to wild-type levels in a Δlmo1722 strain expressing Lmo1722. Interestingly, the C-terminal part of Lmo1722 was redundant for low-temperature growth, motility, 23S rRNA processing, and appropriate ribosomal maturation. However, Lmo1722 lacking the C terminus showed a reduced affinity for the 50S and 70S fractions, suggesting that the C terminus is important for proper guidance of Lmo1722 to the 50S subunit. Taken together, our results show that the Listeria RNA helicase Lmo1722 is essential for growth at low temperatures, motility, and rRNA processing and is important for ribosomal maturation, being associated mainly with the 50S subunit of the ribosome.

  8. Continuous wave protocol for simultaneous polarization and optical detection of P1-center electron spin resonance

    Science.gov (United States)

    Kamp, E. J.; Carvajal, B.; Samarth, N.

    2018-01-01

    The ready optical detection and manipulation of bright nitrogen vacancy center spins in diamond plays a key role in contemporary quantum information science and quantum metrology. Other optically dark defects such as substitutional nitrogen atoms (`P1 centers') could also become potentially useful in this context if they could be as easily optically detected and manipulated. We develop a relatively straightforward continuous wave protocol that takes advantage of the dipolar coupling between nitrogen vacancy and P1 centers in type 1b diamond to detect and polarize the dark P1 spins. By combining mutual spin flip transitions with radio frequency driving, we demonstrate the simultaneous optical polarization and detection of the electron spin resonance of the P1 center. This technique should be applicable to detecting and manipulating a broad range of dark spin populations that couple to the nitrogen vacancy center via dipolar fields, allowing for quantum metrology using these spin populations.

  9. Suppression of Zeeman relaxation in cold collisions of 2P1/2 atoms

    International Nuclear Information System (INIS)

    Tscherbul, T. V.; Dalgarno, A.; Buchachenko, A. A.; Lu, M.-J.; Weinstein, J. D.

    2009-01-01

    We present a combined experimental and theoretical study of angular momentum depolarization in cold collisions of 2 P atoms in the presence of an external magnetic field. We show that collision-induced Zeeman relaxation of Ga( 2 P 1/2 ) and In( 2 P 1/2 ) atoms in cold 4 He gas is dramatically suppressed compared to atoms in 2 P 3/2 states. Using rigorous quantum-scattering calculations based on ab initio interaction potentials, we demonstrate that Zeeman transitions in collisions of atoms in 2 P 1/2 electronic states occur via couplings to the 2 P 3/2 state induced by the anisotropy of the interaction potential. Our results suggest the feasibility of sympathetic cooling and magnetic trapping of 2 P 1/2 -state atoms, such as halogens, thereby opening up exciting areas of research in precision spectroscopy and cold-controlled chemistry.

  10. The Ribosomal RNA is a Useful Marker to Visualize Rhizobia Interacting with Legume Plants

    Science.gov (United States)

    Rinaudi, Luciana; Isola, Maria C.; Giordano, Walter

    2004-01-01

    Symbiosis between rhizobia and leguminous plants leads to the formation of nitrogen-fixing root nodules. In the present article, we recommend the use of the ribosomal RNA (rRNA) isolated from legume nodules in an experimental class with the purpose of introducing students to the structure of eukaryotic and prokaryotic ribosomes and of…

  11. Control of ribosome traffic by position-dependent choice of synonymous codons

    International Nuclear Information System (INIS)

    Mitarai, Namiko; Pedersen, Steen

    2013-01-01

    Messenger RNA (mRNA) encodes a sequence of amino acids by using codons. For most amino acids, there are multiple synonymous codons that can encode the amino acid. The translation speed can vary from one codon to another, thus there is room for changing the ribosome speed while keeping the amino acid sequence and hence the resulting protein. Recently, it has been noticed that the choice of the synonymous codon, via the resulting distribution of slow- and fast-translated codons, affects not only on the average speed of one ribosome translating the mRNA but also might have an effect on nearby ribosomes by affecting the appearance of ‘traffic jams’ where multiple ribosomes collide and form queues. To test this ‘context effect’ further, we here investigate the effect of the sequence of synonymous codons on the ribosome traffic by using a ribosome traffic model with codon-dependent rates, estimated from experiments. We compare the ribosome traffic on wild-type (WT) sequences and sequences where the synonymous codons were swapped randomly. By simulating translation of 87 genes, we demonstrate that the WT sequences, especially those with a high bias in codon usage, tend to have the ability to reduce ribosome collisions, hence optimizing the cellular investment in the translation apparatus. The magnitude of such reduction of the translation time might have a significant impact on the cellular growth rate and thereby have importance for the survival of the species. (paper)

  12. Plastid ribosome pausing is induced by multiple features and is linked to protein complex assembly

    DEFF Research Database (Denmark)

    Gawroński, Piotr; Jensen, Poul Erik; Karpinski, Stanislaw

    2018-01-01

    Many mRNAs contain pause sites that briefly interrupt the progress of translation. Specific features that induce ribosome pausing have been described; however, their individual contributions to pause-site formation, and the overall biological significance of ribosome pausing, remain largely uncle...

  13. Complete Genome Sequence of Methylobacterium populi P-1M, Isolated from Pink-Pigmented Household Biofilm.

    Science.gov (United States)

    Morohoshi, Tomohiro; Ikeda, Tsukasa

    2016-06-16

    Methylobacterium populi P-1M is isolated from the pink-pigmented household biofilm. Here, we present the complete genome sequence of P-1M, consisting of one chromosome of 5,705,640 bp and five plasmids of 64,864 bp, 59,879 bp, 42,569 bp, 41,417 bp, and 29,506 bp. Copyright © 2016 Morohoshi and Ikeda.

  14. Truncation of a P1 leader proteinase facilitates potyvirus replication in a non-permissive host.

    Science.gov (United States)

    Shan, Hongying; Pasin, Fabio; Tzanetakis, Ioannis E; Simón-Mateo, Carmen; García, Juan Antonio; Rodamilans, Bernardo

    2017-11-08

    The Potyviridae family is a major group of plant viruses that includes c. 200 species, most of which have narrow host ranges. The potyvirid P1 leader proteinase self-cleaves from the remainder of the viral polyprotein and shows large sequence variability linked to host adaptation. P1 proteins can be classified as Type A or Type B on the basis, amongst other things, of their dependence or not on a host factor to develop their protease activity. In this work, we studied Type A proteases from the Potyviridae family, characterizing their host factor requirements. Our in vitro cleavage analyses of potyvirid P1 proteases showed that the N-terminal domain is relevant for host factor interaction and suggested that the C-terminal domain is also involved. In the absence of plant factors, the N-terminal end of Plum pox virus P1 antagonizes protease self-processing. We performed extended deletion mutagenesis analysis to define the N-terminal antagonistic domain of P1. In viral infections, removal of the P1 protease antagonistic domain led to a gain-of-function phenotype, strongly increasing local infection in a non-permissive host. Altogether, our results shed new insights into the adaptation and evolution of potyvirids. © 2017 BSPP AND JOHN WILEY & SONS LTD.

  15. Phosphorylation of ribosomal proteins induced by auxins in maize embryonic tissues

    International Nuclear Information System (INIS)

    Perez, L.; Aguilar, R.; Mendez, A.P.; de Jimenez, E.S.

    1990-01-01

    The effect of auxin on ribosomal protein phosphorylation of germinating maize (Zea mays) tissues was investigated. Two-dimensional gel electrophoresis and autoradiography of [ 32 P] ribosomal protein patterns for natural and synthetic auxin-treated tissues were performed. Both the rate of 32 P incorporation and the electrophoretic patterns were dependent on 32 P pulse length, suggesting that active protein phosphorylation-dephosphorylation occurred in small and large subunit proteins, in control as well as in auxin-treated tissues. The effect of ribosomal protein phosphorylation on in vitro translation was tested. Measurements of poly(U) translation rates as a function of ribosome concentration provided apparent K m values significantly different for auxin-treated and nontreated tissues. These findings suggest that auxin might exert some kind of translational control by regulating the phosphorylated status of ribosomal proteins

  16. rRNA:mRNA pairing alters the length and the symmetry of mRNA-protected fragments in ribosome profiling experiments

    OpenAIRE

    O?Connor, Patrick B. F.; Li, Gene-Wei; Weissman, Jonathan S.; Atkins, John F.; Baranov, Pavel V.

    2013-01-01

    Motivation: Ribosome profiling is a new technique that allows monitoring locations of translating ribosomes on mRNA at a whole transcriptome level. A recent ribosome profiling study demonstrated that internal Shine?Dalgarno (SD) sequences have a major global effect on translation rates in bacteria: ribosomes pause at SD sites in mRNA. Therefore, it is important to understand how SD sites effect mRNA movement through the ribosome and generation of ribosome footprints. Results: Here, we provide...

  17. Replication and meiotic transmission of yeast ribosomal RNA genes.

    Science.gov (United States)

    Brewer, B J; Zakian, V A; Fangman, W L

    1980-11-01

    The yeast Saccharomyces cerevisiae has approximately 120 genes for the ribosomal RNAs (rDNA) which are organized in tandem within chromosomal DNA. These multiple-copy genes are homogeneous in sequence but can undergo changes in copy number and topology. To determine if these changes reflect unusual features of rDNA metabolism, we have examined both the replication of rDNA in the mitotic cell cycle and the inheritance of rDNA during meiosis. The results indicate that rDNA behaves identically to chromosomal DNA: each rDNA unit is replicated once during the S phase of each cell cycle and each unit is conserved through meiosis. Therefore, the flexibility in copy number and topology of rDNA does not arise from the selective replication of units in each S phase nor by the selective inheritance of units in meiosis.

  18. Globular conformation of some ribosomal proteins in solution

    International Nuclear Information System (INIS)

    Serdyuk, I.N.; Spirin, A.S.

    1978-01-01

    The possibility that such RNA-binding proteins of the 30 S subparticle as S4, S7, S8 and S16 exist in the form of compact globules in solution has been explored experimentally. These proteins have been studied in D 2 O solution by neutron scattering to measure their radii of gyration. This type of radiation using D 2 O as a solvent provides the maximum 'contrast', that is the maximum difference between the scattering of the protein and the solvent. It allowed measurements to be made using protein at <= 1.5 mg/ml. The radii of gyration for the ribosomal proteins S4, S7, S8 and S16 were found to be relatively small corresponding to the radii of gyration of compact globular proteins of the same molecular weights. (Auth.)

  19. Heavy ion effects on yeast: Inhibition of ribosomal RNA synthesis

    International Nuclear Information System (INIS)

    Weber, K.J.; Schneider, E.; Kiefer, J.; Kraft, G.

    1990-01-01

    Diploid wild-type yeast cells were exposed to beams of heavy ions covering a wide range of linear energy transfer (LET) (43-13,700 keV/microns). Synthesis of ribosomal RNA (rRNA) was assessed as a functional measure of damage produced by particle radiation. An exponential decrease of relative rRNA synthesis with particle fluence was demonstrated in all cases. The inactivation cross sections derived were found to increase with LET over the entire range of LET studied. The corresponding values for relative biological effectiveness were slightly less than unity. Maximum cross sections measured were close to 1 micron 2, implying that some larger structure within the yeast nucleus (e.g., the nucleolus) might represent the target for an impairment of synthetic activity by very heavy ions rather than the genes coding for rRNA. Where tested, an oxygen effect for rRNA synthesis could not be demonstrated

  20. Expanding the Entamoeba Universe: New Hosts Yield Novel Ribosomal Lineages.

    Science.gov (United States)

    Jacob, Alison S; Busby, Eloise J; Levy, Abigail D; Komm, Natasha; Clark, C Graham

    2016-01-01

    Removing the requirement for cell culture has led to a substantial increase in the number of lineages of Entamoeba recognized as distinct. Surveying the range of potential host species for this parasite genus has barely been started and it is clear that additional sampling of the same host in different locations often identifies additional diversity. In this study, using small subunit ribosomal RNA gene sequencing, we identify four new lineages of Entamoeba, including the first report of Entamoeba from an elephant, and extend the host range of some previously described lineages. In addition, examination of microbiome data from a number of host animals suggests that substantial Entamoeba diversity remains to be uncovered. © 2015 The Author(s) Journal of Eukaryotic Microbiology © 2015 International Society of Protistologists.

  1. Cross-species functionality of pararetroviral elements driving ribosome shunting.

    Directory of Open Access Journals (Sweden)

    Mikhail M Pooggin

    Full Text Available BACKGROUND: Cauliflower mosaic virus (CaMV and Rice tungro bacilliform virus (RTBV belong to distinct genera of pararetroviruses infecting dicot and monocot plants, respectively. In both viruses, polycistronic translation of pregenomic (pg RNA is initiated by shunting ribosomes that bypass a large region of the pgRNA leader with several short (sORFs and a stable stem-loop structure. The shunt requires translation of a 5'-proximal sORF terminating near the stem. In CaMV, mutations knocking out this sORF nearly abolish shunting and virus viability. METHODOLOGY/PRINCIPAL FINDINGS: Here we show that two distant regions of the CaMV leader that form a minimal shunt configuration comprising the sORF, a bottom part of the stem, and a shunt landing sequence can be replaced by heterologous sequences that form a structurally similar configuration in RTBV without any dramatic effect on shunt-mediated translation and CaMV infectivity. The CaMV-RTBV chimeric leader sequence was largely stable over five viral passages in turnip plants: a few alterations that did eventually occur in the virus progenies are indicative of fine tuning of the chimeric sequence during adaptation to a new host. CONCLUSIONS/SIGNIFICANCE: Our findings demonstrate cross-species functionality of pararetroviral cis-elements driving ribosome shunting and evolutionary conservation of the shunt mechanism. We are grateful to Matthias Müller and Sandra Pauli for technical assistance. This work was initiated at Friedrich Miescher Institute (Basel, Switzerland. We thank Prof. Thomas Boller for hosting the group at the Institute of Botany.

  2. Ribosomal protein gene knockdown causes developmental defects in zebrafish.

    Directory of Open Access Journals (Sweden)

    Tamayo Uechi

    Full Text Available The ribosomal proteins (RPs form the majority of cellular proteins and are mandatory for cellular growth. RP genes have been linked, either directly or indirectly, to various diseases in humans. Mutations in RP genes are also associated with tissue-specific phenotypes, suggesting a possible role in organ development during early embryogenesis. However, it is not yet known how mutations in a particular RP gene result in specific cellular changes, or how RP genes might contribute to human diseases. The development of animal models with defects in RP genes will be essential for studying these questions. In this study, we knocked down 21 RP genes in zebrafish by using morpholino antisense oligos to inhibit their translation. Of these 21, knockdown of 19 RPs resulted in the development of morphants with obvious deformities. Although mutations in RP genes, like other housekeeping genes, would be expected to result in nonspecific developmental defects with widespread phenotypes, we found that knockdown of some RP genes resulted in phenotypes specific to each gene, with varying degrees of abnormality in the brain, body trunk, eyes, and ears at about 25 hours post fertilization. We focused further on the organogenesis of the brain. Each knocked-down gene that affected the morphogenesis of the brain produced a different pattern of abnormality. Among the 7 RP genes whose knockdown produced severe brain phenotypes, 3 human orthologs are located within chromosomal regions that have been linked to brain-associated diseases, suggesting a possible involvement of RP genes in brain or neurological diseases. The RP gene knockdown system developed in this study could be a powerful tool for studying the roles of ribosomes in human diseases.

  3. Potential relationships between morphological differentiation and mutants with high nuclease P1 production of Penicillium citrinum

    Energy Technology Data Exchange (ETDEWEB)

    Xinle, Liang; Qian, Shou; Hong, Zhang; Min, Chen [Department of Biotechnology, Zhejiang Gongshang University, Hangzhou, Zhejiang (China); Xuan, Liu [Beihai Institute of Environmental Science, Beihai, Guangxi (China)

    2009-08-15

    Diversification of colony characteristics of mutants derived from Penicillium citrinum CICC 4011 treated with {sup 60}Co {gamma}-irradiation and protoplast fusion were analyzed. There were distinct differences among mutants with different nuclease P1 activity, especially in pigment productivity. Color of colony was changed from the original green to white, grey-green, or yellow-green etc., while the nuclease P1 activity would be fluctuated with the color change. The hypothesis was suggested that there would be a relationship between pigments and nuclease P1 production. Mutants with grey-green colony would give out high nuclease P1 outputs in a high probability such as mutant J1Y6 (nuclease P1 activity, 167.3U/ml) and fusant F-13 (nuclease P1 activity, 568.7U/ml), while others with deep-green colony observed low nuclease outputs. Four variation strains didn't show any significant difference in growth rate. Broom branches of conidiophore stem in J1Y6 and F-13 were obviously reduced, conidiophores productivity reduced, but hyphae growth haled. These suggested that nuclease P1 production was associated with growth phase, but pigment synthesis course wasn't. RAPD from 6 randomly selected primers was used to analyze the polymorphic rich of the four strains, the results showed that there were 70 percent polymorphism detection rate among those. UPGMA cluster analysis and genetic map constructed by NTSYS-PC software, which showed that J1Y6 and F-14 were clustered as one group at similar coefficient 0.9, where there was an appear distance from the group of 4011 and F-R-33 strains (similar coefficient 0.8). (authors)

  4. Potential relationships between morphological differentiation and mutants with high nuclease P1 production of Penicillium citrinum

    International Nuclear Information System (INIS)

    Liang Xinle; Shou Qian; Zhang Hong; Chen Min; Liu Xuan

    2009-01-01

    Diversification of colony characteristics of mutants derived from Penicillium citrinum CICC 4011 treated with 60 Co γ-irradiation and protoplast fusion were analyzed. There were distinct differences among mutants with different nuclease P1 activity, especially in pigment productivity. Color of colony was changed from the original green to white, grey-green, or yellow-green etc., while the nuclease P1 activity would be fluctuated with the color change. The hypothesis was suggested that there would be a relationship between pigments and nuclease P1 production. Mutants with grey-green colony would give out high nuclease P1 outputs in a high probability such as mutant J1Y6( nuclease P1 activity, 167.3U/ml) and fusant F-13 (nuclease P1 activity, 568.7U/ml), while others with deep-green colony observed low nuclease outputs. Four variation strains didn't show any significant difference in growth rate. Broom branches of conidiophore stem in J1Y6 and F-13 were obviously reduced, conidiophores productivity reduced, but hyphae growth haled. These suggested that nuclease P1 production was associated with growth phase, but pigment synthesis course wasn't. RAPD from 6 randomly selected primers was used to analyze the polymorphic rich of the four strains, the results showed that there were 70 percent polymorphism detection rate among those. UPGMA cluster analysis and genetic map constructed by NTSYS-PC software, which showed that J1Y6 and F-14 were clustered as one group at similar coefficient 0.9, where there was an appear distance from the group of 4011 and F-R-33 strains (similar coefficient 0.8). (authors)

  5. Only Acyl Carrier Protein 1 (AcpP1 Functions in Pseudomonas aeruginosa Fatty Acid Synthesis

    Directory of Open Access Journals (Sweden)

    Jin-Cheng Ma

    2017-11-01

    Full Text Available The genome of Pseudomonas aeruginosa contains three open reading frames, PA2966, PA1869, and PA3334, which encode putative acyl carrier proteins, AcpP1, AcpP2, and AcpP3, respectively. In this study, we found that, although these apo-ACPs were successfully phosphopantetheinylated by P. aeruginosa phosphopantetheinyl transferase (PcpS and all holo-forms of these proteins could be acylated by Vibrio harveyi acyl-ACP synthetase (AasS, only AcpP1 could be used as a substrate for the synthesis of fatty acids, catalyzed by P. aeruginosa cell free extracts in vitro, and only acpP1 gene could restore growth in the Escherichia coliacpP mutant strain CY1877. And P. aeruginosaacpP1 could not be deleted, while disruption of acpP2 or acpP3 in the P. aeruginosa genome allowed mutant strains to grow as well as the wild type strain. These findings confirmed that only P. aeruginosa AcpP1 functions in fatty acid biosynthesis, and that acpP2 and acpP3 do not play roles in the fatty acid synthetic pathway. Moreover, disruption of acpP2 and acpP3 did not affect the ability of P. aeruginosa to produce N-acylhomoserine lactones (AHL, but replacement of P. aeruginosaacpP1 with E. coliacpP caused P. aeruginosa to reduce the production of AHL molecules, which indicated that neither P. aeruginosa AcpP2 nor AcpP3 can act as a substrate for synthesis of AHL molecules in vivo. Furthermore, replacement of acpP1 with E. coliacpP reduced the ability of P. aeruginosa to produce some exo-products and abolished swarming motility in P. aeruginosa.

  6. Characterization of anti-P monoclonal antibodies directed against the ribosomal protein-RNA complex antigen and produced using Murphy Roths large autoimmune-prone mice.

    Science.gov (United States)

    Sato, H; Onozuka, M; Hagiya, A; Hoshino, S; Narita, I; Uchiumi, T

    2015-02-01

    Autoantibodies, including anti-ribosomal P proteins (anti-P), are thought to be produced by an antigen-driven immune response in systemic lupus erythematosus (SLE). To test this hypothesis, we reconstituted the ribosomal antigenic complex in vitro using human P0, phosphorylated P1 and P2 and a 28S rRNA fragment covering the P0 binding site, and immunized Murphy Roths large (MRL)/lrp lupus mice with this complex without any added adjuvant to generate anti-P antibodies. Using hybridoma technology, we subsequently obtained 34 clones, each producing an anti-P monoclonal antibody (mAb) that recognized the conserved C-terminal tail sequence common to all three P proteins. We also obtained two P0-specific monoclonal antibodies, but no antibody specific to P1, P2 or rRNA fragment. Two types of mAbs were found among these anti-P antibodies: one type (e.g. 9D5) reacted more strongly with the phosphorylated P1 and P2 than that with their non-phosphorylated forms, whereas the other type (e.g. 4H11) reacted equally with both phosphorylated and non-phosphorylated forms of P1/P2. Both 9D5 and 4H11 inhibited the ribosome/eukaryotic elongation factor-2 (eEF-2)-coupled guanosine triphosphate (GTP)ase activity. However, preincubation with a synthetic peptide corresponding to the C-terminal sequence common to all three P proteins, but not the peptide that lacked the last three C-terminal amino acids, mostly prevented the mAb-induced inhibition of GTPase activity. Thus, at least two types of anti-P were produced preferentially following the immunization of MRL mice with the reconstituted antigenic complex. Presence of multiple copies of the C-termini, particularly that of the last three C-terminal amino acid residues, in the antigenic complex appears to contribute to the immunogenic stimulus. © 2014 British Society for Immunology.

  7. Characterization of anti-P monoclonal antibodies directed against the ribosomal protein–RNA complex antigen and produced using Murphy Roths large autoimmune-prone mice

    Science.gov (United States)

    Sato, H; Onozuka, M; Hagiya, A; Hoshino, S; Narita, I; Uchiumi, T

    2015-01-01

    Autoantibodies, including anti-ribosomal P proteins (anti-P), are thought to be produced by an antigen-driven immune response in systemic lupus erythematosus (SLE). To test this hypothesis, we reconstituted the ribosomal antigenic complex in vitro using human P0, phosphorylated P1 and P2 and a 28S rRNA fragment covering the P0 binding site, and immunized Murphy Roths large (MRL)/lrp lupus mice with this complex without any added adjuvant to generate anti-P antibodies. Using hybridoma technology, we subsequently obtained 34 clones, each producing an anti-P monoclonal antibody (mAb) that recognized the conserved C-terminal tail sequence common to all three P proteins. We also obtained two P0-specific monoclonal antibodies, but no antibody specific to P1, P2 or rRNA fragment. Two types of mAbs were found among these anti-P antibodies: one type (e.g. 9D5) reacted more strongly with the phosphorylated P1 and P2 than that with their non-phosphorylated forms, whereas the other type (e.g. 4H11) reacted equally with both phosphorylated and non-phosphorylated forms of P1/P2. Both 9D5 and 4H11 inhibited the ribosome/eukaryotic elongation factor-2 (eEF-2)-coupled guanosine triphosphate (GTP)ase activity. However, preincubation with a synthetic peptide corresponding to the C-terminal sequence common to all three P proteins, but not the peptide that lacked the last three C-terminal amino acids, mostly prevented the mAb-induced inhibition of GTPase activity. Thus, at least two types of anti-P were produced preferentially following the immunization of MRL mice with the reconstituted antigenic complex. Presence of multiple copies of the C-termini, particularly that of the last three C-terminal amino acid residues, in the antigenic complex appears to contribute to the immunogenic stimulus. PMID:25255895

  8. Translation initiation in bacterial polysomes through ribosome loading on a standby site on a highly translated mRNA

    Science.gov (United States)

    Andreeva, Irena

    2018-01-01

    During translation, consecutive ribosomes load on an mRNA and form a polysome. The first ribosome binds to a single-stranded mRNA region and moves toward the start codon, unwinding potential mRNA structures on the way. In contrast, the following ribosomes can dock at the start codon only when the first ribosome has vacated the initiation site. Here we show that loading of the second ribosome on a natural 38-nt-long 5′ untranslated region of lpp mRNA, which codes for the outer membrane lipoprotein from Escherichia coli, takes place before the leading ribosome has moved away from the start codon. The rapid formation of this standby complex depends on the presence of ribosomal proteins S1/S2 in the leading ribosome. The early recruitment of the second ribosome to the standby site before translation by the leading ribosome and the tight coupling between translation elongation by the first ribosome and the accommodation of the second ribosome can contribute to high translational efficiency of the lpp mRNA. PMID:29632209

  9. P1 interneurons promote a persistent internal state that enhances inter-male aggression in Drosophila

    Science.gov (United States)

    Hoopfer, Eric D; Jung, Yonil; Inagaki, Hidehiko K; Rubin, Gerald M; Anderson, David J

    2015-01-01

    How brains are hardwired to produce aggressive behavior, and how aggression circuits are related to those that mediate courtship, is not well understood. A large-scale screen for aggression-promoting neurons in Drosophila identified several independent hits that enhanced both inter-male aggression and courtship. Genetic intersections revealed that 8-10 P1 interneurons, previously thought to exclusively control male courtship, were sufficient to promote fighting. Optogenetic experiments indicated that P1 activation could promote aggression at a threshold below that required for wing extension. P1 activation in the absence of wing extension triggered persistent aggression via an internal state that could endure for minutes. High-frequency P1 activation promoted wing extension and suppressed aggression during photostimulation, whereas aggression resumed and wing extension was inhibited following photostimulation offset. Thus, P1 neuron activation promotes a latent, internal state that facilitates aggression and courtship, and controls the overt expression of these social behaviors in a threshold-dependent, inverse manner. DOI: http://dx.doi.org/10.7554/eLife.11346.001 PMID:26714106

  10. House dust mite allergen Der p 1 effects on sinonasal epithelial tight junctions.

    Science.gov (United States)

    Henriquez, Oswaldo A; Den Beste, Kyle; Hoddeson, Elizabeth K; Parkos, Charles A; Nusrat, Asma; Wise, Sarah K

    2013-08-01

    Epithelial permeability is highly dependent upon the integrity of tight junctions, which are cell-cell adhesion complexes located at the apical aspect of the lateral membrane of polarized epithelial cells. We hypothesize that sinonasal epithelial exposure to Der p 1 house dust mite antigen decreases expression of tight junction proteins (TJPs), representing a potential mechanism for increased permeability and presentation of antigens across the sinonasal epithelial layer. Confluent cultured primary human sinonasal epithelial cells were exposed to recombinant Der p 1 antigen vs control, and transepithelial resistance measurements were performed over 24 hours. Antibody staining for a panel of TJPs was examined with immunofluorescence/confocal microscopy and Western blotting. Tissue for these experiments was obtained from 4 patients total. Der p 1 exposed sinonasal cells showed a marked decrease in transepithelial resistance when compared to control cells. In addition, results of Western immunoblot and immunofluorescent labeling demonstrated decreased expression of TJPs claudin-1 and junction adhesion molecule-A (JAM-A) in Der p 1-exposed cultured sinonasal cells vs controls. Der p 1 antigen exposure decreases sinonasal epithelium TJP expression, most notably seen in JAM-A and claudin-1 in these preliminary experiments. This decreased TJP expression likely contributes to increased epithelial permeability and represents a potential mechanism for transepithelial antigen exposure in allergic rhinitis. © 2013 ARS-AAOA, LLC.

  11. House Dust Mite Der p 1 Effects on Sinonasal Epithelial Tight Junctions

    Science.gov (United States)

    Henriquez, Oswaldo A.; Beste, Kyle Den; Hoddeson, Elizabeth K.; Parkos, Charles A.; Nusrat, Asma; Wise, Sarah K.

    2013-01-01

    Background Epithelial permeability is highly dependent upon the integrity of tight junctions, cell-cell adhesion complexes located at the apical aspect of the lateral membrane of polarized epithelial cells. We hypothesize that sinonasal epithelial exposure to Der p 1 house dust mite antigen decreases expression of tight junction proteins (TJPs), representing a potential mechanism for increased permeability and presentation of antigens across the sinonasal epithelial layer. Methods Confluent cultured primary human sinonasal epithelial cells were exposed to recombinant Der p 1 antigen versus control, and transepithelial resistance measurements were performed over 24 hours. Antibody staining for a panel of tight junction proteins was examined with immunofluorescence/confocal microscopy and Western blotting. Tissue for these experiments was obtained from 4 patients total. Results Der p 1 exposed sinonasal cells showed a marked decrease in transepithelial resistance when compared to control cells. In addition, results of Western immunoblot and immunofluorescent labeling demonstrated decreased expression of TJPs claudin-1 and junction adhesion molecule-A (JAM-A) in Der p 1 exposed cultured sinonasal cells versus controls. Conclusion Der p 1 antigen exposure decreases sinonasal epithelium TJP expression, most notably seen in JAM-A and claudin-1 in these preliminary experiments. This decreased TJP expression likely contributes to increased epithelial permeability and represents a potential mechanism for transepithelial antigen exposure in allergic rhinitis. PMID:23592402

  12. Deficiency of vasodilator-stimulated phosphoprotein (VASP increases blood-brain-barrier damage and edema formation after ischemic stroke in mice.

    Directory of Open Access Journals (Sweden)

    Peter Kraft

    2010-12-01

    Full Text Available Stroke-induced brain edema formation is a frequent cause of secondary infarct growth and deterioration of neurological function. The molecular mechanisms underlying edema formation after stroke are largely unknown. Vasodilator-stimulated phosphoprotein (VASP is an important regulator of actin dynamics and stabilizes endothelial barriers through interaction with cell-cell contacts and focal adhesion sites. Hypoxia has been shown to foster vascular leakage by downregulation of VASP in vitro but the significance of VASP for regulating vascular permeability in the hypoxic brain in vivo awaits clarification.Focal cerebral ischemia was induced in Vasp(-/- mice and wild-type (WT littermates by transient middle cerebral artery occlusion (tMCAO. Evan's Blue tracer was applied to visualize the extent of blood-brain-barrier (BBB damage. Brain edema formation and infarct volumes were calculated from 2,3,5-triphenyltetrazolium chloride (TTC-stained brain slices. Both mouse groups were carefully controlled for anatomical and physiological parameters relevant for edema formation and stroke outcome. BBB damage (p0.05 towards worse neurological outcomes.Our study identifies VASP as critical regulator of BBB maintenance during acute ischemic stroke. Therapeutic modulation of VASP or VASP-dependent signalling pathways could become a novel strategy to combat excessive edema formation in ischemic brain damage.

  13. Location of the binding domains for the RNA polymerase L and the ribonucleocapsid template within different halves of the NS phosphoprotein of vesicular stomatitis virus

    International Nuclear Information System (INIS)

    Emerson, S.U.; Schubert, M.

    1987-01-01

    Recombinant DNA techniques were used to delete regions of a cDNA clone of the phosphoprotein NS gene of vesicular stomatitis virus. The complete NS gene and four mutant genes containing internal or terminal deletions were inserted into a modified pGem4 vector under the transcriptional control of the page T7 promoter. Run-off transcripts were synthesized and translated in vitro to provide [ 35 S]methionine-labeled complete NS or deletion mutant NS proteins. Immune coprecipitation assays involving these proteins were developed to map the regions of the NS protein responsible for binding to the structural viral nucleocapsid protein N and the catalytic RNA polymerase protein L. The data indicate the NS protein is a bivalent protein consisting of two discrete functional domains. Contrary to previous suggestions, the negatively charged amino-terminal half of NS protein binds to L protein, while the carboxyl-terminal half of NS protein binds to both soluble recombinant nucleocapsid protein N and viral ribonucleocapsid template

  14. Solution structure of the C-terminal X domain of the measles virus phosphoprotein and interaction with the intrinsically disordered C-terminal domain of the nucleoprotein.

    Science.gov (United States)

    Gely, Stéphane; Lowry, David F; Bernard, Cédric; Jensen, Malene R; Blackledge, Martin; Costanzo, Stéphanie; Bourhis, Jean-Marie; Darbon, Hervé; Daughdrill, Gary; Longhi, Sonia

    2010-01-01

    In this report, the solution structure of the nucleocapsid-binding domain of the measles virus phosphoprotein (XD, aa 459-507) is described. A dynamic description of the interaction between XD and the disordered C-terminal domain of the nucleocapsid protein, (N(TAIL), aa 401-525), is also presented. XD is an all alpha protein consisting of a three-helix bundle with an up-down-up arrangement of the helices. The solution structure of XD is very similar to the crystal structures of both the free and bound form of XD. One exception is the presence of a highly dynamic loop encompassing XD residues 489-491, which is involved in the embedding of the alpha-helical XD-binding region of N(TAIL). Secondary chemical shift values for full-length N(TAIL) were used to define the precise boundaries of a transient helical segment that coincides with the XD-binding domain, thus shedding light on the pre-recognition state of N(TAIL). Titration experiments with unlabeled XD showed that the transient alpha-helical conformation of N(TAIL) is stabilized upon binding. Lineshape analysis of NMR resonances revealed that residues 483-506 of N(TAIL) are in intermediate exchange with XD, while the 475-482 and 507-525 regions are in fast exchange. The N(TAIL) resonance behavior in the titration experiments is consistent with a complex binding model with more than two states.

  15. Expression, purification, and characterization of a dentin phosphoprotein produced by Escherichia coli, and its odontoblastic differentiation effects on human dental pulp cells.

    Science.gov (United States)

    Yun, Ye-Rang; Jeon, Eunyi; Lee, Sujin; Kang, Wonmo; Kim, Sang-Gi; Kim, Hae-Won; Suh, Chang Kook; Jang, Jun-Hyeog

    2012-08-01

    To investigate the functions of recombinant human dentin phosphoprotein (rhDPP), we examined cell adhesion, viability and the odontoblastic differentiation activity of human dental pulp cells (hDPCs). Firstly, rhDPP was constructed using pBAD-HisA plasmid in Escherichia coli. Cell adhesion and viability of hDPCs by rhDPP was examined using a crystal violet assay and a MTT assay, ALP, mineralization activity and odontoblastic differentiation-related mRNA levels of hDPCs were measured to elucidate the odontoblastic differentiation effect of rhDPP on hDPCs. Initially, rhDPP significantly and dose-dependently increased hDPCs adhesion versus the untreated control (p < 0.05). Cell viability was also significantly increased by rhDPP at 5 days (p < 0.001). Furthermore, the odontoblastic differentiation effect of rhDPP was verified by measuring ALP activity, mineralization activity and the mRNA levels of odontoblastic differentiation markers. Taken together, rhDPP is expected to play an important role on hDPCs, thereby suggesting its potential use for tooth repair and regeneration.

  16. Dual function of the nuclear export signal of the Borna disease virus nucleoprotein in nuclear export activity and binding to viral phosphoprotein.

    Science.gov (United States)

    Yanai, Mako; Sakai, Madoka; Makino, Akiko; Tomonaga, Keizo

    2017-07-11

    Borna disease virus (BoDV), which has a negative-sense, single-stranded RNA genome, causes persistent infection in the cell nucleus. The nuclear export signal (NES) of the viral nucleoprotein (N) consisting of leucine at positions 128 and 131 and isoleucine at positions 133 and 136 overlaps with one of two predicted binding sites for the viral phosphoprotein (P). A previous study demonstrated that higher expression of BoDV-P inhibits nuclear export of N; however, the function of N NES in the interaction with P remains unclear. We examined the subcellular localization, viral polymerase activity, and P-binding ability of BoDV-N NES mutants. We also characterized a recombinant BoDV (rBoDV) harboring an NES mutation of N. BoDV-N with four alanine-substitutions in the leucine and isoleucine residues of the NES impaired its cytoplasmic localization and abolished polymerase activity and P-binding ability. Although an alanine-substitution at position 131 markedly enhanced viral polymerase activity as determined by a minigenome assay, rBoDV harboring this mutation showed expression of viral RNAs and proteins relative to that of wild-type rBoDV. Our results demonstrate that BoDV-N NES has a dual function in BoDV replication, i.e., nuclear export of N and an interaction with P, affecting viral polymerase activity in the nucleus.

  17. Studies of the effects of ultraviolet radiation on the structural integrities of ribosomal RNA components of the Escherichia coli 50S ribosomal subunit

    International Nuclear Information System (INIS)

    Gorelic, L.; Parker, D.

    1978-01-01

    The effects of 254-nm radiation on the structural integrities of free and 50S ribosome-bound 5S and 23S ribosomal ribonucleic acids (rRNA) have been elucidated. Irradiation of aqueous solutions of Escherichia coli 50S ribosomes with 253.7-nm radiation results in the formation of single-strand breaks in double-stranded regions of the 23S rRNA component, but not in rRNA chain scission, and destabilization of the secondary structure of the 23S rRNA toward denaturation. The minimum doses of 253.7-nm radiation required for the first detection of the two effects are 7 x 10 19 quanta for the production of single-strand breaks in double-stranded regions of the 23S rRNA, and 19 quanta for destabilization of the 23S rRNA secondary structure. Free 23S rRNA is resistant toward photoinduced chain breakage at doses of 253.7-nm radiation up to at least 2.3 x 10 20 and is much less sensitive toward destabilization of secondary structure than ribosome-bound 23S rRNA. In contrast to the photosensitivity of 50S ribosome-bound 23S rRNA toward chain breakage, 50S ribosome-bound 5S rRNA is resistant toward chain breakage at doses of 253.7-nm radiation up to at least 2.3 x 10 20 quanta. Ribosome-bound 5S and 23S rRNA are also not photosensitive toward intermolecular 5S/23S rRNA cross-linkage

  18. The primary structure of rat liver ribosomal protein L37. Homology with yeast and bacterial ribosomal proteins.

    Science.gov (United States)

    Lin, A; McNally, J; Wool, I G

    1983-09-10

    The covalent structure of the rat liver 60 S ribosomal subunit protein L37 was determined. Twenty-four tryptic peptides were purified and the sequence of each was established; they accounted for all 111 residues of L37. The sequence of the first 30 residues of L37, obtained previously by automated Edman degradation of the intact protein, provided the alignment of the first 9 tryptic peptides. Three peptides (CN1, CN2, and CN3) were produced by cleavage of protein L37 with cyanogen bromide. The sequence of CN1 (65 residues) was established from the sequence of secondary peptides resulting from cleavage with trypsin and chymotrypsin. The sequence of CN1 in turn served to order tryptic peptides 1 through 14. The sequence of CN2 (15 residues) was determined entirely by a micromanual procedure and allowed the alignment of tryptic peptides 14 through 18. The sequence of the NH2-terminal 28 amino acids of CN3 (31 residues) was determined; in addition the complete sequences of the secondary tryptic and chymotryptic peptides were done. The sequence of CN3 provided the order of tryptic peptides 18 through 24. Thus the sequence of the three cyanogen bromide peptides also accounted for the 111 residues of protein L37. The carboxyl-terminal amino acids were identified after carboxypeptidase A treatment. There is a disulfide bridge between half-cystinyl residues at positions 40 and 69. Rat liver ribosomal protein L37 is homologous with yeast YP55 and with Escherichia coli L34. Moreover, there is a segment of 17 residues in rat L37 that occurs, albeit with modifications, in yeast YP55 and in E. coli S4, L20, and L34.

  19. Ribosomal studies on the 70S ribosome of E.coli by means of neutron scattering; Strukturuntersuchungen am 70S-Ribosom von E.coli unter Anwendung von Neutronenstreuung

    Energy Technology Data Exchange (ETDEWEB)

    Burkhardt, N. [GKSS-Forschungszentrum Geesthacht GmbH (Germany). Inst. fuer Werkstofforschung

    1997-12-31

    Ribosomes are ribonucleo-protein complexes, which catalyse proteinbiosynthesis in all living organisms. Currently, most of the structural models of the prokaryotic 70S ribosome rely on electron microscopy and describe mainly the outer shape of the particle. Neutron scattering can provide information on the internal structure of the ribosome. Parts of the structure can be contrasted for neutrons by means of an isotopic exchange of the naturally occurring hydrogen ({sup 1}H) for deuterium ({sup 2}H), allowing direct measurements in situ. Specifically deuterium-labeled ribosomes (E. coli) were prepared and analysed with neutron scattering. The biochemical methods were established and combined to a generally applicable preparation system. This allows labeling of all ribosomal components in any combination. A systematic analysis of the protein and RNA phases resulted in the development of a new model for the 70S ribosome. This model describes not only the outer shape of the particle, but displays also an experimentally determined internal protein-RNA distribution and the border of subunits for the first time (four-phase model; resolution: 50A). Models of the 70S ribosome from other studies were evaluated and ranked according to consistency with the measured scattering data. Applying a new neutron scattering technique of particular sensitivity, the proton-spin contrast-variation, single proteins could be measured and localized. The positions of the proteins S6 and S10 were determined, providing the first coordinates of protein mass centers within the 70S ribosome. (orig.) [Deutsch] Ribosomen sind Ribonukleinsaeure-Protein Komplexe, die in allen lebenden Organismen die Proteinbiosynthese katalysieren. Strukturmodelle fuer das prokaryontische 70S-Ribosom beruhen derzeit vorwiegend auf elektronenmikroskopischen Untersuchungen und beschreiben im wesentlichen die aeussere Oberflaeche des Partikels. Informationen ueber die innere Struktur des Ribosoms koennen Messungen mit

  20. Ribosomal studies on the 70S ribosome of E.coli by means of neutron scattering; Strukturuntersuchungen am 70S-Ribosom von E.coli unter Anwendung von Neutronenstreuung

    Energy Technology Data Exchange (ETDEWEB)

    Burkhardt, N [GKSS-Forschungszentrum Geesthacht GmbH (Germany). Inst. fuer Werkstofforschung

    1998-12-31

    Ribosomes are ribonucleo-protein complexes, which catalyse proteinbiosynthesis in all living organisms. Currently, most of the structural models of the prokaryotic 70S ribosome rely on electron microscopy and describe mainly the outer shape of the particle. Neutron scattering can provide information on the internal structure of the ribosome. Parts of the structure can be contrasted for neutrons by means of an isotopic exchange of the naturally occurring hydrogen ({sup 1}H) for deuterium ({sup 2}H), allowing direct measurements in situ. Specifically deuterium-labeled ribosomes (E. coli) were prepared and analysed with neutron scattering. The biochemical methods were established and combined to a generally applicable preparation system. This allows labeling of all ribosomal components in any combination. A systematic analysis of the protein and RNA phases resulted in the development of a new model for the 70S ribosome. This model describes not only the outer shape of the particle, but displays also an experimentally determined internal protein-RNA distribution and the border of subunits for the first time (four-phase model; resolution: 50A). Models of the 70S ribosome from other studies were evaluated and ranked according to consistency with the measured scattering data. Applying a new neutron scattering technique of particular sensitivity, the proton-spin contrast-variation, single proteins could be measured and localized. The positions of the proteins S6 and S10 were determined, providing the first coordinates of protein mass centers within the 70S ribosome. (orig.) [Deutsch] Ribosomen sind Ribonukleinsaeure-Protein Komplexe, die in allen lebenden Organismen die Proteinbiosynthese katalysieren. Strukturmodelle fuer das prokaryontische 70S-Ribosom beruhen derzeit vorwiegend auf elektronenmikroskopischen Untersuchungen und beschreiben im wesentlichen die aeussere Oberflaeche des Partikels. Informationen ueber die innere Struktur des Ribosoms koennen Messungen mit

  1. P1 and N170 components distinguish human-like and animal-like makeup stimuli.

    Science.gov (United States)

    Luo, Shuwei; Luo, Wenbo; He, Weiqi; Chen, Xu; Luo, Yuejia

    2013-06-19

    This study used event-related potentials to investigate the sensitivity of P1 and N170 components to human-like and animal-like makeup stimuli, which were derived from pictures of Peking opera characters. As predicted, human-like makeup stimuli elicited larger P1 and N170 amplitudes than did animal-like makeup stimuli. Interestingly, a right hemisphere advantage was observed for human-like but not for animal-like makeup stimuli. Dipole source analyses of 130-200-ms window showed that the bilateral fusiform face area may contribute to the differential sensitivity of the N170 component in response to human-like and animal-like makeup stimuli. The present study suggests that the amplitudes of both the P1 and the N170 are sensitive for the mouth component of face-like stimuli.

  2. Comparative analysis between P1 and B1 equations for neutron moderation

    International Nuclear Information System (INIS)

    Martinez, Aquilino Senra; Silva, Fernando Carvalho da; Cardoso, Carlos Eduardo Santos

    2000-01-01

    In order to calculate the neutron flux in nuclear reactors, B1 or P1 equations are solved by numerical methods for several groups of energy. The neutron fluxes obtained from the solutions of the B1 and P1 equations are similar when they are applied to large nuclear power reactors. However, an important difference between the two fluxes is that the system of P1 equations uses one more approximation than the B1 system and then, its flux is less precise. The present work shows the relations between both equations and analyzes for what conditions the two equations systems are equivalent. Furthermore, this equations are numerically solved in 54 groups of energy for a quadrangular arrange. (author)

  3. Nature of the fundamental band gap in GaNxP1-x alloys

    International Nuclear Information System (INIS)

    Shan, W.; Walukiewicz, W.; Yu, K. M.; Wu, J.; Ager, J. W. III; Haller, E. E.; Xin, H. P.; Tu, C. W.

    2000-01-01

    The optical properties of GaN x P 1-x alloys (0.007≤x≤0.031) grown by gas-source molecular-beam epitaxy have been studied. An absorption edge appears in GaN x P 1-x at energy below the indirect Γ V -X C transition in GaP, and the absorption edge shifts to lower energy with increasing N concentration. Strong photomodulation signals associated with the absorption edges in GaN x P 1-x indicate that a direct fundamental optical transition is taking place, revealing that the fundamental band gap has changed from indirect to direct. This N-induced transformation from indirect to direct band gap is explained in terms of an interaction between the highly localized nitrogen states and the extended states at the Γ conduction-band minimum. (c) 2000 American Institute of Physics

  4. BEAM EXTRACTION FROM THE RECYCLER RING TO P1 LINE AT FERMILAB

    Energy Technology Data Exchange (ETDEWEB)

    Xiao, M. [Fermilab; Capista, D. [Fermilab; Adams, P. [Fermilab; Morris, D. [Fermilab; Yang, M. J. [Fermilab; Hazewood, K. [Fermilab

    2016-10-03

    The transfer line for beam extraction from the Recycler ring to P1 line provides a way to deliver 8 GeV kinetic energy protons from the Booster to the Delivery ring, via the Recycler, using existing beam transport lines, and without the need for new civil construction. It was designed in 2012. The kicker magnets at RR520 and the lambertson magnet at RR522 in the RR were installed in 2014 Summer Shutdown, the elements of RR to P1 Stub (permanent quads, trim quads, correctors, BPMs, the toroid at 703 and vertical bending dipole at V703 (ADCW) were installed in 2015 Summer Shutdown. On Tuesday, June 21, 2016, beam line from the Recycler Ring to P1 line was commissioned. The detailed results will be presented in this report.

  5. Understanding Biases in Ribosome Profiling Experiments Reveals Signatures of Translation Dynamics in Yeast.

    Directory of Open Access Journals (Sweden)

    Jeffrey A Hussmann

    2015-12-01

    Full Text Available Ribosome profiling produces snapshots of the locations of actively translating ribosomes on messenger RNAs. These snapshots can be used to make inferences about translation dynamics. Recent ribosome profiling studies in yeast, however, have reached contradictory conclusions regarding the average translation rate of each codon. Some experiments have used cycloheximide (CHX to stabilize ribosomes before measuring their positions, and these studies all counterintuitively report a weak negative correlation between the translation rate of a codon and the abundance of its cognate tRNA. In contrast, some experiments performed without CHX report strong positive correlations. To explain this contradiction, we identify unexpected patterns in ribosome density downstream of each type of codon in experiments that use CHX. These patterns are evidence that elongation continues to occur in the presence of CHX but with dramatically altered codon-specific elongation rates. The measured positions of ribosomes in these experiments therefore do not reflect the amounts of time ribosomes spend at each position in vivo. These results suggest that conclusions from experiments in yeast using CHX may need reexamination. In particular, we show that in all such experiments, codons decoded by less abundant tRNAs were in fact being translated more slowly before the addition of CHX disrupted these dynamics.

  6. Ribosomal proteins as biomarkers for bacterial identification by mass spectrometry in the clinical microbiology laboratory.

    Science.gov (United States)

    Suarez, Stéphanie; Ferroni, Agnès; Lotz, Aurélie; Jolley, Keith A; Guérin, Philippe; Leto, Julie; Dauphin, Brunhilde; Jamet, Anne; Maiden, Martin C J; Nassif, Xavier; Armengaud, Jean

    2013-09-01

    Whole-cell matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS) is a rapid method for identification of microorganisms that is increasingly used in microbiology laboratories. This identification is based on the comparison of the tested isolate mass spectrum with reference databases. Using Neisseria meningitidis as a model organism, we showed that in one of the available databases, the Andromas database, 10 of the 13 species-specific biomarkers correspond to ribosomal proteins. Remarkably, one biomarker, ribosomal protein L32, was subject to inter-strain variability. The analysis of the ribosomal protein patterns of 100 isolates for which whole genome sequences were available, confirmed the presence of inter-strain variability in the molecular weight of 29 ribosomal proteins, thus establishing a correlation between the sequence type (ST) and/or clonal complex (CC) of each strain and its ribosomal protein pattern. Since the molecular weight of three of the variable ribosomal proteins (L30, L31 and L32) was included in the spectral window observed by MALDI-TOF MS in clinical microbiology, i.e., 3640-12000 m/z, we were able by analyzing the molecular weight of these three ribosomal proteins to classify each strain in one of six subgroups, each of these subgroups corresponding to specific STs and/or CCs. Their detection by MALDI-TOF allows therefore a quick typing of N. meningitidis isolates. © 2013 Elsevier B.V. All rights reserved.

  7. Ribosomal stress induces L11- and p53-dependent apoptosis in mouse pluripotent stem cells.

    Science.gov (United States)

    Morgado-Palacin, Lucia; Llanos, Susana; Serrano, Manuel

    2012-02-01

    Ribosome biogenesis is the most demanding energetic process in proliferating cells and it is emerging as a critical sensor of cellular homeostasis. Upon disturbance of ribosome biogenesis, specific free ribosomal proteins, most notably L11, bind and inhibit Mdm2, resulting in activation of the tumor suppressor p53. This pathway has been characterized in somatic and cancer cells, but its function in embryonic pluripotent cells has remained unexplored. Here, we show that treatment with low doses of Actinomycin D or depletion of ribosomal protein L37, two well-established inducers of ribosomal stress, activate p53 in an L11-dependent manner in mouse embryonic stem cells (ESCs) and in induced pluripotent stem cells (iPSCs). Activation of p53 results in transcriptional induction of p53 targets, including p21, Mdm2, Pidd, Puma, Noxa and Bax. Finally, ribosomal stress elicits L11- and p53-dependent apoptosis in ESCs/iPSCs. These results extend to pluripotent cells the functionality of the ribosomal stress pathway and we speculate that this could be a relevant cellular checkpoint during early embryogenesis.

  8. Proteome distribution between nucleoplasm and nucleolus and its relation to ribosome biogenesis in Arabidopsis thaliana.

    Science.gov (United States)

    Palm, Denise; Simm, Stefan; Darm, Katrin; Weis, Benjamin L; Ruprecht, Maike; Schleiff, Enrico; Scharf, Christian

    2016-01-01

    Ribosome biogenesis is an essential process initiated in the nucleolus. In eukaryotes, multiple ribosome biogenesis factors (RBFs) can be found in the nucleolus, the nucleus and in the cytoplasm. They act in processing, folding and modification of the pre-ribosomal (r)RNAs, incorporation of ribosomal proteins (RPs), export of pre-ribosomal particles to the cytoplasm, and quality control mechanisms. Ribosome biogenesis is best established for Saccharomyces cerevisiae. Plant ortholog assignment to yeast RBFs revealed the absence of about 30% of the yeast RBFs in plants. In turn, few plant specific proteins have been identified by biochemical experiments to act in plant ribosome biogenesis. Nevertheless, a complete inventory of plant RBFs has not been established yet. We analyzed the proteome of the nucleus and nucleolus of Arabidopsis thaliana and the post-translational modifications of these proteins. We identified 1602 proteins in the nucleolar and 2544 proteins in the nuclear fraction with an overlap of 1429 proteins. For a randomly selected set of proteins identified by the proteomic approach we confirmed the localization inferred from the proteomics data by the localization of GFP fusion proteins. We assigned the identified proteins to various complexes and functions and found about 519 plant proteins that have a potential to act as a RBFs, but which have not been experimentally characterized yet. Last, we compared the distribution of RBFs and RPs in the various fractions with the distribution established for yeast.

  9. Fourier analysis of a new P1 synthetic acceleration for Sn transport equations

    International Nuclear Information System (INIS)

    Turcksin, B.; Ragusa, J. C.

    2010-10-01

    In this work, is derived a new P1 synthetic acceleration scheme (P1SA) for the S N transport equation and analyze its convergence properties through the means of a Fourier analysis. The Fourier analysis is carried out for both continuous (i.e., not spatially discretized) S N equations and linear discontinuous Fem discretization. We show, thanks to the continuous analysis, that the scheme is unstable when the anisotropy is important (μ - >0.5). However, the discrete analysis shows that when cells are large in comparison to the mean free path, the spectral radius decreases and the acceleration scheme becomes effective, even for highly anisotropic scattering. In charged particles transport, scattering is highly anisotropic and mean free paths are very small and, thus, this scheme could be of interest. To use the P1SA when cells are small and anisotropy is important, the scheme is modified by altering the update of the accelerated flux or by using either K transport sweeps before the application of P1SA. The update scheme performs well as long as μ - - ≥0.9, the modified update scheme is unstable. The multiple transport sweeps scheme is convergent with an arbitrary μ - but the spectral radius increases when scattering is isotropic. When anisotropic increases, the frequency of use of the acceleration scheme needs to be decreased. Even if the P1SA is used less often, the spectral radius is significantly smaller when compared with a method that does not use it for high anisotropy (μ - ≥0.5). It is interesting to notice that using P1SA every two iterations gives the same spectral radius than the update method when μ - ≥0.5 but it is much less efficient when μ - <0.5. (Author)

  10. Oceanographic Observations North Pacific Ocean Station VICTOR Standard Section P1 Terminal Report 1964-1972,

    Science.gov (United States)

    1981-01-01

    temperature (*C) for occupation of P1-15, USCG4C MINNETONKA, 27-30 March 1971. 31 34. 8 STATION 16 15 14 13 12 11 10 9 8 7 6 5 4 3 2 1 * ~󈧦 7: 400 3: 27001 3a...Profile of sigma-t (g cm-2 ) for occupation of P1-16, USCGC TANEY, 16-21 April 1971. 36 142*W 144’ 146* 1480 ISO * 152’ 154* 1560 158’ 1600 162’ 164

  11. A Numbers Game: Ribosome Densities, Bacterial Growth, and Antibiotic-Mediated Stasis and Death

    Directory of Open Access Journals (Sweden)

    Bruce R. Levin

    2017-02-01

    Full Text Available We postulate that the inhibition of growth and low rates of mortality of bacteria exposed to ribosome-binding antibiotics deemed bacteriostatic can be attributed almost uniquely to these drugs reducing the number of ribosomes contributing to protein synthesis, i.e., the number of effective ribosomes. We tested this hypothesis with Escherichia coli K-12 MG1655 and constructs that had been deleted for 1 to 6 of the 7 rRNA (rrn operons. In the absence of antibiotics, constructs with fewer rrn operons have lower maximum growth rates and longer lag phases than those with more ribosomal operons. In the presence of the ribosome-binding “bacteriostatic” antibiotics tetracycline, chloramphenicol, and azithromycin, E. coli strains with 1 and 2 rrn operons are killed at a substantially higher rate than those with more rrn operons. This increase in the susceptibility of E. coli with fewer rrn operons to killing by ribosome-targeting bacteriostatic antibiotics is not reflected in their greater sensitivity to killing by the bactericidal antibiotic ciprofloxacin, which does not target ribosomes, but also to killing by gentamicin, which does. Finally, when such strains are exposed to these ribosome-targeting bacteriostatic antibiotics, the time before these bacteria start to grow again when the drugs are removed, referred to as the post-antibiotic effect (PAE, is markedly greater for constructs with fewer rrn operons than for those with more rrn operons. We interpret the results of these other experiments reported here as support for the hypothesis that the reduction in the effective number of ribosomes due to binding to these structures provides a sufficient explanation for the action of bacteriostatic antibiotics that target these structures.

  12. Ribosomal trafficking is reduced in Schwann cells following induction of myelination

    Directory of Open Access Journals (Sweden)

    James M. Love

    2015-08-01

    Full Text Available Local synthesis of proteins within the Schwann cell periphery is extremely important for efficient process extension and myelination, when cells undergo dramatic changes in polarity and geometry. Still, it is unclear how ribosomal distributions are developed and maintained within Schwann cell projections to sustain local translation. In this multi-disciplinary study, we expressed a plasmid encoding a fluorescently labeled ribosomal subunit (L4-GFP in cultured primary rat Schwann cells. This enabled the generation of high-resolution, quantitative data on ribosomal distributions and trafficking dynamics within Schwann cells during early stages of myelination, induced by ascorbic acid treatment. Ribosomes were distributed throughout Schwann cell projections, with ~2-3 bright clusters along each projection. Clusters emerged within 1 day of culture and were maintained throughout early stages of myelination. Three days after induction of myelination, net ribosomal movement remained anterograde (directed away from the Schwann cell body, but ribosomal velocity decreased to about half the levels of the untreated group. Statistical and modeling analysis provided additional insight into key factors underlying ribosomal trafficking. Multiple regression analysis indicated that net transport at early time points was dependent on anterograde velocity, but shifted to dependence on anterograde duration at later time points. A simple, data-driven rate kinetics model suggested that the observed decrease in net ribosomal movement was primarily dictated by an increased conversion of anterograde particles to stationary particles, rather than changes in other directional parameters. These results reveal the strength of a combined experimental and theoretical approach in examining protein localization and transport, and provide evidence of an early establishment of ribosomal populations within Schwann cell projections with a reduction in trafficking following

  13. Mutations in ribosomal protein L3 and 23S ribosomal RNA at the peptidyl transferase centre are associated with reduced susceptibility to tiamulin in Brachyspira spp. isolates.

    Science.gov (United States)

    Pringle, Märit; Poehlsgaard, Jacob; Vester, Birte; Long, Katherine S

    2004-12-01

    The pleuromutilin antibiotic tiamulin binds to the ribosomal peptidyl transferase centre. Three groups of Brachyspira spp. isolates with reduced tiamulin susceptibility were analysed to define resistance mechanisms to the drug. Mutations were identified in genes encoding ribosomal protein L3 and 23S rRNA at positions proximal to the peptidyl transferase centre. In two groups of laboratory-selected mutants, mutations were found at nucleotide positions 2032, 2055, 2447, 2499, 2504 and 2572 of 23S rRNA (Escherichia coli numbering) and at amino acid positions 148 and 149 of ribosomal protein L3 (Brachyspira pilosicoli numbering). In a third group of clinical B. hyodysenteriae isolates, only a single mutation at amino acid 148 of ribosomal protein L3 was detected. Chemical footprinting experiments show a reduced binding of tiamulin to ribosomal subunits from mutants with decreased susceptibility to the drug. This reduction in drug binding is likely the resistance mechanism for these strains. Hence, the identified mutations located near the tiamulin binding site are predicted to be responsible for the resistance phenotype. The positions of the mutated residues relative to the bound drug advocate a model where the mutations affect tiamulin binding indirectly through perturbation of nucleotide U2504.

  14. The Arabidopsis TOR Kinase Specifically Regulates the Expression of Nuclear Genes Coding for Plastidic Ribosomal Proteins and the Phosphorylation of the Cytosolic Ribosomal Protein S6.

    Science.gov (United States)

    Dobrenel, Thomas; Mancera-Martínez, Eder; Forzani, Céline; Azzopardi, Marianne; Davanture, Marlène; Moreau, Manon; Schepetilnikov, Mikhail; Chicher, Johana; Langella, Olivier; Zivy, Michel; Robaglia, Christophe; Ryabova, Lyubov A; Hanson, Johannes; Meyer, Christian

    2016-01-01

    Protein translation is an energy consuming process that has to be fine-tuned at both the cell and organism levels to match the availability of resources. The target of rapamycin kinase (TOR) is a key regulator of a large range of biological processes in response to environmental cues. In this study, we have investigated the effects of TOR inactivation on the expression and regulation of Arabidopsis ribosomal proteins at different levels of analysis, namely from transcriptomic to phosphoproteomic. TOR inactivation resulted in a coordinated down-regulation of the transcription and translation of nuclear-encoded mRNAs coding for plastidic ribosomal proteins, which could explain the chlorotic phenotype of the TOR silenced plants. We have identified in the 5' untranslated regions (UTRs) of this set of genes a conserved sequence related to the 5' terminal oligopyrimidine motif, which is known to confer translational regulation by the TOR kinase in other eukaryotes. Furthermore, the phosphoproteomic analysis of the ribosomal fraction following TOR inactivation revealed a lower phosphorylation of the conserved Ser240 residue in the C-terminal region of the 40S ribosomal protein S6 (RPS6). These results were confirmed by Western blot analysis using an antibody that specifically recognizes phosphorylated Ser240 in RPS6. Finally, this antibody was used to follow TOR activity in plants. Our results thus uncover a multi-level regulation of plant ribosomal genes and proteins by the TOR kinase.

  15. Three-dimensional crystals of ribosomes and their subunits from eu- and archaebacteria.

    Science.gov (United States)

    Glotz, C; Müssig, J; Gewitz, H S; Makowski, I; Arad, T; Yonath, A; Wittmann, H G

    1987-11-01

    Ordered three-dimensional crystals of 70S ribosomes as well as of 30S and 50S ribosomal subunits from various bacteria (E. coli, Bacillus stearothermophilus, Thermus thermophilus and Halobacterium marismortui) have been grown by vapour diffusion in hanging drops using mono- and polyalcohols. A new compact crystal form of 50S subunits has been obtained, and it is suitable for crystallographic studies at medium resolution. In addition, from one crystal form large crystals could be grown in X-ray capillaries. In all cases the crystals were obtained from functionally active ribosomal particles, and the particles from dissolved crystals retained their integrity and biological activity.

  16. Origins of the plant chloroplasts and mitochondria based on comparisons of 5S ribosomal RNAs

    Science.gov (United States)

    Delihas, N.; Fox, G. E.

    1987-01-01

    In this paper, we provide macromolecular comparisons utilizing the 5S ribosomal RNA structure to suggest extant bacteria that are the likely descendants of chloroplast and mitochondria endosymbionts. The genetic stability and near universality of the 5S ribosomal gene allows for a useful means to study ancient evolutionary changes by macromolecular comparisons. The value in current and future ribosomal RNA comparisons is in fine tuning the assignment of ancestors to the organelles and in establishing extant species likely to be descendants of bacteria involved in presumed multiple endosymbiotic events.

  17. Purification and properties of a ribosomal casein kinase from rabbit reticulocytes

    DEFF Research Database (Denmark)

    Issinger, O G

    1977-01-01

    A casein kinase was isolated and purifed from rabbit reticulocytes. About 90% of the enzyme activity co-sedimented with the ribosomal fraction, whereas about 10% of the enzyme activity was found in the ribosome-free supernatant. Both casein kinases (the ribosome-bound enzyme as well as the free...... suggested that the casein kinase is a dimer composed of subunits of identical molecular weight. The enzyme utilizes GTP as well as ATP as a phosphoryl donor. It preferentially phosphorylates acidic proteins, in particular the model substrates casein and phosvitin. Casein kinase is cyclic AMP...

  18. Tracking the potyviral P1 protein in Nicotiana benthamiana plants during plum pox virus infection.

    Science.gov (United States)

    Vozárová, Z; Glasa, M; Šubr, Z W

    The P1 protein is derived from the N terminus of potyvirus-coded polyprotein. In addition to the proteolytic activity essential for its maturation, it probably participates in suppression of host defense and/or in virus replication. Clear validation of the P1 in vivo function(s), however, is not yet available. We applied an infectious cDNA clone of plum pox virus (PPV), where the P1 was N-fused with a hexahistidine tag, to trace this protein in Nicotiana benthamiana plants during the PPV infection. Immunoblot analysis with the anti-his antibody showed a diffuse band corresponding to the molecular weight about 70-80 kDa (about twice larger than expected) in the root samples from early stage of infection. This signal culminated on the sixth day post inoculation, later it rapidly disappeared. Sample denaturation by boiling in SDS before centrifugal clarification was essential, indicating strong affinity of P1-his to some plant compound sedimenting with the tissue and cell debris.

  19. Genotyping of Mycoplasma pneumoniae clinical isolates reveals eight P1 subtypes within two genomic groups

    NARCIS (Netherlands)

    Dorigo-Zetsma, J. W.; Dankert, J.; Zaat, S. A.

    2000-01-01

    Three methods for genotyping of Mycoplasma pneumoniae clinical isolates were applied to 2 reference strains and 21 clinical isolates. By a modified restriction fragment length polymorphism (RFLP) analysis of PCR products of the M. pneumoniae cytadhesin P1 gene, 5 subtypes were discriminated among 13

  20. Hilbert scheme of points on cyclic quotient singularities of type (p,1)

    OpenAIRE

    Gyenge, Ádám

    2016-01-01

    In this note we investigate the generating series of the Euler characteristics of Hilbert scheme of points on cyclic quotient singularities of type (p,1). We link the appearing combinatorics to p-fountains, a generalization of the notion of fountain of coins. We obtain a representation of the generating series as coefficient of a two variable generating series.

  1. Hydrothermal conversion of South African coal fly ash into pure phase Zeolite Na-P1

    CSIR Research Space (South Africa)

    Gitari, MW

    2016-08-01

    Full Text Available South African coal combustion power utilities generate huge amounts of coal fly ash that can be beneficiated into zeolitic products. This chapter reports on the optimization of the presynthesis and synthesis conditions for a pure-phase zeolite Na-P1...

  2. Choline Modulation of the Aβ P1-40 Channel Reconstituted into a Model Lipid Membrane

    Directory of Open Access Journals (Sweden)

    Daniela Meleleo

    2010-01-01

    Full Text Available Nicotinic acetylcholine receptors (AChRs, implicated in memory and learning, in subjects affected by Alzheimer's disease result altered. Stimulation of α7-nAChRs inhibits amyloid plaques and increases ACh release. β-amyloid peptide (AβP forms ion channels in the cell and model phospholipid membranes that are retained responsible in Alzheimer disease. We tested if choline, precursor of ACh, could affect the AβP1-40 channels in oxidized cholesterol (OxCh and in palmitoyl-oleoyl-phosphatidylcholine (POPC:Ch lipid bilayers. Choline concentrations of 5 × 10−11 M–1.5 × 10−8 M added to the cis- or trans-side of membrane quickly increased AβP1-40 ion channel frequency (events/min and ion conductance in OxCh membranes, but not in POPC:Ch membranes. Circular Dichroism (CD spectroscopy shows that after 24 and 48 hours of incubation with AβP1-40, choline stabilizes the random coil conformation of the peptide, making it less prone to fibrillate. These actions seem to be specific in that ACh is ineffective either in solution or on AβP1-40 channel incorporated into PLMs.

  3. Radiative E1-decay of charmonium 1P1 level within sum rules of quantum chromodynamics

    International Nuclear Information System (INIS)

    Martynenko, A.P.

    1991-01-01

    Analysis of radiative decay of 1 P 1 → 1 S 0 + γ charmonium within sum rules of quantum chromodynamics was conducted. The sum rule, taking account of gluon exponential correction, was obtained, and width of Χ → η c + γ decay was calculated

  4. Airborne study of grass allergen (Lol p 1) in different-sized particles.

    Science.gov (United States)

    De Linares, C; Díaz de la Guardia, C; Nieto Lugilde, D; Alba, F

    2010-01-01

    The Poaceae family is considered one of the main causes of pollen allergy in industrialized countries. The aim of this study is to establish the dynamics of the Poaceae allergens and determine their distribution in the different-sized particles in the atmosphere. The air of Granada (southern Spain) was sampled during the pollination period of Poaceae using a cascade impactor and a Hirst-type volumetric collector simultaneously. The sampled airborne allergens were analyzed by indirect ELISA and field emission scanning electron microscopy. Airborne pollen was evaluated with the Spanish Aerobiological Network methodology. Poaceae pollen and allergenic activity have parallel dynamics during the period of maximum pollination, which is reflected in the positive correlations between the 2 variables. In addition, the highest Lol p 1 concentrations were recorded in particle sizes lower than 3.3 mum (stage 4-F). The Spearman correlation test showed that airborne allergens are not dependent on meteorological factors, such as humidity, wind direction or sunshine, however, Lol p 1 allergen correlated positively with Poaceae pollen. The results of the present study confirm that the Lol p 1 allergen is detected more frequently with pollutants than with coarse particles with similar dynamics and a positive correlation between airborne pollen and aeroallergens. Moreover, Lol p 1 is released in stable weather conditions without large changes in humidity or temperature. Copyright 2009 S. Karger AG, Basel.

  5. LMFBR transducer performance in SLSF tests P1 and P2

    International Nuclear Information System (INIS)

    English, J.J.; Anderson, T.T.; Kuzay, T.M.; Wilson, R.E.; Pedersen, D.R.; Kaiser, W.C.; Klingler, W.B.

    1977-01-01

    The reliability and problem areas of sodium-immersed thermocouples, pressure transducers and flowmeters are presented for experiments P1 and P2 of the Sodium Loop Safety Facility (SLSF). The SLSF is a doubly-contained sodium loop situated in a core position of the Engineering Test Reactor at the Idaho National Engineering Laboratory

  6. Heterogeneity of Human Neutrophil CD177 Expression Results from CD177P1 Pseudogene Conversion.

    Directory of Open Access Journals (Sweden)

    Zuopeng Wu

    2016-05-01

    Full Text Available Most humans harbor both CD177neg and CD177pos neutrophils but 1-10% of people are CD177null, placing them at risk for formation of anti-neutrophil antibodies that can cause transfusion-related acute lung injury and neonatal alloimmune neutropenia. By deep sequencing the CD177 locus, we catalogued CD177 single nucleotide variants and identified a novel stop codon in CD177null individuals arising from a single base substitution in exon 7. This is not a mutation in CD177 itself, rather the CD177null phenotype arises when exon 7 of CD177 is supplied entirely by the CD177 pseudogene (CD177P1, which appears to have resulted from allelic gene conversion. In CD177 expressing individuals the CD177 locus contains both CD177P1 and CD177 sequences. The proportion of CD177hi neutrophils in the blood is a heritable trait. Abundance of CD177hi neutrophils correlates with homozygosity for CD177 reference allele, while heterozygosity for ectopic CD177P1 gene conversion correlates with increased CD177neg neutrophils, in which both CD177P1 partially incorporated allele and paired intact CD177 allele are transcribed. Human neutrophil heterogeneity for CD177 expression arises by ectopic allelic conversion. Resolution of the genetic basis of CD177null phenotype identifies a method for screening for individuals at risk of CD177 isoimmunisation.

  7. 1P1 heavy quarkonia production in hadron-hadron collisions

    International Nuclear Information System (INIS)

    Alanakyan, R.A.; Dul'yan, L.S.; Grigoryan, S.G.; Matinyan, S.G.

    1987-01-01

    The production of 1 P 1 -quarkonia (charmonium, bottomonium and toponium) with large transverse momenta is studied in collisions of ultrahigh-energy pp and pp-bar beams. The analysis was carried out in the framework of gluon-gluon fusion mechanism and nonrelativistic quarkonium model

  8. Analysis of glutathione S-transferase (M1, T1 and P1) gene ...

    African Journals Online (AJOL)

    Glutathione S-transferase enzymes are active in detoxifying a wide number of endogenous and exogenous chemical carcinogens and subsequently, are crucial in protecting the DNA. Several studies show some differences in association of glutathione S-transferase M1, T1 and P1 genetic polymorphisms with the risk of ...

  9. Mechanical response of FFTF reference and P1 cladding tubes under transient heating

    International Nuclear Information System (INIS)

    Youngahl, C.A.; Ariman, T.; Lepacek, B.E.

    1977-01-01

    Burst tests of Type 316 stainless steel cladding tube samples subjected to increasing temperature and relatively constant internal pressure were conducted to assist in the pretest analysis of the P1 experiment performed in the Sodium Loop Safety Facility. This paper reports and analyzes the burst test results and those of subsequent transient heating work. The use of a modified extensometer in obtaining mechanical response data for stainless steel in the high temperature range is illustrated, some of such data is provided, and the potential of further experiments and analysis is indicated. Tubing of the same design as Fast Flux Test Facility (FFTF) cladding (20% cold worked, 0.230 in. OD, 15 mil wall) was tested as-received and after annealing or electrolytic thinning. P1 tubing (38% cold worked, 0.230 in. OD, 10 mil wall) was tested before and after aging under conditions anticipated in the P1 reactor experiment. The P1 cladding was designed to simulate FFTF tubing that had experienced irradiation embrittlement and attack by cesium oxide and sodium impurities

  10. Dietary ascorbic acid normalizes ribosomal efficiency for collagen production in skin of streptozotocin-induced diabetic rats

    International Nuclear Information System (INIS)

    Schneir, M.; Imberman, M.; Ramamurthy, N.; Golub, L.

    1987-01-01

    The objective of this study was to quantify the contribution of both ribosome amount and ribosomal efficiency to decreased collagen production in skin of diabetic rats and diabetic rats treated with dietary ascorbic acid. Male Sprague-Dawley rats were distributed equally into the following categories: non-diabetic controls; diabetics; ascorbic acid-treated diabetics. On day-20, all rats were injected with ( 3 H)proline and killed after 2 h. Absolute rate of collagen production, ribosome content, and ribosomal efficiency of collagen production were quantified. Also ribosomal efficiency was quantified for ribosomes in sucrose-gradient fractionated post-mitochondrial supernatants. The results indicate that decreased ribosomal efficiency was responsible for 70% of the decreased collagen production with 30% caused by decreased ribosome content, when measured for total skin or sucrose gradient-isolated ribosomes. At both levels of analysis, ascorbic acid treatment normalized ribosomal efficiency, indicating diabetes-mediated decreased ribosomal efficiency for collagen production is related to a co-translational event, such as procollagen underhydroxylation

  11. Amino acid sequences of ribosomal proteins S11 from Bacillus stearothermophilus and S19 from Halobacterium marismortui. Comparison of the ribosomal protein S11 family.

    Science.gov (United States)

    Kimura, M; Kimura, J; Hatakeyama, T

    1988-11-21

    The complete amino acid sequences of ribosomal proteins S11 from the Gram-positive eubacterium Bacillus stearothermophilus and of S19 from the archaebacterium Halobacterium marismortui have been determined. A search for homologous sequences of these proteins revealed that they belong to the ribosomal protein S11 family. Homologous proteins have previously been sequenced from Escherichia coli as well as from chloroplast, yeast and mammalian ribosomes. A pairwise comparison of the amino acid sequences showed that Bacillus protein S11 shares 68% identical residues with S11 from Escherichia coli and a slightly lower homology (52%) with the homologous chloroplast protein. The halophilic protein S19 is more related to the eukaryotic (45-49%) than to the eubacterial counterparts (35%).

  12. Inhibition of ribosomal RNA synthesis in yeast by ionizing radiations

    Energy Technology Data Exchange (ETDEWEB)

    Weber, K; Kiefer, J [Giessen Univ. (Germany, F.R.). Strahlenzentrum

    1984-12-01

    Synthesis of ribosomal RNA(r-RNA) was measured for 1 h after exposure of Saccharomyces cerevisiae to ..gamma..-rays, X-rays or ..cap alpha.. particles. ..gamma..- or X-ray induced transcription inhibition was always found to decrease exponentially with dose. D/sub 0/ values of 2150 or 1950 Gy were determined in wild-type cells, corresponding to a mean energy of about 60 eV per r-RNA gene. The finding of differential sensitivities of the two high molecular-weight r-RNA species which are cotranscribed from r-DNA is compatible with the existence of a transcription terminating mechanism. Cells from a mutant strain (rad-9), radiation sensitive to colony forming ability, showed an approximately equal sensitivity for transcription inhibition compared to the wild-type (D/sub 0/ (2095) = 2400 Gy). Inactivation of r-RNA synthesis in cells exposed to ..cap alpha..-particles at room-temperature showed a decreased sensitivity with higher particle fluences ('resistant tail'). This phenomenon was drastically reduced if the temperature during irradiation was lowered to 4/sup 0/C and completely abolished when dried cells were used. An inactivation cross-section for ..cap alpha..-particle induced transcription inhibition of about 0.02 ..mu..m/sup 2/ can be derived from the experimental data.

  13. Analysis of Ribosome Inactivating Protein (RIP): A Bioinformatics Approach

    Science.gov (United States)

    Jothi, G. Edward Gnana; Majilla, G. Sahaya Jose; Subhashini, D.; Deivasigamani, B.

    2012-10-01

    In spite of the medical advances in recent years, the world is in need of different sources to encounter certain health issues.Ribosome Inactivating Proteins (RIPs) were found to be one among them. In order to get easy access about RIPs, there is a need to analyse RIPs towards constructing a database on RIPs. Also, multiple sequence alignment was done towards screening for homologues of significant RIPs from rare sources against RIPs from easily available sources in terms of similarity. Protein sequences were retrieved from SWISS-PROT and are further analysed using pair wise and multiple sequence alignment.Analysis shows that, 151 RIPs have been characterized to date. Amongst them, there are 87 type I, 37 type II, 1 type III and 25 unknown RIPs. The sequence length information of various RIPs about the availability of full or partial sequence was also found. The multiple sequence alignment of 37 type I RIP using the online server Multalin, indicates the presence of 20 conserved residues. Pairwise alignment and multiple sequence alignment of certain selected RIPs in two groups namely Group I and Group II were carried out and the consensus level was found to be 98%, 98% and 90% respectively.

  14. Automated genome mining of ribosomal peptide natural products

    Energy Technology Data Exchange (ETDEWEB)

    Mohimani, Hosein; Kersten, Roland; Liu, Wei; Wang, Mingxun; Purvine, Samuel O.; Wu, Si; Brewer, Heather M.; Pasa-Tolic, Ljiljana; Bandeira, Nuno; Moore, Bradley S.; Pevzner, Pavel A.; Dorrestein, Pieter C.

    2014-07-31

    Ribosomally synthesized and posttranslationally modified peptides (RiPPs), especially from microbial sources, are a large group of bioactive natural products that are a promising source of new (bio)chemistry and bioactivity (1). In light of exponentially increasing microbial genome databases and improved mass spectrometry (MS)-based metabolomic platforms, there is a need for computational tools that connect natural product genotypes predicted from microbial genome sequences with their corresponding chemotypes from metabolomic datasets. Here, we introduce RiPPquest, a tandem mass spectrometry database search tool for identification of microbial RiPPs and apply it for lanthipeptide discovery. RiPPquest uses genomics to limit search space to the vicinity of RiPP biosynthetic genes and proteomics to analyze extensive peptide modifications and compute p-values of peptide-spectrum matches (PSMs). We highlight RiPPquest by connection of multiple RiPPs from extracts of Streptomyces to their gene clusters and by the discovery of a new class III lanthipeptide, informatipeptin, from Streptomyces viridochromogenes DSM 40736 as the first natural product to be identified in an automated fashion by genome mining. The presented tool is available at cy-clo.ucsd.edu.

  15. Ribosome reinitiation at leader peptides increases translation of bacterial proteins.

    Science.gov (United States)

    Korolev, Semen A; Zverkov, Oleg A; Seliverstov, Alexandr V; Lyubetsky, Vassily A

    2016-04-16

    Short leader genes usually do not encode stable proteins, although their importance in expression control of bacterial genomes is widely accepted. Such genes are often involved in the control of attenuation regulation. However, the abundance of leader genes suggests that their role in bacteria is not limited to regulation. Specifically, we hypothesize that leader genes increase the expression of protein-coding (structural) genes via ribosome reinitiation at the leader peptide in the case of a short distance between the stop codon of the leader gene and the start codon of the structural gene. For instance, in Actinobacteria, the frequency of leader genes at a distance of 10-11 bp is about 70 % higher than the mean frequency within the 1 to 65 bp range; and it gradually decreases as the range grows longer. A pronounced peak of this frequency-distance relationship is also observed in Proteobacteria, Bacteroidetes, Spirochaetales, Acidobacteria, the Deinococcus-Thermus group, and Planctomycetes. In contrast, this peak falls to the distance of 15-16 bp and is not very pronounced in Firmicutes; and no such peak is observed in cyanobacteria and tenericutes. Generally, this peak is typical for many bacteria. Some leader genes located close to a structural gene probably play a regulatory role as well.

  16. Structure of the quaternary complex between SRP, SR, and translocon bound to the translating ribosome.

    Science.gov (United States)

    Jomaa, Ahmad; Fu, Yu-Hsien Hwang; Boehringer, Daniel; Leibundgut, Marc; Shan, Shu-Ou; Ban, Nenad

    2017-05-19

    During co-translational protein targeting, the signal recognition particle (SRP) binds to the translating ribosome displaying the signal sequence to deliver it to the SRP receptor (SR) on the membrane, where the signal peptide is transferred to the translocon. Using electron cryo-microscopy, we have determined the structure of a quaternary complex of the translating Escherichia coli ribosome, the SRP-SR in the 'activated' state and the translocon. Our structure, supported by biochemical experiments, reveals that the SRP RNA adopts a kinked and untwisted conformation to allow repositioning of the 'activated' SRP-SR complex on the ribosome. In addition, we observe the translocon positioned through interactions with the SR in the vicinity of the ribosome exit tunnel where the signal sequence is extending beyond its hydrophobic binding groove of the SRP M domain towards the translocon. Our study provides new insights into the mechanism of signal sequence transfer from the SRP to the translocon.

  17. Generation of monoclonal antibodies for the assessment of protein purification by recombinant ribosomal coupling

    DEFF Research Database (Denmark)

    Kristensen, Janni; Sperling-Petersen, Hans Uffe; Mortensen, Kim Kusk

    2005-01-01

    We recently described a conceptually novel method for the purification of recombinant proteins with a propensity to form inclusion bodies in the cytoplasm of Escherichia coli. Recombinant proteins were covalently coupled to the E. coli ribosome by fusing them to ribosomal protein 23 (rpL23...... therefore purified rpL23-GFP-His, rpL23-His and GFP from E. coli recombinants using affinity, ion exchange and hydrophobic interaction chromatography. These proteins could be purified with yields of 150, 150 and 1500 microg per gram cellular wet weight, respectively. However, rpL23-GFP-His could only...... proteolytic cleavage sites. We conclude that the generated antibodies can be used to evaluate ribosomal coupling of recombinant target proteins as well as the efficiency of their separation from the ribosome....

  18. Remodeling of ribosomal genes in somatic cells by Xenopus egg extract

    DEFF Research Database (Denmark)

    Østrup, Olga; Hyttel, Poul; Klærke, Dan Arne

    2011-01-01

    Extracts from Xenopus eggs can reprogram gene expression in somatic nuclei, however little is known about the earliest processes associated with the switch in the transcriptional program. We show here that an early reprogramming event is the remodeling of ribosomal chromatin and gene expression....... This occurs within hours of extract treatment and is distinct from a stress response. Egg extract elicits remodeling of the nuclear envelope, chromatin and nucleolus. Nucleolar remodeling involves a rapid and stable decrease in ribosomal gene transcription, and promoter targeting of the nucleolar remodeling...... and elicits a stress-type nuclear response. Thus, an early event of Xenopus egg extract-mediated nuclear reprogramming is the remodeling of ribosomal genes involving nucleolar remodeling complex. Condition-specific and rapid silencing of ribosomal genes may serve as a sensitive marker for evaluation...

  19. Mitochondrial ribosomal protein S18-2 evokes chromosomal instability and transforms primary rat skin fibroblasts

    KAUST Repository

    Kashuba, Elena; Carbone, Ennio; Di Fabrizio, Enzo M.; Tirinato, Luca; Petruchek, Maria; Drummond, Catherine; Kovalevska, Larysa; Gurrapu, Sreeharsha; Mushtaq, Muhammad; Darekar, Suhas D.

    2015-01-01

    We have shown earlier that overexpression of the human mitochondrial ribosomal protein MRPS18-2 (S18-2) led to immortalization of primary rat embryonic fibroblasts. The derived cells expressed the embryonic stem cell markers, and cellular pathways

  20. Dynamic enzyme docking to the ribosome coordinates N-terminal processing with polypeptide folding.

    Science.gov (United States)

    Sandikci, Arzu; Gloge, Felix; Martinez, Michael; Mayer, Matthias P; Wade, Rebecca; Bukau, Bernd; Kramer, Günter

    2013-07-01

    Newly synthesized polypeptides undergo various cotranslational maturation steps, including N-terminal enzymatic processing, chaperone-assisted folding and membrane targeting, but the spatial and temporal coordination of these steps is unclear. We show that Escherichia coli methionine aminopeptidase (MAP) associates with ribosomes through a charged loop that is crucial for nascent-chain processing and cell viability. MAP competes with peptide deformylase (PDF), the first enzyme to act on nascent chains, for binding sites at the ribosomal tunnel exit. PDF has extremely fast association and dissociation kinetics, which allows it to frequently sample ribosomes and ensure the processing of nascent chains after their emergence. Premature recruitment of the chaperone trigger factor, or polypeptide folding, negatively affect processing efficiency. Thus, the fast ribosome association kinetics of PDF and MAP are crucial for the temporal separation of nascent-chain processing from later maturation events, including chaperone recruitment and folding.

  1. Probing the structure of ribosome assembly intermediates in vivo using DMS and hydroxyl radical footprinting.

    Science.gov (United States)

    Hulscher, Ryan M; Bohon, Jen; Rappé, Mollie C; Gupta, Sayan; D'Mello, Rhijuta; Sullivan, Michael; Ralston, Corie Y; Chance, Mark R; Woodson, Sarah A

    2016-07-01

    The assembly of the Escherichia coli ribosome has been widely studied and characterized in vitro. Despite this, ribosome biogenesis in living cells is only partly understood because assembly is coupled with transcription, modification and processing of the pre-ribosomal RNA. We present a method for footprinting and isolating pre-rRNA as it is synthesized in E. coli cells. Pre-rRNA synthesis is synchronized by starvation, followed by nutrient upshift. RNA synthesized during outgrowth is metabolically labeled to facilitate isolation of recent transcripts. Combining this technique with two in vivo RNA probing methods, hydroxyl radical and DMS footprinting, allows the structure of nascent RNA to be probed over time. Together, these can be used to determine changes in the structures of ribosome assembly intermediates as they fold in vivo. Copyright © 2016 Elsevier Inc. All rights reserved.

  2. Ribosomal mutations promote the evolution of antibiotic resistance in a multidrug environment.

    Science.gov (United States)

    Gomez, James E; Kaufmann-Malaga, Benjamin B; Wivagg, Carl N; Kim, Peter B; Silvis, Melanie R; Renedo, Nikolai; Ioerger, Thomas R; Ahmad, Rushdy; Livny, Jonathan; Fishbein, Skye; Sacchettini, James C; Carr, Steven A; Hung, Deborah T

    2017-02-21

    Antibiotic resistance arising via chromosomal mutations is typically specific to a particular antibiotic or class of antibiotics. We have identified mutations in genes encoding ribosomal components in Mycobacterium smegmatis that confer resistance to several structurally and mechanistically unrelated classes of antibiotics and enhance survival following heat shock and membrane stress. These mutations affect ribosome assembly and cause large-scale transcriptomic and proteomic changes, including the downregulation of the catalase KatG, an activating enzyme required for isoniazid sensitivity, and upregulation of WhiB7, a transcription factor involved in innate antibiotic resistance. Importantly, while these ribosomal mutations have a fitness cost in antibiotic-free medium, in a multidrug environment they promote the evolution of high-level, target-based resistance. Further, suppressor mutations can then be easily acquired to restore wild-type growth. Thus, ribosomal mutations can serve as stepping-stones in an evolutionary path leading to the emergence of high-level, multidrug resistance.

  3. Multi-perspective smFRET reveals rate-determining late intermediates of ribosomal translocation

    Science.gov (United States)

    Wasserman, Michael R.; Alejo, Jose L.; Altman, Roger B.; Blanchard, Scott C.

    2016-01-01

    Directional translocation of the ribosome through the messenger RNA open reading frame is a critical determinant of translational fidelity. This process entails a complex interplay of large-scale conformational changes within the actively translating particle, which together coordinate the movement of transfer and messenger RNA substrates with respect to the large and small ribosomal subunits. Using pre-steady state, single-molecule fluorescence resonance energy transfer imaging, we have tracked the nature and timing of these conformational events within the Escherichia coli ribosome from five structural perspectives. Our investigations reveal direct evidence of structurally and kinetically distinct, late intermediates during substrate movement, whose resolution is rate-determining to the translocation mechanism. These steps involve intra-molecular events within the EFG(GDP)-bound ribosome, including exaggerated, reversible fluctuations of the small subunit head domain, which ultimately facilitate peptidyl-tRNA’s movement into its final post-translocation position. PMID:26926435

  4. Multiperspective smFRET reveals rate-determining late intermediates of ribosomal translocation.

    Science.gov (United States)

    Wasserman, Michael R; Alejo, Jose L; Altman, Roger B; Blanchard, Scott C

    2016-04-01

    Directional translocation of the ribosome through the mRNA open reading frame is a critical determinant of translational fidelity. This process entails a complex interplay of large-scale conformational changes within the actively translating particle, which together coordinate the movement of tRNA and mRNA substrates with respect to the large and small ribosomal subunits. Using pre-steady state, single-molecule fluorescence resonance energy transfer imaging, we tracked the nature and timing of these conformational events within the Escherichia coli ribosome from five structural perspectives. Our investigations revealed direct evidence of structurally and kinetically distinct late intermediates during substrate movement, whose resolution determines the rate of translocation. These steps involve intramolecular events within the EF-G-GDP-bound ribosome, including exaggerated, reversible fluctuations of the small-subunit head domain, which ultimately facilitate peptidyl-tRNA's movement into its final post-translocation position.

  5. Serum 25-Hydroxyvitamin D Levels, phosphoprotein enriched in diabetes gene product (PED/PEA-15) and leptin-to-adiponectin ratio in women with PCOS.

    Science.gov (United States)

    Savastano, Silvia; Valentino, Rossella; Di Somma, Carolina; Orio, Francesco; Pivonello, Claudia; Passaretti, Federica; Brancato, Valentina; Formisano, Pietro; Colao, Annamaria; Beguinot, Francesco; Tarantino, Giovanni

    2011-11-23

    Polycystic ovary syndrome (PCOS) is frequently associated with hypovitaminosis D. Vitamin D is endowed with pleiotropic effects, including insulin resistance (IR) and apoptotic pathway. Disruption of the complex mechanism that regulated ovarian apoptosis has been reported in PCOS. Phosphoprotein enriched in diabetes gene product (PED/PEA-15), an anti-apoptotic protein involved in type 2 diabetes mellitus (T2DM), is overexpressed in PCOS women, independently of obesity. Leptin-to-adiponectin ratio (L/A) is a biomarker of IR and low-grade inflammation in PCOS. The aim of the study was to investigate the levels of 25-hydroxy vitamin D (25(OH)D), and L/A, in association with PED/PEA-15 protein abundance, in both lean and overweight/obese (o/o) women with PCOS. PED/PEA-15 protein abundance and circulating levels of 25(OH)D, L/A, sex hormone-binding globulin, and testosterone were evaluated in 90 untreated PCOS patients (25 ± 4 yrs; range 18-34) and 40 healthy controls age and BMI comparable, from the same geographical area. FAI (free androgen index) and the homeostasis model assessment of insulin resistance (HoMA-IR) index were calculated. In o/o PCOS, 25(OH)D levels were significantly lower, and L/A values were significantly higher than in lean PCOS (p involvement in the ovarian imbalance between pro-and anti-apoptotic mechanisms, with high L/A and insulin and low 25(OH)D levels as the main determinants of PED/PEA-15 protein variability. Further studies, involving also different apoptotic pathways or inflammatory cytokines and granulosa cells are mandatory to better define the possible bidirectional relationships between 25(OH)D, PED/PEA-15 protein abundance, leptin and adiponectin in PCOS pathogenesis.

  6. Development and evaluation of an anti-rabies virus phosphoprotein-specific monoclonal antibody for detection of rabies neutralizing antibodies using RFFIT.

    Science.gov (United States)

    Um, Jihye; Chun, Byung Chul; Lee, Yeong Seon; Hwang, Kyu Jam; Yang, Dong-Kun; Park, Jun-Sun; Kim, Su Yeon

    2017-12-01

    Rabies is a major public health problem with a fatality rate close to 100%; however, complete prevention can be achieved through pre- or post-exposure prophylaxis. The rapid fluorescent focus inhibition test (RFFIT) is one of the recommended testing methods to determine the production of neutralizing antibodies after vaccination. Here, we report the development of a new monoclonal antibody (mAb) designed to react specifically with Rabies virus (RABV) phosphoprotein (P protein), and the evaluation of its applicability to the RFFIT and its effectiveness as a diagnostic reagent for human rabies. The mAb KGH P 16B8 was produced to target the P protein of the Korean KGH RABV strain. An indirect immunofluorescence assay (IFA) was conducted to detect various strains of RABV in various cell lines. Alexa-conjugated KGH P 16B8 (16B8-Alexa) was developed for the RFFIT. The IFA test could detect RABV up to a 1:2,500 dilution, with a detection limit comparable to that of a commercial diagnostic reagent. The sensitivity, specificity, positive predictive value, and negative predictive value of the RFFIT using 16B8-Alexa in 414 clinical specimens were 98.67%, 99.47%, 99.55%, and 98.42%, respectively. The results of the RFFIT with 16B8-Alexa were strongly correlated with those obtained using an existing commercial diagnostic reagent (r = 0.995, prabies neutralizing antibody titer and establish a diagnosis in human. Thus, 16B8-Alexa is expected to serve as an alternative diagnostic reagent that is widely accessible, with potentially broad applications beyond those of the RFFIT in Korea. Further studies with 16B8-Alexa should provide insight into the immunological mechanism of the P protein of Korean RABV.

  7. Matrine inhibits the adhesion and migration of BCG823 gastric cancer cells by affecting the structure and function of the vasodilator-stimulated phosphoprotein (VASP).

    Science.gov (United States)

    Zhang, Jing-wei; Su, Ke; Shi, Wen-tao; Wang, Ying; Hu, Peng-chao; Wang, Yang; Wei, Lei; Xiang, Jin; Yang, Fang

    2013-08-01

    Vasodilator-stimulated phosphoprotein (VASP) expression is upregulated in human cancers and correlates with more invasive advanced tumor stages. The aim of this study was to elucidate the mechanisms by which matrine, an alkaloid derived from Sophora species plants, acted on the VASP protein in human gastric cancer cells in vitro. VASP was expressed and purified. Intrinsic fluorescence spectroscopy was used to study the binding of matrine to VASP. CD spectroscopy was used to examine the changes in the VASP protein secondary structure. Human gastric carcinoma cell line BGC823 was tested. Scratch wound and cell adhesion assays were used to detect the cell migration and adhesion, respectively. Real-time PCR and Western blotting assays were used to measure mRNA and protein expression of VASP. In the fluorescence assay, the dissociation constant for binding of matrine to VASP protein was 0.86 mmol/L, thus the direct binding between the two molecules was weak. However, matrine (50 μg/mL) caused obvious change in the secondary structure of VASP protein shown in CD spectrum. Treatments of BGC823 cells with matrine (50 μg/mL) significantly inhibited the cell migration and adhesion. The alkaloid changed the subcellular distribution of VASP and formation of actin stress fibers in BGC823 cells. The alkaloid caused small but statistically significant decreases in VASP protein expression and phosphorylation, but had no significant effect on VASP mRNA expression. Matrine modulates the structure, subcellular distribution, expression and phosphorylation of VASP in human gastric cancer cells, thus inhibiting the cancer cell adhesion and migration.

  8. Mutation of the protein kinase C site in borna disease virus phosphoprotein abrogates viral interference with neuronal signaling and restores normal synaptic activity.

    Directory of Open Access Journals (Sweden)

    Christine M A Prat

    2009-05-01

    Full Text Available Understanding the pathogenesis of infection by neurotropic viruses represents a major challenge and may improve our knowledge of many human neurological diseases for which viruses are thought to play a role. Borna disease virus (BDV represents an attractive model system to analyze the molecular mechanisms whereby a virus can persist in the central nervous system (CNS and lead to altered brain function, in the absence of overt cytolysis or inflammation. Recently, we showed that BDV selectively impairs neuronal plasticity through interfering with protein kinase C (PKC-dependent signaling in neurons. Here, we tested the hypothesis that BDV phosphoprotein (P may serve as a PKC decoy substrate when expressed in neurons, resulting in an interference with PKC-dependent signaling and impaired neuronal activity. By using a recombinant BDV with mutated PKC phosphorylation site on P, we demonstrate the central role of this protein in BDV pathogenesis. We first showed that the kinetics of dissemination of this recombinant virus was strongly delayed, suggesting that phosphorylation of P by PKC is required for optimal viral spread in neurons. Moreover, neurons infected with this mutant virus exhibited a normal pattern of phosphorylation of the PKC endogenous substrates MARCKS and SNAP-25. Finally, activity-dependent modulation of synaptic activity was restored, as assessed by measuring calcium dynamics in response to depolarization and the electrical properties of neuronal networks grown on microelectrode arrays. Therefore, preventing P phosphorylation by PKC abolishes viral interference with neuronal activity in response to stimulation. Our findings illustrate a novel example of viral interference with a differentiated neuronal function, mainly through competition with the PKC signaling pathway. In addition, we provide the first evidence that a viral protein can specifically interfere with stimulus-induced synaptic plasticity in neurons.

  9. Serum 25-Hydroxyvitamin D Levels, phosphoprotein enriched in diabetes gene product (PED/PEA-15 and leptin-to-adiponectin ratio in women with PCOS

    Directory of Open Access Journals (Sweden)

    Savastano Silvia

    2011-11-01

    Full Text Available Abstract Background Polycystic ovary syndrome (PCOS is frequently associated with hypovitaminosis D. Vitamin D is endowed with pleiotropic effects, including insulin resistance (IR and apoptotic pathway. Disruption of the complex mechanism that regulated ovarian apoptosis has been reported in PCOS. Phosphoprotein enriched in diabetes gene product (PED/PEA-15, an anti-apoptotic protein involved in type 2 diabetes mellitus (T2DM, is overexpressed in PCOS women, independently of obesity. Leptin-to-adiponectin ratio (L/A is a biomarker of IR and low-grade inflammation in PCOS. The aim of the study was to investigate the levels of 25-hydroxy vitamin D (25(OHD, and L/A, in association with PED/PEA-15 protein abundance, in both lean and overweight/obese (o/o women with PCOS. Patients and Methods PED/PEA-15 protein abundance and circulating levels of 25(OHD, L/A, sex hormone-binding globulin, and testosterone were evaluated in 90 untreated PCOS patients (25 ± 4 yrs; range 18-34 and 40 healthy controls age and BMI comparable, from the same geographical area. FAI (free androgen index and the homeostasis model assessment of insulin resistance (HoMA-IR index were calculated. Results In o/o PCOS, 25(OHD levels were significantly lower, and L/A values were significantly higher than in lean PCOS (p Conclusions Lower 25(OHD and higher L/A were associated to PED/PEA-15 protein abundance in PCOS, suggesting their involvement in the ovarian imbalance between pro-and anti-apoptotic mechanisms, with high L/A and insulin and low 25(OHD levels as the main determinants of PED/PEA-15 protein variability. Further studies, involving also different apoptotic pathways or inflammatory cytokines and granulosa cells are mandatory to better define the possible bidirectional relationships between 25(OHD, PED/PEA-15 protein abundance, leptin and adiponectin in PCOS pathogenesis.

  10. Structure and functional analysis of the RNA- and viral phosphoprotein-binding domain of respiratory syncytial virus M2-1 protein.

    Directory of Open Access Journals (Sweden)

    Marie-Lise Blondot

    Full Text Available Respiratory syncytial virus (RSV protein M2-1 functions as an essential transcriptional cofactor of the viral RNA-dependent RNA polymerase (RdRp complex by increasing polymerase processivity. M2-1 is a modular RNA binding protein that also interacts with the viral phosphoprotein P, another component of the RdRp complex. These binding properties are related to the core region of M2-1 encompassing residues S58 to K177. Here we report the NMR structure of the RSV M2-1(58-177 core domain, which is structurally homologous to the C-terminal domain of Ebola virus VP30, a transcription co-factor sharing functional similarity with M2-1. The partial overlap of RNA and P interaction surfaces on M2-1(58-177, as determined by NMR, rationalizes the previously observed competitive behavior of RNA versus P. Using site-directed mutagenesis, we identified eight residues located on these surfaces that are critical for an efficient transcription activity of the RdRp complex. Single mutations of these residues disrupted specifically either P or RNA binding to M2-1 in vitro. M2-1 recruitment to cytoplasmic inclusion bodies, which are regarded as sites of viral RNA synthesis, was impaired by mutations affecting only binding to P, but not to RNA, suggesting that M2-1 is associated to the holonucleocapsid by interacting with P. These results reveal that RNA and P binding to M2-1 can be uncoupled and that both are critical for the transcriptional antitermination function of M2-1.

  11. Chimeric Recombinant Human Metapneumoviruses with the Nucleoprotein or Phosphoprotein Open Reading Frame Replaced by That of Avian Metapneumovirus Exhibit Improved Growth In Vitro and Attenuation In Vivo

    Science.gov (United States)

    Pham, Quynh N.; Biacchesi, Stéphane; Skiadopoulos, Mario H.; Murphy, Brian R.; Collins, Peter L.; Buchholz, Ursula J.

    2005-01-01

    Chimeric versions of recombinant human metapneumovirus (HMPV) were generated by replacing the nucleoprotein (N) or phosphoprotein (P) open reading frame with its counterpart from the closely related avian metapneumovirus (AMPV) subgroup C. In Vero cells, AMPV replicated to an approximately 100-fold-higher titer than HMPV. Surprisingly, the N and P chimeric viruses replicated to a peak titer that was 11- and 25-fold higher, respectively, than that of parental HMPV. The basis for this effect is not known but was not due to obvious changes in the efficiency of gene expression. AMPV and the N and P chimeras were evaluated for replication, immunogenicity, and protective efficacy in hamsters. AMPV was attenuated compared to HMPV in this mammalian host on day 5 postinfection, but not on day 3, and only in the nasal turbinates. In contrast, the N and P chimeras were reduced approximately 100-fold in both the upper and lower respiratory tract on day 3 postinfection, although there was little difference by day 5. The N and P chimeras induced a high level of neutralizing serum antibodies and protective efficacy against HMPV; AMPV was only weakly immunogenic and protective against HMPV challenge, reflecting antigenic differences. In African green monkeys immunized intranasally and intratracheally, the mean peak titer of the P chimera was reduced 100- and 1,000-fold in the upper and lower respiratory tracts, whereas the N chimera was reduced only 10-fold in the lower respiratory tract. Both chimeras were comparable to wild-type HMPV in immunogenicity and protective efficacy. Thus, the P chimera is a promising live HMPV vaccine candidate that paradoxically combines improved growth in vitro with attenuation in vivo. PMID:16306583

  12. The ribosome uses two active mechanisms to unwind messenger RNA during translation.

    Science.gov (United States)

    Qu, Xiaohui; Wen, Jin-Der; Lancaster, Laura; Noller, Harry F; Bustamante, Carlos; Tinoco, Ignacio

    2011-07-06

    The ribosome translates the genetic information encoded in messenger RNA into protein. Folded structures in the coding region of an mRNA represent a kinetic barrier that lowers the peptide elongation rate, as the ribosome must disrupt structures it encounters in the mRNA at its entry site to allow translocation to the next codon. Such structures are exploited by the cell to create diverse strategies for translation regulation, such as programmed frameshifting, the modulation of protein expression levels, ribosome localization and co-translational protein folding. Although strand separation activity is inherent to the ribosome, requiring no exogenous helicases, its mechanism is still unknown. Here, using a single-molecule optical tweezers assay on mRNA hairpins, we find that the translation rate of identical codons at the decoding centre is greatly influenced by the GC content of folded structures at the mRNA entry site. Furthermore, force applied to the ends of the hairpin to favour its unfolding significantly speeds translation. Quantitative analysis of the force dependence of its helicase activity reveals that the ribosome, unlike previously studied helicases, uses two distinct active mechanisms to unwind mRNA structure: it destabilizes the helical junction at the mRNA entry site by biasing its thermal fluctuations towards the open state, increasing the probability of the ribosome translocating unhindered; and it mechanically pulls apart the mRNA single strands of the closed junction during the conformational changes that accompany ribosome translocation. The second of these mechanisms ensures a minimal basal rate of translation in the cell; specialized, mechanically stable structures are required to stall the ribosome temporarily. Our results establish a quantitative mechanical basis for understanding the mechanism of regulation of the elongation rate of translation by structured mRNAs. ©2011 Macmillan Publishers Limited. All rights reserved

  13. Kinase-Mediated Regulation of 40S Ribosome Assembly in Human Breast Cancer

    Science.gov (United States)

    2017-02-01

    and will assess if this resistance involves gain-of-function mutations in Ltv1, and if resistance can be overcome with drugs that direct...ribosome assembly factor Ltv1 in both yeast and TNBC cells, and that selective knockdown or silencing of CK1δ, or forced expression of Ltv1 mutant that...cannot be phosphorylated by CK1δ, blocks ribosome assembly in yeast and compromises the growth and survival of TNBC cells. Further, we have shown that

  14. A conserved chloramphenicol binding site at the entrance to the ribosomal peptide exit tunnel

    DEFF Research Database (Denmark)

    Long, Katherine S; Porse, Bo T

    2003-01-01

    , of E.coli 23S rRNA and G2084 (2058 in E.coli numbering) in domain V of H.halobium 23S rRNA. The modification sites overlap with a portion of the macrolide binding site and cluster at the entrance to the peptide exit tunnel. The data correlate with the recently reported chloramphenicol binding site...... on an archaeal ribosome and suggest that a similar binding site is present on the E.coli ribosome....

  15. Production of RNA-protein cross links in γ irradiated E. Coli ribosomes

    International Nuclear Information System (INIS)

    Ekert, Bernard; Giocanti, Nicole

    1976-01-01

    γ irradiation in de-aerated conditions of E. coli MRE 600 ribosomes, labelled with 14 C uracil, leads to a decrease of extractibility of 14 C RNA by lithium chloride 4 M-urea 8 M. On the other hand, the radioactivity of the protein fraction increases with irradiation. These results strongly suggest that RNA-protein cross links are formed in irradiated ribosomes [fr

  16. Evidence for alteration of the membrane-bound ribosomes in Micrococcus luteus cells exposed to lead

    Energy Technology Data Exchange (ETDEWEB)

    Barrow, W; Himmel, M; Squire, P G; Tornabene, T G

    1978-01-01

    Micrococcus luteus cells exposed to Pb(NO/sub 3/)/sub 2/ contained cytosol ribosomal particles and disaggregated membranal ribosomal particles as determined by ultracentrifugation and spectral studies. Approximately 60% of the membrane ribosome fraction from lead exposed cells had a sedimentation value of 8.4S. Cytosol ribosome from lead exposed cells as well as membranal and cytosol ribosomes from control cells were comparable by their contents of predominantly the 70S type with the 50S and 100S present in relatively small amounts. The lead content of the 8.4S components was more than 200 times higher than the components with higher sedimentation coefficients from lead exposed cells and approximately 650 times more than that of control cell ribosomes. The cells exposed to lead, however, showed no adverse effects from the lead in respect to their growth rates and cellular yields. These results indicate that lead is interacting only at specific sites of the membrane and is inducing events initiated only in strategic cellular regions. These data further substantiate that subtle changes do occur in lead exposed cells that show no obvious effects. It is assumed that these minor alterations are, in toto, biologically significant. 24 references, 2 figures, 1 table.

  17. The complete structure of the large subunit of the mammalian mitochondrial ribosome.

    Science.gov (United States)

    Greber, Basil J; Boehringer, Daniel; Leibundgut, Marc; Bieri, Philipp; Leitner, Alexander; Schmitz, Nikolaus; Aebersold, Ruedi; Ban, Nenad

    2014-11-13

    Mitochondrial ribosomes (mitoribosomes) are extensively modified ribosomes of bacterial descent specialized for the synthesis and insertion of membrane proteins that are critical for energy conversion and ATP production inside mitochondria. Mammalian mitoribosomes, which comprise 39S and 28S subunits, have diverged markedly from the bacterial ribosomes from which they are derived, rendering them unique compared to bacterial, eukaryotic cytosolic and fungal mitochondrial ribosomes. We have previously determined at 4.9 Å resolution the architecture of the porcine (Sus scrofa) 39S subunit, which is highly homologous to the human mitoribosomal large subunit. Here we present the complete atomic structure of the porcine 39S large mitoribosomal subunit determined in the context of a stalled translating mitoribosome at 3.4 Å resolution by cryo-electron microscopy and chemical crosslinking/mass spectrometry. The structure reveals the locations and the detailed folds of 50 mitoribosomal proteins, shows the highly conserved mitoribosomal peptidyl transferase active site in complex with its substrate transfer RNAs, and defines the path of the nascent chain in mammalian mitoribosomes along their idiosyncratic exit tunnel. Furthermore, we present evidence that a mitochondrial tRNA has become an integral component of the central protuberance of the 39S subunit where it architecturally substitutes for the absence of the 5S ribosomal RNA, a ubiquitous component of all cytoplasmic ribosomes.

  18. The 5S RNP couples p53 homeostasis to ribosome biogenesis and nucleolar stress.

    Science.gov (United States)

    Sloan, Katherine E; Bohnsack, Markus T; Watkins, Nicholas J

    2013-10-17

    Several proto-oncogenes and tumor suppressors regulate the production of ribosomes. Ribosome biogenesis is a major consumer of cellular energy, and defects result in p53 activation via repression of mouse double minute 2 (MDM2) homolog by the ribosomal proteins RPL5 and RPL11. Here, we report that RPL5 and RPL11 regulate p53 from the context of a ribosomal subcomplex, the 5S ribonucleoprotein particle (RNP). We provide evidence that the third component of this complex, the 5S rRNA, is critical for p53 regulation. In addition, we show that the 5S RNP is essential for the activation of p53 by p14(ARF), a protein that is activated by oncogene overexpression. Our data show that the abundance of the 5S RNP, and therefore p53 levels, is determined by factors regulating 5S complex formation and ribosome integration, including the tumor suppressor PICT1. The 5S RNP therefore emerges as the critical coordinator of signaling pathways that couple cell proliferation with ribosome production. Copyright © 2013 The Authors. Published by Elsevier Inc. All rights reserved.

  19. Could a Proto-Ribosome Emerge Spontaneously in the Prebiotic World?

    Directory of Open Access Journals (Sweden)

    Ilana C. Agmon

    2016-12-01

    Full Text Available An indispensable prerequisite for establishing a scenario of life emerging by natural processes is the requirement that the first simple proto-molecules could have had a realistic probability of self-assembly from random molecular polymers in the prebiotic world. The vestige of the proto-ribosome, which is believed to be still embedded in the contemporary ribosome, is used to assess the feasibility of such spontaneous emergence. Three concentric structural elements of different magnitudes, having a dimeric nature derived from the symmetrical region of the ribosomal large subunit, were suggested to constitute the vestige of the proto-ribosome. It is assumed to have materialized spontaneously in the prebiotic world, catalyzing non-coded peptide bond formation and simple elongation. Probabilistic and energetic considerations are applied in order to evaluate the suitability of the three contenders for being the initial proto-ribosome. The analysis points to the simplest proto-ribosome, comprised of a dimer of tRNA-like molecules presently embedded in the core of the symmetrical region, as the only one having a realistic statistical likelihood of spontaneous emergence from random RNA chains. Hence it offers a feasible starting point for a continuous evolutionary path from the prebiotic matter, through natural processes, into the intricate modern translation system.

  20. Trans-kingdom mimicry underlies ribosome customization by a poxvirus kinase.

    Science.gov (United States)

    Jha, Sujata; Rollins, Madeline G; Fuchs, Gabriele; Procter, Dean J; Hall, Elizabeth A; Cozzolino, Kira; Sarnow, Peter; Savas, Jeffrey N; Walsh, Derek

    2017-06-29

    Ribosomes have the capacity to selectively control translation through changes in their composition that enable recognition of specific RNA elements. However, beyond differential subunit expression during development, evidence for regulated ribosome specification within individual cells has remained elusive. Here we report that a poxvirus kinase phosphorylates serine/threonine residues in the human small ribosomal subunit protein, receptor for activated C kinase (RACK1), that are not phosphorylated in uninfected cells or cells infected by other viruses. These modified residues cluster in an extended loop in RACK1, phosphorylation of which selects for translation of viral or reporter mRNAs with 5' untranslated regions that contain adenosine repeats, so-called polyA-leaders. Structural and phylogenetic analyses revealed that although RACK1 is highly conserved, this loop is variable and contains negatively charged amino acids in plants, in which these leaders act as translational enhancers. Phosphomimetics and inter-species chimaeras have shown that negative charge in the RACK1 loop dictates ribosome selectivity towards viral RNAs. By converting human RACK1 to a charged, plant-like state, poxviruses remodel host ribosomes so that adenosine repeats erroneously generated by slippage of the viral RNA polymerase confer a translational advantage. Our findings provide insight into ribosome customization through trans-kingdom mimicry and the mechanics of species-specific leader activity that underlie poxvirus polyA-leaders.

  1. Mutational analysis of S12 protein and implications for the accuracy of decoding by the ribosome.

    Science.gov (United States)

    Sharma, Divya; Cukras, Anthony R; Rogers, Elizabeth J; Southworth, Daniel R; Green, Rachel

    2007-12-07

    The fidelity of aminoacyl-tRNA selection by the ribosome depends on a conformational switch in the decoding center of the small ribosomal subunit induced by cognate but not by near-cognate aminoacyl-tRNA. The aminoglycosides paromomycin and streptomycin bind to the decoding center and induce related structural rearrangements that explain their observed effects on miscoding. Structural and biochemical studies have identified ribosomal protein S12 (as well as specific nucleotides in 16S ribosomal RNA) as a critical molecular contributor in distinguishing between cognate and near-cognate tRNA species as well as in promoting more global rearrangements in the small subunit, referred to as "closure." Here we use a mutational approach to define contributions made by two highly conserved loops in S12 to the process of tRNA selection. Most S12 variant ribosomes tested display increased levels of fidelity (a "restrictive" phenotype). Interestingly, several variants, K42A and R53A, were substantially resistant to the miscoding effects of paromomycin. Further characterization of the compromised paromomycin response identified a probable second, fidelity-modulating binding site for paromomycin in the 16S ribosomal RNA that facilitates closure of the small subunit and compensates for defects associated with the S12 mutations.

  2. Diverse Regulators of Human Ribosome Biogenesis Discovered by Changes in Nucleolar Number

    Directory of Open Access Journals (Sweden)

    Katherine I. Farley-Barnes

    2018-02-01

    Full Text Available Ribosome biogenesis is a highly regulated, essential cellular process. Although studies in yeast have established some of the biological principles of ribosome biogenesis, many of the intricacies of its regulation in higher eukaryotes remain unknown. To understand how ribosome biogenesis is globally integrated in human cells, we conducted a genome-wide siRNA screen for regulators of nucleolar number. We found 139 proteins whose depletion changed the number of nucleoli per nucleus from 2–3 to only 1 in human MCF10A cells. Follow-up analyses on 20 hits found many (90% to be essential for the nucleolar functions of rDNA transcription (7, pre-ribosomal RNA (pre-rRNA processing (16, and/or global protein synthesis (14. This genome-wide analysis exploits the relationship between nucleolar number and function to discover diverse cellular pathways that regulate the making of ribosomes and paves the way for further exploration of the links between ribosome biogenesis and human disease.

  3. Miscoding-induced stalling of substrate translocation on the bacterial ribosome.

    Science.gov (United States)

    Alejo, Jose L; Blanchard, Scott C

    2017-10-10

    Directional transit of the ribosome along the messenger RNA (mRNA) template is a key determinant of the rate and processivity of protein synthesis. Imaging of the multistep translocation mechanism using single-molecule FRET has led to the hypothesis that substrate movements relative to the ribosome resolve through relatively long-lived late intermediates wherein peptidyl-tRNA enters the P site of the small ribosomal subunit via reversible, swivel-like motions of the small subunit head domain within the elongation factor G (GDP)-bound ribosome complex. Consistent with translocation being rate-limited by recognition and productive engagement of peptidyl-tRNA within the P site, we now show that base-pairing mismatches between the peptidyl-tRNA anticodon and the mRNA codon dramatically delay this rate-limiting, intramolecular process. This unexpected relationship between aminoacyl-tRNA decoding and translocation suggests that miscoding antibiotics may impact protein synthesis by impairing the recognition of peptidyl-tRNA in the small subunit P site during EF-G-catalyzed translocation. Strikingly, we show that elongation factor P (EF-P), traditionally known to alleviate ribosome stalling at polyproline motifs, can efficiently rescue translocation defects arising from miscoding. These findings help reveal the nature and origin of the rate-limiting steps in substrate translocation on the bacterial ribosome and indicate that EF-P can aid in resuming translation elongation stalled by miscoding errors.

  4. Organization of proteins in mammalian mitochondrial ribosomes: accessibility to lactoperoxidase-catalyzed radioiodination

    International Nuclear Information System (INIS)

    Denslow, N.D.; O'Brien, T.W.

    1984-01-01

    To assess the relative exposure of individual ribosomal proteins (r-proteins) in the large and small subunits of the bovine mitochondrial ribosome, double label iodination technique was used. Regions of r-proteins exposed in purified ribosomal subunits were labeled with 131 I using the lactoperoxidase-catalyzed iodination system, and additional reactive groups available upon denaturing the r-proteins in urea were labeled with 125 I using the chloramine-T mediated reaction. The ratio of 131 I to 125 I incorporated into individual proteins under these conditions is representative of the degree of exposure for each of the proteins in the subunits. In this manner, the r-proteins have been grouped into 3 classes depending on their degree of exposure: high exposure, intermediate exposure, and essentially buried. While both subunits have a few proteins in the highly exposed group, and a large number of proteins in the intermediate exposure group, only the large ribosomal subunit has an appreciable number of proteins which appear essentially buried. The more buried proteins may serve mainly structural roles, perhaps acting as assembly proteins, since many from this group bind to ribosomal RNA. The more superficially disposed proteins may comprise binding sites for macromolecules that interact with ribosomes during protein synthesis, as well as stabilizing the association of the large and small subribosomal particles

  5. Ribosomal and hematopoietic defects in induced pluripotent stem cells derived from Diamond Blackfan anemia patients.

    Science.gov (United States)

    Garçon, Loïc; Ge, Jingping; Manjunath, Shwetha H; Mills, Jason A; Apicella, Marisa; Parikh, Shefali; Sullivan, Lisa M; Podsakoff, Gregory M; Gadue, Paul; French, Deborah L; Mason, Philip J; Bessler, Monica; Weiss, Mitchell J

    2013-08-08

    Diamond Blackfan anemia (DBA) is a congenital disorder with erythroid (Ery) hypoplasia and tissue morphogenic abnormalities. Most DBA cases are caused by heterozygous null mutations in genes encoding ribosomal proteins. Understanding how haploinsufficiency of these ubiquitous proteins causes DBA is hampered by limited availability of tissues from affected patients. We generated induced pluripotent stem cells (iPSCs) from fibroblasts of DBA patients carrying mutations in RPS19 and RPL5. Compared with controls, DBA fibroblasts formed iPSCs inefficiently, although we obtained 1 stable clone from each fibroblast line. RPS19-mutated iPSCs exhibited defects in 40S (small) ribosomal subunit assembly and production of 18S ribosomal RNA (rRNA). Upon induced differentiation, the mutant clone exhibited globally impaired hematopoiesis, with the Ery lineage affected most profoundly. RPL5-mutated iPSCs exhibited defective 60S (large) ribosomal subunit assembly, accumulation of 12S pre-rRNA, and impaired erythropoiesis. In both mutant iPSC lines, genetic correction of ribosomal protein deficiency via complementary DNA transfer into the "safe harbor" AAVS1 locus alleviated abnormalities in ribosome biogenesis and hematopoiesis. Our studies show that pathological features of DBA are recapitulated by iPSCs, provide a renewable source of cells to model various tissue defects, and demonstrate proof of principle for genetic correction strategies in patient stem cells.

  6. Product Plan of New Generation System Camera "OLYMPUS PEN E-P1"

    Science.gov (United States)

    Ogawa, Haruo

    "OLYMPUS PEN E-P1", which is new generation system camera, is the first product of Olympus which is new standard "Micro Four-thirds System" for high-resolution mirror-less cameras. It continues good sales by the concept of "small and stylish design, easy operation and SLR image quality" since release on July 3, 2009. On the other hand, the half-size film camera "OLYMPUS PEN" was popular by the concept "small and stylish design and original mechanism" since the first product in 1959 and recorded sale number more than 17 million with 17 models. By the 50th anniversary topic and emotional value of the Olympus pen, Olympus pen E-P1 became big sales. I would like to explain the way of thinking of the product plan that included not only the simple functional value but also emotional value on planning the first product of "Micro Four-thirds System".

  7. Development of Quasi-3DOF upper limb rehabilitation system using ER brake: PLEMO-P1

    International Nuclear Information System (INIS)

    Kikuchi, T; Fukushima, K; Furusho, J; Ozawa, T

    2009-01-01

    In recent years, many researchers have studied the potential of using robotics technology to assist and quantify the motor functions for neuron-rehabilitation. Some kinds of haptic devices have been developed and evaluated its efficiency with clinical tests, for example, upper limb training for patients with spasticity after stroke. However, almost all the devices are active-type (motor-driven) haptic devices and they basically require high-cost safety system compared to passive-type (brake-based) devices. In this study, we developed a new practical haptic device 'PLEMO-P1'; this system adopted ER brakes as its force generators. In this paper, the mechanism of PLEMO-P1 and its software for a reaching rehabilitation are described.

  8. Development of Quasi-3DOF upper limb rehabilitation system using ER brake: PLEMO-P1

    Energy Technology Data Exchange (ETDEWEB)

    Kikuchi, T; Fukushima, K; Furusho, J; Ozawa, T [Graduate School of Engineering, Osaka University, 2-1 Yamadaoka, Suita, Osaka 565-0871 (Japan)], E-mail: kikuchi@mech.eng.osaka-u.ac.jp

    2009-02-01

    In recent years, many researchers have studied the potential of using robotics technology to assist and quantify the motor functions for neuron-rehabilitation. Some kinds of haptic devices have been developed and evaluated its efficiency with clinical tests, for example, upper limb training for patients with spasticity after stroke. However, almost all the devices are active-type (motor-driven) haptic devices and they basically require high-cost safety system compared to passive-type (brake-based) devices. In this study, we developed a new practical haptic device 'PLEMO-P1'; this system adopted ER brakes as its force generators. In this paper, the mechanism of PLEMO-P1 and its software for a reaching rehabilitation are described.

  9. Complexity and diversity of the NKR-P1:Clr (Klrb1:Clec2 recognition systems

    Directory of Open Access Journals (Sweden)

    Christina L Kirkham

    2014-06-01

    Full Text Available The NKR-P1 receptors were identified as prototypical natural killer (NK cell surface antigens and later shown to be conserved from rodents to humans on NK cells and subsets of T cells. C-type lectin-like in nature, they were originally shown to be capable of activating NK cell function and to recognize ligands on tumour cells. However, certain family members have subsequently been shown to be capable of inhibiting NK cell activity, and to recognize proteins encoded by a family of genetically linked C-type lectin-related (Clr ligands. Some of these ligands are expressed by normal, healthy cells, and modulated during transformation, infection, and cellular stress, while other ligands are upregulated during the immune response and during pathological circumstances. Here, we discuss historical and recent developments in NKR-P1 biology that demonstrate this NK receptor-ligand system to be far more complex and diverse than originally anticipated.

  10. Structure of the conserved hypothetical protein MAL13P1.257 from Plasmodium falciparum

    International Nuclear Information System (INIS)

    Holmes, Margaret A.; Buckner, Frederick S.; Van Voorhis, Wesley C.; Mehlin, Christopher; Boni, Erica; Earnest, Thomas N.; DeTitta, George; Luft, Joseph; Lauricella, Angela; Anderson, Lori; Kalyuzhniy, Oleksandr; Zucker, Frank; Schoenfeld, Lori W.; Hol, Wim G. J.; Merritt, Ethan A.

    2006-01-01

    The crystal structure of a conserved hypothetical protein, MAL13P1.257 from P. falciparum, has been determined at 2.17 Å resolution. The structure represents a new protein fold and is the first structural representative for Pfam sequence family PF05907. The structure of a conserved hypothetical protein, PlasmoDB sequence MAL13P1.257 from Plasmodium falciparum, Pfam sequence family PF05907, has been determined as part of the structural genomics effort of the Structural Genomics of Pathogenic Protozoa consortium. The structure was determined by multiple-wavelength anomalous dispersion at 2.17 Å resolution. The structure is almost entirely β-sheet; it consists of 15 β-strands and one short 3 10 -helix and represents a new protein fold. The packing of the two monomers in the asymmetric unit indicates that the biological unit may be a dimer.

  11. TRIMARAN: a three dimensional multigroup P1 Monte Carlo code for criticality studies

    International Nuclear Information System (INIS)

    Ermumcu, G.; Gonnord, J.; Nimal, J.C.

    1980-01-01

    TRIMARAN is developed for safety analysis of nuclear components containing fissionable materials: shipping casks, storage and cooling pools, manufacture and reprocessing plants. It solves the transport equation by Monte Carlo method, in general three dimensional geometry with multigroup P1 approximation. A special representation of cross sections and numbers has been developed in order to reduce considerably the computing cost and allow this three dimensional code to compete with standard numerical program used in parametric studies

  12. TRIMARAN: a three dimensional multigroup P1 Monte Carlo code for criticallity studies

    International Nuclear Information System (INIS)

    Ermuncu, G.; Gonnord, J.; Nimal, J.C.

    1980-04-01

    TRIMARAN is developed for safety analysis of nuclar components containing fissionnable materials: shipping casks, storage and cooling pools, manufacture and reprocessing plants. It solves the transport equation by Monte Carlo method in general three dimensional geometry with multigroup P1 approximation. A special representation of cross sections and numbers has been developed in order to reduce considerably the computing cost and allow this three dimensional code to compete with standard numerical program used in parametric studies

  13. Calculations of Edwards' pipe blowdown tests using the code TRAC P1

    International Nuclear Information System (INIS)

    O'Mahoney, R.

    1979-05-01

    The paper describes the results obtained using the non-thermal equilibrium LOCA code TRAC-P1 for two of a series of Pipe Blowdown Tests. Comparisons are made with the experimental values and RELAP-UK Mark IV predictions. Some discrepancies between prediction and experiment are observed, and certain aspects of the model are considered to warrant possible further attention. (U.K.)

  14. Characterization of P1 promoter activity of the β-galactoside α2,6 ...

    Indian Academy of Sciences (India)

    2012-04-05

    Apr 5, 2012 ... The level of β-galactoside α2,6-sialyltransferase I (ST6Gal I) mRNA, encoded by the gene siat1, is increased in malignant tissues. Expression is regulated by different promoters – P1, P2 and P3 – generating three mRNA isoforms. H, X and YZ. In cervical cancer tissue the mRNA isoform H, which results ...

  15. Electron-impact coherence parameters for 41 P 1 excitation of zinc

    Science.gov (United States)

    Piwiński, Mariusz; Kłosowski, Łukasz; Chwirot, Stanisław; Fursa, Dmitry V.; Bray, Igor; Das, Tapasi; Srivastava, Rajesh

    2018-04-01

    We present electron-impact coherence parameters (EICP) for electron-impact excitation of 41 P 1 state of zinc atoms for collision energies 40 eV and 60 eV. The experimental results are presented together with convergent close-coupling and relativistic distorted-wave approximation theoretical predictions. The results are compared and discussed with EICP data for collision energies 80 eV and 100 eV.

  16. Alfalfa mosaic virus replicase proteins P1 and P2 interact and colocalize at the vacuolar membrane

    NARCIS (Netherlands)

    Heijden, van der M.W.; Carette, J.E.; Reinhoud, P.J.; Haegi, A.; Bol, J.F.

    2001-01-01

    Replication of Alfalfa mosaic virus (AMV) RNAs depends on the virus-encoded proteins P1 and P2. P1 contains methyltransferase- and helicase-like domains, and P2 contains a polymerase-like domain. Coimmunoprecipitation experiments revealed an interaction between in vitro translated-P1 and P2 and

  17. Lateral supraorbital approach to ipsilateral PCA-P1 and ICA-PCoA aneurysms.

    Science.gov (United States)

    Goehre, Felix; Jahromi, Behnam Rezai; Elsharkawy, Ahmed; Lehto, Hanna; Shekhtman, Oleg; Andrade-Barazarte, Hugo; Munoz, Francisco; Hijazy, Ferzat; Makhkamov, Makhkam; Hernesniemi, Juha

    2015-01-01

    Aneurysms of the posterior cerebral artery (PCA) are rare and often associated with anterior circulation aneurysms. The lateral supraorbital approach allows for a very fast and safe approach to the ipsilateral lesions Circle of Willis. A technical note on the successful clip occlusion of two aneurysms in the anterior and posterior Circle of Willis via this less invasive approach has not been published before. The objective of this technical note is to describe the simultaneous microsurgical clip occlusion of an ipsilateral PCA-P1 and an internal carotid artery - posterior communicating artery (ICA-PCoA) aneurysm via the lateral supraorbital approach. The authors present a technical report of successful clip occlusions of ipsilateral located PCA-P1 and ICA-PCoA aneurysms. A 59-year-old female patient was diagnosed with a PCA-P1 and an ipsilateral ICA-PCoA aneurysm by computed tomography angiography (CTA) after an ischemic stroke secondary to a contralateral ICA dissection. The patient underwent microsurgical clipping after a lateral supraorbital craniotomy. The intraoperative indocyanine green (ICG) videoangiography and the postoperative CTA showed a complete occlusion of both aneurysms; the parent vessels (ICA and PCA) were patent. The patient presents postoperative no new neurologic deficit. The lateral supraorbital approach is suitable for the simultaneous microsurgical treatment of proximal anterior circulation and ipsilateral proximal PCA aneurysms. Compared to endovascular treatment, direct visual control of brainstem perforators is possible.

  18. Sim@P1: Using Cloudscheduler for offline processing on the ATLAS HLT farm

    CERN Document Server

    Berghaus, Frank; The ATLAS collaboration

    2018-01-01

    The Simulation at Point1 (Sim@P1) project was built in 2013 to take advantage of the ATLAS Trigger and Data Acquisition High Level Trigger (HLT) farm. The HLT farm provides more than 2,000 compute nodes, which are critical to ATLAS during data taking. When ATLAS is not recording data, this large compute resource is used to generate and process simulation data for the experiment. The Sim@P1 system uses virtual machines, deployed by OpenStack, in order to isolate the resources from the ATLAS technical and control network. During the upcoming long shutdown in 2019 (LS2), the HLT farm including the Sim@P1 infrastructure will be upgraded. A previous paper on the project emphasized the need for “simple, reliable, and efficient tools” to quickly switch between data acquisition operation and offline processing.In this contribution we assess various options for updating and simplifying the provisional tools. Cloudscheduler is a tool for provisioning cloud resources for batch computing that has been managing cloud ...

  19. Linezolid-Dependent Function and Structure Adaptation of Ribosomes in a Staphylococcus epidermidis Strain Exhibiting Linezolid Dependence

    Science.gov (United States)

    Kokkori, Sofia; Apostolidi, Maria; Tsakris, Athanassios; Pournaras, Spyros

    2014-01-01

    Linezolid-dependent growth was recently reported in Staphylococcus epidermidis clinical strains carrying mutations associated with linezolid resistance. To investigate this unexpected behavior at the molecular level, we isolated active ribosomes from one of the linezolid-dependent strains and we compared them with ribosomes isolated from a wild-type strain. Both strains were grown in the absence and presence of linezolid. Detailed biochemical and structural analyses revealed essential differences in the function and structure of isolated ribosomes which were assembled in the presence of linezolid. The catalytic activity of peptidyltransferase was found to be significantly higher in the ribosomes derived from the linezolid-dependent strain. Interestingly, the same ribosomes exhibited an abnormal ribosomal subunit dissociation profile on a sucrose gradient in the absence of linezolid, but the profile was restored after treatment of the ribosomes with an excess of the antibiotic. Our study suggests that linezolid most likely modified the ribosomal assembly procedure, leading to a new functional ribosomal population active only in the presence of linezolid. Therefore, the higher growth rate of the partially linezolid-dependent strains could be attributed to the functional and structural adaptations of ribosomes to linezolid. PMID:24890589

  20. The importance of ribosome production, and the 5S RNP-MDM2 pathway, in health and disease.

    Science.gov (United States)

    Pelava, Andria; Schneider, Claudia; Watkins, Nicholas J

    2016-08-15

    Ribosomes are abundant, large RNA-protein complexes that are the source of all protein synthesis in the cell. The production of ribosomes is an extremely energetically expensive cellular process that has long been linked to human health and disease. More recently, it has been shown that ribosome biogenesis is intimately linked to multiple cellular signalling pathways and that defects in ribosome production can lead to a wide variety of human diseases. Furthermore, changes in ribosome production in response to nutrient levels in the diet lead to metabolic re-programming of the liver. Reduced or abnormal ribosome production in response to cellular stress or mutations in genes encoding factors critical for ribosome biogenesis causes the activation of the tumour suppressor p53, which leads to re-programming of cellular transcription. The ribosomal assembly intermediate 5S RNP (ribonucleoprotein particle), containing RPL5, RPL11 and the 5S rRNA, accumulates when ribosome biogenesis is blocked. The excess 5S RNP binds to murine double minute 2 (MDM2), the main p53-suppressor in the cell, inhibiting its function and leading to p53 activation. Here, we discuss the involvement of ribosome biogenesis in the homoeostasis of p53 in the cell and in human health and disease. © 2016 The Author(s).

  1. Dual binding mode of the nascent polypeptide-associated complex reveals a novel universal adapter site on the ribosome.

    Science.gov (United States)

    Pech, Markus; Spreter, Thomas; Beckmann, Roland; Beatrix, Birgitta

    2010-06-18

    Nascent polypeptide-associated complex (NAC) was identified in eukaryotes as the first cytosolic factor that contacts the nascent polypeptide chain emerging from the ribosome. NAC is present as a homodimer in archaea and as a highly conserved heterodimer in eukaryotes. Mutations in NAC cause severe embryonically lethal phenotypes in mice, Drosophila melanogaster, and Caenorhabditis elegans. In the yeast Saccharomyces cerevisiae NAC is quantitatively associated with ribosomes. Here we show that NAC contacts several ribosomal proteins. The N terminus of betaNAC, however, specifically contacts near the tunnel exit ribosomal protein Rpl31, which is unique to eukaryotes and archaea. Moreover, the first 23 amino acids of betaNAC are sufficient to direct an otherwise non-associated protein to the ribosome. In contrast, alphaNAC (Egd2p) contacts Rpl17, the direct neighbor of Rpl31 at the ribosomal tunnel exit site. Rpl31 was also recently identified as a contact site for the SRP receptor and the ribosome-associated complex. Furthermore, in Escherichia coli peptide deformylase (PDF) interacts with the corresponding surface area on the eubacterial ribosome. In addition to the previously identified universal adapter site represented by Rpl25/Rpl35, we therefore refer to Rpl31/Rpl17 as a novel universal docking site for ribosome-associated factors on the eukaryotic ribosome.

  2. Ribosomal proteins L11 and L10.(L12)4 and the antibiotic thiostrepton interact with overlapping regions of the 23 S rRNA backbone in the ribosomal GTPase centre

    DEFF Research Database (Denmark)

    Rosendahl, G; Douthwaite, S

    1993-01-01

    RNA, and to investigate how this interaction is influenced by other ribosomal components. Complexes were characterized in both naked 23 S rRNA and ribosomes from an E. coli L11-minus strain, before and after reconstitution with L11. The protein protects 17 riboses between positions 1058 and 1085 in the naked 23 S r......The Escherichia coli ribosomal protein (r-protein) L11 and its binding site on 23 S ribosomal RNA (rRNA) are associated with ribosomal hydrolysis of guanosine 5'-triphosphate (GTP). We have used hydroxyl radical footprinting to map the contacts between L11 and the backbone riboses in 23 S r......)4 and other proteins within the ribosome. The antibiotics thiostrepton and micrococcin inhibit the catalytic functions of this region by slotting in between the accessible loops and interacting with nucleotides there....

  3. Enhanced casein kinase II activity during mouse embryogenesis. Identification of a 110-kDa phosphoprotein as the major phosphorylation product in mouse embryos and Krebs II mouse ascites tumor cells

    DEFF Research Database (Denmark)

    Schneider, H R; Reichert, G H; Issinger, O G

    1986-01-01

    Mouse embryos at various stages of development were used to study the relationship of protein kinase activities with normal embryogenesis. Casein kinase II (CKII) activity in developing mouse embryos shows a 3-4-fold activity increase at day 12 of gestation. Together with the CKII activity...... mouse tumour cells also show an enhanced CKII activity. Here too, a 110-kDa phosphoprotein was the major phosphoryl acceptor. Partial proteolytic digestion shows that both proteins are identical. Other protein kinases tested (cAMP- and cGMP-dependent protein kinases) only show a basal level of enzyme...

  4. Novel mRNA-specific effects of ribosome drop-off on translation rate and polysome profile.

    Directory of Open Access Journals (Sweden)

    Pierre Bonnin

    2017-05-01

    Full Text Available The well established phenomenon of ribosome drop-off plays crucial roles in translational accuracy and nutrient starvation responses during protein translation. When cells are under stress conditions, such as amino acid starvation or aminoacyl-tRNA depletion due to a high level of recombinant protein expression, ribosome drop-off can substantially affect the efficiency of protein expression. Here we introduce a mathematical model that describes the effects of ribosome drop-off on the ribosome density along the mRNA and on the concomitant protein synthesis rate. Our results show that ribosome premature termination may lead to non-intuitive ribosome density profiles, such as a ribosome density which increases from the 5' to the 3' end. Importantly, the model predicts that the effects of ribosome drop-off on the translation rate are mRNA-specific, and we quantify their resilience to drop-off, showing that the mRNAs which present ribosome queues are much less affected by ribosome drop-off than those which do not. Moreover, among those mRNAs that do not present ribosome queues, resilience to drop-off correlates positively with the elongation rate, so that sequences using fast codons are expected to be less affected by ribosome drop-off. This result is consistent with a genome-wide analysis of S. cerevisiae, which reveals that under favourable growth conditions mRNAs coding for proteins involved in the translation machinery, known to be highly codon biased and using preferentially fast codons, are highly resilient to ribosome drop-off. Moreover, in physiological conditions, the translation rate of mRNAs coding for regulatory, stress-related proteins, is less resilient to ribosome drop-off. This model therefore allows analysis of variations in the translational efficiency of individual mRNAs by accounting for the full range of known ribosome behaviours, as well as explaining mRNA-specific variations in ribosome density emerging from ribosome profiling

  5. Ribosomal binding region for the antibiotic tiamulin: stoichiometry, subunit location, and affinity for various analogs.

    Science.gov (United States)

    Högenauer, G; Ruf, C

    1981-01-01

    Equilibrium dialysis experiments with a highly purified preparation of labeled tiamulin, a semisynthetic derivative of the antibiotic pleuromutilin, and Escherichia coli ribosomes allowed the determination of two binding sites for the drug. The binding reaction showed a cooperative effect. Of the two subunits, the 50S particle was able to bind the antibiotic in a 1:1 stoichiometry. Hence, the 50S subunit contributed predominantly to the binding energy which held the antibiotic to the ribosomes. The 30S subunit, showing no strong affinity for the drug, may be needed for the generation of the second binding site in the 70S particle. If depleted of ammonium ions, 70S ribosomes lost their binding capacity for the antibiotic. The attachment sites for tiamulin could be restored by heating the ribosomes to 40 degrees C in the presence of either ammonium ions or the antibiotic. Other pleuromutilin derivatives displaced labeled tiamulin from its ribosomal binding sites. By quantifying this competition, the relative affinity of various pleuromutilin derivatives for E. coli ribosomes was determined. The binding correlated with the minimal inhibitory concentrations of these compounds against E. coli. When compared with the minimal inhibitory concentrations of these compounds against E. coli. When compared with the minimal inhibitory concentrations against E. coli. When compared with the minimal inhibitory concentrations against Staphylococcus aureus, the correlation was less strict, but the same trend prevailed. These results suggest that the antibacterial activities of various pleuromutilin derivatives on a given test organism are mainly determined by the strength of binding to the ribosomes within the bacterial cell. PMID:6751216

  6. The 70S ribosome modulates the ATPase activity of Escherichia coli YchF.

    Science.gov (United States)

    Becker, Marion; Gzyl, Katherine E; Altamirano, Alvin M; Vuong, Anthony; Urban, Kirstin; Wieden, Hans-Joachim

    2012-10-01

    YchF is one of two universally conserved GTPases with unknown cellular function. As a first step toward elucidating YchF's cellular role, we performed a detailed biochemical characterization of the protein from Escherichia coli. Our data from fluorescence titrations not only confirmed the surprising finding that YchFE.coli binds adenine nucleotides more efficiently than guanine nucleotides, but also provides the first evidence suggesting that YchF assumes two distinct conformational states (ATP- and ADP-bound) consistent with the functional cycle of a typical GTPase. Based on an in vivo pull-down experiment using a His-tagged variant of YchF from E. coli (YchFE.coli), we were able to isolate a megadalton complex containing the 70S ribosome. Based on this finding, we report the successful reconstitution of a YchF•70S complex in vitro, revealing an affinity (KD) of the YchFE.coli•ADPNP complex for 70S ribosomes of 3 μM. The in vitro reconstitution data also suggests that the identity of the nucleotide-bound state of YchF (ADP or ATP) modulates its affinity for 70S ribosomes. A detailed Michaelis-Menten analysis of YchF's catalytic activity in the presence and the absence of the 70S ribosome and its subunits revealed for the first time that the 70S ribosome is able to stimulate YchF's ATPase activity (~10-fold), confirming the ribosome as part of the functional cycle of YchF. Our findings taken together with previously reported data for the human homolog of YchF (hOLA1) indicate a high level of evolutionary conservation in the enzymatic properties of YchF and suggest that the ribosome is the main functional partner of YchF not only in bacteria.

  7. Acoustic detection of boiling in the Sodium Loop Safety Facility in-reactor experiment P1

    International Nuclear Information System (INIS)

    Carey, W.M.; Anderson, T.T.; Bobis, J.P.

    1976-06-01

    Acoustic data were obtained from two high-temperature lithium niobate microphones on the loop background noise and transient pressure pulses during the Sodium Loop Safety Facility (SLSF) P1 in-reactor experiment. This experiment simulated an LMFBR loss-of-piping-integrity (LOPI) transient on a nineteen element, end-of-life, enriched-UO 2 fuel assembly. The microphones were exposed to liquid sodium at a distance 4.85 meters above the reactor core at temperatures between 315 0 and 590 0 C. The distance and location of the microphones in the P1 Test Train provided an attenuative transmission path which was undesirable for optimum acoustic detection of sodium boiling and fuel failure. The data gathered on the loop background noise was observed to be dominated by pump and electrical noise at frequencies below 1.5 KHz and appeared to be dominated by flow induced local turbulence noise at higher frequencies. During the period of time that the sodium in the fuel assembly was at its saturation temperature 943 0 C (1730 0 F), as indicated by the wire wrap thermocouples, several discrete pulses were observed with peak-to-peak pressure between 3.3 kPa and 7.9 kPa and center frequencies between 360 and 550 Hz. The pulses occurred at two separate gradually increasing repetition rates. These observations appear to be consistent with the result of an impulsive forcing function interacting with a band passed Helmholtz resonator. These data are consistent with the hypothesis that sodium boiling occurred in the P1 fuel assembly, resulting in the formation of individual voids that collapsed upon reaching the subcooled sodium. These data provide pertinent information regarding the feasibility of sodium boiling detection and may provide additional insight into the dynamics of the void behavior

  8. P1 plasmid replication: initiator sequestration is inadequate to explain control by initiator-binding sites.

    OpenAIRE

    Pal, S K; Chattoraj, D K

    1988-01-01

    The unit-copy plasmid replicon mini-P1 consists of an origin, a gene for an initiator protein, RepA, and a control locus, incA. Both the origin and the incA locus contain repeat sequences that bind RepA. It has been proposed that the incA repeats control replication by sequestering the rate-limiting RepA initiator protein. Here we show that when the concentration of RepA was increased about fourfold beyond its normal physiological level from an inducible source in trans, the copy number of a ...

  9. Doc of prophage P1 is inhibited by its antitoxin partner Phd through fold complementation

    DEFF Research Database (Denmark)

    Garcia-Pino, Abel; Christensen-Dalsgaard, Mikkel; Wyns, Lode

    2008-01-01

    Prokaryotic toxin-antitoxin modules are involved in major physiological events set in motion under stress conditions. The toxin Doc (death on curing) from the phd/doc module on phage P1 hosts the C-terminal domain of its antitoxin partner Phd (prevents host death) through fold complementation....... This Phd domain is intrinsically disordered in solution and folds into an alpha-helix upon binding to Doc. The details of the interactions reveal the molecular basis for the inhibitory action of the antitoxin. The complex resembles the Fic (filamentation induced by cAMP) proteins and suggests a possible......-antitoxin locus for its action in vivo....

  10. Electronic Structures of Strained InAs x P1-x by Density Functional Theory.

    Science.gov (United States)

    Lee, Seung Mi; Kim, Min-Young; Kim, Young Heon

    2018-09-01

    We investigated the effects of strain on the electronic structures of InAsxP1-x using quantum mechanical density functional theory calculations. The electronic band gap and electron effective mass decreased with the increase of the uniaxial tensile strain along the [0001] direction of wurtzite InAs0.75P0.25. Therefore, faster electron movements are expected. These theoretical results are in good agreement with the experimental measurements of InAs0.75P0.25 nanowire.

  11. U P1, an example for advanced techniques applied to high level activity dismantling

    International Nuclear Information System (INIS)

    Michel-Noel, M.; Calixte, O.; Blanchard, S.; Bani, J.; Girones, P.; Moitrier, C.; Terry, G.; Bourdy, R.

    2014-01-01

    The U P1 plant on the CEA Marcoule site was dedicated to the processing of spend fuels from the G1, G2 and G3 plutonium-producing reactors. This plant represents 20.000 m 2 of workshops housing about 1000 hot cells. In 1998, a huge program for the dismantling and cleaning-up of the UP1 plant was launched. CEA has developed new techniques to face the complexity of the dismantling operations. These techniques include immersive virtual reality, laser cutting, a specific manipulator arm called MAESTRO and remote handling. (A.C.)

  12. Binding of Signal Recognition Particle Gives Ribosome/Nascent Chain Complexes a Competitive Advantage in Endoplasmic Reticulum Membrane Interaction

    Science.gov (United States)

    Neuhof, Andrea; Rolls, Melissa M.; Jungnickel, Berit; Kalies, Kai-Uwe; Rapoport, Tom A.

    1998-01-01

    Most secretory and membrane proteins are sorted by signal sequences to the endoplasmic reticulum (ER) membrane early during their synthesis. Targeting of the ribosome-nascent chain complex (RNC) involves the binding of the signal sequence to the signal recognition particle (SRP), followed by an interaction of ribosome-bound SRP with the SRP receptor. However, ribosomes can also independently bind to the ER translocation channel formed by the Sec61p complex. To explain the specificity of membrane targeting, it has therefore been proposed that nascent polypeptide-associated complex functions as a cytosolic inhibitor of signal sequence- and SRP-independent ribosome binding to the ER membrane. We report here that SRP-independent binding of RNCs to the ER membrane can occur in the presence of all cytosolic factors, including nascent polypeptide-associated complex. Nontranslating ribosomes competitively inhibit SRP-independent membrane binding of RNCs but have no effect when SRP is bound to the RNCs. The protective effect of SRP against ribosome competition depends on a functional signal sequence in the nascent chain and is also observed with reconstituted proteoliposomes containing only the Sec61p complex and the SRP receptor. We conclude that cytosolic factors do not prevent the membrane binding of ribosomes. Instead, specific ribosome targeting to the Sec61p complex is provided by the binding of SRP to RNCs, followed by an interaction with the SRP receptor, which gives RNC–SRP complexes a selective advantage in membrane targeting over nontranslating ribosomes. PMID:9436994

  13. Synthesis and methylation of ribosomal RNA in HeLa cells infected with the herpes virus pseudorabies virus

    International Nuclear Information System (INIS)

    Furlong, J.C.; Kyriakidis, S.; Stevely, W.S.

    1982-01-01

    The effects of infection with the herpes virus pseudorabies virus on the metabolism of HeLa cell ribosomal RNA were examined. There is a decline both in the synthesis of nucleolar 45S ribosomal precursor RNA and in its processing to mature cytoplasmic RNA. The methylated oligonucleotides in the ribosomal RNA species were studied. The methylation of cytoplasmic ribosomal RNA was essentially unchanged. However there was some undermethylation of the nucleolar precursor. If undermethylated RNA does not mature then this may partly explain the reduced processing in the infected cells. (Author)

  14. FURTHER CONSTRAINTS ON THE OPTICAL TRANSMISSION SPECTRUM OF HAT-P-1b

    International Nuclear Information System (INIS)

    Montalto, M.; Santos, N. C.; Martins, J. H. C.; Figueira, P.; Alonso, R.; Iro, N.; Desidera, S.

    2015-01-01

    We report on novel observations of HAT-P-1 aimed at constraining the optical transmission spectrum of the atmosphere of its transiting hot-Jupiter exoplanet. Ground-based differential spectrophotometry was performed over two transit windows using the DOLORES spectrograph at the Telescopio Nazionale Galileo. Our measurements imply an average planet to star radius ratio equal to R p /R * = (0.1159 ± 0.0005). This result is consistent with the value obtained from recent near-infrared measurements of this object, but differs from previously reported optical measurements, being lower by around 4.4 exoplanet scale heights. Analyzing the data over five different spectral bins of ∼600 Å wide, we observed a single peaked spectrum (3.7 σ level) with a blue cutoff corresponding to the blue edge of the broad absorption wing of sodium and an increased absorption in the region in-between 6180 and 7400 Å. We also infer that the width of the broad absorption wings due to alkali metals is likely narrower than the one implied by solar abundance clear atmospheric models. We interpret the result as evidence that HAT-P-1b has a partially clear atmosphere at optical wavelengths with a more modest contribution from an optical absorber than previously reported

  15. FURTHER CONSTRAINTS ON THE OPTICAL TRANSMISSION SPECTRUM OF HAT-P-1b

    Energy Technology Data Exchange (ETDEWEB)

    Montalto, M.; Santos, N. C.; Martins, J. H. C.; Figueira, P.; Alonso, R. [Instituto de Astrofísica e Ciências do Espaço, Universidade do Porto, CAUP, Rua das Estrelas, PT4150-762 Porto (Portugal); Iro, N. [Theoretical Meteorology Group Klimacampus, University of Hamburg Grindelberg 5, D-20144, Hamburg (Germany); Desidera, S., E-mail: Marco.Montalto@astro.up.pt [INAF—Osservatorio Astronomico di Padova, Vicolo dellOsservatorio 5, Padova, I-35122 (Italy)

    2015-09-20

    We report on novel observations of HAT-P-1 aimed at constraining the optical transmission spectrum of the atmosphere of its transiting hot-Jupiter exoplanet. Ground-based differential spectrophotometry was performed over two transit windows using the DOLORES spectrograph at the Telescopio Nazionale Galileo. Our measurements imply an average planet to star radius ratio equal to R{sub p}/R{sub *} = (0.1159 ± 0.0005). This result is consistent with the value obtained from recent near-infrared measurements of this object, but differs from previously reported optical measurements, being lower by around 4.4 exoplanet scale heights. Analyzing the data over five different spectral bins of ∼600 Å wide, we observed a single peaked spectrum (3.7 σ level) with a blue cutoff corresponding to the blue edge of the broad absorption wing of sodium and an increased absorption in the region in-between 6180 and 7400 Å. We also infer that the width of the broad absorption wings due to alkali metals is likely narrower than the one implied by solar abundance clear atmospheric models. We interpret the result as evidence that HAT-P-1b has a partially clear atmosphere at optical wavelengths with a more modest contribution from an optical absorber than previously reported.

  16. Optimization of nonribosomal peptides production by a psychrotrophic fungus: Trichoderma velutinum ACR-P1.

    Science.gov (United States)

    Sharma, Richa; Singh, Varun P; Singh, Deepika; Yusuf, Farnaz; Kumar, Anil; Vishwakarma, Ram A; Chaubey, Asha

    2016-11-01

    Trichoderma is an anamorphic filamentous fungal genus with immense potential for production of small valuable secondary metabolites with indispensable biological activities. Microbial dynamics of a psychrotrophic strain Trichoderma velutinum ACR-P1, isolated from unexplored niches of the Shiwalik region, bestowed with rich biodiversity of microflora, was investigated for production of nonribosomal peptides (NRPs) by metabolite profiling by intact-cell mass spectrometry (ICMS) employing matrix-assisted laser desorption/ionization-time of flight (MALDI-TOF) mass spectrometer. Being the first report on NRPs production by T. velutinum, studies on optimization of growth conditions by Response Surface Methodology (RSM) for production of NRPs by ACR-P1 was carried out strategically. Multifold enhancement in the yield of NRPs belonging to subfamily SF4 with medium chain of amino acid residues having m/z 1437.9, 1453.9, and 1452.0 at pH 5.9 at 20 °C and of subfamily SF1 with long-chain amino acid residues having m/z 1770.2, 1784.2, 1800.1, 1802.1, and 1815.1 was achieved at pH 7.0 at 25 °C. Complexities of natural mixtures were thus considerably reduced under respective optimized culture conditions accelerating the production of novel microbial natural products by saving time and resources.

  17. Quenching of I(2P1/2) by O3 and O(3P).

    Science.gov (United States)

    Azyazov, Valeriy N; Antonov, Ivan O; Heaven, Michael C

    2007-04-26

    Oxygen-iodine lasers that utilize electrical or microwave discharges to produce singlet oxygen are currently being developed. The discharge generators differ from conventional chemical singlet oxygen generators in that they produce significant amounts of atomic oxygen. Post-discharge chemistry includes channels that lead to the formation of ozone. Consequently, removal of I(2P1/2) by O atoms and O3 may impact the efficiency of discharge driven iodine lasers. In the present study, we have measured the rate constants for quenching of I(2P1/2) by O(3P) atoms and O3 using pulsed laser photolysis techniques. The rate constant for quenching by O3, (1.8 +/- 0.4) x 10(-12) cm3 s-1, was found to be a factor of 5 smaller than the literature value. The rate constant for quenching by O(3P) was (1.2 +/- 0.2) x 10(-11) cm3 s-1.

  18. p53- and ERK7-dependent ribosome surveillance response regulates Drosophila insulin-like peptide secretion.

    Directory of Open Access Journals (Sweden)

    Kiran Hasygar

    2014-11-01

    Full Text Available Insulin-like signalling is a conserved mechanism that coordinates animal growth and metabolism with nutrient status. In Drosophila, insulin-producing median neurosecretory cells (IPCs regulate larval growth by secreting insulin-like peptides (dILPs in a diet-dependent manner. Previous studies have shown that nutrition affects dILP secretion through humoral signals derived from the fat body. Here we uncover a novel mechanism that operates cell autonomously in the IPCs to regulate dILP secretion. We observed that impairment of ribosome biogenesis specifically in the IPCs strongly inhibits dILP secretion, which consequently leads to reduced body size and a delay in larval development. This response is dependent on p53, a known surveillance factor for ribosome biogenesis. A downstream effector of this growth inhibitory response is an atypical MAP kinase ERK7 (ERK8/MAPK15, which is upregulated in the IPCs following impaired ribosome biogenesis as well as starvation. We show that ERK7 is sufficient and essential to inhibit dILP secretion upon impaired ribosome biogenesis, and it acts epistatically to p53. Moreover, we provide evidence that p53 and ERK7 contribute to the inhibition of dILP secretion upon starvation. Thus, we conclude that a cell autonomous ribosome surveillance response, which leads to upregulation of ERK7, inhibits dILP secretion to impede tissue growth under limiting dietary conditions.

  19. Structural insights into methyltransferase KsgA function in 30S ribosomal subunit biogenesis.

    Science.gov (United States)

    Boehringer, Daniel; O'Farrell, Heather C; Rife, Jason P; Ban, Nenad

    2012-03-23

    The assembly of the ribosomal subunits is facilitated by ribosome biogenesis factors. The universally conserved methyltransferase KsgA modifies two adjacent adenosine residues in the 3'-terminal helix 45 of the 16 S ribosomal RNA (rRNA). KsgA recognizes its substrate adenosine residues only in the context of a near mature 30S subunit and is required for the efficient processing of the rRNA termini during ribosome biogenesis. Here, we present the cryo-EM structure of KsgA bound to a nonmethylated 30S ribosomal subunit. The structure reveals that KsgA binds to the 30S platform with the catalytic N-terminal domain interacting with substrate adenosine residues in helix 45 and the C-terminal domain making extensive contacts to helix 27 and helix 24. KsgA excludes the penultimate rRNA helix 44 from adopting its position in the mature 30S subunit, blocking the formation of the decoding site and subunit joining. We suggest that the activation of methyltransferase activity and subsequent dissociation of KsgA control conformational changes in helix 44 required for final rRNA processing and translation initiation.

  20. Structural Insights into Methyltransferase KsgA Function in 30S Ribosomal Subunit Biogenesis*

    Science.gov (United States)

    Boehringer, Daniel; O'Farrell, Heather C.; Rife, Jason P.; Ban, Nenad

    2012-01-01

    The assembly of the ribosomal subunits is facilitated by ribosome biogenesis factors. The universally conserved methyltransferase KsgA modifies two adjacent adenosine residues in the 3′-terminal helix 45 of the 16 S ribosomal RNA (rRNA). KsgA recognizes its substrate adenosine residues only in the context of a near mature 30S subunit and is required for the efficient processing of the rRNA termini during ribosome biogenesis. Here, we present the cryo-EM structure of KsgA bound to a nonmethylated 30S ribosomal subunit. The structure reveals that KsgA binds to the 30S platform with the catalytic N-terminal domain interacting with substrate adenosine residues in helix 45 and the C-terminal domain making extensive contacts to helix 27 and helix 24. KsgA excludes the penultimate rRNA helix 44 from adopting its position in the mature 30S subunit, blocking the formation of the decoding site and subunit joining. We suggest that the activation of methyltransferase activity and subsequent dissociation of KsgA control conformational changes in helix 44 required for final rRNA processing and translation initiation. PMID:22308031

  1. Insertion of the Biogenesis Factor Rei1 Probes the Ribosomal Tunnel during 60S Maturation.

    Science.gov (United States)

    Greber, Basil Johannes; Gerhardy, Stefan; Leitner, Alexander; Leibundgut, Marc; Salem, Michèle; Boehringer, Daniel; Leulliot, Nicolas; Aebersold, Ruedi; Panse, Vikram Govind; Ban, Nenad

    2016-01-14

    Eukaryotic ribosome biogenesis depends on several hundred assembly factors to produce functional 40S and 60S ribosomal subunits. The final phase of 60S subunit biogenesis is cytoplasmic maturation, which includes the proofreading of functional centers of the 60S subunit and the release of several ribosome biogenesis factors. We report the cryo-electron microscopy (cryo-EM) structure of the yeast 60S subunit in complex with the biogenesis factors Rei1, Arx1, and Alb1 at 3.4 Å resolution. In addition to the network of interactions formed by Alb1, the structure reveals a mechanism for ensuring the integrity of the ribosomal polypeptide exit tunnel. Arx1 probes the entire set of inner-ring proteins surrounding the tunnel exit, and the C terminus of Rei1 is deeply inserted into the ribosomal tunnel, where it forms specific contacts along almost its entire length. We provide genetic and biochemical evidence that failure to insert the C terminus of Rei1 precludes subsequent steps of 60S maturation. Copyright © 2016 Elsevier Inc. All rights reserved.

  2. Fluctuations in protein synthesis from a single RNA template: stochastic kinetics of ribosomes.

    Science.gov (United States)

    Garai, Ashok; Chowdhury, Debashish; Ramakrishnan, T V

    2009-01-01

    Proteins are polymerized by cyclic machines called ribosomes, which use their messenger RNA (mRNA) track also as the corresponding template, and the process is called translation. We explore, in depth and detail, the stochastic nature of the translation. We compute various distributions associated with the translation process; one of them--namely, the dwell time distribution--has been measured in recent single-ribosome experiments. The form of the distribution, which fits best with our simulation data, is consistent with that extracted from the experimental data. For our computations, we use a model that captures both the mechanochemistry of each individual ribosome and their steric interactions. We also demonstrate the effects of the sequence inhomogeneities of real genes on the fluctuations and noise in translation. Finally, inspired by recent advances in the experimental techniques of manipulating single ribosomes, we make theoretical predictions on the force-velocity relation for individual ribosomes. In principle, all our predictions can be tested by carrying out in vitro experiments.

  3. Diamond Blackfan Anemia at the Crossroad between Ribosome Biogenesis and Heme Metabolism

    Directory of Open Access Journals (Sweden)

    Deborah Chiabrando

    2010-01-01

    Full Text Available Diamond-Blackfan anemia (DBA is a rare, pure red-cell aplasia that presents during infancy. Approximately 40% of cases are associated with other congenital defects, particularly malformations of the upper limb or craniofacial region. Mutations in the gene coding for the ribosomal protein RPS19 have been identified in 25% of patients with DBA, with resulting impairment of 18S rRNA processing and 40S ribosomal subunit formation. Moreover, mutations in other ribosomal protein coding genes account for about 25% of other DBA cases. Recently, the analysis of mice from which the gene coding for the heme exporter Feline Leukemia Virus subgroup C Receptor (FLVCR1 is deleted suggested that this gene may be involved in the pathogenesis of DBA. FLVCR1-null mice show a phenotype resembling that of DBA patients, including erythroid failure and malformations. Interestingly, some DBA patients have disease linkage to chromosome 1q31, where FLVCR1 is mapped. Moreover, it has been reported that cells from DBA patients express alternatively spliced isoforms of FLVCR1 which encode non-functional proteins. Herein, we review the known roles of RPS19 and FLVCR1 in ribosome function and heme metabolism respectively, and discuss how the deficiency of a ribosomal protein or of a heme exporter may result in the same phenotype.

  4. The Circadian Clock Modulates Global Daily Cycles of mRNA Ribosome Loading[OPEN

    Science.gov (United States)

    Missra, Anamika; Ernest, Ben; Jia, Qidong; Ke, Kenneth

    2015-01-01

    Circadian control of gene expression is well characterized at the transcriptional level, but little is known about diel or circadian control of translation. Genome-wide translation state profiling of mRNAs in Arabidopsis thaliana seedlings grown in long day was performed to estimate ribosome loading per mRNA. The experiments revealed extensive translational regulation of key biological processes. Notably, translation of mRNAs for ribosomal proteins and mitochondrial respiration peaked at night. Central clock mRNAs are among those subject to fluctuations in ribosome loading. There was no consistent phase relationship between peak translation states and peak transcript levels. The overlay of distinct transcriptional and translational cycles can be expected to alter the waveform of the protein synthesis rate. Plants that constitutively overexpress the clock gene CCA1 showed phase shifts in peak translation, with a 6-h delay from midnight to dawn or from noon to evening being particularly common. Moreover, cycles of ribosome loading that were detected under continuous light in the wild type collapsed in the CCA1 overexpressor. Finally, at the transcript level, the CCA1-ox strain adopted a global pattern of transcript abundance that was broadly correlated with the light-dark environment. Altogether, these data demonstrate that gene-specific diel cycles of ribosome loading are controlled in part by the circadian clock. PMID:26392078

  5. Structural and functional organization of ribosomal genes within the mammalian cell nucleolus.

    Science.gov (United States)

    Derenzini, Massimo; Pasquinelli, Gianandrea; O'Donohue, Marie-Françoise; Ploton, Dominique; Thiry, Marc

    2006-02-01

    Data on the in situ structural-functional organization of ribosomal genes in the mammalian cell nucleolus are reviewed here. Major findings on chromatin structure in situ come from investigations carried out using the Feulgen-like osmium ammine reaction as a highly specific electron-opaque DNA tracer. Intranucleolar chromatin shows three different levels of organization: compact clumps, fibers ranging from 11 to 30 nm, and loose agglomerates of extended DNA filaments. Both clumps and fibers of chromatin exhibit a nucleosomal organization that is lacking in the loose agglomerates of extended DNA filaments. In fact, these filaments constantly show a thickness of 2-3 nm, the same as a DNA double-helix molecule. The loose agglomerates of DNA filaments are located in the fibrillar centers, the interphase counterpart of metaphase NORs, therefore being constituted by ribosomal DNA. The extended, non-nucleosomal configuration of this rDNA has been shown to be independent of transcriptional activity and characterizes ribosome genes that are either transcribed or transcriptionally silent. Data reviewed are consistent with a model of control for ribosome gene activity that is not mediated by changes in chromatin structure. The presence of rDNA in mammalian cells always structurally ready for transcription might facilitate a more rapid adjustment of the ribosome production in response to the metabolic needs of the cell.

  6. The nuclear import of ribosomal proteins is regulated by mTOR

    Science.gov (United States)

    Kazyken, Dubek; Kaz, Yelimbek; Kiyan, Vladimir; Zhylkibayev, Assylbek A.; Chen, Chien-Hung; Agarwal, Nitin K.; Sarbassov, Dos D.

    2014-01-01

    Mechanistic target of rapamycin (mTOR) is a central component of the essential signaling pathway that regulates cell growth and proliferation by controlling anabolic processes in cells. mTOR exists in two distinct mTOR complexes known as mTORC1 and mTORC2 that reside mostly in cytoplasm. In our study, the biochemical characterization of mTOR led to discovery of its novel localization on nuclear envelope where it associates with a critical regulator of nuclear import Ran Binding Protein 2 (RanBP2). We show that association of mTOR with RanBP2 is dependent on the mTOR kinase activity that regulates the nuclear import of ribosomal proteins. The mTOR kinase inhibitors within thirty minutes caused a substantial decrease of ribosomal proteins in the nuclear but not cytoplasmic fraction. Detection of a nuclear accumulation of the GFP-tagged ribosomal protein rpL7a also indicated its dependence on the mTOR kinase activity. The nuclear abundance of ribosomal proteins was not affected by inhibition of mTOR Complex 1 (mTORC1) by rapamycin or deficiency of mTORC2, suggesting a distinctive role of the nuclear envelope mTOR complex in the nuclear import. Thus, we identified that mTOR in association with RanBP2 mediates the active nuclear import of ribosomal proteins. PMID:25294810

  7. Thermus Thermophilus as a Model System for the Study of Ribosomal Antibiotic Resistance

    Science.gov (United States)

    Gregory, Steven T.

    2018-03-01

    Ribosomes are the intracellular ribonucleoprotein machines responsible for the translation of mRNA sequence into protein sequence. As an essential cell component, the ribosome is the target of numerous antibiotics that bind to critical functional sites to impair protein synthesis. Mutations causing resistance to antibiotics arise in antibiotic binding sites, and an understanding of the basis of resistance will be an essential component of efforts to develop new antibiotics by rational drug design. We have identified a number of antibiotic-resistance mutations in ribosomal genes of the thermophilic bacterium Thermus thermophilus. This species offers two primary advantages for examining the structural basis of antibiotic-resistance, in particular, its potential for genetic manipulation and the suitability of its ribosomes for analysis by X-ray crystallography. Mutations we have identified in this organism are in many instances identical to those found in other bacterial species, including important pathogens, a result of the extreme conservation of ribosome functional sites. Here I summarize the advantages of this organism as a model system to study antibiotic-resistance mechanisms at the molecular level.

  8. The Split Nucleus of Comet Wilson (C/1986 P1 = 1987 VII).

    Science.gov (United States)

    Meech, Karen J.; Knopp, Graham P.; Farnham, Tony L.; Green, Daniel

    1995-07-01

    We present CCD observations of Comet Wilson (C/1986 P1 = 1987 VII) from 26 nights during the time period 1986 October to 1991 February, which brackets perihelion, During the observing run of 1988 February, the comet was observed to have split into two fragments. Our broadband CCD photometry, along with photometry from the International Cometary Quarterly, shows a steady decline in brightness of Comet Wilson post-perihelion, with an outburst between heliocentric distances r = 2.8 and 3.3 AU during 1987 October and November. By r ≈ 7 AU, the fragment had faded with respect to the parent and was no longer centrally condensed. A brightness limit of mR ≈ 25, when the comet was at r = 12.65 AU, constrains the primary nucleus to have a maximum radius between 5 and 7 km, assuming an albedo of 0.04. The accuracy of direct orbital solutions for the parent body and fragment to determine the time of splitting was limited by the presence of significant nongravitational forces and the limited fragment orbital coverage. We used the relative position of the fragment with respect to the parent to calculate a time of splitting which was consistent with the time of the observed outburst. We discuss the possible causes of the splitting. The coma of Comet Wilson was observed to have a surface-brightness profile which fell off as p-1 (characteristic of a canonical steady-state coma under the influence of radiation pressure) for all of the data with the exception of the data taken during 1987 November when the gradient was p-1.3 . This steeper slope was probably caused by the injection of new material into the coma during the outburst. During 1986 October, there was a break in the surface-brightness profile slope which may be interpreted as the distance at which grains are swept into the tail. The profiles suggested grain velocities of a few x 10 2 to 10 m sec -1 for grains between 1 and a few hundred micrometers. Finson-Probstein dust modeling showed that ejection of grains began

  9. Primary structures of ribosomal proteins from the archaebacterium Halobacterium marismortui and the eubacterium Bacillus stearothermophilus.

    Science.gov (United States)

    Arndt, E; Scholzen, T; Krömer, W; Hatakeyama, T; Kimura, M

    1991-06-01

    Approximately 40 ribosomal proteins from each Halobacterium marismortui and Bacillus stearothermophilus have been sequenced either by direct protein sequence analysis or by DNA sequence analysis of the appropriate genes. The comparison of the amino acid sequences from the archaebacterium H marismortui with the available ribosomal proteins from the eubacterial and eukaryotic kingdoms revealed four different groups of proteins: 24 proteins are related to both eubacterial as well as eukaryotic proteins. Eleven proteins are exclusively related to eukaryotic counterparts. For three proteins only eubacterial relatives-and for another three proteins no counterpart-could be found. The similarities of the halobacterial ribosomal proteins are in general somewhat higher to their eukaryotic than to their eubacterial counterparts. The comparison of B stearothermophilus proteins with their E coli homologues showed that the proteins evolved at different rates. Some proteins are highly conserved with 64-76% identity, others are poorly conserved with only 25-34% identical amino acid residues.

  10. Structures of the E. coli translating ribosome with SRP and its receptor and with the translocon.

    Science.gov (United States)

    Jomaa, Ahmad; Boehringer, Daniel; Leibundgut, Marc; Ban, Nenad

    2016-01-25

    Co-translational protein targeting to membranes is a universally conserved process. Central steps include cargo recognition by the signal recognition particle and handover to the Sec translocon. Here we present snapshots of key co-translational-targeting complexes solved by cryo-electron microscopy at near-atomic resolution, establishing the molecular contacts between the Escherichia coli translating ribosome, the signal recognition particle and the translocon. Our results reveal the conformational changes that regulate the latching of the signal sequence, the release of the heterodimeric domains of the signal recognition particle and its receptor, and the handover of the signal sequence to the translocon. We also observe that the signal recognition particle and the translocon insert-specific structural elements into the ribosomal tunnel to remodel it, possibly to sense nascent chains. Our work provides structural evidence for a conformational state of the signal recognition particle and its receptor primed for translocon binding to the ribosome-nascent chain complex.

  11. Detection of protein-protein interactions by ribosome display and protein in situ immobilisation.

    Science.gov (United States)

    He, Mingyue; Liu, Hong; Turner, Martin; Taussig, Michael J

    2009-12-31

    We describe a method for identification of protein-protein interactions by combining two cell-free protein technologies, namely ribosome display and protein in situ immobilisation. The method requires only PCR fragments as the starting material, the target proteins being made through cell-free protein synthesis, either associated with their encoding mRNA as ribosome complexes or immobilised on a solid surface. The use of ribosome complexes allows identification of interacting protein partners from their attached coding mRNA. To demonstrate the procedures, we have employed the lymphocyte signalling proteins Vav1 and Grb2 and confirmed the interaction between Grb2 and the N-terminal SH3 domain of Vav1. The method has promise for library screening of pairwise protein interactions, down to the analytical level of individual domain or motif mapping.

  12. Binding site of ribosomal proteins on prokaryotic 5S ribonucleic acids: a study with ribonucleases

    DEFF Research Database (Denmark)

    Douthwaite, S; Christensen, A; Garrett, R A

    1982-01-01

    The binding sites of ribosomal proteins L18 and L25 on 5S RNA from Escherichia coli were probed with ribonucleases A, T1, and T2 and a double helix specific cobra venom endonuclease. The results for the protein-RNA complexes, which were compared with those for the free RNA [Douthwaite, S...... stearothermophilus 5S RNA. Several protein-induced changes in the RNA structures were identified; some are possibly allosteric in nature. The two prokaryotic 5S RNAs were also incubated with total 50S subunit proteins from E. coli and B. stearothermophilus ribosomes. Homologous and heterologous reconstitution....... stearothermophilus 5S RNA, which may have been due to a third ribosomal protein L5....

  13. Defining the structural requirements for a helix in 23 S ribosomal RNA that confers erythromycin resistance

    DEFF Research Database (Denmark)

    Douthwaite, S; Powers, T; Lee, J Y

    1989-01-01

    The helix spanning nucleotides 1198 to 1247 (helix 1200-1250) in Escherichia coli 23 S ribosomal RNA (rRNA) is functionally important in protein synthesis, and deletions in this region confer erythromycin resistance. In order to define the structural requirements for resistance, we have dissected...... deletion mutants show a sensitive phenotype. Deletions that extend into the base-pairing between GCC1208 and GGU1240 result in non-functional 23 S RNAs, which consequently do not confer resistance. A number of phylogenetically conserved nucleotides have been shown to be non-essential for 23 S RNA function....... However, removal of either these or non-conserved nucleotides from helix 1200-1250 measurably reduces the efficiency of 23 S RNA in forming functional ribosomes. We have used chemical probing and a modified primer extension method to investigate erythromycin binding to wild-type and resistant ribosomes...

  14. Cross-linking of streptomycin to the 16S ribosomal RNA of Escherichia coli

    International Nuclear Information System (INIS)

    Gravel, M.; Melancon, P.; Barkier-Gingras, L.

    1987-01-01

    [ 3 H]Dihydrostreptomycin was cross-linked to the 30S ribosomal subunit from Escherichia coli with the bifunctional reagent nitrogen mustard. The cross-linking primarily involved the 16S RNA. To localize the site of cross-linking of streptomycin to the 16S RNA, the authors hybridized RNA labeled with streptomycin to restriction fragments of the 16S RNA gene. Labeled RNA hybridized to DNA fragments corresponding to bases 892-917 and bases 1394-1415. These two segments of the ribosomal RNA must by juxtaposed in the ribosome, since there is a single binding site for streptomycin. This region has been implicated both in the decoding site and in the binding of initiation factor IF-3, indicating its functional importance

  15. Site-specific fluorescent labeling of nascent proteins on the translating ribosome.

    Science.gov (United States)

    Saraogi, Ishu; Zhang, Dawei; Chandrasekaran, Sandhya; Shan, Shu-ou

    2011-09-28

    As newly synthesized proteins emerge from the ribosome, they interact with a variety of cotranslational cellular machineries that facilitate their proper folding, maturation, and localization. These interactions are essential for proper function of the cell, and the ability to study these events is crucial to understanding cellular protein biogenesis. To this end, we have developed a highly efficient method to generate ribosome-nascent chain complexes (RNCs) site-specifically labeled with a fluorescent dye on the nascent polypeptide. The fluorescent RNC provides real-time, quantitative information on its cotranslational interaction with the signal recognition particle and will be a valuable tool in elucidating the role of the translating ribosome in numerous biochemical pathways.

  16. Sulfur restriction extends fission yeast chronological lifespan through Ecl1 family genes by downregulation of ribosome.

    Science.gov (United States)

    Ohtsuka, Hokuto; Takinami, Masahiro; Shimasaki, Takafumi; Hibi, Takahide; Murakami, Hiroshi; Aiba, Hirofumi

    2017-07-01

    Nutritional restrictions such as calorie restrictions are known to increase the lifespan of various organisms. Here, we found that a restriction of sulfur extended the chronological lifespan (CLS) of the fission yeast Schizosaccharomyces pombe. The restriction decreased cellular size, RNA content, and ribosomal proteins and increased sporulation rate. These responses depended on Ecl1 family genes, the overexpression of which results in the extension of CLS. We also showed that the Zip1 transcription factor results in the sulfur restriction-dependent expression of the ecl1 + gene. We demonstrated that a decrease in ribosomal activity results in the extension of CLS. Based on these observations, we propose that sulfur restriction extends CLS through Ecl1 family genes in a ribosomal activity-dependent manner. © 2017 John Wiley & Sons Ltd.

  17. Free and membrane-bound ribosomes and polysomes in hippocampal neurons during a learning experiment.

    Science.gov (United States)

    Wenzel, J; David, H; Pohle, W; Marx, I; Matthies, H

    1975-01-24

    The ribosomes of the CA1 and CA3 pyramidal cells of hipocampus were investigated by morphometric methods after the acquisition of a shock-motivated brightness discrimination in rats. A significant increase in the total number of ribosomes was observed in CA1 cells of trained animals and in CA3 cells of both active controls and trained rats. A significant increase in membrane-bound ribosomes was obtained in CA1 and CA3 cells after training only. The results confirm the suggestion of an increased protein synthesis in hippocampal neurons during and after the acquisition of a brightness discrimination, as we have concluded from out previous investigations on the incorporation of labeled amino acids under identical experimental conditions. The results lead to the assumption that the protein synthesis in some neuronal cells may probably differ not only quantitatively, but also qualitatively in trained and untrained animals.

  18. Resistance to Linezolid Caused by Modifications at Its Binding Site on the Ribosome

    DEFF Research Database (Denmark)

    Long, Katherine S.; Vester, Birte

    2012-01-01

    Linezolid is an oxazolidinone antibiotic in clinical use for the treatment of serious infections of resistant Gram-positive bacteria. It inhibits protein synthesis by binding to the peptidyl transferase center on the ribosome. Almost all known resistance mechanisms involve small alterations...... to the linezolid binding site, so this review will therefore focus on the various changes that can adversely affect drug binding and confer resistance. High-resolution structures of linezolid bound to the 50S ribosomal subunit show that it binds in a deep cleft that is surrounded by 23S rRNA nucleotides. Mutation...... of 23S rRNA has for some time been established as a linezolid resistance mechanism. Although ribosomal proteins L3 and L4 are located further away from the bound drug, mutations in specific regions of these proteins are increasingly being associated with linezolid resistance. However, very little...

  19. Functional Dynamics within the Human Ribosome Regulate the Rate of Active Protein Synthesis.

    Science.gov (United States)

    Ferguson, Angelica; Wang, Leyi; Altman, Roger B; Terry, Daniel S; Juette, Manuel F; Burnett, Benjamin J; Alejo, Jose L; Dass, Randall A; Parks, Matthew M; Vincent, C Theresa; Blanchard, Scott C

    2015-11-05

    The regulation of protein synthesis contributes to gene expression in both normal physiology and disease, yet kinetic investigations of the human translation mechanism are currently lacking. Using single-molecule fluorescence imaging methods, we have quantified the nature and timing of structural processes in human ribosomes during single-turnover and processive translation reactions. These measurements reveal that functional complexes exhibit dynamic behaviors and thermodynamic stabilities distinct from those observed for bacterial systems. Structurally defined sub-states of pre- and post-translocation complexes were sensitive to specific inhibitors of the eukaryotic ribosome, demonstrating the utility of this platform to probe drug mechanism. The application of three-color single-molecule fluorescence resonance energy transfer (smFRET) methods further revealed a long-distance allosteric coupling between distal tRNA binding sites within ribosomes bearing three tRNAs, which contributed to the rate of processive translation. Copyright © 2015 Elsevier Inc. All rights reserved.

  20. Second order time evolution of the multigroup diffusion and P1 equations for radiation transport

    International Nuclear Information System (INIS)

    Olson, Gordon L.

    2011-01-01

    Highlights: → An existing multigroup transport algorithm is extended to be second-order in time. → A new algorithm is presented that does not require a grey acceleration solution. → The two algorithms are tested with 2D, multi-material problems. → The two algorithms have comparable computational requirements. - Abstract: An existing solution method for solving the multigroup radiation equations, linear multifrequency-grey acceleration, is here extended to be second order in time. This method works for simple diffusion and for flux-limited diffusion, with or without material conduction. A new method is developed that does not require the solution of an averaged grey transport equation. It is effective solving both the diffusion and P 1 forms of the transport equation. Two dimensional, multi-material test problems are used to compare the solution methods.

  1. The P1-approximation for the Distribution of Neutrons from a Pulsed Source in Hydrogen

    International Nuclear Information System (INIS)

    Claesson, A.

    1963-12-01

    The asymptotic distribution of neutrons from a pulsed, high energy source in an infinite moderator has been obtained earlier in a 'diffusion' approximation. In that paper the cross section was assumed to be constant over the whole energy region and the time derivative of the first moment was disregarded. Here, first, an analytic expression is obtained for the density in a P 1 -approximation. However, the result is very complicated, and it is shown that an asymptotic solution can be found in a simpler way. By taking into account the low hydrogen scattering cross section at the source energy it follows that the space dependence of the distribution is less than that obtained earlier. The importance of keeping the time derivative of the first moment is further shown in a perturbation approximation

  2. Neutron wave reflexions in interface media with transport equation P1 approximation

    International Nuclear Information System (INIS)

    Oliveira Vellozo, S. de.

    1977-01-01

    The propagation of neutron waves in non multiplying media is investigated employing the Telegrapher's equation obtained from the P 1 approximation of the time, space and energy dependent Boltzmann equation. Solution of the problem of propagation of sinusoidally modulated source incident on one face of the medium is obtained by analysing the Fourier component of a pulsed source introduced, for the corresponding frequency. The amplitude and the phase of the flux are computed as a function of frequency in media consisting of one, two and three regions in order to study the effects of reflection at the interfaces. The results are compared with those from the Diffusion approximation obtained by neglecting the term involving the second order time derivative. (author)

  3. Comment on the search for the charmonium 1P1 and its theoretical interpretation

    Science.gov (United States)

    Porter, F. C.

    1984-10-01

    We comment on a recent paper which discusses the theoretical implications of the Crystal Ball search for the 1P1 state of charmonium. On behalf of the Crystal Ball collaboration: California Institute of Technology - C. Edwards, R. Partridge, C. Peck, F. Porter; Harvard University - D. Antreasyan, Y.F. Gu, K. Strauch, K. Wacker, A. Weinstein; Princeton University - D. Aschman, M. Cavalli-Sforza, D. Coyne, C. Newman-Holmes, H. Sadrozinski; Stanford Linear Accelerator Center - E. Bloom, F. Bulos, G. Godfrey, C. Kiesling, W. Lockman, M. Oreglia; Stanford University - D. Gelphman, R. Hofstadter, R. Horisberger, I. Kirkbride, H. Kolanoski, K. Königsmann, R. Lee, A. Osterheld, B. Pollock and J. Tompkins.

  4. SPITZER IRAC SECONDARY ECLIPSE PHOTOMETRY OF THE TRANSITING EXTRASOLAR PLANET HAT-P-1b

    International Nuclear Information System (INIS)

    Todorov, Kamen; Deming, Drake; Harrington, Jospeph; Stevenson, Kevin B.; Bowman, William C.; Nymeyer, Sarah; Fortney, Jonathan J.; Bakos, Gaspar A.

    2010-01-01

    We report Spitzer/IRAC photometry of the transiting giant exoplanet HAT-P-1b during its secondary eclipse. This planet lies near the postulated boundary between the pM and pL-class of hot Jupiters, and is important as a test of models for temperature inversions in hot Jupiter atmospheres. We derive eclipse depths for HAT-P-1b, in units of the stellar flux, that are: 0.080% ± 0.008% [3.6 μm], 0.135% ± 0.022% [4.5 μm], 0.203% ± 0.031% [5.8 μm], and 0.238% ± 0.040% [8.0 μm]. These values are best fit using an atmosphere with a modest temperature inversion, intermediate between the archetype inverted atmosphere (HD 209458b) and a model without an inversion. The observations also suggest that this planet is radiating a large fraction of the available stellar irradiance on its dayside, with little available for redistribution by circulation. This planet has sometimes been speculated to be inflated by tidal dissipation, based on its large radius in discovery observations, and on a non-zero orbital eccentricity allowed by the radial velocity data. The timing of the secondary eclipse is very sensitive to orbital eccentricity, and we find that the central phase of the eclipse is 0.4999 ± 0.0005. The difference between the expected and observed phase indicates that the orbit is close to circular, with a 3σ limit of |e cos ω| < 0.002.

  5. Molecular interactions within the halophilic, thermophilic, and mesophilic prokaryotic ribosomal complexes: clues to environmental adaptation.

    Science.gov (United States)

    Mallik, Saurav; Kundu, Sudip

    2015-01-01

    Using the available crystal structures of 50S ribosomal subunits from three prokaryotic species: Escherichia coli (mesophilic), Thermus thermophilus (thermophilic), and Haloarcula marismortui (halophilic), we have analyzed different structural features of ribosomal RNAs (rRNAs), proteins, and of their interfaces. We have correlated these structural features with the environmental adaptation strategies of the corresponding species. While dense intra-rRNA packing is observed in thermophilic, loose intra-rRNA packing is observed in halophilic (both compared to mesophilic). Interestingly, protein-rRNA interfaces of both the extremophiles are densely packed compared to that of the mesophilic. The intersubunit bridge regions are almost devoid of cavities, probably ensuring the proper formation of each bridge (by not allowing any loosely packed region nearby). During rRNA binding, the ribosomal proteins experience some structural transitions. Here, we have analyzed the intrinsically disordered and ordered regions of the ribosomal proteins, which are subjected to such transitions. The intrinsically disordered and disorder-to-order transition sites of the thermophilic and mesophilic ribosomal proteins are simultaneously (i) highly conserved and (ii) slowly evolving compared to rest of the protein structure. Although high conservation is observed at such sites of halophilic ribosomal proteins, but slow rate of evolution is absent. Such differences between thermophilic, mesophilic, and halophilic can be explained from their environmental adaptation strategy. Interestingly, a universal biophysical principle evident by a linear relationship between the free energy of interface formation, interface area, and structural changes of r-proteins during assembly is always maintained, irrespective of the environmental conditions.

  6. rRNA maturation in yeast cells depleted of large ribosomal subunit proteins.

    Directory of Open Access Journals (Sweden)

    Gisela Pöll

    Full Text Available The structural constituents of the large eukaryotic ribosomal subunit are 3 ribosomal RNAs, namely the 25S, 5.8S and 5S rRNA and about 46 ribosomal proteins (r-proteins. They assemble and mature in a highly dynamic process that involves more than 150 proteins and 70 small RNAs. Ribosome biogenesis starts in the nucleolus, continues in the nucleoplasm and is completed after nucleo-cytoplasmic translocation of the subunits in the cytoplasm. In this work we created 26 yeast strains, each of which conditionally expresses one of the large ribosomal subunit (LSU proteins. In vivo depletion of the analysed LSU r-proteins was lethal and led to destabilisation and degradation of the LSU and/or its precursors. Detailed steady state and metabolic pulse labelling analyses of rRNA precursors in these mutant strains showed that LSU r-proteins can be grouped according to their requirement for efficient progression of different steps of large ribosomal subunit maturation. Comparative analyses of the observed phenotypes and the nature of r-protein-rRNA interactions as predicted by current atomic LSU structure models led us to discuss working hypotheses on i how individual r-proteins control the productive processing of the major 5' end of 5.8S rRNA precursors by exonucleases Rat1p and Xrn1p, and ii the nature of structural characteristics of nascent LSUs that are required for cytoplasmic accumulation of nascent subunits but are nonessential for most of the nuclear LSU pre-rRNA processing events.

  7. sORFs.org: a repository of small ORFs identified by ribosome profiling.

    Science.gov (United States)

    Olexiouk, Volodimir; Crappé, Jeroen; Verbruggen, Steven; Verhegen, Kenneth; Martens, Lennart; Menschaert, Gerben

    2016-01-04

    With the advent of ribosome profiling, a next generation sequencing technique providing a "snap-shot'' of translated mRNA in a cell, many short open reading frames (sORFs) with ribosomal activity were identified. Follow-up studies revealed the existence of functional peptides, so-called micropeptides, translated from these 'sORFs', indicating a new class of bio-active peptides. Over the last few years, several micropeptides exhibiting important cellular functions were discovered. However, ribosome occupancy does not necessarily imply an actual function of the translated peptide, leading to the development of various tools assessing the coding potential of sORFs. Here, we introduce sORFs.org (http://www.sorfs.org), a novel database for sORFs identified using ribosome profiling. Starting from ribosome profiling, sORFs.org identifies sORFs, incorporates state-of-the-art tools and metrics and stores results in a public database. Two query interfaces are provided, a default one enabling quick lookup of sORFs and a BioMart interface providing advanced query and export possibilities. At present, sORFs.org harbors 263 354 sORFs that demonstrate ribosome occupancy, originating from three different cell lines: HCT116 (human), E14_mESC (mouse) and S2 (fruit fly). sORFs.org aims to provide an extensive sORFs database accessible to researchers with limited bioinformatics knowledge, thus enabling easy integration into personal projects. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  8. Simulating movement of tRNA through the ribosome during hybrid-state formation.

    Science.gov (United States)

    Whitford, Paul C; Sanbonmatsu, Karissa Y

    2013-09-28

    Biomolecular simulations provide a means for exploring the relationship between flexibility, energetics, structure, and function. With the availability of atomic models from X-ray crystallography and cryoelectron microscopy (cryo-EM), and rapid increases in computing capacity, it is now possible to apply molecular dynamics (MD) simulations to large biomolecular machines, and systematically partition the factors that contribute to function. A large biomolecular complex for which atomic models are available is the ribosome. In the cell, the ribosome reads messenger RNA (mRNA) in order to synthesize proteins. During this essential process, the ribosome undergoes a wide range of conformational rearrangements. One of the most poorly understood transitions is translocation: the process by which transfer RNA (tRNA) molecules move between binding sites inside of the ribosome. The first step of translocation is the adoption of a "hybrid" configuration by the tRNAs, which is accompanied by large-scale rotations in the ribosomal subunits. To illuminate the relationship between these rearrangements, we apply MD simulations using a multi-basin structure-based (SMOG) model, together with targeted molecular dynamics protocols. From 120 simulated transitions, we demonstrate the viability of a particular route during P/E hybrid-state formation, where there is asynchronous movement along rotation and tRNA coordinates. These simulations not only suggest an ordering of events, but they highlight atomic interactions that may influence the kinetics of hybrid-state formation. From these simulations, we also identify steric features (H74 and surrounding residues) encountered during the hybrid transition, and observe that flexibility of the single-stranded 3'-CCA tail is essential for it to reach the endpoint. Together, these simulations provide a set of structural and energetic signatures that suggest strategies for modulating the physical-chemical properties of protein synthesis by the

  9. The ribosome structure controls and directs mRNA entry, translocation and exit dynamics

    International Nuclear Information System (INIS)

    Kurkcuoglu, Ozge; Doruker, Pemra; Jernigan, Robert L; Sen, Taner Z; Kloczkowski, Andrzej

    2008-01-01

    The protein-synthesizing ribosome undergoes large motions to effect the translocation of tRNAs and mRNA; here, the domain motions of this system are explored with a coarse-grained elastic network model using normal mode analysis. Crystal structures are used to construct various model systems of the 70S complex with/without tRNA, elongation factor Tu and the ribosomal proteins. Computed motions reveal the well-known ratchet-like rotational motion of the large subunits, as well as the head rotation of the small subunit and the high flexibility of the L1 and L7/L12 stalks, even in the absence of ribosomal proteins. This result indicates that these experimentally observed motions during translocation are inherently controlled by the ribosomal shape and only partially dependent upon GTP hydrolysis. Normal mode analysis further reveals the mobility of A- and P-tRNAs to increase in the absence of the E-tRNA. In addition, the dynamics of the E-tRNA is affected by the absence of the ribosomal protein L1. The mRNA in the entrance tunnel interacts directly with helicase proteins S3 and S4, which constrain the mRNA in a clamp-like fashion, as well as with protein S5, which likely orients the mRNA to ensure correct translation. The ribosomal proteins S7, S11 and S18 may also be involved in assuring translation fidelity by constraining the mRNA at the exit site of the channel. The mRNA also interacts with the 16S 3' end forming the Shine–Dalgarno complex at the initiation step; the 3' end may act as a 'hook' to reel in the mRNA to facilitate its exit

  10. Acrolein preferentially damages nucleolus eliciting ribosomal stress and apoptosis in human cancer cells.

    Science.gov (United States)

    Wang, Hsiang-Tsui; Chen, Tzu-Ying; Weng, Ching-Wen; Yang, Chun-Hsiang; Tang, Moon-Shong

    2016-12-06

    Acrolein (Acr) is a potent cytotoxic and DNA damaging agent which is ubiquitous in the environment and abundant in tobacco smoke. Acr is also an active cytotoxic metabolite of the anti-cancer drugs cyclophosphamide and ifosfamide. The mechanisms via which Acr exerts its anti-cancer activity and cytotoxicity are not clear. In this study, we found that Acr induces cytotoxicity and cell death in human cancer cells with different activities of p53. Acr preferentially binds nucleolar ribosomal DNA (rDNA) to form Acr-deoxyguanosine adducts, and induces oxidative damage to both rDNA and ribosomal RNA (rRNA). Acr triggers ribosomal stress responses, inhibits rRNA synthesis, reduces RNA polymerase I binding to the promoter of rRNA gene, disrupts nucleolar integrity, and impairs ribosome biogenesis and polysome formation. Acr causes an increase in MDM2 levels and phosphorylation of MDM2 in A549 and HeLa cells which are p53 active and p53 inactive, respectively. It enhances the binding of ribosomal protein RPL11 to MDM2 and reduces the binding of p53 and E2F-1 to MDM2 resulting in stabilization/activation of p53 in A549 cells and degradation of E2F-1 in A549 and HeLa cells. We propose that Acr induces ribosomal stress which leads to activation of MDM2 and RPL11-MDM2 binding, consequently, activates p53 and enhances E2F-1 degradation, and that taken together these two processes induce apoptosis and cell death.

  11. The ribosomal protein uL22 modulates the shape of the nascent protein exit tunnel

    DEFF Research Database (Denmark)

    Wekselman, I.; Zimmerman, E.; Davidovich, C.

    2017-01-01

    in the entrance of theribosomal exit tunnel and interferes with the progression of nas-cent chains. Commonly, resistance to erythromycin is acquiredby alterations of rRNA nucleotides that interact with the drug.Mutations in theb-hairpin of ribosomal protein uL22, which israther distal to the erythromycin binding...... to erythromycin binding pocket and increases its flexi-bility. Based on our results, we suggest a feasble mechanism thatexplains how nanscent proteins can be translated when ery-thromycin is bound to the ribosome. Furthermore, our findingssupport recent studies showing that the interactions betweenuL22...

  12. The Ribosomal Protein uL22 Modulates the Shape of the Protein Exit Tunnel

    DEFF Research Database (Denmark)

    Wekselman, Itai; Zimmerman, Ella; Davidovich, Chen

    2017-01-01

    Erythromycin is a clinically useful antibiotic that binds to an rRNA pocket in the ribosomal exit tunnel. Commonly, resistance to erythromycin is acquired by alterations of rRNA nucleotides that interact with the drug. Mutations in the β hairpin of ribosomal protein uL22, which is rather distal...... of the β hairpin of the mutated uL22 toward the interior of the exit tunnel, triggering a cascade of structural alterations of rRNA nucleotides that propagate to the erythromycin binding pocket. Our findings support recent studies showing that the interactions between uL22 and specific sequences within...

  13. Implementation of communication-mediating domains for non-ribosomal peptide production in Saccharomyces cerevisiae

    DEFF Research Database (Denmark)

    Siewers, Verena; San-Bento, Rita; Nielsen, Jens

    2010-01-01

    Saccharomyces cerevisiae has in several cases been proven to be a suitable host for the production of natural products and was recently exploited for the production of non-ribosomal peptides. Synthesis of non-ribosomal peptides (NRPs) is mediated by NRP synthetases (NRPSs), modular enzymes, which...... are often organized in enzyme complexes. In these complexes, partner NRPSs interact via communication-mediating domains (COM domains). In order to test whether functional interaction between separate NRPS modules is possible in yeast we constructed a yeast strain expressing two modules with compatible COM...

  14. High-Resolution Analysis of Coronavirus Gene Expression by RNA Sequencing and Ribosome Profiling.

    Science.gov (United States)

    Irigoyen, Nerea; Firth, Andrew E; Jones, Joshua D; Chung, Betty Y-W; Siddell, Stuart G; Brierley, Ian

    2016-02-01

    Members of the family Coronaviridae have the largest genomes of all RNA viruses, typically in the region of 30 kilobases. Several coronaviruses, such as Severe acute respiratory syndrome-related coronavirus (SARS-CoV) and Middle East respiratory syndrome-related coronavirus (MERS-CoV), are of medical importance, with high mortality rates and, in the case of SARS-CoV, significant pandemic potential. Other coronaviruses, such as Porcine epidemic diarrhea virus and Avian coronavirus, are important livestock pathogens. Ribosome profiling is a technique which exploits the capacity of the translating ribosome to protect around 30 nucleotides of mRNA from ribonuclease digestion. Ribosome-protected mRNA fragments are purified, subjected to deep sequencing and mapped back to the transcriptome to give a global "snap-shot" of translation. Parallel RNA sequencing allows normalization by transcript abundance. Here we apply ribosome profiling to cells infected with Murine coronavirus, mouse hepatitis virus, strain A59 (MHV-A59), a model coronavirus in the same genus as SARS-CoV and MERS-CoV. The data obtained allowed us to study the kinetics of virus transcription and translation with exquisite precision. We studied the timecourse of positive and negative-sense genomic and subgenomic viral RNA production and the relative translation efficiencies of the different virus ORFs. Virus mRNAs were not found to be translated more efficiently than host mRNAs; rather, virus translation dominates host translation at later time points due to high levels of virus transcripts. Triplet phasing of the profiling data allowed precise determination of translated reading frames and revealed several translated short open reading frames upstream of, or embedded within, known virus protein-coding regions. Ribosome pause sites were identified in the virus replicase polyprotein pp1a ORF and investigated experimentally. Contrary to expectations, ribosomes were not found to pause at the ribosomal

  15. High-Resolution Analysis of Coronavirus Gene Expression by RNA Sequencing and Ribosome Profiling.

    Directory of Open Access Journals (Sweden)

    Nerea Irigoyen

    2016-02-01

    Full Text Available Members of the family Coronaviridae have the largest genomes of all RNA viruses, typically in the region of 30 kilobases. Several coronaviruses, such as Severe acute respiratory syndrome-related coronavirus (SARS-CoV and Middle East respiratory syndrome-related coronavirus (MERS-CoV, are of medical importance, with high mortality rates and, in the case of SARS-CoV, significant pandemic potential. Other coronaviruses, such as Porcine epidemic diarrhea virus and Avian coronavirus, are important livestock pathogens. Ribosome profiling is a technique which exploits the capacity of the translating ribosome to protect around 30 nucleotides of mRNA from ribonuclease digestion. Ribosome-protected mRNA fragments are purified, subjected to deep sequencing and mapped back to the transcriptome to give a global "snap-shot" of translation. Parallel RNA sequencing allows normalization by transcript abundance. Here we apply ribosome profiling to cells infected with Murine coronavirus, mouse hepatitis virus, strain A59 (MHV-A59, a model coronavirus in the same genus as SARS-CoV and MERS-CoV. The data obtained allowed us to study the kinetics of virus transcription and translation with exquisite precision. We studied the timecourse of positive and negative-sense genomic and subgenomic viral RNA production and the relative translation efficiencies of the different virus ORFs. Virus mRNAs were not found to be translated more efficiently than host mRNAs; rather, virus translation dominates host translation at later time points due to high levels of virus transcripts. Triplet phasing of the profiling data allowed precise determination of translated reading frames and revealed several translated short open reading frames upstream of, or embedded within, known virus protein-coding regions. Ribosome pause sites were identified in the virus replicase polyprotein pp1a ORF and investigated experimentally. Contrary to expectations, ribosomes were not found to pause at the

  16. The NBS1-Treacle complex controls ribosomal RNA transcription in response to DNA damage

    DEFF Research Database (Denmark)

    Larsen, Dorthe H; Hari, Flurina; Clapperton, Julie A

    2014-01-01

    Chromosome breakage elicits transient silencing of ribosomal RNA synthesis, but the mechanisms involved remained elusive. Here we discover an in trans signalling mechanism that triggers pan-nuclear silencing of rRNA transcription in response to DNA damage. This is associated with transient...... recruitment of the Nijmegen breakage syndrome protein 1 (NBS1), a central regulator of DNA damage responses, into the nucleoli. We further identify TCOF1 (also known as Treacle), a nucleolar factor implicated in ribosome biogenesis and mutated in Treacher Collins syndrome, as an interaction partner of NBS1...

  17. 5S Ribosomal RNA Is an Essential Component of a Nascent Ribosomal Precursor Complex that Regulates the Hdm2-p53 Checkpoint

    Directory of Open Access Journals (Sweden)

    Giulio Donati

    2013-07-01

    Full Text Available Recently, we demonstrated that RPL5 and RPL11 act in a mutually dependent manner to inhibit Hdm2 and stabilize p53 following impaired ribosome biogenesis. Given that RPL5 and RPL11 form a preribosomal complex with noncoding 5S ribosomal RNA (rRNA and the three have been implicated in the p53 response, we reasoned they may be part of an Hdm2-inhibitory complex. Here, we show that small interfering RNAs directed against 5S rRNA have no effect on total or nascent levels of the noncoding rRNA, though they prevent the reported Hdm4 inhibition of p53. To achieve efficient inhibition of 5S rRNA synthesis, we targeted TFIIIA, a specific RNA polymerase III cofactor, which, like depletion of either RPL5 or RPL11, did not induce p53. Instead, 5S rRNA acts in a dependent manner with RPL5 and RPL11 to inhibit Hdm2 and stabilize p53. Moreover, depletion of any one of the three components abolished the binding of the other two to Hdm2, explaining their common dependence. Finally, we demonstrate that the RPL5/RPL11/5S rRNA preribosomal complex is redirected from assembly into nascent 60S ribosomes to Hdm2 inhibition as a consequence of impaired ribosome biogenesis. Thus, the activation of the Hdm2-inhibitory complex is not a passive but a regulated event, whose potential role in tumor suppression has been recently noted.

  18. 5S ribosomal RNA is an essential component of a nascent ribosomal precursor complex that regulates the Hdm2-p53 checkpoint.

    Science.gov (United States)

    Donati, Giulio; Peddigari, Suresh; Mercer, Carol A; Thomas, George

    2013-07-11

    Recently, we demonstrated that RPL5 and RPL11 act in a mutually dependent manner to inhibit Hdm2 and stabilize p53 following impaired ribosome biogenesis. Given that RPL5 and RPL11 form a preribosomal complex with noncoding 5S ribosomal RNA (rRNA) and the three have been implicated in the p53 response, we reasoned they may be part of an Hdm2-inhibitory complex. Here, we show that small interfering RNAs directed against 5S rRNA have no effect on total or nascent levels of the noncoding rRNA, though they prevent the reported Hdm4 inhibition of p53. To achieve efficient inhibition of 5S rRNA synthesis, we targeted TFIIIA, a specific RNA polymerase III cofactor, which, like depletion of either RPL5 or RPL11, did not induce p53. Instead, 5S rRNA acts in a dependent manner with RPL5 and RPL11 to inhibit Hdm2 and stabilize p53. Moreover, depletion of any one of the three components abolished the binding of the other two to Hdm2, explaining their common dependence. Finally, we demonstrate that the RPL5/RPL11/5S rRNA preribosomal complex is redirected from assembly into nascent 60S ribosomes to Hdm2 inhibition as a consequence of impaired ribosome biogenesis. Thus, the activation of the Hdm2-inhibitory complex is not a passive but a regulated event, whose potential role in tumor suppression has been recently noted. Copyright © 2013 The Authors. Published by Elsevier Inc. All rights reserved.

  19. Distinct roles for the IIId2 sub-domain in pestivirus and picornavirus internal ribosome entry sites

    DEFF Research Database (Denmark)

    Willcocks, Margaret M.; Zaini, Salmah; Chamond, Nathalie

    2017-01-01

    Viral internal ribosomes entry site (IRES) elements coordinate the recruitment of the host translation machinery to direct the initiation of viral protein synthesis. Within hepatitis C virus (HCV)-like IRES elements, the sub-domain IIId(1) is crucial for recruiting the 40S ribosomal subunit...

  20. The ribosome as a molecular machine: the mechanism of tRNA-mRNA movement in translocation.

    Science.gov (United States)

    Rodnina, Marina V; Wintermeyer, Wolfgang

    2011-04-01

    Translocation of tRNA and mRNA through the ribosome is one of the most dynamic events during protein synthesis. In the cell, translocation is catalysed by EF-G (elongation factor G) and driven by GTP hydrolysis. Major unresolved questions are: how the movement is induced and what the moving parts of the ribosome are. Recent progress in time-resolved cryoelectron microscopy revealed trajectories of tRNA movement through the ribosome. Driven by thermal fluctuations, the ribosome spontaneously samples a large number of conformational states. The spontaneous movement of tRNAs through the ribosome is loosely coupled to the motions within the ribosome. EF-G stabilizes conformational states prone to translocation and promotes a conformational rearrangement of the ribosome (unlocking) that accelerates the rate-limiting step of translocation: the movement of the tRNA anticodons on the small ribosomal subunit. EF-G acts as a Brownian ratchet providing directional bias for movement at the cost of GTP hydrolysis.

  1. Characterization of the domains of E. coli initiation factor IF2 responsible for recognition of the ribosome

    DEFF Research Database (Denmark)

    Manuel Palacios Moreno, Juan; Andersen, Lars Dyrskjøt; Egebjerg Kristensen, Janni

    1999-01-01

    We have studied the interactions between the ribosome and the domains of Escherichia coli translation initiation factor 2, using an in vitro ribosomal binding assay with wild-type forms, N- and C-terminal truncated forms of IF2 as well as isolated structural domains. A deletion mutant of the factor...

  2. Expression Profiling of Ribosome Biogenesis Factors Reveals Nucleolin as a Novel Potential Marker to Predict Outcome in AML Patients.

    Directory of Open Access Journals (Sweden)

    Virginie Marcel

    Full Text Available Acute myeloid leukemia (AML is a heterogeneous disease. Prognosis is mainly influenced by patient age at diagnosis and cytogenetic alterations, two of the main factors currently used in AML patient risk stratification. However, additional criteria are required to improve the current risk classification and better adapt patient care. In neoplastic cells, ribosome biogenesis is increased to sustain the high proliferation rate and ribosome composition is altered to modulate specific gene expression driving tumorigenesis. Here, we investigated the usage of ribosome biogenesis factors as clinical markers in adult patients with AML. We showed that nucleoli, the nucleus compartments where ribosome production takes place, are modified in AML by analyzing a panel of AML and healthy donor cells using immunofluorescence staining. Using four AML series, including the TCGA dataset, altogether representing a total of about 270 samples, we showed that not all factors involved in ribosome biogenesis have clinical values although ribosome biogenesis is increased in AML. Interestingly, we identified the regulator of ribosome production nucleolin (NCL as over-expressed in AML blasts. Moreover, we found in two series that high NCL mRNA expression level was associated with a poor overall survival, particular in elderly patients. Multivariate analyses taking into account age and cytogenetic risk indicated that NCL expression in blast cells is an independent marker of reduced survival. Our study identifies NCL as a potential novel prognostic factor in AML. Altogether, our results suggest that the ribosome biogenesis pathway may be of interest as clinical markers in AML.

  3. Influence of hyperthermia on the phosphorylation of ribosomal protein S6 from human skin fibroblasts and meningioma cells

    DEFF Research Database (Denmark)

    Richter, W W; Zang, K D; Issinger, O G

    1983-01-01

    Skin fibroblasts and meningioma cells, derived from primary cultures of the same patients have been used to study the influence of hyperthermia on (i) cell morphology and (ii) phosphorylation pattern of ribosomal and ribosome-associated proteins. Incubation of tumour cells and fibroblasts up to 7...

  4. Affinity labelling of ribosomes from the livers of different vertebrates by 2-nitro-4-azidobenzoyl-Phe-tRNA

    International Nuclear Information System (INIS)

    Stahl, J.; Boehm, H.; Voderberg, M.

    1981-01-01

    Ribosomal protein L 10 from the livers of trout, hen, and rat was found to be the main target for 2-nitro-4-azidobenzoyl-Phe-tRNA in affinity labelling experiments. Therefore, despite somewhat different electrophoretic mobilities, this protein seems to be involved in the organization of the peptidyl transferase centre in ribosomes of various vertebrates. (author)

  5. The functional half-life of an mRNA depends on the ribosome spacing in an early coding region

    DEFF Research Database (Denmark)

    Pedersen, Margit; Nissen, Søren; Mitarai, Namiko

    2011-01-01

    Bacterial mRNAs are translated by closely spaced ribosomes and degraded from the 5'-end, with half-lives of around 2 min at 37 °C in most cases. Ribosome-free or "naked" mRNA is known to be readily degraded, but the initial event that inactivates the mRNA functionally has not been fully described...

  6. Characterization of the domains of E. coli initiation factor IF2 responsible for recognition of the ribosome

    DEFF Research Database (Denmark)

    Manuel Palacios Moreno, Juan; Andersen, Lars Dyrskjøt; Egebjerg Kristensen, Janni

    1999-01-01

    We have studied the interactions between the ribosome and the domains of Escherichia coli translation initiation factor 2, using an in vitro ribosomal binding assay with wild-type forms, N- and C-terminal truncated forms of IF2 as well as isolated structural domains. A deletion mutant of the fact...

  7. Evidence for rRNA 2'-O-methylation plasticity: Control of intrinsic translational capabilities of human ribosomes.

    Science.gov (United States)

    Erales, Jenny; Marchand, Virginie; Panthu, Baptiste; Gillot, Sandra; Belin, Stéphane; Ghayad, Sandra E; Garcia, Maxime; Laforêts, Florian; Marcel, Virginie; Baudin-Baillieu, Agnès; Bertin, Pierre; Couté, Yohann; Adrait, Annie; Meyer, Mélanie; Therizols, Gabriel; Yusupov, Marat; Namy, Olivier; Ohlmann, Théophile; Motorin, Yuri; Catez, Frédéric; Diaz, Jean-Jacques

    2017-12-05

    Ribosomal RNAs (rRNAs) are main effectors of messenger RNA (mRNA) decoding, peptide-bond formation, and ribosome dynamics during translation. Ribose 2'-O-methylation (2'-O-Me) is the most abundant rRNA chemical modification, and displays a complex pattern in rRNA. 2'-O-Me was shown to be essential for accurate and efficient protein synthesis in eukaryotic cells. However, whether rRNA 2'-O-Me is an adjustable feature of the human ribosome and a means of regulating ribosome function remains to be determined. Here we challenged rRNA 2'-O-Me globally by inhibiting the rRNA methyl-transferase fibrillarin in human cells. Using RiboMethSeq, a nonbiased quantitative mapping of 2'-O-Me, we identified a repertoire of 2'-O-Me sites subjected to variation and demonstrate that functional domains of ribosomes are targets of 2'-O-Me plasticity. Using the cricket paralysis virus internal ribosome entry site element, coupled to in vitro translation, we show that the intrinsic capability of ribosomes to translate mRNAs is modulated through a 2'-O-Me pattern and not by nonribosomal actors of the translational machinery. Our data establish rRNA 2'-O-Me plasticity as a mechanism providing functional specificity to human ribosomes.

  8. Increasing synthetic serum substitute (SSS) concentrations in P1 glucose/phosphate-free medium improves implantation rate: a comparative study.

    Science.gov (United States)

    Ben-Yosef, D; Yovel, I; Schwartz, T; Azem, F; Lessing, J B; Amit, A

    2001-11-01

    To assess the comparative efficacy of IVF medium (MediCult, with 5.2 mM glucose) and a glucose/phosphate-free medium, P1 (Irvine Scientific), and to investigate the influence of increasing the serum supplementation (synthetic serum substitute; SSS; Irvine Scientific) to P1 on embryo development and implantation. Patients were randomly assigned to IVF medium (Group 1, cycles n = 172) or P1 supplemented with 10% SSS (Group 2, cycles n = 229) according to the medium scheduled for use on the day of oocyte retrieval. Another 555 IVF consequent cycles (Group 3) were performed using increased SSS concentrations (20%) in P1 medium. In this large series of IVF cycles, we herein demonstrate that significantly higher pregnancy and implantation rates were found when embryos were cultured in glucose/phosphate-free medium P1 supplemented with 20% SSS compared to supplementation with the lower SSS concentration and with IVF medium.

  9. Solutions of system of P1 equations without use of auxiliary differential equations coupled; Solucoes do sistema de equacoes P1 sem o uso de equacoes diferenciais auxiliares acopladas

    Energy Technology Data Exchange (ETDEWEB)

    Martinez, Aquilino Senra; Silva, Fernando Carvalho da; Cardoso, Carlos Eduardo Santos [Universidade Federal, Rio de Janeiro, RJ (Brazil). Coordenacao dos Programas de Pos-graduacao de Engenharia. Programa de Engenharia Nuclear

    2000-07-01

    The system of P1 equations is composed by two equations coupled itself one for the neutron flux and other for the current. Usually this system is solved by definitions of two integrals parameters, which are named slowing down densities of the flux and the current. Hence, the system P1 can be change from integral to only two differential equations. However, there are two new differentials equations that may be solved with the initial system. The present work analyzes this procedure and studies a method, which solve the P1 equations directly, without definitions of slowing down densities. (author)

  10. Space dependent neutron slowing and thermalization in monatomic hydrogen gas in the P-1 approximation

    International Nuclear Information System (INIS)

    Musazay, M.S.

    1981-01-01

    A solution to the space and energy dependent neutron transport equation in the framework of the consistent P-1 approximation is sought. The transport equation for thermal neutrons in a moderator of 1/v absorption and constant scattering cross section is changed into a set of coupled partial differential equations. The space dependent part is removed by assuming a cosine shaped flux due to a cosine shaped source at a very high energy. The resulting set of strongly coupled ordinary differential equations is decoupled by assuming expansion of collision density in the powers of a leakage parameter whose coefficients are energy and absorption dependent. These energy dependent coefficients are solutions of a set of weakly coupled differential equations. Series solutions to these differential equations in powers of epsilon and 1/epsilon, where epsilon = E/kT, E being the neutron energy and kT the moderator temperature in units of energy, are found. The properties of these solutions are studied extensively. Absorption appears as a parameter in the coefficients of the series. The difficulties arising in choosing the correct form of the asymptotic solutions are resolved by comparing slowing and thermalization. The limitations on the size of the slab and on the range of absorption are included in the analysis

  11. Variational P1 approximations of general-geometry multigroup transport problems

    International Nuclear Information System (INIS)

    Rulko, R.P.; Tomasevic, D.; Larsen, E.W.

    1995-01-01

    A variational approximation is developed for general-geometry multigroup transport problems with arbitrary anisotropic scattering. The variational principle is based on a functional that approximates a reaction rate in a subdomain of the system. In principle, approximations that result from this functional ''optimally'' determine such reaction rates. The functional contains an arbitrary parameter α and requires the approximate solutions of a forward and an adjoint transport problem. If the basis functions for the forward and adjoint solutions are chosen to be linear functions of the angular variable Ω, the functional yields the familiar multigroup P 1 equations for all values of α. However, the boundary conditions that result from the functional depend on α. In particular, for problems with vacuum boundaries, one obtains the conventional mixed boundary condition, but with an extrapolation distance that depends continuously on α. The choice α = 0 yields a generalization of boundary conditions derived earlier by Federighi and Pomraning for a more limited class of problems. The choice α = 1 yields a generalization of boundary conditions derived previously by Davis for monoenergetic problems. Other boundary conditions are obtained by choosing different values of α. The authors discuss this indeterminancy of α in conjunction with numerical experiments

  12. The Properties of Sintered Calcium Phosphate with [Ca]/[P] = 1.50

    Directory of Open Access Journals (Sweden)

    Moo-Chin Wang

    2012-10-01

    Full Text Available In order to obtain the properties of the sintered as-dried calcium phosphate with [Ca]/[P] = 1.50, the characteristics of sintered pellets have been investigated using X-ray diffraction (XRD, inductively coupled plasma-mass spectrometry (ICP-MS, Fourier-transform infrared (FT-IR spectra, Vickers hardness indentation and scanning electron microscopy (SEM. When the pellet samples were sintered between 700 °C and 1200 °C for 4 h, the hydroxyapatite (Ca10(PO46(OH2, HA still maintained the major phase, accompanied with the rhenanite (NaCaPO4 as the secondary phase and β-tricalcium phosphate (β-Ca3(PO42, β-TCP as the minor phases. In addition, the HA partially transformed to α-tricalcium phosphate (α-Ca3(PO42, α-TCP and tetracalcium phosphate (Ca4(PO42O, TTCP, when the pellet samples were sintered at 1300 °C and 1400 °C, respectively, for 4 h. The maximum density and Vickers Hardness (HV of sintered pellet samples were 2.85 g/cm3 (90.18% theoretical density (T.D. and 407, which appeared at 1200 °C and 900 °C, respectively.

  13. Pressure effects on the magnetocaloric properties of MnFeP1-x As x

    International Nuclear Information System (INIS)

    Brueck, E.; Kamarad, J.; Sechovsky, V.; Arnold, Z.; Tegus, O.; Boer, F.R. de

    2007-01-01

    We studied the effect of hydrostatic pressure on the magnetic and magnetocaloric properties of the potential magnetic-refrigerant materials MnFeP 1- x As x with x=0.35 and 0.55. While applied pressure reduces both the Curie temperature and magnetic moment of the former compound, the Curie temperature of the latter is increased whereas the moment is hardly affected by pressure. The same trends are seen in the magnetocaloric properties. These results indicate a different character of the magnetism in these two materials. While the compound with x=0.35 exhibits a volume instability like a weak itinerant ferromagnet, whereas the one with x=0.55 behaves as a strong itinerant ferromagnet. An alternative scenario may be formulated within the localized-moment picture. One may interpret the effect of pressure on the compound with x=0.35 as an indication of pressure-induced enhancement of antiferromagnetic interactions. This latter interpretation is offered by a pronounced enhancement of the high-field susceptibility under pressure

  14. Understanding the Biocompatibility of Sintered Calcium Phosphate with Ratio of [Ca]/[P] = 1.50

    Directory of Open Access Journals (Sweden)

    Feng-Lin Yen

    2012-01-01

    Full Text Available Biocompatibility of sintered calcium phosphate pellets with [Ca]/[P] = 1.50 was determined in this study. Calcium pyrophosphate (CPP phase formed on the sintered pellets immersed in a normal saline solution for 14 d at 37∘C. The intensities of hydroxyapatite (HA reflections in the X-ray diffraction (XRD patterns of the pellets were retrieved to as-sintered state. The pellet surface morphology shows that CPP crystallites were clearly present and make an amorphous calcium phosphate (ACP to discriminate against become to the area of slice join together. In addition, the intensities of the CPP reflections in the XRD patterns were the highest when the pellets were immersed for 28 d. When the CPP powders were extracted from the pellets after immersion in the solution for 14 d, the viability of 3T3 cells remained above 90% for culture times from 1 to 4 d. The pellet surface morphology observed using optical microscopy showed that the cells did not adhere to the bottom of the sintered pellets when cultured for 4 d; however, some CPP phase precipitates were formed, as confirmed by XRD. In consequence, the results suggest that the sintered HA powders are good materials for use in biomedical applications because of their good biocompatibility.

  15. Population pharmacokinetics and pharmacodynamics of ponesimod, a selective S1P1 receptor modulator.

    Science.gov (United States)

    Krause, Andreas; Brossard, Patrick; D'Ambrosio, Daniele; Dingemanse, Jasper

    2014-06-01

    Ponesimod (ACT-128800), a reversible, orally active, selective S1P1 receptor modulator, prevents the egress of lymphocytes from the lymph node into the systemic circulation. It is currently in clinical development for the treatment of relapsing multiple sclerosis. Modulation of circulating lymphocytes serves as biomarker of efficacy and safety, such that the quantitative characterization of the pharmacokinetic/pharmacodynamic (PK/PD) relationship guides the clinical development of the compound. The availability of a variety of doses, dosing regimens, and treatment durations permitted estimation of the pharmacokinetics characterized by an absorption lag time followed by a sequential zero/first-order absorption and two compartments with first-order elimination. The PD are modeled as an indirect-effect model with rates of appearance and disappearance of lymphocytes in blood with a circadian rhythm and a drug effect on the rate of appearance. The model suggests a circadian variation of 9% and a maximum inhibition of 86% of total lymphocyte count with high doses at steady state. It was instrumental for the selection of doses for subsequent studies that confirmed the effect plateau in total lymphocyte count at approximately 0.5 × 10(9) counts/L.

  16. 64Cu-Labeled LyP-1-Dendrimer for PET-CT Imaging of Atherosclerotic Plaque

    Science.gov (United States)

    2015-01-01

    The ability to detect and quantify macrophage accumulation can provide important diagnostic and prognostic information for atherosclerotic plaque. We have previously shown that LyP-1, a cyclic 9-amino acid peptide, binds to p32 proteins on activated macrophages, facilitating the visualization of atherosclerotic plaque with PET. Yet, the in vivo plaque accumulation of monomeric [18F]FBA-LyP-1 was low (0.31 ± 0.05%ID/g). To increase the avidity of LyP-1 constructs to p32, we synthesized a dendritic form of LyP-1 on solid phase using lysine as the core structural element. Imaging probes (FAM or 6-BAT) were conjugated to a lysine or cysteine on the dendrimer for optical and PET studies. The N-terminus of the dendrimer was further modified with an aminooxy group in order to conjugate LyP-1 and ARAL peptides bearing a ketone. Oxime ligation of peptides to both dendrimers resulted in (LyP-1)4- and (ARAL)4-dendrimers with optical (FAM) and PET probes (6-BAT). For PET-CT studies, (LyP-1)4- and (ARAL)4-dendrimer-6-BAT were labeled with 64Cu (t1/2 = 12.7 h) and intravenously injected into the atherosclerotic (ApoE–/–) mice. After two hours of circulation, PET-CT coregistered images demonstrated greater uptake of the (LyP-1)4-dendrimer-64Cu than the (ARAL)4-dendrimer-64Cu in the aortic root and descending aorta. Ex vivo images and the biodistribution acquired at three hours after injection also demonstrated a significantly higher uptake of the (LyP-1)4-dendrimer-64Cu (1.1 ± 0.26%ID/g) than the (ARAL)4-dendrimer-64Cu (0.22 ± 0.05%ID/g) in the aorta. Similarly, subcutaneous injection of the LyP-1-dendrimeric carriers resulted in preferential accumulation in plaque-containing regions over 24 h. In the same model system, ex vivo fluorescence images within aortic plaque depict an increased accumulation and penetration of the (LyP-1)4-dendrimer-FAM as compared to the (ARAL)4-dendrimer-FAM. Taken together, the results suggest that the (LyP-1)4-dendrimer can be applied for in

  17. Markerless Escherichia coli rrn Deletion Strains for Genetic Determination of Ribosomal Binding Sites

    DEFF Research Database (Denmark)

    Quan, Selwyn; Skovgaard, Ole; McLaughlin, Robert E

    2015-01-01

    Single-copy rrn strains facilitate genetic ribosomal studies in Escherichia coli. Consecutive markerless deletion of rrn operons resulted in slower growth upon inactivation of the fourth copy, which was reversed by supplying transfer RNA genes encoded in rrn operons in trans. Removal of the sixth...

  18. Transcription of ribosomal RNA genes is initiated in the third cell cycle of bovine embryos

    DEFF Research Database (Denmark)

    Jakobsen, Anne Sørig; Avery, Birthe; Dieleman, Steph J.

    2006-01-01

    Transcription from the embryos own ribosomal genes is initiated in most species at the same time as the maternal-embryonic transition. Recently data have indicated that a minor activation may take place during the third embryonic cell cycle in the bovine, one cell cycle before the major activation...

  19. The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus.

    Science.gov (United States)

    Hori, H; Osawa, S; Murao, K; Ishikura, H

    1980-01-01

    The nucleotide sequence of ribosomal 5S RNA from Micrococcus lysodeikticus is pGUUACGGCGGCUAUAGCGUGGGGGAAACGCCCGGCCGUAUAUCGAACCCGGAAGCUAAGCCCCAUAGCGCCGAUGGUUACUGUAACCGGGAGGUUGUGGGAGAGUAGGUCGCCGCCGUGAOH. When compared to other 5S RNAs, the sequence homology is greatest with Thermus aquaticus, and these two 5S RNAs reveal several features intermediate between those of typical gram-positive bacteria and gram-negative bacteria. PMID:6780979

  20. Reaction of some macrolide antibiotics with the ribosome. Labeling of the binding site components

    International Nuclear Information System (INIS)

    Tejedor, F.; Ballesta, J.P.

    1986-01-01

    Radioactive carbomycin A, niddamycin, tylosin, and spiramycin, but not erythromycin, can be covalently bound to Escherichia coli ribosomes by incubation at 37 degrees C. The incorporation of radioactivity into the particles is inhibited by SH- and activated double bond containing compounds but not by amino groups, suggesting that the reactions may take place by addition to the double bond present in the reactive antibiotics. This thermic reaction must be different from the photoreaction described for some of these macrolides [Tejedor, F., and Ballesta, J. P. G. (1985) Biochemistry 24, 467-472] since tylosin, which is not photoincorporated, is thermically bound to ribosomes. Most of the radioactivity is incorporated into the ribosomal proteins. Two-dimensional gel electrophoresis of proteins labeled by carbomycin A, niddamycin, and tylosin indicates that about 40% of the radioactivity is bound to protein L27; the rest is distributed among several other proteins such as L8, L2, and S12, to differing extents depending on the drug used. These results indicate, in accordance with previous data, that protein L27 plays an important role in the macrolide binding site, confirming that these drugs bind near the peptidyl transferase center of the ribosome

  1. Genome-Scale Analysis of Translation Elongation with a Ribosome Flow Model

    Science.gov (United States)

    Meilijson, Isaac; Kupiec, Martin; Ruppin, Eytan

    2011-01-01

    We describe the first large scale analysis of gene translation that is based on a model that takes into account the physical and dynamical nature of this process. The Ribosomal Flow Model (RFM) predicts fundamental features of the translation process, including translation rates, protein abundance levels, ribosomal densities and the relation between all these variables, better than alternative (‘non-physical’) approaches. In addition, we show that the RFM can be used for accurate inference of various other quantities including genes' initiation rates and translation costs. These quantities could not be inferred by previous predictors. We find that increasing the number of available ribosomes (or equivalently the initiation rate) increases the genomic translation rate and the mean ribosome density only up to a certain point, beyond which both saturate. Strikingly, assuming that the translation system is tuned to work at the pre-saturation point maximizes the predictive power of the model with respect to experimental data. This result suggests that in all organisms that were analyzed (from bacteria to Human), the global initiation rate is optimized to attain the pre-saturation point. The fact that similar results were not observed for heterologous genes indicates that this feature is under selection. Remarkably, the gap between the performance of the RFM and alternative predictors is strikingly large in the case of heterologous genes, testifying to the model's promising biotechnological value in predicting the abundance of heterologous proteins before expressing them in the desired host. PMID:21909250

  2. The Potential of Targeting Ribosome Biogenesis in High-Grade Serous Ovarian Cancer

    Directory of Open Access Journals (Sweden)

    Shunfei Yan

    2017-01-01

    Full Text Available Overall survival for patients with ovarian cancer (OC has shown little improvement for decades meaning new therapeutic options are critical. OC comprises multiple histological subtypes, of which the most common and aggressive subtype is high-grade serous ovarian cancer (HGSOC. HGSOC is characterized by genomic structural variations with relatively few recurrent somatic mutations or dominantly acting oncogenes that can be targeted for the development of novel therapies. However, deregulation of pathways controlling homologous recombination (HR and ribosome biogenesis has been observed in a high proportion of HGSOC, raising the possibility that targeting these basic cellular processes may provide improved patient outcomes. The poly (ADP-ribose polymerase (PARP inhibitor olaparib has been approved to treat women with defects in HR due to germline BRCA mutations. Recent evidence demonstrated the efficacy of targeting ribosome biogenesis with the specific inhibitor of ribosomal RNA synthesis, CX-5461 in v-myc avian myelocytomatosis viral oncogene homolog (MYC-driven haematological and prostate cancers. CX-5461 has now progressed to a phase I clinical trial in patients with haematological malignancies and phase I/II trial in breast cancer. Here we review the currently available targeted therapies for HGSOC and discuss the potential of targeting ribosome biogenesis as a novel therapeutic approach against HGSOC.

  3. Cross-site comparison of ribosomal depletion kits for Illumina RNAseq library construction.

    Science.gov (United States)

    Herbert, Zachary T; Kershner, Jamie P; Butty, Vincent L; Thimmapuram, Jyothi; Choudhari, Sulbha; Alekseyev, Yuriy O; Fan, Jun; Podnar, Jessica W; Wilcox, Edward; Gipson, Jenny; Gillaspy, Allison; Jepsen, Kristen; BonDurant, Sandra Splinter; Morris, Krystalynne; Berkeley, Maura; LeClerc, Ashley; Simpson, Stephen D; Sommerville, Gary; Grimmett, Leslie; Adams, Marie; Levine, Stuart S

    2018-03-15

    Ribosomal RNA (rRNA) comprises at least 90% of total RNA extracted from mammalian tissue or cell line samples. Informative transcriptional profiling using massively parallel sequencing technologies requires either enrichment of mature poly-adenylated transcripts or targeted depletion of the rRNA fraction. The latter method is of particular interest because it is compatible with degraded samples such as those extracted from FFPE and also captures transcripts that are not poly-adenylated such as some non-coding RNAs. Here we provide a cross-site study that evaluates the performance of ribosomal RNA removal kits from Illumina, Takara/Clontech, Kapa Biosystems, Lexogen, New England Biolabs and Qiagen on intact and degraded RNA samples. We find that all of the kits are capable of performing significant ribosomal depletion, though there are differences in their ease of use. All kits were able to remove ribosomal RNA to below 20% with intact RNA and identify ~ 14,000 protein coding genes from the Universal Human Reference RNA sample at >1FPKM. Analysis of differentially detected genes between kits suggests that transcript length may be a key factor in library production efficiency. These results provide a roadmap for labs on the strengths of each of these methods and how best to utilize them.

  4. Sequence analysis and over-expression of ribosomal protein S28 ...

    African Journals Online (AJOL)

    RPS28 is a component of the 40S small ribosomal subunit encoded by RPS28 gene, which is specific to eukaryotes. The cDNA and the genomic sequence of RPS28 were cloned successfully from the Giant Panda using RT-PCR technology and Touchdown-PCR, respectively. Both sequences were analyzed preliminarily ...

  5. Computational discovery of specificity-conferring sites in non-ribosomal peptide synthetases

    DEFF Research Database (Denmark)

    Knudsen, Michael; Søndergaard, Dan Ariel; Tofting-Olesen, Claus

    2016-01-01

    Motivation: By using a class of large modular enzymes known as Non-Ribosomal Peptide Synthetases (NRPS), bacteria and fungi are capable of synthesizing a large variety of secondary metabolites, many of which are bioactive and have potential, pharmaceutical applications as e.g.~antibiotics. There ...

  6. Molecular mechanism and structure of Trigger Factor bound to the translating ribosome

    Science.gov (United States)

    Merz, Frieder; Boehringer, Daniel; Schaffitzel, Christiane; Preissler, Steffen; Hoffmann, Anja; Maier, Timm; Rutkowska, Anna; Lozza, Jasmin; Ban, Nenad; Bukau, Bernd; Deuerling, Elke

    2008-01-01

    Ribosome-associated chaperone Trigger Factor (TF) initiates folding of newly synthesized proteins in bacteria. Here, we pinpoint by site-specific crosslinking the sequence of molecular interactions of Escherichia coli TF and nascent chains during translation. Furthermore, we provide the first full-length structure of TF associated with ribosome–nascent chain complexes by using cryo-electron microscopy. In its active state, TF arches over the ribosomal exit tunnel accepting nascent chains in a protective void. The growing nascent chain initially follows a predefined path through the entire interior of TF in an unfolded conformation, and even after folding into a domain it remains accommodated inside the protective cavity of ribosome-bound TF. The adaptability to accept nascent chains of different length and folding states may explain how TF is able to assist co-translational folding of all kinds of nascent polypeptides during ongoing synthesis. Moreover, we suggest a model of how TF's chaperoning function can be coordinated with the co-translational processing and membrane targeting of nascent polypeptides by other ribosome-associated factors. PMID:18497744

  7. The use of 125iodine-labeled RNA for detection of the RNA binding to ribosomes

    International Nuclear Information System (INIS)

    Mori, Tomohiko; Fukuda, Mitsuru

    1975-01-01

    The in vitro labeling of RNA with radioactive iodine is the efficient method to obtain the RNA with high specific activity. The present paper reports on the application of this technique to the production of iodine-labeled RNA for use in the experiment of binding RNA to ribosomes. Tobacco mosaic virus (TMV) RNA was used as natural mRNA, and E. coli S-30 preparation was used as a source of ribosomes. The TMV-RNA was prepared by bentonite-phenol extraction from TMV, and the method used for the iodation of RNA was based on the procedure described by Getz et al. The iodine-labeled RNA was incubated in a cell-free protein synthesizing system (S-30) prepared from E. coli K-12. After the incubation, the reaction mixture was layered onto sucrose gradient, centrifuged, and fractionated into 18 fractions. Optical density at 260 nm was measured, and radioactivity was counted, for each fraction. The binding of mRNA to ribosomes occurred even at 0 deg C, and the occurrence of the nonspecific binding was also shown. Consequently, the specific binding, i.e. the formation of the initiation complex being involved in amino acid incorporation, may be estimated by subtracting the radioactivity associated with monosomes in the presence of both rRNA and ATA from that in the presence of rRNA only. It was shown that the iodine-labeled RNA can be used for the studies of binding RNA to ribosomes. (Kako, I.)

  8. Evolutionary dynamics of a conserved sequence motif in the ribosomal genes of the ciliate Paramecium

    Directory of Open Access Journals (Sweden)

    Lynch Michael

    2010-05-01

    Full Text Available Abstract Background In protozoa, the identification of preserved motifs by comparative genomics is often impeded by difficulties to generate reliable alignments for non-coding sequences. Moreover, the evolutionary dynamics of regulatory elements in 3' untranslated regions (both in protozoa and metazoa remains a virtually unexplored issue. Results By screening Paramecium tetraurelia's 3' untranslated regions for 8-mers that were previously found to be preserved in mammalian 3' UTRs, we detect and characterize a motif that is distinctly conserved in the ribosomal genes of this ciliate. The motif appears to be conserved across Paramecium aurelia species but is absent from the ribosomal genes of four additional non-Paramecium species surveyed, including another ciliate, Tetrahymena thermophila. Motif-free ribosomal genes retain fewer paralogs in the genome and appear to be lost more rapidly relative to motif-containing genes. Features associated with the discovered preserved motif are consistent with this 8-mer playing a role in post-transcriptional regulation. Conclusions Our observations 1 shed light on the evolution of a putative regulatory motif across large phylogenetic distances; 2 are expected to facilitate the understanding of the modulation of ribosomal genes expression in Paramecium; and 3 reveal a largely unexplored--and presumably not restricted to Paramecium--association between the presence/absence of a DNA motif and the evolutionary fate of its host genes.

  9. Evolutionary dynamics of a conserved sequence motif in the ribosomal genes of the ciliate Paramecium.

    Science.gov (United States)

    Catania, Francesco; Lynch, Michael

    2010-05-04

    In protozoa, the identification of preserved motifs by comparative genomics is often impeded by difficulties to generate reliable alignments for non-coding sequences. Moreover, the evolutionary dynamics of regulatory elements in 3' untranslated regions (both in protozoa and metazoa) remains a virtually unexplored issue. By screening Paramecium tetraurelia's 3' untranslated regions for 8-mers that were previously found to be preserved in mammalian 3' UTRs, we detect and characterize a motif that is distinctly conserved in the ribosomal genes of this ciliate. The motif appears to be conserved across Paramecium aurelia species but is absent from the ribosomal genes of four additional non-Paramecium species surveyed, including another ciliate, Tetrahymena thermophila. Motif-free ribosomal genes retain fewer paralogs in the genome and appear to be lost more rapidly relative to motif-containing genes. Features associated with the discovered preserved motif are consistent with this 8-mer playing a role in post-transcriptional regulation. Our observations 1) shed light on the evolution of a putative regulatory motif across large phylogenetic distances; 2) are expected to facilitate the understanding of the modulation of ribosomal genes expression in Paramecium; and 3) reveal a largely unexplored--and presumably not restricted to Paramecium--association between the presence/absence of a DNA motif and the evolutionary fate of its host genes.

  10. Ribosome Profiling Reveals Pervasive Translation Outside of Annotated Protein-Coding Genes

    Directory of Open Access Journals (Sweden)

    Nicholas T. Ingolia

    2014-09-01

    Full Text Available Ribosome profiling suggests that ribosomes occupy many regions of the transcriptome thought to be noncoding, including 5′ UTRs and long noncoding RNAs (lncRNAs. Apparent ribosome footprints outside of protein-coding regions raise the possibility of artifacts unrelated to translation, particularly when they occupy multiple, overlapping open reading frames (ORFs. Here, we show hallmarks of translation in these footprints: copurification with the large ribosomal subunit, response to drugs targeting elongation, trinucleotide periodicity, and initiation at early AUGs. We develop a metric for distinguishing between 80S footprints and nonribosomal sources using footprint size distributions, which validates the vast majority of footprints outside of coding regions. We present evidence for polypeptide production beyond annotated genes, including the induction of immune responses following human cytomegalovirus (HCMV infection. Translation is pervasive on cytosolic transcripts outside of conserved reading frames, and direct detection of this expanded universe of translated products enables efforts at understanding how cells manage and exploit its consequences.

  11. Exploring ribosome composition and newly synthesized proteins through proteomics and potential biomedical applications

    Czech Academy of Sciences Publication Activity Database

    Šťastná, Miroslava; Gottlieb, R. A.; Van Eyk, J.E.

    2017-01-01

    Roč. 14, č. 6 (2017), s. 529-543 ISSN 1478-9450 Institutional support: RVO:68081715 Keywords : mass spectrometry * amino-acid labeling * translation * ribosomes * AHA Subject RIV: CB - Analytical Chemistry, Separation OBOR OECD: Analytical chemistry Impact factor: 3.849, year: 2016

  12. Virtual Ribosome - a comprehensive DNA translation tool with support for integration of sequence feature annotation

    DEFF Research Database (Denmark)

    Wernersson, Rasmus

    2006-01-01

    of alternative start codons. ( ii) Integration of sequences feature annotation - in particular, native support for working with files containing intron/ exon structure annotation. The software is available for both download and online use at http://www.cbs.dtu.dk/services/VirtualRibosome/....

  13. Selection of scFvs specific for the HepG2 cell line using ribosome ...

    Indian Academy of Sciences (India)

    Madhsudhan

    the important advantage of requiring no prior knowledge of ... were amplified separately by RT-PCR, and an anti-HepG2 VH/k chain ribosome display library was constructed ..... Engert A, Hudson P R and Power B E 2007 Selection of human.

  14. In silico modelling and analysis of ribosome kinetics and aa-tRNA competition

    NARCIS (Netherlands)

    Bošnački, D.; Pronk, T.E.; de Vink, E.P.

    2008-01-01

    We present a formal analysis of ribosome kinetics using probabilistic model checking and the tool Prism. We compute different parameters of the model, like probabilities of translation errors and average insertion times per codon. The model predicts strong correlation to the quotient of the

  15. YbxF, a protein associated with exponential-phase ribosomes in Bacillus subtilis

    Czech Academy of Sciences Publication Activity Database

    Sojka, Luděk; Fučík, Vladimír; Krásný, Libor; Barvík, I.; Jonák, Jiří

    2007-01-01

    Roč. 189, č. 13 (2007), s. 4809-4814 ISSN 0021-9193 R&D Projects: GA AV ČR IAA5052206 Institutional research plan: CEZ:AV0Z50520514 Keywords : ybxF * ymxC * ribosomes * Bacillus subtilis * GFP * growth phase Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 4.013, year: 2007

  16. Ribosomal PCR and DNA sequencing for detection and identification of bacteria

    DEFF Research Database (Denmark)

    Jensen, Kristine Helander; Dargis, Rimtas; Christensen, Jens Jørgen

    2014-01-01

    -haemolytic streptococci, especially within the mitis group. The data show that ribosomal PCR with subsequent DNA sequencing of the PCR product is a most valuable supplement to culture for identifying bacterial agents of both acute and prolonged infections. However, some bacteria, including non-haemolytic streptococci...

  17. Ribosome stalling regulates IRES-mediated translation in eukaryotes, a parallel to prokaryotic attenuation

    NARCIS (Netherlands)

    Fernandez, James; Yaman, Ibrahim; Huang, Charles; Liu, Haiyan; Lopez, Alex B.; Komar, Anton A.; Caprara, Mark G.; Merrick, William C.; Snider, Martin D.; Kaufman, Randal J.; Lamers, Wouter H.; Hatzoglou, Maria

    2005-01-01

    It was previously shown that the mRNA for the cat-1 Arg/Lys transporter is translated from an internal ribosome entry site (IRES) that is regulated by cellular stress. Amino acid starvation stimulated cat-1 translation via a mechanism that requires translation of an ORF in the mRNA leader and

  18. Development of Soft Tissue Sarcomas in Ribosomal Proteins L5 and S24 Heterozygous Mice

    Czech Academy of Sciences Publication Activity Database

    Kazerounian, S.; Ciarlini, P.D.S.C.; Yuan, D.; Ghazvinian, R.; Alberich-Jorda, Meritxell; Joshi, M.; Zhang, H.; Beggs, A.H.; Gazda, H.T.

    2016-01-01

    Roč. 7, č. 1 (2016), s. 32-36 ISSN 1837-9664 R&D Projects: GA MŠk LK21307 Institutional support: RVO:68378050 Keywords : Ribosomal proteins RPL5 and RPS24 * Diamond-Blackfan anemia * Soft tissue sarcoma Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.916, year: 2016

  19. Ribosome-inhibiting proteins from in vitro cultures of Phytolacca dodecandra

    DEFF Research Database (Denmark)

    Thomsen, S.; Hansen, Harald S.; Nyman, U.

    1991-01-01

    Phytolacca dodecandra (L'Herit) grown in cell cultures was investigated for content of ribosome-inhibiting proteins, which was evaluated hy measuring inhibition of protein synthesis in a cell-free rat liver extract. Calli initiated from leaf, cotyledon, radicle, and hypocotyl and suspension cells...

  20. Specific structural probing of plasmid-coded ribosomal RNAs from Escherichia coli

    DEFF Research Database (Denmark)

    Aagaard, C; Rosendahl, G; Dam, M

    1991-01-01

    The preferred method for construction and in vivo expression of mutagenised Escherichia coli ribosomal RNAs (rRNAs) is via high copy number plasmids. Transcription of wild-type rRNA from the seven chromosomal rrn operons in strains harbouring plasmid-coded mutant rRNAs leads to a heterogeneous...

  1. A rotational diffusion coefficient of the 70s ribosome determined by depolarized laser light scattering

    NARCIS (Netherlands)

    Bruining, J.; Fijnaut, H.M.

    We have obtained a rotational diffusion coefficient of the 70S ribosome isolated from Escherichia-coli (MRE-600), from the depolarized light scattering spectrum measured by photon correlation spectroscopy. The intensity correlation function of depolarized scattered light contains contributions due

  2. Biphasic character of ribosomal translocation and non-Michaelis-Menten kinetics of translation

    Science.gov (United States)

    Xie, Ping

    2014-12-01

    We study theoretically the kinetics of mRNA translocation in the wild-type (WT) Escherichia coli ribosome, which is composed of a small 30 S and large 50 S subunit, and the ribosomes with mutations to some intersubunit bridges such as B1a, B4, B7a, and B8. The theoretical results reproduce well the available in vitro experimental data on the biphasic kinetics of the forward mRNA translocation catalyzed by elongation factor G (EF-G) hydrolyzing GTP, which can be best fit by the sum of two exponentials, and the monophasic kinetics of the spontaneous reverse mRNA translocation in the absence of the elongation factor, which can be best fit by a single-exponential function, in both the WT and mutant ribosomes. We show that both the mutation-induced increase in the maximal rate of the slow phase for the forward mRNA translocation and that in the rate of the spontaneous reverse mRNA translocation result from a reduction in the intrinsic energy barrier to resist the rotational movements between the two subunits, giving the same degree of increase in the two rates. The mutation-induced increase in the maximal rate of the fast phase for the forward mRNA translocation results mainly from the increase in the rate of the ribosomal unlocking, a conformational change in the ribosome that widens the mRNA channel for the mRNA translocation to take place, which could be partly due to the effect of the mutation on the intrasubunit 30S head rotation. Moreover, we study the translation rate of the WT and mutant ribosomes. It is shown that the translation rate versus the concentration of EF-G-GTP does not follow the Michaelis-Menten (MM) kinetics, which is in sharp contrast to the general property of other enzymes that the rate of the enzymatic reaction versus the concentration of a substrate follows the MM kinetics. The physical origin of this non-MM kinetics for the ribosome is revealed.

  3. Bactericide, Immunomodulating, and Wound Healing Properties of Transgenic Kalanchoe pinnata Synergize with Antimicrobial Peptide Cecropin P1 In Vivo

    Directory of Open Access Journals (Sweden)

    A. A. Lebedeva

    2017-01-01

    Full Text Available Procedure of manufacturing K. pinnata water extracts containing cecropin P1 (CecP1 from the formerly described transgenic plants is established. It included incubation of leaves at +4°C for 7 days, mechanical homogenization of leaves using water as extraction solvent, and heating at +70°C for inactivating plant enzymes. Yield of CecP1 (after heating and sterilizing filtration was 0.3% of total protein in the extract. The water extract of K. pinnata + CecP1 exhibits favorable effect on healing of wounds infected with S. aureus (equal to Cefazolin and with a combination of S. aureus with P. aeruginosa (better than Cefazolin. Wild-type K. pinnata extract exhibited evident microbicide activity against S. aureus with P. aeruginosa but it was substantially strengthened in K. pinnata + CecP1 extract. K. pinnata extracts (both wild-type and transgenic did not exhibit general toxicity and accelerated wound recovery. Due to immunomodulating activity, wild-type K. pinnata extract accelerated granulation of the wound bed and marginal epithelialization even better than K. pinnata + CecP1 extract. Immunomodulating and microbicide activity of K. pinnata synergizes with microbicide activity of CecP1 accelerating elimination of bacteria.

  4. Immunomodulating and Revascularizing Activity of Kalanchoe pinnata Synergize with Fungicide Activity of Biogenic Peptide Cecropin P1

    Directory of Open Access Journals (Sweden)

    N. S. Zakharchenko

    2017-01-01

    Full Text Available Previously transgenic Kalanchoe pinnata plants producing an antimicrobial peptide cecropin P1 (CecP1 have been reported. Now we report biological testing K. pinnata extracts containing CecP1 as a candidate drug for treatment of wounds infected with Candida albicans. The drug constitutes the whole juice from K. pinnata leaves (not ethanol extract sterilized with nanofiltration. A microbicide activity of CecP1 against an animal fungal pathogen in vivo was demonstrated for the first time. However, a favorable therapeutic effect of the transgenic K. pinnata extract was attributed to a synergism between the fungicide activity of CecP1 and wound healing (antiscar, revascularizing, and immunomodulating effect of natural biologically active components of K. pinnata. A commercial fungicide preparation clotrimazole eliminated C. albicans cells within infected wounds in rats with efficiency comparable to CecP1-enriched K. pinnata extract. But in contrast to K. pinnata extract, clotrimazole did not exhibit neither wound healing activity nor remodeling of the scar matrix. Taken together, our results allow assumption that CecP1-enriched K. pinnata extracts should be considered as a candidate drug for treatment of dermatomycoses, wounds infected with fungi, and bedsores.

  5. Bactericide, Immunomodulating, and Wound Healing Properties of Transgenic Kalanchoe pinnata Synergize with Antimicrobial Peptide Cecropin P1 In Vivo.

    Science.gov (United States)

    Lebedeva, A A; Zakharchenko, N S; Trubnikova, E V; Medvedeva, O A; Kuznetsova, T V; Masgutova, G A; Zylkova, M V; Buryanov, Y I; Belous, A S

    2017-01-01

    Procedure of manufacturing K. pinnata water extracts containing cecropin P1 (CecP1) from the formerly described transgenic plants is established. It included incubation of leaves at +4°C for 7 days, mechanical homogenization of leaves using water as extraction solvent, and heating at +70°C for inactivating plant enzymes. Yield of CecP1 (after heating and sterilizing filtration) was 0.3% of total protein in the extract. The water extract of K. pinnata + CecP1 exhibits favorable effect on healing of wounds infected with S. aureus (equal to Cefazolin) and with a combination of S. aureus with P. aeruginosa (better than Cefazolin). Wild-type K. pinnata extract exhibited evident microbicide activity against S. aureus with P. aeruginosa but it was substantially strengthened in K. pinnata + CecP1 extract. K. pinnata extracts (both wild-type and transgenic) did not exhibit general toxicity and accelerated wound recovery. Due to immunomodulating activity, wild-type K. pinnata extract accelerated granulation of the wound bed and marginal epithelialization even better than K. pinnata + CecP1 extract. Immunomodulating and microbicide activity of K. pinnata synergizes with microbicide activity of CecP1 accelerating elimination of bacteria.

  6. Immunomodulating and Revascularizing Activity of Kalanchoe pinnata Synergize with Fungicide Activity of Biogenic Peptide Cecropin P1.

    Science.gov (United States)

    Zakharchenko, N S; Belous, A S; Biryukova, Y K; Medvedeva, O A; Belyakova, A V; Masgutova, G A; Trubnikova, E V; Buryanov, Y I; Lebedeva, A A

    2017-01-01

    Previously transgenic Kalanchoe pinnata plants producing an antimicrobial peptide cecropin P1 (CecP1) have been reported. Now we report biological testing K. pinnata extracts containing CecP1 as a candidate drug for treatment of wounds infected with Candida albicans. The drug constitutes the whole juice from K. pinnata leaves (not ethanol extract) sterilized with nanofiltration. A microbicide activity of CecP1 against an animal fungal pathogen in vivo was demonstrated for the first time. However, a favorable therapeutic effect of the transgenic K. pinnata extract was attributed to a synergism between the fungicide activity of CecP1 and wound healing (antiscar), revascularizing, and immunomodulating effect of natural biologically active components of K. pinnata . A commercial fungicide preparation clotrimazole eliminated C. albicans cells within infected wounds in rats with efficiency comparable to CecP1-enriched K. pinnata extract. But in contrast to K. pinnata extract, clotrimazole did not exhibit neither wound healing activity nor remodeling of the scar matrix. Taken together, our results allow assumption that CecP1-enriched K. pinnata extracts should be considered as a candidate drug for treatment of dermatomycoses, wounds infected with fungi, and bedsores.

  7. Nuclear ribosomal internal transcribed spacer (ITS) region as a universal DNA barcode marker for Fungi.

    Science.gov (United States)

    Schoch, Conrad L; Seifert, Keith A; Huhndorf, Sabine; Robert, Vincent; Spouge, John L; Levesque, C André; Chen, Wen

    2012-04-17

    Six DNA regions were evaluated as potential DNA barcodes for Fungi, the second largest kingdom of eukaryotic life, by a multinational, multilaboratory consortium. The region of the mitochondrial cytochrome c oxidase subunit 1 used as the animal barcode was excluded as a potential marker, because it is difficult to amplify in fungi, often includes large introns, and can be insufficiently variable. Three subunits from the nuclear ribosomal RNA cistron were compared together with regions of three representative protein-coding genes (largest subunit of RNA polymerase II, second largest subunit of RNA polymerase II, and minichromosome maintenance protein). Although the protein-coding gene regions often had a higher percent of correct identification compared with ribosomal markers, low PCR amplification and sequencing success eliminated them as candidates for a universal fungal barcode. Among the regions of the ribosomal cistron, the internal transcribed spacer (ITS) region has the highest probability of successful identification for the broadest range of fungi, with the most clearly defined barcode gap between inter- and intraspecific variation. The nuclear ribosomal large subunit, a popular phylogenetic marker in certain groups, had superior species resolution in some taxonomic groups, such as the early diverging lineages and the ascomycete yeasts, but was otherwise slightly inferior to the ITS. The nuclear ribosomal small subunit has poor species-level resolution in fungi. ITS will be formally proposed for adoption as the primary fungal barcode marker to the Consortium for the Barcode of Life, with the possibility that supplementary barcodes may be developed for particular narrowly circumscribed taxonomic groups.

  8. Bactobolin resistance is conferred by mutations in the L2 ribosomal protein.

    Science.gov (United States)

    Chandler, Josephine R; Truong, Thao T; Silva, Patricia M; Seyedsayamdost, Mohammad R; Carr, Gavin; Radey, Matthew; Jacobs, Michael A; Sims, Elizabeth H; Clardy, Jon; Greenberg, E Peter

    2012-12-18

    Burkholderia thailandensis produces a family of polyketide-peptide molecules called bactobolins, some of which are potent antibiotics. We found that growth of B. thailandensis at 30°C versus that at 37°C resulted in increased production of bactobolins. We purified the three most abundant bactobolins and determined their activities against a battery of bacteria and mouse fibroblasts. Two of the three compounds showed strong activities against both bacteria and fibroblasts. The third analog was much less potent in both assays. These results suggested that the target of bactobolins might be conserved across bacteria and mammalian cells. To learn about the mechanism of bactobolin activity, we isolated four spontaneous bactobolin-resistant Bacillus subtilis mutants. We used genomic sequencing technology to show that each of the four resistant variants had mutations in rplB, which codes for the 50S ribosome-associated L2 protein. Ectopic expression of a mutant rplB gene in wild-type B. subtilis conferred bactobolin resistance. Finally, the L2 mutations did not confer resistance to other antibiotics known to interfere with ribosome function. Our data indicate that bactobolins target the L2 protein or a nearby site and that this is not the target of other antibiotics. We presume that the mammalian target of bactobolins involves the eukaryotic homolog of L2 (L8e). Currently available antibiotics target surprisingly few cellular functions, and there is a need to identify novel antibiotic targets. We have been interested in the Burkholderia thailandensis bactobolins, and we sought to learn about the target of bactobolin activity by mapping spontaneous resistance mutations in the bactobolin-sensitive Bacillus subtilis. Our results indicate that the bactobolin target is the 50S ribosome-associated L2 protein or a region of the ribosome affected by L2. Bactobolin-resistant mutants are not resistant to other known ribosome inhibitors. Our evidence indicates that bactobolins

  9. Remodeling of ribosomal genes in somatic cells by Xenopus egg extract

    Energy Technology Data Exchange (ETDEWEB)

    Ostrup, Olga, E-mail: osvarcova@gmail.com [Institute of Basic Animal and Veterinary Sciences, Faculty of Life Sciences, University of Copenhagen, Frederiksberg C (Denmark); Stem Cell Epigenetics Laboratory, Institute of Basic Medical Sciences, Faculty of Medicine, University of Oslo, Oslo (Norway); Norwegian Center for Stem Cell Research, Oslo (Norway); Hyttel, Poul; Klaerke, Dan A. [Institute of Basic Animal and Veterinary Sciences, Faculty of Life Sciences, University of Copenhagen, Frederiksberg C (Denmark); Collas, Philippe, E-mail: philc@medisin.uio.no [Stem Cell Epigenetics Laboratory, Institute of Basic Medical Sciences, Faculty of Medicine, University of Oslo, Oslo (Norway); Norwegian Center for Stem Cell Research, Oslo (Norway)

    2011-09-02

    Highlights: {yields} Xenopus egg extract remodels nuclei and alter cell growth characteristics. {yields} Ribosomal genes are reprogrammed within 6 h after extract exposure. {yields} rDNA reprogramming involves promoter targeting of SNF2H remodeling complex. {yields} Xenopus egg extract does not initiate stress-related response in somatic cells. {yields} Aza-cytidine elicits a stress-induced response in reprogrammed cells. -- Abstract: Extracts from Xenopus eggs can reprogram gene expression in somatic nuclei, however little is known about the earliest processes associated with the switch in the transcriptional program. We show here that an early reprogramming event is the remodeling of ribosomal chromatin and gene expression. This occurs within hours of extract treatment and is distinct from a stress response. Egg extract elicits remodeling of the nuclear envelope, chromatin and nucleolus. Nucleolar remodeling involves a rapid and stable decrease in ribosomal gene transcription, and promoter targeting of the nucleolar remodeling complex component SNF2H without affecting occupancy of the transcription factor UBF and the stress silencers SUV39H1 and SIRT1. During this process, nucleolar localization of UBF and SIRT1 is not altered. On contrary, azacytidine pre-treatment has an adverse effect on rDNA remodeling induced by extract and elicits a stress-type nuclear response. Thus, an early event of Xenopus egg extract-mediated nuclear reprogramming is the remodeling of ribosomal genes involving nucleolar remodeling complex. Condition-specific and rapid silencing of ribosomal genes may serve as a sensitive marker for evaluation of various reprogramming methods.

  10. Expression of flavonoid 3’-hydroxylase is controlled by P1, the regulator of 3-deoxyflavonoid biosynthesis in maize

    Science.gov (United States)

    2012-01-01

    Background The maize (Zea mays) red aleurone1 (pr1) encodes a CYP450-dependent flavonoid 3’-hydroxylase (ZmF3’H1) required for the biosynthesis of purple and red anthocyanin pigments. We previously showed that Zmf3’h1 is regulated by C1 (Colorless1) and R1 (Red1) transcription factors. The current study demonstrates that, in addition to its role in anthocyanin biosynthesis, the Zmf3’h1 gene also participates in the biosynthesis of 3-deoxyflavonoids and phlobaphenes that accumulate in maize pericarps, cob glumes, and silks. Biosynthesis of 3-deoxyflavonoids is regulated by P1 (Pericarp color1) and is independent from the action of C1 and R1 transcription factors. Results In maize, apiforol and luteoforol are the precursors of condensed phlobaphenes. Maize lines with functional alleles of pr1 and p1 (Pr1;P1) accumulate luteoforol, while null pr1 lines with a functional or non-functional p1 allele (pr1;P1 or pr1;p1) accumulate apiforol. Apiforol lacks a hydroxyl group at the 3’-position of the flavylium B-ring, while luteoforol has this hydroxyl group. Our biochemical analysis of accumulated compounds in different pr1 genotypes showed that the pr1 encoded ZmF3’H1 has a role in the conversion of mono-hydroxylated to bi-hydroxylated compounds in the B-ring. Steady state RNA analyses demonstrated that Zmf3’h1 mRNA accumulation requires a functional p1 allele. Using a combination of EMSA and ChIP experiments, we established that the Zmf3’h1 gene is a direct target of P1. Highlighting the significance of the Zmf3’h1 gene for resistance against biotic stress, we also show here that the p1 controlled 3-deoxyanthocyanidin and C-glycosyl flavone (maysin) defence compounds accumulate at significantly higher levels in Pr1 silks as compared to pr1 silks. By virtue of increased maysin synthesis in Pr1 plants, corn ear worm larvae fed on Pr1; P1 silks showed slower growth as compared to pr1; P1 silks. Conclusions Our results show that the Zmf3’h1 gene

  11. Expression of flavonoid 3'-hydroxylase is controlled by P1, the regulator of 3-deoxyflavonoid biosynthesis in maize.

    Science.gov (United States)

    Sharma, Mandeep; Chai, Chenglin; Morohashi, Kengo; Grotewold, Erich; Snook, Maurice E; Chopra, Surinder

    2012-11-01

    The maize (Zea mays) red aleurone1 (pr1) encodes a CYP450-dependent flavonoid 3'-hydroxylase (ZmF3'H1) required for the biosynthesis of purple and red anthocyanin pigments. We previously showed that Zmf3'h1 is regulated by C1 (Colorless1) and R1 (Red1) transcription factors. The current study demonstrates that, in addition to its role in anthocyanin biosynthesis, the Zmf3'h1 gene also participates in the biosynthesis of 3-deoxyflavonoids and phlobaphenes that accumulate in maize pericarps, cob glumes, and silks. Biosynthesis of 3-deoxyflavonoids is regulated by P1 (Pericarp color1) and is independent from the action of C1 and R1 transcription factors. In maize, apiforol and luteoforol are the precursors of condensed phlobaphenes. Maize lines with functional alleles of pr1 and p1 (Pr1;P1) accumulate luteoforol, while null pr1 lines with a functional or non-functional p1 allele (pr1;P1 or pr1;p1) accumulate apiforol. Apiforol lacks a hydroxyl group at the 3'-position of the flavylium B-ring, while luteoforol has this hydroxyl group. Our biochemical analysis of accumulated compounds in different pr1 genotypes showed that the pr1 encoded ZmF3'H1 has a role in the conversion of mono-hydroxylated to bi-hydroxylated compounds in the B-ring. Steady state RNA analyses demonstrated that Zmf3'h1 mRNA accumulation requires a functional p1 allele. Using a combination of EMSA and ChIP experiments, we established that the Zmf3'h1 gene is a direct target of P1. Highlighting the significance of the Zmf3'h1 gene for resistance against biotic stress, we also show here that the p1 controlled 3-deoxyanthocyanidin and C-glycosyl flavone (maysin) defence compounds accumulate at significantly higher levels in Pr1 silks as compared to pr1 silks. By virtue of increased maysin synthesis in Pr1 plants, corn ear worm larvae fed on Pr1; P1 silks showed slower growth as compared to pr1; P1 silks. Our results show that the Zmf3'h1 gene participates in the biosynthesis of phlobaphenes and

  12. Expression of flavonoid 3’-hydroxylase is controlled by P1, the regulator of 3-deoxyflavonoid biosynthesis in maize

    Directory of Open Access Journals (Sweden)

    Sharma Mandeep

    2012-11-01

    Full Text Available Abstract Background The maize (Zea mays red aleurone1 (pr1 encodes a CYP450-dependent flavonoid 3’-hydroxylase (ZmF3’H1 required for the biosynthesis of purple and red anthocyanin pigments. We previously showed that Zmf3’h1 is regulated by C1 (Colorless1 and R1 (Red1 transcription factors. The current study demonstrates that, in addition to its role in anthocyanin biosynthesis, the Zmf3’h1 gene also participates in the biosynthesis of 3-deoxyflavonoids and phlobaphenes that accumulate in maize pericarps, cob glumes, and silks. Biosynthesis of 3-deoxyflavonoids is regulated by P1 (Pericarp color1 and is independent from the action of C1 and R1 transcription factors. Results In maize, apiforol and luteoforol are the precursors of condensed phlobaphenes. Maize lines with functional alleles of pr1 and p1 (Pr1;P1 accumulate luteoforol, while null pr1 lines with a functional or non-functional p1 allele (pr1;P1 or pr1;p1 accumulate apiforol. Apiforol lacks a hydroxyl group at the 3’-position of the flavylium B-ring, while luteoforol has this hydroxyl group. Our biochemical analysis of accumulated compounds in different pr1 genotypes showed that the pr1 encoded ZmF3’H1 has a role in the conversion of mono-hydroxylated to bi-hydroxylated compounds in the B-ring. Steady state RNA analyses demonstrated that Zmf3’h1 mRNA accumulation requires a functional p1 allele. Using a combination of EMSA and ChIP experiments, we established that the Zmf3’h1 gene is a direct target of P1. Highlighting the significance of the Zmf3’h1 gene for resistance against biotic stress, we also show here that the p1 controlled 3-deoxyanthocyanidin and C-glycosyl flavone (maysin defence compounds accumulate at significantly higher levels in Pr1 silks as compared to pr1 silks. By virtue of increased maysin synthesis in Pr1 plants, corn ear worm larvae fed on Pr1; P1 silks showed slower growth as compared to pr1; P1 silks. Conclusions Our results show that the Zmf3

  13. Secreted Klotho Attenuates Inflammation-Associated Aortic Valve Fibrosis in Senescence-Accelerated Mice P1.

    Science.gov (United States)

    Chen, Jianglei; Fan, Jun; Wang, Shirley; Sun, Zhongjie

    2018-05-01

    Senescence-accelerated mice P1 (SAMP1) is an aging model characterized by shortened lifespan and early signs of senescence. Klotho is an aging-suppressor gene. The purpose of this study is to investigate whether in vivo expression of secreted klotho ( Skl ) gene attenuates aortic valve fibrosis in SAMP1 mice. SAMP1 mice and age-matched (AKR/J) control mice were used. SAMP1 mice developed obvious fibrosis in aortic valves, namely fibrotic aortic valve disease. Serum level of Skl was decreased drastically in SAMP1 mice. Expression of MCP-1 (monocyte chemoattractant protein 1), ICAM-1 (intercellular adhesion molecule 1), F4/80, and CD68 was increased in aortic valves of SAMP1 mice, indicating inflammation. An increase in expression of α-smooth muscle actin (myofibroblast marker), transforming growth factorβ-1, and scleraxis (a transcription factor of collagen synthesis) was also found in aortic valves of SAMP1 mice, suggesting that accelerated aging is associated with myofibroblast transition and collagen gene activation. We constructed adeno-associated virus 2 carrying mouse Skl cDNA for in vivo expression of Skl. Skl gene delivery effectively increased serum Skl of SAMP1 mice to the control level. Skl gene delivery inhibited inflammation and myofibroblastic transition in aortic valves and attenuated fibrotic aortic valve disease in SAMP1 mice. It is concluded that senescence-related fibrotic aortic valve disease in SAMP1 mice is associated with a decrease in serum klotho leading to inflammation, including macrophage infiltration and transforming growth factorβ-1/scleraxis-driven myofibroblast differentiation in aortic valves. Restoration of serum Skl levels by adeno-associated virus 2 carrying mouse Skl cDNA effectively suppresses inflammation and myofibroblastic transition and attenuates aortic valve fibrosis. Skl may be a potential therapeutic target for fibrotic aortic valve disease. © 2018 American Heart Association, Inc.

  14. The effect of chemical carcinogenesis on rat glutathione S-transferase P1 gene transcriptional regulation.

    Science.gov (United States)

    Liu, D; Liao, M; Zuo, J; Henner, W D; Fan, F

    2001-03-01

    To investigate mechanisms of rat glutathione S-transferase P1 gene (rGSTP1) expression regulation during chemical carcinogenesis. we studied enhancer elements located in the region between -2.5 kb to -2.2 kb. The region was upstream from the start site of transcription and was divided into two major fragments, GPEI and GPEII. The GPEII fragment was further divided into two smaller fragments, GPEII- I and GPEII-2. Using a luciferase reporter system, we identified a strong enhancer of GPEI and a weak enhancer of GPEII in HeLa and a rat hepatoma cell line CBRH79 19 cell. The enhancer of GPEII was located within the GPEII-I region. Chemical stimulation by glycidyl methatylate (GMA) and phorbol 12-o-tetradecanoate 13-acetate (TPA) analysis revealed that induction of rGSTP1 expression was mainly through GPEI. Although H2O2 could enhance GPEII enhancer activity, the enhancement is not mediated by the NF-kappaB factor that bound the NF-kappaB site in GPEII. Using electrophoretic mobility shift assays (EMSA) and the UV cross-linking assays, we found that HeLa and CBRH7919 cells had proteins that specifically bound GPEI core sequence and a 64 kDa protein that interacted with GPEII-1. The cells from normal rat liver did not express the binding proteins. Therefore, the trans-acting factors seem to be closely related to GPEI, GPEII enhancer activities and may play an important role in high expression of rGSTPI gene.

  15. Broad-Host-Range IncP-1 plasmids and their resistance potential

    Directory of Open Access Journals (Sweden)

    Magdalena ePopowska

    2013-03-01

    Full Text Available The plasmids of the incompatibility group IncP-1, also called IncP, as extrachromosomal genetic elements can transfer and replicate virtually in all Gram-negative bacteria. They are composed of backbone genes that encode a variety of essential functions and accessory genes that have implications for human health and environmental bioremediation. Broad-host-range IncP plasmids are known to spread genes between distinct phylogenetic groups of bacteria. These genes often code for resistances to a broad spectrum of antibiotics, heavy metals and quaternary ammonium compounds used as disinfectants. The backbone of these plasmids carries modules that enable them to effectively replicate, move to a new host via conjugative transfer and to be stably maintained in bacterial cells. The adaptive, resistance and virulence genes are mainly located on mobile genetic elements integrated between the functional plasmid backbone modules. Environmental studies have demonstrated the wide distribution of IncP-like replicons in manure, soils and wastewater treatment plants. They also are present in strains of pathogenic or opportunistic bacteria, which can be a cause for concern, because they may encode multiresistance. Their broad distribution suggests that IncP plasmids play a crucial role in bacterial adaptation by utilizing horizontal gene transfer. This review summarizes the variety of genetic information and physiological functions carried by IncP plasmids, which can contribute to the spread of antibiotic and heavy metal resistance while also mediating the process of bioremediation of pollutants. Due to the location of the resistance genes on plasmids with a broad host range and the presence of transposons carrying these genes it seems that the spread of these genes would be possible and quite hazardous in infection control. Future studies are required to determine the level of risk of the spread of resistance genes located on these plasmids.

  16. A computationally efficient P_1 radiation model for modern combustion systems utilizing pre-conditioned conjugate gradient methods

    International Nuclear Information System (INIS)

    Krishnamoorthy, Gautham

    2017-01-01

    Highlights: • The P_1 radiation model was interfaced with high performance linear solvers. • Pre-conditioned conjugate gradient (PC CG) method improved convergence by 50% • PC CG was more than 30 times faster than classical iterative methods. • The time to solution scaled linearly with increase in problem size employing PC CG. • Employing WSGGM with P_1 model compared reasonably well against benchmark data. - Abstract: The iterative convergence of the P_1 radiation model can be slow in optically thin scenarios when employing classical iterative methods. In order to remedy this shortcoming, an in-house P_1 radiation model was interfaced with high performance, scalable, linear solver libraries. Next, the accuracies of P_1 radiation model calculations was assessed by comparing its predictions against discrete ordinates (DO) model calculations for prototypical problems representative of modern combustion systems. Corresponding benchmark results were also included for comparison. Utilizing Pre-Conditioners (PC) to the Conjugate Gradients (CG) method, the convergence time of the P_1 radiation model reduced by a factor of 30 for modest problem sizes and a factor of 70 for larger sized problems when compared against classical Gauss Seidel sweeps. Further, PC provided 50% computational savings compared to employing CG in a standalone mode. The P_1 model calculation times were about 25–30% of the DO model calculation time. The time to solution also scaled linearly with an increase in problem size. The weighted sum of gray gases model employed in this study in conjunction with the P_1 model provided good agreement against benchmark data with L_2 error norms (defined relative to corresponding DO calculations) improving when isotropic intensities were prevalent.

  17. Closed expressions for $\\int_{0}^{1} t^{-1} log^{n-1}t log^{p}(1 - t) dt$

    CERN Document Server

    Kölbig, Kurt Siegfried

    1982-01-01

    Closed expressions for the integral integral /sub 0//sup 1/ t/sup -1/ log/sup n-1/t log/sup p/(1-t)dt, whose general form is given elsewhere, are listed for n=1(1)9, p=1(1)9. A formula is derived which allows an easy evaluation of these expressions by formula manipulation on a computer. The majority of the above expressions are given in a microfiche supplement to the paper.

  18. Stability of period-one (P1) oscillations generated by semiconductor lasers subject to optical injection or optical feedback.

    Science.gov (United States)

    Lin, Lyu-Chih; Liu, Ssu-Hsin; Lin, Fan-Yi

    2017-10-16

    We study the stability of period-one (P1) oscillations experimentally generated by semiconductor lasers subject to optical injection (OI) and by those subject to optical feedback (OF). With unique advantages of broad frequency tuning range and large sideband rejection ratio, P1 oscillations can be useful in applications such as photonic microwave generation, radio-over-fiber communication, and laser Doppler velocimeter. The stability of the P1 oscillations is critical for these applications, which can be affected by spontaneous emission and fluctuations in both temperature and injection current. Although linewidths of P1 oscillations generated by various schemes have been reported, the mechanisms and roles which each of the OI and the OF play have however not been investigated in detail. To characterize the stability of the P1 oscillations generated by the OI and the OF schemes, we measure the linewidths and linewidth reduction ratios (LRRs) of the P1 oscillations. The OF scheme has a narrowest linewidth of 0.21 ± 0.03 MHz compared to 4.7 ± 0.6 MHz in the OI scheme. In the OF scheme, a much larger region of LRRs higher than 90% is also found. The superior stability of the OF scheme is benefited by the fact that the P1 oscillations in the OF scheme are originated from the undamped relaxation oscillation of a single laser and can be phase-locked to one of its external cavity modes, whereas those in the OI scheme come from two independent lasers which bear no phase relation. Moreover, excess P1 linewidth broadening in the OI scheme caused by fluctuation in injection parameters associated with frequency jitter and relative intensity noise (RIN) is also minimized in the OF scheme.

  19. Direct regulatory immune activity of lactic acid bacteria on Der p 1-pulsed dendritic cells from allergic patients.

    Science.gov (United States)

    Pochard, Pierre; Hammad, Hamida; Ratajczak, Céline; Charbonnier-Hatzfeld, Anne-Sophie; Just, Nicolas; Tonnel, André-Bernard; Pestel, Joël

    2005-07-01

    Lactic acid bacteria (LAB) are suggested to play a regulatory role in the development of allergic reactions. However, their potential effects on dendritic cells (DCs) directing the immune polarization remain unclear. The immunologic effect of Lactobacillus plantarum NCIMB 8826 (LAB1) on monocyte-derived dendritic cells (MD-DCs) from patients allergic to house dust mite was evaluated. MD-DCs were stimulated for 24 hours with the related allergen Der p 1 in the presence or absence of LAB1. Cell-surface markers were assessed by means of FACS analysis, and the key polarizing cytokines IL-12 and IL-10 were quantified. The subsequent regulatory effect of pulsed MD-DCs on naive or memory T cells was evaluated by determining the T-cell cytokine profile. LAB1 induced the maturation of MD-DCs, even if pulsed with Der p 1. Interestingly, after incubation with LAB1 and Der p 1, MD-DCs produced higher amounts of IL-12 than Der p 1-pulsed DCs. Indeed, the T H 2 cytokine (IL-4 and IL-5) production observed when naive or memory autologous T cells were cocultured with Der p 1-pulsed MD-DCs was highly reduced in the presence of LAB1. Finally, in contrast to naive or memory T cells exposed once to Der p 1-pulsed DCs, T cells stimulated by MD-DCs pulsed with Der p 1 and LAB1 failed to produce T H 2 cytokines in response to a new stimulation with Der p 1-pulsed DCs. Thus in the presence of LAB1, MD-DCs from allergic patients tend to reorientate the T-cell response toward a beneficial T H 1 profile.

  20. Alfalfa mosaic virus replicase proteins, P1 and P2, localize to the tonoplast in the presence of virus RNA

    International Nuclear Information System (INIS)

    Ibrahim, Amr; Hutchens, Heather M.; Howard Berg, R.; Sue Loesch-Fries, L.

    2012-01-01

    To identify the virus components important for assembly of the Alfalfa mosaic virus replicase complex, we used live cell imaging of Arabidopsis thaliana protoplasts that expressed various virus cDNAs encoding native and GFP-fusion proteins of P1 and P2 replicase proteins and full-length virus RNAs. Expression of P1-GFP alone resulted in fluorescent vesicle-like bodies in the cytoplasm that colocalized with FM4-64, an endocytic marker, and RFP-AtVSR2, RabF2a/Rha1-mCherry, and RabF2b/Ara7-mCherry, all of which localize to multivesicular bodies (MVBs), which are also called prevacuolar compartments, that mediate traffic to the lytic vacuole. GFP-P2 was driven from the cytosol to MVBs when expressed with P1 indicating that P1 recruited GFP-P2. P1-GFP localized on the tonoplast, which surrounds the vacuole, in the presence of infectious virus RNA, replication competent RNA2, or P2 and replication competent RNA1 or RNA3. This suggests that a functional replication complex containing P1, P2, and a full-length AMV RNA assembles on MVBs to traffic to the tonoplast.

  1. Alfalfa mosaic virus replicase proteins, P1 and P2, localize to the tonoplast in the presence of virus RNA

    Energy Technology Data Exchange (ETDEWEB)

    Ibrahim, Amr [Department of Botany and Plant Pathology, Purdue University, West Lafayette, IN 47907 (United States); Present address: Genomics Facility, Agricultural Genetic Engineering Research Institute, Agricultural Research Center, Giza 12619 (Egypt); Hutchens, Heather M. [Department of Botany and Plant Pathology, Purdue University, West Lafayette, IN 47907 (United States); Howard Berg, R. [Integrated Microscopy Facility, Donald Danforth Plant Science Center, Saint Louis, MO 63132 (United States); Sue Loesch-Fries, L., E-mail: loeschfr@purdue.edu [Department of Botany and Plant Pathology, Purdue University, West Lafayette, IN 47907 (United States)

    2012-11-25

    To identify the virus components important for assembly of the Alfalfa mosaic virus replicase complex, we used live cell imaging of Arabidopsis thaliana protoplasts that expressed various virus cDNAs encoding native and GFP-fusion proteins of P1 and P2 replicase proteins and full-length virus RNAs. Expression of P1-GFP alone resulted in fluorescent vesicle-like bodies in the cytoplasm that colocalized with FM4-64, an endocytic marker, and RFP-AtVSR2, RabF2a/Rha1-mCherry, and RabF2b/Ara7-mCherry, all of which localize to multivesicular bodies (MVBs), which are also called prevacuolar compartments, that mediate traffic to the lytic vacuole. GFP-P2 was driven from the cytosol to MVBs when expressed with P1 indicating that P1 recruited GFP-P2. P1-GFP localized on the tonoplast, which surrounds the vacuole, in the presence of infectious virus RNA, replication competent RNA2, or P2 and replication competent RNA1 or RNA3. This suggests that a functional replication complex containing P1, P2, and a full-length AMV RNA assembles on MVBs to traffic to the tonoplast.

  2. Absence of ribosomal DNA amplification in the meroistic (telotrophic) ovary of the large milkweed bug Oncopeltus fasciatus (Dallas) (Hemiptera: Lygaeidae)

    Science.gov (United States)

    1975-01-01

    In the typical meroistic insect ovary, the oocyte nucleus synthesizes little if any RNA. Nurse cells or trophocytes actively synthesize ribosomes which are transported to and accumulated by the oocyte. In the telotrophic ovary a morphological separation exists, the nurse cells being localized at the apical end of each ovariole and communicating with the ooocytes via nutritive cords. In order to determine whether the genes coding for ribosomal RNA (rRNA) are amplified in the telotrophic ovary of the milkweed bug Oncopeltus fasciatus, the percentages of the genome coding for ribosomal RNA in somatic cells, spermatogenic cells, ovarian follicles, and nurse cells were compared. The oocytes and most of the nurse cells of O. fasciatus are uninucleolate. DNA hybridizing with ribosomal RNA is localized in a satellite DNA, the density of which is 1.712 g/cm(-3). The density of main-band DNA is 1.694 g/cm(-3). The ribosomal DNA satellite accounts for approximately 0.2% of the DNA in somatic and gametogenic tissues of both males and females. RNA-DNA hybridization analysis demonstrates that approximately 0.03% of the DNA in somatic tissues, testis, ovarian follicles, and isolated nurse cells hybridizes with ribosomal RNA. The fact that the percentage of DNA hybridizing with rRNA is the same in somatic and in male and female gametogenic tissues indicates that amplification of ribosomal DNA does not occur in nurse cells and that if it occurs in oocytes, it represents less than a 50- fold increase in ribosomal DNA. An increase in total genome DNA accounted by polyploidization appears to provide for increasing the amount of ribosomal DNA in the nurse cells. PMID:1158969

  3. Toxicity of ricin A chain is reduced in mammalian cells by inhibiting its interaction with the ribosome

    Energy Technology Data Exchange (ETDEWEB)

    Jetzt, Amanda E. [Department of Animal Sciences, Rutgers, The State University of New Jersey, New Brunswick, NJ 08901-8520 (United States); Li, Xiao-Ping; Tumer, Nilgun E. [Department of Plant Biology and Pathology, Rutgers, The State University of New Jersey, New Brunswick, NJ 08901-8520 (United States); Cohick, Wendie S., E-mail: cohick@aesop.rutgers.edu [Department of Animal Sciences, Rutgers, The State University of New Jersey, New Brunswick, NJ 08901-8520 (United States)

    2016-11-01

    Ricin is a potent ribotoxin that is considered a bioterror threat due to its ease of isolation and possibility of aerosolization. In yeast, mutation of arginine residues away from the active site results in a ricin toxin A chain (RTA) variant that is unable to bind the ribosome and exhibits reduced cytotoxicity. The goal of the present work was to determine if these residues contribute to ribosome binding and cytotoxicity of RTA in mammalian cells. The RTA mutant R193A/R235A did not interact with mammalian ribosomes, while a G212E variant with a point mutation near its active site bound ribosomes similarly to wild-type (WT) RTA. R193A/R235A retained full catalytic activity on naked RNA but had reduced activity on mammalian ribosomes. To determine the effect of this mutant in intact cells, pre R193A/R235A containing a signal sequence directing it to the endoplasmic reticulum and mature R193A/R235A that directly targeted cytosolic ribosomes were each expressed. Depurination and protein synthesis inhibition were reduced by both pre- and mature R193A/R235A relative to WT. Protein synthesis inhibition was reduced to a greater extent by R193A/R235A than by G212E. Pre R193A/R235A caused a greater reduction in caspase activation and loss of mitochondrial membrane potential than G212E relative to WT RTA. These findings indicate that an RTA variant with reduced ribosome binding is less toxic than a variant with less catalytic activity but normal ribosome binding activity. The toxin-ribosome interaction represents a novel target for the development of therapeutics to prevent or treat ricin intoxication. - Highlights: • Arginines 193 and 235 of RTA are critical for binding to the mammalian ribosome. • R193A/R235A has full catalytic activity on RNA but not on mammalian ribosomes. • R193A/R235A is less toxic than a mutant that targets the active site. • The toxin-ribosome interaction is a therapeutic target for ricin intoxication.

  4. On the intracellular trafficking of mouse S5 ribosomal protein from cytoplasm to nucleoli.

    Science.gov (United States)

    Matragkou, Ch; Papachristou, H; Karetsou, Z; Papadopoulos, G; Papamarcaki, T; Vizirianakis, I S; Tsiftsoglou, A S; Choli-Papadopoulou, T

    2009-10-09

    The non-ribosomal functions of mammalian ribosomal proteins have recently attracted worldwide attention. The mouse ribosomal protein S5 (rpS5) derived from ribosomal material is an assembled non-phosphorylated protein. The free form of rpS5 protein, however, undergoes phosphorylation. In this study, we have (a) investigated the potential role of phosphorylation in rpS5 protein transport into the nucleus and then into nucleoli and (b) determined which of the domains of rpS5 are involved in this intracellular trafficking. In vitro PCR mutagenesis of mouse rpS5 cDNA, complemented by subsequent cloning and expression of rpS5 truncated recombinant forms, produced in fusion with green fluorescent protein, permitted the investigation of rpS5 intracellular trafficking in HeLa cells using confocal microscopy complemented by Western blot analysis. Our results indicate the following: (a) rpS5 protein enters the nucleus via the region 38-50 aa that forms a random coil as revealed by molecular dynamic simulation. (b) Immunoprecipitation of rpS5 with casein kinase II and immobilized metal affinity chromatography analysis complemented by in vitro kinase assay revealed that phosphorylation of rpS5 seems to be indispensable for its transport from nucleus to nucleoli; upon entering the nucleus, Thr-133 phosphorylation triggers Ser-24 phosphorylation by casein kinase II, thus promoting entrance of rpS5 into the nucleoli. Another important role of rpS5 N-terminal region is proposed to be the regulation of protein's cellular level. The repetitively co-appearance of a satellite C-terminal band below the entire rpS5 at the late stationary phase, and not at the early logarithmic phase, of cell growth suggests a specific degradation balancing probably the unassembled ribosomal protein molecules with those that are efficiently assembled to ribosomal subunits. Overall, these data provide new insights on the structural and functional domains within the rpS5 molecule that contribute to its

  5. P1 epigenetic regulation in leaves of high altitude maize landraces: effect of UV-B radiation

    Directory of Open Access Journals (Sweden)

    Sebastian Pablo Rius

    2016-04-01

    Full Text Available P1 is a R2R3-MYB transcription factor that regulates the accumulation of a specific group of flavonoids in maize floral tissues, such as flavones and phlobaphenes. P1 is also highly expressed in leaves of maize landraces adapted to high altitudes and higher levels of UV-B radiation. In this work, we analyzed the epigenetic regulation of the P1 gene by UV-B in leaves of different maize landraces. Our results demonstrate that DNA methylation in the P1 proximal promoter, intron1 and intron2 is decreased by UV-B in all lines analyzed; however, the basal DNA methylation levels are lower in the landraces than in B73, a low altitude inbred line. DNA demethylation by UV-B is accompanied by a decrease in H3 methylation at Lys 9 and 27, and by an increase in H3 acetylation. smRNAs complementary to specific regions of the proximal promoter and of intron 2 3' end are also decreased by UV-B; interestingly, P1 smRNA levels are lower in the landraces than in B73 both under control conditions and after UV-B exposure, suggesting that smRNAs regulate P1 expression by UV-B in maize leaves. Finally, we investigated if different P1 targets in flower tissues are also regulated by this transcription factor in response to UV-B. Some targets analyzed show an induction in maize landraces in response to UV-B, with higher basal expression levels in the landraces than in B73; however, not all the transcripts analyzed were found to be regulated by UV-B in leaves.

  6. Identification of a Supramolecular Functional Architecture of Streptococcus mutans Adhesin P1 on the Bacterial Cell Surface*

    Science.gov (United States)

    Heim, Kyle P.; Sullan, Ruby May A.; Crowley, Paula J.; El-Kirat-Chatel, Sofiane; Beaussart, Audrey; Tang, Wenxing; Besingi, Richard; Dufrene, Yves F.; Brady, L. Jeannine

    2015-01-01

    P1 (antigen I/II) is a sucrose-independent adhesin of Streptococcus mutans whose functional architecture on the cell surface is not fully understood. S. mutans cells subjected to mechanical extraction were significantly diminished in adherence to immobilized salivary agglutinin but remained immunoreactive and were readily aggregated by fluid-phase salivary agglutinin. Bacterial adherence was restored by incubation of postextracted cells with P1 fragments that contain each of the two known adhesive domains. In contrast to untreated cells, glutaraldehyde-treated bacteria gained reactivity with anti-C-terminal monoclonal antibodies (mAbs), whereas epitopes recognized by mAbs against other portions of the molecule were masked. Surface plasmon resonance experiments demonstrated the ability of apical and C-terminal fragments of P1 to interact. Binding of several different anti-P1 mAbs to unfixed cells triggered release of a C-terminal fragment from the bacterial surface, suggesting a novel mechanism of action of certain adherence-inhibiting antibodies. We also used atomic force microscopy-based single molecule force spectroscopy with tips bearing various mAbs to elucidate the spatial organization and orientation of P1 on living bacteria. The similar rupture lengths detected using mAbs against the head and C-terminal regions, which are widely separated in the tertiary structure, suggest a higher order architecture in which these domains are in close proximity on the cell surface. Taken together, our results suggest a supramolecular organization in which additional P1 polypeptides, including the C-terminal segment originally identified as antigen II, associate with covalently attached P1 to form the functional adhesive layer. PMID:25666624

  7. Identification of a supramolecular functional architecture of Streptococcus mutans adhesin P1 on the bacterial cell surface.

    Science.gov (United States)

    Heim, Kyle P; Sullan, Ruby May A; Crowley, Paula J; El-Kirat-Chatel, Sofiane; Beaussart, Audrey; Tang, Wenxing; Besingi, Richard; Dufrene, Yves F; Brady, L Jeannine

    2015-04-03

    P1 (antigen I/II) is a sucrose-independent adhesin of Streptococcus mutans whose functional architecture on the cell surface is not fully understood. S. mutans cells subjected to mechanical extraction were significantly diminished in adherence to immobilized salivary agglutinin but remained immunoreactive and were readily aggregated by fluid-phase salivary agglutinin. Bacterial adherence was restored by incubation of postextracted cells with P1 fragments that contain each of the two known adhesive domains. In contrast to untreated cells, glutaraldehyde-treated bacteria gained reactivity with anti-C-terminal monoclonal antibodies (mAbs), whereas epitopes recognized by mAbs against other portions of the molecule were masked. Surface plasmon resonance experiments demonstrated the ability of apical and C-terminal fragments of P1 to interact. Binding of several different anti-P1 mAbs to unfixed cells triggered release of a C-terminal fragment from the bacterial surface, suggesting a novel mechanism of action of certain adherence-inhibiting antibodies. We also used atomic force microscopy-based single molecule force spectroscopy with tips bearing various mAbs to elucidate the spatial organization and orientation of P1 on living bacteria. The similar rupture lengths detected using mAbs against the head and C-terminal regions, which are widely separated in the tertiary structure, suggest a higher order architecture in which these domains are in close proximity on the cell surface. Taken together, our results suggest a supramolecular organization in which additional P1 polypeptides, including the C-terminal segment originally identified as antigen II, associate with covalently attached P1 to form the functional adhesive layer. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  8. Comparative analysis between P1 and B1 equations for neutron moderation; Analise comparativa entre os metodos de obtencao e das solucoes das equacoes P1 e B1 para moderacao de neutrons

    Energy Technology Data Exchange (ETDEWEB)

    Martinez, Aquilino Senra; Silva, Fernando Carvalho da; Cardoso, Carlos Eduardo Santos [Universidade Federal, Rio de Janeiro, RJ (Brazil). Coordenacao dos Programas de Pos-graduacao de Engenharia. Programa de Engenharia Nuclear

    2000-07-01

    In order to calculate the neutron flux in nuclear reactors, B1 or P1 equations are solved by numerical methods for several groups of energy. The neutron fluxes obtained from the solutions of the B1 and P1 equations are similar when they are applied to large nuclear power reactors. However, an important difference between the two fluxes is that the system of P1 equations uses one more approximation than the B1 system and then, its flux is less precise. The present work shows the relations between both equations and analyzes for what conditions the two equations systems are equivalent. Furthermore, this equations are numerically solved in 54 groups of energy for a quadrangular arrange. (author)

  9. Late-assembly of human ribosomal protein S20 in the cytoplasm is essential for the functioning of the small subunit ribosome

    International Nuclear Information System (INIS)

    Tai, Lin-Ru; Chou, Chang-Wei; Wu, Jing-Ying; Kirby, Ralph; Lin, Alan

    2013-01-01

    Using immuno-fluorescent probing and Western blotting analysis, we reveal the exclusive cytoplasm nature of the small subunit ribosomal protein S20. To illustrate the importance of the cellular compartmentation of S20 to the function of small subunit 40S, we created a nuclear resident S20 NLS mutant gene and examined polysome profile of cells that had been transfected with the S20 NLS gene. As a result, we observed the formation of recombinant 40S carried S20 NLS but this recombinant 40S was never found in the polysome, suggesting such a recombinant 40S was translation incompetent. Moreover, by the tactic of the energy depletion and restoration, we were able to restrain the nuclear-resided S20 NLS in the cytoplasm. Yet, along a progressive energy restoration, we observed the presence of recombinant 40S subunits carrying the S20 NLS in the polysome. This proves that S20 needs to be cytoplasmic in order to make a functional 40S subunit. Furthermore, it also implies that the assembly order of ribosomal protein in eukaryote is orderly regulated. - Highlights: • The step of S20 assembled on 40S is happened in the cytoplasm. • A small subunit assembled with a nuclear S20 NLS is translational incompetence. • Using energy depletion and recovery to manipulate the cellular compartment of S20 NLS . • Cytoplasm-retained S20 NLS is crucial for creating a functional small subunit

  10. Late-assembly of human ribosomal protein S20 in the cytoplasm is essential for the functioning of the small subunit ribosome

    Energy Technology Data Exchange (ETDEWEB)

    Tai, Lin-Ru [Institute of Genome Sciences, School of Life Sciences, National Yang-Ming University, Taipei, Taiwan, ROC (China); Chou, Chang-Wei [Department of Dentistry, School of Dentistry, National Yang-Ming University, Taipei, Taiwan, ROC (China); Wu, Jing-Ying; Kirby, Ralph [Institute of Genome Sciences, School of Life Sciences, National Yang-Ming University, Taipei, Taiwan, ROC (China); Lin, Alan, E-mail: alin@ym.edu.tw [Institute of Genome Sciences, School of Life Sciences, National Yang-Ming University, Taipei, Taiwan, ROC (China); Department of Dentistry, School of Dentistry, National Yang-Ming University, Taipei, Taiwan, ROC (China)

    2013-11-15

    Using immuno-fluorescent probing and Western blotting analysis, we reveal the exclusive cytoplasm nature of the small subunit ribosomal protein S20. To illustrate the importance of the cellular compartmentation of S20 to the function of small subunit 40S, we created a nuclear resident S20{sub NLS} mutant gene and examined polysome profile of cells that had been transfected with the S20{sub NLS} gene. As a result, we observed the formation of recombinant 40S carried S20{sub NLS} but this recombinant 40S was never found in the polysome, suggesting such a recombinant 40S was translation incompetent. Moreover, by the tactic of the energy depletion and restoration, we were able to restrain the nuclear-resided S20{sub NLS} in the cytoplasm. Yet, along a progressive energy restoration, we observed the presence of recombinant 40S subunits carrying the S20{sub NLS} in the polysome. This proves that S20 needs to be cytoplasmic in order to make a functional 40S subunit. Furthermore, it also implies that the assembly order of ribosomal protein in eukaryote is orderly regulated. - Highlights: • The step of S20 assembled on 40S is happened in the cytoplasm. • A small subunit assembled with a nuclear S20{sub NLS} is translational incompetence. • Using energy depletion and recovery to manipulate the cellular compartment of S20{sub NLS}. • Cytoplasm-retained S20{sub NLS} is crucial for creating a functional small subunit.

  11. The deexcitation of the Ar (3P2, 3p1 and 1P1) states as measured by absorption both in pure argon and in the presence of additives

    International Nuclear Information System (INIS)

    Dutuit, Odile

    1974-01-01

    The de-excitation of the 3 P 2 , 3 p 1 and 1 P 1 states of argon was studied in pure argon between 10 and 200 torr and in Ar + CO and Ar + H 2 mixtures. These states are populated after excitation of the gas by a short (20 ns) pulse of 500 keV electrons (FEBETRON). Under our experimental conditions, the relation between the measured optical density of the lines studied and the concentration of absorbing species was found to be: DO = log I 0 /I ∝ (lC) n with n = 0,4. The three body rate constants k 2 were measured for the two resonant states 3 p 1 (k 2 = (1,65 ± 0,3) x 10 -32 cm 6 s -1 ) and 1 P 1 (k 2 = (1,0 ± 0,2) x 10 -32 cm 6 s -1 ); they had not been considered in previous low pressure studies. For the metastable state 3 P 2 , the measured value of k 2 ((1,6 ± 0,3) x 10 -32 cm 6 s -1 ) is in good agreement with those found in the literature. However, our two body rate constant k 1 is about ten times higher than that found in measurements at low pressure. This difference could be due to a collision-induced emission process at high pressure. The rate constants for the quenching by CO and H 2 were measured for the metastable state 3 P 2 (1,85 and 10,5 x 10 -11 cm 3 s -1 ) and for the resonant states 3 P 1 (4,5 and 20 x 10 -11 cm 3 s -1 ) and 1 P 1 (8,5 and 33 X 10 -11 cm 3 s -1 ). Comparison of the de-excitation cross sections of resonant and metastable states should lead to a better understanding of energy transfer processes from these latter. (author) [fr

  12. Differences in a ribosomal DNA sequence of Strongylus species allows identification of single eggs.

    Science.gov (United States)

    Campbell, A J; Gasser, R B; Chilton, N B

    1995-03-01

    In the current study, molecular techniques were evaluated for the species identification of individual strongyle eggs. Adult worms of Strongylus edentatus, S. equinus and S. vulgaris were collected at necropsy from horses from Australia and the U.S.A. Genomic DNA was isolated and a ribosomal transcribed spacer (ITS-2) amplified and sequenced using polymerase chain reaction (PCR) techniques. The length of the ITS-2 sequence of S. edentatus, S. equinus and S. vulgaris ranged between 217 and 235 nucleotides. Extensive sequence analysis demonstrated a low degree (0-0.9%) of intraspecific variation in the ITS-2 for the Strongylus species examined, whereas the levels of interspecific differences (13-29%) were significantly greater. Interspecific differences in the ITS-2 sequences allowed unequivocal species identification of single worms and eggs using PCR-linked restriction fragment length polymorphism. These results demonstrate the potential of the ribosomal spacers as genetic markers for species identification of single strongyle eggs from horse faeces.

  13. Pioglitazone enhances mitochondrial biogenesis and ribosomal protein biosynthesis in skeletal muscle in polycystic ovary syndrome

    DEFF Research Database (Denmark)

    Skov, Vibe; Glintborg, Dorte; Knudsen, Steen

    2008-01-01

    indicate that pioglitazone therapy restores insulin sensitivity, in part, by a coordinated upregulation of genes involved in mitochondrial OXPHOS and ribosomal protein biosynthesis in muscle in PCOS. These transcriptional effects of pioglitazone may contribute to prevent the onset of type 2 diabetes...... by changes in the transcriptional profile of muscle favoring insulin sensitivity. Using Affymetrix microarrays, we examined the effect of pioglitazone (30 mg/day for 16 weeks) on gene expression in skeletal muscle of 10 obese women with PCOS metabolically characterized by a euglycemic-hyperinsulinemic clamp...... Annotator and Pathway Profiler (GenMAPP 2.1) and Gene Set Enrichment Analysis (GSEA 2.0.1) revealed a significant upregulation of genes representing mitochondrial oxidative phosphorylation (OXPHOS), ribosomal proteins, mRNA processing reactome, translation factors, and proteasome degradation in PCOS after...

  14. Detection of carriers and genetic counseling in duchenne muscular dystrophy by ribosomal protein synthesis.

    Science.gov (United States)

    Ionasescu, V; Zellweger, H; Burmeister, L

    1976-11-01

    The in vitro protein synthesis by polyribosomes extracted from biopsied muscle (vastus lateralis) was studied in 47 known carriers, 87 possible carriers and in 60 normal females. A significant increase in specific activity of monomeric ribosomes, total polyribosomes and collagen synthesis was found in 46 (97.8 per cent) known carriers and 47 (54 per cent) possible carriers of Duchenne muscular dytrophy. The latter showed an increase in ribosomal protein synthesis in 10 (52.6 per cent) of 19 mothers of isolated cases, 31 (53.3 per cent) of 58 sisters, and 6 (60 per cent) of other female relatives. Serum creatine phosphokinase was increased in 30 (63.8 per cent) of 47 known carriers.

  15. MATHEMATICAL AND COMPUTATIONAL MODELLING OF RIBOSOMAL MOVEMENT AND PROTEIN SYNTHESIS: AN OVERVIEW

    Directory of Open Access Journals (Sweden)

    Tobias von der Haar

    2012-04-01

    Full Text Available Translation or protein synthesis consists of a complex system of chemical reactions, which ultimately result in decoding of the mRNA and the production of a protein. The complexity of this reaction system makes it difficult to quantitatively connect its input parameters (such as translation factor or ribosome concentrations, codon composition of the mRNA, or energy availability to output parameters (such as protein synthesis rates or ribosome densities on mRNAs. Mathematical and computational models of translation have now been used for nearly five decades to investigate translation, and to shed light on the relationship between the different reactions in the system. This review gives an overview over the principal approaches used in the modelling efforts, and summarises some of the major findings that were made.

  16. The 2009 Nobel Prize in Chemistry: Thomas A. Steitz and the structure of the ribosome.

    Science.gov (United States)

    Zhao, Peter

    2011-06-01

    Over the past 200 years, there have been countless groundbreaking discoveries in biology and medicine at Yale University. However, one particularly noteworthy discovery with profoundly important and broad consequences happened here in just the past two decades. In 2009, Thomas Steitz, the Sterling Professor of Molecular Biophysics & Biochemistry, was awarded the Nobel Prize in Chemistry for "studies of the structure and function of the ribosome," along with Venkatraman Ramakrishnan of the MRC Laboratory of Molecular Biology and Ada E. Yonath of the Weizmann Institute of Science. This article covers the historical context of Steitz's important discovery, the techniques his laboratory used to study the ribosome, and the impact that this research has had, and will have, on the future of biological and medical research.

  17. Structure of a prehandover mammalian ribosomal SRP·SRP receptor targeting complex.

    Science.gov (United States)

    Kobayashi, Kan; Jomaa, Ahmad; Lee, Jae Ho; Chandrasekar, Sowmya; Boehringer, Daniel; Shan, Shu-Ou; Ban, Nenad

    2018-04-20

    Signal recognition particle (SRP) targets proteins to the endoplasmic reticulum (ER). SRP recognizes the ribosome synthesizing a signal sequence and delivers it to the SRP receptor (SR) on the ER membrane followed by the transfer of the signal sequence to the translocon. Here, we present the cryo-electron microscopy structure of the mammalian translating ribosome in complex with SRP and SR in a conformation preceding signal sequence handover. The structure visualizes all eukaryotic-specific SRP and SR proteins and reveals their roles in stabilizing this conformation by forming a large protein assembly at the distal site of SRP RNA. We provide biochemical evidence that the guanosine triphosphate hydrolysis of SRP·SR is delayed at this stage, possibly to provide a time window for signal sequence handover to the translocon. Copyright © 2018 The Authors, some rights reserved; exclusive licensee American Association for the Advancement of Science. No claim to original U.S. Government Works.

  18. Mitochondrial genome evolution in Alismatales: Size reduction and extensive loss of ribosomal protein genes

    DEFF Research Database (Denmark)

    Petersen, Gitte; Cuenca, Argelia; Zervas, Athanasios

    2017-01-01

    The order Alismatales is a hotspot for evolution of plant mitochondrial genomes characterized by remarkable differences in genome size, substitution rates, RNA editing, retrotranscription, gene loss and intron loss. Here we have sequenced the complete mitogenomes of Zostera marina and Stratiotes...... aloides, which together with previously sequenced mitogenomes from Butomus and Spirodela, provide new evolutionary evidence of genome size reduction, gene loss and transfer to the nucleus. The Zostera mitogenome includes a large portion of DNA transferred from the plastome, yet it is the smallest known...... mitogenome from a non-parasitic plant. Using a broad sample of the Alismatales, the evolutionary history of ribosomal protein gene loss is analyzed. In Zostera almost all ribosomal protein genes are lost from the mitogenome, but only some can be found in the nucleus....

  19. Revealing −1 Programmed Ribosomal Frameshifting Mechanisms by Single-Molecule Techniques and Computational Methods

    Directory of Open Access Journals (Sweden)

    Kai-Chun Chang

    2012-01-01

    Full Text Available Programmed ribosomal frameshifting (PRF serves as an intrinsic translational regulation mechanism employed by some viruses to control the ratio between structural and enzymatic proteins. Most viral mRNAs which use PRF adapt an H-type pseudoknot to stimulate −1 PRF. The relationship between the thermodynamic stability and the frameshifting efficiency of pseudoknots has not been fully understood. Recently, single-molecule force spectroscopy has revealed that the frequency of −1 PRF correlates with the unwinding forces required for disrupting pseudoknots, and that some of the unwinding work dissipates irreversibly due to the torsional restraint of pseudoknots. Complementary to single-molecule techniques, computational modeling provides insights into global motions of the ribosome, whose structural transitions during frameshifting have not yet been elucidated in atomic detail. Taken together, recent advances in biophysical tools may help to develop antiviral therapies that target the ubiquitous −1 PRF mechanism among viruses.

  20. Organization of Mitochondrial Gene Expression in Two Distinct Ribosome-Containing Assemblies

    Directory of Open Access Journals (Sweden)

    Kirsten Kehrein

    2015-02-01

    Full Text Available Mitochondria contain their own genetic system that provides subunits of the complexes driving oxidative phosphorylation. A quarter of the mitochondrial proteome participates in gene expression, but how all these factors are orchestrated and spatially organized is currently unknown. Here, we established a method to purify and analyze native and intact complexes of mitochondrial ribosomes. Quantitative mass spectrometry revealed extensive interactions of ribosomes with factors involved in all the steps of posttranscriptional gene expression. These interactions result in large expressosome-like assemblies that we termed mitochondrial organization of gene expression (MIOREX complexes. Superresolution microscopy revealed that most MIOREX complexes are evenly distributed throughout the mitochondrial network, whereas a subset is present as nucleoid-MIOREX complexes that unite the whole spectrum of organellar gene expression. Our work therefore provides a conceptual framework for the spatial organization of mitochondrial protein synthesis that likely developed to facilitate gene expression in the organelle.