WorldWideScience

Sample records for ribosomal phosphoprotein p1

  1. The activity of the acidic phosphoproteins from the 80 S rat liver ribosome.

    Science.gov (United States)

    MacConnell, W P; Kaplan, N O

    1982-05-25

    The selective removal of acidic phosphoproteins from the 80 S rat liver ribosome was accomplished by successive alcohol extractions at low salt concentration. The resulting core ribosomes lost over 90% of their translation activity and were unable to support the elongation factor 2 GTPase reaction. Both activities were partially restored when the dialyzed extracts were added back to the core ribosome. The binding of labeled adenosine diphosphoribosyl-elongation factor 2 to ribosomes was also affected by extraction and could be reconstituted, although not to the same extent as the GTPase activity associated with elongation factor 2 in the presence of the ribosome. The alcohol extracts of the 80 S ribosome contained mostly phosphoproteins P1 and P2 which could be dephosphorylated and rephosphorylated in solution by alkaline phosphatase and protein kinase, respectively. Dephosphorylation of the P1/P2 mixture in the extracts caused a decrease in the ability of these proteins to reactivate the polyphenylalanine synthesis activity of the core ribosome. However, treatment of the dephosphorylated proteins with the catalytic subunit of 3':5'-cAMP-dependent protein kinase in the presence of ATP reactivated the proteins when compared to the activity of the native extracts. Rabbit antisera raised against the alcohol-extracted proteins were capable of impairing both the polyphenylalanine synthesis reaction and the elongation factor 2-dependent GTPase reaction in the intact ribosomes.

  2. Baculovirus-mediated expression and isolation of human ribosomal phosphoprotein P0 carrying a GST-tag in a functional state

    International Nuclear Information System (INIS)

    Abo, Yohichi; Hagiya, Akiko; Naganuma, Takao; Tohkairin, Yukiko; Shiomi, Kunihiro; Kajiura, Zenta; Hachimori, Akira; Uchiumi, Toshio; Nakagaki, Masao

    2004-01-01

    We constructed an overexpression system for human ribosomal phosphoprotein P0, together with P1 and P2, which is crucially important for translation. Genes for these proteins, fused with the glutathione S-transferase (GST)-tag at the N-terminus, were inserted into baculovirus and introduced to insect cells. The fusion proteins, but not the proteins without the tag, were efficiently expressed into cells as soluble forms. The fusion protein GST.P0 as well as GST.P1/GST.P2 was phosphorylated in cells as detected by incorporation of 32 P and reactivity with monoclonal anti-phosphoserine antibody. GST.P0 expressed in insect cells, but not the protein obtained in Escherichia coli, had the ability to form a complex with P1 and P2 proteins and to bind to 28S rRNA. Moreover, the GST.P0-P1-P2 complex participated in high eEF-2-dependent GTPase activity. Baculovirus expression systems appear to provide recombinant human P0 samples that can be used for studies on the structure and function

  3. The subcellular distribution of the human ribosomal "stalk" components: P1, P2 and P0 proteins

    DEFF Research Database (Denmark)

    Tchórzewski, Marek; Krokowski, Dawid; Rzeski, Wojciech

    2003-01-01

    The ribosomal "stalk" structure is a distinct lateral protuberance located on the large ribosomal subunit in prokaryotic, as well as in eukaryotic cells. In eukaryotes, this ribosomal structure is composed of the acidic ribosomal P proteins, forming two hetero-dimers (P1/P2) attached...

  4. Hypoxic stress-induced changes in ribosomes of maize seedling roots

    International Nuclear Information System (INIS)

    Bailey-Serres, J.; Freeling, M.

    1990-01-01

    The hypoxic stress response of Zea mays L. seedling roots involves regulation of gene expression at transcriptional and posttranscriptional levels. We investigated the effect of hypoxia on the translational machinery of seedling roots. The levels of monoribosomes and ribosomal subunits increased dramatically within 1 hour of stress. Prolonged hypoxia resulted in continued accumulation of nontranslating ribosomes, as well as increased levels of small polyribosomes. The return of seedlings to normal aerobic conditions resulted in recovery of normal polyribosome levels. Comparison of ribosomal proteins from control and hypoxic roots revealed differences in quantity and electrophoretic mobility. In vivo labeling of roots with [ 35 S]methionine revealed variations in newly synthesized ribosomal proteins. In vivo labeling of roots with [ 32 P]orthophosphate revealed a major reduction in the phosphorylation of a 31 kilodalton ribosomal protein in hypoxic stressed roots. In vitro phosphorylation of ribosomal proteins by endogenous kinases was used to probe for differences in ribosome structure and composition. The patterns of in vitro kinased phosphoproteins of ribosomes from control and hypoxic roots were not identical. Variation in phosphoproteins of polyribosomes from control and hypoxic roots, as well as among polyribosomes from hypoxic roots were observed. These results indicate that modification of the translational machinery occurs in response to hypoxic stress

  5. The amino terminal end determines the stability and assembling capacity of eukaryotic ribosomal stalk proteins P1 and P2.

    Science.gov (United States)

    Camargo, Hendricka; Nusspaumer, Gretel; Abia, David; Briceño, Verónica; Remacha, Miguel; Ballesta, Juan P G

    2011-05-01

    The eukaryotic ribosomal proteins P1 and P2 bind to protein P0 through their N-terminal domain to form the essential ribosomal stalk. A mutational analysis points to amino acids at positions 2 and 3 as determinants for the drastic difference of Saccharomyces cerevisiae P1 and P2 half-life, and suggest different degradation mechanisms for each protein type. Moreover, the capacity to form P1/P2 heterodimers is drastically affected by mutations in the P2β four initial amino acids, while these mutations have no effect on P1β. Binding of P2β and, to a lesser extent, P1β to the ribosome is also seriously affected showing the high relevance of the amino acids in the first turn of the NTD α-helix 1 for the stalk assembly. The negative effect of some mutations on ribosome binding can be reversed by the presence of the second P1/P2 couple in the ribosome, indicating a stabilizing structural influence between the two heterodimers. Unexpectedly, some mutations totally abolish heterodimer formation but allow significant ribosome binding and, therefore, a previous P1 and P2 association seems not to be an absolute requirement for stalk assembly. Homology modeling of the protein complexes suggests that the mutated residues can affect the overall protein conformation. © The Author(s) 2011. Published by Oxford University Press.

  6. A photoaffinity scan maps regions of the p85 SH2 domain involved in phosphoprotein binding.

    Science.gov (United States)

    Williams, K P; Shoelson, S E

    1993-03-15

    Src homology 2 (SH2) domains are modular phosphotyrosine binding pockets found within a wide variety of cytoplasmic signaling molecules. Here we develop a new approach to analyzing protein-protein interfaces termed photoaffinity scanning, and apply the method to map regions of the phosphatidylinositol 3-kinase p85 SH2 domain that participate in phospho-protein binding. Each residue except phosphotyrosine (pY) within a tightly binding, IRS-1-derived phosphopeptide (GNGDpYMPMSPKS) was substituted with the photoactive amino acid, benzoylphenylalanine (Bpa). Whereas most substitutions had little effect on binding affinity, Bpa substitution of either Met (+1 and +3 with respect to pY) reduced affinity 50-100-fold to confirm their importance in the pYMXM recognition motif. In three cases photolysis of SH2 domain/Bpa phosphopeptide complexes led to cross-linking of > 50% of the SH2 domain; cross-link positions were identified by microsequence, amino acid composition, and electrospray mass spectrometric analyses. Bpa-1 cross-links within alpha-helix I, whereas Bpa+1 and Bpa+4 cross-link the SH2 domain within the flexible loop C-terminal to alpha-helix II. Moreover, cross-linking at any position prevents SH2 domain cleavage at a trypsin-sensitive site within the flexible loop between beta-strands 1 and 2. Therefore, at least three distinct SH2 regions in addition to the beta-sheet participate in phosphoprotein binding; the loop cross-linked by phosphopeptide residues C-terminal to pY appears to confer specificity to the phosphoprotein/SH2 domain interaction.

  7. The effect of complexing phosphoproteins to decalcified collagen on in vitro calcification.

    Science.gov (United States)

    Endo, A; Glimcher, M J

    1989-01-01

    Decalcified samples of chicken bone containing phosphoproteins of varying concentrations were used to assess the effect of phosphoproteins and of protein-bound Ser(P) and Thr(P) in the in vitro nucleation of a Ca-P solid phase from metastable solutions of Ca and P. Phosphoproteins of bone as well as the phosphoproteins from egg yolk (phosvitin) were used. Increasing concentrations of phosphoprotein [as measured by the amount of protein bound Ser(P) and Thr(P)] in the decalcified bone particles significantly reduced the time required for nucleation to occur after exposure to metastable solutions of Ca and P (decreased operational lag times). Treatment with wheat germ acid phosphatase markedly reduced the concentration of Ser(P) and Thr(P) in the decalcified bone samples and in the decalcified bone collagen samples complexed with phosphoproteins (almost to zero). The loss of the organic phosphate groups significantly increased the operational lag time, but did not abolish nucleation of apatite crystals by the bone collagen fibrils essentially devoid of Ser(P) and Thr(P). Bone phosphoproteins were not specific; substitution of phosvitin for bone phosphoproteins as complexes with bone collagen also proved to be effective facilitators of nucleation, which was interesting since both types of phosphoproteins have certain common chemical and structural characteristics. Noncollagenous components other than phosphoproteins were present in the decalcified bone samples. However, the marked dependence of the lag time on the Ser(P) and Thr(P) concentrations and the very marked diminution in the efficacy of the nucleation phenomenon as a result of treatment with wheat germ acid phosphatase, clearly suggests that the organic phosphate residues of the phosphoproteins play a direct and significant role in the process of in vitro nucleation of a solid phase of Ca and P (apatite) by bone collagen, and by implication, possibly in in vivo mineralization as well.

  8. Combined use of nuclear phosphoprotein c-Myc and cellular phosphoprotein p53 for hepatocellular carcinoma detection in high-risk chronic hepatitis C patients.

    Science.gov (United States)

    Attallah, A M; El-Far, M; Abdelrazek, M A; Omran, M M; Attallah, A A; Elkhouly, A A; Elkenawy, H M; Farid, K

    2017-10-01

    Hepatocellular carcinoma (HCC) is a multistage process resulting from various genetic changes. We aimed to determine nuclear phosphoprotein c-Myc and cellular phosphoprotein p53 expression and to evaluate their importance in HCC diagnosis. One hundred and twenty chronic hepatitis C (CHC) patients (60 non-HCC CHC patients and 60 HCC patients who had a single small (c-Myc and p53 were identified in liver tissues and serum samples using immunostaining, western blot and ELISA. Immunohistochemical detection of c-Myc and p53 with monospecific antibodies revealed intense and diffuse cytoplasmic staining patterns. Accumulated mutant proteins, released from tumour cells into the extracellular serum, were detected at 62 KDa, for c-Myc, and 53 KDa, for p53, using western blotting. In contrast to alpha feto-protein, there was a significant increase (p c-Myc (86.7% vs. 6.7%) and p53 (78.3% vs. 8.3%) in the malignant vs. non-malignant patients. The parallel combination of c-Myc and p53 reach the absolute sensitivity (100%), for more accurate and reliable HCC detection (specificity was 87%). c-Myc and p53 are potential HCC diagnostic biomarkers, and convenient combinations of them could improve diagnostic accuracy of HCC.

  9. Unphosphorylated rhabdoviridae phosphoproteins form elongated dimers in solution.

    Science.gov (United States)

    Gerard, Francine C A; Ribeiro, Euripedes de Almeida; Albertini, Aurélie A V; Gutsche, Irina; Zaccai, Guiseppe; Ruigrok, Rob W H; Jamin, Marc

    2007-09-11

    The phosphoprotein (P) is an essential component of the replication machinery of rabies virus (RV) and vesicular stomatitis virus (VSV), and the oligomerization of P, potentially controlled by phosphorylation, is required for its function. Up to now the stoichiometry of phosphoprotein oligomers has been controversial. Size exclusion chromatography combined with detection by multiangle laser light scattering shows that the recombinant unphosphorylated phosphoproteins from VSV and from RV exist as dimers in solution. Hydrodynamic analysis indicates that the dimers are highly asymmetric, with a Stokes radius of 4.8-5.3 nm and a frictional ratio larger than 1.7. Small-angle neutron scattering experiments confirm the dimeric state and the asymmetry of the structure and yield a radius of gyration of about 5.3 nm and a cross-sectional radius of gyration of about 1.6-1.8 nm. Similar hydrodynamic properties and molecular dimensions were obtained with a variant of VSV phosphoprotein in which Ser60 and Thr62 are substituted by Asp residues and which has been reported previously to mimic phosphorylation by inducing oligomerization and activating transcription. Here, we show that this mutant also forms a dimer with hydrodynamic properties and molecular dimensions similar to those of the wild type protein. However, incubation at 30 degrees C for several hours induced self-assembly of both wild type and mutant proteins, leading to the formation of irregular filamentous structures.

  10. The ribosome-bound chaperones RAC and Ssb1/2p are required for accurate translation in Saccharomyces cerevisiae.

    Science.gov (United States)

    Rakwalska, Magdalena; Rospert, Sabine

    2004-10-01

    The chaperone homologs RAC (ribosome-associated complex) and Ssb1/2p are anchored to ribosomes; Ssb1/2p directly interacts with nascent polypeptides. The absence of RAC or Ssb1/2p results in a similar set of phenotypes, including hypersensitivity against the aminoglycoside paromomycin, which binds to the small ribosomal subunit and compromises the fidelity of translation. In order to understand this phenomenon we measured the frequency of translation termination and misincorporation in vivo and in vitro with a novel reporter system. Translational fidelity was impaired in the absence of functional RAC or Ssb1/2p, and the effect was further enhanced by paromomycin. The mutant strains suffered primarily from a defect in translation termination, while misincorporation was compromised to a lesser extent. Consistently, a low level of soluble translation termination factor Sup35p enhanced growth defects in the mutant strains. Based on the combined data we conclude that RAC and Ssb1/2p are crucial in maintaining translational fidelity beyond their postulated role as chaperones for nascent polypeptides.

  11. Medicago PhosphoProtein Database: a repository for Medicago truncatula phosphoprotein data

    Directory of Open Access Journals (Sweden)

    Christopher M. Rose

    2012-06-01

    Full Text Available The ability of legume crops to fix atmospheric nitrogen via a symbiotic association with soil rhizobia makes them an essential component of many agricultural systems. Initiation of this symbiosis requires protein phosphorylation-mediated signaling in response to rhizobial signals named Nod factors. Medicago truncatula (Medicago is the model system for studying legume biology, making the study of its phosphoproteome essential. Here, we describe the Medicago Phosphoprotein Database (http://phospho.medicago.wisc.edu, a repository built to house phosphoprotein, phosphopeptide, and phosphosite data specific to Medicago. Currently, the Medicago Phosphoprotein Database holds 3,457 unique phosphopeptides that contain 3,404 non-redundant sites of phosphorylation on 829 proteins. Through the web-based interface, users are allowed to browse identified proteins or search for proteins of interest. Furthermore, we allow users to conduct BLAST searches of the database using both peptide sequences and phosphorylation motifs as queries. The data contained within the database are available for download to be investigated at the user’s discretion. The Medicago Phosphoprotein Database will be updated continually with novel phosphoprotein and phosphopeptide identifications, with the intent of constructing an unparalleled compendium of large-scale Medicago phosphorylation data.

  12. Analysis of the protein-protein interactions between the human acidic ribosomal P-proteins: evaluation by the two hybrid system

    DEFF Research Database (Denmark)

    Tchórzewski, M; Boldyreff, B; Issinger, O

    2000-01-01

    The surface acidic ribosomal proteins (P-proteins), together with ribosomal core protein P0 form a multimeric lateral protuberance on the 60 S ribosomal subunit. This structure, also called stalk, is important for efficient translational activity of the ribosome. In order to shed more light...... forms the 60 S ribosomal stalk: P0-(P1/P2)(2). Additionally, mutual interactions among human and yeast P-proteins were analyzed. Heterodimer formation could be observed between human P2 and yeast P1 proteins....

  13. Phosphoprotein phosphatase of bovine spleen cell nuclei: physicochemical properties

    International Nuclear Information System (INIS)

    Rezyapkin, V.I.; Leonova, L.E.; Komkova, A.I.

    1986-01-01

    The physicochemical properties of phosphoprotein phosphatase (EC 1.3.1.16) from bovine spleen cell nuclei were studied. The enzyme possesses broad substrate specificity and catalyzes the dephosphorylation of phosphocasein, ATP, ADP, and p-nitrophenyl phosphate (pNPP). K/sub m/ for ATP, ADP, and pNPP are equal to 0.44, 0.43, and 1.25 mM, respectively. M/sub r/ of the enzyme, according to the data of gel filtraction of Sephadex G-75 and electrophoresis in polyacrylamide gel of various concentrations is ∼ 33,000. In electrophoresis in the presence of SDS, two protein bands with M/sub r/ 12,000 and 18,000 are detected. In the enzyme molecule, acid amino acid residues predominate; two free SH groups and two disulfide bridges are detected. Phosphoprotein phosphatase is a glycoprotein, containing ∼ 22% carbonhydrates. The protein possesses a supplementary absorption maximum at 560 nm. Ammonium molybdate is a competitive inhibitor with K/sub i/ 0.37 μM, while sodium fluoride is a noncompetitive inhibitor with K/sub i/ 1.3 mM. Incubation in the presence of 2 mM phenylmethylsulfonyl fluoride for 25 h leads to a loss of ∼ 46% of the enzymatic activity. Ammonium molybdate, sodium fluoride, and PMSF are reversible inhibitors. Modifications of the SH groups, NH 2 groups, and histidine leads to a decrease in the enzymatic activity. Incubation of phosphoprotein phosphatase with [γ- 32 P]ATP leads to the incorporation of 0.33 mole 33 P per mole of the enzyme. The mechanism of hydrolysis of the phosphodiester bond, catalyzed by the enzyme, is discussed

  14. A portrait of tissue phosphoprotein stability in the clinical tissue procurement process.

    Science.gov (United States)

    Espina, Virginia; Edmiston, Kirsten H; Heiby, Michael; Pierobon, Mariaelena; Sciro, Manuela; Merritt, Barbara; Banks, Stacey; Deng, Jianghong; VanMeter, Amy J; Geho, David H; Pastore, Lucia; Sennesh, Joel; Petricoin, Emanuel F; Liotta, Lance A

    2008-10-01

    Little is known about the preanalytical fluctuations of phosphoproteins during tissue procurement for molecular profiling. This information is crucial to establish guidelines for the reliable measurement of these analytes. To develop phosphoprotein profiles of tissue subjected to the trauma of excision, we measured the fidelity of 53 signal pathway phosphoproteins over time in tissue specimens procured in a community clinical practice. This information provides strategies for potential surrogate markers of stability and the design of phosphoprotein preservative/fixation solutions. Eleven different specimen collection time course experiments revealed augmentation (+/-20% from the time 0 sample) of signal pathway phosphoprotein levels as well as decreases over time independent of tissue type, post-translational modification, and protein subcellular location (tissues included breast, colon, lung, ovary, and uterus (endometrium/myometrium) and metastatic melanoma). Comparison across tissue specimens showed an >20% decrease of protein kinase B (AKT) Ser-473 (p 20% increases within 90-min postprocurement. Endothelial nitric-oxide synthase Ser-1177 did not change over the time period evaluated with breast or leiomyoma tissue. Treatment with phosphatase or kinase inhibitors alone revealed that tissue kinase pathways are active ex vivo. Combinations of kinase and phosphatase inhibitors appeared to stabilize proteins that exhibited increases in the presence of phosphatase inhibitors alone (ATF-2 Thr-71, SAPK/JNK Thr-183/Tyr-185, STAT1 Tyr-701, JAK1 Tyr-1022/1023, and PAK1/PAK2 Ser-199/204/192/197). This time course study 1) establishes the dynamic nature of specific phosphoproteins in excised tissue, 2) demonstrates augmented phosphorylation in the presence of phosphatase inhibitors, 3) shows that kinase inhibitors block the upsurge in phosphorylation of phosphoproteins, 4) provides a rational strategy for room temperature preservation of proteins, and 5) constitutes a

  15. The 5S RNP couples p53 homeostasis to ribosome biogenesis and nucleolar stress.

    Science.gov (United States)

    Sloan, Katherine E; Bohnsack, Markus T; Watkins, Nicholas J

    2013-10-17

    Several proto-oncogenes and tumor suppressors regulate the production of ribosomes. Ribosome biogenesis is a major consumer of cellular energy, and defects result in p53 activation via repression of mouse double minute 2 (MDM2) homolog by the ribosomal proteins RPL5 and RPL11. Here, we report that RPL5 and RPL11 regulate p53 from the context of a ribosomal subcomplex, the 5S ribonucleoprotein particle (RNP). We provide evidence that the third component of this complex, the 5S rRNA, is critical for p53 regulation. In addition, we show that the 5S RNP is essential for the activation of p53 by p14(ARF), a protein that is activated by oncogene overexpression. Our data show that the abundance of the 5S RNP, and therefore p53 levels, is determined by factors regulating 5S complex formation and ribosome integration, including the tumor suppressor PICT1. The 5S RNP therefore emerges as the critical coordinator of signaling pathways that couple cell proliferation with ribosome production. Copyright © 2013 The Authors. Published by Elsevier Inc. All rights reserved.

  16. Tobacco etch virus protein P1 traffics to the nucleolus and associates with the host 60S ribosomal subunits during infection.

    Science.gov (United States)

    Martínez, Fernando; Daròs, José-Antonio

    2014-09-01

    The genus Potyvirus comprises a large group of positive-strand RNA plant viruses whose genome encodes a large polyprotein processed by three viral proteinases. P1 protein, the most amino-terminal product of the polyprotein, is an accessory factor stimulating viral genome amplification whose role during infection is not well understood. We infected plants with Tobacco etch virus (TEV; genus Potyvirus) clones in which P1 was tagged with a fluorescent protein to track its expression and subcellular localization or with an affinity tag to identify host proteins involved in complexes in which P1 also takes part during infection. Our results showed that TEV P1 exclusively accumulates in infected cells at an early stage of infection and that the protein displays a dynamic subcellular localization, trafficking in and out of the nucleus and nucleolus during infection. Inside the nucleolus, P1 particularly targets the dense granular component. Consistently, we found functional nucleolar localization and nuclear export signals in TEV P1 sequence. Our results also indicated that TEV P1 physically interacts with the host 80S cytoplasmic ribosomes and specifically binds to the 60S ribosomal subunits during infection. In vitro translation assays of reporter proteins suggested that TEV P1 stimulates protein translation, particularly when driven from the TEV internal ribosome entry site. These in vitro assays also suggested that TEV helper-component proteinase (HC-Pro) inhibits protein translation. Based on these findings, we propose that TEV P1 stimulates translation of viral proteins in infected cells. In this work, we researched the role during infection of tobacco etch virus P1 protease. P1 is the most mysterious protein of potyviruses, a relevant group of RNA viruses infecting plants. Our experiments showed that the viral P1 protein exclusively accumulates in infected cells at an early stage of infection and moves in and out of the nucleus of infected cells, particularly

  17. The measles virus phosphoprotein interacts with the linker domain of STAT1

    International Nuclear Information System (INIS)

    Devaux, Patricia; Priniski, Lauren; Cattaneo, Roberto

    2013-01-01

    The measles virus (MV) phosphoprotein (P) and V proteins block the interferon (IFN) response by impeding phosphorylation of the signal transducer and activator of transcription 1 (STAT1) by the Janus kinase 1 (JAK1). We characterized how STAT1 mutants interact with P and JAK1 phosphorylation. Certain mutants of the linker, the Src-homology 2 domain (SH2), or the transactivation domain had reduced or abolished phosphorylation through JAK1 after IFN treatment. Other mutants, mainly localized in the linker, failed to interact with P as documented by the lack of interference with nuclear translocation. Thus the functional footprint of P on STAT1 localizes mainly to the linker domain; there is also some overlap with the STAT1 phosphorylation functional footprint on the SH2 domain. Based on these observations, we discuss how the MV-P might operate to inhibit the JAK/STAT pathway. - Highlights: • Residue in the linker and SH2 domains of STAT1 are important for MV-P interaction. • Residue in the linker and SH2 domains of STAT1 are important for STAT1 phosphorylation. • Residues interferring with both functions have similar location on STAT1. • The viral P and V proteins may operate in concert to inhibit the JAK/STAT pathway

  18. The measles virus phosphoprotein interacts with the linker domain of STAT1

    Energy Technology Data Exchange (ETDEWEB)

    Devaux, Patricia, E-mail: devaux.patricia@mayo.edu; Priniski, Lauren; Cattaneo, Roberto

    2013-09-15

    The measles virus (MV) phosphoprotein (P) and V proteins block the interferon (IFN) response by impeding phosphorylation of the signal transducer and activator of transcription 1 (STAT1) by the Janus kinase 1 (JAK1). We characterized how STAT1 mutants interact with P and JAK1 phosphorylation. Certain mutants of the linker, the Src-homology 2 domain (SH2), or the transactivation domain had reduced or abolished phosphorylation through JAK1 after IFN treatment. Other mutants, mainly localized in the linker, failed to interact with P as documented by the lack of interference with nuclear translocation. Thus the functional footprint of P on STAT1 localizes mainly to the linker domain; there is also some overlap with the STAT1 phosphorylation functional footprint on the SH2 domain. Based on these observations, we discuss how the MV-P might operate to inhibit the JAK/STAT pathway. - Highlights: • Residue in the linker and SH2 domains of STAT1 are important for MV-P interaction. • Residue in the linker and SH2 domains of STAT1 are important for STAT1 phosphorylation. • Residues interferring with both functions have similar location on STAT1. • The viral P and V proteins may operate in concert to inhibit the JAK/STAT pathway.

  19. Characterization of the interactions between the nucleoprotein and the phosphoprotein of Henipavirus.

    Science.gov (United States)

    Habchi, Johnny; Blangy, Stéphanie; Mamelli, Laurent; Jensen, Malene Ringkjøbing; Blackledge, Martin; Darbon, Hervé; Oglesbee, Michael; Shu, Yaoling; Longhi, Sonia

    2011-04-15

    The Henipavirus genome is encapsidated by the nucleoprotein (N) within a helical nucleocapsid that recruits the polymerase complex via the phosphoprotein (P). In a previous study, we reported that in henipaviruses, the N-terminal domain of the phosphoprotein and the C-terminal domain of the nucleoprotein (N(TAIL)) are both intrinsically disordered. Here we show that Henipavirus N(TAIL) domains are also disordered in the context of full-length nucleoproteins. We also report the cloning, purification, and characterization of the C-terminal X domains (P(XD)) of Henipavirus phosphoproteins. Using isothermal titration calorimetry, we show that N(TAIL) and P(XD) form a 1:1 stoichiometric complex that is stable under NaCl concentrations as high as 1 M and has a K(D) in the μM range. Using far-UV circular dichroism and nuclear magnetic resonance, we show that P(XD) triggers an increase in the α-helical content of N(TAIL). Using fluorescence spectroscopy, we show that P(XD) has no impact on the chemical environment of a Trp residue introduced at position 527 of the Henipavirus N(TAIL) domain, thus arguing for the lack of stable contacts between the C termini of N(TAIL) and P(XD). Finally, we present a tentative structural model of the N(TAIL)-P(XD) interaction in which a short, order-prone region of N(TAIL) (α-MoRE; amino acids 473-493) adopts an α-helical conformation and is embedded between helices α2 and α3 of P(XD), leading to a relatively small interface dominated by hydrophobic contacts. The present results provide the first detailed experimental characterization of the N-P interaction in henipaviruses and designate the N(TAIL)-P(XD) interaction as a valuable target for rational antiviral approaches.

  20. The mitochondrial ribosomal protein of the large subunit, Afo1p, determines cellular longevity through mitochondrial back-signaling via TOR1.

    Science.gov (United States)

    Heeren, Gino; Rinnerthaler, Mark; Laun, Peter; von Seyerl, Phyllis; Kössler, Sonja; Klinger, Harald; Hager, Matthias; Bogengruber, Edith; Jarolim, Stefanie; Simon-Nobbe, Birgit; Schüller, Christoph; Carmona-Gutierrez, Didac; Breitenbach-Koller, Lore; Mück, Christoph; Jansen-Dürr, Pidder; Criollo, Alfredo; Kroemer, Guido; Madeo, Frank; Breitenbach, Michael

    2009-07-13

    Yeast mother cell-specific aging constitutes a model of replicative aging as it occurs in stem cell populations of higher eukaryotes. Here, we present a new long-lived yeast deletion mutation,afo1 (for aging factor one), that confers a 60% increase in replicative lifespan. AFO1/MRPL25 codes for a protein that is contained in the large subunit of the mitochondrial ribosome. Double mutant experiments indicate that the longevity-increasing action of the afo1 mutation is independent of mitochondrial translation, yet involves the cytoplasmic Tor1p as well as the growth-controlling transcription factor Sfp1p. In their final cell cycle, the long-lived mutant cells do show the phenotypes of yeast apoptosis indicating that the longevity of the mutant is not caused by an inability to undergo programmed cell death. Furthermore, the afo1 mutation displays high resistance against oxidants. Despite the respiratory deficiency the mutant has paradoxical increase in growth rate compared to generic petite mutants. A comparison of the single and double mutant strains for afo1 and fob1 shows that the longevity phenotype of afo1 is independent of the formation of ERCs (ribosomal DNA minicircles). AFO1/MRPL25 function establishes a new connection between mitochondria, metabolism and aging.

  1. Ribosomal stress induces L11- and p53-dependent apoptosis in mouse pluripotent stem cells.

    Science.gov (United States)

    Morgado-Palacin, Lucia; Llanos, Susana; Serrano, Manuel

    2012-02-01

    Ribosome biogenesis is the most demanding energetic process in proliferating cells and it is emerging as a critical sensor of cellular homeostasis. Upon disturbance of ribosome biogenesis, specific free ribosomal proteins, most notably L11, bind and inhibit Mdm2, resulting in activation of the tumor suppressor p53. This pathway has been characterized in somatic and cancer cells, but its function in embryonic pluripotent cells has remained unexplored. Here, we show that treatment with low doses of Actinomycin D or depletion of ribosomal protein L37, two well-established inducers of ribosomal stress, activate p53 in an L11-dependent manner in mouse embryonic stem cells (ESCs) and in induced pluripotent stem cells (iPSCs). Activation of p53 results in transcriptional induction of p53 targets, including p21, Mdm2, Pidd, Puma, Noxa and Bax. Finally, ribosomal stress elicits L11- and p53-dependent apoptosis in ESCs/iPSCs. These results extend to pluripotent cells the functionality of the ribosomal stress pathway and we speculate that this could be a relevant cellular checkpoint during early embryogenesis.

  2. Mitochondrial ribosomal protein L41 mediates serum starvation-induced cell-cycle arrest through an increase of p21WAF1/CIP1

    International Nuclear Information System (INIS)

    Kim, Mi Jin; Yoo, Young A.; Kim, Hyung Jung; Kang, Seongman; Kim, Yong Geon; Kim, Jun Suk; Yoo, Young Do

    2005-01-01

    Ribosomal proteins not only act as components of the translation apparatus but also regulate cell proliferation and apoptosis. A previous study reported that MRPL41 plays an important role in p53-dependent apoptosis. It also showed that MRPL41 arrests the cell cycle by stabilizing p27 Kip1 in the absence of p53. This study found that MRPL41 mediates the p21 WAF1/CIP1 -mediated G1 arrest in response to serum starvation. The cells were released from serum starvation-induced G1 arrest via the siRNA-mediated blocking of MRPL41 expression. Overall, these results suggest that MRPL41 arrests the cell cycle by increasing the p21 WAF1/CIP1 and p27 Kip1 levels under the growth inhibitory conditions

  3. Lassomycin, a ribosomally synthesized cyclic peptide, kills mycobacterium tuberculosis by targeting the ATP-dependent protease ClpC1P1P2.

    Science.gov (United States)

    Gavrish, Ekaterina; Sit, Clarissa S; Cao, Shugeng; Kandror, Olga; Spoering, Amy; Peoples, Aaron; Ling, Losee; Fetterman, Ashley; Hughes, Dallas; Bissell, Anthony; Torrey, Heather; Akopian, Tatos; Mueller, Andreas; Epstein, Slava; Goldberg, Alfred; Clardy, Jon; Lewis, Kim

    2014-04-24

    Languishing antibiotic discovery and flourishing antibiotic resistance have prompted the development of alternative untapped sources for antibiotic discovery, including previously uncultured bacteria. Here, we screen extracts from uncultured species against Mycobacterium tuberculosis and identify lassomycin, an antibiotic that exhibits potent bactericidal activity against both growing and dormant mycobacteria, including drug-resistant forms of M. tuberculosis, but little activity against other bacteria or mammalian cells. Lassomycin is a highly basic, ribosomally encoded cyclic peptide with an unusual structural fold that only partially resembles that of other lasso peptides. We show that lassomycin binds to a highly acidic region of the ClpC1 ATPase complex and markedly stimulates its ATPase activity without stimulating ClpP1P2-catalyzed protein breakdown, which is essential for viability of mycobacteria. This mechanism, uncoupling ATPase from proteolytic activity, accounts for the bactericidal activity of lassomycin. Copyright © 2014 Elsevier Ltd. All rights reserved.

  4. Journal of Biosciences | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    The ribosomal phosphoprotein P0 of the human malarial parasite Plasmodium falciparum (PfP0) has been identified as a protective surface protein. In Drosophila, P0 protein functions in the nucleus. The ribosomal function of P0 is mediated at the stalk of the large ribosomal subunit at the GTPase centre, where the ...

  5. Generation and characterization of polyclonal antibodies specific to N-terminal extension of p85 isoform of ribosomal protein S6 kinase 1 (p85 S6K1

    Directory of Open Access Journals (Sweden)

    Savinska L. O.

    2015-08-01

    Full Text Available Aim. Generation of polyclonal antibodies specific to the ribosomal protein S6 kinase isoform – p85S6K1 and directed to the N-terminal (1–23 aa extension of p85S6K1. Methods. Animal immunization with synthetic (1–23 aa peptide, ELISA, Western blot, Immunoprecipitation, immunofluorescent analysis. Results. Polyclonal antibodies have been generated, which specifically recognize only p85 but not p70 isoform of S6K1 in western blot, immunoprecipitation and immunofluorescence analysis. Conclusions. The obtained antibodies can be recommended for studies on the p85S6K1 and other S6K1 isoforms possessing the N-terminal extension – the identification of binding protein partners, analysis of subcellular localization under different physiological conditions, elucidation of the signal transduction pathways involving different S6K1 isoforms.

  6. A dynamic ribosomal biogenesis response is not required for IGF-1-mediated hypertrophy of human primary myotubes.

    Science.gov (United States)

    Crossland, Hannah; Timmons, James A; Atherton, Philip J

    2017-12-01

    Increased ribosomal DNA transcription has been proposed to limit muscle protein synthesis, making ribosome biogenesis central to skeletal muscle hypertrophy. We examined the relationship between ribosomal RNA (rRNA) production and IGF-1-mediated myotube hypertrophy in vitro Primary skeletal myotubes were treated with IGF-1 (50 ng/ml) with or without 0.5 µM CX-5461 (CX), an inhibitor of RNA polymerase I. Myotube diameter, total protein, and RNA and DNA levels were measured along with markers of RNA polymerase I regulatory factors and regulators of protein synthesis. CX treatment reduced 45S pre-rRNA expression (-64 ± 5% vs. IGF-1; P IGF-1; P IGF-1-treated myotubes. IGF-1-mediated increases in myotube diameter (1.27 ± 0.09-fold, P IGF-1 treatment did not prevent early increases in AKT (+203 ± 39% vs. CX; P IGF-1, myotube diameter and protein accretion were sustained. Thus, while ribosome biogenesis represents a potential site for the regulation of skeletal muscle protein synthesis and muscle mass, it does not appear to be a prerequisite for IGF-1-induced myotube hypertrophy in vitro. -Crossland, H., Timmons, J. A., Atherton, P. J. A dynamic ribosomal biogenesis response is not required for IGF-1-mediated hypertrophy of human primary myotubes. © The Author(s).

  7. Antibodies to ribosomal P proteins of Trypanosoma cruzi in Chagas disease possess functional autoreactivity with heart tissue and differ from anti-P autoantibodies in lupus.

    Science.gov (United States)

    Kaplan, D; Ferrari, I; Bergami, P L; Mahler, E; Levitus, G; Chiale, P; Hoebeke, J; Van Regenmortel, M H; Levin, M J

    1997-09-16

    Anti-P antibodies present in sera from patients with chronic Chagas heart disease (cChHD) recognize peptide R13, EEEDDDMGFGLFD, which encompasses the C-terminal region of the Trypanosoma cruzi ribosomal P1 and P2 proteins. This peptide shares homology with the C-terminal region (peptide H13 EESDDDMGFGLFD) of the human ribosomal P proteins, which is in turn the target of anti-P autoantibodies in systemic lupus erythematosus (SLE), and with the acidic epitope, AESDE, of the second extracellular loop of the beta1-adrenergic receptor. Anti-P antibodies from chagasic patients showed a marked preference for recombinant parasite ribosomal P proteins and peptides, whereas anti-P autoantibodies from SLE reacted with human and parasite ribosomal P proteins and peptides to the same extent. A semi-quantitative estimation of the binding of cChHD anti-P antibodies to R13 and H13 using biosensor technology indicated that the average affinity constant was about 5 times higher for R13 than for H13. Competitive enzyme immunoassays demonstrated that cChHD anti-P antibodies bind to the acidic portions of peptide H13, as well as to peptide H26R, encompassing the second extracellular loop of the beta1 adrenoreceptor. Anti-P antibodies isolated from cChHD patients exert a positive chronotropic effect in vitro on cardiomyocytes from neonatal rats, which resembles closely that of anti-beta1 receptor antibodies isolated from the same patient. In contrast, SLE anti-P autoantibodies have no functional effect. Our results suggest that the adrenergic-stimulating activity of anti-P antibodies may be implicated in the induction of functional myocardial impairments observed in cChHD.

  8. Hypoxia-induced invadopodia formation involves activation of NHE-1 by the p90 ribosomal S6 kinase (p90RSK.

    Directory of Open Access Journals (Sweden)

    Fabrice Lucien

    Full Text Available The hypoxic and acidic microenvironments in tumors are strongly associated with malignant progression and metastasis, and have thus become a central issue in tumor physiology and cancer treatment. Despite this, the molecular links between acidic pH- and hypoxia-mediated cell invasion/metastasis remain mostly unresolved. One of the mechanisms that tumor cells use for tissue invasion is the generation of invadopodia, which are actin-rich invasive plasma membrane protrusions that degrade the extracellular matrix. Here, we show that hypoxia stimulates the formation of invadopodia as well as the invasive ability of cancer cells. Inhibition or shRNA-based depletion of the Na(+/H(+ exchanger NHE-1, along with intracellular pH monitoring by live-cell imaging, revealed that invadopodia formation is associated with alterations in cellular pH homeostasis, an event that involves activation of the Na(+/H(+ exchange rate by NHE-1. Further characterization indicates that hypoxia triggered the activation of the p90 ribosomal S6 kinase (p90 RSK, which resulted in invadopodia formation and site-specific phosphorylation and activation of NHE-1. This study reveals an unsuspected role of p90RSK in tumor cell invasion and establishes p90RS kinase as a link between hypoxia and the acidic microenvironment of tumors.

  9. Structural dissection of human metapneumovirus phosphoprotein using small angle x-ray scattering.

    Science.gov (United States)

    Renner, Max; Paesen, Guido C; Grison, Claire M; Granier, Sébastien; Grimes, Jonathan M; Leyrat, Cédric

    2017-11-01

    The phosphoprotein (P) is the main and essential cofactor of the RNA polymerase (L) of non-segmented, negative-strand RNA viruses. P positions the viral polymerase onto its nucleoprotein-RNA template and acts as a chaperone of the nucleoprotein (N), thereby preventing nonspecific encapsidation of cellular RNAs. The phosphoprotein of human metapneumovirus (HMPV) forms homotetramers composed of a stable oligomerization domain (P core ) flanked by large intrinsically disordered regions (IDRs). Here we combined x-ray crystallography of P core with small angle x-ray scattering (SAXS)-based ensemble modeling of the full-length P protein and several of its fragments to provide a structural description of P that captures its dynamic character, and highlights the presence of varyingly stable structural elements within the IDRs. We discuss the implications of the structural properties of HMPV P for the assembly and functioning of the viral transcription/replication machinery.

  10. Crystallization of the two-domain N-terminal fragment of the archaeal ribosomal protein L10(P0) in complex with a specific fragment of 23S rRNA

    Science.gov (United States)

    Kravchenko, O. V.; Mitroshin, I. V.; Gabdulkhakov, A. G.; Nikonov, S. V.; Garber, M. B.

    2011-07-01

    Lateral L12-stalk (P1-stalk in Archaea, P1/P2-stalk in eukaryotes) is an obligatory morphological element of large ribosomal subunits in all organisms studied. This stalk is composed of the complex of ribosomal proteins L10(P0) and L12(P1) and interacts with 23S rRNA through the protein L10(P0). L12(P1)-stalk is involved in the formation of GTPase center of the ribosome and plays an important role in the ribosome interaction with translation factors. High mobility of this stalk puts obstacles in determination of its structure within the intact ribosome. Crystals of a two-domain N-terminal fragment of ribosomal protein L10(P0) from the archaeon Methanococcus jannaschii in complex with a specific fragment of rRNA from the same organism have been obtained. The crystals diffract X-rays at 3.2 Å resolution.

  11. Crystallization of the two-domain N-terminal fragment of the archaeal ribosomal protein L10(P0) in complex with a specific fragment of 23S rRNA

    Energy Technology Data Exchange (ETDEWEB)

    Kravchenko, O. V.; Mitroshin, I. V.; Gabdulkhakov, A. G.; Nikonov, S. V.; Garber, M. B., E-mail: garber@vega.protres.ru [Institute of Protein Research RAS (Russian Federation)

    2011-07-15

    Lateral L12-stalk (P1-stalk in Archaea, P1/P2-stalk in eukaryotes) is an obligatory morphological element of large ribosomal subunits in all organisms studied. This stalk is composed of the complex of ribosomal proteins L10(P0) and L12(P1) and interacts with 23S rRNA through the protein L10(P0). L12(P1)-stalk is involved in the formation of GTPase center of the ribosome and plays an important role in the ribosome interaction with translation factors. High mobility of this stalk puts obstacles in determination of its structure within the intact ribosome. Crystals of a two-domain N-terminal fragment of ribosomal protein L10(P0) from the archaeon Methanococcus jannaschii in complex with a specific fragment of rRNA from the same organism have been obtained. The crystals diffract X-rays at 3.2 Angstrom-Sign resolution.

  12. Inhibition of hydroxyapatite growth by casein, a potential salivary phosphoprotein homologue.

    Science.gov (United States)

    Romero, Maria J R H; Nakashima, Syozi; Nikaido, Toru; Ichinose, Shizuko; Sadr, Alireza; Tagami, Junji

    2015-08-01

    Salivary phosphoproteins are essential in tooth mineral regulation but are often overlooked in vitro. This study aimed to evaluate the effect of casein, as a salivary phosphoprotein homologue, on the deposition and growth of hydroxyapatite (HA) on tooth surfaces. Hydroxyapatite growth was quantified using seeded crystal systems. Artificial saliva (AS) containing HA powder and 0, 10, 20, 50, or 100 μg ml(-1) of casein, or 100 μg ml(-1) of dephosphorylated casein (Dcasein), was incubated for 0-8 h at 37°C, pH 7.2. Calcium concentrations were measured using atomic absorption spectroscopy (AAS). Surface precipitation of HA on bovine enamel and dentine blocks, incubated in similar conditions for 7 d, was examined using field emission scanning electron microscopy (FE-SEM) and transmission electron microscopy (TEM) with selected area electron diffraction (SAED). Casein adsorption was assessed using modified Lowry assays and zeta-potential measurements. The AAS results revealed a concentration-dependent inhibition of calcium consumption. Hydroxyapatite precipitation occurred when no casein was present, whereas precipitation of HA was apparently completely inhibited in casein-containing groups. Adsorption data demonstrated increasingly negative zeta-potential with increased casein concentration and an affinity constant similar to proline-rich proteins with Langmuir modelling. Casein inhibited the deposition and growth of HA primarily through the binding of esterized phosphate to HA active sites, indicating its potential as a mineral-regulating salivary phosphoprotein homologue in vitro. © 2015 Eur J Oral Sci.

  13. The ribosomal protein Rpl22 controls ribosome composition by directly repressing expression of its own paralog, Rpl22l1.

    Directory of Open Access Journals (Sweden)

    Monique N O'Leary

    Full Text Available Most yeast ribosomal protein genes are duplicated and their characterization has led to hypotheses regarding the existence of specialized ribosomes with different subunit composition or specifically-tailored functions. In yeast, ribosomal protein genes are generally duplicated and evidence has emerged that paralogs might have specific roles. Unlike yeast, most mammalian ribosomal proteins are thought to be encoded by a single gene copy, raising the possibility that heterogenous populations of ribosomes are unique to yeast. Here, we examine the roles of the mammalian Rpl22, finding that Rpl22(-/- mice have only subtle phenotypes with no significant translation defects. We find that in the Rpl22(-/- mouse there is a compensatory increase in Rpl22-like1 (Rpl22l1 expression and incorporation into ribosomes. Consistent with the hypothesis that either ribosomal protein can support translation, knockdown of Rpl22l1 impairs growth of cells lacking Rpl22. Mechanistically, Rpl22 regulates Rpl22l1 directly by binding to an internal hairpin structure and repressing its expression. We propose that ribosome specificity may exist in mammals, providing evidence that one ribosomal protein can influence composition of the ribosome by regulating its own paralog.

  14. 5S Ribosomal RNA Is an Essential Component of a Nascent Ribosomal Precursor Complex that Regulates the Hdm2-p53 Checkpoint

    Directory of Open Access Journals (Sweden)

    Giulio Donati

    2013-07-01

    Full Text Available Recently, we demonstrated that RPL5 and RPL11 act in a mutually dependent manner to inhibit Hdm2 and stabilize p53 following impaired ribosome biogenesis. Given that RPL5 and RPL11 form a preribosomal complex with noncoding 5S ribosomal RNA (rRNA and the three have been implicated in the p53 response, we reasoned they may be part of an Hdm2-inhibitory complex. Here, we show that small interfering RNAs directed against 5S rRNA have no effect on total or nascent levels of the noncoding rRNA, though they prevent the reported Hdm4 inhibition of p53. To achieve efficient inhibition of 5S rRNA synthesis, we targeted TFIIIA, a specific RNA polymerase III cofactor, which, like depletion of either RPL5 or RPL11, did not induce p53. Instead, 5S rRNA acts in a dependent manner with RPL5 and RPL11 to inhibit Hdm2 and stabilize p53. Moreover, depletion of any one of the three components abolished the binding of the other two to Hdm2, explaining their common dependence. Finally, we demonstrate that the RPL5/RPL11/5S rRNA preribosomal complex is redirected from assembly into nascent 60S ribosomes to Hdm2 inhibition as a consequence of impaired ribosome biogenesis. Thus, the activation of the Hdm2-inhibitory complex is not a passive but a regulated event, whose potential role in tumor suppression has been recently noted.

  15. 5S ribosomal RNA is an essential component of a nascent ribosomal precursor complex that regulates the Hdm2-p53 checkpoint.

    Science.gov (United States)

    Donati, Giulio; Peddigari, Suresh; Mercer, Carol A; Thomas, George

    2013-07-11

    Recently, we demonstrated that RPL5 and RPL11 act in a mutually dependent manner to inhibit Hdm2 and stabilize p53 following impaired ribosome biogenesis. Given that RPL5 and RPL11 form a preribosomal complex with noncoding 5S ribosomal RNA (rRNA) and the three have been implicated in the p53 response, we reasoned they may be part of an Hdm2-inhibitory complex. Here, we show that small interfering RNAs directed against 5S rRNA have no effect on total or nascent levels of the noncoding rRNA, though they prevent the reported Hdm4 inhibition of p53. To achieve efficient inhibition of 5S rRNA synthesis, we targeted TFIIIA, a specific RNA polymerase III cofactor, which, like depletion of either RPL5 or RPL11, did not induce p53. Instead, 5S rRNA acts in a dependent manner with RPL5 and RPL11 to inhibit Hdm2 and stabilize p53. Moreover, depletion of any one of the three components abolished the binding of the other two to Hdm2, explaining their common dependence. Finally, we demonstrate that the RPL5/RPL11/5S rRNA preribosomal complex is redirected from assembly into nascent 60S ribosomes to Hdm2 inhibition as a consequence of impaired ribosome biogenesis. Thus, the activation of the Hdm2-inhibitory complex is not a passive but a regulated event, whose potential role in tumor suppression has been recently noted. Copyright © 2013 The Authors. Published by Elsevier Inc. All rights reserved.

  16. The C-terminal helix of ribosomal P stalk recognizes a hydrophobic groove of elongation factor 2 in a novel fashion.

    Science.gov (United States)

    Tanzawa, Takehito; Kato, Koji; Girodat, Dylan; Ose, Toyoyuki; Kumakura, Yuki; Wieden, Hans-Joachim; Uchiumi, Toshio; Tanaka, Isao; Yao, Min

    2018-04-06

    Archaea and eukaryotes have ribosomal P stalks composed of anchor protein P0 and aP1 homodimers (archaea) or P1P2 heterodimers (eukaryotes). These P stalks recruit translational GTPases to the GTPase-associated center in ribosomes to provide energy during translation. The C-terminus of the P stalk is known to selectively recognize GTPases. Here we investigated the interaction between the P stalk and elongation factor 2 by determining the structures of Pyrococcus horikoshii EF-2 (PhoEF-2) in the Apo-form, GDP-form, GMPPCP-form (GTP-form), and GMPPCP-form bound with 11 C-terminal residues of P1 (P1C11). Helical structured P1C11 binds to a hydrophobic groove between domain G and subdomain G' of PhoEF-2, where is completely different from that of aEF-1α in terms of both position and sequence, implying that such interaction characteristic may be requested by how GTPases perform their functions on the ribosome. Combining PhoEF-2 P1-binding assays with a structural comparison of current PhoEF-2 structures and molecular dynamics model of a P1C11-bound GDP form, the conformational changes of the P1C11-binding groove in each form suggest that in response to the translation process, the groove has three states: closed, open, and release for recruiting and releasing GTPases.

  17. PF-4708671, a specific inhibitor of p70 ribosomal S6 kinase 1, activates Nrf2 by promoting p62-dependent autophagic degradation of Keap1

    Energy Technology Data Exchange (ETDEWEB)

    Park, Jeong Su [Severance Biomedical Science Institute (Korea, Republic of); Yonsei Biomedical Research Institute, Yonsei University College of Medicine, 50 Yonsei-ro, Seodaemun-gu, Seoul 120-752 (Korea, Republic of); Kang, Dong Hoon [Department of Life Science and Ewha Research Center for Systems Biology (Korea, Republic of); The Research Center for Cell Homeostasis, Ewha Womans University, Seoul 127-750 (Korea, Republic of); Lee, Da Hyun [Severance Biomedical Science Institute (Korea, Republic of); Yonsei Biomedical Research Institute, Yonsei University College of Medicine, 50 Yonsei-ro, Seodaemun-gu, Seoul 120-752 (Korea, Republic of); Bae, Soo Han, E-mail: soohanbae@yuhs.ac [Severance Biomedical Science Institute (Korea, Republic of); Yonsei Biomedical Research Institute, Yonsei University College of Medicine, 50 Yonsei-ro, Seodaemun-gu, Seoul 120-752 (Korea, Republic of)

    2015-10-23

    p70 ribosomal S6 kinase 1 (S6K1) is an important serine/threonine kinase and downstream target of the mechanistic target of rapamycin complex 1 (mTORC1) signaling pathway. PF-4708671 is a specific inhibitor of S6K1, and prevents S6K1-mediated phosphorylation of the S6 protein. PF-4708671 treatment often leads to apoptotic cell death. However, the protective mechanism against PF-4708671-induced cell death has not been elucidated. The nuclear factor erythroid 2-related factor 2 (Nrf2)-Kelch-like ECH-associated protein 1 (Keap1) pathway is essential for protecting cells against oxidative stress. p62, an adaptor protein in the autophagic process, enhances Nrf2 activation through the impairment of Keap1 activity. In this study, we showed that PF-4708671 induces autophagic Keap1 degradation-mediated Nrf2 activation in p62-dependent manner. Furthermore, p62-dependent Nrf2 activation plays a crucial role in protecting cells from PF-4708671-mediated apoptosis. - Highlights: • PF-4708671, a S6K1-specific inhibitor, prevents S6K1-mediated S6 phosphorylation. • However, PF-4708671 treatment often leads to apoptotic cell death. • Protective mechanism against PF-4708671-induced cell death remains to be elucidated. • PF-4708671 induced p62-dependent, autophagic Keap1 degradation-mediated Nrf2 activation. • p62-dependent Nrf2 activation protects cells from PF-4708671-mediated apoptosis.

  18. IDENTIFICATION AND FUNCTIONAL ANNOTATION OF APOPLASTIC PHOSPHOPROTEINS OF HIPPOPHAE RHAMNOIDES SEEDLINGS

    Directory of Open Access Journals (Sweden)

    Ravi Gupta

    2016-12-01

    Full Text Available Phosphorylation is a reversible switch that regulates the biological activities of the proteins. Although there are ample of reports on the plant phosphoproteome analysis, phosphorylation status of apoplastic proteins has not been investigated profoundly. Here a shotgun proteomics approach was used to identify the phosphoproteins from the apoplast of the Hippophae rhamnoides (Seabuckthorn. A total of 123 phosphoproteins were identified using an SYNAPT G2 quadrupole time-of-flight mass spectrometer (Q-ToF-MS. Functional annotation of the identified phosphoproteins using PANTHER, Gene ontology, and KEGG programs showed that the majority of proteins were associated with the transporter, nucleic acid binding and amino acid metabolic activities. Prediction of secretory nature of the identified proteins using SignalP and SecretomeP servers showed that 56 % of the proteins were secretory, while rest of the 44 % of the proteins were non-secretory. PhosPhAt 4.0 detected 534 putative phosphorylation sites in the 75 unique Arabidopsis annotated proteins, wherein 195 (36% were on the serine residue, 196 (37% were on the threonine residue and 143 (27% were detected on the tyrosine residue. Taken together, our results provide the first insight into the phosphorylation-mediated regulation of apoplastic proteins by cellular processes, which would be helpful in an in-depth understanding of the apoplastic signaling

  19. Elevated expression of ribosomal protein genes L37, RPP-1, and S2 in the presence of mutant p53.

    Science.gov (United States)

    Loging, W T; Reisman, D

    1999-11-01

    The wild-type p53 protein is a DNA-binding transcription factor that activates genes such as p21, MDM2, GADD45, and Bax that are required for the regulation of cell cycle progression or apoptosis in response to DNA damage. Mutant forms of p53, which are transforming oncogenes and are expressed at high levels in tumor cells, generally have a reduced binding affinity for the consensus DNA sequence. Interestingly, some p53 mutants that are no longer effective at binding to the consensus DNA sequence and transactivating promoters containing this target site have acquired the ability to transform cells in culture, in part through their ability to transactivate promoters of a number of genes that are not targets of the wild-type protein. Certain p53 mutants are therefore considered to be gain-of-function mutants and appear to be promoting proliferation or transforming cells through their ability to alter the expression of novel sets of genes. Our goal is to identify genes that have altered expression in the presence of a specific mutant p53 (Arg to Trp mutation at codon 248) protein. Through examining differential gene expression in cells devoid of p53 expression and in cells that express high levels of mutant p53 protein, we have identified three ribosomal protein genes that have elevated expression in response to mutant p53. Consistent with these findings, the overexpression of a number of ribosomal protein genes in human tumors and evidence for their contribution to oncogenic transformation have been reported previously, although the mechanism leading to this overexpression has remained elusive. We show results that indicate that expression of these specific ribosomal protein genes is increased in the presence of the R248W p53 mutant, which provides a mechanism for their overexpression in human tumors.

  20. Phosphoproteins in extracellular vesicles as candidate markers for breast cancer.

    Science.gov (United States)

    Chen, I-Hsuan; Xue, Liang; Hsu, Chuan-Chih; Paez, Juan Sebastian Paez; Pan, Li; Andaluz, Hillary; Wendt, Michael K; Iliuk, Anton B; Zhu, Jian-Kang; Tao, W Andy

    2017-03-21

    The state of protein phosphorylation can be a key determinant of cellular physiology such as early-stage cancer, but the development of phosphoproteins in biofluids for disease diagnosis remains elusive. Here we demonstrate a strategy to isolate and identify phosphoproteins in extracellular vesicles (EVs) from human plasma as potential markers to differentiate disease from healthy states. We identified close to 10,000 unique phosphopeptides in EVs isolated from small volumes of plasma samples. Using label-free quantitative phosphoproteomics, we identified 144 phosphoproteins in plasma EVs that are significantly higher in patients diagnosed with breast cancer compared with healthy controls. Several biomarkers were validated in individual patients using paralleled reaction monitoring for targeted quantitation. This study demonstrates that the development of phosphoproteins in plasma EV as disease biomarkers is highly feasible and may transform cancer screening and monitoring.

  1. p53- and ERK7-dependent ribosome surveillance response regulates Drosophila insulin-like peptide secretion.

    Directory of Open Access Journals (Sweden)

    Kiran Hasygar

    2014-11-01

    Full Text Available Insulin-like signalling is a conserved mechanism that coordinates animal growth and metabolism with nutrient status. In Drosophila, insulin-producing median neurosecretory cells (IPCs regulate larval growth by secreting insulin-like peptides (dILPs in a diet-dependent manner. Previous studies have shown that nutrition affects dILP secretion through humoral signals derived from the fat body. Here we uncover a novel mechanism that operates cell autonomously in the IPCs to regulate dILP secretion. We observed that impairment of ribosome biogenesis specifically in the IPCs strongly inhibits dILP secretion, which consequently leads to reduced body size and a delay in larval development. This response is dependent on p53, a known surveillance factor for ribosome biogenesis. A downstream effector of this growth inhibitory response is an atypical MAP kinase ERK7 (ERK8/MAPK15, which is upregulated in the IPCs following impaired ribosome biogenesis as well as starvation. We show that ERK7 is sufficient and essential to inhibit dILP secretion upon impaired ribosome biogenesis, and it acts epistatically to p53. Moreover, we provide evidence that p53 and ERK7 contribute to the inhibition of dILP secretion upon starvation. Thus, we conclude that a cell autonomous ribosome surveillance response, which leads to upregulation of ERK7, inhibits dILP secretion to impede tissue growth under limiting dietary conditions.

  2. Cloning, purification, crystallization and preliminary X-ray analysis of the Burkholderia pseudomallei L1 ribosomal protein

    International Nuclear Information System (INIS)

    Abd Aziz, Abd Ghani; Ruzheinikov, Sergey N.; Sedelnikova, Svetlana E.; Mohamed, Rahmah; Nathan, Sheila; Baker, Patrick J.; Rice, David W.

    2012-01-01

    The L1 ribosomal protein from B. pseudomallei has been overexpressed, purified and crystallized in a form suitable for X-ray analysis. The gene encoding the L1 ribosomal protein from Burkholderia pseudomallei strain D286 has been cloned into the pETBLUE-1 vector system, overexpressed in Escherichia coli and purified. Crystals of the native protein were grown by the hanging-drop vapour-diffusion technique using PEG 3350 as a precipitant and diffracted to beyond 1.65 Å resolution. The crystals belonged to space group P2 1 2 1 2, with unit-cell parameters a = 53.6, b = 127.1, c = 31.8 Å and with a single molecule in the asymmetric unit

  3. The CCA-end of P-tRNA Contacts Both the Human RPL36AL and the A-site Bound Translation Termination Factor eRF1 at the Peptidyl Transferase Center of the Human 80S Ribosome.

    Science.gov (United States)

    Hountondji, Codjo; Bulygin, Konstantin; Créchet, Jean-Bernard; Woisard, Anne; Tuffery, Pierre; Nakayama, Jun-Ichi; Frolova, Ludmila; Nierhaus, Knud H; Karpova, Galina; Baouz, Soria

    2014-01-01

    We have demonstrated previously that the E-site specific protein RPL36AL present in human ribosomes can be crosslinked with the CCA-end of a P-tRNA in situ. Here we report the following: (i) We modeled RPL36AL into the structure of the archaeal ortholog RPL44E extracted from the known X-ray structure of the 50S subunit of Haloarcula marismortui. Superimposing the obtained RPL36AL structure with that of P/E tRNA observed in eukaryotic 80S ribosomes suggested that RPL36AL might in addition to its CCA neighbourhood interact with the inner site of the tRNA elbow similar to an interaction pattern known from tRNA•synthetase pairs. (ii) Accordingly, we detected that the isolated recombinant protein RPL36AL can form a tight binary complex with deacylated tRNA, and even tRNA fragments truncated at their CCA end showed a high affinity in the nanomolar range supporting a strong interaction outside the CCA end. (iii) We constructed programmed 80S complexes containing the termination factor eRF1 (stop codon UAA at the A-site) and a 2',3'-dialdehyde tRNA (tRNAox) analog at the P-site. Surprisingly, we observed a crosslinked ternary complex containing the tRNA, eRF1 and RPL36AL crosslinked both to the aldehyde groups of tRNAox at the 2'- and 3'-positions of the ultimate A. We also demonstrated that, upon binding to the ribosomal A-site, eRF1 induces an alternative conformation of the ribosome and/or the tRNA, leading to a novel crosslink of tRNAox to another large-subunit ribosomal protein (namely L37) rather than to RPL36AL, both ribosomal proteins being labeled in a mutually exclusive fashion. Since the human 80S ribosome in complex with P-site bound tRNAox and A-site bound eRF1 corresponds to the post-termination state of the ribosome, the results represent the first biochemical evidence for the positioning of the CCA-arm of the P-tRNA in close proximity to both RPL36AL and eRF1 at the end of the translation process.

  4. 12th International Conference on Second Messengers and Phosphoproteins

    Czech Academy of Sciences Publication Activity Database

    Tuháčková, Zdena

    2004-01-01

    Roč. 32, č. 3 (2004), s. 89-91 ISSN 1211-2526. [International conference on second messengers and phosphoproteins /12./. Montreal, 03.08.2004-07.08.2004] R&D Projects: GA ČR GA301/04/0550; GA AV ČR KSK5020115 Institutional research plan: CEZ:AV0Z5052915 Keywords : MTOR -PI3-K signalling * p70 S 6 kinase * v-Src Subject RIV: CE - Biochemistry

  5. Loss of ribosomal protein L11 affects zebrafish embryonic development through a p53-dependent apoptotic response.

    Directory of Open Access Journals (Sweden)

    Anirban Chakraborty

    Full Text Available Ribosome is responsible for protein synthesis in all organisms and ribosomal proteins (RPs play important roles in the formation of a functional ribosome. L11 was recently shown to regulate p53 activity through a direct binding with MDM2 and abrogating the MDM2-induced p53 degradation in response to ribosomal stress. However, the studies were performed in cell lines and the significance of this tumor suppressor function of L11 has yet to be explored in animal models. To investigate the effects of the deletion of L11 and its physiological relevance to p53 activity, we knocked down the rpl11 gene in zebrafish and analyzed the p53 response. Contrary to the cell line-based results, our data indicate that an L11 deficiency in a model organism activates the p53 pathway. The L11-deficient embryos (morphants displayed developmental abnormalities primarily in the brain, leading to embryonic lethality within 6-7 days post fertilization. Extensive apoptosis was observed in the head region of the morphants, thus correlating the morphological defects with apparent cell death. A decrease in total abundance of genes involved in neural patterning of the brain was observed in the morphants, suggesting a reduction in neural progenitor cells. Upregulation of the genes involved in the p53 pathway were observed in the morphants. Simultaneous knockdown of the p53 gene rescued the developmental defects and apoptosis in the morphants. These results suggest that ribosomal dysfunction due to the loss of L11 activates a p53-dependent checkpoint response to prevent improper embryonic development.

  6. The Phosphorylation of Ribosomal Protein in Lemna minor

    Science.gov (United States)

    Trewavas, A.

    1973-01-01

    Sterile cultures of Lemna minor have been labeled with 32P1, and the ribosomal proteins have been examined for radioactivity. In relatively short term labeling a radioactive protein was found which ran as a single component in both urea/acetic acid and sodium lauryl sulfate gel electrophoresis. Acid hydrolysis of the labeled protein permitted the isolation of serine phosphate. After labeling to equilibrium with 32P1, calculation indicated only 0.6 to 0.75 atom of this protein phosphorus per ribosome. The phosphorylated protein is found in both polysomes and “derived” monomers and appears to be located in the ribosomal small subunit. Its apparent molecular weight is 42,000. Addition of growth-inhibiting concentrations of abscisic acid does not alter the apparent degree of labeling of this protein in 5 hours, but after 24 hours of treatment the total protein phosphorus was reduced from 0.75 atom of phosphorus per ribosome to 0.36 atom of phosphorus per ribosome. PMID:16658405

  7. Proteomic analysis of phosphoproteins sensitive to a phosphatidylinositol 3-kinase inhibitor, ZSTK474, by using SELDI-TOF MS

    Directory of Open Access Journals (Sweden)

    Yamori Takao

    2009-03-01

    Full Text Available Abstract Background Phosphoproteins play important roles in a vast series of biological processes. Recent proteomic technologies offer the comprehensive analyses of phosphoproteins. Recently, we demonstrated that surface-enhanced laser desorption/ionization time of flight mass (SELDI-TOF MS would detect phosphoproteins quantitatively, which was a new application of SELDI-TOF MS. Results We combined immobilized metal affinity chromatography (IMAC with SELDI-TOF MS. After SELDI-TOF MS analysis of IMAC-enrichment phosphoproteins from A549 cancer cells, a series of protein peaks at 12.9, 12.8, 12.7 and 12.6 kDa was obtained in a mass spectrum. The peak intensities of these proteins decreased after a phosphatase treatment and, interestingly, they also decreased when the cells were pre-treated with a novel phosphatidylinositol 3-kinase (PI3K inhibitor, ZSTK474, suggesting that these proteins were ZSTK474-sensitive phosphoproteins. Identity of the phosphoproteins, which were predicted as the multi-phosphorylated forms of 4E-binding protein 1 (4E-BP1 with the aid of TagIdent algorithm, was confirmed by immunoprecipitation and subsequent SELDI-TOF MS analysis. 4E-BP1 is a downstream component of the PI3K/Akt/mTOR pathway and it regulates protein synthesis. We also investigated the effect of ZSTK474 on 4E-BP1 phosphorylation using phospho-specific antibodies. ZSTK474, which have little inhibitory activity for mTOR, inhibited phosphorylation of Ser65, Thr70 and Thr37/46 in 4E-BP1. In contrast, rapamycin, an inhibitor of mTOR, blocked phosphorylation only of Ser65 and Thr70. These results suggest that ZSTK474 and rapamycin inhibited the phosphorylation of 4E-BP1 in a different manner. Conclusion We identified a group of ZSTK474-sensitive phosphoproteins as the multi-phosphorylated form of 4E-BP1 by combining IMAC, SELDI-TOF MS and antibodies.

  8. [Identification of Clonorchis sinensis metacercariae based on PCR targeting ribosomal DNA ITS regions and COX1 gene].

    Science.gov (United States)

    Yang, Qing-Li; Shen, Ji-Qing; Jiang, Zhi-Hua; Yang, Yi-Chao; Li, Hong-Mei; Chen, Ying-Dan; Zhou, Xiao-Nong

    2014-06-01

    To identify Clonorchis sinensis metacercariae using PCR targeting ribosomal DNA ITS region and COX1 gene. Pseudorasbora parva were collected from Hengxian County of Guangxi at the end of May 2013. Single metacercaria of C. sinensis and other trematodes were separated from muscle tissue of P. parva by digestion method. Primers targeting ribosomal DNA ITS region and COX1 gene of C. sinensis were designed for PCR and the universal primers were used as control. The sensitivity and specificity of the PCR detection were analyzed. C. sinensis metacercariae at different stages were identified by PCR. DNA from single C. sinensis metacercaria was detected by PCR targeting ribosomal DNA ITS region and COX1 gene. The specific amplicans have sizes of 437/549, 156/249 and 195/166 bp, respectively. The ratio of the two positive numbers in PCR with universal primers and specific primers targeting C. sinensis ribosomal DNA ITS1 and ITS2 regions was 0.905 and 0.952, respectively. The target gene fragments were amplified by PCR using COX1 gene-specific primers. The PCR with specific primers did not show any non-specific amplification. However, the PCR with universal primers targeting ribosomal DNA ITS regions performed serious non-specific amplification. C. sinensis metacercariae at different stages are identified by morphological observation and PCR method. Species-specific primers targeting ribosomal DNA ITS region show higher sensitivity and specificity than the universal primers. PCR targeting COX1 gene shows similar sensitivity and specificity to PCR with specific primers targeting ribosomal DNA ITS regions.

  9. Chronic Alcohol Consumption Alters Mammalian Target of Rapamycin (mTOR), Reduces Ribosomal p70S6 Kinase and p4E-BP1 Levels in Mouse Cerebral Cortex

    OpenAIRE

    Li, Qun; Ren, Jun

    2007-01-01

    Reduced insulin sensitivity following chronic alcohol consumption may contribute to alcohol-induced brain damage although the underlying mechanism(s) has not been elucidated. This study was designed to examine the effect of chronic alcohol intake on insulin signaling in mouse cerebral cortex. FVB mice were fed with a 4% alcohol diet for 16 weeks. Insulin receptor substrates (IRS-1, IRS-2) and post-receptor signaling molecules Akt, mammalian target of rapamycin (mTOR), ribosomal p70s6 kinase (...

  10. Sphingosine-1-Phosphate (S1P) Impacts Presynaptic Functions by Regulating Synapsin I Localization in the Presynaptic Compartment.

    Science.gov (United States)

    Riganti, Loredana; Antonucci, Flavia; Gabrielli, Martina; Prada, Ilaria; Giussani, Paola; Viani, Paola; Valtorta, Flavia; Menna, Elisabetta; Matteoli, Michela; Verderio, Claudia

    2016-04-20

    Growing evidence indicates that sphingosine-1-P (S1P) upregulates glutamate secretion in hippocampal neurons. However, the molecular mechanisms through which S1P enhances excitatory activity remain largely undefined. The aim of this study was to identify presynaptic targets of S1P action controlling exocytosis. Confocal analysis of rat hippocampal neurons showed that S1P applied at nanomolar concentration alters the distribution of Synapsin I (SynI), a presynaptic phosphoprotein that controls the availability of synaptic vesicles for exocytosis. S1P induced SynI relocation to extrasynaptic regions of mature neurons, as well as SynI dispersion from synaptic vesicle clusters present at axonal growth cones of developing neurons. S1P-induced SynI relocation occurred in a Ca(2+)-independent but ERK-dependent manner, likely through the activation of S1P3 receptors, as it was prevented by the S1P3 receptor selective antagonist CAY1044 and in neurons in which S1P3 receptor was silenced. Our recent evidence indicates that microvesicles (MVs) released by microglia enhance the metabolism of endogenous sphingolipids in neurons and stimulate excitatory transmission. We therefore investigated whether MVs affect SynI distribution and whether endogenous S1P could be involved in the process. Analysis of SynI immunoreactivity showed that exposure to microglial MVs induces SynI mobilization at presynaptic sites and growth cones, whereas the use of inhibitors of sphingolipid cascade identified S1P as the sphingolipid mediating SynI redistribution. Our data represent the first demonstration that S1P induces SynI mobilization from synapses, thereby indicating the phosphoprotein as a novel target through which S1P controls exocytosis. Growing evidence indicates that the bioactive lipid sphingosine and its metabolite sphingosine-1-P (S1P) stimulate excitatory transmission. While it has been recently clarified that sphingosine influences directly the exocytotic machinery by activating the

  11. Phosphoproteins in extracellular vesicles as candidate markers for breast cancer

    OpenAIRE

    Chen, I-Hsuan; Xue, Liang; Hsu, Chuan-Chih; Paez, Juan Sebastian Paez; Pan, Li; Andaluz, Hillary; Wendt, Michael K.; Iliuk, Anton B.; Zhu, Jian-Kang; Tao, W. Andy

    2017-01-01

    Protein phosphorylation is a major regulatory mechanism for many cellular functions, but no phosphoprotein in biofluids has been developed for disease diagnosis because of the presence of active phosphatases. This study presents a general strategy to isolate and identify phosphoproteins in extracellular vesicles (EVs) from human plasma as potential markers to differentiate disease from healthy states. We identified close to 10,000 unique phosphopeptides in EVs from small volumes of plasma sam...

  12. Ribosomal protein methyltransferases in the yeast Saccharomyces cerevisiae: Roles in ribosome biogenesis and translation.

    Science.gov (United States)

    Al-Hadid, Qais; White, Jonelle; Clarke, Steven

    2016-02-12

    A significant percentage of the methyltransferasome in Saccharomyces cerevisiae and higher eukaryotes is devoted to methylation of the translational machinery. Methylation of the RNA components of the translational machinery has been studied extensively and is important for structure stability, ribosome biogenesis, and translational fidelity. However, the functional effects of ribosomal protein methylation by their cognate methyltransferases are still largely unknown. Previous work has shown that the ribosomal protein Rpl3 methyltransferase, histidine protein methyltransferase 1 (Hpm1), is important for ribosome biogenesis and translation elongation fidelity. In this study, yeast strains deficient in each of the ten ribosomal protein methyltransferases in S. cerevisiae were examined for potential defects in ribosome biogenesis and translation. Like Hpm1-deficient cells, loss of four of the nine other ribosomal protein methyltransferases resulted in defects in ribosomal subunit synthesis. All of the mutant strains exhibited resistance to the ribosome inhibitors anisomycin and/or cycloheximide in plate assays, but not in liquid culture. Translational fidelity assays measuring stop codon readthrough, amino acid misincorporation, and programmed -1 ribosomal frameshifting, revealed that eight of the ten enzymes are important for translation elongation fidelity and the remaining two are necessary for translation termination efficiency. Altogether, these results demonstrate that ribosomal protein methyltransferases in S. cerevisiae play important roles in ribosome biogenesis and translation. Copyright © 2016 Elsevier Inc. All rights reserved.

  13. Myb-binding protein 1a (Mybbp1a) regulates levels and processing of pre-ribosomal RNA.

    Science.gov (United States)

    Hochstatter, Julia; Hölzel, Michael; Rohrmoser, Michaela; Schermelleh, Lothar; Leonhardt, Heinrich; Keough, Rebecca; Gonda, Thomas J; Imhof, Axel; Eick, Dirk; Längst, Gernot; Németh, Attila

    2012-07-13

    Ribosomal RNA gene transcription, co-transcriptional processing, and ribosome biogenesis are highly coordinated processes that are tightly regulated during cell growth. In this study we discovered that Mybbp1a is associated with both the RNA polymerase I complex and the ribosome biogenesis machinery. Using a reporter assay that uncouples transcription and RNA processing, we show that Mybbp1a represses rRNA gene transcription. In addition, overexpression of the protein reduces RNA polymerase I loading on endogenous rRNA genes as revealed by chromatin immunoprecipitation experiments. Accordingly, depletion of Mybbp1a results in an accumulation of the rRNA precursor in vivo but surprisingly also causes growth arrest of the cells. This effect can be explained by the observation that the modulation of Mybbp1a protein levels results in defects in pre-rRNA processing within the cell. Therefore, the protein may play a dual role in the rRNA metabolism, potentially linking and coordinating ribosomal DNA transcription and pre-rRNA processing to allow for the efficient synthesis of ribosomes.

  14. Crystallization of ribosomes from Thermus thermophilus

    International Nuclear Information System (INIS)

    Karpova, E.A.; Serdyuk, I.N.; Tarkhovskii, Yu.S.; Orlova, E.V.; Borovyagin, V.L.

    1987-01-01

    An understanding of the molecular bases of the process of protein biosynthesis on the ribosome requires a knowledge of its structure with high three-dimensional resolution involving the method of x-ray crystallographic analysis. The authors report on the production of crystals of the 70S ribosomes from a new source - the highly thermophilic bacterium Thermus thermophilus. Ribosomes for crystallization were obtained from Th. thermophilus strain HB8 by two washings in buffer with high ionic strength. The ribosome preparation was investigated for homogeneity by the method of high-speed sedimentation in a buffer containing 15 mM MgCl 2 , 50 mM NH 4 Cl, and 10 MM Tris-HCl, pH 7.5. Analysis showed that the preparation if homogeneous. The same preparation was investigated for intactness of ribosomal RNA by the method of gel electrophoresis in 2.75% acrylamide 0.5% agarose gel in a buffer containing 30 mM Tris, 30 mM NaH 2 PO 4 , 10 mM EDTA, 1-2% SDS, and 6 M urea. Analysis showed that the preparation possesses intact 16S and 23S RNA. The latter did not degrade, at least in a week of exposure of the ribosomes in buffer solution at 5 0 C. The ribosome preparation had no appreciable RNase activity, which was verified by incubating 4.5 micrograms of ribosomes with 3 micrograms of 14 C-labeled 16S rRna (50 0 C, 90 min) in a buffer containing 10 mM MgCl 2 , 100 mM NH 4 Cl, and 10 mM Tris-HCl, pH/sub 20 0 / 7.5. The incubated nonhydrolyzed RNA was precipitated with 5% trichloroacetic acid and applied on a GF/C filter. The radioactivity was determined in a toluene scintillator on an LS-100C counter

  15. Haloperidol Regulates the State of Phosphorylation of Ribosomal Protein S6 via Activation of PKA and Phosphorylation of DARPP-32

    Science.gov (United States)

    Valjent, Emmanuel; Bertran-Gonzalez, Jesus; Bowling, Heather; Lopez, Sébastien; Santini, Emanuela; Matamales, Miriam; Bonito-Oliva, Alessandra; Hervé, Denis; Hoeffer, Charles; Klann, Eric; Girault, Jean-Antoine; Fisone, Gilberto

    2011-01-01

    Administration of typical antipsychotic drugs, such as haloperidol, promotes cAMP-dependent signaling in the medium spiny neurons (MSNs) of the striatum. In this study, we have examined the effect of haloperidol on the state of phosphorylation of the ribosomal protein S6 (rpS6), a component of the small 40S ribosomal subunit. We found that haloperidol increases the phosphorylation of rpS6 at the dual site Ser235/236, which is involved in the regulation of mRNA translation. This effect was exerted in the MSNs of the indirect pathway, which express specifically dopamine D2 receptors (D2Rs) and adenosine A2 receptors (A2ARs). The effect of haloperidol was decreased by blockade of A2ARs or by genetic attenuation of the Gαolf protein, which couples A2ARs to activation of adenylyl cyclase. Moreover, stimulation of cAMP-dependent protein kinase A (PKA) increased Ser235/236 phosphorylation in cultured striatal neurons. The ability of haloperidol to promote rpS6 phosphorylation was abolished in knock-in mice deficient for PKA activation of the protein phosphatase-1 inhibitor, dopamine- and cAMP-regulated phosphoprotein of 32 kDa. In contrast, pharmacological or genetic inactivation of p70 rpS6 kinase 1, or extracellular signal-regulated kinases did not affect haloperidol-induced rpS6 phosphorylation. These results identify PKA as a major rpS6 kinase in neuronal cells and suggest that regulation of protein synthesis through rpS6 may be a potential target of antipsychotic drugs. PMID:21814187

  16. Depletion of ribosomal protein L37 occurs in response to DNA damage and activates p53 through the L11/MDM2 pathway.

    Science.gov (United States)

    Llanos, Susana; Serrano, Manuel

    2010-10-01

    Perturbation of ribosomal biogenesis has recently emerged as a relevant p53-activating pathway. This pathway can be initiated by depletion of certain ribosomal proteins, which is followed by the binding and inhibition of MDM2 by a different subset of ribosomal proteins that includes L11. Here, we report that depletion of L37 leads to cell cycle arrest in a L11- and p53-dependent manner. DNA damage can initiate ribosomal stress, although little is known about the mechanisms involved. We have found that some genotoxic insults, namely, UV light and cisplatin, lead to proteasomal degradation of L37 in the nucleoplasm and to the ensuing L11-dependent stabilization of p53. Moreover, ectopic L37 overexpression can attenuate the DNA damage response mediated by p53. These results support the concept that DNA damage-induced proteasomal degradation of L37 constitutes a mechanistic link between DNA damage and the ribosomal stress pathway, and is a relevant contributing signaling pathway for the activation of p53 in response to DNA damage.

  17. Structure and functional analysis of the RNA- and viral phosphoprotein-binding domain of respiratory syncytial virus M2-1 protein.

    Directory of Open Access Journals (Sweden)

    Marie-Lise Blondot

    Full Text Available Respiratory syncytial virus (RSV protein M2-1 functions as an essential transcriptional cofactor of the viral RNA-dependent RNA polymerase (RdRp complex by increasing polymerase processivity. M2-1 is a modular RNA binding protein that also interacts with the viral phosphoprotein P, another component of the RdRp complex. These binding properties are related to the core region of M2-1 encompassing residues S58 to K177. Here we report the NMR structure of the RSV M2-1(58-177 core domain, which is structurally homologous to the C-terminal domain of Ebola virus VP30, a transcription co-factor sharing functional similarity with M2-1. The partial overlap of RNA and P interaction surfaces on M2-1(58-177, as determined by NMR, rationalizes the previously observed competitive behavior of RNA versus P. Using site-directed mutagenesis, we identified eight residues located on these surfaces that are critical for an efficient transcription activity of the RdRp complex. Single mutations of these residues disrupted specifically either P or RNA binding to M2-1 in vitro. M2-1 recruitment to cytoplasmic inclusion bodies, which are regarded as sites of viral RNA synthesis, was impaired by mutations affecting only binding to P, but not to RNA, suggesting that M2-1 is associated to the holonucleocapsid by interacting with P. These results reveal that RNA and P binding to M2-1 can be uncoupled and that both are critical for the transcriptional antitermination function of M2-1.

  18. Phosphorylation of acidic ribosomal proteins from rabbit reticulocytes by a ribosome-associated casein kinase

    DEFF Research Database (Denmark)

    Issinger, O G

    1977-01-01

    Two acidic proteins from 80-S ribosomes were isolated and purified to homogeneity. The purified acidic proteins could be phosphorylated by casein kinase using [gamma-32P]ATP and [gamma-32P]GTP as a phosphoryl donor. The proteins became phosphorylated in situ, too. Sodium dodecyl sulfate polyacryl......Two acidic proteins from 80-S ribosomes were isolated and purified to homogeneity. The purified acidic proteins could be phosphorylated by casein kinase using [gamma-32P]ATP and [gamma-32P]GTP as a phosphoryl donor. The proteins became phosphorylated in situ, too. Sodium dodecyl sulfate...

  19. The pre-existing population of 5S rRNA effects p53 stabilization during ribosome biogenesis inhibition.

    Science.gov (United States)

    Onofrillo, Carmine; Galbiati, Alice; Montanaro, Lorenzo; Derenzini, Massimo

    2017-01-17

    Pre-ribosomal complex RPL5/RPL11/5S rRNA (5S RNP) is considered the central MDM2 inhibitory complex that control p53 stabilization during ribosome biogenesis inhibition. Despite its role is well defined, the dynamic of 5S RNP assembly still requires further characterization. In the present work, we report that MDM2 inhibition is dependent by a pre-existing population of 5S rRNA.

  20. Evidence for phosphoprotein phosphatase in Streptomyces granaticolor

    Czech Academy of Sciences Publication Activity Database

    Bobek, J.; Hercík, K.; Dobrová, Zuzana; Branny, Pavel; Nádvorník, Richard; Janeček, Jiří

    2000-01-01

    Roč. 45, č. 4 (2000), s. 310-312 ISSN 0015-5632 R&D Projects: GA ČR GA204/99/1534 Institutional research plan: CEZ:AV0Z5020903 Keywords : streptomycetes * phosphoprotein phosphatase Subject RIV: EE - Microbiology, Virology Impact factor: 0.752, year: 2000

  1. Identification of nuclear phosphoproteins as novel tobacco markers in mouse lung tissue following short-term exposure to tobacco smoke

    Directory of Open Access Journals (Sweden)

    Kanako Niimori-Kita

    2014-01-01

    Full Text Available Smoking is a risk factor for lung diseases, including chronic obstructive pulmonary disease and lung cancer. However, the molecular mechanisms mediating the progression of these diseases remain unclear. Therefore, we sought to identify signaling pathways activated by tobacco-smoke exposure, by analyzing nuclear phosphoprotein expression using phosphoproteomic analysis of lung tissue from mice exposed to tobacco smoke. Sixteen mice were exposed to tobacco smoke for 1 or 7 days, and the expression of phosphorylated peptides was analyzed by mass spectrometry. A total of 253 phosphoproteins were identified, including FACT complex subunit SPT16 in the 1-day exposure group, keratin type 1 cytoskeletal 18 (K18, and adipocyte fatty acid-binding protein, in the 7-day exposure group, and peroxiredoxin-1 (OSF3 and spectrin β chain brain 1 (SPTBN1, in both groups. Semi-quantitative analysis of the identified phosphoproteins revealed that 33 proteins were significantly differentially expressed between the control and exposed groups. The identified phosphoproteins were classified according to their biological functions. We found that the identified proteins were related to inflammation, regeneration, repair, proliferation, differentiation, morphogenesis, and response to stress and nicotine. In conclusion, we identified proteins, including OSF3 and SPTBN1, as candidate tobacco smoke-exposure markers; our results provide insights into the mechanisms of tobacco smoke-induced diseases.

  2. One-Step Preservation of Phosphoproteins and Tissue Morphology at Room Temperature for Diagnostic and Research Specimens

    Science.gov (United States)

    Mueller, Claudius; Edmiston, Kirsten H.; Carpenter, Calvin; Gaffney, Eoin; Ryan, Ciara; Ward, Ronan; White, Susan; Memeo, Lorenzo; Colarossi, Cristina; Petricoin, Emanuel F.; Liotta, Lance A.; Espina, Virginia

    2011-01-01

    Background There is an urgent need to measure phosphorylated cell signaling proteins in cancer tissue for the individualization of molecular targeted kinase inhibitor therapy. However, phosphoproteins fluctuate rapidly following tissue procurement. Snap-freezing preserves phosphoproteins, but is unavailable in most clinics and compromises diagnostic morphology. Formalin fixation preserves tissue histomorphology, but penetrates tissue slowly, and is unsuitable for stabilizing phosphoproteins. We originated and evaluated a novel one-step biomarker and histology preservative (BHP) chemistry that stabilizes signaling protein phosphorylation and retains formalin-like tissue histomorphology with equivalent immunohistochemistry in a single paraffin block. Results Total protein yield extracted from BHP-fixed, routine paraffin-embedded mouse liver was 100% compared to snap-frozen tissue. The abundance of 14 phosphorylated proteins was found to be stable over extended fixation times in BHP fixed paraffin embedded human colon mucosa. Compared to matched snap-frozen tissue, 8 phosphoproteins were equally preserved in mouse liver, while AMPKβ1 Ser108 was slightly elevated after BHP fixation. More than 25 tissues from mouse, cat and human specimens were evaluated for preservation of histomorphology. Selected tissues were evaluated in a multi-site, independent pathology review. Tissue fixed with BHP showed equivalent preservation of cytoplasmic and membrane cytomorphology, with significantly better nuclear chromatin preservation by BHP compared to formalin. Immunohistochemical staining of 13 non-phosphorylated proteins, including estrogen receptor alpha, progesterone receptor, Ki-67 and Her2, was equal to or stronger in BHP compared to formalin. BHP demonstrated significantly improved immunohistochemical detection of phosphorylated proteins ERK Thr202/Tyr204, GSK3-α/β Ser21/Ser9, p38-MAPK Thr180/Tyr182, eIF4G Ser1108 and Acetyl-CoA Carboxylase Ser79. Conclusion In a single

  3. One-step preservation of phosphoproteins and tissue morphology at room temperature for diagnostic and research specimens.

    Directory of Open Access Journals (Sweden)

    Claudius Mueller

    Full Text Available BACKGROUND: There is an urgent need to measure phosphorylated cell signaling proteins in cancer tissue for the individualization of molecular targeted kinase inhibitor therapy. However, phosphoproteins fluctuate rapidly following tissue procurement. Snap-freezing preserves phosphoproteins, but is unavailable in most clinics and compromises diagnostic morphology. Formalin fixation preserves tissue histomorphology, but penetrates tissue slowly, and is unsuitable for stabilizing phosphoproteins. We originated and evaluated a novel one-step biomarker and histology preservative (BHP chemistry that stabilizes signaling protein phosphorylation and retains formalin-like tissue histomorphology with equivalent immunohistochemistry in a single paraffin block. RESULTS: Total protein yield extracted from BHP-fixed, routine paraffin-embedded mouse liver was 100% compared to snap-frozen tissue. The abundance of 14 phosphorylated proteins was found to be stable over extended fixation times in BHP fixed paraffin embedded human colon mucosa. Compared to matched snap-frozen tissue, 8 phosphoproteins were equally preserved in mouse liver, while AMPKβ1 Ser108 was slightly elevated after BHP fixation. More than 25 tissues from mouse, cat and human specimens were evaluated for preservation of histomorphology. Selected tissues were evaluated in a multi-site, independent pathology review. Tissue fixed with BHP showed equivalent preservation of cytoplasmic and membrane cytomorphology, with significantly better nuclear chromatin preservation by BHP compared to formalin. Immunohistochemical staining of 13 non-phosphorylated proteins, including estrogen receptor alpha, progesterone receptor, Ki-67 and Her2, was equal to or stronger in BHP compared to formalin. BHP demonstrated significantly improved immunohistochemical detection of phosphorylated proteins ERK Thr202/Tyr204, GSK3-α/β Ser21/Ser9, p38-MAPK Thr180/Tyr182, eIF4G Ser1108 and Acetyl-CoA Carboxylase Ser79

  4. Induction of the 5S RNP-Mdm2-p53 ribosomal stress pathway delays the initiation but fails to eradicate established murine acute myeloid leukemia.

    Science.gov (United States)

    Jaako, P; Ugale, A; Wahlestedt, M; Velasco-Hernandez, T; Cammenga, J; Lindström, M S; Bryder, D

    2017-01-01

    Mutations resulting in constitutive activation of signaling pathways that regulate ribosome biogenesis are among the most common genetic events in acute myeloid leukemia (AML). However, whether ribosome biogenesis presents as a therapeutic target to treat AML remains unexplored. Perturbations in ribosome biogenesis trigger the 5S ribonucleoprotein particle (RNP)-Mdm2-p53 ribosomal stress pathway, and induction of this pathway has been shown to have therapeutic efficacy in Myc-driven lymphoma. In the current study we address the physiological and therapeutic role of the 5S RNP-Mdm2-p53 pathway in AML. By utilizing mice that have defective ribosome biogenesis due to downregulation of ribosomal protein S19 (Rps19), we demonstrate that induction of the 5S RNP-Mdm2-p53 pathway significantly delays the initiation of AML. However, even a severe Rps19 deficiency that normally results in acute bone marrow failure has no consistent efficacy on already established disease. Finally, by using mice that harbor a mutation in the Mdm2 gene disrupting its binding to 5S RNP, we show that loss of the 5S RNP-Mdm2-p53 pathway is dispensable for development of AML. Our study suggests that induction of the 5S RNP-Mdm2-p53 ribosomal stress pathway holds limited potential as a single-agent therapy in the treatment of AML.

  5. The complete structure of the chloroplast 70S ribosome in complex with translation factor pY.

    Science.gov (United States)

    Bieri, Philipp; Leibundgut, Marc; Saurer, Martin; Boehringer, Daniel; Ban, Nenad

    2017-02-15

    Chloroplasts are cellular organelles of plants and algae that are responsible for energy conversion and carbon fixation by the photosynthetic reaction. As a consequence of their endosymbiotic origin, they still contain their own genome and the machinery for protein biosynthesis. Here, we present the atomic structure of the chloroplast 70S ribosome prepared from spinach leaves and resolved by cryo-EM at 3.4 Å resolution. The complete structure reveals the features of the 4.5S rRNA, which probably evolved by the fragmentation of the 23S rRNA, and all five plastid-specific ribosomal proteins. These proteins, required for proper assembly and function of the chloroplast translation machinery, bind and stabilize rRNA including regions that only exist in the chloroplast ribosome. Furthermore, the structure reveals plastid-specific extensions of ribosomal proteins that extensively remodel the mRNA entry and exit site on the small subunit as well as the polypeptide tunnel exit and the putative binding site of the signal recognition particle on the large subunit. The translation factor pY, involved in light- and temperature-dependent control of protein synthesis, is bound to the mRNA channel of the small subunit and interacts with 16S rRNA nucleotides at the A-site and P-site, where it protects the decoding centre and inhibits translation by preventing tRNA binding. The small subunit is locked by pY in a non-rotated state, in which the intersubunit bridges to the large subunit are stabilized. © 2016 The Authors. Published under the terms of the CC BY NC ND 4.0 license.

  6. The Unexplored Mechanisms and Regulatory Functions of Ribosomal Translocation

    Science.gov (United States)

    Alejo, Jose Luis

    In every cell, protein synthesis is carried out by the ribosome, a complex macromolecular RNA-protein assembly. Decades of structural and kinetic studies have increased our understanding of ribosome initiation, decoding, translocation and termination. Yet, the underlying mechanism of these fundamental processes has yet to be fully delineated. Hence, the molecular basis of regulation remains obscure. Here, single-molecule fluorescence methods are applied to decipher the mechanism and regulatory roles of the multi-step process of directional substrate translocation on the ribosome that accompanies every round of protein synthesis. In Chapter 1, single-molecule fluorescence resonance energy transfer (smFRET) is introduced as a tool for studying bacterial ribosome translocation. Chapter 2 details the experimental methods. In Chapter 3, the elongation factor G(EF-G)-catalyzed movement of substrates through the ribosome is examined from several perspectives or signals reporting on various degrees of freedom of ribosome dynamics. Two ribosomal states interconvert in the presence of EF-G(GDP), displaying novel head domain motions, until relocking takes place. In Chapter 4, in order to test if the mentioned fluctuations leading to relocking are correlated to the engagement of the P-site by the peptidyl-tRNA, the translocation of miscoded tRNAs is studied. Severe defects in the relocking stages of translocation reveal the correlation between this new stage of translocation and P-site tRNA engagement.

  7. Acrolein preferentially damages nucleolus eliciting ribosomal stress and apoptosis in human cancer cells.

    Science.gov (United States)

    Wang, Hsiang-Tsui; Chen, Tzu-Ying; Weng, Ching-Wen; Yang, Chun-Hsiang; Tang, Moon-Shong

    2016-12-06

    Acrolein (Acr) is a potent cytotoxic and DNA damaging agent which is ubiquitous in the environment and abundant in tobacco smoke. Acr is also an active cytotoxic metabolite of the anti-cancer drugs cyclophosphamide and ifosfamide. The mechanisms via which Acr exerts its anti-cancer activity and cytotoxicity are not clear. In this study, we found that Acr induces cytotoxicity and cell death in human cancer cells with different activities of p53. Acr preferentially binds nucleolar ribosomal DNA (rDNA) to form Acr-deoxyguanosine adducts, and induces oxidative damage to both rDNA and ribosomal RNA (rRNA). Acr triggers ribosomal stress responses, inhibits rRNA synthesis, reduces RNA polymerase I binding to the promoter of rRNA gene, disrupts nucleolar integrity, and impairs ribosome biogenesis and polysome formation. Acr causes an increase in MDM2 levels and phosphorylation of MDM2 in A549 and HeLa cells which are p53 active and p53 inactive, respectively. It enhances the binding of ribosomal protein RPL11 to MDM2 and reduces the binding of p53 and E2F-1 to MDM2 resulting in stabilization/activation of p53 in A549 cells and degradation of E2F-1 in A549 and HeLa cells. We propose that Acr induces ribosomal stress which leads to activation of MDM2 and RPL11-MDM2 binding, consequently, activates p53 and enhances E2F-1 degradation, and that taken together these two processes induce apoptosis and cell death.

  8. Characterization of anti-P monoclonal antibodies directed against the ribosomal protein-RNA complex antigen and produced using Murphy Roths large autoimmune-prone mice.

    Science.gov (United States)

    Sato, H; Onozuka, M; Hagiya, A; Hoshino, S; Narita, I; Uchiumi, T

    2015-02-01

    Autoantibodies, including anti-ribosomal P proteins (anti-P), are thought to be produced by an antigen-driven immune response in systemic lupus erythematosus (SLE). To test this hypothesis, we reconstituted the ribosomal antigenic complex in vitro using human P0, phosphorylated P1 and P2 and a 28S rRNA fragment covering the P0 binding site, and immunized Murphy Roths large (MRL)/lrp lupus mice with this complex without any added adjuvant to generate anti-P antibodies. Using hybridoma technology, we subsequently obtained 34 clones, each producing an anti-P monoclonal antibody (mAb) that recognized the conserved C-terminal tail sequence common to all three P proteins. We also obtained two P0-specific monoclonal antibodies, but no antibody specific to P1, P2 or rRNA fragment. Two types of mAbs were found among these anti-P antibodies: one type (e.g. 9D5) reacted more strongly with the phosphorylated P1 and P2 than that with their non-phosphorylated forms, whereas the other type (e.g. 4H11) reacted equally with both phosphorylated and non-phosphorylated forms of P1/P2. Both 9D5 and 4H11 inhibited the ribosome/eukaryotic elongation factor-2 (eEF-2)-coupled guanosine triphosphate (GTP)ase activity. However, preincubation with a synthetic peptide corresponding to the C-terminal sequence common to all three P proteins, but not the peptide that lacked the last three C-terminal amino acids, mostly prevented the mAb-induced inhibition of GTPase activity. Thus, at least two types of anti-P were produced preferentially following the immunization of MRL mice with the reconstituted antigenic complex. Presence of multiple copies of the C-termini, particularly that of the last three C-terminal amino acid residues, in the antigenic complex appears to contribute to the immunogenic stimulus. © 2014 British Society for Immunology.

  9. Characterization of anti-P monoclonal antibodies directed against the ribosomal protein–RNA complex antigen and produced using Murphy Roths large autoimmune-prone mice

    Science.gov (United States)

    Sato, H; Onozuka, M; Hagiya, A; Hoshino, S; Narita, I; Uchiumi, T

    2015-01-01

    Autoantibodies, including anti-ribosomal P proteins (anti-P), are thought to be produced by an antigen-driven immune response in systemic lupus erythematosus (SLE). To test this hypothesis, we reconstituted the ribosomal antigenic complex in vitro using human P0, phosphorylated P1 and P2 and a 28S rRNA fragment covering the P0 binding site, and immunized Murphy Roths large (MRL)/lrp lupus mice with this complex without any added adjuvant to generate anti-P antibodies. Using hybridoma technology, we subsequently obtained 34 clones, each producing an anti-P monoclonal antibody (mAb) that recognized the conserved C-terminal tail sequence common to all three P proteins. We also obtained two P0-specific monoclonal antibodies, but no antibody specific to P1, P2 or rRNA fragment. Two types of mAbs were found among these anti-P antibodies: one type (e.g. 9D5) reacted more strongly with the phosphorylated P1 and P2 than that with their non-phosphorylated forms, whereas the other type (e.g. 4H11) reacted equally with both phosphorylated and non-phosphorylated forms of P1/P2. Both 9D5 and 4H11 inhibited the ribosome/eukaryotic elongation factor-2 (eEF-2)-coupled guanosine triphosphate (GTP)ase activity. However, preincubation with a synthetic peptide corresponding to the C-terminal sequence common to all three P proteins, but not the peptide that lacked the last three C-terminal amino acids, mostly prevented the mAb-induced inhibition of GTPase activity. Thus, at least two types of anti-P were produced preferentially following the immunization of MRL mice with the reconstituted antigenic complex. Presence of multiple copies of the C-termini, particularly that of the last three C-terminal amino acid residues, in the antigenic complex appears to contribute to the immunogenic stimulus. PMID:25255895

  10. Clinical application for the preservation of phospho-proteins through in-situ tissue stabilization

    Directory of Open Access Journals (Sweden)

    Ding Wei

    2010-11-01

    Full Text Available Abstract Background Protein biomarkers will play a pivotal role in the future of personalized medicine for both diagnosis and treatment decision-making. While the results of several pre-clinical and small-scale clinical studies have demonstrated the value of protein biomarkers, there have been significant challenges to translating these findings into routine clinical care. Challenges to the use of protein biomarkers include inter-sample variability introduced by differences in post-collection handling and ex vivo degradation of proteins and protein modifications. Results In this report, we re-create laboratory and clinical scenarios for sample collection and test the utility of a new tissue stabilization technique in preserving proteins and protein modifications. In the laboratory setting, tissue stabilization with the Denator Stabilizor T1 resulted in a significantly higher yield of phospho-protein when compared to standard snap freeze preservation. Furthermore, in a clinical scenario, tissue stabilization at collection resulted in a higher yield of total phospho-protein, total phospho-tyrosine, pErkT202/Y204 and pAktS473 when compared to standard methods. Tissue stabilization did not have a significant effect on other post-translational modifications such as acetylation and glycosylation, which are more stable ex-vivo. Tissue stabilization did decrease total RNA quantity and quality. Conclusion Stabilization at the time of collection offers the potential to better preserve tissue protein and protein modification levels, as well as reduce the variability related to tissue processing delays that are often associated with clinical samples.

  11. Insertion of the Biogenesis Factor Rei1 Probes the Ribosomal Tunnel during 60S Maturation.

    Science.gov (United States)

    Greber, Basil Johannes; Gerhardy, Stefan; Leitner, Alexander; Leibundgut, Marc; Salem, Michèle; Boehringer, Daniel; Leulliot, Nicolas; Aebersold, Ruedi; Panse, Vikram Govind; Ban, Nenad

    2016-01-14

    Eukaryotic ribosome biogenesis depends on several hundred assembly factors to produce functional 40S and 60S ribosomal subunits. The final phase of 60S subunit biogenesis is cytoplasmic maturation, which includes the proofreading of functional centers of the 60S subunit and the release of several ribosome biogenesis factors. We report the cryo-electron microscopy (cryo-EM) structure of the yeast 60S subunit in complex with the biogenesis factors Rei1, Arx1, and Alb1 at 3.4 Å resolution. In addition to the network of interactions formed by Alb1, the structure reveals a mechanism for ensuring the integrity of the ribosomal polypeptide exit tunnel. Arx1 probes the entire set of inner-ring proteins surrounding the tunnel exit, and the C terminus of Rei1 is deeply inserted into the ribosomal tunnel, where it forms specific contacts along almost its entire length. We provide genetic and biochemical evidence that failure to insert the C terminus of Rei1 precludes subsequent steps of 60S maturation. Copyright © 2016 Elsevier Inc. All rights reserved.

  12. The Ulip family phosphoproteins--common and specific properties.

    Science.gov (United States)

    Byk, T; Ozon, S; Sobel, A

    1998-05-15

    The search for intracellular phosphoproteins implicated in the regulation of neuronal differentiation led to the identification of Ulip1, a mammalian protein related to the Caenorhabditis elegans unc-33 gene product [Byk, T., Dobransky, T., Cifuentes-Diaz, C. & Sobel, A. (1996) J. Neurosc. 16, 688-701]. The expression level and phosphorylation pattern of Ulip1 were shown to be strongly regulated during development and neuronal differentiation. We have isolated three additional complete coding sequences for members of the Ulip family in the mouse, Ulips 2-4, all preferentially expressed in the nervous system. Furthermore, two Ulip sequences, Ulips A and Ulips B, could be identified in C. elegans. The Ulip family is highly conserved throughout evolution (more than 96 % for Ulips 1-3 and 92.5 % for Ulip4 between mouse and human) and the various members of the family within a single species display about 75% similarity. Sequence comparisons further reveal several highly similar domains and subdomains, including a 32-amino-acid region highly conserved from a bacterial hydantoinase to human Ulips. Two-dimensional immunoblot analysis of in vitro translated Ulips 1-4 demonstrates the existence, for each Ulip protein, of several, most probably differentially phosphorylated forms, in agreement with the presence of conserved phosphorylation consensus sites within their sequences. The expression of Ulips 1-4 mRNAs is differentially regulated during development and nerve-growth-factor-induced neuronal differentiation of PC12 cells. Our results indicate a differential, possibly complementary role of phosphoproteins of the highly conserved Ulip family in the control of neuronal differentiation, in relation with the development and plasticity of the nervous system.

  13. Electrophoretic demonstration of glycoproteins, lipoproteins, and phosphoproteins in human and bovine enamel

    DEFF Research Database (Denmark)

    Kirkeby, S; Moe, D; Bøg-Hansen, T C

    1990-01-01

    Enamel proteins from fully mineralized human molars and from bovine tooth germs were separated by electrophoresis. The gels were stained for detection of glycoproteins, lipoproteins, and phosphoproteins. Glycoproteins were shown by periodic acid-Schiff staining and lectin blotting. In mature human...... enamel a number of high molecular weight proteins could be demonstrated after ethylenediaminetetra-acetic acid demineralization and subsequent Triton X-100 extraction. These proteins are suggested to be lipoproteins. Phosphoproteins could only be visualized in enamel matrix from the tooth germs....

  14. The AAA-ATPase NVL2 is a component of pre-ribosomal particles that interacts with the DExD/H-box RNA helicase DOB1

    International Nuclear Information System (INIS)

    Nagahama, Masami; Yamazoe, Takeshi; Hara, Yoshimitsu; Tani, Katsuko; Tsuji, Akihiko; Tagaya, Mitsuo

    2006-01-01

    Nuclear VCP/p97-like protein 2 (NVL2) is a member of the chaperone-like AAA-ATPase family with two conserved ATP-binding modules. Our previous studies have shown that NVL2 is localized to the nucleolus by interacting with ribosomal protein L5 and may participate in ribosome synthesis, a process involving various non-ribosomal factors including chaperones and RNA helicases. Here, we show that NVL2 is associated with pre-ribosomal particles in the nucleus. Moreover, we used yeast two-hybrid and co-immunoprecipitation assays to identify an NVL2-interacting protein that could yield insights into NVL2 function in ribosome biogenesis. We found that NVL2 interacts with DOB1, a DExD/H-box RNA helicase, whose yeast homologue functions in a late stage of the 60S subunit synthesis. DOB1 can interact with a second ATP-binding module mutant of NVL2, which shows a dominant negative effect on ribosome synthesis. In contrast, it cannot interact with a first ATP-binding module mutant, which does not show the dominant negative effect. When the dominant negative mutant of NVL2 was overexpressed in cells, DOB1 appeared to remain associated with nuclear pre-ribosomal particles. Such accumulation was not observed upon overexpression of wild-type NVL2 or a nondominant-negative mutant. Taken together, our results suggest that NVL2 might regulate the association/dissociation reaction of DOB1 with pre-ribosomal particles by acting as a molecular chaperone

  15. GTPases and the origin of the ribosome

    Directory of Open Access Journals (Sweden)

    Smith Temple F

    2010-05-01

    Full Text Available Abstract Background This paper is an attempt to trace the evolution of the ribosome through the evolution of the universal P-loop GTPases that are involved with the ribosome in translation and with the attachment of the ribosome to the membrane. The GTPases involved in translation in Bacteria/Archaea are the elongation factors EFTu/EF1, the initiation factors IF2/aeIF5b + aeIF2, and the elongation factors EFG/EF2. All of these GTPases also contain the OB fold also found in the non GTPase IF1 involved in initiation. The GTPase involved in the signal recognition particle in most Bacteria and Archaea is SRP54. Results 1 The Elongation Factors of the Archaea based on structural considerations of the domains have the following evolutionary path: EF1→ aeIF2 → EF2. The evolution of the aeIF5b was a later event; 2 the Elongation Factors of the Bacteria based on the topological considerations of the GTPase domain have a similar evolutionary path: EFTu→ IF→2→EFG. These evolutionary sequences reflect the evolution of the LSU followed by the SSU to form the ribosome; 3 the OB-fold IF1 is a mimic of an ancient tRNA minihelix. Conclusion The evolution of translational GTPases of both the Archaea and Bacteria point to the evolution of the ribosome. The elongation factors, EFTu/EF1, began as a Ras-like GTPase bringing the activated minihelix tRNA to the Large Subunit Unit. The initiation factors and elongation factor would then have evolved from the EFTu/EF1 as the small subunit was added to the evolving ribosome. The SRP has an SRP54 GTPase and a specific RNA fold in its RNA component similar to the PTC. We consider the SRP to be a remnant of an ancient form of an LSU bound to a membrane. Reviewers This article was reviewed by George Fox, Leonid Mirny and Chris Sander.

  16. Yeast ribosomal proteins

    International Nuclear Information System (INIS)

    Otaka, E.; Kobata, K.

    1978-01-01

    The cytoplasmic 80s ribosomal proteins from the cells of yeast Saccharomyces cerevisiae were analyzed by SDS two-dimensional polyacrylamide gel electrophoresis. Seventyfour proteins were identified and consecutively numbered from 1 to 74. Upon oxidation of the 80s proteins with performic acid, ten proteins (no. 15, 20, 35, 40, 44, 46, 49, 51, 54 and 55) were dislocated on the gel without change of the total number of protein spots. Five proteins (no. 8, 14, 16, 36 and 74) were phosphorylated in vivo as seen in 32 P-labelling experiments. The large and small subunits separated in low magnesium medium were analyzed by the above gel electrophoresis. At least forty-five and twenty-eight proteins were assumed to be in the large and small subunits, respectively. All proteins found in the 80s ribosomes, except for no. 3, were detected in either subunit without appearance of new spots. The acidic protein no. 3 seems to be lost during subunit dissociation. (orig.) [de

  17. Silencing of ribosomal protein S9 elicits a multitude of cellular responses inhibiting the growth of cancer cells subsequent to p53 activation.

    Directory of Open Access Journals (Sweden)

    Mikael S Lindström

    Full Text Available BACKGROUND: Disruption of the nucleolus often leads to activation of the p53 tumor suppressor pathway through inhibition of MDM2 that is mediated by a limited set of ribosomal proteins including RPL11 and RPL5. The effects of ribosomal protein loss in cultured mammalian cells have not been thoroughly investigated. Here we characterize the cellular stress response caused by depletion of ribosomal protein S9 (RPS9. METHODOLOGY/PRINCIPAL FINDINGS: Depletion of RPS9 impaired production of 18S ribosomal RNA and induced p53 activity. It promoted p53-dependent morphological differentiation of U343MGa Cl2:6 glioma cells as evidenced by intensified expression of glial fibrillary acidic protein and profound changes in cell shape. U2OS osteosarcoma cells displayed a limited senescence response with increased expression of DNA damage response markers, whereas HeLa cervical carcinoma cells underwent cell death by apoptosis. Knockdown of RPL11 impaired p53-dependent phenotypes in the different RPS9 depleted cell cultures. Importantly, knockdown of RPS9 or RPL11 also markedly inhibited cell proliferation through p53-independent mechanisms. RPL11 binding to MDM2 was retained despite decreased levels of RPL11 protein following nucleolar stress. In these settings, RPL11 was critical for maintaining p53 protein stability but was not strictly required for p53 protein synthesis. CONCLUSIONS: p53 plays an important role in the initial restriction of cell proliferation that occurs in response to decreased level of RPS9. Our results do not exclude the possibility that other nucleolar stress sensing molecules act upstream or in parallel to RPL11 to activate p53. Inhibiting the expression of certain ribosomal proteins, such as RPS9, could be one efficient way to reinitiate differentiation processes or to induce senescence or apoptosis in rapidly proliferating tumor cells.

  18. Cloning of a cDNA encoding a novel human nuclear phosphoprotein belonging to the WD-40 family

    DEFF Research Database (Denmark)

    Honoré, B; Leffers, H; Madsen, Peder

    1994-01-01

    We have cloned and expressed in vaccinia virus a cDNA encoding an ubiquitous 501-amino-acid (aa) phosphoprotein that corresponds to protein IEF SSP 9502 (79,400 Da, pI 4.5) in the master 2-D-gel keratinocyte protein database [Celis et al., Electrophoresis 14 (1993) 1091-1198]. The deduced aa...

  19. Miscoding-induced stalling of substrate translocation on the bacterial ribosome.

    Science.gov (United States)

    Alejo, Jose L; Blanchard, Scott C

    2017-10-10

    Directional transit of the ribosome along the messenger RNA (mRNA) template is a key determinant of the rate and processivity of protein synthesis. Imaging of the multistep translocation mechanism using single-molecule FRET has led to the hypothesis that substrate movements relative to the ribosome resolve through relatively long-lived late intermediates wherein peptidyl-tRNA enters the P site of the small ribosomal subunit via reversible, swivel-like motions of the small subunit head domain within the elongation factor G (GDP)-bound ribosome complex. Consistent with translocation being rate-limited by recognition and productive engagement of peptidyl-tRNA within the P site, we now show that base-pairing mismatches between the peptidyl-tRNA anticodon and the mRNA codon dramatically delay this rate-limiting, intramolecular process. This unexpected relationship between aminoacyl-tRNA decoding and translocation suggests that miscoding antibiotics may impact protein synthesis by impairing the recognition of peptidyl-tRNA in the small subunit P site during EF-G-catalyzed translocation. Strikingly, we show that elongation factor P (EF-P), traditionally known to alleviate ribosome stalling at polyproline motifs, can efficiently rescue translocation defects arising from miscoding. These findings help reveal the nature and origin of the rate-limiting steps in substrate translocation on the bacterial ribosome and indicate that EF-P can aid in resuming translation elongation stalled by miscoding errors.

  20. Phosphorylation of ribosomal proteins induced by auxins in maize embryonic tissues

    International Nuclear Information System (INIS)

    Perez, L.; Aguilar, R.; Mendez, A.P.; de Jimenez, E.S.

    1990-01-01

    The effect of auxin on ribosomal protein phosphorylation of germinating maize (Zea mays) tissues was investigated. Two-dimensional gel electrophoresis and autoradiography of [ 32 P] ribosomal protein patterns for natural and synthetic auxin-treated tissues were performed. Both the rate of 32 P incorporation and the electrophoretic patterns were dependent on 32 P pulse length, suggesting that active protein phosphorylation-dephosphorylation occurred in small and large subunit proteins, in control as well as in auxin-treated tissues. The effect of ribosomal protein phosphorylation on in vitro translation was tested. Measurements of poly(U) translation rates as a function of ribosome concentration provided apparent K m values significantly different for auxin-treated and nontreated tissues. These findings suggest that auxin might exert some kind of translational control by regulating the phosphorylated status of ribosomal proteins

  1. Purification and partial characterization of analogous 26-kDa rat submandibular and parotid gland integral membrane phosphoproteins that may have a role in exocytosis.

    Science.gov (United States)

    Quissell, D O; Deisher, L M

    1992-04-01

    Rat submandibular and parotid gland exocytosis is primarily controlled by beta-adrenergic receptor stimulation. Although its precise role in the regulation of salivary gland exocytosis is not fully understood, protein phosphorylation, mediated by the activation of cAMP-dependent protein kinase, may be directly involved. Previous studies suggest that analogous 26-kDa integral membrane phosphoproteins may play a direct role in regulating exocytosis. Studies were here undertaken to purify and partially characterize both phosphoproteins. After endogenous phosphorylation with 32P, subcellular fraction and solubilization of the microsomal fraction in n-octyl beta-glucopyranoside, the 26-kDa integral membrane phosphoproteins were purified by high performance liquid chromatography (HPLC), followed by sodium dodecyl sulphate-polyacrylamide gel electrophoresis and electroelution of the proteins. Amino acid analysis indicated a significant number of serine amino acids: N-terminal sequence data demonstrated a high level of homology; and trypsin digestion followed by reversed-phase HPLC indicated the possibility of multiple phosphorylation sites.

  2. Deciphering the role of the Gag-Pol ribosomal frameshift signal in HIV-1 RNA genome packaging.

    Science.gov (United States)

    Nikolaitchik, Olga A; Hu, Wei-Shau

    2014-04-01

    A key step of retroviral replication is packaging of the viral RNA genome during virus assembly. Specific packaging is mediated by interactions between the viral protein Gag and elements in the viral RNA genome. In HIV-1, similar to most retroviruses, the packaging signal is located within the 5' untranslated region and extends into the gag-coding region. A recent study reported that a region including the Gag-Pol ribosomal frameshift signal plays an important role in HIV-1 RNA packaging; deletions or mutations that affect the RNA structure of this signal lead to drastic decreases (10- to 50-fold) in viral RNA packaging and virus titer. We examined here the role of the ribosomal frameshift signal in HIV-1 RNA packaging by studying the RNA packaging and virus titer in the context of proviruses. Three mutants with altered ribosomal frameshift signal, either through direct deletion of the signal, mutation of the 6U slippery sequence, or alterations of the secondary structure were examined. We found that RNAs from all three mutants were packaged efficiently, and they generate titers similar to that of a virus containing the wild-type ribosomal frameshift signal. We conclude that although the ribosomal frameshift signal plays an important role in regulating the replication cycle, this RNA element is not directly involved in regulating RNA encapsidation. To generate infectious viruses, HIV-1 must package viral RNA genome during virus assembly. The specific HIV-1 genome packaging is mediated by interactions between the structural protein Gag and elements near the 5' end of the viral RNA known as packaging signal. In this study, we examined whether the Gag-Pol ribosomal frameshift signal is important for HIV-1 RNA packaging as recently reported. Our results demonstrated that when Gag/Gag-Pol is supplied in trans, none of the tested ribosomal frameshift signal mutants has defects in RNA packaging or virus titer. These studies provide important information on how HIV-1

  3. Acidic ribosomal proteins and histone H3 from Leishmania present a high rate of divergence

    Directory of Open Access Journals (Sweden)

    Ysabel Montoya

    2000-08-01

    Full Text Available Another additional peculiarity in Leishmania will be discussed about of the amino acid divergence rate of three structural proteins: acidic ribosomal P1 and P2b proteins, and histone H3 by using multiple sequence alignment and dendrograms. These structural proteins present a high rate of divergence regarding to their homologous protein in Trypanosoma cruzi. At this regard, L. (V. peruviana P1 and T. cruzi P1 showed 57.4% of divergence rate. Likewise, L. (V. braziliensis histone H3 and acidic ribosomal P2 protein exhibited 31.8% and 41.7% respectively of rate of divergence in comparison with their homologous in T. cruzi.

  4. The NBS1-Treacle complex controls ribosomal RNA transcription in response to DNA damage

    DEFF Research Database (Denmark)

    Larsen, Dorthe H; Hari, Flurina; Clapperton, Julie A

    2014-01-01

    Chromosome breakage elicits transient silencing of ribosomal RNA synthesis, but the mechanisms involved remained elusive. Here we discover an in trans signalling mechanism that triggers pan-nuclear silencing of rRNA transcription in response to DNA damage. This is associated with transient...... recruitment of the Nijmegen breakage syndrome protein 1 (NBS1), a central regulator of DNA damage responses, into the nucleoli. We further identify TCOF1 (also known as Treacle), a nucleolar factor implicated in ribosome biogenesis and mutated in Treacher Collins syndrome, as an interaction partner of NBS1...

  5. The structure of the nucleoprotein binding domain of lyssavirus phosphoprotein reveals a structural relationship between the N-RNA binding domains of Rhabdoviridae and Paramyxoviridae.

    Science.gov (United States)

    Delmas, Olivier; Assenberg, Rene; Grimes, Jonathan M; Bourhy, Hervé

    2010-01-01

    The phosphoprotein P of non-segmented negative-sense RNA viruses is an essential component of the replication and transcription complex and acts as a co-factor for the viral RNA-dependent RNA polymerase. P recruits the viral polymerase to the nucleoprotein-bound viral RNA (N-RNA) via an interaction between its C-terminal domain and the N-RNA complex. We have obtained the structure of the C-terminal domain of P of Mokola virus (MOKV), a lyssavirus that belongs to the Rhabdoviridae family and mapped at the amino acid level the crucial positions involved in interaction with N and in the formation of the viral replication complex. Comparison of the N-RNA binding domains of P solved to date suggests that the N-RNA binding domains are structurally conserved among paramyxoviruses and rhabdoviruses in spite of low sequence conservation. We also review the numerous other functions of this domain and more generally of the phosphoprotein.

  6. Emerging functions of ribosomal proteins in gene-specific transcription and translation

    International Nuclear Information System (INIS)

    Lindstroem, Mikael S.

    2009-01-01

    Ribosomal proteins have remained highly conserved during evolution presumably reflecting often critical functions in ribosome biogenesis or mature ribosome function. In addition, several ribosomal proteins possess distinct extra-ribosomal functions in apoptosis, DNA repair and transcription. An increasing number of ribosomal proteins have been shown to modulate the trans-activation function of important regulatory proteins such as NF-κB, p53, c-Myc and nuclear receptors. Furthermore, a subset of ribosomal proteins can bind directly to untranslated regions of mRNA resulting in transcript-specific translational control outside of the ribosome itself. Collectively, these findings suggest that ribosomal proteins may have a wider functional repertoire within the cell than previously thought. The future challenge is to identify and validate these novel functions in the background of an often essential primary function in ribosome biogenesis and cell growth.

  7. An unusual internal ribosomal entry site of inverted symmetry directs expression of a potato leafroll polerovirus replication-associated protein

    Science.gov (United States)

    Jaag, Hannah Miriam; Kawchuk, Lawrence; Rohde, Wolfgang; Fischer, Rainer; Emans, Neil; Prüfer, Dirk

    2003-01-01

    Potato leafroll polerovirus (PLRV) genomic RNA acts as a polycistronic mRNA for the production of proteins P0, P1, and P2 translated from the 5′-proximal half of the genome. Within the P1 coding region we identified a 5-kDa replication-associated protein 1 (Rap1) essential for viral multiplication. An internal ribosome entry site (IRES) with unusual structure and location was identified that regulates Rap1 translation. Core structural elements for internal ribosome entry include a conserved AUG codon and a downstream GGAGAGAGAGG motif with inverted symmetry. Reporter gene expression in potato protoplasts confirmed the internal ribosome entry function. Unlike known IRES motifs, the PLRV IRES is located completely within the coding region of Rap1 at the center of the PLRV genome. PMID:12835413

  8. rRNA maturation in yeast cells depleted of large ribosomal subunit proteins.

    Directory of Open Access Journals (Sweden)

    Gisela Pöll

    Full Text Available The structural constituents of the large eukaryotic ribosomal subunit are 3 ribosomal RNAs, namely the 25S, 5.8S and 5S rRNA and about 46 ribosomal proteins (r-proteins. They assemble and mature in a highly dynamic process that involves more than 150 proteins and 70 small RNAs. Ribosome biogenesis starts in the nucleolus, continues in the nucleoplasm and is completed after nucleo-cytoplasmic translocation of the subunits in the cytoplasm. In this work we created 26 yeast strains, each of which conditionally expresses one of the large ribosomal subunit (LSU proteins. In vivo depletion of the analysed LSU r-proteins was lethal and led to destabilisation and degradation of the LSU and/or its precursors. Detailed steady state and metabolic pulse labelling analyses of rRNA precursors in these mutant strains showed that LSU r-proteins can be grouped according to their requirement for efficient progression of different steps of large ribosomal subunit maturation. Comparative analyses of the observed phenotypes and the nature of r-protein-rRNA interactions as predicted by current atomic LSU structure models led us to discuss working hypotheses on i how individual r-proteins control the productive processing of the major 5' end of 5.8S rRNA precursors by exonucleases Rat1p and Xrn1p, and ii the nature of structural characteristics of nascent LSUs that are required for cytoplasmic accumulation of nascent subunits but are nonessential for most of the nuclear LSU pre-rRNA processing events.

  9. Interleukin 6 downregulates p53 expression and activity by stimulating ribosome biogenesis: a new pathway connecting inflammation to cancer

    Science.gov (United States)

    Brighenti, E; Calabrese, C; Liguori, G; Giannone, F A; Trerè, D; Montanaro, L; Derenzini, M

    2014-01-01

    Chronic inflammation is an established risk factor for the onset of cancer, and the inflammatory cytokine IL-6 has a role in tumorigenesis by enhancing proliferation and hindering apoptosis. As factors stimulating proliferation also downregulate p53 expression by enhancing ribosome biogenesis, we hypothesized that IL-6 may cause similar changes in inflamed tissues, thus activating a mechanism that favors neoplastic transformation. Here, we showed that IL-6 downregulated the expression and activity of p53 in transformed and untransformed human cell lines. This was the consequence of IL-6-dependent stimulation of c-MYC mRNA translation, which was responsible for the upregulation of rRNA transcription. The enhanced rRNA transcription stimulated the MDM2-mediated proteasomal degradation of p53, by reducing the availability of ribosome proteins for MDM2 binding. The p53 downregulation induced the acquisition of cellular phenotypic changes characteristic of epithelial–mesenchymal transition, such as a reduced level of E-cadherin expression, increased cell invasiveness and a decreased response to cytotoxic stresses. We found that these changes also occurred in colon epithelial cells of patients with ulcerative colitis, a very representative example of chronic inflammation at high risk for tumor development. Histochemical and immunohistochemical analysis of colon biopsy samples showed an upregulation of ribosome biogenesis, a reduced expression of p53, together with a focal reduction or absence of E-cadherin expression in chronic colitis in comparison with normal mucosa samples. These changes disappeared after treatment with anti-inflammatory drugs. Taken together, the present results highlight a new mechanism that may link chronic inflammation to cancer, based on p53 downregulation, which is activated by the enhancement of rRNA transcription upon IL-6 exposure. PMID:24531714

  10. Positive associations between upregulated levels of stress-induced phosphoprotein 1 and matrix metalloproteinase-9 in endometriosis/adenomyosis.

    Science.gov (United States)

    Wang, Hsin-Shih; Tsai, Chia-Lung; Chang, Pi-Yueh; Chao, Angel; Wu, Ren-Chin; Chen, Shun-Hua; Wang, Chin-Jung; Yen, Chih-Feng; Lee, Yun-Shien; Wang, Tzu-Hao

    2018-01-01

    Stress-induced phosphoprotein-1 (STIP1), an adaptor protein that coordinates the functions of HSP70 and HSP90 in protein folding, has been implicated in the development of human gynecologic malignancies. This case-control study investigates STIP1 serum levels and tissue expression in relation to endometriosis/adenomyosis in Taiwanese population. Female patients with surgically confirmed endometriosis/adenomyosis were compared with women free of endometriosis/adenomyosis. Serum STIP1 levels were measured using an enzyme-linked immunosorbent assay and surgical tissues were analyzed by immunohistochemistry. Both epithelial and stromal cells in surgical tissues of endometriosis and adenomyosis expressed STIP1 and MMP-9. Notably, MMP-9 expression was significantly decreased when STIP1 expression was knocked-down. In vitro experiments revealed that STIP1 was capable of binding to the MMP-9 promoter and enhanced its transcriptional expression. The preoperative serum STIP1 levels of patients with endometriosis/adenomyosis were significantly higher than those of the controls. In brief, our data suggest an association between STIP1 levels and endometriosis/adenomyosis.

  11. Ribosomal studies on the 70S ribosome of E.coli by means of neutron scattering

    International Nuclear Information System (INIS)

    Burkhardt, N.

    1997-01-01

    Ribosomes are ribonucleo-protein complexes, which catalyse proteinbiosynthesis in all living organisms. Currently, most of the structural models of the prokaryotic 70S ribosome rely on electron microscopy and describe mainly the outer shape of the particle. Neutron scattering can provide information on the internal structure of the ribosome. Parts of the structure can be contrasted for neutrons by means of an isotopic exchange of the naturally occurring hydrogen ( 1 H) for deuterium ( 2 H), allowing direct measurements in situ. Specifically deuterium-labeled ribosomes (E. coli) were prepared and analysed with neutron scattering. The biochemical methods were established and combined to a generally applicable preparation system. This allows labeling of all ribosomal components in any combination. A systematic analysis of the protein and RNA phases resulted in the development of a new model for the 70S ribosome. This model describes not only the outer shape of the particle, but displays also an experimentally determined internal protein-RNA distribution and the border of subunits for the first time (four-phase model; resolution: 50A). Models of the 70S ribosome from other studies were evaluated and ranked according to consistency with the measured scattering data. Applying a new neutron scattering technique of particular sensitivity, the proton-spin contrast-variation, single proteins could be measured and localized. The positions of the proteins S6 and S10 were determined, providing the first coordinates of protein mass centers within the 70S ribosome. (orig.) [de

  12. Pre-crisis mouse cells show strain-specific covariation in the amount of 54-kilodalton phosphoprotein and in susceptibility to transformation by simian virus 40.

    Science.gov (United States)

    Chen, S; Blanck, G; Pollack, R E

    1983-09-01

    We have used several inbred mouse strains to examine the role of the 54-kilodalton (kDa) cellular phosphoprotein in transformation by the papovavirus simian virus 40. We have measured the endogenous 54-kDa phosphoprotein in cells obtained from these inbred mouse strains. To study the effect of passage, cell cultures were measured for amount of the 54-kDa phosphoprotein at the 2nd and 12th passages. In the absence of any transforming agent, the amount of endogenous 54-kDa phosphoprotein in early pre-crisis mouse cells varied in a strain-specific way. Transformation frequency varied coordinately with endogenous 54-kDa expression. Mouse strains whose cells produced a high level of endogenous 54-kDa phosphoprotein on passage did not further increase its expression after simian virus 40 transformation.

  13. Sulfur restriction extends fission yeast chronological lifespan through Ecl1 family genes by downregulation of ribosome.

    Science.gov (United States)

    Ohtsuka, Hokuto; Takinami, Masahiro; Shimasaki, Takafumi; Hibi, Takahide; Murakami, Hiroshi; Aiba, Hirofumi

    2017-07-01

    Nutritional restrictions such as calorie restrictions are known to increase the lifespan of various organisms. Here, we found that a restriction of sulfur extended the chronological lifespan (CLS) of the fission yeast Schizosaccharomyces pombe. The restriction decreased cellular size, RNA content, and ribosomal proteins and increased sporulation rate. These responses depended on Ecl1 family genes, the overexpression of which results in the extension of CLS. We also showed that the Zip1 transcription factor results in the sulfur restriction-dependent expression of the ecl1 + gene. We demonstrated that a decrease in ribosomal activity results in the extension of CLS. Based on these observations, we propose that sulfur restriction extends CLS through Ecl1 family genes in a ribosomal activity-dependent manner. © 2017 John Wiley & Sons Ltd.

  14. Cytokine production but lack of proliferation in peripheral blood mononuclear cells from chronic Chagas' disease cardiomyopathy patients in response to T. cruzi ribosomal P proteins.

    Directory of Open Access Journals (Sweden)

    Silvia A Longhi

    2014-06-01

    Full Text Available BACKGROUND: Trypanosoma cruzi ribosomal P proteins, P2β and P0, induce high levels of antibodies in patients with chronic Chagas' disease Cardiomyopathy (CCC. It is well known that these antibodies alter the beating rate of cardiomyocytes and provoke apoptosis by their interaction with β1-adrenergic and M2-muscarinic cardiac receptors. Based on these findings, we decided to study the cellular immune response to these proteins in CCC patients compared to non-infected individuals. METHODOLOGY/PRINCIPAL FINDINGS: We evaluated proliferation, presence of surface activation markers and cytokine production in peripheral blood mononuclear cells (PBMC stimulated with P2β, the C-terminal portion of P0 (CP0 proteins and T. cruzi lysate from CCC patients predominantly infected with TcVI lineage. PBMC from CCC patients cultured with P2β or CP0 proteins, failed to proliferate and express CD25 and HLA-DR on T cell populations. However, multiplex cytokine assays showed that these antigens triggered higher secretion of IL-10, TNF-α and GM-CSF by PBMC as well as both CD4+ and CD8+ T cells subsets of CCC subjects. Upon T. cruzi lysate stimulation, PBMC from CCC patients not only proliferated but also became activated within the context of Th1 response. Interestingly, T. cruzi lysate was also able to induce the secretion of GM-CSF by CD4+ or CD8+ T cells. CONCLUSIONS/SIGNIFICANCE: Our results showed that although the lack of PBMC proliferation in CCC patients in response to ribosomal P proteins, the detection of IL-10, TNF-α and GM-CSF suggests that specific T cells could have both immunoregulatory and pro-inflammatory potential, which might modulate the immune response in Chagas' disease. Furthermore, it was possible to demonstrate for the first time that GM-CSF was produced by PBMC of CCC patients in response not only to recombinant ribosomal P proteins but also to parasite lysate, suggesting the value of this cytokine to evaluate T cells responses in T

  15. Further characterization of ribosome binding to thylakoid membranes

    International Nuclear Information System (INIS)

    Hurewitz, J.; Jagendorf, A.T.

    1987-01-01

    Previous work indicated more polysomes bound to pea (Pisum sativum cv Progress No. 9) thylakoids in light than in the dark, in vivo. With isolated intact chloroplasts incubated in darkness, addition of MgATP had no effect but 24 to 74% more RNA was thylakoid-bound at pH 8.3 than at pH 7. Thus, the major effect of light on ribosome-binding in vivo may be due to higher stroma pH. In isolated pea chloroplasts, initiation inhibitors (pactamycin and kanamycin) decreased the extent of RNA binding, and elongation inhibitors (lincomycin and streptomycin) increased it. Thus, cycling of ribosomes is controlled by translation, initiation, and termination. Bound RNA accounted for 19 to 24% of the total chloroplast RNA and the incorporation of [ 3 H]leucine into thylakoids was proportional to the amount of this bound RNA. These data support the concept that stroma ribosomes are recruited into thylakoid polysomes, which are active in synthesizing thylakoid proteins

  16. [Family of ribosomal proteins S1 contains unique conservative domain].

    Science.gov (United States)

    Deriusheva, E I; Machulin, A V; Selivanova, O M; Serdiuk, I N

    2010-01-01

    Different representatives of bacteria have different number of amino acid residues in the ribosomal proteins S1. This number varies from 111 (Spiroplasma kunkelii) to 863 a.a. (Treponema pallidum). Traditionally and for lack of this protein three-dimensional structure, its architecture is represented as repeating S1 domains. Number of these domains depends on the protein's length. Domain's quantity and its boundaries data are contained in the specialized databases, such as SMART, Pfam and PROSITE. However, for the same object these data may be very different. For search of domain's quantity and its boundaries, new approach, based on the analysis of dicted secondary structure (PsiPred), was used. This approach allowed us to reveal structural domains in amino acid sequences of S1 proteins and at that number varied from one to six. Alignment of S1 proteins, containing different domain's number, with the S1 RNAbinding domain of Escherichia coli PNPase elicited a fact that in family of ribosomal proteins SI one domain has maximal homology with S1 domain from PNPase. This conservative domain migrates along polypeptide chain and locates in proteins, containing different domain's number, according to specified pattern. In this domain as well in the S1 domain from PNPase, residues Phe-19, Phe-22, His-34, Asp-64 and Arg-68 are clustered on the surface and formed RNA binding site.

  17. The BRCT domain is a phospho-protein binding domain.

    Science.gov (United States)

    Yu, Xiaochun; Chini, Claudia Christiano Silva; He, Miao; Mer, Georges; Chen, Junjie

    2003-10-24

    The carboxyl-terminal domain (BRCT) of the Breast Cancer Gene 1 (BRCA1) protein is an evolutionarily conserved module that exists in a large number of proteins from prokaryotes to eukaryotes. Although most BRCT domain-containing proteins participate in DNA-damage checkpoint or DNA-repair pathways, or both, the function of the BRCT domain is not fully understood. We show that the BRCA1 BRCT domain directly interacts with phosphorylated BRCA1-Associated Carboxyl-terminal Helicase (BACH1). This specific interaction between BRCA1 and phosphorylated BACH1 is cell cycle regulated and is required for DNA damage-induced checkpoint control during the transition from G2 to M phase of the cell cycle. Further, we show that two other BRCT domains interact with their respective physiological partners in a phosphorylation-dependent manner. Thirteen additional BRCT domains also preferentially bind phospho-peptides rather than nonphosphorylated control peptides. These data imply that the BRCT domain is a phospho-protein binding domain involved in cell cycle control.

  18. Modulation of cellular phosphoprotein profiles in transformation and redifferentiation of murine and embryonic fibroblastic cells

    International Nuclear Information System (INIS)

    Chakrabarty, Subhas; Brattain, M.G.

    1985-01-01

    Cellular phosphoprotein profiles from normal mouse embryonic fibroblast AKR-2B cells were compared to those of their permanently, chemically transformed malignant counterparts AKR-MCA cells, and AKR-2B cells reversibly transformed by transforming growth factor (AKR-TGF). Similar 32 P-phosphorylation profiles were observed for both the AKR-TGF and AKR-MCA cells which were distinct from that of the normal AKR-2B cells. Dimethylformamide (DMF)-induced differentiation of the AKR-MCA cells resulted in restoration of the normal AKR-2B phosphorylation profile to the malignant AKR-MCA cells. (author)

  19. Neuron-Like Networks Between Ribosomal Proteins Within the Ribosome

    Science.gov (United States)

    Poirot, Olivier; Timsit, Youri

    2016-05-01

    From brain to the World Wide Web, information-processing networks share common scale invariant properties. Here, we reveal the existence of neural-like networks at a molecular scale within the ribosome. We show that with their extensions, ribosomal proteins form complex assortative interaction networks through which they communicate through tiny interfaces. The analysis of the crystal structures of 50S eubacterial particles reveals that most of these interfaces involve key phylogenetically conserved residues. The systematic observation of interactions between basic and aromatic amino acids at the interfaces and along the extension provides new structural insights that may contribute to decipher the molecular mechanisms of signal transmission within or between the ribosomal proteins. Similar to neurons interacting through “molecular synapses”, ribosomal proteins form a network that suggest an analogy with a simple molecular brain in which the “sensory-proteins” innervate the functional ribosomal sites, while the “inter-proteins” interconnect them into circuits suitable to process the information flow that circulates during protein synthesis. It is likely that these circuits have evolved to coordinate both the complex macromolecular motions and the binding of the multiple factors during translation. This opens new perspectives on nanoscale information transfer and processing.

  20. Ribosomal L1 domain and lysine-rich region are essential for CSIG/ RSL1D1 to regulate proliferation and senescence

    Energy Technology Data Exchange (ETDEWEB)

    Ma, Liwei; Zhao, Wenting; Zheng, Quanhui; Chen, Tianda; Qi, Ji; Li, Guodong; Tong, Tanjun, E-mail: tztong@bjmu.edu.cn

    2016-01-15

    The expression change of cellular senescence-associated genes is underlying the genetic foundation of cellular senescence. Using a suppressive subtractive hybridization system, we identified CSIG (cellular senescence-inhibited gene protein; RSL1D1) as a novel senescence-associated gene. CSIG is implicated in various process including cell cycle regulation, apoptosis, and tumor metastasis. We previously showed that CSIG plays an important role in regulating cell proliferation and cellular senescence progression through inhibiting PTEN, however, which domain or region of CSIG contributes to this function? To clarify this question, we investigated the functional importance of ribosomal L1 domain and lysine (Lys) -rich region of CSIG. The data showed that expression of CSIG potently reduced PTEN expression, increased cell proliferation rates, and reduced the senescent phenotype (lower SA-β-gal activity). By contrast, neither the expression of CSIG N- terminal (NT) fragment containing the ribosomal L1 domain nor C-terminal (CT) fragment containing Lys-rich region could significantly altered the levels of PTEN; instead of promoting cell proliferation and delaying cellular senescence, expression of CSIG-NT or CSIG-CT inhibited cell proliferation and accelerated cell senescence (increased SA-β-gal activity) compared to either CSIG over-expressing or control (empty vector transfected) cells. The further immunofluorescence analysis showed that CSIG-CT and CSIG-NT truncated proteins exhibited different subcellular distribution with that of wild-type CSIG. Conclusively, both ribosomal L1 domain and Lys-rich region of CSIG are critical for CSIG to act as a regulator of cell proliferation and cellular senescence. - Highlights: • The ribosomal L1 domain and lysine-rich region of CSIG were expressed. • They are critical for CSIG to regulate proliferation and senescence. • CSIG and its domains exhibit different subcellular distribution.

  1. Ribosomal L1 domain and lysine-rich region are essential for CSIG/ RSL1D1 to regulate proliferation and senescence

    International Nuclear Information System (INIS)

    Ma, Liwei; Zhao, Wenting; Zheng, Quanhui; Chen, Tianda; Qi, Ji; Li, Guodong; Tong, Tanjun

    2016-01-01

    The expression change of cellular senescence-associated genes is underlying the genetic foundation of cellular senescence. Using a suppressive subtractive hybridization system, we identified CSIG (cellular senescence-inhibited gene protein; RSL1D1) as a novel senescence-associated gene. CSIG is implicated in various process including cell cycle regulation, apoptosis, and tumor metastasis. We previously showed that CSIG plays an important role in regulating cell proliferation and cellular senescence progression through inhibiting PTEN, however, which domain or region of CSIG contributes to this function? To clarify this question, we investigated the functional importance of ribosomal L1 domain and lysine (Lys) -rich region of CSIG. The data showed that expression of CSIG potently reduced PTEN expression, increased cell proliferation rates, and reduced the senescent phenotype (lower SA-β-gal activity). By contrast, neither the expression of CSIG N- terminal (NT) fragment containing the ribosomal L1 domain nor C-terminal (CT) fragment containing Lys-rich region could significantly altered the levels of PTEN; instead of promoting cell proliferation and delaying cellular senescence, expression of CSIG-NT or CSIG-CT inhibited cell proliferation and accelerated cell senescence (increased SA-β-gal activity) compared to either CSIG over-expressing or control (empty vector transfected) cells. The further immunofluorescence analysis showed that CSIG-CT and CSIG-NT truncated proteins exhibited different subcellular distribution with that of wild-type CSIG. Conclusively, both ribosomal L1 domain and Lys-rich region of CSIG are critical for CSIG to act as a regulator of cell proliferation and cellular senescence. - Highlights: • The ribosomal L1 domain and lysine-rich region of CSIG were expressed. • They are critical for CSIG to regulate proliferation and senescence. • CSIG and its domains exhibit different subcellular distribution.

  2. RINT-1 interacts with MSP58 within nucleoli and plays a role in ribosomal gene transcription

    International Nuclear Information System (INIS)

    Yang, Chuan-Pin; Kuo, Yu-Liang; Lee, Yi-Chao; Lee, Kuen-Haur; Chiang, Chi-Wu; Wang, Ju-Ming; Hsu, Che-Chia

    2016-01-01

    The nucleolus is the cellular site of ribosomal (r)DNA transcription and ribosome biogenesis. The 58-kDa microspherule protein (MSP58) is a nucleolar protein involved in rDNA transcription and cell proliferation. However, regulation of MSP58-mediated rDNA transcription remains unknown. Using a yeast two-hybrid system with MSP58 as bait, we isolated complementary (c)DNA encoding Rad50-interacting protein 1 (RINT-1), as a MSP58-binding protein. RINT-1 was implicated in the cell cycle checkpoint, membrane trafficking, Golgi apparatus and centrosome dynamic integrity, and telomere length control. Both in vitro and in vivo interaction assays showed that MSP58 directly interacts with RINT-1. Interestingly, microscopic studies revealed the co-localization of MSP58, RINT-1, and the upstream binding factor (UBF), a rRNA transcription factor, in the nucleolus. We showed that ectopic expression of MSP58 or RINT-1 resulted in decreased rRNA expression and rDNA promoter activity, whereas knockdown of MSP58 or RINT-1 by siRNA exerted the opposite effect. Coexpression of MSP58 and RINT-1 robustly decreased rRNA synthesis compared to overexpression of either protein alone, whereas depletion of RINT-1 from MSP58-transfected cells enhanced rRNA synthesis. We also found that MSP58, RINT-1, and the UBF were associated with the rDNA promoter using a chromatin immunoprecipitation assay. Because aberrant ribosome biogenesis contributes to neoplastic transformation, our results revealed a novel protein complex involved in the regulation of rRNA gene expression, suggesting a role for MSP58 and RINT-1 in cancer development. - Highlights: • RINT-1 is a novel MSP58-interacting protein. • RINT-1 is a nucleolar protein that suppresses ribosomal RNA gene transcription. • RINT-1 and MSP58 cooperate to suppress ribosomal RNA gene transcription. • RINT-1, MSP58, and UBF form a complex on the rDNA promoter.

  3. The importance of ribosome production, and the 5S RNP-MDM2 pathway, in health and disease.

    Science.gov (United States)

    Pelava, Andria; Schneider, Claudia; Watkins, Nicholas J

    2016-08-15

    Ribosomes are abundant, large RNA-protein complexes that are the source of all protein synthesis in the cell. The production of ribosomes is an extremely energetically expensive cellular process that has long been linked to human health and disease. More recently, it has been shown that ribosome biogenesis is intimately linked to multiple cellular signalling pathways and that defects in ribosome production can lead to a wide variety of human diseases. Furthermore, changes in ribosome production in response to nutrient levels in the diet lead to metabolic re-programming of the liver. Reduced or abnormal ribosome production in response to cellular stress or mutations in genes encoding factors critical for ribosome biogenesis causes the activation of the tumour suppressor p53, which leads to re-programming of cellular transcription. The ribosomal assembly intermediate 5S RNP (ribonucleoprotein particle), containing RPL5, RPL11 and the 5S rRNA, accumulates when ribosome biogenesis is blocked. The excess 5S RNP binds to murine double minute 2 (MDM2), the main p53-suppressor in the cell, inhibiting its function and leading to p53 activation. Here, we discuss the involvement of ribosome biogenesis in the homoeostasis of p53 in the cell and in human health and disease. © 2016 The Author(s).

  4. Crystallization and preliminary crystallographic studies of L30e, a ribosomal protein from Methanocaldococcus jannaschii (MJ1044)

    International Nuclear Information System (INIS)

    Rangarajan, Sarani; Jeyakanthan, Jeyaraman; Mridula, Palappetty; Sakamoto, Keiko; Kitamura, Yoshiaki; Agari, Yoshihiro; Shinkai, Akeo; Ebihara, Akio; Kuramitsu, Seiki; Yokoyama, Shigeyuki; Sekar, Kanagaraj

    2008-01-01

    The ribosomal protein (L30e) from M. jannaschii was cloned from the gene MJ1044, expressed, purified and crystallized. The crystal belongs to the primitive tetragonal space group P4 3 and diffracted to 1.9 Å resolution. In view of the biological significance of understanding the ribosomal machinery of both prokaryotes and eukaryotes, the L30e ribosomal protein from Methanocaldococcus jannaschii was cloned, overexpressed, purified and crystallized using the microbatch-under-oil method with the crystallization conditions 40% PEG 400, 0.1 M MES pH 6.0 and 5% PEG 3000 at 291 K. A diffraction-quality crystal (0.20 × 0.20 × 0.35 mm) was obtained that belonged to the primitive tetragonal space group P4 3 , with unit-cell parameters a = 46.1, b = 46.1, c = 98.5 Å, and diffracted to a resolution of 1.9 Å. Preliminary calculations reveal that the asymmetric unit contains two monomers with a Matthews coefficient (V M ) of 2.16 Å 3 Da −1

  5. Ribosomal studies on the 70S ribosome of E.coli by means of neutron scattering; Strukturuntersuchungen am 70S-Ribosom von E.coli unter Anwendung von Neutronenstreuung

    Energy Technology Data Exchange (ETDEWEB)

    Burkhardt, N. [GKSS-Forschungszentrum Geesthacht GmbH (Germany). Inst. fuer Werkstofforschung

    1997-12-31

    Ribosomes are ribonucleo-protein complexes, which catalyse proteinbiosynthesis in all living organisms. Currently, most of the structural models of the prokaryotic 70S ribosome rely on electron microscopy and describe mainly the outer shape of the particle. Neutron scattering can provide information on the internal structure of the ribosome. Parts of the structure can be contrasted for neutrons by means of an isotopic exchange of the naturally occurring hydrogen ({sup 1}H) for deuterium ({sup 2}H), allowing direct measurements in situ. Specifically deuterium-labeled ribosomes (E. coli) were prepared and analysed with neutron scattering. The biochemical methods were established and combined to a generally applicable preparation system. This allows labeling of all ribosomal components in any combination. A systematic analysis of the protein and RNA phases resulted in the development of a new model for the 70S ribosome. This model describes not only the outer shape of the particle, but displays also an experimentally determined internal protein-RNA distribution and the border of subunits for the first time (four-phase model; resolution: 50A). Models of the 70S ribosome from other studies were evaluated and ranked according to consistency with the measured scattering data. Applying a new neutron scattering technique of particular sensitivity, the proton-spin contrast-variation, single proteins could be measured and localized. The positions of the proteins S6 and S10 were determined, providing the first coordinates of protein mass centers within the 70S ribosome. (orig.) [Deutsch] Ribosomen sind Ribonukleinsaeure-Protein Komplexe, die in allen lebenden Organismen die Proteinbiosynthese katalysieren. Strukturmodelle fuer das prokaryontische 70S-Ribosom beruhen derzeit vorwiegend auf elektronenmikroskopischen Untersuchungen und beschreiben im wesentlichen die aeussere Oberflaeche des Partikels. Informationen ueber die innere Struktur des Ribosoms koennen Messungen mit

  6. Ribosomal studies on the 70S ribosome of E.coli by means of neutron scattering; Strukturuntersuchungen am 70S-Ribosom von E.coli unter Anwendung von Neutronenstreuung

    Energy Technology Data Exchange (ETDEWEB)

    Burkhardt, N [GKSS-Forschungszentrum Geesthacht GmbH (Germany). Inst. fuer Werkstofforschung

    1998-12-31

    Ribosomes are ribonucleo-protein complexes, which catalyse proteinbiosynthesis in all living organisms. Currently, most of the structural models of the prokaryotic 70S ribosome rely on electron microscopy and describe mainly the outer shape of the particle. Neutron scattering can provide information on the internal structure of the ribosome. Parts of the structure can be contrasted for neutrons by means of an isotopic exchange of the naturally occurring hydrogen ({sup 1}H) for deuterium ({sup 2}H), allowing direct measurements in situ. Specifically deuterium-labeled ribosomes (E. coli) were prepared and analysed with neutron scattering. The biochemical methods were established and combined to a generally applicable preparation system. This allows labeling of all ribosomal components in any combination. A systematic analysis of the protein and RNA phases resulted in the development of a new model for the 70S ribosome. This model describes not only the outer shape of the particle, but displays also an experimentally determined internal protein-RNA distribution and the border of subunits for the first time (four-phase model; resolution: 50A). Models of the 70S ribosome from other studies were evaluated and ranked according to consistency with the measured scattering data. Applying a new neutron scattering technique of particular sensitivity, the proton-spin contrast-variation, single proteins could be measured and localized. The positions of the proteins S6 and S10 were determined, providing the first coordinates of protein mass centers within the 70S ribosome. (orig.) [Deutsch] Ribosomen sind Ribonukleinsaeure-Protein Komplexe, die in allen lebenden Organismen die Proteinbiosynthese katalysieren. Strukturmodelle fuer das prokaryontische 70S-Ribosom beruhen derzeit vorwiegend auf elektronenmikroskopischen Untersuchungen und beschreiben im wesentlichen die aeussere Oberflaeche des Partikels. Informationen ueber die innere Struktur des Ribosoms koennen Messungen mit

  7. Short interfering RNAs targeting a vampire-bat related rabies virus phosphoprotein mRNA.

    Science.gov (United States)

    Ono, Ekaterina Alexandrovna Durymanova; Taniwaki, Sueli Akemi; Brandão, Paulo

    The aim of this study was to assess the in vitro and in vivo effects of short-interfering RNAs (siRNAs) against rabies virus phosphoprotein (P) mRNA in a post-infection treatment for rabies as an extension of a previous report (Braz J Microbiol. 2013 Nov 15;44(3):879-82). To this end, rabies virus strain RABV-4005 (related to the Desmodus rotundus vampire bat) were used to inoculate BHK-21 cells and mice, and the transfection with each of the siRNAs was made with Lipofectamine-2000™. In vitro results showed that siRNA 360 was able to inhibit the replication of strain RABV-4005 with a 1log decrease in virus titter and 5.16-fold reduction in P mRNA, 24h post-inoculation when compared to non-treated cells. In vivo, siRNA 360 was able to induce partial protection, but with no significant difference when compared to non-treated mice. These results indicate that, despite the need for improvement for in vivo applications, P mRNA might be a target for an RNAi-based treatment for rabies. Copyright © 2017 Sociedade Brasileira de Microbiologia. Published by Elsevier Editora Ltda. All rights reserved.

  8. Defective ribosome assembly in Shwachman-Diamond syndrome.

    Science.gov (United States)

    Wong, Chi C; Traynor, David; Basse, Nicolas; Kay, Robert R; Warren, Alan J

    2011-10-20

    Shwachman-Diamond syndrome (SDS), a recessive leukemia predisposition disorder characterized by bone marrow failure, exocrine pancreatic insufficiency, skeletal abnormalities and poor growth, is caused by mutations in the highly conserved SBDS gene. Here, we test the hypothesis that defective ribosome biogenesis underlies the pathogenesis of SDS. We create conditional mutants in the essential SBDS ortholog of the ancient eukaryote Dictyostelium discoideum using temperature-sensitive, self-splicing inteins, showing that mutant cells fail to grow at the restrictive temperature because ribosomal subunit joining is markedly impaired. Remarkably, wild type human SBDS complements the growth and ribosome assembly defects in mutant Dictyostelium cells, but disease-associated human SBDS variants are defective. SBDS directly interacts with the GTPase elongation factor-like 1 (EFL1) on nascent 60S subunits in vivo and together they catalyze eviction of the ribosome antiassociation factor eukaryotic initiation factor 6 (eIF6), a prerequisite for the translational activation of ribosomes. Importantly, lymphoblasts from SDS patients harbor a striking defect in ribosomal subunit joining whose magnitude is inversely proportional to the level of SBDS protein. These findings in Dictyostelium and SDS patient cells provide compelling support for the hypothesis that SDS is a ribosomopathy caused by corruption of an essential cytoplasmic step in 60S subunit maturation.

  9. Role of the ribosomal P-site elements of m²G966, m⁵C967, and the S9 C-terminal tail in maintenance of the reading frame during translational elongation in Escherichia coli.

    Science.gov (United States)

    Arora, Smriti; Bhamidimarri, Satya Prathyusha; Weber, Michael H W; Varshney, Umesh

    2013-08-01

    The ribosomal P-site hosts the peptidyl-tRNAs during translation elongation. Which P-site elements support these tRNA species to maintain codon-anticodon interactions has remained unclear. We investigated the effects of P-site features of methylations of G966, C967, and the conserved C-terminal tail sequence of Ser, Lys, and Arg (SKR) of the S9 ribosomal protein in maintenance of the translational reading frame of an mRNA. We generated Escherichia coli strains deleted for the SKR sequence in S9 ribosomal protein, RsmB (which methylates C967), and RsmD (which methylates G966) and used them to translate LacZ from its +1 and -1 out-of-frame constructs. We show that the S9 SKR tail prevents both the +1 and -1 frameshifts and plays a general role in holding the P-site tRNA/peptidyl-tRNA in place. In contrast, the G966 and C967 methylations did not make a direct contribution to the maintenance of the translational frame of an mRNA. However, deletion of rsmB in the S9Δ3 background caused significantly increased -1 frameshifting at 37°C. Interestingly, the effects of the deficiency of C967 methylation were annulled when the E. coli strain was grown at 30°C, supporting its context-dependent role.

  10. Characterisation of ribosomal proteins from HeLa and Krebs II mouse ascites tumor cells by different two-dimensional polyacrylamide gel electrophoresis techniques

    DEFF Research Database (Denmark)

    Issinger, O G; Beier, H

    1978-01-01

    Electrophoresis of ribosomal proteins according to Kaltschmidt and Wittmann, 1970a, b (pH 8.6/pH 4.5 urea system) yielded 29 proteins for the small subunits and 35 and 37 proteins for the large subunits of Krebs II ascites and HeLa ribosomes, respectively. Analysis of the proteins according...... to a modified technique by Mets and Bogorad (1974) (pH 4.5/pH 8.6 SDS system) revealed 28 and 29 proteins in the small subunits and 37 and 38 proteins in the large subunits of Krebs II ascites and HeLa ribosomes. The molecular weights of the individual proteins were determined by: 1. "three-dimensional" gel...... using the pH 4.5/pH 8.6 SDS system. The molecular weights Krebs II ascites and HeLa ribosomal proteins are compared with those obtained by other authors for different mammalian species....

  11. Solution and crystallographic structures of the central region of the phosphoprotein from human metapneumovirus.

    Directory of Open Access Journals (Sweden)

    Cedric Leyrat

    Full Text Available Human metapneumovirus (HMPV of the family Paramyxoviridae is a major cause of respiratory illness worldwide. Phosphoproteins (P from Paramyxoviridae are essential co-factors of the viral RNA polymerase that form tetramers and possess long intrinsically disordered regions (IDRs. We located the central region of HMPV P (P(ced which is involved in tetramerization using disorder analysis and modeled its 3D structure ab initio using Rosetta fold-and-dock. We characterized the solution-structure of P(ced using small angle X-ray scattering (SAXS and carried out direct fitting to the scattering data to filter out incorrect models. Molecular dynamics simulations (MDS and ensemble optimization were employed to select correct models and capture the dynamic character of P(ced. Our analysis revealed that oligomerization involves a compact central core located between residues 169-194 (P(core, that is surrounded by flexible regions with α-helical propensity. We crystallized this fragment and solved its structure at 3.1 Å resolution by molecular replacement, using the folded core from our SAXS-validated ab initio model. The RMSD between modeled and experimental tetramers is as low as 0.9 Å, demonstrating the accuracy of the approach. A comparison of the structure of HMPV P to existing mononegavirales P(ced structures suggests that P(ced evolved under weak selective pressure. Finally, we discuss the advantages of using SAXS in combination with ab initio modeling and MDS to solve the structure of small, homo-oligomeric protein complexes.

  12. Heterogeneous Ribosomes Preferentially Translate Distinct Subpools of mRNAs Genome-wide.

    Science.gov (United States)

    Shi, Zhen; Fujii, Kotaro; Kovary, Kyle M; Genuth, Naomi R; Röst, Hannes L; Teruel, Mary N; Barna, Maria

    2017-07-06

    Emerging studies have linked the ribosome to more selective control of gene regulation. However, an outstanding question is whether ribosome heterogeneity at the level of core ribosomal proteins (RPs) exists and enables ribosomes to preferentially translate specific mRNAs genome-wide. Here, we measured the absolute abundance of RPs in translating ribosomes and profiled transcripts that are enriched or depleted from select subsets of ribosomes within embryonic stem cells. We find that heterogeneity in RP composition endows ribosomes with differential selectivity for translating subpools of transcripts, including those controlling metabolism, cell cycle, and development. As an example, mRNAs enriched in binding to RPL10A/uL1-containing ribosomes are shown to require RPL10A/uL1 for their efficient translation. Within several of these transcripts, this level of regulation is mediated, at least in part, by internal ribosome entry sites. Together, these results reveal a critical functional link between ribosome heterogeneity and the post-transcriptional circuitry of gene expression. Copyright © 2017 Elsevier Inc. All rights reserved.

  13. Caracterización e inmunoreactividad de la proteína acídica Ribosomal P2ß de L. (V. braziliensis

    Directory of Open Access Journals (Sweden)

    Carlos Padilla R

    2003-04-01

    Full Text Available Introducción: El diagnóstico serológico de la leishmaniasis usando proteínas totales presenta reacciones cruzadas. La caracterización de nuevos antígenos de Leishmania mejorará el uso de herramientas serológicas en el diagnóstico de esta enfermedad. Objetivo: Caracterizar un nuevo antígeno de Leishmania. Materiales y métodos: Se seleccionó el bacteriófago T166-U19 de una biblioteca de cADN de L. (V. braziliensis el cual es reactivo a mezclas de sueros de leishmaniasis cutánea y mucocutánea. El cADN del clon T166-U19 fue subclonado en el plásmido pGEX, luego secuenciado y la proteína recombinante fue expresada. La reactividad de esta proteína recombinante se evaluó por ELISA. Resultados: El cADN del clon T166- U19 presentó un marco de lectura abierto de 318 pb que traduce una proteína de 105 aminoácidos con 81,1%, 82,9% y 60,7% de identidad total con la proteína acídica ribosomal LiP de L. (L. infantum, P2 de L. (L. donovani, y P2 de T. cruzi, respectivamente. Además, la proteína recombinante presentó baja reactividad (50% con sueros de pacientes con leishmaniosis, mientras que presentó reactividad cruzada con sueros de pacientes chagásicos. Conclusiones: Se caracterizó por primera vez la proteína acídica ribosomal P2B de L. (V. braziliensis, y presentando baja reactividad con sueros de pacientes con leishmaniasis.

  14. Purification, crystallization and preliminary X-ray diffraction study of human ribosomal protein L10 core domain

    International Nuclear Information System (INIS)

    Nishimura, Mitsuhiro; Kaminishi, Tatsuya; Kawazoe, Masahito; Shirouzu, Mikako; Takemoto, Chie; Yokoyama, Shigeyuki; Tanaka, Akiko; Sugano, Sumio; Yoshida, Takuya; Ohkubo, Tadayasu; Kobayashi, Yuji

    2007-01-01

    A truncated variant of human ribosomal protien L10 was prepared and crystallized. Diffraction data were collected to 2.5 Å resolution. Eukaryotic ribosomal protein L10 is an essential component of the large ribosomal subunit, which organizes the architecture of the aminoacyl-tRNA binding site. The human L10 protein is also called the QM protein and consists of 214 amino-acid residues. For crystallization, the L10 core domain (L10CD, Phe34–Glu182) was recombinantly expressed in Escherichia coli and purified to homogeneity. A hexagonal crystal of L10CD was obtained by the sitting-drop vapour-diffusion method. The L10CD crystal diffracted to 2.5 Å resolution and belongs to space group P3 1 21 or P3 2 21

  15. Structure based hypothesis of a mitochondrial ribosome rescue mechanism

    Directory of Open Access Journals (Sweden)

    Huynen Martijn A

    2012-05-01

    Full Text Available Abstract Background mtRF1 is a vertebrate mitochondrial protein with an unknown function that arose from a duplication of the mitochondrial release factor mtRF1a. To elucidate the function of mtRF1, we determined the positions that are conserved among mtRF1 sequences but that are different in their mtRF1a paralogs. We subsequently modeled the 3D structure of mtRF1a and mtRF1 bound to the ribosome, highlighting the structural implications of these differences to derive a hypothesis for the function of mtRF1. Results Our model predicts, in agreement with the experimental data, that the 3D structure of mtRF1a allows it to recognize the stop codons UAA and UAG in the A-site of the ribosome. In contrast, we show that mtRF1 likely can only bind the ribosome when the A-site is devoid of mRNA. Furthermore, while mtRF1a will adopt its catalytic conformation, in which it functions as a peptidyl-tRNA hydrolase in the ribosome, only upon binding of a stop codon in the A-site, mtRF1 appears specifically adapted to assume this extended, peptidyl-tRNA hydrolyzing conformation in the absence of mRNA in the A-site. Conclusions We predict that mtRF1 specifically recognizes ribosomes with an empty A-site and is able to function as a peptidyl-tRNA hydrolase in those situations. Stalled ribosomes with empty A-sites that still contain a tRNA bound to a peptide chain can result from the translation of truncated, stop-codon less mRNAs. We hypothesize that mtRF1 recycles such stalled ribosomes, performing a function that is analogous to that of tmRNA in bacteria. Reviewers This article was reviewed by Dr. Eugene Koonin, Prof. Knud H. Nierhaus (nominated by Dr. Sarah Teichmann and Dr. Shamil Sunyaev.

  16. Ribosomal DNA internal transcribed spacer 1 and internal ...

    African Journals Online (AJOL)

    USER

    2010-07-26

    Jul 26, 2010 ... in some East Asian countries such as China, Korea and. *Corresponding author. E-mail: soonkwan@kangwon.ac.kr. Tel: +82 33 250 6476. Fax: +82 33 250 6470. Abbreviations: nrDNA, Nuclear ribosomal DNA; ITS, internal transcribed spacer; PCR, polymerase chain reaction; BLAST, basic local alignment ...

  17. Perturbation of Ribosome Biogenesis Drives Cells into Senescence through 5S RNP-Mediated p53 Activation

    Directory of Open Access Journals (Sweden)

    Kazuho Nishimura

    2015-03-01

    Full Text Available The 5S ribonucleoprotein particle (RNP complex, consisting of RPL11, RPL5, and 5S rRNA, is implicated in p53 regulation under ribotoxic stress. Here, we show that the 5S RNP contributes to p53 activation and promotes cellular senescence in response to oncogenic or replicative stress. Oncogenic stress accelerates rRNA transcription and replicative stress delays rRNA processing, resulting in RPL11 and RPL5 accumulation in the ribosome-free fraction, where they bind MDM2. Experimental upregulation of rRNA transcription or downregulation of rRNA processing, mimicking the nucleolus under oncogenic or replicative stress, respectively, also induces RPL11-mediated p53 activation and cellular senescence. We demonstrate that exogenous expression of certain rRNA-processing factors rescues the processing defect, attenuates p53 accumulation, and increases replicative lifespan. To summarize, the nucleolar-5S RNP-p53 pathway functions as a senescence inducer in response to oncogenic and replicative stresses.

  18. Sustained mitogen-activated protein kinase activation reprograms defense metabolism and phosphoprotein profile in Arabidopsis thaliana.

    Directory of Open Access Journals (Sweden)

    Ines eLassowskat

    2014-10-01

    Full Text Available Mitogen-activated protein kinases (MAPKs target a variety of protein substrates to regulate cellular signaling processes in eukaryotes. In plants, the number of identified MAPK substrates that control plant defense responses is still limited. Here, we generated transgenic Arabidopsis thaliana plants with an inducible system to simulate in vivo activation of two stress-activated MAPKs, MPK3 and MPK6. Metabolome analysis revealed that this artificial MPK3/6 activation (without any exposure to pathogens or other stresses is sufficient to drive the production of major defense-related metabolites, including various camalexin, indole glucosinolate and agmatine derivatives. An accompanying (phosphoproteome analysis led to detection of hundreds of potential phosphoproteins downstream of MPK3/6 activation. Besides known MAPK substrates, many candidates on this list possess typical MAPK-targeted phosphosites and in many cases, the corresponding phosphopeptides were detected by mass spectrometry. Notably, several of these putative phosphoproteins have been reported to be associated with the biosynthesis of antimicrobial defense substances (e.g. WRKY transcription factors and proteins encoded by the genes from the PEN pathway required for penetration resistance to filamentous pathogens. Thus, this work provides an inventory of candidate phosphoproteins, including putative direct MAPK substrates, for future analysis of MAPK-mediated defense control. (Proteomics data are available with the identifier PXD001252 via ProteomeXchange, http://proteomecentral.proteomexchange.org.

  19. Revealing −1 Programmed Ribosomal Frameshifting Mechanisms by Single-Molecule Techniques and Computational Methods

    Directory of Open Access Journals (Sweden)

    Kai-Chun Chang

    2012-01-01

    Full Text Available Programmed ribosomal frameshifting (PRF serves as an intrinsic translational regulation mechanism employed by some viruses to control the ratio between structural and enzymatic proteins. Most viral mRNAs which use PRF adapt an H-type pseudoknot to stimulate −1 PRF. The relationship between the thermodynamic stability and the frameshifting efficiency of pseudoknots has not been fully understood. Recently, single-molecule force spectroscopy has revealed that the frequency of −1 PRF correlates with the unwinding forces required for disrupting pseudoknots, and that some of the unwinding work dissipates irreversibly due to the torsional restraint of pseudoknots. Complementary to single-molecule techniques, computational modeling provides insights into global motions of the ribosome, whose structural transitions during frameshifting have not yet been elucidated in atomic detail. Taken together, recent advances in biophysical tools may help to develop antiviral therapies that target the ubiquitous −1 PRF mechanism among viruses.

  20. 5S rRNA and ribosome.

    Science.gov (United States)

    Gongadze, G M

    2011-12-01

    5S rRNA is an integral component of the ribosome of all living organisms. It is known that the ribosome without 5S rRNA is functionally inactive. However, the question about the specific role of this RNA in functioning of the translation apparatus is still open. This review presents a brief history of the discovery of 5S rRNA and studies of its origin and localization in the ribosome. The previously expressed hypotheses about the role of this RNA in the functioning of the ribosome are discussed considering the unique location of 5S rRNA in the ribosome and its intermolecular contacts. Based on analysis of the current data on ribosome structure and its functional complexes, the role of 5S rRNA as an intermediary between ribosome functional domains is discussed.

  1. In vitro degradation of ribosomes.

    Science.gov (United States)

    Mora, G; Rivas, A

    1976-12-01

    The cytoplasmic ribosomes from Euglena gracilis var. bacillaris are found to be of two types taking into consideration their stability "in vitro". In the group of unstable ribosomes the large subunit is degraded. The other group apparently does not suffer any degradation under the conditions described. However the RNAs extracted from both types of ribosomes are degraded during sucrose density gradients. The degradation of the largest RNA species has been reported previously, but no comment has been made about the stability of the ribosome itself.

  2. Anti-ribosomal P antibodies related to depression in early clinical course of systemic lupus erythematosus

    Directory of Open Access Journals (Sweden)

    Mansoor Karimifar

    2013-01-01

    Full Text Available Background: Diagnosis and treatment of neuropsychiatric lupus is still a major challenge in clinical practice. We investigated the association between depression and anti-ribosomal P (anti-P antibodies in a sample of Iranian patients with systemic lupus erythematosus (SLE. Materials and Methods: This cross-sectional study was conducted on adult patients with SLE referring to a referral out-patient clinic of rheumatology. Demographic data and clinical data with regards to measuring disease activity with the systemic lupus erythematosus disease activity index were gathered. Anti-P antibodies were measured with the enzyme-linked immunosorbent assay method. Depression severity was measured by the Beck Depression Inventory-II. Results: One hundred patients (80% female and 20% male, age = 34.8 ± 10.9 years were included. Anti-P antibodies were present more frequently in depressed than non-depressed patients (30% vs. 10%, P = 0.015. Depression severity was correlated with anti-P antibodies level only in patients with disease duration of less than 2 years (r = 0.517, P = 0.019. There was no association between the depression severity and disease activity. Binary logistic regression analysis showed age (B = 0.953, CI 95%: 0.914-0.993 and positive anti-P antibodies (B = 4.30, CI 95%: 1.18-15.59 as factors that independently associated with depression. Conclusion: We found an association between depression and presence of anti-P antibodies, and also strong correlation between depression severity and anti-P antibodies level in newly diagnosed SLE patients. Depression severity in newly diagnosed SLE patients may reflect a neuropsychiatric involvement, and in later phases, it is more affected by the chronicity of the disease as well as other environmental factors.

  3. Seventeen copies of the human 37 kDa laminin receptor precursor/p40 ribosome-associated protein gene are processed pseudogenes arisen from retropositional events

    DEFF Research Database (Denmark)

    Jackers, P; Clausse, N; Fernandez, M

    1996-01-01

    A cDNA coding for a 37 kDa polypeptide has been identified in several species as both the potential precursor of the 67 kDa laminin receptor (37LRP) and a putative ribosome-associated protein (p40). Interestingly, increased expression of this polypeptide (37LRP/p40) is consistently observed...

  4. Genetic and evolutionary characterization of RABVs from China using the phosphoprotein gene.

    Science.gov (United States)

    Wang, Lihua; Wu, Hui; Tao, Xiaoyan; Li, Hao; Rayner, Simon; Liang, Guodong; Tang, Qing

    2013-01-07

    While the function of the phosphoprotein (P) gene of the rabies virus (RABV) has been well studied in laboratory adapted RABVs, the genetic diversity and evolution characteristics of the P gene of street RABVs remain unclear. The objective of the present study was to investigate the mutation and evolution of P genes in Chinese street RABVs. The P gene of 77 RABVs from brain samples of dogs and wild animals collected in eight Chinese provinces through 2003 to 2008 were sequenced. The open reading frame (ORF) of the P genes was 894 nucleotides (nt) in length, with 85-99% (80-89%) amino acid (nucleotide) identity compared with the laboratory RABVs and vaccine strains. Phylogenetic analysis based on the P gene revealed that Chinese RABVs strains could be divided into two distinct clades, and several RABV variants were found to co circulating in the same province. Two conserved (CD1, 2) and two variable (VD1, 2) domains were identified by comparing the deduced primary sequences of the encoded P proteins. Two sequence motifs, one believed to confer binding to the cytoplasmic dynein light chain LC8 and a lysine-rich sequence were conserved throughout the Chinese RABVs. In contrast, the isolates exhibited lower conservation of one phosphate acceptor and one internal translation initiation site identified in the P protein of the rabies challenge virus standard (CVS) strain. Bayesian coalescent analysis showed that the P gene in Chinese RABVs have a substitution rate (3.305x10(-4) substitutions per site per year) and evolution history (592 years ago) similar to values for the glycoprotein (G) and nucleoprotein (N) reported previously. Several substitutions were found in the P gene of Chinese RABVs strains compared to the laboratory adapted and vaccine strains, whether these variations could affect the biological characteristics of Chinese RABVs need to be further investigated. The substitution rate and evolution history of P gene is similar to G and N gene, combine the

  5. Trans-kingdom mimicry underlies ribosome customization by a poxvirus kinase.

    Science.gov (United States)

    Jha, Sujata; Rollins, Madeline G; Fuchs, Gabriele; Procter, Dean J; Hall, Elizabeth A; Cozzolino, Kira; Sarnow, Peter; Savas, Jeffrey N; Walsh, Derek

    2017-06-29

    Ribosomes have the capacity to selectively control translation through changes in their composition that enable recognition of specific RNA elements. However, beyond differential subunit expression during development, evidence for regulated ribosome specification within individual cells has remained elusive. Here we report that a poxvirus kinase phosphorylates serine/threonine residues in the human small ribosomal subunit protein, receptor for activated C kinase (RACK1), that are not phosphorylated in uninfected cells or cells infected by other viruses. These modified residues cluster in an extended loop in RACK1, phosphorylation of which selects for translation of viral or reporter mRNAs with 5' untranslated regions that contain adenosine repeats, so-called polyA-leaders. Structural and phylogenetic analyses revealed that although RACK1 is highly conserved, this loop is variable and contains negatively charged amino acids in plants, in which these leaders act as translational enhancers. Phosphomimetics and inter-species chimaeras have shown that negative charge in the RACK1 loop dictates ribosome selectivity towards viral RNAs. By converting human RACK1 to a charged, plant-like state, poxviruses remodel host ribosomes so that adenosine repeats erroneously generated by slippage of the viral RNA polymerase confer a translational advantage. Our findings provide insight into ribosome customization through trans-kingdom mimicry and the mechanics of species-specific leader activity that underlie poxvirus polyA-leaders.

  6. 20-Hydroxyecdysone stimulates nuclear accumulation of BmNep1, a nuclear ribosome biogenesis-related protein in the silkworm, Bombyx mori.

    Science.gov (United States)

    Ji, M-M; Liu, A-Q; Sima, Y-H; Xu, S-Q

    2016-10-01

    The pathway of communication between endocrine hormones and ribosome biogenesis critical for physiological adaptation is largely unknown. Nucleolar essential protein 1 (Nep1) is an essential gene for ribosome biogenesis and is functionally conserved in many in vertebrate and invertebrate species. In this study, we cloned Bombyx mori Nep1 (BmNep1) due to its high expression in silk glands of silkworms on day 3 of the fifth instar. We found that BmNep1 mRNA and protein levels were upregulated in silk glands during fourth-instar ecdysis and larval-pupal metamorphosis. By immunoprecipitation with the anti-BmNep1 antibody and liquid chromatography-tandem mass spectrometry analyses, it was shown that BmNep1 probably interacts with proteins related to ribosome structure formation. Immunohistochemistry, biochemical fractionation and immunocytochemistry revealed that BmNep1 is localized to the nuclei in Bombyx cells. Using BmN cells originally derived from ovaries, we demonstrated that 20-hydroxyecdysone (20E) induced BmNep1 expression and stimulated nuclear accumulation of BmNep1. Under physiological conditions, BmNep1 was also upregulated in ovaries during larval-pupal metamorphosis. Overall, our results indicate that the endocrine hormone 20E facilitates nuclear accumulation of BmNep1, which is involved in nuclear ribosome biogenesis in Bombyx. © 2016 The Royal Entomological Society.

  7. Detection and Quantification of Ribosome Inhibition by Aminoglycoside Antibiotics in Living Bacteria Using an Orthogonal Ribosome-Controlled Fluorescent Reporter.

    Science.gov (United States)

    Huang, Shijie; Zhu, Xuechen; Melançon, Charles E

    2016-01-15

    The ribosome is the quintessential antibacterial drug target, with many structurally and mechanistically distinct classes of antibacterial agents acting by inhibiting ribosome function. Detecting and quantifying ribosome inhibition by small molecules and investigating their binding modes and mechanisms of action are critical to antibacterial drug discovery and development efforts. To develop a ribosome inhibition assay that is operationally simple, yet provides direct information on the drug target and the mechanism of action, we have developed engineered E. coli strains harboring an orthogonal ribosome-controlled green fluorescent protein (GFP) reporter that produce fluorescent signal when the orthogonal ribosome is inhibited. As a proof of concept, we demonstrate that these strains, when coexpressing homogeneous populations of aminoglycoside resistant ribosomes, act as sensitive and quantitative detectors of ribosome inhibition by a set of 12 structurally diverse aminoglycoside antibiotics. We suggest that this strategy can be extended to quantifying ribosome inhibition by other drug classes.

  8. The ribosome can prevent aggregation of partially folded protein intermediates: studies using the Escherichia coli ribosome.

    Directory of Open Access Journals (Sweden)

    Bani Kumar Pathak

    Full Text Available BACKGROUND: Molecular chaperones that support de novo folding of proteins under non stress condition are classified as chaperone 'foldases' that are distinct from chaperone' holdases' that provide high affinity binding platform for unfolded proteins and prevent their aggregation specifically under stress conditions. Ribosome, the cellular protein synthesis machine can act as a foldase chaperone that can bind unfolded proteins and release them in folding competent state. The peptidyl transferase center (PTC located in the domain V of the 23S rRNA of Escherichia coli ribosome (bDV RNA is the chaperoning center of the ribosome. It has been proposed that via specific interactions between the RNA and refolding proteins, the chaperone provides information for the correct folding of unfolded polypeptide chains. RESULTS: We demonstrate using Escherichia coli ribosome and variants of its domain V RNA that the ribosome can bind to partially folded intermediates of bovine carbonic anhydrase II (BCAII and lysozyme and suppress aggregation during their refolding. Using mutants of domain V RNA we demonstrate that the time for which the chaperone retains the bound protein is an important factor in determining its ability to suppress aggregation and/or support reactivation of protein. CONCLUSION: The ribosome can behave like a 'holdase' chaperone and has the ability to bind and hold back partially folded intermediate states of proteins from participating in the aggregation process. Since the ribosome is an essential organelle that is present in large numbers in all living cells, this ability of the ribosome provides an energetically inexpensive way to suppress cellular aggregation. Further, this ability of the ribosome might also be crucial in the context that the ribosome is one of the first chaperones to be encountered by a large nascent polypeptide chains that have a tendency to form partially folded intermediates immediately following their synthesis.

  9. Dynamic modulation of phosphoprotein expression in ovarian cancer xenograft models

    International Nuclear Information System (INIS)

    Koussounadis, Antonis; Langdon, Simon P.; Um, Inhwa; Kay, Charlene; Francis, Kyle E.; Harrison, David J.; Smith, V. Anne

    2016-01-01

    The dynamic changes that occur in protein expression after treatment of a cancer in vivo are poorly described. In this study we measure the effect of chemotherapy over time on the expression of a panel of proteins in ovarian cancer xenograft models. The objective was to identify phosphoprotein and other protein changes indicative of pathway activation that might link with drug response. Two xenograft models, platinum-responsive OV1002 and platinum-unresponsive HOX424, were used. Treatments were carboplatin and carboplatin-paclitaxel. Expression of 49 proteins over 14 days post treatment was measured by quantitative immunofluorescence and analysed by AQUA. Carboplatin treatment in the platinum-sensitive OV1002 model triggered up-regulation of cell cycle, mTOR and DDR pathways, while at late time points WNT, invasion, EMT and MAPK pathways were modulated. Estrogen receptor-alpha (ESR1) and ERBB pathways were down-regulated early, within 24 h from treatment administration. Combined carboplatin-paclitaxel treatment triggered a more extensive response in the OV1002 model modulating expression of 23 of 49 proteins. Therefore the cell cycle and DDR pathways showed similar or more pronounced changes than with carboplatin alone. In addition to expression of pS6 and pERK increasing, components of the AKT pathway were modulated with pAKT increasing while its regulator PTEN was down-regulated early. WNT signaling, EMT and invasion markers were modulated at later time points. Additional pathways were also observed with the NFκB and JAK/STAT pathways being up-regulated. ESR1 was down-regulated as was HER4, while further protein members of the ERBB pathway were upregulated late. By contrast, in the carboplatin-unresponsive HOX 424 xenograft, carboplatin only modulated expression of MLH1 while carboplatin-paclitaxel treatment modulated ESR1 and pMET. Thirteen proteins were modulated by carboplatin and a more robust set of changes by carboplatin-paclitaxel. Early changes included

  10. Genome-wide mRNA processing in methanogenic archaea reveals post-transcriptional regulation of ribosomal protein synthesis.

    Science.gov (United States)

    Qi, Lei; Yue, Lei; Feng, Deqin; Qi, Fengxia; Li, Jie; Dong, Xiuzhu

    2017-07-07

    Unlike stable RNAs that require processing for maturation, prokaryotic cellular mRNAs generally follow an 'all-or-none' pattern. Herein, we used a 5΄ monophosphate transcript sequencing (5΄P-seq) that specifically captured the 5΄-end of processed transcripts and mapped the genome-wide RNA processing sites (PSSs) in a methanogenic archaeon. Following statistical analysis and stringent filtration, we identified 1429 PSSs, among which 23.5% and 5.4% were located in 5΄ untranslated region (uPSS) and intergenic region (iPSS), respectively. A predominant uridine downstream PSSs served as a processing signature. Remarkably, 5΄P-seq detected overrepresented uPSS and iPSS in the polycistronic operons encoding ribosomal proteins, and the majority upstream and proximal ribosome binding sites, suggesting a regulatory role of processing on translation initiation. The processed transcripts showed increased stability and translation efficiency. Particularly, processing within the tricistronic transcript of rplA-rplJ-rplL enhanced the translation of rplL, which can provide a driving force for the 1:4 stoichiometry of L10 to L12 in the ribosome. Growth-associated mRNA processing intensities were also correlated with the cellular ribosomal protein levels, thereby suggesting that mRNA processing is involved in tuning growth-dependent ribosome synthesis. In conclusion, our findings suggest that mRNA processing-mediated post-transcriptional regulation is a potential mechanism of ribosomal protein synthesis and stoichiometry. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  11. Perturbation of ribosome biogenesis drives cells into senescence through 5S RNP-mediated p53 activation.

    Science.gov (United States)

    Nishimura, Kazuho; Kumazawa, Takuya; Kuroda, Takao; Katagiri, Naohiro; Tsuchiya, Mai; Goto, Natsuka; Furumai, Ryohei; Murayama, Akiko; Yanagisawa, Junn; Kimura, Keiji

    2015-03-03

    The 5S ribonucleoprotein particle (RNP) complex, consisting of RPL11, RPL5, and 5S rRNA, is implicated in p53 regulation under ribotoxic stress. Here, we show that the 5S RNP contributes to p53 activation and promotes cellular senescence in response to oncogenic or replicative stress. Oncogenic stress accelerates rRNA transcription and replicative stress delays rRNA processing, resulting in RPL11 and RPL5 accumulation in the ribosome-free fraction, where they bind MDM2. Experimental upregulation of rRNA transcription or downregulation of rRNA processing, mimicking the nucleolus under oncogenic or replicative stress, respectively, also induces RPL11-mediated p53 activation and cellular senescence. We demonstrate that exogenous expression of certain rRNA-processing factors rescues the processing defect, attenuates p53 accumulation, and increases replicative lifespan. To summarize, the nucleolar-5S RNP-p53 pathway functions as a senescence inducer in response to oncogenic and replicative stresses. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

  12. Binding of Signal Recognition Particle Gives Ribosome/Nascent Chain Complexes a Competitive Advantage in Endoplasmic Reticulum Membrane Interaction

    Science.gov (United States)

    Neuhof, Andrea; Rolls, Melissa M.; Jungnickel, Berit; Kalies, Kai-Uwe; Rapoport, Tom A.

    1998-01-01

    Most secretory and membrane proteins are sorted by signal sequences to the endoplasmic reticulum (ER) membrane early during their synthesis. Targeting of the ribosome-nascent chain complex (RNC) involves the binding of the signal sequence to the signal recognition particle (SRP), followed by an interaction of ribosome-bound SRP with the SRP receptor. However, ribosomes can also independently bind to the ER translocation channel formed by the Sec61p complex. To explain the specificity of membrane targeting, it has therefore been proposed that nascent polypeptide-associated complex functions as a cytosolic inhibitor of signal sequence- and SRP-independent ribosome binding to the ER membrane. We report here that SRP-independent binding of RNCs to the ER membrane can occur in the presence of all cytosolic factors, including nascent polypeptide-associated complex. Nontranslating ribosomes competitively inhibit SRP-independent membrane binding of RNCs but have no effect when SRP is bound to the RNCs. The protective effect of SRP against ribosome competition depends on a functional signal sequence in the nascent chain and is also observed with reconstituted proteoliposomes containing only the Sec61p complex and the SRP receptor. We conclude that cytosolic factors do not prevent the membrane binding of ribosomes. Instead, specific ribosome targeting to the Sec61p complex is provided by the binding of SRP to RNCs, followed by an interaction with the SRP receptor, which gives RNC–SRP complexes a selective advantage in membrane targeting over nontranslating ribosomes. PMID:9436994

  13. Protein-protein interactions within late pre-40S ribosomes.

    Directory of Open Access Journals (Sweden)

    Melody G Campbell

    2011-01-01

    Full Text Available Ribosome assembly in eukaryotic organisms requires more than 200 assembly factors to facilitate and coordinate rRNA transcription, processing, and folding with the binding of the ribosomal proteins. Many of these assembly factors bind and dissociate at defined times giving rise to discrete assembly intermediates, some of which have been partially characterized with regards to their protein and RNA composition. Here, we have analyzed the protein-protein interactions between the seven assembly factors bound to late cytoplasmic pre-40S ribosomes using recombinant proteins in binding assays. Our data show that these factors form two modules: one comprising Enp1 and the export adaptor Ltv1 near the beak structure, and the second comprising the kinase Rio2, the nuclease Nob1, and a regulatory RNA binding protein Dim2/Pno1 on the front of the head. The GTPase-like Tsr1 and the universally conserved methylase Dim1 are also peripherally connected to this second module. Additionally, in an effort to further define the locations for these essential proteins, we have analyzed the interactions between these assembly factors and six ribosomal proteins: Rps0, Rps3, Rps5, Rps14, Rps15 and Rps29. Together, these results and previous RNA-protein crosslinking data allow us to propose a model for the binding sites of these seven assembly factors. Furthermore, our data show that the essential kinase Rio2 is located at the center of the pre-ribosomal particle and interacts, directly or indirectly, with every other assembly factor, as well as three ribosomal proteins required for cytoplasmic 40S maturation. These data suggest that Rio2 could play a central role in regulating cytoplasmic maturation steps.

  14. The ribosome structure controls and directs mRNA entry, translocation and exit dynamics

    International Nuclear Information System (INIS)

    Kurkcuoglu, Ozge; Doruker, Pemra; Jernigan, Robert L; Sen, Taner Z; Kloczkowski, Andrzej

    2008-01-01

    The protein-synthesizing ribosome undergoes large motions to effect the translocation of tRNAs and mRNA; here, the domain motions of this system are explored with a coarse-grained elastic network model using normal mode analysis. Crystal structures are used to construct various model systems of the 70S complex with/without tRNA, elongation factor Tu and the ribosomal proteins. Computed motions reveal the well-known ratchet-like rotational motion of the large subunits, as well as the head rotation of the small subunit and the high flexibility of the L1 and L7/L12 stalks, even in the absence of ribosomal proteins. This result indicates that these experimentally observed motions during translocation are inherently controlled by the ribosomal shape and only partially dependent upon GTP hydrolysis. Normal mode analysis further reveals the mobility of A- and P-tRNAs to increase in the absence of the E-tRNA. In addition, the dynamics of the E-tRNA is affected by the absence of the ribosomal protein L1. The mRNA in the entrance tunnel interacts directly with helicase proteins S3 and S4, which constrain the mRNA in a clamp-like fashion, as well as with protein S5, which likely orients the mRNA to ensure correct translation. The ribosomal proteins S7, S11 and S18 may also be involved in assuring translation fidelity by constraining the mRNA at the exit site of the channel. The mRNA also interacts with the 16S 3' end forming the Shine–Dalgarno complex at the initiation step; the 3' end may act as a 'hook' to reel in the mRNA to facilitate its exit

  15. Mechanistic insights into phosphoprotein-binding FHA domains.

    Science.gov (United States)

    Liang, Xiangyang; Van Doren, Steven R

    2008-08-01

    [Structure: see text]. FHA domains are protein modules that switch signals in diverse biological pathways by monitoring the phosphorylation of threonine residues of target proteins. As part of the effort to gain insight into cellular avoidance of cancer, FHA domains involved in the cellular response to DNA damage have been especially well-characterized. The complete protein where the FHA domain resides and the interaction partners determine the nature of the signaling. Thus, a key biochemical question is how do FHA domains pick out their partners from among thousands of alternatives in the cell? This Account discusses the structure, affinity, and specificity of FHA domains and the formation of their functional structure. Although FHA domains share sequence identity at only five loop residues, they all fold into a beta-sandwich of two beta-sheets. The conserved arginine and serine of the recognition loops recognize the phosphorylation of the threonine targeted. Side chains emanating from loops that join beta-strand 4 with 5, 6 with 7, or 10 with 11 make specific contacts with amino acids of the ligand that tailor sequence preferences. Many FHA domains choose a partner in extended conformation, somewhat according to the residue three after the phosphothreonine in sequence (pT + 3 position). One group of FHA domains chooses a short carboxylate-containing side chain at pT + 3. Another group chooses a long, branched aliphatic side chain. A third group prefers other hydrophobic or uncharged polar side chains at pT + 3. However, another FHA domain instead chooses on the basis of pT - 2, pT - 3, and pT + 1 positions. An FHA domain from a marker of human cancer instead chooses a much longer protein fragment that adds a beta-strand to its beta-sheet and that presents hydrophobic residues from a novel helix to the usual recognition surface. This novel recognition site and more remote sites for the binding of other types of protein partners were predicted for the entire family

  16. Evidence for the interaction of the regulatory protein Ki-1/57 with p53 and its interacting proteins

    International Nuclear Information System (INIS)

    Nery, Flavia C.; Rui, Edmilson; Kuniyoshi, Tais M.; Kobarg, Joerg

    2006-01-01

    Ki-1/57 is a cytoplasmic and nuclear phospho-protein of 57 kDa and interacts with the adaptor protein RACK1, the transcription factor MEF2C, and the chromatin remodeling factor CHD3, suggesting that it might be involved in the regulation of transcription. Here, we describe yeast two-hybrid studies that identified a total of 11 proteins interacting with Ki-1/57, all of which interact or are functionally associated with p53 or other members of the p53 family of proteins. We further found that Ki-1/57 is able to interact with p53 itself in the yeast two-hybrid system when the interaction was tested directly. This interaction could be confirmed by pull down assays with purified proteins in vitro and by reciprocal co-immunoprecipitation assays from the human Hodgkin analogous lymphoma cell line L540. Furthermore, we found that the phosphorylation of p53 by PKC abolishes its interaction with Ki-1/57 in vitro

  17. A ribosome without RNA

    Directory of Open Access Journals (Sweden)

    Harold S Bernhardt

    2015-11-01

    Full Text Available It was Francis Crick who first asked why the ribosome contains so much RNA, and discussed the implications of this for the direct flow of genetic information from DNA to protein. Remarkable advances in our understanding of the ribosome and protein synthesis, including the recent publication of two mammalian mitochondrial ribosome structures, have shed new light on this intriguing aspect of evolution in molecular biology. We examine here whether RNA is indispensable for coded protein synthesis, or whether an all-protein ‘ribosome’ (or ‘synthosome’ might be possible, with a protein enzyme catalyzing peptide synthesis, and release factor-like protein adaptors able to read a message composed of deoxyribonucleotides. We also compare the RNA world hypothesis with the alternative ‘proteins first’ hypothesis in terms of their different understandings of the evolution of the ribosome, and whether this might have been preceded by an ancestral form of nonribosomal peptide synthesis catalyzed by protein enzymes.

  18. Topography and stoichiometry of acidic proteins in large ribosomal subunits from Artemia salina as determined by crosslinking

    International Nuclear Information System (INIS)

    Uchiumi, T.; Wahba, A.J.; Traut, R.R.

    1987-01-01

    The 60S subunits isolated from Artemia salina ribosomes were treated with the crosslinking reagent 2-iminothiolane under mild conditions. Proteins were extracted and fractions containing crosslinked acidic proteins were obtained by stepwise elution from CM-cellulose. Each fraction was analyzed by diagonal (two-dimensional nonreducing-reducing) NaDodSO 4 /polyacrylamide gel electrophoresis. Crosslinked proteins below the diagonal were radioiodinated and identified by two-dimensional acidic urea-NaDodSO 4 gel electrophoresis. Each of the acidic proteins P1 and P2 was crosslinked individually to the same third protein, PO. The fractions containing acidic proteins were also analyzed by two-dimensional nonequilibrium isoelectric focusing-NaDodSO 4 /polyacrylamide gel electrophoresis. Two crosslinked complexes were observed that coincide in isoelectric positions with monomeric P1 and P2, respectively. Both P1 and P2 appear to form crosslinked homodimers. These results suggest the presence in the 60S subunit of (P1) 2 and (P2) 2 dimers, each of which is anchored to PO. Protein PO appears to play the same role as L10 in Escherichia coli ribosomes and may form a pentameric complex with the two dimers in the 60S subunits

  19. Ribosome-catalyzed formation of an abnormal peptide analogue

    International Nuclear Information System (INIS)

    Roesser, J.R.; Chorghade, M.S.; Hecht, S.M.

    1986-01-01

    The peptidyl-tRNA analogue N-(chloracetyl) phenylalanyl-tRNA/sup Phe/ was prepared by chemical aminoacylation and prebound to the P site of Escherichia coli ribosomes in response to poly(uridylic acid). Admixture of phenylalanyl-tRNA/sup Phe/ to the A site resulted in the formation of two dipeptides, one of which was found by displacement of chloride ion from the peptidyl-tRNA. This constitutes the first example of ribosome-mediated formation of a peptide of altered connectivity and suggests a need for revision of the current model of peptide bond formation. Also suggested by the present finding is the feasibility of utilizing tRNAs to prepare polypeptides of altered connectivity in an in vitro protein biosynthesizing system. [ 32 P]-oligo(rA), [ 3 H]- and [ 14 C] phenylalanines were used in the assay of the peptidye-tRNA analogue

  20. Synthetic peptides and ribosomal proteins as substrate for 60S ribosomal protein kinase from yeast cells

    DEFF Research Database (Denmark)

    Grankowski, N; Gasior, E; Issinger, O G

    1993-01-01

    Kinetic studies on the 60S protein kinase were conducted with synthetic peptides and ribosomal proteins as substrate. Peptide RRREEESDDD proved to be the best synthetic substrate for this enzyme. The peptide has a sequence of amino acids which most closely resembles the structure of potential...... phosphorylation sites in natural substrates, i.e., acidic ribosomal proteins. The superiority of certain kinetic parameters for 60S kinase obtained with the native whole 80S ribosomes over those of the isolated fraction of acidic ribosomal proteins indicates that the affinity of 60S kinase to the specific protein...

  1. RINT-1 interacts with MSP58 within nucleoli and plays a role in ribosomal gene transcription.

    Science.gov (United States)

    Yang, Chuan-Pin; Kuo, Yu-Liang; Lee, Yi-Chao; Lee, Kuen-Haur; Chiang, Chi-Wu; Wang, Ju-Ming; Hsu, Che-Chia; Chang, Wen-Chang; Lin, Ding-Yen

    2016-09-16

    The nucleolus is the cellular site of ribosomal (r)DNA transcription and ribosome biogenesis. The 58-kDa microspherule protein (MSP58) is a nucleolar protein involved in rDNA transcription and cell proliferation. However, regulation of MSP58-mediated rDNA transcription remains unknown. Using a yeast two-hybrid system with MSP58 as bait, we isolated complementary (c)DNA encoding Rad50-interacting protein 1 (RINT-1), as a MSP58-binding protein. RINT-1 was implicated in the cell cycle checkpoint, membrane trafficking, Golgi apparatus and centrosome dynamic integrity, and telomere length control. Both in vitro and in vivo interaction assays showed that MSP58 directly interacts with RINT-1. Interestingly, microscopic studies revealed the co-localization of MSP58, RINT-1, and the upstream binding factor (UBF), a rRNA transcription factor, in the nucleolus. We showed that ectopic expression of MSP58 or RINT-1 resulted in decreased rRNA expression and rDNA promoter activity, whereas knockdown of MSP58 or RINT-1 by siRNA exerted the opposite effect. Coexpression of MSP58 and RINT-1 robustly decreased rRNA synthesis compared to overexpression of either protein alone, whereas depletion of RINT-1 from MSP58-transfected cells enhanced rRNA synthesis. We also found that MSP58, RINT-1, and the UBF were associated with the rDNA promoter using a chromatin immunoprecipitation assay. Because aberrant ribosome biogenesis contributes to neoplastic transformation, our results revealed a novel protein complex involved in the regulation of rRNA gene expression, suggesting a role for MSP58 and RINT-1 in cancer development. Copyright © 2016 Elsevier Inc. All rights reserved.

  2. Structural Disorder within Paramyxoviral Nucleoproteins and Phosphoproteins in Their Free and Bound Forms: From Predictions to Experimental Assessment

    Directory of Open Access Journals (Sweden)

    Johnny Habchi

    2015-07-01

    Full Text Available We herein review available computational and experimental data pointing to the abundance of structural disorder within the nucleoprotein (N and phosphoprotein (P from three paramyxoviruses, namely the measles (MeV, Nipah (NiV and Hendra (HeV viruses. We provide a detailed molecular description of the mechanisms governing the disorder-to-order transition that the intrinsically disordered C-terminal domain (NTAIL of their N proteins undergoes upon binding to the C-terminal X domain (PXD of the homologous P proteins. We also show that NTAIL–PXD complexes are “fuzzy”, i.e., they possess a significant residual disorder, and discuss the possible functional significance of this fuzziness. Finally, we emphasize the relevance of N–P interactions involving intrinsically disordered proteins as promising targets for new antiviral approaches, and end up summarizing the general functional advantages of disorder for viruses.

  3. The PAXgene(® tissue system preserves phosphoproteins in human tissue specimens and enables comprehensive protein biomarker research.

    Directory of Open Access Journals (Sweden)

    Sibylle Gündisch

    Full Text Available Precise quantitation of protein biomarkers in clinical tissue specimens is a prerequisite for accurate and effective diagnosis, prognosis, and personalized medicine. Although progress is being made, protein analysis from formalin-fixed and paraffin-embedded tissues is still challenging. In previous reports, we showed that the novel formalin-free tissue preservation technology, the PAXgene Tissue System, allows the extraction of intact and immunoreactive proteins from PAXgene-fixed and paraffin-embedded (PFPE tissues. In the current study, we focused on the analysis of phosphoproteins and the applicability of two-dimensional gel electrophoresis (2D-PAGE and enzyme-linked immunosorbent assay (ELISA to the analysis of a variety of malignant and non-malignant human tissues. Using western blot analysis, we found that phosphoproteins are quantitatively preserved in PFPE tissues, and signal intensities are comparable to that in paired, frozen tissues. Furthermore, proteins extracted from PFPE samples are suitable for 2D-PAGE and can be quantified by ELISA specific for denatured proteins. In summary, the PAXgene Tissue System reliably preserves phosphoproteins in human tissue samples, even after prolonged fixation or stabilization times, and is compatible with methods for protein analysis such as 2D-PAGE and ELISA. We conclude that the PAXgene Tissue System has the potential to serve as a versatile tissue fixative for modern pathology.

  4. The Arabidopsis gene DIG6 encodes a large 60S subunit nuclear export GTPase 1 that is involved in ribosome biogenesis and affects multiple auxin-regulated development processes

    KAUST Repository

    Zhao, Huayan

    2015-08-13

    The circularly permuted GTPase large subunit GTPase 1 (LSG1) is involved in the maturation step of the 60S ribosome and is essential for cell viability in yeast. Here, an Arabidopsis mutant dig6 (drought inhibited growth of lateral roots) was isolated. The mutant exhibited multiple auxin-related phenotypes, which included reduced lateral root number, altered leaf veins, and shorter roots. Genetic mapping combined with next-generation DNA sequencing identified that the mutation occurred in AtLSG1-2. This gene was highly expressed in regions of auxin accumulation. Ribosome profiling revealed that a loss of function of AtLSG1-2 led to decreased levels of monosomes, further demonstrating its role in ribosome biogenesis. Quantitative proteomics showed that the expression of certain proteins involved in ribosome biogenesis was differentially regulated, indicating that ribosome biogenesis processes were impaired in the mutant. Further investigations showed that an AtLSG1-2 deficiency caused the alteration of auxin distribution, response, and transport in plants. It is concluded that AtLSG1-2 is integral to ribosome biogenesis, consequently affecting auxin homeostasis and plant development.

  5. The Arabidopsis gene DIG6 encodes a large 60S subunit nuclear export GTPase 1 that is involved in ribosome biogenesis and affects multiple auxin-regulated development processes

    KAUST Repository

    Zhao, Huayan; Lü , Shiyou; Li, Ruixi; Chen, Tao; Zhang, Huoming; Cui, Peng; Ding, Feng; Liu, Pei; Wang, Guangchao; Xia, Yiji; Running, Mark P.; Xiong, Liming

    2015-01-01

    The circularly permuted GTPase large subunit GTPase 1 (LSG1) is involved in the maturation step of the 60S ribosome and is essential for cell viability in yeast. Here, an Arabidopsis mutant dig6 (drought inhibited growth of lateral roots) was isolated. The mutant exhibited multiple auxin-related phenotypes, which included reduced lateral root number, altered leaf veins, and shorter roots. Genetic mapping combined with next-generation DNA sequencing identified that the mutation occurred in AtLSG1-2. This gene was highly expressed in regions of auxin accumulation. Ribosome profiling revealed that a loss of function of AtLSG1-2 led to decreased levels of monosomes, further demonstrating its role in ribosome biogenesis. Quantitative proteomics showed that the expression of certain proteins involved in ribosome biogenesis was differentially regulated, indicating that ribosome biogenesis processes were impaired in the mutant. Further investigations showed that an AtLSG1-2 deficiency caused the alteration of auxin distribution, response, and transport in plants. It is concluded that AtLSG1-2 is integral to ribosome biogenesis, consequently affecting auxin homeostasis and plant development.

  6. The Р60-S6K1 isoform of ribosomal protein S6 kinase 1 is a product of alternative mRNA translation

    Directory of Open Access Journals (Sweden)

    I. V. Zaiets

    2018-07-01

    Full Text Available Ribosomal protein S6 kinase 1 (S6K1 is a well-known downstream effector of mTORC1 (mechanistic target of rapamycin complex 1 participating primarily in the regulation of cell growth and metabolism. Deregulation of mTOR/S6K1 signaling can promote numerous human pathologies, including cancer, neurodegeneration, cardiovascular disease, and metabolic disorders. As existing data suggest, the S6K1 gene encodes several protein isoforms, including p85-S6K1, p70-S6K1, and p60-S6K1. The two of these isoforms, p85-S6K1 and p70-S6K1, were extensively studied to date. The origin and functional significance of the p60-S6K1 isoform remains a mystery, however, it was suggested that the isoform could be a product of alternative S6K1 mRNA translation. Herein we report the generation of HEK-293 cells exclusively expressing p60-S6K1 as a result of CRISPR/Cas9-mediated inactivation of p85/p70-S6K1 translation. Moreover, the generated modified cells displayed the elevated level of p60-S6K1 expression compared to that in wild-type HEK-293 cells. Our data confirm an assumption that p60-S6K1 is alternatively translated, most probably, from the common for both p70- and p85-S6K1 mRNA transcript and reveal a link between p60-S6K1 expression and such cellular processes as cell proliferation and motility. In addition, our findings indicate that the p60-S6K1 isoform of S6K1 may undergo a mode of regulation distinct from p70- and p85-S6K1 due to the absence of mTOR-regulated p60-S6K1 phosphorylation at T389 that is important for S6K1 activation.

  7. Adenovirus type 2 endopeptidase: an unusual phosphoprotein enzyme matured by autocatalysis

    Energy Technology Data Exchange (ETDEWEB)

    Chatterjee, P.K.; Flint, S.J.

    1987-02-01

    A 19-kDa protein, present in low copy number in purified adenovirus type 2, has been characterized. Several criteria were used to establish that this protein is neither a degradation product of the known structural proteins of the virion nor a minor, unusually modified, form of protein VII. This 19-kDa protein, unlike other virion proteins, possesses alkali-resistant phosphoamino acids. Analysis by partial proteolysis indicated that it is related to a 23-kDa phosphoprotein present in H2ts-1 virions assembled in infected cells maintained at 39/sup 0/C. Affinity labeling with (/sup 3/H)diisopropyl fluorophosphate showed that the 19-kDa protein contains the active site for a serine protease. The authors, therefore, conclude that the 19-kDa protein is the active form of the adenovirus-encoded endopeptidase, defined by the H2ts-1 mutation, and is synthesized as a 23-kDa precursor that appears to mature by autocatalysis.

  8. Structure of Ribosomal Silencing Factor Bound to Mycobacterium tuberculosis Ribosome.

    Science.gov (United States)

    Li, Xiaojun; Sun, Qingan; Jiang, Cai; Yang, Kailu; Hung, Li-Wei; Zhang, Junjie; Sacchettini, James C

    2015-10-06

    The ribosomal silencing factor RsfS slows cell growth by inhibiting protein synthesis during periods of diminished nutrient availability. The crystal structure of Mycobacterium tuberculosis (Mtb) RsfS, together with the cryo-electron microscopy (EM) structure of the large subunit 50S of Mtb ribosome, reveals how inhibition of protein synthesis by RsfS occurs. RsfS binds to the 50S at L14, which, when occupied, blocks the association of the small subunit 30S. Although Mtb RsfS is a dimer in solution, only a single subunit binds to 50S. The overlap between the dimer interface and the L14 binding interface confirms that the RsfS dimer must first dissociate to a monomer in order to bind to L14. RsfS interacts primarily through electrostatic and hydrogen bonding to L14. The EM structure shows extended rRNA density that it is not found in the Escherichia coli ribosome, the most striking of these being the extended RNA helix of H54a. Copyright © 2015 Elsevier Ltd. All rights reserved.

  9. Studies on the catalytic rate constant of ribosomal peptidyltransferase.

    Science.gov (United States)

    Synetos, D; Coutsogeorgopoulos, C

    1987-02-20

    A detailed kinetic analysis of a model reaction for the ribosomal peptidyltransferase is described, using fMet-tRNA or Ac-Phe-tRNA as the peptidyl donor and puromycin as the acceptor. The initiation complex (fMet-tRNA X AUG X 70 S ribosome) or (Ac-Phe-tRNA X poly(U) X 70 S ribosome) (complex C) is isolated and then reacted with excess puromycin (S) to give fMet-puromycin or Ac-Phe-puromycin. This reaction (puromycin reaction) is first order at all concentrations of S tested. An important asset of this kinetic analysis is the fact that the relationship between the first order rate constant kobs and [S] shows hyperbolic saturation and that the value of kobs at saturating [S] is a measure of the catalytic rate constant (k cat) of peptidyltransferase in the puromycin reaction. With fMet-tRNA as the donor, this kcat of peptidyltransferase is 8.3 min-1 when the 0.5 M NH4Cl ribosomal wash is present, compared to 3.8 min-1 in its absence. The kcat of peptidyltransferase is 2.0 min-1 when Ac-Phe-tRNA replaces fMet-tRNA in the presence of the ribosomal wash and decreases to 0.8 min-1 in its absence. This kinetic procedure is the best method available for evaluating changes in the activity of peptidyltransferase in vitro. The results suggest that peptidyltransferase is subjected to activation by the binding of fMet-tRNA to the 70 S initiation complex.

  10. Differential Stoichiometry among Core Ribosomal Proteins

    Directory of Open Access Journals (Sweden)

    Nikolai Slavov

    2015-11-01

    Full Text Available Understanding the regulation and structure of ribosomes is essential to understanding protein synthesis and its dysregulation in disease. While ribosomes are believed to have a fixed stoichiometry among their core ribosomal proteins (RPs, some experiments suggest a more variable composition. Testing such variability requires direct and precise quantification of RPs. We used mass spectrometry to directly quantify RPs across monosomes and polysomes of mouse embryonic stem cells (ESC and budding yeast. Our data show that the stoichiometry among core RPs in wild-type yeast cells and ESC depends both on the growth conditions and on the number of ribosomes bound per mRNA. Furthermore, we find that the fitness of cells with a deleted RP-gene is inversely proportional to the enrichment of the corresponding RP in polysomes. Together, our findings support the existence of ribosomes with distinct protein composition and physiological function.

  11. Control of ribosome formation in rat heart

    International Nuclear Information System (INIS)

    Russo, L.A.

    1987-01-01

    Diabetes of 9 days duration produced a 17% diminution in the rate of total protein synthesis in rat hearts perfused as Langendorff preparations supplied with glucose, plasma levels of amino acids, and 400 μU/ml insulin. This reduction was attributable to a decrease in efficiency of protein synthesis and total RNA content. Total messenger RNA content decreased in diabetic hearts in proportion to the reduction in total RNA. Diabetes also resulted in diminished ribosome content as reflected by the induction in total RNA. Ribosome production was investigated by monitoring incorporation of [ 3 H]phenylalanine into the proteins of cytoplasmic ribosomes. Rates of ribosome formation in diabetic hearts were as fast as control rates in the presence of insulin, and were faster than control rates in the absence of the hormone. These results indicated that ribosome content fell in diabetic hearts despite unchanged or faster rates of ribosome formation

  12. Cryo-EM structure of the archaeal 50S ribosomal subunit in complex with initiation factor 6 and implications for ribosome evolution

    DEFF Research Database (Denmark)

    Greber, Basil J; Boehringer, Daniel; Godinic-Mikulcic, Vlatka

    2012-01-01

    additional components of the translation machinery with eukaryotes that are absent in bacteria. One of these translation factors is initiation factor 6 (IF6), which associates with the large ribosomal subunit. We have reconstructed the 50S ribosomal subunit from the archaeon Methanothermobacter...... between this archaeal ribosome and eukaryotic ribosomes but are mostly absent in bacteria and in some archaeal lineages. Furthermore, the structure reveals that, in spite of highly divergent evolutionary trajectories of the ribosomal particle and the acquisition of novel functions of IF6 in eukaryotes......, the molecular binding of IF6 on the ribosome is conserved between eukaryotes and archaea. The structure also provides a snapshot of the reductive evolution of the archaeal ribosome and offers new insights into the evolution of the translation system in archaea....

  13. Kinetic pathway of 40S ribosomal subunit recruitment to hepatitis C virus internal ribosome entry site.

    Science.gov (United States)

    Fuchs, Gabriele; Petrov, Alexey N; Marceau, Caleb D; Popov, Lauren M; Chen, Jin; O'Leary, Seán E; Wang, Richard; Carette, Jan E; Sarnow, Peter; Puglisi, Joseph D

    2015-01-13

    Translation initiation can occur by multiple pathways. To delineate these pathways by single-molecule methods, fluorescently labeled ribosomal subunits are required. Here, we labeled human 40S ribosomal subunits with a fluorescent SNAP-tag at ribosomal protein eS25 (RPS25). The resulting ribosomal subunits could be specifically labeled in living cells and in vitro. Using single-molecule Förster resonance energy transfer (FRET) between RPS25 and domain II of the hepatitis C virus (HCV) internal ribosome entry site (IRES), we measured the rates of 40S subunit arrival to the HCV IRES. Our data support a single-step model of HCV IRES recruitment to 40S subunits, irreversible on the initiation time scale. We furthermore demonstrated that after binding, the 40S:HCV IRES complex is conformationally dynamic, undergoing slow large-scale rearrangements. Addition of translation extracts suppresses these fluctuations, funneling the complex into a single conformation on the 80S assembly pathway. These findings show that 40S:HCV IRES complex formation is accompanied by dynamic conformational rearrangements that may be modulated by initiation factors.

  14. Chromophore-assisted light inactivation of pKi-67 leads to inhibition of ribosomal RNA synthesis.

    Science.gov (United States)

    Rahmanzadeh, R; Hüttmann, G; Gerdes, J; Scholzen, T

    2007-06-01

    Expression of the nuclear Ki-67 protein (pKi-67) is strongly associated with cell proliferation. For this reason, antibodies against this protein are widely used as prognostic tools for the assessment of cell proliferation in biopsies from cancer patients. Despite this broad application in histopathology, functional evidence for the physiological role of pKi-67 is still missing. Recently, we proposed a function of pKi-67 in the early steps of ribosomal RNA (rRNA) synthesis. Here, we have examined the involvement of pKi-67 in this process by photochemical inhibition using chromophore-assisted light inactivation (CALI). Anti-pKi-67 antibodies were labelled with the fluorochrome fluorescein 5(6)-isothiocyanate and were irradiated after binding to their target protein. Performing CALI in vitro on cell lysates led to specific cross-linking of pKi-67. Moreover, the upstream binding factor (UBF) necessary for rRNA transcription was also partly subjected to cross-link formation, indicating a close spatial proximity of UBF and pKi-67. CALI in living cells, using micro-injected antibody, caused a striking relocalization of UBF from foci within the nucleoli to spots located at the nucleolar rim or within the nucleoplasm. pKi-67-CALI resulted in dramatic inhibition of RNA polymerase I-dependent nucleolar rRNA synthesis, whereas RNA polymerase II-dependent nucleoplasmic RNA synthesis remained almost unaltered. Our data presented here argue for a crucial role of pKi-67 in RNA polymerase I-dependent nucleolar rRNA synthesis.

  15. Cryo-EM Structure of the Archaeal 50S Ribosomal Subunit in Complex with Initiation Factor 6 and Implications for Ribosome Evolution

    Science.gov (United States)

    Greber, Basil J.; Boehringer, Daniel; Godinic-Mikulcic, Vlatka; Crnkovic, Ana; Ibba, Michael; Weygand-Durasevic, Ivana; Ban, Nenad

    2013-01-01

    Translation of mRNA into proteins by the ribosome is universally conserved in all cellular life. The composition and complexity of the translation machinery differ markedly between the three domains of life. Organisms from the domain Archaea show an intermediate level of complexity, sharing several additional components of the translation machinery with eukaryotes that are absent in bacteria. One of these translation factors is initiation factor 6 (IF6), which associates with the large ribosomal subunit. We have reconstructed the 50S ribosomal subunit from the archaeon Methanothermobacter thermautotrophicus in complex with archaeal IF6 at 6.6 Å resolution using cryo-electron microscopy (EM). The structure provides detailed architectural insights into the 50S ribosomal subunit from a methanogenic archaeon through identification of the rRNA expansion segments and ribosomal proteins that are shared between this archaeal ribosome and eukaryotic ribosomes but are mostly absent in bacteria and in some archaeal lineages. Furthermore, the structure reveals that, in spite of highly divergent evolutionary trajectories of the ribosomal particle and the acquisition of novel functions of IF6 in eukaryotes, the molecular binding of IF6 on the ribosome is conserved between eukaryotes and archaea. The structure also provides a snapshot of the reductive evolution of the archaeal ribosome and offers new insights into the evolution of the translation system in archaea. PMID:22306461

  16. The ribosome-associated complex antagonizes prion formation in yeast.

    Science.gov (United States)

    Amor, Alvaro J; Castanzo, Dominic T; Delany, Sean P; Selechnik, Daniel M; van Ooy, Alex; Cameron, Dale M

    2015-01-01

    The number of known fungal proteins capable of switching between alternative stable conformations is steadily increasing, suggesting that a prion-like mechanism may be broadly utilized as a means to propagate altered cellular states. To gain insight into the mechanisms by which cells regulate prion formation and toxicity we examined the role of the yeast ribosome-associated complex (RAC) in modulating both the formation of the [PSI(+)] prion - an alternative conformer of Sup35 protein - and the toxicity of aggregation-prone polypeptides. The Hsp40 RAC chaperone Zuo1 anchors the RAC to ribosomes and stimulates the ATPase activity of the Hsp70 chaperone Ssb. We found that cells lacking Zuo1 are sensitive to over-expression of some aggregation-prone proteins, including the Sup35 prion domain, suggesting that co-translational protein misfolding increases in Δzuo1 strains. Consistent with this finding, Δzuo1 cells exhibit higher frequencies of spontaneous and induced prion formation. Cells expressing mutant forms of Zuo1 lacking either a C-terminal charged region required for ribosome association, or the J-domain responsible for Ssb ATPase stimulation, exhibit similarly high frequencies of prion formation. Our findings are consistent with a role for the RAC in chaperoning nascent Sup35 to regulate folding of the N-terminal prion domain as it emerges from the ribosome.

  17. Ribosomal history reveals origins of modern protein synthesis.

    Directory of Open Access Journals (Sweden)

    Ajith Harish

    Full Text Available The origin and evolution of the ribosome is central to our understanding of the cellular world. Most hypotheses posit that the ribosome originated in the peptidyl transferase center of the large ribosomal subunit. However, these proposals do not link protein synthesis to RNA recognition and do not use a phylogenetic comparative framework to study ribosomal evolution. Here we infer evolution of the structural components of the ribosome. Phylogenetic methods widely used in morphometrics are applied directly to RNA structures of thousands of molecules and to a census of protein structures in hundreds of genomes. We find that components of the small subunit involved in ribosomal processivity evolved earlier than the catalytic peptidyl transferase center responsible for protein synthesis. Remarkably, subunit RNA and proteins coevolved, starting with interactions between the oldest proteins (S12 and S17 and the oldest substructure (the ribosomal ratchet in the small subunit and ending with the rise of a modern multi-subunit ribosome. Ancestral ribonucleoprotein components show similarities to in vitro evolved RNA replicase ribozymes and protein structures in extant replication machinery. Our study therefore provides important clues about the chicken-or-egg dilemma associated with the central dogma of molecular biology by showing that ribosomal history is driven by the gradual structural accretion of protein and RNA structures. Most importantly, results suggest that functionally important and conserved regions of the ribosome were recruited and could be relics of an ancient ribonucleoprotein world.

  18. Anti-Human Endoglin (hCD105) Immunotoxin-Containing Recombinant Single Chain Ribosome-Inactivating Protein Musarmin 1.

    Science.gov (United States)

    Barriuso, Begoña; Antolín, Pilar; Arias, F Javier; Girotti, Alessandra; Jiménez, Pilar; Cordoba-Diaz, Manuel; Cordoba-Diaz, Damián; Girbés, Tomás

    2016-06-10

    Endoglin (CD105) is an accessory component of the TGF-β receptor complex, which is expressed in a number of tissues and over-expressed in the endothelial cells of tumor neovasculature. Targeting endoglin with immunotoxins containing type 2 ribosome-inactivating proteins has proved an effective tool to reduce blood supply to B16 mice tumor xenografts. We prepared anti-endoglin immunotoxin (IT)-containing recombinant musarmin 1 (single chain ribosome-inactivating proteins) linked to the mouse anti-human CD105 44G4 mouse monoclonal antibody via N-succinimidyl 3-(2-pyridyldithio) propionate (SPDP). The immunotoxin specifically killed L929 fibroblast mouse cells transfected with the short form of human endoglin with IC50 values in the range of 5 × 10(-10) to 10(-9) M.

  19. Detection of Ribosomal DNA Sequence Polymorphisms in the Protist Plasmodiophora brassicae for the Identification of Geographical Isolates

    Directory of Open Access Journals (Sweden)

    Rawnak Laila

    2017-01-01

    Full Text Available Clubroot is a soil-borne disease caused by the protist Plasmodiophora brassicae (P. brassicae. It is one of the most economically important diseases of Brassica rapa and other cruciferous crops as it can cause remarkable yield reductions. Understanding P. brassicae genetics, and developing efficient molecular markers, is essential for effective detection of harmful races of this pathogen. Samples from 11 Korean field populations of P. brassicae (geographic isolates, collected from nine different locations in South Korea, were used in this study. Genomic DNA was extracted from the clubroot-infected samples to sequence the ribosomal DNA. Primers and probes for P. brassicae were designed using a ribosomal DNA gene sequence from a Japanese strain available in GenBank (accession number AB526843; isolate NGY. The nuclear ribosomal DNA (rDNA sequence of P. brassicae, comprising 6932 base pairs (bp, was cloned and sequenced and found to include the small subunits (SSUs and a large subunit (LSU, internal transcribed spacers (ITS1 and ITS2, and a 5.8s. Sequence variation was observed in both the SSU and LSU. Four markers showed useful differences in high-resolution melting analysis to identify nucleotide polymorphisms including single- nucleotide polymorphisms (SNPs, oligonucleotide polymorphisms, and insertions/deletions (InDels. A combination of three markers was able to distinguish the geographical isolates into two groups.

  20. Epigenetic up-regulation of ribosome biogenesis and more aggressive phenotype triggered by the lack of the histone demethylase JHDM1B in mammary epithelial cells.

    Science.gov (United States)

    Galbiati, Alice; Penzo, Marianna; Bacalini, Maria Giulia; Onofrillo, Carmine; Guerrieri, Ania Naila; Garagnani, Paolo; Franceschi, Claudio; Treré, Davide; Montanaro, Lorenzo

    2017-06-06

    The alterations of ribosome biogenesis and protein synthesis play a direct role in the development of tumors. The accessibility and transcription of ribosomal genes is controlled at several levels, with their epigenetic regulation being one of the most important. Here we explored the JmjC domain-containing histone demethylase 1B (JHDM1B) function in the epigenetic control of rDNA transcription. Since JHDM1B is a negative regulator of gene transcription, we focused on the effects induced by JHDM1B knock-down (KD). We studied the consequences of stable inducible JHDM1B silencing in cell lines derived from transformed and untransformed mammary epithelial cells. In these cellular models, prolonged JHDM1B downregulation triggered a surge of 45S pre-rRNA transcription and processing, associated with a re-modulation of the H3K36me2 levels at rDNA loci and with changes in DNA methylation of specific CpG sites in rDNA genes. We also found that after JHDM1B KD, cells showed a higher ribosome content: which were engaged in mRNA translation. JHDM1B KD and the consequent stimulation of ribosomes biogenesis conferred more aggressive features to the tested cellular models, which acquired a greater clonogenic, staminal and invasive potential. Taken together, these data indicate that the reduction of JHDM1B leads to a more aggressive cellular phenotype in mammary gland cells, by virtue of its negative regulatory activity on ribosome biogenesis.

  1. Post-transcriptional regulation of ribosome biogenesis in yeast

    Directory of Open Access Journals (Sweden)

    Isabelle C. Kos-Braun

    2017-05-01

    Full Text Available Most microorganisms are exposed to the constantly and often rapidly changing environment. As such they evolved mechanisms to balance their metabolism and energy expenditure with the resources available to them. When resources become scarce or conditions turn out to be unfavourable for growth, cells reduce their metabolism and energy usage to survive. One of the major energy consuming processes in the cell is ribosome biogenesis. Unsurprisingly, cells encountering adverse conditions immediately shut down production of new ribosomes. It is well established that nutrient depletion leads to a rapid repression of transcription of the genes encoding ribosomal proteins, ribosome biogenesis factors as well as ribosomal RNA (rRNA. However, if pre-rRNA processing and ribosome assembly are regulated post-transcriptionally remains largely unclear. We have recently uncovered that the yeast Saccharomyces cerevisiae rapidly switches between two alternative pre-rRNA processing pathways depending on the environmental conditions. Our findings reveal a new level of complexity in the regulation of ribosome biogenesis.

  2. Ribosomal Antibiotics: Contemporary Challenges

    Directory of Open Access Journals (Sweden)

    Tamar Auerbach-Nevo

    2016-06-01

    Full Text Available Most ribosomal antibiotics obstruct distinct ribosomal functions. In selected cases, in addition to paralyzing vital ribosomal tasks, some ribosomal antibiotics are involved in cellular regulation. Owing to the global rapid increase in the appearance of multi-drug resistance in pathogenic bacterial strains, and to the extremely slow progress in developing new antibiotics worldwide, it seems that, in addition to the traditional attempts at improving current antibiotics and the intensive screening for additional natural compounds, this field should undergo substantial conceptual revision. Here, we highlight several contemporary issues, including challenging the common preference of broad-range antibiotics; the marginal attention to alterations in the microbiome population resulting from antibiotics usage, and the insufficient awareness of ecological and environmental aspects of antibiotics usage. We also highlight recent advances in the identification of species-specific structural motifs that may be exploited for the design and the creation of novel, environmental friendly, degradable, antibiotic types, with a better distinction between pathogens and useful bacterial species in the microbiome. Thus, these studies are leading towards the design of “pathogen-specific antibiotics,” in contrast to the current preference of broad range antibiotics, partially because it requires significant efforts in speeding up the discovery of the unique species motifs as well as the clinical pathogen identification.

  3. Effect of primary and secondary radicals on chain breaks in ribosomal RNA in E. coli ribosomes

    International Nuclear Information System (INIS)

    Singh, H.; Bishop, J.

    1984-01-01

    It has been shown previously that, in dilute aerated solutions, ribosomes are inactivated by OH radicals and by secondary radicals produced from added alcohols (Singh and Vadasz 1983 a). In de-aerated solutions, both radicalH and e - sub(aq) also inactivate ribosomes (Singh and Vadasz 1983 b). The results of these studies and other on different systems (Adams et al. 1973, Aldrich and Cundall 1969, Dewey and Stein 1970, Masuda et al. 1971, Nabben et al. 1982, 1983, Samuni et al. 1980, Singh and Singh 1982) have shown that damage to biological systems occurs by diverse mechanisms. One of these mechanisms involves chain breaks in RNA (Pollard and Weller 1967). The purpose of this study was to determine which of the primary and secondary radicals cause chain breaks in ribosomal RNA (rRNA) within the ribosomes. (author)

  4. A combined quantitative mass spectrometry and electron microscopy analysis of ribosomal 30S subunit assembly in E. coli.

    Science.gov (United States)

    Sashital, Dipali G; Greeman, Candacia A; Lyumkis, Dmitry; Potter, Clinton S; Carragher, Bridget; Williamson, James R

    2014-10-14

    Ribosome assembly is a complex process involving the folding and processing of ribosomal RNAs (rRNAs), concomitant binding of ribosomal proteins (r-proteins), and participation of numerous accessory cofactors. Here, we use a quantitative mass spectrometry/electron microscopy hybrid approach to determine the r-protein composition and conformation of 30S ribosome assembly intermediates in Escherichia coli. The relative timing of assembly of the 3' domain and the formation of the central pseudoknot (PK) structure depends on the presence of the assembly factor RimP. The central PK is unstable in the absence of RimP, resulting in the accumulation of intermediates in which the 3'-domain is unanchored and the 5'-domain is depleted for r-proteins S5 and S12 that contact the central PK. Our results reveal the importance of the cofactor RimP in central PK formation, and introduce a broadly applicable method for characterizing macromolecular assembly in cells.

  5. Placeholder factors in ribosome biogenesis: please, pave my way

    Directory of Open Access Journals (Sweden)

    Francisco J. Espinar-Marchena

    2017-04-01

    Full Text Available The synthesis of cytoplasmic eukaryotic ribosomes is an extraordinarily energy-demanding cellular activity that occurs progressively from the nucleolus to the cytoplasm. In the nucleolus, precursor rRNAs associate with a myriad of trans-acting factors and some ribosomal proteins to form pre-ribosomal particles. These factors include snoRNPs, nucleases, ATPases, GTPases, RNA helicases, and a vast list of proteins with no predicted enzymatic activity. Their coordinate activity orchestrates in a spatiotemporal manner the modification and processing of precursor rRNAs, the rearrangement reactions required for the formation of productive RNA folding intermediates, the ordered assembly of the ribosomal proteins, and the export of pre-ribosomal particles to the cytoplasm; thus, providing speed, directionality and accuracy to the overall process of formation of translation-competent ribosomes. Here, we review a particular class of trans-acting factors known as “placeholders”. Placeholder factors temporarily bind selected ribosomal sites until these have achieved a structural context that is appropriate for exchanging the placeholder with another site-specific binding factor. By this strategy, placeholders sterically prevent premature recruitment of subsequently binding factors, premature formation of structures, avoid possible folding traps, and act as molecular clocks that supervise the correct progression of pre-ribosomal particles into functional ribosomal subunits. We summarize the current understanding of those factors that delay the assembly of distinct ribosomal proteins or subsequently bind key sites in pre-ribosomal particles. We also discuss recurrent examples of RNA-protein and protein-protein mimicry between rRNAs and/or factors, which have clear functional implications for the ribosome biogenesis pathway.

  6. Phylogenetic Information Content of Copepoda Ribosomal DNA Repeat Units: ITS1 and ITS2 Impact

    Science.gov (United States)

    Zagoskin, Maxim V.; Lazareva, Valentina I.; Grishanin, Andrey K.; Mukha, Dmitry V.

    2014-01-01

    The utility of various regions of the ribosomal repeat unit for phylogenetic analysis was examined in 16 species representing four families, nine genera, and two orders of the subclass Copepoda (Crustacea). Fragments approximately 2000 bp in length containing the ribosomal DNA (rDNA) 18S and 28S gene fragments, the 5.8S gene, and the internal transcribed spacer regions I and II (ITS1 and ITS2) were amplified and analyzed. The DAMBE (Data Analysis in Molecular Biology and Evolution) software was used to analyze the saturation of nucleotide substitutions; this test revealed the suitability of both the 28S gene fragment and the ITS1/ITS2 rDNA regions for the reconstruction of phylogenetic trees. Distance (minimum evolution) and probabilistic (maximum likelihood, Bayesian) analyses of the data revealed that the 28S rDNA and the ITS1 and ITS2 regions are informative markers for inferring phylogenetic relationships among families of copepods and within the Cyclopidae family and associated genera. Split-graph analysis of concatenated ITS1/ITS2 rDNA regions of cyclopoid copepods suggested that the Mesocyclops, Thermocyclops, and Macrocyclops genera share complex evolutionary relationships. This study revealed that the ITS1 and ITS2 regions potentially represent different phylogenetic signals. PMID:25215300

  7. Escherichia coli Phosphoenolpyruvate Dependent Phosphotransferase System. NMR Studies of the Conformation of HPr and P-HPr and the Mechanism of Energy Coupling

    NARCIS (Netherlands)

    Dooijewaard, G.; Roossien, F.F.; Robillard, G.T.

    1979-01-01

    1H and 31P nuclear magnetic resonance investigations of the phosphoprotein intermediate P-HPr and the parent molecule HPr of the E. coli phosphoenolpyruvate dependent phosphotransferase system (PTS) show that HPr can exist in two conformations. These conformations influence the protonation state of

  8. Diverse Regulators of Human Ribosome Biogenesis Discovered by Changes in Nucleolar Number

    Directory of Open Access Journals (Sweden)

    Katherine I. Farley-Barnes

    2018-02-01

    Full Text Available Ribosome biogenesis is a highly regulated, essential cellular process. Although studies in yeast have established some of the biological principles of ribosome biogenesis, many of the intricacies of its regulation in higher eukaryotes remain unknown. To understand how ribosome biogenesis is globally integrated in human cells, we conducted a genome-wide siRNA screen for regulators of nucleolar number. We found 139 proteins whose depletion changed the number of nucleoli per nucleus from 2–3 to only 1 in human MCF10A cells. Follow-up analyses on 20 hits found many (90% to be essential for the nucleolar functions of rDNA transcription (7, pre-ribosomal RNA (pre-rRNA processing (16, and/or global protein synthesis (14. This genome-wide analysis exploits the relationship between nucleolar number and function to discover diverse cellular pathways that regulate the making of ribosomes and paves the way for further exploration of the links between ribosome biogenesis and human disease.

  9. Anti-Human Endoglin (hCD105 Immunotoxin—Containing Recombinant Single Chain Ribosome-Inactivating Protein Musarmin 1

    Directory of Open Access Journals (Sweden)

    Begoña Barriuso

    2016-06-01

    Full Text Available Endoglin (CD105 is an accessory component of the TGF-β receptor complex, which is expressed in a number of tissues and over-expressed in the endothelial cells of tumor neovasculature. Targeting endoglin with immunotoxins containing type 2 ribosome-inactivating proteins has proved an effective tool to reduce blood supply to B16 mice tumor xenografts. We prepared anti-endoglin immunotoxin (IT—containing recombinant musarmin 1 (single chain ribosome-inactivating proteins linked to the mouse anti-human CD105 44G4 mouse monoclonal antibody via N-succinimidyl 3-(2-pyridyldithio propionate (SPDP. The immunotoxin specifically killed L929 fibroblast mouse cells transfected with the short form of human endoglin with IC50 values in the range of 5 × 10−10 to 10−9 M.

  10. Diamond Blackfan Anemia at the Crossroad between Ribosome Biogenesis and Heme Metabolism

    Directory of Open Access Journals (Sweden)

    Deborah Chiabrando

    2010-01-01

    Full Text Available Diamond-Blackfan anemia (DBA is a rare, pure red-cell aplasia that presents during infancy. Approximately 40% of cases are associated with other congenital defects, particularly malformations of the upper limb or craniofacial region. Mutations in the gene coding for the ribosomal protein RPS19 have been identified in 25% of patients with DBA, with resulting impairment of 18S rRNA processing and 40S ribosomal subunit formation. Moreover, mutations in other ribosomal protein coding genes account for about 25% of other DBA cases. Recently, the analysis of mice from which the gene coding for the heme exporter Feline Leukemia Virus subgroup C Receptor (FLVCR1 is deleted suggested that this gene may be involved in the pathogenesis of DBA. FLVCR1-null mice show a phenotype resembling that of DBA patients, including erythroid failure and malformations. Interestingly, some DBA patients have disease linkage to chromosome 1q31, where FLVCR1 is mapped. Moreover, it has been reported that cells from DBA patients express alternatively spliced isoforms of FLVCR1 which encode non-functional proteins. Herein, we review the known roles of RPS19 and FLVCR1 in ribosome function and heme metabolism respectively, and discuss how the deficiency of a ribosomal protein or of a heme exporter may result in the same phenotype.

  11. Rrp12 and the Exportin Crm1 participate in late assembly events in the nucleolus during 40S ribosomal subunit biogenesis.

    Science.gov (United States)

    Moriggi, Giulia; Nieto, Blanca; Dosil, Mercedes

    2014-12-01

    During the biogenesis of small ribosomal subunits in eukaryotes, the pre-40S particles formed in the nucleolus are rapidly transported to the cytoplasm. The mechanisms underlying the nuclear export of these particles and its coordination with other biogenesis steps are mostly unknown. Here we show that yeast Rrp12 is required for the exit of pre-40S particles to the cytoplasm and for proper maturation dynamics of upstream 90S pre-ribosomes. Due to this, in vivo elimination of Rrp12 leads to an accumulation of nucleoplasmic 90S to pre-40S transitional particles, abnormal 35S pre-rRNA processing, delayed elimination of processing byproducts, and no export of intermediate pre-40S complexes. The exportin Crm1 is also required for the same pre-ribosome maturation events that involve Rrp12. Thus, in addition to their implication in nuclear export, Rrp12 and Crm1 participate in earlier biosynthetic steps that take place in the nucleolus. Our results indicate that, in the 40S subunit synthesis pathway, the completion of early pre-40S particle assembly, the initiation of byproduct degradation and the priming for nuclear export occur in an integrated manner in late 90S pre-ribosomes.

  12. Evolutionary Conservation of the Ribosomal Biogenesis Factor Rbm19/Mrd1: Implications for Function

    OpenAIRE

    Kallberg, Yvonne; Segerstolpe, Åsa; Lackmann, Fredrik; Persson, Bengt; Wieslander, Lars

    2012-01-01

    Ribosome biogenesis in eukaryotes requires coordinated folding and assembly of a pre-rRNA into sequential pre-rRNA-protein complexes in which chemical modifications and RNA cleavages occur. These processes require many small nucleolar RNAs (snoRNAs) and proteins. Rbm19/Mrd1 is one such protein that is built from multiple RNA-binding domains (RBDs). We find that Rbm19/Mrd1 with five RBDs is present in all branches of the eukaryotic phylogenetic tree, except in animals and Choanoflagellates, th...

  13. Ribosomal trafficking is reduced in Schwann cells following induction of myelination

    Directory of Open Access Journals (Sweden)

    James M. Love

    2015-08-01

    Full Text Available Local synthesis of proteins within the Schwann cell periphery is extremely important for efficient process extension and myelination, when cells undergo dramatic changes in polarity and geometry. Still, it is unclear how ribosomal distributions are developed and maintained within Schwann cell projections to sustain local translation. In this multi-disciplinary study, we expressed a plasmid encoding a fluorescently labeled ribosomal subunit (L4-GFP in cultured primary rat Schwann cells. This enabled the generation of high-resolution, quantitative data on ribosomal distributions and trafficking dynamics within Schwann cells during early stages of myelination, induced by ascorbic acid treatment. Ribosomes were distributed throughout Schwann cell projections, with ~2-3 bright clusters along each projection. Clusters emerged within 1 day of culture and were maintained throughout early stages of myelination. Three days after induction of myelination, net ribosomal movement remained anterograde (directed away from the Schwann cell body, but ribosomal velocity decreased to about half the levels of the untreated group. Statistical and modeling analysis provided additional insight into key factors underlying ribosomal trafficking. Multiple regression analysis indicated that net transport at early time points was dependent on anterograde velocity, but shifted to dependence on anterograde duration at later time points. A simple, data-driven rate kinetics model suggested that the observed decrease in net ribosomal movement was primarily dictated by an increased conversion of anterograde particles to stationary particles, rather than changes in other directional parameters. These results reveal the strength of a combined experimental and theoretical approach in examining protein localization and transport, and provide evidence of an early establishment of ribosomal populations within Schwann cell projections with a reduction in trafficking following

  14. Genetic interactions of MAF1 identify a role for Med20 in transcriptional repression of ribosomal protein genes.

    Directory of Open Access Journals (Sweden)

    Ian M Willis

    2008-07-01

    Full Text Available Transcriptional repression of ribosomal components and tRNAs is coordinately regulated in response to a wide variety of environmental stresses. Part of this response involves the convergence of different nutritional and stress signaling pathways on Maf1, a protein that is essential for repressing transcription by RNA polymerase (pol III in Saccharomyces cerevisiae. Here we identify the functions buffering yeast cells that are unable to down-regulate transcription by RNA pol III. MAF1 genetic interactions identified in screens of non-essential gene-deletions and conditionally expressed essential genes reveal a highly interconnected network of 64 genes involved in ribosome biogenesis, RNA pol II transcription, tRNA modification, ubiquitin-dependent proteolysis and other processes. A survey of non-essential MAF1 synthetic sick/lethal (SSL genes identified six gene-deletions that are defective in transcriptional repression of ribosomal protein (RP genes following rapamycin treatment. This subset of MAF1 SSL genes included MED20 which encodes a head module subunit of the RNA pol II Mediator complex. Genetic interactions between MAF1 and subunits in each structural module of Mediator were investigated to examine the functional relationship between these transcriptional regulators. Gene expression profiling identified a prominent and highly selective role for Med20 in the repression of RP gene transcription under multiple conditions. In addition, attenuated repression of RP genes by rapamycin was observed in a strain deleted for the Mediator tail module subunit Med16. The data suggest that Mediator and Maf1 function in parallel pathways to negatively regulate RP mRNA and tRNA synthesis.

  15. Dual binding mode of the nascent polypeptide-associated complex reveals a novel universal adapter site on the ribosome.

    Science.gov (United States)

    Pech, Markus; Spreter, Thomas; Beckmann, Roland; Beatrix, Birgitta

    2010-06-18

    Nascent polypeptide-associated complex (NAC) was identified in eukaryotes as the first cytosolic factor that contacts the nascent polypeptide chain emerging from the ribosome. NAC is present as a homodimer in archaea and as a highly conserved heterodimer in eukaryotes. Mutations in NAC cause severe embryonically lethal phenotypes in mice, Drosophila melanogaster, and Caenorhabditis elegans. In the yeast Saccharomyces cerevisiae NAC is quantitatively associated with ribosomes. Here we show that NAC contacts several ribosomal proteins. The N terminus of betaNAC, however, specifically contacts near the tunnel exit ribosomal protein Rpl31, which is unique to eukaryotes and archaea. Moreover, the first 23 amino acids of betaNAC are sufficient to direct an otherwise non-associated protein to the ribosome. In contrast, alphaNAC (Egd2p) contacts Rpl17, the direct neighbor of Rpl31 at the ribosomal tunnel exit site. Rpl31 was also recently identified as a contact site for the SRP receptor and the ribosome-associated complex. Furthermore, in Escherichia coli peptide deformylase (PDF) interacts with the corresponding surface area on the eubacterial ribosome. In addition to the previously identified universal adapter site represented by Rpl25/Rpl35, we therefore refer to Rpl31/Rpl17 as a novel universal docking site for ribosome-associated factors on the eukaryotic ribosome.

  16. A Numbers Game: Ribosome Densities, Bacterial Growth, and Antibiotic-Mediated Stasis and Death

    Directory of Open Access Journals (Sweden)

    Bruce R. Levin

    2017-02-01

    Full Text Available We postulate that the inhibition of growth and low rates of mortality of bacteria exposed to ribosome-binding antibiotics deemed bacteriostatic can be attributed almost uniquely to these drugs reducing the number of ribosomes contributing to protein synthesis, i.e., the number of effective ribosomes. We tested this hypothesis with Escherichia coli K-12 MG1655 and constructs that had been deleted for 1 to 6 of the 7 rRNA (rrn operons. In the absence of antibiotics, constructs with fewer rrn operons have lower maximum growth rates and longer lag phases than those with more ribosomal operons. In the presence of the ribosome-binding “bacteriostatic” antibiotics tetracycline, chloramphenicol, and azithromycin, E. coli strains with 1 and 2 rrn operons are killed at a substantially higher rate than those with more rrn operons. This increase in the susceptibility of E. coli with fewer rrn operons to killing by ribosome-targeting bacteriostatic antibiotics is not reflected in their greater sensitivity to killing by the bactericidal antibiotic ciprofloxacin, which does not target ribosomes, but also to killing by gentamicin, which does. Finally, when such strains are exposed to these ribosome-targeting bacteriostatic antibiotics, the time before these bacteria start to grow again when the drugs are removed, referred to as the post-antibiotic effect (PAE, is markedly greater for constructs with fewer rrn operons than for those with more rrn operons. We interpret the results of these other experiments reported here as support for the hypothesis that the reduction in the effective number of ribosomes due to binding to these structures provides a sufficient explanation for the action of bacteriostatic antibiotics that target these structures.

  17. The nuclear import of ribosomal proteins is regulated by mTOR

    Science.gov (United States)

    Kazyken, Dubek; Kaz, Yelimbek; Kiyan, Vladimir; Zhylkibayev, Assylbek A.; Chen, Chien-Hung; Agarwal, Nitin K.; Sarbassov, Dos D.

    2014-01-01

    Mechanistic target of rapamycin (mTOR) is a central component of the essential signaling pathway that regulates cell growth and proliferation by controlling anabolic processes in cells. mTOR exists in two distinct mTOR complexes known as mTORC1 and mTORC2 that reside mostly in cytoplasm. In our study, the biochemical characterization of mTOR led to discovery of its novel localization on nuclear envelope where it associates with a critical regulator of nuclear import Ran Binding Protein 2 (RanBP2). We show that association of mTOR with RanBP2 is dependent on the mTOR kinase activity that regulates the nuclear import of ribosomal proteins. The mTOR kinase inhibitors within thirty minutes caused a substantial decrease of ribosomal proteins in the nuclear but not cytoplasmic fraction. Detection of a nuclear accumulation of the GFP-tagged ribosomal protein rpL7a also indicated its dependence on the mTOR kinase activity. The nuclear abundance of ribosomal proteins was not affected by inhibition of mTOR Complex 1 (mTORC1) by rapamycin or deficiency of mTORC2, suggesting a distinctive role of the nuclear envelope mTOR complex in the nuclear import. Thus, we identified that mTOR in association with RanBP2 mediates the active nuclear import of ribosomal proteins. PMID:25294810

  18. DNA replication stress restricts ribosomal DNA copy number.

    Science.gov (United States)

    Salim, Devika; Bradford, William D; Freeland, Amy; Cady, Gillian; Wang, Jianmin; Pruitt, Steven C; Gerton, Jennifer L

    2017-09-01

    Ribosomal RNAs (rRNAs) in budding yeast are encoded by ~100-200 repeats of a 9.1kb sequence arranged in tandem on chromosome XII, the ribosomal DNA (rDNA) locus. Copy number of rDNA repeat units in eukaryotic cells is maintained far in excess of the requirement for ribosome biogenesis. Despite the importance of the repeats for both ribosomal and non-ribosomal functions, it is currently not known how "normal" copy number is determined or maintained. To identify essential genes involved in the maintenance of rDNA copy number, we developed a droplet digital PCR based assay to measure rDNA copy number in yeast and used it to screen a yeast conditional temperature-sensitive mutant collection of essential genes. Our screen revealed that low rDNA copy number is associated with compromised DNA replication. Further, subculturing yeast under two separate conditions of DNA replication stress selected for a contraction of the rDNA array independent of the replication fork blocking protein, Fob1. Interestingly, cells with a contracted array grew better than their counterparts with normal copy number under conditions of DNA replication stress. Our data indicate that DNA replication stresses select for a smaller rDNA array. We speculate that this liberates scarce replication factors for use by the rest of the genome, which in turn helps cells complete DNA replication and continue to propagate. Interestingly, tumors from mini chromosome maintenance 2 (MCM2)-deficient mice also show a loss of rDNA repeats. Our data suggest that a reduction in rDNA copy number may indicate a history of DNA replication stress, and that rDNA array size could serve as a diagnostic marker for replication stress. Taken together, these data begin to suggest the selective pressures that combine to yield a "normal" rDNA copy number.

  19. DNA replication stress restricts ribosomal DNA copy number

    Science.gov (United States)

    Salim, Devika; Bradford, William D.; Freeland, Amy; Cady, Gillian; Wang, Jianmin

    2017-01-01

    Ribosomal RNAs (rRNAs) in budding yeast are encoded by ~100–200 repeats of a 9.1kb sequence arranged in tandem on chromosome XII, the ribosomal DNA (rDNA) locus. Copy number of rDNA repeat units in eukaryotic cells is maintained far in excess of the requirement for ribosome biogenesis. Despite the importance of the repeats for both ribosomal and non-ribosomal functions, it is currently not known how “normal” copy number is determined or maintained. To identify essential genes involved in the maintenance of rDNA copy number, we developed a droplet digital PCR based assay to measure rDNA copy number in yeast and used it to screen a yeast conditional temperature-sensitive mutant collection of essential genes. Our screen revealed that low rDNA copy number is associated with compromised DNA replication. Further, subculturing yeast under two separate conditions of DNA replication stress selected for a contraction of the rDNA array independent of the replication fork blocking protein, Fob1. Interestingly, cells with a contracted array grew better than their counterparts with normal copy number under conditions of DNA replication stress. Our data indicate that DNA replication stresses select for a smaller rDNA array. We speculate that this liberates scarce replication factors for use by the rest of the genome, which in turn helps cells complete DNA replication and continue to propagate. Interestingly, tumors from mini chromosome maintenance 2 (MCM2)-deficient mice also show a loss of rDNA repeats. Our data suggest that a reduction in rDNA copy number may indicate a history of DNA replication stress, and that rDNA array size could serve as a diagnostic marker for replication stress. Taken together, these data begin to suggest the selective pressures that combine to yield a “normal” rDNA copy number. PMID:28915237

  20. DNA replication stress restricts ribosomal DNA copy number.

    Directory of Open Access Journals (Sweden)

    Devika Salim

    2017-09-01

    Full Text Available Ribosomal RNAs (rRNAs in budding yeast are encoded by ~100-200 repeats of a 9.1kb sequence arranged in tandem on chromosome XII, the ribosomal DNA (rDNA locus. Copy number of rDNA repeat units in eukaryotic cells is maintained far in excess of the requirement for ribosome biogenesis. Despite the importance of the repeats for both ribosomal and non-ribosomal functions, it is currently not known how "normal" copy number is determined or maintained. To identify essential genes involved in the maintenance of rDNA copy number, we developed a droplet digital PCR based assay to measure rDNA copy number in yeast and used it to screen a yeast conditional temperature-sensitive mutant collection of essential genes. Our screen revealed that low rDNA copy number is associated with compromised DNA replication. Further, subculturing yeast under two separate conditions of DNA replication stress selected for a contraction of the rDNA array independent of the replication fork blocking protein, Fob1. Interestingly, cells with a contracted array grew better than their counterparts with normal copy number under conditions of DNA replication stress. Our data indicate that DNA replication stresses select for a smaller rDNA array. We speculate that this liberates scarce replication factors for use by the rest of the genome, which in turn helps cells complete DNA replication and continue to propagate. Interestingly, tumors from mini chromosome maintenance 2 (MCM2-deficient mice also show a loss of rDNA repeats. Our data suggest that a reduction in rDNA copy number may indicate a history of DNA replication stress, and that rDNA array size could serve as a diagnostic marker for replication stress. Taken together, these data begin to suggest the selective pressures that combine to yield a "normal" rDNA copy number.

  1. Selection of diethylstilbestrol-specific single-chain antibodies from a non-immunized mouse ribosome display library.

    Directory of Open Access Journals (Sweden)

    Yanan Sun

    Full Text Available Single chain variable fragments (scFvs against diethylstilbestrol (DES were selected from the splenocytes of non-immunized mice by ribosome display technology. A naive library was constructed and engineered to allow in vitro transcription and translation using an E. coli lysate system. Alternating selection in solution and immobilization in microtiter wells was used to pan mRNA-ribosome-antibody (ARM complexes. After seven rounds of ribosome display, the expression vector pTIG-TRX containing the selected specific scFv DNAs were transformed into Escherichia coli BL21 (DE3 for expression. Twenty-six positive clones were screened and five clones had high antibody affinity and specificity to DES as evidenced by indirect competitive ELISA. Sequence analysis showed that these five DES-specific scFvs had different amino acid sequences, but the CDRs were highly similar. Surface plasmon resonance (SPR analysis was used to determine binding kinetics of one clone (30-1. The measured K(D was 3.79 µM. These results indicate that ribosome display technology can be used to efficiently isolate hapten-specific antibody (Ab fragments from a naive library; this study provides a methodological framework for the development of novel immunoassays for multiple environmental pollutants with low molecular weight detection using recombinant antibodies.

  2. Mutations in ribosomal proteins, RPL4 and RACK1, suppress the phenotype of a thermospermine-deficient mutant of Arabidopsis thaliana.

    Directory of Open Access Journals (Sweden)

    Jun-ichi Kakehi

    Full Text Available Thermospermine acts in negative regulation of xylem differentiation and its deficient mutant of Arabidopsis thaliana, acaulis5 (acl5, shows excessive xylem formation and severe dwarfism. Studies of two dominant suppressors of acl5, sac51-d and sac52-d, have revealed that SAC51 and SAC52 encode a transcription factor and a ribosomal protein L10 (RPL10, respectively, and these mutations enhance translation of the SAC51 mRNA, which contains conserved upstream open reading frames in the 5' leader. Here we report identification of SAC53 and SAC56 responsible for additional suppressors of acl5. sac53-d is a semi-dominant allele of the gene encoding a receptor for activated C kinase 1 (RACK1 homolog, a component of the 40S ribosomal subunit. sac56-d represents a semi-dominant allele of the gene for RPL4. We show that the GUS reporter activity driven by the CaMV 35S promoter plus the SAC51 5' leader is reduced in acl5 and restored by sac52-d, sac53-d, and sac56-d as well as thermospermine. Furthermore, the SAC51 mRNA, which may be a target of nonsense-mediated mRNA decay, was found to be stabilized in these ribosomal mutants and by thermospermine. These ribosomal proteins are suggested to act in the control of uORF-mediated translation repression of SAC51, which is derepressed by thermospermine.

  3. The Absence of the Transcription Factor Yrr1p, Identified from Comparative Genome Profiling, Increased Vanillin Tolerance Due to Enhancements of ABC Transporters Expressing, rRNA Processing and Ribosome Biogenesis in Saccharomyces cerevisiae.

    Science.gov (United States)

    Wang, Xinning; Liang, Zhenzhen; Hou, Jin; Shen, Yu; Bao, Xiaoming

    2017-01-01

    Enhancing the tolerance of Saccharomyces cerevisiae to inhibitors derived from lignocellulose is conducive to producing biofuel and chemicals using abundant lignocellulosic materials. Vanillin is a major type of phenolic inhibitor in lignocellulose hydrolysates for S. cerevisiae . In the present work, the factors beneficial to vanillin resistance in yeast were identified from the vanillin-resistant strain EMV-8, which was derived from strain NAN-27 by adaptive evolution. We found 450 SNPs and 44 genes with InDels in the vanillin-tolerant strain EMV-8 by comparing the genome sequences of EMV-8 and NAN-27. To investigate the effects of InDels, InDels were deleted in BY4741, respectively. We demonstrated that the deletion of YRR1 improved vanillin tolerance of strain. In the presence of 6 mM vanillin, deleting YRR1 increase the maximum specific growth rate and the vanillin consumption rate by 142 and 51%, respectively. The subsequent transcriptome analysis revealed that deleting YRR1 resulted in changed expression of over 200 genes in the presence of 5 mM vanillin. The most marked changes were the significant up-regulation of the dehydrogenase ADH7 , several ATP-binding cassette (ABC) transporters, and dozens of genes involved in ribosome biogenesis and rRNA processing. Coincidently, the crude enzyme solution of BY4741( yrr1 Δ) exhibited higher NADPH-dependent vanillin reduction activity than control. In addition, overexpressing the ABC transporter genes PDR5, YOR1 , and SNQ2 , as well as the RNA helicase gene DBP2 , increased the vanillin tolerance of strain. Interestingly, unlike the marked changes we mentioned above, under vanillin-free conditions, there are only limited transcriptional differences between wildtype and yrr1 Δ. This indicated that vanillin might act as an effector in Yrr1p-related regulatory processes. The new findings of the relationship between YRR1 and vanillin tolerance, as well as the contribution of rRNA processing and ribosome biogenesis to

  4. Therapeutic dosages of aspirin counteract the IL-6 induced pro-tumorigenic effects by slowing down the ribosome biogenesis rate.

    Science.gov (United States)

    Brighenti, Elisa; Giannone, Ferdinando Antonino; Fornari, Francesca; Onofrillo, Carmine; Govoni, Marzia; Montanaro, Lorenzo; Treré, Davide; Derenzini, Massimo

    2016-09-27

    Chronic inflammation is a risk factor for the onset of cancer and the regular use of aspirin reduces the risk of cancer development. Here we showed that therapeutic dosages of aspirin counteract the pro-tumorigenic effects of the inflammatory cytokine interleukin(IL)-6 in cancer and non-cancer cell lines, and in mouse liver in vivo. We found that therapeutic dosages of aspirin prevented IL-6 from inducing the down-regulation of p53 expression and the acquisition of the epithelial mesenchymal transition (EMT) phenotypic changes in the cell lines. This was the result of a reduction in c-Myc mRNA transcription which was responsible for a down-regulation of the ribosomal protein S6 expression which, in turn, slowed down the rRNA maturation process, thus reducing the ribosome biogenesis rate. The perturbation of ribosome biogenesis hindered the Mdm2-mediated proteasomal degradation of p53, throughout the ribosomal protein-Mdm2-p53 pathway. P53 stabilization hindered the IL-6 induction of the EMT changes. The same effects were observed in livers from mice stimulated with IL-6 and treated with aspirin. It is worth noting that aspirin down-regulated ribosome biogenesis, stabilized p53 and up-regulated E-cadherin expression in unstimulated control cells also. In conclusion, these data showed that therapeutic dosages of aspirin increase the p53-mediated tumor-suppressor activity of the cells thus being in this way able to reduce the risk of cancer onset, either or not linked to chronic inflammatory processes.

  5. Therapeutic dosages of aspirin counteract the IL-6 induced pro-tumorigenic effects by slowing down the ribosome biogenesis rate

    Science.gov (United States)

    Brighenti, Elisa; Giannone, Ferdinando Antonino; Fornari, Francesca; Onofrillo, Carmine; Govoni, Marzia; Montanaro, Lorenzo; Treré, Davide; Derenzini, Massimo

    2016-01-01

    Chronic inflammation is a risk factor for the onset of cancer and the regular use of aspirin reduces the risk of cancer development. Here we showed that therapeutic dosages of aspirin counteract the pro-tumorigenic effects of the inflammatory cytokine interleukin(IL)-6 in cancer and non-cancer cell lines, and in mouse liver in vivo. We found that therapeutic dosages of aspirin prevented IL-6 from inducing the down-regulation of p53 expression and the acquisition of the epithelial mesenchymal transition (EMT) phenotypic changes in the cell lines. This was the result of a reduction in c-Myc mRNA transcription which was responsible for a down-regulation of the ribosomal protein S6 expression which, in turn, slowed down the rRNA maturation process, thus reducing the ribosome biogenesis rate. The perturbation of ribosome biogenesis hindered the Mdm2-mediated proteasomal degradation of p53, throughout the ribosomal protein-Mdm2-p53 pathway. P53 stabilization hindered the IL-6 induction of the EMT changes. The same effects were observed in livers from mice stimulated with IL-6 and treated with aspirin. It is worth noting that aspirin down-regulated ribosome biogenesis, stabilized p53 and up-regulated E-cadherin expression in unstimulated control cells also. In conclusion, these data showed that therapeutic dosages of aspirin increase the p53-mediated tumor-suppressor activity of the cells thus being in this way able to reduce the risk of cancer onset, either or not linked to chronic inflammatory processes. PMID:27557515

  6. Dicty_cDB: Contig-U16209-1 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available 0 1 ( FJ393112 ) Uncultured Enterobacteriaceae bacterium clone MFC... 700 0.0 1 ( FJ268925 ) Uncultured Kleb...tia... 700 0.0 1 ( DQ852624 ) Klebsiella pneumoniae strain TM100 16S ribosomal ... 700 0.0 1 ( DQ837043 ) Enterobacteriaceae... bacterium p4s-5f 16S ribosomal... 700 0.0 1 ( DQ837041 ) Enterobacteriaceae bacterium p4f-5... 16S ribosomal ... 700 0.0 1 ( DQ520801 ) Enterobacteriaceae bacterium NR58 16S r... DQ379506 ) Klebsiella pneumoniae strain TSL-2 16S ribosomal ... 700 0.0 1 ( DQ313412 ) Enterobacteriaceae b

  7. Detecting remote sequence homology in disordered proteins: discovery of conserved motifs in the N-termini of Mononegavirales phosphoproteins.

    Directory of Open Access Journals (Sweden)

    David Karlin

    Full Text Available Paramyxovirinae are a large group of viruses that includes measles virus and parainfluenza viruses. The viral Phosphoprotein (P plays a central role in viral replication. It is composed of a highly variable, disordered N-terminus and a conserved C-terminus. A second viral protein alternatively expressed, the V protein, also contains the N-terminus of P, fused to a zinc finger. We suspected that, despite their high variability, the N-termini of P/V might all be homologous; however, using standard approaches, we could previously identify sequence conservation only in some Paramyxovirinae. We now compared the N-termini using sensitive sequence similarity search programs, able to detect residual similarities unnoticeable by conventional approaches. We discovered that all Paramyxovirinae share a short sequence motif in their first 40 amino acids, which we called soyuz1. Despite its short length (11-16aa, several arguments allow us to conclude that soyuz1 probably evolved by homologous descent, unlike linear motifs. Conservation across such evolutionary distances suggests that soyuz1 plays a crucial role and experimental data suggest that it binds the viral nucleoprotein to prevent its illegitimate self-assembly. In some Paramyxovirinae, the N-terminus of P/V contains a second motif, soyuz2, which might play a role in blocking interferon signaling. Finally, we discovered that the P of related Mononegavirales contain similarly overlooked motifs in their N-termini, and that their C-termini share a previously unnoticed structural similarity suggesting a common origin. Our results suggest several testable hypotheses regarding the replication of Mononegavirales and suggest that disordered regions with little overall sequence similarity, common in viral and eukaryotic proteins, might contain currently overlooked motifs (intermediate in length between linear motifs and disordered domains that could be detected simply by comparing orthologous proteins.

  8. Ribosome-induced changes in elongation factor Tu conformation control GTP hydrolysis

    DEFF Research Database (Denmark)

    Villa, Elizabeth; Sengupta, Jayati; Trabuco, Leonard G.

    2009-01-01

    In translation, elongation factor Tu (EF-Tu) molecules deliver aminoacyl-tRNAs to the mRNA-programmed ribosome. The GTPase activity of EF-Tu is triggered by ribosome-induced conformational changes of the factor that play a pivotal role in the selection of the cognate aminoacyl-tRNAs. We present a 6.......7-A cryo-electron microscopy map of the aminoacyl-tRNA x EF-Tu x GDP x kirromycin-bound Escherichia coli ribosome, together with an atomic model of the complex obtained through molecular dynamics flexible fitting. The model reveals the conformational changes in the conserved GTPase switch regions...... of EF-Tu that trigger hydrolysis of GTP, along with key interactions, including those between the sarcin-ricin loop and the P loop of EF-Tu, and between the effector loop of EF-Tu and a conserved region of the 16S rRNA. Our data suggest that GTP hydrolysis on EF-Tu is controlled through a hydrophobic...

  9. SwissProt search result: AK102383 [KOME

    Lifescience Database Archive (English)

    Full Text Available AK102383 J033092C12 (Q14978) Nucleolar phosphoprotein p130 (Nucleolar 130 kDa protein) (140 kDa nucleol...ar phosphoprotein) (Nopp140) (Nucleolar and coiled-body phosphoprotein 1) NOLC1_HUMAN 3e-16 ...

  10. Regulatory module involving FGF13, miR-504, and p53 regulates ribosomal biogenesis and supports cancer cell survival

    Science.gov (United States)

    Bublik, Débora R.; Bursać, Slađana; Sheffer, Michal; Oršolić, Ines; Shalit, Tali; Tarcic, Ohad; Kotler, Eran; Mouhadeb, Odelia; Hoffman, Yonit; Fuchs, Gilad; Levin, Yishai; Volarević, Siniša; Oren, Moshe

    2017-01-01

    The microRNA miR-504 targets TP53 mRNA encoding the p53 tumor suppressor. miR-504 resides within the fibroblast growth factor 13 (FGF13) gene, which is overexpressed in various cancers. We report that the FGF13 locus, comprising FGF13 and miR-504, is transcriptionally repressed by p53, defining an additional negative feedback loop in the p53 network. Furthermore, we show that FGF13 1A is a nucleolar protein that represses ribosomal RNA transcription and attenuates protein synthesis. Importantly, in cancer cells expressing high levels of FGF13, the depletion of FGF13 elicits increased proteostasis stress, associated with the accumulation of reactive oxygen species and apoptosis. Notably, stepwise neoplastic transformation is accompanied by a gradual increase in FGF13 expression and increased dependence on FGF13 for survival (“nononcogene addiction”). Moreover, FGF13 overexpression enables cells to cope more effectively with the stress elicited by oncogenic Ras protein. We propose that, in cells in which activated oncogenes drive excessive protein synthesis, FGF13 may favor survival by maintaining translation rates at a level compatible with the protein quality-control capacity of the cell. Thus, FGF13 may serve as an enabler, allowing cancer cells to evade proteostasis stress triggered by oncogene activation. PMID:27994142

  11. Eukaryotic ribosome display with in situ DNA recovery.

    Science.gov (United States)

    He, Mingyue; Edwards, Bryan M; Kastelic, Damjana; Taussig, Michael J

    2012-01-01

    Ribosome display is a cell-free display technology for in vitro selection and optimisation of proteins from large diversified libraries. It operates through the formation of stable protein-ribosome-mRNA (PRM) complexes and selection of ligand-binding proteins, followed by DNA recovery from the selected genetic information. Both prokaryotic and eukaryotic ribosome display systems have been developed. In this chapter, we describe the eukaryotic rabbit reticulocyte method in which a distinct in situ single-primer RT-PCR procedure is used to recover DNA from the selected PRM complexes without the need for prior disruption of the ribosome.

  12. Internal ribosomal entry site-mediated translation is important for rhythmic PERIOD1 expression.

    Directory of Open Access Journals (Sweden)

    Kyung-Ha Lee

    Full Text Available The mouse PERIOD1 (mPER1 plays an important role in the maintenance of circadian rhythm. Translation of mPer1 is directed by both a cap-dependent process and cap-independent translation mediated by an internal ribosomal entry site (IRES in the 5' untranslated region (UTR. Here, we compared mPer1 IRES activity with other cellular IRESs. We also found critical region in mPer1 5'UTR for heterogeneous nuclear ribonucleoprotein Q (HNRNPQ binding. Deletion of HNRNPQ binding region markedly decreased IRES activity and disrupted rhythmicity. A mathematical model also suggests that rhythmic IRES-dependent translation is a key process in mPER1 oscillation. The IRES-mediated translation of mPer1 will help define the post-transcriptional regulation of the core clock genes.

  13. Differential expression of secreted phosphoprotein 1 in the motor cortex among primate species and during postnatal development and functional recovery.

    Directory of Open Access Journals (Sweden)

    Tatsuya Yamamoto

    Full Text Available We previously reported that secreted phosphoprotein 1 (SPP1 mRNA is expressed in neurons whose axons form the corticospinal tract (CST of the rhesus macaque, but not in the corresponding neurons of the marmoset and rat. This suggests that SPP1 expression is involved in the functional or structural specialization of highly developed corticospinal systems in certain primate species. To further examine this hypothesis, we evaluated the expression of SPP1 mRNA in the motor cortex from three viewpoints: species differences, postnatal development, and functional/structural changes of the CST after a lesion of the lateral CST (l-CST at the mid-cervical level. The density of SPP1-positive neurons in layer V of the primary motor cortex (M1 was much greater in species with highly developed corticospinal systems (i.e., rhesus macaque, capuchin monkey, and humans than in those with less developed corticospinal systems (i.e., squirrel monkey, marmoset, and rat. SPP1-positive neurons in the macaque monkey M1 increased logarithmically in layer V during postnatal development, following a time course consistent with the increase in conduction velocity of the CST. After an l-CST lesion, SPP1-positive neurons increased in layer V of the ventral premotor cortex, in which compensatory changes in CST function/structure may occur, which positively correlated with the extent of finger dexterity recovery. These results further support the concept that the expression of SPP1 may reflect functional or structural specialization of highly developed corticospinal systems in certain primate species.

  14. Cloning and characterization of DNA complementary to the canine distemper virus mRNA encoding matrix, phosphoprotein, and nucleocapsid protein

    International Nuclear Information System (INIS)

    Rozenblatt, S.; Eizenberg, O.; Englund, G.; Bellini, W.J.

    1985-01-01

    Double-stranded cDNA synthesized from total polyadenylate-containing mRNA, extracted from monkey kidney cells infected with canine distemper virus (CDV), has been cloned into the PstI site of Escherichia coli plasmid pBR322. Clones containing canine distemper virus DNA were identified by hybridization to a canine distemper virus-specific, 32 P-labeled cDNA. Four specific clones containing different classes of sequences have been identified. The cloned plasmids contain inserts of 800 (clone 44-80), 960 (clone 74-16), 1700 (clone 364), and 950 (clone 40-9) base pairs. The sizes of the mRNA species complementary to these inserts are 1500, 1850, 1850 and 2500 nucleotides, respectively, as determined by the Northern technique. Three of the cloned DNA fragments were further identified as the reverse transcripts of the mRNA coding for the matrix, phosphoprotein, and nucleocapsid protein of CDV

  15. Cloning and characterization of DNA complementary to the canine distemper virus mRNA encoding matrix, phosphoprotein, and nucleocapsid protein

    Energy Technology Data Exchange (ETDEWEB)

    Rozenblatt, S.; Eizenberg, O.; Englund, G.; Bellini, W.J.

    1985-02-01

    Double-stranded cDNA synthesized from total polyadenylate-containing mRNA, extracted from monkey kidney cells infected with canine distemper virus (CDV), has been cloned into the PstI site of Escherichia coli plasmid pBR322. Clones containing canine distemper virus DNA were identified by hybridization to a canine distemper virus-specific, /sup 32/P-labeled cDNA. Four specific clones containing different classes of sequences have been identified. The cloned plasmids contain inserts of 800 (clone 44-80), 960 (clone 74-16), 1700 (clone 364), and 950 (clone 40-9) base pairs. The sizes of the mRNA species complementary to these inserts are 1500, 1850, 1850 and 2500 nucleotides, respectively, as determined by the Northern technique. Three of the cloned DNA fragments were further identified as the reverse transcripts of the mRNA coding for the matrix, phosphoprotein, and nucleocapsid protein of CDV.

  16. Kinase-Mediated Regulation of 40S Ribosome Assembly in Human Breast Cancer

    Science.gov (United States)

    2017-02-01

    and will assess if this resistance involves gain-of-function mutations in Ltv1, and if resistance can be overcome with drugs that direct...ribosome assembly factor Ltv1 in both yeast and TNBC cells, and that selective knockdown or silencing of CK1δ, or forced expression of Ltv1 mutant that...cannot be phosphorylated by CK1δ, blocks ribosome assembly in yeast and compromises the growth and survival of TNBC cells. Further, we have shown that

  17. The Interaction Pattern between a Homology Model of 40S Ribosomal S9 Protein of Rhizoctonia solani and 1-Hydroxyphenaize by Docking Study

    Directory of Open Access Journals (Sweden)

    Seema Dharni

    2014-01-01

    Full Text Available 1-Hydroxyphenazine (1-OH-PHZ, a natural product from Pseudomonas aeruginosa strain SD12, was earlier reported to have potent antifungal activity against Rhizoctonia solani. In the present work, the antifungal activity of 1-OH-PHZ on 40S ribosomal S9 protein was validated by molecular docking approach. 1-OH-PHZ showed interaction with two polar contacts with residues, Arg69 and Phe19, which inhibits the synthesis of fungal protein. Our study reveals that 1-OH-PHZ can be a potent inhibitor of 40S ribosomal S9 protein of R. solani that may be a promising approach for the management of fungal diseases.

  18. Effect of sodium fluoride on the amount of polyribosomes, single ribosomes and ribosomal subunits in a cellular slime mold, Dictyostelium discoideum

    Energy Technology Data Exchange (ETDEWEB)

    Sameshima, M; Ito, K; Iwabuchi, M

    1972-01-01

    In the slime mold, Dictyostelium discoideum, when the rate of protein synthesis was decreased by NaF, free 80-S ribosomes accumulated at the expense of polyribosomes, while 60-S and 40-S ribosomal subunits remained almost constant. The same level of ribosomal subunits was also maintained in cells after incubation with cycloheximide or at the stationary phase of growth.

  19. The NS1 Protein from Influenza Virus Stimulates Translation Initiation by Enhancing Ribosome Recruitment to mRNAs.

    Science.gov (United States)

    Panthu, Baptiste; Terrier, Olivier; Carron, Coralie; Traversier, Aurélien; Corbin, Antoine; Balvay, Laurent; Lina, Bruno; Rosa-Calatrava, Manuel; Ohlmann, Théophile

    2017-10-27

    The non-structural protein NS1 of influenza A viruses exerts pleiotropic functions during infection. Among these functions, NS1 was shown to be involved in the control of both viral and cellular translation; however, the mechanism by which this occurs remains to be determined. Thus, we have revisited the role of NS1 in translation by using a combination of influenza infection, mRNA reporter transfection, and in vitro functional and biochemical assays. Our data show that the NS1 protein is able to enhance the translation of virtually all tested mRNAs with the exception of constructs bearing the Dicistroviruses Internal ribosome entry segment (IRESes) (DCV and CrPV), suggesting a role at the level of translation initiation. The domain of NS1 required for translation stimulation was mapped to the RNA binding amino-terminal motif of the protein with residues R38 and K41 being critical for activity. Although we show that NS1 can bind directly to mRNAs, it does not correlate with its ability to stimulate translation. This activity rather relies on the property of NS1 to associate with ribosomes and to recruit them to target mRNAs. Copyright © 2017 Elsevier Ltd. All rights reserved.

  20. Ribosome dynamics and tRNA movement by time-resolved electron cryomicroscopy.

    Science.gov (United States)

    Fischer, Niels; Konevega, Andrey L; Wintermeyer, Wolfgang; Rodnina, Marina V; Stark, Holger

    2010-07-15

    The translocation step of protein synthesis entails large-scale rearrangements of the ribosome-transfer RNA (tRNA) complex. Here we have followed tRNA movement through the ribosome during translocation by time-resolved single-particle electron cryomicroscopy (cryo-EM). Unbiased computational sorting of cryo-EM images yielded 50 distinct three-dimensional reconstructions, showing the tRNAs in classical, hybrid and various novel intermediate states that provide trajectories and kinetic information about tRNA movement through the ribosome. The structures indicate how tRNA movement is coupled with global and local conformational changes of the ribosome, in particular of the head and body of the small ribosomal subunit, and show that dynamic interactions between tRNAs and ribosomal residues confine the path of the tRNAs through the ribosome. The temperature dependence of ribosome dynamics reveals a surprisingly flat energy landscape of conformational variations at physiological temperature. The ribosome functions as a Brownian machine that couples spontaneous conformational changes driven by thermal energy to directed movement.

  1. Differential expression of proteins and phosphoproteins during larval metamorphosis of the polychaete Capitella sp. I

    Directory of Open Access Journals (Sweden)

    Qian Pei-Yuan

    2011-09-01

    Full Text Available Abstract Background The spontaneous metamorphosis of the polychaete Capitella sp. I larvae into juveniles requires minor morphological changes, including segment formation, body elongation, and loss of cilia. In this study, we investigated changes in the expression patterns of both proteins and phosphoproteins during the transition from larvae to juveniles in this species. We used two-dimensional gel electrophoresis (2-DE followed by multiplex fluorescent staining and MALDI-TOF mass spectrometry analysis to identify the differentially expressed proteins as well as the protein and phosphoprotein profiles of both competent larvae and juveniles. Results Twenty-three differentially expressed proteins were identified in the two developmental stages. Expression patterns of two of those proteins were examined at the protein level by Western blot analysis while seven were further studied at the mRNA level by real-time PCR. Results showed that proteins related to cell division, cell migration, energy storage and oxidative stress were plentifully expressed in the competent larvae; in contrast, proteins involved in oxidative metabolism and transcriptional regulation were abundantly expressed in the juveniles. Conclusion It is likely that these differentially expressed proteins are involved in regulating the larval metamorphosis process and can be used as protein markers for studying molecular mechanisms associated with larval metamorphosis in polychaetes.

  2. Remodeling of ribosomal genes in somatic cells by Xenopus egg extract

    Energy Technology Data Exchange (ETDEWEB)

    Ostrup, Olga, E-mail: osvarcova@gmail.com [Institute of Basic Animal and Veterinary Sciences, Faculty of Life Sciences, University of Copenhagen, Frederiksberg C (Denmark); Stem Cell Epigenetics Laboratory, Institute of Basic Medical Sciences, Faculty of Medicine, University of Oslo, Oslo (Norway); Norwegian Center for Stem Cell Research, Oslo (Norway); Hyttel, Poul; Klaerke, Dan A. [Institute of Basic Animal and Veterinary Sciences, Faculty of Life Sciences, University of Copenhagen, Frederiksberg C (Denmark); Collas, Philippe, E-mail: philc@medisin.uio.no [Stem Cell Epigenetics Laboratory, Institute of Basic Medical Sciences, Faculty of Medicine, University of Oslo, Oslo (Norway); Norwegian Center for Stem Cell Research, Oslo (Norway)

    2011-09-02

    Highlights: {yields} Xenopus egg extract remodels nuclei and alter cell growth characteristics. {yields} Ribosomal genes are reprogrammed within 6 h after extract exposure. {yields} rDNA reprogramming involves promoter targeting of SNF2H remodeling complex. {yields} Xenopus egg extract does not initiate stress-related response in somatic cells. {yields} Aza-cytidine elicits a stress-induced response in reprogrammed cells. -- Abstract: Extracts from Xenopus eggs can reprogram gene expression in somatic nuclei, however little is known about the earliest processes associated with the switch in the transcriptional program. We show here that an early reprogramming event is the remodeling of ribosomal chromatin and gene expression. This occurs within hours of extract treatment and is distinct from a stress response. Egg extract elicits remodeling of the nuclear envelope, chromatin and nucleolus. Nucleolar remodeling involves a rapid and stable decrease in ribosomal gene transcription, and promoter targeting of the nucleolar remodeling complex component SNF2H without affecting occupancy of the transcription factor UBF and the stress silencers SUV39H1 and SIRT1. During this process, nucleolar localization of UBF and SIRT1 is not altered. On contrary, azacytidine pre-treatment has an adverse effect on rDNA remodeling induced by extract and elicits a stress-type nuclear response. Thus, an early event of Xenopus egg extract-mediated nuclear reprogramming is the remodeling of ribosomal genes involving nucleolar remodeling complex. Condition-specific and rapid silencing of ribosomal genes may serve as a sensitive marker for evaluation of various reprogramming methods.

  3. mTORC1 directly phosphorylates and regulates human MAF1.

    OpenAIRE

    Michels Annemieke A; Robitaille Aaron M; Buczynski-Ruchonnet Diane; Hodroj Wassim; Reina Jaime H; Hall Michael N; Hernandez Nouria

    2010-01-01

    mTORC1 is a central regulator of growth in response to nutrient availability, but few direct targets have been identified. RNA polymerase (pol) III produces a number of essential RNA molecules involved in protein synthesis, RNA maturation, and other processes. Its activity is highly regulated, and deregulation can lead to cell transformation. The human phosphoprotein MAF1 becomes dephosphorylated and represses pol III transcription after various stresses, but neither the significance of the p...

  4. Expression, tissue localization and serodiagnostic potential of Taenia multiceps acidic ribosomal protein P2.

    Science.gov (United States)

    Huang, Xing; Chen, Lin; Yang, Yingdong; Gu, Xiaobin; Wang, Yu; Lai, Weimin; Peng, Xuerong; Yang, Guangyou

    2015-12-01

    The larval stage of Taenia multiceps, also known as coenurus, is the causative agent of coenurosis, which results in severe health problems in sheep, goats, cattle and other animals that negatively impact on animal husbandry. There is no reliable method to identify coenurus infected goats in the early period of infection. We identified a full-length cDNA that encodes acidic ribosomal protein P2 from the transcriptome of T. multiceps (TmP2). Following cloning, sequencing and structural analyses were performed using bioinformatics tools. Recombinant TmP2 (rTmP2) was prokaryotically expressed and then used to test immunoreactivity and immunogenicity in immunoblotting assays. The native proteins in adult stage and coenurus were located via immunofluorescence assays, while the potential of rTmP2 for indirect ELISA-based serodiagnostics was assessed using native goat sera. In addition, 20 goats were randomly divided into a drug treatment group and a control group. Each goat was orally given mature, viable T. multiceps eggs. The drug treatment group was given 10% praziquantel by intramuscular injection 45 days post-infection (p.i), and all goats were screened for anti-TmP2 antibodies with the indirect ELISA method established here, once a week for 17 weeks p.i. The open reading frame (366 bp) of the target gene encodes a 12.62 kDa protein, which showed high homology to that from Taenia solium (93% identity) and lacked a signal peptide. Immunofluorescence staining showed that TmP2 was highly localized to the parenchymatous zone of both the adult parasite and the coenurus; besides, it was widely distributed in cystic wall of coenurus. Building on good immunogenic properties, rTmP2-based ELISA exhibited a sensitivity of 95.0% (19/20) and a specificity of 96.3% (26/27) in detecting anti-P2 antibodies in the sera of naturally infected goats and sheep. In goats experimentally infected with T. multiceps, anti-TmP2 antibody was detectable in the control group from 3 to 10 weeks

  5. [Analytic study of dot blotting for the detection of anti-Jo-1, anti-M2, anti-ribosomes and anti-LKM].

    Science.gov (United States)

    Huguet, S; Sghiri, R; Ballot, E; Johanet, C

    2004-01-01

    The Cyto-Dot 4 HM043 kit commercialised by BMD, has replaced the Cyto-Dot HM010 kit that allowed three auto-antibodies detection (anti-Jo-1, anti-M2 and anti-ribosomal protein). Detection of anti-LKM1 auto-antibody was added. These four auto-antibodies have in common only the intracytoplasmic localisation of their respective antigen. The aim of our study was to evaluate this new kit using 104 sera and to compare our results with reference techniques (indirect immunofluorescence IF for anti-M2, anti-ribosomal protein and anti-LKM1, double immunodiffusion ID for anti-Jo-1 and anti-LKM1, western blotting WB for anti-M2) and with Cyto-Dot HM010. The one hundred and four sera were divided into five groups: Group I (n = 12) with anti-Jo-1 detected by ID; Group II (n = 28) with 26 anti-M2 positive by IF and WB, 2 anti-M2 positive only by WB; Group III (n = 10) with anti-ribosomal protein detected by IF 5 of which precipitated by ID; Group IV (n = 32) with anti-LKM1 by IF and ID divided into 18 AIH2 and 14 HCV; Group V (n = 22) consisting of 14 healthy individuals and 8 patients with hypergammaglobulinemia. Results of this study are similar to those of Cyto-Dot HM010 for the three auto-antibodies already in use. Cyto-Dot 4 is a very good anti-LKM1 confirmation method as it is ID. Copyright John Libbey Eurotext 2003.

  6. Plasticity in Structural and Functional Interactions between the Phosphoprotein and Nucleoprotein of Measles Virus*

    Science.gov (United States)

    Shu, Yaoling; Habchi, Johnny; Costanzo, Stéphanie; Padilla, André; Brunel, Joanna; Gerlier, Denis; Oglesbee, Michael; Longhi, Sonia

    2012-01-01

    The measles virus (MeV) phosphoprotein (P) tethers the polymerase to the nucleocapsid template for transcription and genome replication. Binding of P to nucleocapsid is mediated by the X domain of P (XD) and a conserved sequence (Box-2) within the C-terminal domain of the nucleoprotein (NTAIL). XD binding induces NTAIL α-helical folding, which in turn has been proposed to stabilize the polymerase-nucleocapsid complex, with cycles of binding and release required for transcription and genome replication. The current work directly assessed the relationships among XD-induced NTAIL folding, XD-NTAIL binding affinity, and polymerase activity. Amino acid substitutions that abolished XD-induced NTAIL α-helical folding were created within Box-2 of Edmonston MeV NTAIL. Polymerase activity in minireplicons was maintained despite a 35-fold decrease in XD-NTAIL binding affinity or reduction/loss of XD-induced NTAIL alpha-helical folding. Recombinant infectious virus was recovered for all mutants, and transcriptase elongation rates remained within a 1.7-fold range of parent virus. Box-2 mutations did however impose a significant cost to infectivity, reflected in an increase in the amount of input genome required to match the infectivity of parent virus. Diminished infectivity could not be attributed to changes in virion protein composition or production of defective interfering particles, where changes from parent virus were within a 3-fold range. The results indicated that MeV polymerase activity, but not infectivity, tolerates amino acid changes in the XD-binding region of the nucleoprotein. Selectional pressure for conservation of the Box-2 sequence may thus reflect a role in assuring the fidelity of polymerase functions or the assembly of viral particles required for optimal infectivity. PMID:22318731

  7. Plasticity in structural and functional interactions between the phosphoprotein and nucleoprotein of measles virus.

    Science.gov (United States)

    Shu, Yaoling; Habchi, Johnny; Costanzo, Stéphanie; Padilla, André; Brunel, Joanna; Gerlier, Denis; Oglesbee, Michael; Longhi, Sonia

    2012-04-06

    The measles virus (MeV) phosphoprotein (P) tethers the polymerase to the nucleocapsid template for transcription and genome replication. Binding of P to nucleocapsid is mediated by the X domain of P (XD) and a conserved sequence (Box-2) within the C-terminal domain of the nucleoprotein (N(TAIL)). XD binding induces N(TAIL) α-helical folding, which in turn has been proposed to stabilize the polymerase-nucleocapsid complex, with cycles of binding and release required for transcription and genome replication. The current work directly assessed the relationships among XD-induced N(TAIL) folding, XD-N(TAIL) binding affinity, and polymerase activity. Amino acid substitutions that abolished XD-induced N(TAIL) α-helical folding were created within Box-2 of Edmonston MeV N(TAIL). Polymerase activity in minireplicons was maintained despite a 35-fold decrease in XD-N(TAIL) binding affinity or reduction/loss of XD-induced N(TAIL) alpha-helical folding. Recombinant infectious virus was recovered for all mutants, and transcriptase elongation rates remained within a 1.7-fold range of parent virus. Box-2 mutations did however impose a significant cost to infectivity, reflected in an increase in the amount of input genome required to match the infectivity of parent virus. Diminished infectivity could not be attributed to changes in virion protein composition or production of defective interfering particles, where changes from parent virus were within a 3-fold range. The results indicated that MeV polymerase activity, but not infectivity, tolerates amino acid changes in the XD-binding region of the nucleoprotein. Selectional pressure for conservation of the Box-2 sequence may thus reflect a role in assuring the fidelity of polymerase functions or the assembly of viral particles required for optimal infectivity.

  8. Translation initiation in bacterial polysomes through ribosome loading on a standby site on a highly translated mRNA

    Science.gov (United States)

    Andreeva, Irena

    2018-01-01

    During translation, consecutive ribosomes load on an mRNA and form a polysome. The first ribosome binds to a single-stranded mRNA region and moves toward the start codon, unwinding potential mRNA structures on the way. In contrast, the following ribosomes can dock at the start codon only when the first ribosome has vacated the initiation site. Here we show that loading of the second ribosome on a natural 38-nt-long 5′ untranslated region of lpp mRNA, which codes for the outer membrane lipoprotein from Escherichia coli, takes place before the leading ribosome has moved away from the start codon. The rapid formation of this standby complex depends on the presence of ribosomal proteins S1/S2 in the leading ribosome. The early recruitment of the second ribosome to the standby site before translation by the leading ribosome and the tight coupling between translation elongation by the first ribosome and the accommodation of the second ribosome can contribute to high translational efficiency of the lpp mRNA. PMID:29632209

  9. A computational investigation on the connection between dynamics properties of ribosomal proteins and ribosome assembly.

    Directory of Open Access Journals (Sweden)

    Brittany Burton

    Full Text Available Assembly of the ribosome from its protein and RNA constituents has been studied extensively over the past 50 years, and experimental evidence suggests that prokaryotic ribosomal proteins undergo conformational changes during assembly. However, to date, no studies have attempted to elucidate these conformational changes. The present work utilizes computational methods to analyze protein dynamics and to investigate the linkage between dynamics and binding of these proteins during the assembly of the ribosome. Ribosomal proteins are known to be positively charged and we find the percentage of positive residues in r-proteins to be about twice that of the average protein: Lys+Arg is 18.7% for E. coli and 21.2% for T. thermophilus. Also, positive residues constitute a large proportion of RNA contacting residues: 39% for E. coli and 46% for T. thermophilus. This affirms the known importance of charge-charge interactions in the assembly of the ribosome. We studied the dynamics of three primary proteins from E. coli and T. thermophilus 30S subunits that bind early in the assembly (S15, S17, and S20 with atomic molecular dynamic simulations, followed by a study of all r-proteins using elastic network models. Molecular dynamics simulations show that solvent-exposed proteins (S15 and S17 tend to adopt more stable solution conformations than an RNA-embedded protein (S20. We also find protein residues that contact the 16S rRNA are generally more mobile in comparison with the other residues. This is because there is a larger proportion of contacting residues located in flexible loop regions. By the use of elastic network models, which are computationally more efficient, we show that this trend holds for most of the 30S r-proteins.

  10. On the control of ribosomal protein biosynthesis in Escherichia coli

    International Nuclear Information System (INIS)

    Pichon, J.; Marvaldi, J.; Coeroli, C.; Cozzone, A.; Marchis-Mouren, G.

    1977-01-01

    The rate of individual ribosomal protein synthesis relative to total protein synthesis has been determined in Escherichia coli rel + and rel - cells, under valyl-tRNA deprivation. These strains have a temperature-sensitive valyl-tRNA synthetase. Starvation was obtained following transfer of the cells to non-permissive temperature. Ribosomal proteins were obtained by treatment of either total lysates of freeze-thawed lysozyme spheroplasts or ammonium sulphate precipitate of ribosomes, with acetic acid. Differential labelling of the ribosomal proteins was observed in both strains: proteins from the rel + strain appear more labelled than those from the rel - strain, the rate of labelling of individual proteins being about the same in both strains. Moreover ribosomal proteins were found as stable during starvation as total protein. It is thus concluded that in starving cells individual ribosomal proteins are not synthesized at equal rates. This indicates that the synthesis of ribosomal proteins is not only under the control of the rel gene

  11. D1/D2 domain of large-subunit ribosomal DNA for differentiation of Orpinomyces spp.

    Science.gov (United States)

    Dagar, Sumit S; Kumar, Sanjay; Mudgil, Priti; Singh, Rameshwar; Puniya, Anil K

    2011-09-01

    This study presents the suitability of D1/D2 domain of large-subunit (LSU) ribosomal DNA (rDNA) for differentiation of Orpinomyces joyonii and Orpinomyces intercalaris based on PCR-restriction fragment length polymorphism (RFLP). A variation of G/T in O. intercalaris created an additional restriction site for AluI, which was used as an RFLP marker. The results demonstrate adequate heterogeneity in the LSU rDNA for species-level differentiation.

  12. Simulating movement of tRNA through the ribosome during hybrid-state formation.

    Science.gov (United States)

    Whitford, Paul C; Sanbonmatsu, Karissa Y

    2013-09-28

    Biomolecular simulations provide a means for exploring the relationship between flexibility, energetics, structure, and function. With the availability of atomic models from X-ray crystallography and cryoelectron microscopy (cryo-EM), and rapid increases in computing capacity, it is now possible to apply molecular dynamics (MD) simulations to large biomolecular machines, and systematically partition the factors that contribute to function. A large biomolecular complex for which atomic models are available is the ribosome. In the cell, the ribosome reads messenger RNA (mRNA) in order to synthesize proteins. During this essential process, the ribosome undergoes a wide range of conformational rearrangements. One of the most poorly understood transitions is translocation: the process by which transfer RNA (tRNA) molecules move between binding sites inside of the ribosome. The first step of translocation is the adoption of a "hybrid" configuration by the tRNAs, which is accompanied by large-scale rotations in the ribosomal subunits. To illuminate the relationship between these rearrangements, we apply MD simulations using a multi-basin structure-based (SMOG) model, together with targeted molecular dynamics protocols. From 120 simulated transitions, we demonstrate the viability of a particular route during P/E hybrid-state formation, where there is asynchronous movement along rotation and tRNA coordinates. These simulations not only suggest an ordering of events, but they highlight atomic interactions that may influence the kinetics of hybrid-state formation. From these simulations, we also identify steric features (H74 and surrounding residues) encountered during the hybrid transition, and observe that flexibility of the single-stranded 3'-CCA tail is essential for it to reach the endpoint. Together, these simulations provide a set of structural and energetic signatures that suggest strategies for modulating the physical-chemical properties of protein synthesis by the

  13. Structure of the C-terminal domain of lettuce necrotic yellows virus phosphoprotein.

    Science.gov (United States)

    Martinez, Nicolas; Ribeiro, Euripedes A; Leyrat, Cédric; Tarbouriech, Nicolas; Ruigrok, Rob W H; Jamin, Marc

    2013-09-01

    Lettuce necrotic yellows virus (LNYV) is a prototype of the plant-adapted cytorhabdoviruses. Through a meta-prediction of disorder, we localized a folded C-terminal domain in the amino acid sequence of its phosphoprotein. This domain consists of an autonomous folding unit that is monomeric in solution. Its structure, solved by X-ray crystallography, reveals a lollipop-shaped structure comprising five helices. The structure is different from that of the corresponding domains of other Rhabdoviridae, Filoviridae, and Paramyxovirinae; only the overall topology of the polypeptide chain seems to be conserved, suggesting that this domain evolved under weak selective pressure and varied in size by the acquisition or loss of functional modules.

  14. Raptor, a positive regulatory subunit of mTOR complex 1, is a novel phosphoprotein of the rDNA transcription machinery in nucleoli and chromosomal nucleolus organizer regions (NORs).

    Science.gov (United States)

    Vazquez-Martin, Alejandro; Cufí, Sílvia; Oliveras-Ferraros, Cristina; Menendez, Javier A

    2011-09-15

    Raptor is the key scaffolding protein that recruits mTOR substrates to rapamycin-sensitive mTOR complex 1 (mTORC1), a molecular integrator of mitogenic and nutrient/energy environmental inputs into protein translation and cell growth. Although Raptor phosphorylation on various sites is pivotal in the regulation of mTORC1 activity, it remains to be elucidated whether site-specific phosphorylation differentially distributes Raptor to unique subcellular compartments. When exploring the spatiotemporal cell cycle dynamics of six different phospho (P)-Raptor isoforms (Thr ( 706) , Ser ( 722) , Ser ( 863) , Ser ( 792) and Ser ( 877) ), a number of remarkable events differentially defined a topological resetting of P-RaptorThr706 on interphasic and mitotic chromosomes. In interphase nuclei, P-Raptor (Thr706) co-localized with fibrillarin, a component of the nucleolar small nuclear ribonucleoprotein particle, as well as with RNA polymerase I, the enzyme that transcribes nucleolar rRNA. Upon Actinomycin D-induced nucleolar segregation and disaggregation, P-RaptorThr706 was excluded from the nucleolus to accumulate at discrete nucleoplasmic bodies. During mitosis, CDK1 inhibition-induced premature assembly of nucleoli relocated fibrillarin to the surrounding regions of chromosomal-associated P-Raptor (Thr706) , suggesting that a subpopulation of mitotic P-Raptor (Thr706) remained targeted at chromosomal loops of rDNA or nuclear organizer regions (NORs). At the end of mitosis and cytokinesis, when reassembly of incipient nucleoli begins upon NORs activation of rDNA transcription, fibrillarin spatially reorganized with P-Raptor (Thr706) to give rise to daughter nucleoli. Treatment with IGF1 exclusively hyperactivated nuclear P-Raptor (Ser706) and concomitantly promoted Ser ( 2481) autophosphorylation of mTOR, which monitors mTORC1-associated catalytic activity. Nucleolar- and NOR-associated P-Raptor (Ser706) may physically link mTORC1 signaling to ever-growing nucleolus

  15. Genes Involved in Human Ribosome Biogenesis areTranscriptionally Upregulated in Colorectal Cancer

    DEFF Research Database (Denmark)

    Mansilla, Francisco; Lamy, Philippe; Ørntoft, Torben Falck

    2009-01-01

    Microarray gene expression profiling comprising 168 colorectal adenocarcinomas and 10 normal mucosas showed that over 79% of the genes involved in human ribosome biogenesis are significantly upregulated (log2>0.5, p<10-3) when compared to normal mucosa. Overexpression was independent of microsate......Microarray gene expression profiling comprising 168 colorectal adenocarcinomas and 10 normal mucosas showed that over 79% of the genes involved in human ribosome biogenesis are significantly upregulated (log2>0.5, p... of microsatellite status. The promoters of the genes studied showed a significant enrichment for several transcription factor binding sites. There was a significant correlation between the number of binding site targets for these transcription factors and the observed gene transcript upregulation. The upregulation...

  16. In Profile: Models of Ribosome Biogenesis Defects and Regulation of Protein Synthesis

    NARCIS (Netherlands)

    Essers, P.B.M.

    2013-01-01

    Ribosomes are the mediators of protein synthesis in the cell and therefore crucial to proper cell function. In addition, ribosomes are highly abundant, with ribosomal RNA making up 80% of the RNA in the cell. A large amount of resources go into maintaining this pool of ribosomes, so ribosome

  17. The primary structures of ribosomal proteins S14 and S16 from the archaebacterium Halobacterium marismortui. Comparison with eubacterial and eukaryotic ribosomal proteins.

    Science.gov (United States)

    Kimura, J; Kimura, M

    1987-09-05

    The amino acid sequences of two ribosomal proteins, S14 and S16, from the archaebacterium Halobacterium marismortui have been determined. Sequence data were obtained by the manual and solid-phase sequencing of peptides derived from enzymatic digestions with trypsin, chymotrypsin, pepsin, and Staphylococcus aureus protease as well as by chemical cleavage with cyanogen bromide. Proteins S14 and S16 contain 109 and 126 amino acid residues and have Mr values of 11,964 and 13,515, respectively. Comparison of the sequences with those of ribosomal proteins from other organisms demonstrates that S14 has a significant homology with the rat liver ribosomal protein S11 (36% identity) as well as with the Escherichia coli ribosomal protein S17 (37%), and that S16 is related to the yeast ribosomal protein YS22 (40%) and proteins S8 from E. coli (28%) and Bacillus stearothermophilus (30%). A comparison of the amino acid residues in the homologous regions of halophilic and nonhalophilic ribosomal proteins reveals that halophilic proteins have more glutamic acids, asparatic acids, prolines, and alanines, and less lysines, arginines, and isoleucines than their nonhalophilic counterparts. These amino acid substitutions probably contribute to the structural stability of halophilic ribosomal proteins.

  18. The Circadian Clock Modulates Global Daily Cycles of mRNA Ribosome Loading[OPEN

    Science.gov (United States)

    Missra, Anamika; Ernest, Ben; Jia, Qidong; Ke, Kenneth

    2015-01-01

    Circadian control of gene expression is well characterized at the transcriptional level, but little is known about diel or circadian control of translation. Genome-wide translation state profiling of mRNAs in Arabidopsis thaliana seedlings grown in long day was performed to estimate ribosome loading per mRNA. The experiments revealed extensive translational regulation of key biological processes. Notably, translation of mRNAs for ribosomal proteins and mitochondrial respiration peaked at night. Central clock mRNAs are among those subject to fluctuations in ribosome loading. There was no consistent phase relationship between peak translation states and peak transcript levels. The overlay of distinct transcriptional and translational cycles can be expected to alter the waveform of the protein synthesis rate. Plants that constitutively overexpress the clock gene CCA1 showed phase shifts in peak translation, with a 6-h delay from midnight to dawn or from noon to evening being particularly common. Moreover, cycles of ribosome loading that were detected under continuous light in the wild type collapsed in the CCA1 overexpressor. Finally, at the transcript level, the CCA1-ox strain adopted a global pattern of transcript abundance that was broadly correlated with the light-dark environment. Altogether, these data demonstrate that gene-specific diel cycles of ribosome loading are controlled in part by the circadian clock. PMID:26392078

  19. Ribosomes slide on lysine-encoding homopolymeric A stretches

    Science.gov (United States)

    Koutmou, Kristin S; Schuller, Anthony P; Brunelle, Julie L; Radhakrishnan, Aditya; Djuranovic, Sergej; Green, Rachel

    2015-01-01

    Protein output from synonymous codons is thought to be equivalent if appropriate tRNAs are sufficiently abundant. Here we show that mRNAs encoding iterated lysine codons, AAA or AAG, differentially impact protein synthesis: insertion of iterated AAA codons into an ORF diminishes protein expression more than insertion of synonymous AAG codons. Kinetic studies in E. coli reveal that differential protein production results from pausing on consecutive AAA-lysines followed by ribosome sliding on homopolymeric A sequence. Translation in a cell-free expression system demonstrates that diminished output from AAA-codon-containing reporters results from premature translation termination on out of frame stop codons following ribosome sliding. In eukaryotes, these premature termination events target the mRNAs for Nonsense-Mediated-Decay (NMD). The finding that ribosomes slide on homopolymeric A sequences explains bioinformatic analyses indicating that consecutive AAA codons are under-represented in gene-coding sequences. Ribosome ‘sliding’ represents an unexpected type of ribosome movement possible during translation. DOI: http://dx.doi.org/10.7554/eLife.05534.001 PMID:25695637

  20. Two Nucleolar Proteins, GDP1 and OLI2, Function As Ribosome Biogenesis Factors and Are Preferentially Involved in Promotion of Leaf Cell Proliferation without Strongly Affecting Leaf Adaxial–Abaxial Patterning in Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    Koji Kojima

    2018-01-01

    Full Text Available Leaf abaxial–adaxial patterning is dependent on the mutual repression of leaf polarity genes expressed either adaxially or abaxially. In Arabidopsis thaliana, this process is strongly affected by mutations in ribosomal protein genes and in ribosome biogenesis genes in a sensitized genetic background, such as asymmetric leaves2 (as2. Most ribosome-related mutants by themselves do not show leaf abaxialization, and one of their typical phenotypes is the formation of pointed rather than rounded leaves. In this study, we characterized two ribosome-related mutants to understand how ribosome biogenesis is linked to several aspects of leaf development. Previously, we isolated oligocellula2 (oli2 which exhibits the pointed-leaf phenotype and has a cell proliferation defect. OLI2 encodes a homolog of Nop2 in Saccharomyces cerevisiae, a ribosome biogenesis factor involved in pre-60S subunit maturation. In this study, we found another pointed-leaf mutant that carries a mutation in a gene encoding an uncharacterized protein with a G-patch domain. Similar to oli2, this mutant, named g-patch domain protein1 (gdp1, has a reduced number of leaf cells. In addition, gdp1 oli2 double mutants showed a strong genetic interaction such that they synergistically impaired cell proliferation in leaves and produced markedly larger cells. On the other hand, they showed additive phenotypes when combined with several known ribosomal protein mutants. Furthermore, these mutants have a defect in pre-rRNA processing. GDP1 and OLI2 are strongly expressed in tissues with high cell proliferation activity, and GDP1-GFP and GFP-OLI2 are localized in the nucleolus. These results suggest that OLI2 and GDP1 are involved in ribosome biogenesis. We then examined the effects of gdp1 and oli2 on adaxial–abaxial patterning by crossing them with as2. Interestingly, neither gdp1 nor oli2 strongly enhanced the leaf polarity defect of as2. Similar results were obtained with as2 gdp1 oli2

  1. Mice with a Mutation in the Mdm2 Gene That Interferes with MDM2/Ribosomal Protein Binding Develop a Defect in Erythropoiesis.

    Directory of Open Access Journals (Sweden)

    Takuya Kamio

    Full Text Available MDM2, an E3 ubiquitin ligase, is an important negative regulator of tumor suppressor p53. In turn the Mdm2 gene is a transcriptional target of p53, forming a negative feedback loop that is important in cell cycle control. It has recently become apparent that the ubiquitination of p53 by MDM2 can be inhibited when certain ribosomal proteins, including RPL5 and RPL11, bind to MDM2. This inhibition, and the resulting increase in p53 levels has been proposed to be responsible for the red cell aplasia seen in Diamond-Blackfan anemia (DBA and in 5q- myelodysplastic syndrome (MDS. DBA and 5q- MDS are associated with inherited (DBA or acquired (5q- MDS haploinsufficiency of ribosomal proteins. A mutation in Mdm2 causing a C305F amino acid substitution blocks the binding of ribosomal proteins. Mice harboring this mutation (Mdm2C305F, retain a normal p53 response to DNA damage, but lack the p53 response to perturbations in ribosome biogenesis. While studying the interaction between RP haploinsufficiency and the Mdm2C305F mutation we noticed that Mdm2C305F homozygous mice had altered hematopoiesis. These mice developed a mild macrocytic anemia with reticulocytosis. In the bone marrow (BM, these mice showed a significant decrease in Ter119hi cells compared to wild type (WT littermates, while no decrease in the number of mature erythroid cells (Ter119hiCD71low was found in the spleen, which showed compensated bone marrow hematopoiesis. In methylcellulose cultures, BFU-E colonies from the mutant mice were slightly reduced in number and there was a significant reduction in CFU-E colony numbers in mutant mice compared with WT controls (p < 0.01. This erythropoietic defect was abrogated by concomitant p53 deficiency (Trp53ko/ko. Further investigation revealed that in Mdm2C305F animals, there was a decrease in Lin-Sca-1+c-Kit+ (LSK cells, accompanied by significant decreases in multipotent progenitor (MPP cells (p < 0.01. Competitive BM repopulation experiments

  2. Differential expression of proteins and phosphoproteins during larval metamorphosis of the polychaete Capitella sp. I

    KAUST Repository

    Chandramouli, Kondethimmanahalli

    2011-09-03

    Background: The spontaneous metamorphosis of the polychaete Capitella sp. I larvae into juveniles requires minor morphological changes, including segment formation, body elongation, and loss of cilia. In this study, we investigated changes in the expression patterns of both proteins and phosphoproteins during the transition from larvae to juveniles in this species. We used two-dimensional gel electrophoresis (2-DE) followed by multiplex fluorescent staining and MALDI-TOF mass spectrometry analysis to identify the differentially expressed proteins as well as the protein and phosphoprotein profiles of both competent larvae and juveniles.Results: Twenty-three differentially expressed proteins were identified in the two developmental stages. Expression patterns of two of those proteins were examined at the protein level by Western blot analysis while seven were further studied at the mRNA level by real-time PCR. Results showed that proteins related to cell division, cell migration, energy storage and oxidative stress were plentifully expressed in the competent larvae; in contrast, proteins involved in oxidative metabolism and transcriptional regulation were abundantly expressed in the juveniles.Conclusion: It is likely that these differentially expressed proteins are involved in regulating the larval metamorphosis process and can be used as protein markers for studying molecular mechanisms associated with larval metamorphosis in polychaetes. © 2011 Chandramouli et al; licensee BioMed Central Ltd.

  3. Differential expression of proteins and phosphoproteins during larval metamorphosis of the polychaete Capitella sp. I

    KAUST Repository

    Chandramouli, Kondethimmanahalli; Soo, Lisa; Qian, Pei-Yuan

    2011-01-01

    Background: The spontaneous metamorphosis of the polychaete Capitella sp. I larvae into juveniles requires minor morphological changes, including segment formation, body elongation, and loss of cilia. In this study, we investigated changes in the expression patterns of both proteins and phosphoproteins during the transition from larvae to juveniles in this species. We used two-dimensional gel electrophoresis (2-DE) followed by multiplex fluorescent staining and MALDI-TOF mass spectrometry analysis to identify the differentially expressed proteins as well as the protein and phosphoprotein profiles of both competent larvae and juveniles.Results: Twenty-three differentially expressed proteins were identified in the two developmental stages. Expression patterns of two of those proteins were examined at the protein level by Western blot analysis while seven were further studied at the mRNA level by real-time PCR. Results showed that proteins related to cell division, cell migration, energy storage and oxidative stress were plentifully expressed in the competent larvae; in contrast, proteins involved in oxidative metabolism and transcriptional regulation were abundantly expressed in the juveniles.Conclusion: It is likely that these differentially expressed proteins are involved in regulating the larval metamorphosis process and can be used as protein markers for studying molecular mechanisms associated with larval metamorphosis in polychaetes. © 2011 Chandramouli et al; licensee BioMed Central Ltd.

  4. Phosphoric acid as a matrix additive for MALDI MS analysis of phosphopeptides and phosphoproteins

    DEFF Research Database (Denmark)

    Kjellström, Sven; Jensen, Ole Nørregaard

    2004-01-01

    Phosphopeptides are often detected with low efficiency by MALDI MS analysis of peptide mixtures. In an effort to improve the phosphopeptide ion response in MALDI MS, we investigated the effects of adding low concentrations of organic and inorganic acids during peptide sample preparation in 2,5-di...... acid to 2,5-DHB were also observed in LC-MALDI-MS analysis of tryptic phosphopeptides of B. subtilis PrkC phosphoprotein. Finally, the mass resolution of MALDI mass spectra of intact proteins was significantly improved by using phosphoric acid in 2,5-DHB matrix....

  5. Characterization of a viral phosphoprotein binding site on the surface of the respiratory syncytial nucleoprotein.

    Science.gov (United States)

    Galloux, Marie; Tarus, Bogdan; Blazevic, Ilfad; Fix, Jenna; Duquerroy, Stéphane; Eléouët, Jean-François

    2012-08-01

    The human respiratory syncytial virus (HRSV) genome is composed of a negative-sense single-stranded RNA that is tightly associated with the nucleoprotein (N). This ribonucleoprotein (RNP) complex is the template for replication and transcription by the viral RNA-dependent RNA polymerase. RNP recognition by the viral polymerase involves a specific interaction between the C-terminal domain of the phosphoprotein (P) (P(CTD)) and N. However, the P binding region on N remains to be identified. In this study, glutathione S-transferase (GST) pulldown assays were used to identify the N-terminal core domain of HRSV N (N(NTD)) as a P binding domain. A biochemical characterization of the P(CTD) and molecular modeling of the N(NTD) allowed us to define four potential candidate pockets on N (pocket I [PI] to PIV) as hydrophobic sites surrounded by positively charged regions, which could constitute sites complementary to the P(CTD) interaction domain. The role of selected amino acids in the recognition of the N-RNA complex by P was first screened for by site-directed mutagenesis using a polymerase activity assay, based on an HRSV minigenome containing a luciferase reporter gene. When changed to Ala, most of the residues of PI were found to be critical for viral RNA synthesis, with the R132A mutant having the strongest effect. These mutations also reduced or abolished in vitro and in vivo P-N interactions, as determined by GST pulldown and immunoprecipitation experiments. The pocket formed by these residues is critical for P binding to the N-RNA complex, is specific for pneumovirus N proteins, and is clearly distinct from the P binding sites identified so far for other nonsegmented negative-strand viruses.

  6. Unstable structure of ribosomal particles synthesized in. gamma. -irradiated Escherichia coli

    Energy Technology Data Exchange (ETDEWEB)

    Fujita, H; Morita, K [National Inst. of Radiological Sciences, Chiba (Japan)

    1975-06-01

    Stability of Escherichia coli ribosomes newly synthesized after ..gamma..-irradiation was compared with that of normal ribosomes. The ribosomal particles around 70-S synthesized in irradiated cells were more sensitive to digestion by pancreatic ribonuclease A. A larger number of the salt-unstable '50-S' precursor particles existed in the extract from irradiated cells than in the extract from unirradiated cells. These facts suggest that ribosomal particles, synthesized during an earlier stage in irradiated cells, maintain an incomplete structure even though they are not distinguishable from normal ribosomes by means of sucrose density-gradient centrifugation.

  7. Label-Free Quantitation of Ribosomal Proteins from Bacillus subtilis for Antibiotic Research.

    Science.gov (United States)

    Schäkermann, Sina; Prochnow, Pascal; Bandow, Julia E

    2017-01-01

    Current research is focusing on ribosome heterogeneity as a response to changing environmental conditions and stresses, such as antibiotic stress. Altered stoichiometry and composition of ribosomal proteins as well as association of additional protein factors are mechanisms for shaping the protein expression profile or hibernating ribosomes. Here, we present a method for the isolation of ribosomes to analyze antibiotic-induced changes in the composition of ribosomes in Bacillus subtilis or other bacteria. Ribosomes and associated proteins are isolated by ultracentrifugation and proteins are identified and quantified using label-free mass spectrometry.

  8. A comparative study of ribosomal proteins: linkage between amino acid distribution and ribosomal assembly

    International Nuclear Information System (INIS)

    Lott, Brittany Burton; Wang, Yongmei; Nakazato, Takuya

    2013-01-01

    Assembly of the ribosome from its protein and RNA constituents must occur quickly and efficiently in order to synthesize the proteins necessary for all cellular activity. Since the early 1960’s, certain characteristics of possible assembly pathways have been elucidated, yet the mechanisms that govern the precise recognition events remain unclear. We utilize a comparative analysis to investigate the amino acid composition of ribosomal proteins (r-proteins) with respect to their role in the assembly process. We compared small subunit (30S) r-protein sequences to those of other housekeeping proteins from 560 bacterial species and searched for correlations between r-protein amino acid content and factors such as assembly binding order, environmental growth temperature, protein size, and contact with ribosomal RNA (rRNA) in the 30S complex. We find r-proteins have a significantly high percent of positive residues, which are highly represented at rRNA contact sites. An inverse correlation between the percent of positive residues and r-protein size was identified and is mainly due to the content of Lysine residues, rather than Arginine. Nearly all r-proteins carry a net positive charge, but no statistical correlation between the net charge and the binding order was detected. Thermophilic (high-temperature) r-proteins contain increased Arginine, Isoleucine, and Tyrosine, and decreased Serine and Threonine compared to mesophilic (lower-temperature), reflecting a known distinction between thermophiles and mesophiles, possibly to account for protein thermostability. However, this difference in amino acid content does not extend to rRNA contact sites, as the proportions of thermophilic and mesophilic contact residues are not significantly different. Given the significantly higher level of positively charged residues in r-proteins and at contact sites, we conclude that ribosome assembly relies heavily on an electrostatic component of interaction. However, the binding order of

  9. Architecture of the large subunit of the mammalian mitochondrial ribosome.

    Science.gov (United States)

    Greber, Basil J; Boehringer, Daniel; Leitner, Alexander; Bieri, Philipp; Voigts-Hoffmann, Felix; Erzberger, Jan P; Leibundgut, Marc; Aebersold, Ruedi; Ban, Nenad

    2014-01-23

    Mitochondrial ribosomes synthesize a number of highly hydrophobic proteins encoded on the genome of mitochondria, the organelles in eukaryotic cells that are responsible for energy conversion by oxidative phosphorylation. The ribosomes in mammalian mitochondria have undergone massive structural changes throughout their evolution, including ribosomal RNA shortening and acquisition of mitochondria-specific ribosomal proteins. Here we present the three-dimensional structure of the 39S large subunit of the porcine mitochondrial ribosome determined by cryo-electron microscopy at 4.9 Å resolution. The structure, combined with data from chemical crosslinking and mass spectrometry experiments, reveals the unique features of the 39S subunit at near-atomic resolution and provides detailed insight into the architecture of the polypeptide exit site. This region of the mitochondrial ribosome has been considerably remodelled compared to its bacterial counterpart, providing a specialized platform for the synthesis and membrane insertion of the highly hydrophobic protein components of the respiratory chain.

  10. Hierarchical recruitment of ribosomal proteins and assembly factors remodels nucleolar pre-60S ribosomes.

    Science.gov (United States)

    Biedka, Stephanie; Micic, Jelena; Wilson, Daniel; Brown, Hailey; Diorio-Toth, Luke; Woolford, John L

    2018-04-24

    Ribosome biogenesis involves numerous preribosomal RNA (pre-rRNA) processing events to remove internal and external transcribed spacer sequences, ultimately yielding three mature rRNAs. Removal of the internal transcribed spacer 2 spacer RNA is the final step in large subunit pre-rRNA processing and begins with endonucleolytic cleavage at the C 2 site of 27SB pre-rRNA. C 2 cleavage requires the hierarchical recruitment of 11 ribosomal proteins and 14 ribosome assembly factors. However, the function of these proteins in C 2 cleavage remained unclear. In this study, we have performed a detailed analysis of the effects of depleting proteins required for C 2 cleavage and interpreted these results using cryo-electron microscopy structures of assembling 60S subunits. This work revealed that these proteins are required for remodeling of several neighborhoods, including two major functional centers of the 60S subunit, suggesting that these remodeling events form a checkpoint leading to C 2 cleavage. Interestingly, when C 2 cleavage is directly blocked by depleting or inactivating the C 2 endonuclease, assembly progresses through all other subsequent steps. © 2018 Biedka et al.

  11. gamma. radiation effect on the functional properties of the cotton ribosomes

    Energy Technology Data Exchange (ETDEWEB)

    Ibragimov, A P; Safarov, Sh

    1973-01-01

    A study is made of the action of radiation on the functional properties of ribosomes in irradiated organisms and on isolated ribosomes exposed to different doses. With increase in dose there occurs a reduction in the incorporation of labelled amino acids by the ribosomes released from irradiated sprouts and also during irradiation of isolated ribosomes. The study covered the functional activity of ribosomes irradiated at different doses with the use of synthetic poly-U and poly-A matrices synthesizing polyphenylalanine and polylysine, depending on the irradiation dose. The inhibition of the activity of the protein synthesis system at high doses is due to structural and functional changes in ribosomes and also to disturbance in the biosynthesis and functions of the messenger RNA.

  12. Structure of the C-Terminal Domain of Lettuce Necrotic Yellows Virus Phosphoprotein

    Science.gov (United States)

    Martinez, Nicolas; Ribeiro, Euripedes A.; Leyrat, Cédric; Tarbouriech, Nicolas; Ruigrok, Rob W. H.

    2013-01-01

    Lettuce necrotic yellows virus (LNYV) is a prototype of the plant-adapted cytorhabdoviruses. Through a meta-prediction of disorder, we localized a folded C-terminal domain in the amino acid sequence of its phosphoprotein. This domain consists of an autonomous folding unit that is monomeric in solution. Its structure, solved by X-ray crystallography, reveals a lollipop-shaped structure comprising five helices. The structure is different from that of the corresponding domains of other Rhabdoviridae, Filoviridae, and Paramyxovirinae; only the overall topology of the polypeptide chain seems to be conserved, suggesting that this domain evolved under weak selective pressure and varied in size by the acquisition or loss of functional modules. PMID:23785215

  13. Interaction of tRNA with Eukaryotic Ribosome

    Directory of Open Access Journals (Sweden)

    Dmitri Graifer

    2015-03-01

    Full Text Available This paper is a review of currently available data concerning interactions of tRNAs with the eukaryotic ribosome at various stages of translation. These data include the results obtained by means of cryo-electron microscopy and X-ray crystallography applied to various model ribosomal complexes, site-directed cross-linking with the use of tRNA derivatives bearing chemically or photochemically reactive groups in the CCA-terminal fragment and chemical probing of 28S rRNA in the region of the peptidyl transferase center. Similarities and differences in the interactions of tRNAs with prokaryotic and eukaryotic ribosomes are discussed with concomitant consideration of the extent of resemblance between molecular mechanisms of translation in eukaryotes and bacteria.

  14. The architecture of mammalian ribosomal protein promoters

    Directory of Open Access Journals (Sweden)

    Perry Robert P

    2005-02-01

    Full Text Available Abstract Background Mammalian ribosomes contain 79 different proteins encoded by widely scattered single copy genes. Coordinate expression of these genes at transcriptional and post-transcriptional levels is required to ensure a roughly equimolar accumulation of ribosomal proteins. To date, detailed studies of only a very few ribosomal protein (rp promoters have been made. To elucidate the general features of rp promoter architecture, I made a detailed sequence comparison of the promoter regions of the entire set of orthologous human and mouse rp genes. Results A striking evolutionarily conserved feature of most rp genes is the separation by an intron of the sequences involved in transcriptional and translational regulation from the sequences with protein encoding function. Another conserved feature is the polypyrimidine initiator, which conforms to the consensus (Y2C+1TY(T2(Y3. At least 60 % of the rp promoters contain a largely conserved TATA box or A/T-rich motif, which should theoretically have TBP-binding capability. A remarkably high proportion of the promoters contain conserved binding sites for transcription factors that were previously implicated in rp gene expression, namely upstream GABP and Sp1 sites and downstream YY1 sites. Over 80 % of human and mouse rp genes contain a transposable element residue within 900 bp of 5' flanking sequence; very little sequence identity between human and mouse orthologues was evident more than 200 bp upstream of the transcriptional start point. Conclusions This analysis has provided some valuable insights into the general architecture of mammalian rp promoters and has identified parameters that might coordinately regulate the transcriptional activity of certain subsets of rp genes.

  15. [Screening of phosphoprotein associated with glycosphingolipid microdomains 1 (PAG1) by cDNA microarray and influence of overexpression of PAG1 on biologic behavior of human metastatic prostatic cancer cell line in vitro].

    Science.gov (United States)

    Yu, Wen-juan; Wang, Yue-wei; Xie, Zhi-gang; You, Jiang-feng; Wang, Jie-liang; Cui, Xiang-lin; Pei, Fei; Zheng, Jie

    2010-02-01

    To screen for novel gene(s) associated with tumor metastasis, and to investigate the effect of overexpression of phosphoprotein associated with glycosphingolipid microdomains 1 (PAG1) on the biological behaviors of human prostatic cancer cell line PC-3M-1E8 in vitro. Four cDNA microarrays were constructed using cDNA library of prostatic cancer cells PC-3M-1E8 (high metastatic potential), PC-3M-2B4 (low metastatic potential), lung cancer cells PG-BE1 (high metastatic potential)and PG-LH7 (low metastatic potential)to screen genes which were differentially expressed according to their different metastatic properties. From a battery of differentially expressed genes, PAG1, which was markedly downregulated in both high metastatic sublines of PC-3M and PG was chosen for further investigation. Real-time PCR and Western blot were used to confirm the gene expression of PAG1 at mRNA and protein levels. Full-length coding sequence of human PAG1 was subcloned into plasmid pcDNA3.0 and the recombinant plasmids were stably transfected into PC-3M-1E8. The cell proliferation ability, anchorage-independent growth, cell cycle distribution, apoptosis rates and invasive ability were detected by MTT, and in addition, soft agar colony formation, flow cytometry analysis and matrigel invasion assay using Boyden chamber were also carried out respectively. All experiments contained pcDNA3.0-PAG1-transfected clones, vector transfected clones and non-transfected parental cells. A total of 327 differentially expressed genes were obtained between the high and low metastatic sublines of PC-3M cells, including 123 upregulated and 204 downregulated genes in PC-3M-1E8. A total of 281 genes, including 167 upregulated and 114 downregulated genes were obtained in PG-BE1 cells. Nine genes were simultaneously downregulated and 8 genes were upregulated in both high metastatic cell lines of PC-3M and PG. The expression of PAG1 at mRNA and protein level were decreased in the high metastatic subline PC-3M-1

  16. Macrolide antibiotic interaction and resistance on the bacterial ribosome.

    Science.gov (United States)

    Poehlsgaard, Jacob; Douthwaite, Stephen

    2003-02-01

    Our understanding of the fine structure of many antibiotic target sites has reached a new level of enlightenment in the last couple of years due to the advent, by X-ray crystallography, of high-resolution structures of the bacterial ribosome. Many classes of clinically useful antibiotics bind to the ribosome to inhibit bacterial protein synthesis. Macrolide, lincosamide and streptogramin B (MLSB) antibiotics form one of the largest groups, and bind to the same site on the 50S ribosomal subunit. Here, we review the molecular details of the ribosomal MLSB site to put into perspective the main points from a wealth of biochemical and genetic data that have been collected over several decades. The information is now available to understand, at atomic resolution, how macrolide antibiotics interact with their ribosomal target, how the target is altered to confer resistance, and in which directions we need to look if we are to rationally design better drugs to overcome the extant resistance mechanisms.

  17. Cis-regulatory RNA elements that regulate specialized ribosome activity.

    Science.gov (United States)

    Xue, Shifeng; Barna, Maria

    2015-01-01

    Recent evidence has shown that the ribosome itself can play a highly regulatory role in the specialized translation of specific subpools of mRNAs, in particular at the level of ribosomal proteins (RP). However, the mechanism(s) by which this selection takes place has remained poorly understood. In our recent study, we discovered a combination of unique RNA elements in the 5'UTRs of mRNAs that allows for such control by the ribosome. These mRNAs contain a Translation Inhibitory Element (TIE) that inhibits general cap-dependent translation, and an Internal Ribosome Entry Site (IRES) that relies on a specific RP for activation. The unique combination of an inhibitor of general translation and an activator of specialized translation is key to ribosome-mediated control of gene expression. Here we discuss how these RNA regulatory elements provide a new level of control to protein expression and their implications for gene expression, organismal development and evolution.

  18. D1/D2 Domain of Large-Subunit Ribosomal DNA for Differentiation of Orpinomyces spp.▿

    Science.gov (United States)

    Dagar, Sumit S.; Kumar, Sanjay; Mudgil, Priti; Singh, Rameshwar; Puniya, Anil K.

    2011-01-01

    This study presents the suitability of D1/D2 domain of large-subunit (LSU) ribosomal DNA (rDNA) for differentiation of Orpinomyces joyonii and Orpinomyces intercalaris based on PCR-restriction fragment length polymorphism (RFLP). A variation of G/T in O. intercalaris created an additional restriction site for AluI, which was used as an RFLP marker. The results demonstrate adequate heterogeneity in the LSU rDNA for species-level differentiation. PMID:21784906

  19. Combined Effect of the Cfr Methyltransferase and Ribosomal Protein L3 Mutations on Resistance to Ribosome-Targeting Antibiotics.

    Science.gov (United States)

    Pakula, Kevin K; Hansen, Lykke H; Vester, Birte

    2017-09-01

    Several groups of antibiotics inhibit bacterial growth by binding to bacterial ribosomes. Mutations in ribosomal protein L3 have been associated with resistance to linezolid and tiamulin, which both bind at the peptidyl transferase center in the ribosome. Resistance to these and other antibiotics also occurs through methylation of 23S rRNA at position A2503 by the methyltransferase Cfr. The mutations in L3 and the cfr gene have been found together in clinical isolates, raising the question of whether they have a combined effect on antibiotic resistance or growth. We transformed a plasmid-borne cfr gene into a uL3-depleted Escherichia coli strain containing either wild-type L3 or L3 with one of seven mutations, G147R, Q148F, N149S, N149D, N149R, Q150L, or T151P, expressed from plasmid-carried rplC genes. The L3 mutations are well tolerated, with small to moderate growth rate decreases. The presence of Cfr has a very minor influence on the growth rate. The resistance of the transformants to linezolid, tiamulin, florfenicol, and Synercid (a combination of quinupristin and dalfopristin [Q-D]) was measured by MIC assays. The resistance from Cfr was, in all cases, stronger than the effects of the L3 mutations, but various effects were obtained with the combinations of Cfr and L3 mutations ranging from a synergistic to an antagonistic effect. Linezolid and tiamulin susceptibility varied greatly among the L3 mutations, while no significant effects on florfenicol and Q-D susceptibility were seen. This study underscores the complex interplay between various resistance mechanisms and cross-resistance, even from antibiotics with overlapping binding sites. Copyright © 2017 American Society for Microbiology.

  20. Reaction of some macrolide antibiotics with the ribosome. Labeling of the binding site components

    International Nuclear Information System (INIS)

    Tejedor, F.; Ballesta, J.P.

    1986-01-01

    Radioactive carbomycin A, niddamycin, tylosin, and spiramycin, but not erythromycin, can be covalently bound to Escherichia coli ribosomes by incubation at 37 degrees C. The incorporation of radioactivity into the particles is inhibited by SH- and activated double bond containing compounds but not by amino groups, suggesting that the reactions may take place by addition to the double bond present in the reactive antibiotics. This thermic reaction must be different from the photoreaction described for some of these macrolides [Tejedor, F., and Ballesta, J. P. G. (1985) Biochemistry 24, 467-472] since tylosin, which is not photoincorporated, is thermically bound to ribosomes. Most of the radioactivity is incorporated into the ribosomal proteins. Two-dimensional gel electrophoresis of proteins labeled by carbomycin A, niddamycin, and tylosin indicates that about 40% of the radioactivity is bound to protein L27; the rest is distributed among several other proteins such as L8, L2, and S12, to differing extents depending on the drug used. These results indicate, in accordance with previous data, that protein L27 plays an important role in the macrolide binding site, confirming that these drugs bind near the peptidyl transferase center of the ribosome

  1. The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus.

    Science.gov (United States)

    Hori, H; Osawa, S; Murao, K; Ishikura, H

    1980-01-01

    The nucleotide sequence of ribosomal 5S RNA from Micrococcus lysodeikticus is pGUUACGGCGGCUAUAGCGUGGGGGAAACGCCCGGCCGUAUAUCGAACCCGGAAGCUAAGCCCCAUAGCGCCGAUGGUUACUGUAACCGGGAGGUUGUGGGAGAGUAGGUCGCCGCCGUGAOH. When compared to other 5S RNAs, the sequence homology is greatest with Thermus aquaticus, and these two 5S RNAs reveal several features intermediate between those of typical gram-positive bacteria and gram-negative bacteria. PMID:6780979

  2. Trapping the ribosome to control gene expression.

    Science.gov (United States)

    Boehringer, Daniel; Ban, Nenad

    2007-09-21

    Protein synthesis is often regulated by structured mRNAs that interact with ribosomes. In this issue of Cell, Marzi et al. (2007) provide insights into the autoregulation of protein S15 by visualizing the folded repressor mRNA on the ribosome stalled in the preinitiation state. These results have implications for our understanding of the mechanism of translation initiation in general.

  3. A Listeria monocytogenes RNA helicase essential for growth and ribosomal maturation at low temperatures uses its C terminus for appropriate interaction with the ribosome.

    Science.gov (United States)

    Netterling, Sakura; Vaitkevicius, Karolis; Nord, Stefan; Johansson, Jörgen

    2012-08-01

    Listeria monocytogenes, a Gram-positive food-borne human pathogen, is able to grow at temperatures close to 0°C and is thus of great concern for the food industry. In this work, we investigated the physiological role of one DExD-box RNA helicase in Listeria monocytogenes. The RNA helicase Lmo1722 was required for optimal growth at low temperatures, whereas it was dispensable at 37°C. A Δlmo1722 strain was less motile due to downregulation of the major subunit of the flagellum, FlaA, caused by decreased flaA expression. By ribosomal fractionation experiments, it was observed that Lmo1722 was mainly associated with the 50S subunit of the ribosome. Absence of Lmo1722 decreased the fraction of 50S ribosomal subunits and mature 70S ribosomes and affected the processing of the 23S precursor rRNA. The ribosomal profile could be restored to wild-type levels in a Δlmo1722 strain expressing Lmo1722. Interestingly, the C-terminal part of Lmo1722 was redundant for low-temperature growth, motility, 23S rRNA processing, and appropriate ribosomal maturation. However, Lmo1722 lacking the C terminus showed a reduced affinity for the 50S and 70S fractions, suggesting that the C terminus is important for proper guidance of Lmo1722 to the 50S subunit. Taken together, our results show that the Listeria RNA helicase Lmo1722 is essential for growth at low temperatures, motility, and rRNA processing and is important for ribosomal maturation, being associated mainly with the 50S subunit of the ribosome.

  4. Ribosomal binding region for the antibiotic tiamulin: stoichiometry, subunit location, and affinity for various analogs.

    Science.gov (United States)

    Högenauer, G; Ruf, C

    1981-01-01

    Equilibrium dialysis experiments with a highly purified preparation of labeled tiamulin, a semisynthetic derivative of the antibiotic pleuromutilin, and Escherichia coli ribosomes allowed the determination of two binding sites for the drug. The binding reaction showed a cooperative effect. Of the two subunits, the 50S particle was able to bind the antibiotic in a 1:1 stoichiometry. Hence, the 50S subunit contributed predominantly to the binding energy which held the antibiotic to the ribosomes. The 30S subunit, showing no strong affinity for the drug, may be needed for the generation of the second binding site in the 70S particle. If depleted of ammonium ions, 70S ribosomes lost their binding capacity for the antibiotic. The attachment sites for tiamulin could be restored by heating the ribosomes to 40 degrees C in the presence of either ammonium ions or the antibiotic. Other pleuromutilin derivatives displaced labeled tiamulin from its ribosomal binding sites. By quantifying this competition, the relative affinity of various pleuromutilin derivatives for E. coli ribosomes was determined. The binding correlated with the minimal inhibitory concentrations of these compounds against E. coli. When compared with the minimal inhibitory concentrations of these compounds against E. coli. When compared with the minimal inhibitory concentrations against E. coli. When compared with the minimal inhibitory concentrations against Staphylococcus aureus, the correlation was less strict, but the same trend prevailed. These results suggest that the antibacterial activities of various pleuromutilin derivatives on a given test organism are mainly determined by the strength of binding to the ribosomes within the bacterial cell. PMID:6751216

  5. Studies of the effects of ultraviolet radiation on the structural integrities of ribosomal RNA components of the Escherichia coli 50S ribosomal subunit

    International Nuclear Information System (INIS)

    Gorelic, L.; Parker, D.

    1978-01-01

    The effects of 254-nm radiation on the structural integrities of free and 50S ribosome-bound 5S and 23S ribosomal ribonucleic acids (rRNA) have been elucidated. Irradiation of aqueous solutions of Escherichia coli 50S ribosomes with 253.7-nm radiation results in the formation of single-strand breaks in double-stranded regions of the 23S rRNA component, but not in rRNA chain scission, and destabilization of the secondary structure of the 23S rRNA toward denaturation. The minimum doses of 253.7-nm radiation required for the first detection of the two effects are 7 x 10 19 quanta for the production of single-strand breaks in double-stranded regions of the 23S rRNA, and 19 quanta for destabilization of the 23S rRNA secondary structure. Free 23S rRNA is resistant toward photoinduced chain breakage at doses of 253.7-nm radiation up to at least 2.3 x 10 20 and is much less sensitive toward destabilization of secondary structure than ribosome-bound 23S rRNA. In contrast to the photosensitivity of 50S ribosome-bound 23S rRNA toward chain breakage, 50S ribosome-bound 5S rRNA is resistant toward chain breakage at doses of 253.7-nm radiation up to at least 2.3 x 10 20 quanta. Ribosome-bound 5S and 23S rRNA are also not photosensitive toward intermolecular 5S/23S rRNA cross-linkage

  6. cDNA, genomic sequence cloning and analysis of the ribosomal ...

    African Journals Online (AJOL)

    Ribosomal protein L37A (RPL37A) is a component of 60S large ribosomal subunit encoded by the RPL37A gene, which belongs to the family of ribosomal L37AE proteins, located in the cytoplasm. The complementary deoxyribonucleic acid (cDNA) and the genomic sequence of RPL37A were cloned successfully from giant ...

  7. Ribosomal and hematopoietic defects in induced pluripotent stem cells derived from Diamond Blackfan anemia patients.

    Science.gov (United States)

    Garçon, Loïc; Ge, Jingping; Manjunath, Shwetha H; Mills, Jason A; Apicella, Marisa; Parikh, Shefali; Sullivan, Lisa M; Podsakoff, Gregory M; Gadue, Paul; French, Deborah L; Mason, Philip J; Bessler, Monica; Weiss, Mitchell J

    2013-08-08

    Diamond Blackfan anemia (DBA) is a congenital disorder with erythroid (Ery) hypoplasia and tissue morphogenic abnormalities. Most DBA cases are caused by heterozygous null mutations in genes encoding ribosomal proteins. Understanding how haploinsufficiency of these ubiquitous proteins causes DBA is hampered by limited availability of tissues from affected patients. We generated induced pluripotent stem cells (iPSCs) from fibroblasts of DBA patients carrying mutations in RPS19 and RPL5. Compared with controls, DBA fibroblasts formed iPSCs inefficiently, although we obtained 1 stable clone from each fibroblast line. RPS19-mutated iPSCs exhibited defects in 40S (small) ribosomal subunit assembly and production of 18S ribosomal RNA (rRNA). Upon induced differentiation, the mutant clone exhibited globally impaired hematopoiesis, with the Ery lineage affected most profoundly. RPL5-mutated iPSCs exhibited defective 60S (large) ribosomal subunit assembly, accumulation of 12S pre-rRNA, and impaired erythropoiesis. In both mutant iPSC lines, genetic correction of ribosomal protein deficiency via complementary DNA transfer into the "safe harbor" AAVS1 locus alleviated abnormalities in ribosome biogenesis and hematopoiesis. Our studies show that pathological features of DBA are recapitulated by iPSCs, provide a renewable source of cells to model various tissue defects, and demonstrate proof of principle for genetic correction strategies in patient stem cells.

  8. Spontaneous reverse movement of mRNA-bound tRNA through the ribosome.

    Science.gov (United States)

    Konevega, Andrey L; Fischer, Niels; Semenkov, Yuri P; Stark, Holger; Wintermeyer, Wolfgang; Rodnina, Marina V

    2007-04-01

    During the translocation step of protein synthesis, a complex of two transfer RNAs bound to messenger RNA (tRNA-mRNA) moves through the ribosome. The reaction is promoted by an elongation factor, called EF-G in bacteria, which, powered by GTP hydrolysis, induces an open, unlocked conformation of the ribosome that allows for spontaneous tRNA-mRNA movement. Here we show that, in the absence of EF-G, there is spontaneous backward movement, or retrotranslocation, of two tRNAs bound to mRNA. Retrotranslocation is driven by the gain in affinity when a cognate E-site tRNA moves into the P site, which compensates the affinity loss accompanying the movement of peptidyl-tRNA from the P to the A site. These results lend support to the diffusion model of tRNA movement during translocation. In the cell, tRNA movement is biased in the forward direction by EF-G, which acts as a Brownian ratchet and prevents backward movement.

  9. Detection of protein-protein interactions by ribosome display and protein in situ immobilisation.

    Science.gov (United States)

    He, Mingyue; Liu, Hong; Turner, Martin; Taussig, Michael J

    2009-12-31

    We describe a method for identification of protein-protein interactions by combining two cell-free protein technologies, namely ribosome display and protein in situ immobilisation. The method requires only PCR fragments as the starting material, the target proteins being made through cell-free protein synthesis, either associated with their encoding mRNA as ribosome complexes or immobilised on a solid surface. The use of ribosome complexes allows identification of interacting protein partners from their attached coding mRNA. To demonstrate the procedures, we have employed the lymphocyte signalling proteins Vav1 and Grb2 and confirmed the interaction between Grb2 and the N-terminal SH3 domain of Vav1. The method has promise for library screening of pairwise protein interactions, down to the analytical level of individual domain or motif mapping.

  10. The ribosome biogenesis factor Nol11 is required for optimal rDNA transcription and craniofacial development in Xenopus.

    Directory of Open Access Journals (Sweden)

    John N Griffin

    2015-03-01

    Full Text Available The production of ribosomes is ubiquitous and fundamental to life. As such, it is surprising that defects in ribosome biogenesis underlie a growing number of symptomatically distinct inherited disorders, collectively called ribosomopathies. We previously determined that the nucleolar protein, NOL11, is essential for optimal pre-rRNA transcription and processing in human tissue culture cells. However, the role of NOL11 in the development of a multicellular organism remains unknown. Here, we reveal a critical function for NOL11 in vertebrate ribosome biogenesis and craniofacial development. Nol11 is strongly expressed in the developing cranial neural crest (CNC of both amphibians and mammals, and knockdown of Xenopus nol11 results in impaired pre-rRNA transcription and processing, increased apoptosis, and abnormal development of the craniofacial cartilages. Inhibition of p53 rescues this skeletal phenotype, but not the underlying ribosome biogenesis defect, demonstrating an evolutionarily conserved control mechanism through which ribosome-impaired craniofacial cells are removed. Excessive activation of this mechanism impairs craniofacial development. Together, our findings reveal a novel requirement for Nol11 in craniofacial development, present the first frog model of a ribosomopathy, and provide further insight into the clinically important relationship between specific ribosome biogenesis proteins and craniofacial cell survival.

  11. Control of ribosome traffic by position-dependent choice of synonymous codons

    DEFF Research Database (Denmark)

    Mitarai, Namiko; Pedersen, Steen

    2013-01-01

    Messenger RNA (mRNA) encodes a sequence of amino acids by using codons. For most amino acids, there are multiple synonymous codons that can encode the amino acid. The translation speed can vary from one codon to another, thus there is room for changing the ribosome speed while keeping the amino...... acid sequence and hence the resulting protein. Recently, it has been noticed that the choice of the synonymous codon, via the resulting distribution of slow- and fast-translated codons, affects not only on the average speed of one ribosome translating the mRNA but also might have an effect on nearby...... ribosomes by affecting the appearance of 'traffic jams' where multiple ribosomes collide and form queues. To test this 'context effect' further, we here investigate the effect of the sequence of synonymous codons on the ribosome traffic by using a ribosome traffic model with codon-dependent rates, estimated...

  12. Charge Segregation and Low Hydrophobicity Are Key Features of Ribosomal Proteins from Different Organisms*

    Science.gov (United States)

    Fedyukina, Daria V.; Jennaro, Theodore S.; Cavagnero, Silvia

    2014-01-01

    Ribosomes are large and highly charged macromolecular complexes consisting of RNA and proteins. Here, we address the electrostatic and nonpolar properties of ribosomal proteins that are important for ribosome assembly and interaction with other cellular components and may influence protein folding on the ribosome. We examined 50 S ribosomal subunits from 10 species and found a clear distinction between the net charge of ribosomal proteins from halophilic and non-halophilic organisms. We found that ∼67% ribosomal proteins from halophiles are negatively charged, whereas only up to ∼15% of ribosomal proteins from non-halophiles share this property. Conversely, hydrophobicity tends to be lower for ribosomal proteins from halophiles than for the corresponding proteins from non-halophiles. Importantly, the surface electrostatic potential of ribosomal proteins from all organisms, especially halophiles, has distinct positive and negative regions across all the examined species. Positively and negatively charged residues of ribosomal proteins tend to be clustered in buried and solvent-exposed regions, respectively. Hence, the majority of ribosomal proteins is characterized by a significant degree of intramolecular charge segregation, regardless of the organism of origin. This key property enables the ribosome to accommodate proteins within its complex scaffold regardless of their overall net charge. PMID:24398678

  13. Identification of nucleosome assembly protein 1 (NAP1) as an interacting partner of plant ribosomal protein S6 (RPS6) and a positive regulator of rDNA transcription

    Energy Technology Data Exchange (ETDEWEB)

    Son, Ora [Department of Biological Science, Sookmyung Women' s University, Seoul 140-742 (Korea, Republic of); Kim, Sunghan [Department of Biological Science, Sookmyung Women' s University, Seoul 140-742 (Korea, Republic of); Department of Plant Science, Plant Genomics and Breeding Institute, Research Institute of Agriculture and Life Sciences, Seoul National University, Seoul 151-921 (Korea, Republic of); Shin, Yun-jeong [Department of Biological Science, Sookmyung Women' s University, Seoul 140-742 (Korea, Republic of); Kim, Woo-Young [College of Pharmacy, Sookmyung Women' s University, Seoul 140-742 (Korea, Republic of); Koh, Hee-Jong, E-mail: heejkoh@snu.ac.kr [Department of Plant Science, Plant Genomics and Breeding Institute, Research Institute of Agriculture and Life Sciences, Seoul National University, Seoul 151-921 (Korea, Republic of); Cheon, Choong-Ill, E-mail: ccheon@sookmyung.ac.kr [Department of Biological Science, Sookmyung Women' s University, Seoul 140-742 (Korea, Republic of)

    2015-09-18

    The ribosomal protein S6 (RPS6) is a downstream component of the signaling mediated by the target of rapamycin (TOR) kinase that acts as a central regulator of the key metabolic processes, such as protein translation and ribosome biogenesis, in response to various environmental cues. In our previous study, we identified a novel role of plant RPS6, which negatively regulates rDNA transcription, forming a complex with a plant-specific histone deacetylase, AtHD2B. Here we report that the Arabidopsis RPS6 interacts additionally with a histone chaperone, nucleosome assembly protein 1(AtNAP1;1). The interaction does not appear to preclude the association of RPS6 with AtHD2B, as the AtNAP1 was also able to interact with AtHD2B as well as with an RPS6-AtHD2B fusion protein in the BiFC assay and pulldown experiment. Similar to a positive effect of the ribosomal S6 kinase 1 (AtS6K1) on rDNA transcription observed in this study, overexpression or down regulation of the AtNAP1;1 resulted in concomitant increase and decrease, respectively, in rDNA transcription suggesting a positive regulatory role played by AtNAP1 in plant rDNA transcription, possibly through derepression of the negative effect of the RPS6-AtHD2B complex. - Highlights: • Nucleosome assembly protein 1 (AtNAP1) interacts with RPS6 as well as with AtHD2B. • rDNA transcription is regulated S6K1. • Overexpression or down regulation of AtNAP1 results in concomitant increase or decrease in rDNA transcription.

  14. Transcriptional activation of ribosomal RNA genes during compensatory renal hypertrophy

    International Nuclear Information System (INIS)

    Ouellette, A.J.; Moonka, R.; Zelenetz, A.; Malt, R.A.

    1986-01-01

    The overall rate of rDNA transcription increases by 50% during the first 24 hours of compensatory renal hypertrophy in the mouse. To study mechanisms of ribosome accumulation after uninephrectomy, transcription rates were measured in isolated kidneys by transcriptional runoff. 32 P-labeled nascent transcripts were hybridized to blots containing linearized, denatured cloned rDNA, and hybridization was quantitated autoradiographically and by direct counting. Overall transcriptional activity of rDNA was increased by 30% above control levels at 6 hrs after nephrectomy and by 50% at 12, 18, and 24 hrs after operation. Hybridizing RNA was insensitive to inhibiby alpha-amanitin, and no hybridization was detected to vector DNA. Thus, accelerated rDNA transcription is one regulatory element in the accretion of ribosomes in renal growth, and the regulatory event is an early event. Mechanisms of activation may include enhanced transcription of active genes or induction of inactive DNA

  15. Altered Machinery of Protein Synthesis in Alzheimer's: From the Nucleolus to the Ribosome.

    Science.gov (United States)

    Hernández-Ortega, Karina; Garcia-Esparcia, Paula; Gil, Laura; Lucas, José J; Ferrer, Isidre

    2016-09-01

    Ribosomes and protein synthesis have been reported to be altered in the cerebral cortex at advanced stages of Alzheimer's disease (AD). Modifications in the hippocampus with disease progression have not been assessed. Sixty-seven cases including middle-aged (MA) and AD stages I-VI were analyzed. Nucleolar chaperones nucleolin, nucleophosmin and nucleoplasmin 3, and upstream binding transcription factor RNA polymerase I gene (UBTF) mRNAs are abnormally regulated and their protein levels reduced in AD. Histone modifications dimethylated histone H3K9 (H3K9me2) and acetylated histone H3K12 (H3K12ac) are decreased in CA1. Nuclear tau declines in CA1 and dentate gyrus (DG), and practically disappears in neurons with neurofibrillary tangles. Subunit 28 ribosomal RNA (28S rRNA) expression is altered in CA1 and DG in AD. Several genes encoding ribosomal proteins are abnormally regulated and protein levels of translation initiation factors eIF2α, eIF3η and eIF5, and elongation factor eEF2, are altered in the CA1 region in AD. These findings show alterations in the protein synthesis machinery in AD involving the nucleolus, nucleus and ribosomes in the hippocampus in AD some of them starting at first stages (I-II) preceding neuron loss. These changes may lie behind reduced numbers of dendritic branches and reduced synapses of CA1 and DG neurons which cause hippocampal atrophy. © 2015 International Society of Neuropathology.

  16. Expanding the ribosomal universe.

    Science.gov (United States)

    Dinman, Jonathan D; Kinzy, Terri Goss

    2009-12-09

    In this issue of Structure, Taylor et al. (2009) present the most complete model of an eukaryotic ribosome to date. This achievement represents a critical milestone along the path to structurally defining the unique aspects of the eukaryotic protein synthetic machinery.

  17. Hippocampal phosphoproteomics of F344 rats exposed to 1-bromopropane

    International Nuclear Information System (INIS)

    Huang, Zhenlie; Ichihara, Sahoko; Oikawa, Shinji; Chang, Jie; Zhang, Lingyi; Hu, Shijie; Huang, Hanlin; Ichihara, Gaku

    2015-01-01

    1-Bromopropane (1-BP) is neurotoxic in both experimental animals and human. To identify phosphorylated modification on the unrecognized post-translational modifications of proteins and investigate their role in 1-BP-induced neurotoxicity, changes in hippocampal phosphoprotein expression levels were analyzed quantitatively in male F344 rats exposed to 1-BP inhalation at 0, 400, or 1000 ppm for 8 h/day for 1 or 4 weeks. Hippocampal protein extracts were analyzed qualitatively and quantitatively by Pro-Q Diamond gel staining and SYPRO Ruby staining coupled with two-dimensional difference in gel electrophoresis (2D-DIGE), respectively, as well as by matrix-assisted laser-desorption ionization time-of-flight (MALDI-TOF) mass spectrometry (MS) to identify phosphoproteins. Changes in selected proteins were further confirmed by Manganese II (Mn 2+ )-Phos-tag SDS-polyacrylamide gel electrophoresis (SDS-PAGE). Bax and cytochrome c protein levels were determined by western blotting. Pro-Q Diamond gel staining combined with 2D-DIGE identified 26 phosphoprotein spots (p < 0.05), and MALDI-TOF/MS identified 18 up-regulated proteins and 8 down-regulated proteins. These proteins are involved in the biological process of response to stimuli, metabolic processes, and apoptosis signaling. Changes in the expression of phosphorylated 14-3-3 θ were further confirmed by Mn 2+ -Phos-tag SDS-PAGE. Western blotting showed overexpression of Bax protein in the mitochondria with down-regulation in the cytoplasm, whereas cytochrome c expression was high in the cytoplasm but low in the mitochondria after 1-BP exposure. Our results suggest that the pathogenesis of 1-BP-induced hippocampal damage involves inhibition of antiapoptosis process. Phosphoproteins identified in this study can potentially serve as biomarkers for 1-BP-induced neurotoxicity. - Highlights: • 1-BP modified hippocampal phosphoproteome in rat and 23 altered proteins were identified. • 1-BP changed phosphorylation of GRP78

  18. Hippocampal phosphoproteomics of F344 rats exposed to 1-bromopropane

    Energy Technology Data Exchange (ETDEWEB)

    Huang, Zhenlie [Guangdong Provincial Key Laboratory of Occupational Disease Prevention and Treatment, Guangdong Province Hospital for Occupational Disease Prevention and Treatment, Guangzhou 510-300 (China); Department of Occupational and Environmental Health, Nagoya University Graduate School of Medicine, Nagoya 466-8550 (Japan); Ichihara, Sahoko [Graduate School of Regional Innovation Studies, Mie University, Tsu 514-8507 (Japan); Oikawa, Shinji [Department of Environmental and Molecular Medicine, Mie University Graduate School of Medicine, Mie 514-8507 (Japan); Chang, Jie [Department of Occupational and Environmental Health, Nagoya University Graduate School of Medicine, Nagoya 466-8550 (Japan); Graduate School of Regional Innovation Studies, Mie University, Tsu 514-8507 (Japan); Zhang, Lingyi [Department of Occupational and Environmental Health, Nagoya University Graduate School of Medicine, Nagoya 466-8550 (Japan); Department of Occupational and Environmental Health, Faculty of Pharmaceutical Sciences, Tokyo University of Science, Noda 278-8510 (Japan); Hu, Shijie [Guangdong Provincial Key Laboratory of Occupational Disease Prevention and Treatment, Guangdong Province Hospital for Occupational Disease Prevention and Treatment, Guangzhou 510-300 (China); Huang, Hanlin, E-mail: huanghl@gdoh.org [Guangdong Provincial Key Laboratory of Occupational Disease Prevention and Treatment, Guangdong Province Hospital for Occupational Disease Prevention and Treatment, Guangzhou 510-300 (China); Ichihara, Gaku, E-mail: gak@rs.tus.ac.jp [Department of Occupational and Environmental Health, Nagoya University Graduate School of Medicine, Nagoya 466-8550 (Japan); Department of Occupational and Environmental Health, Faculty of Pharmaceutical Sciences, Tokyo University of Science, Noda 278-8510 (Japan)

    2015-01-15

    1-Bromopropane (1-BP) is neurotoxic in both experimental animals and human. To identify phosphorylated modification on the unrecognized post-translational modifications of proteins and investigate their role in 1-BP-induced neurotoxicity, changes in hippocampal phosphoprotein expression levels were analyzed quantitatively in male F344 rats exposed to 1-BP inhalation at 0, 400, or 1000 ppm for 8 h/day for 1 or 4 weeks. Hippocampal protein extracts were analyzed qualitatively and quantitatively by Pro-Q Diamond gel staining and SYPRO Ruby staining coupled with two-dimensional difference in gel electrophoresis (2D-DIGE), respectively, as well as by matrix-assisted laser-desorption ionization time-of-flight (MALDI-TOF) mass spectrometry (MS) to identify phosphoproteins. Changes in selected proteins were further confirmed by Manganese II (Mn{sup 2+})-Phos-tag SDS-polyacrylamide gel electrophoresis (SDS-PAGE). Bax and cytochrome c protein levels were determined by western blotting. Pro-Q Diamond gel staining combined with 2D-DIGE identified 26 phosphoprotein spots (p < 0.05), and MALDI-TOF/MS identified 18 up-regulated proteins and 8 down-regulated proteins. These proteins are involved in the biological process of response to stimuli, metabolic processes, and apoptosis signaling. Changes in the expression of phosphorylated 14-3-3 θ were further confirmed by Mn{sup 2+}-Phos-tag SDS-PAGE. Western blotting showed overexpression of Bax protein in the mitochondria with down-regulation in the cytoplasm, whereas cytochrome c expression was high in the cytoplasm but low in the mitochondria after 1-BP exposure. Our results suggest that the pathogenesis of 1-BP-induced hippocampal damage involves inhibition of antiapoptosis process. Phosphoproteins identified in this study can potentially serve as biomarkers for 1-BP-induced neurotoxicity. - Highlights: • 1-BP modified hippocampal phosphoproteome in rat and 23 altered proteins were identified. • 1-BP changed phosphorylation

  19. Crystal Structure of the 23S rRNA Fragment Specific to r-Protein L1 and Designed Model of the Ribosomal L1 Stalk from Haloarcula marismortui

    Directory of Open Access Journals (Sweden)

    Azat Gabdulkhakov

    2017-02-01

    Full Text Available The crystal structure of the 92-nucleotide L1-specific fragment of 23S rRNA from Haloarcula marismortui (Hma has been determined at 3.3 Å resolution. Similar to the corresponding bacterial rRNA fragments, this structure contains joined helix 76-77 topped by an approximately globular structure formed by the residual part of the L1 stalk rRNA. The position of HmaL1 relative to the rRNA was found by its docking to the rRNA fragment using the L1-rRNA complex from Thermus thermophilus as a guide model. In spite of the anomalous negative charge of the halophilic archaeal protein, the conformation of the HmaL1-rRNA interface appeared to be very close to that observed in all known L1-rRNA complexes. The designed structure of the L1 stalk was incorporated into the H. marismortui 50S ribosomal subunit. Comparison of relative positions of L1 stalks in 50S subunits from H. marismortui and T. thermophilus made it possible to reveal the site of inflection of rRNA during the ribosome function.

  20. The Complete Structure of the Mycobacterium smegmatis 70S Ribosome

    Directory of Open Access Journals (Sweden)

    Jendrik Hentschel

    2017-07-01

    Full Text Available The ribosome carries out the synthesis of proteins in every living cell. It consequently represents a frontline target in anti-microbial therapy. Tuberculosis ranks among the leading causes of death worldwide, due in large part to the combination of difficult-to-treat latency and antibiotic resistance. Here, we present the 3.3-Å cryo-EM structure of the 70S ribosome of Mycobacterium smegmatis, a close relative to the human pathogen Mycobacterium tuberculosis. The structure reveals two additional ribosomal proteins and localizes them to the vicinity of drug-target sites in both the catalytic center and the decoding site of the ribosome. Furthermore, we visualized actinobacterium-specific rRNA and protein expansions that extensively remodel the ribosomal surface with implications for polysome organization. Our results provide a foundation for understanding the idiosyncrasies of mycobacterial translation and reveal atomic details of the structure that will facilitate the design of anti-tubercular therapeutics.

  1. The Complete Structure of the Mycobacterium smegmatis 70S Ribosome.

    Science.gov (United States)

    Hentschel, Jendrik; Burnside, Chloe; Mignot, Ingrid; Leibundgut, Marc; Boehringer, Daniel; Ban, Nenad

    2017-07-05

    The ribosome carries out the synthesis of proteins in every living cell. It consequently represents a frontline target in anti-microbial therapy. Tuberculosis ranks among the leading causes of death worldwide, due in large part to the combination of difficult-to-treat latency and antibiotic resistance. Here, we present the 3.3-Å cryo-EM structure of the 70S ribosome of Mycobacterium smegmatis, a close relative to the human pathogen Mycobacterium tuberculosis. The structure reveals two additional ribosomal proteins and localizes them to the vicinity of drug-target sites in both the catalytic center and the decoding site of the ribosome. Furthermore, we visualized actinobacterium-specific rRNA and protein expansions that extensively remodel the ribosomal surface with implications for polysome organization. Our results provide a foundation for understanding the idiosyncrasies of mycobacterial translation and reveal atomic details of the structure that will facilitate the design of anti-tubercular therapeutics. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

  2. Control of ribosome traffic by position-dependent choice of synonymous codons

    International Nuclear Information System (INIS)

    Mitarai, Namiko; Pedersen, Steen

    2013-01-01

    Messenger RNA (mRNA) encodes a sequence of amino acids by using codons. For most amino acids, there are multiple synonymous codons that can encode the amino acid. The translation speed can vary from one codon to another, thus there is room for changing the ribosome speed while keeping the amino acid sequence and hence the resulting protein. Recently, it has been noticed that the choice of the synonymous codon, via the resulting distribution of slow- and fast-translated codons, affects not only on the average speed of one ribosome translating the mRNA but also might have an effect on nearby ribosomes by affecting the appearance of ‘traffic jams’ where multiple ribosomes collide and form queues. To test this ‘context effect’ further, we here investigate the effect of the sequence of synonymous codons on the ribosome traffic by using a ribosome traffic model with codon-dependent rates, estimated from experiments. We compare the ribosome traffic on wild-type (WT) sequences and sequences where the synonymous codons were swapped randomly. By simulating translation of 87 genes, we demonstrate that the WT sequences, especially those with a high bias in codon usage, tend to have the ability to reduce ribosome collisions, hence optimizing the cellular investment in the translation apparatus. The magnitude of such reduction of the translation time might have a significant impact on the cellular growth rate and thereby have importance for the survival of the species. (paper)

  3. Post-transcriptional gene silencing of ribosomal protein S6 kinase 1 restores insulin action in leucine-treated skeletal muscle

    DEFF Research Database (Denmark)

    Deshmukh, A; Salehzadeh, F; Metayer-Coustard, S

    2009-01-01

    Excessive nutrients, especially amino acids, impair insulin action on glucose metabolism in skeletal muscle. We tested the hypothesis that the branched-chain amino acid leucine reduces acute insulin action in primary myotubes via a negative feedback mechanism involving ribosomal protein S6 kinase 1...... to excessive leucine. In conclusion, S6K1 plays an important role in the regulation of insulin action on glucose metabolism in skeletal muscle....

  4. Using the Ribodeblur pipeline to recover A-sites from yeast ribosome profiling data.

    Science.gov (United States)

    Wang, Hao; Kingsford, Carl; McManus, C Joel

    2018-03-15

    Ribosome profiling has emerged as a powerful technique to study mRNA translation. Ribosome profiling has the potential to determine the relative quantities and locations of ribosomes on mRNA genome wide. Taking full advantage of this approach requires accurate measurement of ribosome locations. However, experimental inconsistencies often obscure the positional information encoded in ribosome profiling data. Here, we describe the Ribodeblur pipeline, a computational analysis tool that uses a maximum likelihood framework to infer ribosome positions from heterogeneous datasets. Ribodeblur is simple to install, and can be run on an average modern Mac or Linux-based laptop. We detail the process of applying the pipeline to high-coverage ribosome profiling data in yeast, and discuss important considerations for potential extension to other organisms. Copyright © 2018 Elsevier Inc. All rights reserved.

  5. Ribosomal synthesis of polylysine from individual lysyl-tRNA/sup Lys/ in the absence of a template

    International Nuclear Information System (INIS)

    Yusupova, G.Z.; Remme, Y.L.; Belitsina, N.B.; Spirin, A.S.

    1987-01-01

    Earlier studies showed that ribosomes of Escherichia coli, in the absence of a template, can synthesize oligolysine, using lysyl-tRNA as a substrate. The authors present results on the use of preparations of individual lysyl-tRNA/sup Lys/ and phenylalanyl-tRNA/sup Phe/ in a system of templateless peptide synthesis. For these studies, the authors used ribosomes of E. coli MRE 600, washed four times with 1 M NH 4 Cl with 10 MM MgCl 2 . The purified ribosomes were stored at -70 0 C in standard buffer, containing 20 mM Tris-HCl, 100 mM NH 4 Cl, 10 mM MgCl 2 , 0.1 mM ethylenediamine tetraacetate (EDTA), and 10% glycerin, pH/sub 37 0 C/7.6. A preparation of [ 14 C]lysyl-tRNA/sup Lys/ was produced by affinity chromatography on immobilized factor EF-T/sub u/ from Thermus thermophilus HB8. The elongation factor EF-T/sub u/ from T. thermophilus and immobilized on BrCN-activated Sepharose 4B. The initial preparation of total tRNA of E. coli, enzymatically acylated by [ 14 C]lysine (348 Ci/mole, Amersham), was produced as described earlier. The degree of aminoacylation was 52-59 pmoles [ 14 C]lysine per unit of A 260 of tRNA

  6. Cloning and Characterization of the Acidic Ribosomal Protein P2 of Cryptosporidium parvum, a New 17-Kilodalton Antigen▿

    Science.gov (United States)

    Priest, Jeffrey W.; Kwon, James P.; Montgomery, Joel M.; Bern, Caryn; Moss, Delynn M.; Freeman, Amanda R.; Jones, Cara C.; Arrowood, Michael J.; Won, Kimberly Y.; Lammie, Patrick J.; Gilman, Robert H.; Mead, Jan R.

    2010-01-01

    Cryptosporidium infection is commonly observed among children and immunocompromised individuals in developing countries, but large-scale outbreaks of disease among adults have not been reported. In contrast, outbreaks of cryptosporidiosis in the United States and Canada are increasingly common among patients of all ages. Thus, it seems likely that residents of regions where Cryptosporidium is highly endemic acquire some level of immunity, while residents of the developed world do not. A new immunodominant Cryptosporidium parvum antigen in the 15- to 17-kDa size range was identified as the Cryptosporidium parvum 60S acidic ribosomal protein P2 (CpP2). We developed a recombinant protein-based enzyme-linked immunosorbent assay for serologic population surveillance for antibodies that was 89% sensitive and 92% specific relative to the results of the large-format Western blot assay. The human IgG response is directed almost exclusively toward the highly conserved, carboxy-terminal 15 amino acids of the protein. Although IgG antibody cross-reactivity was documented with sera from patients with acute babesiosis, the development of an anti-CpP2 antibody response in our Peru study population correlated better with Cryptosporidium infection than with infection by any other parasitic protozoan. In Haiti, the prevalence of antibodies to CpP2 plateaus at 11 to 20 years of age. Because anti-CpP2 IgG antibodies were found only among residents of countries in the developing world where Cryptosporidium infection occurs early and often, we propose that this response may be a proxy for the intensity of infection and for acquired immunity. PMID:20410328

  7. Expression of ribosomal genes in pea cotyledons at the initial stages of germination

    International Nuclear Information System (INIS)

    Gumilevskaya, N.A.; Chumikhina, L.V.; Akhmatova, A.T.; Kretovich, V.L.

    1986-01-01

    The time of appearance of newly synthesized rRNAs and ribosomal proteins (r-proteins) in the ribosomes of pea cotyledons (Pisum sativum L.) during germination was investigated. The ribosomal fraction was isolated and analyzed according to the method of germination of the embryo in the presence of labeled precursors or after pulse labeling of the embryos at different stages of germination. For the identification of newly synthesized rRNAs in the ribosomes we estimated the relative stability of labeled RNAs to the action of RNase, the sedimentation rate, the ability to be methylated in vivo in the presence of [ 14 C]CH 3 -methionine, and the localization in the subunits of dissociated ribosomes. The presence of newly synthesized r-proteins in the ribosomes was judged on the basis of the electrophoretic similarity in SDS-disc electrophoresis of labeled polypeptides of purified ribosome preparations and of genuine r-proteins, as well as according to the localization of labeled proteins in the subunits of the dissociated ribosomes. It was shown that the expression of the ribosomal genes in highly specialized cells of pea cotyledons that have completed their growth occurs at very early stages of germination

  8. Could a Proto-Ribosome Emerge Spontaneously in the Prebiotic World?

    Directory of Open Access Journals (Sweden)

    Ilana C. Agmon

    2016-12-01

    Full Text Available An indispensable prerequisite for establishing a scenario of life emerging by natural processes is the requirement that the first simple proto-molecules could have had a realistic probability of self-assembly from random molecular polymers in the prebiotic world. The vestige of the proto-ribosome, which is believed to be still embedded in the contemporary ribosome, is used to assess the feasibility of such spontaneous emergence. Three concentric structural elements of different magnitudes, having a dimeric nature derived from the symmetrical region of the ribosomal large subunit, were suggested to constitute the vestige of the proto-ribosome. It is assumed to have materialized spontaneously in the prebiotic world, catalyzing non-coded peptide bond formation and simple elongation. Probabilistic and energetic considerations are applied in order to evaluate the suitability of the three contenders for being the initial proto-ribosome. The analysis points to the simplest proto-ribosome, comprised of a dimer of tRNA-like molecules presently embedded in the core of the symmetrical region, as the only one having a realistic statistical likelihood of spontaneous emergence from random RNA chains. Hence it offers a feasible starting point for a continuous evolutionary path from the prebiotic matter, through natural processes, into the intricate modern translation system.

  9. High-Resolution Analysis of Coronavirus Gene Expression by RNA Sequencing and Ribosome Profiling.

    Science.gov (United States)

    Irigoyen, Nerea; Firth, Andrew E; Jones, Joshua D; Chung, Betty Y-W; Siddell, Stuart G; Brierley, Ian

    2016-02-01

    Members of the family Coronaviridae have the largest genomes of all RNA viruses, typically in the region of 30 kilobases. Several coronaviruses, such as Severe acute respiratory syndrome-related coronavirus (SARS-CoV) and Middle East respiratory syndrome-related coronavirus (MERS-CoV), are of medical importance, with high mortality rates and, in the case of SARS-CoV, significant pandemic potential. Other coronaviruses, such as Porcine epidemic diarrhea virus and Avian coronavirus, are important livestock pathogens. Ribosome profiling is a technique which exploits the capacity of the translating ribosome to protect around 30 nucleotides of mRNA from ribonuclease digestion. Ribosome-protected mRNA fragments are purified, subjected to deep sequencing and mapped back to the transcriptome to give a global "snap-shot" of translation. Parallel RNA sequencing allows normalization by transcript abundance. Here we apply ribosome profiling to cells infected with Murine coronavirus, mouse hepatitis virus, strain A59 (MHV-A59), a model coronavirus in the same genus as SARS-CoV and MERS-CoV. The data obtained allowed us to study the kinetics of virus transcription and translation with exquisite precision. We studied the timecourse of positive and negative-sense genomic and subgenomic viral RNA production and the relative translation efficiencies of the different virus ORFs. Virus mRNAs were not found to be translated more efficiently than host mRNAs; rather, virus translation dominates host translation at later time points due to high levels of virus transcripts. Triplet phasing of the profiling data allowed precise determination of translated reading frames and revealed several translated short open reading frames upstream of, or embedded within, known virus protein-coding regions. Ribosome pause sites were identified in the virus replicase polyprotein pp1a ORF and investigated experimentally. Contrary to expectations, ribosomes were not found to pause at the ribosomal

  10. High-Resolution Analysis of Coronavirus Gene Expression by RNA Sequencing and Ribosome Profiling.

    Directory of Open Access Journals (Sweden)

    Nerea Irigoyen

    2016-02-01

    Full Text Available Members of the family Coronaviridae have the largest genomes of all RNA viruses, typically in the region of 30 kilobases. Several coronaviruses, such as Severe acute respiratory syndrome-related coronavirus (SARS-CoV and Middle East respiratory syndrome-related coronavirus (MERS-CoV, are of medical importance, with high mortality rates and, in the case of SARS-CoV, significant pandemic potential. Other coronaviruses, such as Porcine epidemic diarrhea virus and Avian coronavirus, are important livestock pathogens. Ribosome profiling is a technique which exploits the capacity of the translating ribosome to protect around 30 nucleotides of mRNA from ribonuclease digestion. Ribosome-protected mRNA fragments are purified, subjected to deep sequencing and mapped back to the transcriptome to give a global "snap-shot" of translation. Parallel RNA sequencing allows normalization by transcript abundance. Here we apply ribosome profiling to cells infected with Murine coronavirus, mouse hepatitis virus, strain A59 (MHV-A59, a model coronavirus in the same genus as SARS-CoV and MERS-CoV. The data obtained allowed us to study the kinetics of virus transcription and translation with exquisite precision. We studied the timecourse of positive and negative-sense genomic and subgenomic viral RNA production and the relative translation efficiencies of the different virus ORFs. Virus mRNAs were not found to be translated more efficiently than host mRNAs; rather, virus translation dominates host translation at later time points due to high levels of virus transcripts. Triplet phasing of the profiling data allowed precise determination of translated reading frames and revealed several translated short open reading frames upstream of, or embedded within, known virus protein-coding regions. Ribosome pause sites were identified in the virus replicase polyprotein pp1a ORF and investigated experimentally. Contrary to expectations, ribosomes were not found to pause at the

  11. Expression, purification, and characterization of a dentin phosphoprotein produced by Escherichia coli, and its odontoblastic differentiation effects on human dental pulp cells.

    Science.gov (United States)

    Yun, Ye-Rang; Jeon, Eunyi; Lee, Sujin; Kang, Wonmo; Kim, Sang-Gi; Kim, Hae-Won; Suh, Chang Kook; Jang, Jun-Hyeog

    2012-08-01

    To investigate the functions of recombinant human dentin phosphoprotein (rhDPP), we examined cell adhesion, viability and the odontoblastic differentiation activity of human dental pulp cells (hDPCs). Firstly, rhDPP was constructed using pBAD-HisA plasmid in Escherichia coli. Cell adhesion and viability of hDPCs by rhDPP was examined using a crystal violet assay and a MTT assay, ALP, mineralization activity and odontoblastic differentiation-related mRNA levels of hDPCs were measured to elucidate the odontoblastic differentiation effect of rhDPP on hDPCs. Initially, rhDPP significantly and dose-dependently increased hDPCs adhesion versus the untreated control (p < 0.05). Cell viability was also significantly increased by rhDPP at 5 days (p < 0.001). Furthermore, the odontoblastic differentiation effect of rhDPP was verified by measuring ALP activity, mineralization activity and the mRNA levels of odontoblastic differentiation markers. Taken together, rhDPP is expected to play an important role on hDPCs, thereby suggesting its potential use for tooth repair and regeneration.

  12. The 70S ribosome modulates the ATPase activity of Escherichia coli YchF.

    Science.gov (United States)

    Becker, Marion; Gzyl, Katherine E; Altamirano, Alvin M; Vuong, Anthony; Urban, Kirstin; Wieden, Hans-Joachim

    2012-10-01

    YchF is one of two universally conserved GTPases with unknown cellular function. As a first step toward elucidating YchF's cellular role, we performed a detailed biochemical characterization of the protein from Escherichia coli. Our data from fluorescence titrations not only confirmed the surprising finding that YchFE.coli binds adenine nucleotides more efficiently than guanine nucleotides, but also provides the first evidence suggesting that YchF assumes two distinct conformational states (ATP- and ADP-bound) consistent with the functional cycle of a typical GTPase. Based on an in vivo pull-down experiment using a His-tagged variant of YchF from E. coli (YchFE.coli), we were able to isolate a megadalton complex containing the 70S ribosome. Based on this finding, we report the successful reconstitution of a YchF•70S complex in vitro, revealing an affinity (KD) of the YchFE.coli•ADPNP complex for 70S ribosomes of 3 μM. The in vitro reconstitution data also suggests that the identity of the nucleotide-bound state of YchF (ADP or ATP) modulates its affinity for 70S ribosomes. A detailed Michaelis-Menten analysis of YchF's catalytic activity in the presence and the absence of the 70S ribosome and its subunits revealed for the first time that the 70S ribosome is able to stimulate YchF's ATPase activity (~10-fold), confirming the ribosome as part of the functional cycle of YchF. Our findings taken together with previously reported data for the human homolog of YchF (hOLA1) indicate a high level of evolutionary conservation in the enzymatic properties of YchF and suggest that the ribosome is the main functional partner of YchF not only in bacteria.

  13. Biphasic character of ribosomal translocation and non-Michaelis-Menten kinetics of translation

    Science.gov (United States)

    Xie, Ping

    2014-12-01

    We study theoretically the kinetics of mRNA translocation in the wild-type (WT) Escherichia coli ribosome, which is composed of a small 30 S and large 50 S subunit, and the ribosomes with mutations to some intersubunit bridges such as B1a, B4, B7a, and B8. The theoretical results reproduce well the available in vitro experimental data on the biphasic kinetics of the forward mRNA translocation catalyzed by elongation factor G (EF-G) hydrolyzing GTP, which can be best fit by the sum of two exponentials, and the monophasic kinetics of the spontaneous reverse mRNA translocation in the absence of the elongation factor, which can be best fit by a single-exponential function, in both the WT and mutant ribosomes. We show that both the mutation-induced increase in the maximal rate of the slow phase for the forward mRNA translocation and that in the rate of the spontaneous reverse mRNA translocation result from a reduction in the intrinsic energy barrier to resist the rotational movements between the two subunits, giving the same degree of increase in the two rates. The mutation-induced increase in the maximal rate of the fast phase for the forward mRNA translocation results mainly from the increase in the rate of the ribosomal unlocking, a conformational change in the ribosome that widens the mRNA channel for the mRNA translocation to take place, which could be partly due to the effect of the mutation on the intrasubunit 30S head rotation. Moreover, we study the translation rate of the WT and mutant ribosomes. It is shown that the translation rate versus the concentration of EF-G-GTP does not follow the Michaelis-Menten (MM) kinetics, which is in sharp contrast to the general property of other enzymes that the rate of the enzymatic reaction versus the concentration of a substrate follows the MM kinetics. The physical origin of this non-MM kinetics for the ribosome is revealed.

  14. Free and membrane-bound ribosomes and polysomes in hippocampal neurons during a learning experiment.

    Science.gov (United States)

    Wenzel, J; David, H; Pohle, W; Marx, I; Matthies, H

    1975-01-24

    The ribosomes of the CA1 and CA3 pyramidal cells of hipocampus were investigated by morphometric methods after the acquisition of a shock-motivated brightness discrimination in rats. A significant increase in the total number of ribosomes was observed in CA1 cells of trained animals and in CA3 cells of both active controls and trained rats. A significant increase in membrane-bound ribosomes was obtained in CA1 and CA3 cells after training only. The results confirm the suggestion of an increased protein synthesis in hippocampal neurons during and after the acquisition of a brightness discrimination, as we have concluded from out previous investigations on the incorporation of labeled amino acids under identical experimental conditions. The results lead to the assumption that the protein synthesis in some neuronal cells may probably differ not only quantitatively, but also qualitatively in trained and untrained animals.

  15. Distinct roles for the IIId2 sub-domain in pestivirus and picornavirus internal ribosome entry sites

    DEFF Research Database (Denmark)

    Willcocks, Margaret M.; Zaini, Salmah; Chamond, Nathalie

    2017-01-01

    Viral internal ribosomes entry site (IRES) elements coordinate the recruitment of the host translation machinery to direct the initiation of viral protein synthesis. Within hepatitis C virus (HCV)-like IRES elements, the sub-domain IIId(1) is crucial for recruiting the 40S ribosomal subunit...

  16. Phosphotyrosine biased enrichment of tryptic peptides from cancer cells by combining pY-MIP and TiO2 affinity resins

    DEFF Research Database (Denmark)

    Bllaci, Loreta; Torsetnes, Silje Bøen; Wierzbicka, Celina Katarzyna

    2017-01-01

    Protein phosphorylation at distinct tyrosine residues (pY) is essential for fast, specific and accurate signal transduction in cells. Enrichment of pY-containing peptides derived from phosphoproteins is commonly facilitated by use of immobilized anti-pY antibodies prior to phosphoproteomics analy...

  17. Pactamycin binding site on archaebacterial and eukaryotic ribosomes

    International Nuclear Information System (INIS)

    Tejedor, F.; Amils, R.; Ballesta, J.P.G.

    1987-01-01

    The presence of a photoreactive acetophenone group in the protein synthesis inhibitor pactamycin and the possibility of obtaining active iodinated derivatives that retain full biological activity allow the antibiotic binding site on Saccharomyces cerevisiae and archaebacterium Sulfolobus solfataricus ribosomes to be photoaffinity labeled. Four major labeled proteins have been identified in the yeast ribosomes, i.e., YS10, YS18, YS21/24, and YS30, while proteins AL1a, AS10/L8, AS18/20, and AS21/22 appeared as radioactive spots in S. solfataricus. There seems to be a correlation between some of the proteins labeled in yeast and those previously reported in Escherichia coli indicating that the pactamycin binding sites of both species, which are in the small subunit close to the initiation factors and mRNA binding sites, must have similar characteristics

  18. Evidence for alteration of the membrane-bound ribosomes in Micrococcus luteus cells exposed to lead

    Energy Technology Data Exchange (ETDEWEB)

    Barrow, W; Himmel, M; Squire, P G; Tornabene, T G

    1978-01-01

    Micrococcus luteus cells exposed to Pb(NO/sub 3/)/sub 2/ contained cytosol ribosomal particles and disaggregated membranal ribosomal particles as determined by ultracentrifugation and spectral studies. Approximately 60% of the membrane ribosome fraction from lead exposed cells had a sedimentation value of 8.4S. Cytosol ribosome from lead exposed cells as well as membranal and cytosol ribosomes from control cells were comparable by their contents of predominantly the 70S type with the 50S and 100S present in relatively small amounts. The lead content of the 8.4S components was more than 200 times higher than the components with higher sedimentation coefficients from lead exposed cells and approximately 650 times more than that of control cell ribosomes. The cells exposed to lead, however, showed no adverse effects from the lead in respect to their growth rates and cellular yields. These results indicate that lead is interacting only at specific sites of the membrane and is inducing events initiated only in strategic cellular regions. These data further substantiate that subtle changes do occur in lead exposed cells that show no obvious effects. It is assumed that these minor alterations are, in toto, biologically significant. 24 references, 2 figures, 1 table.

  19. Selection of scFvs specific for the HepG2 cell line using ribosome ...

    Indian Academy of Sciences (India)

    Madhsudhan

    the important advantage of requiring no prior knowledge of ... were amplified separately by RT-PCR, and an anti-HepG2 VH/k chain ribosome display library was constructed ..... Engert A, Hudson P R and Power B E 2007 Selection of human.

  20. Tetrahymena thermophila acidic ribosomal protein L37 contains an archaebacterial type of C-terminus

    DEFF Research Database (Denmark)

    Hansen, T S; Andreasen, P H; Dreisig, H

    1991-01-01

    We have cloned and characterized a Tetrahymena thermophila macronuclear gene (L37) encoding the acidic ribosomal protein (A-protein) L37. The gene contains a single intron located in the 3'-part of the coding region. Two major and three minor transcription start points (tsp) were mapped 39 to 63 ...... by protein sequencing. The T. thermophila L37 clearly belongs to the P1-type family of eukaryotic A-proteins, but the C-terminal region has the hallmarks of archaebacterial A-proteins.......We have cloned and characterized a Tetrahymena thermophila macronuclear gene (L37) encoding the acidic ribosomal protein (A-protein) L37. The gene contains a single intron located in the 3'-part of the coding region. Two major and three minor transcription start points (tsp) were mapped 39 to 63...... nucleotides upstream from the translational start codon. The uppermost tsp mapped to the first T in a putative T. thermophila RNA polymerase II initiator element, TATAA. The coding region of L37 predicts a protein of 109 amino acid (aa) residues. A substantial part of the deduced aa sequence was verified...

  1. Relationship between organization and function of ribosomal genes in Drosophila melanogaster

    International Nuclear Information System (INIS)

    Karpen, G.H.

    1987-01-01

    In most eukaryotic organisms, the genes that encode the 18S and 28S ribosomal RNAs (rDNA genes) are tandemly repeated, and are located in constitutive heterochromatin and/or centromeric or telomeric regions. P-element mediated transformation was used to investigate the relationship between rDNA organization and function in Drosophila melanogaster. Tritiated-uridine incorporation under heat shock conditions and in situ hybridization to rRNA were used to demonstrate that a single rDNA gene inserted into euchromatin can be transcribed at a high rate, in polytene nuclei. P-element-mediated transformation of a single Drosophila rDNA gene was also utilized to investigate the ability of ribosomal DNA to organize a nucleolus. Cytological approaches demonstrated that structures resembling the endogenous nucleoli were preferentially associated with four different sites of rDNA insertion, in polytene nuclei. These mini-nucleoli also contained components specific to the nucleolus, as shown by in situ hybridization to rRNA and indirect immunofluorescence with an antibody that binds to Drosophila nucleoli. The transformed genes were able to partially rescue mutant phenotypes due to a deficiency of rDNA, indicating that the mini-nucleoli were functional

  2. The transcription factor EGR1 localizes to the nucleolus and is linked to suppression of ribosomal precursor synthesis.

    Science.gov (United States)

    Ponti, Donatella; Bellenchi, Gian Carlo; Puca, Rosa; Bastianelli, Daniela; Maroder, Marella; Ragona, Giuseppe; Roussel, Pascal; Thiry, Marc; Mercola, Dan; Calogero, Antonella

    2014-01-01

    EGR1 is an immediate early gene with a wide range of activities as transcription factor, spanning from regulation of cell growth to differentiation. Numerous studies show that EGR1 either promotes the proliferation of stimulated cells or suppresses the tumorigenic growth of transformed cells. Upon interaction with ARF, EGR1 is sumoylated and acquires the ability to bind to specific targets such as PTEN and in turn to regulate cell growth. ARF is mainly localized to the periphery of nucleolus where is able to negatively regulate ribosome biogenesis. Since EGR1 colocalizes with ARF under IGF-1 stimulation we asked the question of whether EGR1 also relocate to the nucleolus to interact with ARF. Here we show that EGR1 colocalizes with nucleolar markers such as fibrillarin and B23 in the presence of ARF. Western analysis of nucleolar extracts from HeLa cells was used to confirm the presence of EGR1 in the nucleolus mainly as the 100 kDa sumoylated form. We also show that the level of the ribosomal RNA precursor 47S is inversely correlated to the level of EGR1 transcripts. The EGR1 iseffective to regulate the synthesis of the 47S rRNA precursor. Then we demonstrated that EGR1 binds to the Upstream Binding Factor (UBF) leading us to hypothesize that the regulating activity of EGR1 is mediated by its interaction within the transcriptional complex of RNA polymerase I. These results confirm the presence of EGR1 in the nucleolus and point to a role for EGR1 in the control of nucleolar metabolism.

  3. The transcription factor EGR1 localizes to the nucleolus and is linked to suppression of ribosomal precursor synthesis.

    Directory of Open Access Journals (Sweden)

    Donatella Ponti

    Full Text Available EGR1 is an immediate early gene with a wide range of activities as transcription factor, spanning from regulation of cell growth to differentiation. Numerous studies show that EGR1 either promotes the proliferation of stimulated cells or suppresses the tumorigenic growth of transformed cells. Upon interaction with ARF, EGR1 is sumoylated and acquires the ability to bind to specific targets such as PTEN and in turn to regulate cell growth. ARF is mainly localized to the periphery of nucleolus where is able to negatively regulate ribosome biogenesis. Since EGR1 colocalizes with ARF under IGF-1 stimulation we asked the question of whether EGR1 also relocate to the nucleolus to interact with ARF. Here we show that EGR1 colocalizes with nucleolar markers such as fibrillarin and B23 in the presence of ARF. Western analysis of nucleolar extracts from HeLa cells was used to confirm the presence of EGR1 in the nucleolus mainly as the 100 kDa sumoylated form. We also show that the level of the ribosomal RNA precursor 47S is inversely correlated to the level of EGR1 transcripts. The EGR1 iseffective to regulate the synthesis of the 47S rRNA precursor. Then we demonstrated that EGR1 binds to the Upstream Binding Factor (UBF leading us to hypothesize that the regulating activity of EGR1 is mediated by its interaction within the transcriptional complex of RNA polymerase I. These results confirm the presence of EGR1 in the nucleolus and point to a role for EGR1 in the control of nucleolar metabolism.

  4. Novel mRNA-specific effects of ribosome drop-off on translation rate and polysome profile.

    Directory of Open Access Journals (Sweden)

    Pierre Bonnin

    2017-05-01

    Full Text Available The well established phenomenon of ribosome drop-off plays crucial roles in translational accuracy and nutrient starvation responses during protein translation. When cells are under stress conditions, such as amino acid starvation or aminoacyl-tRNA depletion due to a high level of recombinant protein expression, ribosome drop-off can substantially affect the efficiency of protein expression. Here we introduce a mathematical model that describes the effects of ribosome drop-off on the ribosome density along the mRNA and on the concomitant protein synthesis rate. Our results show that ribosome premature termination may lead to non-intuitive ribosome density profiles, such as a ribosome density which increases from the 5' to the 3' end. Importantly, the model predicts that the effects of ribosome drop-off on the translation rate are mRNA-specific, and we quantify their resilience to drop-off, showing that the mRNAs which present ribosome queues are much less affected by ribosome drop-off than those which do not. Moreover, among those mRNAs that do not present ribosome queues, resilience to drop-off correlates positively with the elongation rate, so that sequences using fast codons are expected to be less affected by ribosome drop-off. This result is consistent with a genome-wide analysis of S. cerevisiae, which reveals that under favourable growth conditions mRNAs coding for proteins involved in the translation machinery, known to be highly codon biased and using preferentially fast codons, are highly resilient to ribosome drop-off. Moreover, in physiological conditions, the translation rate of mRNAs coding for regulatory, stress-related proteins, is less resilient to ribosome drop-off. This model therefore allows analysis of variations in the translational efficiency of individual mRNAs by accounting for the full range of known ribosome behaviours, as well as explaining mRNA-specific variations in ribosome density emerging from ribosome profiling

  5. Mechanism of recycling of post-termination ribosomal complexes in ...

    Indian Academy of Sciences (India)

    Madhu

    all pathway of ribosome recycling in eubacteria with especial reference to the important role of the initiation factor ... [Seshadri A and Varshney U 2006 Mechanism of recycling of post-termination ribosomal complexes in eubacteria: a new role of initiation factor 3 .... RRF binding results in a remarkable conformational change.

  6. Expression of protein-coding genes embedded in ribosomal DNA

    DEFF Research Database (Denmark)

    Johansen, Steinar D; Haugen, Peik; Nielsen, Henrik

    2007-01-01

    Ribosomal DNA (rDNA) is a specialised chromosomal location that is dedicated to high-level transcription of ribosomal RNA genes. Interestingly, rDNAs are frequently interrupted by parasitic elements, some of which carry protein genes. These are non-LTR retrotransposons and group II introns that e...... in the nucleolus....

  7. Computational resources for ribosome profiling: from database to Web server and software.

    Science.gov (United States)

    Wang, Hongwei; Wang, Yan; Xie, Zhi

    2017-08-14

    Ribosome profiling is emerging as a powerful technique that enables genome-wide investigation of in vivo translation at sub-codon resolution. The increasing application of ribosome profiling in recent years has achieved remarkable progress toward understanding the composition, regulation and mechanism of translation. This benefits from not only the awesome power of ribosome profiling but also an extensive range of computational resources available for ribosome profiling. At present, however, a comprehensive review on these resources is still lacking. Here, we survey the recent computational advances guided by ribosome profiling, with a focus on databases, Web servers and software tools for storing, visualizing and analyzing ribosome profiling data. This review is intended to provide experimental and computational biologists with a reference to make appropriate choices among existing resources for the question at hand. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  8. Modeling of the structure of ribosomal protein L1 from the archaeon Haloarcula marismortui

    Science.gov (United States)

    Nevskaya, N. A.; Kljashtorny, V. G.; Vakhrusheva, A. V.; Garber, M. B.; Nikonov, S. V.

    2017-07-01

    The halophilic archaeon Haloarcula marismortui proliferates in the Dead Sea at extremely high salt concentrations (higher than 3 M). This is the only archaeon, for which the crystal structure of the ribosomal 50S subunit was determined. However, the structure of the functionally important side protuberance containing the abnormally negatively charged protein L1 (HmaL1) was not visualized. Attempts to crystallize HmaL1 in the isolated state or as its complex with RNA using normal salt concentrations (≤500 mM) failed. A theoretical model of HmaL1 was built based on the structural data for homologs of the protein L1 from other organisms, and this model was refined by molecular dynamics methods. Analysis of this model showed that the protein HmaL1 can undergo aggregation due to the presence of a cluster of positive charges unique for proteins L1. This cluster is located at the RNA-protein interface, which interferes with the crystallization of HmaL1 and the binding of the latter to RNA.

  9. Cloning, periplasmic expression, purification and structural characterization of human ribosomal protein L10

    International Nuclear Information System (INIS)

    Pereira, Larissa Miranda

    2009-01-01

    The ribosomal protein L10 (RP L10) is a strong candidate to be included in the class of tumor suppressor proteins. This protein, also denominated as QM, is known to participate in the binding of ribosomal subunits 60S and 40S and the translation of mRNAs. It has a molecular weight that varies between 24 and 26 kDa and an isoelectric point of (pI) 10.5. The sequence of the protein QM is highly conserved in mammals, plants, invertebrates, insects and yeast which indicates its critical functions in a cell. As a tumor suppressor, RP L10 has been studied in strains of Wilm's tumor (WT-1) and tumor cells in the stomach, where was observed a decrease in the amount of its mRNA. More recently, the RP L10 was found in low amounts in the early stages of prostate adenoma and showed some mutation in ovarian cancer, what indicates its role as a suppressor protein in the development of these diseases. It has also been described that this protein interacts with c-Jun and c-Yes inhibiting growth factors and consequently, cell division. This work has an important role on the establishment of soluble expression of QM to give base information for further studies on expression that aim to evaluate the specific regions where it acts binding the 60S and 40S ribosomal subunits and translation, as well as its binding to proto-oncogenes. The cDNA for QM protein was amplified by PCR and cloned into periplasmic expression vector p3SN8. The QM protein was expressed in E. coli BL21 (DE3) in the region of cytoplasm and periplasm, the best condition was obtained from the expression of the recombinant plasmid QM p1813 Q M at 25 degree C or 30 degree C, the soluble protein was obtained with small amounts of contaminants. The assays of secondary structure showed that the QM protein is predominantly alpha-helix, but when it loses the folding, this condition changes and the protein is replaced by β- sheet feature. (author)

  10. Ribosomal proteins L11 and L10.(L12)4 and the antibiotic thiostrepton interact with overlapping regions of the 23 S rRNA backbone in the ribosomal GTPase centre

    DEFF Research Database (Denmark)

    Rosendahl, G; Douthwaite, S

    1993-01-01

    RNA, and to investigate how this interaction is influenced by other ribosomal components. Complexes were characterized in both naked 23 S rRNA and ribosomes from an E. coli L11-minus strain, before and after reconstitution with L11. The protein protects 17 riboses between positions 1058 and 1085 in the naked 23 S r......The Escherichia coli ribosomal protein (r-protein) L11 and its binding site on 23 S ribosomal RNA (rRNA) are associated with ribosomal hydrolysis of guanosine 5'-triphosphate (GTP). We have used hydroxyl radical footprinting to map the contacts between L11 and the backbone riboses in 23 S r......)4 and other proteins within the ribosome. The antibiotics thiostrepton and micrococcin inhibit the catalytic functions of this region by slotting in between the accessible loops and interacting with nucleotides there....

  11. Photoaffinity labeling of rat liver ribosomes by N-(2-Nitro-4-azidobenzoyl)puromycin

    International Nuclear Information System (INIS)

    Boehm, H.; Stahl, J.; Bielka, H.

    1979-01-01

    N-(2-nitro-4-azidobenzoyl)-[ 3 H]puromycin (NAB-puromycin) was synthesized as a photoreactive derivative of puromycin in order to detect ribosomal proteins located near the peptidyltransferase centre of rat liver ribosomes. Irradiation of ribosome-NAB-puromycin complexes leads to covalent attachment of the affinity label to proteins of the large ribosomal subunit, in particular to proteins L28/29, and, to a somewhat lower extent, to proteins L4, L6, L10 and L24. The results are discussed in the light of earlier studies performed with other affinity labels that attacked the peptidyltransferase region of rat liver ribosomes. (author)

  12. In vivo labelling of functional ribosomes reveals spatial regulation during starvation in Podospora anserina

    Directory of Open Access Journals (Sweden)

    Silar Philippe

    2000-11-01

    Full Text Available Abstract Background To date, in eukaryotes, ribosomal protein expression is known to be regulated at the transcriptional and/or translational levels. But other forms of regulation may be possible. Results Here, we report the successful tagging of functional ribosomal particles with a S7-GFP chimaeric protein, making it possible to observe in vivo ribosome dynamics in the filamentous fungus Podospora anserina. Microscopic observations revealed a novel kind of ribosomal protein regulation during the passage between cell growth and stationary phases, with a transient accumulation of ribosomal proteins and/or ribosome subunits in the nucleus, possibly the nucleolus, being observed at the beginning of stationary phase. Conclusion Nuclear sequestration can be another level of ribosomal protein regulation in eukaryotic cells.This may contribute to the regulation of cell growth and division.

  13. In vivo labelling of functional ribosomes reveals spatial regulation during starvation in Podospora anserina

    Science.gov (United States)

    Lalucque, Hervé; Silar, Philippe

    2000-01-01

    Background To date, in eukaryotes, ribosomal protein expression is known to be regulated at the transcriptional and/or translational levels. But other forms of regulation may be possible. Results Here, we report the successful tagging of functional ribosomal particles with a S7-GFP chimaeric protein, making it possible to observe in vivo ribosome dynamics in the filamentous fungus Podospora anserina. Microscopic observations revealed a novel kind of ribosomal protein regulation during the passage between cell growth and stationary phases, with a transient accumulation of ribosomal proteins and/or ribosome subunits in the nucleus, possibly the nucleolus, being observed at the beginning of stationary phase. Conclusion Nuclear sequestration can be another level of ribosomal protein regulation in eukaryotic cells.This may contribute to the regulation of cell growth and division. PMID:11112985

  14. ATM-dependent E2F1 accumulation in the nucleolus is an indicator of ribosomal stress in early response to DNA damage.

    Science.gov (United States)

    Jin, Ya-Qiong; An, Guo-Shun; Ni, Ju-Hua; Li, Shu-Yan; Jia, Hong-Ti

    2014-01-01

    The nucleolus plays a major role in ribosome biogenesis. Most genotoxic agents disrupt nucleolar structure and function, which results in the stabilization/activation of p53, inducing cell cycle arrest or apoptosis. Likewise, transcription factor E2F1 as a DNA damage responsive protein also plays roles in cell cycle arrest, DNA repair, or apoptosis in response to DNA damage through transcriptional response and protein-protein interaction. Furthermore, E2F1 is known to be involved in regulating rRNA transcription. However, how E2F1 displays in coordinating DNA damage and nucleolar stress is unclear. In this study, we demonstrate that ATM-dependent E2F1 accumulation in the nucleolus is a characteristic feature of nucleolar stress in early response to DNA damage. We found that at the early stage of DNA damage, E2F1 accumulation in the nucleolus was an ATM-dependent and a common event in p53-suficient and -deficient cells. Increased nucleolar E2F1 was sequestered by the nucleolar protein p14ARF, which repressed E2F1-dependent rRNA transcription initiation, and was coupled with S phase. Our data indicate that early accumulation of E2F1 in the nucleolus is an indicator for nucleolar stress and a component of ATM pathway, which presumably buffers elevation of E2F1 in the nucleoplasm and coordinates the diversifying mechanisms of E2F1 acts in cell cycle progression and apoptosis in early response to DNA damage.

  15. Insulin receptors mediate growth effects in cultured fetal neurons. II. Activation of a protein kinase that phosphorylates ribosomal protein S6

    International Nuclear Information System (INIS)

    Heidenreich, K.A.; Toledo, S.P.

    1989-01-01

    As an initial attempt to identify early steps in insulin action that may be involved in the growth responses of neurons to insulin, we investigated whether insulin receptor activation increases the phosphorylation of ribosomal protein S6 in cultured fetal neurons and whether activation of a protein kinase is involved in this process. When neurons were incubated for 2 h with 32Pi, the addition of insulin (100 ng/ml) for the final 30 min increased the incorporation of 32Pi into a 32K microsomal protein. The incorporation of 32Pi into the majority of other neuronal proteins was unaltered by the 30-min exposure to insulin. Cytosolic extracts from insulin-treated neurons incubated in the presence of exogenous rat liver 40S ribosomes and [gamma-32P]ATP displayed a 3- to 8-fold increase in the phosphorylation of ribosomal protein S6 compared to extracts from untreated cells. Inclusion of cycloheximide during exposure of the neurons to insulin did not inhibit the increased cytosolic kinase activity. Activation of S6 kinase activity by insulin was dose dependent (seen at insulin concentration as low as 0.1 ng/ml) and reached a maximum after 20 min of incubation. Addition of phosphatidylserine, diolein, and Ca2+ to the in vitro kinase reaction had no effect on the phosphorylation of ribosomal protein S6. Likewise, treatment of neurons with (Bu)2cAMP did not alter the phosphorylation of ribosomal protein S6 by neuronal cytosolic extracts. We conclude that insulin activates a cytosolic protein kinase that phosphorylates ribosomal S6 in neurons and is distinct from protein kinase-C and cAMP-dependent protein kinase. Stimulation of this kinase may play a role in insulin signal transduction in neurons

  16. Dietary ascorbic acid normalizes ribosomal efficiency for collagen production in skin of streptozotocin-induced diabetic rats

    International Nuclear Information System (INIS)

    Schneir, M.; Imberman, M.; Ramamurthy, N.; Golub, L.

    1987-01-01

    The objective of this study was to quantify the contribution of both ribosome amount and ribosomal efficiency to decreased collagen production in skin of diabetic rats and diabetic rats treated with dietary ascorbic acid. Male Sprague-Dawley rats were distributed equally into the following categories: non-diabetic controls; diabetics; ascorbic acid-treated diabetics. On day-20, all rats were injected with ( 3 H)proline and killed after 2 h. Absolute rate of collagen production, ribosome content, and ribosomal efficiency of collagen production were quantified. Also ribosomal efficiency was quantified for ribosomes in sucrose-gradient fractionated post-mitochondrial supernatants. The results indicate that decreased ribosomal efficiency was responsible for 70% of the decreased collagen production with 30% caused by decreased ribosome content, when measured for total skin or sucrose gradient-isolated ribosomes. At both levels of analysis, ascorbic acid treatment normalized ribosomal efficiency, indicating diabetes-mediated decreased ribosomal efficiency for collagen production is related to a co-translational event, such as procollagen underhydroxylation

  17. Differential antibiotic sensitivity determined by the large ribosomal subunit in thermophilic archaea.

    OpenAIRE

    Ruggero, D; Londei, P

    1996-01-01

    Hybrid ribosomes obtained by mixing the ribosomal subunits of the extremely thermophilic archaea Sulfolobus solfataricus and Desulfurococcus mobilis were tested for their sensitivity to selected antibiotics. It is shown that structural differences in the large ribosomal subunits determine qualitatively and quantitatively the patterns of response to alpha-sarcin and paromomycin in these species.

  18. Genetic selection of peptide aptamers that interact and inhibit both Small protein B and alternative ribosome-rescue factor A of Aeromonas veronii C4

    Directory of Open Access Journals (Sweden)

    Peng Liu

    2016-08-01

    Full Text Available Aeromonas veronii is a pathogenic gram-negative bacterium, which infects a variety of animals and results in mass mortality. The stalled-ribosome rescues are reported to ensure viability and virulence under stress conditions, of which primarily include trans-translation and alternative ribosome-rescue factor A (ArfA in A. veronii. For identification of specific peptides that interact and inhibit the stalled-ribosome rescues, peptide aptamer library (pTRG-SN-peptides was constructed using pTRG as vector and Staphylococcus aureus nuclease (SN as scaffold protein, in which 16 random amino acids were introduced to form an exposed surface loop. In the meantime both Small Protein B (SmpB which acts as one of the key components in trans-translation, and alternative ribosome-rescue factor A (ArfA were inserted to pBT to constitute pBT-SmpB and pBT-ArfA, respectively. The peptide aptamer PA-2 was selected from pTRG-SN-peptides by bacterial two-hybrid system (B2H employing pBT-SmpB or pBT-ArfA as baits. The conserved sites G133K134 and D138K139R140 of C-terminal SmpB were identified by interacting with N-terminal SN, and concurrently the residue K62 of ArfA was recognized by interacting with the surface loop of the specific peptide aptamer PA-2. The expression plasmids pN-SN or pN-PA-2, which combined the duplication origin of pRE112 with the neokanamycin promoter expressing SN or PA-2, were created and transformed into A. veronii C4, separately. The engineered A. veronii C4 which endowing SN or PA-2 expression impaired growth capabilities under stress conditions including temperatures, sucrose, glucose, potassium chloride (KCl and antibiotics, and the stress-related genes rpoS and nhaP were down-regulated significantly by Quantitative Real-time PCR (qRT-PCR when treating in 2.0% KCl. Thus,the engineered A. veronii C4 conferring PA-2 expression might be potentially attenuated vaccine, and also the peptide aptamer PA-2 could develop as anti

  19. Genome-wide polysomal analysis of a yeast strain with mutated ribosomal protein S9

    Directory of Open Access Journals (Sweden)

    Arava Yoav

    2007-08-01

    Full Text Available Abstract Background The yeast ribosomal protein S9 (S9 is located at the entrance tunnel of the mRNA into the ribosome. It is known to play a role in accurate decoding and its bacterial homolog (S4 has recently been shown to be involved in opening RNA duplexes. Here we examined the effects of changing the C terminus of S9, which is rich in acidic amino acids and extends out of the ribosome surface. Results We performed a genome-wide analysis to reveal effects at the transcription and translation levels of all yeast genes. While negligible relative changes were observed in steady-state mRNA levels, a significant number of mRNAs appeared to have altered ribosomal density. Notably, 40% of the genes having reliable signals changed their ribosomal association by more than one ribosome. Yet, no general correlations with physical or functional features of the mRNA were observed. Ribosome Density Mapping (RDM along four of the mRNAs with increased association revealed an increase in ribosomal density towards the end of the coding region for at least two of them. Read-through analysis did not reveal any increase in read-through of a premature stop codon by the mutant strain. Conclusion The ribosomal protein rpS9 appears to be involved in the translation of many mRNAs, since altering its C terminus led to a significant change in ribosomal association of many mRNAs. We did not find strong correlations between these changes and several physical features of the mRNA, yet future studies with advanced tools may allow such correlations to be determined. Importantly, our results indicate an accumulation of ribosomes towards the end of the coding regions of some mRNAs. This suggests an involvement of S9 in ribosomal dissociation during translation termination.

  20. Development and evaluation of an anti-rabies virus phosphoprotein-specific monoclonal antibody for detection of rabies neutralizing antibodies using RFFIT.

    Science.gov (United States)

    Um, Jihye; Chun, Byung Chul; Lee, Yeong Seon; Hwang, Kyu Jam; Yang, Dong-Kun; Park, Jun-Sun; Kim, Su Yeon

    2017-12-01

    Rabies is a major public health problem with a fatality rate close to 100%; however, complete prevention can be achieved through pre- or post-exposure prophylaxis. The rapid fluorescent focus inhibition test (RFFIT) is one of the recommended testing methods to determine the production of neutralizing antibodies after vaccination. Here, we report the development of a new monoclonal antibody (mAb) designed to react specifically with Rabies virus (RABV) phosphoprotein (P protein), and the evaluation of its applicability to the RFFIT and its effectiveness as a diagnostic reagent for human rabies. The mAb KGH P 16B8 was produced to target the P protein of the Korean KGH RABV strain. An indirect immunofluorescence assay (IFA) was conducted to detect various strains of RABV in various cell lines. Alexa-conjugated KGH P 16B8 (16B8-Alexa) was developed for the RFFIT. The IFA test could detect RABV up to a 1:2,500 dilution, with a detection limit comparable to that of a commercial diagnostic reagent. The sensitivity, specificity, positive predictive value, and negative predictive value of the RFFIT using 16B8-Alexa in 414 clinical specimens were 98.67%, 99.47%, 99.55%, and 98.42%, respectively. The results of the RFFIT with 16B8-Alexa were strongly correlated with those obtained using an existing commercial diagnostic reagent (r = 0.995, prabies neutralizing antibody titer and establish a diagnosis in human. Thus, 16B8-Alexa is expected to serve as an alternative diagnostic reagent that is widely accessible, with potentially broad applications beyond those of the RFFIT in Korea. Further studies with 16B8-Alexa should provide insight into the immunological mechanism of the P protein of Korean RABV.

  1. Cross-site comparison of ribosomal depletion kits for Illumina RNAseq library construction.

    Science.gov (United States)

    Herbert, Zachary T; Kershner, Jamie P; Butty, Vincent L; Thimmapuram, Jyothi; Choudhari, Sulbha; Alekseyev, Yuriy O; Fan, Jun; Podnar, Jessica W; Wilcox, Edward; Gipson, Jenny; Gillaspy, Allison; Jepsen, Kristen; BonDurant, Sandra Splinter; Morris, Krystalynne; Berkeley, Maura; LeClerc, Ashley; Simpson, Stephen D; Sommerville, Gary; Grimmett, Leslie; Adams, Marie; Levine, Stuart S

    2018-03-15

    Ribosomal RNA (rRNA) comprises at least 90% of total RNA extracted from mammalian tissue or cell line samples. Informative transcriptional profiling using massively parallel sequencing technologies requires either enrichment of mature poly-adenylated transcripts or targeted depletion of the rRNA fraction. The latter method is of particular interest because it is compatible with degraded samples such as those extracted from FFPE and also captures transcripts that are not poly-adenylated such as some non-coding RNAs. Here we provide a cross-site study that evaluates the performance of ribosomal RNA removal kits from Illumina, Takara/Clontech, Kapa Biosystems, Lexogen, New England Biolabs and Qiagen on intact and degraded RNA samples. We find that all of the kits are capable of performing significant ribosomal depletion, though there are differences in their ease of use. All kits were able to remove ribosomal RNA to below 20% with intact RNA and identify ~ 14,000 protein coding genes from the Universal Human Reference RNA sample at >1FPKM. Analysis of differentially detected genes between kits suggests that transcript length may be a key factor in library production efficiency. These results provide a roadmap for labs on the strengths of each of these methods and how best to utilize them.

  2. Structural basis for ribosome protein S1 interaction with RNA in trans-translation of Mycobacterium tuberculosis.

    Science.gov (United States)

    Fan, Yi; Dai, Yazhuang; Hou, Meijing; Wang, Huilin; Yao, Hongwei; Guo, Chenyun; Lin, Donghai; Liao, Xinli

    2017-05-27

    Ribosomal protein S1 (RpsA), the largest 30S protein in ribosome, plays a significant role in translation and trans-translation. In Mycobacterium tuberculosis, the C-terminus of RpsA is known as tuberculosis drug target of pyrazinoic acid, which inhibits the interaction between MtRpsA and tmRNA in trans-translation. However, the molecular mechanism underlying the interaction of MtRpsA with tmRNA remains unknown. We herein analyzed the interaction of the C-terminal domain of MtRpsA with three RNA fragments poly(A), sMLD and pre-sMLD. NMR titration analysis revealed that the RNA binding sites on MtRpsA CTD are mainly located in the β2, β3 and β5 strands and the adjacent L3 loop of the S1 domain. Fluorescence experiments determined the MtRpsA CTD binding to RNAs are in the micromolar affinity range. Sequence analysis also revealed conserved residues in the mapped RNA binding region. Residues L304, V305, G308, F310, H322, I323, R357 and I358 were verified to be the key residues influencing the interaction between MtRpsA CTD and pre-sMLD. Molecular docking further confirmed that the poly(A)-like sequence and sMLD of tmRNA are all involved in the protein-RNA interaction, through charged interaction and hydrogen bonds. The results will be beneficial for designing new anti-tuberculosis drugs. Copyright © 2017 Elsevier Inc. All rights reserved.

  3. The NEDD8 inhibitor MLN4924 increases the size of the nucleolus and activates p53 through the ribosomal-Mdm2 pathway.

    Science.gov (United States)

    Bailly, A; Perrin, A; Bou Malhab, L J; Pion, E; Larance, M; Nagala, M; Smith, P; O'Donohue, M-F; Gleizes, P-E; Zomerdijk, J; Lamond, A I; Xirodimas, D P

    2016-01-28

    The ubiquitin-like molecule NEDD8 is essential for viability, growth and development, and is a potential target for therapeutic intervention. We found that the small molecule inhibitor of NEDDylation, MLN4924, alters the morphology and increases the surface size of the nucleolus in human and germline cells of Caenorhabditis elegans in the absence of nucleolar fragmentation. SILAC proteomics and monitoring of rRNA production, processing and ribosome profiling shows that MLN4924 changes the composition of the nucleolar proteome but does not inhibit RNA Pol I transcription. Further analysis demonstrates that MLN4924 activates the p53 tumour suppressor through the RPL11/RPL5-Mdm2 pathway, with characteristics of nucleolar stress. The study identifies the nucleolus as a target of inhibitors of NEDDylation and provides a mechanism for p53 activation upon NEDD8 inhibition. It also indicates that targeting the nucleolar proteome without affecting nucleolar transcription initiates the required signalling events for the control of cell cycle regulators.

  4. Multiple effects of S13 in modulating the strength of intersubunit interactions in the ribosome during translation.

    Science.gov (United States)

    Cukras, Anthony R; Green, Rachel

    2005-05-27

    The ribosomal protein S13 is found in the head region of the small subunit, where it interacts with the central protuberance of the large ribosomal subunit and with the P site-bound tRNA through its extended C terminus. The bridging interactions between the large and small subunits are dynamic, and are thought to be critical in orchestrating the molecular motions of the translation cycle. S13 provides a direct link between the tRNA-binding site and the movements in the head of the small subunit seen during translocation, thereby providing a possible pathway of signal transduction. We have created and characterized an rpsM(S13)-deficient strain of Escherichia coli and have found significant defects in subunit association, initiation and translocation through in vitro assays of S13-deficient ribosomes. Targeted mutagenesis of specific bridge and tRNA contact elements in S13 provides evidence that these two interaction domains play critical roles in maintaining the fidelity of translation. This ribosomal protein thus appears to play a non-essential, yet important role by modulating subunit interactions in multiple steps of the translation cycle.

  5. Phosphoproteomics analysis of postmortem porcine muscle with pH decline rate and time difference

    DEFF Research Database (Denmark)

    Huang, Honggang; Larsen, Martin R; Karlsson, Anders H

    2012-01-01

    The aim of this study was to characterize the protein phosphorylation in postmortem (PM) muscle and reveal the change during meat quality development. The gel-based phosphoproteomic analysis of PM porcine muscle was performed in three pig groups with different pH decline rates from PM 1h to 24 h....... The sarcoplasmic and myofibrillar fractions were analyzed using gel electrophoresis in combination with a phosphoprotein specific staining. Globally, the group with fast pH decline rate had the highest phosphorylation level at PM 1 h, but lowest at PM 24 h, whereas the group with slow pH decline rate showed...... the reverse case. The phosphorylation level of 12 bands in sarcoplasmic fraction and 3 bands in myofibrillar fraction were significantly affected by the synergy effects of pH and time (p

  6. Proto-ribosome: a theoretical approach based on RNA relics

    OpenAIRE

    Demongeot, Jacques

    2017-01-01

    We describe in this paper, based on already published articles, a contribution to the theory postulating the existence of a proto-ribosome, which could have appeared early at the origin of life and we discuss the interest of this notion in an evolutionary perspective, taking into account the existence of possible RNA relics of this proto-ribosome.

  7. Ribosomal protein-Mdm2-p53 pathway coordinates nutrient stress with lipid metabolism by regulating MCD and promoting fatty acid oxidation.

    Science.gov (United States)

    Liu, Yong; He, Yizhou; Jin, Aiwen; Tikunov, Andrey P; Zhou, Lishi; Tollini, Laura A; Leslie, Patrick; Kim, Tae-Hyung; Li, Lei O; Coleman, Rosalind A; Gu, Zhennan; Chen, Yong Q; Macdonald, Jeffrey M; Graves, Lee M; Zhang, Yanping

    2014-06-10

    The tumor suppressor p53 has recently been shown to regulate energy metabolism through multiple mechanisms. However, the in vivo signaling pathways related to p53-mediated metabolic regulation remain largely uncharacterized. By using mice bearing a single amino acid substitution at cysteine residue 305 of mouse double minute 2 (Mdm2(C305F)), which renders Mdm2 deficient in binding ribosomal proteins (RPs) RPL11 and RPL5, we show that the RP-Mdm2-p53 signaling pathway is critical for sensing nutrient deprivation and maintaining liver lipid homeostasis. Although the Mdm2(C305F) mutation does not significantly affect growth and development in mice, this mutation promotes fat accumulation under normal feeding conditions and hepatosteatosis under acute fasting conditions. We show that nutrient deprivation inhibits rRNA biosynthesis, increases RP-Mdm2 interaction, and induces p53-mediated transactivation of malonyl-CoA decarboxylase (MCD), which catalyzes the degradation of malonyl-CoA to acetyl-CoA, thus modulating lipid partitioning. Fasted Mdm2(C305F) mice demonstrate attenuated MCD induction and enhanced malonyl-CoA accumulation in addition to decreased oxidative respiration and increased fatty acid accumulation in the liver. Thus, the RP-Mdm2-p53 pathway appears to function as an endogenous sensor responsible for stimulating fatty acid oxidation in response to nutrient depletion.

  8. Absence of ribosomal DNA amplification in the meroistic (telotrophic) ovary of the large milkweed bug Oncopeltus fasciatus (Dallas) (Hemiptera: Lygaeidae)

    Science.gov (United States)

    1975-01-01

    In the typical meroistic insect ovary, the oocyte nucleus synthesizes little if any RNA. Nurse cells or trophocytes actively synthesize ribosomes which are transported to and accumulated by the oocyte. In the telotrophic ovary a morphological separation exists, the nurse cells being localized at the apical end of each ovariole and communicating with the ooocytes via nutritive cords. In order to determine whether the genes coding for ribosomal RNA (rRNA) are amplified in the telotrophic ovary of the milkweed bug Oncopeltus fasciatus, the percentages of the genome coding for ribosomal RNA in somatic cells, spermatogenic cells, ovarian follicles, and nurse cells were compared. The oocytes and most of the nurse cells of O. fasciatus are uninucleolate. DNA hybridizing with ribosomal RNA is localized in a satellite DNA, the density of which is 1.712 g/cm(-3). The density of main-band DNA is 1.694 g/cm(-3). The ribosomal DNA satellite accounts for approximately 0.2% of the DNA in somatic and gametogenic tissues of both males and females. RNA-DNA hybridization analysis demonstrates that approximately 0.03% of the DNA in somatic tissues, testis, ovarian follicles, and isolated nurse cells hybridizes with ribosomal RNA. The fact that the percentage of DNA hybridizing with rRNA is the same in somatic and in male and female gametogenic tissues indicates that amplification of ribosomal DNA does not occur in nurse cells and that if it occurs in oocytes, it represents less than a 50- fold increase in ribosomal DNA. An increase in total genome DNA accounted by polyploidization appears to provide for increasing the amount of ribosomal DNA in the nurse cells. PMID:1158969

  9. Nuclear Export of Pre-Ribosomal Subunits Requires Dbp5, but Not as an RNA-Helicase as for mRNA Export.

    Science.gov (United States)

    Neumann, Bettina; Wu, Haijia; Hackmann, Alexandra; Krebber, Heike

    2016-01-01

    The DEAD-box RNA-helicase Dbp5/Rat8 is known for its function in nuclear mRNA export, where it displaces the export receptor Mex67 from the mRNA at the cytoplasmic side of the nuclear pore complex (NPC). Here we show that Dbp5 is also required for the nuclear export of both pre-ribosomal subunits. Yeast temperature-sensitive dbp5 mutants accumulate both ribosomal particles in their nuclei. Furthermore, Dbp5 genetically and physically interacts with known ribosomal transport factors such as Nmd3. Similar to mRNA export we show that also for ribosomal transport Dbp5 is required at the cytoplasmic side of the NPC. However, unlike its role in mRNA export, Dbp5 does not seem to undergo its ATPase cycle for this function, as ATPase-deficient dbp5 mutants that selectively inhibit mRNA export do not affect ribosomal transport. Furthermore, mutants of GLE1, the ATPase stimulating factor of Dbp5, show no major ribosomal export defects. Consequently, while Dbp5 uses its ATPase cycle to displace the export receptor Mex67 from the translocated mRNAs, Mex67 remains bound to ribosomal subunits upon transit to the cytoplasm, where it is detectable on translating ribosomes. Therefore, we propose a model, in which Dbp5 supports ribosomal transport by capturing ribosomal subunits upon their cytoplasmic appearance at the NPC, possibly by binding export factors such as Mex67. Thus, our findings reveal that although different ribonucleoparticles, mRNAs and pre-ribosomal subunits, use shared export factors, they utilize different transport mechanisms.

  10. A 4'-phosphopantetheinyl transferase mediates non-ribosomal peptide synthetase activation in Aspergillus fumigatus.

    Science.gov (United States)

    Neville, Claire; Murphy, Alan; Kavanagh, Kevin; Doyle, Sean

    2005-04-01

    Aspergillus fumigatus is a significant human pathogen. Non-ribosomal peptide (NRP) synthesis is thought to be responsible for a significant proportion of toxin and siderophore production in the organism. Furthermore, it has been shown that 4'-phosphopantetheinylation is required for the activation of key enzymes involved in non-ribosomal peptide synthesis in other species. Here we report the cloning, recombinant expression and functional characterisation of a 4'-phosphopantetheinyl transferase from A. fumigatus and the identification of an atypical NRP synthetase (Afpes1), spanning 14.3 kb. Phylogenetic analysis has shown that the NRP synthetase exhibits greatest identity to NRP synthetases from Metarhizium anisolpiae (PesA) and Alternaria brassicae (AbrePsy1). Northern hybridisation and RT-PCR analysis have confirmed that both genes are expressed in A. fumigatus. A 120 kDa fragment of the A. fumigatus NRP synthetase, containing a putative thiolation domain, was cloned and expressed in the baculovirus expression system. Detection of a 4'-phosphopantetheinylated peptide (SFSAMK) from this protein, by MALDI-TOF mass spectrometric analysis after coincubation of the 4'-phosphopantetheinyl transferase with the recombinant NRP synthetase fragment and acetyl CoA, confirms that it is competent to play a role in NRP synthetase activation in A. fumigatus. The 4'-phosphopantetheinyl transferase also activates, by 4'-phosphopantetheinylation, recombinant alpha-aminoadipate reductase (Lys2p) from Candida albicans, a key enzyme involved in lysine biosynthesis.

  11. Involvement of ribosomal protein L6 in assembly of functional 50S ribosomal subunit in Escherichia coli cells

    International Nuclear Information System (INIS)

    Shigeno, Yuta; Uchiumi, Toshio; Nomura, Takaomi

    2016-01-01

    Ribosomal protein L6, an essential component of the large (50S) subunit, primarily binds to helix 97 of 23S rRNA and locates near the sarcin/ricin loop of helix 95 that directly interacts with GTPase translation factors. Although L6 is believed to play important roles in factor-dependent ribosomal function, crucial biochemical evidence for this hypothesis has not been obtained. We constructed and characterized an Escherichia coli mutant bearing a chromosomal L6 gene (rplF) disruption and carrying a plasmid with an arabinose-inducible L6 gene. Although this ΔL6 mutant grew more slowly than its wild-type parent, it proliferated in the presence of arabinose. Interestingly, cell growth in the absence of arabinose was biphasic. Early growth lasted only a few generations (LI-phase) and was followed by a suspension of growth for several hours (S-phase). This suspension was followed by a second growth phase (LII-phase). Cells harvested at both LI- and S-phases contained ribosomes with reduced factor-dependent GTPase activity and accumulated 50S subunit precursors (45S particles). The 45S particles completely lacked L6. Complete 50S subunits containing L6 were observed in all growth phases regardless of the L6-depleted condition, implying that the ΔL6 mutant escaped death because of a leaky expression of L6 from the complementing plasmid. We conclude that L6 is essential for the assembly of functional 50S subunits at the late stage. We thus established conditions for the isolation of L6-depleted 50S subunits, which are essential to study the role of L6 in translation. - Highlights: • We constructed an in vivo functional assay system for Escherichia coli ribosomal protein L6. • Growth of an E. coli ΔL6 mutant was biphasic when L6 levels were depleted. • The ΔL6 mutant accumulated 50S ribosomal subunit precursors that sedimented at 45S. • L6 is a key player in the late stage of E. coli 50S subunit assembly.

  12. Involvement of ribosomal protein L6 in assembly of functional 50S ribosomal subunit in Escherichia coli cells

    Energy Technology Data Exchange (ETDEWEB)

    Shigeno, Yuta [Division of Applied Biology, Faculty of Textile Science and Technology, Shinshu University, Ueda 386-8567 (Japan); Uchiumi, Toshio [Department of Biology, Faculty of Science, Niigata University, Niigata 950-2181 (Japan); Nomura, Takaomi, E-mail: nomurat@shinshu-u.ac.jp [Division of Applied Biology, Faculty of Textile Science and Technology, Shinshu University, Ueda 386-8567 (Japan)

    2016-04-22

    Ribosomal protein L6, an essential component of the large (50S) subunit, primarily binds to helix 97 of 23S rRNA and locates near the sarcin/ricin loop of helix 95 that directly interacts with GTPase translation factors. Although L6 is believed to play important roles in factor-dependent ribosomal function, crucial biochemical evidence for this hypothesis has not been obtained. We constructed and characterized an Escherichia coli mutant bearing a chromosomal L6 gene (rplF) disruption and carrying a plasmid with an arabinose-inducible L6 gene. Although this ΔL6 mutant grew more slowly than its wild-type parent, it proliferated in the presence of arabinose. Interestingly, cell growth in the absence of arabinose was biphasic. Early growth lasted only a few generations (LI-phase) and was followed by a suspension of growth for several hours (S-phase). This suspension was followed by a second growth phase (LII-phase). Cells harvested at both LI- and S-phases contained ribosomes with reduced factor-dependent GTPase activity and accumulated 50S subunit precursors (45S particles). The 45S particles completely lacked L6. Complete 50S subunits containing L6 were observed in all growth phases regardless of the L6-depleted condition, implying that the ΔL6 mutant escaped death because of a leaky expression of L6 from the complementing plasmid. We conclude that L6 is essential for the assembly of functional 50S subunits at the late stage. We thus established conditions for the isolation of L6-depleted 50S subunits, which are essential to study the role of L6 in translation. - Highlights: • We constructed an in vivo functional assay system for Escherichia coli ribosomal protein L6. • Growth of an E. coli ΔL6 mutant was biphasic when L6 levels were depleted. • The ΔL6 mutant accumulated 50S ribosomal subunit precursors that sedimented at 45S. • L6 is a key player in the late stage of E. coli 50S subunit assembly.

  13. Identification and role of functionally important motifs in the 970 loop of Escherichia coli 16S ribosomal RNA.

    Science.gov (United States)

    Saraiya, Ashesh A; Lamichhane, Tek N; Chow, Christine S; SantaLucia, John; Cunningham, Philip R

    2008-02-22

    The 970 loop (helix 31) of Escherichia coli 16S ribosomal RNA contains two modified nucleotides, m(2)G966 and m(5)C967. Positions A964, A969, and C970 are conserved among the Bacteria, Archaea, and Eukarya. The nucleotides present at positions 965, 966, 967, 968, and 971, however, are only conserved and unique within each domain. All organisms contain a modified nucleoside at position 966, but the type of the modification is domain specific. Biochemical and structure studies have placed this loop near the P site and have shown it to be involved in the decoding process and in binding the antibiotic tetracycline. To identify the functional components of this ribosomal RNA hairpin, the eight nucleotides of the 970 loop of helix 31 were subjected to saturation mutagenesis and 107 unique functional mutants were isolated and analyzed. Nonrandom nucleotide distributions were observed at each mutated position among the functional isolates. Nucleotide identity at positions 966 and 969 significantly affects ribosome function. Ribosomes with single mutations of m(2)G966 or m(5)C967 produce more protein in vivo than do wild-type ribosomes. Overexpression of initiation factor 3 specifically restored wild-type levels of protein synthesis to the 966 and 967 mutants, suggesting that modification of these residues is important for initiation factor 3 binding and for the proper initiation of protein synthesis.

  14. Binding site of ribosomal proteins on prokaryotic 5S ribonucleic acids: a study with ribonucleases

    DEFF Research Database (Denmark)

    Douthwaite, S; Christensen, A; Garrett, R A

    1982-01-01

    The binding sites of ribosomal proteins L18 and L25 on 5S RNA from Escherichia coli were probed with ribonucleases A, T1, and T2 and a double helix specific cobra venom endonuclease. The results for the protein-RNA complexes, which were compared with those for the free RNA [Douthwaite, S...... stearothermophilus 5S RNA. Several protein-induced changes in the RNA structures were identified; some are possibly allosteric in nature. The two prokaryotic 5S RNAs were also incubated with total 50S subunit proteins from E. coli and B. stearothermophilus ribosomes. Homologous and heterologous reconstitution....... stearothermophilus 5S RNA, which may have been due to a third ribosomal protein L5....

  15. Senescent changes in the ribosomes of animal cells in vivo and in vitro

    Science.gov (United States)

    Miquel, J.; Johnson, J. E., Jr.

    1979-01-01

    The paper examines RNA-ribosomal changes observed in protozoa and fixed postmitotic cells, as well as the characteristics of intermitotic cells. Attention is given to a discussion of the implications of the reported ribosomal changes as to the senescent deterioration of protein synthesis and physiological functions. A survey of the literature suggests that, while the data on ribosomal change in dividing cells both in vivo and in vitro are inconclusive, there is strong histological and biochemical evidence in favor of some degree of quantitative ribosomal loss in fixed postmitotic cells. Since these decreases in ribosomes are demonstrated in differential cells from nematodes, insects and mammals, they may represent a universal manifestation of cytoplasmic senescence in certain types of fixed postmitotic animal cells. The observed variability in ribosomal loss for cells belonging to the same type suggests that this involution phenomenon is rather related to the wear and tear suffered by a particular cell.

  16. Arabidopsis Yak1 protein (AtYak1) is a dual specificity protein kinase

    KAUST Repository

    Kim, Dongjin; Ntui, Valentine Otang; Zhang, Nianshu; Xiong, Liming

    2015-01-01

    Yak1 is a member of dual-specificity Tyr phosphorylation-regulated kinases (DYRKs) that are evolutionarily conserved. The downstream targets of Yak1 and their functions are largely unknown. Here, a homologous protein AtYAK1 was identified in Arabidopsis thaliana and the phosphoprotein profiles of the wild type and an atyak1 mutant were compared on two-dimensional gel following Pro-Q Diamond phosphoprotein gel staining. Annexin1, Annexin2 and RBD were phosphorylated at serine/ threonine residues by the AtYak1 kinase. Annexin1, Annexin2 and Annexin4 were also phosphorylated at tyrosine residues. Our study demonstrated that AtYak1 is a dual specificity protein kinase in Arabidopsis that may regulate the phosphorylation status of the annexin family proteins.

  17. Arabidopsis Yak1 protein (AtYak1) is a dual specificity protein kinase

    KAUST Repository

    Kim, Dongjin

    2015-10-09

    Yak1 is a member of dual-specificity Tyr phosphorylation-regulated kinases (DYRKs) that are evolutionarily conserved. The downstream targets of Yak1 and their functions are largely unknown. Here, a homologous protein AtYAK1 was identified in Arabidopsis thaliana and the phosphoprotein profiles of the wild type and an atyak1 mutant were compared on two-dimensional gel following Pro-Q Diamond phosphoprotein gel staining. Annexin1, Annexin2 and RBD were phosphorylated at serine/ threonine residues by the AtYak1 kinase. Annexin1, Annexin2 and Annexin4 were also phosphorylated at tyrosine residues. Our study demonstrated that AtYak1 is a dual specificity protein kinase in Arabidopsis that may regulate the phosphorylation status of the annexin family proteins.

  18. Insights into the Inhibition of the p90 Ribosomal S6 Kinase (RSK) by the Flavonol Glycoside SL0101 from the 1.5 Å Crystal Structure of the N-Terminal Domain of RSK2 with Bound Inhibitor

    Energy Technology Data Exchange (ETDEWEB)

    Utepbergenov, Darkhan; Derewenda, Urszula; Olekhnovich, Natalya; Szukalska, Gabriela; Banerjee, Budhaditya; Hilinski, Michael K.; Lannigan, Deborah A.; Stukenberg, P. Todd; Derewenda, Zygmunt S. (Lodz - Poland); (UV)

    2012-09-11

    The p90 ribosomal S6 family of kinases (RSK) are potential drug targets, due to their involvement in cancer and other pathologies. There are currently only two known selective inhibitors of RSK, but the basis for selectivity is not known. One of these inhibitors is a naturally occurring kaempferol-a-l-diacetylrhamnoside, SL0101. Here, we report the crystal structure of the complex of the N-terminal kinase domain of the RSK2 isoform with SL0101 at 1.5 {angstrom} resolution. The refined atomic model reveals unprecedented structural reorganization of the protein moiety, as compared to the nucleotide-bound form. The entire N-lobe, the hinge region, and the aD-helix undergo dramatic conformational changes resulting in a rearrangement of the nucleotide binding site with concomitant formation of a highly hydrophobic pocket spatially suited to accommodate SL0101. These unexpected results will be invaluable in further optimization of the SL0101 scaffold as a promising lead for a novel class of kinase inhibitors.

  19. γ-irradiated ribosomes from Micrococcus radiodurans in a cell-free protein synthesizing system

    International Nuclear Information System (INIS)

    Suessmuth, R.; Widmann, A.

    1979-01-01

    γ-irradiation inactivation of isolated ribosomes of Micrococcus radiodurans was studied by examining poly U directed synthesis of polyphenylalanine. Ribosomes of M. radiodurans did not show significant γ-radiation sensitivity up to a dose of approx. 11.6 k Gy. Cells of M. radiodurans take up more magnesium than E. coli cells under the same conditions. The magnesium content of ribosomes of M. radiodurans was 18% higher than that of E.coli ribosomes. A possible relation between Mg 2+ -content and γ-resistance is discussed. (orig.) [de

  20. Remodeling of ribosomal genes in somatic cells by Xenopus egg extract

    DEFF Research Database (Denmark)

    Østrup, Olga; Hyttel, Poul; Klærke, Dan Arne

    2011-01-01

    Extracts from Xenopus eggs can reprogram gene expression in somatic nuclei, however little is known about the earliest processes associated with the switch in the transcriptional program. We show here that an early reprogramming event is the remodeling of ribosomal chromatin and gene expression....... This occurs within hours of extract treatment and is distinct from a stress response. Egg extract elicits remodeling of the nuclear envelope, chromatin and nucleolus. Nucleolar remodeling involves a rapid and stable decrease in ribosomal gene transcription, and promoter targeting of the nucleolar remodeling...... and elicits a stress-type nuclear response. Thus, an early event of Xenopus egg extract-mediated nuclear reprogramming is the remodeling of ribosomal genes involving nucleolar remodeling complex. Condition-specific and rapid silencing of ribosomal genes may serve as a sensitive marker for evaluation...

  1. Secondary structure of prokaryotic 5S ribosomal ribonucleic acids: a study with ribonucleases

    DEFF Research Database (Denmark)

    Douthwaite, S; Garrett, R A

    1981-01-01

    The structures of 5S ribosomal RNAs from Escherichia coli and Bacillus stearothermophilus were examined by using ribonucleases A, T1, and T2 and a double helix specific cobra venom ribonuclease. By using both 5' and 3'-32P-end labeling methods and selecting for digested but intact 5S RNA molecules...... evidence for three of the helical regions of the Fox and Woese model of 5S RNA [Fox, G. E., & Woese, C. (1975) Nature (London) 256, 505] and support other important structural features which include a nucleotide looped out from a helical region which has been proposed as a recognition site for protein L18....

  2. Dual function of the nuclear export signal of the Borna disease virus nucleoprotein in nuclear export activity and binding to viral phosphoprotein.

    Science.gov (United States)

    Yanai, Mako; Sakai, Madoka; Makino, Akiko; Tomonaga, Keizo

    2017-07-11

    Borna disease virus (BoDV), which has a negative-sense, single-stranded RNA genome, causes persistent infection in the cell nucleus. The nuclear export signal (NES) of the viral nucleoprotein (N) consisting of leucine at positions 128 and 131 and isoleucine at positions 133 and 136 overlaps with one of two predicted binding sites for the viral phosphoprotein (P). A previous study demonstrated that higher expression of BoDV-P inhibits nuclear export of N; however, the function of N NES in the interaction with P remains unclear. We examined the subcellular localization, viral polymerase activity, and P-binding ability of BoDV-N NES mutants. We also characterized a recombinant BoDV (rBoDV) harboring an NES mutation of N. BoDV-N with four alanine-substitutions in the leucine and isoleucine residues of the NES impaired its cytoplasmic localization and abolished polymerase activity and P-binding ability. Although an alanine-substitution at position 131 markedly enhanced viral polymerase activity as determined by a minigenome assay, rBoDV harboring this mutation showed expression of viral RNAs and proteins relative to that of wild-type rBoDV. Our results demonstrate that BoDV-N NES has a dual function in BoDV replication, i.e., nuclear export of N and an interaction with P, affecting viral polymerase activity in the nucleus.

  3. Phosphorylation of Ribosomal Protein S6 Mediates Mammalian Target of Rapamycin Complex 1-Induced Parathyroid Cell Proliferation in Secondary Hyperparathyroidism.

    Science.gov (United States)

    Volovelsky, Oded; Cohen, Gili; Kenig, Ariel; Wasserman, Gilad; Dreazen, Avigail; Meyuhas, Oded; Silver, Justin; Naveh-Many, Tally

    2016-04-01

    Secondary hyperparathyroidism is characterized by increased serum parathyroid hormone (PTH) level and parathyroid cell proliferation. However, the molecular pathways mediating the increased parathyroid cell proliferation remain undefined. Here, we found that the mTOR pathway was activated in the parathyroid of rats with secondary hyperparathyroidism induced by either chronic hypocalcemia or uremia, which was measured by increased phosphorylation of ribosomal protein S6 (rpS6), a downstream target of the mTOR pathway. This activation correlated with increased parathyroid cell proliferation. Inhibition of mTOR complex 1 by rapamycin decreased or prevented parathyroid cell proliferation in secondary hyperparathyroidism rats and in vitro in uremic rat parathyroid glands in organ culture. Knockin rpS6(p-/-) mice, in which rpS6 cannot be phosphorylated because of substitution of all five phosphorylatable serines with alanines, had impaired PTH secretion after experimental uremia- or folic acid-induced AKI. Uremic rpS6(p-/-) mice had no increase in parathyroid cell proliferation compared with a marked increase in uremic wild-type mice. These results underscore the importance of mTOR activation and rpS6 phosphorylation for the pathogenesis of secondary hyperparathyroidism and indicate that mTORC1 is a significant regulator of parathyroid cell proliferation through rpS6. Copyright © 2016 by the American Society of Nephrology.

  4. Understanding Biases in Ribosome Profiling Experiments Reveals Signatures of Translation Dynamics in Yeast.

    Directory of Open Access Journals (Sweden)

    Jeffrey A Hussmann

    2015-12-01

    Full Text Available Ribosome profiling produces snapshots of the locations of actively translating ribosomes on messenger RNAs. These snapshots can be used to make inferences about translation dynamics. Recent ribosome profiling studies in yeast, however, have reached contradictory conclusions regarding the average translation rate of each codon. Some experiments have used cycloheximide (CHX to stabilize ribosomes before measuring their positions, and these studies all counterintuitively report a weak negative correlation between the translation rate of a codon and the abundance of its cognate tRNA. In contrast, some experiments performed without CHX report strong positive correlations. To explain this contradiction, we identify unexpected patterns in ribosome density downstream of each type of codon in experiments that use CHX. These patterns are evidence that elongation continues to occur in the presence of CHX but with dramatically altered codon-specific elongation rates. The measured positions of ribosomes in these experiments therefore do not reflect the amounts of time ribosomes spend at each position in vivo. These results suggest that conclusions from experiments in yeast using CHX may need reexamination. In particular, we show that in all such experiments, codons decoded by less abundant tRNAs were in fact being translated more slowly before the addition of CHX disrupted these dynamics.

  5. Linezolid-Dependent Function and Structure Adaptation of Ribosomes in a Staphylococcus epidermidis Strain Exhibiting Linezolid Dependence

    Science.gov (United States)

    Kokkori, Sofia; Apostolidi, Maria; Tsakris, Athanassios; Pournaras, Spyros

    2014-01-01

    Linezolid-dependent growth was recently reported in Staphylococcus epidermidis clinical strains carrying mutations associated with linezolid resistance. To investigate this unexpected behavior at the molecular level, we isolated active ribosomes from one of the linezolid-dependent strains and we compared them with ribosomes isolated from a wild-type strain. Both strains were grown in the absence and presence of linezolid. Detailed biochemical and structural analyses revealed essential differences in the function and structure of isolated ribosomes which were assembled in the presence of linezolid. The catalytic activity of peptidyltransferase was found to be significantly higher in the ribosomes derived from the linezolid-dependent strain. Interestingly, the same ribosomes exhibited an abnormal ribosomal subunit dissociation profile on a sucrose gradient in the absence of linezolid, but the profile was restored after treatment of the ribosomes with an excess of the antibiotic. Our study suggests that linezolid most likely modified the ribosomal assembly procedure, leading to a new functional ribosomal population active only in the presence of linezolid. Therefore, the higher growth rate of the partially linezolid-dependent strains could be attributed to the functional and structural adaptations of ribosomes to linezolid. PMID:24890589

  6. The ribosome uses two active mechanisms to unwind messenger RNA during translation.

    Science.gov (United States)

    Qu, Xiaohui; Wen, Jin-Der; Lancaster, Laura; Noller, Harry F; Bustamante, Carlos; Tinoco, Ignacio

    2011-07-06

    The ribosome translates the genetic information encoded in messenger RNA into protein. Folded structures in the coding region of an mRNA represent a kinetic barrier that lowers the peptide elongation rate, as the ribosome must disrupt structures it encounters in the mRNA at its entry site to allow translocation to the next codon. Such structures are exploited by the cell to create diverse strategies for translation regulation, such as programmed frameshifting, the modulation of protein expression levels, ribosome localization and co-translational protein folding. Although strand separation activity is inherent to the ribosome, requiring no exogenous helicases, its mechanism is still unknown. Here, using a single-molecule optical tweezers assay on mRNA hairpins, we find that the translation rate of identical codons at the decoding centre is greatly influenced by the GC content of folded structures at the mRNA entry site. Furthermore, force applied to the ends of the hairpin to favour its unfolding significantly speeds translation. Quantitative analysis of the force dependence of its helicase activity reveals that the ribosome, unlike previously studied helicases, uses two distinct active mechanisms to unwind mRNA structure: it destabilizes the helical junction at the mRNA entry site by biasing its thermal fluctuations towards the open state, increasing the probability of the ribosome translocating unhindered; and it mechanically pulls apart the mRNA single strands of the closed junction during the conformational changes that accompany ribosome translocation. The second of these mechanisms ensures a minimal basal rate of translation in the cell; specialized, mechanically stable structures are required to stall the ribosome temporarily. Our results establish a quantitative mechanical basis for understanding the mechanism of regulation of the elongation rate of translation by structured mRNAs. ©2011 Macmillan Publishers Limited. All rights reserved

  7. Structure of Vibrio cholerae ribosome hibernation promoting factor

    International Nuclear Information System (INIS)

    De Bari, Heather; Berry, Edward A.

    2013-01-01

    The X-ray crystal structure of ribosome hibernation promoting factor from V. cholerae has been determined at 2.0 Å resolution. The crystal was phased by two-wavelength MAD using cocrystallized cobalt. The X-ray crystal structure of ribosome hibernation promoting factor (HPF) from Vibrio cholerae is presented at 2.0 Å resolution. The crystal was phased by two-wavelength MAD using cocrystallized cobalt. The asymmetric unit contained two molecules of HPF linked by four Co atoms. The metal-binding sites observed in the crystal are probably not related to biological function. The structure of HPF has a typical β–α–β–β–β–α fold consistent with previous structures of YfiA and HPF from Escherichia coli. Comparison of the new structure with that of HPF from E. coli bound to the Thermus thermophilus ribosome [Polikanov et al. (2012 ▶), Science, 336, 915–918] shows that no significant structural changes are induced in HPF by binding

  8. Interdependence of Pes1, Bop1, and WDR12 controls nucleolar localization and assembly of the PeBoW complex required for maturation of the 60S ribosomal subunit.

    Science.gov (United States)

    Rohrmoser, Michaela; Hölzel, Michael; Grimm, Thomas; Malamoussi, Anastassia; Harasim, Thomas; Orban, Mathias; Pfisterer, Iris; Gruber-Eber, Anita; Kremmer, Elisabeth; Eick, Dirk

    2007-05-01

    The PeBoW complex is essential for cell proliferation and maturation of the large ribosomal subunit in mammalian cells. Here we examined the role of PeBoW-specific proteins Pes1, Bop1, and WDR12 in complex assembly and stability, nucleolar transport, and pre-ribosome association. Recombinant expression of the three subunits is sufficient for complex formation. The stability of all three subunits strongly increases upon incorporation into the complex. Only overexpression of Bop1 inhibits cell proliferation and rRNA processing, and its negative effects could be rescued by coexpression of WDR12, but not Pes1. Elevated levels of Bop1 induce Bop1/WDR12 and Bop1/Pes1 subcomplexes. Knockdown of Bop1 abolishes the copurification of Pes1 with WDR12, demonstrating Bop1 as the integral component of the complex. Overexpressed Bop1 substitutes for endogenous Bop1 in PeBoW complex assembly, leading to the instability of endogenous Bop1. Finally, indirect immunofluorescence, cell fractionation, and sucrose gradient centrifugation experiments indicate that transport of Bop1 from the cytoplasm to the nucleolus is Pes1 dependent, while Pes1 can migrate to the nucleolus and bind to preribosomal particles independently of Bop1. We conclude that the assembly and integrity of the PeBoW complex are highly sensitive to changes in Bop1 protein levels.

  9. The N-terminal sequence of ribosomal protein L10 from the archaebacterium Halobacterium marismortui and its relationship to eubacterial protein L6 and other ribosomal proteins.

    Science.gov (United States)

    Dijk, J; van den Broek, R; Nasiulas, G; Beck, A; Reinhardt, R; Wittmann-Liebold, B

    1987-08-01

    The amino-terminal sequence of ribosomal protein L10 from Halobacterium marismortui has been determined up to residue 54, using both a liquid- and a gas-phase sequenator. The two sequences are in good agreement. The protein is clearly homologous to protein HcuL10 from the related strain Halobacterium cutirubrum. Furthermore, a weaker but distinct homology to ribosomal protein L6 from Escherichia coli and Bacillus stearothermophilus can be detected. In addition to 7 identical amino acids in the first 36 residues in all four sequences a number of conservative replacements occurs, of mainly hydrophobic amino acids. In this common region the pattern of conserved amino acids suggests the presence of a beta-alpha fold as it occurs in ribosomal proteins L12 and L30. Furthermore, several potential cases of homology to other ribosomal components of the three ur-kingdoms have been found.

  10. Ribosomes: Ribozymes that Survived Evolution Pressures but Is Paralyzed by Tiny Antibiotics

    Science.gov (United States)

    Yonath, Ada

    An impressive number of crystal structures of ribosomes, the universal cellular machines that translate the genetic code into proteins, emerged during the last decade. The determination of ribosome high resolution structure, which was widely considered formidable, led to novel insights into the ribosomal function, namely, fidelity, catalytic mechanism, and polymerize activities. They also led to suggestions concerning its origin and shed light on the action, selectivity and synergism of ribosomal antibiotics; illuminated mechanisms acquiring bacterial resistance and provided structural information for drug improvement and design. These studies required the pioneering and implementation of advanced technologies, which directly influenced the remarkable increase of the number of structures deposited in the Protein Data Bank.

  11. Multiperspective smFRET reveals rate-determining late intermediates of ribosomal translocation.

    Science.gov (United States)

    Wasserman, Michael R; Alejo, Jose L; Altman, Roger B; Blanchard, Scott C

    2016-04-01

    Directional translocation of the ribosome through the mRNA open reading frame is a critical determinant of translational fidelity. This process entails a complex interplay of large-scale conformational changes within the actively translating particle, which together coordinate the movement of tRNA and mRNA substrates with respect to the large and small ribosomal subunits. Using pre-steady state, single-molecule fluorescence resonance energy transfer imaging, we tracked the nature and timing of these conformational events within the Escherichia coli ribosome from five structural perspectives. Our investigations revealed direct evidence of structurally and kinetically distinct late intermediates during substrate movement, whose resolution determines the rate of translocation. These steps involve intramolecular events within the EF-G-GDP-bound ribosome, including exaggerated, reversible fluctuations of the small-subunit head domain, which ultimately facilitate peptidyl-tRNA's movement into its final post-translocation position.

  12. Characterization of Anti-Citrinin Specific ScFvs Selected from Non-Immunized Mouse Splenocytes by Eukaryotic Ribosome Display.

    Directory of Open Access Journals (Sweden)

    Haiwei Cheng

    Full Text Available Single chain variable fragments (scFvs against citrinin (CIT were selected from a scFv library constructed from the splenocytes of non-immunized mice by an improved eukaryotic ribosome display technology in this study. Bovine serum albumin (BSA/ CIT-BSA and ovalbumin (OVA/ CIT-OVA were used as the antigens to select specific anti-CIT scFvs. Eukaryotic in situ RT-PCR method was used to recover the selected mRNA after every affinity selection. After six rounds of ribosome display, expression vector pTIG-TRX carrying specific scFv DNAs were constructed and transformed into Escherichia coli BL21 (DE3 for protein expression. Thirteen positive clones were selected out of which three (designated 23, 68 and 109 showed high binding activity and specificity to CIT by indirect ELISA, while no clone showed binding activity with carrier proteins. The three scFvs showed high specificity to CIT and the cross reactivity with other mycotoxins was below 0.01% as determined by indirect competitive ELISA. These specific scFvs offer a potential novel immunoassay method for CIT residues. This study confirmed the effectiveness of the improved eukaryotic ribosome display system and could be used as a reference for the selection of scFvs specific to other small molecules using ribosome display.

  13. Purification and properties of a ribosomal casein kinase from rabbit reticulocytes

    DEFF Research Database (Denmark)

    Issinger, O G

    1977-01-01

    A casein kinase was isolated and purifed from rabbit reticulocytes. About 90% of the enzyme activity co-sedimented with the ribosomal fraction, whereas about 10% of the enzyme activity was found in the ribosome-free supernatant. Both casein kinases (the ribosome-bound enzyme as well as the free...... suggested that the casein kinase is a dimer composed of subunits of identical molecular weight. The enzyme utilizes GTP as well as ATP as a phosphoryl donor. It preferentially phosphorylates acidic proteins, in particular the model substrates casein and phosvitin. Casein kinase is cyclic AMP...

  14. Simulation and analysis of single-ribosome translation

    International Nuclear Information System (INIS)

    Tinoco, Ignacio Jr; Wen, Jin-Der

    2009-01-01

    In the cell, proteins are synthesized by ribosomes in a multi-step process called translation. The ribosome translocates along the messenger RNA to read the codons that encode the amino acid sequence of a protein. Elongation factors, including EF-G and EF-Tu, are used to catalyze the process. Recently, we have shown that translation can be followed at the single-molecule level using optical tweezers; this technique allows us to study the kinetics of translation by measuring the lifetime the ribosome spends at each codon. Here, we analyze the data from single-molecule experiments and fit the data with simple kinetic models. We also simulate the translation kinetics based on a multi-step mechanism from ensemble kinetic measurements. The mean lifetimes from the simulation were consistent with our experimental single-molecule measurements. We found that the calculated lifetime distributions were fit in general by equations with up to five rate-determining steps. Two rate-determining steps were only obtained at low concentrations of elongation factors. These analyses can be used to design new single-molecule experiments to better understand the kinetics and mechanism of translation

  15. Dicty_cDB: Contig-U03408-1 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available ec... 40 0.095 2 ( EF634883 ) Pristionchus pauli small subunit ribosomal protei... 42 0.25 2 ( EH361767 ) NP...Haliotis discus discus ribosomal p... 46 4e-04 EF634883_1( EF634883 |pid:none) Pristionchus pauli small subu

  16. Stability of the 'L12 stalk' in ribosomes from mesophilic and (hyper)thermophilic Archaea and Bacteria.

    Science.gov (United States)

    Shcherbakov, D; Dontsova, M; Tribus, M; Garber, M; Piendl, W

    2006-01-01

    The ribosomal stalk complex, consisting of one molecule of L10 and four or six molecules of L12, is attached to 23S rRNA via protein L10. This complex forms the so-called 'L12 stalk' on the 50S ribosomal subunit. Ribosomal protein L11 binds to the same region of 23S rRNA and is located at the base of the 'L12 stalk'. The 'L12 stalk' plays a key role in the interaction of the ribosome with translation factors. In this study stalk complexes from mesophilic and (hyper)thermophilic species of the archaeal genus Methanococcus and from the Archaeon Sulfolobus solfataricus, as well as from the Bacteria Escherichia coli, Geobacillus stearothermophilus and Thermus thermophilus, were overproduced in E.coli and purified under non-denaturing conditions. Using filter-binding assays the affinities of the archaeal and bacterial complexes to their specific 23S rRNA target site were analyzed at different pH, ionic strength and temperature. Affinities of both archaeal and bacterial complexes for 23S rRNA vary by more than two orders of magnitude, correlating very well with the growth temperatures of the organisms. A cooperative effect of binding to 23S rRNA of protein L11 and the L10/L12(4) complex from mesophilic and thermophilic Archaea was shown to be temperature-dependent.

  17. Comparative profiling of sarcoplasmic phosphoproteins in ovine muscle with different color stability.

    Science.gov (United States)

    Li, Meng; Li, Zheng; Li, Xin; Xin, Jianzeng; Wang, Ying; Li, Guixia; Wu, Liguo; Shen, Qingwu W; Zhang, Dequan

    2018-02-01

    The phosphorylation of sarcoplasmic proteins in postmortem muscles was investigated in relationship to color stability in the present study. Although no difference was observed in the global phosphorylation level of sarcoplasmic proteins, difference was determined in the phosphorylation levels of individual protein bands from muscles with different color stability. Correlation analysis and liquid chromatography - tandem mass spectrometry (LC-MS/MS) identification of phosphoproteins showed that most of the color stability-related proteins were glycolytic enzymes. Interestingly, the phosphorylation level of myoglobin was inversely related to meat color stability. As the phosphorylation of myoglobin increased, color stability based on a ∗ value decreased and metMb content increased. In summary, the study revealed that protein phosphorylation might play a role in the regulation of meat color stability probably by regulating glycolysis and the redox stability of myoglobin, which might be affected by the phosphorylation of myoglobin. Copyright © 2017 Elsevier Ltd. All rights reserved.

  18. AcEST: BP915632 [AcEST

    Lifescience Database Archive (English)

    Full Text Available ... 31 2.6 sp|P03186|TEGU_EBV Large tegument protein OS=Epstein-Barr virus ... 30 3.3 sp|Q9E7N7|VP4A_LNYV Phosphoprotein OS=Lettuce...E7N7|VP4A_LNYV Phosphoprotein OS=Lettuce necrotic yellows virus GN=P PE=2 SV=1 Le

  19. The ribosome as a molecular machine: the mechanism of tRNA-mRNA movement in translocation.

    Science.gov (United States)

    Rodnina, Marina V; Wintermeyer, Wolfgang

    2011-04-01

    Translocation of tRNA and mRNA through the ribosome is one of the most dynamic events during protein synthesis. In the cell, translocation is catalysed by EF-G (elongation factor G) and driven by GTP hydrolysis. Major unresolved questions are: how the movement is induced and what the moving parts of the ribosome are. Recent progress in time-resolved cryoelectron microscopy revealed trajectories of tRNA movement through the ribosome. Driven by thermal fluctuations, the ribosome spontaneously samples a large number of conformational states. The spontaneous movement of tRNAs through the ribosome is loosely coupled to the motions within the ribosome. EF-G stabilizes conformational states prone to translocation and promotes a conformational rearrangement of the ribosome (unlocking) that accelerates the rate-limiting step of translocation: the movement of the tRNA anticodons on the small ribosomal subunit. EF-G acts as a Brownian ratchet providing directional bias for movement at the cost of GTP hydrolysis.

  20. Structural basis for precursor protein-directed ribosomal peptide macrocyclization

    Science.gov (United States)

    Li, Kunhua; Condurso, Heather L.; Li, Gengnan; Ding, Yousong; Bruner, Steven D.

    2016-01-01

    Macrocyclization is a common feature of natural product biosynthetic pathways including the diverse family of ribosomal peptides. Microviridins are architecturally complex cyanobacterial ribosomal peptides whose members target proteases with potent reversible inhibition. The product structure is constructed by three macrocyclizations catalyzed sequentially by two members of the ATP-grasp family, a unique strategy for ribosomal peptide macrocyclization. Here, we describe the detailed structural basis for the enzyme-catalyzed macrocyclizations in the microviridin J pathway of Microcystis aeruginosa. The macrocyclases, MdnC and MdnB, interact with a conserved α-helix of the precursor peptide using a novel precursor peptide recognition mechanism. The results provide insight into the unique protein/protein interactions key to the chemistry, suggest an origin of the natural combinatorial synthesis of microviridin peptides and provide a framework for future engineering efforts to generate designed compounds. PMID:27669417

  1. Structural basis for precursor protein-directed ribosomal peptide macrocyclization.

    Science.gov (United States)

    Li, Kunhua; Condurso, Heather L; Li, Gengnan; Ding, Yousong; Bruner, Steven D

    2016-11-01

    Macrocyclization is a common feature of natural product biosynthetic pathways including the diverse family of ribosomal peptides. Microviridins are architecturally complex cyanobacterial ribosomal peptides that target proteases with potent reversible inhibition. The product structure is constructed via three macrocyclizations catalyzed sequentially by two members of the ATP-grasp family, a unique strategy for ribosomal peptide macrocyclization. Here we describe in detail the structural basis for the enzyme-catalyzed macrocyclizations in the microviridin J pathway of Microcystis aeruginosa. The macrocyclases MdnC and MdnB interact with a conserved α-helix of the precursor peptide using a novel precursor-peptide recognition mechanism. The results provide insight into the unique protein-protein interactions that are key to the chemistry, suggest an origin for the natural combinatorial synthesis of microviridin peptides, and provide a framework for future engineering efforts to generate designed compounds.

  2. ITSoneDB: a comprehensive collection of eukaryotic ribosomal RNA Internal Transcribed Spacer 1 (ITS1) sequences.

    Science.gov (United States)

    Santamaria, Monica; Fosso, Bruno; Licciulli, Flavio; Balech, Bachir; Larini, Ilaria; Grillo, Giorgio; De Caro, Giorgio; Liuni, Sabino; Pesole, Graziano

    2018-01-04

    A holistic understanding of environmental communities is the new challenge of metagenomics. Accordingly, the amplicon-based or metabarcoding approach, largely applied to investigate bacterial microbiomes, is moving to the eukaryotic world too. Indeed, the analysis of metabarcoding data may provide a comprehensive assessment of both bacterial and eukaryotic composition in a variety of environments, including human body. In this respect, whereas hypervariable regions of the 16S rRNA are the de facto standard barcode for bacteria, the Internal Transcribed Spacer 1 (ITS1) of ribosomal RNA gene cluster has shown a high potential in discriminating eukaryotes at deep taxonomic levels. As metabarcoding data analysis rely on the availability of a well-curated barcode reference resource, a comprehensive collection of ITS1 sequences supplied with robust taxonomies, is highly needed. To address this issue, we created ITSoneDB (available at http://itsonedb.cloud.ba.infn.it/) which in its current version hosts 985 240 ITS1 sequences spanning over 134 000 eukaryotic species. Each ITS1 is mapped on the NCBI reference taxonomy with its start and end positions precisely annotated. ITSoneDB has been developed in agreement to the FAIR guidelines by enabling the users to query and download its content through a simple web-interface and access relevant metadata by cross-linking to European Nucleotide Archive. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  3. The primary structure of rat liver ribosomal protein L37. Homology with yeast and bacterial ribosomal proteins.

    Science.gov (United States)

    Lin, A; McNally, J; Wool, I G

    1983-09-10

    The covalent structure of the rat liver 60 S ribosomal subunit protein L37 was determined. Twenty-four tryptic peptides were purified and the sequence of each was established; they accounted for all 111 residues of L37. The sequence of the first 30 residues of L37, obtained previously by automated Edman degradation of the intact protein, provided the alignment of the first 9 tryptic peptides. Three peptides (CN1, CN2, and CN3) were produced by cleavage of protein L37 with cyanogen bromide. The sequence of CN1 (65 residues) was established from the sequence of secondary peptides resulting from cleavage with trypsin and chymotrypsin. The sequence of CN1 in turn served to order tryptic peptides 1 through 14. The sequence of CN2 (15 residues) was determined entirely by a micromanual procedure and allowed the alignment of tryptic peptides 14 through 18. The sequence of the NH2-terminal 28 amino acids of CN3 (31 residues) was determined; in addition the complete sequences of the secondary tryptic and chymotryptic peptides were done. The sequence of CN3 provided the order of tryptic peptides 18 through 24. Thus the sequence of the three cyanogen bromide peptides also accounted for the 111 residues of protein L37. The carboxyl-terminal amino acids were identified after carboxypeptidase A treatment. There is a disulfide bridge between half-cystinyl residues at positions 40 and 69. Rat liver ribosomal protein L37 is homologous with yeast YP55 and with Escherichia coli L34. Moreover, there is a segment of 17 residues in rat L37 that occurs, albeit with modifications, in yeast YP55 and in E. coli S4, L20, and L34.

  4. The complete structure of the large subunit of the mammalian mitochondrial ribosome.

    Science.gov (United States)

    Greber, Basil J; Boehringer, Daniel; Leibundgut, Marc; Bieri, Philipp; Leitner, Alexander; Schmitz, Nikolaus; Aebersold, Ruedi; Ban, Nenad

    2014-11-13

    Mitochondrial ribosomes (mitoribosomes) are extensively modified ribosomes of bacterial descent specialized for the synthesis and insertion of membrane proteins that are critical for energy conversion and ATP production inside mitochondria. Mammalian mitoribosomes, which comprise 39S and 28S subunits, have diverged markedly from the bacterial ribosomes from which they are derived, rendering them unique compared to bacterial, eukaryotic cytosolic and fungal mitochondrial ribosomes. We have previously determined at 4.9 Å resolution the architecture of the porcine (Sus scrofa) 39S subunit, which is highly homologous to the human mitoribosomal large subunit. Here we present the complete atomic structure of the porcine 39S large mitoribosomal subunit determined in the context of a stalled translating mitoribosome at 3.4 Å resolution by cryo-electron microscopy and chemical crosslinking/mass spectrometry. The structure reveals the locations and the detailed folds of 50 mitoribosomal proteins, shows the highly conserved mitoribosomal peptidyl transferase active site in complex with its substrate transfer RNAs, and defines the path of the nascent chain in mammalian mitoribosomes along their idiosyncratic exit tunnel. Furthermore, we present evidence that a mitochondrial tRNA has become an integral component of the central protuberance of the 39S subunit where it architecturally substitutes for the absence of the 5S ribosomal RNA, a ubiquitous component of all cytoplasmic ribosomes.

  5. Organization of proteins in mammalian mitochondrial ribosomes: accessibility to lactoperoxidase-catalyzed radioiodination

    International Nuclear Information System (INIS)

    Denslow, N.D.; O'Brien, T.W.

    1984-01-01

    To assess the relative exposure of individual ribosomal proteins (r-proteins) in the large and small subunits of the bovine mitochondrial ribosome, double label iodination technique was used. Regions of r-proteins exposed in purified ribosomal subunits were labeled with 131 I using the lactoperoxidase-catalyzed iodination system, and additional reactive groups available upon denaturing the r-proteins in urea were labeled with 125 I using the chloramine-T mediated reaction. The ratio of 131 I to 125 I incorporated into individual proteins under these conditions is representative of the degree of exposure for each of the proteins in the subunits. In this manner, the r-proteins have been grouped into 3 classes depending on their degree of exposure: high exposure, intermediate exposure, and essentially buried. While both subunits have a few proteins in the highly exposed group, and a large number of proteins in the intermediate exposure group, only the large ribosomal subunit has an appreciable number of proteins which appear essentially buried. The more buried proteins may serve mainly structural roles, perhaps acting as assembly proteins, since many from this group bind to ribosomal RNA. The more superficially disposed proteins may comprise binding sites for macromolecules that interact with ribosomes during protein synthesis, as well as stabilizing the association of the large and small subribosomal particles

  6. Molecular dynamics simulation of ribosome jam

    KAUST Repository

    Matsumoto, Shigenori; Takagi, Fumiko; Shimada, Takashi; Ito, Nobuyasu

    2011-01-01

    We propose a coarse-grained molecular dynamics model of ribosome molecules to study the dependence of translation process on environmental parameters. We found the model exhibits traffic jam property, which is consistent with an ASEP model. We

  7. Affinity labelling in situ of the bL12 protein on E. coli 70S ribosomes by means of a tRNA dialdehyde derivative.

    Science.gov (United States)

    Hountondji, Codjo; Créchet, Jean-Bernard; Le Caër, Jean-Pierre; Lancelot, Véronique; Cognet, Jean A H; Baouz, Soria

    2017-12-01

    In this report, we have used periodate-oxidized tRNA (tRNAox) as an affinity laleling reagent to demonstrate that: (i) the bL12 protein contacts the CCA-arm of P-site bound tRNA on the Escherichia coli 70S ribosomes; (ii) the stoichiometry of labelling is one molecule of tRNAox bound to one polypeptide chain of endogenous bL12; (iii) cross-linking in situ of bL12 with tRNAox on the ribosomes provokes the loss of activity; (iv) intact tRNA protects bL12 in the 70S ribosomes against cross-linking with tRNAox; (v) both tRNAox and pyridoxal 5'-phosphate (PLP) compete for the same or for proximal cross-linking site(s) on bL12 inside the ribosome; (vi) the stoichiometry of cross-linking of PLP to the recombinant E. coli bL12 protein is one molecule of PLP covalently bound per polypeptide chain; (vii) the amino acid residue of recombinant bL12 cross-linked with PLP is Lys-65; (viii) Lys-65 of E. coli bL12 corresponds to Lys-53 of eL42 which was previously shown to cross-link with P-site bound tRNAox on human 80S ribosomes in situ; (ix) finally, E. coli bL12 and human eL42 proteins display significant primary structure similarities, which argues for evolutionary conservation of these two proteins located at the tRNA-CCA binding site on eubacterial and eukaryal ribosomes. © The Authors 2017. Published by Oxford University Press on behalf of the Japanese Biochemical Society. All rights reserved.

  8. Inverse agonism at the P2Y12 receptor and ENT1 transporter blockade contribute to platelet inhibition by ticagrelor.

    Science.gov (United States)

    Aungraheeta, Riyaad; Conibear, Alexandra; Butler, Mark; Kelly, Eamonn; Nylander, Sven; Mumford, Andrew; Mundell, Stuart J

    2016-12-08

    Ticagrelor is a potent antagonist of the P2Y 12 receptor (P2Y 12 R) and consequently an inhibitor of platelet activity effective in the treatment of atherothrombosis. Here, we sought to further characterize its molecular mechanism of action. Initial studies showed that ticagrelor promoted a greater inhibition of adenosine 5'-diphosphate (ADP)-induced Ca 2+ release in washed platelets vs other P2Y 12 R antagonists. This additional effect of ticagrelor beyond P2Y 12 R antagonism was in part as a consequence of ticagrelor inhibiting the equilibrative nucleoside transporter 1 (ENT1) on platelets, leading to accumulation of extracellular adenosine and activation of G s -coupled adenosine A 2A receptors. This contributed to an increase in basal cyclic adenosine monophosphate (cAMP) and vasodilator-stimulated phosphoprotein phosphorylation (VASP-P). In addition, ticagrelor increased platelet cAMP and VASP-P in the absence of ADP in an adenosine receptor-independent manner. We hypothesized that this increase originated from a direct effect on basal agonist-independent P2Y 12 R signaling, and this was validated in 1321N1 cells stably transfected with human P2Y 12 R. In these cells, ticagrelor blocked the constitutive agonist-independent activity of the P2Y 12 R, limiting basal G i -coupled signaling and thereby increasing cAMP levels. These data suggest that ticagrelor has the pharmacological profile of an inverse agonist. Based on our results showing insurmountable inhibition of ADP-induced Ca 2+ release and forskolin-induced cAMP, the mode of antagonism of ticagrelor also appears noncompetitive, at least functionally. In summary, our studies describe 2 novel modes of action of ticagrelor, inhibition of platelet ENT1 and inverse agonism at the P2Y 12 R that contribute to its effective inhibition of platelet activation. © 2016 by The American Society of Hematology.

  9. Mutations in ribosomal protein L3 and 23S ribosomal RNA at the peptidyl transferase centre are associated with reduced susceptibility to tiamulin in Brachyspira spp. isolates.

    Science.gov (United States)

    Pringle, Märit; Poehlsgaard, Jacob; Vester, Birte; Long, Katherine S

    2004-12-01

    The pleuromutilin antibiotic tiamulin binds to the ribosomal peptidyl transferase centre. Three groups of Brachyspira spp. isolates with reduced tiamulin susceptibility were analysed to define resistance mechanisms to the drug. Mutations were identified in genes encoding ribosomal protein L3 and 23S rRNA at positions proximal to the peptidyl transferase centre. In two groups of laboratory-selected mutants, mutations were found at nucleotide positions 2032, 2055, 2447, 2499, 2504 and 2572 of 23S rRNA (Escherichia coli numbering) and at amino acid positions 148 and 149 of ribosomal protein L3 (Brachyspira pilosicoli numbering). In a third group of clinical B. hyodysenteriae isolates, only a single mutation at amino acid 148 of ribosomal protein L3 was detected. Chemical footprinting experiments show a reduced binding of tiamulin to ribosomal subunits from mutants with decreased susceptibility to the drug. This reduction in drug binding is likely the resistance mechanism for these strains. Hence, the identified mutations located near the tiamulin binding site are predicted to be responsible for the resistance phenotype. The positions of the mutated residues relative to the bound drug advocate a model where the mutations affect tiamulin binding indirectly through perturbation of nucleotide U2504.

  10. Alterations at the peptidyl transferase centre of the ribosome induced by the synergistic action of the streptogramins dalfopristin and quinupristin

    Directory of Open Access Journals (Sweden)

    Fucini Paola

    2004-04-01

    Full Text Available Abstract Background The bacterial ribosome is a primary target of several classes of antibiotics. Investigation of the structure of the ribosomal subunits in complex with different antibiotics can reveal the mode of inhibition of ribosomal protein synthesis. Analysis of the interactions between antibiotics and the ribosome permits investigation of the specific effect of modifications leading to antimicrobial resistances. Streptogramins are unique among the ribosome-targeting antibiotics because they consist of two components, streptogramins A and B, which act synergistically. Each compound alone exhibits a weak bacteriostatic activity, whereas the combination can act bactericidal. The streptogramins A display a prolonged activity that even persists after removal of the drug. However, the mode of activity of the streptogramins has not yet been fully elucidated, despite a plethora of biochemical and structural data. Results The investigation of the crystal structure of the 50S ribosomal subunit from Deinococcus radiodurans in complex with the clinically relevant streptogramins quinupristin and dalfopristin reveals their unique inhibitory mechanism. Quinupristin, a streptogramin B compound, binds in the ribosomal exit tunnel in a similar manner and position as the macrolides, suggesting a similar inhibitory mechanism, namely blockage of the ribosomal tunnel. Dalfopristin, the corresponding streptogramin A compound, binds close to quinupristin directly within the peptidyl transferase centre affecting both A- and P-site occupation by tRNA molecules. Conclusions The crystal structure indicates that the synergistic effect derives from direct interaction between both compounds and shared contacts with a single nucleotide, A2062. Upon binding of the streptogramins, the peptidyl transferase centre undergoes a significant conformational transition, which leads to a stable, non-productive orientation of the universally conserved U2585. Mutations of this r

  11. Ribosome Profiling Reveals Pervasive Translation Outside of Annotated Protein-Coding Genes

    Directory of Open Access Journals (Sweden)

    Nicholas T. Ingolia

    2014-09-01

    Full Text Available Ribosome profiling suggests that ribosomes occupy many regions of the transcriptome thought to be noncoding, including 5′ UTRs and long noncoding RNAs (lncRNAs. Apparent ribosome footprints outside of protein-coding regions raise the possibility of artifacts unrelated to translation, particularly when they occupy multiple, overlapping open reading frames (ORFs. Here, we show hallmarks of translation in these footprints: copurification with the large ribosomal subunit, response to drugs targeting elongation, trinucleotide periodicity, and initiation at early AUGs. We develop a metric for distinguishing between 80S footprints and nonribosomal sources using footprint size distributions, which validates the vast majority of footprints outside of coding regions. We present evidence for polypeptide production beyond annotated genes, including the induction of immune responses following human cytomegalovirus (HCMV infection. Translation is pervasive on cytosolic transcripts outside of conserved reading frames, and direct detection of this expanded universe of translated products enables efforts at understanding how cells manage and exploit its consequences.

  12. Ribosome slowed by mutation to streptomycin resistance. [Escherichia coli

    Energy Technology Data Exchange (ETDEWEB)

    Galas, D J; Branscomb, E W

    1976-08-12

    The effect of mutation to streptomycin resistance on the speed of polypeptide elongation in Escherichia coli was investigated. Translation speed was determined by measuring the time required for the first newly synthesized ..beta..-galactosidase molecules to appear after induction of the lactose operon. The results showed that ribosome speed is not a fixed parameter inherent to the protein synthetic apparatus, but a variable determined by the kinetics of translation and ultimately by the structure of the ribosome. (HLW)

  13. ABC-F Proteins Mediate Antibiotic Resistance through Ribosomal Protection.

    Science.gov (United States)

    Sharkey, Liam K R; Edwards, Thomas A; O'Neill, Alex J

    2016-03-22

    Members of the ABC-F subfamily of ATP-binding cassette proteins mediate resistance to a broad array of clinically important antibiotic classes that target the ribosome of Gram-positive pathogens. The mechanism by which these proteins act has been a subject of long-standing controversy, with two competing hypotheses each having gained considerable support: antibiotic efflux versus ribosomal protection. Here, we report on studies employing a combination of bacteriological and biochemical techniques to unravel the mechanism of resistance of these proteins, and provide several lines of evidence that together offer clear support to the ribosomal protection hypothesis. Of particular note, we show that addition of purified ABC-F proteins to anin vitrotranslation assay prompts dose-dependent rescue of translation, and demonstrate that such proteins are capable of displacing antibiotic from the ribosomein vitro To our knowledge, these experiments constitute the first direct evidence that ABC-F proteins mediate antibiotic resistance through ribosomal protection.IMPORTANCEAntimicrobial resistance ranks among the greatest threats currently facing human health. Elucidation of the mechanisms by which microorganisms resist the effect of antibiotics is central to understanding the biology of this phenomenon and has the potential to inform the development of new drugs capable of blocking or circumventing resistance. Members of the ABC-F family, which includelsa(A),msr(A),optr(A), andvga(A), collectively yield resistance to a broader range of clinically significant antibiotic classes than any other family of resistance determinants, although their mechanism of action has been controversial since their discovery 25 years ago. Here we present the first direct evidence that proteins of the ABC-F family act to protect the bacterial ribosome from antibiotic-mediated inhibition. Copyright © 2016 Sharkey et al.

  14. Fluctuations in protein synthesis from a single RNA template: stochastic kinetics of ribosomes.

    Science.gov (United States)

    Garai, Ashok; Chowdhury, Debashish; Ramakrishnan, T V

    2009-01-01

    Proteins are polymerized by cyclic machines called ribosomes, which use their messenger RNA (mRNA) track also as the corresponding template, and the process is called translation. We explore, in depth and detail, the stochastic nature of the translation. We compute various distributions associated with the translation process; one of them--namely, the dwell time distribution--has been measured in recent single-ribosome experiments. The form of the distribution, which fits best with our simulation data, is consistent with that extracted from the experimental data. For our computations, we use a model that captures both the mechanochemistry of each individual ribosome and their steric interactions. We also demonstrate the effects of the sequence inhomogeneities of real genes on the fluctuations and noise in translation. Finally, inspired by recent advances in the experimental techniques of manipulating single ribosomes, we make theoretical predictions on the force-velocity relation for individual ribosomes. In principle, all our predictions can be tested by carrying out in vitro experiments.

  15. Amino acid sequences of ribosomal proteins S11 from Bacillus stearothermophilus and S19 from Halobacterium marismortui. Comparison of the ribosomal protein S11 family.

    Science.gov (United States)

    Kimura, M; Kimura, J; Hatakeyama, T

    1988-11-21

    The complete amino acid sequences of ribosomal proteins S11 from the Gram-positive eubacterium Bacillus stearothermophilus and of S19 from the archaebacterium Halobacterium marismortui have been determined. A search for homologous sequences of these proteins revealed that they belong to the ribosomal protein S11 family. Homologous proteins have previously been sequenced from Escherichia coli as well as from chloroplast, yeast and mammalian ribosomes. A pairwise comparison of the amino acid sequences showed that Bacillus protein S11 shares 68% identical residues with S11 from Escherichia coli and a slightly lower homology (52%) with the homologous chloroplast protein. The halophilic protein S19 is more related to the eukaryotic (45-49%) than to the eubacterial counterparts (35%).

  16. Rmt1 catalyzes zinc-finger independent arginine methylation of ribosomal protein Rps2 in Saccharomyces cerevisiae

    International Nuclear Information System (INIS)

    Lipson, Rebecca S.; Webb, Kristofor J.; Clarke, Steven G.

    2010-01-01

    Rps2/rpS2 is a well conserved protein of the eukaryotic ribosomal small subunit. Rps2 has previously been shown to contain asymmetric dimethylarginine residues, the addition of which is catalyzed by zinc-finger-containing arginine methyltransferase 3 (Rmt3) in the fission yeast Schizosaccharomyces pombe and protein arginine methyltransferase 3 (PRMT3) in mammalian cells. Here, we demonstrate that despite the lack of a zinc-finger-containing homolog of Rmt3/PRMT3 in the budding yeast Saccharomyces cerevisiae, Rps2 is partially modified to generate asymmetric dimethylarginine and monomethylarginine residues. We find that this modification of Rps2 is dependent upon the major arginine methyltransferase 1 (Rmt1) in S. cerevisiae. These results are suggestive of a role for Rmt1 in modifying the function of Rps2 in a manner distinct from that occurring in S. pombe and mammalian cells.

  17. Protein folding on the ribosome studied using NMR spectroscopy

    Science.gov (United States)

    Waudby, Christopher A.; Launay, Hélène; Cabrita, Lisa D.; Christodoulou, John

    2013-01-01

    NMR spectroscopy is a powerful tool for the investigation of protein folding and misfolding, providing a characterization of molecular structure, dynamics and exchange processes, across a very wide range of timescales and with near atomic resolution. In recent years NMR methods have also been developed to study protein folding as it might occur within the cell, in a de novo manner, by observing the folding of nascent polypeptides in the process of emerging from the ribosome during synthesis. Despite the 2.3 MDa molecular weight of the bacterial 70S ribosome, many nascent polypeptides, and some ribosomal proteins, have sufficient local flexibility that sharp resonances may be observed in solution-state NMR spectra. In providing information on dynamic regions of the structure, NMR spectroscopy is therefore highly complementary to alternative methods such as X-ray crystallography and cryo-electron microscopy, which have successfully characterized the rigid core of the ribosome particle. However, the low working concentrations and limited sample stability associated with ribosome–nascent chain complexes means that such studies still present significant technical challenges to the NMR spectroscopist. This review will discuss the progress that has been made in this area, surveying all NMR studies that have been published to date, and with a particular focus on strategies for improving experimental sensitivity. PMID:24083462

  18. Influence of the dietary protein deficiency on the activities of ribosomes and polysome patterns in muscle and liver of rats

    International Nuclear Information System (INIS)

    Goto, Akihiko; Kametaka, Masao

    1975-01-01

    A group of rats weighing about 120 g were killed at the beginning of the experiment and after 10 days on the 20% casein diet (C-0 and C-10 groups), and another group of rats were killed after 1,2 and 10 days on the protein-free diet (PF-1, PF-2 and PF-10 groups). From muscle and the liver of each group ribosomes were prepared, and the protein synthesis activity and the polysome patterns were investigated. The activity of polysome fractionated into each size was also measured. Muscle ribosome activity in PF-1, PF-2 and PF-10 groups decreased to about 60%, 40% and 40% of that in C groups, respectively, and this decrease was due to a fall in activity of prolysome itself rather than disaggregation of polysome. Liver ribosome activity in PF-1, PF-2 and PF-10 groups were reduced to about 95%, 90% and 65% of that in C groups, respectively. These alterations in PF-1 and PF-2 groups seemed to be in part related to changes in polysome pattern, whereas ribosome activity in PF-10 group was reduced without changes in polysome pattern. (auth.)

  19. Nuclear ribosomal internal transcribed spacer 1 (ITS1) variation in the Anastrepha fraterculus cryptic species complex (Diptera, Tephritidae) of the Andean region

    Science.gov (United States)

    Sutton, Bruce D.; Steck, Gary J.; Norrbom, Allen L.; Rodriguez, Erick J.; Srivastava, Pratibha; Alvarado, Norma Nolazco; Colque, Fredy; Landa, Erick Yábar; Sánchez, Juan José Lagrava; Quisberth, Elizabeth; Peñaranda, Emilio Arévalo; Clavijo, P. A. Rodriguez; Alvarez-Baca, Jeniffer K.; Zapata, Tito Guevara; Ponce, Patricio

    2015-01-01

    Abstract The nuclear ribosomal internal transcribed spacer 1 (ITS1) was sequenced for Anastrepha fraterculus (Wiedemann, 1830) originating from 85 collections from the northern and central Andean countries of South America including Argentina (Tucumán), Bolivia, Perú, Ecuador, Colombia, and Venezuela. The ITS1 regions of additional specimens (17 collections) from Central America (México, Guatemala, Costa Rica, and Panamá), Brazil, Caribbean Colombia, and coastal Venezuela were sequenced and together with published sequences (Paraguay) provided context for interpretation. A total of six ITS1 sequence variants were recognized in the Andean region comprising four groups. Type I predominates in the southernmost range of Anastrepha fraterculus. Type II predominates in its northernmost range. In the central and northern Andes, the geographic distributions overlap and interdigitate with a strong elevational effect. A discussion of relationships between observed ITS1 types and morphometric types is included. PMID:26798259

  20. sORFs.org: a repository of small ORFs identified by ribosome profiling.

    Science.gov (United States)

    Olexiouk, Volodimir; Crappé, Jeroen; Verbruggen, Steven; Verhegen, Kenneth; Martens, Lennart; Menschaert, Gerben

    2016-01-04

    With the advent of ribosome profiling, a next generation sequencing technique providing a "snap-shot'' of translated mRNA in a cell, many short open reading frames (sORFs) with ribosomal activity were identified. Follow-up studies revealed the existence of functional peptides, so-called micropeptides, translated from these 'sORFs', indicating a new class of bio-active peptides. Over the last few years, several micropeptides exhibiting important cellular functions were discovered. However, ribosome occupancy does not necessarily imply an actual function of the translated peptide, leading to the development of various tools assessing the coding potential of sORFs. Here, we introduce sORFs.org (http://www.sorfs.org), a novel database for sORFs identified using ribosome profiling. Starting from ribosome profiling, sORFs.org identifies sORFs, incorporates state-of-the-art tools and metrics and stores results in a public database. Two query interfaces are provided, a default one enabling quick lookup of sORFs and a BioMart interface providing advanced query and export possibilities. At present, sORFs.org harbors 263 354 sORFs that demonstrate ribosome occupancy, originating from three different cell lines: HCT116 (human), E14_mESC (mouse) and S2 (fruit fly). sORFs.org aims to provide an extensive sORFs database accessible to researchers with limited bioinformatics knowledge, thus enabling easy integration into personal projects. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  1. Nucleolar TRF2 attenuated nucleolus stress-induced HCC cell-cycle arrest by altering rRNA synthesis.

    Science.gov (United States)

    Yuan, Fuwen; Xu, Chenzhong; Li, Guodong; Tong, Tanjun

    2018-05-03

    The nucleolus is an important organelle that is responsible for the biogenesis of ribosome RNA (rRNA) and ribosomal subunits assembly. It is also deemed to be the center of metabolic control, considering the critical role of ribosomes in protein translation. Perturbations of rRNA synthesis are closely related to cell proliferation and tumor progression. Telomeric repeat-binding factor 2 (TRF2) is a member of shelterin complex that is responsible for telomere DNA protection. Interestingly, it was recently reported to localize in the nucleolus of human cells in a cell-cycle-dependent manner, while the underlying mechanism and its role on the nucleolus remained unclear. In this study, we found that nucleolar and coiled-body phosphoprotein 1 (NOLC1), a nucleolar protein that is responsible for the nucleolus construction and rRNA synthesis, interacted with TRF2 and mediated the shuttle of TRF2 between the nucleolus and nucleus. Abating the expression of NOLC1 decreased the nucleolar-resident TRF2. Besides, the nucleolar TRF2 could bind rDNA and promoted rRNA transcription. Furthermore, in hepatocellular carcinoma (HCC) cell lines HepG2 and SMMC7721, TRF2 overexpression participated in the nucleolus stress-induced rRNA inhibition and cell-cycle arrest.

  2. 5SRNAdb: an information resource for 5S ribosomal RNAs.

    Science.gov (United States)

    Szymanski, Maciej; Zielezinski, Andrzej; Barciszewski, Jan; Erdmann, Volker A; Karlowski, Wojciech M

    2016-01-04

    Ribosomal 5S RNA (5S rRNA) is the ubiquitous RNA component found in the large subunit of ribosomes in all known organisms. Due to its small size, abundance and evolutionary conservation 5S rRNA for many years now is used as a model molecule in studies on RNA structure, RNA-protein interactions and molecular phylogeny. 5SRNAdb (http://combio.pl/5srnadb/) is the first database that provides a high quality reference set of ribosomal 5S RNAs (5S rRNA) across three domains of life. Here, we give an overview of new developments in the database and associated web tools since 2002, including updates to database content, curation processes and user web interfaces. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  3. The Arabidopsis TOR Kinase Specifically Regulates the Expression of Nuclear Genes Coding for Plastidic Ribosomal Proteins and the Phosphorylation of the Cytosolic Ribosomal Protein S6.

    Science.gov (United States)

    Dobrenel, Thomas; Mancera-Martínez, Eder; Forzani, Céline; Azzopardi, Marianne; Davanture, Marlène; Moreau, Manon; Schepetilnikov, Mikhail; Chicher, Johana; Langella, Olivier; Zivy, Michel; Robaglia, Christophe; Ryabova, Lyubov A; Hanson, Johannes; Meyer, Christian

    2016-01-01

    Protein translation is an energy consuming process that has to be fine-tuned at both the cell and organism levels to match the availability of resources. The target of rapamycin kinase (TOR) is a key regulator of a large range of biological processes in response to environmental cues. In this study, we have investigated the effects of TOR inactivation on the expression and regulation of Arabidopsis ribosomal proteins at different levels of analysis, namely from transcriptomic to phosphoproteomic. TOR inactivation resulted in a coordinated down-regulation of the transcription and translation of nuclear-encoded mRNAs coding for plastidic ribosomal proteins, which could explain the chlorotic phenotype of the TOR silenced plants. We have identified in the 5' untranslated regions (UTRs) of this set of genes a conserved sequence related to the 5' terminal oligopyrimidine motif, which is known to confer translational regulation by the TOR kinase in other eukaryotes. Furthermore, the phosphoproteomic analysis of the ribosomal fraction following TOR inactivation revealed a lower phosphorylation of the conserved Ser240 residue in the C-terminal region of the 40S ribosomal protein S6 (RPS6). These results were confirmed by Western blot analysis using an antibody that specifically recognizes phosphorylated Ser240 in RPS6. Finally, this antibody was used to follow TOR activity in plants. Our results thus uncover a multi-level regulation of plant ribosomal genes and proteins by the TOR kinase.

  4. Simultaneous Binding of Multiple EF-Tu Copies to Translating Ribosomes in Live Escherichia coli.

    Science.gov (United States)

    Mustafi, Mainak; Weisshaar, James C

    2018-01-16

    In bacteria, elongation factor Tu is a translational cofactor that forms ternary complexes with aminoacyl-tRNA (aa-tRNA) and GTP. Binding of a ternary complex to one of four flexible L7/L12 units on the ribosome tethers a charged tRNA in close proximity to the ribosomal A site. Two sequential tests for a match between the aa-tRNA anticodon and the current mRNA codon then follow. Because one elongation cycle can occur in as little as 50 ms and the vast majority of aa-tRNA copies are not cognate with the current mRNA codon, this testing must occur rapidly. We present a single-molecule localization and tracking study of fluorescently labeled EF-Tu in live Escherichia coli Imaging at 2 ms/frame distinguishes 60% slowly diffusing EF-Tu copies (assigned as transiently bound to translating ribosome) from 40% rapidly diffusing copies (assigned as a mixture of free ternary complexes and free EF-Tu). Combining these percentages with copy number estimates, we infer that the four L7/L12 sites are essentially saturated with ternary complexes in vivo. The results corroborate an earlier inference that all four sites can simultaneously tether ternary complexes near the A site, creating a high local concentration that may greatly enhance the rate of testing of aa-tRNAs. Our data and a combinatorial argument both suggest that the initial recognition test for a codon-anticodon match occurs in less than 1 to 2 ms per aa-tRNA copy. The results refute a recent study (A. Plochowietz, I. Farrell, Z. Smilansky, B. S. Cooperman, and A. N. Kapanidis, Nucleic Acids Res 45:926-937, 2016, https://doi.org/10.1093/nar/gkw787) of tRNA diffusion in E. coli that inferred that aa-tRNAs arrive at the ribosomal A site as bare monomers, not as ternary complexes. IMPORTANCE Ribosomes catalyze translation of the mRNA codon sequence into the corresponding sequence of amino acids within the nascent polypeptide chain. Polypeptide elongation can be as fast as 50 ms per added amino acid. Each amino acid

  5. Translation activity of chimeric ribosomes composed of Escherichia coli and Bacillus subtilis or Geobacillus stearothermophilus subunits

    Directory of Open Access Journals (Sweden)

    Sayaka Tsuji

    2017-07-01

    Full Text Available Ribosome composition, consisting of rRNA and ribosomal proteins, is highly conserved among a broad range of organisms. However, biochemical studies focusing on ribosomal subunit exchangeability between organisms remain limited. In this study, we show that chimeric ribosomes, composed of Escherichia coli and Bacillus subtilis or E. coli and Geobacillus stearothermophilus subunits, are active for β-galactosidase translation in a highly purified E. coli translation system. Activities of the chimeric ribosomes showed only a modest decrease when using E. coli 30 S subunits, indicating functional conservation of the 50 S subunit between these bacterial species.

  6. Evidence that the primary effect of phosphorylation of eukaryotic initiation factor 2(alpha) in rabbit reticulocyte lysate is inhibition of the release of eukaryotic initiation factor-2.GDP from 60 S ribosomal subunits

    International Nuclear Information System (INIS)

    Gross, M.; Redman, R.; Kaplansky, D.A.

    1985-01-01

    The phosphorylation of eukaryotic initiation factor (eIF) 2 alpha that occurs when rabbit reticulocyte lysate is incubated in the absence of hemin or with poly(I.C) causes inhibition of polypeptide chain initiation by preventing a separate factor (termed RF) from promoting the exchange of GTP for GDP on eIF-2. When lysate was incubated in the presence of hemin and [ 14 C] eIF-2 or [alpha- 32 P]GTP, the authors observed binding of eIF-2 and GDP or GTP to 60 S ribosomal subunits that was slightly greater than that bound to 40 S subunits and little binding to 80 S ribosomes. When incubation was in the absence of hemin or in the presence of hemin plus 0.1 microgram/ml poly(I.C), eIF-2 and GDP binding to 60 S subunits was increased 1.5- to 2-fold, that bound to 80 S ribosomes was almost as great as that bound to 60 S subunits, and that bound to 40 S subunits was unchanged. The data indicate that about 40% of the eIF-2 that becomes bound to 60 S subunits and 80 S ribosomes in the absence of hemin or with poly(I.C) is eIF-2(alpha-P) and suggest that the eIF-2 and GDP bound is probably in the form of a binary complex. The rate of turnover of GDP (presumably eIF-2.GDP) on 60 S subunits and 80 S ribosomes in the absence of hemin is reduced to less than 10% the control rate, because the dissociation of eIF-2.GDP is inhibited. Our findings suggest that eIF-2.GTP binding to and eIF-2.GDP release from 60 S subunits may normally occur and serve to promote subunit joining

  7. Human nucleolus organizers on nonhomologous chromosomes can share the same ribosomal gene variants.

    Science.gov (United States)

    Krystal, M; D'Eustachio, P; Ruddle, F H; Arnheim, N

    1981-01-01

    The distributions of three human ribosomal gene polymorphisms among individual chromosomes containing nucleolus organizers were analyzed by using mouse--human hybrid cells. Different nucleolus organizers can contain the same variant, suggesting the occurrence of genetic exchanges among ribosomal gene clusters on nonhomologous chromosomes. Such exchanges appear to occur less frequently in mice. This difference is discussed in terms of the nucleolar organization and chromosomal location of ribosomal gene clusters in humans and mice. Images PMID:6272316

  8. Multi-perspective smFRET reveals rate-determining late intermediates of ribosomal translocation

    Science.gov (United States)

    Wasserman, Michael R.; Alejo, Jose L.; Altman, Roger B.; Blanchard, Scott C.

    2016-01-01

    Directional translocation of the ribosome through the messenger RNA open reading frame is a critical determinant of translational fidelity. This process entails a complex interplay of large-scale conformational changes within the actively translating particle, which together coordinate the movement of transfer and messenger RNA substrates with respect to the large and small ribosomal subunits. Using pre-steady state, single-molecule fluorescence resonance energy transfer imaging, we have tracked the nature and timing of these conformational events within the Escherichia coli ribosome from five structural perspectives. Our investigations reveal direct evidence of structurally and kinetically distinct, late intermediates during substrate movement, whose resolution is rate-determining to the translocation mechanism. These steps involve intra-molecular events within the EFG(GDP)-bound ribosome, including exaggerated, reversible fluctuations of the small subunit head domain, which ultimately facilitate peptidyl-tRNA’s movement into its final post-translocation position. PMID:26926435

  9. Site-specific fluorescent labeling of nascent proteins on the translating ribosome.

    Science.gov (United States)

    Saraogi, Ishu; Zhang, Dawei; Chandrasekaran, Sandhya; Shan, Shu-ou

    2011-09-28

    As newly synthesized proteins emerge from the ribosome, they interact with a variety of cotranslational cellular machineries that facilitate their proper folding, maturation, and localization. These interactions are essential for proper function of the cell, and the ability to study these events is crucial to understanding cellular protein biogenesis. To this end, we have developed a highly efficient method to generate ribosome-nascent chain complexes (RNCs) site-specifically labeled with a fluorescent dye on the nascent polypeptide. The fluorescent RNC provides real-time, quantitative information on its cotranslational interaction with the signal recognition particle and will be a valuable tool in elucidating the role of the translating ribosome in numerous biochemical pathways.

  10. Specific phosphopeptide binding regulates a conformational change in the PI 3-kinase SH2 domain associated with enzyme activation.

    Science.gov (United States)

    Shoelson, S E; Sivaraja, M; Williams, K P; Hu, P; Schlessinger, J; Weiss, M A

    1993-01-01

    SH2 (src-homology 2) domains define a newly recognized binding motif that mediates the physical association of target phosphotyrosyl proteins with downstream effector enzymes. An example of such phosphoprotein-effector coupling is provided by the association of phosphatidylinositol 3-kinase (PI 3-kinase) with specific phosphorylation sites within the PDGF receptor, the c-Src/polyoma virus middle T antigen complex and the insulin receptor substrate IRS-1. Notably, phosphoprotein association with the SH2 domains of p85 also stimulates an increase in catalytic activity of the PI 3-kinase p110 subunit, which can be mimicked by phosphopeptides corresponding to targeted phosphoprotein phosphorylation sites. To investigate how phosphoprotein binding to the p85 SH2 domain stimulates p110 catalytic activation, we have examined the differential effects of phosphotyrosine and PDGF receptor-, IRS-1- and c-Src-derived phosphopeptides on the conformation of an isolated SH2 domain of PI 3-kinase. Although phosphotyrosine and both activating and non-activating phosphopeptides bind to the SH2 domain, activating phosphopeptides bind with higher affinity and induce a qualitatively distinct conformational change as monitored by CD and NMR spectroscopy. Amide proton exchange and protease protection assays further show that high affinity, specific phosphopeptide binding induces non-local dynamic SH2 domain stabilization. Based on these findings we propose that specific phosphoprotein binding to the p85 subunit induces a change in SH2 domain structure which is transmitted to the p110 subunit and regulates enzymatic activity by an allosteric mechanism. Images PMID:8382612

  11. Thermus Thermophilus as a Model System for the Study of Ribosomal Antibiotic Resistance

    Science.gov (United States)

    Gregory, Steven T.

    2018-03-01

    Ribosomes are the intracellular ribonucleoprotein machines responsible for the translation of mRNA sequence into protein sequence. As an essential cell component, the ribosome is the target of numerous antibiotics that bind to critical functional sites to impair protein synthesis. Mutations causing resistance to antibiotics arise in antibiotic binding sites, and an understanding of the basis of resistance will be an essential component of efforts to develop new antibiotics by rational drug design. We have identified a number of antibiotic-resistance mutations in ribosomal genes of the thermophilic bacterium Thermus thermophilus. This species offers two primary advantages for examining the structural basis of antibiotic-resistance, in particular, its potential for genetic manipulation and the suitability of its ribosomes for analysis by X-ray crystallography. Mutations we have identified in this organism are in many instances identical to those found in other bacterial species, including important pathogens, a result of the extreme conservation of ribosome functional sites. Here I summarize the advantages of this organism as a model system to study antibiotic-resistance mechanisms at the molecular level.

  12. Translational profiling of B cells infected with the Epstein-Barr virus reveals 5' leader ribosome recruitment through upstream open reading frames.

    Science.gov (United States)

    Bencun, Maja; Klinke, Olaf; Hotz-Wagenblatt, Agnes; Klaus, Severina; Tsai, Ming-Han; Poirey, Remy; Delecluse, Henri-Jacques

    2018-04-06

    The Epstein-Barr virus (EBV) genome encodes several hundred transcripts. We have used ribosome profiling to characterize viral translation in infected cells and map new translation initiation sites. We show here that EBV transcripts are translated with highly variable efficiency, owing to variable transcription and translation rates, variable ribosome recruitment to the leader region and coverage by monosomes versus polysomes. Some transcripts were hardly translated, others mainly carried monosomes, showed ribosome accumulation in leader regions and most likely represent non-coding RNAs. A similar process was visible for a subset of lytic genes including the key transactivators BZLF1 and BRLF1 in cells infected with weakly replicating EBV strains. This suggests that ribosome trapping, particularly in the leader region, represents a new checkpoint for the repression of lytic replication. We could identify 25 upstream open reading frames (uORFs) located upstream of coding transcripts that displayed 5' leader ribosome trapping, six of which were located in the leader region shared by many latent transcripts. These uORFs repressed viral translation and are likely to play an important role in the regulation of EBV translation.

  13. Ribosomal RNA in the salivary gland of Sciara ocellaris during larval development

    International Nuclear Information System (INIS)

    Dessen, E.M.B.; Perondini, A.L.P.

    1979-01-01

    Ribosomal RNA in the salivary gland of Sciara ocellaris during larval development. The molecular weights of the precursor and of the 28S and 18S mature fractions of the ribosomal RNA estimated by poliacrilamid gel electrophoresis are 2.6 X 10 6 D, 1.4 X 10 6 D and 0.68 X 10 6 D, respectively. The in vivo processing of pre-rRNA is very fast since radioactivity could be detected in the mature fractions fifteen minutes after incorporation. The processing rate of salivary pre-rRNA increases after the stage of metamorphosis induction. The in vitro processing of the pre-rRNA is less rapid when compared to that in vivo, and no differences were found in RNAs [pt

  14. Evidence for rRNA 2'-O-methylation plasticity: Control of intrinsic translational capabilities of human ribosomes.

    Science.gov (United States)

    Erales, Jenny; Marchand, Virginie; Panthu, Baptiste; Gillot, Sandra; Belin, Stéphane; Ghayad, Sandra E; Garcia, Maxime; Laforêts, Florian; Marcel, Virginie; Baudin-Baillieu, Agnès; Bertin, Pierre; Couté, Yohann; Adrait, Annie; Meyer, Mélanie; Therizols, Gabriel; Yusupov, Marat; Namy, Olivier; Ohlmann, Théophile; Motorin, Yuri; Catez, Frédéric; Diaz, Jean-Jacques

    2017-12-05

    Ribosomal RNAs (rRNAs) are main effectors of messenger RNA (mRNA) decoding, peptide-bond formation, and ribosome dynamics during translation. Ribose 2'-O-methylation (2'-O-Me) is the most abundant rRNA chemical modification, and displays a complex pattern in rRNA. 2'-O-Me was shown to be essential for accurate and efficient protein synthesis in eukaryotic cells. However, whether rRNA 2'-O-Me is an adjustable feature of the human ribosome and a means of regulating ribosome function remains to be determined. Here we challenged rRNA 2'-O-Me globally by inhibiting the rRNA methyl-transferase fibrillarin in human cells. Using RiboMethSeq, a nonbiased quantitative mapping of 2'-O-Me, we identified a repertoire of 2'-O-Me sites subjected to variation and demonstrate that functional domains of ribosomes are targets of 2'-O-Me plasticity. Using the cricket paralysis virus internal ribosome entry site element, coupled to in vitro translation, we show that the intrinsic capability of ribosomes to translate mRNAs is modulated through a 2'-O-Me pattern and not by nonribosomal actors of the translational machinery. Our data establish rRNA 2'-O-Me plasticity as a mechanism providing functional specificity to human ribosomes.

  15. Genetic Selection of Peptide Aptamers That Interact and Inhibit Both Small Protein B and Alternative Ribosome-Rescue Factor A of Aeromonas veronii C4.

    Science.gov (United States)

    Liu, Peng; Chen, Yong; Wang, Dan; Tang, Yanqiong; Tang, Hongqian; Song, Haichao; Sun, Qun; Zhang, Yueling; Liu, Zhu

    2016-01-01

    Aeromonas veronii is a pathogenic gram-negative bacterium, which infects a variety of animals and results in mass mortality. The stalled-ribosome rescues are reported to ensure viability and virulence under stress conditions, of which primarily include trans-translation and alternative ribosome-rescue factor A (ArfA) in A. veronii. For identification of specific peptides that interact and inhibit the stalled-ribosome rescues, peptide aptamer library (pTRG-SN-peptides) was constructed using pTRG as vector and Staphylococcus aureus nuclease (SN) as scaffold protein, in which 16 random amino acids were introduced to form an exposed surface loop. In the meantime both Small Protein B (SmpB) which acts as one of the key components in trans-translation, and ArfA were inserted to pBT to constitute pBT-SmpB and pBT-ArfA, respectively. The peptide aptamer PA-2 was selected from pTRG-SN-peptides by bacterial two-hybrid system (B2H) employing pBT-SmpB or pBT-ArfA as baits. The conserved sites G133K134 and D138K139R140 of C-terminal SmpB were identified by interacting with N-terminal SN, and concurrently the residue K62 of ArfA was recognized by interacting with the surface loop of the specific peptide aptamer PA-2. The expression plasmids pN-SN or pN-PA-2, which combined the duplication origin of pRE112 with the neokanamycin promoter expressing SN or PA-2, were created and transformed into A. veronii C4, separately. The engineered A. veronii C4 which endowing SN or PA-2 expression impaired growth capabilities under stress conditions including temperatures, sucrose, glucose, potassium chloride (KCl) and antibiotics, and the stress-related genes rpoS and nhaP were down-regulated significantly by Quantitative Real-time PCR (qRT-PCR) when treating in 2.0% KCl. Thus, the engineered A. veronii C4 conferring PA-2 expression might be potentially attenuated vaccine, and also the peptide aptamer PA-2 could develop as anti-microbial drugs targeted to the ribosome rescued factors in A

  16. Ribosomal mutations promote the evolution of antibiotic resistance in a multidrug environment.

    Science.gov (United States)

    Gomez, James E; Kaufmann-Malaga, Benjamin B; Wivagg, Carl N; Kim, Peter B; Silvis, Melanie R; Renedo, Nikolai; Ioerger, Thomas R; Ahmad, Rushdy; Livny, Jonathan; Fishbein, Skye; Sacchettini, James C; Carr, Steven A; Hung, Deborah T

    2017-02-21

    Antibiotic resistance arising via chromosomal mutations is typically specific to a particular antibiotic or class of antibiotics. We have identified mutations in genes encoding ribosomal components in Mycobacterium smegmatis that confer resistance to several structurally and mechanistically unrelated classes of antibiotics and enhance survival following heat shock and membrane stress. These mutations affect ribosome assembly and cause large-scale transcriptomic and proteomic changes, including the downregulation of the catalase KatG, an activating enzyme required for isoniazid sensitivity, and upregulation of WhiB7, a transcription factor involved in innate antibiotic resistance. Importantly, while these ribosomal mutations have a fitness cost in antibiotic-free medium, in a multidrug environment they promote the evolution of high-level, target-based resistance. Further, suppressor mutations can then be easily acquired to restore wild-type growth. Thus, ribosomal mutations can serve as stepping-stones in an evolutionary path leading to the emergence of high-level, multidrug resistance.

  17. Na{sup +}/H{sup +} exchanger-1 alleles: Strain distribution and correlation with activity

    Energy Technology Data Exchange (ETDEWEB)

    McClive, P.J.; Morahan, G. [Walter and Eliza Hall Inst. of Medical Research, Parkville, Victoria (Australia); Little, P.J. [Baker Medical Research Inst., Victoria (Australia)

    1996-12-31

    The Na{sup +}/H{sup +} exchanger-1 molecule (NHE1) regulates intracellular pH, cell volume, and cell growth. NHE1 is a phosphoprotein of approximately M{sub r} 110000 with 10 or 12 transmembrane domains. NHE1 is ubiquitously expressed. Three other family members have been identified which show close similarity to NHE1 but are significantly more restricted in their expression: all are found in the gastrointestinal tract, while NHE2 and NHE3 are also expressed in the kidney. 14 refs., 2 figs.

  18. Nuclear ribosomal internal transcribed spacer (ITS) region as a universal DNA barcode marker for Fungi.

    Science.gov (United States)

    Schoch, Conrad L; Seifert, Keith A; Huhndorf, Sabine; Robert, Vincent; Spouge, John L; Levesque, C André; Chen, Wen

    2012-04-17

    Six DNA regions were evaluated as potential DNA barcodes for Fungi, the second largest kingdom of eukaryotic life, by a multinational, multilaboratory consortium. The region of the mitochondrial cytochrome c oxidase subunit 1 used as the animal barcode was excluded as a potential marker, because it is difficult to amplify in fungi, often includes large introns, and can be insufficiently variable. Three subunits from the nuclear ribosomal RNA cistron were compared together with regions of three representative protein-coding genes (largest subunit of RNA polymerase II, second largest subunit of RNA polymerase II, and minichromosome maintenance protein). Although the protein-coding gene regions often had a higher percent of correct identification compared with ribosomal markers, low PCR amplification and sequencing success eliminated them as candidates for a universal fungal barcode. Among the regions of the ribosomal cistron, the internal transcribed spacer (ITS) region has the highest probability of successful identification for the broadest range of fungi, with the most clearly defined barcode gap between inter- and intraspecific variation. The nuclear ribosomal large subunit, a popular phylogenetic marker in certain groups, had superior species resolution in some taxonomic groups, such as the early diverging lineages and the ascomycete yeasts, but was otherwise slightly inferior to the ITS. The nuclear ribosomal small subunit has poor species-level resolution in fungi. ITS will be formally proposed for adoption as the primary fungal barcode marker to the Consortium for the Barcode of Life, with the possibility that supplementary barcodes may be developed for particular narrowly circumscribed taxonomic groups.

  19. Ribosome evolution: Emergence of peptide synthesis machinery

    Indian Academy of Sciences (India)

    suggested the dynamic movement of ribosomal proteins. The L2 protein (a .... Such kinds of interactions are important in elucidating the evolution of RNA .... Tamura K 2009 Molecular handedness of life: significance of RNA aminoacylation.

  20. Is there a channel in the ribosome for nascent peptide. Labellimg of translating ribosomes with atomar tritium

    Energy Technology Data Exchange (ETDEWEB)

    Kolb, V A; Kammer, A A; Spirin, A S

    1987-01-01

    The method of tritium bombardment was applied to investigate exposure of growing peptide on the surface of ribsome E.coli. Distribution of radioactivity by fractions is presented. Tritium inclusion in all the aminoacid residues of heteropeptide testifies to its exposure on the surface of the ribosome.

  1. Evolutionary dynamics of a conserved sequence motif in the ribosomal genes of the ciliate Paramecium.

    Science.gov (United States)

    Catania, Francesco; Lynch, Michael

    2010-05-04

    In protozoa, the identification of preserved motifs by comparative genomics is often impeded by difficulties to generate reliable alignments for non-coding sequences. Moreover, the evolutionary dynamics of regulatory elements in 3' untranslated regions (both in protozoa and metazoa) remains a virtually unexplored issue. By screening Paramecium tetraurelia's 3' untranslated regions for 8-mers that were previously found to be preserved in mammalian 3' UTRs, we detect and characterize a motif that is distinctly conserved in the ribosomal genes of this ciliate. The motif appears to be conserved across Paramecium aurelia species but is absent from the ribosomal genes of four additional non-Paramecium species surveyed, including another ciliate, Tetrahymena thermophila. Motif-free ribosomal genes retain fewer paralogs in the genome and appear to be lost more rapidly relative to motif-containing genes. Features associated with the discovered preserved motif are consistent with this 8-mer playing a role in post-transcriptional regulation. Our observations 1) shed light on the evolution of a putative regulatory motif across large phylogenetic distances; 2) are expected to facilitate the understanding of the modulation of ribosomal genes expression in Paramecium; and 3) reveal a largely unexplored--and presumably not restricted to Paramecium--association between the presence/absence of a DNA motif and the evolutionary fate of its host genes.

  2. Chimeric Recombinant Human Metapneumoviruses with the Nucleoprotein or Phosphoprotein Open Reading Frame Replaced by That of Avian Metapneumovirus Exhibit Improved Growth In Vitro and Attenuation In Vivo

    Science.gov (United States)

    Pham, Quynh N.; Biacchesi, Stéphane; Skiadopoulos, Mario H.; Murphy, Brian R.; Collins, Peter L.; Buchholz, Ursula J.

    2005-01-01

    Chimeric versions of recombinant human metapneumovirus (HMPV) were generated by replacing the nucleoprotein (N) or phosphoprotein (P) open reading frame with its counterpart from the closely related avian metapneumovirus (AMPV) subgroup C. In Vero cells, AMPV replicated to an approximately 100-fold-higher titer than HMPV. Surprisingly, the N and P chimeric viruses replicated to a peak titer that was 11- and 25-fold higher, respectively, than that of parental HMPV. The basis for this effect is not known but was not due to obvious changes in the efficiency of gene expression. AMPV and the N and P chimeras were evaluated for replication, immunogenicity, and protective efficacy in hamsters. AMPV was attenuated compared to HMPV in this mammalian host on day 5 postinfection, but not on day 3, and only in the nasal turbinates. In contrast, the N and P chimeras were reduced approximately 100-fold in both the upper and lower respiratory tract on day 3 postinfection, although there was little difference by day 5. The N and P chimeras induced a high level of neutralizing serum antibodies and protective efficacy against HMPV; AMPV was only weakly immunogenic and protective against HMPV challenge, reflecting antigenic differences. In African green monkeys immunized intranasally and intratracheally, the mean peak titer of the P chimera was reduced 100- and 1,000-fold in the upper and lower respiratory tracts, whereas the N chimera was reduced only 10-fold in the lower respiratory tract. Both chimeras were comparable to wild-type HMPV in immunogenicity and protective efficacy. Thus, the P chimera is a promising live HMPV vaccine candidate that paradoxically combines improved growth in vitro with attenuation in vivo. PMID:16306583

  3. Elongation factor P is dispensable in Escherichia coli and Pseudomonas aeruginosa.

    Science.gov (United States)

    Balibar, Carl J; Iwanowicz, Dorothy; Dean, Charles R

    2013-09-01

    Elongation factor P (EF-P) is a highly conserved ribosomal initiation factor responsible for stimulating formation of the first peptide bond. Its essentiality has been debated and may differ depending on the organism. Here, we demonstrate that EF-P is dispensable in Escherichia coli and Pseudomonas aeruginosa under laboratory growth conditions. Although knockouts are viable, growth rates are diminished compared with wild-type strains. Despite this cost in fitness, these mutants are not more susceptible to a wide range of antibiotics; including ribosome targeting antibiotics, such as lincomycin, chloramphenicol, and streptomycin, which have been shown previously to disrupt EF-P function in vitro. In Pseudomonas, knockout of efp leads to an upregulation of mexX, a phenotype previously observed with other genetic lesions affecting ribosome function and that can be induced by the treatment with antibiotics affecting protein synthesis.

  4. Ribosomal elongation factor 4 promotes cell death associated with lethal stress.

    Science.gov (United States)

    Li, Liping; Hong, Yuzhi; Luan, Gan; Mosel, Michael; Malik, Muhammad; Drlica, Karl; Zhao, Xilin

    2014-12-09

    Ribosomal elongation factor 4 (EF4) is highly conserved among bacteria, mitochondria, and chloroplasts. However, the EF4-encoding gene, lepA, is nonessential and its deficiency shows no growth or fitness defect. In purified systems, EF4 back-translocates stalled, posttranslational ribosomes for efficient protein synthesis; consequently, EF4 has a protective role during moderate stress. We were surprised to find that EF4 also has a detrimental role during severe stress: deletion of lepA increased Escherichia coli survival following treatment with several antimicrobials. EF4 contributed to stress-mediated lethality through reactive oxygen species (ROS) because (i) the protective effect of a ΔlepA mutation against lethal antimicrobials was eliminated by anaerobic growth or by agents that block hydroxyl radical accumulation and (ii) the ΔlepA mutation decreased ROS levels stimulated by antimicrobial stress. Epistasis experiments showed that EF4 functions in the same genetic pathway as the MazF toxin, a stress response factor implicated in ROS-mediated cell death. The detrimental action of EF4 required transfer-messenger RNA (tmRNA, which tags truncated proteins for degradation and is known to be inhibited by EF4) and the ClpP protease. Inhibition of a protective, tmRNA/ClpP-mediated degradative activity would allow truncated proteins to indirectly perturb the respiratory chain and thereby provide a potential link between EF4 and ROS. The connection among EF4, MazF, tmRNA, and ROS expands a pathway leading from harsh stress to bacterial self-destruction. The destructive aspect of EF4 plus the protective properties described previously make EF4 a bifunctional factor in a stress response that promotes survival or death, depending on the severity of stress. Translation elongation factor 4 (EF4) is one of the most conserved proteins in nature, but it is dispensable. Lack of strong phenotypes for its genetic knockout has made EF4 an enigma. Recent biochemical work has

  5. Cell cycle, differentiation and tissue-independent expression of ribosomal protein L37.

    Science.gov (United States)

    Su, S; Bird, R C

    1995-09-15

    A unique human cDNA (hG1.16) that encodes a mRNA of 450 nucleotides was isolated from a subtractive library derived from HeLa cells. The relative expression level of hG1.16 during different cell-cycle phases was determined by Northern-blot analysis of cells synchronized by double-thymidine block and serum deprivation/refeeding. hG1.16 was constitutively expressed during all phases of the cell cycle, including the quiescent phase when even most constitutively expressed genes experience some suppression of expression. The expression level of hG1.16 did not change during terminal differentiation of myoblasts to myotubes, during which cells become permanently post-mitotic. Examination of other tissues revealed that the relative expression level of hG1.16 was constitutive in all embryonic mouse tissues examined, including brain, eye, heart, kidney, liver, lung and skeletal muscle. This was unusual in that expression was not down-modulated during differentiation and did not vary appreciably between tissue types. Analysis by inter-species Northern-blot analysis revealed that hG1.16 was highly conserved among all vertebrates studied (from fish to humans but not in insects). DNA sequence analysis of hG1.16 revealed a high level of similarity to rat ribosomal protein L37, identifying hG1.16 as a new member of this multigene family. The deduced amino acid sequence of hG1.16 was identical to rat ribosomal protein L37 that contained 97 amino acids, many of which are highly positively charged (15 arginine and 14 lysine residues with a predicted M(r) of 11,065). hG1.16 protein has a single C2-C2 zinc-finger-like motif which is also present in rat ribosomal protein L37. Using primers designed from the sequence of hG1.16, unique bovine and rat cDNAs were also isolated by 5'-rapid-amplification of cDNA ends. DNA sequences of bovine and rat G1.16, clones were 92.8% and 92.2% similar to human G1.16 while the deduced amino acid sequences derived from bovine and rat cDNAs each differed

  6. Structural insights into methyltransferase KsgA function in 30S ribosomal subunit biogenesis.

    Science.gov (United States)

    Boehringer, Daniel; O'Farrell, Heather C; Rife, Jason P; Ban, Nenad

    2012-03-23

    The assembly of the ribosomal subunits is facilitated by ribosome biogenesis factors. The universally conserved methyltransferase KsgA modifies two adjacent adenosine residues in the 3'-terminal helix 45 of the 16 S ribosomal RNA (rRNA). KsgA recognizes its substrate adenosine residues only in the context of a near mature 30S subunit and is required for the efficient processing of the rRNA termini during ribosome biogenesis. Here, we present the cryo-EM structure of KsgA bound to a nonmethylated 30S ribosomal subunit. The structure reveals that KsgA binds to the 30S platform with the catalytic N-terminal domain interacting with substrate adenosine residues in helix 45 and the C-terminal domain making extensive contacts to helix 27 and helix 24. KsgA excludes the penultimate rRNA helix 44 from adopting its position in the mature 30S subunit, blocking the formation of the decoding site and subunit joining. We suggest that the activation of methyltransferase activity and subsequent dissociation of KsgA control conformational changes in helix 44 required for final rRNA processing and translation initiation.

  7. Structural Insights into Methyltransferase KsgA Function in 30S Ribosomal Subunit Biogenesis*

    Science.gov (United States)

    Boehringer, Daniel; O'Farrell, Heather C.; Rife, Jason P.; Ban, Nenad

    2012-01-01

    The assembly of the ribosomal subunits is facilitated by ribosome biogenesis factors. The universally conserved methyltransferase KsgA modifies two adjacent adenosine residues in the 3′-terminal helix 45 of the 16 S ribosomal RNA (rRNA). KsgA recognizes its substrate adenosine residues only in the context of a near mature 30S subunit and is required for the efficient processing of the rRNA termini during ribosome biogenesis. Here, we present the cryo-EM structure of KsgA bound to a nonmethylated 30S ribosomal subunit. The structure reveals that KsgA binds to the 30S platform with the catalytic N-terminal domain interacting with substrate adenosine residues in helix 45 and the C-terminal domain making extensive contacts to helix 27 and helix 24. KsgA excludes the penultimate rRNA helix 44 from adopting its position in the mature 30S subunit, blocking the formation of the decoding site and subunit joining. We suggest that the activation of methyltransferase activity and subsequent dissociation of KsgA control conformational changes in helix 44 required for final rRNA processing and translation initiation. PMID:22308031

  8. Three-dimensional crystals of ribosomes and their subunits from eu- and archaebacteria.

    Science.gov (United States)

    Glotz, C; Müssig, J; Gewitz, H S; Makowski, I; Arad, T; Yonath, A; Wittmann, H G

    1987-11-01

    Ordered three-dimensional crystals of 70S ribosomes as well as of 30S and 50S ribosomal subunits from various bacteria (E. coli, Bacillus stearothermophilus, Thermus thermophilus and Halobacterium marismortui) have been grown by vapour diffusion in hanging drops using mono- and polyalcohols. A new compact crystal form of 50S subunits has been obtained, and it is suitable for crystallographic studies at medium resolution. In addition, from one crystal form large crystals could be grown in X-ray capillaries. In all cases the crystals were obtained from functionally active ribosomal particles, and the particles from dissolved crystals retained their integrity and biological activity.

  9. Structural and functional organization of ribosomal genes within the mammalian cell nucleolus.

    Science.gov (United States)

    Derenzini, Massimo; Pasquinelli, Gianandrea; O'Donohue, Marie-Françoise; Ploton, Dominique; Thiry, Marc

    2006-02-01

    Data on the in situ structural-functional organization of ribosomal genes in the mammalian cell nucleolus are reviewed here. Major findings on chromatin structure in situ come from investigations carried out using the Feulgen-like osmium ammine reaction as a highly specific electron-opaque DNA tracer. Intranucleolar chromatin shows three different levels of organization: compact clumps, fibers ranging from 11 to 30 nm, and loose agglomerates of extended DNA filaments. Both clumps and fibers of chromatin exhibit a nucleosomal organization that is lacking in the loose agglomerates of extended DNA filaments. In fact, these filaments constantly show a thickness of 2-3 nm, the same as a DNA double-helix molecule. The loose agglomerates of DNA filaments are located in the fibrillar centers, the interphase counterpart of metaphase NORs, therefore being constituted by ribosomal DNA. The extended, non-nucleosomal configuration of this rDNA has been shown to be independent of transcriptional activity and characterizes ribosome genes that are either transcribed or transcriptionally silent. Data reviewed are consistent with a model of control for ribosome gene activity that is not mediated by changes in chromatin structure. The presence of rDNA in mammalian cells always structurally ready for transcription might facilitate a more rapid adjustment of the ribosome production in response to the metabolic needs of the cell.

  10. Rplp1 bypasses replicative senescence and contributes to transformation

    Energy Technology Data Exchange (ETDEWEB)

    Artero-Castro, A. [Pathology Department, Fundacio Institut de Recerca Hospital Vall d' Hebron, Passeig Vall d' Hebron 119-129, 08035 Barcelona (Spain); Kondoh, H. [Department of Geriatric Medicine, Graduate School of Medicine, Kyoto University, 54 Kawahara-cho, Shogoin, Sakyo-ku, Kyoto 606-8507 (Japan); Fernandez-Marcos, P.J.; Serrano, M. [Spanish National Cancer Research Center (CNIO), 3 Melchor Fernandez Almagro St, Madrid 28029 (Spain); Ramon y Cajal, S. [Pathology Department, Fundacio Institut de Recerca Hospital Vall d' Hebron, Passeig Vall d' Hebron 119-129, 08035 Barcelona (Spain); LLeonart, M.E., E-mail: melleona@ir.vhebron.net [Pathology Department, Fundacio Institut de Recerca Hospital Vall d' Hebron, Passeig Vall d' Hebron 119-129, 08035 Barcelona (Spain)

    2009-05-01

    To determine whether genes expressed by embryonic stem cells have a proliferative effect in primary cells, primary mouse embryonic fibroblasts were infected with an ES cell cDNA library. This led to identification of the ribosomal protein, Rplp1, a member of the P group of ribosomal proteins, whose putative role for bypassing replicative senescence in MEFs was investigated. Our results show that Rplp1 produces a two-fold increase in the expression of an E2F1 promoter and upregulation of cyclin E in MEFs. Therefore, this study is the first to show that overexpression of a single ribosomal protein, Rplp1, is a cause and not a consequence of cell proliferation. In addition, co-expression of Rplp1 with mutant ras{sup Val12} contributed to transformation in NIH3T3 cells, as was evidenced by colony production in soft-agar assays. Moreover, the Rplp1 protein was upregulated in MEFs and NIH3T3 cells upon expression of a p53 dominant negative mutant gene designated p53R175H. Hence, mutation of p53 may facilitate immortalization in vitro by upregulating Rplp1. Lastly, Rplp1 mRNA was found to be upregulated in 16 of 26 human colon cancer biopsy specimens, a finding that may be of relevance to cancer research.

  11. Rplp1 bypasses replicative senescence and contributes to transformation

    International Nuclear Information System (INIS)

    Artero-Castro, A.; Kondoh, H.; Fernandez-Marcos, P.J.; Serrano, M.; Ramon y Cajal, S.; LLeonart, M.E.

    2009-01-01

    To determine whether genes expressed by embryonic stem cells have a proliferative effect in primary cells, primary mouse embryonic fibroblasts were infected with an ES cell cDNA library. This led to identification of the ribosomal protein, Rplp1, a member of the P group of ribosomal proteins, whose putative role for bypassing replicative senescence in MEFs was investigated. Our results show that Rplp1 produces a two-fold increase in the expression of an E2F1 promoter and upregulation of cyclin E in MEFs. Therefore, this study is the first to show that overexpression of a single ribosomal protein, Rplp1, is a cause and not a consequence of cell proliferation. In addition, co-expression of Rplp1 with mutant ras Val12 contributed to transformation in NIH3T3 cells, as was evidenced by colony production in soft-agar assays. Moreover, the Rplp1 protein was upregulated in MEFs and NIH3T3 cells upon expression of a p53 dominant negative mutant gene designated p53R175H. Hence, mutation of p53 may facilitate immortalization in vitro by upregulating Rplp1. Lastly, Rplp1 mRNA was found to be upregulated in 16 of 26 human colon cancer biopsy specimens, a finding that may be of relevance to cancer research.

  12. A streamlined ribosome profiling protocol for the characterization of microorganisms

    DEFF Research Database (Denmark)

    Latif, Haythem; Szubin, Richard; Tan, Justin

    2015-01-01

    Ribosome profiling is a powerful tool for characterizing in vivo protein translation at the genome scale, with multiple applications ranging from detailed molecular mechanisms to systems-level predictive modeling. Though highly effective, this intricate technique has yet to become widely used...... in the microbial research community. Here we present a streamlined ribosome profiling protocol with reduced barriers to entry for microbial characterization studies. Our approach provides simplified alternatives during harvest, lysis, and recovery of monosomes and also eliminates several time-consuming steps...

  13. Is The Ribosome Targeted By Adaptive Mutations

    DEFF Research Database (Denmark)

    Jimenez Fernandez, Alicia; Molin, Søren; Johansen, Helle Krogh

    2015-01-01

    Introduction: RNA polymerase and ribosomes, composing the macromolecular synthesis machinery (MMSM), carry out the central processes of transcription and translation, but are usually seen as mechanical elements with no regulatory function. Extensive investigations of gene regulation and the high ...

  14. Secreted phosphoprotein 24 kD (Spp24) inhibits growth of human pancreatic cancer cells caused by BMP-2

    International Nuclear Information System (INIS)

    Li, Chen-Shuang; Tian, Haijun; Zou, Min; Zhao, Ke-Wei; Li, Yawei; Lao, Lifeng; Brochmann, Elsa J.; Duarte, M. Eugenia L.; Daubs, Michael D.; Zhou, Yan-Heng; Murray, Samuel S.; Wang, Jeffrey C.

    2015-01-01

    The emerging role of bone morphogenetic proteins (BMPs) in the initiation and progression of multiple cancers has drawn great attention in cancer research. In this study, we report that BMP-2 can promote the proliferation of the pancreatic tumor cell line, PANC-1. Secreted phosphoprotein 24 kD (Spp24), a BMP binding protein, did not affect the proliferation of the cells but promoted the apoptosis of the cells in vitro. In a xeneograft tumor model using PANC-1 cells, BMP-2 dramatically promoted tumor growth, while Spp24 not only abolished the effect of BMP-2, but also dramatically induced tumor shrinking when used alone. Activation of Smad1/5/8 participated in this process as demonstrated by immunohistochemical staining of phosphorylated Smad 1/5/8. We conclude that Spp24 can be developed into a therapeutic agent that could be employed in clinical situations where the inhibition of BMPs and related proteins is advantageous. - Highlights: • Spp24 effectively inhibited the in vivo tumor growth of PANC-1. • BMP-2 dramatically promoted tumor growth by promoting PANC-1 proliferation. • Spp24 abolished the tumor growth effect of BMP-2 by promoting PANC-1 apoptosis. • Spp24 may be a candidate as a therapeutic agent of pancreatic cancer.

  15. Secreted phosphoprotein 24 kD (Spp24) inhibits growth of human pancreatic cancer cells caused by BMP-2

    Energy Technology Data Exchange (ETDEWEB)

    Li, Chen-Shuang [Department of Orthodontics, Peking University School and Hospital of Stomatology, Beijing (China); Tian, Haijun, E-mail: haijuntianmd@gmail.com [Department of Orthopaedic Surgery, Changzheng Hospital, Second Military Medical University, Shanghai (China); Department of Orthopaedic Surgery, University of California, Los Angeles, Los Angeles, CA (United States); Department of Surgery, Bethune School of Medics, Shijiazhuang (China); Zou, Min [Department of Orthodontics, School and Hospital of Stomatology, Xi' an Jiaotong University, Xi' an (China); Zhao, Ke-Wei [Research Service, VA Greater Los Angeles Healthcare System, North Hills, CA (United States); Li, Yawei; Lao, Lifeng [Department of Orthopaedic Surgery, University of California, Los Angeles, Los Angeles, CA (United States); Brochmann, Elsa J. [Research Service, VA Greater Los Angeles Healthcare System, North Hills, CA (United States); Geriatric Research, Education and Clinical Center, VA Greater Los Angeles Healthcare System, North Hills, CA (United States); Department of Medicine, University of California, Los Angeles, Los Angeles, CA (United States); Duarte, M. Eugenia L. [National Institute of Traumatology and Orthopaedics, Rio de Janeiro (Brazil); Daubs, Michael D. [Division of Orthopaedic Surgery, Department of Surgery, University of Nevada School of Medicine, Las Vegas, NV (United States); Zhou, Yan-Heng, E-mail: yanhengzhou@vip.163.com [Department of Orthodontics, Peking University School and Hospital of Stomatology, Beijing (China); Murray, Samuel S. [Research Service, VA Greater Los Angeles Healthcare System, North Hills, CA (United States); Geriatric Research, Education and Clinical Center, VA Greater Los Angeles Healthcare System, North Hills, CA (United States); Department of Medicine, University of California, Los Angeles, Los Angeles, CA (United States); Wang, Jeffrey C. [Department of Orthopaedic Surgery, University of Southern California, Los Angeles, CA (United States)

    2015-10-16

    The emerging role of bone morphogenetic proteins (BMPs) in the initiation and progression of multiple cancers has drawn great attention in cancer research. In this study, we report that BMP-2 can promote the proliferation of the pancreatic tumor cell line, PANC-1. Secreted phosphoprotein 24 kD (Spp24), a BMP binding protein, did not affect the proliferation of the cells but promoted the apoptosis of the cells in vitro. In a xeneograft tumor model using PANC-1 cells, BMP-2 dramatically promoted tumor growth, while Spp24 not only abolished the effect of BMP-2, but also dramatically induced tumor shrinking when used alone. Activation of Smad1/5/8 participated in this process as demonstrated by immunohistochemical staining of phosphorylated Smad 1/5/8. We conclude that Spp24 can be developed into a therapeutic agent that could be employed in clinical situations where the inhibition of BMPs and related proteins is advantageous. - Highlights: • Spp24 effectively inhibited the in vivo tumor growth of PANC-1. • BMP-2 dramatically promoted tumor growth by promoting PANC-1 proliferation. • Spp24 abolished the tumor growth effect of BMP-2 by promoting PANC-1 apoptosis. • Spp24 may be a candidate as a therapeutic agent of pancreatic cancer.

  16. How does a scanning ribosomal particle move along the 5'-untranslated region of eukaryotic mRNA? Brownian Ratchet model.

    Science.gov (United States)

    Spirin, Alexander S

    2009-11-17

    A model of the ATP-dependent unidirectional movement of the 43S ribosomal initiation complex (=40S ribosomal subunit + eIF1 + eIF1A + eIF2.GTP.Met-tRNA(i) + eIF3) during scanning of the 5'-untranslated region of eukaryotic mRNA is proposed. The model is based on the principles of molecular Brownian ratchet machines and explains several enigmatic data concerning the scanning complex. In this model, the one-dimensional diffusion of the ribosomal initiation complex along the mRNA chain is rectified into the net-unidirectional 5'-to-3' movement by the Feynman ratchet-and-pawl mechanism. The proposed mechanism is organized by the heterotrimeric protein eIF4F (=eIF4A + eIF4E + eIF4G), attached to the scanning ribosomal particle via eIF3, and the RNA-binding protein eIF4B that is postulated to play the role of the pawl. The energy for the useful work of the ratchet-and-pawl mechanism is supplied from ATP hydrolysis induced by the eIF4A subunit: ATP binding and its hydrolysis alternately change the affinities of eIF4A for eIF4B and for mRNA, resulting in the restriction of backward diffusional sliding of the 43S ribosomal complex along the mRNA chain, while stochastic movements ahead are allowed.

  17. Automated genome mining of ribosomal peptide natural products

    Energy Technology Data Exchange (ETDEWEB)

    Mohimani, Hosein; Kersten, Roland; Liu, Wei; Wang, Mingxun; Purvine, Samuel O.; Wu, Si; Brewer, Heather M.; Pasa-Tolic, Ljiljana; Bandeira, Nuno; Moore, Bradley S.; Pevzner, Pavel A.; Dorrestein, Pieter C.

    2014-07-31

    Ribosomally synthesized and posttranslationally modified peptides (RiPPs), especially from microbial sources, are a large group of bioactive natural products that are a promising source of new (bio)chemistry and bioactivity (1). In light of exponentially increasing microbial genome databases and improved mass spectrometry (MS)-based metabolomic platforms, there is a need for computational tools that connect natural product genotypes predicted from microbial genome sequences with their corresponding chemotypes from metabolomic datasets. Here, we introduce RiPPquest, a tandem mass spectrometry database search tool for identification of microbial RiPPs and apply it for lanthipeptide discovery. RiPPquest uses genomics to limit search space to the vicinity of RiPP biosynthetic genes and proteomics to analyze extensive peptide modifications and compute p-values of peptide-spectrum matches (PSMs). We highlight RiPPquest by connection of multiple RiPPs from extracts of Streptomyces to their gene clusters and by the discovery of a new class III lanthipeptide, informatipeptin, from Streptomyces viridochromogenes DSM 40736 as the first natural product to be identified in an automated fashion by genome mining. The presented tool is available at cy-clo.ucsd.edu.

  18. Dynamic enzyme docking to the ribosome coordinates N-terminal processing with polypeptide folding.

    Science.gov (United States)

    Sandikci, Arzu; Gloge, Felix; Martinez, Michael; Mayer, Matthias P; Wade, Rebecca; Bukau, Bernd; Kramer, Günter

    2013-07-01

    Newly synthesized polypeptides undergo various cotranslational maturation steps, including N-terminal enzymatic processing, chaperone-assisted folding and membrane targeting, but the spatial and temporal coordination of these steps is unclear. We show that Escherichia coli methionine aminopeptidase (MAP) associates with ribosomes through a charged loop that is crucial for nascent-chain processing and cell viability. MAP competes with peptide deformylase (PDF), the first enzyme to act on nascent chains, for binding sites at the ribosomal tunnel exit. PDF has extremely fast association and dissociation kinetics, which allows it to frequently sample ribosomes and ensure the processing of nascent chains after their emergence. Premature recruitment of the chaperone trigger factor, or polypeptide folding, negatively affect processing efficiency. Thus, the fast ribosome association kinetics of PDF and MAP are crucial for the temporal separation of nascent-chain processing from later maturation events, including chaperone recruitment and folding.

  19. Clusters of basic amino acids contribute to RNA binding and nucleolar localization of ribosomal protein L22.

    Directory of Open Access Journals (Sweden)

    Jennifer L Houmani

    Full Text Available The ribosomal protein L22 is a component of the 60S eukaryotic ribosomal subunit. As an RNA-binding protein, it has been shown to interact with both cellular and viral RNAs including 28S rRNA and the Epstein-Barr virus encoded RNA, EBER-1. L22 is localized to the cell nucleus where it accumulates in nucleoli. Although previous studies demonstrated that a specific amino acid sequence is required for nucleolar localization, the RNA-binding domain has not been identified. Here, we investigated the hypothesis that the nucleolar accumulation of L22 is linked to its ability to bind RNA. To address this hypothesis, mutated L22 proteins were generated to assess the contribution of specific amino acids to RNA binding and protein localization. Using RNA-protein binding assays, we demonstrate that basic amino acids 80-93 are required for high affinity binding of 28S rRNA and EBER-1 by L22. Fluorescence localization studies using GFP-tagged mutated L22 proteins further reveal that basic amino acids 80-93 are critical for nucleolar accumulation and for incorporation into ribosomes. Our data support the growing consensus that the nucleolar accumulation of ribosomal proteins may not be mediated by a defined localization signal, but rather by specific interaction with established nucleolar components such as rRNA.

  20. rRNA:mRNA pairing alters the length and the symmetry of mRNA-protected fragments in ribosome profiling experiments

    OpenAIRE

    O?Connor, Patrick B. F.; Li, Gene-Wei; Weissman, Jonathan S.; Atkins, John F.; Baranov, Pavel V.

    2013-01-01

    Motivation: Ribosome profiling is a new technique that allows monitoring locations of translating ribosomes on mRNA at a whole transcriptome level. A recent ribosome profiling study demonstrated that internal Shine?Dalgarno (SD) sequences have a major global effect on translation rates in bacteria: ribosomes pause at SD sites in mRNA. Therefore, it is important to understand how SD sites effect mRNA movement through the ribosome and generation of ribosome footprints. Results: Here, we provide...

  1. Molecular mechanism and structure of Trigger Factor bound to the translating ribosome

    Science.gov (United States)

    Merz, Frieder; Boehringer, Daniel; Schaffitzel, Christiane; Preissler, Steffen; Hoffmann, Anja; Maier, Timm; Rutkowska, Anna; Lozza, Jasmin; Ban, Nenad; Bukau, Bernd; Deuerling, Elke

    2008-01-01

    Ribosome-associated chaperone Trigger Factor (TF) initiates folding of newly synthesized proteins in bacteria. Here, we pinpoint by site-specific crosslinking the sequence of molecular interactions of Escherichia coli TF and nascent chains during translation. Furthermore, we provide the first full-length structure of TF associated with ribosome–nascent chain complexes by using cryo-electron microscopy. In its active state, TF arches over the ribosomal exit tunnel accepting nascent chains in a protective void. The growing nascent chain initially follows a predefined path through the entire interior of TF in an unfolded conformation, and even after folding into a domain it remains accommodated inside the protective cavity of ribosome-bound TF. The adaptability to accept nascent chains of different length and folding states may explain how TF is able to assist co-translational folding of all kinds of nascent polypeptides during ongoing synthesis. Moreover, we suggest a model of how TF's chaperoning function can be coordinated with the co-translational processing and membrane targeting of nascent polypeptides by other ribosome-associated factors. PMID:18497744

  2. Ribosome stalling regulates IRES-mediated translation in eukaryotes, a parallel to prokaryotic attenuation

    NARCIS (Netherlands)

    Fernandez, James; Yaman, Ibrahim; Huang, Charles; Liu, Haiyan; Lopez, Alex B.; Komar, Anton A.; Caprara, Mark G.; Merrick, William C.; Snider, Martin D.; Kaufman, Randal J.; Lamers, Wouter H.; Hatzoglou, Maria

    2005-01-01

    It was previously shown that the mRNA for the cat-1 Arg/Lys transporter is translated from an internal ribosome entry site (IRES) that is regulated by cellular stress. Amino acid starvation stimulated cat-1 translation via a mechanism that requires translation of an ORF in the mRNA leader and

  3. Structure of the Paramyxovirus Parainfluenza Virus 5 Nucleoprotein in Complex with an Amino-Terminal Peptide of the Phosphoprotein

    Energy Technology Data Exchange (ETDEWEB)

    Aggarwal, Megha; Leser, George P.; Kors, Christopher A.; Lamb, Robert A.; Sundquist, Wesley I.

    2017-12-13

    <p>Parainfluenza virus 5 (PIV5) belongs to the familyParamyxoviridae, which consists of enveloped viruses with a nonsegmented negative-strand RNA genome encapsidated by the nucleoprotein (N). Paramyxovirus replication is regulated by the phosphoprotein (P) through protein-protein interactions with N and the RNA polymerase (L). The chaperone activity of P is essential to maintain the unassembled RNA-free form of N in order to prevent nonspecific RNA binding and premature N oligomerization. Here, we determined the crystal structure of unassembled PIV5 N in complex with a P peptide (N0P) derived from the N terminus of P (P50) at 2.65 Å. The PIV5 N0P consists of two domains: an N-terminal domain (NTD) and a C-terminal domain (CTD) separated by a hinge region. The cleft at the hinge region of RNA-bound PIV5 N was previously shown to be an RNA binding site. The N0P structure shows that the P peptide binds to the CTD of N and extends toward the RNA binding site to inhibit N oligomerization and, hence, RNA binding. Binding of P peptide also keeps the PIV5 N in the open form. A molecular dynamics (MD) analysis of both the open and closed forms of N shows the flexibility of the CTD and the preference of the N protein to be in an open conformation. The gradual opening of the hinge region, to release the RNA, was also observed. Together, these results advance our knowledge of the conformational swapping of N required for the highly regulated paramyxovirus replication.p> <p>IMPORTANCEParamyxovirus replication is regulated by the interaction of P with N and L proteins. Here, we report the crystal structure of unassembled parainfluenza virus 5 (PIV5) N chaperoned with P peptide. Our results provide a detailed understanding of the binding of P to N. The conformational switching of N between closed and open forms during its initial interaction with P, as well as

  4. Ribosomal proteins as biomarkers for bacterial identification by mass spectrometry in the clinical microbiology laboratory.

    Science.gov (United States)

    Suarez, Stéphanie; Ferroni, Agnès; Lotz, Aurélie; Jolley, Keith A; Guérin, Philippe; Leto, Julie; Dauphin, Brunhilde; Jamet, Anne; Maiden, Martin C J; Nassif, Xavier; Armengaud, Jean

    2013-09-01

    Whole-cell matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS) is a rapid method for identification of microorganisms that is increasingly used in microbiology laboratories. This identification is based on the comparison of the tested isolate mass spectrum with reference databases. Using Neisseria meningitidis as a model organism, we showed that in one of the available databases, the Andromas database, 10 of the 13 species-specific biomarkers correspond to ribosomal proteins. Remarkably, one biomarker, ribosomal protein L32, was subject to inter-strain variability. The analysis of the ribosomal protein patterns of 100 isolates for which whole genome sequences were available, confirmed the presence of inter-strain variability in the molecular weight of 29 ribosomal proteins, thus establishing a correlation between the sequence type (ST) and/or clonal complex (CC) of each strain and its ribosomal protein pattern. Since the molecular weight of three of the variable ribosomal proteins (L30, L31 and L32) was included in the spectral window observed by MALDI-TOF MS in clinical microbiology, i.e., 3640-12000 m/z, we were able by analyzing the molecular weight of these three ribosomal proteins to classify each strain in one of six subgroups, each of these subgroups corresponding to specific STs and/or CCs. Their detection by MALDI-TOF allows therefore a quick typing of N. meningitidis isolates. © 2013 Elsevier B.V. All rights reserved.

  5. Proteome distribution between nucleoplasm and nucleolus and its relation to ribosome biogenesis in Arabidopsis thaliana.

    Science.gov (United States)

    Palm, Denise; Simm, Stefan; Darm, Katrin; Weis, Benjamin L; Ruprecht, Maike; Schleiff, Enrico; Scharf, Christian

    2016-01-01

    Ribosome biogenesis is an essential process initiated in the nucleolus. In eukaryotes, multiple ribosome biogenesis factors (RBFs) can be found in the nucleolus, the nucleus and in the cytoplasm. They act in processing, folding and modification of the pre-ribosomal (r)RNAs, incorporation of ribosomal proteins (RPs), export of pre-ribosomal particles to the cytoplasm, and quality control mechanisms. Ribosome biogenesis is best established for Saccharomyces cerevisiae. Plant ortholog assignment to yeast RBFs revealed the absence of about 30% of the yeast RBFs in plants. In turn, few plant specific proteins have been identified by biochemical experiments to act in plant ribosome biogenesis. Nevertheless, a complete inventory of plant RBFs has not been established yet. We analyzed the proteome of the nucleus and nucleolus of Arabidopsis thaliana and the post-translational modifications of these proteins. We identified 1602 proteins in the nucleolar and 2544 proteins in the nuclear fraction with an overlap of 1429 proteins. For a randomly selected set of proteins identified by the proteomic approach we confirmed the localization inferred from the proteomics data by the localization of GFP fusion proteins. We assigned the identified proteins to various complexes and functions and found about 519 plant proteins that have a potential to act as a RBFs, but which have not been experimentally characterized yet. Last, we compared the distribution of RBFs and RPs in the various fractions with the distribution established for yeast.

  6. Toxicity of ricin A chain is reduced in mammalian cells by inhibiting its interaction with the ribosome

    Energy Technology Data Exchange (ETDEWEB)

    Jetzt, Amanda E. [Department of Animal Sciences, Rutgers, The State University of New Jersey, New Brunswick, NJ 08901-8520 (United States); Li, Xiao-Ping; Tumer, Nilgun E. [Department of Plant Biology and Pathology, Rutgers, The State University of New Jersey, New Brunswick, NJ 08901-8520 (United States); Cohick, Wendie S., E-mail: cohick@aesop.rutgers.edu [Department of Animal Sciences, Rutgers, The State University of New Jersey, New Brunswick, NJ 08901-8520 (United States)

    2016-11-01

    Ricin is a potent ribotoxin that is considered a bioterror threat due to its ease of isolation and possibility of aerosolization. In yeast, mutation of arginine residues away from the active site results in a ricin toxin A chain (RTA) variant that is unable to bind the ribosome and exhibits reduced cytotoxicity. The goal of the present work was to determine if these residues contribute to ribosome binding and cytotoxicity of RTA in mammalian cells. The RTA mutant R193A/R235A did not interact with mammalian ribosomes, while a G212E variant with a point mutation near its active site bound ribosomes similarly to wild-type (WT) RTA. R193A/R235A retained full catalytic activity on naked RNA but had reduced activity on mammalian ribosomes. To determine the effect of this mutant in intact cells, pre R193A/R235A containing a signal sequence directing it to the endoplasmic reticulum and mature R193A/R235A that directly targeted cytosolic ribosomes were each expressed. Depurination and protein synthesis inhibition were reduced by both pre- and mature R193A/R235A relative to WT. Protein synthesis inhibition was reduced to a greater extent by R193A/R235A than by G212E. Pre R193A/R235A caused a greater reduction in caspase activation and loss of mitochondrial membrane potential than G212E relative to WT RTA. These findings indicate that an RTA variant with reduced ribosome binding is less toxic than a variant with less catalytic activity but normal ribosome binding activity. The toxin-ribosome interaction represents a novel target for the development of therapeutics to prevent or treat ricin intoxication. - Highlights: • Arginines 193 and 235 of RTA are critical for binding to the mammalian ribosome. • R193A/R235A has full catalytic activity on RNA but not on mammalian ribosomes. • R193A/R235A is less toxic than a mutant that targets the active site. • The toxin-ribosome interaction is a therapeutic target for ricin intoxication.

  7. Generation of monoclonal antibodies for the assessment of protein purification by recombinant ribosomal coupling

    DEFF Research Database (Denmark)

    Kristensen, Janni; Sperling-Petersen, Hans Uffe; Mortensen, Kim Kusk

    2005-01-01

    We recently described a conceptually novel method for the purification of recombinant proteins with a propensity to form inclusion bodies in the cytoplasm of Escherichia coli. Recombinant proteins were covalently coupled to the E. coli ribosome by fusing them to ribosomal protein 23 (rpL23...... therefore purified rpL23-GFP-His, rpL23-His and GFP from E. coli recombinants using affinity, ion exchange and hydrophobic interaction chromatography. These proteins could be purified with yields of 150, 150 and 1500 microg per gram cellular wet weight, respectively. However, rpL23-GFP-His could only...... proteolytic cleavage sites. We conclude that the generated antibodies can be used to evaluate ribosomal coupling of recombinant target proteins as well as the efficiency of their separation from the ribosome....

  8. Evolutionary dynamics of a conserved sequence motif in the ribosomal genes of the ciliate Paramecium

    Directory of Open Access Journals (Sweden)

    Lynch Michael

    2010-05-01

    Full Text Available Abstract Background In protozoa, the identification of preserved motifs by comparative genomics is often impeded by difficulties to generate reliable alignments for non-coding sequences. Moreover, the evolutionary dynamics of regulatory elements in 3' untranslated regions (both in protozoa and metazoa remains a virtually unexplored issue. Results By screening Paramecium tetraurelia's 3' untranslated regions for 8-mers that were previously found to be preserved in mammalian 3' UTRs, we detect and characterize a motif that is distinctly conserved in the ribosomal genes of this ciliate. The motif appears to be conserved across Paramecium aurelia species but is absent from the ribosomal genes of four additional non-Paramecium species surveyed, including another ciliate, Tetrahymena thermophila. Motif-free ribosomal genes retain fewer paralogs in the genome and appear to be lost more rapidly relative to motif-containing genes. Features associated with the discovered preserved motif are consistent with this 8-mer playing a role in post-transcriptional regulation. Conclusions Our observations 1 shed light on the evolution of a putative regulatory motif across large phylogenetic distances; 2 are expected to facilitate the understanding of the modulation of ribosomal genes expression in Paramecium; and 3 reveal a largely unexplored--and presumably not restricted to Paramecium--association between the presence/absence of a DNA motif and the evolutionary fate of its host genes.

  9. Cryo-EM structures of the 80S ribosomes from human parasites Trichomonas vaginalis and Toxoplasma gondii

    Institute of Scientific and Technical Information of China (English)

    Zhifei Li; Qiang Guo; Lvqin Zheng; Yongsheng Ji; Yi-Ting Xie; De-Hua Lai; Zhao-Rong Lun; Xun Suo; Ning Gao

    2017-01-01

    As an indispensable molecular machine universal in all living organisms,the ribosome has been selected by evolution to be the natural target of many antibiotics and small-molecule inhibitors.High-resolution structures of pathogen ribosomes are crucial for understanding the general and unique aspects of translation control in disease-causing microbes.With cryo-electron microscopy technique,we have determined structures of the cytosolic ribosomes from two human parasites,Trichomonas vaginalis and Toxoplasma gondii,at resolution of 3.2-3.4,(A).Although the ribosomal proteins from both pathogens are typical members of eukaryotic families,with a co-evolution pattern between certain species-specific insertions/extensions and neighboring ribosomal RNA (rRNA) expansion segments,the sizes of their rRNAs are sharply different.Very interestingly,rRNAs of T.vaginalis are in size comparable to prokaryotic counterparts,with nearly all the eukaryote-specific rRNA expansion segments missing.These structures facilitate the dissection of evolution path for ribosomal proteins and RNAs,and may aid in design of novel translation inhibitors.

  10. Karyotypic evolution of ribosomal sites in buffalo subspecies and their crossbreed

    Directory of Open Access Journals (Sweden)

    Tiago Marafiga Degrandi

    2014-06-01

    Full Text Available Domestic buffaloes are divided into two group based on cytogenetic characteristics and habitats: the "river buffaloes" with 2n = 50 and the "swamp buffaloes", 2n = 48. Nevertheless, their hybrids are viable, fertile and identified by a 2n = 49. In order to have a better characterization of these different cytotypes of buffaloes, and considering that NOR-bearing chromosomes are involved in the rearrangements responsible for the karyotypic differences, we applied silver staining (Ag-NOR and performed fluorescent in situ hybridization (FISH experiments using 18S rDNA as probe. Metaphases were obtained through blood lymphocyte culture of 21 individuals, including river, swamp and hybrid cytotypes. Ag-NOR staining revealed active NORs on six chromosome pairs (3p, 4p, 6, 21, 23, 24 in the river buffaloes, whereas the swamp buffaloes presented only five NOR-bearing pairs (4p, 6, 20, 22, 23. The F1 crossbreed had 11 chromosomes with active NORs, indicating expression of both parental chromosomes. FISH analysis confirmed the numerical divergence identified with Ag-NOR. This result is explained by the loss of the NOR located on chromosome 4p in the river buffalo, which is involved in the tandem fusion with chromosome 9 in this subspecies. A comparison with the ancestral cattle karyotype suggests that the NOR found on the 3p of the river buffalo may have originated from a duplication of ribosomal genes, resulting in the formation of new NOR sites in this subspecies.

  11. Assembly constraints drive co-evolution among ribosomal constituents.

    Science.gov (United States)

    Mallik, Saurav; Akashi, Hiroshi; Kundu, Sudip

    2015-06-23

    Ribosome biogenesis, a central and essential cellular process, occurs through sequential association and mutual co-folding of protein-RNA constituents in a well-defined assembly pathway. Here, we construct a network of co-evolving nucleotide/amino acid residues within the ribosome and demonstrate that assembly constraints are strong predictors of co-evolutionary patterns. Predictors of co-evolution include a wide spectrum of structural reconstitution events, such as cooperativity phenomenon, protein-induced rRNA reconstitutions, molecular packing of different rRNA domains, protein-rRNA recognition, etc. A correlation between folding rate of small globular proteins and their topological features is known. We have introduced an analogous topological characteristic for co-evolutionary network of ribosome, which allows us to differentiate between rRNA regions subjected to rapid reconstitutions from those hindered by kinetic traps. Furthermore, co-evolutionary patterns provide a biological basis for deleterious mutation sites and further allow prediction of potential antibiotic targeting sites. Understanding assembly pathways of multicomponent macromolecules remains a key challenge in biophysics. Our study provides a 'proof of concept' that directly relates co-evolution to biophysical interactions during multicomponent assembly and suggests predictive power to identify candidates for critical functional interactions as well as for assembly-blocking antibiotic target sites. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  12. Interaction of pleuromutilin derivatives with the ribosomal peptidyl transferase center

    DEFF Research Database (Denmark)

    Long, K. S.; Hansen, L. K.; Jakobsen, L.

    2006-01-01

    Tiamulin is a pleuromutilin antibiotic that is used in veterinary medicine. The recently published crystal structure of a tiamulin-50S ribosomal subunit complex provides detailed information about how this drug targets the peptidyl transferase center of the ribosome. To promote rational design...... mutant strain is resistant to tiamulin and pleuromutilin, but not valnemulin, implying that valnemulin is better able to withstand an altered rRNA binding surface around the mutilin core. This is likely due to additional interactions made between the valnemulin side chain extension and the rRNA binding...

  13. Production of RNA-protein cross links in γ irradiated E. Coli ribosomes

    International Nuclear Information System (INIS)

    Ekert, Bernard; Giocanti, Nicole

    1976-01-01

    γ irradiation in de-aerated conditions of E. coli MRE 600 ribosomes, labelled with 14 C uracil, leads to a decrease of extractibility of 14 C RNA by lithium chloride 4 M-urea 8 M. On the other hand, the radioactivity of the protein fraction increases with irradiation. These results strongly suggest that RNA-protein cross links are formed in irradiated ribosomes [fr

  14. Histone and ribosomal RNA repetitive gene clusters of the boll weevil are linked in a tandem array.

    Science.gov (United States)

    Roehrdanz, R; Heilmann, L; Senechal, P; Sears, S; Evenson, P

    2010-08-01

    Histones are the major protein component of chromatin structure. The histone family is made up of a quintet of proteins, four core histones (H2A, H2B, H3 & H4) and the linker histones (H1). Spacers are found between the coding regions. Among insects this quintet of genes is usually clustered and the clusters are tandemly repeated. Ribosomal DNA contains a cluster of the rRNA sequences 18S, 5.8S and 28S. The rRNA genes are separated by the spacers ITS1, ITS2 and IGS. This cluster is also tandemly repeated. We found that the ribosomal RNA repeat unit of at least two species of Anthonomine weevils, Anthonomus grandis and Anthonomus texanus (Coleoptera: Curculionidae), is interspersed with a block containing the histone gene quintet. The histone genes are situated between the rRNA 18S and 28S genes in what is known as the intergenic spacer region (IGS). The complete reiterated Anthonomus grandis histone-ribosomal sequence is 16,248 bp.

  15. Tyrosine 110 in the measles virus phosphoprotein is required to block STAT1 phosphorylation

    International Nuclear Information System (INIS)

    Devaux, Patricia; Messling, Veronika von; Songsungthong, Warangkhana; Springfeld, Christoph; Cattaneo, Roberto

    2007-01-01

    The measles virus (MV) P gene encodes three proteins: P, an essential polymerase cofactor, and C and V, which have multiple functions including immune evasion. We show here that the MV P protein also contributes to immune evasion, and that tyrosine 110 is required to block nuclear translocation of the signal transducer and activator of transcription factors (STAT) after interferon type I treatment. In particular, MV P inhibits STAT1 phosphorylation. This is shown not only by transient expression but also by reverse genetic analyses based on a new functional infectious cDNA derived from a MV vaccine vial (Moraten strain). Our study also identifies a conserved sequence around P protein tyrosine 110 as a candidate interaction site with a cellular protein

  16. Evidence for ribosomal frameshifting and a novel overlapping gene in the genomes of insect-specific flaviviruses

    International Nuclear Information System (INIS)

    Firth, Andrew E.; Blitvich, Bradley J.; Wills, Norma M.; Miller, Cathy L.; Atkins, John F.

    2010-01-01

    Flaviviruses have a positive-sense, single-stranded RNA genome of ∼11 kb, encoding a large polyprotein that is cleaved to produce ∼10 mature proteins. Cell fusing agent virus, Kamiti River virus, Culex flavivirus and several recently discovered flaviviruses have no known vertebrate host and apparently infect only insects. We present compelling bioinformatic evidence for a 253-295 codon overlapping gene (designated fifo) conserved throughout these insect-specific flaviviruses and immunofluorescent detection of its product. Fifo overlaps the NS2A/NS2B coding sequence in the - 1/+ 2 reading frame and is most likely expressed as a trans-frame fusion protein via ribosomal frameshifting at a conserved GGAUUUY slippery heptanucleotide with 3'-adjacent RNA secondary structure (which stimulates efficient frameshifting in vitro). The discovery bears striking parallels to the recently discovered ribosomal frameshifting site in the NS2A coding sequence of the Japanese encephalitis serogroup of flaviviruses and suggests that programmed ribosomal frameshifting may be more widespread in flaviviruses than currently realized.

  17. Intraspecific differentiation of Paramecium novaurelia strains (Ciliophora, Protozoa) inferred from phylogenetic analysis of ribosomal and mitochondrial DNA variation.

    Science.gov (United States)

    Tarcz, Sebastian

    2013-01-01

    Paramecium novaurelia Beale and Schneller, 1954, was first found in Scotland and is known to occur mainly in Europe, where it is the most common species of the P. aurelia complex. In recent years, two non-European localities have been described: Turkey and the United States of America. This article presents the analysis of intraspecific variability among 25 strains of P. novaurelia with the application of ribosomal and mitochondrial loci (ITS1-5.8S-ITS2, 5' large subunit rDNA (5'LSU rDNA) and cytochrome c oxidase subunit 1 (COI) mtDNA). The mean distance observed for all of the studied P. novaurelia sequence pairs was p=0.008/0.016/0.092 (ITS1-5.8S-ITS2/5'LSU rDNA/COI). Phylogenetic trees (NJ/MP/BI) based on a comparison of all of the analysed sequences show that the studied strains of P. novaurelia form a distinct clade, separate from the P. caudatum outgroup, and are divided into two clusters (A and B) and two branches (C and D). The occurrence of substantial genetic differentiation within P. novaurelia, confirmed by the analysed DNA fragments, indicates a rapid evolution of particular species within the Paramecium genus. Copyright © 2012 Elsevier GmbH. All rights reserved.

  18. Sublethal effects of imidacloprid on targeting muscle and ribosomal protein related genes in the honey bee Apis mellifera L.

    Science.gov (United States)

    Wu, Yan-Yan; Luo, Qi-Hua; Hou, Chun-Sheng; Wang, Qiang; Dai, Ping-Li; Gao, Jing; Liu, Yong-Jun; Diao, Qing-Yun

    2017-11-21

    A sublethal concentration of imidacloprid can cause chronic toxicity in bees and can impact the behavior of honey bees. The nectar- and water-collecting, and climbing abilities of bees are crucial to the survival of the bees and the execution of responsibilities in bee colonies. Besides behavioral impact, data on the molecular mechanisms underlying the toxicity of imidacloprid, especially by the way of RNA-seq at the transcriptomic level, are limited. We treated Apis mellifera L. with sublethal concentrations of imidacloprid (0.1, 1 and 10 ppb) and determined the effect on behaviors and the transcriptomic changes. The sublethal concentrations of imidacloprid had a limited impact on the survival and syrup consumption of bees, but caused a significant increase in water consumption. Moreover, the climbing ability was significantly impaired by 10 ppb imidacloprid at 8 d. In the RNA-seq analysis, gene ontology (GO) term enrichment indicated a significant down-regulation of muscle-related genes, which might contribute to the impairment in climbing ability of bees. The enriched GO terms were attributed to the up-regulated ribosomal protein genes. Considering the ribosomal and extra-ribosomal functions of the ribosomal proteins, we hypothesized that imidacloprid also causes cell dysfunction. Our findings further enhance the understanding of imidacloprid sublethal toxicity.

  19. Processing of the 17-S Escherichia coli precursor RNA in the 27-S pre-ribosomal particle

    Energy Technology Data Exchange (ETDEWEB)

    Hayes, F; Vasseur, M [Institut de Biologie Physico-Chimique, 75 - Paris (France)

    1976-01-01

    An RNase activity probably involved in the maturation of 16-S pre-ribosomal RNA in Escherichia coli has been partially purified from crude cell extracts. When 27-S ribosome precursor particles are incubated with this enzyme preparation in vitro, their 17-S RNA is converted to a product with the same electrophoretic mobility as mature 16-S rRNA. FingerprS rRNA. Generation of the normal 5'-P terminus seems to require a factor present in cell extracts since incubation of the 27-S precursor particle in an extract obtained after centrifugation at 30,000 x g causes conversion of the 17-S RNA to a 16-S species containing both termini of mature 16-S rRNS. Preliminary experiments suggest that correct maturation of the 5' end of the 17-S precursor RNA requires a system in which protein synthesis can take place.

  20. Photoaffinity labeling of the pactamycin binding site on eubacterial ribosomes

    International Nuclear Information System (INIS)

    Tejedor, F.; Amils, R.; Ballesta, J.P.

    1985-01-01

    Pactamycin, an inhibitor of the initial steps of protein synthesis, has an acetophenone group in its chemical structure that makes the drug a potentially photoreactive molecule. In addition, the presence of a phenolic residue makes it easily susceptible to radioactive labeling. Through iodination, one radioactive derivative of pactamycin has been obtained with biological activities similar to the unmodified drug when tested on in vivo and cell-free systems. With the use of [ 125 I]iodopactamycin, ribosomes of Escherichia coli have been photolabeled under conditions that preserve the activity of the particles and guarantee the specificity of the binding sites. Under these conditions, RNA is preferentially labeled when free, small ribosomal subunits are photolabeled, but proteins are the main target in the whole ribosome. This indicates that an important conformational change takes place in the binding site on association of the two subunits. The major labeled proteins are S2, S4, S18, S21, and L13. These proteins in the pactamycin binding site are probably related to the initiation step of protein synthesis

  1. Characterization of three different clusters of 18S-26S ribosomal DNA genes in the sea urchin P. lividus: Genetic and epigenetic regulation synchronous to 5S rDNA.

    Science.gov (United States)

    Bellavia, Daniele; Dimarco, Eufrosina; Caradonna, Fabio

    2016-04-15

    We previously reported the characterization 5S ribosomal DNA (rDNA) clusters in the common sea urchin Paracentrotus lividus and demonstrated the presence of DNA methylation-dependent silencing of embryo specific 5S rDNA cluster in adult tissue. In this work, we show genetic and epigenetic characterization of 18S-26S rDNA clusters in this specie. The results indicate the presence of three different 18S-26S rDNA clusters with different Non-Transcribed Spacer (NTS) regions that have different chromosomal localizations. Moreover, we show that the two largest clusters are hyper-methylated in the promoter-containing NTS regions in adult tissues, as in the 5S rDNA. These findings demonstrate an analogous epigenetic regulation in small and large rDNA clusters and support the logical synchronism in building ribosomes. In fact, all the ribosomal RNA genes must be synchronously and equally transcribed to perform their unique final product. Copyright © 2016 Elsevier B.V. All rights reserved.

  2. Pioglitazone enhances mitochondrial biogenesis and ribosomal protein biosynthesis in skeletal muscle in polycystic ovary syndrome

    DEFF Research Database (Denmark)

    Skov, Vibe; Glintborg, Dorte; Knudsen, Steen

    2008-01-01

    indicate that pioglitazone therapy restores insulin sensitivity, in part, by a coordinated upregulation of genes involved in mitochondrial OXPHOS and ribosomal protein biosynthesis in muscle in PCOS. These transcriptional effects of pioglitazone may contribute to prevent the onset of type 2 diabetes...... by changes in the transcriptional profile of muscle favoring insulin sensitivity. Using Affymetrix microarrays, we examined the effect of pioglitazone (30 mg/day for 16 weeks) on gene expression in skeletal muscle of 10 obese women with PCOS metabolically characterized by a euglycemic-hyperinsulinemic clamp...... Annotator and Pathway Profiler (GenMAPP 2.1) and Gene Set Enrichment Analysis (GSEA 2.0.1) revealed a significant upregulation of genes representing mitochondrial oxidative phosphorylation (OXPHOS), ribosomal proteins, mRNA processing reactome, translation factors, and proteasome degradation in PCOS after...

  3. Synthesis and methylation of ribosomal RNA in HeLa cells infected with the herpes virus pseudorabies virus

    International Nuclear Information System (INIS)

    Furlong, J.C.; Kyriakidis, S.; Stevely, W.S.

    1982-01-01

    The effects of infection with the herpes virus pseudorabies virus on the metabolism of HeLa cell ribosomal RNA were examined. There is a decline both in the synthesis of nucleolar 45S ribosomal precursor RNA and in its processing to mature cytoplasmic RNA. The methylated oligonucleotides in the ribosomal RNA species were studied. The methylation of cytoplasmic ribosomal RNA was essentially unchanged. However there was some undermethylation of the nucleolar precursor. If undermethylated RNA does not mature then this may partly explain the reduced processing in the infected cells. (Author)

  4. Transduced PEP-1-ribosomal protein S3 (rpS3) ameliorates 12-O-tetradecanoylphorbol-13-acetate-induced inflammation in mice

    International Nuclear Information System (INIS)

    Ahn, Eun Hee; Kim, Dae Won; Kang, Hye Won; Shin, Min Jae; Won, Moo Ho; Kim, Joon; Kim, Dong Joon; Kwon, Oh-Shin; Kang, Tae-Cheon; Han, Kyu Hyung; Park, Jinseu; Eum, Won Sik; Choi, Soo Young

    2010-01-01

    This study investigated the preventive effect of ribosomal protein S3 (rpS3) on 12-O-tetradecanoylphorbol-13-acetate (TPA)-induced ear edema in mice. A cell permeable expression vector PEP-1-rpS3 was constructed. Topical application of the vector markedly inhibited TPA-induced expression levels of cyclooxygenase-2 (COX-2) and pro-inflammatory cytokines. Application of PEP-1-rpS3 also resulted in a significant reduction in the activation of nuclear factor-kappa B (NF-kB) and mitogen-activated protein kinase (MAPK) in TPA-treated ears. These results indicate that PEP-1-rpS3 inhibits inflammatory response cytokines and enzymes by blocking NF-kB and MAPK, prompting the suggestion that PEP-1-rpS3 can be used as a therapeutic agent against skin inflammation.

  5. Location of the binding domains for the RNA polymerase L and the ribonucleocapsid template within different halves of the NS phosphoprotein of vesicular stomatitis virus

    International Nuclear Information System (INIS)

    Emerson, S.U.; Schubert, M.

    1987-01-01

    Recombinant DNA techniques were used to delete regions of a cDNA clone of the phosphoprotein NS gene of vesicular stomatitis virus. The complete NS gene and four mutant genes containing internal or terminal deletions were inserted into a modified pGem4 vector under the transcriptional control of the page T7 promoter. Run-off transcripts were synthesized and translated in vitro to provide [ 35 S]methionine-labeled complete NS or deletion mutant NS proteins. Immune coprecipitation assays involving these proteins were developed to map the regions of the NS protein responsible for binding to the structural viral nucleocapsid protein N and the catalytic RNA polymerase protein L. The data indicate the NS protein is a bivalent protein consisting of two discrete functional domains. Contrary to previous suggestions, the negatively charged amino-terminal half of NS protein binds to L protein, while the carboxyl-terminal half of NS protein binds to both soluble recombinant nucleocapsid protein N and viral ribonucleocapsid template

  6. Deficiency of vasodilator-stimulated phosphoprotein (VASP increases blood-brain-barrier damage and edema formation after ischemic stroke in mice.

    Directory of Open Access Journals (Sweden)

    Peter Kraft

    2010-12-01

    Full Text Available Stroke-induced brain edema formation is a frequent cause of secondary infarct growth and deterioration of neurological function. The molecular mechanisms underlying edema formation after stroke are largely unknown. Vasodilator-stimulated phosphoprotein (VASP is an important regulator of actin dynamics and stabilizes endothelial barriers through interaction with cell-cell contacts and focal adhesion sites. Hypoxia has been shown to foster vascular leakage by downregulation of VASP in vitro but the significance of VASP for regulating vascular permeability in the hypoxic brain in vivo awaits clarification.Focal cerebral ischemia was induced in Vasp(-/- mice and wild-type (WT littermates by transient middle cerebral artery occlusion (tMCAO. Evan's Blue tracer was applied to visualize the extent of blood-brain-barrier (BBB damage. Brain edema formation and infarct volumes were calculated from 2,3,5-triphenyltetrazolium chloride (TTC-stained brain slices. Both mouse groups were carefully controlled for anatomical and physiological parameters relevant for edema formation and stroke outcome. BBB damage (p0.05 towards worse neurological outcomes.Our study identifies VASP as critical regulator of BBB maintenance during acute ischemic stroke. Therapeutic modulation of VASP or VASP-dependent signalling pathways could become a novel strategy to combat excessive edema formation in ischemic brain damage.

  7. Dopamine D1 receptors and phosphorylation of dopamine- and cyclic AMP-regulated phosphoprotein-32 in the medial preoptic area are involved in experience-induced enhancement of male sexual behavior in rats.

    Science.gov (United States)

    McHenry, Jenna A; Bell, Genevieve A; Parrish, Bradley P; Hull, Elaine M

    2012-08-01

    The medial preoptic area (MPOA) is an integral site for male sexual behavior. Dopamine is released in the MPOA before and during copulation and facilitates male rat sexual behavior. Repeated sexual experience and noncopulatory exposures to an estrous female facilitate subsequent copulation. However, the neurobiological mechanisms that mediate such enhancement remain unclear. Here, we examined the role of dopamine D₁ receptors in the MPOA in experience-induced enhancement of male sexual behavior in rats. In experiment 1, microinjections of the D₁ antagonist SCH-23390 into the MPOA before each of seven daily 30-min noncopulatory exposures to a receptive female impaired copulation on a drug-free test on Day 8, compared to vehicle-treated female-exposed animals. Copulatory performance in drug-treated animals was similar to that of vehicle-treated males that had not been preexposed to females. This effect was site specific. There were no group differences in locomotor activity in an open field on the copulation test day. In experiment 2, a separate cohort of animals was used to examine phosphorylation of dopamine- and cAMP-regulated phosphoprotein (DARPP-32) in the MPOA of animals with acute and/or chronic sexual experience. DARPP-32 is a downstream marker of D₁ receptor signaling and substrate of cAMP-dependent protein kinase (PKA). Western immunoblot analysis revealed that p-DARPP-32 expression was greatest in the MPOA of males that received both acute and chronic sexual experience, compared to all other mated conditions and naïve controls. These data suggest that D₁ receptors in the MPOA contribute to experience-induced enhancement of male sexual behavior, perhaps through a PKA regulated mechanism.

  8. Free-Energy Landscape of Reverse tRNA Translocation through the Ribosome Analyzed by Electron Microscopy Density Maps and Molecular Dynamics Simulations

    Science.gov (United States)

    Ishida, Hisashi; Matsumoto, Atsushi

    2014-01-01

    To understand the mechanism of reverse tRNA translocation in the ribosome, all-atom molecular dynamics simulations of the ribosome-tRNAs-mRNA-EFG complex were performed. The complex at the post-translocational state was directed towards the translocational and pre-translocational states by fitting the complex into cryo-EM density maps. Between a series of the fitting simulations, umbrella sampling simulations were performed to obtain the free-energy landscape. Multistep structural changes, such as a ratchet-like motion and rotation of the head of the small subunit were observed. The free-energy landscape showed that there were two main free-energy barriers: one between the post-translocational and intermediate states, and the other between the pre-translocational and intermediate states. The former corresponded to a clockwise rotation, which was coupled to the movement of P-tRNA over the P/E-gate made of G1338, A1339 and A790 in the small subunit. The latter corresponded to an anticlockwise rotation of the head, which was coupled to the location of the two tRNAs in the hybrid state. This indicates that the coupled motion of the head rotation and tRNA translocation plays an important role in opening and closing of the P/E-gate during the ratchet-like movement in the ribosome. Conformational change of EF-G was interpreted to be the result of the combination of the external motion by L12 around an axis passing near the sarcin-ricin loop, and internal hinge-bending motion. These motions contributed to the movement of domain IV of EF-G to maintain its interaction with A/P-tRNA. PMID:24999999

  9. Free-energy landscape of reverse tRNA translocation through the ribosome analyzed by electron microscopy density maps and molecular dynamics simulations.

    Directory of Open Access Journals (Sweden)

    Hisashi Ishida

    Full Text Available To understand the mechanism of reverse tRNA translocation in the ribosome, all-atom molecular dynamics simulations of the ribosome-tRNAs-mRNA-EFG complex were performed. The complex at the post-translocational state was directed towards the translocational and pre-translocational states by fitting the complex into cryo-EM density maps. Between a series of the fitting simulations, umbrella sampling simulations were performed to obtain the free-energy landscape. Multistep structural changes, such as a ratchet-like motion and rotation of the head of the small subunit were observed. The free-energy landscape showed that there were two main free-energy barriers: one between the post-translocational and intermediate states, and the other between the pre-translocational and intermediate states. The former corresponded to a clockwise rotation, which was coupled to the movement of P-tRNA over the P/E-gate made of G1338, A1339 and A790 in the small subunit. The latter corresponded to an anticlockwise rotation of the head, which was coupled to the location of the two tRNAs in the hybrid state. This indicates that the coupled motion of the head rotation and tRNA translocation plays an important role in opening and closing of the P/E-gate during the ratchet-like movement in the ribosome. Conformational change of EF-G was interpreted to be the result of the combination of the external motion by L12 around an axis passing near the sarcin-ricin loop, and internal hinge-bending motion. These motions contributed to the movement of domain IV of EF-G to maintain its interaction with A/P-tRNA.

  10. Isolation and characterization of an RIP (ribosome-inactivating protein)-like protein from tobacco with dual enzymatic activity.

    Science.gov (United States)

    Sharma, Neelam; Park, Sang-Wook; Vepachedu, Ramarao; Barbieri, Luigi; Ciani, Marialibera; Stirpe, Fiorenzo; Savary, Brett J; Vivanco, Jorge M

    2004-01-01

    Ribosome-inactivating proteins (RIPs) are N-glycosidases that remove a specific adenine from the sarcin/ricin loop of the large rRNA, thus arresting protein synthesis at the translocation step. In the present study, a protein termed tobacco RIP (TRIP) was isolated from tobacco (Nicotiana tabacum) leaves and purified using ion exchange and gel filtration chromatography in combination with yeast ribosome depurination assays. TRIP has a molecular mass of 26 kD as evidenced by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and showed strong N-glycosidase activity as manifested by the depurination of yeast rRNA. Purified TRIP showed immunoreactivity with antibodies of RIPs from Mirabilis expansa. TRIP released fewer amounts of adenine residues from ribosomal (Artemia sp. and rat ribosomes) and non-ribosomal substrates (herring sperm DNA, rRNA, and tRNA) compared with other RIPs. TRIP inhibited translation in wheat (Triticum aestivum) germ more efficiently than in rabbit reticulocytes, showing an IC50 at 30 ng in the former system. Antimicrobial assays using highly purified TRIP (50 microg mL(-1)) conducted against various fungi and bacterial pathogens showed the strongest inhibitory activity against Trichoderma reesei and Pseudomonas solancearum. A 15-amino acid internal polypeptide sequence of TRIP was identical with the internal sequences of the iron-superoxide dismutase (Fe-SOD) from wild tobacco (Nicotiana plumbaginifolia), Arabidopsis, and potato (Solanum tuberosum). Purified TRIP showed SOD activity, and Escherichia coli Fe-SOD was observed to have RIP activity too. Thus, TRIP may be considered a dual activity enzyme showing RIP-like activity and Fe-SOD characteristics.

  11. Cleavage of nicotinamide adenine dinucleotide by the ribosome-inactivating protein from Momordica charantia.

    Science.gov (United States)

    Vinkovic, M; Dunn, G; Wood, G E; Husain, J; Wood, S P; Gill, R

    2015-09-01

    The interaction of momordin, a type 1 ribosome-inactivating protein from Momordica charantia, with NADP(+) and NADPH has been investigated by X-ray diffraction analysis of complexes generated by co-crystallization and crystal soaking. It is known that the proteins of this family readily cleave the adenine-ribose bond of adenosine and related nucleotides in the crystal, leaving the product, adenine, bound to the enzyme active site. Surprisingly, the nicotinamide-ribose bond of oxidized NADP(+) is cleaved, leaving nicotinamide bound in the active site in the same position but in a slightly different orientation to that of the five-membered ring of adenine. No binding or cleavage of NADPH was observed at pH 7.4 in these experiments. These observations are in accord with current views of the enzyme mechanism and may contribute to ongoing searches for effective inhibitors.

  12. Conservation of RNA sequence and cross-linking ability in ribosomes from a higher eukaryote: photochemical cross-linking of the anticodon of P site bound tRNA to the penultimate cytidine of the UACACACG sequence in Artemia salina 18S rRNA

    International Nuclear Information System (INIS)

    Ciesiolka, J.; Nurse, K.; Klein, J.; Ofengand, J.

    1985-01-01

    The complex of Artemia salina ribosomes and Escherichia coli acetylvalyl-tRNA could be cross-linked by irradiation with near-UV light. Cross-linking required the presence of the codon GUU, GUA being ineffective. The acetylvalyl group could be released from the cross-linked tRNA by treatment with puromycin, demonstrating that cross-linking had occurred at the P site. This was true both for pGUU- and also for poly(U2,G)-dependent cross-linking. All of the cross-linking was to the 18S rRNA of the small ribosomal subunit. Photolysis of the cross-link at 254 nm occurred with the same kinetics as that for the known cyclobutane dimer between this tRNA and Escherichia coli 16S rRNA. T1 RNase digestion of the cross-linked tRNA yielded an oligonucleotide larger in molecular weight than any from un-cross-linked rRNA or tRNA or from a prephotolyzed complex. Extended electrophoresis showed this material to consist of two oligomers of similar mobility, a faster one-third component and a slower two-thirds component. Each oligomer yielded two components on 254-nm photolysis. The slower band from each was the tRNA T1 oligomer CACCUCCCUVACAAGp, which includes the anticodon. The faster band was the rRNA 9-mer UACACACCGp and its derivative UACACACUG. Unexpectedly, the dephosphorylated and slower moving 9-mer was derived from the faster moving dimer. Deamination of the penultimate C to U is probably due to cyclobutane dimer formation and was evidence for that nucleotide being the site of cross-linking. Direct confirmation of the cross-linking site was obtained by Z-gel analysis

  13. Structure of the ribosomal interacting GTPase YjeQ from the enterobacterial species Salmonella typhimurium

    International Nuclear Information System (INIS)

    Nichols, C. E.; Johnson, C.; Lamb, H. K.; Lockyer, M.; Charles, I. G.; Hawkins, A. R.; Stammers, D. K.

    2007-01-01

    The X-ray crystal structure of the GTPase YjeQ from S. typhimurium is presented and compared with those of orthologues from T. maritima and B. subtilis. The YjeQ class of P-loop GTPases assist in ribosome biogenesis and also bind to the 30S subunit of mature ribosomes. YjeQ ribosomal binding is GTP-dependent and thought to specifically direct protein synthesis, although the nature of the upstream signal causing this event in vivo is as yet unknown. The attenuating effect of YjeQ mutants on bacterial growth in Escherichia coli makes it a potential target for novel antimicrobial agents. In order to further explore the structure and function of YjeQ, the isolation, crystallization and structure determination of YjeQ from the enterobacterial species Salmonella typhimurium (StYjeQ) is reported. Whilst the overall StYjeQ fold is similar to those of the previously reported Thematoga maritima and Bacillus subtilis orthologues, particularly the GTPase domain, there are larger differences in the three OB folds. Although the zinc-finger secondary structure is conserved, significant sequence differences alter the nature of the external surface in each case and may reflect varying signalling pathways. Therefore, it may be easier to develop YjeQ-specific inhibitors that target the N- and C-terminal regions, disrupting the metabolic connectivity rather than the GTPase activity. The availability of coordinates for StYjeQ will provide a significantly improved basis for threading Gram-negative orthologue sequences and in silico compound-screening studies, with the potential for the development of species-selective drugs

  14. Structure of the ribosomal interacting GTPase YjeQ from the enterobacterial species Salmonella typhimurium

    Energy Technology Data Exchange (ETDEWEB)

    Nichols, C. E. [Division of Structural Biology, The Wellcome Trust Centre for Human Genetics, University of Oxford, Roosevelt Drive, Oxford OX3 7BN (United Kingdom); Johnson, C.; Lamb, H. K. [Institute of Cell and Molecular Biosciences, Catherine Cookson Building, Medical School, Framlington Place, Newcastle University, Newcastle-upon-Tyne NE2 4HH (United Kingdom); Lockyer, M. [Arrow Therapeutics Ltd, Britannia House, Trinity Street, Borough, London SE1 1DA (United Kingdom); Charles, I. G. [The Wolfson Institute for Biomedical Research, The Cruciform Building, University College London, Gower Street, London WC1E 6BT (United Kingdom); Hawkins, A. R. [Institute of Cell and Molecular Biosciences, Catherine Cookson Building, Medical School, Framlington Place, Newcastle University, Newcastle-upon-Tyne NE2 4HH (United Kingdom); Stammers, D. K., E-mail: daves@strubi.ox.ac.uk [Division of Structural Biology, The Wellcome Trust Centre for Human Genetics, University of Oxford, Roosevelt Drive, Oxford OX3 7BN (United Kingdom)

    2007-11-01

    The X-ray crystal structure of the GTPase YjeQ from S. typhimurium is presented and compared with those of orthologues from T. maritima and B. subtilis. The YjeQ class of P-loop GTPases assist in ribosome biogenesis and also bind to the 30S subunit of mature ribosomes. YjeQ ribosomal binding is GTP-dependent and thought to specifically direct protein synthesis, although the nature of the upstream signal causing this event in vivo is as yet unknown. The attenuating effect of YjeQ mutants on bacterial growth in Escherichia coli makes it a potential target for novel antimicrobial agents. In order to further explore the structure and function of YjeQ, the isolation, crystallization and structure determination of YjeQ from the enterobacterial species Salmonella typhimurium (StYjeQ) is reported. Whilst the overall StYjeQ fold is similar to those of the previously reported Thematoga maritima and Bacillus subtilis orthologues, particularly the GTPase domain, there are larger differences in the three OB folds. Although the zinc-finger secondary structure is conserved, significant sequence differences alter the nature of the external surface in each case and may reflect varying signalling pathways. Therefore, it may be easier to develop YjeQ-specific inhibitors that target the N- and C-terminal regions, disrupting the metabolic connectivity rather than the GTPase activity. The availability of coordinates for StYjeQ will provide a significantly improved basis for threading Gram-negative orthologue sequences and in silico compound-screening studies, with the potential for the development of species-selective drugs.

  15. A new version of the RDP (Ribosomal Database Project)

    Science.gov (United States)

    Maidak, B. L.; Cole, J. R.; Parker, C. T. Jr; Garrity, G. M.; Larsen, N.; Li, B.; Lilburn, T. G.; McCaughey, M. J.; Olsen, G. J.; Overbeek, R.; hide

    1999-01-01

    The Ribosomal Database Project (RDP-II), previously described by Maidak et al. [ Nucleic Acids Res. (1997), 25, 109-111], is now hosted by the Center for Microbial Ecology at Michigan State University. RDP-II is a curated database that offers ribosomal RNA (rRNA) nucleotide sequence data in aligned and unaligned forms, analysis services, and associated computer programs. During the past two years, data alignments have been updated and now include >9700 small subunit rRNA sequences. The recent development of an ObjectStore database will provide more rapid updating of data, better data accuracy and increased user access. RDP-II includes phylogenetically ordered alignments of rRNA sequences, derived phylogenetic trees, rRNA secondary structure diagrams, and various software programs for handling, analyzing and displaying alignments and trees. The data are available via anonymous ftp (ftp.cme.msu. edu) and WWW (http://www.cme.msu.edu/RDP). The WWW server provides ribosomal probe checking, approximate phylogenetic placement of user-submitted sequences, screening for possible chimeric rRNA sequences, automated alignment, and a suggested placement of an unknown sequence on an existing phylogenetic tree. Additional utilities also exist at RDP-II, including distance matrix, T-RFLP, and a Java-based viewer of the phylogenetic trees that can be used to create subtrees.

  16. MMB-GUI: a fast morphing method demonstrates a possible ribosomal tRNA translocation trajectory.

    Science.gov (United States)

    Tek, Alex; Korostelev, Andrei A; Flores, Samuel Coulbourn

    2016-01-08

    Easy-to-use macromolecular viewers, such as UCSF Chimera, are a standard tool in structural biology. They allow rendering and performing geometric operations on large complexes, such as viruses and ribosomes. Dynamical simulation codes enable modeling of conformational changes, but may require considerable time and many CPUs. There is an unmet demand from structural and molecular biologists for software in the middle ground, which would allow visualization combined with quick and interactive modeling of conformational changes, even of large complexes. This motivates MMB-GUI. MMB uses an internal-coordinate, multiscale approach, yielding as much as a 2000-fold speedup over conventional simulation methods. We use Chimera as an interactive graphical interface to control MMB. We show how this can be used for morphing of macromolecules that can be heterogeneous in biopolymer type, sequence, and chain count, accurately recapitulating structural intermediates. We use MMB-GUI to create a possible trajectory of EF-G mediated gate-passing translocation in the ribosome, with all-atom structures. This shows that the GUI makes modeling of large macromolecules accessible to a wide audience. The morph highlights similarities in tRNA conformational changes as tRNA translocates from A to P and from P to E sites and suggests that tRNA flexibility is critical for translocation completion. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  17. Tetrahymena thermophila acidic ribosomal protein L37 contains an archaebacterial type of C-terminus.

    Science.gov (United States)

    Hansen, T S; Andreasen, P H; Dreisig, H; Højrup, P; Nielsen, H; Engberg, J; Kristiansen, K

    1991-09-15

    We have cloned and characterized a Tetrahymena thermophila macronuclear gene (L37) encoding the acidic ribosomal protein (A-protein) L37. The gene contains a single intron located in the 3'-part of the coding region. Two major and three minor transcription start points (tsp) were mapped 39 to 63 nucleotides upstream from the translational start codon. The uppermost tsp mapped to the first T in a putative T. thermophila RNA polymerase II initiator element, TATAA. The coding region of L37 predicts a protein of 109 amino acid (aa) residues. A substantial part of the deduced aa sequence was verified by protein sequencing. The T. thermophila L37 clearly belongs to the P1-type family of eukaryotic A-proteins, but the C-terminal region has the hallmarks of archaebacterial A-proteins.

  18. Expression of the double-stranded RNA of the soybean pod borer Leguminivora glycinivorella (Lepidoptera: Tortricidae) ribosomal protein P0 gene enhances the resistance of transgenic soybean plants.

    Science.gov (United States)

    Meng, Fanli; Li, Yang; Zang, Zhenyuan; Li, Na; Ran, Ruixue; Cao, Yingxue; Li, Tianyu; Zhou, Quan; Li, Wenbin

    2017-12-01

    The soybean pod borer [SPB; Leguminivora glycinivorella (Matsumura) (Lepidoptera: Tortricidae)] is the most important soybean pest in northeastern Asia. Silencing genes using plant-mediated RNA-interference is a promising strategy for controlling SPB infestations. The ribosomal protein P0 is important for protein translation and DNA repair in the SPB. Thus, transferring P0 double-stranded RNA (dsRNA) into plants may help prevent SPB-induced damage. We investigated the effects of SpbP0 dsRNA injections and SpbP0 dsRNA-expressing transgenic soybean plants on the SPB. Larval mortality rates were greater for SpbP0 dsRNA-injected larvae (96%) than for the control larvae (31%) at 14 days after injections. Transgenic T 2 soybean plants expressing SpbP0 dsRNA sustained less damage from SPB larvae than control plants. In addition, the expression level of the SpbP0 gene decreased and the mortality rate increased when SPB larvae were fed on T 3 transgenic soybean pods. Moreover, the surviving larvae were deformed and exhibited inhibited growth. Silencing SpbP0 expression is lethal to the SPB. Transgenic soybean plants expressing SpbP0 dsRNA are more resistant to the SPB than wild-type plants. Thus, SpbP0 dsRNA-expressing transgenic plants may be useful for controlling insect pests. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

  19. Several genes encoding ribosomal proteins are over-expressed in prostate-cancer cell lines: confirmation of L7a and L37 over-expression in prostate-cancer tissue samples.

    Science.gov (United States)

    Vaarala, M H; Porvari, K S; Kyllönen, A P; Mustonen, M V; Lukkarinen, O; Vihko, P T

    1998-09-25

    A cDNA library specific for mRNA over-expressed in prostate cancer was generated by subtractive hybridization of transcripts originating from prostatic hyperplasia and cancer tissues. cDNA encoding ribosomal proteins L4, L5, L7a, L23a, L30, L37, S14 and S18 was found to be present among 100 analyzed clones. Levels of ribosomal mRNA were significantly higher at least in one of the prostate-cancer cell lines, LNCaP, DU-145 and PC-3, than in hyperplastic tissue, as determined by slot-blot hybridization. Furthermore, L23a- and S14-transcript levels were significantly elevated in PC-3 cells as compared with those in the normal prostate epithelial cell line PrEC. Generally, dramatic changes in the mRNA content of the ribosomal proteins were not detected, the most evident over-expression being that of L37 mRNA, which was 3.4 times more abundant in LNCaP cells than in hyperplastic prostate tissue. The over-expression of L7a and L37 mRNA was confirmed in prostate-cancer tissue samples by in situ hybridization. Elevated cancer-related expression of L4 and L30 has not been reported, but levels of the other ribosomal proteins are known to be increased in several types of cancers. These results therefore suggest that prostate cancer is comparable with other types of cancers, in that a larger pool of some ribosomal proteins is gained during the transformation process, by an unknown mechanism.

  20. Ribosomal protein L5 has a highly twisted concave surface and flexible arms responsible for rRNA binding.

    OpenAIRE

    Nakashima, T; Yao, M; Kawamura, S; Iwasaki, K; Kimura, M; Tanaka, I

    2001-01-01

    Ribosomal protein L5 is a 5S rRNA binding protein in the large subunit and plays an essential role in the promotion of a particular conformation of 5S rRNA. The crystal structure of the ribosomal protein L5 from Bacillus stearothermophilus has been determined at 1.8 A resolution. The molecule consists of a five-stranded antiparallel beta-sheet and four alpha-helices, which fold in a way that is topologically similar to the ribonucleoprotein (RNP) domain. The molecular shape and electrostatic ...

  1. Increasing pro-survival factors within whole brain tissue of Sprague Dawley rats via intracerebral administration of modified valproic acid

    Directory of Open Access Journals (Sweden)

    Ryan C. Bates

    2015-08-01

    Full Text Available Neural tissue exposure to valproic acid (VPA increases several pro-survival phospho-proteins that can be used as biomarkers for indicating a beneficial drug response (pAktSer473, pGSK3βSer9, pErk1/2Thr202/Tyr204. Unfortunately, targeting VPA to neural tissue is a problem due to severe asymmetrical distribution, wherein the drug tends to remain in peripheral blood rather than localizing within the brain. Intracerebral delivery of an amide-linked VPA–PEG conjugate could address these issues by enhancing retention and promoting cerebro-global increases in pro-survival phospho-proteins. It is necessary to assay for the retained bioactivity of a PEGylated valproic acid molecule, along with locating an intracranial cannula placement that optimizes the increase of a known downstream biomarker for chronic VPA exposure. Here we show an acute injection of VPA–PEG conjugate within brain tissue increased virtually all of the assayed phospho-proteins, including well-known pro-survival factors. In contrast, an acute injection of VPA expectedly decreased signaling throughout the hour. Needle penetration into whole brain tissue is the intentional cause of trauma in this procedure. The trauma to brain tissue was observed to overcome known phospho-protein increases for unmodified VPA in the injected solution, while VPA–PEG conjugate appeared to induce significant increases in pro-survival phospho-proteins, despite the procedural trauma.

  2. Mutational analysis of S12 protein and implications for the accuracy of decoding by the ribosome.

    Science.gov (United States)

    Sharma, Divya; Cukras, Anthony R; Rogers, Elizabeth J; Southworth, Daniel R; Green, Rachel

    2007-12-07

    The fidelity of aminoacyl-tRNA selection by the ribosome depends on a conformational switch in the decoding center of the small ribosomal subunit induced by cognate but not by near-cognate aminoacyl-tRNA. The aminoglycosides paromomycin and streptomycin bind to the decoding center and induce related structural rearrangements that explain their observed effects on miscoding. Structural and biochemical studies have identified ribosomal protein S12 (as well as specific nucleotides in 16S ribosomal RNA) as a critical molecular contributor in distinguishing between cognate and near-cognate tRNA species as well as in promoting more global rearrangements in the small subunit, referred to as "closure." Here we use a mutational approach to define contributions made by two highly conserved loops in S12 to the process of tRNA selection. Most S12 variant ribosomes tested display increased levels of fidelity (a "restrictive" phenotype). Interestingly, several variants, K42A and R53A, were substantially resistant to the miscoding effects of paromomycin. Further characterization of the compromised paromomycin response identified a probable second, fidelity-modulating binding site for paromomycin in the 16S ribosomal RNA that facilitates closure of the small subunit and compensates for defects associated with the S12 mutations.

  3. Dwell-Time Distribution, Long Pausing and Arrest of Single-Ribosome Translation through the mRNA Duplex.

    Science.gov (United States)

    Xie, Ping

    2015-10-09

    Proteins in the cell are synthesized by a ribosome translating the genetic information encoded on the single-stranded messenger RNA (mRNA). It has been shown that the ribosome can also translate through the duplex region of the mRNA by unwinding the duplex. Here, based on our proposed model of the ribosome translation through the mRNA duplex we study theoretically the distribution of dwell times of the ribosome translation through the mRNA duplex under the effect of a pulling force externally applied to the ends of the mRNA to unzip the duplex. We provide quantitative explanations of the available single molecule experimental data on the distribution of dwell times with both short and long durations, on rescuing of the long paused ribosomes by raising the pulling force to unzip the duplex, on translational arrests induced by the mRNA duplex and Shine-Dalgarno(SD)-like sequence in the mRNA. The functional consequences of the pauses or arrests caused by the mRNA duplex and the SD sequence are discussed and compared with those obtained from other types of pausing, such as those induced by "hungry" codons or interactions of specific sequences in the nascent chain with the ribosomal exit tunnel.

  4. The Potential of Targeting Ribosome Biogenesis in High-Grade Serous Ovarian Cancer

    Directory of Open Access Journals (Sweden)

    Shunfei Yan

    2017-01-01

    Full Text Available Overall survival for patients with ovarian cancer (OC has shown little improvement for decades meaning new therapeutic options are critical. OC comprises multiple histological subtypes, of which the most common and aggressive subtype is high-grade serous ovarian cancer (HGSOC. HGSOC is characterized by genomic structural variations with relatively few recurrent somatic mutations or dominantly acting oncogenes that can be targeted for the development of novel therapies. However, deregulation of pathways controlling homologous recombination (HR and ribosome biogenesis has been observed in a high proportion of HGSOC, raising the possibility that targeting these basic cellular processes may provide improved patient outcomes. The poly (ADP-ribose polymerase (PARP inhibitor olaparib has been approved to treat women with defects in HR due to germline BRCA mutations. Recent evidence demonstrated the efficacy of targeting ribosome biogenesis with the specific inhibitor of ribosomal RNA synthesis, CX-5461 in v-myc avian myelocytomatosis viral oncogene homolog (MYC-driven haematological and prostate cancers. CX-5461 has now progressed to a phase I clinical trial in patients with haematological malignancies and phase I/II trial in breast cancer. Here we review the currently available targeted therapies for HGSOC and discuss the potential of targeting ribosome biogenesis as a novel therapeutic approach against HGSOC.

  5. Comparative Immunohistochemical Analysis of Ochratoxin A Tumourigenesis in Rats and Urinary Tract Carcinoma in Humans; Mechanistic Significance of p-S6 Ribosomal Protein Expression

    Directory of Open Access Journals (Sweden)

    Sarah Pinder

    2012-09-01

    Full Text Available Ochratoxin A (OTA is considered to be a possible human urinary tract carcinogen, based largely on a rat model, but no molecular genetic changes in the rat carcinomas have yet been defined. The phosphorylated-S6 ribosomal protein is a marker indicating activity of the mammalian target of rapamycin, which is a serine/threonine kinase with a key role in protein biosynthesis, cell proliferation, transcription, cellular metabolism and apoptosis, while being functionally deregulated in cancer. To assess p-S6 expression we performed immunohistochemistry on formalin-fixed and paraffin-embedded tumours and normal tissues. Marked intensity of p-S6 expression was observed in highly proliferative regions of rat renal carcinomas and a rare angiosarcoma, all of which were attributed to prolonged exposure to dietary OTA. Only very small OTA-generated renal adenomas were negative for p-S6. Examples of rat subcutaneous fibrosarcoma and testicular seminoma, as well as of normal renal tissue, showed no or very weak positive staining. In contrast to the animal model, human renal cell carcinoma, upper urinary tract transitional cell carcinoma from cases of Balkan endemic nephropathy, and a human angiosarcoma were negative for p-S6. The combined findings are reminiscent of constitutive changes in the rat tuberous sclerosis gene complex in the Eker strain correlated with renal neoplasms, Therefore rat renal carcinogenesis caused by OTA does not obviously mimic human urinary tract tumourigenesis.

  6. Translational regulation of ribosomal protein S15 drives characteristic patterns of protein-mRNA epistasis.

    Science.gov (United States)

    Mallik, Saurav; Basu, Sudipto; Hait, Suman; Kundu, Sudip

    2018-04-21

    Do coding and regulatory segments of a gene co-evolve with each-other? Seeking answers to this question, here we analyze the case of Escherichia coli ribosomal protein S15, that represses its own translation by specifically binding its messenger RNA (rpsO mRNA) and stabilizing a pseudoknot structure at the upstream untranslated region, thus trapping the ribosome into an incomplete translation initiation complex. In the absence of S15, ribosomal protein S1 recognizes rpsO and promotes translation by melting this very pseudoknot. We employ a robust statistical method to detect signatures of positive epistasis between residue site pairs and find that biophysical constraints of translational regulation (S15-rpsO and S1-rpsO recognition, S15-mediated rpsO structural rearrangement, and S1-mediated melting) are strong predictors of positive epistasis. Transforming the epistatic pairs into a network, we find that signatures of two different, but interconnected regulatory cascades are imprinted in the sequence-space and can be captured in terms of two dense network modules that are sparsely connected to each other. This network topology further reflects a general principle of how functionally coupled components of biological networks are interconnected. These results depict a model case, where translational regulation drives characteristic residue-level epistasis-not only between a protein and its own mRNA but also between a protein and the mRNA of an entirely different protein. © 2018 Wiley Periodicals, Inc.

  7. Phylogenetic utility of ribosomal genes for reconstructing the phylogeny of five Chinese satyrine tribes (Lepidoptera, Nymphalidae

    Directory of Open Access Journals (Sweden)

    Mingsheng Yang

    2015-03-01

    Full Text Available Satyrinae is one of twelve subfamilies of the butterfly family Nymphalidae, which currently includes nine tribes. However, phylogenetic relationships among them remain largely unresolved, though different researches have been conducted based on both morphological and molecular data. However, ribosomal genes have never been used in tribe level phylogenetic analyses of Satyrinae. In this study we investigate for the first time the phylogenetic relationships among the tribes Elymniini, Amathusiini, Zetherini and Melanitini which are indicated to be a monophyletic group, and the Satyrini, using two ribosomal genes (28s rDNA and 16s rDNA and four protein-coding genes (EF-1α, COI, COII and Cytb. We mainly aim to assess the phylogenetic informativeness of the ribosomal genes as well as clarify the relationships among different tribes. Our results show the two ribosomal genes generally have the same high phylogenetic informativeness compared with EF-1α; and we infer the 28s rDNA would show better informativeness if the 28s rDNA sequence data for each sampling taxon are obtained in this study. The placement of the monotypic genus Callarge Leech in Zetherini is confirmed for the first time based on molecular evidence. In addition, our maximum likelihood (ML and Bayesian inference (BI trees consistently show that the involved Satyrinae including the Amathusiini is monophyletic with high support values. Although the relationships among the five tribes are identical among ML and BI analyses and are mostly strongly-supported in BI analysis, those in ML analysis are lowly- or moderately- supported. Therefore, the relationships among the related five tribes recovered herein need further verification based on more sampling taxa.

  8. Probing the structure of ribosome assembly intermediates in vivo using DMS and hydroxyl radical footprinting.

    Science.gov (United States)

    Hulscher, Ryan M; Bohon, Jen; Rappé, Mollie C; Gupta, Sayan; D'Mello, Rhijuta; Sullivan, Michael; Ralston, Corie Y; Chance, Mark R; Woodson, Sarah A

    2016-07-01

    The assembly of the Escherichia coli ribosome has been widely studied and characterized in vitro. Despite this, ribosome biogenesis in living cells is only partly understood because assembly is coupled with transcription, modification and processing of the pre-ribosomal RNA. We present a method for footprinting and isolating pre-rRNA as it is synthesized in E. coli cells. Pre-rRNA synthesis is synchronized by starvation, followed by nutrient upshift. RNA synthesized during outgrowth is metabolically labeled to facilitate isolation of recent transcripts. Combining this technique with two in vivo RNA probing methods, hydroxyl radical and DMS footprinting, allows the structure of nascent RNA to be probed over time. Together, these can be used to determine changes in the structures of ribosome assembly intermediates as they fold in vivo. Copyright © 2016 Elsevier Inc. All rights reserved.

  9. Genome-Scale Analysis of Translation Elongation with a Ribosome Flow Model

    Science.gov (United States)

    Meilijson, Isaac; Kupiec, Martin; Ruppin, Eytan

    2011-01-01

    We describe the first large scale analysis of gene translation that is based on a model that takes into account the physical and dynamical nature of this process. The Ribosomal Flow Model (RFM) predicts fundamental features of the translation process, including translation rates, protein abundance levels, ribosomal densities and the relation between all these variables, better than alternative (‘non-physical’) approaches. In addition, we show that the RFM can be used for accurate inference of various other quantities including genes' initiation rates and translation costs. These quantities could not be inferred by previous predictors. We find that increasing the number of available ribosomes (or equivalently the initiation rate) increases the genomic translation rate and the mean ribosome density only up to a certain point, beyond which both saturate. Strikingly, assuming that the translation system is tuned to work at the pre-saturation point maximizes the predictive power of the model with respect to experimental data. This result suggests that in all organisms that were analyzed (from bacteria to Human), the global initiation rate is optimized to attain the pre-saturation point. The fact that similar results were not observed for heterologous genes indicates that this feature is under selection. Remarkably, the gap between the performance of the RFM and alternative predictors is strikingly large in the case of heterologous genes, testifying to the model's promising biotechnological value in predicting the abundance of heterologous proteins before expressing them in the desired host. PMID:21909250

  10. Cross-linking of streptomycin to the 16S ribosomal RNA of Escherichia coli

    International Nuclear Information System (INIS)

    Gravel, M.; Melancon, P.; Barkier-Gingras, L.

    1987-01-01

    [ 3 H]Dihydrostreptomycin was cross-linked to the 30S ribosomal subunit from Escherichia coli with the bifunctional reagent nitrogen mustard. The cross-linking primarily involved the 16S RNA. To localize the site of cross-linking of streptomycin to the 16S RNA, the authors hybridized RNA labeled with streptomycin to restriction fragments of the 16S RNA gene. Labeled RNA hybridized to DNA fragments corresponding to bases 892-917 and bases 1394-1415. These two segments of the ribosomal RNA must by juxtaposed in the ribosome, since there is a single binding site for streptomycin. This region has been implicated both in the decoding site and in the binding of initiation factor IF-3, indicating its functional importance

  11. Origins of the plant chloroplasts and mitochondria based on comparisons of 5S ribosomal RNAs

    Science.gov (United States)

    Delihas, N.; Fox, G. E.

    1987-01-01

    In this paper, we provide macromolecular comparisons utilizing the 5S ribosomal RNA structure to suggest extant bacteria that are the likely descendants of chloroplast and mitochondria endosymbionts. The genetic stability and near universality of the 5S ribosomal gene allows for a useful means to study ancient evolutionary changes by macromolecular comparisons. The value in current and future ribosomal RNA comparisons is in fine tuning the assignment of ancestors to the organelles and in establishing extant species likely to be descendants of bacteria involved in presumed multiple endosymbiotic events.

  12. tmRNA-mediated trans-translation as the major ribosome rescue system in a bacterial cell

    Directory of Open Access Journals (Sweden)

    Hyouta eHimeno

    2014-04-01

    Full Text Available tmRNA (transfer messenger RNA; also known as 10Sa RNA or SsrA RNA is a small RNA molecule that is conserved among bacteria. It has structural and functional similarities to tRNA: it has an upper half of the tRNA-like structure, its 5’ end is processed by RNase P, it has typical tRNA-specific base modifications, it is aminoacylated with alanine, it binds to EF-Tu after aminoacylation and it enters the ribosome with EF-Tu and GTP. However, tmRNA lacks an anticodon, and instead it has a coding sequence for a short peptide called tag-peptide. An elaborate interplay of actions of tmRNA as both tRNA and mRNA with the help of a tmRNA-binding protein, SmpB, facilitates trans-translation, which produces a single polypeptide from two mRNA molecules. Initially alanyl-tmRNA in complex with EF-Tu and SmpB enters the vacant A-site of the stalled ribosome like aminoacyl-tRNA but without a codon-anticodon interaction, and subsequently truncated mRNA is replaced with the tag-encoding region of tmRNA. During these processes, not only tmRNA but also SmpB structurally and functionally mimics both tRNA and mRNA. Thus trans-translation rescues the stalled ribosome, thereby allowing recycling of the ribosome. Since the tag-peptide serves as a target of AAA+ proteases, the trans-translation products are preferentially degraded so that they do not accumulate in the cell. Although alternative rescue systems have recently been revealed, trans-translation is the only system that universally exists in bacteria. Furthermore, it is unique in that it employs a small RNA and that it prevents accumulation of nonfunctional proteins from truncated mRNA in the cell. It might play the major role in rescuing the stalled translation in the bacterial cell.

  13. Plastid ribosome pausing is induced by multiple features and is linked to protein complex assembly

    DEFF Research Database (Denmark)

    Gawroński, Piotr; Jensen, Poul Erik; Karpinski, Stanislaw

    2018-01-01

    Many mRNAs contain pause sites that briefly interrupt the progress of translation. Specific features that induce ribosome pausing have been described; however, their individual contributions to pause-site formation, and the overall biological significance of ribosome pausing, remain largely uncle...

  14. Yeast linker histone Hho1p is required for efficient RNA polymerase I processivity and transcriptional silencing at the ribosomal DNA

    OpenAIRE

    Levy, Anat; Eyal, Miri; Hershkovits, Gitit; Salmon-Divon, Mali; Klutstein, Michael; Katcoff, Don Jay

    2008-01-01

    Nucleosome core particles in eukaryotes are linked by a stretch of DNA that is usually associated with a linker histone. Here, we show in yeast, that the presence of yeast linker histone Hho1p represses expression of a pol II transcribed gene (MET15) embedded in the rDNA. In vivo deletions of Hho1p sequences showed that the second globular domain is sufficient for that repression, whereas the presence of the N terminus is required for its derepression. In contrast, a run-on assay confirmed by...

  15. The Ribosomal RNA is a Useful Marker to Visualize Rhizobia Interacting with Legume Plants

    Science.gov (United States)

    Rinaudi, Luciana; Isola, Maria C.; Giordano, Walter

    2004-01-01

    Symbiosis between rhizobia and leguminous plants leads to the formation of nitrogen-fixing root nodules. In the present article, we recommend the use of the ribosomal RNA (rRNA) isolated from legume nodules in an experimental class with the purpose of introducing students to the structure of eukaryotic and prokaryotic ribosomes and of…

  16. Sphingosine-1-phosphate (S1P) displays sustained S1P1 receptor agonism and signaling through S1P lyase-dependent receptor recycling.

    Science.gov (United States)

    Gatfield, John; Monnier, Lucile; Studer, Rolf; Bolli, Martin H; Steiner, Beat; Nayler, Oliver

    2014-07-01

    The sphingosine-1-phosphate (S1P) type 1 receptor (S1P1R) is a novel therapeutic target in lymphocyte-mediated autoimmune diseases. S1P1 receptor desensitization caused by synthetic S1P1 receptor agonists prevents T-lymphocyte egress from secondary lymphoid organs into the circulation. The selective S1P1 receptor agonist ponesimod, which is in development for the treatment of autoimmune diseases, efficiently reduces peripheral lymphocyte counts and displays efficacy in animal models of autoimmune disease. Using ponesimod and the natural ligand S1P, we investigated the molecular mechanisms leading to different signaling, desensitization and trafficking behavior of S1P1 receptors. In recombinant S1P1 receptor-expressing cells, ponesimod and S1P triggered Gαi protein-mediated signaling and β-arrestin recruitment with comparable potency and efficiency, but only ponesimod efficiently induced intracellular receptor accumulation. In human umbilical vein endothelial cells (HUVEC), ponesimod and S1P triggered translocation of the endogenous S1P1 receptor to the Golgi compartment. However, only ponesimod treatment caused efficient surface receptor depletion, receptor accumulation in the Golgi and degradation. Impedance measurements in HUVEC showed that ponesimod induced only short-lived Gαi protein-mediated signaling followed by resistance to further stimulation, whereas S1P induced sustained Gαi protein-mediated signaling without desensitization. Inhibition of S1P lyase activity in HUVEC rendered S1P an efficient S1P1 receptor internalizing compound and abrogated S1P-mediated sustained signaling. This suggests that S1P lyase - by facilitating S1P1 receptor recycling - is essential for S1P-mediated sustained signaling, and that synthetic agonists are functional antagonists because they are not S1P lyase substrates. Copyright © 2014 Elsevier Inc. All rights reserved.

  17. Distinct roles for the IIId2 sub-domain in pestivirus and picornavirus internal ribosome entry sites.

    Science.gov (United States)

    Willcocks, Margaret M; Zaini, Salmah; Chamond, Nathalie; Ulryck, Nathalie; Allouche, Delphine; Rajagopalan, Noemie; Davids, Nana A; Fahnøe, Ulrik; Hadsbjerg, Johanne; Rasmussen, Thomas Bruun; Roberts, Lisa O; Sargueil, Bruno; Belsham, Graham J; Locker, Nicolas

    2017-12-15

    Viral internal ribosomes entry site (IRES) elements coordinate the recruitment of the host translation machinery to direct the initiation of viral protein synthesis. Within hepatitis C virus (HCV)-like IRES elements, the sub-domain IIId(1) is crucial for recruiting the 40S ribosomal subunit. However, some HCV-like IRES elements possess an additional sub-domain, termed IIId2, whose function remains unclear. Herein, we show that IIId2 sub-domains from divergent viruses have different functions. The IIId2 sub-domain present in Seneca valley virus (SVV), a picornavirus, is dispensable for IRES activity, while the IIId2 sub-domains of two pestiviruses, classical swine fever virus (CSFV) and border disease virus (BDV), are required for 80S ribosomes assembly and IRES activity. Unlike in SVV, the deletion of IIId2 from the CSFV and BDV IRES elements impairs initiation of translation by inhibiting the assembly of 80S ribosomes. Consequently, this negatively affects the replication of CSFV and BDV. Finally, we show that the SVV IIId2 sub-domain is required for efficient viral RNA synthesis and growth of SVV, but not for IRES function. This study sheds light on the molecular evolution of viruses by clearly demonstrating that conserved RNA structures, within distantly related RNA viruses, have acquired different roles in the virus life cycles. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  18. Blocking S1P interaction with S1P1 receptor by a novel competitive S1P1-selective antagonist inhibits angiogenesis

    International Nuclear Information System (INIS)

    Fujii, Yasuyuki; Ueda, Yasuji; Ohtake, Hidenori; Ono, Naoya; Takayama, Tetsuo; Nakazawa, Kiyoshi; Igarashi, Yasuyuki; Goitsuka, Ryo

    2012-01-01

    Highlights: ► The effect of a newly developed S1P 1 -selective antagonist on angiogenic responses. ► S1P 1 is a critical component of VEGF-related angiogenic responses. ► S1P 1 -selective antagonist showed in vitro activity to inhibit angiogenesis. ► S1P 1 -selective antagonist showed in vivo activity to inhibit angiogenesis. ► The efficacy of S1P 1 -selective antagonist for anti-cancer therapies. -- Abstract: Sphingosine 1-phosphate receptor type 1 (S1P 1 ) was shown to be essential for vascular maturation during embryonic development and it has been demonstrated that substantial crosstalk exists between S1P 1 and other pro-angiogenic growth factors, such as vascular endothelial growth factor (VEGF) and basic fibroblast growth factor. We developed a novel S1P 1 -selective antagonist, TASP0277308, which is structurally unrelated to S1P as well as previously described S1P 1 antagonists. TASP0277308 inhibited S1P- as well as VEGF-induced cellular responses, including migration and proliferation of human umbilical vein endothelial cells. Furthermore, TASP0277308 effectively blocked a VEGF-induced tube formation in vitro and significantly suppressed tumor cell-induced angiogenesis in vivo. These findings revealed that S1P 1 is a critical component of VEGF-related angiogenic responses and also provide evidence for the efficacy of TASP0277308 for anti-cancer therapies.

  19. Molecular interactions within the halophilic, thermophilic, and mesophilic prokaryotic ribosomal complexes: clues to environmental adaptation.

    Science.gov (United States)

    Mallik, Saurav; Kundu, Sudip

    2015-01-01

    Using the available crystal structures of 50S ribosomal subunits from three prokaryotic species: Escherichia coli (mesophilic), Thermus thermophilus (thermophilic), and Haloarcula marismortui (halophilic), we have analyzed different structural features of ribosomal RNAs (rRNAs), proteins, and of their interfaces. We have correlated these structural features with the environmental adaptation strategies of the corresponding species. While dense intra-rRNA packing is observed in thermophilic, loose intra-rRNA packing is observed in halophilic (both compared to mesophilic). Interestingly, protein-rRNA interfaces of both the extremophiles are densely packed compared to that of the mesophilic. The intersubunit bridge regions are almost devoid of cavities, probably ensuring the proper formation of each bridge (by not allowing any loosely packed region nearby). During rRNA binding, the ribosomal proteins experience some structural transitions. Here, we have analyzed the intrinsically disordered and ordered regions of the ribosomal proteins, which are subjected to such transitions. The intrinsically disordered and disorder-to-order transition sites of the thermophilic and mesophilic ribosomal proteins are simultaneously (i) highly conserved and (ii) slowly evolving compared to rest of the protein structure. Although high conservation is observed at such sites of halophilic ribosomal proteins, but slow rate of evolution is absent. Such differences between thermophilic, mesophilic, and halophilic can be explained from their environmental adaptation strategy. Interestingly, a universal biophysical principle evident by a linear relationship between the free energy of interface formation, interface area, and structural changes of r-proteins during assembly is always maintained, irrespective of the environmental conditions.

  20. Defining the bacteroides ribosomal binding site.

    Science.gov (United States)

    Wegmann, Udo; Horn, Nikki; Carding, Simon R

    2013-03-01

    The human gastrointestinal tract, in particular the colon, hosts a vast number of commensal microorganisms. Representatives of the genus Bacteroides are among the most abundant bacterial species in the human colon. Bacteroidetes diverged from the common line of eubacterial descent before other eubacterial groups. As a result, they employ unique transcription initiation signals and, because of this uniqueness, they require specific genetic tools. Although some tools exist, they are not optimal for studying the roles and functions of these bacteria in the human gastrointestinal tract. Focusing on translation initiation signals in Bacteroides, we created a series of expression vectors allowing for different levels of protein expression in this genus, and we describe the use of pepI from Lactobacillus delbrueckii subsp. lactis as a novel reporter gene for Bacteroides. Furthermore, we report the identification of the 3' end of the 16S rRNA of Bacteroides ovatus and analyze in detail its ribosomal binding site, thus defining a core region necessary for efficient translation, which we have incorporated into the design of our expression vectors. Based on the sequence logo information from the 5' untranslated region of other Bacteroidales ribosomal protein genes, we conclude that our findings are relevant to all members of this order.

  1. Phosphoproteome analysis during larval development and metamorphosis in the spionid polychaete Pseudopolydora vexillosa

    KAUST Repository

    Chandramouli, Kondethimmanahalli; Mok, Flora SY; Wang, Hao; Qian, Pei-Yuan

    2011-01-01

    Background: The metamorphosis of the spionid polychaete Pseudopolydora vexillosa includes spontaneous settlement onto soft-bottom habitats and morphogenesis that can be completed in a very short time. A previous study on the total changes to the proteome during the various developmental stages of P. vexillosa suggested that little or no de novo protein synthesis occurs during metamorphosis. In this study, we used multicolor fluorescence detection of proteins in 2-D gels for differential analysis of proteins and phosphoproteins to reveal the dynamics of post-translational modification proteins in this species. A combination of affinity chromatography, 2D-PAGE, and mass spectrometry was used to identify the phosphoproteins in pre-competent larvae, competent larvae, and newly metamorphosed juveniles. Results: We reproducibly detected 210, 492, and 172 phosphoproteins in pre-competent larvae, competent larvae, and newly metamorphosed juveniles, respectively. The highest percentage of phosphorylation was observed during the competent larval stage. About 64 stage-specific phosphoprotein spots were detected in the competent stage, and 32 phosphoproteins were found to be significantly differentially expressed in the three stages. We identified 38 phosphoproteins, 10 of which were differentially expressed during metamorphosis. These phosphoproteins belonged to six categories of biological processes: (1) development, (2) cell differentiation and integrity, (3) transcription and translation, (4) metabolism, (5) protein-protein interaction and proteolysis, and (6) receptors and enzymes. Conclusion: This is the first study to report changes in phosphoprotein expression patterns during the metamorphosis of the marine polychaete P. vexillosa. The higher degree of phosphorylation during the process of attaining competence to settle and metamorphose may be due to fast morphological transitions regulated by various mechanisms. Our data are consistent with previous studies showing a

  2. Phosphoproteome analysis during larval development and metamorphosis in the spionid polychaete Pseudopolydora vexillosa

    KAUST Repository

    Chandramouli, Kondethimmanahalli

    2011-05-25

    Background: The metamorphosis of the spionid polychaete Pseudopolydora vexillosa includes spontaneous settlement onto soft-bottom habitats and morphogenesis that can be completed in a very short time. A previous study on the total changes to the proteome during the various developmental stages of P. vexillosa suggested that little or no de novo protein synthesis occurs during metamorphosis. In this study, we used multicolor fluorescence detection of proteins in 2-D gels for differential analysis of proteins and phosphoproteins to reveal the dynamics of post-translational modification proteins in this species. A combination of affinity chromatography, 2D-PAGE, and mass spectrometry was used to identify the phosphoproteins in pre-competent larvae, competent larvae, and newly metamorphosed juveniles. Results: We reproducibly detected 210, 492, and 172 phosphoproteins in pre-competent larvae, competent larvae, and newly metamorphosed juveniles, respectively. The highest percentage of phosphorylation was observed during the competent larval stage. About 64 stage-specific phosphoprotein spots were detected in the competent stage, and 32 phosphoproteins were found to be significantly differentially expressed in the three stages. We identified 38 phosphoproteins, 10 of which were differentially expressed during metamorphosis. These phosphoproteins belonged to six categories of biological processes: (1) development, (2) cell differentiation and integrity, (3) transcription and translation, (4) metabolism, (5) protein-protein interaction and proteolysis, and (6) receptors and enzymes. Conclusion: This is the first study to report changes in phosphoprotein expression patterns during the metamorphosis of the marine polychaete P. vexillosa. The higher degree of phosphorylation during the process of attaining competence to settle and metamorphose may be due to fast morphological transitions regulated by various mechanisms. Our data are consistent with previous studies showing a

  3. Klebsazolicin inhibits 70S ribosome by obstructing the peptide exit tunnel

    Energy Technology Data Exchange (ETDEWEB)

    Metelev, Mikhail; Osterman, Ilya A.; Ghilarov, Dmitry; Khabibullina, Nelli F.; Yakimov, Alexander; Shabalin, Konstantin; Utkina, Irina; Travin, Dmitry Y.; Komarova, Ekaterina S.; Serebryakova, Marina; Artamonova, Tatyana; Khodorkovskii, Mikhail; Konevega, Andrey L.; Sergiev, Petr V.; Severinov, Konstantin; Polikanov, Yury S.

    2017-08-28

    Whereas screening of the small-molecule metabolites produced by most cultivatable microorganisms often results in the rediscovery of known compounds, genome-mining programs allow researchers to harness much greater chemical diversity, and result in the discovery of new molecular scaffolds. Here we report the genome-guided identification of a new antibiotic, klebsazolicin (KLB), from Klebsiella pneumoniae that inhibits the growth of sensitive cells by targeting ribosomes. A ribosomally synthesized post-translationally modified peptide (RiPP), KLB is characterized by the presence of a unique N-terminal amidine ring that is essential for its activity. Biochemical in vitro studies indicate that KLB inhibits ribosomes by interfering with translation elongation. Structural analysis of the ribosome–KLB complex showed that the compound binds in the peptide exit tunnel overlapping with the binding sites of macrolides or streptogramin-B. KLB adopts a compact conformation and largely obstructs the tunnel. Engineered KLB fragments were observed to retain in vitro activity, and thus have the potential to serve as a starting point for the development of new bioactive compounds.

  4. Emergence of robust growth laws from optimal regulation of ribosome synthesis.

    Science.gov (United States)

    Scott, Matthew; Klumpp, Stefan; Mateescu, Eduard M; Hwa, Terence

    2014-08-22

    Bacteria must constantly adapt their growth to changes in nutrient availability; yet despite large-scale changes in protein expression associated with sensing, adaptation, and processing different environmental nutrients, simple growth laws connect the ribosome abundance and the growth rate. Here, we investigate the origin of these growth laws by analyzing the features of ribosomal regulation that coordinate proteome-wide expression changes with cell growth in a variety of nutrient conditions in the model organism Escherichia coli. We identify supply-driven feedforward activation of ribosomal protein synthesis as the key regulatory motif maximizing amino acid flux, and autonomously guiding a cell to achieve optimal growth in different environments. The growth laws emerge naturally from the robust regulatory strategy underlying growth rate control, irrespective of the details of the molecular implementation. The study highlights the interplay between phenomenological modeling and molecular mechanisms in uncovering fundamental operating constraints, with implications for endogenous and synthetic design of microorganisms. © 2014 The Authors. Published under the terms of the CC BY 4.0 license.

  5. Recognition of Ribosomal Protein L11 by the Protein Trimethyltransferase PrmA

    Energy Technology Data Exchange (ETDEWEB)

    Demirci,H.; Gregory, S.; Dahlberg, A.; Jogl, G.

    2007-01-01

    Bacterial ribosomal protein L11 is post-translationally trimethylated at multiple residues by a single methyltransferase, PrmA. Here, we describe four structures of PrmA from the extreme thermophile Thermus thermophilus. Two apo-PrmA structures at 1.59 and 2.3 {angstrom} resolution and a third with bound cofactor S-adenosyl-L-methionine at 1.75 {angstrom} each exhibit distinct relative positions of the substrate recognition and catalytic domains, revealing how PrmA can position the L11 substrate for multiple, consecutive side-chain methylation reactions. The fourth structure, the PrmA-L11 enzyme-substrate complex at 2.4 {angstrom} resolution, illustrates the highly specific interaction of the N-terminal domain with its substrate and places Lys39 in the PrmA active site. The presence of a unique flexible loop in the cofactor-binding site suggests how exchange of AdoMet with the reaction product S-adenosyl-L-homocysteine can occur without necessitating the dissociation of PrmA from L11. Finally, the mode of interaction of PrmA with L11 explains its observed preference for L11 as substrate before its assembly into the 50S ribosomal subunit.

  6. Oxidative damage of 18S and 5S ribosomal RNA in digestive gland of mussels exposed to trace metals.

    Science.gov (United States)

    Kournoutou, Georgia G; Giannopoulou, Panagiota C; Sazakli, Eleni; Leotsinidis, Michel; Kalpaxis, Dimitrios L

    2017-11-01

    Numerous studies have shown the ability of trace metals to accumulate in marine organisms and cause oxidative stress that leads to perturbations in many important intracellular processes, including protein synthesis. This study is mainly focused on the exploration of structural changes, like base modifications, scissions, and conformational changes, caused in 18S and 5S ribosomal RNA (rRNA) isolated from the mussel Mytilus galloprovincialis exposed to 40μg/L Cu, 30μg/L Hg, or 100μg/L Cd, for 5 or 15days. 18S rRNA and 5S rRNA are components of the small and large ribosomal subunit, respectively, found in complex with ribosomal proteins, translation factors and other auxiliary components (metal ions, toxins etc). 18S rRNA plays crucial roles in all stages of protein synthesis, while 5S rRNA serves as a master signal transducer between several functional regions of 28S rRNA. Therefore, structural changes in these ribosomal constituents could affect the basic functions of ribosomes and hence the normal metabolism of cells. Especially, 18S rRNA along with ribosomal proteins forms the decoding centre that ensures the correct codon-anticodon pairing. As exemplified by ELISA, primer extension analysis and DMS footprinting analysis, each metal caused oxidative damage to rRNA, depending on the nature of metal ion and the duration of exposure. Interestingly, exposure of mussels to Cu or Hg caused structural alterations in 5S rRNA, localized in paired regions and within loops A, B, C, and E, leading to a continuous progressive loss of the 5S RNA structural integrity. In contrast, structural impairments of 5S rRNA in mussels exposed to Cd were accumulating for the initial 5days, and then progressively decreased to almost the normal level by day 15, probably due to the parallel elevation of metallothionein content that depletes the pools of free Cd. Regions of interest in 18S rRNA, such as the decoding centre, sites implicated in the binding of tRNAs (A- and P-sites) or

  7. Human ribosomal protein L37 has motifs predicting serine/threonine phosphorylation and a zinc-finger domain.

    Science.gov (United States)

    Barnard, G F; Staniunas, R J; Puder, M; Steele, G D; Chen, L B

    1994-08-02

    Ribosomal protein L37 mRNA is overexpressed in colon cancer. The nucleotide sequences of human L37 from several tumor and normal, colon and liver cDNA sources were determined to be identical. L37 mRNA was approximately 375 nucleotides long encoding 97 amino acids with M(r) = 11,070, pI = 12.6, multiple potential serine/threonine phosphorylation sites and a zinc-finger domain. The human sequence is compared to other species.

  8. The SmpB C-terminal tail helps tmRNA to recognize and enter stalled ribosomes

    Directory of Open Access Journals (Sweden)

    Mickey R. Miller

    2014-09-01

    Full Text Available In bacteria, transfer-messenger RNA (tmRNA and SmpB comprise the most common and effective system for rescuing stalled ribosomes. Ribosomes stall on mRNA transcripts lacking stop codons and are rescued as the defective mRNA is swapped for the tmRNA template in a process known as trans-translation. The tmRNA–SmpB complex is recruited to the ribosome independent of a codon–anticodon interaction. Given that the ribosome uses robust discriminatory mechanisms to select against non-cognate tRNAs during canonical decoding, it has been hard to explain how this can happen. Recent structural and biochemical studies show that SmpB licenses tmRNA entry through its interactions with the decoding center and mRNA channel. In particular, the C-terminal tail of SmpB promotes both EFTu activation and accommodation of tmRNA, the former through interactions with 16S rRNA nucleotide G530 and the latter through interactions with the mRNA channel downstream of the A site. Here we present a detailed model of the earliest steps in trans-translation, and in light of these mechanistic considerations, revisit the question of how tmRNA preferentially reacts with stalled, non-translating ribosomes.

  9. Ribosomal Stalk Protein Silencing Partially Corrects the ΔF508-CFTR Functional Expression Defect.

    Directory of Open Access Journals (Sweden)

    Guido Veit

    2016-05-01

    Full Text Available The most common cystic fibrosis (CF causing mutation, deletion of phenylalanine 508 (ΔF508 or Phe508del, results in functional expression defect of the CF transmembrane conductance regulator (CFTR at the apical plasma membrane (PM of secretory epithelia, which is attributed to the degradation of the misfolded channel at the endoplasmic reticulum (ER. Deletion of phenylalanine 670 (ΔF670 in the yeast oligomycin resistance 1 gene (YOR1, an ABC transporter of Saccharomyces cerevisiae phenocopies the ΔF508-CFTR folding and trafficking defects. Genome-wide phenotypic (phenomic analysis of the Yor1-ΔF670 biogenesis identified several modifier genes of mRNA processing and translation, which conferred oligomycin resistance to yeast. Silencing of orthologues of these candidate genes enhanced the ΔF508-CFTR functional expression at the apical PM in human CF bronchial epithelia. Although knockdown of RPL12, a component of the ribosomal stalk, attenuated the translational elongation rate, it increased the folding efficiency as well as the conformational stability of the ΔF508-CFTR, manifesting in 3-fold augmented PM density and function of the mutant. Combination of RPL12 knockdown with the corrector drug, VX-809 (lumacaftor restored the mutant function to ~50% of the wild-type channel in primary CFTRΔF508/ΔF508 human bronchial epithelia. These results and the observation that silencing of other ribosomal stalk proteins partially rescue the loss-of-function phenotype of ΔF508-CFTR suggest that the ribosomal stalk modulates the folding efficiency of the mutant and is a potential therapeutic target for correction of the ΔF508-CFTR folding defect.

  10. An evolved ribosome-inactivating protein targets and kills human melanoma cells in vitro and in vivo

    Directory of Open Access Journals (Sweden)

    Green David E

    2010-02-01

    Full Text Available Abstract Background Few treatment options exist for patients with metastatic melanoma, resulting in poor prognosis. One standard treatment, dacarbazine (DTIC, shows low response rates ranging from 15 to 25 percent with an 8-month median survival time. The development of targeted therapeutics with novel mechanisms of action may improve patient outcome. Ribosome-inactivating proteins (RIPs such as Shiga-like Toxin 1 (SLT-1 represent powerful scaffolds for developing selective anticancer agents. Here we report the discovery and properties of a single chain ribosome-inactivating protein (scRIP derived from the cytotoxic A subunit of SLT-1 (SLT-1A, harboring the 7-amino acid peptide insertion IYSNKLM (termed SLT-1AIYSNKLM allowing the toxin variant to selectively target and kill human melanoma cells. Results SLT-1AIYSNKLM was able to kill 7 of 8 human melanoma cell lines. This scRIP binds to 518-A2 human melanoma cells with a dissociation constant of 18 nM, resulting in the blockage of protein synthesis and apoptosis in such cells. Biodistribution and imaging studies of radiolabeled SLT-1AIYSNKLM administered intravenously into SCID mice bearing a human melanoma xenograft indicate that SLT-1AIYSNKLM readily accumulates at the tumor site as opposed to non-target tissues. Furthermore, the co-administration of SLT-1AIYSNKLM with DTIC resulted in tumor regression and greatly increased survival in this mouse xenograft model in comparison to DTIC or SLT-1AIYSNKLM treatment alone (115 day median survival versus 46 and 47 days respectively; P values IYSNKLM is stable in serum and its intravenous administration resulted in modest immune responses following repeated injections in CD1 mice. Conclusions These results demonstrate that the evolution of a scRIP template can lead to the discovery of novel cancer cell-targeted compounds and in the case of SLT-1AIYSNKLM can specifically kill human melanoma cells in vitro and in vivo.

  11. Inhibition of peptide bond formation by pleuromutilins: the structure of the 50S ribosomal subunit from Deinococcus radiodurans in complex with tiamulin.

    Science.gov (United States)

    Schlünzen, Frank; Pyetan, Erez; Fucini, Paola; Yonath, Ada; Harms, Jörg M

    2004-12-01

    Tiamulin, a prominent member of the pleuromutilin class of antibiotics, is a potent inhibitor of protein synthesis in bacteria. Up to now the effect of pleuromutilins on the ribosome has not been determined on a molecular level. The 3.5 A structure of the 50S ribosomal subunit from Deinococcus radiodurans in complex with tiamulin provides for the first time a detailed picture of its interactions with the 23S rRNA, thus explaining the molecular mechanism of the antimicrobial activity of the pleuromutilin class of antibiotics. Our results show that tiamulin is located within the peptidyl transferase center (PTC) of the 50S ribosomal subunit with its tricyclic mutilin core positioned in a tight pocket at the A-tRNA binding site. Also, the extension, which protrudes from its mutilin core, partially overlaps with the P-tRNA binding site. Thereby, tiamulin directly inhibits peptide bond formation. Comparison of the tiamulin binding site with other PTC targeting drugs, like chloramphenicol, clindamycin and streptogramins, may facilitate the design of modified or hybridized drugs that extend the applicability of this class of antibiotics.

  12. Is the extraction by Whatman FTA filter matrix technology and sequencing of large ribosomal subunit D1-D2 region sufficient for identification of clinical fungi?

    Science.gov (United States)

    Kiraz, Nuri; Oz, Yasemin; Aslan, Huseyin; Erturan, Zayre; Ener, Beyza; Akdagli, Sevtap Arikan; Muslumanoglu, Hamza; Cetinkaya, Zafer

    2015-10-01

    Although conventional identification of pathogenic fungi is based on the combination of tests evaluating their morphological and biochemical characteristics, they can fail to identify the less common species or the differentiation of closely related species. In addition these tests are time consuming, labour-intensive and require experienced personnel. We evaluated the feasibility and sufficiency of DNA extraction by Whatman FTA filter matrix technology and DNA sequencing of D1-D2 region of the large ribosomal subunit gene for identification of clinical isolates of 21 yeast and 160 moulds in our clinical mycology laboratory. While the yeast isolates were identified at species level with 100% homology, 102 (63.75%) clinically important mould isolates were identified at species level, 56 (35%) isolates at genus level against fungal sequences existing in DNA databases and two (1.25%) isolates could not be identified. Consequently, Whatman FTA filter matrix technology was a useful method for extraction of fungal DNA; extremely rapid, practical and successful. Sequence analysis strategy of D1-D2 region of the large ribosomal subunit gene was found considerably sufficient in identification to genus level for the most clinical fungi. However, the identification to species level and especially discrimination of closely related species may require additional analysis. © 2015 Blackwell Verlag GmbH.

  13. Ribosomal protein mutations induce autophagy through S6 kinase inhibition of the insulin pathway.

    Directory of Open Access Journals (Sweden)

    Harry F Heijnen

    Full Text Available Mutations affecting the ribosome lead to several diseases known as ribosomopathies, with phenotypes that include growth defects, cytopenia, and bone marrow failure. Diamond-Blackfan anemia (DBA, for example, is a pure red cell aplasia linked to the mutation of ribosomal protein (RP genes. Here we show the knock-down of the DBA-linked RPS19 gene induces the cellular self-digestion process of autophagy, a pathway critical for proper hematopoiesis. We also observe an increase of autophagy in cells derived from DBA patients, in CD34+ erythrocyte progenitor cells with RPS19 knock down, in the red blood cells of zebrafish embryos with RP-deficiency, and in cells from patients with Shwachman-Diamond syndrome (SDS. The loss of RPs in all these models results in a marked increase in S6 kinase phosphorylation that we find is triggered by an increase in reactive oxygen species (ROS. We show that this increase in S6 kinase phosphorylation inhibits the insulin pathway and AKT phosphorylation activity through a mechanism reminiscent of insulin resistance. While stimulating RP-deficient cells with insulin reduces autophagy, antioxidant treatment reduces S6 kinase phosphorylation, autophagy, and stabilization of the p53 tumor suppressor. Our data suggest that RP loss promotes the aberrant activation of both S6 kinase and p53 by increasing intracellular ROS levels. The deregulation of these signaling pathways is likely playing a major role in the pathophysiology of ribosomopathies.

  14. Effect of single base changes and the absence of modified bases in 16S RNA on the reconstitution and function of Escherichia coli 30S ribosomes

    International Nuclear Information System (INIS)

    Denman, R.; Krzyzosiak, W.; Nurse, K.; Ofengand, J.

    1987-01-01

    The gene coding for E. coli 16S rRNA was placed in pUC19 under the control of the strong class III T7 promoter, phi 10, by ligation of the 1490 bp BclI/BstEII fragment of the rrnB operon with appropriate synthetic oligodeoxynucleotides. Such constructs allowed efficient in vitro synthesis of full-length transcripts (up to 900 mol RNA/mol template) free of modified bases. The synthetic RNA could be assembled into 30S subunits upon addition of E. coli 30S ribosomal proteins. The particles co-sedimented with authentic 30S particles and were electron microscopically indistinguishable from them. Upon addition of 50S subunits, codon-dependent P-site binding of tRNA and codon-dependent polypeptide synthesis were >80% of 30S reconstituted from natural 16S RNA and >50% of isolated 30S. UV-induced crosslinking of P-site bound AcVal-tRNA to residue C 1400 was preserved. Changing C 1400 to A had little effect on reconstitution, P-site binding, or polypeptide synthesis. However, the substitution of C 1499 by G markedly inhibited assembly. The effect on P-site binding and polypeptide synthesis is under study. These results show (1) none of the modified bases of 16S RNA are essential for protein synthesis, (2) substitution of A for C 1400 has little functional effect, and (3) position 1400 may be important for ribosome assembly

  15. Fluctuations between multiple EF-G-induced chimeric tRNA states during translocation on the ribosome

    Science.gov (United States)

    Adio, Sarah; Senyushkina, Tamara; Peske, Frank; Fischer, Niels; Wintermeyer, Wolfgang; Rodnina, Marina V.

    2015-06-01

    The coupled translocation of transfer RNA and messenger RNA through the ribosome entails large-scale structural rearrangements, including step-wise movements of the tRNAs. Recent structural work has visualized intermediates of translocation induced by elongation factor G (EF-G) with tRNAs trapped in chimeric states with respect to 30S and 50S ribosomal subunits. The functional role of the chimeric states is not known. Here we follow the formation of translocation intermediates by single-molecule fluorescence resonance energy transfer. Using EF-G mutants, a non-hydrolysable GTP analogue, and fusidic acid, we interfere with either translocation or EF-G release from the ribosome and identify several rapidly interconverting chimeric tRNA states on the reaction pathway. EF-G engagement prevents backward transitions early in translocation and increases the fraction of ribosomes that rapidly fluctuate between hybrid, chimeric and posttranslocation states. Thus, the engagement of EF-G alters the energetics of translocation towards a flat energy landscape, thereby promoting forward tRNA movement.

  16. Structure of the quaternary complex between SRP, SR, and translocon bound to the translating ribosome.

    Science.gov (United States)

    Jomaa, Ahmad; Fu, Yu-Hsien Hwang; Boehringer, Daniel; Leibundgut, Marc; Shan, Shu-Ou; Ban, Nenad

    2017-05-19

    During co-translational protein targeting, the signal recognition particle (SRP) binds to the translating ribosome displaying the signal sequence to deliver it to the SRP receptor (SR) on the membrane, where the signal peptide is transferred to the translocon. Using electron cryo-microscopy, we have determined the structure of a quaternary complex of the translating Escherichia coli ribosome, the SRP-SR in the 'activated' state and the translocon. Our structure, supported by biochemical experiments, reveals that the SRP RNA adopts a kinked and untwisted conformation to allow repositioning of the 'activated' SRP-SR complex on the ribosome. In addition, we observe the translocon positioned through interactions with the SR in the vicinity of the ribosome exit tunnel where the signal sequence is extending beyond its hydrophobic binding groove of the SRP M domain towards the translocon. Our study provides new insights into the mechanism of signal sequence transfer from the SRP to the translocon.

  17. Ribosomal incorporation of backbone modified amino acids via an editing-deficient aminoacyl-tRNA synthetase.

    Science.gov (United States)

    Iqbal, Emil S; Dods, Kara K; Hartman, Matthew C T

    2018-02-14

    The ability to incorporate non-canonical amino acids (ncAA) using translation offers researchers the ability to extend the functionality of proteins and peptides for many applications including synthetic biology, biophysical and structural studies, and discovery of novel ligands. Here we describe the high promiscuity of an editing-deficient valine-tRNA synthetase (ValRS T222P). Using this enzyme, we demonstrate ribosomal translation of 11 ncAAs including those with novel side chains, α,α-disubstitutions, and cyclic β-amino acids.

  18. Initial bridges between two ribosomal subunits are formed within 9.4 milliseconds, as studied by time-resolved cryo-EM.

    Science.gov (United States)

    Shaikh, Tanvir R; Yassin, Aymen S; Lu, Zonghuan; Barnard, David; Meng, Xing; Lu, Toh-Ming; Wagenknecht, Terence; Agrawal, Rajendra K

    2014-07-08

    Association of the two ribosomal subunits during the process of translation initiation is a crucial step of protein synthesis. The two subunits (30S and 50S) of the bacterial 70S ribosome are held together by 12 dynamic bridges involving RNA-RNA, RNA-protein, and protein-protein interactions. The process of bridge formation, such as whether all these bridges are formed simultaneously or in a sequential order, is poorly understood. To understand such processes, we have developed and implemented a class of microfluidic devices that mix two components to completion within 0.4 ms and spray the mixture in the form of microdroplets onto an electron microscopy grid, yielding a minimum reaction time of 9.4 ms before cryofixation. Using these devices, we have obtained cryo-EM data corresponding to reaction times of 9.4 and 43 ms and have determined 3D structures of ribosomal subunit association intermediates. Molecular analyses of the cryo-EM maps reveal that eight intersubunit bridges (bridges B1a, B1b, B2a, B2b, B3, B7a, B7b, and B8) form within 9.4 ms, whereas the remaining four bridges (bridges B2c, B4, B5, and B6) take longer than 43 ms to form, suggesting that bridges are formed in a stepwise fashion. Our approach can be used to characterize sequences of various dynamic functional events on complex macromolecular assemblies such as ribosomes.

  19. PCR Amplification of Ribosomal DNA for Species Identification in the Plant Pathogen Genus Phytophthora

    Science.gov (United States)

    Ristaino, Jean B.; Madritch, Michael; Trout, Carol L.; Parra, Gregory

    1998-01-01

    We have developed a PCR procedure to amplify DNA for quick identification of the economically important species from each of the six taxonomic groups in the plant pathogen genus Phytophthora. This procedure involves amplification of the 5.8S ribosomal DNA gene and internal transcribed spacers (ITS) with the ITS primers ITS 5 and ITS 4. Restriction digests of the amplified DNA products were conducted with the restriction enzymes RsaI, MspI, and HaeIII. Restriction fragment patterns were similar after digestions with RsaI for the following species: P. capsici and P. citricola; P. infestans, P. cactorum, and P. mirabilis; P. fragariae, P. cinnamomi, and P. megasperma from peach; P. palmivora, P. citrophthora, P. erythroseptica, and P. cryptogea; and P. megasperma from raspberry and P. sojae. Restriction digests with MspI separated P. capsici from P. citricola and separated P. cactorum from P. infestans and P. mirabilis. Restriction digests with HaeIII separated P. citrophthora from P. cryptogea, P. cinnamomi from P. fragariae and P. megasperma on peach, P. palmivora from P. citrophthora, and P. megasperma on raspberry from P. sojae. P. infestans and P. mirabilis digests were identical and P. cryptogea and P. erythroseptica digests were identical with all restriction enzymes tested. A unique DNA sequence from the ITS region I in P. capsici was used to develop a primer called PCAP. The PCAP primer was used in PCRs with ITS 1 and amplified only isolates of P. capsici, P. citricola, and P. citrophthora and not 13 other species in the genus. Restriction digests with MspI separated P. capsici from the other two species. PCR was superior to traditional isolation methods for detection of P. capsici in infected bell pepper tissue in field samples. The techniques described will provide a powerful tool for identification of the major species in the genus Phytophthora. PMID:9501434

  20. Characterization of a minimal pKW2124 replicon from Weissella cibaria KLC140 and its application for the construction of the Weissella expression vector pKUCm1

    Science.gov (United States)

    Ku, Hye-Jin; Park, Myeong Soo; Lee, Ju-Hoon

    2015-01-01

    A 2.1-kb plasmid was previously isolated from Weissella cibaria KLC140 in kimchi and cloned into pUC19 along with the slpA and gfp genes, resulting in an 8.6-kb pKWCSLGFP construct for use as a novel surface display vector. To reduce the size of the vector, the minimal replicon of pKW2124 was determined. The pKW2124 plasmid contains a putative origin of replication (ori), a potential ribosomal binding site (RBS), and the repA gene encoding a plasmid replication protein. To conduct the minimal replicon experiment, four different PCR products (MR1, ori+RBS+repA; MR2, RBS+repA; MR2’, repA; MR3, fragment of repA) were obtained and cloned into pUC19 (pKUCm1, pKUCm2, pKUCm2’, and pKUCm3, respectively) containing the chloramphenicol acetyltransferase (CAT) gene. These constructed vectors were electroporated into W. confusa ATCC 10881 with different transformation efficiencies of 1.5 × 105 CFU/μg, 1.3 × 101 CFU/μg, and no transformation, respectively, suggesting that the putative ori, RBS, and repA gene are essential for optimum plasmid replication. Subsequent segregational plasmid stability testing of pKUCm1 and pKUCm2 showed that the vector pKUCm1 is highly stable up to 100 generations but pKUCm2 was completely lost after 60 generations, suggesting that the putative ori may be important for plasmid stability in the host strain. In addition, a host range test of pKUCm1 revealed that it has a broad host range spectrum including Weissella, Lactococcus, Leuconostoc, and even Lactobacillus. To verify the application of pKUCm1, the β-galactosidase gene and its promoter region from W. cibaria KSD1 were cloned in the vector, resulting in pKUGal. Expression of the β-galactosidase gene was confirmed using blue-white screening after IPTG induction. The small and stable pKUGal vector will be useful for gene transfer, expression, and manipulation in the Weissella genome and in other lactic acid bacteria. PMID:25691882

  1. Suboptimal T-cell receptor signaling compromises protein translation, ribosome biogenesis, and proliferation of mouse CD8 T cells.

    Science.gov (United States)

    Tan, Thomas C J; Knight, John; Sbarrato, Thomas; Dudek, Kate; Willis, Anne E; Zamoyska, Rose

    2017-07-25

    Global transcriptomic and proteomic analyses of T cells have been rich sources of unbiased data for understanding T-cell activation. Lack of full concordance of these datasets has illustrated that important facets of T-cell activation are controlled at the level of translation. We undertook translatome analysis of CD8 T-cell activation, combining polysome profiling and microarray analysis. We revealed that altering T-cell receptor stimulation influenced recruitment of mRNAs to heavy polysomes and translation of subsets of genes. A major pathway that was compromised, when TCR signaling was suboptimal, was linked to ribosome biogenesis, a rate-limiting factor in both cell growth and proliferation. Defective TCR signaling affected transcription and processing of ribosomal RNA precursors, as well as the translation of specific ribosomal proteins and translation factors. Mechanistically, IL-2 production was compromised in weakly stimulated T cells, affecting the abundance of Myc protein, a known regulator of ribosome biogenesis. Consequently, weakly activated T cells showed impaired production of ribosomes and a failure to maintain proliferative capacity after stimulation. We demonstrate that primary T cells respond to various environmental cues by regulating ribosome biogenesis and mRNA translation at multiple levels to sustain proliferation and differentiation.

  2. (Brassicaceae) based on nuclear ribosomal ITS DNA sequences

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Genetics; Volume 93; Issue 2. Phylogeny and biogeography of Alyssum (Brassicaceae) based on nuclear ribosomal ITS DNA sequences. Yan Li Yan Kong Zhe Zhang Yanqiang Yin Bin Liu Guanghui Lv Xiyong Wang. Research Article Volume 93 Issue 2 August 2014 pp 313-323 ...

  3. Architecture of the E.coli 70S ribosome

    DEFF Research Database (Denmark)

    Burkhardt, N.; Diedrich, G.; Nierhaus, K.H.

    1997-01-01

    The 70S ribosome from E.coli was analysed by neutron scattering focusing on the shape and the internal protein-RNA-distribution of the complex. Measurements on selectively deuterated 70S particles and free 30S and 50S subunits applying conventional contrast variation and proton-spin contrast...

  4. Simultaneous inhibition of mTOR-containing complex 1 (mTORC1) and MNK induces apoptosis of cutaneous T-cell lymphoma (CTCL) cells

    DEFF Research Database (Denmark)

    Marzec, Michal Tomasz; Liu, Xiaobin; Wysocka, Maria

    2011-01-01

    mTOR kinase forms the mTORC1 complex by associating with raptor and other proteins and affects a number of key cell functions. mTORC1 activates p70S6kinase 1 (p70S6K1) and inhibits 4E-binding protein 1 (4E-BP1). In turn, p70S6K1 phosphorylates a S6 protein of the 40S ribosomal subunit (S6rp) and 4E...

  5. Fanconi anemia protein, FANCG, is a phosphoprotein and is upregulated with FANCA after TNF-alpha treatment.

    Science.gov (United States)

    Futaki, M; Watanabe, S; Kajigaya, S; Liu, J M

    2001-02-23

    Fanconi anemia (FA) is a genetic syndrome characterized by bone marrow failure, birth defects, and a predisposition to malignancy. At this time, six FA genes have been identified, and several gene products have been found to interact in a protein complex. FA cells appear to overexpress the proinflammatory cytokine, tumor necrosis factor-alpha (TNF-alpha). We therefore examined the effects of TNF-alpha on the regulation of FA complementation group proteins, FANCG and FANCA. We found that treatment with TNF-alpha induced FANCG protein expression. FANCA was induced concurrently with FANCG, and the FANCA/FANCG complex was increased in the nucleus following TNF-alpha treatment. Inactivation of inhibitory kappa B kinase-2 modulated the expression of FANCG. We also found that both nuclear and cytoplasmic FANCG fractions were phosphorylated. These results show that FANCG is a phosphoprotein and suggest that the cellular accumulation of FA proteins is subject to regulation by TNF-alpha signaling.

  6. Organization of Replication of Ribosomal DNA in Saccharomyces cerevisiae

    NARCIS (Netherlands)

    Linskens, Maarten H.K.; Huberman, Joel A.

    1988-01-01

    Using recently developed replicon mapping techniques, we have analyzed the replication of the ribosomal DNA in Saccharomyces cerevisiae. The results show that (i) the functional origin of replication colocalizes with an autonomously replicating sequence element previously mapped to the

  7. Expression Profiling of Ribosome Biogenesis Factors Reveals Nucleolin as a Novel Potential Marker to Predict Outcome in AML Patients.

    Directory of Open Access Journals (Sweden)

    Virginie Marcel

    Full Text Available Acute myeloid leukemia (AML is a heterogeneous disease. Prognosis is mainly influenced by patient age at diagnosis and cytogenetic alterations, two of the main factors currently used in AML patient risk stratification. However, additional criteria are required to improve the current risk classification and better adapt patient care. In neoplastic cells, ribosome biogenesis is increased to sustain the high proliferation rate and ribosome composition is altered to modulate specific gene expression driving tumorigenesis. Here, we investigated the usage of ribosome biogenesis factors as clinical markers in adult patients with AML. We showed that nucleoli, the nucleus compartments where ribosome production takes place, are modified in AML by analyzing a panel of AML and healthy donor cells using immunofluorescence staining. Using four AML series, including the TCGA dataset, altogether representing a total of about 270 samples, we showed that not all factors involved in ribosome biogenesis have clinical values although ribosome biogenesis is increased in AML. Interestingly, we identified the regulator of ribosome production nucleolin (NCL as over-expressed in AML blasts. Moreover, we found in two series that high NCL mRNA expression level was associated with a poor overall survival, particular in elderly patients. Multivariate analyses taking into account age and cytogenetic risk indicated that NCL expression in blast cells is an independent marker of reduced survival. Our study identifies NCL as a potential novel prognostic factor in AML. Altogether, our results suggest that the ribosome biogenesis pathway may be of interest as clinical markers in AML.

  8. Predicting the dynamics of bacterial growth inhibition by ribosome-targeting antibiotics

    Science.gov (United States)

    Greulich, Philip; Doležal, Jakub; Scott, Matthew; Evans, Martin R.; Allen, Rosalind J.

    2017-12-01

    Understanding how antibiotics inhibit bacteria can help to reduce antibiotic use and hence avoid antimicrobial resistance—yet few theoretical models exist for bacterial growth inhibition by a clinically relevant antibiotic treatment regimen. In particular, in the clinic, antibiotic treatment is time-dependent. Here, we use a theoretical model, previously applied to steady-state bacterial growth, to predict the dynamical response of a bacterial cell to a time-dependent dose of ribosome-targeting antibiotic. Our results depend strongly on whether the antibiotic shows reversible transport and/or low-affinity ribosome binding (‘low-affinity antibiotic’) or, in contrast, irreversible transport and/or high affinity ribosome binding (‘high-affinity antibiotic’). For low-affinity antibiotics, our model predicts that growth inhibition depends on the duration of the antibiotic pulse, and can show a transient period of very fast growth following removal of the antibiotic. For high-affinity antibiotics, growth inhibition depends on peak dosage rather than dose duration, and the model predicts a pronounced post-antibiotic effect, due to hysteresis, in which growth can be suppressed for long times after the antibiotic dose has ended. These predictions are experimentally testable and may be of clinical significance.

  9. The primary structure of L37--a rat ribosomal protein with a zinc finger-like motif.

    Science.gov (United States)

    Chan, Y L; Paz, V; Olvera, J; Wool, I G

    1993-04-30

    The amino acid sequence of the rat 60S ribosomal subunit protein L37 was deduced from the sequence of nucleotides in a recombinant cDNA. Ribosomal protein L37 has 96 amino acids, the NH2-terminal methionine is removed after translation of the mRNA, and has a molecular weight of 10,939. Ribosomal protein L37 has a single zinc finger-like motif of the C2-C2 type. Hybridization of the cDNA to digests of nuclear DNA suggests that there are 13 or 14 copies of the L37 gene. The mRNA for the protein is about 500 nucleotides in length. Rat L37 is related to Saccharomyces cerevisiae ribosomal protein YL35 and to Caenorhabditis elegans L37. We have identified in the data base a DNA sequence that encodes the chicken homolog of rat L37.

  10. DNA replication initiator Cdc6 also regulates ribosomal DNA transcription initiation.

    Science.gov (United States)

    Huang, Shijiao; Xu, Xiaowei; Wang, Guopeng; Lu, Guoliang; Xie, Wenbing; Tao, Wei; Zhang, Hongyin; Jiang, Qing; Zhang, Chuanmao

    2016-04-01

    RNA-polymerase-I-dependent ribosomal DNA (rDNA) transcription is fundamental to rRNA processing, ribosome assembly and protein synthesis. However, how this process is initiated during the cell cycle is not fully understood. By performing a proteomic analysis of transcription factors that bind RNA polymerase I during rDNA transcription initiation, we identified that the DNA replication initiator Cdc6 interacts with RNA polymerase I and its co-factors, and promotes rDNA transcription in G1 phase in an ATPase-activity-dependent manner. We further showed that Cdc6 is targeted to the nucleolus during late mitosis and G1 phase in a manner that is dependent on B23 (also known as nucleophosmin, NPM1), and preferentially binds to the rDNA promoter through its ATP-binding domain. Overexpression of Cdc6 increases rDNA transcription, whereas knockdown of Cdc6 results in a decreased association of both RNA polymerase I and the RNA polymerase I transcription factor RRN3 with rDNA, and a reduction of rDNA transcription. Furthermore, depletion of Cdc6 impairs the interaction between RRN3 and RNA polymerase I. Taken together, our data demonstrate that Cdc6 also serves as a regulator of rDNA transcription initiation, and indicate a mechanism by which initiation of rDNA transcription and DNA replication can be coordinated in cells. © 2016. Published by The Company of Biologists Ltd.

  11. Nucleolus-derived mediators in oncogenic stress response and activation of p53-dependent pathways.

    Science.gov (United States)

    Stępiński, Dariusz

    2016-08-01

    Rapid growth and division of cells, including tumor ones, is correlated with intensive protein biosynthesis. The output of nucleoli, organelles where translational machineries are formed, depends on a rate of particular stages of ribosome production and on accessibility of elements crucial for their effective functioning, including substrates, enzymes as well as energy resources. Different factors that induce cellular stress also often lead to nucleolar dysfunction which results in ribosome biogenesis impairment. Such nucleolar disorders, called nucleolar or ribosomal stress, usually affect cellular functioning which in fact is a result of p53-dependent pathway activation, elicited as a response to stress. These pathways direct cells to new destinations such as cell cycle arrest, damage repair, differentiation, autophagy, programmed cell death or aging. In the case of impaired nucleolar functioning, nucleolar and ribosomal proteins mediate activation of the p53 pathways. They are also triggered as a response to oncogenic factor overexpression to protect tissues and organs against extensive proliferation of abnormal cells. Intentional impairment of any step of ribosome biosynthesis which would direct the cells to these destinations could be a strategy used in anticancer therapy. This review presents current knowledge on a nucleolus, mainly in relation to cancer biology, which is an important and extremely sensitive element of the mechanism participating in cellular stress reaction mediating activation of the p53 pathways in order to counteract stress effects, especially cancer development.

  12. The role of the RACK1 ortholog Cpc2p in modulating pheromone-induced cell cycle arrest in fission yeast.

    Directory of Open Access Journals (Sweden)

    Magdalena Mos

    Full Text Available The detection and amplification of extracellular signals requires the involvement of multiple protein components. In mammalian cells the receptor of activated C kinase (RACK1 is an important scaffolding protein for signal transduction networks. Further, it also performs a critical function in regulating the cell cycle by modulating the G1/S transition. Many eukaryotic cells express RACK1 orthologs, with one example being Cpc2p in the fission yeast Schizosaccharomyces pombe. In contrast to RACK1, Cpc2p has been described to positively regulate, at the ribosomal level, cells entry into M phase. In addition, Cpc2p controls the stress response pathways through an interaction with Msa2p, and sexual development by modulating Ran1p/Pat1p. Here we describe investigations into the role, which Cpc2p performs in controlling the G protein-mediated mating response pathway. Despite structural similarity to Gβ-like subunits, Cpc2p appears not to function at the G protein level. However, upon pheromone stimulation, cells overexpressing Cpc2p display substantial cell morphology defects, disorientation of septum formation and a significantly protracted G1 arrest. Cpc2p has the potential to function at multiple positions within the pheromone response pathway. We provide a mechanistic interpretation of this novel data by linking Cpc2p function, during the mating response, with its previous described interactions with Ran1p/Pat1p. We suggest that overexpressing Cpc2p prolongs the stimulated state of pheromone-induced cells by increasing ste11 gene expression. These data indicate that Cpc2p regulates the pheromone-induced cell cycle arrest in fission yeast by delaying cells entry into S phase.

  13. Bactobolin resistance is conferred by mutations in the L2 ribosomal protein.

    Science.gov (United States)

    Chandler, Josephine R; Truong, Thao T; Silva, Patricia M; Seyedsayamdost, Mohammad R; Carr, Gavin; Radey, Matthew; Jacobs, Michael A; Sims, Elizabeth H; Clardy, Jon; Greenberg, E Peter

    2012-12-18

    Burkholderia thailandensis produces a family of polyketide-peptide molecules called bactobolins, some of which are potent antibiotics. We found that growth of B. thailandensis at 30°C versus that at 37°C resulted in increased production of bactobolins. We purified the three most abundant bactobolins and determined their activities against a battery of bacteria and mouse fibroblasts. Two of the three compounds showed strong activities against both bacteria and fibroblasts. The third analog was much less potent in both assays. These results suggested that the target of bactobolins might be conserved across bacteria and mammalian cells. To learn about the mechanism of bactobolin activity, we isolated four spontaneous bactobolin-resistant Bacillus subtilis mutants. We used genomic sequencing technology to show that each of the four resistant variants had mutations in rplB, which codes for the 50S ribosome-associated L2 protein. Ectopic expression of a mutant rplB gene in wild-type B. subtilis conferred bactobolin resistance. Finally, the L2 mutations did not confer resistance to other antibiotics known to interfere with ribosome function. Our data indicate that bactobolins target the L2 protein or a nearby site and that this is not the target of other antibiotics. We presume that the mammalian target of bactobolins involves the eukaryotic homolog of L2 (L8e). Currently available antibiotics target surprisingly few cellular functions, and there is a need to identify novel antibiotic targets. We have been interested in the Burkholderia thailandensis bactobolins, and we sought to learn about the target of bactobolin activity by mapping spontaneous resistance mutations in the bactobolin-sensitive Bacillus subtilis. Our results indicate that the bactobolin target is the 50S ribosome-associated L2 protein or a region of the ribosome affected by L2. Bactobolin-resistant mutants are not resistant to other known ribosome inhibitors. Our evidence indicates that bactobolins

  14. Resistance to Linezolid Caused by Modifications at Its Binding Site on the Ribosome

    DEFF Research Database (Denmark)

    Long, Katherine S.; Vester, Birte

    2012-01-01

    Linezolid is an oxazolidinone antibiotic in clinical use for the treatment of serious infections of resistant Gram-positive bacteria. It inhibits protein synthesis by binding to the peptidyl transferase center on the ribosome. Almost all known resistance mechanisms involve small alterations...... to the linezolid binding site, so this review will therefore focus on the various changes that can adversely affect drug binding and confer resistance. High-resolution structures of linezolid bound to the 50S ribosomal subunit show that it binds in a deep cleft that is surrounded by 23S rRNA nucleotides. Mutation...... of 23S rRNA has for some time been established as a linezolid resistance mechanism. Although ribosomal proteins L3 and L4 are located further away from the bound drug, mutations in specific regions of these proteins are increasingly being associated with linezolid resistance. However, very little...

  15. Functional Dynamics within the Human Ribosome Regulate the Rate of Active Protein Synthesis.

    Science.gov (United States)

    Ferguson, Angelica; Wang, Leyi; Altman, Roger B; Terry, Daniel S; Juette, Manuel F; Burnett, Benjamin J; Alejo, Jose L; Dass, Randall A; Parks, Matthew M; Vincent, C Theresa; Blanchard, Scott C

    2015-11-05

    The regulation of protein synthesis contributes to gene expression in both normal physiology and disease, yet kinetic investigations of the human translation mechanism are currently lacking. Using single-molecule fluorescence imaging methods, we have quantified the nature and timing of structural processes in human ribosomes during single-turnover and processive translation reactions. These measurements reveal that functional complexes exhibit dynamic behaviors and thermodynamic stabilities distinct from those observed for bacterial systems. Structurally defined sub-states of pre- and post-translocation complexes were sensitive to specific inhibitors of the eukaryotic ribosome, demonstrating the utility of this platform to probe drug mechanism. The application of three-color single-molecule fluorescence resonance energy transfer (smFRET) methods further revealed a long-distance allosteric coupling between distal tRNA binding sites within ribosomes bearing three tRNAs, which contributed to the rate of processive translation. Copyright © 2015 Elsevier Inc. All rights reserved.

  16. On the intracellular trafficking of mouse S5 ribosomal protein from cytoplasm to nucleoli.

    Science.gov (United States)

    Matragkou, Ch; Papachristou, H; Karetsou, Z; Papadopoulos, G; Papamarcaki, T; Vizirianakis, I S; Tsiftsoglou, A S; Choli-Papadopoulou, T

    2009-10-09

    The non-ribosomal functions of mammalian ribosomal proteins have recently attracted worldwide attention. The mouse ribosomal protein S5 (rpS5) derived from ribosomal material is an assembled non-phosphorylated protein. The free form of rpS5 protein, however, undergoes phosphorylation. In this study, we have (a) investigated the potential role of phosphorylation in rpS5 protein transport into the nucleus and then into nucleoli and (b) determined which of the domains of rpS5 are involved in this intracellular trafficking. In vitro PCR mutagenesis of mouse rpS5 cDNA, complemented by subsequent cloning and expression of rpS5 truncated recombinant forms, produced in fusion with green fluorescent protein, permitted the investigation of rpS5 intracellular trafficking in HeLa cells using confocal microscopy complemented by Western blot analysis. Our results indicate the following: (a) rpS5 protein enters the nucleus via the region 38-50 aa that forms a random coil as revealed by molecular dynamic simulation. (b) Immunoprecipitation of rpS5 with casein kinase II and immobilized metal affinity chromatography analysis complemented by in vitro kinase assay revealed that phosphorylation of rpS5 seems to be indispensable for its transport from nucleus to nucleoli; upon entering the nucleus, Thr-133 phosphorylation triggers Ser-24 phosphorylation by casein kinase II, thus promoting entrance of rpS5 into the nucleoli. Another important role of rpS5 N-terminal region is proposed to be the regulation of protein's cellular level. The repetitively co-appearance of a satellite C-terminal band below the entire rpS5 at the late stationary phase, and not at the early logarithmic phase, of cell growth suggests a specific degradation balancing probably the unassembled ribosomal protein molecules with those that are efficiently assembled to ribosomal subunits. Overall, these data provide new insights on the structural and functional domains within the rpS5 molecule that contribute to its

  17. Structure of the hepatitis C virus IRES bound to the human 80S ribosome: remodeling of the HCV IRES.

    Science.gov (United States)

    Boehringer, Daniel; Thermann, Rolf; Ostareck-Lederer, Antje; Lewis, Joe D; Stark, Holger

    2005-11-01

    Initiation of translation of the hepatitis C virus (HCV) polyprotein is driven by an internal ribosome entry site (IRES) RNA that bypasses much of the eukaryotic translation initiation machinery. Here, single-particle electron cryomicroscopy has been used to study the mechanism of HCV IRES-mediated initiation. A HeLa in vitro translation system was used to assemble human IRES-80S ribosome complexes under near physiological conditions; these were stalled before elongation. Domain 2 of the HCV IRES is bound to the tRNA exit site, touching the L1 stalk of the 60S subunit, suggesting a mechanism for the removal of the HCV IRES in the progression to elongation. Domain 3 of the HCV IRES positions the initiation codon in the ribosomal mRNA binding cleft by binding helix 28 at the head of the 40S subunit. The comparison with the previously published binary 40S-HCV IRES complex reveals structural rearrangements in the two pseudoknot structures of the HCV IRES in translation initiation.

  18. Symportin 1 chaperones 5S RNP assembly during ribosome biogenesis by occupying an essential rRNA-binding site.

    Science.gov (United States)

    Calviño, Fabiola R; Kharde, Satyavati; Ori, Alessandro; Hendricks, Astrid; Wild, Klemens; Kressler, Dieter; Bange, Gert; Hurt, Ed; Beck, Martin; Sinning, Irmgard

    2015-04-07

    During 60S biogenesis, mature 5S RNP consisting of 5S RNA, RpL5 and RpL11, assembles into a pre-60S particle, where docking relies on RpL11 interacting with helix 84 (H84) of the 25S RNA. How 5S RNP is assembled for recruitment into the pre-60S is not known. Here we report the crystal structure of a ternary symportin Syo1-RpL5-N-RpL11 complex and provide biochemical and structural insights into 5S RNP assembly. Syo1 guards the 25S RNA-binding surface on RpL11 and competes with H84 for binding. Pull-down experiments show that H84 releases RpL11 from the ternary complex, but not in the presence of 5S RNA. Crosslinking mass spectrometry visualizes structural rearrangements on incorporation of 5S RNA into the Syo1-RpL5-RpL11 complex supporting the formation of a pre-5S RNP. Our data underline the dual role of Syo1 in ribosomal protein transport and as an assembly platform for 5S RNP.

  19. Ribosomal S6K1 in POMC and AgRP Neurons Regulates Glucose Homeostasis but Not Feeding Behavior in Mice

    Directory of Open Access Journals (Sweden)

    Mark A. Smith

    2015-04-01

    Full Text Available Hypothalamic ribosomal S6K1 has been suggested as a point of convergence for hormonal and nutrient signals in the regulation of feeding behavior, bodyweight, and glucose metabolism. However, the long-term effects of manipulating hypothalamic S6K1 signaling on energy homeostasis and the cellular mechanisms underlying these roles are unclear. We therefore inactivated S6K1 in pro-opiomelanocortin (POMC and agouti-related protein (AgRP neurons, key regulators of energy homeostasis, but in contrast to the current view, we found no evidence that S6K1 regulates food intake and bodyweight. In contrast, S6K1 signaling in POMC neurons regulated hepatic glucose production and peripheral lipid metabolism and modulated neuronal excitability. S6K1 signaling in AgRP neurons regulated skeletal muscle insulin sensitivity and was required for glucose sensing by these neurons. Our findings suggest that S6K1 signaling is not a general integrator of energy homeostasis in the mediobasal hypothalamus but has distinct roles in the regulation of glucose homeostasis by POMC and AgRP neurons.

  20. Non-canonical ribosomal DNA segments in the human genome, and nucleoli functioning.

    Science.gov (United States)

    Kupriyanova, Natalia S; Netchvolodov, Kirill K; Sadova, Anastasia A; Cherepanova, Marina D; Ryskov, Alexei P

    2015-11-10

    Ribosomal DNA (rDNA) in the human genome is represented by tandem repeats of 43 kb nucleotide sequences that form nucleoli organizers (NORs) on each of five pairs of acrocentric chromosomes. RDNA-similar segments of different lengths are also present on (NOR)(-) chromosomes. Many of these segments contain nucleotide substitutions, supplementary microsatellite clusters, and extended deletions. Recently, it was shown that, in addition to ribosome biogenesis, nucleoli exhibit additional functions, such as cell-cycle regulation and response to stresses. In particular, several stress-inducible loci located in the ribosomal intergenic spacer (rIGS) produce stimuli-specific noncoding nucleolus RNAs. By mapping the 5'/3' ends of the rIGS segments scattered throughout (NOR)(-) chromosomes, we discovered that the bonds in the rIGS that were most often susceptible to disruption in the rIGS were adjacent to, or overlapped with stimuli-specific inducible loci. This suggests the interconnection of the two phenomena - nucleoli functioning and the scattering of rDNA-like sequences on (NOR)(-) chromosomes. Copyright © 2015 Elsevier B.V. All rights reserved.