GTPases and the origin of the ribosome
Directory of Open Access Journals (Sweden)
Smith Temple F
2010-05-01
Full Text Available Abstract Background This paper is an attempt to trace the evolution of the ribosome through the evolution of the universal P-loop GTPases that are involved with the ribosome in translation and with the attachment of the ribosome to the membrane. The GTPases involved in translation in Bacteria/Archaea are the elongation factors EFTu/EF1, the initiation factors IF2/aeIF5b + aeIF2, and the elongation factors EFG/EF2. All of these GTPases also contain the OB fold also found in the non GTPase IF1 involved in initiation. The GTPase involved in the signal recognition particle in most Bacteria and Archaea is SRP54. Results 1 The Elongation Factors of the Archaea based on structural considerations of the domains have the following evolutionary path: EF1→ aeIF2 → EF2. The evolution of the aeIF5b was a later event; 2 the Elongation Factors of the Bacteria based on the topological considerations of the GTPase domain have a similar evolutionary path: EFTu→ IF→2→EFG. These evolutionary sequences reflect the evolution of the LSU followed by the SSU to form the ribosome; 3 the OB-fold IF1 is a mimic of an ancient tRNA minihelix. Conclusion The evolution of translational GTPases of both the Archaea and Bacteria point to the evolution of the ribosome. The elongation factors, EFTu/EF1, began as a Ras-like GTPase bringing the activated minihelix tRNA to the Large Subunit Unit. The initiation factors and elongation factor would then have evolved from the EFTu/EF1 as the small subunit was added to the evolving ribosome. The SRP has an SRP54 GTPase and a specific RNA fold in its RNA component similar to the PTC. We consider the SRP to be a remnant of an ancient form of an LSU bound to a membrane. Reviewers This article was reviewed by George Fox, Leonid Mirny and Chris Sander.
International Nuclear Information System (INIS)
Nichols, C. E.; Johnson, C.; Lamb, H. K.; Lockyer, M.; Charles, I. G.; Hawkins, A. R.; Stammers, D. K.
2007-01-01
The X-ray crystal structure of the GTPase YjeQ from S. typhimurium is presented and compared with those of orthologues from T. maritima and B. subtilis. The YjeQ class of P-loop GTPases assist in ribosome biogenesis and also bind to the 30S subunit of mature ribosomes. YjeQ ribosomal binding is GTP-dependent and thought to specifically direct protein synthesis, although the nature of the upstream signal causing this event in vivo is as yet unknown. The attenuating effect of YjeQ mutants on bacterial growth in Escherichia coli makes it a potential target for novel antimicrobial agents. In order to further explore the structure and function of YjeQ, the isolation, crystallization and structure determination of YjeQ from the enterobacterial species Salmonella typhimurium (StYjeQ) is reported. Whilst the overall StYjeQ fold is similar to those of the previously reported Thematoga maritima and Bacillus subtilis orthologues, particularly the GTPase domain, there are larger differences in the three OB folds. Although the zinc-finger secondary structure is conserved, significant sequence differences alter the nature of the external surface in each case and may reflect varying signalling pathways. Therefore, it may be easier to develop YjeQ-specific inhibitors that target the N- and C-terminal regions, disrupting the metabolic connectivity rather than the GTPase activity. The availability of coordinates for StYjeQ will provide a significantly improved basis for threading Gram-negative orthologue sequences and in silico compound-screening studies, with the potential for the development of species-selective drugs
Energy Technology Data Exchange (ETDEWEB)
Nichols, C. E. [Division of Structural Biology, The Wellcome Trust Centre for Human Genetics, University of Oxford, Roosevelt Drive, Oxford OX3 7BN (United Kingdom); Johnson, C.; Lamb, H. K. [Institute of Cell and Molecular Biosciences, Catherine Cookson Building, Medical School, Framlington Place, Newcastle University, Newcastle-upon-Tyne NE2 4HH (United Kingdom); Lockyer, M. [Arrow Therapeutics Ltd, Britannia House, Trinity Street, Borough, London SE1 1DA (United Kingdom); Charles, I. G. [The Wolfson Institute for Biomedical Research, The Cruciform Building, University College London, Gower Street, London WC1E 6BT (United Kingdom); Hawkins, A. R. [Institute of Cell and Molecular Biosciences, Catherine Cookson Building, Medical School, Framlington Place, Newcastle University, Newcastle-upon-Tyne NE2 4HH (United Kingdom); Stammers, D. K., E-mail: daves@strubi.ox.ac.uk [Division of Structural Biology, The Wellcome Trust Centre for Human Genetics, University of Oxford, Roosevelt Drive, Oxford OX3 7BN (United Kingdom)
2007-11-01
The X-ray crystal structure of the GTPase YjeQ from S. typhimurium is presented and compared with those of orthologues from T. maritima and B. subtilis. The YjeQ class of P-loop GTPases assist in ribosome biogenesis and also bind to the 30S subunit of mature ribosomes. YjeQ ribosomal binding is GTP-dependent and thought to specifically direct protein synthesis, although the nature of the upstream signal causing this event in vivo is as yet unknown. The attenuating effect of YjeQ mutants on bacterial growth in Escherichia coli makes it a potential target for novel antimicrobial agents. In order to further explore the structure and function of YjeQ, the isolation, crystallization and structure determination of YjeQ from the enterobacterial species Salmonella typhimurium (StYjeQ) is reported. Whilst the overall StYjeQ fold is similar to those of the previously reported Thematoga maritima and Bacillus subtilis orthologues, particularly the GTPase domain, there are larger differences in the three OB folds. Although the zinc-finger secondary structure is conserved, significant sequence differences alter the nature of the external surface in each case and may reflect varying signalling pathways. Therefore, it may be easier to develop YjeQ-specific inhibitors that target the N- and C-terminal regions, disrupting the metabolic connectivity rather than the GTPase activity. The availability of coordinates for StYjeQ will provide a significantly improved basis for threading Gram-negative orthologue sequences and in silico compound-screening studies, with the potential for the development of species-selective drugs.
Polkinghorne, Adam; Vaughan, Lloyd
2011-01-01
The stringent stress response is vital for bacterial survival under adverse environmental conditions. Obligate intracellular Chlamydia lack key stringent response proteins, but nevertheless can interrupt the cell cycle and enter stasis or persistence upon amino acid starvation. A possible key protein retained is YhbZ, a homologue of the ObgE guanosine triphosphatase (GTPase) superfamily connecting the stringent stress response to ribosome maturation. Curiously, chlamydial YhbZ lacks the ObgE C-terminal domain thought to be essential for binding the large ribosomal subunit. We expressed recombinant Chlamydia abortus YhbZ and showed it to be a functional GTPase, with similar activity to other Obg GTPase family members. As Chlamydia are resistant to genetic manipulation, we performed heterologous expression and gradient centrifugation experiments in Escherichia coli and found that, despite the missing C-terminal domain, C. abortus YhbZ co-fractionates with the E. coli 50S large ribosomal subunit. In addition, overexpression of chlamydial YhbZ in E. coli leads to growth defects and elongation, as reported for other Obg members. YhbZ did not complement an E. coli obgE temperature-sensitive mutant, indicating the C-terminal acidic domain may have an additional role. This data supports a role for YhbZ linking the chlamydial stress response to ribosome function and cellular growth. Copyright © 2010 Elsevier Ltd. All rights reserved.
DEFF Research Database (Denmark)
Porse, B T; Leviev, I; Mankin, A S
1998-01-01
A newly identified class of highly thiostrepton-resistant mutants of the archaeon Halobacterium halobium carry a missense mutation at codon 18 within the gene encoding ribosomal protein L11. In the mutant proteins, a proline, conserved in archaea and bacteria, is converted to either serine...... technique, demonstrated that a general tightening of the C-terminal domain occurred on rRNA binding, while thiostrepton produced a footprint centred on tyrosine 62 at the junction of the N and C-terminal domains of protein L11 complexed to rRNA. The intensity of this protein footprint was strongly reduced...
Zhao, Huayan
2015-08-13
The circularly permuted GTPase large subunit GTPase 1 (LSG1) is involved in the maturation step of the 60S ribosome and is essential for cell viability in yeast. Here, an Arabidopsis mutant dig6 (drought inhibited growth of lateral roots) was isolated. The mutant exhibited multiple auxin-related phenotypes, which included reduced lateral root number, altered leaf veins, and shorter roots. Genetic mapping combined with next-generation DNA sequencing identified that the mutation occurred in AtLSG1-2. This gene was highly expressed in regions of auxin accumulation. Ribosome profiling revealed that a loss of function of AtLSG1-2 led to decreased levels of monosomes, further demonstrating its role in ribosome biogenesis. Quantitative proteomics showed that the expression of certain proteins involved in ribosome biogenesis was differentially regulated, indicating that ribosome biogenesis processes were impaired in the mutant. Further investigations showed that an AtLSG1-2 deficiency caused the alteration of auxin distribution, response, and transport in plants. It is concluded that AtLSG1-2 is integral to ribosome biogenesis, consequently affecting auxin homeostasis and plant development.
Zhao, Huayan; Lü , Shiyou; Li, Ruixi; Chen, Tao; Zhang, Huoming; Cui, Peng; Ding, Feng; Liu, Pei; Wang, Guangchao; Xia, Yiji; Running, Mark P.; Xiong, Liming
2015-01-01
The circularly permuted GTPase large subunit GTPase 1 (LSG1) is involved in the maturation step of the 60S ribosome and is essential for cell viability in yeast. Here, an Arabidopsis mutant dig6 (drought inhibited growth of lateral roots) was isolated. The mutant exhibited multiple auxin-related phenotypes, which included reduced lateral root number, altered leaf veins, and shorter roots. Genetic mapping combined with next-generation DNA sequencing identified that the mutation occurred in AtLSG1-2. This gene was highly expressed in regions of auxin accumulation. Ribosome profiling revealed that a loss of function of AtLSG1-2 led to decreased levels of monosomes, further demonstrating its role in ribosome biogenesis. Quantitative proteomics showed that the expression of certain proteins involved in ribosome biogenesis was differentially regulated, indicating that ribosome biogenesis processes were impaired in the mutant. Further investigations showed that an AtLSG1-2 deficiency caused the alteration of auxin distribution, response, and transport in plants. It is concluded that AtLSG1-2 is integral to ribosome biogenesis, consequently affecting auxin homeostasis and plant development.
Characterization of mitochondrion-targeted GTPases in Plasmodium falciparum.
Gupta, Kirti; Gupta, Ankit; Haider, Afreen; Habib, Saman
2018-04-12
Ribosome assembly is critical for translation and regulating the response to cellular events and requires a complex interplay of ribosomal RNA and proteins with assembly factors. We investigated putative participants in the biogenesis of the reduced organellar ribosomes of Plasmodium falciparum and identified homologues of two assembly GTPases - EngA and Obg that were found in mitochondria. Both are indispensable in bacteria and P. berghei EngA is among the 'essential' parasite blood stage proteins identified recently. PfEngA and PfObg1 interacted with parasite mitoribosomes in vivo. GTP stimulated PfEngA interaction with the 50S subunit of Escherichia coli surrogate ribosomes. Although PfObg1-ribosome interaction was independent of nucleotide binding, GTP hydrolysis by PfObg1 was enhanced upon ribosomal association. An additional function for PfObg1 in mitochondrial DNA transactions was suggested by its specific interaction with the parasite mitochondrial genome in vivo. Deletion analysis revealed that the positively-charged OBG (spoOB-associated GTP-binding protein) domain mediates DNA-binding. A role for PfEngA in mitochondrial genotoxic stress response was indicated by its over-expression upon methyl methanesulfonate-induced DNA damage. PfEngA had lower sensitivity to an E. coli EngA inhibitor suggesting differences with bacterial counterparts. Our results show the involvement of two important GTPases in P. falciparum mitochondrial function, with the first confirmed localization of an EngA homologue in eukaryotic mitochondria.
The activity of the acidic phosphoproteins from the 80 S rat liver ribosome.
MacConnell, W P; Kaplan, N O
1982-05-25
The selective removal of acidic phosphoproteins from the 80 S rat liver ribosome was accomplished by successive alcohol extractions at low salt concentration. The resulting core ribosomes lost over 90% of their translation activity and were unable to support the elongation factor 2 GTPase reaction. Both activities were partially restored when the dialyzed extracts were added back to the core ribosome. The binding of labeled adenosine diphosphoribosyl-elongation factor 2 to ribosomes was also affected by extraction and could be reconstituted, although not to the same extent as the GTPase activity associated with elongation factor 2 in the presence of the ribosome. The alcohol extracts of the 80 S ribosome contained mostly phosphoproteins P1 and P2 which could be dephosphorylated and rephosphorylated in solution by alkaline phosphatase and protein kinase, respectively. Dephosphorylation of the P1/P2 mixture in the extracts caused a decrease in the ability of these proteins to reactivate the polyphenylalanine synthesis activity of the core ribosome. However, treatment of the dephosphorylated proteins with the catalytic subunit of 3':5'-cAMP-dependent protein kinase in the presence of ATP reactivated the proteins when compared to the activity of the native extracts. Rabbit antisera raised against the alcohol-extracted proteins were capable of impairing both the polyphenylalanine synthesis reaction and the elongation factor 2-dependent GTPase reaction in the intact ribosomes.
DEFF Research Database (Denmark)
Rosendahl, G; Douthwaite, S
1993-01-01
RNA, and to investigate how this interaction is influenced by other ribosomal components. Complexes were characterized in both naked 23 S rRNA and ribosomes from an E. coli L11-minus strain, before and after reconstitution with L11. The protein protects 17 riboses between positions 1058 and 1085 in the naked 23 S r......The Escherichia coli ribosomal protein (r-protein) L11 and its binding site on 23 S ribosomal RNA (rRNA) are associated with ribosomal hydrolysis of guanosine 5'-triphosphate (GTP). We have used hydroxyl radical footprinting to map the contacts between L11 and the backbone riboses in 23 S r......)4 and other proteins within the ribosome. The antibiotics thiostrepton and micrococcin inhibit the catalytic functions of this region by slotting in between the accessible loops and interacting with nucleotides there....
Pringle, Märit; Poehlsgaard, Jacob; Vester, Birte; Long, Katherine S
2004-12-01
The pleuromutilin antibiotic tiamulin binds to the ribosomal peptidyl transferase centre. Three groups of Brachyspira spp. isolates with reduced tiamulin susceptibility were analysed to define resistance mechanisms to the drug. Mutations were identified in genes encoding ribosomal protein L3 and 23S rRNA at positions proximal to the peptidyl transferase centre. In two groups of laboratory-selected mutants, mutations were found at nucleotide positions 2032, 2055, 2447, 2499, 2504 and 2572 of 23S rRNA (Escherichia coli numbering) and at amino acid positions 148 and 149 of ribosomal protein L3 (Brachyspira pilosicoli numbering). In a third group of clinical B. hyodysenteriae isolates, only a single mutation at amino acid 148 of ribosomal protein L3 was detected. Chemical footprinting experiments show a reduced binding of tiamulin to ribosomal subunits from mutants with decreased susceptibility to the drug. This reduction in drug binding is likely the resistance mechanism for these strains. Hence, the identified mutations located near the tiamulin binding site are predicted to be responsible for the resistance phenotype. The positions of the mutated residues relative to the bound drug advocate a model where the mutations affect tiamulin binding indirectly through perturbation of nucleotide U2504.
Ribosome-induced changes in elongation factor Tu conformation control GTP hydrolysis
DEFF Research Database (Denmark)
Villa, Elizabeth; Sengupta, Jayati; Trabuco, Leonard G.
2009-01-01
In translation, elongation factor Tu (EF-Tu) molecules deliver aminoacyl-tRNAs to the mRNA-programmed ribosome. The GTPase activity of EF-Tu is triggered by ribosome-induced conformational changes of the factor that play a pivotal role in the selection of the cognate aminoacyl-tRNAs. We present a 6.......7-A cryo-electron microscopy map of the aminoacyl-tRNA x EF-Tu x GDP x kirromycin-bound Escherichia coli ribosome, together with an atomic model of the complex obtained through molecular dynamics flexible fitting. The model reveals the conformational changes in the conserved GTPase switch regions...... of EF-Tu that trigger hydrolysis of GTP, along with key interactions, including those between the sarcin-ricin loop and the P loop of EF-Tu, and between the effector loop of EF-Tu and a conserved region of the 16S rRNA. Our data suggest that GTP hydrolysis on EF-Tu is controlled through a hydrophobic...
Directory of Open Access Journals (Sweden)
Fucini Paola
2004-04-01
Full Text Available Abstract Background The bacterial ribosome is a primary target of several classes of antibiotics. Investigation of the structure of the ribosomal subunits in complex with different antibiotics can reveal the mode of inhibition of ribosomal protein synthesis. Analysis of the interactions between antibiotics and the ribosome permits investigation of the specific effect of modifications leading to antimicrobial resistances. Streptogramins are unique among the ribosome-targeting antibiotics because they consist of two components, streptogramins A and B, which act synergistically. Each compound alone exhibits a weak bacteriostatic activity, whereas the combination can act bactericidal. The streptogramins A display a prolonged activity that even persists after removal of the drug. However, the mode of activity of the streptogramins has not yet been fully elucidated, despite a plethora of biochemical and structural data. Results The investigation of the crystal structure of the 50S ribosomal subunit from Deinococcus radiodurans in complex with the clinically relevant streptogramins quinupristin and dalfopristin reveals their unique inhibitory mechanism. Quinupristin, a streptogramin B compound, binds in the ribosomal exit tunnel in a similar manner and position as the macrolides, suggesting a similar inhibitory mechanism, namely blockage of the ribosomal tunnel. Dalfopristin, the corresponding streptogramin A compound, binds close to quinupristin directly within the peptidyl transferase centre affecting both A- and P-site occupation by tRNA molecules. Conclusions The crystal structure indicates that the synergistic effect derives from direct interaction between both compounds and shared contacts with a single nucleotide, A2062. Upon binding of the streptogramins, the peptidyl transferase centre undergoes a significant conformational transition, which leads to a stable, non-productive orientation of the universally conserved U2585. Mutations of this r
Tanzawa, Takehito; Kato, Koji; Girodat, Dylan; Ose, Toyoyuki; Kumakura, Yuki; Wieden, Hans-Joachim; Uchiumi, Toshio; Tanaka, Isao; Yao, Min
2018-04-06
Archaea and eukaryotes have ribosomal P stalks composed of anchor protein P0 and aP1 homodimers (archaea) or P1•P2 heterodimers (eukaryotes). These P stalks recruit translational GTPases to the GTPase-associated center in ribosomes to provide energy during translation. The C-terminus of the P stalk is known to selectively recognize GTPases. Here we investigated the interaction between the P stalk and elongation factor 2 by determining the structures of Pyrococcus horikoshii EF-2 (PhoEF-2) in the Apo-form, GDP-form, GMPPCP-form (GTP-form), and GMPPCP-form bound with 11 C-terminal residues of P1 (P1C11). Helical structured P1C11 binds to a hydrophobic groove between domain G and subdomain G' of PhoEF-2, where is completely different from that of aEF-1α in terms of both position and sequence, implying that such interaction characteristic may be requested by how GTPases perform their functions on the ribosome. Combining PhoEF-2 P1-binding assays with a structural comparison of current PhoEF-2 structures and molecular dynamics model of a P1C11-bound GDP form, the conformational changes of the P1C11-binding groove in each form suggest that in response to the translation process, the groove has three states: closed, open, and release for recruiting and releasing GTPases.
DEFF Research Database (Denmark)
Poulsen, S M; Karlsson, M; Johansson, L B
2001-01-01
The pleuromutilin antibiotic derivatives, tiamulin and valnemulin, inhibit protein synthesis by binding to the 50S ribosomal subunit of bacteria. The action and binding site of tiamulin and valnemulin was further characterized on Escherichia coli ribosomes. It was revealed that these drugs...... centre and have been associated with binding of several antibiotics. Competitive footprinting shows that tiamulin and valnemulin can bind concurrently with the macrolide erythromycin but compete with the macrolide carbomycin, which is a peptidyl transferase inhibitor. We infer from these and previous...... results that tiamulin and valnemulin interact with the rRNA in the peptidyl transferase slot on the ribosomes in which they prevent the correct positioning of the CCA-ends of tRNAs for peptide transfer....
Salmonella Enterica Serovar Typhimurium BipA Exhibits Two Distinct Ribosome Binding Modes
Energy Technology Data Exchange (ETDEWEB)
deLivron, M.; Robinson, V
2008-01-01
BipA is a highly conserved prokaryotic GTPase that functions to influence numerous cellular processes in bacteria. In Escherichia coli and Salmonella enterica serovar Typhimurium, BipA has been implicated in controlling bacterial motility, modulating attachment and effacement processes, and upregulating the expression of virulence genes and is also responsible for avoidance of host defense mechanisms. In addition, BipA is thought to be involved in bacterial stress responses, such as those associated with virulence, temperature, and symbiosis. Thus, BipA is necessary for securing bacterial survival and successful invasion of the host. Steady-state kinetic analysis and pelleting assays were used to assess the GTPase and ribosome-binding properties of S. enterica BipA. Under normal bacterial growth, BipA associates with the ribosome in the GTP-bound state. However, using sucrose density gradients, we demonstrate that the association of BipA and the ribosome is altered under stress conditions in bacteria similar to those experienced during virulence. The data show that this differential binding is brought about by the presence of ppGpp, an alarmone that signals the onset of stress-related events in bacteria.
Defective ribosome assembly in Shwachman-Diamond syndrome.
Wong, Chi C; Traynor, David; Basse, Nicolas; Kay, Robert R; Warren, Alan J
2011-10-20
Shwachman-Diamond syndrome (SDS), a recessive leukemia predisposition disorder characterized by bone marrow failure, exocrine pancreatic insufficiency, skeletal abnormalities and poor growth, is caused by mutations in the highly conserved SBDS gene. Here, we test the hypothesis that defective ribosome biogenesis underlies the pathogenesis of SDS. We create conditional mutants in the essential SBDS ortholog of the ancient eukaryote Dictyostelium discoideum using temperature-sensitive, self-splicing inteins, showing that mutant cells fail to grow at the restrictive temperature because ribosomal subunit joining is markedly impaired. Remarkably, wild type human SBDS complements the growth and ribosome assembly defects in mutant Dictyostelium cells, but disease-associated human SBDS variants are defective. SBDS directly interacts with the GTPase elongation factor-like 1 (EFL1) on nascent 60S subunits in vivo and together they catalyze eviction of the ribosome antiassociation factor eukaryotic initiation factor 6 (eIF6), a prerequisite for the translational activation of ribosomes. Importantly, lymphoblasts from SDS patients harbor a striking defect in ribosomal subunit joining whose magnitude is inversely proportional to the level of SBDS protein. These findings in Dictyostelium and SDS patient cells provide compelling support for the hypothesis that SDS is a ribosomopathy caused by corruption of an essential cytoplasmic step in 60S subunit maturation.
Journal of Biosciences | Indian Academy of Sciences
Indian Academy of Sciences (India)
The ribosomal phosphoprotein P0 of the human malarial parasite Plasmodium falciparum (PfP0) has been identified as a protective surface protein. In Drosophila, P0 protein functions in the nucleus. The ribosomal function of P0 is mediated at the stalk of the large ribosomal subunit at the GTPase centre, where the ...
The 70S ribosome modulates the ATPase activity of Escherichia coli YchF.
Becker, Marion; Gzyl, Katherine E; Altamirano, Alvin M; Vuong, Anthony; Urban, Kirstin; Wieden, Hans-Joachim
2012-10-01
YchF is one of two universally conserved GTPases with unknown cellular function. As a first step toward elucidating YchF's cellular role, we performed a detailed biochemical characterization of the protein from Escherichia coli. Our data from fluorescence titrations not only confirmed the surprising finding that YchFE.coli binds adenine nucleotides more efficiently than guanine nucleotides, but also provides the first evidence suggesting that YchF assumes two distinct conformational states (ATP- and ADP-bound) consistent with the functional cycle of a typical GTPase. Based on an in vivo pull-down experiment using a His-tagged variant of YchF from E. coli (YchFE.coli), we were able to isolate a megadalton complex containing the 70S ribosome. Based on this finding, we report the successful reconstitution of a YchF•70S complex in vitro, revealing an affinity (KD) of the YchFE.coli•ADPNP complex for 70S ribosomes of 3 μM. The in vitro reconstitution data also suggests that the identity of the nucleotide-bound state of YchF (ADP or ATP) modulates its affinity for 70S ribosomes. A detailed Michaelis-Menten analysis of YchF's catalytic activity in the presence and the absence of the 70S ribosome and its subunits revealed for the first time that the 70S ribosome is able to stimulate YchF's ATPase activity (~10-fold), confirming the ribosome as part of the functional cycle of YchF. Our findings taken together with previously reported data for the human homolog of YchF (hOLA1) indicate a high level of evolutionary conservation in the enzymatic properties of YchF and suggest that the ribosome is the main functional partner of YchF not only in bacteria.
International Nuclear Information System (INIS)
Shigeno, Yuta; Uchiumi, Toshio; Nomura, Takaomi
2016-01-01
Ribosomal protein L6, an essential component of the large (50S) subunit, primarily binds to helix 97 of 23S rRNA and locates near the sarcin/ricin loop of helix 95 that directly interacts with GTPase translation factors. Although L6 is believed to play important roles in factor-dependent ribosomal function, crucial biochemical evidence for this hypothesis has not been obtained. We constructed and characterized an Escherichia coli mutant bearing a chromosomal L6 gene (rplF) disruption and carrying a plasmid with an arabinose-inducible L6 gene. Although this ΔL6 mutant grew more slowly than its wild-type parent, it proliferated in the presence of arabinose. Interestingly, cell growth in the absence of arabinose was biphasic. Early growth lasted only a few generations (LI-phase) and was followed by a suspension of growth for several hours (S-phase). This suspension was followed by a second growth phase (LII-phase). Cells harvested at both LI- and S-phases contained ribosomes with reduced factor-dependent GTPase activity and accumulated 50S subunit precursors (45S particles). The 45S particles completely lacked L6. Complete 50S subunits containing L6 were observed in all growth phases regardless of the L6-depleted condition, implying that the ΔL6 mutant escaped death because of a leaky expression of L6 from the complementing plasmid. We conclude that L6 is essential for the assembly of functional 50S subunits at the late stage. We thus established conditions for the isolation of L6-depleted 50S subunits, which are essential to study the role of L6 in translation. - Highlights: • We constructed an in vivo functional assay system for Escherichia coli ribosomal protein L6. • Growth of an E. coli ΔL6 mutant was biphasic when L6 levels were depleted. • The ΔL6 mutant accumulated 50S ribosomal subunit precursors that sedimented at 45S. • L6 is a key player in the late stage of E. coli 50S subunit assembly.
Energy Technology Data Exchange (ETDEWEB)
Shigeno, Yuta [Division of Applied Biology, Faculty of Textile Science and Technology, Shinshu University, Ueda 386-8567 (Japan); Uchiumi, Toshio [Department of Biology, Faculty of Science, Niigata University, Niigata 950-2181 (Japan); Nomura, Takaomi, E-mail: nomurat@shinshu-u.ac.jp [Division of Applied Biology, Faculty of Textile Science and Technology, Shinshu University, Ueda 386-8567 (Japan)
2016-04-22
Ribosomal protein L6, an essential component of the large (50S) subunit, primarily binds to helix 97 of 23S rRNA and locates near the sarcin/ricin loop of helix 95 that directly interacts with GTPase translation factors. Although L6 is believed to play important roles in factor-dependent ribosomal function, crucial biochemical evidence for this hypothesis has not been obtained. We constructed and characterized an Escherichia coli mutant bearing a chromosomal L6 gene (rplF) disruption and carrying a plasmid with an arabinose-inducible L6 gene. Although this ΔL6 mutant grew more slowly than its wild-type parent, it proliferated in the presence of arabinose. Interestingly, cell growth in the absence of arabinose was biphasic. Early growth lasted only a few generations (LI-phase) and was followed by a suspension of growth for several hours (S-phase). This suspension was followed by a second growth phase (LII-phase). Cells harvested at both LI- and S-phases contained ribosomes with reduced factor-dependent GTPase activity and accumulated 50S subunit precursors (45S particles). The 45S particles completely lacked L6. Complete 50S subunits containing L6 were observed in all growth phases regardless of the L6-depleted condition, implying that the ΔL6 mutant escaped death because of a leaky expression of L6 from the complementing plasmid. We conclude that L6 is essential for the assembly of functional 50S subunits at the late stage. We thus established conditions for the isolation of L6-depleted 50S subunits, which are essential to study the role of L6 in translation. - Highlights: • We constructed an in vivo functional assay system for Escherichia coli ribosomal protein L6. • Growth of an E. coli ΔL6 mutant was biphasic when L6 levels were depleted. • The ΔL6 mutant accumulated 50S ribosomal subunit precursors that sedimented at 45S. • L6 is a key player in the late stage of E. coli 50S subunit assembly.
Placeholder factors in ribosome biogenesis: please, pave my way
Directory of Open Access Journals (Sweden)
Francisco J. Espinar-Marchena
2017-04-01
Full Text Available The synthesis of cytoplasmic eukaryotic ribosomes is an extraordinarily energy-demanding cellular activity that occurs progressively from the nucleolus to the cytoplasm. In the nucleolus, precursor rRNAs associate with a myriad of trans-acting factors and some ribosomal proteins to form pre-ribosomal particles. These factors include snoRNPs, nucleases, ATPases, GTPases, RNA helicases, and a vast list of proteins with no predicted enzymatic activity. Their coordinate activity orchestrates in a spatiotemporal manner the modification and processing of precursor rRNAs, the rearrangement reactions required for the formation of productive RNA folding intermediates, the ordered assembly of the ribosomal proteins, and the export of pre-ribosomal particles to the cytoplasm; thus, providing speed, directionality and accuracy to the overall process of formation of translation-competent ribosomes. Here, we review a particular class of trans-acting factors known as “placeholders”. Placeholder factors temporarily bind selected ribosomal sites until these have achieved a structural context that is appropriate for exchanging the placeholder with another site-specific binding factor. By this strategy, placeholders sterically prevent premature recruitment of subsequently binding factors, premature formation of structures, avoid possible folding traps, and act as molecular clocks that supervise the correct progression of pre-ribosomal particles into functional ribosomal subunits. We summarize the current understanding of those factors that delay the assembly of distinct ribosomal proteins or subsequently bind key sites in pre-ribosomal particles. We also discuss recurrent examples of RNA-protein and protein-protein mimicry between rRNAs and/or factors, which have clear functional implications for the ribosome biogenesis pathway.
DEFF Research Database (Denmark)
Li, Hui; Peyrollier, Karine; Kilic, Gülcan
2014-01-01
Rho GTPases are a family of small GTPases, which play an important role in the regulation of the actin cytoskeleton. Not surprisingly, Rho GTPases are crucial for cell migration and therefore highly important for cancer cell invasion and the formation of metastases. In addition, Rho GTPases...... are involved in growth and survival of tumor cells, in the interaction of tumor cells with their environment, and they are vital for the cancer supporting functions of the tumor stroma. Recent research has significantly improved our understanding of the regulation of Rho GTPase activity, the specificity of Rho...
Poulsen, S M; Karlsson, M; Johansson, L B; Vester, B
2001-09-01
The pleuromutilin antibiotic derivatives, tiamulin and valnemulin, inhibit protein synthesis by binding to the 50S ribosomal subunit of bacteria. The action and binding site of tiamulin and valnemulin was further characterized on Escherichia coli ribosomes. It was revealed that these drugs are strong inhibitors of peptidyl transferase and interact with domain V of 23S RNA, giving clear chemical footprints at nucleotides A2058-9, U2506 and U2584-5. Most of these nucleotides are highly conserved phylogenetically and functionally important, and all of them are at or near the peptidyl transferase centre and have been associated with binding of several antibiotics. Competitive footprinting shows that tiamulin and valnemulin can bind concurrently with the macrolide erythromycin but compete with the macrolide carbomycin, which is a peptidyl transferase inhibitor. We infer from these and previous results that tiamulin and valnemulin interact with the rRNA in the peptidyl transferase slot on the ribosomes in which they prevent the correct positioning of the CCA-ends of tRNAs for peptide transfer.
Directory of Open Access Journals (Sweden)
Scheffzek Klaus
2005-10-01
Full Text Available Abstract Background Compartmentalization is a key feature of eukaryotic cells, but its evolution remains poorly understood. GTPases are the oldest enzymes that use nucleotides as substrates and they participate in a wide range of cellular processes. Therefore, they are ideal tools for comparative genomic studies aimed at understanding how aspects of biological complexity such as cellular compartmentalization evolved. Results We describe the identification and characterization of a unique family of circularly permuted GTPases represented by the human orthologue of yeast Lsg1p. We placed the members of this family in the phylogenetic context of the YlqF Related GTPase (YRG family, which are present in Eukarya, Bacteria and Archea and include the stem cell regulator Nucleostemin. To extend the computational analysis, we showed that hLsg1 is an essential GTPase predominantly located in the endoplasmic reticulum and, in some cells, in Cajal bodies in the nucleus. Comparison of localization and siRNA datasets suggests that all members of the family are essential GTPases that have increased in number as the compartmentalization of the eukaryotic cell and the ribosome biogenesis pathway have evolved. Conclusion We propose a scenario, consistent with our data, for the evolution of this family: cytoplasmic components were first acquired, followed by nuclear components, and finally the mitochondrial and chloroplast elements were derived from different bacterial species, in parallel with the formation of the nucleolus and the specialization of nuclear components.
Rho GTPase function in tumorigenesis
DEFF Research Database (Denmark)
Karlsson, R; Pedersen, Esben Ditlev Kølle; Wang, Zhipeng
2009-01-01
, for that reason, Rho GTPases, their regulators, and their effectors have been suggested to control tumor formation and progression in humans. However, while the tumor-relevant functions of Rho GTPases are very well documented in vitro, we are only now beginning to assess their contribution to cancer in human...... patients and in animal models. This review will give a very brief overview of Rho GTPase function in general and then focus on in vivo evidence for a role of Rho GTPases in malignant tumors, both in human patients and in genetically modified mice....
Protein-protein interactions within late pre-40S ribosomes.
Directory of Open Access Journals (Sweden)
Melody G Campbell
2011-01-01
Full Text Available Ribosome assembly in eukaryotic organisms requires more than 200 assembly factors to facilitate and coordinate rRNA transcription, processing, and folding with the binding of the ribosomal proteins. Many of these assembly factors bind and dissociate at defined times giving rise to discrete assembly intermediates, some of which have been partially characterized with regards to their protein and RNA composition. Here, we have analyzed the protein-protein interactions between the seven assembly factors bound to late cytoplasmic pre-40S ribosomes using recombinant proteins in binding assays. Our data show that these factors form two modules: one comprising Enp1 and the export adaptor Ltv1 near the beak structure, and the second comprising the kinase Rio2, the nuclease Nob1, and a regulatory RNA binding protein Dim2/Pno1 on the front of the head. The GTPase-like Tsr1 and the universally conserved methylase Dim1 are also peripherally connected to this second module. Additionally, in an effort to further define the locations for these essential proteins, we have analyzed the interactions between these assembly factors and six ribosomal proteins: Rps0, Rps3, Rps5, Rps14, Rps15 and Rps29. Together, these results and previous RNA-protein crosslinking data allow us to propose a model for the binding sites of these seven assembly factors. Furthermore, our data show that the essential kinase Rio2 is located at the center of the pre-ribosomal particle and interacts, directly or indirectly, with every other assembly factor, as well as three ribosomal proteins required for cytoplasmic 40S maturation. These data suggest that Rio2 could play a central role in regulating cytoplasmic maturation steps.
A Pan-GTPase Inhibitor as a Molecular Probe.
Directory of Open Access Journals (Sweden)
Lin Hong
Full Text Available Overactive GTPases have often been linked to human diseases. The available inhibitors are limited and have not progressed far in clinical trials. We report here a first-in-class small molecule pan-GTPase inhibitor discovered from a high throughput screening campaign. The compound CID1067700 inhibits multiple GTPases in biochemical, cellular protein and protein interaction, as well as cellular functional assays. In the biochemical and protein interaction assays, representative GTPases from Rho, Ras, and Rab, the three most generic subfamilies of the GTPases, were probed, while in the functional assays, physiological processes regulated by each of the three subfamilies of the GTPases were examined. The chemical functionalities essential for the activity of the compound were identified through structural derivatization. The compound is validated as a useful molecular probe upon which GTPase-targeting inhibitors with drug potentials might be developed.
Photoaffinity labeling of rat liver ribosomes by N-(2-Nitro-4-azidobenzoyl)puromycin
International Nuclear Information System (INIS)
Boehm, H.; Stahl, J.; Bielka, H.
1979-01-01
N-(2-nitro-4-azidobenzoyl)-[ 3 H]puromycin (NAB-puromycin) was synthesized as a photoreactive derivative of puromycin in order to detect ribosomal proteins located near the peptidyltransferase centre of rat liver ribosomes. Irradiation of ribosome-NAB-puromycin complexes leads to covalent attachment of the affinity label to proteins of the large ribosomal subunit, in particular to proteins L28/29, and, to a somewhat lower extent, to proteins L4, L6, L10 and L24. The results are discussed in the light of earlier studies performed with other affinity labels that attacked the peptidyltransferase region of rat liver ribosomes. (author)
Kravchenko, O. V.; Mitroshin, I. V.; Gabdulkhakov, A. G.; Nikonov, S. V.; Garber, M. B.
2011-07-01
Lateral L12-stalk (P1-stalk in Archaea, P1/P2-stalk in eukaryotes) is an obligatory morphological element of large ribosomal subunits in all organisms studied. This stalk is composed of the complex of ribosomal proteins L10(P0) and L12(P1) and interacts with 23S rRNA through the protein L10(P0). L12(P1)-stalk is involved in the formation of GTPase center of the ribosome and plays an important role in the ribosome interaction with translation factors. High mobility of this stalk puts obstacles in determination of its structure within the intact ribosome. Crystals of a two-domain N-terminal fragment of ribosomal protein L10(P0) from the archaeon Methanococcus jannaschii in complex with a specific fragment of rRNA from the same organism have been obtained. The crystals diffract X-rays at 3.2 Å resolution.
Energy Technology Data Exchange (ETDEWEB)
Kravchenko, O. V.; Mitroshin, I. V.; Gabdulkhakov, A. G.; Nikonov, S. V.; Garber, M. B., E-mail: garber@vega.protres.ru [Institute of Protein Research RAS (Russian Federation)
2011-07-15
Lateral L12-stalk (P1-stalk in Archaea, P1/P2-stalk in eukaryotes) is an obligatory morphological element of large ribosomal subunits in all organisms studied. This stalk is composed of the complex of ribosomal proteins L10(P0) and L12(P1) and interacts with 23S rRNA through the protein L10(P0). L12(P1)-stalk is involved in the formation of GTPase center of the ribosome and plays an important role in the ribosome interaction with translation factors. High mobility of this stalk puts obstacles in determination of its structure within the intact ribosome. Crystals of a two-domain N-terminal fragment of ribosomal protein L10(P0) from the archaeon Methanococcus jannaschii in complex with a specific fragment of rRNA from the same organism have been obtained. The crystals diffract X-rays at 3.2 Angstrom-Sign resolution.
Insights into the classification of small GTPases
Directory of Open Access Journals (Sweden)
Dominik Heider
2010-05-01
Full Text Available Dominik Heider1, Sascha Hauke3, Martin Pyka4, Daniel Kessler21Department of Bioinformatics, Center for Medical Biotechnology, 2Institute of Cell Biology (Cancer Research, University of Duisburg-Essen, Essen, Germany; 3Institute of Computer Science, University of Münster, Münster, Germany; 4Interdisciplinary Center for Clinical Research, University Hospital of Münster, Münster, GermanyAbstract: In this study we used a Random Forest-based approach for an assignment of small guanosine triphosphate proteins (GTPases to specific subgroups. Small GTPases represent an important functional group of proteins that serve as molecular switches in a wide range of fundamental cellular processes, including intracellular transport, movement and signaling events. These proteins have further gained a special emphasis in cancer research, because within the last decades a huge variety of small GTPases from different subgroups could be related to the development of all types of tumors. Using a random forest approach, we were able to identify the most important amino acid positions for the classification process within the small GTPases superfamily and its subgroups. These positions are in line with the results of earlier studies and have been shown to be the essential elements for the different functionalities of the GTPase families. Furthermore, we provide an accurate and reliable software tool (GTPasePred to identify potential novel GTPases and demonstrate its application to genome sequences.Keywords: cancer, machine learning, classification, Random Forests, proteins
ATPase and GTPase Tangos Drive Intracellular Protein Transport.
Shan, Shu-Ou
2016-12-01
The GTPase superfamily of proteins provides molecular switches to regulate numerous cellular processes. The 'GTPase switch' paradigm, in which external regulatory factors control the switch of a GTPase between 'on' and 'off' states, has been used to interpret the regulatory mechanism of many GTPases. However, recent work unveiled a class of nucleotide hydrolases that do not adhere to this classical paradigm. Instead, they use nucleotide-dependent dimerization cycles to regulate key cellular processes. In this review article, recent studies of dimeric GTPases and ATPases involved in intracellular protein targeting are summarized. It is suggested that these proteins can use the conformational plasticity at their dimer interface to generate multiple points of regulation, thereby providing the driving force and spatiotemporal coordination of complex cellular pathways. Copyright © 2016 Elsevier Ltd. All rights reserved.
Lin, Yuan; Li, Yan; Zhu, Ningyu; Han, Yanxing; Jiang, Wei; Wang, Yanchang; Si, Shuyi; Jiang, Jiandong
2014-01-01
Capreomycin is a second-line drug for multiple-drug-resistant tuberculosis (TB). However, with increased use in clinics, the therapeutic efficiency of capreomycin is decreasing. To better understand TB resistance to capreomycin, we have done research to identify the molecular target of capreomycin. Mycobacterium tuberculosis ribosomal proteins L12 and L10 interact with each other and constitute the stalk of the 50S ribosomal subunit, which recruits initiation and elongation factors during translation. Hence, the L12-L10 interaction is considered to be essential for ribosomal function and protein synthesis. Here we provide evidence showing that capreomycin inhibits the L12-L10 interaction by using an established L12-L10 interaction assay. Overexpression of L12 and/or L10 in M. smegmatis, a species close to M. tuberculosis, increases the MIC of capreomycin. Moreover, both elongation factor G-dependent GTPase activity and ribosome-mediated protein synthesis are inhibited by capreomycin. When protein synthesis was blocked with thiostrepton, however, the bactericidal activity of capreomycin was restrained. All of these results suggest that capreomycin seems to inhibit TB by interrupting the L12-L10 interaction. This finding might provide novel clues for anti-TB drug discovery.
Rab GTPases in Immunity and Inflammation.
Prashar, Akriti; Schnettger, Laura; Bernard, Elliott M; Gutierrez, Maximiliano G
2017-01-01
Strict spatiotemporal control of trafficking events between organelles is critical for maintaining homeostasis and directing cellular responses. This regulation is particularly important in immune cells for mounting specialized immune defenses. By controlling the formation, transport and fusion of intracellular organelles, Rab GTPases serve as master regulators of membrane trafficking. In this review, we discuss the cellular and molecular mechanisms by which Rab GTPases regulate immunity and inflammation.
Rab GTPases in Immunity and Inflammation
Directory of Open Access Journals (Sweden)
Akriti Prashar
2017-09-01
Full Text Available Strict spatiotemporal control of trafficking events between organelles is critical for maintaining homeostasis and directing cellular responses. This regulation is particularly important in immune cells for mounting specialized immune defenses. By controlling the formation, transport and fusion of intracellular organelles, Rab GTPases serve as master regulators of membrane trafficking. In this review, we discuss the cellular and molecular mechanisms by which Rab GTPases regulate immunity and inflammation.
Rho GTPase expression in human myeloid cells.
Directory of Open Access Journals (Sweden)
Suzanne F G van Helden
Full Text Available Myeloid cells are critical for innate immunity and the initiation of adaptive immunity. Strict regulation of the adhesive and migratory behavior is essential for proper functioning of these cells. Rho GTPases are important regulators of adhesion and migration; however, it is unknown which Rho GTPases are expressed in different myeloid cells. Here, we use a qPCR-based approach to investigate Rho GTPase expression in myeloid cells.We found that the mRNAs encoding Cdc42, RhoQ, Rac1, Rac2, RhoA and RhoC are the most abundant. In addition, RhoG, RhoB, RhoF and RhoV are expressed at low levels or only in specific cell types. More differentiated cells along the monocyte-lineage display lower levels of Cdc42 and RhoV, while RhoC mRNA is more abundant. In addition, the Rho GTPase expression profile changes during dendritic cell maturation with Rac1 being upregulated and Rac2 downregulated. Finally, GM-CSF stimulation, during macrophage and osteoclast differentiation, leads to high expression of Rac2, while M-CSF induces high levels of RhoA, showing that these cytokines induce a distinct pattern. Our data uncover cell type specific modulation of the Rho GTPase expression profile in hematopoietic stem cells and in more differentiated cells of the myeloid lineage.
Reverse engineering GTPase programming languages with reconstituted signaling networks.
Coyle, Scott M
2016-07-02
The Ras superfamily GTPases represent one of the most prolific signaling currencies used in Eukaryotes. With these remarkable molecules, evolution has built GTPase networks that control diverse cellular processes such as growth, morphology, motility and trafficking. (1-4) Our knowledge of the individual players that underlie the function of these networks is deep; decades of biochemical and structural data has provided a mechanistic understanding of the molecules that turn GTPases ON and OFF, as well as how those GTPase states signal by controlling the assembly of downstream effectors. However, we know less about how these different activities work together as a system to specify complex dynamic signaling outcomes. Decoding this molecular "programming language" would help us understand how different species and cell types have used the same GTPase machinery in different ways to accomplish different tasks, and would also provide new insights as to how mutations to these networks can cause disease. We recently developed a bead-based microscopy assay to watch reconstituted H-Ras signaling systems at work under arbitrary configurations of regulators and effectors. (5) Here we highlight key observations and insights from this study and propose extensions to our method to further study this and other GTPase signaling systems.
Identification of the GTPase superfamily in Mycoplasma synoviae and Mycoplasma hyopneumoniae
Directory of Open Access Journals (Sweden)
Clayton Luiz Borges
2007-01-01
Full Text Available Mycoplasmas are the smallest known prokaryotes with self-replication ability. They are obligate parasites, taking up many molecules of their hosts and acting as pathogens in men, animals, birds and plants. Mycoplasma hyopneumoniae is the infective agent of swine mycoplasmosis and Mycoplasma synoviae is responsible for subclinical upper respiratory infections that may result in airsacculitis and synovitis in chickens and turkeys. These highly infectious organisms present a worldwide distribution and are responsible for major economic problems. Proteins of the GTPase superfamily occur in all domains of life, regulating functions such as protein synthesis, cell cycle and differentiation. Despite their functional diversity, all GTPases are believed to have evolved from a single common ancestor. In this work we have identified mycoplasma GTPases by searching the complete genome databases of Mycoplasma synoviae and Mycoplasma hyopneumoniae, J (non-pathogenic and 7448 (pathogenic strains. Fifteen ORFs encoding predicted GTPases were found in M. synoviae and in the two strains of M. hyopneumoniae. Searches for conserved G domains in GTPases were performed and the sequences were classified into families. The GTPase phylogenetic analysis showed that the subfamilies were well resolved into clades. The presence of GTPases in the three strains suggests the importance of GTPases in 'minimalist' genomes.
Rho GTPases in ameloblast differentiation
Directory of Open Access Journals (Sweden)
Keishi Otsu
2016-05-01
Full Text Available During tooth development, ameloblasts differentiate from inner enamel epithelial cells to enamel-forming cells by modulating the signal pathways mediating epithelial–mesenchymal interaction and a cell-autonomous gene network. The differentiation process of epithelial cells is characterized by marked changes in their morphology and polarity, accompanied by dynamic cytoskeletal reorganization and changes in cell–cell and cell–matrix adhesion over time. Functional ameloblasts are tall, columnar, polarized cells that synthesize and secrete enamel-specific proteins. After deposition of the full thickness of enamel matrix, ameloblasts become smaller and regulate enamel maturation. Recent significant advances in the fields of molecular biology and genetics have improved our understanding of the regulatory mechanism of the ameloblast cell life cycle, mediated by the Rho family of small GTPases. They act as intracellular molecular switch that transduce signals from extracellular stimuli to the actin cytoskeleton and the nucleus. In our review, we summarize studies that provide current evidence for Rho GTPases and their involvement in ameloblast differentiation. In addition to the Rho GTPases themselves, their downstream effectors and upstream regulators have also been implicated in ameloblast differentiation.
Inhibition by Siomycin and Thiostrepton of Both Aminoacyl-tRNA and Factor G Binding to Ribosomes
Ll, Juan Modole; Cabrer, Bartolomé; Parmeggiani, Andrea; Azquez, David V
1971-01-01
Siomycin, a peptide antibiotic that interacts with the 50S ribosomal subunit and inhibits binding of factor G, is shown also to inhibit binding of aminoacyl-tRNA; however, it does not impair binding of fMet-tRNA and completion of the initiation complex. Moreover, unlike other inhibitors of aminoacyl-tRNA binding (tetracycline, sparsomycin, and streptogramin A), siomycin completely abolishes the GTPase activity associated with the binding of aminoacyl-tRNA catalyzed by factor Tu. A single-site interaction of siomycin appears to be responsible for its effect on both the binding of the aminoacyl-tRNA-Tu-GTP complex and that of factor G. PMID:4331558
Evolution and Diversity of the Ras Superfamily of Small GTPases in Prokaryotes
Wuichet, Kristin; Søgaard-Andersen, Lotte
2015-01-01
The Ras superfamily of small GTPases are single domain nucleotide-dependent molecular switches that act as highly tuned regulators of complex signal transduction pathways. Originally identified in eukaryotes for their roles in fundamental cellular processes including proliferation, motility, polarity, nuclear transport, and vesicle transport, recent studies have revealed that single domain GTPases also control complex functions such as cell polarity, motility, predation, development and antibiotic resistance in bacteria. Here, we used a computational genomics approach to understand the abundance, diversity, and evolution of small GTPases in prokaryotes. We collected 520 small GTPase sequences present in 17% of 1,611 prokaryotic genomes analyzed that cover diverse lineages. We identified two discrete families of small GTPases in prokaryotes that show evidence of three distinct catalytic mechanisms. The MglA family includes MglA homologs, which are typically associated with the MglB GTPase activating protein, whereas members of the Rup (Ras superfamily GTPase of unknown function in prokaryotes) family are not predicted to interact with MglB homologs. System classification and genome context analyses support the involvement of small GTPases in diverse prokaryotic signal transduction pathways including two component systems, laying the foundation for future experimental characterization of these proteins. Phylogenetic analysis of prokaryotic and eukaryotic GTPases supports that the last universal common ancestor contained ancestral MglA and Rup family members. We propose that the MglA family was lost from the ancestral eukaryote and that the Ras superfamily members in extant eukaryotes are the result of vertical and horizontal gene transfer events of ancestral Rup GTPases. PMID:25480683
International Nuclear Information System (INIS)
Stahl, J.; Boehm, H.; Voderberg, M.
1981-01-01
Ribosomal protein L 10 from the livers of trout, hen, and rat was found to be the main target for 2-nitro-4-azidobenzoyl-Phe-tRNA in affinity labelling experiments. Therefore, despite somewhat different electrophoretic mobilities, this protein seems to be involved in the organization of the peptidyl transferase centre in ribosomes of various vertebrates. (author)
BAR domain proteins regulate Rho GTPase signaling.
Aspenström, Pontus
2014-01-01
BAR proteins comprise a heterogeneous group of multi-domain proteins with diverse biological functions. The common denominator is the Bin-Amphiphysin-Rvs (BAR) domain that not only confers targeting to lipid bilayers, but also provides scaffolding to mold lipid membranes into concave or convex surfaces. This function of BAR proteins is an important determinant in the dynamic reconstruction of membrane vesicles, as well as of the plasma membrane. Several BAR proteins function as linkers between cytoskeletal regulation and membrane dynamics. These links are provided by direct interactions between BAR proteins and actin-nucleation-promoting factors of the Wiskott-Aldrich syndrome protein family and the Diaphanous-related formins. The Rho GTPases are key factors for orchestration of this intricate interplay. This review describes how BAR proteins regulate the activity of Rho GTPases, as well as how Rho GTPases regulate the function of BAR proteins. This mutual collaboration is a central factor in the regulation of vital cellular processes, such as cell migration, cytokinesis, intracellular transport, endocytosis, and exocytosis.
Implications of Rho GTPase signaling in glioma cell invasion and tumor progression
Directory of Open Access Journals (Sweden)
Shannon Patricia Fortin Ensign
2013-10-01
Full Text Available Glioblastoma (GB is the most malignant of primary adult brain tumors, characterized by a highly locally-invasive cell population, as well as abundant proliferative cells, neoangiogenesis, and necrosis. Clinical intervention with chemotherapy or radiation may either promote or establish an environment for manifestation of invasive behavior. Understanding the molecular drivers of invasion in the context of glioma progression may be insightful in directing new treatments for patients with GB. Here, we review current knowledge on Rho family GTPases, their aberrant regulation in GB, and their effect on GB cell invasion and tumor progression. Rho GTPases are modulators of cell migration through effects on actin cytoskeleton rearrangement; in non-neoplastic tissue, expression and activation of Rho GTPases are normally under tight regulation. In GB, Rho GTPases are deregulated, often via hyperactivity or overexpression of their activators, Rho GEFs. Downstream effectors of Rho GTPases have been shown to promote invasiveness and, importantly, glioma cell survival. The study of aberrant Rho GTPase signaling in GB is thus an important investigation of cell invasion as well as treatment resistance and disease progression.
Rac and Rho GTPases in cancer cell motility control
Directory of Open Access Journals (Sweden)
Parri Matteo
2010-09-01
Full Text Available Abstract Rho GTPases represent a family of small GTP-binding proteins involved in cell cytoskeleton organization, migration, transcription, and proliferation. A common theme of these processes is a dynamic reorganization of actin cytoskeleton which has now emerged as a major switch control mainly carried out by Rho and Rac GTPase subfamilies, playing an acknowledged role in adaptation of cell motility to the microenvironment. Cells exhibit three distinct modes of migration when invading the 3 D environment. Collective motility leads to movement of cohorts of cells which maintain the adherens junctions and move by photolytic degradation of matrix barriers. Single cell mesenchymal-type movement is characterized by an elongated cellular shape and again requires extracellular proteolysis and integrin engagement. In addition it depends on Rac1-mediated cell polarization and lamellipodia formation. Conversely, in amoeboid movement cells have a rounded morphology, the movement is independent from proteases but requires high Rho GTPase to drive elevated levels of actomyosin contractility. These two modes of cell movement are interconvertible and several moving cells, including tumor cells, show an high degree of plasticity in motility styles shifting ad hoc between mesenchymal or amoeboid movements. This review will focus on the role of Rac and Rho small GTPases in cell motility and in the complex relationship driving the reciprocal control between Rac and Rho granting for the opportunistic motile behaviour of aggressive cancer cells. In addition we analyse the role of these GTPases in cancer progression and metastatic dissemination.
The ribosome uses two active mechanisms to unwind messenger RNA during translation.
Qu, Xiaohui; Wen, Jin-Der; Lancaster, Laura; Noller, Harry F; Bustamante, Carlos; Tinoco, Ignacio
2011-07-06
The ribosome translates the genetic information encoded in messenger RNA into protein. Folded structures in the coding region of an mRNA represent a kinetic barrier that lowers the peptide elongation rate, as the ribosome must disrupt structures it encounters in the mRNA at its entry site to allow translocation to the next codon. Such structures are exploited by the cell to create diverse strategies for translation regulation, such as programmed frameshifting, the modulation of protein expression levels, ribosome localization and co-translational protein folding. Although strand separation activity is inherent to the ribosome, requiring no exogenous helicases, its mechanism is still unknown. Here, using a single-molecule optical tweezers assay on mRNA hairpins, we find that the translation rate of identical codons at the decoding centre is greatly influenced by the GC content of folded structures at the mRNA entry site. Furthermore, force applied to the ends of the hairpin to favour its unfolding significantly speeds translation. Quantitative analysis of the force dependence of its helicase activity reveals that the ribosome, unlike previously studied helicases, uses two distinct active mechanisms to unwind mRNA structure: it destabilizes the helical junction at the mRNA entry site by biasing its thermal fluctuations towards the open state, increasing the probability of the ribosome translocating unhindered; and it mechanically pulls apart the mRNA single strands of the closed junction during the conformational changes that accompany ribosome translocation. The second of these mechanisms ensures a minimal basal rate of translation in the cell; specialized, mechanically stable structures are required to stall the ribosome temporarily. Our results establish a quantitative mechanical basis for understanding the mechanism of regulation of the elongation rate of translation by structured mRNAs. ©2011 Macmillan Publishers Limited. All rights reserved
Sato, H; Onozuka, M; Hagiya, A; Hoshino, S; Narita, I; Uchiumi, T
2015-02-01
Autoantibodies, including anti-ribosomal P proteins (anti-P), are thought to be produced by an antigen-driven immune response in systemic lupus erythematosus (SLE). To test this hypothesis, we reconstituted the ribosomal antigenic complex in vitro using human P0, phosphorylated P1 and P2 and a 28S rRNA fragment covering the P0 binding site, and immunized Murphy Roths large (MRL)/lrp lupus mice with this complex without any added adjuvant to generate anti-P antibodies. Using hybridoma technology, we subsequently obtained 34 clones, each producing an anti-P monoclonal antibody (mAb) that recognized the conserved C-terminal tail sequence common to all three P proteins. We also obtained two P0-specific monoclonal antibodies, but no antibody specific to P1, P2 or rRNA fragment. Two types of mAbs were found among these anti-P antibodies: one type (e.g. 9D5) reacted more strongly with the phosphorylated P1 and P2 than that with their non-phosphorylated forms, whereas the other type (e.g. 4H11) reacted equally with both phosphorylated and non-phosphorylated forms of P1/P2. Both 9D5 and 4H11 inhibited the ribosome/eukaryotic elongation factor-2 (eEF-2)-coupled guanosine triphosphate (GTP)ase activity. However, preincubation with a synthetic peptide corresponding to the C-terminal sequence common to all three P proteins, but not the peptide that lacked the last three C-terminal amino acids, mostly prevented the mAb-induced inhibition of GTPase activity. Thus, at least two types of anti-P were produced preferentially following the immunization of MRL mice with the reconstituted antigenic complex. Presence of multiple copies of the C-termini, particularly that of the last three C-terminal amino acid residues, in the antigenic complex appears to contribute to the immunogenic stimulus. © 2014 British Society for Immunology.
Sato, H; Onozuka, M; Hagiya, A; Hoshino, S; Narita, I; Uchiumi, T
2015-01-01
Autoantibodies, including anti-ribosomal P proteins (anti-P), are thought to be produced by an antigen-driven immune response in systemic lupus erythematosus (SLE). To test this hypothesis, we reconstituted the ribosomal antigenic complex in vitro using human P0, phosphorylated P1 and P2 and a 28S rRNA fragment covering the P0 binding site, and immunized Murphy Roths large (MRL)/lrp lupus mice with this complex without any added adjuvant to generate anti-P antibodies. Using hybridoma technology, we subsequently obtained 34 clones, each producing an anti-P monoclonal antibody (mAb) that recognized the conserved C-terminal tail sequence common to all three P proteins. We also obtained two P0-specific monoclonal antibodies, but no antibody specific to P1, P2 or rRNA fragment. Two types of mAbs were found among these anti-P antibodies: one type (e.g. 9D5) reacted more strongly with the phosphorylated P1 and P2 than that with their non-phosphorylated forms, whereas the other type (e.g. 4H11) reacted equally with both phosphorylated and non-phosphorylated forms of P1/P2. Both 9D5 and 4H11 inhibited the ribosome/eukaryotic elongation factor-2 (eEF-2)-coupled guanosine triphosphate (GTP)ase activity. However, preincubation with a synthetic peptide corresponding to the C-terminal sequence common to all three P proteins, but not the peptide that lacked the last three C-terminal amino acids, mostly prevented the mAb-induced inhibition of GTPase activity. Thus, at least two types of anti-P were produced preferentially following the immunization of MRL mice with the reconstituted antigenic complex. Presence of multiple copies of the C-termini, particularly that of the last three C-terminal amino acid residues, in the antigenic complex appears to contribute to the immunogenic stimulus. PMID:25255895
Al-Hadid, Qais; White, Jonelle; Clarke, Steven
2016-02-12
A significant percentage of the methyltransferasome in Saccharomyces cerevisiae and higher eukaryotes is devoted to methylation of the translational machinery. Methylation of the RNA components of the translational machinery has been studied extensively and is important for structure stability, ribosome biogenesis, and translational fidelity. However, the functional effects of ribosomal protein methylation by their cognate methyltransferases are still largely unknown. Previous work has shown that the ribosomal protein Rpl3 methyltransferase, histidine protein methyltransferase 1 (Hpm1), is important for ribosome biogenesis and translation elongation fidelity. In this study, yeast strains deficient in each of the ten ribosomal protein methyltransferases in S. cerevisiae were examined for potential defects in ribosome biogenesis and translation. Like Hpm1-deficient cells, loss of four of the nine other ribosomal protein methyltransferases resulted in defects in ribosomal subunit synthesis. All of the mutant strains exhibited resistance to the ribosome inhibitors anisomycin and/or cycloheximide in plate assays, but not in liquid culture. Translational fidelity assays measuring stop codon readthrough, amino acid misincorporation, and programmed -1 ribosomal frameshifting, revealed that eight of the ten enzymes are important for translation elongation fidelity and the remaining two are necessary for translation termination efficiency. Altogether, these results demonstrate that ribosomal protein methyltransferases in S. cerevisiae play important roles in ribosome biogenesis and translation. Copyright © 2016 Elsevier Inc. All rights reserved.
He, J; Cooper, H M; Reyes, A; Di Re, M; Kazak, L; Wood, S R; Mao, C C; Fearnley, I M; Walker, J E; Holt, I J
2012-07-01
The bacterial homologue of C4orf14, YqeH, has been linked to assembly of the small ribosomal subunit. Here, recombinant C4orf14 isolated from human cells, co-purified with the small, 28S subunit of the mitochondrial ribosome and the endogenous protein co-fractionated with the 28S subunit in sucrose gradients. Gene silencing of C4orf14 specifically affected components of the small subunit, leading to decreased protein synthesis in the organelle. The GTPase of C4orf14 was critical to its interaction with the 28S subunit, as was GTP. Therefore, we propose that C4orf14, with bound GTP, binds to components of the 28S subunit facilitating its assembly, and GTP hydrolysis acts as the release mechanism. C4orf14 was also found to be associated with human mitochondrial nucleoids, and C4orf14 gene silencing caused mitochondrial DNA depletion. In vitro C4orf14 is capable of binding to DNA. The association of C4orf14 with mitochondrial translation factors and the mitochondrial nucleoid suggests that the 28S subunit is assembled at the mitochondrial nucleoid, enabling the direct transfer of messenger RNA from the nucleoid to the ribosome in the organelle.
Regulation of ER-Golgi Transport Dynamics by GTPases in Budding Yeast
Directory of Open Access Journals (Sweden)
Yasuyuki Suda
2018-01-01
Full Text Available A large number of proteins are synthesized de novo in the endoplasmic reticulum (ER. They are transported through the Golgi apparatus and then delivered to their proper destinations. The ER and the Golgi play a central role in protein processing and sorting and show dynamic features in their forms. Ras super family small GTPases mediate the protein transport through and between these organelles. The ER-localized GTPase, Sar1, facilitates the formation of COPII transport carriers at the ER exit sites (ERES on the ER for the transport of cargo proteins from the ER to the Golgi. The Golgi-localized GTPase, Arf1, controls intra-Golgi, and Golgi-to-ER transport of cargo proteins by the formation of COPI carriers. Rab GTPases localized at the Golgi, which are responsible for fusion of membranes, are thought to establish the identities of compartments. Recent evidence suggests that these small GTPases regulate not only discrete sites for generation/fusion of transport carriers, but also membrane dynamics of the organelles where they locate to ensure the integrity of transport. Here we summarize the current understandings about the membrane traffic between these organelles and highlight the cutting-edge advances from super-resolution live imaging of budding yeast, Saccharomyces cerevisiae.
Neuron-Like Networks Between Ribosomal Proteins Within the Ribosome
Poirot, Olivier; Timsit, Youri
2016-05-01
From brain to the World Wide Web, information-processing networks share common scale invariant properties. Here, we reveal the existence of neural-like networks at a molecular scale within the ribosome. We show that with their extensions, ribosomal proteins form complex assortative interaction networks through which they communicate through tiny interfaces. The analysis of the crystal structures of 50S eubacterial particles reveals that most of these interfaces involve key phylogenetically conserved residues. The systematic observation of interactions between basic and aromatic amino acids at the interfaces and along the extension provides new structural insights that may contribute to decipher the molecular mechanisms of signal transmission within or between the ribosomal proteins. Similar to neurons interacting through “molecular synapses”, ribosomal proteins form a network that suggest an analogy with a simple molecular brain in which the “sensory-proteins” innervate the functional ribosomal sites, while the “inter-proteins” interconnect them into circuits suitable to process the information flow that circulates during protein synthesis. It is likely that these circuits have evolved to coordinate both the complex macromolecular motions and the binding of the multiple factors during translation. This opens new perspectives on nanoscale information transfer and processing.
Role of Rab family GTPases and their effectors in melanosomal logistics.
Ohbayashi, Norihiko; Fukuda, Mitsunori
2012-04-01
Rab GTPases constitute a family of small GTPases that regulate a variety of membrane trafficking events in all eukaryotic cells by recruiting their specific effector molecules. Recent accumulating evidence indicates that members of the mammalian Rab small GTPase family are involved in certain physiological and pathological processes. In particular, functional impairments of specific Rab proteins, e.g. Rab38 and Rab27A, their regulators or their effectors cause pigmentation disorders in humans and coat colour variations in mice because such impairments cause defects in melanosomal logistics, i.e. defects in melanosome biogenesis and transport. Genetic and biochemical analyses of the gene products responsible for mammalian pigmentation disorders in the past decade have revealed that Rab-mediated endosomal transport systems and melanosome transport systems play crucial roles in the efficient darkening of mammalian hair and skin. In this article, we review current knowledge regarding melanosomal logistics, with particular focus on the roles of Rab small GTPases and their effectors.
The interdependence of the Rho GTPases and apicobasal cell polarity.
Mack, Natalie Ann; Georgiou, Marios
2014-01-01
Signaling via the Rho GTPases provides crucial regulation of numerous cell polarization events, including apicobasal (AB) polarity, polarized cell migration, polarized cell division and neuronal polarity. Here we review the relationships between the Rho family GTPases and epithelial AB polarization events, focusing on the 3 best-characterized members: Rho, Rac and Cdc42. We discuss a multitude of processes that are important for AB polarization, including lumen formation, apical membrane specification, cell-cell junction assembly and maintenance, as well as tissue polarity. Our discussions aim to highlight the immensely complex regulatory mechanisms that encompass Rho GTPase signaling during AB polarization. More specifically, in this review we discuss several emerging common themes, that include: 1) the need for Rho GTPase activities to be carefully balanced in both a spatial and temporal manner through a multitude of mechanisms; 2) the existence of signaling feedback loops and crosstalk to create robust cellular responses; and 3) the frequent multifunctionality that exists among AB polarity regulators. Regarding this latter theme, we provide further discussion of the potential plasticity of the cell polarity machinery and as a result the possible implications for human disease.
Coupling mechanical tension and GTPase signaling to generate cell and tissue dynamics
Zmurchok, Cole; Bhaskar, Dhananjay; Edelstein-Keshet, Leah
2018-07-01
Regulators of the actin cytoskeleton such Rho GTPases can modulate forces developed in cells by promoting actomyosin contraction. At the same time, through mechanosensing, tension is known to affect the activity of Rho GTPases. What happens when these effects act in concert? Using a minimal model (1 GTPase coupled to a Kelvin–Voigt element), we show that two-way feedback between signaling (‘RhoA’) and mechanical tension (stretching) leads to a spectrum of cell behaviors, including contracted or relaxed cells, and cells that oscillate between these extremes. When such ‘model cells’ are connected to one another in a row or in a 2D sheet (‘epithelium’), we observe waves of contraction/relaxation and GTPase activity sweeping through the tissue. The minimal model lends itself to full bifurcation analysis, and suggests a mechanism that explains behavior observed in the context of development and collective cell behavior.
Plant Rho-type (Rop) GTPase-dependent activation of receptor-like cytoplasmic kinases in vitro.
Dorjgotov, Dulguun; Jurca, Manuela E; Fodor-Dunai, Csilla; Szucs, Attila; Otvös, Krisztina; Klement, Eva; Bíró, Judit; Fehér, Attila
2009-04-02
Plants have evolved distinct mechanisms to link Rho-type (Rop) GTPases to downstream signaling pathways as compared to other eukaryotes. Here, experimental data are provided that members of the Medicago, as well as Arabidopsis, receptor-like cytoplasmic kinase family (RLCK Class VI) were strongly and specifically activated by GTP-bound Rop GTPases in vitro. Deletion analysis indicated that the residues implicated in the interaction might be distributed on various parts of the kinases. Using a chimaeric Rop GTPase protein, the importance of the Rho-insert region in kinase activation could also be verified. These data strengthen the possibility that RLCKs may serve as Rop GTPase effectors in planta.
Zhang, Cheng-Cheng; Li, Ru; Jiang, Honghui; Lin, Shujun; Rogalski, Jason C; Liu, Kate; Kast, Juergen
2015-02-06
Small GTPases are a family of key signaling molecules that are ubiquitously expressed in various types of cells. Their activity is often analyzed by western blot, which is limited by its multiplexing capability, the quality of isoform-specific antibodies, and the accuracy of quantification. To overcome these issues, a quantitative multiplexed small GTPase activity assay has been developed. Using four different binding domains, this assay allows the binding of up to 12 active small GTPase isoforms simultaneously in a single experiment. To accurately quantify the closely related small GTPase isoforms, a targeted proteomic approach, i.e., selected/multiple reaction monitoring, was developed, and its functionality and reproducibility were validated. This assay was successfully applied to human platelets and revealed time-resolved coactivation of multiple small GTPase isoforms in response to agonists and differential activation of these isoforms in response to inhibitor treatment. This widely applicable approach can be used for signaling pathway studies and inhibitor screening in many cellular systems.
Human Mammary Epithelial Cell Transformation by Rho GTPase Through a Novel Mechanism
2009-08-01
87: 635-44. 18. Burbelo P, Wellstein A, Pestell RG. Altered Rho GTPase signaling pathways in breast cancer cells. Breast Cancer Res Treat 2004; 84...Burbelo P, Wellstein A, Pestell RG. Altered Rho GTPase signaling pathways in breast cancer cells. Breast Cancer Res Treat 2004;84:43–8. 19. Band V
Flores, Ana Claudia; Via, Virginia Dalla; Savy, Virginia; Villagra, Ulises Mancini; Zanetti, María Eugenia; Blanco, Flavio
2018-02-01
Small monomeric GTPases act as molecular switches in several processes that involve polar cell growth, participating mainly in vesicle trafficking and cytoskeleton rearrangements. This gene superfamily has largely expanded in plants through evolution as compared with other Kingdoms, leading to the suggestion that members of each subfamily might have acquired new functions associated to plant-specific processes. Legume plants engage in a nitrogen-fixing symbiotic interaction with rhizobia in a process that involves polar growth processes associated with the infection throughout the root hair. To get insight into the evolution of small GTPases associated with this process, we use a comparative genomic approach to establish differences in the Ras GTPase superfamily between legume and non-legume plants. Phylogenetic analyses did not show clear differences in the organization of the different subfamilies of small GTPases between plants that engage or not in nodule symbiosis. Protein alignments revealed a strong conservation at the sequence level of small GTPases previously linked to nodulation by functional genetics. Interestingly, one Rab and three Rop proteins showed conserved amino acid substitutions in legumes, but these changes do not alter the predicted conformational structure of these proteins. Although the steady-state levels of most small GTPases do not change in response to rhizobia, we identified a subset of Rab, Rop and Arf genes whose transcript levels are modulated during the symbiotic interaction, including their spatial distribution along the indeterminate nodule. This study provides a comprehensive study of the small GTPase superfamily in several plant species. The genetic program associated to root nodule symbiosis includes small GTPases to fulfill specific functions during infection and formation of the symbiosomes. These GTPases seems to have been recruited from members that were already present in common ancestors with plants as distant as monocots
Small GTPases are involved in sprout formation in human granulosa lutein cells.
Franz, Maximilian B; Daube, Stefanie; Keck, Christoph; Sator, Michael; Pietrowski, Detlef
2013-04-01
The corpus luteum (CL), develops from the ruptured follicle after gonadotropin stimulation. Based on intracellular reorganization of the cytoskeleton an human chorionic gonadotropin (hCG) dependent sprouting and migration of luteinizing granulosa cells (LGCs) and endothelial cells is observed. Rho-GTPases are shown to be key regulators of cytoskeletal restructuring. In the present study we analyzed the role of Rho-GTPases in the sprouting activity of LGCs. We used the Rho-GTPase-inhibitors Toxin A and -B and the Cdc42-activator Bradykinin in a LGC-spheroid sprouting assay to determine the effect of these modulators in LGCs. Toxin A and Toxin B reduces sprout formation in LGC spheroids. However, the reduction is less than in hCG treated cells. The usage of Bradykinin demonstrates both, a reduction of sprouts in untreated spheroids and an increase of sprouting in previous hCG treated spheroids. The presented results let us suggest that small Rho-GTPases may regulate the sprouting activity of LGCs after stimulation by hCG and that this mechanism may play a role in CL formation.
Topological and functional properties of the small GTPases protein interaction network.
Directory of Open Access Journals (Sweden)
Anna Delprato
Full Text Available Small GTP binding proteins of the Ras superfamily (Ras, Rho, Rab, Arf, and Ran regulate key cellular processes such as signal transduction, cell proliferation, cell motility, and vesicle transport. A great deal of experimental evidence supports the existence of signaling cascades and feedback loops within and among the small GTPase subfamilies suggesting that these proteins function in a coordinated and cooperative manner. The interplay occurs largely through association with bi-partite regulatory and effector proteins but can also occur through the active form of the small GTPases themselves. In order to understand the connectivity of the small GTPases signaling routes, a systems-level approach that analyzes data describing direct and indirect interactions was used to construct the small GTPases protein interaction network. The data were curated from the Search Tool for the Retrieval of Interacting Genes (STRING database and include only experimentally validated interactions. The network method enables the conceptualization of the overall structure as well as the underlying organization of the protein-protein interactions. The interaction network described here is comprised of 778 nodes and 1943 edges and has a scale-free topology. Rac1, Cdc42, RhoA, and HRas are identified as the hubs. Ten sub-network motifs are also identified in this study with themes in apoptosis, cell growth/proliferation, vesicle traffic, cell adhesion/junction dynamics, the nicotinamide adenine dinucleotide phosphate (NADPH oxidase response, transcription regulation, receptor-mediated endocytosis, gene silencing, and growth factor signaling. Bottleneck proteins that bridge signaling paths and proteins that overlap in multiple small GTPase networks are described along with the functional annotation of all proteins in the network.
Targeting and localized signalling by small GTPases
ten Klooster, Jean Paul; Hordijk, Peter L.
2007-01-01
Polarized cellular responses, for example, cell migration, require the co-ordinated assembly of signalling complexes at a particular subcellular location, such as the leading edge of cells. Small GTPases of the Ras superfamily play central roles in many (polarized) responses to growth factors,
Gongadze, G M
2011-12-01
5S rRNA is an integral component of the ribosome of all living organisms. It is known that the ribosome without 5S rRNA is functionally inactive. However, the question about the specific role of this RNA in functioning of the translation apparatus is still open. This review presents a brief history of the discovery of 5S rRNA and studies of its origin and localization in the ribosome. The previously expressed hypotheses about the role of this RNA in the functioning of the ribosome are discussed considering the unique location of 5S rRNA in the ribosome and its intermolecular contacts. Based on analysis of the current data on ribosome structure and its functional complexes, the role of 5S rRNA as an intermediary between ribosome functional domains is discussed.
In vitro degradation of ribosomes.
Mora, G; Rivas, A
1976-12-01
The cytoplasmic ribosomes from Euglena gracilis var. bacillaris are found to be of two types taking into consideration their stability "in vitro". In the group of unstable ribosomes the large subunit is degraded. The other group apparently does not suffer any degradation under the conditions described. However the RNAs extracted from both types of ribosomes are degraded during sucrose density gradients. The degradation of the largest RNA species has been reported previously, but no comment has been made about the stability of the ribosome itself.
Olson, Michael F
2018-05-04
The 20 members of the Rho GTPase family are key regulators of a wide-variety of biological activities. In response to activation, they signal via downstream effector proteins to induce dynamic alterations in the organization of the actomyosin cytoskeleton. In this review, post-translational modifications, mechanisms of dysregulation identified in human pathological conditions, and the ways that Rho GTPases might be targeted for chemotherapy will be discussed.
Ribosomal studies on the 70S ribosome of E.coli by means of neutron scattering
International Nuclear Information System (INIS)
Burkhardt, N.
1997-01-01
Ribosomes are ribonucleo-protein complexes, which catalyse proteinbiosynthesis in all living organisms. Currently, most of the structural models of the prokaryotic 70S ribosome rely on electron microscopy and describe mainly the outer shape of the particle. Neutron scattering can provide information on the internal structure of the ribosome. Parts of the structure can be contrasted for neutrons by means of an isotopic exchange of the naturally occurring hydrogen ( 1 H) for deuterium ( 2 H), allowing direct measurements in situ. Specifically deuterium-labeled ribosomes (E. coli) were prepared and analysed with neutron scattering. The biochemical methods were established and combined to a generally applicable preparation system. This allows labeling of all ribosomal components in any combination. A systematic analysis of the protein and RNA phases resulted in the development of a new model for the 70S ribosome. This model describes not only the outer shape of the particle, but displays also an experimentally determined internal protein-RNA distribution and the border of subunits for the first time (four-phase model; resolution: 50A). Models of the 70S ribosome from other studies were evaluated and ranked according to consistency with the measured scattering data. Applying a new neutron scattering technique of particular sensitivity, the proton-spin contrast-variation, single proteins could be measured and localized. The positions of the proteins S6 and S10 were determined, providing the first coordinates of protein mass centers within the 70S ribosome. (orig.) [de
Huang, Shijie; Zhu, Xuechen; Melançon, Charles E
2016-01-15
The ribosome is the quintessential antibacterial drug target, with many structurally and mechanistically distinct classes of antibacterial agents acting by inhibiting ribosome function. Detecting and quantifying ribosome inhibition by small molecules and investigating their binding modes and mechanisms of action are critical to antibacterial drug discovery and development efforts. To develop a ribosome inhibition assay that is operationally simple, yet provides direct information on the drug target and the mechanism of action, we have developed engineered E. coli strains harboring an orthogonal ribosome-controlled green fluorescent protein (GFP) reporter that produce fluorescent signal when the orthogonal ribosome is inhibited. As a proof of concept, we demonstrate that these strains, when coexpressing homogeneous populations of aminoglycoside resistant ribosomes, act as sensitive and quantitative detectors of ribosome inhibition by a set of 12 structurally diverse aminoglycoside antibiotics. We suggest that this strategy can be extended to quantifying ribosome inhibition by other drug classes.
Directory of Open Access Journals (Sweden)
Bani Kumar Pathak
Full Text Available BACKGROUND: Molecular chaperones that support de novo folding of proteins under non stress condition are classified as chaperone 'foldases' that are distinct from chaperone' holdases' that provide high affinity binding platform for unfolded proteins and prevent their aggregation specifically under stress conditions. Ribosome, the cellular protein synthesis machine can act as a foldase chaperone that can bind unfolded proteins and release them in folding competent state. The peptidyl transferase center (PTC located in the domain V of the 23S rRNA of Escherichia coli ribosome (bDV RNA is the chaperoning center of the ribosome. It has been proposed that via specific interactions between the RNA and refolding proteins, the chaperone provides information for the correct folding of unfolded polypeptide chains. RESULTS: We demonstrate using Escherichia coli ribosome and variants of its domain V RNA that the ribosome can bind to partially folded intermediates of bovine carbonic anhydrase II (BCAII and lysozyme and suppress aggregation during their refolding. Using mutants of domain V RNA we demonstrate that the time for which the chaperone retains the bound protein is an important factor in determining its ability to suppress aggregation and/or support reactivation of protein. CONCLUSION: The ribosome can behave like a 'holdase' chaperone and has the ability to bind and hold back partially folded intermediate states of proteins from participating in the aggregation process. Since the ribosome is an essential organelle that is present in large numbers in all living cells, this ability of the ribosome provides an energetically inexpensive way to suppress cellular aggregation. Further, this ability of the ribosome might also be crucial in the context that the ribosome is one of the first chaperones to be encountered by a large nascent polypeptide chains that have a tendency to form partially folded intermediates immediately following their synthesis.
GTPase activity plays a key role in the pathobiology of LRRK2.
Directory of Open Access Journals (Sweden)
Yulan Xiong
2010-04-01
Full Text Available Mutations in the leucine-rich repeat kinase 2 (LRRK2 gene are associated with late-onset, autosomal-dominant, familial Parkinson's disease (PD and also contribute to sporadic disease. The LRRK2 gene encodes a large protein with multiple domains, including functional Roc GTPase and protein kinase domains. Mutations in LRRK2 most likely cause disease through a toxic gain-of-function mechanism. The expression of human LRRK2 variants in cultured primary neurons induces toxicity that is dependent on intact GTP binding or kinase activities. However, the mechanism(s underlying LRRK2-induced neuronal toxicity is poorly understood, and the contribution of GTPase and/or kinase activity to LRRK2 pathobiology is not well defined. To explore the pathobiology of LRRK2, we have developed a model of LRRK2 cytotoxicity in the baker's yeast Saccharomyces cerevisiae. Protein domain analysis in this model reveals that expression of GTPase domain-containing fragments of human LRRK2 are toxic. LRRK2 toxicity in yeast can be modulated by altering GTPase activity and is closely associated with defects in endocytic vesicular trafficking and autophagy. These truncated LRRK2 variants induce similar toxicity in both yeast and primary neuronal models and cause similar vesicular defects in yeast as full-length LRRK2 causes in primary neurons. The toxicity induced by truncated LRRK2 variants in yeast acts through a mechanism distinct from toxicity induced by human alpha-synuclein. A genome-wide genetic screen identified modifiers of LRRK2-induced toxicity in yeast including components of vesicular trafficking pathways, which can also modulate the trafficking defects caused by expression of truncated LRRK2 variants. Our results provide insight into the basic pathobiology of LRRK2 and suggest that the GTPase domain may contribute to the toxicity of LRRK2. These findings may guide future therapeutic strategies aimed at attenuating LRRK2-mediated neurodegeneration.
Directory of Open Access Journals (Sweden)
Harold S Bernhardt
2015-11-01
Full Text Available It was Francis Crick who first asked why the ribosome contains so much RNA, and discussed the implications of this for the direct flow of genetic information from DNA to protein. Remarkable advances in our understanding of the ribosome and protein synthesis, including the recent publication of two mammalian mitochondrial ribosome structures, have shed new light on this intriguing aspect of evolution in molecular biology. We examine here whether RNA is indispensable for coded protein synthesis, or whether an all-protein ‘ribosome’ (or ‘synthosome’ might be possible, with a protein enzyme catalyzing peptide synthesis, and release factor-like protein adaptors able to read a message composed of deoxyribonucleotides. We also compare the RNA world hypothesis with the alternative ‘proteins first’ hypothesis in terms of their different understandings of the evolution of the ribosome, and whether this might have been preceded by an ancestral form of nonribosomal peptide synthesis catalyzed by protein enzymes.
Directory of Open Access Journals (Sweden)
Monique N O'Leary
Full Text Available Most yeast ribosomal protein genes are duplicated and their characterization has led to hypotheses regarding the existence of specialized ribosomes with different subunit composition or specifically-tailored functions. In yeast, ribosomal protein genes are generally duplicated and evidence has emerged that paralogs might have specific roles. Unlike yeast, most mammalian ribosomal proteins are thought to be encoded by a single gene copy, raising the possibility that heterogenous populations of ribosomes are unique to yeast. Here, we examine the roles of the mammalian Rpl22, finding that Rpl22(-/- mice have only subtle phenotypes with no significant translation defects. We find that in the Rpl22(-/- mouse there is a compensatory increase in Rpl22-like1 (Rpl22l1 expression and incorporation into ribosomes. Consistent with the hypothesis that either ribosomal protein can support translation, knockdown of Rpl22l1 impairs growth of cells lacking Rpl22. Mechanistically, Rpl22 regulates Rpl22l1 directly by binding to an internal hairpin structure and repressing its expression. We propose that ribosome specificity may exist in mammals, providing evidence that one ribosomal protein can influence composition of the ribosome by regulating its own paralog.
DEFF Research Database (Denmark)
Grankowski, N; Gasior, E; Issinger, O G
1993-01-01
Kinetic studies on the 60S protein kinase were conducted with synthetic peptides and ribosomal proteins as substrate. Peptide RRREEESDDD proved to be the best synthetic substrate for this enzyme. The peptide has a sequence of amino acids which most closely resembles the structure of potential...... phosphorylation sites in natural substrates, i.e., acidic ribosomal proteins. The superiority of certain kinetic parameters for 60S kinase obtained with the native whole 80S ribosomes over those of the isolated fraction of acidic ribosomal proteins indicates that the affinity of 60S kinase to the specific protein...
The small GTPase RhoH is an atypical regulator of haematopoietic cells
Directory of Open Access Journals (Sweden)
Kubatzky Katharina F
2008-09-01
Full Text Available Abstract Rho GTPases are a distinct subfamily of the superfamily of Ras GTPases. The best-characterised members are RhoA, Rac and Cdc42 that regulate many diverse actions such as actin cytoskeleton reorganisation, adhesion, motility as well as cell proliferation, differentiation and gene transcription. Among the 20 members of that family, only Rac2 and RhoH show an expression restricted to the haematopoietic lineage. RhoH was first discovered in 1995 as a fusion transcript with the transcriptional repressor LAZ3/BCL6. It was therefore initially named translation three four (TTF but later on renamed RhoH due to its close relationship to the Ras/Rho family of GTPases. Since then, RhoH has been implicated in human cancer as the gene is subject to somatic hypermutation and by the detection of RHOH as a translocation partner for LAZ3/BCL6 or other genes in human lymphomas. Underexpression of RhoH is found in hairy cell leukaemia and acute myeloid leukaemia. Some of the amino acids that are crucial for GTPase activity are mutated in RhoH so that the protein is a GTPase-deficient, so-called atypical Rho GTPase. Therefore other mechanisms of regulating RhoH activity have been described. These include regulation at the mRNA level and tyrosine phosphorylation of the protein's unique ITAM-like motif. The C-terminal CaaX box of RhoH is mainly a target for farnesyl-transferase but can also be modified by geranylgeranyl-transferase. Isoprenylation of RhoH and changes in subcellular localisation may be an additional factor to fine-tune signalling. Little is currently known about its signalling, regulation or interaction partners. Recent studies have shown that RhoH negatively influences the proliferation and homing of murine haematopoietic progenitor cells, presumably by acting as an antagonist for Rac1. In leukocytes, RhoH is needed to keep the cells in a resting, non-adhesive state, but the exact mechanism has yet to be elucidated. RhoH has also been
Novel Activities of Select NSAID R-Enantiomers against Rac1 and Cdc42 GTPases.
Directory of Open Access Journals (Sweden)
Tudor I Oprea
Full Text Available Rho family GTPases (including Rac, Rho and Cdc42 collectively control cell proliferation, adhesion and migration and are of interest as functional therapeutic targets in numerous epithelial cancers. Based on high throughput screening of the Prestwick Chemical Library® and cheminformatics we identified the R-enantiomers of two approved drugs (naproxen and ketorolac as inhibitors of Rac1 and Cdc42. The corresponding S-enantiomers are considered the active component in racemic drug formulations, acting as non-steroidal anti-inflammatory drugs (NSAIDs with selective activity against cyclooxygenases. Here, we show that the S-enantiomers of naproxen and ketorolac are inactive against the GTPases. Additionally, more than twenty other NSAIDs lacked inhibitory action against the GTPases, establishing the selectivity of the two identified NSAIDs. R-naproxen was first identified as a lead compound and tested in parallel with its S-enantiomer and the non-chiral 6-methoxy-naphthalene acetic acid (active metabolite of nabumetone, another NSAID as a structural series. Cheminformatics-based substructure analyses-using the rotationally constrained carboxylate in R-naproxen-led to identification of racemic [R/S] ketorolac as a suitable FDA-approved candidate. Cell based measurement of GTPase activity (in animal and human cell lines demonstrated that the R-enantiomers specifically inhibit epidermal growth factor stimulated Rac1 and Cdc42 activation. The GTPase inhibitory effects of the R-enantiomers in cells largely mimic those of established Rac1 (NSC23766 and Cdc42 (CID2950007/ML141 specific inhibitors. Docking predicts that rotational constraints position the carboxylate moieties of the R-enantiomers to preferentially coordinate the magnesium ion, thereby destabilizing nucleotide binding to Rac1 and Cdc42. The S-enantiomers can be docked but are less favorably positioned in proximity to the magnesium. R-naproxen and R-ketorolac have potential for rapid
Structure of Ribosomal Silencing Factor Bound to Mycobacterium tuberculosis Ribosome.
Li, Xiaojun; Sun, Qingan; Jiang, Cai; Yang, Kailu; Hung, Li-Wei; Zhang, Junjie; Sacchettini, James C
2015-10-06
The ribosomal silencing factor RsfS slows cell growth by inhibiting protein synthesis during periods of diminished nutrient availability. The crystal structure of Mycobacterium tuberculosis (Mtb) RsfS, together with the cryo-electron microscopy (EM) structure of the large subunit 50S of Mtb ribosome, reveals how inhibition of protein synthesis by RsfS occurs. RsfS binds to the 50S at L14, which, when occupied, blocks the association of the small subunit 30S. Although Mtb RsfS is a dimer in solution, only a single subunit binds to 50S. The overlap between the dimer interface and the L14 binding interface confirms that the RsfS dimer must first dissociate to a monomer in order to bind to L14. RsfS interacts primarily through electrostatic and hydrogen bonding to L14. The EM structure shows extended rRNA density that it is not found in the Escherichia coli ribosome, the most striking of these being the extended RNA helix of H54a. Copyright © 2015 Elsevier Ltd. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Burkhardt, N. [GKSS-Forschungszentrum Geesthacht GmbH (Germany). Inst. fuer Werkstofforschung
1997-12-31
Ribosomes are ribonucleo-protein complexes, which catalyse proteinbiosynthesis in all living organisms. Currently, most of the structural models of the prokaryotic 70S ribosome rely on electron microscopy and describe mainly the outer shape of the particle. Neutron scattering can provide information on the internal structure of the ribosome. Parts of the structure can be contrasted for neutrons by means of an isotopic exchange of the naturally occurring hydrogen ({sup 1}H) for deuterium ({sup 2}H), allowing direct measurements in situ. Specifically deuterium-labeled ribosomes (E. coli) were prepared and analysed with neutron scattering. The biochemical methods were established and combined to a generally applicable preparation system. This allows labeling of all ribosomal components in any combination. A systematic analysis of the protein and RNA phases resulted in the development of a new model for the 70S ribosome. This model describes not only the outer shape of the particle, but displays also an experimentally determined internal protein-RNA distribution and the border of subunits for the first time (four-phase model; resolution: 50A). Models of the 70S ribosome from other studies were evaluated and ranked according to consistency with the measured scattering data. Applying a new neutron scattering technique of particular sensitivity, the proton-spin contrast-variation, single proteins could be measured and localized. The positions of the proteins S6 and S10 were determined, providing the first coordinates of protein mass centers within the 70S ribosome. (orig.) [Deutsch] Ribosomen sind Ribonukleinsaeure-Protein Komplexe, die in allen lebenden Organismen die Proteinbiosynthese katalysieren. Strukturmodelle fuer das prokaryontische 70S-Ribosom beruhen derzeit vorwiegend auf elektronenmikroskopischen Untersuchungen und beschreiben im wesentlichen die aeussere Oberflaeche des Partikels. Informationen ueber die innere Struktur des Ribosoms koennen Messungen mit
Energy Technology Data Exchange (ETDEWEB)
Burkhardt, N [GKSS-Forschungszentrum Geesthacht GmbH (Germany). Inst. fuer Werkstofforschung
1998-12-31
Ribosomes are ribonucleo-protein complexes, which catalyse proteinbiosynthesis in all living organisms. Currently, most of the structural models of the prokaryotic 70S ribosome rely on electron microscopy and describe mainly the outer shape of the particle. Neutron scattering can provide information on the internal structure of the ribosome. Parts of the structure can be contrasted for neutrons by means of an isotopic exchange of the naturally occurring hydrogen ({sup 1}H) for deuterium ({sup 2}H), allowing direct measurements in situ. Specifically deuterium-labeled ribosomes (E. coli) were prepared and analysed with neutron scattering. The biochemical methods were established and combined to a generally applicable preparation system. This allows labeling of all ribosomal components in any combination. A systematic analysis of the protein and RNA phases resulted in the development of a new model for the 70S ribosome. This model describes not only the outer shape of the particle, but displays also an experimentally determined internal protein-RNA distribution and the border of subunits for the first time (four-phase model; resolution: 50A). Models of the 70S ribosome from other studies were evaluated and ranked according to consistency with the measured scattering data. Applying a new neutron scattering technique of particular sensitivity, the proton-spin contrast-variation, single proteins could be measured and localized. The positions of the proteins S6 and S10 were determined, providing the first coordinates of protein mass centers within the 70S ribosome. (orig.) [Deutsch] Ribosomen sind Ribonukleinsaeure-Protein Komplexe, die in allen lebenden Organismen die Proteinbiosynthese katalysieren. Strukturmodelle fuer das prokaryontische 70S-Ribosom beruhen derzeit vorwiegend auf elektronenmikroskopischen Untersuchungen und beschreiben im wesentlichen die aeussere Oberflaeche des Partikels. Informationen ueber die innere Struktur des Ribosoms koennen Messungen mit
Directory of Open Access Journals (Sweden)
LIN eHONG
2014-06-01
Full Text Available Neurological diseases have placed heavy social and financial burdens on modern society. As the life expectancy of humans is extended, neurological diseases, such as Parkinson’s disease, have become increasingly common among senior populations. Although the enigmas of Parkinson’s diseases await resolution, more vivid pictures on the cause, progression and control of the illness are emerging after years of research. On the molecular level, GTPases are implicated in the etiology of Parkinson’s disease and are rational pharmaceutical targets for their control. However, targeting individual GTPases, which belong to a superfamily of proteins containing multiple members with a conserved guanine nucleotide binding domain, has proven to be challenging. In contrast, pharmaceutical pursuit of inhibition of kinases, which constitute another superfamily of proteins with more than 500 members, has been fairly successful. We reviewed the breakthroughs in the history of kinase drug discovery to provide guidance for the GTPase field. We summarize recent progress made in the regulation of GTPase activity. We also present an efficient and cost effective approach to drug screening, which uses multiplex flow cytometry and mixture-based positional scanning libraries. These methods allow simultaneous measurements of both the activity and the selectivity of the screened library. Several GTPase activator clusters were identified which showed selectivity against different GTPase subfamilies. While the clusters need to be further deconvoluted to identify individual active compounds, the method described here and the structure information gathered create a foundation for further developments to build upon.
Differential Stoichiometry among Core Ribosomal Proteins
Directory of Open Access Journals (Sweden)
Nikolai Slavov
2015-11-01
Full Text Available Understanding the regulation and structure of ribosomes is essential to understanding protein synthesis and its dysregulation in disease. While ribosomes are believed to have a fixed stoichiometry among their core ribosomal proteins (RPs, some experiments suggest a more variable composition. Testing such variability requires direct and precise quantification of RPs. We used mass spectrometry to directly quantify RPs across monosomes and polysomes of mouse embryonic stem cells (ESC and budding yeast. Our data show that the stoichiometry among core RPs in wild-type yeast cells and ESC depends both on the growth conditions and on the number of ribosomes bound per mRNA. Furthermore, we find that the fitness of cells with a deleted RP-gene is inversely proportional to the enrichment of the corresponding RP in polysomes. Together, our findings support the existence of ribosomes with distinct protein composition and physiological function.
Oxidative damage of 18S and 5S ribosomal RNA in digestive gland of mussels exposed to trace metals.
Kournoutou, Georgia G; Giannopoulou, Panagiota C; Sazakli, Eleni; Leotsinidis, Michel; Kalpaxis, Dimitrios L
2017-11-01
Numerous studies have shown the ability of trace metals to accumulate in marine organisms and cause oxidative stress that leads to perturbations in many important intracellular processes, including protein synthesis. This study is mainly focused on the exploration of structural changes, like base modifications, scissions, and conformational changes, caused in 18S and 5S ribosomal RNA (rRNA) isolated from the mussel Mytilus galloprovincialis exposed to 40μg/L Cu, 30μg/L Hg, or 100μg/L Cd, for 5 or 15days. 18S rRNA and 5S rRNA are components of the small and large ribosomal subunit, respectively, found in complex with ribosomal proteins, translation factors and other auxiliary components (metal ions, toxins etc). 18S rRNA plays crucial roles in all stages of protein synthesis, while 5S rRNA serves as a master signal transducer between several functional regions of 28S rRNA. Therefore, structural changes in these ribosomal constituents could affect the basic functions of ribosomes and hence the normal metabolism of cells. Especially, 18S rRNA along with ribosomal proteins forms the decoding centre that ensures the correct codon-anticodon pairing. As exemplified by ELISA, primer extension analysis and DMS footprinting analysis, each metal caused oxidative damage to rRNA, depending on the nature of metal ion and the duration of exposure. Interestingly, exposure of mussels to Cu or Hg caused structural alterations in 5S rRNA, localized in paired regions and within loops A, B, C, and E, leading to a continuous progressive loss of the 5S RNA structural integrity. In contrast, structural impairments of 5S rRNA in mussels exposed to Cd were accumulating for the initial 5days, and then progressively decreased to almost the normal level by day 15, probably due to the parallel elevation of metallothionein content that depletes the pools of free Cd. Regions of interest in 18S rRNA, such as the decoding centre, sites implicated in the binding of tRNAs (A- and P-sites) or
Zhao, Huan-Yu; Han, Yang; Wang, Jian; Yang, Lian-He; Zheng, Xiao-Ying; Du, Jiang; Wu, Guang-Ping; Wang, En-Hua
2017-06-01
IQ-domain GTPase-activating protein 1 is a scaffolding protein with multidomain which plays a role in modulating dishevelled (Dvl) nuclear translocation in canonical Wnt pathway. However, the biological function and mechanism of IQ-domain GTPase-activating protein 1 in invasive ductal carcinoma (IDC) remain unknown. In this study, we found that IQ-domain GTPase-activating protein 1 expression was elevated in invasive ductal carcinoma, which was positively correlated with tumor grade, lymphatic metastasis, and poor prognosis. Coexpression of IQ-domain GTPase-activating protein 1 and Dvl in the nucleus and cytoplasm of invasive ductal carcinoma was significantly correlated but not in the membrane. Postoperative survival in the patients with their coexpression in the nucleus and cytoplasm was obviously lower than that without coexpression. The positive expression rates of c-myc and cyclin D1 were significantly higher in the patients with nuclear coexpression of Dvl and IQ-domain GTPase-activating protein 1 than that with cytoplasmic coexpression, correlating with poor prognosis. IQ-domain GTPase-activating protein 1 significantly enhanced cell proliferation and invasion in invasive ductal carcinoma cell lines by interacting with Dvl in cytoplasm to promote Dvl nuclear translocation so as to upregulate the expression of c-myc and cyclin D1. Collectively, our data suggest that IQ-domain GTPase-activating protein 1 may promote the malignant phenotype of invasive ductal carcinoma via canonical Wnt signaling, and it could be used as a potential prognostic biomarker for breast cancer patients.
Control of ribosome formation in rat heart
International Nuclear Information System (INIS)
Russo, L.A.
1987-01-01
Diabetes of 9 days duration produced a 17% diminution in the rate of total protein synthesis in rat hearts perfused as Langendorff preparations supplied with glucose, plasma levels of amino acids, and 400 μU/ml insulin. This reduction was attributable to a decrease in efficiency of protein synthesis and total RNA content. Total messenger RNA content decreased in diabetic hearts in proportion to the reduction in total RNA. Diabetes also resulted in diminished ribosome content as reflected by the induction in total RNA. Ribosome production was investigated by monitoring incorporation of [ 3 H]phenylalanine into the proteins of cytoplasmic ribosomes. Rates of ribosome formation in diabetic hearts were as fast as control rates in the presence of insulin, and were faster than control rates in the absence of the hormone. These results indicated that ribosome content fell in diabetic hearts despite unchanged or faster rates of ribosome formation
DEFF Research Database (Denmark)
Greber, Basil J; Boehringer, Daniel; Godinic-Mikulcic, Vlatka
2012-01-01
additional components of the translation machinery with eukaryotes that are absent in bacteria. One of these translation factors is initiation factor 6 (IF6), which associates with the large ribosomal subunit. We have reconstructed the 50S ribosomal subunit from the archaeon Methanothermobacter...... between this archaeal ribosome and eukaryotic ribosomes but are mostly absent in bacteria and in some archaeal lineages. Furthermore, the structure reveals that, in spite of highly divergent evolutionary trajectories of the ribosomal particle and the acquisition of novel functions of IF6 in eukaryotes......, the molecular binding of IF6 on the ribosome is conserved between eukaryotes and archaea. The structure also provides a snapshot of the reductive evolution of the archaeal ribosome and offers new insights into the evolution of the translation system in archaea....
Fuchs, Gabriele; Petrov, Alexey N; Marceau, Caleb D; Popov, Lauren M; Chen, Jin; O'Leary, Seán E; Wang, Richard; Carette, Jan E; Sarnow, Peter; Puglisi, Joseph D
2015-01-13
Translation initiation can occur by multiple pathways. To delineate these pathways by single-molecule methods, fluorescently labeled ribosomal subunits are required. Here, we labeled human 40S ribosomal subunits with a fluorescent SNAP-tag at ribosomal protein eS25 (RPS25). The resulting ribosomal subunits could be specifically labeled in living cells and in vitro. Using single-molecule Förster resonance energy transfer (FRET) between RPS25 and domain II of the hepatitis C virus (HCV) internal ribosome entry site (IRES), we measured the rates of 40S subunit arrival to the HCV IRES. Our data support a single-step model of HCV IRES recruitment to 40S subunits, irreversible on the initiation time scale. We furthermore demonstrated that after binding, the 40S:HCV IRES complex is conformationally dynamic, undergoing slow large-scale rearrangements. Addition of translation extracts suppresses these fluctuations, funneling the complex into a single conformation on the 80S assembly pathway. These findings show that 40S:HCV IRES complex formation is accompanied by dynamic conformational rearrangements that may be modulated by initiation factors.
Crystallization of ribosomes from Thermus thermophilus
International Nuclear Information System (INIS)
Karpova, E.A.; Serdyuk, I.N.; Tarkhovskii, Yu.S.; Orlova, E.V.; Borovyagin, V.L.
1987-01-01
An understanding of the molecular bases of the process of protein biosynthesis on the ribosome requires a knowledge of its structure with high three-dimensional resolution involving the method of x-ray crystallographic analysis. The authors report on the production of crystals of the 70S ribosomes from a new source - the highly thermophilic bacterium Thermus thermophilus. Ribosomes for crystallization were obtained from Th. thermophilus strain HB8 by two washings in buffer with high ionic strength. The ribosome preparation was investigated for homogeneity by the method of high-speed sedimentation in a buffer containing 15 mM MgCl 2 , 50 mM NH 4 Cl, and 10 MM Tris-HCl, pH 7.5. Analysis showed that the preparation if homogeneous. The same preparation was investigated for intactness of ribosomal RNA by the method of gel electrophoresis in 2.75% acrylamide 0.5% agarose gel in a buffer containing 30 mM Tris, 30 mM NaH 2 PO 4 , 10 mM EDTA, 1-2% SDS, and 6 M urea. Analysis showed that the preparation possesses intact 16S and 23S RNA. The latter did not degrade, at least in a week of exposure of the ribosomes in buffer solution at 5 0 C. The ribosome preparation had no appreciable RNase activity, which was verified by incubating 4.5 micrograms of ribosomes with 3 micrograms of 14 C-labeled 16S rRna (50 0 C, 90 min) in a buffer containing 10 mM MgCl 2 , 100 mM NH 4 Cl, and 10 mM Tris-HCl, pH/sub 20 0 / 7.5. The incubated nonhydrolyzed RNA was precipitated with 5% trichloroacetic acid and applied on a GF/C filter. The radioactivity was determined in a toluene scintillator on an LS-100C counter
Directory of Open Access Journals (Sweden)
Amrutraj eZade
2015-09-01
Full Text Available Rab GTPases are the key regulators of intracellular membrane trafficking in eukaryotes. Many viruses and intracellular bacterial pathogens have evolved to hijack the host Rab GTPase functions, mainly through activators and effector proteins, for their benefit. Acanthamoeba polyphaga mimivirus (APMV is one of the largest viruses and belongs to the monophyletic clade of nucleo-cytoplasmic large DNA viruses (NCLDV. The inner membrane lining is integral to the APMV virion structure. APMV assembly involves extensive host membrane modifications, like vesicle budding and fusion, leading to the formation of a membrane sheet that is incorporated into the virion. Intriguingly, APMV and all group I members of the Mimiviridae family code for a putative Rab GTPase protein. APMV is the first reported virus to code for a Rab GTPase (encoded by R214 gene. Our thorough in silico analysis of the subfamily specific (SF region of Mimiviridae Rab GTPase sequences suggests that they are related to Rab5, a member of the group II Rab GTPases, of lower eukaryotes. Because of their high divergence from the existing three isoforms, A, B and C of the Rab5-family, we suggest that Mimiviridae Rabs constitute a new isoform, Rab5D. Phylogenetic analysis indicated probable horizontal acquisition from a lower eukaryotic ancestor followed by selection and divergence. Furthermore, interaction network analysis suggests that vps34 (a Class III P13K homolog, coded by APMV L615, Atg-8 and dynamin (host proteins are recruited by APMV Rab GTPase during capsid assembly. Based on these observations, we hypothesize that APMV Rab plays a role in the acquisition of inner membrane during virion assembly.
The immunity-related GTPase Irga6 dimerizes in a parallel head-to-head fashion.
Schulte, Kathrin; Pawlowski, Nikolaus; Faelber, Katja; Fröhlich, Chris; Howard, Jonathan; Daumke, Oliver
2016-03-02
The immunity-related GTPases (IRGs) constitute a powerful cell-autonomous resistance system against several intracellular pathogens. Irga6 is a dynamin-like protein that oligomerizes at the parasitophorous vacuolar membrane (PVM) of Toxoplasma gondii leading to its vesiculation. Based on a previous biochemical analysis, it has been proposed that the GTPase domains of Irga6 dimerize in an antiparallel fashion during oligomerization. We determined the crystal structure of an oligomerization-impaired Irga6 mutant bound to a non-hydrolyzable GTP analog. Contrary to the previous model, the structure shows that the GTPase domains dimerize in a parallel fashion. The nucleotides in the center of the interface participate in dimerization by forming symmetric contacts with each other and with the switch I region of the opposing Irga6 molecule. The latter contact appears to activate GTP hydrolysis by stabilizing the position of the catalytic glutamate 106 in switch I close to the active site. Further dimerization contacts involve switch II, the G4 helix and the trans stabilizing loop. The Irga6 structure features a parallel GTPase domain dimer, which appears to be a unifying feature of all dynamin and septin superfamily members. This study contributes important insights into the assembly and catalytic mechanisms of IRG proteins as prerequisite to understand their anti-microbial action.
Small GTPases and Stress Responses of vvran1 in the Straw Mushroom Volvariella volvacea
Directory of Open Access Journals (Sweden)
Jun-Jie Yan
2016-09-01
Full Text Available Small GTPases play important roles in the growth, development and environmental responses of eukaryotes. Based on the genomic sequence of the straw mushroom Volvariella volvacea, 44 small GTPases were identified. A clustering analysis using human small GTPases as the references revealed that V. volvacea small GTPases can be grouped into five families: nine are in the Ras family, 10 are in the Rho family, 15 are in the Rab family, one is in the Ran family and nine are in the Arf family. The transcription of vvran1 was up-regulated upon hydrogen peroxide (H2O2 stress, and could be repressed by diphenyleneiodonium chloride (DPI, a NADPH oxidase-specific inhibitor. The number of vvran1 transcripts also increased upon cold stress. Diphenyleneiodonium chloride, but not the superoxide dismutase (SOD inhibitor diethy dithiocarbamate (DDC, could suppress the up-regulation of vvran1 gene expression to cold stress. These results combined with the high correlations between gene expression and superoxide anion (O2− generation indicated that vvran1 could be one of the candidate genes in the downstream of O2− mediated pathways that are generated by NADPH oxidase under low temperature and oxidative stresses.
Greber, Basil J.; Boehringer, Daniel; Godinic-Mikulcic, Vlatka; Crnkovic, Ana; Ibba, Michael; Weygand-Durasevic, Ivana; Ban, Nenad
2013-01-01
Translation of mRNA into proteins by the ribosome is universally conserved in all cellular life. The composition and complexity of the translation machinery differ markedly between the three domains of life. Organisms from the domain Archaea show an intermediate level of complexity, sharing several additional components of the translation machinery with eukaryotes that are absent in bacteria. One of these translation factors is initiation factor 6 (IF6), which associates with the large ribosomal subunit. We have reconstructed the 50S ribosomal subunit from the archaeon Methanothermobacter thermautotrophicus in complex with archaeal IF6 at 6.6 Å resolution using cryo-electron microscopy (EM). The structure provides detailed architectural insights into the 50S ribosomal subunit from a methanogenic archaeon through identification of the rRNA expansion segments and ribosomal proteins that are shared between this archaeal ribosome and eukaryotic ribosomes but are mostly absent in bacteria and in some archaeal lineages. Furthermore, the structure reveals that, in spite of highly divergent evolutionary trajectories of the ribosomal particle and the acquisition of novel functions of IF6 in eukaryotes, the molecular binding of IF6 on the ribosome is conserved between eukaryotes and archaea. The structure also provides a snapshot of the reductive evolution of the archaeal ribosome and offers new insights into the evolution of the translation system in archaea. PMID:22306461
WAVE regulatory complex activation by cooperating GTPases Arf and Rac1
DEFF Research Database (Denmark)
Koronakis, Vassilis; Hume, Peter J; Humphreys, Daniel
2011-01-01
The WAVE regulatory complex (WRC) is a critical element in the control of actin polymerization at the eukaryotic cell membrane, but how WRC is activated remains uncertain. While Rho GTPase Rac1 can bind and activate WRC in vitro, this interaction is of low affinity, suggesting other factors may...... be important. By reconstituting WAVE-dependent actin assembly on membrane-coated beads in mammalian cell extracts, we found that Rac1 was not sufficient to engender bead motility, and we uncovered a key requirement for Arf GTPases. In vitro, Rac1 and Arf1 were individually able to bind weakly to recombinant...... be central components in WAVE signalling, acting directly, alongside Rac1....
Ribosomal history reveals origins of modern protein synthesis.
Directory of Open Access Journals (Sweden)
Ajith Harish
Full Text Available The origin and evolution of the ribosome is central to our understanding of the cellular world. Most hypotheses posit that the ribosome originated in the peptidyl transferase center of the large ribosomal subunit. However, these proposals do not link protein synthesis to RNA recognition and do not use a phylogenetic comparative framework to study ribosomal evolution. Here we infer evolution of the structural components of the ribosome. Phylogenetic methods widely used in morphometrics are applied directly to RNA structures of thousands of molecules and to a census of protein structures in hundreds of genomes. We find that components of the small subunit involved in ribosomal processivity evolved earlier than the catalytic peptidyl transferase center responsible for protein synthesis. Remarkably, subunit RNA and proteins coevolved, starting with interactions between the oldest proteins (S12 and S17 and the oldest substructure (the ribosomal ratchet in the small subunit and ending with the rise of a modern multi-subunit ribosome. Ancestral ribonucleoprotein components show similarities to in vitro evolved RNA replicase ribozymes and protein structures in extant replication machinery. Our study therefore provides important clues about the chicken-or-egg dilemma associated with the central dogma of molecular biology by showing that ribosomal history is driven by the gradual structural accretion of protein and RNA structures. Most importantly, results suggest that functionally important and conserved regions of the ribosome were recruited and could be relics of an ancient ribonucleoprotein world.
Zárský, Viktor; Potocký, Martin
2010-04-01
The Rho/Rop small GTPase regulatory module is central for initiating exocytotically ACDs (active cortical domains) in plant cell cortex, and a growing array of Rop regulators and effectors are being discovered in plants. Structural membrane phospholipids are important constituents of cells as well as signals, and phospholipid-modifying enzymes are well known effectors of small GTPases. We have shown that PLDs (phospholipases D) and their product, PA (phosphatidic acid), belong to the regulators of the secretory pathway in plants. We have also shown that specific NOXs (NADPH oxidases) producing ROS (reactive oxygen species) are involved in cell growth as exemplified by pollen tubes and root hairs. Most plant cells exhibit several distinct plasma membrane domains (ACDs), established and maintained by endocytosis/exocytosis-driven membrane protein recycling. We proposed recently the concept of a 'recycling domain' (RD), uniting the ACD and the connected endosomal recycling compartment (endosome), as a dynamic spatiotemporal entity. We have described a putative GTPase-effector complex exocyst involved in exocytic vesicle tethering in plants. Owing to the multiplicity of its Exo70 subunits, this complex, along with many RabA GTPases (putative recycling endosome organizers), may belong to core regulators of RD organization in plants.
Post-transcriptional regulation of ribosome biogenesis in yeast
Directory of Open Access Journals (Sweden)
Isabelle C. Kos-Braun
2017-05-01
Full Text Available Most microorganisms are exposed to the constantly and often rapidly changing environment. As such they evolved mechanisms to balance their metabolism and energy expenditure with the resources available to them. When resources become scarce or conditions turn out to be unfavourable for growth, cells reduce their metabolism and energy usage to survive. One of the major energy consuming processes in the cell is ribosome biogenesis. Unsurprisingly, cells encountering adverse conditions immediately shut down production of new ribosomes. It is well established that nutrient depletion leads to a rapid repression of transcription of the genes encoding ribosomal proteins, ribosome biogenesis factors as well as ribosomal RNA (rRNA. However, if pre-rRNA processing and ribosome assembly are regulated post-transcriptionally remains largely unclear. We have recently uncovered that the yeast Saccharomyces cerevisiae rapidly switches between two alternative pre-rRNA processing pathways depending on the environmental conditions. Our findings reveal a new level of complexity in the regulation of ribosome biogenesis.
Ribosomal Antibiotics: Contemporary Challenges
Directory of Open Access Journals (Sweden)
Tamar Auerbach-Nevo
2016-06-01
Full Text Available Most ribosomal antibiotics obstruct distinct ribosomal functions. In selected cases, in addition to paralyzing vital ribosomal tasks, some ribosomal antibiotics are involved in cellular regulation. Owing to the global rapid increase in the appearance of multi-drug resistance in pathogenic bacterial strains, and to the extremely slow progress in developing new antibiotics worldwide, it seems that, in addition to the traditional attempts at improving current antibiotics and the intensive screening for additional natural compounds, this field should undergo substantial conceptual revision. Here, we highlight several contemporary issues, including challenging the common preference of broad-range antibiotics; the marginal attention to alterations in the microbiome population resulting from antibiotics usage, and the insufficient awareness of ecological and environmental aspects of antibiotics usage. We also highlight recent advances in the identification of species-specific structural motifs that may be exploited for the design and the creation of novel, environmental friendly, degradable, antibiotic types, with a better distinction between pathogens and useful bacterial species in the microbiome. Thus, these studies are leading towards the design of “pathogen-specific antibiotics,” in contrast to the current preference of broad range antibiotics, partially because it requires significant efforts in speeding up the discovery of the unique species motifs as well as the clinical pathogen identification.
Effect of primary and secondary radicals on chain breaks in ribosomal RNA in E. coli ribosomes
International Nuclear Information System (INIS)
Singh, H.; Bishop, J.
1984-01-01
It has been shown previously that, in dilute aerated solutions, ribosomes are inactivated by OH radicals and by secondary radicals produced from added alcohols (Singh and Vadasz 1983 a). In de-aerated solutions, both radicalH and e - sub(aq) also inactivate ribosomes (Singh and Vadasz 1983 b). The results of these studies and other on different systems (Adams et al. 1973, Aldrich and Cundall 1969, Dewey and Stein 1970, Masuda et al. 1971, Nabben et al. 1982, 1983, Samuni et al. 1980, Singh and Singh 1982) have shown that damage to biological systems occurs by diverse mechanisms. One of these mechanisms involves chain breaks in RNA (Pollard and Weller 1967). The purpose of this study was to determine which of the primary and secondary radicals cause chain breaks in ribosomal RNA (rRNA) within the ribosomes. (author)
Galli, Valentina; Sebastian, Rafael; Moutel, Sandrine; Ecard, Jason; Perez, Franck; Roux, Aurélien
2017-10-12
Dynamin is a large GTPase that forms a helical collar at the neck of endocytic pits, and catalyzes membrane fission (Schmid and Frolov, 2011; Ferguson and De Camilli, 2012). Dynamin fission reaction is strictly dependent on GTP hydrolysis, but how fission is mediated is still debated (Antonny et al., 2016): GTP energy could be spent in membrane constriction required for fission, or in disassembly of the dynamin polymer to trigger fission. To follow dynamin GTP hydrolysis at endocytic pits, we generated a conformation-specific nanobody called dynab, that binds preferentially to the GTP hydrolytic state of dynamin-1. Dynab allowed us to follow the GTPase activity of dynamin-1 in real-time. We show that in fibroblasts, dynamin GTP hydrolysis occurs as stochastic bursts, which are randomly distributed relatively to the peak of dynamin assembly. Thus, dynamin disassembly is not coupled to GTPase activity, supporting that the GTP energy is primarily spent in constriction.
The GTPase Rab37 Participates in the Control of Insulin Exocytosis.
Directory of Open Access Journals (Sweden)
Sanda Ljubicic
Full Text Available Rab37 belongs to a subclass of Rab GTPases regulating exocytosis, including also Rab3a and Rab27a. Proteomic studies indicate that Rab37 is associated with insulin-containing large dense core granules of pancreatic β-cells. In agreement with these observations, we detected Rab37 in extracts of β-cell lines and human pancreatic islets and confirmed by confocal microscopy the localization of the GTPase on insulin-containing secretory granules. We found that, as is the case for Rab3a and Rab27a, reduction of Rab37 levels by RNA interference leads to impairment in glucose-induced insulin secretion and to a decrease in the number of granules in close apposition to the plasma membrane. Pull-down experiments revealed that, despite similar functional effects, Rab37 does not interact with known Rab3a or Rab27a effectors and is likely to operate through a different mechanism. Exposure of insulin-secreting cells to proinflammatory cytokines, fatty acids or oxidized low-density lipoproteins, mimicking physiopathological conditions that favor the development of diabetes, resulted in a decrease in Rab37 expression. Our data identify Rab37 as an additional component of the machinery governing exocytosis of β-cells and suggest that impaired expression of this GTPase may contribute to defective insulin release in pre-diabetic and diabetic conditions.
DEFF Research Database (Denmark)
Stanley, Alanna; Thompson, Kerry; Hynes, Ailish
2014-01-01
Abstract Significance: Rho GTPases are historically known to be central regulators of actin cytoskeleton reorganization. This affects many processes including cell migration. In addition, members of the Rac subfamily are known to be involved in reactive oxygen species (ROS) production through...... mediating cytoskeletal reorganization. Critical Issues: The role of the actin cytoskeleton in providing a scaffold for components of the Nox complex needs to be examined in the light of these new advances. During cell migration, Rho GTPases, ROS, and cytoskeletal organization appear to function as a complex...... compartments. This in conjunction with the analysis of tissues lacking specific Rho GTPases, and Nox components will facilitate a detailed examination of the interactions of these structures with the actin cytoskeleton. In combination with the analysis of ROS production, including its subcellular location...
International Nuclear Information System (INIS)
Klinglmayr, Eva; Wenger, Julia; Mayr, Sandra; Bossy-Wetzel, Ella; Puehringer, Sandra
2012-01-01
The crystallization and initial diffraction analysis of human Drp1 GTPase-GED fusion protein are reported. The mechano-enzyme dynamin-related protein 1 plays an important role in mitochondrial fission and is implicated in cell physiology. Dysregulation of Drp1 is associated with abnormal mitochondrial dynamics and neuronal damage. Drp1 shares structural and functional similarities with dynamin 1 with respect to domain organization, ability to self-assemble into spiral-like oligomers and GTP-cycle-dependent membrane scission. Structural studies of human dynamin-1 have greatly improved the understanding of this prototypical member of the dynamin superfamily. However, high-resolution structural information for full-length human Drp1 covering the GTPase domain, the middle domain and the GTPase effector domain (GED) is still lacking. In order to obtain mechanistic insights into the catalytic activity, a nucleotide-free GTPase-GED fusion protein of human Drp1 was expressed, purified and crystallized. Initial X-ray diffraction experiments yielded data to 2.67 Å resolution. The hexagonal-shaped crystals belonged to space group P2 1 2 1 2, with unit-cell parameters a = 53.59, b = 151.65, c = 43.53 Å, one molecule per asymmetric unit and a solvent content of 42%. Expression of selenomethionine-labelled protein is currently in progress. Here, the expression, purification, crystallization and X-ray diffraction analysis of the Drp1 GTPase-GED fusion protein are presented, which form a basis for more detailed structural and biophysical analysis
Identification and Characterization of a Chloroplast-Targeted Obg GTPase in Dendrobium officinale.
Chen, Ji; Deng, Feng; Deng, Mengsheng; Han, Jincheng; Chen, Jianbin; Wang, Li; Yan, Shen; Tong, Kai; Liu, Fan; Tian, Mengliang
2016-12-01
Bacterial homologous chloroplast-targeted Obg GTPases (ObgCs) belong to the plant-typical Obg group, which is involved in diverse physiological processes during chloroplast development. However, the evolutionarily conserved function of ObgC in plants remains elusive and requires further investigation. In this study, we identified DoObgC from an epiphytic plant Dendrobium officinale and demonstrated the characteristics of DoObgC. Sequence analysis indicated that DoObgC is highly conserved with other plant ObgCs, which contain the chloroplast transit peptide (cTP), Obg fold, G domain, and OCT regions. The C terminus of DoObgC lacking the chloroplast-targeting cTP region, DoObgC Δ1-160 , showed strong similarity to ObgE and other bacterial Obgs. Overexpression of DoObgC Δ1-160 in Escherichia coli caused slow cell growth and an increased number of elongated cells. This phenotype was consistent with the phenotype of cells overexpressing ObgE. Furthermore, the expression of recombinant DoObgC Δ1-160 enhanced the cell persistence of E. coli to streptomycin. Results of transient expression assays revealed that DoObgC was localized to chloroplasts. Moreover, we demonstrated that DoObgC could rescue the embryotic lethal phenotype of the Arabidopsis obgc-t mutant, suggesting that DoObgC is a functional homolog to Arabidopsis AtObgC in D. officinale. Gene expression profiles showed that DoObgC was expressed in leaf-specific and light-dependent patterns and that DoObgC responded to wounding treatments. Our previous and present studies reveal that ObgC has an evolutionarily conserved role in ribosome biogenesis to adapt chloroplast development to the environment.
Emerging functions of ribosomal proteins in gene-specific transcription and translation
International Nuclear Information System (INIS)
Lindstroem, Mikael S.
2009-01-01
Ribosomal proteins have remained highly conserved during evolution presumably reflecting often critical functions in ribosome biogenesis or mature ribosome function. In addition, several ribosomal proteins possess distinct extra-ribosomal functions in apoptosis, DNA repair and transcription. An increasing number of ribosomal proteins have been shown to modulate the trans-activation function of important regulatory proteins such as NF-κB, p53, c-Myc and nuclear receptors. Furthermore, a subset of ribosomal proteins can bind directly to untranslated regions of mRNA resulting in transcript-specific translational control outside of the ribosome itself. Collectively, these findings suggest that ribosomal proteins may have a wider functional repertoire within the cell than previously thought. The future challenge is to identify and validate these novel functions in the background of an often essential primary function in ribosome biogenesis and cell growth.
Eukaryotic ribosome display with in situ DNA recovery.
He, Mingyue; Edwards, Bryan M; Kastelic, Damjana; Taussig, Michael J
2012-01-01
Ribosome display is a cell-free display technology for in vitro selection and optimisation of proteins from large diversified libraries. It operates through the formation of stable protein-ribosome-mRNA (PRM) complexes and selection of ligand-binding proteins, followed by DNA recovery from the selected genetic information. Both prokaryotic and eukaryotic ribosome display systems have been developed. In this chapter, we describe the eukaryotic rabbit reticulocyte method in which a distinct in situ single-primer RT-PCR procedure is used to recover DNA from the selected PRM complexes without the need for prior disruption of the ribosome.
DEFF Research Database (Denmark)
Rosendahl, G; Douthwaite, S
1994-01-01
The antibiotics thiostrepton and micrococcin bind to the GTPase region in domain II of 23S rRNA, and inhibit ribosomal A-site associated reactions. When bound to the ribosome, these antibiotics alter the accessibility of nucleotides 1067A and 1095A towards chemical reagents. Plasmid......-coded Escherichia coli 23S rRNAs with single mutations at positions 1067 or 1095 were expressed in vivo. Mutant ribosomes are functional in protein synthesis, although those with transversion mutations function less effectively. Antibiotics were bound under conditions where wild-type and mutant ribosomes compete...
International Nuclear Information System (INIS)
Abo, Yohichi; Hagiya, Akiko; Naganuma, Takao; Tohkairin, Yukiko; Shiomi, Kunihiro; Kajiura, Zenta; Hachimori, Akira; Uchiumi, Toshio; Nakagaki, Masao
2004-01-01
We constructed an overexpression system for human ribosomal phosphoprotein P0, together with P1 and P2, which is crucially important for translation. Genes for these proteins, fused with the glutathione S-transferase (GST)-tag at the N-terminus, were inserted into baculovirus and introduced to insect cells. The fusion proteins, but not the proteins without the tag, were efficiently expressed into cells as soluble forms. The fusion protein GST.P0 as well as GST.P1/GST.P2 was phosphorylated in cells as detected by incorporation of 32 P and reactivity with monoclonal anti-phosphoserine antibody. GST.P0 expressed in insect cells, but not the protein obtained in Escherichia coli, had the ability to form a complex with P1 and P2 proteins and to bind to 28S rRNA. Moreover, the GST.P0-P1-P2 complex participated in high eEF-2-dependent GTPase activity. Baculovirus expression systems appear to provide recombinant human P0 samples that can be used for studies on the structure and function
Characterization of a Rab11-like GTPase, EhRab11, of Entamoeba histolytica.
McGugan, Glen C; Temesvari, Lesly A
2003-07-01
The Entamoeba histolytica Rab11 family of small molecular weight GTPases consists of three members, EhRab11, EhRab11B, and EhRab11C. The functions of these Rabs in Entamoeba have not been determined. Therefore, as an approach to elucidate the role of the Rab11 family of GTPases in Entamoeba, immunofluorescence microscopy was undertaken to define the subcellular localization of one member of this family, EhRab11. Under conditions of growth, EhRab11 displayed a punctate pattern in the cytoplasm of trophozoites. EhRab11 did not colocalize with markers for the Golgi apparatus, endoplasmic reticulum, pinosomes, phagosomes, or compartments formed by receptor-mediated endocytosis, suggesting that this Rab may not play a role in vesicle trafficking between these organelles. Under conditions of iron and serum starvation, EhRab11 was translocated to the periphery of the cell. The altered cellular localization was accompanied by multinucleation of the cells as well as the acquisition of detergent resistance by the cells, features that are characteristic of Entamoeba cysts. The translocation of EhRab11 to the periphery of the cell during iron and serum starvation was specific as the subcellular localizations of two other Rab GTPases, EhRab7 and EhRabA, were not altered under the same conditions. In addition, the formation of multinucleated cells by inhibition of cytokinesis was not sufficient to induce the translocation of EhRab11 to the cell periphery. Taken together, the data suggest that iron and serum starvation may induce encystation in E. histolytica and that EhRab11 may play a role in this process. Moreover, these studies are the first to describe a putative role for a Rab GTPase in encystation in Entamoeba sp.
Heterogeneous Ribosomes Preferentially Translate Distinct Subpools of mRNAs Genome-wide.
Shi, Zhen; Fujii, Kotaro; Kovary, Kyle M; Genuth, Naomi R; Röst, Hannes L; Teruel, Mary N; Barna, Maria
2017-07-06
Emerging studies have linked the ribosome to more selective control of gene regulation. However, an outstanding question is whether ribosome heterogeneity at the level of core ribosomal proteins (RPs) exists and enables ribosomes to preferentially translate specific mRNAs genome-wide. Here, we measured the absolute abundance of RPs in translating ribosomes and profiled transcripts that are enriched or depleted from select subsets of ribosomes within embryonic stem cells. We find that heterogeneity in RP composition endows ribosomes with differential selectivity for translating subpools of transcripts, including those controlling metabolism, cell cycle, and development. As an example, mRNAs enriched in binding to RPL10A/uL1-containing ribosomes are shown to require RPL10A/uL1 for their efficient translation. Within several of these transcripts, this level of regulation is mediated, at least in part, by internal ribosome entry sites. Together, these results reveal a critical functional link between ribosome heterogeneity and the post-transcriptional circuitry of gene expression. Copyright © 2017 Elsevier Inc. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Wang, Xiang; Zhao, Fang [Jiangsu Key Laboratory of Drug Screening, China Pharmaceutical University, Nanjing 210009 (China); Lv, Zhong-ming; Shi, Wei-qin [Jiangsu Provincial Center for Disease Control and Prevention, Nanjing (China); Zhang, Lu-yong, E-mail: lyzhang@cpu.edu.cn [Jiangsu Key Laboratory of Drug Screening, China Pharmaceutical University, Nanjing 210009 (China); Key Laboratory of Drug Quality Control and Pharmacovigilance, China Pharmaceutical University, Nanjing (China); State Key Laboratory of Natural Medicines, China Pharmaceutical University, Nanjing 210009 (China); Yan, Ming, E-mail: brookming@cpu.edu.cn [Jiangsu Key Laboratory of Drug Screening, China Pharmaceutical University, Nanjing 210009 (China)
2016-11-01
Triptolide (TP), derived from the medicinal plant Triterygium wilfordii Hook. f. (TWHF), is a diterpene triepoxide with variety biological and pharmacological activities. However, TP has been restricted in clinical application due to its narrow therapeutic window especially in reproductive system. During spermatogenesis, Sertoli cell cytoskeleton plays an essential role in facilitating germ cell movement and cell-cell actin-based adherens junctions (AJ). At Sertoli cell-spermatid interface, the anchoring device is a kind of AJ, known as ectoplasmic specializations (ES). In this study, we demonstrate that β-actin, an important component of cytoskeleton, has been significantly down-regulated after TP treatment. TP can inhibit the expression of Rho GTPase such as, RhoA, RhoB, Cdc42 and Rac1. Downstream of Rho GTPase, Rho-associated protein kinase (ROCKs) gene expressions were also suppressed by TP. F-actin immunofluorescence proved that TP disrupts Sertoli cells cytoskeleton network. As a result of β-actin down-regulation, TP treatment increased expression of testin, which indicating ES has been disassembled. In summary, this report illustrates that TP induces cytoskeleton dysfunction and disrupts cell-cell adherens junctions via inhibition of Rho GTPases. - Highlights: • Triptolide induced the disruption of Sertoli-germ cell adherens junction. • Rho GTPases expression and actin dynamics have been suppressed by triptolide. • Actin-based adherens junction is a potential antifertility target of triptolide. • Rho-Rock is involved in the regulation of actin dynamics.
International Nuclear Information System (INIS)
Wang, Xiang; Zhao, Fang; Lv, Zhong-ming; Shi, Wei-qin; Zhang, Lu-yong; Yan, Ming
2016-01-01
Triptolide (TP), derived from the medicinal plant Triterygium wilfordii Hook. f. (TWHF), is a diterpene triepoxide with variety biological and pharmacological activities. However, TP has been restricted in clinical application due to its narrow therapeutic window especially in reproductive system. During spermatogenesis, Sertoli cell cytoskeleton plays an essential role in facilitating germ cell movement and cell-cell actin-based adherens junctions (AJ). At Sertoli cell-spermatid interface, the anchoring device is a kind of AJ, known as ectoplasmic specializations (ES). In this study, we demonstrate that β-actin, an important component of cytoskeleton, has been significantly down-regulated after TP treatment. TP can inhibit the expression of Rho GTPase such as, RhoA, RhoB, Cdc42 and Rac1. Downstream of Rho GTPase, Rho-associated protein kinase (ROCKs) gene expressions were also suppressed by TP. F-actin immunofluorescence proved that TP disrupts Sertoli cells cytoskeleton network. As a result of β-actin down-regulation, TP treatment increased expression of testin, which indicating ES has been disassembled. In summary, this report illustrates that TP induces cytoskeleton dysfunction and disrupts cell-cell adherens junctions via inhibition of Rho GTPases. - Highlights: • Triptolide induced the disruption of Sertoli-germ cell adherens junction. • Rho GTPases expression and actin dynamics have been suppressed by triptolide. • Actin-based adherens junction is a potential antifertility target of triptolide. • Rho-Rock is involved in the regulation of actin dynamics.
Schulz, Jana; Franke, Kristin; Frick, Manfred; Schumacher, Stefan
2016-10-01
Rho GTPases play prominent roles in the regulation of cytoskeletal reorganization. Many aspects have been elaborated concerning the individual functions of Rho GTPases in distinct signaling pathways leading to cytoskeletal rearrangements. However, major questions have yet to be answered regarding the integration and the signaling hierarchy of different Rho GTPases in regulating the cytoskeleton in fundamental physiological events like neuronal process differentiation. Here, we investigate the roles of the small GTPases Rac1, Cdc42, and RhoG in defining dendritic tree complexity stimulated by the transmembrane epidermal growth factor family member CALEB/NGC. Combining gain-of-function and loss-of-function analysis in primary hippocampal neurons, we find that Rac1 is essential for CALEB/NGC-mediated dendritic branching. Cdc42 reduces the complexity of dendritic trees. Interestingly, we identify the palmitoylated isoform of Cdc42 to adversely affect dendritic outgrowth and dendritic branching, whereas the prenylated Cdc42 isoform does not. In contrast to Rac1, CALEB/NGC and Cdc42 are not directly interconnected in regulating dendritic tree complexity. Unlike Rac1, the Rac1-related GTPase RhoG reduces the complexity of dendritic trees by acting upstream of CALEB/NGC. Mechanistically, CALEB/NGC activates Rac1, and RhoG reduces the amount of CALEB/NGC that is located at the right site for Rac1 activation at the cell membrane. Thus, Rac1, Cdc42, and RhoG perform very specific and non-redundant functions at different levels of hierarchy in regulating dendritic tree complexity induced by CALEB/NGC. Rho GTPases play a prominent role in dendritic branching. CALEB/NGC is a transmembrane member of the epidermal growth factor (EGF) family that mediates dendritic branching, dependent on Rac1. CALEB/NGC stimulates Rac1 activity. RhoG inhibits CALEB/NGC-mediated dendritic branching by decreasing the amount of CALEB/NGC at the plasma membrane. Palmitoylated, but not prenylated form
Energy Technology Data Exchange (ETDEWEB)
Sameshima, M; Ito, K; Iwabuchi, M
1972-01-01
In the slime mold, Dictyostelium discoideum, when the rate of protein synthesis was decreased by NaF, free 80-S ribosomes accumulated at the expense of polyribosomes, while 60-S and 40-S ribosomal subunits remained almost constant. The same level of ribosomal subunits was also maintained in cells after incubation with cycloheximide or at the stationary phase of growth.
Ribosome dynamics and tRNA movement by time-resolved electron cryomicroscopy.
Fischer, Niels; Konevega, Andrey L; Wintermeyer, Wolfgang; Rodnina, Marina V; Stark, Holger
2010-07-15
The translocation step of protein synthesis entails large-scale rearrangements of the ribosome-transfer RNA (tRNA) complex. Here we have followed tRNA movement through the ribosome during translocation by time-resolved single-particle electron cryomicroscopy (cryo-EM). Unbiased computational sorting of cryo-EM images yielded 50 distinct three-dimensional reconstructions, showing the tRNAs in classical, hybrid and various novel intermediate states that provide trajectories and kinetic information about tRNA movement through the ribosome. The structures indicate how tRNA movement is coupled with global and local conformational changes of the ribosome, in particular of the head and body of the small ribosomal subunit, and show that dynamic interactions between tRNAs and ribosomal residues confine the path of the tRNAs through the ribosome. The temperature dependence of ribosome dynamics reveals a surprisingly flat energy landscape of conformational variations at physiological temperature. The ribosome functions as a Brownian machine that couples spontaneous conformational changes driven by thermal energy to directed movement.
The complete structure of the chloroplast 70S ribosome in complex with translation factor pY.
Bieri, Philipp; Leibundgut, Marc; Saurer, Martin; Boehringer, Daniel; Ban, Nenad
2017-02-15
Chloroplasts are cellular organelles of plants and algae that are responsible for energy conversion and carbon fixation by the photosynthetic reaction. As a consequence of their endosymbiotic origin, they still contain their own genome and the machinery for protein biosynthesis. Here, we present the atomic structure of the chloroplast 70S ribosome prepared from spinach leaves and resolved by cryo-EM at 3.4 Å resolution. The complete structure reveals the features of the 4.5S rRNA, which probably evolved by the fragmentation of the 23S rRNA, and all five plastid-specific ribosomal proteins. These proteins, required for proper assembly and function of the chloroplast translation machinery, bind and stabilize rRNA including regions that only exist in the chloroplast ribosome. Furthermore, the structure reveals plastid-specific extensions of ribosomal proteins that extensively remodel the mRNA entry and exit site on the small subunit as well as the polypeptide tunnel exit and the putative binding site of the signal recognition particle on the large subunit. The translation factor pY, involved in light- and temperature-dependent control of protein synthesis, is bound to the mRNA channel of the small subunit and interacts with 16S rRNA nucleotides at the A-site and P-site, where it protects the decoding centre and inhibits translation by preventing tRNA binding. The small subunit is locked by pY in a non-rotated state, in which the intersubunit bridges to the large subunit are stabilized. © 2016 The Authors. Published under the terms of the CC BY NC ND 4.0 license.
The Phosphorylation of Ribosomal Protein in Lemna minor
Trewavas, A.
1973-01-01
Sterile cultures of Lemna minor have been labeled with 32P1, and the ribosomal proteins have been examined for radioactivity. In relatively short term labeling a radioactive protein was found which ran as a single component in both urea/acetic acid and sodium lauryl sulfate gel electrophoresis. Acid hydrolysis of the labeled protein permitted the isolation of serine phosphate. After labeling to equilibrium with 32P1, calculation indicated only 0.6 to 0.75 atom of this protein phosphorus per ribosome. The phosphorylated protein is found in both polysomes and “derived” monomers and appears to be located in the ribosomal small subunit. Its apparent molecular weight is 42,000. Addition of growth-inhibiting concentrations of abscisic acid does not alter the apparent degree of labeling of this protein in 5 hours, but after 24 hours of treatment the total protein phosphorus was reduced from 0.75 atom of phosphorus per ribosome to 0.36 atom of phosphorus per ribosome. PMID:16658405
Directory of Open Access Journals (Sweden)
Brittany Burton
Full Text Available Assembly of the ribosome from its protein and RNA constituents has been studied extensively over the past 50 years, and experimental evidence suggests that prokaryotic ribosomal proteins undergo conformational changes during assembly. However, to date, no studies have attempted to elucidate these conformational changes. The present work utilizes computational methods to analyze protein dynamics and to investigate the linkage between dynamics and binding of these proteins during the assembly of the ribosome. Ribosomal proteins are known to be positively charged and we find the percentage of positive residues in r-proteins to be about twice that of the average protein: Lys+Arg is 18.7% for E. coli and 21.2% for T. thermophilus. Also, positive residues constitute a large proportion of RNA contacting residues: 39% for E. coli and 46% for T. thermophilus. This affirms the known importance of charge-charge interactions in the assembly of the ribosome. We studied the dynamics of three primary proteins from E. coli and T. thermophilus 30S subunits that bind early in the assembly (S15, S17, and S20 with atomic molecular dynamic simulations, followed by a study of all r-proteins using elastic network models. Molecular dynamics simulations show that solvent-exposed proteins (S15 and S17 tend to adopt more stable solution conformations than an RNA-embedded protein (S20. We also find protein residues that contact the 16S rRNA are generally more mobile in comparison with the other residues. This is because there is a larger proportion of contacting residues located in flexible loop regions. By the use of elastic network models, which are computationally more efficient, we show that this trend holds for most of the 30S r-proteins.
Directory of Open Access Journals (Sweden)
Krishna eVadodaria
2013-08-01
Full Text Available Adult neurogenesis, restricted to specific regions in the mammalian brain, represents one of the most interesting forms of plasticity in the mature nervous system. Adult-born hippocampal neurons play important roles in certain forms of learning and memory, and altered hippocampal neurogenesis has been associated with a number of neuropsychiatric diseases such as major depression and epilepsy. Newborn neurons go through distinct developmental steps from a dividing neurogenic precursor to a synaptically integrated mature neuron. Previous studies have uncovered several molecular signaling pathways involved in distinct steps of this maturational process. In this context, the small Rho GTPases, Cdc42, Rac1 and RhoA have recently been shown to regulate the morphological and synaptic maturation of adult-born dentate granule cells in vivo. Distinct upstream regulators, including several growth factors that modulate maturation and integration of newborn neurons have been shown to also recruit the small Rho GTPases. Here we review recent findings and highlight the possibility that small Rho GTPases may act as central assimilators, downstream of critical input onto adult-born hippocampal neurons contributing to their maturation and integration into the existing dentate gyrus circuitry.
DEFF Research Database (Denmark)
Issinger, O G
1977-01-01
Two acidic proteins from 80-S ribosomes were isolated and purified to homogeneity. The purified acidic proteins could be phosphorylated by casein kinase using [gamma-32P]ATP and [gamma-32P]GTP as a phosphoryl donor. The proteins became phosphorylated in situ, too. Sodium dodecyl sulfate polyacryl......Two acidic proteins from 80-S ribosomes were isolated and purified to homogeneity. The purified acidic proteins could be phosphorylated by casein kinase using [gamma-32P]ATP and [gamma-32P]GTP as a phosphoryl donor. The proteins became phosphorylated in situ, too. Sodium dodecyl sulfate...
On the control of ribosomal protein biosynthesis in Escherichia coli
International Nuclear Information System (INIS)
Pichon, J.; Marvaldi, J.; Coeroli, C.; Cozzone, A.; Marchis-Mouren, G.
1977-01-01
The rate of individual ribosomal protein synthesis relative to total protein synthesis has been determined in Escherichia coli rel + and rel - cells, under valyl-tRNA deprivation. These strains have a temperature-sensitive valyl-tRNA synthetase. Starvation was obtained following transfer of the cells to non-permissive temperature. Ribosomal proteins were obtained by treatment of either total lysates of freeze-thawed lysozyme spheroplasts or ammonium sulphate precipitate of ribosomes, with acetic acid. Differential labelling of the ribosomal proteins was observed in both strains: proteins from the rel + strain appear more labelled than those from the rel - strain, the rate of labelling of individual proteins being about the same in both strains. Moreover ribosomal proteins were found as stable during starvation as total protein. It is thus concluded that in starving cells individual ribosomal proteins are not synthesized at equal rates. This indicates that the synthesis of ribosomal proteins is not only under the control of the rel gene
A class of dynamin-like GTPases involved in the generation of the tubular ER network
Hu, Junjie; Shibata, Yoko; Zhu, Peng-Peng; Voss, Christiane; Rismanchi, Neggy; Prinz, William A.; Rapoport, Tom A.; Blackstone, Craig
2009-01-01
The endoplasmic reticulum (ER) consists of tubules that are shaped by the reticulons and DP1/Yop1p, but how the tubules form an interconnected network is unknown. Here, we show that mammalian atlastins, which are dynamin-like, integral membrane GTPases, interact with the tubule-shaping proteins. The atlastins localize to the tubular ER and are required for proper network formation in vivo and in vitro. Depletion of the atlastins or overexpression of dominant-negative forms inhibits tubule interconnections. The Sey1p GTPase in S. cerevisiae is likely a functional ortholog of the atlastins; it shares the same signature motifs and membrane topology and interacts genetically and physically with the tubule-shaping proteins. Cells simultaneously lacking Sey1p and a tubule-shaping protein have ER morphology defects. These results indicate that formation of the tubular ER network depends on conserved dynamin-like GTPases. Since atlastin-1 mutations cause a common form of hereditary spastic paraplegia, we suggest ER shaping defects as a novel neuropathogenic mechanism. PMID:19665976
International Nuclear Information System (INIS)
Rybin, V.O.; Gureeva, A.A.
1986-01-01
The action of cholera toxin, capable of ADP-ribosylation of the activator N/sub s/ protein, and pertussis toxin, capable of ADP-ribosylation of the inhibitor N/sub i/ protein of the adenylate cyclase complex, on transducin, the GTP-binding protein of the rod outer segments of the retina, was investigated. It was shown that under the action of pertussis and cholera toxins, the GTPase activity of transducin is inhibited. Pertussin toxin inhibits the GTPase of native retinal rod outer segments by 30-40%, while GTPase of homogeneous transducin produces a 70-80% inhibition. The action of toxins on transducin depends on the presence and nature of the guanylic nucleotide with which incubation is performed. On the basis of the data obtained it is suggested that pertussis toxin interacts with pretransducin and with the transducin-GDP complex, while cholera toxin ADP-ribosylates the transducin-GTP complex and does not act on transducin lacking GTP
In Profile: Models of Ribosome Biogenesis Defects and Regulation of Protein Synthesis
Essers, P.B.M.
2013-01-01
Ribosomes are the mediators of protein synthesis in the cell and therefore crucial to proper cell function. In addition, ribosomes are highly abundant, with ribosomal RNA making up 80% of the RNA in the cell. A large amount of resources go into maintaining this pool of ribosomes, so ribosome
Kimura, J; Kimura, M
1987-09-05
The amino acid sequences of two ribosomal proteins, S14 and S16, from the archaebacterium Halobacterium marismortui have been determined. Sequence data were obtained by the manual and solid-phase sequencing of peptides derived from enzymatic digestions with trypsin, chymotrypsin, pepsin, and Staphylococcus aureus protease as well as by chemical cleavage with cyanogen bromide. Proteins S14 and S16 contain 109 and 126 amino acid residues and have Mr values of 11,964 and 13,515, respectively. Comparison of the sequences with those of ribosomal proteins from other organisms demonstrates that S14 has a significant homology with the rat liver ribosomal protein S11 (36% identity) as well as with the Escherichia coli ribosomal protein S17 (37%), and that S16 is related to the yeast ribosomal protein YS22 (40%) and proteins S8 from E. coli (28%) and Bacillus stearothermophilus (30%). A comparison of the amino acid residues in the homologous regions of halophilic and nonhalophilic ribosomal proteins reveals that halophilic proteins have more glutamic acids, asparatic acids, prolines, and alanines, and less lysines, arginines, and isoleucines than their nonhalophilic counterparts. These amino acid substitutions probably contribute to the structural stability of halophilic ribosomal proteins.
Davidson, Anthony C; Humphreys, Daniel; Brooks, Andrew B E; Hume, Peter J; Koronakis, Vassilis
2015-02-10
To establish intracellular infections, Salmonella bacteria trigger host cell membrane ruffling and invasion by subverting cellular Arf guanine nucleotide exchange factors (GEFs) that activate Arf1 and Arf6 GTPases by promoting GTP binding. A family of cellular Arf GTPase-activating proteins (GAPs) can downregulate Arf signaling by stimulating GTP hydrolysis, but whether they do this during infection is unknown. Here, we uncovered a remarkable role for distinct Arf GAP family members in Salmonella invasion. The Arf6 GAPs ACAP1 and ADAP1 and the Arf1 GAP ASAP1 localized at Salmonella-induced ruffles, which was not the case for the plasma membrane-localized Arf6 GAPs ARAP3 and GIT1 or the Golgi-associated Arf1 GAP1. Surprisingly, we found that loss of ACAP1, ADAP1, or ASAP1 impaired Salmonella invasion, revealing that GAPs cannot be considered mere terminators of cytoskeleton remodeling. Salmonella invasion was restored in Arf GAP-depleted cells by expressing fast-cycling Arf derivatives, demonstrating that Arf GTP/GDP cycles facilitate Salmonella invasion. Consistent with this view, both constitutively active and dominant-negative Arf derivatives that cannot undergo GTP/GDP cycles inhibited invasion. Furthermore, we demonstrated that Arf GEFs and GAPs colocalize at invading Salmonella and collaborate to drive Arf1-dependent pathogen invasion. This study revealed that Salmonella bacteria exploit a remarkable interplay between Arf GEFs and GAPs to direct cycles of Arf GTPase activation and inactivation. These cycles drive Salmonella cytoskeleton remodeling and enable intracellular infections. To initiate infections, the Salmonella bacterial pathogen remodels the mammalian actin cytoskeleton and invades host cells by subverting host Arf GEFs that activate Arf1 and Arf6 GTPases. Cellular Arf GAPs deactivate Arf GTPases and negatively regulate cell processes, but whether they target Arfs during infection is unknown. Here, we uncovered an important role for the Arf GAP
Hypoxic stress-induced changes in ribosomes of maize seedling roots
International Nuclear Information System (INIS)
Bailey-Serres, J.; Freeling, M.
1990-01-01
The hypoxic stress response of Zea mays L. seedling roots involves regulation of gene expression at transcriptional and posttranscriptional levels. We investigated the effect of hypoxia on the translational machinery of seedling roots. The levels of monoribosomes and ribosomal subunits increased dramatically within 1 hour of stress. Prolonged hypoxia resulted in continued accumulation of nontranslating ribosomes, as well as increased levels of small polyribosomes. The return of seedlings to normal aerobic conditions resulted in recovery of normal polyribosome levels. Comparison of ribosomal proteins from control and hypoxic roots revealed differences in quantity and electrophoretic mobility. In vivo labeling of roots with [ 35 S]methionine revealed variations in newly synthesized ribosomal proteins. In vivo labeling of roots with [ 32 P]orthophosphate revealed a major reduction in the phosphorylation of a 31 kilodalton ribosomal protein in hypoxic stressed roots. In vitro phosphorylation of ribosomal proteins by endogenous kinases was used to probe for differences in ribosome structure and composition. The patterns of in vitro kinased phosphoproteins of ribosomes from control and hypoxic roots were not identical. Variation in phosphoproteins of polyribosomes from control and hypoxic roots, as well as among polyribosomes from hypoxic roots were observed. These results indicate that modification of the translational machinery occurs in response to hypoxic stress
Ribosomes slide on lysine-encoding homopolymeric A stretches
Koutmou, Kristin S; Schuller, Anthony P; Brunelle, Julie L; Radhakrishnan, Aditya; Djuranovic, Sergej; Green, Rachel
2015-01-01
Protein output from synonymous codons is thought to be equivalent if appropriate tRNAs are sufficiently abundant. Here we show that mRNAs encoding iterated lysine codons, AAA or AAG, differentially impact protein synthesis: insertion of iterated AAA codons into an ORF diminishes protein expression more than insertion of synonymous AAG codons. Kinetic studies in E. coli reveal that differential protein production results from pausing on consecutive AAA-lysines followed by ribosome sliding on homopolymeric A sequence. Translation in a cell-free expression system demonstrates that diminished output from AAA-codon-containing reporters results from premature translation termination on out of frame stop codons following ribosome sliding. In eukaryotes, these premature termination events target the mRNAs for Nonsense-Mediated-Decay (NMD). The finding that ribosomes slide on homopolymeric A sequences explains bioinformatic analyses indicating that consecutive AAA codons are under-represented in gene-coding sequences. Ribosome ‘sliding’ represents an unexpected type of ribosome movement possible during translation. DOI: http://dx.doi.org/10.7554/eLife.05534.001 PMID:25695637
The Unexplored Mechanisms and Regulatory Functions of Ribosomal Translocation
Alejo, Jose Luis
In every cell, protein synthesis is carried out by the ribosome, a complex macromolecular RNA-protein assembly. Decades of structural and kinetic studies have increased our understanding of ribosome initiation, decoding, translocation and termination. Yet, the underlying mechanism of these fundamental processes has yet to be fully delineated. Hence, the molecular basis of regulation remains obscure. Here, single-molecule fluorescence methods are applied to decipher the mechanism and regulatory roles of the multi-step process of directional substrate translocation on the ribosome that accompanies every round of protein synthesis. In Chapter 1, single-molecule fluorescence resonance energy transfer (smFRET) is introduced as a tool for studying bacterial ribosome translocation. Chapter 2 details the experimental methods. In Chapter 3, the elongation factor G(EF-G)-catalyzed movement of substrates through the ribosome is examined from several perspectives or signals reporting on various degrees of freedom of ribosome dynamics. Two ribosomal states interconvert in the presence of EF-G(GDP), displaying novel head domain motions, until relocking takes place. In Chapter 4, in order to test if the mentioned fluctuations leading to relocking are correlated to the engagement of the P-site by the peptidyl-tRNA, the translocation of miscoded tRNAs is studied. Severe defects in the relocking stages of translocation reveal the correlation between this new stage of translocation and P-site tRNA engagement.
Insight into temperature dependence of GTPase activity in human guanylate binding protein-1.
Directory of Open Access Journals (Sweden)
Anjana Rani
Full Text Available Interferon-γ induced human guanylate binding protein-1(hGBP1 belongs to a family of dynamin related large GTPases. Unlike all other GTPases, hGBP1 hydrolyzes GTP to a mixture of GDP and GMP with GMP being the major product at 37°C but GDP became significant when the hydrolysis reaction was carried out at 15°C. The hydrolysis reaction in hGBP1 is believed to involve with a number of catalytic steps. To investigate the effect of temperature in the product formation and on the different catalytic complexes of hGBP1, we carried out temperature dependent GTPase assays, mutational analysis, chemical and thermal denaturation studies. The Arrhenius plot for both GDP and GMP interestingly showed nonlinear behaviour, suggesting that the product formation from the GTP-bound enzyme complex is associated with at least more than one step. The negative activation energy for GDP formation and GTPase assay with external GDP together indicate that GDP formation occurs through the reversible dissociation of GDP-bound enzyme dimer to monomer, which further reversibly dissociates to give the product. Denaturation studies of different catalytic complexes show that unlike other complexes the free energy of GDP-bound hGBP1 decreases significantly at lower temperature. GDP formation is found to be dependent on the free energy of the GDP-bound enzyme complex. The decrease in the free energy of this complex at low temperature compared to at high is the reason for higher GDP formation at low temperature. Thermal denaturation studies also suggest that the difference in the free energy of the GTP-bound enzyme dimer compared to its monomer plays a crucial role in the product formation; higher stability favours GMP but lower favours GDP. Thus, this study provides the first thermodynamic insight into the effect of temperature in the product formation of hGBP1.
Nayak, Ramesh C.; Keshava, Shiva; Esmon, Charles T.; Pendurthi, Usha R.; Rao, L. Vijaya Mohan
2013-01-01
Recent studies have established that factor VIIa (FVIIa) binds to the endothelial cell protein C receptor (EPCR). FVIIa binding to EPCR may promote the endocytosis of this receptor/ligand complex. Rab GTPases are known to play a crucial role in the endocytic and exocytic pathways of receptors or receptor/ligand complexes. The present study was undertaken to investigate the role of Rab GTPases in the intracellular trafficking of EPCR and FVIIa. CHO-EPCR cells and human umbilical vein endothelial cells (HUVEC) were transduced with recombinant adenoviral vectors to express wild-type, constitutively active, or dominant negative mutant of various Rab GTPases. Cells were exposed to FVIIa conjugated with AF488 fluorescent probe (AF488-FVIIa), and intracellular trafficking of FVIIa, EPCR, and Rab proteins was evaluated by immunofluorescence confocal microscopy. In cells expressing wild-type or constitutively active Rab4A, internalized AF488-FVIIa accumulated in early/sorting endosomes and its entry into the recycling endosomal compartment (REC) was inhibited. Expression of constitutively active Rab5A induced large endosomal structures beneath the plasma membrane where EPCR and FVIIa accumulated. Dominant negative Rab5A inhibited the endocytosis of EPCR-FVIIa. Expression of constitutively active Rab11 resulted in retention of accumulated AF488-FVIIa in the REC, whereas expression of a dominant negative form of Rab11 led to accumulation of internalized FVIIa in the cytoplasm and prevented entry of internalized FVIIa into the REC. Expression of dominant negative Rab11 also inhibited the transport of FVIIa across the endothelium. Overall our data show that Rab GTPases regulate the internalization and intracellular trafficking of EPCR-FVIIa. PMID:23555015
Unstable structure of ribosomal particles synthesized in. gamma. -irradiated Escherichia coli
Energy Technology Data Exchange (ETDEWEB)
Fujita, H; Morita, K [National Inst. of Radiological Sciences, Chiba (Japan)
1975-06-01
Stability of Escherichia coli ribosomes newly synthesized after ..gamma..-irradiation was compared with that of normal ribosomes. The ribosomal particles around 70-S synthesized in irradiated cells were more sensitive to digestion by pancreatic ribonuclease A. A larger number of the salt-unstable '50-S' precursor particles existed in the extract from irradiated cells than in the extract from unirradiated cells. These facts suggest that ribosomal particles, synthesized during an earlier stage in irradiated cells, maintain an incomplete structure even though they are not distinguishable from normal ribosomes by means of sucrose density-gradient centrifugation.
Label-Free Quantitation of Ribosomal Proteins from Bacillus subtilis for Antibiotic Research.
Schäkermann, Sina; Prochnow, Pascal; Bandow, Julia E
2017-01-01
Current research is focusing on ribosome heterogeneity as a response to changing environmental conditions and stresses, such as antibiotic stress. Altered stoichiometry and composition of ribosomal proteins as well as association of additional protein factors are mechanisms for shaping the protein expression profile or hibernating ribosomes. Here, we present a method for the isolation of ribosomes to analyze antibiotic-induced changes in the composition of ribosomes in Bacillus subtilis or other bacteria. Ribosomes and associated proteins are isolated by ultracentrifugation and proteins are identified and quantified using label-free mass spectrometry.
International Nuclear Information System (INIS)
Lott, Brittany Burton; Wang, Yongmei; Nakazato, Takuya
2013-01-01
Assembly of the ribosome from its protein and RNA constituents must occur quickly and efficiently in order to synthesize the proteins necessary for all cellular activity. Since the early 1960’s, certain characteristics of possible assembly pathways have been elucidated, yet the mechanisms that govern the precise recognition events remain unclear. We utilize a comparative analysis to investigate the amino acid composition of ribosomal proteins (r-proteins) with respect to their role in the assembly process. We compared small subunit (30S) r-protein sequences to those of other housekeeping proteins from 560 bacterial species and searched for correlations between r-protein amino acid content and factors such as assembly binding order, environmental growth temperature, protein size, and contact with ribosomal RNA (rRNA) in the 30S complex. We find r-proteins have a significantly high percent of positive residues, which are highly represented at rRNA contact sites. An inverse correlation between the percent of positive residues and r-protein size was identified and is mainly due to the content of Lysine residues, rather than Arginine. Nearly all r-proteins carry a net positive charge, but no statistical correlation between the net charge and the binding order was detected. Thermophilic (high-temperature) r-proteins contain increased Arginine, Isoleucine, and Tyrosine, and decreased Serine and Threonine compared to mesophilic (lower-temperature), reflecting a known distinction between thermophiles and mesophiles, possibly to account for protein thermostability. However, this difference in amino acid content does not extend to rRNA contact sites, as the proportions of thermophilic and mesophilic contact residues are not significantly different. Given the significantly higher level of positively charged residues in r-proteins and at contact sites, we conclude that ribosome assembly relies heavily on an electrostatic component of interaction. However, the binding order of
Tian, Xiaoxia; Yan, Huijuan; Li, Jiayi; Wu, Shuang; Wang, Junyu; Fan, Lifei
2017-01-13
Members of the well-known semaphorin family of proteins can induce both repulsive and attractive signaling in neural network formation and their cytoskeletal effects are mediated in part by small guanosine 5'-triphosphatase (GTPases). The aim of this study was to investigate the cellular role of Rif GTPase in the neurotrophin-induced neurite outgrowth. By using PC12 cells which are known to cease dividing and begin to show neurite outgrowth responding to nerve growth factor (NGF), we found that semaphorin 6A was as effective as nerve growth factor at stimulating neurite outgrowth in PC12 cells, and that its neurotrophic effect was transmitted through signaling by mitogen-activated protein kinases (MAPKs) and phosphatidylinositol-3-kinase (PI3K). We further found that neurotrophin-induced neurite formation in PC12 cells could be partially mediated by inhibition of Rif GTPase activity downstream of MAPKs and PI3K signaling. In conclusion, we newly identified Rif as a regulator of the cytoskeletal rearrangement mediated by semaphorins.
Architecture of the large subunit of the mammalian mitochondrial ribosome.
Greber, Basil J; Boehringer, Daniel; Leitner, Alexander; Bieri, Philipp; Voigts-Hoffmann, Felix; Erzberger, Jan P; Leibundgut, Marc; Aebersold, Ruedi; Ban, Nenad
2014-01-23
Mitochondrial ribosomes synthesize a number of highly hydrophobic proteins encoded on the genome of mitochondria, the organelles in eukaryotic cells that are responsible for energy conversion by oxidative phosphorylation. The ribosomes in mammalian mitochondria have undergone massive structural changes throughout their evolution, including ribosomal RNA shortening and acquisition of mitochondria-specific ribosomal proteins. Here we present the three-dimensional structure of the 39S large subunit of the porcine mitochondrial ribosome determined by cryo-electron microscopy at 4.9 Å resolution. The structure, combined with data from chemical crosslinking and mass spectrometry experiments, reveals the unique features of the 39S subunit at near-atomic resolution and provides detailed insight into the architecture of the polypeptide exit site. This region of the mitochondrial ribosome has been considerably remodelled compared to its bacterial counterpart, providing a specialized platform for the synthesis and membrane insertion of the highly hydrophobic protein components of the respiratory chain.
Rudack, Till; Jenrich, Sarah; Brucker, Sven; Vetter, Ingrid R.; Gerwert, Klaus; Kötting, Carsten
2015-01-01
Small GTPases regulate key processes in cells. Malfunction of their GTPase reaction by mutations is involved in severe diseases. Here, we compare the GTPase reaction of the slower hydrolyzing GTPase Ran with Ras. By combination of time-resolved FTIR difference spectroscopy and QM/MM simulations we elucidate that the Mg2+ coordination by the phosphate groups, which varies largely among the x-ray structures, is the same for Ran and Ras. A new x-ray structure of a Ran·RanBD1 complex with improved resolution confirmed this finding and revealed a general problem with the refinement of Mg2+ in GTPases. The Mg2+ coordination is not responsible for the much slower GTPase reaction of Ran. Instead, the location of the Tyr-39 side chain of Ran between the γ-phosphate and Gln-69 prevents the optimal positioning of the attacking water molecule by the Gln-69 relative to the γ-phosphate. This is confirmed in the RanY39A·RanBD1 crystal structure. The QM/MM simulations provide IR spectra of the catalytic center, which agree very nicely with the experimental ones. The combination of both methods can correlate spectra with structure at atomic detail. For example the FTIR difference spectra of RasA18T and RanT25A mutants show that spectral differences are mainly due to the hydrogen bond of Thr-25 to the α-phosphate in Ran. By integration of x-ray structure analysis, experimental, and theoretical IR spectroscopy the catalytic center of the x-ray structural models are further refined to sub-Å resolution, allowing an improved understanding of catalysis. PMID:26272610
Biedka, Stephanie; Micic, Jelena; Wilson, Daniel; Brown, Hailey; Diorio-Toth, Luke; Woolford, John L
2018-04-24
Ribosome biogenesis involves numerous preribosomal RNA (pre-rRNA) processing events to remove internal and external transcribed spacer sequences, ultimately yielding three mature rRNAs. Removal of the internal transcribed spacer 2 spacer RNA is the final step in large subunit pre-rRNA processing and begins with endonucleolytic cleavage at the C 2 site of 27SB pre-rRNA. C 2 cleavage requires the hierarchical recruitment of 11 ribosomal proteins and 14 ribosome assembly factors. However, the function of these proteins in C 2 cleavage remained unclear. In this study, we have performed a detailed analysis of the effects of depleting proteins required for C 2 cleavage and interpreted these results using cryo-electron microscopy structures of assembling 60S subunits. This work revealed that these proteins are required for remodeling of several neighborhoods, including two major functional centers of the 60S subunit, suggesting that these remodeling events form a checkpoint leading to C 2 cleavage. Interestingly, when C 2 cleavage is directly blocked by depleting or inactivating the C 2 endonuclease, assembly progresses through all other subsequent steps. © 2018 Biedka et al.
gamma. radiation effect on the functional properties of the cotton ribosomes
Energy Technology Data Exchange (ETDEWEB)
Ibragimov, A P; Safarov, Sh
1973-01-01
A study is made of the action of radiation on the functional properties of ribosomes in irradiated organisms and on isolated ribosomes exposed to different doses. With increase in dose there occurs a reduction in the incorporation of labelled amino acids by the ribosomes released from irradiated sprouts and also during irradiation of isolated ribosomes. The study covered the functional activity of ribosomes irradiated at different doses with the use of synthetic poly-U and poly-A matrices synthesizing polyphenylalanine and polylysine, depending on the irradiation dose. The inhibition of the activity of the protein synthesis system at high doses is due to structural and functional changes in ribosomes and also to disturbance in the biosynthesis and functions of the messenger RNA.
Interaction of tRNA with Eukaryotic Ribosome
Directory of Open Access Journals (Sweden)
Dmitri Graifer
2015-03-01
Full Text Available This paper is a review of currently available data concerning interactions of tRNAs with the eukaryotic ribosome at various stages of translation. These data include the results obtained by means of cryo-electron microscopy and X-ray crystallography applied to various model ribosomal complexes, site-directed cross-linking with the use of tRNA derivatives bearing chemically or photochemically reactive groups in the CCA-terminal fragment and chemical probing of 28S rRNA in the region of the peptidyl transferase center. Similarities and differences in the interactions of tRNAs with prokaryotic and eukaryotic ribosomes are discussed with concomitant consideration of the extent of resemblance between molecular mechanisms of translation in eukaryotes and bacteria.
Macrolide antibiotic interaction and resistance on the bacterial ribosome.
Poehlsgaard, Jacob; Douthwaite, Stephen
2003-02-01
Our understanding of the fine structure of many antibiotic target sites has reached a new level of enlightenment in the last couple of years due to the advent, by X-ray crystallography, of high-resolution structures of the bacterial ribosome. Many classes of clinically useful antibiotics bind to the ribosome to inhibit bacterial protein synthesis. Macrolide, lincosamide and streptogramin B (MLSB) antibiotics form one of the largest groups, and bind to the same site on the 50S ribosomal subunit. Here, we review the molecular details of the ribosomal MLSB site to put into perspective the main points from a wealth of biochemical and genetic data that have been collected over several decades. The information is now available to understand, at atomic resolution, how macrolide antibiotics interact with their ribosomal target, how the target is altered to confer resistance, and in which directions we need to look if we are to rationally design better drugs to overcome the extant resistance mechanisms.
Cis-regulatory RNA elements that regulate specialized ribosome activity.
Xue, Shifeng; Barna, Maria
2015-01-01
Recent evidence has shown that the ribosome itself can play a highly regulatory role in the specialized translation of specific subpools of mRNAs, in particular at the level of ribosomal proteins (RP). However, the mechanism(s) by which this selection takes place has remained poorly understood. In our recent study, we discovered a combination of unique RNA elements in the 5'UTRs of mRNAs that allows for such control by the ribosome. These mRNAs contain a Translation Inhibitory Element (TIE) that inhibits general cap-dependent translation, and an Internal Ribosome Entry Site (IRES) that relies on a specific RP for activation. The unique combination of an inhibitor of general translation and an activator of specialized translation is key to ribosome-mediated control of gene expression. Here we discuss how these RNA regulatory elements provide a new level of control to protein expression and their implications for gene expression, organismal development and evolution.
Nucleophosmin1 is a negative regulator of the small GTPase Rac1
Zoughlami, Younes; van Stalborgh, Anne M.; van Hennik, Paula B.; Hordijk, Peter L.
2013-01-01
The Rac1 GTPase is a critical regulator of cytoskeletal dynamics and controls many biological processes, such as cell migration, cell-cell contacts, cellular growth and cell division. These complex processes are controlled by Rac1 signaling through effector proteins. We have previously identified
International Nuclear Information System (INIS)
Otaka, E.; Kobata, K.
1978-01-01
The cytoplasmic 80s ribosomal proteins from the cells of yeast Saccharomyces cerevisiae were analyzed by SDS two-dimensional polyacrylamide gel electrophoresis. Seventyfour proteins were identified and consecutively numbered from 1 to 74. Upon oxidation of the 80s proteins with performic acid, ten proteins (no. 15, 20, 35, 40, 44, 46, 49, 51, 54 and 55) were dislocated on the gel without change of the total number of protein spots. Five proteins (no. 8, 14, 16, 36 and 74) were phosphorylated in vivo as seen in 32 P-labelling experiments. The large and small subunits separated in low magnesium medium were analyzed by the above gel electrophoresis. At least forty-five and twenty-eight proteins were assumed to be in the large and small subunits, respectively. All proteins found in the 80s ribosomes, except for no. 3, were detected in either subunit without appearance of new spots. The acidic protein no. 3 seems to be lost during subunit dissociation. (orig.) [de
Directory of Open Access Journals (Sweden)
Olivier De Wever
2013-05-01
Full Text Available The Rab27 family of small GTPases regulates exocytosis of distinct vesicle types including multivesicular endosomes, which results in the release of exosomes. Exosomes are nanometer-sized membrane vesicles that enclose soluble factors such as proteins and nucleic acids within a lipid bilayer and can travel toward distant tissues to influence multiple aspects of cell behavior. In our view that tumors are endocrine organs producing exosomes, Rab27 GTPases and their effector proteins are critical determinants for invasive growth and metastasis. Rab27 proteins and their effectors may serve as prognostic biomarkers or as targets for patient-tailored therapy.
Rho GTPase activity modulates paramyxovirus fusion protein-mediated cell-cell fusion
International Nuclear Information System (INIS)
Schowalter, Rachel M.; Wurth, Mark A.; Aguilar, Hector C.; Lee, Benhur; Moncman, Carole L.; McCann, Richard O.; Dutch, Rebecca Ellis
2006-01-01
The paramyxovirus fusion protein (F) promotes fusion of the viral envelope with the plasma membrane of target cells as well as cell-cell fusion. The plasma membrane is closely associated with the actin cytoskeleton, but the role of actin dynamics in paramyxovirus F-mediated membrane fusion is unclear. We examined cell-cell fusion promoted by two different paramyxovirus F proteins in three cell types in the presence of constitutively active Rho family GTPases, major cellular coordinators of actin dynamics. Reporter gene and syncytia assays demonstrated that expression of either Rac1 V12 or Cdc42 V12 could increase cell-cell fusion promoted by the Hendra or SV5 glycoproteins, though the effect was dependent on the cell type expressing the viral glycoproteins. In contrast, RhoA L63 decreased cell-cell fusion promoted by Hendra glycoproteins but had little affect on SV5 F-mediated fusion. Also, data suggested that GTPase activation in the viral glycoprotein-containing cell was primarily responsible for changes in fusion. Additionally, we found that activated Cdc42 promoted nuclear rearrangement in syncytia
Tiryaki, Volkan Mujdat; Ayres, Virginia M; Khan, Adeel A; Ahmed, Ijaz; Shreiber, David I; Meiners, Sally
2012-01-01
Cerebral cortical astrocyte responses to polyamide nanofibrillar scaffolds versus poly-L-lysine (PLL)-functionalized planar glass, unfunctionalized planar Aclar coverslips, and PLL-functionalized planar Aclar surfaces were investigated by atomic force microscopy and immunocytochemistry. The physical properties of the cell culture environments were evaluated using contact angle and surface roughness measurements and compared. Astrocyte morphological responses, including filopodia, lamellipodia, and stress fiber formation, and stellation were imaged using atomic force microscopy and phalloidin staining for F-actin. Activation of the corresponding Rho GTPase regulators was investigated using immunolabeling with Cdc42, Rac1, and RhoA. Astrocytes cultured on the nanofibrillar scaffolds showed a unique response that included stellation, cell–cell interactions by stellate processes, and evidence of depression of RhoA. The results support the hypothesis that the extracellular environment can trigger preferential activation of members of the Rho GTPase family, with demonstrable morphological consequences for cerebral cortical astrocytes. PMID:22915841
Trapping the ribosome to control gene expression.
Boehringer, Daniel; Ban, Nenad
2007-09-21
Protein synthesis is often regulated by structured mRNAs that interact with ribosomes. In this issue of Cell, Marzi et al. (2007) provide insights into the autoregulation of protein S15 by visualizing the folded repressor mRNA on the ribosome stalled in the preinitiation state. These results have implications for our understanding of the mechanism of translation initiation in general.
Rudack, Till; Jenrich, Sarah; Brucker, Sven; Vetter, Ingrid R; Gerwert, Klaus; Kötting, Carsten
2015-10-02
Small GTPases regulate key processes in cells. Malfunction of their GTPase reaction by mutations is involved in severe diseases. Here, we compare the GTPase reaction of the slower hydrolyzing GTPase Ran with Ras. By combination of time-resolved FTIR difference spectroscopy and QM/MM simulations we elucidate that the Mg(2+) coordination by the phosphate groups, which varies largely among the x-ray structures, is the same for Ran and Ras. A new x-ray structure of a Ran·RanBD1 complex with improved resolution confirmed this finding and revealed a general problem with the refinement of Mg(2+) in GTPases. The Mg(2+) coordination is not responsible for the much slower GTPase reaction of Ran. Instead, the location of the Tyr-39 side chain of Ran between the γ-phosphate and Gln-69 prevents the optimal positioning of the attacking water molecule by the Gln-69 relative to the γ-phosphate. This is confirmed in the RanY39A·RanBD1 crystal structure. The QM/MM simulations provide IR spectra of the catalytic center, which agree very nicely with the experimental ones. The combination of both methods can correlate spectra with structure at atomic detail. For example the FTIR difference spectra of RasA18T and RanT25A mutants show that spectral differences are mainly due to the hydrogen bond of Thr-25 to the α-phosphate in Ran. By integration of x-ray structure analysis, experimental, and theoretical IR spectroscopy the catalytic center of the x-ray structural models are further refined to sub-Å resolution, allowing an improved understanding of catalysis. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.
Netterling, Sakura; Vaitkevicius, Karolis; Nord, Stefan; Johansson, Jörgen
2012-08-01
Listeria monocytogenes, a Gram-positive food-borne human pathogen, is able to grow at temperatures close to 0°C and is thus of great concern for the food industry. In this work, we investigated the physiological role of one DExD-box RNA helicase in Listeria monocytogenes. The RNA helicase Lmo1722 was required for optimal growth at low temperatures, whereas it was dispensable at 37°C. A Δlmo1722 strain was less motile due to downregulation of the major subunit of the flagellum, FlaA, caused by decreased flaA expression. By ribosomal fractionation experiments, it was observed that Lmo1722 was mainly associated with the 50S subunit of the ribosome. Absence of Lmo1722 decreased the fraction of 50S ribosomal subunits and mature 70S ribosomes and affected the processing of the 23S precursor rRNA. The ribosomal profile could be restored to wild-type levels in a Δlmo1722 strain expressing Lmo1722. Interestingly, the C-terminal part of Lmo1722 was redundant for low-temperature growth, motility, 23S rRNA processing, and appropriate ribosomal maturation. However, Lmo1722 lacking the C terminus showed a reduced affinity for the 50S and 70S fractions, suggesting that the C terminus is important for proper guidance of Lmo1722 to the 50S subunit. Taken together, our results show that the Listeria RNA helicase Lmo1722 is essential for growth at low temperatures, motility, and rRNA processing and is important for ribosomal maturation, being associated mainly with the 50S subunit of the ribosome.
International Nuclear Information System (INIS)
Gorelic, L.; Parker, D.
1978-01-01
The effects of 254-nm radiation on the structural integrities of free and 50S ribosome-bound 5S and 23S ribosomal ribonucleic acids (rRNA) have been elucidated. Irradiation of aqueous solutions of Escherichia coli 50S ribosomes with 253.7-nm radiation results in the formation of single-strand breaks in double-stranded regions of the 23S rRNA component, but not in rRNA chain scission, and destabilization of the secondary structure of the 23S rRNA toward denaturation. The minimum doses of 253.7-nm radiation required for the first detection of the two effects are 7 x 10 19 quanta for the production of single-strand breaks in double-stranded regions of the 23S rRNA, and 19 quanta for destabilization of the 23S rRNA secondary structure. Free 23S rRNA is resistant toward photoinduced chain breakage at doses of 253.7-nm radiation up to at least 2.3 x 10 20 and is much less sensitive toward destabilization of secondary structure than ribosome-bound 23S rRNA. In contrast to the photosensitivity of 50S ribosome-bound 23S rRNA toward chain breakage, 50S ribosome-bound 5S rRNA is resistant toward chain breakage at doses of 253.7-nm radiation up to at least 2.3 x 10 20 quanta. Ribosome-bound 5S and 23S rRNA are also not photosensitive toward intermolecular 5S/23S rRNA cross-linkage
cDNA, genomic sequence cloning and analysis of the ribosomal ...
African Journals Online (AJOL)
Ribosomal protein L37A (RPL37A) is a component of 60S large ribosomal subunit encoded by the RPL37A gene, which belongs to the family of ribosomal L37AE proteins, located in the cytoplasm. The complementary deoxyribonucleic acid (cDNA) and the genomic sequence of RPL37A were cloned successfully from giant ...
Directory of Open Access Journals (Sweden)
Upasana Mehra
2017-06-01
Full Text Available Protein expression in mitochondria is carried out by ribosomes that are distinct from their cytosolic counterpart. Mitochondrial ribosomes are made of individual proteins having distinct lineages: those with clear bacterial orthologues, those conserved in eukaryotes only and proteins that are species specific. MTG2 is the mitochondrial member of the universally conserved Obg family of GTPases in Saccharomyces cerevisiae which associates with and regulates mitochondrial large ribosomal subunit assembly. In this study we demonstrate that MTG2, in addition to the universally conserved OBG and GTPase domains, has an essential yeast specific insertion domain positioned within the N terminal OBG fold. Cells expressing mtg2∆201-294, deleted for the insertion domain are not able to support cellular respiration. In addition, we show that large stretches of amino acids can be inserted into MTG2 at the end of the yeast specific insertion domain and the OBG fold without perturbing its cellular functions, consistent with the insertion domain folding into a species specific protein binding platform.
Control of ribosome traffic by position-dependent choice of synonymous codons
DEFF Research Database (Denmark)
Mitarai, Namiko; Pedersen, Steen
2013-01-01
Messenger RNA (mRNA) encodes a sequence of amino acids by using codons. For most amino acids, there are multiple synonymous codons that can encode the amino acid. The translation speed can vary from one codon to another, thus there is room for changing the ribosome speed while keeping the amino...... acid sequence and hence the resulting protein. Recently, it has been noticed that the choice of the synonymous codon, via the resulting distribution of slow- and fast-translated codons, affects not only on the average speed of one ribosome translating the mRNA but also might have an effect on nearby...... ribosomes by affecting the appearance of 'traffic jams' where multiple ribosomes collide and form queues. To test this 'context effect' further, we here investigate the effect of the sequence of synonymous codons on the ribosome traffic by using a ribosome traffic model with codon-dependent rates, estimated...
Fedyukina, Daria V.; Jennaro, Theodore S.; Cavagnero, Silvia
2014-01-01
Ribosomes are large and highly charged macromolecular complexes consisting of RNA and proteins. Here, we address the electrostatic and nonpolar properties of ribosomal proteins that are important for ribosome assembly and interaction with other cellular components and may influence protein folding on the ribosome. We examined 50 S ribosomal subunits from 10 species and found a clear distinction between the net charge of ribosomal proteins from halophilic and non-halophilic organisms. We found that ∼67% ribosomal proteins from halophiles are negatively charged, whereas only up to ∼15% of ribosomal proteins from non-halophiles share this property. Conversely, hydrophobicity tends to be lower for ribosomal proteins from halophiles than for the corresponding proteins from non-halophiles. Importantly, the surface electrostatic potential of ribosomal proteins from all organisms, especially halophiles, has distinct positive and negative regions across all the examined species. Positively and negatively charged residues of ribosomal proteins tend to be clustered in buried and solvent-exposed regions, respectively. Hence, the majority of ribosomal proteins is characterized by a significant degree of intramolecular charge segregation, regardless of the organism of origin. This key property enables the ribosome to accommodate proteins within its complex scaffold regardless of their overall net charge. PMID:24398678
Ribosomal trafficking is reduced in Schwann cells following induction of myelination
Directory of Open Access Journals (Sweden)
James M. Love
2015-08-01
Full Text Available Local synthesis of proteins within the Schwann cell periphery is extremely important for efficient process extension and myelination, when cells undergo dramatic changes in polarity and geometry. Still, it is unclear how ribosomal distributions are developed and maintained within Schwann cell projections to sustain local translation. In this multi-disciplinary study, we expressed a plasmid encoding a fluorescently labeled ribosomal subunit (L4-GFP in cultured primary rat Schwann cells. This enabled the generation of high-resolution, quantitative data on ribosomal distributions and trafficking dynamics within Schwann cells during early stages of myelination, induced by ascorbic acid treatment. Ribosomes were distributed throughout Schwann cell projections, with ~2-3 bright clusters along each projection. Clusters emerged within 1 day of culture and were maintained throughout early stages of myelination. Three days after induction of myelination, net ribosomal movement remained anterograde (directed away from the Schwann cell body, but ribosomal velocity decreased to about half the levels of the untreated group. Statistical and modeling analysis provided additional insight into key factors underlying ribosomal trafficking. Multiple regression analysis indicated that net transport at early time points was dependent on anterograde velocity, but shifted to dependence on anterograde duration at later time points. A simple, data-driven rate kinetics model suggested that the observed decrease in net ribosomal movement was primarily dictated by an increased conversion of anterograde particles to stationary particles, rather than changes in other directional parameters. These results reveal the strength of a combined experimental and theoretical approach in examining protein localization and transport, and provide evidence of an early establishment of ribosomal populations within Schwann cell projections with a reduction in trafficking following
The Ins and Outs of Small GTPase Rac1 in the Vasculature
Marinković, Goran; Heemskerk, Niels; van Buul, Jaap D.; de Waard, Vivian
2015-01-01
The Rho family of small GTPases forms a 20-member family within the Ras superfamily of GTP-dependent enzymes that are activated by a variety of extracellular signals. The most well known Rho family members are RhoA (Ras homolog gene family, member A), Cdc42 (cell division control protein 42), and
Expanding the ribosomal universe.
Dinman, Jonathan D; Kinzy, Terri Goss
2009-12-09
In this issue of Structure, Taylor et al. (2009) present the most complete model of an eukaryotic ribosome to date. This achievement represents a critical milestone along the path to structurally defining the unique aspects of the eukaryotic protein synthetic machinery.
Interaction between the p21ras GTPase activating protein and the insulin receptor
Pronk, G.J.; Medema, R.H.; Burgering, B.M.T.; Clark, R.; McCormick, F.; Bos, J.L.
1992-01-01
We investigated the involvement of the p21ras-GTPase activating protein (GAP) in insulin-induced signal transduction. In cells overexpressing the insulin receptor, we did not observe association between GAP and the insulin receptor after insulin treatment nor the phosphorylation of GAP on tyrosine
The Complete Structure of the Mycobacterium smegmatis 70S Ribosome
Directory of Open Access Journals (Sweden)
Jendrik Hentschel
2017-07-01
Full Text Available The ribosome carries out the synthesis of proteins in every living cell. It consequently represents a frontline target in anti-microbial therapy. Tuberculosis ranks among the leading causes of death worldwide, due in large part to the combination of difficult-to-treat latency and antibiotic resistance. Here, we present the 3.3-Å cryo-EM structure of the 70S ribosome of Mycobacterium smegmatis, a close relative to the human pathogen Mycobacterium tuberculosis. The structure reveals two additional ribosomal proteins and localizes them to the vicinity of drug-target sites in both the catalytic center and the decoding site of the ribosome. Furthermore, we visualized actinobacterium-specific rRNA and protein expansions that extensively remodel the ribosomal surface with implications for polysome organization. Our results provide a foundation for understanding the idiosyncrasies of mycobacterial translation and reveal atomic details of the structure that will facilitate the design of anti-tubercular therapeutics.
The Complete Structure of the Mycobacterium smegmatis 70S Ribosome.
Hentschel, Jendrik; Burnside, Chloe; Mignot, Ingrid; Leibundgut, Marc; Boehringer, Daniel; Ban, Nenad
2017-07-05
The ribosome carries out the synthesis of proteins in every living cell. It consequently represents a frontline target in anti-microbial therapy. Tuberculosis ranks among the leading causes of death worldwide, due in large part to the combination of difficult-to-treat latency and antibiotic resistance. Here, we present the 3.3-Å cryo-EM structure of the 70S ribosome of Mycobacterium smegmatis, a close relative to the human pathogen Mycobacterium tuberculosis. The structure reveals two additional ribosomal proteins and localizes them to the vicinity of drug-target sites in both the catalytic center and the decoding site of the ribosome. Furthermore, we visualized actinobacterium-specific rRNA and protein expansions that extensively remodel the ribosomal surface with implications for polysome organization. Our results provide a foundation for understanding the idiosyncrasies of mycobacterial translation and reveal atomic details of the structure that will facilitate the design of anti-tubercular therapeutics. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.
Control of ribosome traffic by position-dependent choice of synonymous codons
International Nuclear Information System (INIS)
Mitarai, Namiko; Pedersen, Steen
2013-01-01
Messenger RNA (mRNA) encodes a sequence of amino acids by using codons. For most amino acids, there are multiple synonymous codons that can encode the amino acid. The translation speed can vary from one codon to another, thus there is room for changing the ribosome speed while keeping the amino acid sequence and hence the resulting protein. Recently, it has been noticed that the choice of the synonymous codon, via the resulting distribution of slow- and fast-translated codons, affects not only on the average speed of one ribosome translating the mRNA but also might have an effect on nearby ribosomes by affecting the appearance of ‘traffic jams’ where multiple ribosomes collide and form queues. To test this ‘context effect’ further, we here investigate the effect of the sequence of synonymous codons on the ribosome traffic by using a ribosome traffic model with codon-dependent rates, estimated from experiments. We compare the ribosome traffic on wild-type (WT) sequences and sequences where the synonymous codons were swapped randomly. By simulating translation of 87 genes, we demonstrate that the WT sequences, especially those with a high bias in codon usage, tend to have the ability to reduce ribosome collisions, hence optimizing the cellular investment in the translation apparatus. The magnitude of such reduction of the translation time might have a significant impact on the cellular growth rate and thereby have importance for the survival of the species. (paper)
International Nuclear Information System (INIS)
Hernandez Torres, Jorge; Maldonado, Monica Alexandra Arias; Chomilier, Jacques
2007-01-01
The evolutionary origin of some nuclear encoded proteins that translocate proteins across the chloroplast envelope remains unknown. Therefore, sequences of GTPase proteins constituting the Arabidopsis thaliana translocon at the outer membrane of chloroplast (atToc) complexes were analyzed by means of HCA. In particular, atToc159 and related proteins (atToc132, atToc120, and atToc90) do not have proven homologues of prokaryotic or eukaryotic ancestry. We established that the three domains commonly referred to as A, G, and M originate from the GTPase G domain, tandemly repeated, and probably evolving toward an unstructured conformation in the case of the A domain. It resulted from this study a putative common ancestor for these proteins and a new domain definition, in particular the splitting of A into three domains (A1, A2, and A3), has been proposed. The family of Toc159, previously containing A. thaliana and Pisum sativum, has been extended to Medicago truncatula and Populus trichocarpa and it has been revised for Oryza sativa. They have also been compared to GTPase subunits involved in the cpSRP system. A distant homology has been revealed among Toc and cpSRP GTP-hydrolyzing proteins of A. thaliana, and repetitions of a GTPase domain were also found in cpSRP protein receptors, by means of HCA analysis
Using the Ribodeblur pipeline to recover A-sites from yeast ribosome profiling data.
Wang, Hao; Kingsford, Carl; McManus, C Joel
2018-03-15
Ribosome profiling has emerged as a powerful technique to study mRNA translation. Ribosome profiling has the potential to determine the relative quantities and locations of ribosomes on mRNA genome wide. Taking full advantage of this approach requires accurate measurement of ribosome locations. However, experimental inconsistencies often obscure the positional information encoded in ribosome profiling data. Here, we describe the Ribodeblur pipeline, a computational analysis tool that uses a maximum likelihood framework to infer ribosome positions from heterogeneous datasets. Ribodeblur is simple to install, and can be run on an average modern Mac or Linux-based laptop. We detail the process of applying the pipeline to high-coverage ribosome profiling data in yeast, and discuss important considerations for potential extension to other organisms. Copyright © 2018 Elsevier Inc. All rights reserved.
Expression of ribosomal genes in pea cotyledons at the initial stages of germination
International Nuclear Information System (INIS)
Gumilevskaya, N.A.; Chumikhina, L.V.; Akhmatova, A.T.; Kretovich, V.L.
1986-01-01
The time of appearance of newly synthesized rRNAs and ribosomal proteins (r-proteins) in the ribosomes of pea cotyledons (Pisum sativum L.) during germination was investigated. The ribosomal fraction was isolated and analyzed according to the method of germination of the embryo in the presence of labeled precursors or after pulse labeling of the embryos at different stages of germination. For the identification of newly synthesized rRNAs in the ribosomes we estimated the relative stability of labeled RNAs to the action of RNase, the sedimentation rate, the ability to be methylated in vivo in the presence of [ 14 C]CH 3 -methionine, and the localization in the subunits of dissociated ribosomes. The presence of newly synthesized r-proteins in the ribosomes was judged on the basis of the electrophoretic similarity in SDS-disc electrophoresis of labeled polypeptides of purified ribosome preparations and of genuine r-proteins, as well as according to the localization of labeled proteins in the subunits of the dissociated ribosomes. It was shown that the expression of the ribosomal genes in highly specialized cells of pea cotyledons that have completed their growth occurs at very early stages of germination
Could a Proto-Ribosome Emerge Spontaneously in the Prebiotic World?
Directory of Open Access Journals (Sweden)
Ilana C. Agmon
2016-12-01
Full Text Available An indispensable prerequisite for establishing a scenario of life emerging by natural processes is the requirement that the first simple proto-molecules could have had a realistic probability of self-assembly from random molecular polymers in the prebiotic world. The vestige of the proto-ribosome, which is believed to be still embedded in the contemporary ribosome, is used to assess the feasibility of such spontaneous emergence. Three concentric structural elements of different magnitudes, having a dimeric nature derived from the symmetrical region of the ribosomal large subunit, were suggested to constitute the vestige of the proto-ribosome. It is assumed to have materialized spontaneously in the prebiotic world, catalyzing non-coded peptide bond formation and simple elongation. Probabilistic and energetic considerations are applied in order to evaluate the suitability of the three contenders for being the initial proto-ribosome. The analysis points to the simplest proto-ribosome, comprised of a dimer of tRNA-like molecules presently embedded in the core of the symmetrical region, as the only one having a realistic statistical likelihood of spontaneous emergence from random RNA chains. Hence it offers a feasible starting point for a continuous evolutionary path from the prebiotic matter, through natural processes, into the intricate modern translation system.
Phosphorylation of ribosomal proteins induced by auxins in maize embryonic tissues
International Nuclear Information System (INIS)
Perez, L.; Aguilar, R.; Mendez, A.P.; de Jimenez, E.S.
1990-01-01
The effect of auxin on ribosomal protein phosphorylation of germinating maize (Zea mays) tissues was investigated. Two-dimensional gel electrophoresis and autoradiography of [ 32 P] ribosomal protein patterns for natural and synthetic auxin-treated tissues were performed. Both the rate of 32 P incorporation and the electrophoretic patterns were dependent on 32 P pulse length, suggesting that active protein phosphorylation-dephosphorylation occurred in small and large subunit proteins, in control as well as in auxin-treated tissues. The effect of ribosomal protein phosphorylation on in vitro translation was tested. Measurements of poly(U) translation rates as a function of ribosome concentration provided apparent K m values significantly different for auxin-treated and nontreated tissues. These findings suggest that auxin might exert some kind of translational control by regulating the phosphorylated status of ribosomal proteins
Comprehensive functional analysis of Rab GTPases in Drosophila nephrocytes.
Fu, Yulong; Zhu, Jun-Yi; Zhang, Fujian; Richman, Adam; Zhao, Zhanzheng; Han, Zhe
2017-06-01
The Drosophila nephrocyte is a critical component of the fly renal system and bears structural and functional homology to podocytes and proximal tubule cells of the mammalian kidney. Investigations of nephrocyte cell biological processes are fundamental to understanding the insect renal system. Nephrocytes are highly active in endocytosis and vesicle trafficking. Rab GTPases regulate endocytosis and trafficking but specific functions of nephrocyte Rabs remain undefined. We analyzed Rab GTPase expression and function in Drosophila nephrocytes and found that 11 out of 27 Drosophila Rabs were required for normal activity. Rabs 1, 5, 7, 11 and 35 were most important. Gene silencing of the nephrocyte-specific Rab5 eliminated all intracellular vesicles and the specialized plasma membrane structures essential for nephrocyte function. Rab7 silencing dramatically increased clear vacuoles and reduced lysosomes. Rab11 silencing increased lysosomes and reduced clear vacuoles. Our results suggest that Rab5 mediates endocytosis that is essential for the maintenance of functionally critical nephrocyte plasma membrane structures and that Rabs 7 and 11 mediate alternative downstream vesicle trafficking pathways leading to protein degradation and membrane recycling, respectively. Elucidating molecular pathways underlying nephrocyte function has the potential to yield important insights into human kidney cell physiology and mechanisms of cell injury that lead to disease. The Drosophila nephrocyte is emerging as a useful in vivo model system for molecular target identification and initial testing of therapeutic approaches in humans.
Regulation of cerebral cortex development by Rho GTPases: insights from in vivo studies
Directory of Open Access Journals (Sweden)
Roberta eAzzarelli
2015-01-01
Full Text Available The cerebral cortex is the site of higher human cognitive and motor functions. Histologically, it is organized into six horizontal layers, each containing unique populations of molecularly and functionally distinct excitatory projection neurons and inhibitory interneurons. The stereotyped cellular distribution of cortical neurons is crucial for the formation of functional neural circuits and it is predominantly established during embryonic development. Cortical neuron development is a multiphasic process characterized by sequential steps of neural progenitor proliferation, cell cycle exit, neuroblast migration and neuronal differentiation. This series of events requires an extensive and dynamic remodeling of the cell cytoskeleton at each step of the process. As major regulators of the cytoskeleton, the family of small Rho GTPases has been shown to play essential functions in cerebral cortex development. Here we review in vivo findings that support the contribution of Rho GTPases to cortical projection neuron development and we address their involvement in the etiology of cerebral cortex malformations.
The 'invisible hand': regulation of RHO GTPases by RHOGDIs.
Garcia-Mata, Rafael; Boulter, Etienne; Burridge, Keith
2011-07-22
The 'invisible hand' is a term originally coined by Adam Smith in The Theory of Moral Sentiments to describe the forces of self-interest, competition and supply and demand that regulate the resources in society. This metaphor continues to be used by economists to describe the self-regulating nature of a market economy. The same metaphor can be used to describe the RHO-specific guanine nucleotide dissociation inhibitor (RHOGDI) family, which operates in the background, as an invisible hand, using similar forces to regulate the RHO GTPase cycle.
The invisible hand: regulation of RHO GTPases by RHOGDIs
Garcia-Mata, Rafael; Boulter, Etienne; Burridge, Keith
2011-01-01
Preface The 'invisible hand' is a term originally coined by Adam Smith in the Theory of Moral Sentiments to describe the forces of self-interest, competition, and supply and demand that regulate the resources in society. This metaphor continues to be used by economists to describe the self-regulating nature of a market economy. The same metaphor can be used to describe the RHO-specific guanine nucleotide dissociation inhibitor (RHOGDI) family, which operates in the background, as an invisible hand, using similar forces to regulate the RHO GTPase cycle. PMID:21779026
Kutys, Matthew L; Yamada, Kenneth M
2014-09-01
Rho-family GTPases govern distinct types of cell migration on different extracellular matrix proteins in tissue culture or three-dimensional (3D) matrices. We searched for mechanisms selectively regulating 3D cell migration in different matrix environments and discovered a form of Cdc42-RhoA crosstalk governing cell migration through a specific pair of GTPase activator and inhibitor molecules. We first identified βPix, a guanine nucleotide exchange factor (GEF), as a specific regulator of migration in 3D collagen using an affinity-precipitation-based GEF screen. Knockdown of βPix specifically blocks cell migration in fibrillar collagen microenvironments, leading to hyperactive cellular protrusion accompanied by increased collagen matrix contraction. Live FRET imaging and RNAi knockdown linked this βPix knockdown phenotype to loss of polarized Cdc42 but not Rac1 activity, accompanied by enhanced, de-localized RhoA activity. Mechanistically, collagen phospho-regulates βPix, leading to its association with srGAP1, a GTPase-activating protein (GAP), needed to suppress RhoA activity. Our results reveal a matrix-specific pathway controlling migration involving a GEF-GAP interaction of βPix with srGAP1 that is critical for maintaining suppressive crosstalk between Cdc42 and RhoA during 3D collagen migration.
Directory of Open Access Journals (Sweden)
Emilie Fugier
2009-06-01
Full Text Available The intracellular pathogen Brucella abortus survives and replicates inside host cells within an endoplasmic reticulum (ER-derived replicative organelle named the "Brucella-containing vacuole" (BCV. Here, we developed a subcellular fractionation method to isolate BCVs and characterize for the first time the protein composition of its replicative niche. After identification of BCV membrane proteins by 2 dimensional (2D gel electrophoresis and mass spectrometry, we focused on two eukaryotic proteins: the glyceraldehyde-3-phosphate dehydrogenase (GAPDH and the small GTPase Rab 2 recruited to the vacuolar membrane of Brucella. These proteins were previously described to localize on vesicular and tubular clusters (VTC and to regulate the VTC membrane traffic between the endoplasmic reticulum (ER and the Golgi. Inhibition of either GAPDH or Rab 2 expression by small interfering RNA strongly inhibited B. abortus replication. Consistent with this result, inhibition of other partners of GAPDH and Rab 2, such as COPI and PKC iota, reduced B. abortus replication. Furthermore, blockage of Rab 2 GTPase in a GDP-locked form also inhibited B. abortus replication. Bacteria did not fuse with the ER and instead remained in lysosomal-associated membrane vacuoles. These results reveal an essential role for GAPDH and the small GTPase Rab 2 in B. abortus virulence within host cells.
The Rho-family GTPase Rac1 regulates integrin localization in Drosophila immunosurveillance cells.
Directory of Open Access Journals (Sweden)
Miguel J Xavier
Full Text Available BACKGROUND: When the parasitoid wasp Leptopilina boulardi lays an egg in a Drosophila larva, phagocytic cells called plasmatocytes and specialized cells known as lamellocytes encapsulate the egg. The Drosophila β-integrin Myospheroid (Mys is necessary for lamellocytes to adhere to the cellular capsule surrounding L. boulardi eggs. Integrins are heterodimeric adhesion receptors consisting of α and β subunits, and similar to other plasma membrane receptors undergo ligand-dependent endocytosis. In mammalian cells it is known that integrin binding to the extracellular matrix induces the activation of Rac GTPases, and we have previously shown that Rac1 and Rac2 are necessary for a proper encapsulation response in Drosophila larvae. We wanted to test the possibility that Myospheroid and Rac GTPases interact during the Drosophila anti-parasitoid immune response. RESULTS: In the current study we demonstrate that Rac1 is required for the proper localization of Myospheroid to the cell periphery of haemocytes after parasitization. Interestingly, the mislocalization of Myospheroid in Rac1 mutants is rescued by hyperthermia, involving the heat shock protein Hsp83. From these results we conclude that Rac1 and Hsp83 are required for the proper localization of Mys after parasitization. SIGNIFICANCE: We show for the first time that the small GTPase Rac1 is required for Mysopheroid localization. Interestingly, the necessity of Rac1 in Mys localization was negated by hyperthermia. This presents a problem, in Drosophila we quite often raise larvae at 29°C when using the GAL4/UAS misexpression system. If hyperthermia rescues receptor endosomal recycling defects, raising larvae in hyperthermic conditions may mask potentially interesting phenotypes.
Trans-kingdom mimicry underlies ribosome customization by a poxvirus kinase.
Jha, Sujata; Rollins, Madeline G; Fuchs, Gabriele; Procter, Dean J; Hall, Elizabeth A; Cozzolino, Kira; Sarnow, Peter; Savas, Jeffrey N; Walsh, Derek
2017-06-29
Ribosomes have the capacity to selectively control translation through changes in their composition that enable recognition of specific RNA elements. However, beyond differential subunit expression during development, evidence for regulated ribosome specification within individual cells has remained elusive. Here we report that a poxvirus kinase phosphorylates serine/threonine residues in the human small ribosomal subunit protein, receptor for activated C kinase (RACK1), that are not phosphorylated in uninfected cells or cells infected by other viruses. These modified residues cluster in an extended loop in RACK1, phosphorylation of which selects for translation of viral or reporter mRNAs with 5' untranslated regions that contain adenosine repeats, so-called polyA-leaders. Structural and phylogenetic analyses revealed that although RACK1 is highly conserved, this loop is variable and contains negatively charged amino acids in plants, in which these leaders act as translational enhancers. Phosphomimetics and inter-species chimaeras have shown that negative charge in the RACK1 loop dictates ribosome selectivity towards viral RNAs. By converting human RACK1 to a charged, plant-like state, poxviruses remodel host ribosomes so that adenosine repeats erroneously generated by slippage of the viral RNA polymerase confer a translational advantage. Our findings provide insight into ribosome customization through trans-kingdom mimicry and the mechanics of species-specific leader activity that underlie poxvirus polyA-leaders.
Miscoding-induced stalling of substrate translocation on the bacterial ribosome.
Alejo, Jose L; Blanchard, Scott C
2017-10-10
Directional transit of the ribosome along the messenger RNA (mRNA) template is a key determinant of the rate and processivity of protein synthesis. Imaging of the multistep translocation mechanism using single-molecule FRET has led to the hypothesis that substrate movements relative to the ribosome resolve through relatively long-lived late intermediates wherein peptidyl-tRNA enters the P site of the small ribosomal subunit via reversible, swivel-like motions of the small subunit head domain within the elongation factor G (GDP)-bound ribosome complex. Consistent with translocation being rate-limited by recognition and productive engagement of peptidyl-tRNA within the P site, we now show that base-pairing mismatches between the peptidyl-tRNA anticodon and the mRNA codon dramatically delay this rate-limiting, intramolecular process. This unexpected relationship between aminoacyl-tRNA decoding and translocation suggests that miscoding antibiotics may impact protein synthesis by impairing the recognition of peptidyl-tRNA in the small subunit P site during EF-G-catalyzed translocation. Strikingly, we show that elongation factor P (EF-P), traditionally known to alleviate ribosome stalling at polyproline motifs, can efficiently rescue translocation defects arising from miscoding. These findings help reveal the nature and origin of the rate-limiting steps in substrate translocation on the bacterial ribosome and indicate that EF-P can aid in resuming translation elongation stalled by miscoding errors.
Structure based hypothesis of a mitochondrial ribosome rescue mechanism
Directory of Open Access Journals (Sweden)
Huynen Martijn A
2012-05-01
Full Text Available Abstract Background mtRF1 is a vertebrate mitochondrial protein with an unknown function that arose from a duplication of the mitochondrial release factor mtRF1a. To elucidate the function of mtRF1, we determined the positions that are conserved among mtRF1 sequences but that are different in their mtRF1a paralogs. We subsequently modeled the 3D structure of mtRF1a and mtRF1 bound to the ribosome, highlighting the structural implications of these differences to derive a hypothesis for the function of mtRF1. Results Our model predicts, in agreement with the experimental data, that the 3D structure of mtRF1a allows it to recognize the stop codons UAA and UAG in the A-site of the ribosome. In contrast, we show that mtRF1 likely can only bind the ribosome when the A-site is devoid of mRNA. Furthermore, while mtRF1a will adopt its catalytic conformation, in which it functions as a peptidyl-tRNA hydrolase in the ribosome, only upon binding of a stop codon in the A-site, mtRF1 appears specifically adapted to assume this extended, peptidyl-tRNA hydrolyzing conformation in the absence of mRNA in the A-site. Conclusions We predict that mtRF1 specifically recognizes ribosomes with an empty A-site and is able to function as a peptidyl-tRNA hydrolase in those situations. Stalled ribosomes with empty A-sites that still contain a tRNA bound to a peptide chain can result from the translation of truncated, stop-codon less mRNAs. We hypothesize that mtRF1 recycles such stalled ribosomes, performing a function that is analogous to that of tmRNA in bacteria. Reviewers This article was reviewed by Dr. Eugene Koonin, Prof. Knud H. Nierhaus (nominated by Dr. Sarah Teichmann and Dr. Shamil Sunyaev.
A photocleavable rapamycin conjugate for spatiotemporal control of small GTPase activity.
Umeda, Nobuhiro; Ueno, Tasuku; Pohlmeyer, Christopher; Nagano, Tetsuo; Inoue, Takanari
2011-01-12
We developed a novel method to spatiotemporally control the activity of signaling molecules. A newly synthesized photocaged rapamycin derivative induced rapid dimerization of FKBP (FK-506 binding protein) and FRB (FKBP-rapamycin binding protein) upon UV irradiation. With this system and the spatially confined UV irradiation, we achieved subcellularly localized activation of Rac, a member of small GTPases. Our technique offers a powerful approach to studies of dynamic intracellular signaling events.
Novel mRNA-specific effects of ribosome drop-off on translation rate and polysome profile.
Directory of Open Access Journals (Sweden)
Pierre Bonnin
2017-05-01
Full Text Available The well established phenomenon of ribosome drop-off plays crucial roles in translational accuracy and nutrient starvation responses during protein translation. When cells are under stress conditions, such as amino acid starvation or aminoacyl-tRNA depletion due to a high level of recombinant protein expression, ribosome drop-off can substantially affect the efficiency of protein expression. Here we introduce a mathematical model that describes the effects of ribosome drop-off on the ribosome density along the mRNA and on the concomitant protein synthesis rate. Our results show that ribosome premature termination may lead to non-intuitive ribosome density profiles, such as a ribosome density which increases from the 5' to the 3' end. Importantly, the model predicts that the effects of ribosome drop-off on the translation rate are mRNA-specific, and we quantify their resilience to drop-off, showing that the mRNAs which present ribosome queues are much less affected by ribosome drop-off than those which do not. Moreover, among those mRNAs that do not present ribosome queues, resilience to drop-off correlates positively with the elongation rate, so that sequences using fast codons are expected to be less affected by ribosome drop-off. This result is consistent with a genome-wide analysis of S. cerevisiae, which reveals that under favourable growth conditions mRNAs coding for proteins involved in the translation machinery, known to be highly codon biased and using preferentially fast codons, are highly resilient to ribosome drop-off. Moreover, in physiological conditions, the translation rate of mRNAs coding for regulatory, stress-related proteins, is less resilient to ribosome drop-off. This model therefore allows analysis of variations in the translational efficiency of individual mRNAs by accounting for the full range of known ribosome behaviours, as well as explaining mRNA-specific variations in ribosome density emerging from ribosome profiling
Mechanism of recycling of post-termination ribosomal complexes in ...
Indian Academy of Sciences (India)
Madhu
all pathway of ribosome recycling in eubacteria with especial reference to the important role of the initiation factor ... [Seshadri A and Varshney U 2006 Mechanism of recycling of post-termination ribosomal complexes in eubacteria: a new role of initiation factor 3 .... RRF binding results in a remarkable conformational change.
Expression of protein-coding genes embedded in ribosomal DNA
DEFF Research Database (Denmark)
Johansen, Steinar D; Haugen, Peik; Nielsen, Henrik
2007-01-01
Ribosomal DNA (rDNA) is a specialised chromosomal location that is dedicated to high-level transcription of ribosomal RNA genes. Interestingly, rDNAs are frequently interrupted by parasitic elements, some of which carry protein genes. These are non-LTR retrotransposons and group II introns that e...... in the nucleolus....
Computational resources for ribosome profiling: from database to Web server and software.
Wang, Hongwei; Wang, Yan; Xie, Zhi
2017-08-14
Ribosome profiling is emerging as a powerful technique that enables genome-wide investigation of in vivo translation at sub-codon resolution. The increasing application of ribosome profiling in recent years has achieved remarkable progress toward understanding the composition, regulation and mechanism of translation. This benefits from not only the awesome power of ribosome profiling but also an extensive range of computational resources available for ribosome profiling. At present, however, a comprehensive review on these resources is still lacking. Here, we survey the recent computational advances guided by ribosome profiling, with a focus on databases, Web servers and software tools for storing, visualizing and analyzing ribosome profiling data. This review is intended to provide experimental and computational biologists with a reference to make appropriate choices among existing resources for the question at hand. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
Diverse Regulators of Human Ribosome Biogenesis Discovered by Changes in Nucleolar Number
Directory of Open Access Journals (Sweden)
Katherine I. Farley-Barnes
2018-02-01
Full Text Available Ribosome biogenesis is a highly regulated, essential cellular process. Although studies in yeast have established some of the biological principles of ribosome biogenesis, many of the intricacies of its regulation in higher eukaryotes remain unknown. To understand how ribosome biogenesis is globally integrated in human cells, we conducted a genome-wide siRNA screen for regulators of nucleolar number. We found 139 proteins whose depletion changed the number of nucleoli per nucleus from 2–3 to only 1 in human MCF10A cells. Follow-up analyses on 20 hits found many (90% to be essential for the nucleolar functions of rDNA transcription (7, pre-ribosomal RNA (pre-rRNA processing (16, and/or global protein synthesis (14. This genome-wide analysis exploits the relationship between nucleolar number and function to discover diverse cellular pathways that regulate the making of ribosomes and paves the way for further exploration of the links between ribosome biogenesis and human disease.
Directory of Open Access Journals (Sweden)
Silar Philippe
2000-11-01
Full Text Available Abstract Background To date, in eukaryotes, ribosomal protein expression is known to be regulated at the transcriptional and/or translational levels. But other forms of regulation may be possible. Results Here, we report the successful tagging of functional ribosomal particles with a S7-GFP chimaeric protein, making it possible to observe in vivo ribosome dynamics in the filamentous fungus Podospora anserina. Microscopic observations revealed a novel kind of ribosomal protein regulation during the passage between cell growth and stationary phases, with a transient accumulation of ribosomal proteins and/or ribosome subunits in the nucleus, possibly the nucleolus, being observed at the beginning of stationary phase. Conclusion Nuclear sequestration can be another level of ribosomal protein regulation in eukaryotic cells.This may contribute to the regulation of cell growth and division.
Lalucque, Hervé; Silar, Philippe
2000-01-01
Background To date, in eukaryotes, ribosomal protein expression is known to be regulated at the transcriptional and/or translational levels. But other forms of regulation may be possible. Results Here, we report the successful tagging of functional ribosomal particles with a S7-GFP chimaeric protein, making it possible to observe in vivo ribosome dynamics in the filamentous fungus Podospora anserina. Microscopic observations revealed a novel kind of ribosomal protein regulation during the passage between cell growth and stationary phases, with a transient accumulation of ribosomal proteins and/or ribosome subunits in the nucleus, possibly the nucleolus, being observed at the beginning of stationary phase. Conclusion Nuclear sequestration can be another level of ribosomal protein regulation in eukaryotic cells.This may contribute to the regulation of cell growth and division. PMID:11112985
International Nuclear Information System (INIS)
Schneir, M.; Imberman, M.; Ramamurthy, N.; Golub, L.
1987-01-01
The objective of this study was to quantify the contribution of both ribosome amount and ribosomal efficiency to decreased collagen production in skin of diabetic rats and diabetic rats treated with dietary ascorbic acid. Male Sprague-Dawley rats were distributed equally into the following categories: non-diabetic controls; diabetics; ascorbic acid-treated diabetics. On day-20, all rats were injected with ( 3 H)proline and killed after 2 h. Absolute rate of collagen production, ribosome content, and ribosomal efficiency of collagen production were quantified. Also ribosomal efficiency was quantified for ribosomes in sucrose-gradient fractionated post-mitochondrial supernatants. The results indicate that decreased ribosomal efficiency was responsible for 70% of the decreased collagen production with 30% caused by decreased ribosome content, when measured for total skin or sucrose gradient-isolated ribosomes. At both levels of analysis, ascorbic acid treatment normalized ribosomal efficiency, indicating diabetes-mediated decreased ribosomal efficiency for collagen production is related to a co-translational event, such as procollagen underhydroxylation
Ruggero, D; Londei, P
1996-01-01
Hybrid ribosomes obtained by mixing the ribosomal subunits of the extremely thermophilic archaea Sulfolobus solfataricus and Desulfurococcus mobilis were tested for their sensitivity to selected antibiotics. It is shown that structural differences in the large ribosomal subunits determine qualitatively and quantitatively the patterns of response to alpha-sarcin and paromomycin in these species.
Genome-wide polysomal analysis of a yeast strain with mutated ribosomal protein S9
Directory of Open Access Journals (Sweden)
Arava Yoav
2007-08-01
Full Text Available Abstract Background The yeast ribosomal protein S9 (S9 is located at the entrance tunnel of the mRNA into the ribosome. It is known to play a role in accurate decoding and its bacterial homolog (S4 has recently been shown to be involved in opening RNA duplexes. Here we examined the effects of changing the C terminus of S9, which is rich in acidic amino acids and extends out of the ribosome surface. Results We performed a genome-wide analysis to reveal effects at the transcription and translation levels of all yeast genes. While negligible relative changes were observed in steady-state mRNA levels, a significant number of mRNAs appeared to have altered ribosomal density. Notably, 40% of the genes having reliable signals changed their ribosomal association by more than one ribosome. Yet, no general correlations with physical or functional features of the mRNA were observed. Ribosome Density Mapping (RDM along four of the mRNAs with increased association revealed an increase in ribosomal density towards the end of the coding region for at least two of them. Read-through analysis did not reveal any increase in read-through of a premature stop codon by the mutant strain. Conclusion The ribosomal protein rpS9 appears to be involved in the translation of many mRNAs, since altering its C terminus led to a significant change in ribosomal association of many mRNAs. We did not find strong correlations between these changes and several physical features of the mRNA, yet future studies with advanced tools may allow such correlations to be determined. Importantly, our results indicate an accumulation of ribosomes towards the end of the coding regions of some mRNAs. This suggests an involvement of S9 in ribosomal dissociation during translation termination.
Proto-ribosome: a theoretical approach based on RNA relics
Demongeot, Jacques
2017-01-01
We describe in this paper, based on already published articles, a contribution to the theory postulating the existence of a proto-ribosome, which could have appeared early at the origin of life and we discuss the interest of this notion in an evolutionary perspective, taking into account the existence of possible RNA relics of this proto-ribosome.
Small GTPases and formins in mammalian oocyte maturation: cytoskeletal organizers.
Kwon, Sojung; Lim, Hyunjung J
2011-03-01
The maturation process of mammalian oocytes accompanies an extensive rearrangement of the cytoskeleton and associated proteins. As this process requires a delicate interplay between the cytoskeleton and its regulators, it is often targeted by various external and internal adversaries that affect the congression and/or segregation of chromosomes. Asymmetric cell division in oocytes also requires specific regulators of the cytoskeleton, including formin-2 and small GTPases. Recent literature providing clues regarding how actin filaments and microtubules interact during spindle migration in mouse oocytes are highlighted in this review.
Senescent changes in the ribosomes of animal cells in vivo and in vitro
Miquel, J.; Johnson, J. E., Jr.
1979-01-01
The paper examines RNA-ribosomal changes observed in protozoa and fixed postmitotic cells, as well as the characteristics of intermitotic cells. Attention is given to a discussion of the implications of the reported ribosomal changes as to the senescent deterioration of protein synthesis and physiological functions. A survey of the literature suggests that, while the data on ribosomal change in dividing cells both in vivo and in vitro are inconclusive, there is strong histological and biochemical evidence in favor of some degree of quantitative ribosomal loss in fixed postmitotic cells. Since these decreases in ribosomes are demonstrated in differential cells from nematodes, insects and mammals, they may represent a universal manifestation of cytoplasmic senescence in certain types of fixed postmitotic animal cells. The observed variability in ribosomal loss for cells belonging to the same type suggests that this involution phenomenon is rather related to the wear and tear suffered by a particular cell.
DNA replication stress restricts ribosomal DNA copy number.
Salim, Devika; Bradford, William D; Freeland, Amy; Cady, Gillian; Wang, Jianmin; Pruitt, Steven C; Gerton, Jennifer L
2017-09-01
Ribosomal RNAs (rRNAs) in budding yeast are encoded by ~100-200 repeats of a 9.1kb sequence arranged in tandem on chromosome XII, the ribosomal DNA (rDNA) locus. Copy number of rDNA repeat units in eukaryotic cells is maintained far in excess of the requirement for ribosome biogenesis. Despite the importance of the repeats for both ribosomal and non-ribosomal functions, it is currently not known how "normal" copy number is determined or maintained. To identify essential genes involved in the maintenance of rDNA copy number, we developed a droplet digital PCR based assay to measure rDNA copy number in yeast and used it to screen a yeast conditional temperature-sensitive mutant collection of essential genes. Our screen revealed that low rDNA copy number is associated with compromised DNA replication. Further, subculturing yeast under two separate conditions of DNA replication stress selected for a contraction of the rDNA array independent of the replication fork blocking protein, Fob1. Interestingly, cells with a contracted array grew better than their counterparts with normal copy number under conditions of DNA replication stress. Our data indicate that DNA replication stresses select for a smaller rDNA array. We speculate that this liberates scarce replication factors for use by the rest of the genome, which in turn helps cells complete DNA replication and continue to propagate. Interestingly, tumors from mini chromosome maintenance 2 (MCM2)-deficient mice also show a loss of rDNA repeats. Our data suggest that a reduction in rDNA copy number may indicate a history of DNA replication stress, and that rDNA array size could serve as a diagnostic marker for replication stress. Taken together, these data begin to suggest the selective pressures that combine to yield a "normal" rDNA copy number.
DNA replication stress restricts ribosomal DNA copy number
Salim, Devika; Bradford, William D.; Freeland, Amy; Cady, Gillian; Wang, Jianmin
2017-01-01
Ribosomal RNAs (rRNAs) in budding yeast are encoded by ~100–200 repeats of a 9.1kb sequence arranged in tandem on chromosome XII, the ribosomal DNA (rDNA) locus. Copy number of rDNA repeat units in eukaryotic cells is maintained far in excess of the requirement for ribosome biogenesis. Despite the importance of the repeats for both ribosomal and non-ribosomal functions, it is currently not known how “normal” copy number is determined or maintained. To identify essential genes involved in the maintenance of rDNA copy number, we developed a droplet digital PCR based assay to measure rDNA copy number in yeast and used it to screen a yeast conditional temperature-sensitive mutant collection of essential genes. Our screen revealed that low rDNA copy number is associated with compromised DNA replication. Further, subculturing yeast under two separate conditions of DNA replication stress selected for a contraction of the rDNA array independent of the replication fork blocking protein, Fob1. Interestingly, cells with a contracted array grew better than their counterparts with normal copy number under conditions of DNA replication stress. Our data indicate that DNA replication stresses select for a smaller rDNA array. We speculate that this liberates scarce replication factors for use by the rest of the genome, which in turn helps cells complete DNA replication and continue to propagate. Interestingly, tumors from mini chromosome maintenance 2 (MCM2)-deficient mice also show a loss of rDNA repeats. Our data suggest that a reduction in rDNA copy number may indicate a history of DNA replication stress, and that rDNA array size could serve as a diagnostic marker for replication stress. Taken together, these data begin to suggest the selective pressures that combine to yield a “normal” rDNA copy number. PMID:28915237
DNA replication stress restricts ribosomal DNA copy number.
Directory of Open Access Journals (Sweden)
Devika Salim
2017-09-01
Full Text Available Ribosomal RNAs (rRNAs in budding yeast are encoded by ~100-200 repeats of a 9.1kb sequence arranged in tandem on chromosome XII, the ribosomal DNA (rDNA locus. Copy number of rDNA repeat units in eukaryotic cells is maintained far in excess of the requirement for ribosome biogenesis. Despite the importance of the repeats for both ribosomal and non-ribosomal functions, it is currently not known how "normal" copy number is determined or maintained. To identify essential genes involved in the maintenance of rDNA copy number, we developed a droplet digital PCR based assay to measure rDNA copy number in yeast and used it to screen a yeast conditional temperature-sensitive mutant collection of essential genes. Our screen revealed that low rDNA copy number is associated with compromised DNA replication. Further, subculturing yeast under two separate conditions of DNA replication stress selected for a contraction of the rDNA array independent of the replication fork blocking protein, Fob1. Interestingly, cells with a contracted array grew better than their counterparts with normal copy number under conditions of DNA replication stress. Our data indicate that DNA replication stresses select for a smaller rDNA array. We speculate that this liberates scarce replication factors for use by the rest of the genome, which in turn helps cells complete DNA replication and continue to propagate. Interestingly, tumors from mini chromosome maintenance 2 (MCM2-deficient mice also show a loss of rDNA repeats. Our data suggest that a reduction in rDNA copy number may indicate a history of DNA replication stress, and that rDNA array size could serve as a diagnostic marker for replication stress. Taken together, these data begin to suggest the selective pressures that combine to yield a "normal" rDNA copy number.
Role of Arf GTPases in fungal morphogenesis and virulence.
Directory of Open Access Journals (Sweden)
Hayet Labbaoui
2017-02-01
Full Text Available Virulence of the human fungal pathogen Candida albicans depends on the switch from budding to filamentous growth, which requires sustained membrane traffic and polarized growth. In many organisms, small GTPases of the Arf (ADP-ribosylation factor family regulate membrane/protein trafficking, yet little is known about their role in fungal filamentous growth. To investigate these GTPases in C. albicans, we generated loss of function mutants in all 3 Arf proteins, Arf1-Arf3, and 2 Arf-like proteins, Arl1 and Arl3. Our results indicate that of these proteins, Arf2 is required for viability and sensitivity to antifungal drugs. Repressible ARF2 expression results in defects in filamentous growth, cell wall integrity and virulence, likely due to alteration of the Golgi. Arl1 is also required for invasive filamentous growth and, although arl1/arl1 cells can initiate hyphal growth, hyphae are substantially shorter than that of the wild-type, due to the inability of this mutant to maintain hyphal growth at a single site. We show that this defect does not result from an alteration of phospholipid distribution and is unlikely to result from the sole Golgin Imh1 mislocalization, as Imh1 is not required for invasive filamentous growth. Rather, our results suggest that the arl1/arl1 hyphal growth defect results from increased secretion in this mutant. Strikingly, the arl1/arl1 mutant is drastically reduced in virulence during oropharyngeal candidiasis. Together, our results highlight the importance of Arl1 and Arf2 as key regulators of hyphal growth and virulence in C. albicans and identify a unique function of Arl1 in secretion.
γ-irradiated ribosomes from Micrococcus radiodurans in a cell-free protein synthesizing system
International Nuclear Information System (INIS)
Suessmuth, R.; Widmann, A.
1979-01-01
γ-irradiation inactivation of isolated ribosomes of Micrococcus radiodurans was studied by examining poly U directed synthesis of polyphenylalanine. Ribosomes of M. radiodurans did not show significant γ-radiation sensitivity up to a dose of approx. 11.6 k Gy. Cells of M. radiodurans take up more magnesium than E. coli cells under the same conditions. The magnesium content of ribosomes of M. radiodurans was 18% higher than that of E.coli ribosomes. A possible relation between Mg 2+ -content and γ-resistance is discussed. (orig.) [de
A Numbers Game: Ribosome Densities, Bacterial Growth, and Antibiotic-Mediated Stasis and Death
Directory of Open Access Journals (Sweden)
Bruce R. Levin
2017-02-01
Full Text Available We postulate that the inhibition of growth and low rates of mortality of bacteria exposed to ribosome-binding antibiotics deemed bacteriostatic can be attributed almost uniquely to these drugs reducing the number of ribosomes contributing to protein synthesis, i.e., the number of effective ribosomes. We tested this hypothesis with Escherichia coli K-12 MG1655 and constructs that had been deleted for 1 to 6 of the 7 rRNA (rrn operons. In the absence of antibiotics, constructs with fewer rrn operons have lower maximum growth rates and longer lag phases than those with more ribosomal operons. In the presence of the ribosome-binding “bacteriostatic” antibiotics tetracycline, chloramphenicol, and azithromycin, E. coli strains with 1 and 2 rrn operons are killed at a substantially higher rate than those with more rrn operons. This increase in the susceptibility of E. coli with fewer rrn operons to killing by ribosome-targeting bacteriostatic antibiotics is not reflected in their greater sensitivity to killing by the bactericidal antibiotic ciprofloxacin, which does not target ribosomes, but also to killing by gentamicin, which does. Finally, when such strains are exposed to these ribosome-targeting bacteriostatic antibiotics, the time before these bacteria start to grow again when the drugs are removed, referred to as the post-antibiotic effect (PAE, is markedly greater for constructs with fewer rrn operons than for those with more rrn operons. We interpret the results of these other experiments reported here as support for the hypothesis that the reduction in the effective number of ribosomes due to binding to these structures provides a sufficient explanation for the action of bacteriostatic antibiotics that target these structures.
Remodeling of ribosomal genes in somatic cells by Xenopus egg extract
DEFF Research Database (Denmark)
Østrup, Olga; Hyttel, Poul; Klærke, Dan Arne
2011-01-01
Extracts from Xenopus eggs can reprogram gene expression in somatic nuclei, however little is known about the earliest processes associated with the switch in the transcriptional program. We show here that an early reprogramming event is the remodeling of ribosomal chromatin and gene expression....... This occurs within hours of extract treatment and is distinct from a stress response. Egg extract elicits remodeling of the nuclear envelope, chromatin and nucleolus. Nucleolar remodeling involves a rapid and stable decrease in ribosomal gene transcription, and promoter targeting of the nucleolar remodeling...... and elicits a stress-type nuclear response. Thus, an early event of Xenopus egg extract-mediated nuclear reprogramming is the remodeling of ribosomal genes involving nucleolar remodeling complex. Condition-specific and rapid silencing of ribosomal genes may serve as a sensitive marker for evaluation...
DeRose, Robert; Pohlmeyer, Christopher; Umeda, Nobuhiro; Ueno, Tasuku; Nagano, Tetsuo; Kuo, Scot; Inoue, Takanari
2012-03-09
Dynamic regulation of the Rho family of small guanosine triphosphatases (GTPases) with great spatiotemporal precision is essential for various cellular functions and events(1, 2). Their spatiotemporally dynamic nature has been revealed by visualization of their activity and localization in real time(3). In order to gain deeper understanding of their roles in diverse cellular functions at the molecular level, the next step should be perturbation of protein activities at a precise subcellular location and timing. To achieve this goal, we have developed a method for light-induced, spatio-temporally controlled activation of small GTPases by combining two techniques: (1) rapamycin-induced FKBP-FRB heterodimerization and (2) a photo-caging method of rapamycin. With the use of rapamycin-mediated FKBP-FRB heterodimerization, we have developed a method for rapidly inducible activation or inactivation of small GTPases including Rac(4), Cdc42(4), RhoA(4) and Ras(5), in which rapamycin induces translocation of FKBP-fused GTPases, or their activators, to the plasma membrane where FRB is anchored. For coupling with this heterodimerization system, we have also developed a photo-caging system of rapamycin analogs. A photo-caged compound is a small molecule whose activity is suppressed with a photocleavable protecting group known as a caging group. To suppress heterodimerization activity completely, we designed a caged rapamycin that is tethered to a macromolecule such that the resulting large complex cannot cross the plasma membrane, leading to virtually no background activity as a chemical dimerizer inside cells(6). Figure 1 illustrates a scheme of our system. With the combination of these two systems, we locally recruited a Rac activator to the plasma membrane on a timescale of seconds and achieved light-induced Rac activation at the subcellular level(6).
Studies on the catalytic rate constant of ribosomal peptidyltransferase.
Synetos, D; Coutsogeorgopoulos, C
1987-02-20
A detailed kinetic analysis of a model reaction for the ribosomal peptidyltransferase is described, using fMet-tRNA or Ac-Phe-tRNA as the peptidyl donor and puromycin as the acceptor. The initiation complex (fMet-tRNA X AUG X 70 S ribosome) or (Ac-Phe-tRNA X poly(U) X 70 S ribosome) (complex C) is isolated and then reacted with excess puromycin (S) to give fMet-puromycin or Ac-Phe-puromycin. This reaction (puromycin reaction) is first order at all concentrations of S tested. An important asset of this kinetic analysis is the fact that the relationship between the first order rate constant kobs and [S] shows hyperbolic saturation and that the value of kobs at saturating [S] is a measure of the catalytic rate constant (k cat) of peptidyltransferase in the puromycin reaction. With fMet-tRNA as the donor, this kcat of peptidyltransferase is 8.3 min-1 when the 0.5 M NH4Cl ribosomal wash is present, compared to 3.8 min-1 in its absence. The kcat of peptidyltransferase is 2.0 min-1 when Ac-Phe-tRNA replaces fMet-tRNA in the presence of the ribosomal wash and decreases to 0.8 min-1 in its absence. This kinetic procedure is the best method available for evaluating changes in the activity of peptidyltransferase in vitro. The results suggest that peptidyltransferase is subjected to activation by the binding of fMet-tRNA to the 70 S initiation complex.
Directory of Open Access Journals (Sweden)
Jeffrey A Hussmann
2015-12-01
Full Text Available Ribosome profiling produces snapshots of the locations of actively translating ribosomes on messenger RNAs. These snapshots can be used to make inferences about translation dynamics. Recent ribosome profiling studies in yeast, however, have reached contradictory conclusions regarding the average translation rate of each codon. Some experiments have used cycloheximide (CHX to stabilize ribosomes before measuring their positions, and these studies all counterintuitively report a weak negative correlation between the translation rate of a codon and the abundance of its cognate tRNA. In contrast, some experiments performed without CHX report strong positive correlations. To explain this contradiction, we identify unexpected patterns in ribosome density downstream of each type of codon in experiments that use CHX. These patterns are evidence that elongation continues to occur in the presence of CHX but with dramatically altered codon-specific elongation rates. The measured positions of ribosomes in these experiments therefore do not reflect the amounts of time ribosomes spend at each position in vivo. These results suggest that conclusions from experiments in yeast using CHX may need reexamination. In particular, we show that in all such experiments, codons decoded by less abundant tRNAs were in fact being translated more slowly before the addition of CHX disrupted these dynamics.
Kokkori, Sofia; Apostolidi, Maria; Tsakris, Athanassios; Pournaras, Spyros
2014-01-01
Linezolid-dependent growth was recently reported in Staphylococcus epidermidis clinical strains carrying mutations associated with linezolid resistance. To investigate this unexpected behavior at the molecular level, we isolated active ribosomes from one of the linezolid-dependent strains and we compared them with ribosomes isolated from a wild-type strain. Both strains were grown in the absence and presence of linezolid. Detailed biochemical and structural analyses revealed essential differences in the function and structure of isolated ribosomes which were assembled in the presence of linezolid. The catalytic activity of peptidyltransferase was found to be significantly higher in the ribosomes derived from the linezolid-dependent strain. Interestingly, the same ribosomes exhibited an abnormal ribosomal subunit dissociation profile on a sucrose gradient in the absence of linezolid, but the profile was restored after treatment of the ribosomes with an excess of the antibiotic. Our study suggests that linezolid most likely modified the ribosomal assembly procedure, leading to a new functional ribosomal population active only in the presence of linezolid. Therefore, the higher growth rate of the partially linezolid-dependent strains could be attributed to the functional and structural adaptations of ribosomes to linezolid. PMID:24890589
Further characterization of ribosome binding to thylakoid membranes
International Nuclear Information System (INIS)
Hurewitz, J.; Jagendorf, A.T.
1987-01-01
Previous work indicated more polysomes bound to pea (Pisum sativum cv Progress No. 9) thylakoids in light than in the dark, in vivo. With isolated intact chloroplasts incubated in darkness, addition of MgATP had no effect but 24 to 74% more RNA was thylakoid-bound at pH 8.3 than at pH 7. Thus, the major effect of light on ribosome-binding in vivo may be due to higher stroma pH. In isolated pea chloroplasts, initiation inhibitors (pactamycin and kanamycin) decreased the extent of RNA binding, and elongation inhibitors (lincomycin and streptomycin) increased it. Thus, cycling of ribosomes is controlled by translation, initiation, and termination. Bound RNA accounted for 19 to 24% of the total chloroplast RNA and the incorporation of [ 3 H]leucine into thylakoids was proportional to the amount of this bound RNA. These data support the concept that stroma ribosomes are recruited into thylakoid polysomes, which are active in synthesizing thylakoid proteins
Structure of Vibrio cholerae ribosome hibernation promoting factor
International Nuclear Information System (INIS)
De Bari, Heather; Berry, Edward A.
2013-01-01
The X-ray crystal structure of ribosome hibernation promoting factor from V. cholerae has been determined at 2.0 Å resolution. The crystal was phased by two-wavelength MAD using cocrystallized cobalt. The X-ray crystal structure of ribosome hibernation promoting factor (HPF) from Vibrio cholerae is presented at 2.0 Å resolution. The crystal was phased by two-wavelength MAD using cocrystallized cobalt. The asymmetric unit contained two molecules of HPF linked by four Co atoms. The metal-binding sites observed in the crystal are probably not related to biological function. The structure of HPF has a typical β–α–β–β–β–α fold consistent with previous structures of YfiA and HPF from Escherichia coli. Comparison of the new structure with that of HPF from E. coli bound to the Thermus thermophilus ribosome [Polikanov et al. (2012 ▶), Science, 336, 915–918] shows that no significant structural changes are induced in HPF by binding
Dijk, J; van den Broek, R; Nasiulas, G; Beck, A; Reinhardt, R; Wittmann-Liebold, B
1987-08-01
The amino-terminal sequence of ribosomal protein L10 from Halobacterium marismortui has been determined up to residue 54, using both a liquid- and a gas-phase sequenator. The two sequences are in good agreement. The protein is clearly homologous to protein HcuL10 from the related strain Halobacterium cutirubrum. Furthermore, a weaker but distinct homology to ribosomal protein L6 from Escherichia coli and Bacillus stearothermophilus can be detected. In addition to 7 identical amino acids in the first 36 residues in all four sequences a number of conservative replacements occurs, of mainly hydrophobic amino acids. In this common region the pattern of conserved amino acids suggests the presence of a beta-alpha fold as it occurs in ribosomal proteins L12 and L30. Furthermore, several potential cases of homology to other ribosomal components of the three ur-kingdoms have been found.
Essential role of the small GTPase Ran in postnatal pancreatic islet development.
Directory of Open Access Journals (Sweden)
Fang Xia
Full Text Available The small GTPase Ran orchestrates pleiotropic cellular responses of nucleo-cytoplasmic shuttling, mitosis and subcellular trafficking, but whether deregulation of these pathways contributes to disease pathogenesis has remained elusive. Here, we generated transgenic mice expressing wild type (WT Ran, loss-of-function Ran T24N mutant or constitutively active Ran G19V mutant in pancreatic islet β cells under the control of the rat insulin promoter. Embryonic pancreas and islet development, including emergence of insulin(+ β cells, was indistinguishable in control or transgenic mice. However, by one month after birth, transgenic mice expressing any of the three Ran variants exhibited overt diabetes, with hyperglycemia, reduced insulin production, and nearly complete loss of islet number and islet mass, in vivo. Deregulated Ran signaling in transgenic mice, adenoviral over-expression of WT or mutant Ran in isolated islets, or short hairpin RNA (shRNA silencing of endogenous Ran in model insulinoma INS-1 cells, all resulted in decreased expression of the pancreatic and duodenal homeobox transcription factor, PDX-1, and reduced β cell proliferation, in vivo. These data demonstrate that a finely-tuned balance of Ran GTPase signaling is essential for postnatal pancreatic islet development and glucose homeostasis, in vivo.
Ribosomes: Ribozymes that Survived Evolution Pressures but Is Paralyzed by Tiny Antibiotics
Yonath, Ada
An impressive number of crystal structures of ribosomes, the universal cellular machines that translate the genetic code into proteins, emerged during the last decade. The determination of ribosome high resolution structure, which was widely considered formidable, led to novel insights into the ribosomal function, namely, fidelity, catalytic mechanism, and polymerize activities. They also led to suggestions concerning its origin and shed light on the action, selectivity and synergism of ribosomal antibiotics; illuminated mechanisms acquiring bacterial resistance and provided structural information for drug improvement and design. These studies required the pioneering and implementation of advanced technologies, which directly influenced the remarkable increase of the number of structures deposited in the Protein Data Bank.
Multiperspective smFRET reveals rate-determining late intermediates of ribosomal translocation.
Wasserman, Michael R; Alejo, Jose L; Altman, Roger B; Blanchard, Scott C
2016-04-01
Directional translocation of the ribosome through the mRNA open reading frame is a critical determinant of translational fidelity. This process entails a complex interplay of large-scale conformational changes within the actively translating particle, which together coordinate the movement of tRNA and mRNA substrates with respect to the large and small ribosomal subunits. Using pre-steady state, single-molecule fluorescence resonance energy transfer imaging, we tracked the nature and timing of these conformational events within the Escherichia coli ribosome from five structural perspectives. Our investigations revealed direct evidence of structurally and kinetically distinct late intermediates during substrate movement, whose resolution determines the rate of translocation. These steps involve intramolecular events within the EF-G-GDP-bound ribosome, including exaggerated, reversible fluctuations of the small-subunit head domain, which ultimately facilitate peptidyl-tRNA's movement into its final post-translocation position.
Purification and properties of a ribosomal casein kinase from rabbit reticulocytes
DEFF Research Database (Denmark)
Issinger, O G
1977-01-01
A casein kinase was isolated and purifed from rabbit reticulocytes. About 90% of the enzyme activity co-sedimented with the ribosomal fraction, whereas about 10% of the enzyme activity was found in the ribosome-free supernatant. Both casein kinases (the ribosome-bound enzyme as well as the free...... suggested that the casein kinase is a dimer composed of subunits of identical molecular weight. The enzyme utilizes GTP as well as ATP as a phosphoryl donor. It preferentially phosphorylates acidic proteins, in particular the model substrates casein and phosvitin. Casein kinase is cyclic AMP...
Simulation and analysis of single-ribosome translation
International Nuclear Information System (INIS)
Tinoco, Ignacio Jr; Wen, Jin-Der
2009-01-01
In the cell, proteins are synthesized by ribosomes in a multi-step process called translation. The ribosome translocates along the messenger RNA to read the codons that encode the amino acid sequence of a protein. Elongation factors, including EF-G and EF-Tu, are used to catalyze the process. Recently, we have shown that translation can be followed at the single-molecule level using optical tweezers; this technique allows us to study the kinetics of translation by measuring the lifetime the ribosome spends at each codon. Here, we analyze the data from single-molecule experiments and fit the data with simple kinetic models. We also simulate the translation kinetics based on a multi-step mechanism from ensemble kinetic measurements. The mean lifetimes from the simulation were consistent with our experimental single-molecule measurements. We found that the calculated lifetime distributions were fit in general by equations with up to five rate-determining steps. Two rate-determining steps were only obtained at low concentrations of elongation factors. These analyses can be used to design new single-molecule experiments to better understand the kinetics and mechanism of translation
Slit-Robo GTPase-Activating Protein 2 as a metastasis suppressor in osteosarcoma
Marko, Tracy A.; Shamsan, Ghaidan A.; Edwards, Elizabeth N.; Hazelton, Paige E.; Rathe, Susan K.; Cornax, Ingrid; Overn, Paula R.; Varshney, Jyotika; Diessner, Brandon J.; Moriarity, Branden S.; O?Sullivan, M. Gerard; Odde, David J.; Largaespada, David A.
2016-01-01
Osteosarcoma is the most common primary bone tumor, with metastatic disease responsible for most treatment failure and patient death. A forward genetic screen utilizing Sleeping Beauty mutagenesis in mice previously identified potential genetic drivers of osteosarcoma metastasis, including Slit-Robo GTPase-Activating Protein 2 (Srgap2). This study evaluates the potential role of SRGAP2 in metastases-associated properties of osteosarcoma cell lines through Srgap2 knockout via the CRISPR/Cas9 n...
Stage-specific functions of the small Rho GTPases Cdc42 and Rac1 for adult hippocampal neurogenesis
DEFF Research Database (Denmark)
Vadodaria, Krishna C; Brakebusch, Cord; Suter, Ueli
2013-01-01
The molecular mechanisms underlying the generation, maturation, and integration of new granule cells generated throughout life in the mammalian hippocampus remain poorly understood. Small Rho GTPases, such as Cdc42 and Rac1, have been implicated previously in neural stem/progenitor cell (NSPC......) proliferation and neuronal maturation during embryonic development. Here we used conditional genetic deletion and virus-based loss-of-function approaches to identify temporally distinct functions for Cdc42 and Rac1 in adult hippocampal neurogenesis. We found that Cdc42 is involved in mouse NSPC proliferation......, initial dendritic development, and dendritic spine maturation. In contrast, Rac1 is dispensable for early steps of neuronal development but is important for late steps of dendritic growth and spine maturation. These results establish cell-autonomous and stage-specific functions for the small Rho GTPases...
Andreeva, Irena
2018-01-01
During translation, consecutive ribosomes load on an mRNA and form a polysome. The first ribosome binds to a single-stranded mRNA region and moves toward the start codon, unwinding potential mRNA structures on the way. In contrast, the following ribosomes can dock at the start codon only when the first ribosome has vacated the initiation site. Here we show that loading of the second ribosome on a natural 38-nt-long 5′ untranslated region of lpp mRNA, which codes for the outer membrane lipoprotein from Escherichia coli, takes place before the leading ribosome has moved away from the start codon. The rapid formation of this standby complex depends on the presence of ribosomal proteins S1/S2 in the leading ribosome. The early recruitment of the second ribosome to the standby site before translation by the leading ribosome and the tight coupling between translation elongation by the first ribosome and the accommodation of the second ribosome can contribute to high translational efficiency of the lpp mRNA. PMID:29632209
Musumeci, Rosario; Calaresu, Enrico; Gerosa, Jolanda; Oggioni, Davide; Bramati, Simone; Morelli, Patrizia; Mura, Ida; Piana, Andrea; Are, Bianca Maria; Cocuzza, Clementina Elvezia
2016-10-01
Linezolid is the main representative of the oxazolidinones, introduced in 2000 in clinical practice to treat severe Gram-positive infections. This compound inhibits protein synthesis by binding to the peptidyl transferase centre of the 50S bacterial ribosomal subunit. The aim of this study was to characterize 12 clinical strains of linezolid-resistant Staphylococcus spp. isolated in Northern Italy. All isolates of Staphylococcus spp. studied showed a multi-antibiotic resistance phenotype. In particular, all isolates showed the presence of the mecA gene associated with SSCmec types IVa, V or I. Mutations in domain V of 23S rRNA were shown to be the most prevalent mechanism of linezolid resistance: among these a new C2551T mutation was found in S. aureus, whilst the G2576T mutation was shown to be the most prevalent overall. Moreover, three S. epidermidis isolates were shown to have linezolid resistance associated only with alterations in both L3 and L4 ribosomal proteins. No strain was shown to harbor the previously described cfr gene. These results have shown how the clinical use of linezolid in Northern Italy has resulted in the selection of multiple antibiotic-resistant clinical isolates of Staphylococcus spp., with linezolid resistance in these strains being associated with mutations in 23S rRNA or ribosomal proteins L3 and L4.
The ribosome as a molecular machine: the mechanism of tRNA-mRNA movement in translocation.
Rodnina, Marina V; Wintermeyer, Wolfgang
2011-04-01
Translocation of tRNA and mRNA through the ribosome is one of the most dynamic events during protein synthesis. In the cell, translocation is catalysed by EF-G (elongation factor G) and driven by GTP hydrolysis. Major unresolved questions are: how the movement is induced and what the moving parts of the ribosome are. Recent progress in time-resolved cryoelectron microscopy revealed trajectories of tRNA movement through the ribosome. Driven by thermal fluctuations, the ribosome spontaneously samples a large number of conformational states. The spontaneous movement of tRNAs through the ribosome is loosely coupled to the motions within the ribosome. EF-G stabilizes conformational states prone to translocation and promotes a conformational rearrangement of the ribosome (unlocking) that accelerates the rate-limiting step of translocation: the movement of the tRNA anticodons on the small ribosomal subunit. EF-G acts as a Brownian ratchet providing directional bias for movement at the cost of GTP hydrolysis.
Structural basis for precursor protein-directed ribosomal peptide macrocyclization
Li, Kunhua; Condurso, Heather L.; Li, Gengnan; Ding, Yousong; Bruner, Steven D.
2016-01-01
Macrocyclization is a common feature of natural product biosynthetic pathways including the diverse family of ribosomal peptides. Microviridins are architecturally complex cyanobacterial ribosomal peptides whose members target proteases with potent reversible inhibition. The product structure is constructed by three macrocyclizations catalyzed sequentially by two members of the ATP-grasp family, a unique strategy for ribosomal peptide macrocyclization. Here, we describe the detailed structural basis for the enzyme-catalyzed macrocyclizations in the microviridin J pathway of Microcystis aeruginosa. The macrocyclases, MdnC and MdnB, interact with a conserved α-helix of the precursor peptide using a novel precursor peptide recognition mechanism. The results provide insight into the unique protein/protein interactions key to the chemistry, suggest an origin of the natural combinatorial synthesis of microviridin peptides and provide a framework for future engineering efforts to generate designed compounds. PMID:27669417
Structural basis for precursor protein-directed ribosomal peptide macrocyclization.
Li, Kunhua; Condurso, Heather L; Li, Gengnan; Ding, Yousong; Bruner, Steven D
2016-11-01
Macrocyclization is a common feature of natural product biosynthetic pathways including the diverse family of ribosomal peptides. Microviridins are architecturally complex cyanobacterial ribosomal peptides that target proteases with potent reversible inhibition. The product structure is constructed via three macrocyclizations catalyzed sequentially by two members of the ATP-grasp family, a unique strategy for ribosomal peptide macrocyclization. Here we describe in detail the structural basis for the enzyme-catalyzed macrocyclizations in the microviridin J pathway of Microcystis aeruginosa. The macrocyclases MdnC and MdnB interact with a conserved α-helix of the precursor peptide using a novel precursor-peptide recognition mechanism. The results provide insight into the unique protein-protein interactions that are key to the chemistry, suggest an origin for the natural combinatorial synthesis of microviridin peptides, and provide a framework for future engineering efforts to generate designed compounds.
Inter-cellular transport of ran GTPase.
Directory of Open Access Journals (Sweden)
Deepak Khuperkar
Full Text Available Ran, a member of the Ras-GTPase superfamily, has a well-established role in regulating the transport of macromolecules across the nuclear envelope (NE. Ran has also been implicated in mitosis, cell cycle progression, and NE formation. Over-expression of Ran is associated with various cancers, although the molecular mechanism underlying this phenomenon is unclear. Serendipitously, we found that Ran possesses the ability to move from cell-to-cell when transiently expressed in mammalian cells. Moreover, we show that the inter-cellular transport of Ran is GTP-dependent. Importantly, Ran displays a similar distribution pattern in the recipient cells as that in the donor cell and co-localizes with the Ran binding protein Nup358 (also called RanBP2. Interestingly, leptomycin B, an inhibitor of CRM1-mediated export, or siRNA mediated depletion of CRM1, significantly impaired the inter-cellular transport of Ran, suggesting a function for CRM1 in this process. These novel findings indicate a possible role for Ran beyond nucleo-cytoplasmic transport, with potential implications in inter-cellular communication and cancers.
Modeling the mechanisms of biological GTP hydrolysis
DEFF Research Database (Denmark)
Carvalho, Alexandra T.P.; Szeler, Klaudia; Vavitsas, Konstantinos
2015-01-01
Enzymes that hydrolyze GTP are currently in the spotlight, due to their molecular switch mechanism that controls many cellular processes. One of the best-known classes of these enzymes are small GTPases such as members of the Ras superfamily, which catalyze the hydrolysis of the γ-phosphate bond...... in GTP. In addition, the availability of an increasing number of crystal structures of translational GTPases such as EF-Tu and EF-G have made it possible to probe the molecular details of GTP hydrolysis on the ribosome. However, despite a wealth of biochemical, structural and computational data, the way...
The complete structure of the large subunit of the mammalian mitochondrial ribosome.
Greber, Basil J; Boehringer, Daniel; Leibundgut, Marc; Bieri, Philipp; Leitner, Alexander; Schmitz, Nikolaus; Aebersold, Ruedi; Ban, Nenad
2014-11-13
Mitochondrial ribosomes (mitoribosomes) are extensively modified ribosomes of bacterial descent specialized for the synthesis and insertion of membrane proteins that are critical for energy conversion and ATP production inside mitochondria. Mammalian mitoribosomes, which comprise 39S and 28S subunits, have diverged markedly from the bacterial ribosomes from which they are derived, rendering them unique compared to bacterial, eukaryotic cytosolic and fungal mitochondrial ribosomes. We have previously determined at 4.9 Å resolution the architecture of the porcine (Sus scrofa) 39S subunit, which is highly homologous to the human mitoribosomal large subunit. Here we present the complete atomic structure of the porcine 39S large mitoribosomal subunit determined in the context of a stalled translating mitoribosome at 3.4 Å resolution by cryo-electron microscopy and chemical crosslinking/mass spectrometry. The structure reveals the locations and the detailed folds of 50 mitoribosomal proteins, shows the highly conserved mitoribosomal peptidyl transferase active site in complex with its substrate transfer RNAs, and defines the path of the nascent chain in mammalian mitoribosomes along their idiosyncratic exit tunnel. Furthermore, we present evidence that a mitochondrial tRNA has become an integral component of the central protuberance of the 39S subunit where it architecturally substitutes for the absence of the 5S ribosomal RNA, a ubiquitous component of all cytoplasmic ribosomes.
International Nuclear Information System (INIS)
Denslow, N.D.; O'Brien, T.W.
1984-01-01
To assess the relative exposure of individual ribosomal proteins (r-proteins) in the large and small subunits of the bovine mitochondrial ribosome, double label iodination technique was used. Regions of r-proteins exposed in purified ribosomal subunits were labeled with 131 I using the lactoperoxidase-catalyzed iodination system, and additional reactive groups available upon denaturing the r-proteins in urea were labeled with 125 I using the chloramine-T mediated reaction. The ratio of 131 I to 125 I incorporated into individual proteins under these conditions is representative of the degree of exposure for each of the proteins in the subunits. In this manner, the r-proteins have been grouped into 3 classes depending on their degree of exposure: high exposure, intermediate exposure, and essentially buried. While both subunits have a few proteins in the highly exposed group, and a large number of proteins in the intermediate exposure group, only the large ribosomal subunit has an appreciable number of proteins which appear essentially buried. The more buried proteins may serve mainly structural roles, perhaps acting as assembly proteins, since many from this group bind to ribosomal RNA. The more superficially disposed proteins may comprise binding sites for macromolecules that interact with ribosomes during protein synthesis, as well as stabilizing the association of the large and small subribosomal particles
Molecular dynamics simulation of ribosome jam
Matsumoto, Shigenori; Takagi, Fumiko; Shimada, Takashi; Ito, Nobuyasu
2011-01-01
We propose a coarse-grained molecular dynamics model of ribosome molecules to study the dependence of translation process on environmental parameters. We found the model exhibits traffic jam property, which is consistent with an ASEP model. We
Sugiyama, Yuki; Wakazaki, Mayumi; Toyooka, Kiminori; Fukuda, Hiroo; Oda, Yoshihisa
2017-08-21
Spatial control of cell-wall deposition is essential for determining plant cell shape [1]. Rho-type GTPases, together with the cortical cytoskeleton, play central roles in regulating cell-wall patterning [2]. In metaxylem vessel cells, which are the major components of xylem tissues, active ROP11 Rho GTPases form oval plasma membrane domains that locally disrupt cortical microtubules, thereby directing the formation of oval pits in secondary cell walls [3-5]. However, the regulatory mechanism that determines the planar shape of active Rho of Plants (ROP) domains is still unknown. Here we show that IQD13 associates with cortical microtubules and the plasma membrane to laterally restrict the localization of ROP GTPase domains, thereby directing the formation of oval secondary cell-wall pits. Loss and overexpression of IQD13 led to the formation of abnormally round and narrow secondary cell-wall pits, respectively. Ectopically expressed IQD13 increased the presence of parallel cortical microtubules by promoting microtubule rescue. A reconstructive approach revealed that IQD13 confines the area of active ROP domains within the lattice of the cortical microtubules, causing narrow ROP domains to form. This activity required the interaction of IQD13 with the plasma membrane. These findings suggest that IQD13 positively regulates microtubule dynamics as well as their linkage to the plasma membrane, which synergistically confines the area of active ROP domains, leading to the formation of oval secondary cell-wall pits. This finding sheds light on the role of microtubule-plasma membrane linkage as a lateral fence that determines the planar shape of Rho GTPase domains. Copyright © 2017 Elsevier Ltd. All rights reserved.
Ribosome Profiling Reveals Pervasive Translation Outside of Annotated Protein-Coding Genes
Directory of Open Access Journals (Sweden)
Nicholas T. Ingolia
2014-09-01
Full Text Available Ribosome profiling suggests that ribosomes occupy many regions of the transcriptome thought to be noncoding, including 5′ UTRs and long noncoding RNAs (lncRNAs. Apparent ribosome footprints outside of protein-coding regions raise the possibility of artifacts unrelated to translation, particularly when they occupy multiple, overlapping open reading frames (ORFs. Here, we show hallmarks of translation in these footprints: copurification with the large ribosomal subunit, response to drugs targeting elongation, trinucleotide periodicity, and initiation at early AUGs. We develop a metric for distinguishing between 80S footprints and nonribosomal sources using footprint size distributions, which validates the vast majority of footprints outside of coding regions. We present evidence for polypeptide production beyond annotated genes, including the induction of immune responses following human cytomegalovirus (HCMV infection. Translation is pervasive on cytosolic transcripts outside of conserved reading frames, and direct detection of this expanded universe of translated products enables efforts at understanding how cells manage and exploit its consequences.
Ribosome slowed by mutation to streptomycin resistance. [Escherichia coli
Energy Technology Data Exchange (ETDEWEB)
Galas, D J; Branscomb, E W
1976-08-12
The effect of mutation to streptomycin resistance on the speed of polypeptide elongation in Escherichia coli was investigated. Translation speed was determined by measuring the time required for the first newly synthesized ..beta..-galactosidase molecules to appear after induction of the lactose operon. The results showed that ribosome speed is not a fixed parameter inherent to the protein synthetic apparatus, but a variable determined by the kinetics of translation and ultimately by the structure of the ribosome. (HLW)
Ribosomal stress induces L11- and p53-dependent apoptosis in mouse pluripotent stem cells.
Morgado-Palacin, Lucia; Llanos, Susana; Serrano, Manuel
2012-02-01
Ribosome biogenesis is the most demanding energetic process in proliferating cells and it is emerging as a critical sensor of cellular homeostasis. Upon disturbance of ribosome biogenesis, specific free ribosomal proteins, most notably L11, bind and inhibit Mdm2, resulting in activation of the tumor suppressor p53. This pathway has been characterized in somatic and cancer cells, but its function in embryonic pluripotent cells has remained unexplored. Here, we show that treatment with low doses of Actinomycin D or depletion of ribosomal protein L37, two well-established inducers of ribosomal stress, activate p53 in an L11-dependent manner in mouse embryonic stem cells (ESCs) and in induced pluripotent stem cells (iPSCs). Activation of p53 results in transcriptional induction of p53 targets, including p21, Mdm2, Pidd, Puma, Noxa and Bax. Finally, ribosomal stress elicits L11- and p53-dependent apoptosis in ESCs/iPSCs. These results extend to pluripotent cells the functionality of the ribosomal stress pathway and we speculate that this could be a relevant cellular checkpoint during early embryogenesis.
ABC-F Proteins Mediate Antibiotic Resistance through Ribosomal Protection.
Sharkey, Liam K R; Edwards, Thomas A; O'Neill, Alex J
2016-03-22
Members of the ABC-F subfamily of ATP-binding cassette proteins mediate resistance to a broad array of clinically important antibiotic classes that target the ribosome of Gram-positive pathogens. The mechanism by which these proteins act has been a subject of long-standing controversy, with two competing hypotheses each having gained considerable support: antibiotic efflux versus ribosomal protection. Here, we report on studies employing a combination of bacteriological and biochemical techniques to unravel the mechanism of resistance of these proteins, and provide several lines of evidence that together offer clear support to the ribosomal protection hypothesis. Of particular note, we show that addition of purified ABC-F proteins to anin vitrotranslation assay prompts dose-dependent rescue of translation, and demonstrate that such proteins are capable of displacing antibiotic from the ribosomein vitro To our knowledge, these experiments constitute the first direct evidence that ABC-F proteins mediate antibiotic resistance through ribosomal protection.IMPORTANCEAntimicrobial resistance ranks among the greatest threats currently facing human health. Elucidation of the mechanisms by which microorganisms resist the effect of antibiotics is central to understanding the biology of this phenomenon and has the potential to inform the development of new drugs capable of blocking or circumventing resistance. Members of the ABC-F family, which includelsa(A),msr(A),optr(A), andvga(A), collectively yield resistance to a broader range of clinically significant antibiotic classes than any other family of resistance determinants, although their mechanism of action has been controversial since their discovery 25 years ago. Here we present the first direct evidence that proteins of the ABC-F family act to protect the bacterial ribosome from antibiotic-mediated inhibition. Copyright © 2016 Sharkey et al.
Fluctuations in protein synthesis from a single RNA template: stochastic kinetics of ribosomes.
Garai, Ashok; Chowdhury, Debashish; Ramakrishnan, T V
2009-01-01
Proteins are polymerized by cyclic machines called ribosomes, which use their messenger RNA (mRNA) track also as the corresponding template, and the process is called translation. We explore, in depth and detail, the stochastic nature of the translation. We compute various distributions associated with the translation process; one of them--namely, the dwell time distribution--has been measured in recent single-ribosome experiments. The form of the distribution, which fits best with our simulation data, is consistent with that extracted from the experimental data. For our computations, we use a model that captures both the mechanochemistry of each individual ribosome and their steric interactions. We also demonstrate the effects of the sequence inhomogeneities of real genes on the fluctuations and noise in translation. Finally, inspired by recent advances in the experimental techniques of manipulating single ribosomes, we make theoretical predictions on the force-velocity relation for individual ribosomes. In principle, all our predictions can be tested by carrying out in vitro experiments.
Kimura, M; Kimura, J; Hatakeyama, T
1988-11-21
The complete amino acid sequences of ribosomal proteins S11 from the Gram-positive eubacterium Bacillus stearothermophilus and of S19 from the archaebacterium Halobacterium marismortui have been determined. A search for homologous sequences of these proteins revealed that they belong to the ribosomal protein S11 family. Homologous proteins have previously been sequenced from Escherichia coli as well as from chloroplast, yeast and mammalian ribosomes. A pairwise comparison of the amino acid sequences showed that Bacillus protein S11 shares 68% identical residues with S11 from Escherichia coli and a slightly lower homology (52%) with the homologous chloroplast protein. The halophilic protein S19 is more related to the eukaryotic (45-49%) than to the eubacterial counterparts (35%).
The ribosome-associated complex antagonizes prion formation in yeast.
Amor, Alvaro J; Castanzo, Dominic T; Delany, Sean P; Selechnik, Daniel M; van Ooy, Alex; Cameron, Dale M
2015-01-01
The number of known fungal proteins capable of switching between alternative stable conformations is steadily increasing, suggesting that a prion-like mechanism may be broadly utilized as a means to propagate altered cellular states. To gain insight into the mechanisms by which cells regulate prion formation and toxicity we examined the role of the yeast ribosome-associated complex (RAC) in modulating both the formation of the [PSI(+)] prion - an alternative conformer of Sup35 protein - and the toxicity of aggregation-prone polypeptides. The Hsp40 RAC chaperone Zuo1 anchors the RAC to ribosomes and stimulates the ATPase activity of the Hsp70 chaperone Ssb. We found that cells lacking Zuo1 are sensitive to over-expression of some aggregation-prone proteins, including the Sup35 prion domain, suggesting that co-translational protein misfolding increases in Δzuo1 strains. Consistent with this finding, Δzuo1 cells exhibit higher frequencies of spontaneous and induced prion formation. Cells expressing mutant forms of Zuo1 lacking either a C-terminal charged region required for ribosome association, or the J-domain responsible for Ssb ATPase stimulation, exhibit similarly high frequencies of prion formation. Our findings are consistent with a role for the RAC in chaperoning nascent Sup35 to regulate folding of the N-terminal prion domain as it emerges from the ribosome.
Protein folding on the ribosome studied using NMR spectroscopy
Waudby, Christopher A.; Launay, Hélène; Cabrita, Lisa D.; Christodoulou, John
2013-01-01
NMR spectroscopy is a powerful tool for the investigation of protein folding and misfolding, providing a characterization of molecular structure, dynamics and exchange processes, across a very wide range of timescales and with near atomic resolution. In recent years NMR methods have also been developed to study protein folding as it might occur within the cell, in a de novo manner, by observing the folding of nascent polypeptides in the process of emerging from the ribosome during synthesis. Despite the 2.3 MDa molecular weight of the bacterial 70S ribosome, many nascent polypeptides, and some ribosomal proteins, have sufficient local flexibility that sharp resonances may be observed in solution-state NMR spectra. In providing information on dynamic regions of the structure, NMR spectroscopy is therefore highly complementary to alternative methods such as X-ray crystallography and cryo-electron microscopy, which have successfully characterized the rigid core of the ribosome particle. However, the low working concentrations and limited sample stability associated with ribosome–nascent chain complexes means that such studies still present significant technical challenges to the NMR spectroscopist. This review will discuss the progress that has been made in this area, surveying all NMR studies that have been published to date, and with a particular focus on strategies for improving experimental sensitivity. PMID:24083462
The subcellular distribution of the human ribosomal "stalk" components: P1, P2 and P0 proteins
DEFF Research Database (Denmark)
Tchórzewski, Marek; Krokowski, Dawid; Rzeski, Wojciech
2003-01-01
The ribosomal "stalk" structure is a distinct lateral protuberance located on the large ribosomal subunit in prokaryotic, as well as in eukaryotic cells. In eukaryotes, this ribosomal structure is composed of the acidic ribosomal P proteins, forming two hetero-dimers (P1/P2) attached...
sORFs.org: a repository of small ORFs identified by ribosome profiling.
Olexiouk, Volodimir; Crappé, Jeroen; Verbruggen, Steven; Verhegen, Kenneth; Martens, Lennart; Menschaert, Gerben
2016-01-04
With the advent of ribosome profiling, a next generation sequencing technique providing a "snap-shot'' of translated mRNA in a cell, many short open reading frames (sORFs) with ribosomal activity were identified. Follow-up studies revealed the existence of functional peptides, so-called micropeptides, translated from these 'sORFs', indicating a new class of bio-active peptides. Over the last few years, several micropeptides exhibiting important cellular functions were discovered. However, ribosome occupancy does not necessarily imply an actual function of the translated peptide, leading to the development of various tools assessing the coding potential of sORFs. Here, we introduce sORFs.org (http://www.sorfs.org), a novel database for sORFs identified using ribosome profiling. Starting from ribosome profiling, sORFs.org identifies sORFs, incorporates state-of-the-art tools and metrics and stores results in a public database. Two query interfaces are provided, a default one enabling quick lookup of sORFs and a BioMart interface providing advanced query and export possibilities. At present, sORFs.org harbors 263 354 sORFs that demonstrate ribosome occupancy, originating from three different cell lines: HCT116 (human), E14_mESC (mouse) and S2 (fruit fly). sORFs.org aims to provide an extensive sORFs database accessible to researchers with limited bioinformatics knowledge, thus enabling easy integration into personal projects. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
The importance of ribosome production, and the 5S RNP-MDM2 pathway, in health and disease.
Pelava, Andria; Schneider, Claudia; Watkins, Nicholas J
2016-08-15
Ribosomes are abundant, large RNA-protein complexes that are the source of all protein synthesis in the cell. The production of ribosomes is an extremely energetically expensive cellular process that has long been linked to human health and disease. More recently, it has been shown that ribosome biogenesis is intimately linked to multiple cellular signalling pathways and that defects in ribosome production can lead to a wide variety of human diseases. Furthermore, changes in ribosome production in response to nutrient levels in the diet lead to metabolic re-programming of the liver. Reduced or abnormal ribosome production in response to cellular stress or mutations in genes encoding factors critical for ribosome biogenesis causes the activation of the tumour suppressor p53, which leads to re-programming of cellular transcription. The ribosomal assembly intermediate 5S RNP (ribonucleoprotein particle), containing RPL5, RPL11 and the 5S rRNA, accumulates when ribosome biogenesis is blocked. The excess 5S RNP binds to murine double minute 2 (MDM2), the main p53-suppressor in the cell, inhibiting its function and leading to p53 activation. Here, we discuss the involvement of ribosome biogenesis in the homoeostasis of p53 in the cell and in human health and disease. © 2016 The Author(s).
International Nuclear Information System (INIS)
Oesterberg, R.; Garrett, A.
1977-01-01
The 5-S RNA (A) and the L 18 protein (B) from Escherichia coli ribosomes form one single AB complex in the concentration ranges supposed to prevail in vivo; at concentrations of L 18 higher than 40 mM there is some indication for a minor species, most probably an AB 2 species. This is indicated from the X-ray scattering titration data of the 5-S RNA/L 18 system recorded at 21 0 C in ribosomal reconstitution buffer. As a result of the 1 : 1 complex formation, there is a relatively small but defined increase in the radius of gyration from 3.61 to 3.85 nm. This result as well as the experimental scattering curve can be explained by models where it is assumed that the elongated L 18 model is quite far from the electron density centre and where protein L 18 interacts with one or both of the minor arms of the supposed Y-shaped 5-S RNA molecule. (orig.) [de
DEFF Research Database (Denmark)
Llavero, Francisco; Urzelai, Bakarne; Osinalde, Nerea
2015-01-01
Recently, we have reported that the active form of Rac 1 GTPase binds to the glycogen phosphorylase muscle isoform (PYGM) and modulates its enzymatic activity leading to T cell proliferation. In the lymphoid system, Rac 1 and in general other small GTPases of the Rho family participate...... in the signaling cascades that are activated after engagement of the T cell antigen receptor. However, little is known about the IL-2-dependent Rac 1 activator molecules. For the first time, a signaling pathway leading to the activation of Rac 1/PYGM in response to IL-2-stimulated T cell proliferation is described....... More specifically, αPIX, a known guanine nucleotide exchange factor for the small GTPases of the Rho family, preferentially Rac 1, mediates PYGM activation in Kit 225 T cells stimulated with IL-2. Using directed mutagenesis, phosphorylation of αPIX Rho-GEF serines 225 and 488 is required for activation...
The nuclear import of ribosomal proteins is regulated by mTOR
Kazyken, Dubek; Kaz, Yelimbek; Kiyan, Vladimir; Zhylkibayev, Assylbek A.; Chen, Chien-Hung; Agarwal, Nitin K.; Sarbassov, Dos D.
2014-01-01
Mechanistic target of rapamycin (mTOR) is a central component of the essential signaling pathway that regulates cell growth and proliferation by controlling anabolic processes in cells. mTOR exists in two distinct mTOR complexes known as mTORC1 and mTORC2 that reside mostly in cytoplasm. In our study, the biochemical characterization of mTOR led to discovery of its novel localization on nuclear envelope where it associates with a critical regulator of nuclear import Ran Binding Protein 2 (RanBP2). We show that association of mTOR with RanBP2 is dependent on the mTOR kinase activity that regulates the nuclear import of ribosomal proteins. The mTOR kinase inhibitors within thirty minutes caused a substantial decrease of ribosomal proteins in the nuclear but not cytoplasmic fraction. Detection of a nuclear accumulation of the GFP-tagged ribosomal protein rpL7a also indicated its dependence on the mTOR kinase activity. The nuclear abundance of ribosomal proteins was not affected by inhibition of mTOR Complex 1 (mTORC1) by rapamycin or deficiency of mTORC2, suggesting a distinctive role of the nuclear envelope mTOR complex in the nuclear import. Thus, we identified that mTOR in association with RanBP2 mediates the active nuclear import of ribosomal proteins. PMID:25294810
5SRNAdb: an information resource for 5S ribosomal RNAs.
Szymanski, Maciej; Zielezinski, Andrzej; Barciszewski, Jan; Erdmann, Volker A; Karlowski, Wojciech M
2016-01-04
Ribosomal 5S RNA (5S rRNA) is the ubiquitous RNA component found in the large subunit of ribosomes in all known organisms. Due to its small size, abundance and evolutionary conservation 5S rRNA for many years now is used as a model molecule in studies on RNA structure, RNA-protein interactions and molecular phylogeny. 5SRNAdb (http://combio.pl/5srnadb/) is the first database that provides a high quality reference set of ribosomal 5S RNAs (5S rRNA) across three domains of life. Here, we give an overview of new developments in the database and associated web tools since 2002, including updates to database content, curation processes and user web interfaces. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
Dobrenel, Thomas; Mancera-Martínez, Eder; Forzani, Céline; Azzopardi, Marianne; Davanture, Marlène; Moreau, Manon; Schepetilnikov, Mikhail; Chicher, Johana; Langella, Olivier; Zivy, Michel; Robaglia, Christophe; Ryabova, Lyubov A; Hanson, Johannes; Meyer, Christian
2016-01-01
Protein translation is an energy consuming process that has to be fine-tuned at both the cell and organism levels to match the availability of resources. The target of rapamycin kinase (TOR) is a key regulator of a large range of biological processes in response to environmental cues. In this study, we have investigated the effects of TOR inactivation on the expression and regulation of Arabidopsis ribosomal proteins at different levels of analysis, namely from transcriptomic to phosphoproteomic. TOR inactivation resulted in a coordinated down-regulation of the transcription and translation of nuclear-encoded mRNAs coding for plastidic ribosomal proteins, which could explain the chlorotic phenotype of the TOR silenced plants. We have identified in the 5' untranslated regions (UTRs) of this set of genes a conserved sequence related to the 5' terminal oligopyrimidine motif, which is known to confer translational regulation by the TOR kinase in other eukaryotes. Furthermore, the phosphoproteomic analysis of the ribosomal fraction following TOR inactivation revealed a lower phosphorylation of the conserved Ser240 residue in the C-terminal region of the 40S ribosomal protein S6 (RPS6). These results were confirmed by Western blot analysis using an antibody that specifically recognizes phosphorylated Ser240 in RPS6. Finally, this antibody was used to follow TOR activity in plants. Our results thus uncover a multi-level regulation of plant ribosomal genes and proteins by the TOR kinase.
DEFF Research Database (Denmark)
Karabiyik, Cansu; Fernandes, Rui; Figueiredo, Francisco Rosário
2018-01-01
The Rho GTPase Rac1 is a multifunctional protein involved in distinct pathways ranging from development to pathology. The aim of the present study was to unravel the contribution of neuronal Rac1 in regulating the response to brain injury induced by permanent focal cerebral ischemia (pMCAO). Our ...
DEFF Research Database (Denmark)
Karabiyik, Cansu; Fernandes, Rui; Figueiredo, Francisci Rosário
2017-01-01
The Rho GTPase Rac1 is a multifunctional protein involved in distinct pathways ranging from development to pathology. The aim of the present study was to unravel the contribution of neuronal Rac1 in regulating the response to brain injury induced by permanent focal cerebral ischemia (pMCAO). Our ...
DEFF Research Database (Denmark)
Böhm, Johann; Biancalana, Valérie; Dechene, Elizabeth T
2012-01-01
Centronuclear myopathy (CNM) is a genetically heterogeneous disorder associated with general skeletal muscle weakness, type I fiber predominance and atrophy, and abnormally centralized nuclei. Autosomal dominant CNM is due to mutations in the large GTPase dynamin 2 (DNM2), a mechanochemical enzym...
Directory of Open Access Journals (Sweden)
Sayaka Tsuji
2017-07-01
Full Text Available Ribosome composition, consisting of rRNA and ribosomal proteins, is highly conserved among a broad range of organisms. However, biochemical studies focusing on ribosomal subunit exchangeability between organisms remain limited. In this study, we show that chimeric ribosomes, composed of Escherichia coli and Bacillus subtilis or E. coli and Geobacillus stearothermophilus subunits, are active for β-galactosidase translation in a highly purified E. coli translation system. Activities of the chimeric ribosomes showed only a modest decrease when using E. coli 30 S subunits, indicating functional conservation of the 50 S subunit between these bacterial species.
Human nucleolus organizers on nonhomologous chromosomes can share the same ribosomal gene variants.
Krystal, M; D'Eustachio, P; Ruddle, F H; Arnheim, N
1981-01-01
The distributions of three human ribosomal gene polymorphisms among individual chromosomes containing nucleolus organizers were analyzed by using mouse--human hybrid cells. Different nucleolus organizers can contain the same variant, suggesting the occurrence of genetic exchanges among ribosomal gene clusters on nonhomologous chromosomes. Such exchanges appear to occur less frequently in mice. This difference is discussed in terms of the nucleolar organization and chromosomal location of ribosomal gene clusters in humans and mice. Images PMID:6272316
Multi-perspective smFRET reveals rate-determining late intermediates of ribosomal translocation
Wasserman, Michael R.; Alejo, Jose L.; Altman, Roger B.; Blanchard, Scott C.
2016-01-01
Directional translocation of the ribosome through the messenger RNA open reading frame is a critical determinant of translational fidelity. This process entails a complex interplay of large-scale conformational changes within the actively translating particle, which together coordinate the movement of transfer and messenger RNA substrates with respect to the large and small ribosomal subunits. Using pre-steady state, single-molecule fluorescence resonance energy transfer imaging, we have tracked the nature and timing of these conformational events within the Escherichia coli ribosome from five structural perspectives. Our investigations reveal direct evidence of structurally and kinetically distinct, late intermediates during substrate movement, whose resolution is rate-determining to the translocation mechanism. These steps involve intra-molecular events within the EFG(GDP)-bound ribosome, including exaggerated, reversible fluctuations of the small subunit head domain, which ultimately facilitate peptidyl-tRNA’s movement into its final post-translocation position. PMID:26926435
Site-specific fluorescent labeling of nascent proteins on the translating ribosome.
Saraogi, Ishu; Zhang, Dawei; Chandrasekaran, Sandhya; Shan, Shu-ou
2011-09-28
As newly synthesized proteins emerge from the ribosome, they interact with a variety of cotranslational cellular machineries that facilitate their proper folding, maturation, and localization. These interactions are essential for proper function of the cell, and the ability to study these events is crucial to understanding cellular protein biogenesis. To this end, we have developed a highly efficient method to generate ribosome-nascent chain complexes (RNCs) site-specifically labeled with a fluorescent dye on the nascent polypeptide. The fluorescent RNC provides real-time, quantitative information on its cotranslational interaction with the signal recognition particle and will be a valuable tool in elucidating the role of the translating ribosome in numerous biochemical pathways.
Thermus Thermophilus as a Model System for the Study of Ribosomal Antibiotic Resistance
Gregory, Steven T.
2018-03-01
Ribosomes are the intracellular ribonucleoprotein machines responsible for the translation of mRNA sequence into protein sequence. As an essential cell component, the ribosome is the target of numerous antibiotics that bind to critical functional sites to impair protein synthesis. Mutations causing resistance to antibiotics arise in antibiotic binding sites, and an understanding of the basis of resistance will be an essential component of efforts to develop new antibiotics by rational drug design. We have identified a number of antibiotic-resistance mutations in ribosomal genes of the thermophilic bacterium Thermus thermophilus. This species offers two primary advantages for examining the structural basis of antibiotic-resistance, in particular, its potential for genetic manipulation and the suitability of its ribosomes for analysis by X-ray crystallography. Mutations we have identified in this organism are in many instances identical to those found in other bacterial species, including important pathogens, a result of the extreme conservation of ribosome functional sites. Here I summarize the advantages of this organism as a model system to study antibiotic-resistance mechanisms at the molecular level.
The 5S RNP couples p53 homeostasis to ribosome biogenesis and nucleolar stress.
Sloan, Katherine E; Bohnsack, Markus T; Watkins, Nicholas J
2013-10-17
Several proto-oncogenes and tumor suppressors regulate the production of ribosomes. Ribosome biogenesis is a major consumer of cellular energy, and defects result in p53 activation via repression of mouse double minute 2 (MDM2) homolog by the ribosomal proteins RPL5 and RPL11. Here, we report that RPL5 and RPL11 regulate p53 from the context of a ribosomal subcomplex, the 5S ribonucleoprotein particle (RNP). We provide evidence that the third component of this complex, the 5S rRNA, is critical for p53 regulation. In addition, we show that the 5S RNP is essential for the activation of p53 by p14(ARF), a protein that is activated by oncogene overexpression. Our data show that the abundance of the 5S RNP, and therefore p53 levels, is determined by factors regulating 5S complex formation and ribosome integration, including the tumor suppressor PICT1. The 5S RNP therefore emerges as the critical coordinator of signaling pathways that couple cell proliferation with ribosome production. Copyright © 2013 The Authors. Published by Elsevier Inc. All rights reserved.
rRNA maturation in yeast cells depleted of large ribosomal subunit proteins.
Directory of Open Access Journals (Sweden)
Gisela Pöll
Full Text Available The structural constituents of the large eukaryotic ribosomal subunit are 3 ribosomal RNAs, namely the 25S, 5.8S and 5S rRNA and about 46 ribosomal proteins (r-proteins. They assemble and mature in a highly dynamic process that involves more than 150 proteins and 70 small RNAs. Ribosome biogenesis starts in the nucleolus, continues in the nucleoplasm and is completed after nucleo-cytoplasmic translocation of the subunits in the cytoplasm. In this work we created 26 yeast strains, each of which conditionally expresses one of the large ribosomal subunit (LSU proteins. In vivo depletion of the analysed LSU r-proteins was lethal and led to destabilisation and degradation of the LSU and/or its precursors. Detailed steady state and metabolic pulse labelling analyses of rRNA precursors in these mutant strains showed that LSU r-proteins can be grouped according to their requirement for efficient progression of different steps of large ribosomal subunit maturation. Comparative analyses of the observed phenotypes and the nature of r-protein-rRNA interactions as predicted by current atomic LSU structure models led us to discuss working hypotheses on i how individual r-proteins control the productive processing of the major 5' end of 5.8S rRNA precursors by exonucleases Rat1p and Xrn1p, and ii the nature of structural characteristics of nascent LSUs that are required for cytoplasmic accumulation of nascent subunits but are nonessential for most of the nuclear LSU pre-rRNA processing events.
Erales, Jenny; Marchand, Virginie; Panthu, Baptiste; Gillot, Sandra; Belin, Stéphane; Ghayad, Sandra E; Garcia, Maxime; Laforêts, Florian; Marcel, Virginie; Baudin-Baillieu, Agnès; Bertin, Pierre; Couté, Yohann; Adrait, Annie; Meyer, Mélanie; Therizols, Gabriel; Yusupov, Marat; Namy, Olivier; Ohlmann, Théophile; Motorin, Yuri; Catez, Frédéric; Diaz, Jean-Jacques
2017-12-05
Ribosomal RNAs (rRNAs) are main effectors of messenger RNA (mRNA) decoding, peptide-bond formation, and ribosome dynamics during translation. Ribose 2'-O-methylation (2'-O-Me) is the most abundant rRNA chemical modification, and displays a complex pattern in rRNA. 2'-O-Me was shown to be essential for accurate and efficient protein synthesis in eukaryotic cells. However, whether rRNA 2'-O-Me is an adjustable feature of the human ribosome and a means of regulating ribosome function remains to be determined. Here we challenged rRNA 2'-O-Me globally by inhibiting the rRNA methyl-transferase fibrillarin in human cells. Using RiboMethSeq, a nonbiased quantitative mapping of 2'-O-Me, we identified a repertoire of 2'-O-Me sites subjected to variation and demonstrate that functional domains of ribosomes are targets of 2'-O-Me plasticity. Using the cricket paralysis virus internal ribosome entry site element, coupled to in vitro translation, we show that the intrinsic capability of ribosomes to translate mRNAs is modulated through a 2'-O-Me pattern and not by nonribosomal actors of the translational machinery. Our data establish rRNA 2'-O-Me plasticity as a mechanism providing functional specificity to human ribosomes.
High-Resolution Analysis of Coronavirus Gene Expression by RNA Sequencing and Ribosome Profiling.
Irigoyen, Nerea; Firth, Andrew E; Jones, Joshua D; Chung, Betty Y-W; Siddell, Stuart G; Brierley, Ian
2016-02-01
Members of the family Coronaviridae have the largest genomes of all RNA viruses, typically in the region of 30 kilobases. Several coronaviruses, such as Severe acute respiratory syndrome-related coronavirus (SARS-CoV) and Middle East respiratory syndrome-related coronavirus (MERS-CoV), are of medical importance, with high mortality rates and, in the case of SARS-CoV, significant pandemic potential. Other coronaviruses, such as Porcine epidemic diarrhea virus and Avian coronavirus, are important livestock pathogens. Ribosome profiling is a technique which exploits the capacity of the translating ribosome to protect around 30 nucleotides of mRNA from ribonuclease digestion. Ribosome-protected mRNA fragments are purified, subjected to deep sequencing and mapped back to the transcriptome to give a global "snap-shot" of translation. Parallel RNA sequencing allows normalization by transcript abundance. Here we apply ribosome profiling to cells infected with Murine coronavirus, mouse hepatitis virus, strain A59 (MHV-A59), a model coronavirus in the same genus as SARS-CoV and MERS-CoV. The data obtained allowed us to study the kinetics of virus transcription and translation with exquisite precision. We studied the timecourse of positive and negative-sense genomic and subgenomic viral RNA production and the relative translation efficiencies of the different virus ORFs. Virus mRNAs were not found to be translated more efficiently than host mRNAs; rather, virus translation dominates host translation at later time points due to high levels of virus transcripts. Triplet phasing of the profiling data allowed precise determination of translated reading frames and revealed several translated short open reading frames upstream of, or embedded within, known virus protein-coding regions. Ribosome pause sites were identified in the virus replicase polyprotein pp1a ORF and investigated experimentally. Contrary to expectations, ribosomes were not found to pause at the ribosomal
High-Resolution Analysis of Coronavirus Gene Expression by RNA Sequencing and Ribosome Profiling.
Directory of Open Access Journals (Sweden)
Nerea Irigoyen
2016-02-01
Full Text Available Members of the family Coronaviridae have the largest genomes of all RNA viruses, typically in the region of 30 kilobases. Several coronaviruses, such as Severe acute respiratory syndrome-related coronavirus (SARS-CoV and Middle East respiratory syndrome-related coronavirus (MERS-CoV, are of medical importance, with high mortality rates and, in the case of SARS-CoV, significant pandemic potential. Other coronaviruses, such as Porcine epidemic diarrhea virus and Avian coronavirus, are important livestock pathogens. Ribosome profiling is a technique which exploits the capacity of the translating ribosome to protect around 30 nucleotides of mRNA from ribonuclease digestion. Ribosome-protected mRNA fragments are purified, subjected to deep sequencing and mapped back to the transcriptome to give a global "snap-shot" of translation. Parallel RNA sequencing allows normalization by transcript abundance. Here we apply ribosome profiling to cells infected with Murine coronavirus, mouse hepatitis virus, strain A59 (MHV-A59, a model coronavirus in the same genus as SARS-CoV and MERS-CoV. The data obtained allowed us to study the kinetics of virus transcription and translation with exquisite precision. We studied the timecourse of positive and negative-sense genomic and subgenomic viral RNA production and the relative translation efficiencies of the different virus ORFs. Virus mRNAs were not found to be translated more efficiently than host mRNAs; rather, virus translation dominates host translation at later time points due to high levels of virus transcripts. Triplet phasing of the profiling data allowed precise determination of translated reading frames and revealed several translated short open reading frames upstream of, or embedded within, known virus protein-coding regions. Ribosome pause sites were identified in the virus replicase polyprotein pp1a ORF and investigated experimentally. Contrary to expectations, ribosomes were not found to pause at the
Directory of Open Access Journals (Sweden)
Giulio Donati
2013-07-01
Full Text Available Recently, we demonstrated that RPL5 and RPL11 act in a mutually dependent manner to inhibit Hdm2 and stabilize p53 following impaired ribosome biogenesis. Given that RPL5 and RPL11 form a preribosomal complex with noncoding 5S ribosomal RNA (rRNA and the three have been implicated in the p53 response, we reasoned they may be part of an Hdm2-inhibitory complex. Here, we show that small interfering RNAs directed against 5S rRNA have no effect on total or nascent levels of the noncoding rRNA, though they prevent the reported Hdm4 inhibition of p53. To achieve efficient inhibition of 5S rRNA synthesis, we targeted TFIIIA, a specific RNA polymerase III cofactor, which, like depletion of either RPL5 or RPL11, did not induce p53. Instead, 5S rRNA acts in a dependent manner with RPL5 and RPL11 to inhibit Hdm2 and stabilize p53. Moreover, depletion of any one of the three components abolished the binding of the other two to Hdm2, explaining their common dependence. Finally, we demonstrate that the RPL5/RPL11/5S rRNA preribosomal complex is redirected from assembly into nascent 60S ribosomes to Hdm2 inhibition as a consequence of impaired ribosome biogenesis. Thus, the activation of the Hdm2-inhibitory complex is not a passive but a regulated event, whose potential role in tumor suppression has been recently noted.
Donati, Giulio; Peddigari, Suresh; Mercer, Carol A; Thomas, George
2013-07-11
Recently, we demonstrated that RPL5 and RPL11 act in a mutually dependent manner to inhibit Hdm2 and stabilize p53 following impaired ribosome biogenesis. Given that RPL5 and RPL11 form a preribosomal complex with noncoding 5S ribosomal RNA (rRNA) and the three have been implicated in the p53 response, we reasoned they may be part of an Hdm2-inhibitory complex. Here, we show that small interfering RNAs directed against 5S rRNA have no effect on total or nascent levels of the noncoding rRNA, though they prevent the reported Hdm4 inhibition of p53. To achieve efficient inhibition of 5S rRNA synthesis, we targeted TFIIIA, a specific RNA polymerase III cofactor, which, like depletion of either RPL5 or RPL11, did not induce p53. Instead, 5S rRNA acts in a dependent manner with RPL5 and RPL11 to inhibit Hdm2 and stabilize p53. Moreover, depletion of any one of the three components abolished the binding of the other two to Hdm2, explaining their common dependence. Finally, we demonstrate that the RPL5/RPL11/5S rRNA preribosomal complex is redirected from assembly into nascent 60S ribosomes to Hdm2 inhibition as a consequence of impaired ribosome biogenesis. Thus, the activation of the Hdm2-inhibitory complex is not a passive but a regulated event, whose potential role in tumor suppression has been recently noted. Copyright © 2013 The Authors. Published by Elsevier Inc. All rights reserved.
Ribosomal mutations promote the evolution of antibiotic resistance in a multidrug environment.
Gomez, James E; Kaufmann-Malaga, Benjamin B; Wivagg, Carl N; Kim, Peter B; Silvis, Melanie R; Renedo, Nikolai; Ioerger, Thomas R; Ahmad, Rushdy; Livny, Jonathan; Fishbein, Skye; Sacchettini, James C; Carr, Steven A; Hung, Deborah T
2017-02-21
Antibiotic resistance arising via chromosomal mutations is typically specific to a particular antibiotic or class of antibiotics. We have identified mutations in genes encoding ribosomal components in Mycobacterium smegmatis that confer resistance to several structurally and mechanistically unrelated classes of antibiotics and enhance survival following heat shock and membrane stress. These mutations affect ribosome assembly and cause large-scale transcriptomic and proteomic changes, including the downregulation of the catalase KatG, an activating enzyme required for isoniazid sensitivity, and upregulation of WhiB7, a transcription factor involved in innate antibiotic resistance. Importantly, while these ribosomal mutations have a fitness cost in antibiotic-free medium, in a multidrug environment they promote the evolution of high-level, target-based resistance. Further, suppressor mutations can then be easily acquired to restore wild-type growth. Thus, ribosomal mutations can serve as stepping-stones in an evolutionary path leading to the emergence of high-level, multidrug resistance.
Pech, Markus; Spreter, Thomas; Beckmann, Roland; Beatrix, Birgitta
2010-06-18
Nascent polypeptide-associated complex (NAC) was identified in eukaryotes as the first cytosolic factor that contacts the nascent polypeptide chain emerging from the ribosome. NAC is present as a homodimer in archaea and as a highly conserved heterodimer in eukaryotes. Mutations in NAC cause severe embryonically lethal phenotypes in mice, Drosophila melanogaster, and Caenorhabditis elegans. In the yeast Saccharomyces cerevisiae NAC is quantitatively associated with ribosomes. Here we show that NAC contacts several ribosomal proteins. The N terminus of betaNAC, however, specifically contacts near the tunnel exit ribosomal protein Rpl31, which is unique to eukaryotes and archaea. Moreover, the first 23 amino acids of betaNAC are sufficient to direct an otherwise non-associated protein to the ribosome. In contrast, alphaNAC (Egd2p) contacts Rpl17, the direct neighbor of Rpl31 at the ribosomal tunnel exit site. Rpl31 was also recently identified as a contact site for the SRP receptor and the ribosome-associated complex. Furthermore, in Escherichia coli peptide deformylase (PDF) interacts with the corresponding surface area on the eubacterial ribosome. In addition to the previously identified universal adapter site represented by Rpl25/Rpl35, we therefore refer to Rpl31/Rpl17 as a novel universal docking site for ribosome-associated factors on the eukaryotic ribosome.
Biphasic character of ribosomal translocation and non-Michaelis-Menten kinetics of translation
Xie, Ping
2014-12-01
We study theoretically the kinetics of mRNA translocation in the wild-type (WT) Escherichia coli ribosome, which is composed of a small 30 S and large 50 S subunit, and the ribosomes with mutations to some intersubunit bridges such as B1a, B4, B7a, and B8. The theoretical results reproduce well the available in vitro experimental data on the biphasic kinetics of the forward mRNA translocation catalyzed by elongation factor G (EF-G) hydrolyzing GTP, which can be best fit by the sum of two exponentials, and the monophasic kinetics of the spontaneous reverse mRNA translocation in the absence of the elongation factor, which can be best fit by a single-exponential function, in both the WT and mutant ribosomes. We show that both the mutation-induced increase in the maximal rate of the slow phase for the forward mRNA translocation and that in the rate of the spontaneous reverse mRNA translocation result from a reduction in the intrinsic energy barrier to resist the rotational movements between the two subunits, giving the same degree of increase in the two rates. The mutation-induced increase in the maximal rate of the fast phase for the forward mRNA translocation results mainly from the increase in the rate of the ribosomal unlocking, a conformational change in the ribosome that widens the mRNA channel for the mRNA translocation to take place, which could be partly due to the effect of the mutation on the intrasubunit 30S head rotation. Moreover, we study the translation rate of the WT and mutant ribosomes. It is shown that the translation rate versus the concentration of EF-G-GTP does not follow the Michaelis-Menten (MM) kinetics, which is in sharp contrast to the general property of other enzymes that the rate of the enzymatic reaction versus the concentration of a substrate follows the MM kinetics. The physical origin of this non-MM kinetics for the ribosome is revealed.
Ribosome evolution: Emergence of peptide synthesis machinery
Indian Academy of Sciences (India)
suggested the dynamic movement of ribosomal proteins. The L2 protein (a .... Such kinds of interactions are important in elucidating the evolution of RNA .... Tamura K 2009 Molecular handedness of life: significance of RNA aminoacylation.
Energy Technology Data Exchange (ETDEWEB)
Kolb, V A; Kammer, A A; Spirin, A S
1987-01-01
The method of tritium bombardment was applied to investigate exposure of growing peptide on the surface of ribsome E.coli. Distribution of radioactivity by fractions is presented. Tritium inclusion in all the aminoacid residues of heteropeptide testifies to its exposure on the surface of the ribosome.
RhoGDI: multiple functions in the regulation of Rho family GTPase activities
DEFF Research Database (Denmark)
Dovas, Athanassios; Couchman, John R
2005-01-01
necessary for the correct targeting and regulation of Rho activities by conferring cues for spatial restriction, guidance and availability to effectors. These potential functions are discussed in the context of RhoGDI-associated multimolecular complexes, the newly emerged shuttling capability...... insight as to how RhoGDI exerts its effects on nucleotide binding, the membrane association-dissociation cycling of the GTPase and how these activities are controlled. Despite the initial negative roles attributed to RhoGDI, recent evidence has come to suggest that it may also act as a positive regulator...... of activities....
Directory of Open Access Journals (Sweden)
Shirasawa Senji
2011-09-01
Full Text Available Abstract Background Colorectal cancer is a common disease that involves genetic alterations, such as inactivation of tumour suppressor genes and activation of oncogenes. Among them are RAS and BRAF mutations, which rarely coexist in the same tumour. Individual members of the Rho (Ras homology GTPases contribute with distinct roles in tumour cell morphology, invasion and metastasis. The aim of this study is to dissect cell migration and invasion pathways that are utilised by BRAFV600E as compared to KRASG12V and HRASG12V oncoproteins. In particular, the role of RhoA (Ras homolog gene family, member A, Rac1 (Ras-related C3 botulinum toxin substrate 1 and Cdc42 (cell division cycle 42 in cancer progression induced by each of the three oncogenes is described. Methods Colon adenocarcinoma cells with endogenous as well as ectopically expressed or silenced oncogenic mutations of BRAFV600E, KRASG12V and HRASG12V were employed. Signalling pathways and Rho GTPases were inhibited with specific kinase inhibitors and siRNAs. Cell motility and invasion properties were correlated with cytoskeletal properties and Rho GTPase activities. Results Evidence presented here indicate that BRAFV600E significantly induces cell migration and invasion properties in vitro in colon cancer cells, at least in part through activation of RhoA GTPase. The relationship established between BRAFV600E and RhoA activation is mediated by the MEK-ERK pathway. In parallel, KRASG12V enhances the ability of colon adenocarcinoma cells Caco-2 to migrate and invade through filopodia formation and PI3K-dependent Cdc42 activation. Ultimately increased cell migration and invasion, mediated by Rac1, along with the mesenchymal morphology obtained through the Epithelial-Mesenchymal Transition (EMT were the main characteristics rendered by HRASG12V in Caco-2 cells. Moreover, BRAF and KRAS oncogenes are shown to cooperate with the TGFβ-1 pathway to provide cells with additional transforming
Structural insights into methyltransferase KsgA function in 30S ribosomal subunit biogenesis.
Boehringer, Daniel; O'Farrell, Heather C; Rife, Jason P; Ban, Nenad
2012-03-23
The assembly of the ribosomal subunits is facilitated by ribosome biogenesis factors. The universally conserved methyltransferase KsgA modifies two adjacent adenosine residues in the 3'-terminal helix 45 of the 16 S ribosomal RNA (rRNA). KsgA recognizes its substrate adenosine residues only in the context of a near mature 30S subunit and is required for the efficient processing of the rRNA termini during ribosome biogenesis. Here, we present the cryo-EM structure of KsgA bound to a nonmethylated 30S ribosomal subunit. The structure reveals that KsgA binds to the 30S platform with the catalytic N-terminal domain interacting with substrate adenosine residues in helix 45 and the C-terminal domain making extensive contacts to helix 27 and helix 24. KsgA excludes the penultimate rRNA helix 44 from adopting its position in the mature 30S subunit, blocking the formation of the decoding site and subunit joining. We suggest that the activation of methyltransferase activity and subsequent dissociation of KsgA control conformational changes in helix 44 required for final rRNA processing and translation initiation.
Structural Insights into Methyltransferase KsgA Function in 30S Ribosomal Subunit Biogenesis*
Boehringer, Daniel; O'Farrell, Heather C.; Rife, Jason P.; Ban, Nenad
2012-01-01
The assembly of the ribosomal subunits is facilitated by ribosome biogenesis factors. The universally conserved methyltransferase KsgA modifies two adjacent adenosine residues in the 3′-terminal helix 45 of the 16 S ribosomal RNA (rRNA). KsgA recognizes its substrate adenosine residues only in the context of a near mature 30S subunit and is required for the efficient processing of the rRNA termini during ribosome biogenesis. Here, we present the cryo-EM structure of KsgA bound to a nonmethylated 30S ribosomal subunit. The structure reveals that KsgA binds to the 30S platform with the catalytic N-terminal domain interacting with substrate adenosine residues in helix 45 and the C-terminal domain making extensive contacts to helix 27 and helix 24. KsgA excludes the penultimate rRNA helix 44 from adopting its position in the mature 30S subunit, blocking the formation of the decoding site and subunit joining. We suggest that the activation of methyltransferase activity and subsequent dissociation of KsgA control conformational changes in helix 44 required for final rRNA processing and translation initiation. PMID:22308031
Three-dimensional crystals of ribosomes and their subunits from eu- and archaebacteria.
Glotz, C; Müssig, J; Gewitz, H S; Makowski, I; Arad, T; Yonath, A; Wittmann, H G
1987-11-01
Ordered three-dimensional crystals of 70S ribosomes as well as of 30S and 50S ribosomal subunits from various bacteria (E. coli, Bacillus stearothermophilus, Thermus thermophilus and Halobacterium marismortui) have been grown by vapour diffusion in hanging drops using mono- and polyalcohols. A new compact crystal form of 50S subunits has been obtained, and it is suitable for crystallographic studies at medium resolution. In addition, from one crystal form large crystals could be grown in X-ray capillaries. In all cases the crystals were obtained from functionally active ribosomal particles, and the particles from dissolved crystals retained their integrity and biological activity.
Asano, Kyouhei; Lee, Jung-Bum; Yamamura, Yoshimi; Kurosaki, Fumiya
2013-12-01
Leaf tissues of Atropa belladonna were transformed by Sdrac2, a Rac GTPase gene, that is isolated from Scoparia dulcis, and the change in atropine concentration of the transformants was examined. Re-differentiated A. belladonna overexpressing Sdrac2 accumulated considerable concentration of atropine in the leaf tissues, whereas the leaves of plants transformed by an empty vector accumulated only a very low concentration of the compound. A. belladonna transformed by CASdrac2, a modified Sdrac2 of which translate was expected to bind guanosine triphosphate (GTP) permanently, accumulated very high concentrations of atropine (approximately 2.4-fold excess to those found in the wild-type plant in its natural habitat). In sharp contrast, the atropine concentration in transformed A. belladonna prepared with negatively modified Sdrac2, DNSdrac2, expected to bind guanosine diphosphate instead of GTP, was very low. These results suggested that Rac GTPases play an important role in the regulation of secondary metabolism in plant cells and that overexpression of the gene(s) may be capable of enhancing the production of natural products accumulated in higher plant cells.
Remodeling of ribosomal genes in somatic cells by Xenopus egg extract
Energy Technology Data Exchange (ETDEWEB)
Ostrup, Olga, E-mail: osvarcova@gmail.com [Institute of Basic Animal and Veterinary Sciences, Faculty of Life Sciences, University of Copenhagen, Frederiksberg C (Denmark); Stem Cell Epigenetics Laboratory, Institute of Basic Medical Sciences, Faculty of Medicine, University of Oslo, Oslo (Norway); Norwegian Center for Stem Cell Research, Oslo (Norway); Hyttel, Poul; Klaerke, Dan A. [Institute of Basic Animal and Veterinary Sciences, Faculty of Life Sciences, University of Copenhagen, Frederiksberg C (Denmark); Collas, Philippe, E-mail: philc@medisin.uio.no [Stem Cell Epigenetics Laboratory, Institute of Basic Medical Sciences, Faculty of Medicine, University of Oslo, Oslo (Norway); Norwegian Center for Stem Cell Research, Oslo (Norway)
2011-09-02
Highlights: {yields} Xenopus egg extract remodels nuclei and alter cell growth characteristics. {yields} Ribosomal genes are reprogrammed within 6 h after extract exposure. {yields} rDNA reprogramming involves promoter targeting of SNF2H remodeling complex. {yields} Xenopus egg extract does not initiate stress-related response in somatic cells. {yields} Aza-cytidine elicits a stress-induced response in reprogrammed cells. -- Abstract: Extracts from Xenopus eggs can reprogram gene expression in somatic nuclei, however little is known about the earliest processes associated with the switch in the transcriptional program. We show here that an early reprogramming event is the remodeling of ribosomal chromatin and gene expression. This occurs within hours of extract treatment and is distinct from a stress response. Egg extract elicits remodeling of the nuclear envelope, chromatin and nucleolus. Nucleolar remodeling involves a rapid and stable decrease in ribosomal gene transcription, and promoter targeting of the nucleolar remodeling complex component SNF2H without affecting occupancy of the transcription factor UBF and the stress silencers SUV39H1 and SIRT1. During this process, nucleolar localization of UBF and SIRT1 is not altered. On contrary, azacytidine pre-treatment has an adverse effect on rDNA remodeling induced by extract and elicits a stress-type nuclear response. Thus, an early event of Xenopus egg extract-mediated nuclear reprogramming is the remodeling of ribosomal genes involving nucleolar remodeling complex. Condition-specific and rapid silencing of ribosomal genes may serve as a sensitive marker for evaluation of various reprogramming methods.
Diamond Blackfan Anemia at the Crossroad between Ribosome Biogenesis and Heme Metabolism
Directory of Open Access Journals (Sweden)
Deborah Chiabrando
2010-01-01
Full Text Available Diamond-Blackfan anemia (DBA is a rare, pure red-cell aplasia that presents during infancy. Approximately 40% of cases are associated with other congenital defects, particularly malformations of the upper limb or craniofacial region. Mutations in the gene coding for the ribosomal protein RPS19 have been identified in 25% of patients with DBA, with resulting impairment of 18S rRNA processing and 40S ribosomal subunit formation. Moreover, mutations in other ribosomal protein coding genes account for about 25% of other DBA cases. Recently, the analysis of mice from which the gene coding for the heme exporter Feline Leukemia Virus subgroup C Receptor (FLVCR1 is deleted suggested that this gene may be involved in the pathogenesis of DBA. FLVCR1-null mice show a phenotype resembling that of DBA patients, including erythroid failure and malformations. Interestingly, some DBA patients have disease linkage to chromosome 1q31, where FLVCR1 is mapped. Moreover, it has been reported that cells from DBA patients express alternatively spliced isoforms of FLVCR1 which encode non-functional proteins. Herein, we review the known roles of RPS19 and FLVCR1 in ribosome function and heme metabolism respectively, and discuss how the deficiency of a ribosomal protein or of a heme exporter may result in the same phenotype.
Structural and functional organization of ribosomal genes within the mammalian cell nucleolus.
Derenzini, Massimo; Pasquinelli, Gianandrea; O'Donohue, Marie-Françoise; Ploton, Dominique; Thiry, Marc
2006-02-01
Data on the in situ structural-functional organization of ribosomal genes in the mammalian cell nucleolus are reviewed here. Major findings on chromatin structure in situ come from investigations carried out using the Feulgen-like osmium ammine reaction as a highly specific electron-opaque DNA tracer. Intranucleolar chromatin shows three different levels of organization: compact clumps, fibers ranging from 11 to 30 nm, and loose agglomerates of extended DNA filaments. Both clumps and fibers of chromatin exhibit a nucleosomal organization that is lacking in the loose agglomerates of extended DNA filaments. In fact, these filaments constantly show a thickness of 2-3 nm, the same as a DNA double-helix molecule. The loose agglomerates of DNA filaments are located in the fibrillar centers, the interphase counterpart of metaphase NORs, therefore being constituted by ribosomal DNA. The extended, non-nucleosomal configuration of this rDNA has been shown to be independent of transcriptional activity and characterizes ribosome genes that are either transcribed or transcriptionally silent. Data reviewed are consistent with a model of control for ribosome gene activity that is not mediated by changes in chromatin structure. The presence of rDNA in mammalian cells always structurally ready for transcription might facilitate a more rapid adjustment of the ribosome production in response to the metabolic needs of the cell.
The Rho-GTPase binding protein IQGAP2 is required for the glomerular filtration barrier.
Sugano, Yuya; Lindenmeyer, Maja T; Auberger, Ines; Ziegler, Urs; Segerer, Stephan; Cohen, Clemens D; Neuhauss, Stephan C F; Loffing, Johannes
2015-11-01
Podocyte dysfunction impairs the size selectivity of the glomerular filter, leading to proteinuria, hypoalbuminuria, and edema, clinically defined as nephrotic syndrome. Hereditary forms of nephrotic syndrome are linked to mutations in podocyte-specific genes. To identify genes contributing to podocyte dysfunction in acquired nephrotic syndrome, we studied human glomerular gene expression data sets for glomerular-enriched gene transcripts differentially regulated between pretransplant biopsy samples and biopsies from patients with nephrotic syndrome. Candidate genes were screened by in situ hybridization for expression in the zebrafish pronephros, an easy-to-use in vivo assay system to assess podocyte function. One glomerulus-enriched product was the Rho-GTPase binding protein, IQGAP2. Immunohistochemistry found a strong presence of IQGAP2 in normal human and zebrafish podocytes. In zebrafish larvae, morpholino-based knockdown of iqgap2 caused a mild foot process effacement of zebrafish podocytes and a cystic dilation of the urinary space of Bowman's capsule upon onset of urinary filtration. Moreover, the glomerulus of zebrafish morphants showed a glomerular permeability for injected high-molecular-weight dextrans, indicating an impaired size selectivity of the glomerular filter. Thus, IQGAP2 is a Rho-GTPase binding protein, highly abundant in human and zebrafish podocytes, which controls normal podocyte structure and function as evidenced in the zebrafish pronephros.
Directory of Open Access Journals (Sweden)
Pascal F Egea
Full Text Available In all organisms the Signal Recognition Particle (SRP, binds to signal sequences of proteins destined for secretion or membrane insertion as they emerge from translating ribosomes. In Archaea and Eucarya, the conserved ribonucleoproteic core is composed of two proteins, the accessory protein SRP19, the essential GTPase SRP54, and an evolutionarily conserved and essential SRP RNA. Through the GTP-dependent interaction between the SRP and its cognate receptor SR, ribosomes harboring nascent polypeptidic chains destined for secretion are dynamically transferred to the protein translocation apparatus at the membrane. We present here high-resolution X-ray structures of SRP54 and SRP19, the two RNA binding components forming the core of the signal recognition particle from the hyper-thermophilic archaeon Pyrococcus furiosus (Pfu. The 2.5 A resolution structure of free Pfu-SRP54 is the first showing the complete domain organization of a GDP bound full-length SRP54 subunit. In its ras-like GTPase domain, GDP is found tightly associated with the protein. The flexible linker that separates the GTPase core from the hydrophobic signal sequence binding M domain, adopts a purely alpha-helical structure and acts as an articulated arm allowing the M domain to explore multiple regions as it scans for signal peptides as they emerge from the ribosomal tunnel. This linker is structurally coupled to the GTPase catalytic site and likely to propagate conformational changes occurring in the M domain through the SRP RNA upon signal sequence binding. Two different 1.8 A resolution crystal structures of free Pfu-SRP19 reveal a compact, rigid and well-folded protein even in absence of its obligate SRP RNA partner. Comparison with other SRP19*SRP RNA structures suggests the rearrangement of a disordered loop upon binding with the RNA through a reciprocal induced-fit mechanism and supports the idea that SRP19 acts as a molecular scaffold and a chaperone, assisting the SRP
Antony A, Charles; Alone, Pankaj V
2017-05-13
In eukaryotes, the eIF5 protein plays an important role in translation start site selection by providing the GAP (GTPase activating protein) function. However, in yeast translation initiation fidelity defective eIF5 G31R mutant causes preferential utilization of UUG as initiation codon and is termed as Suppressor of initiation codon (Sui - ) phenotype due to its hyper GTPase activity. The eIF5 G31R mutant dominantly represses GCN4 expression and confers sensitivity to 3-Amino-1,2,4-Trizole (3AT) induced starvation. The down-regulation of the GCN4 expression (Gcn - phenotype) in the eIF5 G31R mutant was not because of leaky scanning defects; rather was due to the utilization of upUUG initiation codons at the 5' regulatory region present between uORF1 and the main GCN4 ORF. Copyright © 2017 Elsevier Inc. All rights reserved.
Yavuz, Sevil; Warren, Graham
2017-01-01
A single Golgi stack is duplicated and partitioned into two daughter cells during the cell cycle of the protozoan parasite Trypanosoma brucei. The source of components required to generate the new Golgi and the mechanism by which it forms are poorly understood. Using photoactivatable GFP, we show that the existing Golgi supplies components directly to the newly forming Golgi in both intact and semipermeabilized cells. The movement of a putative glycosyltransferase, GntB, requires the Sar1 and ARF1 GTPases in intact cells. In addition, we show that transfer of GntB from the existing Golgi to the new Golgi can be recapitulated in semipermeabilized cells and is sensitive to the GTP analogue GTPγS. We suggest that the existing Golgi is a key source of components required to form the new Golgi and that this process is regulated by small GTPases. PMID:28495798
Directory of Open Access Journals (Sweden)
Xiao-Feng Zhao
2018-01-01
Full Text Available Summary: Dentate gyrus (DG development requires specification of granule cell (GC progenitors in the hippocampal neuroepithelium, as well as their proliferation and migration into the primordial DG. We identify the Plexin family members Plxna2 and Plxna4 as important regulators of DG development. Distribution of immature GCs is regulated by Sema5A signaling through PlxnA2 and requires a functional PlxnA2 GTPase-activating protein (GAP domain and Rap1 small GTPases. In adult Plxna2−/− but not Plxna2-GAP-deficient mice, the dentate GC layer is severely malformed, neurogenesis is compromised, and mossy fibers form aberrant synaptic boutons within CA3. Behavioral studies with Plxna2−/− mice revealed deficits in associative learning, sociability, and sensorimotor gating—traits commonly observed in neuropsychiatric disorder. Remarkably, while morphological defects are minimal in Plxna2-GAP-deficient brains, defects in fear memory and sensorimotor gating persist. Since allelic variants of human PLXNA2 and RAP1 associate with schizophrenia, our studies identify a biochemical pathway important for brain development and mental health. : Zhao et al. find that Sema5A-PlexinA2 forward signaling through Rap1 GTPases is required for progenitor distribution in the developing mouse dentate gyrus. Adult Plxna2−/−, but not Plxna2-GAP-deficient, mice show defects in dentate morphology, neurogenesis, and mossy fiber connectivity. Plxna2−/− and Plxna2-GAP mice exhibit behavioral defects suggestive of neuropsychiatric illness. Keywords: PlexinA2, semaphoring, Rap1, GAP, dentate gyrus, adult neurogenesis, mossy fiber, fear memory, sensorimotor gating, schizophrenia
A streamlined ribosome profiling protocol for the characterization of microorganisms
DEFF Research Database (Denmark)
Latif, Haythem; Szubin, Richard; Tan, Justin
2015-01-01
Ribosome profiling is a powerful tool for characterizing in vivo protein translation at the genome scale, with multiple applications ranging from detailed molecular mechanisms to systems-level predictive modeling. Though highly effective, this intricate technique has yet to become widely used...... in the microbial research community. Here we present a streamlined ribosome profiling protocol with reduced barriers to entry for microbial characterization studies. Our approach provides simplified alternatives during harvest, lysis, and recovery of monosomes and also eliminates several time-consuming steps...
Is The Ribosome Targeted By Adaptive Mutations
DEFF Research Database (Denmark)
Jimenez Fernandez, Alicia; Molin, Søren; Johansen, Helle Krogh
2015-01-01
Introduction: RNA polymerase and ribosomes, composing the macromolecular synthesis machinery (MMSM), carry out the central processes of transcription and translation, but are usually seen as mechanical elements with no regulatory function. Extensive investigations of gene regulation and the high ...
Simulating movement of tRNA through the ribosome during hybrid-state formation.
Whitford, Paul C; Sanbonmatsu, Karissa Y
2013-09-28
Biomolecular simulations provide a means for exploring the relationship between flexibility, energetics, structure, and function. With the availability of atomic models from X-ray crystallography and cryoelectron microscopy (cryo-EM), and rapid increases in computing capacity, it is now possible to apply molecular dynamics (MD) simulations to large biomolecular machines, and systematically partition the factors that contribute to function. A large biomolecular complex for which atomic models are available is the ribosome. In the cell, the ribosome reads messenger RNA (mRNA) in order to synthesize proteins. During this essential process, the ribosome undergoes a wide range of conformational rearrangements. One of the most poorly understood transitions is translocation: the process by which transfer RNA (tRNA) molecules move between binding sites inside of the ribosome. The first step of translocation is the adoption of a "hybrid" configuration by the tRNAs, which is accompanied by large-scale rotations in the ribosomal subunits. To illuminate the relationship between these rearrangements, we apply MD simulations using a multi-basin structure-based (SMOG) model, together with targeted molecular dynamics protocols. From 120 simulated transitions, we demonstrate the viability of a particular route during P/E hybrid-state formation, where there is asynchronous movement along rotation and tRNA coordinates. These simulations not only suggest an ordering of events, but they highlight atomic interactions that may influence the kinetics of hybrid-state formation. From these simulations, we also identify steric features (H74 and surrounding residues) encountered during the hybrid transition, and observe that flexibility of the single-stranded 3'-CCA tail is essential for it to reach the endpoint. Together, these simulations provide a set of structural and energetic signatures that suggest strategies for modulating the physical-chemical properties of protein synthesis by the
Dynamic enzyme docking to the ribosome coordinates N-terminal processing with polypeptide folding.
Sandikci, Arzu; Gloge, Felix; Martinez, Michael; Mayer, Matthias P; Wade, Rebecca; Bukau, Bernd; Kramer, Günter
2013-07-01
Newly synthesized polypeptides undergo various cotranslational maturation steps, including N-terminal enzymatic processing, chaperone-assisted folding and membrane targeting, but the spatial and temporal coordination of these steps is unclear. We show that Escherichia coli methionine aminopeptidase (MAP) associates with ribosomes through a charged loop that is crucial for nascent-chain processing and cell viability. MAP competes with peptide deformylase (PDF), the first enzyme to act on nascent chains, for binding sites at the ribosomal tunnel exit. PDF has extremely fast association and dissociation kinetics, which allows it to frequently sample ribosomes and ensure the processing of nascent chains after their emergence. Premature recruitment of the chaperone trigger factor, or polypeptide folding, negatively affect processing efficiency. Thus, the fast ribosome association kinetics of PDF and MAP are crucial for the temporal separation of nascent-chain processing from later maturation events, including chaperone recruitment and folding.
O?Connor, Patrick B. F.; Li, Gene-Wei; Weissman, Jonathan S.; Atkins, John F.; Baranov, Pavel V.
2013-01-01
Motivation: Ribosome profiling is a new technique that allows monitoring locations of translating ribosomes on mRNA at a whole transcriptome level. A recent ribosome profiling study demonstrated that internal Shine?Dalgarno (SD) sequences have a major global effect on translation rates in bacteria: ribosomes pause at SD sites in mRNA. Therefore, it is important to understand how SD sites effect mRNA movement through the ribosome and generation of ribosome footprints. Results: Here, we provide...
Molecular mechanism and structure of Trigger Factor bound to the translating ribosome
Merz, Frieder; Boehringer, Daniel; Schaffitzel, Christiane; Preissler, Steffen; Hoffmann, Anja; Maier, Timm; Rutkowska, Anna; Lozza, Jasmin; Ban, Nenad; Bukau, Bernd; Deuerling, Elke
2008-01-01
Ribosome-associated chaperone Trigger Factor (TF) initiates folding of newly synthesized proteins in bacteria. Here, we pinpoint by site-specific crosslinking the sequence of molecular interactions of Escherichia coli TF and nascent chains during translation. Furthermore, we provide the first full-length structure of TF associated with ribosome–nascent chain complexes by using cryo-electron microscopy. In its active state, TF arches over the ribosomal exit tunnel accepting nascent chains in a protective void. The growing nascent chain initially follows a predefined path through the entire interior of TF in an unfolded conformation, and even after folding into a domain it remains accommodated inside the protective cavity of ribosome-bound TF. The adaptability to accept nascent chains of different length and folding states may explain how TF is able to assist co-translational folding of all kinds of nascent polypeptides during ongoing synthesis. Moreover, we suggest a model of how TF's chaperoning function can be coordinated with the co-translational processing and membrane targeting of nascent polypeptides by other ribosome-associated factors. PMID:18497744
DEFF Research Database (Denmark)
Guilfoyle, Amy P.; Deshpande, Chandrika N.; Font Sadurni, Josep
2014-01-01
, biophysical studies on both the eukaryotic Gα proteins and the GTPase domain (NFeoB) of prokaryotic FeoB proteins have revealed conformational changes in the G5 loop that accompany nucleotide binding and release. However, it is unclear whether this conformational change in the G5 loop is a prerequisite...
Wang, Hsiang-Tsui; Chen, Tzu-Ying; Weng, Ching-Wen; Yang, Chun-Hsiang; Tang, Moon-Shong
2016-12-06
Acrolein (Acr) is a potent cytotoxic and DNA damaging agent which is ubiquitous in the environment and abundant in tobacco smoke. Acr is also an active cytotoxic metabolite of the anti-cancer drugs cyclophosphamide and ifosfamide. The mechanisms via which Acr exerts its anti-cancer activity and cytotoxicity are not clear. In this study, we found that Acr induces cytotoxicity and cell death in human cancer cells with different activities of p53. Acr preferentially binds nucleolar ribosomal DNA (rDNA) to form Acr-deoxyguanosine adducts, and induces oxidative damage to both rDNA and ribosomal RNA (rRNA). Acr triggers ribosomal stress responses, inhibits rRNA synthesis, reduces RNA polymerase I binding to the promoter of rRNA gene, disrupts nucleolar integrity, and impairs ribosome biogenesis and polysome formation. Acr causes an increase in MDM2 levels and phosphorylation of MDM2 in A549 and HeLa cells which are p53 active and p53 inactive, respectively. It enhances the binding of ribosomal protein RPL11 to MDM2 and reduces the binding of p53 and E2F-1 to MDM2 resulting in stabilization/activation of p53 in A549 cells and degradation of E2F-1 in A549 and HeLa cells. We propose that Acr induces ribosomal stress which leads to activation of MDM2 and RPL11-MDM2 binding, consequently, activates p53 and enhances E2F-1 degradation, and that taken together these two processes induce apoptosis and cell death.
Zhang, Jiwei; Zhang, Yanmei; Zhong, Yaohua; Qu, Yinbo; Wang, Tianhong
2012-01-01
Background The model cellulolytic fungus Trichoderma reesei (teleomorph Hypocrea jecorina) is capable of responding to environmental cues to compete for nutrients in its natural saprophytic habitat despite its genome encodes fewer degradative enzymes. Efficient signalling pathways in perception and interpretation of environmental signals are indispensable in this process. Ras GTPases represent a kind of critical signal proteins involved in signal transduction and regulation of gene expression. In T. reesei the genome contains two Ras subfamily small GTPases TrRas1 and TrRas2 homologous to Ras1 and Ras2 from S. cerevisiae, but their functions remain unknown. Methodology/Principal Findings Here, we have investigated the roles of GTPases TrRas1 and TrRas2 during fungal morphogenesis and cellulase gene expression. We show that both TrRas1 and TrRas2 play important roles in some cellular processes such as polarized apical growth, hyphal branch formation, sporulation and cAMP level adjustment, while TrRas1 is more dominant in these processes. Strikingly, we find that TrRas2 is involved in modulation of cellulase gene expression. Deletion of TrRas2 results in considerably decreased transcription of cellulolytic genes upon growth on cellulose. Although the strain carrying a constitutively activated TrRas2G16V allele exhibits increased cellulase gene transcription, the cbh1 and cbh2 expression in this mutant still strictly depends on cellulose, indicating TrRas2 does not directly mediate the transmission of the cellulose signal. In addition, our data suggest that the effect of TrRas2 on cellulase gene is exerted through regulation of transcript abundance of cellulase transcription factors such as Xyr1, but the influence is independent of cAMP signalling pathway. Conclusions/Significance Together, these findings elucidate the functions for Ras signalling of T. reesei in cellular morphogenesis, especially in cellulase gene expression, which contribute to deciphering the
Suarez, Stéphanie; Ferroni, Agnès; Lotz, Aurélie; Jolley, Keith A; Guérin, Philippe; Leto, Julie; Dauphin, Brunhilde; Jamet, Anne; Maiden, Martin C J; Nassif, Xavier; Armengaud, Jean
2013-09-01
Whole-cell matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS) is a rapid method for identification of microorganisms that is increasingly used in microbiology laboratories. This identification is based on the comparison of the tested isolate mass spectrum with reference databases. Using Neisseria meningitidis as a model organism, we showed that in one of the available databases, the Andromas database, 10 of the 13 species-specific biomarkers correspond to ribosomal proteins. Remarkably, one biomarker, ribosomal protein L32, was subject to inter-strain variability. The analysis of the ribosomal protein patterns of 100 isolates for which whole genome sequences were available, confirmed the presence of inter-strain variability in the molecular weight of 29 ribosomal proteins, thus establishing a correlation between the sequence type (ST) and/or clonal complex (CC) of each strain and its ribosomal protein pattern. Since the molecular weight of three of the variable ribosomal proteins (L30, L31 and L32) was included in the spectral window observed by MALDI-TOF MS in clinical microbiology, i.e., 3640-12000 m/z, we were able by analyzing the molecular weight of these three ribosomal proteins to classify each strain in one of six subgroups, each of these subgroups corresponding to specific STs and/or CCs. Their detection by MALDI-TOF allows therefore a quick typing of N. meningitidis isolates. © 2013 Elsevier B.V. All rights reserved.
Palm, Denise; Simm, Stefan; Darm, Katrin; Weis, Benjamin L; Ruprecht, Maike; Schleiff, Enrico; Scharf, Christian
2016-01-01
Ribosome biogenesis is an essential process initiated in the nucleolus. In eukaryotes, multiple ribosome biogenesis factors (RBFs) can be found in the nucleolus, the nucleus and in the cytoplasm. They act in processing, folding and modification of the pre-ribosomal (r)RNAs, incorporation of ribosomal proteins (RPs), export of pre-ribosomal particles to the cytoplasm, and quality control mechanisms. Ribosome biogenesis is best established for Saccharomyces cerevisiae. Plant ortholog assignment to yeast RBFs revealed the absence of about 30% of the yeast RBFs in plants. In turn, few plant specific proteins have been identified by biochemical experiments to act in plant ribosome biogenesis. Nevertheless, a complete inventory of plant RBFs has not been established yet. We analyzed the proteome of the nucleus and nucleolus of Arabidopsis thaliana and the post-translational modifications of these proteins. We identified 1602 proteins in the nucleolar and 2544 proteins in the nuclear fraction with an overlap of 1429 proteins. For a randomly selected set of proteins identified by the proteomic approach we confirmed the localization inferred from the proteomics data by the localization of GFP fusion proteins. We assigned the identified proteins to various complexes and functions and found about 519 plant proteins that have a potential to act as a RBFs, but which have not been experimentally characterized yet. Last, we compared the distribution of RBFs and RPs in the various fractions with the distribution established for yeast.
Stakaitytė, Gabrielė; Nwogu, Nnenna; Dobson, Samuel J; Knight, Laura M; Wasson, Christopher W; Salguero, Francisco J; Blackbourn, David J; Blair, G Eric; Mankouri, Jamel; Macdonald, Andrew; Whitehouse, Adrian
2018-01-15
Cell motility and migration is a complex, multistep, and multicomponent process intrinsic to progression and metastasis. Motility is dependent on the activities of integrin receptors and Rho family GTPases, resulting in the remodeling of the actin cytoskeleton and formation of various motile actin-based protrusions. Merkel cell carcinoma (MCC) is an aggressive skin cancer with a high likelihood of recurrence and metastasis. Merkel cell polyomavirus (MCPyV) is associated with the majority of MCC cases, and MCPyV-induced tumorigenesis largely depends on the expression of the small tumor antigen (ST). Since the discovery of MCPyV, a number of mechanisms have been suggested to account for replication and tumorigenesis, but to date, little is known about potential links between MCPyV T antigen expression and the metastatic nature of MCC. Previously, we described the action of MCPyV ST on the microtubule network and how it impacts cell motility and migration. Here, we demonstrate that MCPyV ST affects the actin cytoskeleton to promote the formation of filopodia through a mechanism involving the catalytic subunit of protein phosphatase 4 (PP4C). We also show that MCPyV ST-induced cell motility is dependent upon the activities of the Rho family GTPases Cdc42 and RhoA. In addition, our results indicate that the MCPyV ST-PP4C interaction results in the dephosphorylation of β 1 integrin, likely driving the cell motility pathway. These findings describe a novel mechanism by which a tumor virus induces cell motility, which may ultimately lead to cancer metastasis, and provides opportunities and strategies for targeted interventions for disseminated MCC. IMPORTANCE Merkel cell polyomavirus (MCPyV) is the most recently discovered human tumor virus. It causes the majority of cases of Merkel cell carcinoma (MCC), an aggressive skin cancer. However, the molecular mechanisms implicating MCPyV-encoded proteins in cancer development are yet to be fully elucidated. This study builds
Energy Technology Data Exchange (ETDEWEB)
Jetzt, Amanda E. [Department of Animal Sciences, Rutgers, The State University of New Jersey, New Brunswick, NJ 08901-8520 (United States); Li, Xiao-Ping; Tumer, Nilgun E. [Department of Plant Biology and Pathology, Rutgers, The State University of New Jersey, New Brunswick, NJ 08901-8520 (United States); Cohick, Wendie S., E-mail: cohick@aesop.rutgers.edu [Department of Animal Sciences, Rutgers, The State University of New Jersey, New Brunswick, NJ 08901-8520 (United States)
2016-11-01
Ricin is a potent ribotoxin that is considered a bioterror threat due to its ease of isolation and possibility of aerosolization. In yeast, mutation of arginine residues away from the active site results in a ricin toxin A chain (RTA) variant that is unable to bind the ribosome and exhibits reduced cytotoxicity. The goal of the present work was to determine if these residues contribute to ribosome binding and cytotoxicity of RTA in mammalian cells. The RTA mutant R193A/R235A did not interact with mammalian ribosomes, while a G212E variant with a point mutation near its active site bound ribosomes similarly to wild-type (WT) RTA. R193A/R235A retained full catalytic activity on naked RNA but had reduced activity on mammalian ribosomes. To determine the effect of this mutant in intact cells, pre R193A/R235A containing a signal sequence directing it to the endoplasmic reticulum and mature R193A/R235A that directly targeted cytosolic ribosomes were each expressed. Depurination and protein synthesis inhibition were reduced by both pre- and mature R193A/R235A relative to WT. Protein synthesis inhibition was reduced to a greater extent by R193A/R235A than by G212E. Pre R193A/R235A caused a greater reduction in caspase activation and loss of mitochondrial membrane potential than G212E relative to WT RTA. These findings indicate that an RTA variant with reduced ribosome binding is less toxic than a variant with less catalytic activity but normal ribosome binding activity. The toxin-ribosome interaction represents a novel target for the development of therapeutics to prevent or treat ricin intoxication. - Highlights: • Arginines 193 and 235 of RTA are critical for binding to the mammalian ribosome. • R193A/R235A has full catalytic activity on RNA but not on mammalian ribosomes. • R193A/R235A is less toxic than a mutant that targets the active site. • The toxin-ribosome interaction is a therapeutic target for ricin intoxication.
DEFF Research Database (Denmark)
Kristensen, Janni; Sperling-Petersen, Hans Uffe; Mortensen, Kim Kusk
2005-01-01
We recently described a conceptually novel method for the purification of recombinant proteins with a propensity to form inclusion bodies in the cytoplasm of Escherichia coli. Recombinant proteins were covalently coupled to the E. coli ribosome by fusing them to ribosomal protein 23 (rpL23...... therefore purified rpL23-GFP-His, rpL23-His and GFP from E. coli recombinants using affinity, ion exchange and hydrophobic interaction chromatography. These proteins could be purified with yields of 150, 150 and 1500 microg per gram cellular wet weight, respectively. However, rpL23-GFP-His could only...... proteolytic cleavage sites. We conclude that the generated antibodies can be used to evaluate ribosomal coupling of recombinant target proteins as well as the efficiency of their separation from the ribosome....
Institute of Scientific and Technical Information of China (English)
Zhifei Li; Qiang Guo; Lvqin Zheng; Yongsheng Ji; Yi-Ting Xie; De-Hua Lai; Zhao-Rong Lun; Xun Suo; Ning Gao
2017-01-01
As an indispensable molecular machine universal in all living organisms,the ribosome has been selected by evolution to be the natural target of many antibiotics and small-molecule inhibitors.High-resolution structures of pathogen ribosomes are crucial for understanding the general and unique aspects of translation control in disease-causing microbes.With cryo-electron microscopy technique,we have determined structures of the cytosolic ribosomes from two human parasites,Trichomonas vaginalis and Toxoplasma gondii,at resolution of 3.2-3.4,(A).Although the ribosomal proteins from both pathogens are typical members of eukaryotic families,with a co-evolution pattern between certain species-specific insertions/extensions and neighboring ribosomal RNA (rRNA) expansion segments,the sizes of their rRNAs are sharply different.Very interestingly,rRNAs of T.vaginalis are in size comparable to prokaryotic counterparts,with nearly all the eukaryote-specific rRNA expansion segments missing.These structures facilitate the dissection of evolution path for ribosomal proteins and RNAs,and may aid in design of novel translation inhibitors.
Akashi, Kinya; Yoshimura, Kazuya; Kajikawa, Masataka; Hanada, Kouhei; Kosaka, Rina; Kato, Atsushi; Katoh, Akira; Nanasato, Yoshihiko; Tsujimoto, Hisashi; Yokota, Akiho
2016-10-01
Enhanced root growth is known as the survival strategy of plants under drought. Previous proteome analysis in drought-resistant wild watermelon has shown that Ran GTPase, an essential regulator of cell division and proliferation, was induced in the roots under drought. In this study, two cDNAs were isolated from wild watermelon, CLRan1 and CLRan2, which showed a high degree of structural similarity with those of other plant Ran GTPases. Quantitative RT-PCR and promoter-GUS assays suggested that CLRan1 was expressed mainly in the root apex and lateral root primordia, whereas CLRan2 was more broadly expressed in other part of the roots. Immunoblotting analysis confirmed that the abundance of CLRan proteins was elevated in the root apex region under drought stress. Transgenic Arabidopsis overexpressing CLRan1 showed enhanced primary root growth, and the growth was maintained under osmotic stress, indicating that CLRan1 functions as a positive factor for maintaining root growth under stress conditions.
Evidence for alteration of the membrane-bound ribosomes in Micrococcus luteus cells exposed to lead
Energy Technology Data Exchange (ETDEWEB)
Barrow, W; Himmel, M; Squire, P G; Tornabene, T G
1978-01-01
Micrococcus luteus cells exposed to Pb(NO/sub 3/)/sub 2/ contained cytosol ribosomal particles and disaggregated membranal ribosomal particles as determined by ultracentrifugation and spectral studies. Approximately 60% of the membrane ribosome fraction from lead exposed cells had a sedimentation value of 8.4S. Cytosol ribosome from lead exposed cells as well as membranal and cytosol ribosomes from control cells were comparable by their contents of predominantly the 70S type with the 50S and 100S present in relatively small amounts. The lead content of the 8.4S components was more than 200 times higher than the components with higher sedimentation coefficients from lead exposed cells and approximately 650 times more than that of control cell ribosomes. The cells exposed to lead, however, showed no adverse effects from the lead in respect to their growth rates and cellular yields. These results indicate that lead is interacting only at specific sites of the membrane and is inducing events initiated only in strategic cellular regions. These data further substantiate that subtle changes do occur in lead exposed cells that show no obvious effects. It is assumed that these minor alterations are, in toto, biologically significant. 24 references, 2 figures, 1 table.
Zaim, Merve; Isik, Sevim
2018-04-25
DNA topoisomerase IIβ (topo IIβ) is known to regulate neural differentiation by inducing the neuronal genes responsible for critical neural differentiation events such as neurite outgrowth and axon guidance. However, the pathways of axon growth controlled by topo IIβ have not been clarified yet. Microarray results of our previous study have shown that topo IIβ silencing in neural differentiated primary human mesenchymal stem cells (hMSCs) significantly alters the expression pattern of genes involved in neural polarity, axonal growth, and guidance, including Rho-GTPases. This study aims to further analyze the regulatory role of topo IIβ on the process of axon growth via regulation of Rho-GTPases. For this purpose, topo IIβ was silenced in neurally differentiated hMSCs. Cells lost their morphology because of topo IIβ deficiency, becoming enlarged and flattened. Additionally, a reduction in both neural differentiation efficiency and neurite length, upregulation in RhoA and Rock2, downregulation in Cdc42 gene expression were detected. On the other hand, cells were transfected with topo IIβ gene to elucidate the possible neuroprotective effect of topo IIβ overexpression on neural-induced hMSCs. Topo IIβ overexpression prompted all the cells to exhibit neural cell morphology as characterized by longer neurites. RhoA and Rock2 expressions were downregulated, whereas Cdc42 expression was upregulated. Nurr1 expression level correlated with topo IIβ in both topo IIβ-overexpressed and -silenced cells. Furthermore, differential translocation of Rho-GTPases was detected by immunostaining in response to topo IIβ. Our results suggest that topo IIβ deficiency could give rise to neurodegeneration through dysregulation of Rho-GTPases. However, further in-vivo research is needed to demonstrate if re-regulation of Rho GTPases by topo IIβ overexpression could be a neuroprotective treatment in the case of neurodegenerative diseases.
Assembly constraints drive co-evolution among ribosomal constituents.
Mallik, Saurav; Akashi, Hiroshi; Kundu, Sudip
2015-06-23
Ribosome biogenesis, a central and essential cellular process, occurs through sequential association and mutual co-folding of protein-RNA constituents in a well-defined assembly pathway. Here, we construct a network of co-evolving nucleotide/amino acid residues within the ribosome and demonstrate that assembly constraints are strong predictors of co-evolutionary patterns. Predictors of co-evolution include a wide spectrum of structural reconstitution events, such as cooperativity phenomenon, protein-induced rRNA reconstitutions, molecular packing of different rRNA domains, protein-rRNA recognition, etc. A correlation between folding rate of small globular proteins and their topological features is known. We have introduced an analogous topological characteristic for co-evolutionary network of ribosome, which allows us to differentiate between rRNA regions subjected to rapid reconstitutions from those hindered by kinetic traps. Furthermore, co-evolutionary patterns provide a biological basis for deleterious mutation sites and further allow prediction of potential antibiotic targeting sites. Understanding assembly pathways of multicomponent macromolecules remains a key challenge in biophysics. Our study provides a 'proof of concept' that directly relates co-evolution to biophysical interactions during multicomponent assembly and suggests predictive power to identify candidates for critical functional interactions as well as for assembly-blocking antibiotic target sites. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
Interaction of pleuromutilin derivatives with the ribosomal peptidyl transferase center
DEFF Research Database (Denmark)
Long, K. S.; Hansen, L. K.; Jakobsen, L.
2006-01-01
Tiamulin is a pleuromutilin antibiotic that is used in veterinary medicine. The recently published crystal structure of a tiamulin-50S ribosomal subunit complex provides detailed information about how this drug targets the peptidyl transferase center of the ribosome. To promote rational design...... mutant strain is resistant to tiamulin and pleuromutilin, but not valnemulin, implying that valnemulin is better able to withstand an altered rRNA binding surface around the mutilin core. This is likely due to additional interactions made between the valnemulin side chain extension and the rRNA binding...
Production of RNA-protein cross links in γ irradiated E. Coli ribosomes
International Nuclear Information System (INIS)
Ekert, Bernard; Giocanti, Nicole
1976-01-01
γ irradiation in de-aerated conditions of E. coli MRE 600 ribosomes, labelled with 14 C uracil, leads to a decrease of extractibility of 14 C RNA by lithium chloride 4 M-urea 8 M. On the other hand, the radioactivity of the protein fraction increases with irradiation. These results strongly suggest that RNA-protein cross links are formed in irradiated ribosomes [fr
DEFF Research Database (Denmark)
Tchórzewski, M; Boldyreff, B; Issinger, O
2000-01-01
The surface acidic ribosomal proteins (P-proteins), together with ribosomal core protein P0 form a multimeric lateral protuberance on the 60 S ribosomal subunit. This structure, also called stalk, is important for efficient translational activity of the ribosome. In order to shed more light...... forms the 60 S ribosomal stalk: P0-(P1/P2)(2). Additionally, mutual interactions among human and yeast P-proteins were analyzed. Heterodimer formation could be observed between human P2 and yeast P1 proteins....
Högenauer, G; Ruf, C
1981-01-01
Equilibrium dialysis experiments with a highly purified preparation of labeled tiamulin, a semisynthetic derivative of the antibiotic pleuromutilin, and Escherichia coli ribosomes allowed the determination of two binding sites for the drug. The binding reaction showed a cooperative effect. Of the two subunits, the 50S particle was able to bind the antibiotic in a 1:1 stoichiometry. Hence, the 50S subunit contributed predominantly to the binding energy which held the antibiotic to the ribosomes. The 30S subunit, showing no strong affinity for the drug, may be needed for the generation of the second binding site in the 70S particle. If depleted of ammonium ions, 70S ribosomes lost their binding capacity for the antibiotic. The attachment sites for tiamulin could be restored by heating the ribosomes to 40 degrees C in the presence of either ammonium ions or the antibiotic. Other pleuromutilin derivatives displaced labeled tiamulin from its ribosomal binding sites. By quantifying this competition, the relative affinity of various pleuromutilin derivatives for E. coli ribosomes was determined. The binding correlated with the minimal inhibitory concentrations of these compounds against E. coli. When compared with the minimal inhibitory concentrations of these compounds against E. coli. When compared with the minimal inhibitory concentrations against E. coli. When compared with the minimal inhibitory concentrations against Staphylococcus aureus, the correlation was less strict, but the same trend prevailed. These results suggest that the antibacterial activities of various pleuromutilin derivatives on a given test organism are mainly determined by the strength of binding to the ribosomes within the bacterial cell. PMID:6751216
Neuhof, Andrea; Rolls, Melissa M.; Jungnickel, Berit; Kalies, Kai-Uwe; Rapoport, Tom A.
1998-01-01
Most secretory and membrane proteins are sorted by signal sequences to the endoplasmic reticulum (ER) membrane early during their synthesis. Targeting of the ribosome-nascent chain complex (RNC) involves the binding of the signal sequence to the signal recognition particle (SRP), followed by an interaction of ribosome-bound SRP with the SRP receptor. However, ribosomes can also independently bind to the ER translocation channel formed by the Sec61p complex. To explain the specificity of membrane targeting, it has therefore been proposed that nascent polypeptide-associated complex functions as a cytosolic inhibitor of signal sequence- and SRP-independent ribosome binding to the ER membrane. We report here that SRP-independent binding of RNCs to the ER membrane can occur in the presence of all cytosolic factors, including nascent polypeptide-associated complex. Nontranslating ribosomes competitively inhibit SRP-independent membrane binding of RNCs but have no effect when SRP is bound to the RNCs. The protective effect of SRP against ribosome competition depends on a functional signal sequence in the nascent chain and is also observed with reconstituted proteoliposomes containing only the Sec61p complex and the SRP receptor. We conclude that cytosolic factors do not prevent the membrane binding of ribosomes. Instead, specific ribosome targeting to the Sec61p complex is provided by the binding of SRP to RNCs, followed by an interaction with the SRP receptor, which gives RNC–SRP complexes a selective advantage in membrane targeting over nontranslating ribosomes. PMID:9436994
The Circadian Clock Modulates Global Daily Cycles of mRNA Ribosome Loading[OPEN
Missra, Anamika; Ernest, Ben; Jia, Qidong; Ke, Kenneth
2015-01-01
Circadian control of gene expression is well characterized at the transcriptional level, but little is known about diel or circadian control of translation. Genome-wide translation state profiling of mRNAs in Arabidopsis thaliana seedlings grown in long day was performed to estimate ribosome loading per mRNA. The experiments revealed extensive translational regulation of key biological processes. Notably, translation of mRNAs for ribosomal proteins and mitochondrial respiration peaked at night. Central clock mRNAs are among those subject to fluctuations in ribosome loading. There was no consistent phase relationship between peak translation states and peak transcript levels. The overlay of distinct transcriptional and translational cycles can be expected to alter the waveform of the protein synthesis rate. Plants that constitutively overexpress the clock gene CCA1 showed phase shifts in peak translation, with a 6-h delay from midnight to dawn or from noon to evening being particularly common. Moreover, cycles of ribosome loading that were detected under continuous light in the wild type collapsed in the CCA1 overexpressor. Finally, at the transcript level, the CCA1-ox strain adopted a global pattern of transcript abundance that was broadly correlated with the light-dark environment. Altogether, these data demonstrate that gene-specific diel cycles of ribosome loading are controlled in part by the circadian clock. PMID:26392078
Ablation of p120-Catenin Altering the Activity of Small GTPase in Human Lung Cancer Cells
Directory of Open Access Journals (Sweden)
Nan LIU
2009-05-01
Full Text Available Background and objective p120-catenin (p120ctn, a member of the Armadillo gene family, has emerged as an important modulator of small GTPase activities. Therefore, it plays novel roles in tumor malignant phenotype, such as invasion and metastasis, whose mechanism are not well clarified yet. The aim of this study is to explore the roles of p120ctn on the regulation of small GTP family members in lung cancer and the effects to lung cancer invasions andmetastasis. Methods After p120ctn was knocked down by siRNA, in vivo and in vitro analysis was applied to investigate the role and possible mechanism of p120ctn in lung cancer, such as Western Blot, pull-down analysis, and nude mice models. Results p120ctn depletion inactivated RhoA, with the the activity of Cdc42 and Rac1 increased, the invasiveness of lung cancer cells was promoted both in vitro and in vivo . Conclusion p120ctn gene knockdown enhances the metastasis of lung cancer cells, probably by altering expression of small GTPase, such as inactivation of RhoA and activation of Cdc42/Rac1.
Photoaffinity labeling of the pactamycin binding site on eubacterial ribosomes
International Nuclear Information System (INIS)
Tejedor, F.; Amils, R.; Ballesta, J.P.
1985-01-01
Pactamycin, an inhibitor of the initial steps of protein synthesis, has an acetophenone group in its chemical structure that makes the drug a potentially photoreactive molecule. In addition, the presence of a phenolic residue makes it easily susceptible to radioactive labeling. Through iodination, one radioactive derivative of pactamycin has been obtained with biological activities similar to the unmodified drug when tested on in vivo and cell-free systems. With the use of [ 125 I]iodopactamycin, ribosomes of Escherichia coli have been photolabeled under conditions that preserve the activity of the particles and guarantee the specificity of the binding sites. Under these conditions, RNA is preferentially labeled when free, small ribosomal subunits are photolabeled, but proteins are the main target in the whole ribosome. This indicates that an important conformational change takes place in the binding site on association of the two subunits. The major labeled proteins are S2, S4, S18, S21, and L13. These proteins in the pactamycin binding site are probably related to the initiation step of protein synthesis
International Nuclear Information System (INIS)
Furlong, J.C.; Kyriakidis, S.; Stevely, W.S.
1982-01-01
The effects of infection with the herpes virus pseudorabies virus on the metabolism of HeLa cell ribosomal RNA were examined. There is a decline both in the synthesis of nucleolar 45S ribosomal precursor RNA and in its processing to mature cytoplasmic RNA. The methylated oligonucleotides in the ribosomal RNA species were studied. The methylation of cytoplasmic ribosomal RNA was essentially unchanged. However there was some undermethylation of the nucleolar precursor. If undermethylated RNA does not mature then this may partly explain the reduced processing in the infected cells. (Author)
Insertion of the Biogenesis Factor Rei1 Probes the Ribosomal Tunnel during 60S Maturation.
Greber, Basil Johannes; Gerhardy, Stefan; Leitner, Alexander; Leibundgut, Marc; Salem, Michèle; Boehringer, Daniel; Leulliot, Nicolas; Aebersold, Ruedi; Panse, Vikram Govind; Ban, Nenad
2016-01-14
Eukaryotic ribosome biogenesis depends on several hundred assembly factors to produce functional 40S and 60S ribosomal subunits. The final phase of 60S subunit biogenesis is cytoplasmic maturation, which includes the proofreading of functional centers of the 60S subunit and the release of several ribosome biogenesis factors. We report the cryo-electron microscopy (cryo-EM) structure of the yeast 60S subunit in complex with the biogenesis factors Rei1, Arx1, and Alb1 at 3.4 Å resolution. In addition to the network of interactions formed by Alb1, the structure reveals a mechanism for ensuring the integrity of the ribosomal polypeptide exit tunnel. Arx1 probes the entire set of inner-ring proteins surrounding the tunnel exit, and the C terminus of Rei1 is deeply inserted into the ribosomal tunnel, where it forms specific contacts along almost its entire length. We provide genetic and biochemical evidence that failure to insert the C terminus of Rei1 precludes subsequent steps of 60S maturation. Copyright © 2016 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Katherine Maringer
2014-08-01
Full Text Available Small molecular weight GTPase Rab2 has been shown to be a resident of pre-Golgi intermediates and required for protein transport from the ER to the Golgi complex, however, the function of Rab2 in Dictyostelium has yet to be fully characterized. Using cell lines that over-express DdRab2, as well as cell lines over-expressing constitutively active (CA, and dominant negative (DN forms of the GTPase, we report a functional role in vesicular transport specifically phagocytosis, and endocytosis. Furthermore, Rab2 like other GTPases cycles between an active GTP-bound and an inactive GDP-bound state. We found that this GTP/GDP cycle for DdRab2 is crucial for normal Dictyostelium development and cell–cell adhesion. Similar to Rab5 and Rab7 in C. elegans, we found that DdRab2 plays a role in programmed cell death, possibly in the phagocytic removal of apoptotic corpses.
Garçon, Loïc; Ge, Jingping; Manjunath, Shwetha H; Mills, Jason A; Apicella, Marisa; Parikh, Shefali; Sullivan, Lisa M; Podsakoff, Gregory M; Gadue, Paul; French, Deborah L; Mason, Philip J; Bessler, Monica; Weiss, Mitchell J
2013-08-08
Diamond Blackfan anemia (DBA) is a congenital disorder with erythroid (Ery) hypoplasia and tissue morphogenic abnormalities. Most DBA cases are caused by heterozygous null mutations in genes encoding ribosomal proteins. Understanding how haploinsufficiency of these ubiquitous proteins causes DBA is hampered by limited availability of tissues from affected patients. We generated induced pluripotent stem cells (iPSCs) from fibroblasts of DBA patients carrying mutations in RPS19 and RPL5. Compared with controls, DBA fibroblasts formed iPSCs inefficiently, although we obtained 1 stable clone from each fibroblast line. RPS19-mutated iPSCs exhibited defects in 40S (small) ribosomal subunit assembly and production of 18S ribosomal RNA (rRNA). Upon induced differentiation, the mutant clone exhibited globally impaired hematopoiesis, with the Ery lineage affected most profoundly. RPL5-mutated iPSCs exhibited defective 60S (large) ribosomal subunit assembly, accumulation of 12S pre-rRNA, and impaired erythropoiesis. In both mutant iPSC lines, genetic correction of ribosomal protein deficiency via complementary DNA transfer into the "safe harbor" AAVS1 locus alleviated abnormalities in ribosome biogenesis and hematopoiesis. Our studies show that pathological features of DBA are recapitulated by iPSCs, provide a renewable source of cells to model various tissue defects, and demonstrate proof of principle for genetic correction strategies in patient stem cells.
The ribosome structure controls and directs mRNA entry, translocation and exit dynamics
International Nuclear Information System (INIS)
Kurkcuoglu, Ozge; Doruker, Pemra; Jernigan, Robert L; Sen, Taner Z; Kloczkowski, Andrzej
2008-01-01
The protein-synthesizing ribosome undergoes large motions to effect the translocation of tRNAs and mRNA; here, the domain motions of this system are explored with a coarse-grained elastic network model using normal mode analysis. Crystal structures are used to construct various model systems of the 70S complex with/without tRNA, elongation factor Tu and the ribosomal proteins. Computed motions reveal the well-known ratchet-like rotational motion of the large subunits, as well as the head rotation of the small subunit and the high flexibility of the L1 and L7/L12 stalks, even in the absence of ribosomal proteins. This result indicates that these experimentally observed motions during translocation are inherently controlled by the ribosomal shape and only partially dependent upon GTP hydrolysis. Normal mode analysis further reveals the mobility of A- and P-tRNAs to increase in the absence of the E-tRNA. In addition, the dynamics of the E-tRNA is affected by the absence of the ribosomal protein L1. The mRNA in the entrance tunnel interacts directly with helicase proteins S3 and S4, which constrain the mRNA in a clamp-like fashion, as well as with protein S5, which likely orients the mRNA to ensure correct translation. The ribosomal proteins S7, S11 and S18 may also be involved in assuring translation fidelity by constraining the mRNA at the exit site of the channel. The mRNA also interacts with the 16S 3' end forming the Shine–Dalgarno complex at the initiation step; the 3' end may act as a 'hook' to reel in the mRNA to facilitate its exit
The architecture of mammalian ribosomal protein promoters
Directory of Open Access Journals (Sweden)
Perry Robert P
2005-02-01
Full Text Available Abstract Background Mammalian ribosomes contain 79 different proteins encoded by widely scattered single copy genes. Coordinate expression of these genes at transcriptional and post-transcriptional levels is required to ensure a roughly equimolar accumulation of ribosomal proteins. To date, detailed studies of only a very few ribosomal protein (rp promoters have been made. To elucidate the general features of rp promoter architecture, I made a detailed sequence comparison of the promoter regions of the entire set of orthologous human and mouse rp genes. Results A striking evolutionarily conserved feature of most rp genes is the separation by an intron of the sequences involved in transcriptional and translational regulation from the sequences with protein encoding function. Another conserved feature is the polypyrimidine initiator, which conforms to the consensus (Y2C+1TY(T2(Y3. At least 60 % of the rp promoters contain a largely conserved TATA box or A/T-rich motif, which should theoretically have TBP-binding capability. A remarkably high proportion of the promoters contain conserved binding sites for transcription factors that were previously implicated in rp gene expression, namely upstream GABP and Sp1 sites and downstream YY1 sites. Over 80 % of human and mouse rp genes contain a transposable element residue within 900 bp of 5' flanking sequence; very little sequence identity between human and mouse orthologues was evident more than 200 bp upstream of the transcriptional start point. Conclusions This analysis has provided some valuable insights into the general architecture of mammalian rp promoters and has identified parameters that might coordinately regulate the transcriptional activity of certain subsets of rp genes.
A new version of the RDP (Ribosomal Database Project)
Maidak, B. L.; Cole, J. R.; Parker, C. T. Jr; Garrity, G. M.; Larsen, N.; Li, B.; Lilburn, T. G.; McCaughey, M. J.; Olsen, G. J.; Overbeek, R.;
1999-01-01
The Ribosomal Database Project (RDP-II), previously described by Maidak et al. [ Nucleic Acids Res. (1997), 25, 109-111], is now hosted by the Center for Microbial Ecology at Michigan State University. RDP-II is a curated database that offers ribosomal RNA (rRNA) nucleotide sequence data in aligned and unaligned forms, analysis services, and associated computer programs. During the past two years, data alignments have been updated and now include >9700 small subunit rRNA sequences. The recent development of an ObjectStore database will provide more rapid updating of data, better data accuracy and increased user access. RDP-II includes phylogenetically ordered alignments of rRNA sequences, derived phylogenetic trees, rRNA secondary structure diagrams, and various software programs for handling, analyzing and displaying alignments and trees. The data are available via anonymous ftp (ftp.cme.msu. edu) and WWW (http://www.cme.msu.edu/RDP). The WWW server provides ribosomal probe checking, approximate phylogenetic placement of user-submitted sequences, screening for possible chimeric rRNA sequences, automated alignment, and a suggested placement of an unknown sequence on an existing phylogenetic tree. Additional utilities also exist at RDP-II, including distance matrix, T-RFLP, and a Java-based viewer of the phylogenetic trees that can be used to create subtrees.
Energy Technology Data Exchange (ETDEWEB)
Tsukamoto, Yuta; Katayama, Chisako [Graduate School of Science, Kobe University, 1-1 Rokkodai-cho Nada, Kobe 657-8501 (Japan); Shinohara, Miki; Shinohara, Akira [Institute for Protein Research, Osaka University, 3-2 Yamadaoka, Suita, Osaka 565-0871 (Japan); Maekawa, Shohei [Graduate School of Science, Kobe University, 1-1 Rokkodai-cho Nada, Kobe 657-8501 (Japan); Miyamoto, Masaaki, E-mail: miya@kobe-u.ac.jp [Graduate School of Science, Kobe University, 1-1 Rokkodai-cho Nada, Kobe 657-8501 (Japan); Center for Supports to Research and Education Activities, Kobe University, 1-1 Rokkodai-cho Nada, Kobe 657-8501 (Japan)
2013-11-29
Highlights: •Multiple functions of Rab5 GTPase in fission yeast were found. •Roles of Rab5 in fission yeast were discussed. •Relation between Rab5 and actin cytoskeleton were discussed. -- Abstract: Inner-membrane transport is critical to cell function. Rab family GTPases play an important role in vesicle transport. In mammalian cells, Rab5 is reported to be involved in the regulation of endosome formation, phagocytosis and chromosome alignment. Here, we examined the role of the fission yeast Rab5 homologue Ypt5 using a point mutant allele. Mutant cells displayed abnormal cell morphology, mating, sporulation, endocytosis, vacuole fusion and responses to ion stress. Our data strongly suggest that fission yeast Rab5 is involved in the regulation of various types of cellular functions.
International Nuclear Information System (INIS)
Tsukamoto, Yuta; Katayama, Chisako; Shinohara, Miki; Shinohara, Akira; Maekawa, Shohei; Miyamoto, Masaaki
2013-01-01
Highlights: •Multiple functions of Rab5 GTPase in fission yeast were found. •Roles of Rab5 in fission yeast were discussed. •Relation between Rab5 and actin cytoskeleton were discussed. -- Abstract: Inner-membrane transport is critical to cell function. Rab family GTPases play an important role in vesicle transport. In mammalian cells, Rab5 is reported to be involved in the regulation of endosome formation, phagocytosis and chromosome alignment. Here, we examined the role of the fission yeast Rab5 homologue Ypt5 using a point mutant allele. Mutant cells displayed abnormal cell morphology, mating, sporulation, endocytosis, vacuole fusion and responses to ion stress. Our data strongly suggest that fission yeast Rab5 is involved in the regulation of various types of cellular functions
Quantification of local morphodynamics and local GTPase activity by edge evolution tracking.
Directory of Open Access Journals (Sweden)
Yuki Tsukada
2008-11-01
Full Text Available Advances in time-lapse fluorescence microscopy have enabled us to directly observe dynamic cellular phenomena. Although the techniques themselves have promoted the understanding of dynamic cellular functions, the vast number of images acquired has generated a need for automated processing tools to extract statistical information. A problem underlying the analysis of time-lapse cell images is the lack of rigorous methods to extract morphodynamic properties. Here, we propose an algorithm called edge evolution tracking (EET to quantify the relationship between local morphological changes and local fluorescence intensities around a cell edge using time-lapse microscopy images. This algorithm enables us to trace the local edge extension and contraction by defining subdivided edges and their corresponding positions in successive frames. Thus, this algorithm enables the investigation of cross-correlations between local morphological changes and local intensity of fluorescent signals by considering the time shifts. By applying EET to fluorescence resonance energy transfer images of the Rho-family GTPases Rac1, Cdc42, and RhoA, we examined the cross-correlation between the local area difference and GTPase activity. The calculated correlations changed with time-shifts as expected, but surprisingly, the peak of the correlation coefficients appeared with a 6-8 min time shift of morphological changes and preceded the Rac1 or Cdc42 activities. Our method enables the quantification of the dynamics of local morphological change and local protein activity and statistical investigation of the relationship between them by considering time shifts in the relationship. Thus, this algorithm extends the value of time-lapse imaging data to better understand dynamics of cellular function.
Pakula, Kevin K; Hansen, Lykke H; Vester, Birte
2017-09-01
Several groups of antibiotics inhibit bacterial growth by binding to bacterial ribosomes. Mutations in ribosomal protein L3 have been associated with resistance to linezolid and tiamulin, which both bind at the peptidyl transferase center in the ribosome. Resistance to these and other antibiotics also occurs through methylation of 23S rRNA at position A2503 by the methyltransferase Cfr. The mutations in L3 and the cfr gene have been found together in clinical isolates, raising the question of whether they have a combined effect on antibiotic resistance or growth. We transformed a plasmid-borne cfr gene into a uL3-depleted Escherichia coli strain containing either wild-type L3 or L3 with one of seven mutations, G147R, Q148F, N149S, N149D, N149R, Q150L, or T151P, expressed from plasmid-carried rplC genes. The L3 mutations are well tolerated, with small to moderate growth rate decreases. The presence of Cfr has a very minor influence on the growth rate. The resistance of the transformants to linezolid, tiamulin, florfenicol, and Synercid (a combination of quinupristin and dalfopristin [Q-D]) was measured by MIC assays. The resistance from Cfr was, in all cases, stronger than the effects of the L3 mutations, but various effects were obtained with the combinations of Cfr and L3 mutations ranging from a synergistic to an antagonistic effect. Linezolid and tiamulin susceptibility varied greatly among the L3 mutations, while no significant effects on florfenicol and Q-D susceptibility were seen. This study underscores the complex interplay between various resistance mechanisms and cross-resistance, even from antibiotics with overlapping binding sites. Copyright © 2017 American Society for Microbiology.
Neumann, Bettina; Wu, Haijia; Hackmann, Alexandra; Krebber, Heike
2016-01-01
The DEAD-box RNA-helicase Dbp5/Rat8 is known for its function in nuclear mRNA export, where it displaces the export receptor Mex67 from the mRNA at the cytoplasmic side of the nuclear pore complex (NPC). Here we show that Dbp5 is also required for the nuclear export of both pre-ribosomal subunits. Yeast temperature-sensitive dbp5 mutants accumulate both ribosomal particles in their nuclei. Furthermore, Dbp5 genetically and physically interacts with known ribosomal transport factors such as Nmd3. Similar to mRNA export we show that also for ribosomal transport Dbp5 is required at the cytoplasmic side of the NPC. However, unlike its role in mRNA export, Dbp5 does not seem to undergo its ATPase cycle for this function, as ATPase-deficient dbp5 mutants that selectively inhibit mRNA export do not affect ribosomal transport. Furthermore, mutants of GLE1, the ATPase stimulating factor of Dbp5, show no major ribosomal export defects. Consequently, while Dbp5 uses its ATPase cycle to displace the export receptor Mex67 from the translocated mRNAs, Mex67 remains bound to ribosomal subunits upon transit to the cytoplasm, where it is detectable on translating ribosomes. Therefore, we propose a model, in which Dbp5 supports ribosomal transport by capturing ribosomal subunits upon their cytoplasmic appearance at the NPC, possibly by binding export factors such as Mex67. Thus, our findings reveal that although different ribonucleoparticles, mRNAs and pre-ribosomal subunits, use shared export factors, they utilize different transport mechanisms.
Pactamycin binding site on archaebacterial and eukaryotic ribosomes
International Nuclear Information System (INIS)
Tejedor, F.; Amils, R.; Ballesta, J.P.G.
1987-01-01
The presence of a photoreactive acetophenone group in the protein synthesis inhibitor pactamycin and the possibility of obtaining active iodinated derivatives that retain full biological activity allow the antibiotic binding site on Saccharomyces cerevisiae and archaebacterium Sulfolobus solfataricus ribosomes to be photoaffinity labeled. Four major labeled proteins have been identified in the yeast ribosomes, i.e., YS10, YS18, YS21/24, and YS30, while proteins AL1a, AS10/L8, AS18/20, and AS21/22 appeared as radioactive spots in S. solfataricus. There seems to be a correlation between some of the proteins labeled in yeast and those previously reported in Escherichia coli indicating that the pactamycin binding sites of both species, which are in the small subunit close to the initiation factors and mRNA binding sites, must have similar characteristics
Ribosome-catalyzed formation of an abnormal peptide analogue
International Nuclear Information System (INIS)
Roesser, J.R.; Chorghade, M.S.; Hecht, S.M.
1986-01-01
The peptidyl-tRNA analogue N-(chloracetyl) phenylalanyl-tRNA/sup Phe/ was prepared by chemical aminoacylation and prebound to the P site of Escherichia coli ribosomes in response to poly(uridylic acid). Admixture of phenylalanyl-tRNA/sup Phe/ to the A site resulted in the formation of two dipeptides, one of which was found by displacement of chloride ion from the peptidyl-tRNA. This constitutes the first example of ribosome-mediated formation of a peptide of altered connectivity and suggests a need for revision of the current model of peptide bond formation. Also suggested by the present finding is the feasibility of utilizing tRNAs to prepare polypeptides of altered connectivity in an in vitro protein biosynthesizing system. [ 32 P]-oligo(rA), [ 3 H]- and [ 14 C] phenylalanines were used in the assay of the peptidye-tRNA analogue
Mutational analysis of S12 protein and implications for the accuracy of decoding by the ribosome.
Sharma, Divya; Cukras, Anthony R; Rogers, Elizabeth J; Southworth, Daniel R; Green, Rachel
2007-12-07
The fidelity of aminoacyl-tRNA selection by the ribosome depends on a conformational switch in the decoding center of the small ribosomal subunit induced by cognate but not by near-cognate aminoacyl-tRNA. The aminoglycosides paromomycin and streptomycin bind to the decoding center and induce related structural rearrangements that explain their observed effects on miscoding. Structural and biochemical studies have identified ribosomal protein S12 (as well as specific nucleotides in 16S ribosomal RNA) as a critical molecular contributor in distinguishing between cognate and near-cognate tRNA species as well as in promoting more global rearrangements in the small subunit, referred to as "closure." Here we use a mutational approach to define contributions made by two highly conserved loops in S12 to the process of tRNA selection. Most S12 variant ribosomes tested display increased levels of fidelity (a "restrictive" phenotype). Interestingly, several variants, K42A and R53A, were substantially resistant to the miscoding effects of paromomycin. Further characterization of the compromised paromomycin response identified a probable second, fidelity-modulating binding site for paromomycin in the 16S ribosomal RNA that facilitates closure of the small subunit and compensates for defects associated with the S12 mutations.
Xie, Ping
2015-10-09
Proteins in the cell are synthesized by a ribosome translating the genetic information encoded on the single-stranded messenger RNA (mRNA). It has been shown that the ribosome can also translate through the duplex region of the mRNA by unwinding the duplex. Here, based on our proposed model of the ribosome translation through the mRNA duplex we study theoretically the distribution of dwell times of the ribosome translation through the mRNA duplex under the effect of a pulling force externally applied to the ends of the mRNA to unzip the duplex. We provide quantitative explanations of the available single molecule experimental data on the distribution of dwell times with both short and long durations, on rescuing of the long paused ribosomes by raising the pulling force to unzip the duplex, on translational arrests induced by the mRNA duplex and Shine-Dalgarno(SD)-like sequence in the mRNA. The functional consequences of the pauses or arrests caused by the mRNA duplex and the SD sequence are discussed and compared with those obtained from other types of pausing, such as those induced by "hungry" codons or interactions of specific sequences in the nascent chain with the ribosomal exit tunnel.
International Nuclear Information System (INIS)
Cai, Kun; Mulatz, Kirk; Ard, Ryan; Nguyen, Thanh; Gee, Stephen H
2014-01-01
Unraveling the signaling pathways responsible for the establishment of a metastatic phenotype in carcinoma cells is critically important for understanding the pathology of cancer. The acquisition of cell motility is a key property of metastatic tumor cells and is a prerequisite for invasion. Rho GTPases regulate actin cytoskeleton reorganization and the cellular responses required for cell motility and invasion. Diacylglycerol kinase ζ (DGKζ), an enzyme that phosphorylates diacylglycerol to yield phosphatidic acid, regulates the activity of the Rho GTPases Rac1 and RhoA. DGKζ mRNA is highly expressed in several different colon cancer cell lines, as well as in colon cancer tissue relative to normal colonic epithelium, and thus may contribute to the metastatic process. To investigate potential roles of DGKζ in cancer metastasis, a cellular, isogenic model of human colorectal cancer metastatic transition was used. DGKζ protein levels, Rac1 and RhoA activity, and PAK phosphorylation were measured in the non-metastatic SW480 adenocarcinoma cell line and its highly metastatic variant, the SW620 line. The effect of DGKζ silencing on Rho GTPase activity and invasion through Matrigel-coated Transwell inserts was studied in SW620 cells. Invasiveness was also measured in PC-3 prostate cancer and MDA-MB-231 breast cancer cells depleted of DGKζ. DGKζ protein levels were elevated approximately 3-fold in SW620 cells compared to SW480 cells. There was a concomitant increase in active Rac1 in SW620 cells, as well as substantial increases in the expression and phosphorylation of the Rac1 effector PAK1. Similarly, RhoA activity and expression were increased in SW620 cells. Knockdown of DGKζ expression in SW620 cells by shRNA-mediated silencing significantly reduced Rac1 and RhoA activity and attenuated the invasiveness of SW620 cells in vitro. DGKζ silencing in highly metastatic MDA-MB-231 breast cancer cells and PC-3 prostate cancer cells also significantly attenuated
The Potential of Targeting Ribosome Biogenesis in High-Grade Serous Ovarian Cancer
Directory of Open Access Journals (Sweden)
Shunfei Yan
2017-01-01
Full Text Available Overall survival for patients with ovarian cancer (OC has shown little improvement for decades meaning new therapeutic options are critical. OC comprises multiple histological subtypes, of which the most common and aggressive subtype is high-grade serous ovarian cancer (HGSOC. HGSOC is characterized by genomic structural variations with relatively few recurrent somatic mutations or dominantly acting oncogenes that can be targeted for the development of novel therapies. However, deregulation of pathways controlling homologous recombination (HR and ribosome biogenesis has been observed in a high proportion of HGSOC, raising the possibility that targeting these basic cellular processes may provide improved patient outcomes. The poly (ADP-ribose polymerase (PARP inhibitor olaparib has been approved to treat women with defects in HR due to germline BRCA mutations. Recent evidence demonstrated the efficacy of targeting ribosome biogenesis with the specific inhibitor of ribosomal RNA synthesis, CX-5461 in v-myc avian myelocytomatosis viral oncogene homolog (MYC-driven haematological and prostate cancers. CX-5461 has now progressed to a phase I clinical trial in patients with haematological malignancies and phase I/II trial in breast cancer. Here we review the currently available targeted therapies for HGSOC and discuss the potential of targeting ribosome biogenesis as a novel therapeutic approach against HGSOC.
Cross-site comparison of ribosomal depletion kits for Illumina RNAseq library construction.
Herbert, Zachary T; Kershner, Jamie P; Butty, Vincent L; Thimmapuram, Jyothi; Choudhari, Sulbha; Alekseyev, Yuriy O; Fan, Jun; Podnar, Jessica W; Wilcox, Edward; Gipson, Jenny; Gillaspy, Allison; Jepsen, Kristen; BonDurant, Sandra Splinter; Morris, Krystalynne; Berkeley, Maura; LeClerc, Ashley; Simpson, Stephen D; Sommerville, Gary; Grimmett, Leslie; Adams, Marie; Levine, Stuart S
2018-03-15
Ribosomal RNA (rRNA) comprises at least 90% of total RNA extracted from mammalian tissue or cell line samples. Informative transcriptional profiling using massively parallel sequencing technologies requires either enrichment of mature poly-adenylated transcripts or targeted depletion of the rRNA fraction. The latter method is of particular interest because it is compatible with degraded samples such as those extracted from FFPE and also captures transcripts that are not poly-adenylated such as some non-coding RNAs. Here we provide a cross-site study that evaluates the performance of ribosomal RNA removal kits from Illumina, Takara/Clontech, Kapa Biosystems, Lexogen, New England Biolabs and Qiagen on intact and degraded RNA samples. We find that all of the kits are capable of performing significant ribosomal depletion, though there are differences in their ease of use. All kits were able to remove ribosomal RNA to below 20% with intact RNA and identify ~ 14,000 protein coding genes from the Universal Human Reference RNA sample at >1FPKM. Analysis of differentially detected genes between kits suggests that transcript length may be a key factor in library production efficiency. These results provide a roadmap for labs on the strengths of each of these methods and how best to utilize them.
Rab4GTPase modulates CFTR function by impairing channel expression at plasma membrane
International Nuclear Information System (INIS)
Saxena, Sunil K.; Kaur, Simarna; George, Constantine
2006-01-01
Cystic fibrosis (CF), an autosomal recessive disorder, is caused by the disruption of biosynthesis or the function of a membrane cAMP-activated chloride channel, CFTR. CFTR regulatory mechanisms include recruitment of channel proteins to the cell surface from intracellular pools and by protein-protein interactions. Rab proteins are small GTPases involved in regulated trafficking controlling vesicle docking and fusion. Rab4 controls recycling events from endosome to the plasma membrane, fusion, and degradation. The colorectal cell line HT-29 natively expresses CFTR and responds to cAMP stimulation with an increase in CFTR-mediated currents. Rab4 over-expression in HT-29 cells inhibits both basal and cAMP-stimulated CFTR-mediated currents. GTPase-deficient Rab4Q67L and GDP locked Rab4S22N both inhibit channel activity, which appears characteristically different. Active status of Rab4 was confirmed by GTP overlay assay, while its expression was verified by Western blotting. The pull-down and immunoprecipitation experiments suggest that Rab4 physically interacts with CFTR through protein-protein interaction. Biotinylation with cell impermeant NHS-Sulfo-SS-Biotin implies that Rab4 impairs CFTR expression at cell surface. The enhanced cytosolic CFTR indicates that Rab4 expression restrains CFTR appearance at the cell membrane. The study suggests that Rab4 regulates the channel through multiple mechanisms that include protein-protein interaction, GTP/GDP exchange, and channel protein trafficking. We propose that Rab4 is a dynamic molecule with a significant role in CFTR function
Directory of Open Access Journals (Sweden)
Carter Christine
2009-04-01
Full Text Available Abstract Background GIMAP (GTPase of the immunity-associated protein family proteins are a family of putative GTPases believed to be regulators of cell death in lymphomyeloid cells. GIMAP1 was the first reported member of this gene family, identified as a gene up-regulated at the RNA level in the spleens of mice infected with the malarial parasite, Plasmodium chabaudi. Methods A monoclonal antibody against mouse GIMAP1 was developed and was used to analyse the expression of the endogenous protein in tissues of normal mice and in defined sub-populations of cells prepared from lymphoid tissues using flow cytometry. It was also used to assess the expression of GIMAP1 protein after infection and/or immunization of mice with P. chabaudi. Real-time PCR analysis was employed to measure the expression of GIMAP1 for comparison with the protein level analysis. Results GIMAP1 protein expression was detected in all lineages of lymphocytes (T, B, NK, in F4/80+ splenic macrophages and in some lymphoid cell lines. Additional evidence is presented suggesting that the strong expression by mature B cells of GIMAP1 and other GIMAP genes and proteins seen in mice may be a species-dependent characteristic. Unexpectedly, no increase was found in the expression of GIMAP1 in P. chabaudi infected mice at either the mRNA or protein level, and this remained so despite applying a number of variations to the protocol. Conclusion The model of up-regulation of GIMAP1 in response to infection/immunization with P. chabaudi is not a robustly reproducible experimental system. The GIMAP1 protein is widely expressed in lymphoid cells, with an interesting increase in expression in the later stages of B cell development. Alternative approaches will be required to define the functional role of this GTPase in immune cells.
Hulscher, Ryan M; Bohon, Jen; Rappé, Mollie C; Gupta, Sayan; D'Mello, Rhijuta; Sullivan, Michael; Ralston, Corie Y; Chance, Mark R; Woodson, Sarah A
2016-07-01
The assembly of the Escherichia coli ribosome has been widely studied and characterized in vitro. Despite this, ribosome biogenesis in living cells is only partly understood because assembly is coupled with transcription, modification and processing of the pre-ribosomal RNA. We present a method for footprinting and isolating pre-rRNA as it is synthesized in E. coli cells. Pre-rRNA synthesis is synchronized by starvation, followed by nutrient upshift. RNA synthesized during outgrowth is metabolically labeled to facilitate isolation of recent transcripts. Combining this technique with two in vivo RNA probing methods, hydroxyl radical and DMS footprinting, allows the structure of nascent RNA to be probed over time. Together, these can be used to determine changes in the structures of ribosome assembly intermediates as they fold in vivo. Copyright © 2016 Elsevier Inc. All rights reserved.
Genome-Scale Analysis of Translation Elongation with a Ribosome Flow Model
Meilijson, Isaac; Kupiec, Martin; Ruppin, Eytan
2011-01-01
We describe the first large scale analysis of gene translation that is based on a model that takes into account the physical and dynamical nature of this process. The Ribosomal Flow Model (RFM) predicts fundamental features of the translation process, including translation rates, protein abundance levels, ribosomal densities and the relation between all these variables, better than alternative (‘non-physical’) approaches. In addition, we show that the RFM can be used for accurate inference of various other quantities including genes' initiation rates and translation costs. These quantities could not be inferred by previous predictors. We find that increasing the number of available ribosomes (or equivalently the initiation rate) increases the genomic translation rate and the mean ribosome density only up to a certain point, beyond which both saturate. Strikingly, assuming that the translation system is tuned to work at the pre-saturation point maximizes the predictive power of the model with respect to experimental data. This result suggests that in all organisms that were analyzed (from bacteria to Human), the global initiation rate is optimized to attain the pre-saturation point. The fact that similar results were not observed for heterologous genes indicates that this feature is under selection. Remarkably, the gap between the performance of the RFM and alternative predictors is strikingly large in the case of heterologous genes, testifying to the model's promising biotechnological value in predicting the abundance of heterologous proteins before expressing them in the desired host. PMID:21909250
DEFF Research Database (Denmark)
Vester, Birte; Garrett, Roger Antony
1988-01-01
in vivo on a plasmid-encoded rRNA (rrnB) operon and each one yielded dramatically altered phenotypes. Cells exhibiting A2060----C or A2450----C transversions were inviable and it was shown by inserting the mutated genes after a temperature-inducible promoter that the mutant RNAs were directly responsible...... into 50S subunits, but while the two lethal mutant RNAs were strongly selected against in 70S ribosomes, the plasmid-encoded A2503----C RNA was preferred over the chromosome-encoded RNA, contrary to current regulatory theories. The results establish the critical structural and functional importance...
Cross-linking of streptomycin to the 16S ribosomal RNA of Escherichia coli
International Nuclear Information System (INIS)
Gravel, M.; Melancon, P.; Barkier-Gingras, L.
1987-01-01
[ 3 H]Dihydrostreptomycin was cross-linked to the 30S ribosomal subunit from Escherichia coli with the bifunctional reagent nitrogen mustard. The cross-linking primarily involved the 16S RNA. To localize the site of cross-linking of streptomycin to the 16S RNA, the authors hybridized RNA labeled with streptomycin to restriction fragments of the 16S RNA gene. Labeled RNA hybridized to DNA fragments corresponding to bases 892-917 and bases 1394-1415. These two segments of the ribosomal RNA must by juxtaposed in the ribosome, since there is a single binding site for streptomycin. This region has been implicated both in the decoding site and in the binding of initiation factor IF-3, indicating its functional importance
Chen, Shuying; Li, Huan; Li, Shouyun; Yu, Jing; Wang, Min; Xing, Haiyan; Tang, Kejing; Tian, Zheng; Rao, Qing; Wang, Jianxiang
2016-07-01
Interaction between hematopoietic stem/progenitor cells (HSPCs) with their niche is critical for HSPC function. The interaction also plays an important role in the multistep process of leukemogenesis. Rac1 GTPase has been found to be highly expressed and activated in leukemia patients. Here, by forced expression of constitutively active form of Rac1 (Rac1-V12) in HSPCs, we demonstrate that active Rac1 promotes interaction of HSPC with niche. We then established an active Rac1 associated acute myeloid leukemia (AML) model by expression of Rac1-V12 cooperated with AML1-ETO9a (AE9a) in mouse HSPCs. Compared with AE9a alone, Rac1-V12 cooperated with AE9a (AER) drives an AML with a short latency, demonstrating that activation of Rac1 GTPase in mice promotes AML development. The mechanism of this AML promotion is by a better homing and lodging of leukemia cells in niche, which further enhancing their colony formation, quiescence and preventing leukemia cells from apoptosis. Further study showed that an inhibitor targeting activated Rac1 can increase the efficacy of chemotherapeutic agents to leukemia cells. This study provides evidence that activation of Rac1 promotes leukemia development through enhancing leukemia cells' homing and retention in niche, and suggests that inhibition of Rac1 GTPase could be an effective way of eliminating AML cells. Stem Cells 2016;34:1730-1741. © 2016 AlphaMed Press.
Origins of the plant chloroplasts and mitochondria based on comparisons of 5S ribosomal RNAs
Delihas, N.; Fox, G. E.
1987-01-01
In this paper, we provide macromolecular comparisons utilizing the 5S ribosomal RNA structure to suggest extant bacteria that are the likely descendants of chloroplast and mitochondria endosymbionts. The genetic stability and near universality of the 5S ribosomal gene allows for a useful means to study ancient evolutionary changes by macromolecular comparisons. The value in current and future ribosomal RNA comparisons is in fine tuning the assignment of ancestors to the organelles and in establishing extant species likely to be descendants of bacteria involved in presumed multiple endosymbiotic events.
LENUS (Irish Health Repository)
Vlahou, Georgia
2009-07-14
Abstract Background All human pathogenic Yersinia species share a virulence-associated type III secretion system that translocates Yersinia effector proteins into host cells to counteract infection-induced signaling responses and prevent phagocytosis. Dictyostelium discoideum has been recently used to study the effects of bacterial virulence factors produced by internalized pathogens. In this study we explored the potential of Dictyostelium as model organism for analyzing the effects of ectopically expressed Yersinia outer proteins (Yops). Results The Yersinia pseudotuberculosis virulence factors YopE, YopH, YopM and YopJ were expressed de novo within Dictyostelium and their effects on growth in axenic medium and on bacterial lawns were analyzed. No severe effect was observed for YopH, YopJ and YopM, but expression of YopE, which is a GTPase activating protein for Rho GTPases, was found to be highly detrimental. GFP-tagged YopE expressing cells had less conspicuous cortical actin accumulation and decreased amounts of F-actin. The actin polymerization response upon cAMP stimulation was impaired, although chemotaxis was unaffected. YopE also caused reduced uptake of yeast particles. These alterations are probably due to impaired Rac1 activation. We also found that YopE predominantly associates with intracellular membranes including the Golgi apparatus and inhibits the function of moderately overexpressed RacH. Conclusion The phenotype elicited by YopE in Dictyostelium can be explained, at least in part, by inactivation of one or more Rho family GTPases. It further demonstrates that the social amoeba Dictyostelium discoideum can be used as an efficient and easy-to-handle model organism in order to analyze the function of a translocated GAP protein of a human pathogen.
Plastid ribosome pausing is induced by multiple features and is linked to protein complex assembly
DEFF Research Database (Denmark)
Gawroński, Piotr; Jensen, Poul Erik; Karpinski, Stanislaw
2018-01-01
Many mRNAs contain pause sites that briefly interrupt the progress of translation. Specific features that induce ribosome pausing have been described; however, their individual contributions to pause-site formation, and the overall biological significance of ribosome pausing, remain largely uncle...
Myb-binding protein 1a (Mybbp1a) regulates levels and processing of pre-ribosomal RNA.
Hochstatter, Julia; Hölzel, Michael; Rohrmoser, Michaela; Schermelleh, Lothar; Leonhardt, Heinrich; Keough, Rebecca; Gonda, Thomas J; Imhof, Axel; Eick, Dirk; Längst, Gernot; Németh, Attila
2012-07-13
Ribosomal RNA gene transcription, co-transcriptional processing, and ribosome biogenesis are highly coordinated processes that are tightly regulated during cell growth. In this study we discovered that Mybbp1a is associated with both the RNA polymerase I complex and the ribosome biogenesis machinery. Using a reporter assay that uncouples transcription and RNA processing, we show that Mybbp1a represses rRNA gene transcription. In addition, overexpression of the protein reduces RNA polymerase I loading on endogenous rRNA genes as revealed by chromatin immunoprecipitation experiments. Accordingly, depletion of Mybbp1a results in an accumulation of the rRNA precursor in vivo but surprisingly also causes growth arrest of the cells. This effect can be explained by the observation that the modulation of Mybbp1a protein levels results in defects in pre-rRNA processing within the cell. Therefore, the protein may play a dual role in the rRNA metabolism, potentially linking and coordinating ribosomal DNA transcription and pre-rRNA processing to allow for the efficient synthesis of ribosomes.
Zhao, Huayan
2017-03-10
AtLSG1-2 is a circularly permuted GTPase required for ribosome biogenesis and recently shown to be involved in early leaf development, although it was unclear how AtLSG1-2 affects leaf growth. Here, we found that atlsg1-2 mutants had reduced leaf size as a result of decreased cell size and cell number. Leaf kinematic analysis and CYCB1;1
Zhao, Huayan; Lü , Shiyou; Xiong, Liming
2017-01-01
AtLSG1-2 is a circularly permuted GTPase required for ribosome biogenesis and recently shown to be involved in early leaf development, although it was unclear how AtLSG1-2 affects leaf growth. Here, we found that atlsg1-2 mutants had reduced leaf size as a result of decreased cell size and cell number. Leaf kinematic analysis and CYCB1;1
Kinase-Mediated Regulation of 40S Ribosome Assembly in Human Breast Cancer
2017-02-01
and will assess if this resistance involves gain-of-function mutations in Ltv1, and if resistance can be overcome with drugs that direct...ribosome assembly factor Ltv1 in both yeast and TNBC cells, and that selective knockdown or silencing of CK1δ, or forced expression of Ltv1 mutant that...cannot be phosphorylated by CK1δ, blocks ribosome assembly in yeast and compromises the growth and survival of TNBC cells. Further, we have shown that
The Ribosomal RNA is a Useful Marker to Visualize Rhizobia Interacting with Legume Plants
Rinaudi, Luciana; Isola, Maria C.; Giordano, Walter
2004-01-01
Symbiosis between rhizobia and leguminous plants leads to the formation of nitrogen-fixing root nodules. In the present article, we recommend the use of the ribosomal RNA (rRNA) isolated from legume nodules in an experimental class with the purpose of introducing students to the structure of eukaryotic and prokaryotic ribosomes and of…
Retrotransposition and mutation events yield Rap1 GTPases with differential signalling capacity
Directory of Open Access Journals (Sweden)
Penzkofer Tobias
2010-02-01
Full Text Available Abstract Background Retrotransposition of mRNA transcripts gives occasionally rise to functional retrogenes. Through acquiring tempero-spatial expression patterns distinct from their parental genes and/or functional mutations in their coding sequences, such retrogenes may in principle reshape signalling networks. Results Here we present evidence for such a scenario, involving retrogenes of Rap1 belonging to the Ras family of small GTPases. We identified two murine and one human-specific retrogene of Rap1A and Rap1B, which encode proteins that differ by only a few amino acids from their parental Rap1 proteins. Markedly, human hRap1B-retro and mouse mRap1A-retro1 acquired mutations in the 12th and 59th amino acids, respectively, corresponding to residues mutated in constitutively active oncogenic Ras proteins. Statistical and structural analyses support a functional evolution scenario, where Rap1 isoforms of retrogenic origin are functionally distinct from their parental proteins. Indeed, all retrogene-encoded GTPases have an increased GTP/GDP binding ratio in vivo, indicating that their conformations resemble that of active GTP-bound Rap1. We furthermore demonstrate that these three Rap1 isoforms exhibit distinct affinities for the Ras-binding domain of RalGDS. Finally, when tested for their capacity to induce key cellular processes like integrin-mediated cell adhesion or cell spreading, marked differences are seen. Conclusions Together, these data lend strong support for an evolution scenario, where retrotransposition and subsequent mutation events generated species-specific Rap1 isoforms with differential signaling potential. Expression of the constitutively active human Rap1B-retro in cells like those derived from Ramos Burkitt's lymphoma and bone marrow from a patient with myelodysplastic syndrome (MDS warrants further investigation into its role in disease development.
Mallik, Saurav; Kundu, Sudip
2015-01-01
Using the available crystal structures of 50S ribosomal subunits from three prokaryotic species: Escherichia coli (mesophilic), Thermus thermophilus (thermophilic), and Haloarcula marismortui (halophilic), we have analyzed different structural features of ribosomal RNAs (rRNAs), proteins, and of their interfaces. We have correlated these structural features with the environmental adaptation strategies of the corresponding species. While dense intra-rRNA packing is observed in thermophilic, loose intra-rRNA packing is observed in halophilic (both compared to mesophilic). Interestingly, protein-rRNA interfaces of both the extremophiles are densely packed compared to that of the mesophilic. The intersubunit bridge regions are almost devoid of cavities, probably ensuring the proper formation of each bridge (by not allowing any loosely packed region nearby). During rRNA binding, the ribosomal proteins experience some structural transitions. Here, we have analyzed the intrinsically disordered and ordered regions of the ribosomal proteins, which are subjected to such transitions. The intrinsically disordered and disorder-to-order transition sites of the thermophilic and mesophilic ribosomal proteins are simultaneously (i) highly conserved and (ii) slowly evolving compared to rest of the protein structure. Although high conservation is observed at such sites of halophilic ribosomal proteins, but slow rate of evolution is absent. Such differences between thermophilic, mesophilic, and halophilic can be explained from their environmental adaptation strategy. Interestingly, a universal biophysical principle evident by a linear relationship between the free energy of interface formation, interface area, and structural changes of r-proteins during assembly is always maintained, irrespective of the environmental conditions.
Defining the bacteroides ribosomal binding site.
Wegmann, Udo; Horn, Nikki; Carding, Simon R
2013-03-01
The human gastrointestinal tract, in particular the colon, hosts a vast number of commensal microorganisms. Representatives of the genus Bacteroides are among the most abundant bacterial species in the human colon. Bacteroidetes diverged from the common line of eubacterial descent before other eubacterial groups. As a result, they employ unique transcription initiation signals and, because of this uniqueness, they require specific genetic tools. Although some tools exist, they are not optimal for studying the roles and functions of these bacteria in the human gastrointestinal tract. Focusing on translation initiation signals in Bacteroides, we created a series of expression vectors allowing for different levels of protein expression in this genus, and we describe the use of pepI from Lactobacillus delbrueckii subsp. lactis as a novel reporter gene for Bacteroides. Furthermore, we report the identification of the 3' end of the 16S rRNA of Bacteroides ovatus and analyze in detail its ribosomal binding site, thus defining a core region necessary for efficient translation, which we have incorporated into the design of our expression vectors. Based on the sequence logo information from the 5' untranslated region of other Bacteroidales ribosomal protein genes, we conclude that our findings are relevant to all members of this order.
Klebsazolicin inhibits 70S ribosome by obstructing the peptide exit tunnel
Energy Technology Data Exchange (ETDEWEB)
Metelev, Mikhail; Osterman, Ilya A.; Ghilarov, Dmitry; Khabibullina, Nelli F.; Yakimov, Alexander; Shabalin, Konstantin; Utkina, Irina; Travin, Dmitry Y.; Komarova, Ekaterina S.; Serebryakova, Marina; Artamonova, Tatyana; Khodorkovskii, Mikhail; Konevega, Andrey L.; Sergiev, Petr V.; Severinov, Konstantin; Polikanov, Yury S.
2017-08-28
Whereas screening of the small-molecule metabolites produced by most cultivatable microorganisms often results in the rediscovery of known compounds, genome-mining programs allow researchers to harness much greater chemical diversity, and result in the discovery of new molecular scaffolds. Here we report the genome-guided identification of a new antibiotic, klebsazolicin (KLB), from Klebsiella pneumoniae that inhibits the growth of sensitive cells by targeting ribosomes. A ribosomally synthesized post-translationally modified peptide (RiPP), KLB is characterized by the presence of a unique N-terminal amidine ring that is essential for its activity. Biochemical in vitro studies indicate that KLB inhibits ribosomes by interfering with translation elongation. Structural analysis of the ribosome–KLB complex showed that the compound binds in the peptide exit tunnel overlapping with the binding sites of macrolides or streptogramin-B. KLB adopts a compact conformation and largely obstructs the tunnel. Engineered KLB fragments were observed to retain in vitro activity, and thus have the potential to serve as a starting point for the development of new bioactive compounds.
Emergence of robust growth laws from optimal regulation of ribosome synthesis.
Scott, Matthew; Klumpp, Stefan; Mateescu, Eduard M; Hwa, Terence
2014-08-22
Bacteria must constantly adapt their growth to changes in nutrient availability; yet despite large-scale changes in protein expression associated with sensing, adaptation, and processing different environmental nutrients, simple growth laws connect the ribosome abundance and the growth rate. Here, we investigate the origin of these growth laws by analyzing the features of ribosomal regulation that coordinate proteome-wide expression changes with cell growth in a variety of nutrient conditions in the model organism Escherichia coli. We identify supply-driven feedforward activation of ribosomal protein synthesis as the key regulatory motif maximizing amino acid flux, and autonomously guiding a cell to achieve optimal growth in different environments. The growth laws emerge naturally from the robust regulatory strategy underlying growth rate control, irrespective of the details of the molecular implementation. The study highlights the interplay between phenomenological modeling and molecular mechanisms in uncovering fundamental operating constraints, with implications for endogenous and synthetic design of microorganisms. © 2014 The Authors. Published under the terms of the CC BY 4.0 license.
Detection of protein-protein interactions by ribosome display and protein in situ immobilisation.
He, Mingyue; Liu, Hong; Turner, Martin; Taussig, Michael J
2009-12-31
We describe a method for identification of protein-protein interactions by combining two cell-free protein technologies, namely ribosome display and protein in situ immobilisation. The method requires only PCR fragments as the starting material, the target proteins being made through cell-free protein synthesis, either associated with their encoding mRNA as ribosome complexes or immobilised on a solid surface. The use of ribosome complexes allows identification of interacting protein partners from their attached coding mRNA. To demonstrate the procedures, we have employed the lymphocyte signalling proteins Vav1 and Grb2 and confirmed the interaction between Grb2 and the N-terminal SH3 domain of Vav1. The method has promise for library screening of pairwise protein interactions, down to the analytical level of individual domain or motif mapping.
Purification and some properties of G-factor from the silk gland of silkworm
International Nuclear Information System (INIS)
Taira, Hideharu; Ejiri, Shin-ichiro; Shimura, Kensuke
1972-01-01
Purification of G-factor from the silk gland of silkworms and some of its properties have been studied in comparison with the G-factor from E. coli and rat liver transferase II. In the experiment, GTP-γ- 32 P was prepared from GDP and 32 Pi by photophosphorylation with spinach chloroplasts, and purified by Dowex-1 chromatography. The purified G-factor was homogeneous on disc gel electrophoresis. Molecular weight of 80,000 was estimated from a calibrated Sephadex G-200 column. The purified G-factor exhibited uncoupled ribosome-dependent GTPase activity, and was inhibited by fusidic acid, SH inhibitor, and diphtheria toxin plus NAD. The G-factor from E. coli and that from the silk gland were not interchangeable in GTPase reaction. (Yamanoto, Y.)
Purification and some properties of G-factor from the silk gland of silkworm
Energy Technology Data Exchange (ETDEWEB)
Taira, H; Ejiri, S I; Shimura, K [Tohoku Univ., Sendai (Japan). Faculty of Agriculture
1972-12-01
Purification of G-factor from the silk gland of silkworms and some of its properties have been studied in comparison with the G-factor from E. coli and rat liver transferase II. In the experiment, GTP-..gamma..-/sup 32/P was prepared from GDP and /sup 32/Pi by photophosphorylation with spinach chloroplasts, and purified by Dowex-1 chromatography. The purified G-factor was homogeneous on disc gel electrophoresis. Molecular weight of 80,000 was estimated from a calibrated Sephadex G-200 column. The purified G-factor exhibited uncoupled ribosome-dependent GTPase activity, and was inhibited by fusidic acid, SH inhibitor, and diphtheria toxin plus NAD. The G-factor from E. coli and that from the silk gland were not interchangeable in GTPase reaction.
The SmpB C-terminal tail helps tmRNA to recognize and enter stalled ribosomes
Directory of Open Access Journals (Sweden)
Mickey R. Miller
2014-09-01
Full Text Available In bacteria, transfer-messenger RNA (tmRNA and SmpB comprise the most common and effective system for rescuing stalled ribosomes. Ribosomes stall on mRNA transcripts lacking stop codons and are rescued as the defective mRNA is swapped for the tmRNA template in a process known as trans-translation. The tmRNA–SmpB complex is recruited to the ribosome independent of a codon–anticodon interaction. Given that the ribosome uses robust discriminatory mechanisms to select against non-cognate tRNAs during canonical decoding, it has been hard to explain how this can happen. Recent structural and biochemical studies show that SmpB licenses tmRNA entry through its interactions with the decoding center and mRNA channel. In particular, the C-terminal tail of SmpB promotes both EFTu activation and accommodation of tmRNA, the former through interactions with 16S rRNA nucleotide G530 and the latter through interactions with the mRNA channel downstream of the A site. Here we present a detailed model of the earliest steps in trans-translation, and in light of these mechanistic considerations, revisit the question of how tmRNA preferentially reacts with stalled, non-translating ribosomes.
Fluctuations between multiple EF-G-induced chimeric tRNA states during translocation on the ribosome
Adio, Sarah; Senyushkina, Tamara; Peske, Frank; Fischer, Niels; Wintermeyer, Wolfgang; Rodnina, Marina V.
2015-06-01
The coupled translocation of transfer RNA and messenger RNA through the ribosome entails large-scale structural rearrangements, including step-wise movements of the tRNAs. Recent structural work has visualized intermediates of translocation induced by elongation factor G (EF-G) with tRNAs trapped in chimeric states with respect to 30S and 50S ribosomal subunits. The functional role of the chimeric states is not known. Here we follow the formation of translocation intermediates by single-molecule fluorescence resonance energy transfer. Using EF-G mutants, a non-hydrolysable GTP analogue, and fusidic acid, we interfere with either translocation or EF-G release from the ribosome and identify several rapidly interconverting chimeric tRNA states on the reaction pathway. EF-G engagement prevents backward transitions early in translocation and increases the fraction of ribosomes that rapidly fluctuate between hybrid, chimeric and posttranslocation states. Thus, the engagement of EF-G alters the energetics of translocation towards a flat energy landscape, thereby promoting forward tRNA movement.
Jomaa, Ahmad; Fu, Yu-Hsien Hwang; Boehringer, Daniel; Leibundgut, Marc; Shan, Shu-Ou; Ban, Nenad
2017-05-19
During co-translational protein targeting, the signal recognition particle (SRP) binds to the translating ribosome displaying the signal sequence to deliver it to the SRP receptor (SR) on the membrane, where the signal peptide is transferred to the translocon. Using electron cryo-microscopy, we have determined the structure of a quaternary complex of the translating Escherichia coli ribosome, the SRP-SR in the 'activated' state and the translocon. Our structure, supported by biochemical experiments, reveals that the SRP RNA adopts a kinked and untwisted conformation to allow repositioning of the 'activated' SRP-SR complex on the ribosome. In addition, we observe the translocon positioned through interactions with the SR in the vicinity of the ribosome exit tunnel where the signal sequence is extending beyond its hydrophobic binding groove of the SRP M domain towards the translocon. Our study provides new insights into the mechanism of signal sequence transfer from the SRP to the translocon.
Yang, Qing-Li; Shen, Ji-Qing; Jiang, Zhi-Hua; Yang, Yi-Chao; Li, Hong-Mei; Chen, Ying-Dan; Zhou, Xiao-Nong
2014-06-01
To identify Clonorchis sinensis metacercariae using PCR targeting ribosomal DNA ITS region and COX1 gene. Pseudorasbora parva were collected from Hengxian County of Guangxi at the end of May 2013. Single metacercaria of C. sinensis and other trematodes were separated from muscle tissue of P. parva by digestion method. Primers targeting ribosomal DNA ITS region and COX1 gene of C. sinensis were designed for PCR and the universal primers were used as control. The sensitivity and specificity of the PCR detection were analyzed. C. sinensis metacercariae at different stages were identified by PCR. DNA from single C. sinensis metacercaria was detected by PCR targeting ribosomal DNA ITS region and COX1 gene. The specific amplicans have sizes of 437/549, 156/249 and 195/166 bp, respectively. The ratio of the two positive numbers in PCR with universal primers and specific primers targeting C. sinensis ribosomal DNA ITS1 and ITS2 regions was 0.905 and 0.952, respectively. The target gene fragments were amplified by PCR using COX1 gene-specific primers. The PCR with specific primers did not show any non-specific amplification. However, the PCR with universal primers targeting ribosomal DNA ITS regions performed serious non-specific amplification. C. sinensis metacercariae at different stages are identified by morphological observation and PCR method. Species-specific primers targeting ribosomal DNA ITS region show higher sensitivity and specificity than the universal primers. PCR targeting COX1 gene shows similar sensitivity and specificity to PCR with specific primers targeting ribosomal DNA ITS regions.
Tan, Thomas C J; Knight, John; Sbarrato, Thomas; Dudek, Kate; Willis, Anne E; Zamoyska, Rose
2017-07-25
Global transcriptomic and proteomic analyses of T cells have been rich sources of unbiased data for understanding T-cell activation. Lack of full concordance of these datasets has illustrated that important facets of T-cell activation are controlled at the level of translation. We undertook translatome analysis of CD8 T-cell activation, combining polysome profiling and microarray analysis. We revealed that altering T-cell receptor stimulation influenced recruitment of mRNAs to heavy polysomes and translation of subsets of genes. A major pathway that was compromised, when TCR signaling was suboptimal, was linked to ribosome biogenesis, a rate-limiting factor in both cell growth and proliferation. Defective TCR signaling affected transcription and processing of ribosomal RNA precursors, as well as the translation of specific ribosomal proteins and translation factors. Mechanistically, IL-2 production was compromised in weakly stimulated T cells, affecting the abundance of Myc protein, a known regulator of ribosome biogenesis. Consequently, weakly activated T cells showed impaired production of ribosomes and a failure to maintain proliferative capacity after stimulation. We demonstrate that primary T cells respond to various environmental cues by regulating ribosome biogenesis and mRNA translation at multiple levels to sustain proliferation and differentiation.
(Brassicaceae) based on nuclear ribosomal ITS DNA sequences
Indian Academy of Sciences (India)
Home; Journals; Journal of Genetics; Volume 93; Issue 2. Phylogeny and biogeography of Alyssum (Brassicaceae) based on nuclear ribosomal ITS DNA sequences. Yan Li Yan Kong Zhe Zhang Yanqiang Yin Bin Liu Guanghui Lv Xiyong Wang. Research Article Volume 93 Issue 2 August 2014 pp 313-323 ...
Architecture of the E.coli 70S ribosome
DEFF Research Database (Denmark)
Burkhardt, N.; Diedrich, G.; Nierhaus, K.H.
1997-01-01
The 70S ribosome from E.coli was analysed by neutron scattering focusing on the shape and the internal protein-RNA-distribution of the complex. Measurements on selectively deuterated 70S particles and free 30S and 50S subunits applying conventional contrast variation and proton-spin contrast...
Directory of Open Access Journals (Sweden)
Kiran Hasygar
2014-11-01
Full Text Available Insulin-like signalling is a conserved mechanism that coordinates animal growth and metabolism with nutrient status. In Drosophila, insulin-producing median neurosecretory cells (IPCs regulate larval growth by secreting insulin-like peptides (dILPs in a diet-dependent manner. Previous studies have shown that nutrition affects dILP secretion through humoral signals derived from the fat body. Here we uncover a novel mechanism that operates cell autonomously in the IPCs to regulate dILP secretion. We observed that impairment of ribosome biogenesis specifically in the IPCs strongly inhibits dILP secretion, which consequently leads to reduced body size and a delay in larval development. This response is dependent on p53, a known surveillance factor for ribosome biogenesis. A downstream effector of this growth inhibitory response is an atypical MAP kinase ERK7 (ERK8/MAPK15, which is upregulated in the IPCs following impaired ribosome biogenesis as well as starvation. We show that ERK7 is sufficient and essential to inhibit dILP secretion upon impaired ribosome biogenesis, and it acts epistatically to p53. Moreover, we provide evidence that p53 and ERK7 contribute to the inhibition of dILP secretion upon starvation. Thus, we conclude that a cell autonomous ribosome surveillance response, which leads to upregulation of ERK7, inhibits dILP secretion to impede tissue growth under limiting dietary conditions.
Organization of Replication of Ribosomal DNA in Saccharomyces cerevisiae
Linskens, Maarten H.K.; Huberman, Joel A.
1988-01-01
Using recently developed replicon mapping techniques, we have analyzed the replication of the ribosomal DNA in Saccharomyces cerevisiae. The results show that (i) the functional origin of replication colocalizes with an autonomously replicating sequence element previously mapped to the
Ribosomal DNA internal transcribed spacer 1 and internal ...
African Journals Online (AJOL)
USER
2010-07-26
Jul 26, 2010 ... in some East Asian countries such as China, Korea and. *Corresponding author. E-mail: soonkwan@kangwon.ac.kr. Tel: +82 33 250 6476. Fax: +82 33 250 6470. Abbreviations: nrDNA, Nuclear ribosomal DNA; ITS, internal transcribed spacer; PCR, polymerase chain reaction; BLAST, basic local alignment ...
Reaction of some macrolide antibiotics with the ribosome. Labeling of the binding site components
International Nuclear Information System (INIS)
Tejedor, F.; Ballesta, J.P.
1986-01-01
Radioactive carbomycin A, niddamycin, tylosin, and spiramycin, but not erythromycin, can be covalently bound to Escherichia coli ribosomes by incubation at 37 degrees C. The incorporation of radioactivity into the particles is inhibited by SH- and activated double bond containing compounds but not by amino groups, suggesting that the reactions may take place by addition to the double bond present in the reactive antibiotics. This thermic reaction must be different from the photoreaction described for some of these macrolides [Tejedor, F., and Ballesta, J. P. G. (1985) Biochemistry 24, 467-472] since tylosin, which is not photoincorporated, is thermically bound to ribosomes. Most of the radioactivity is incorporated into the ribosomal proteins. Two-dimensional gel electrophoresis of proteins labeled by carbomycin A, niddamycin, and tylosin indicates that about 40% of the radioactivity is bound to protein L27; the rest is distributed among several other proteins such as L8, L2, and S12, to differing extents depending on the drug used. These results indicate, in accordance with previous data, that protein L27 plays an important role in the macrolide binding site, confirming that these drugs bind near the peptidyl transferase center of the ribosome
Directory of Open Access Journals (Sweden)
Virginie Marcel
Full Text Available Acute myeloid leukemia (AML is a heterogeneous disease. Prognosis is mainly influenced by patient age at diagnosis and cytogenetic alterations, two of the main factors currently used in AML patient risk stratification. However, additional criteria are required to improve the current risk classification and better adapt patient care. In neoplastic cells, ribosome biogenesis is increased to sustain the high proliferation rate and ribosome composition is altered to modulate specific gene expression driving tumorigenesis. Here, we investigated the usage of ribosome biogenesis factors as clinical markers in adult patients with AML. We showed that nucleoli, the nucleus compartments where ribosome production takes place, are modified in AML by analyzing a panel of AML and healthy donor cells using immunofluorescence staining. Using four AML series, including the TCGA dataset, altogether representing a total of about 270 samples, we showed that not all factors involved in ribosome biogenesis have clinical values although ribosome biogenesis is increased in AML. Interestingly, we identified the regulator of ribosome production nucleolin (NCL as over-expressed in AML blasts. Moreover, we found in two series that high NCL mRNA expression level was associated with a poor overall survival, particular in elderly patients. Multivariate analyses taking into account age and cytogenetic risk indicated that NCL expression in blast cells is an independent marker of reduced survival. Our study identifies NCL as a potential novel prognostic factor in AML. Altogether, our results suggest that the ribosome biogenesis pathway may be of interest as clinical markers in AML.
Predicting the dynamics of bacterial growth inhibition by ribosome-targeting antibiotics
Greulich, Philip; Doležal, Jakub; Scott, Matthew; Evans, Martin R.; Allen, Rosalind J.
2017-12-01
Understanding how antibiotics inhibit bacteria can help to reduce antibiotic use and hence avoid antimicrobial resistance—yet few theoretical models exist for bacterial growth inhibition by a clinically relevant antibiotic treatment regimen. In particular, in the clinic, antibiotic treatment is time-dependent. Here, we use a theoretical model, previously applied to steady-state bacterial growth, to predict the dynamical response of a bacterial cell to a time-dependent dose of ribosome-targeting antibiotic. Our results depend strongly on whether the antibiotic shows reversible transport and/or low-affinity ribosome binding (‘low-affinity antibiotic’) or, in contrast, irreversible transport and/or high affinity ribosome binding (‘high-affinity antibiotic’). For low-affinity antibiotics, our model predicts that growth inhibition depends on the duration of the antibiotic pulse, and can show a transient period of very fast growth following removal of the antibiotic. For high-affinity antibiotics, growth inhibition depends on peak dosage rather than dose duration, and the model predicts a pronounced post-antibiotic effect, due to hysteresis, in which growth can be suppressed for long times after the antibiotic dose has ended. These predictions are experimentally testable and may be of clinical significance.
The primary structure of L37--a rat ribosomal protein with a zinc finger-like motif.
Chan, Y L; Paz, V; Olvera, J; Wool, I G
1993-04-30
The amino acid sequence of the rat 60S ribosomal subunit protein L37 was deduced from the sequence of nucleotides in a recombinant cDNA. Ribosomal protein L37 has 96 amino acids, the NH2-terminal methionine is removed after translation of the mRNA, and has a molecular weight of 10,939. Ribosomal protein L37 has a single zinc finger-like motif of the C2-C2 type. Hybridization of the cDNA to digests of nuclear DNA suggests that there are 13 or 14 copies of the L37 gene. The mRNA for the protein is about 500 nucleotides in length. Rat L37 is related to Saccharomyces cerevisiae ribosomal protein YL35 and to Caenorhabditis elegans L37. We have identified in the data base a DNA sequence that encodes the chicken homolog of rat L37.
Fiorentini, Carla; Falzano, Loredana; Fabbri, Alessia; Stringaro, Annarita; Logozzi, Mariaantonia; Travaglione, Sara; Contamin, Stéphanette; Arancia, Giuseppe; Malorni, Walter; Fais, Stefano
2001-01-01
Macropinocytosis, a ruffling-driven process that allows the capture of large material, is an essential aspect of normal cell function. It can be either constitutive, as in professional phagocytes where it ends with the digestion of captured material, or induced, as in epithelial cells stimulated by growth factors. In this case, the internalized material recycles back to the cell surface. We herein show that activation of Rho GTPases by a bacterial protein toxin, the Escherichia coli cytotoxic necrotizing factor 1 (CNF1), allowed epithelial cells to engulf and digest apoptotic cells in a manner similar to that of professional phagocytes. In particular, we have demonstrated that 1) the activation of all Rho, Rac, and Cdc42 by CNF1 was essential for the capture and internalization of apoptotic cells; and 2) such activation allowed the discharge of macropinosomal content into Rab7 and lysosomal associated membrane protein-1 acidic lysosomal vesicles where the ingested particles underwent degradation. Taken together, these findings indicate that CNF1-induced “switching on” of Rho GTPases may induce in epithelial cells a scavenging activity, comparable to that exerted by professional phagocytes. The activation of such activity in epithelial cells may be relevant, in mucosal tissues, in supporting or integrating the scavenging activity of resident macrophages. PMID:11452003
Qi, Lei; Yue, Lei; Feng, Deqin; Qi, Fengxia; Li, Jie; Dong, Xiuzhu
2017-07-07
Unlike stable RNAs that require processing for maturation, prokaryotic cellular mRNAs generally follow an 'all-or-none' pattern. Herein, we used a 5΄ monophosphate transcript sequencing (5΄P-seq) that specifically captured the 5΄-end of processed transcripts and mapped the genome-wide RNA processing sites (PSSs) in a methanogenic archaeon. Following statistical analysis and stringent filtration, we identified 1429 PSSs, among which 23.5% and 5.4% were located in 5΄ untranslated region (uPSS) and intergenic region (iPSS), respectively. A predominant uridine downstream PSSs served as a processing signature. Remarkably, 5΄P-seq detected overrepresented uPSS and iPSS in the polycistronic operons encoding ribosomal proteins, and the majority upstream and proximal ribosome binding sites, suggesting a regulatory role of processing on translation initiation. The processed transcripts showed increased stability and translation efficiency. Particularly, processing within the tricistronic transcript of rplA-rplJ-rplL enhanced the translation of rplL, which can provide a driving force for the 1:4 stoichiometry of L10 to L12 in the ribosome. Growth-associated mRNA processing intensities were also correlated with the cellular ribosomal protein levels, thereby suggesting that mRNA processing is involved in tuning growth-dependent ribosome synthesis. In conclusion, our findings suggest that mRNA processing-mediated post-transcriptional regulation is a potential mechanism of ribosomal protein synthesis and stoichiometry. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
Directory of Open Access Journals (Sweden)
Pablo Lorenzano Menna
2010-12-01
Full Text Available Las Rho GTPasas son una familia de proteínas clave en la transmisión de señales provenientes del exterior celular hacia efectores intracelulares tanto citoplasmáticos como nucleares. En los últimos año ha habido un desarrollo vertiginoso de múltiples herramientas genéticas y farmacológicas, lo que ha permitido establecer de manera mucho más precisa las funciones específicas de estas proteínas. El objetivo de la presente revisión es hacer foco en las múltiples funciones celulares reguladas por las Rho GTPasas, describiendo en detalle el mecanismo molecular involucrado. Se discute además la participación de estas proteínas en diversas enfermedades humanas haciendo énfasis en su vinculación con el cáncer. Por último, se hace una actualización detallada sobre las estrategias terapéuticas en experimentación que tienen a las Rho GTPasas como blancos moleculares.Rho GTPases are a key protein family controlling the transduction of external signals to cytoplasmatic and nuclear effectors. In the last few years, the development of genetic and pharmacological tools has allowed a more precise definition of the specific roles of Rho GTPases. The aim of this review is to describe the cellular functions regulated by these proteins with focus on the molecular mechanism involved. We also address the role of Rho GTPases in the development of different human diseases such as cancer. Finally, we describe different experimental therapeutic strategies with Rho GTPases as molecular targets.
Bactobolin resistance is conferred by mutations in the L2 ribosomal protein.
Chandler, Josephine R; Truong, Thao T; Silva, Patricia M; Seyedsayamdost, Mohammad R; Carr, Gavin; Radey, Matthew; Jacobs, Michael A; Sims, Elizabeth H; Clardy, Jon; Greenberg, E Peter
2012-12-18
Burkholderia thailandensis produces a family of polyketide-peptide molecules called bactobolins, some of which are potent antibiotics. We found that growth of B. thailandensis at 30°C versus that at 37°C resulted in increased production of bactobolins. We purified the three most abundant bactobolins and determined their activities against a battery of bacteria and mouse fibroblasts. Two of the three compounds showed strong activities against both bacteria and fibroblasts. The third analog was much less potent in both assays. These results suggested that the target of bactobolins might be conserved across bacteria and mammalian cells. To learn about the mechanism of bactobolin activity, we isolated four spontaneous bactobolin-resistant Bacillus subtilis mutants. We used genomic sequencing technology to show that each of the four resistant variants had mutations in rplB, which codes for the 50S ribosome-associated L2 protein. Ectopic expression of a mutant rplB gene in wild-type B. subtilis conferred bactobolin resistance. Finally, the L2 mutations did not confer resistance to other antibiotics known to interfere with ribosome function. Our data indicate that bactobolins target the L2 protein or a nearby site and that this is not the target of other antibiotics. We presume that the mammalian target of bactobolins involves the eukaryotic homolog of L2 (L8e). Currently available antibiotics target surprisingly few cellular functions, and there is a need to identify novel antibiotic targets. We have been interested in the Burkholderia thailandensis bactobolins, and we sought to learn about the target of bactobolin activity by mapping spontaneous resistance mutations in the bactobolin-sensitive Bacillus subtilis. Our results indicate that the bactobolin target is the 50S ribosome-associated L2 protein or a region of the ribosome affected by L2. Bactobolin-resistant mutants are not resistant to other known ribosome inhibitors. Our evidence indicates that bactobolins
Resistance to Linezolid Caused by Modifications at Its Binding Site on the Ribosome
DEFF Research Database (Denmark)
Long, Katherine S.; Vester, Birte
2012-01-01
Linezolid is an oxazolidinone antibiotic in clinical use for the treatment of serious infections of resistant Gram-positive bacteria. It inhibits protein synthesis by binding to the peptidyl transferase center on the ribosome. Almost all known resistance mechanisms involve small alterations...... to the linezolid binding site, so this review will therefore focus on the various changes that can adversely affect drug binding and confer resistance. High-resolution structures of linezolid bound to the 50S ribosomal subunit show that it binds in a deep cleft that is surrounded by 23S rRNA nucleotides. Mutation...... of 23S rRNA has for some time been established as a linezolid resistance mechanism. Although ribosomal proteins L3 and L4 are located further away from the bound drug, mutations in specific regions of these proteins are increasingly being associated with linezolid resistance. However, very little...
Functional Dynamics within the Human Ribosome Regulate the Rate of Active Protein Synthesis.
Ferguson, Angelica; Wang, Leyi; Altman, Roger B; Terry, Daniel S; Juette, Manuel F; Burnett, Benjamin J; Alejo, Jose L; Dass, Randall A; Parks, Matthew M; Vincent, C Theresa; Blanchard, Scott C
2015-11-05
The regulation of protein synthesis contributes to gene expression in both normal physiology and disease, yet kinetic investigations of the human translation mechanism are currently lacking. Using single-molecule fluorescence imaging methods, we have quantified the nature and timing of structural processes in human ribosomes during single-turnover and processive translation reactions. These measurements reveal that functional complexes exhibit dynamic behaviors and thermodynamic stabilities distinct from those observed for bacterial systems. Structurally defined sub-states of pre- and post-translocation complexes were sensitive to specific inhibitors of the eukaryotic ribosome, demonstrating the utility of this platform to probe drug mechanism. The application of three-color single-molecule fluorescence resonance energy transfer (smFRET) methods further revealed a long-distance allosteric coupling between distal tRNA binding sites within ribosomes bearing three tRNAs, which contributed to the rate of processive translation. Copyright © 2015 Elsevier Inc. All rights reserved.
On the intracellular trafficking of mouse S5 ribosomal protein from cytoplasm to nucleoli.
Matragkou, Ch; Papachristou, H; Karetsou, Z; Papadopoulos, G; Papamarcaki, T; Vizirianakis, I S; Tsiftsoglou, A S; Choli-Papadopoulou, T
2009-10-09
The non-ribosomal functions of mammalian ribosomal proteins have recently attracted worldwide attention. The mouse ribosomal protein S5 (rpS5) derived from ribosomal material is an assembled non-phosphorylated protein. The free form of rpS5 protein, however, undergoes phosphorylation. In this study, we have (a) investigated the potential role of phosphorylation in rpS5 protein transport into the nucleus and then into nucleoli and (b) determined which of the domains of rpS5 are involved in this intracellular trafficking. In vitro PCR mutagenesis of mouse rpS5 cDNA, complemented by subsequent cloning and expression of rpS5 truncated recombinant forms, produced in fusion with green fluorescent protein, permitted the investigation of rpS5 intracellular trafficking in HeLa cells using confocal microscopy complemented by Western blot analysis. Our results indicate the following: (a) rpS5 protein enters the nucleus via the region 38-50 aa that forms a random coil as revealed by molecular dynamic simulation. (b) Immunoprecipitation of rpS5 with casein kinase II and immobilized metal affinity chromatography analysis complemented by in vitro kinase assay revealed that phosphorylation of rpS5 seems to be indispensable for its transport from nucleus to nucleoli; upon entering the nucleus, Thr-133 phosphorylation triggers Ser-24 phosphorylation by casein kinase II, thus promoting entrance of rpS5 into the nucleoli. Another important role of rpS5 N-terminal region is proposed to be the regulation of protein's cellular level. The repetitively co-appearance of a satellite C-terminal band below the entire rpS5 at the late stationary phase, and not at the early logarithmic phase, of cell growth suggests a specific degradation balancing probably the unassembled ribosomal protein molecules with those that are efficiently assembled to ribosomal subunits. Overall, these data provide new insights on the structural and functional domains within the rpS5 molecule that contribute to its
Distinct roles for the IIId2 sub-domain in pestivirus and picornavirus internal ribosome entry sites
DEFF Research Database (Denmark)
Willcocks, Margaret M.; Zaini, Salmah; Chamond, Nathalie
2017-01-01
Viral internal ribosomes entry site (IRES) elements coordinate the recruitment of the host translation machinery to direct the initiation of viral protein synthesis. Within hepatitis C virus (HCV)-like IRES elements, the sub-domain IIId(1) is crucial for recruiting the 40S ribosomal subunit...
1975-01-01
In the typical meroistic insect ovary, the oocyte nucleus synthesizes little if any RNA. Nurse cells or trophocytes actively synthesize ribosomes which are transported to and accumulated by the oocyte. In the telotrophic ovary a morphological separation exists, the nurse cells being localized at the apical end of each ovariole and communicating with the ooocytes via nutritive cords. In order to determine whether the genes coding for ribosomal RNA (rRNA) are amplified in the telotrophic ovary of the milkweed bug Oncopeltus fasciatus, the percentages of the genome coding for ribosomal RNA in somatic cells, spermatogenic cells, ovarian follicles, and nurse cells were compared. The oocytes and most of the nurse cells of O. fasciatus are uninucleolate. DNA hybridizing with ribosomal RNA is localized in a satellite DNA, the density of which is 1.712 g/cm(-3). The density of main-band DNA is 1.694 g/cm(-3). The ribosomal DNA satellite accounts for approximately 0.2% of the DNA in somatic and gametogenic tissues of both males and females. RNA-DNA hybridization analysis demonstrates that approximately 0.03% of the DNA in somatic tissues, testis, ovarian follicles, and isolated nurse cells hybridizes with ribosomal RNA. The fact that the percentage of DNA hybridizing with rRNA is the same in somatic and in male and female gametogenic tissues indicates that amplification of ribosomal DNA does not occur in nurse cells and that if it occurs in oocytes, it represents less than a 50- fold increase in ribosomal DNA. An increase in total genome DNA accounted by polyploidization appears to provide for increasing the amount of ribosomal DNA in the nurse cells. PMID:1158969
Directory of Open Access Journals (Sweden)
John N Griffin
2015-03-01
Full Text Available The production of ribosomes is ubiquitous and fundamental to life. As such, it is surprising that defects in ribosome biogenesis underlie a growing number of symptomatically distinct inherited disorders, collectively called ribosomopathies. We previously determined that the nucleolar protein, NOL11, is essential for optimal pre-rRNA transcription and processing in human tissue culture cells. However, the role of NOL11 in the development of a multicellular organism remains unknown. Here, we reveal a critical function for NOL11 in vertebrate ribosome biogenesis and craniofacial development. Nol11 is strongly expressed in the developing cranial neural crest (CNC of both amphibians and mammals, and knockdown of Xenopus nol11 results in impaired pre-rRNA transcription and processing, increased apoptosis, and abnormal development of the craniofacial cartilages. Inhibition of p53 rescues this skeletal phenotype, but not the underlying ribosome biogenesis defect, demonstrating an evolutionarily conserved control mechanism through which ribosome-impaired craniofacial cells are removed. Excessive activation of this mechanism impairs craniofacial development. Together, our findings reveal a novel requirement for Nol11 in craniofacial development, present the first frog model of a ribosomopathy, and provide further insight into the clinically important relationship between specific ribosome biogenesis proteins and craniofacial cell survival.
Binding site of ribosomal proteins on prokaryotic 5S ribonucleic acids: a study with ribonucleases
DEFF Research Database (Denmark)
Douthwaite, S; Christensen, A; Garrett, R A
1982-01-01
The binding sites of ribosomal proteins L18 and L25 on 5S RNA from Escherichia coli were probed with ribonucleases A, T1, and T2 and a double helix specific cobra venom endonuclease. The results for the protein-RNA complexes, which were compared with those for the free RNA [Douthwaite, S...... stearothermophilus 5S RNA. Several protein-induced changes in the RNA structures were identified; some are possibly allosteric in nature. The two prokaryotic 5S RNAs were also incubated with total 50S subunit proteins from E. coli and B. stearothermophilus ribosomes. Homologous and heterologous reconstitution....... stearothermophilus 5S RNA, which may have been due to a third ribosomal protein L5....
Non-canonical ribosomal DNA segments in the human genome, and nucleoli functioning.
Kupriyanova, Natalia S; Netchvolodov, Kirill K; Sadova, Anastasia A; Cherepanova, Marina D; Ryskov, Alexei P
2015-11-10
Ribosomal DNA (rDNA) in the human genome is represented by tandem repeats of 43 kb nucleotide sequences that form nucleoli organizers (NORs) on each of five pairs of acrocentric chromosomes. RDNA-similar segments of different lengths are also present on (NOR)(-) chromosomes. Many of these segments contain nucleotide substitutions, supplementary microsatellite clusters, and extended deletions. Recently, it was shown that, in addition to ribosome biogenesis, nucleoli exhibit additional functions, such as cell-cycle regulation and response to stresses. In particular, several stress-inducible loci located in the ribosomal intergenic spacer (rIGS) produce stimuli-specific noncoding nucleolus RNAs. By mapping the 5'/3' ends of the rIGS segments scattered throughout (NOR)(-) chromosomes, we discovered that the bonds in the rIGS that were most often susceptible to disruption in the rIGS were adjacent to, or overlapped with stimuli-specific inducible loci. This suggests the interconnection of the two phenomena - nucleoli functioning and the scattering of rDNA-like sequences on (NOR)(-) chromosomes. Copyright © 2015 Elsevier B.V. All rights reserved.
Ribosome. The complete structure of the 55S mammalian mitochondrial ribosome.
Greber, Basil J; Bieri, Philipp; Leibundgut, Marc; Leitner, Alexander; Aebersold, Ruedi; Boehringer, Daniel; Ban, Nenad
2015-04-17
Mammalian mitochondrial ribosomes (mitoribosomes) synthesize mitochondrially encoded membrane proteins that are critical for mitochondrial function. Here we present the complete atomic structure of the porcine 55S mitoribosome at 3.8 angstrom resolution by cryo-electron microscopy and chemical cross-linking/mass spectrometry. The structure of the 28S subunit in the complex was resolved at 3.6 angstrom resolution by focused alignment, which allowed building of a detailed atomic structure including all of its 15 mitoribosomal-specific proteins. The structure reveals the intersubunit contacts in the 55S mitoribosome, the molecular architecture of the mitoribosomal messenger RNA (mRNA) binding channel and its interaction with transfer RNAs, and provides insight into the highly specialized mechanism of mRNA recruitment to the 28S subunit. Furthermore, the structure contributes to a mechanistic understanding of aminoglycoside ototoxicity. Copyright © 2015, American Association for the Advancement of Science.
RhoA GTPase regulates radiation-induced alterations in endothelial cell adhesion and migration
International Nuclear Information System (INIS)
Rousseau, Matthieu; Gaugler, Marie-Hélène; Rodallec, Audrey; Bonnaud, Stéphanie; Paris, François; Corre, Isabelle
2011-01-01
Highlights: ► We explore the role of RhoA in endothelial cell response to ionizing radiation. ► RhoA is rapidly activated by single high-dose of radiation. ► Radiation leads to RhoA/ROCK-dependent actin cytoskeleton remodeling. ► Radiation-induced apoptosis does not require the RhoA/ROCK pathway. ► Radiation-induced alteration of endothelial adhesion and migration requires RhoA/ROCK. -- Abstract: Endothelial cells of the microvasculature are major target of ionizing radiation, responsible of the radiation-induced vascular early dysfunctions. Molecular signaling pathways involved in endothelial responses to ionizing radiation, despite being increasingly investigated, still need precise characterization. Small GTPase RhoA and its effector ROCK are crucial signaling molecules involved in many endothelial cellular functions. Recent studies identified implication of RhoA/ROCK in radiation-induced increase in endothelial permeability but other endothelial functions altered by radiation might also require RhoA proteins. Human microvascular endothelial cells HMEC-1, either treated with Y-27632 (inhibitor of ROCK) or invalidated for RhoA by RNA interference were exposed to 15 Gy. We showed a rapid radiation-induced activation of RhoA, leading to a deep reorganisation of actin cytoskeleton with rapid formation of stress fibers. Endothelial early apoptosis induced by ionizing radiation was not affected by Y-27632 pre-treatment or RhoA depletion. Endothelial adhesion to fibronectin and formation of focal adhesions increased in response to radiation in a RhoA/ROCK-dependent manner. Consistent with its pro-adhesive role, ionizing radiation also decreased endothelial cells migration and RhoA was required for this inhibition. These results highlight the role of RhoA GTPase in ionizing radiation-induced deregulation of essential endothelial functions linked to actin cytoskeleton.
Deciphering the role of the Gag-Pol ribosomal frameshift signal in HIV-1 RNA genome packaging.
Nikolaitchik, Olga A; Hu, Wei-Shau
2014-04-01
A key step of retroviral replication is packaging of the viral RNA genome during virus assembly. Specific packaging is mediated by interactions between the viral protein Gag and elements in the viral RNA genome. In HIV-1, similar to most retroviruses, the packaging signal is located within the 5' untranslated region and extends into the gag-coding region. A recent study reported that a region including the Gag-Pol ribosomal frameshift signal plays an important role in HIV-1 RNA packaging; deletions or mutations that affect the RNA structure of this signal lead to drastic decreases (10- to 50-fold) in viral RNA packaging and virus titer. We examined here the role of the ribosomal frameshift signal in HIV-1 RNA packaging by studying the RNA packaging and virus titer in the context of proviruses. Three mutants with altered ribosomal frameshift signal, either through direct deletion of the signal, mutation of the 6U slippery sequence, or alterations of the secondary structure were examined. We found that RNAs from all three mutants were packaged efficiently, and they generate titers similar to that of a virus containing the wild-type ribosomal frameshift signal. We conclude that although the ribosomal frameshift signal plays an important role in regulating the replication cycle, this RNA element is not directly involved in regulating RNA encapsidation. To generate infectious viruses, HIV-1 must package viral RNA genome during virus assembly. The specific HIV-1 genome packaging is mediated by interactions between the structural protein Gag and elements near the 5' end of the viral RNA known as packaging signal. In this study, we examined whether the Gag-Pol ribosomal frameshift signal is important for HIV-1 RNA packaging as recently reported. Our results demonstrated that when Gag/Gag-Pol is supplied in trans, none of the tested ribosomal frameshift signal mutants has defects in RNA packaging or virus titer. These studies provide important information on how HIV-1
Molecular dynamics simulation of ribosome jam
Matsumoto, Shigenori
2011-09-01
We propose a coarse-grained molecular dynamics model of ribosome molecules to study the dependence of translation process on environmental parameters. We found the model exhibits traffic jam property, which is consistent with an ASEP model. We estimated the influence of the temperature and concentration of molecules on the hopping probability used in the ASEP model. Our model can also treat environmental effects on the translation process that cannot be explained by such cellular automaton models. © 2010 Elsevier B.V. All rights reserved.
A conserved chloramphenicol binding site at the entrance to the ribosomal peptide exit tunnel
DEFF Research Database (Denmark)
Long, Katherine S; Porse, Bo T
2003-01-01
, of E.coli 23S rRNA and G2084 (2058 in E.coli numbering) in domain V of H.halobium 23S rRNA. The modification sites overlap with a portion of the macrolide binding site and cluster at the entrance to the peptide exit tunnel. The data correlate with the recently reported chloramphenicol binding site...... on an archaeal ribosome and suggest that a similar binding site is present on the E.coli ribosome....
Directory of Open Access Journals (Sweden)
O’Farrell Heather C
2012-10-01
Full Text Available Abstract Background The KsgA methyltransferase has been conserved throughout evolution, methylating two adenosines in the small subunit rRNA in all three domains of life as well as in eukaryotic organelles that contain ribosomes. Understanding of KsgA’s important role in ribosome biogenesis has been recently expanded in Escherichia coli; these studies help explain why KsgA is so highly conserved and also suggest KsgA’s potential as an antimicrobial drug target. Results We have analyzed KsgA’s contribution to ribosome biogenesis and cell growth in Staphylococcus aureus. We found that deletion of ksgA in S. aureus led to a cold-sensitive growth phenotype, although KsgA was not as critical for ribosome biogenesis as it was shown to be in E. coli. Additionally, the ksgA knockout strain showed an increased sensitivity to aminoglycoside antibiotics. Overexpression of a catalytically inactive KsgA mutant was deleterious in the knockout strain but not the wild-type strain; this negative phenotype disappeared at low temperature. Conclusions This work extends the study of KsgA, allowing comparison of this aspect of ribosome biogenesis between a Gram-negative and a Gram-positive organism. Our results in S. aureus are in contrast to results previously described in E. coli, where the catalytically inactive protein showed a negative phenotype in the presence or absence of endogenous KsgA.
International Nuclear Information System (INIS)
Reis Monteiro dos-Santos, Guilherme Rodrigo; Fontenele, Marcio Ribeiro; Dias, Felipe de Almeida; Oliveira, Pedro Lagerblad de; Nepomuceno-Silva, José Luciano
2015-01-01
The life cycle of the protozoan parasite Trypanosoma cruzi comprises rounds of proliferative cycles and differentiation in distinct host environments. Ras GTPases are molecular switches that play pivotal regulatory functions in cell fate. Rjl is a novel GTPase with unknown function. Herein we show that TcRjl blocks in vivo cell differentiation. The forced expression of TcRjl leads to changes in the overall tyrosine protein phosphorylation profile of parasites. TcRjl expressing parasites sustained DNA synthesis regardless the external stimuli for differentiation. Heterologous expression in the Drosophila melanogaster genetic system strongly suggests a role from TcRjl protein in RTK-dependent pathways and MAPK activation.
Energy Technology Data Exchange (ETDEWEB)
Reis Monteiro dos-Santos, Guilherme Rodrigo [Laboratório de Parasitologia Molecular, Instituto de Biofísica Carlos Chagas Filho, CCS, UFRJ, Rio de Janeiro (Brazil); Fontenele, Marcio Ribeiro [Laboratório de Biologia Molecular do Desenvolvimento Instituto de Ciências Biomédicas, CCS, UFRJ, Rio de Janeiro (Brazil); Dias, Felipe de Almeida [Laboratório de Bioquímica de Artrópodes Hematófagos, Instituto de Bioquímica Médica, CCS, UFRJ, Rio de Janeiro (Brazil); Oliveira, Pedro Lagerblad de [Laboratório de Bioquímica de Artrópodes Hematófagos, Instituto de Bioquímica Médica, CCS, UFRJ, Rio de Janeiro (Brazil); Instituto Nacional de Ciência e Tecnologia em Entomologia Molecular (INCT-EM) (Brazil); Nepomuceno-Silva, José Luciano [Laboratório Integrado de Bioquímica Hatisaburo Masuda, NUPEM/UFRJ, Pólo Barreto, Universidade Federal do Rio de Janeiro, Campus Macaé, Macaé (Brazil); and others
2015-11-06
The life cycle of the protozoan parasite Trypanosoma cruzi comprises rounds of proliferative cycles and differentiation in distinct host environments. Ras GTPases are molecular switches that play pivotal regulatory functions in cell fate. Rjl is a novel GTPase with unknown function. Herein we show that TcRjl blocks in vivo cell differentiation. The forced expression of TcRjl leads to changes in the overall tyrosine protein phosphorylation profile of parasites. TcRjl expressing parasites sustained DNA synthesis regardless the external stimuli for differentiation. Heterologous expression in the Drosophila melanogaster genetic system strongly suggests a role from TcRjl protein in RTK-dependent pathways and MAPK activation.
Hatakeyama, T; Hatakeyama, T; Kimura, M
1988-11-21
The complete amino acid sequences of ribosomal proteins L16, L23 and L33 from the archaebacterium Halobacterium marismortui were determined. The sequences were established by manual sequencing of peptides produced with several proteases as well as by cleavage with dilute HCl. Proteins L16, L23 and L33 consist of 119, 154 and 69 amino acid residues, and their molecular masses are 13,538, 16,812 and 7620 Da, respectively. The comparison of their sequences with those of ribosomal proteins from other organisms revealed that L23 and L33 are related to eubacterial ribosomal proteins from Escherichia coli and Bacillus stearothermophilus, while protein L16 was found to be homologous to a eukaryotic ribosomal protein from yeast. These results provide information about the special phylogenetic position of archaebacteria.
Simultaneous Binding of Multiple EF-Tu Copies to Translating Ribosomes in Live Escherichia coli.
Mustafi, Mainak; Weisshaar, James C
2018-01-16
In bacteria, elongation factor Tu is a translational cofactor that forms ternary complexes with aminoacyl-tRNA (aa-tRNA) and GTP. Binding of a ternary complex to one of four flexible L7/L12 units on the ribosome tethers a charged tRNA in close proximity to the ribosomal A site. Two sequential tests for a match between the aa-tRNA anticodon and the current mRNA codon then follow. Because one elongation cycle can occur in as little as 50 ms and the vast majority of aa-tRNA copies are not cognate with the current mRNA codon, this testing must occur rapidly. We present a single-molecule localization and tracking study of fluorescently labeled EF-Tu in live Escherichia coli Imaging at 2 ms/frame distinguishes 60% slowly diffusing EF-Tu copies (assigned as transiently bound to translating ribosome) from 40% rapidly diffusing copies (assigned as a mixture of free ternary complexes and free EF-Tu). Combining these percentages with copy number estimates, we infer that the four L7/L12 sites are essentially saturated with ternary complexes in vivo. The results corroborate an earlier inference that all four sites can simultaneously tether ternary complexes near the A site, creating a high local concentration that may greatly enhance the rate of testing of aa-tRNAs. Our data and a combinatorial argument both suggest that the initial recognition test for a codon-anticodon match occurs in less than 1 to 2 ms per aa-tRNA copy. The results refute a recent study (A. Plochowietz, I. Farrell, Z. Smilansky, B. S. Cooperman, and A. N. Kapanidis, Nucleic Acids Res 45:926-937, 2016, https://doi.org/10.1093/nar/gkw787) of tRNA diffusion in E. coli that inferred that aa-tRNAs arrive at the ribosomal A site as bare monomers, not as ternary complexes. IMPORTANCE Ribosomes catalyze translation of the mRNA codon sequence into the corresponding sequence of amino acids within the nascent polypeptide chain. Polypeptide elongation can be as fast as 50 ms per added amino acid. Each amino acid
Directory of Open Access Journals (Sweden)
Ying-Hung Lin
2017-01-01
Full Text Available According to recent estimates, 2%–15% of couples are sterile, and approximately half of the infertility cases are attributed to male reproductive factors. However, the reasons remain undefined in approximately 25% of male infertility cases, and most infertility cases exhibit spermatogenic defects. Numerous genes involved in spermatogenesis still remain unknown. We previously identified Male Germ Cells Rab GTPase-Activating Proteins (MGCRABGAPs through cDNA microarray analysis of human testicular tissues with spermatogenic defects. MGCRABGAP contains a conserved RABGAP catalytic domain, TBC (Tre2/Bub2/Cdc16. RABGAP family proteins regulate cellular function (e.g., cytoskeletal remodeling, vesicular trafficking, and cell migration by inactivating RAB proteins. MGCRABGAP is a male germ cell-specific protein expressed in elongating and elongated spermatids during mammalian spermiogenesis. The purpose of this study was to identify proteins that interact with MGCRABGAP during mammalian spermiogenesis using a proteomic approach. We found that MGCRABGAP exhibited GTPase-activating bioability, and several MGCRABGAP interactors, possible substrates (e.g., RAB10, RAB5C, and RAP1, were identified using co-immunoprecipitation (co-IP and nano liquid chromatography-mass spectrometry/mass spectrometry (nano LC-MS/MS. We confirmed the binding ability between RAB10 and MGCRABGAP via co-IP. Additionally, MGCRABGAP–RAB10 complexes were specifically colocalized in the manchette structure, a critical structure for the formation of spermatid heads, and were slightly expressed at the midpiece of mature spermatozoa. Based on these results, we propose that MGCRABGAP is involved in mammalian spermiogenesis by modulating RAB10.
Altered Machinery of Protein Synthesis in Alzheimer's: From the Nucleolus to the Ribosome.
Hernández-Ortega, Karina; Garcia-Esparcia, Paula; Gil, Laura; Lucas, José J; Ferrer, Isidre
2016-09-01
Ribosomes and protein synthesis have been reported to be altered in the cerebral cortex at advanced stages of Alzheimer's disease (AD). Modifications in the hippocampus with disease progression have not been assessed. Sixty-seven cases including middle-aged (MA) and AD stages I-VI were analyzed. Nucleolar chaperones nucleolin, nucleophosmin and nucleoplasmin 3, and upstream binding transcription factor RNA polymerase I gene (UBTF) mRNAs are abnormally regulated and their protein levels reduced in AD. Histone modifications dimethylated histone H3K9 (H3K9me2) and acetylated histone H3K12 (H3K12ac) are decreased in CA1. Nuclear tau declines in CA1 and dentate gyrus (DG), and practically disappears in neurons with neurofibrillary tangles. Subunit 28 ribosomal RNA (28S rRNA) expression is altered in CA1 and DG in AD. Several genes encoding ribosomal proteins are abnormally regulated and protein levels of translation initiation factors eIF2α, eIF3η and eIF5, and elongation factor eEF2, are altered in the CA1 region in AD. These findings show alterations in the protein synthesis machinery in AD involving the nucleolus, nucleus and ribosomes in the hippocampus in AD some of them starting at first stages (I-II) preceding neuron loss. These changes may lie behind reduced numbers of dendritic branches and reduced synapses of CA1 and DG neurons which cause hippocampal atrophy. © 2015 International Society of Neuropathology.
Ribosomal RNA: a key to phylogeny
Olsen, G. J.; Woese, C. R.
1993-01-01
As molecular phylogeny increasingly shapes our understanding of organismal relationships, no molecule has been applied to more questions than have ribosomal RNAs. We review this role of the rRNAs and some of the insights that have been gained from them. We also offer some of the practical considerations in extracting the phylogenetic information from the sequences. Finally, we stress the importance of comparing results from multiple molecules, both as a method for testing the overall reliability of the organismal phylogeny and as a method for more broadly exploring the history of the genome.
Schoch, Conrad L; Seifert, Keith A; Huhndorf, Sabine; Robert, Vincent; Spouge, John L; Levesque, C André; Chen, Wen
2012-04-17
Six DNA regions were evaluated as potential DNA barcodes for Fungi, the second largest kingdom of eukaryotic life, by a multinational, multilaboratory consortium. The region of the mitochondrial cytochrome c oxidase subunit 1 used as the animal barcode was excluded as a potential marker, because it is difficult to amplify in fungi, often includes large introns, and can be insufficiently variable. Three subunits from the nuclear ribosomal RNA cistron were compared together with regions of three representative protein-coding genes (largest subunit of RNA polymerase II, second largest subunit of RNA polymerase II, and minichromosome maintenance protein). Although the protein-coding gene regions often had a higher percent of correct identification compared with ribosomal markers, low PCR amplification and sequencing success eliminated them as candidates for a universal fungal barcode. Among the regions of the ribosomal cistron, the internal transcribed spacer (ITS) region has the highest probability of successful identification for the broadest range of fungi, with the most clearly defined barcode gap between inter- and intraspecific variation. The nuclear ribosomal large subunit, a popular phylogenetic marker in certain groups, had superior species resolution in some taxonomic groups, such as the early diverging lineages and the ascomycete yeasts, but was otherwise slightly inferior to the ITS. The nuclear ribosomal small subunit has poor species-level resolution in fungi. ITS will be formally proposed for adoption as the primary fungal barcode marker to the Consortium for the Barcode of Life, with the possibility that supplementary barcodes may be developed for particular narrowly circumscribed taxonomic groups.
Zeng, Canjun; Goodluck, Helen; Qin, Xuezhong; Liu, Bo; Mohan, Subburaman; Xing, Weirong
2016-10-01
Leucine-rich repeat kinase-1 (Lrrk1) consists of ankyrin repeats (ANK), leucine-rich repeats (LRR), a GTPase-like domain of Roc (ROC), a COR domain, a serine/threonine kinase domain (KD), and WD40 repeats (WD40). Previous studies have revealed that knockout (KO) of Lrrk1 in mice causes severe osteopetrosis, and a human mutation of Lrrk1 leads to osteosclerotic metaphysial dysplasia. The molecular mechanism by which Lrrk1 regulates osteoclast function is unknown. In this study, we generated a series of Lrrk1 mutants and evaluated their ability to rescue defective bone resorption in Lrrk1-deficient osteoclasts by use of pit formation assays. Overexpression of Lrrk1 or LRR-truncated Lrrk1, but not ANK-truncated Lrrk1, WD40-truncated Lrrk1, Lrrk1-KD, or K651A mutant Lrrk1, rescued bone resorption function of Lrrk1 KO osteoclasts. We next examined whether RAC1/Cdc42 small GTPases are direct substrates of Lrrk1 in osteoclasts. Western blot and pull-down assays revealed that Lrrk1 deficiency in osteoclasts resulted in reduced phosphorylation and activation of RAC1/Cdc42. In vitro kinase assays confirmed that recombinant Lrrk1 phosphorylated RAC1-GST protein, and immunoprecipitation showed that the interaction of Lrrk1 with RAC1 occurred within 10 min after RANKL treatment. Overexpression of constitutively active Q61L RAC1 partially rescued the resorptive function of Lrrk1-deficient osteoclasts. Furthermore, lack of Lrrk1 in osteoclasts led to reduced autophosphorylation of p21 protein-activated kinase-1 at Ser 144 , catalyzed by RAC1/Cdc42 binding and activation. Our data indicate that Lrrk1 regulates osteoclast function by directly modulating phosphorylation and activation of small GTPase RAC1/Cdc42 and that its function depends on ANK, ROC, WD40, and kinase domains. Copyright © 2016 the American Physiological Society.
DEFF Research Database (Denmark)
Siewers, Verena; San-Bento, Rita; Nielsen, Jens
2010-01-01
Saccharomyces cerevisiae has in several cases been proven to be a suitable host for the production of natural products and was recently exploited for the production of non-ribosomal peptides. Synthesis of non-ribosomal peptides (NRPs) is mediated by NRP synthetases (NRPSs), modular enzymes, which...... are often organized in enzyme complexes. In these complexes, partner NRPSs interact via communication-mediating domains (COM domains). In order to test whether functional interaction between separate NRPS modules is possible in yeast we constructed a yeast strain expressing two modules with compatible COM...
Ribosomal protein S14 transcripts are edited in Oenothera mitochondria.
Schuster, W; Unseld, M; Wissinger, B; Brennicke, A
1990-01-01
The gene encoding ribosomal protein S14 (rps14) in Oenothera mitochondria is located upstream of the cytochrome b gene (cob). Sequence analysis of independently derived cDNA clones covering the entire rps14 coding region shows two nucleotides edited from the genomic DNA to the mRNA derived sequences by C to U modifications. A third editing event occurs four nucleotides upstream of the AUG initiation codon and improves a potential ribosome binding site. A CGG codon specifying arginine in a position conserved in evolution between chloroplasts and E. coli as a UGG tryptophan codon is not edited in any of the cDNAs analysed. An inverted repeat 3' of an unidentified open reading frame is located upstream of the rps14 gene. The inverted repeat sequence is highly conserved at analogous regions in other Oenothera mitochondrial loci. Images PMID:2326162
Free and membrane-bound ribosomes and polysomes in hippocampal neurons during a learning experiment.
Wenzel, J; David, H; Pohle, W; Marx, I; Matthies, H
1975-01-24
The ribosomes of the CA1 and CA3 pyramidal cells of hipocampus were investigated by morphometric methods after the acquisition of a shock-motivated brightness discrimination in rats. A significant increase in the total number of ribosomes was observed in CA1 cells of trained animals and in CA3 cells of both active controls and trained rats. A significant increase in membrane-bound ribosomes was obtained in CA1 and CA3 cells after training only. The results confirm the suggestion of an increased protein synthesis in hippocampal neurons during and after the acquisition of a brightness discrimination, as we have concluded from out previous investigations on the incorporation of labeled amino acids under identical experimental conditions. The results lead to the assumption that the protein synthesis in some neuronal cells may probably differ not only quantitatively, but also qualitatively in trained and untrained animals.
Ozdemir, E Sila; Jang, Hyunbum; Gursoy, Attila; Keskin, Ozlem; Li, Zhigang; Sacks, David B; Nussinov, Ruth
2018-03-09
IQ motif-containing GTPase-activating proteins (IQGAPs) are scaffolding proteins playing central roles in cell-cell adhesion, polarity, and motility. The Rho GTPases Cdc42 and Rac1, in their GTP-bound active forms, interact with all three human IQGAPs. The IQGAP-Cdc42 interaction promotes metastasis by enhancing actin polymerization. However, despite their high sequence identity, Cdc42 and Rac1 differ in their interactions with IQGAP. Two Cdc42 molecules can bind to the Ex-domain and the RasGAP site of the GTPase-activating protein (GAP)-related domain (GRD) of IQGAP and promote IQGAP dimerization. Only one Rac1 molecule might bind to the RasGAP site of GRD and may not facilitate the dimerization, and the exact mechanism of Cdc42 and Rac1 binding to IQGAP is unclear. Using all-atom molecular dynamics simulations, site-directed mutagenesis, and Western blotting, we unraveled the detailed mechanisms of Cdc42 and Rac1 interactions with IQGAP2. We observed that Cdc42 binding to the Ex-domain of GRD of IQGAP2 (GRD2) releases the Ex-domain at the C-terminal region of GRD2, facilitating IQGAP2 dimerization. Cdc42 binding to the Ex-domain promoted allosteric changes in the RasGAP site, providing a binding site for the second Cdc42 in the RasGAP site. Of note, the Cdc42 "insert loop" was important for the interaction of the first Cdc42 with the Ex-domain. By contrast, differences in Rac1 insert-loop sequence and structure precluded its interaction with the Ex-domain. Rac1 could bind only to the RasGAP site of apo-GRD2 and could not facilitate IQGAP2 dimerization. Our detailed mechanistic insights help decipher how Cdc42 can stimulate actin polymerization in metastasis.
Koch, Miriam; Willi, Jessica; Pradère, Ugo; Hall, Jonathan; Polacek, Norbert
2017-06-20
The nascent peptide exit tunnel has recently been identified as a functional region of ribosomes contributing to translation regulation and co-translational protein folding. Inducible expression of the erm resistance genes depends on ribosome stalling at specific codons of an upstream open reading frame in the presence of an exit tunnel-bound macrolide antibiotic. The molecular basis for this translation arrest is still not fully understood. Here, we used a nucleotide analog interference approach to unravel important functional groups on 23S rRNA residues in the ribosomal exit tunnel for ribosome stalling on the ErmC leader peptide. By replacing single nucleobase functional groups or even single atoms we were able to demonstrate the importance of A2062, A2503 and U2586 for drug-dependent ribosome stalling. Our data show that the universally conserved A2062 and A2503 are capable of forming a non-Watson-Crick base pair that is critical for sensing and transmitting the stalling signal from the exit tunnel back to the peptidyl transferase center of the ribosome. The nucleobases of A2062, A2503 as well as U2586 do not contribute significantly to the overall mechanism of protein biosynthesis, yet their elaborate role for co-translational monitoring of nascent peptide chains inside the exit tunnel can explain their evolutionary conservation. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
2010-05-01
GTPase) that belongs to the Ras superfamily and has homologs in yeast, fungi , slime mold, fruit fly, zebra fish, and mammals (1–3). Ge- netic and...characterization of TSC2 disease mutations affecting its GAP activity (months 9-12) While the final aspects of this task are yet to be completed, we have...domain mutants of TSC2 that we examined affected its enzymatic activ- ity. This method can now be applied to study the function and regulation of other
Ribosome-Inactivating Proteins from Plants: A Historical Overview
Directory of Open Access Journals (Sweden)
Andrea Bolognesi
2016-11-01
Full Text Available This review provides a historical overview of the research on plant ribosome-inactivating proteins (RIPs, starting from the first studies at the end of eighteenth century involving the purification of abrin and ricin, as well as the immunological experiments of Paul Erlich. Interest in these plant toxins was revived in 1970 by the observation of their anticancer activity, which has given rise to a large amount of research contributing to the development of various scientific fields. Biochemistry analyses succeeded in identifying the enzymatic activity of RIPs and allowed for a better understanding of the ribosomal machinery. Studies on RIP/cell interactions were able to detail the endocytosis and intracellular routing of ricin, thus increasing our knowledge of how cells handle exogenous proteins. The identification of new RIPs and the finding that most RIPs are single-chain polypeptides, together with their genetic sequencing, has aided in the development of new phylogenetic theories. Overall, the biological properties of these proteins, including their abortifacient, anticancer, antiviral and neurotoxic activities, suggest that RIPs could be utilized in agriculture and in many biomedical fields, including clinical drug development.
Directory of Open Access Journals (Sweden)
Abhishek Ghosh
2014-10-01
Full Text Available The conserved TOR kinase signaling network links nutrient availability to cell, tissue and body growth in animals. One important growth-regulatory target of TOR signaling is ribosome biogenesis. Studies in yeast and mammalian cell culture have described how TOR controls rRNA synthesis-a limiting step in ribosome biogenesis-via the RNA Polymerase I transcription factor TIF-IA. However, the contribution of TOR-dependent ribosome synthesis to tissue and body growth in animals is less clear. Here we show in Drosophila larvae that ribosome synthesis in muscle is required non-autonomously to maintain normal body growth and development. We find that amino acid starvation and TOR inhibition lead to reduced levels of TIF-IA, and decreased rRNA synthesis in larval muscle. When we mimic this decrease in muscle ribosome synthesis using RNAi-mediated knockdown of TIF-IA, we observe delayed larval development and reduced body growth. This reduction in growth is caused by lowered systemic insulin signaling via two endocrine responses: reduced expression of Drosophila insulin-like peptides (dILPs from the brain and increased expression of Imp-L2-a secreted factor that binds and inhibits dILP activity-from muscle. We also observed that maintaining TIF-IA levels in muscle could partially reverse the starvation-mediated suppression of systemic insulin signaling. Finally, we show that activation of TOR specifically in muscle can increase overall body size and this effect requires TIF-IA function. These data suggest that muscle ribosome synthesis functions as a nutrient-dependent checkpoint for overall body growth: in nutrient rich conditions, TOR is required to maintain levels of TIF-IA and ribosome synthesis to promote high levels of systemic insulin, but under conditions of starvation stress, reduced muscle ribosome synthesis triggers an endocrine response that limits systemic insulin signaling to restrict growth and maintain homeostasis.
Nuclear ribosomal DNA diversity of a cotton pest ( Rotylenchulus ...
African Journals Online (AJOL)
The reniform nematode (Rotylenchulus reniformis) has emerged as a major cotton pest in the United States. A recent analysis of over 20 amphimictic populations of this pest from the US and three other countries has shown no sequence variation at the nuclear ribosomal internal transcribed spacer (ITS) despite the region's ...
DEFF Research Database (Denmark)
Manuel Palacios Moreno, Juan; Andersen, Lars Dyrskjøt; Egebjerg Kristensen, Janni
1999-01-01
We have studied the interactions between the ribosome and the domains of Escherichia coli translation initiation factor 2, using an in vitro ribosomal binding assay with wild-type forms, N- and C-terminal truncated forms of IF2 as well as isolated structural domains. A deletion mutant of the factor...
DEFF Research Database (Denmark)
Manuel Palacios Moreno, Juan; Andersen, Lars Dyrskjøt; Egebjerg Kristensen, Janni
1999-01-01
We have studied the interactions between the ribosome and the domains of Escherichia coli translation initiation factor 2, using an in vitro ribosomal binding assay with wild-type forms, N- and C-terminal truncated forms of IF2 as well as isolated structural domains. A deletion mutant of the fact...
Expression of a ribosome inactivating protein (curcin 2) in Jatropha ...
Indian Academy of Sciences (India)
Unknown
mechanisms employed by a number of higher-plant species involve defensive ... of RIPs in the same plant species. ..... Lam C J, Ryals J A, Ward E R and Dixon R A 1992 Emerging ... against insect pests and diseases of plants: ribosome in-.
Ribosome-inhibiting proteins from in vitro cultures of Phytolacca dodecandra
DEFF Research Database (Denmark)
Thomsen, S.; Hansen, Harald S.; Nyman, U.
1991-01-01
Phytolacca dodecandra (L'Herit) grown in cell cultures was investigated for content of ribosome-inhibiting proteins, which was evaluated hy measuring inhibition of protein synthesis in a cell-free rat liver extract. Calli initiated from leaf, cotyledon, radicle, and hypocotyl and suspension cells...
Catania, Francesco; Lynch, Michael
2010-05-04
In protozoa, the identification of preserved motifs by comparative genomics is often impeded by difficulties to generate reliable alignments for non-coding sequences. Moreover, the evolutionary dynamics of regulatory elements in 3' untranslated regions (both in protozoa and metazoa) remains a virtually unexplored issue. By screening Paramecium tetraurelia's 3' untranslated regions for 8-mers that were previously found to be preserved in mammalian 3' UTRs, we detect and characterize a motif that is distinctly conserved in the ribosomal genes of this ciliate. The motif appears to be conserved across Paramecium aurelia species but is absent from the ribosomal genes of four additional non-Paramecium species surveyed, including another ciliate, Tetrahymena thermophila. Motif-free ribosomal genes retain fewer paralogs in the genome and appear to be lost more rapidly relative to motif-containing genes. Features associated with the discovered preserved motif are consistent with this 8-mer playing a role in post-transcriptional regulation. Our observations 1) shed light on the evolution of a putative regulatory motif across large phylogenetic distances; 2) are expected to facilitate the understanding of the modulation of ribosomal genes expression in Paramecium; and 3) reveal a largely unexplored--and presumably not restricted to Paramecium--association between the presence/absence of a DNA motif and the evolutionary fate of its host genes.
Directory of Open Access Journals (Sweden)
Yanan Sun
Full Text Available Single chain variable fragments (scFvs against diethylstilbestrol (DES were selected from the splenocytes of non-immunized mice by ribosome display technology. A naive library was constructed and engineered to allow in vitro transcription and translation using an E. coli lysate system. Alternating selection in solution and immobilization in microtiter wells was used to pan mRNA-ribosome-antibody (ARM complexes. After seven rounds of ribosome display, the expression vector pTIG-TRX containing the selected specific scFv DNAs were transformed into Escherichia coli BL21 (DE3 for expression. Twenty-six positive clones were screened and five clones had high antibody affinity and specificity to DES as evidenced by indirect competitive ELISA. Sequence analysis showed that these five DES-specific scFvs had different amino acid sequences, but the CDRs were highly similar. Surface plasmon resonance (SPR analysis was used to determine binding kinetics of one clone (30-1. The measured K(D was 3.79 µM. These results indicate that ribosome display technology can be used to efficiently isolate hapten-specific antibody (Ab fragments from a naive library; this study provides a methodological framework for the development of novel immunoassays for multiple environmental pollutants with low molecular weight detection using recombinant antibodies.
2016-02-11
unlimited. Improved Ribosome-Footprint and mRNA Measurements Provide Insights into Dynamics and Regulation of Yeast Translation The views, opinions and...into Dynamics and Regulation of Yeast Translation Report Title Ribosome-footprint profiling provides genome-wide snapshots of translation, but...tend to slow translation. With the improved mRNA measurements, the variation attributable to translational control in exponentially growing yeast was
Crossland, Hannah; Timmons, James A; Atherton, Philip J
2017-12-01
Increased ribosomal DNA transcription has been proposed to limit muscle protein synthesis, making ribosome biogenesis central to skeletal muscle hypertrophy. We examined the relationship between ribosomal RNA (rRNA) production and IGF-1-mediated myotube hypertrophy in vitro Primary skeletal myotubes were treated with IGF-1 (50 ng/ml) with or without 0.5 µM CX-5461 (CX), an inhibitor of RNA polymerase I. Myotube diameter, total protein, and RNA and DNA levels were measured along with markers of RNA polymerase I regulatory factors and regulators of protein synthesis. CX treatment reduced 45S pre-rRNA expression (-64 ± 5% vs. IGF-1; P IGF-1; P IGF-1-treated myotubes. IGF-1-mediated increases in myotube diameter (1.27 ± 0.09-fold, P IGF-1 treatment did not prevent early increases in AKT (+203 ± 39% vs. CX; P IGF-1, myotube diameter and protein accretion were sustained. Thus, while ribosome biogenesis represents a potential site for the regulation of skeletal muscle protein synthesis and muscle mass, it does not appear to be a prerequisite for IGF-1-induced myotube hypertrophy in vitro. -Crossland, H., Timmons, J. A., Atherton, P. J. A dynamic ribosomal biogenesis response is not required for IGF-1-mediated hypertrophy of human primary myotubes. © The Author(s).
De novo design and engineering of non-ribosomal peptide synthetases
Bozhüyük, Kenan A. J.; Fleischhacker, Florian; Linck, Annabell; Wesche, Frank; Tietze, Andreas; Niesert, Claus-Peter; Bode, Helge B.
2018-03-01
Peptides derived from non-ribosomal peptide synthetases (NRPSs) represent an important class of pharmaceutically relevant drugs. Methods to generate novel non-ribosomal peptides or to modify peptide natural products in an easy and predictable way are therefore of great interest. However, although the overall modular structure of NRPSs suggests the possibility of adjusting domain specificity and selectivity, only a few examples have been reported and these usually show a severe drop in production titre. Here we report a new strategy for the modification of NRPSs that uses defined exchange units (XUs) and not modules as functional units. XUs are fused at specific positions that connect the condensation and adenylation domains and respect the original specificity of the downstream module to enable the production of the desired peptides. We also present the use of internal condensation domains as an alternative to other peptide-chain-releasing domains for the production of cyclic peptides.
Transcriptional activation of ribosomal RNA genes during compensatory renal hypertrophy
International Nuclear Information System (INIS)
Ouellette, A.J.; Moonka, R.; Zelenetz, A.; Malt, R.A.
1986-01-01
The overall rate of rDNA transcription increases by 50% during the first 24 hours of compensatory renal hypertrophy in the mouse. To study mechanisms of ribosome accumulation after uninephrectomy, transcription rates were measured in isolated kidneys by transcriptional runoff. 32 P-labeled nascent transcripts were hybridized to blots containing linearized, denatured cloned rDNA, and hybridization was quantitated autoradiographically and by direct counting. Overall transcriptional activity of rDNA was increased by 30% above control levels at 6 hrs after nephrectomy and by 50% at 12, 18, and 24 hrs after operation. Hybridizing RNA was insensitive to inhibiby alpha-amanitin, and no hybridization was detected to vector DNA. Thus, accelerated rDNA transcription is one regulatory element in the accretion of ribosomes in renal growth, and the regulatory event is an early event. Mechanisms of activation may include enhanced transcription of active genes or induction of inactive DNA
Biological significance of 5S rRNA import into human mitochondria: role of ribosomal protein MRP-L18
Smirnov, Alexandre; Entelis, Nina; Martin, Robert P.; Tarassov, Ivan
2011-01-01
5S rRNA is an essential component of ribosomes of all living organisms, the only known exceptions being mitochondrial ribosomes of fungi, animals, and some protists. An intriguing situation distinguishes mammalian cells: Although the mitochondrial genome contains no 5S rRNA genes, abundant import of the nuclear DNA-encoded 5S rRNA into mitochondria was reported. Neither the detailed mechanism of this pathway nor its rationale was clarified to date. In this study, we describe an elegant molecular conveyor composed of a previously identified human 5S rRNA import factor, rhodanese, and mitochondrial ribosomal protein L18, thanks to which 5S rRNA molecules can be specifically withdrawn from the cytosolic pool and redirected to mitochondria, bypassing the classic nucleolar reimport pathway. Inside mitochondria, the cytosolic 5S rRNA is shown to be associated with mitochondrial ribosomes. PMID:21685364
RIBOSOMAL COMPLEX IN PROPHYLAXIS AND TREATMENT OF ACUTE RESPIRATORY INFECTIONS IN CHILDREN
Directory of Open Access Journals (Sweden)
A.A. Alekseeva
2010-01-01
Full Text Available Acute respiratory infections (ARI are widespread in children regardless of age and region of living; they are characterized with big amount of infectious agents and absence of a trend to morbidity decrease. Drugs for nonspecific prophylaxis (immunostimulators and immunomodulatory agents are frequently used for prevention of ARI. There are plenty of immunomodulating agents; the wellstudied medication with systemic action with good efficacy and safety in pediatric practice is ribosomal-proteoglycan complex. The article presents the description of clinical experience of treatment with this complex in pediatric practice.Key words: children, acute respiratory infections, prophylaxis, treatment, ribosomal complex.(Voprosy sovremennoi pediatrii — Current Pediatrics. 2010;9(6:127-130
DEFF Research Database (Denmark)
Richter, W W; Zang, K D; Issinger, O G
1983-01-01
Skin fibroblasts and meningioma cells, derived from primary cultures of the same patients have been used to study the influence of hyperthermia on (i) cell morphology and (ii) phosphorylation pattern of ribosomal and ribosome-associated proteins. Incubation of tumour cells and fibroblasts up to 7...
Giannandrea, Maila; Bianchi, Veronica; Mignogna, Maria Lidia; Sirri, Alessandra; Carrabino, Salvatore; D'Elia, Errico; Vecellio, Matteo; Russo, Silvia; Cogliati, Francesca; Larizza, Lidia; Ropers, Hans-Hilger; Tzschach, Andreas; Kalscheuer, Vera; Oehl-Jaschkowitz, Barbara; Skinner, Cindy; Schwartz, Charles E; Gecz, Jozef; Van Esch, Hilde; Raynaud, Martine; Chelly, Jamel; de Brouwer, Arjan P M; Toniolo, Daniela; D'Adamo, Patrizia
2010-02-12
Human Mental Retardation (MR) is a common and highly heterogeneous pediatric disorder affecting around 3% of the general population; at least 215 X-linked MR (XLMR) conditions have been described, and mutations have been identified in 83 different genes, encoding proteins with a variety of function, such as chromatin remodeling, synaptic function, and intracellular trafficking. The small GTPases of the RAB family, which play an essential role in intracellular vesicular trafficking, have been shown to be involved in MR. We report here the identification of mutations in the small GTPase RAB39B gene in two male patients. One mutation in family X (D-23) introduced a stop codon seven amino acids after the start codon (c.21C > A; p.Y7X). A second mutation, in the MRX72 family, altered the 5' splice site (c.215+1G > A) and normal splicing. Neither instance produced a protein. Mutations segregate with the disease in the families, and in some family members intellectual disabilities were associated with autism spectrum disorder, epileptic seizures, and macrocephaly. We show that RAB39B, a novel RAB GTPase of unknown function, is a neuronal-specific protein that is localized to the Golgi compartment. Its downregulation leads to an alteration in the number and morphology of neurite growth cones and a significant reduction in presynaptic buttons, suggesting that RAB39B is required for synapse formation and maintenance. Our results demonstrate developmental and functional neuronal alteration as a consequence of downregulation of RAB39B and emphasize the critical role of vesicular trafficking in the development of neurons and human intellectual abilities. Copyright (c) 2010 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
María Milagros López de Armentia
2016-03-01
Full Text Available Autophagy is an intracellular process that comprises degradation of damaged organelles, protein aggregates and intracellular pathogens, having an important role in controlling the fate of invading microorganisms. Intracellular pathogens are internalized by professional and non-professional phagocytes, localizing in compartments called phagosomes. To degrade the internalized microorganism, the microbial phagosome matures by fusion events with early and late endosomal compartments and lysosomes, a process that is regulated by Rab GTPases. Interestingly, in order to survive and replicate in the phagosome, some pathogens employ different strategies to manipulate vesicular traffic, inhibiting phagolysosomal biogenesis (e.g., Staphylococcus aureus and Mycobacterium tuberculosis or surviving in acidic compartments and forming replicative vacuoles (e.g., Coxiella burnetti and Legionella pneumophila. The bacteria described in this review often use secretion systems to control the host’s response and thus disseminate. To date, eight types of secretion systems (Type I to Type VIII are known. Some of these systems are used by bacteria to translocate pathogenic proteins into the host cell and regulate replicative vacuole formation, apoptosis, cytokine responses, and autophagy. Herein, we have focused on how bacteria manipulate small Rab GTPases to control many of these processes. The growing knowledge in this field may facilitate the development of new treatments or contribute to the prevention of these types of bacterial infections.
Rac1 GTPase regulates 11β hydroxysteroid dehydrogenase type 2 and fibrotic remodeling.
Lavall, Daniel; Schuster, Pia; Jacobs, Nadine; Kazakov, Andrey; Böhm, Michael; Laufs, Ulrich
2017-05-05
The aim of the study was to characterize the role of Rac1 GTPase for the mineralocorticoid receptor (MR)-mediated pro-fibrotic remodeling. Transgenic mice with cardiac overexpression of constitutively active Rac1 (RacET) develop an age-dependent phenotype with atrial dilatation, fibrosis, and atrial fibrillation. Expression of MR was similar in RacET and WT mice. The expression of 11β hydroxysteroid dehydrogenase type 2 (11β-HSD2) was age-dependently up-regulated in the atria and the left ventricles of RacET mice on mRNA and protein levels. Statin treatment inhibiting Rac1 geranylgeranylation reduced 11β-HSD2 up-regulation. Samples of human left atrial myocardium showed a positive correlation between Rac1 activity and 11β-HSD2 expression ( r = 0.7169). Immunoprecipitation showed enhanced Rac1-bound 11β-HSD2 relative to Rac1 expression in RacET mice that was diminished with statin treatment. Both basal and phorbol 12-myristate 13-acetate (PMA)-induced NADPH oxidase activity were increased in RacET and correlated positively with 11β-HSD2 expression ( r = 0.788 and r = 0.843, respectively). In cultured H9c2 cardiomyocytes, Rac1 activation with l-buthionine sulfoximine increased; Rac1 inhibition with NSC23766 decreased 11β-HSD2 mRNA and protein expression. Connective tissue growth factor (CTGF) up-regulation induced by aldosterone was prevented with NSC23766. Cardiomyocyte transfection with 11β-HSD2 siRNA abolished the aldosterone-induced CTGF up-regulation. Aldosterone-stimulated MR nuclear translocation was blocked by the 11β-HSD2 inhibitor carbenoxolone. In cardiac fibroblasts, nuclear MR translocation induced by aldosterone was inhibited with NSC23766 and spironolactone. NSC23766 prevented the aldosterone-induced proliferation and migration of cardiac fibroblasts and the up-regulation of CTGF and fibronectin. In conclusion, Rac1 GTPase regulates 11β-HSD2 expression, MR activation, and MR-mediated pro-fibrotic signaling. © 2017 by The American Society for
International Nuclear Information System (INIS)
Xue Yan; Bi Feng; Zhang Xueyong; Pan Yanglin; Liu Na; Zheng Yi; Fan Daiming
2004-01-01
Hypoxia-induced angiogenesis plays an important role in the malignancy of solid tumors. A number of recent studies including our own have suggested that Rho family small GTPases are involved in this process, and Rac1, a prominent member of the Rho family, may be critical in regulating hypoxia-induced gene activation of several angiogenesis factors and tumor suppressors. To further define Rac1 function in angiogenesis and to explore novel approaches to modulate angiogenesis, we employed the small interference RNA technique to knock down gene expression of Rac1 in gastric cancer cell line AGS that expresses a high level of Rac1. Both the mRNA and protein levels of Rac1 in the AGS cells were decreased dramatically after transfection with a Rac1-specific siRNA vector. When the conditioned medium derived from the Rac1 downregulated AGS cells was applied to the human endothelial cells, it could significantly inhibit the cell proliferation. Further study proved that, VEGF and HIF-1α, two angiogenesis promoting factors, were found to be downregulated whereas p53 and VHL, which are tumor suppressors and angiogenesis inhibitors, were upregulated in the Rac1 siRNA transfected cells. Our results suggest that Rac1 may be involved in angiogenesis by controlling the expression of angiogenesis-related factors and provide a possible strategy for the treatment of tumor angiogenesis by targeting the Rac1 GTPase
Directory of Open Access Journals (Sweden)
Matthias Stein
Full Text Available Rab GTPases constitute the largest subfamily of the Ras protein superfamily. Rab proteins regulate organelle biogenesis and transport, and display distinct binding preferences for effector and activator proteins, many of which have not been elucidated yet. The underlying molecular recognition motifs, binding partner preferences and selectivities are not well understood.Comparative analysis of the amino acid sequences and the three-dimensional electrostatic and hydrophobic molecular interaction fields of 62 human Rab proteins revealed a wide range of binding properties with large differences between some Rab proteins. This analysis assists the functional annotation of Rab proteins 12, 14, 26, 37 and 41 and provided an explanation for the shared function of Rab3 and 27. Rab7a and 7b have very different electrostatic potentials, indicating that they may bind to different effector proteins and thus, exert different functions. The subfamily V Rab GTPases which are associated with endosome differ subtly in the interaction properties of their switch regions, and this may explain exchange factor specificity and exchange kinetics.We have analysed conservation of sequence and of molecular interaction fields to cluster and annotate the human Rab proteins. The analysis of three dimensional molecular interaction fields provides detailed insight that is not available from a sequence-based approach alone. Based on our results, we predict novel functions for some Rab proteins and provide insights into their divergent functions and the determinants of their binding partner selectivity.
cDNA, genomic sequence cloning and overexpression of ribosomal ...
African Journals Online (AJOL)
RPS16 of eukaryote is a component of the 40S small ribosomal subunit encoded by RPS16 gene and is also a homolog of prokaryotic RPS9. The cDNA and genomic sequence of RPS16 was cloned successfully for the first time from the Giant Panda (Ailuropoda melanoleuca) using reverse transcription-polymerase chain ...
Sashital, Dipali G; Greeman, Candacia A; Lyumkis, Dmitry; Potter, Clinton S; Carragher, Bridget; Williamson, James R
2014-10-14
Ribosome assembly is a complex process involving the folding and processing of ribosomal RNAs (rRNAs), concomitant binding of ribosomal proteins (r-proteins), and participation of numerous accessory cofactors. Here, we use a quantitative mass spectrometry/electron microscopy hybrid approach to determine the r-protein composition and conformation of 30S ribosome assembly intermediates in Escherichia coli. The relative timing of assembly of the 3' domain and the formation of the central pseudoknot (PK) structure depends on the presence of the assembly factor RimP. The central PK is unstable in the absence of RimP, resulting in the accumulation of intermediates in which the 3'-domain is unanchored and the 5'-domain is depleted for r-proteins S5 and S12 that contact the central PK. Our results reveal the importance of the cofactor RimP in central PK formation, and introduce a broadly applicable method for characterizing macromolecular assembly in cells.
Cryo-EM structure of Hepatitis C virus IRES bound to the human ribosome at 3.9-Å resolution.
Quade, Nick; Boehringer, Daniel; Leibundgut, Marc; van den Heuvel, Joop; Ban, Nenad
2015-07-08
Hepatitis C virus (HCV), a widespread human pathogen, is dependent on a highly structured 5'-untranslated region of its mRNA, referred to as internal ribosome entry site (IRES), for the translation of all of its proteins. The HCV IRES initiates translation by directly binding to the small ribosomal subunit (40S), circumventing the need for many eukaryotic translation initiation factors required for mRNA scanning. Here we present the cryo-EM structure of the human 40S ribosomal subunit in complex with the HCV IRES at 3.9 Å resolution, determined by focused refinement of an 80S ribosome-HCV IRES complex. The structure reveals the molecular details of the interactions between the IRES and the 40S, showing that expansion segment 7 (ES7) of the 18S rRNA acts as a central anchor point for the HCV IRES. The structural data rationalizes previous biochemical and genetic evidence regarding the initiation mechanism of the HCV and other related IRESs.
The NBS1-Treacle complex controls ribosomal RNA transcription in response to DNA damage
DEFF Research Database (Denmark)
Larsen, Dorthe H; Hari, Flurina; Clapperton, Julie A
2014-01-01
Chromosome breakage elicits transient silencing of ribosomal RNA synthesis, but the mechanisms involved remained elusive. Here we discover an in trans signalling mechanism that triggers pan-nuclear silencing of rRNA transcription in response to DNA damage. This is associated with transient...... recruitment of the Nijmegen breakage syndrome protein 1 (NBS1), a central regulator of DNA damage responses, into the nucleoli. We further identify TCOF1 (also known as Treacle), a nucleolar factor implicated in ribosome biogenesis and mutated in Treacher Collins syndrome, as an interaction partner of NBS1...
Ohtsuka, Hokuto; Takinami, Masahiro; Shimasaki, Takafumi; Hibi, Takahide; Murakami, Hiroshi; Aiba, Hirofumi
2017-07-01
Nutritional restrictions such as calorie restrictions are known to increase the lifespan of various organisms. Here, we found that a restriction of sulfur extended the chronological lifespan (CLS) of the fission yeast Schizosaccharomyces pombe. The restriction decreased cellular size, RNA content, and ribosomal proteins and increased sporulation rate. These responses depended on Ecl1 family genes, the overexpression of which results in the extension of CLS. We also showed that the Zip1 transcription factor results in the sulfur restriction-dependent expression of the ecl1 + gene. We demonstrated that a decrease in ribosomal activity results in the extension of CLS. Based on these observations, we propose that sulfur restriction extends CLS through Ecl1 family genes in a ribosomal activity-dependent manner. © 2017 John Wiley & Sons Ltd.
International Nuclear Information System (INIS)
Nishimura, Mitsuhiro; Kaminishi, Tatsuya; Kawazoe, Masahito; Shirouzu, Mikako; Takemoto, Chie; Yokoyama, Shigeyuki; Tanaka, Akiko; Sugano, Sumio; Yoshida, Takuya; Ohkubo, Tadayasu; Kobayashi, Yuji
2007-01-01
A truncated variant of human ribosomal protien L10 was prepared and crystallized. Diffraction data were collected to 2.5 Å resolution. Eukaryotic ribosomal protein L10 is an essential component of the large ribosomal subunit, which organizes the architecture of the aminoacyl-tRNA binding site. The human L10 protein is also called the QM protein and consists of 214 amino-acid residues. For crystallization, the L10 core domain (L10CD, Phe34–Glu182) was recombinantly expressed in Escherichia coli and purified to homogeneity. A hexagonal crystal of L10CD was obtained by the sitting-drop vapour-diffusion method. The L10CD crystal diffracted to 2.5 Å resolution and belongs to space group P3 1 21 or P3 2 21
Evolutionary dynamics of a conserved sequence motif in the ribosomal genes of the ciliate Paramecium
Directory of Open Access Journals (Sweden)
Lynch Michael
2010-05-01
Full Text Available Abstract Background In protozoa, the identification of preserved motifs by comparative genomics is often impeded by difficulties to generate reliable alignments for non-coding sequences. Moreover, the evolutionary dynamics of regulatory elements in 3' untranslated regions (both in protozoa and metazoa remains a virtually unexplored issue. Results By screening Paramecium tetraurelia's 3' untranslated regions for 8-mers that were previously found to be preserved in mammalian 3' UTRs, we detect and characterize a motif that is distinctly conserved in the ribosomal genes of this ciliate. The motif appears to be conserved across Paramecium aurelia species but is absent from the ribosomal genes of four additional non-Paramecium species surveyed, including another ciliate, Tetrahymena thermophila. Motif-free ribosomal genes retain fewer paralogs in the genome and appear to be lost more rapidly relative to motif-containing genes. Features associated with the discovered preserved motif are consistent with this 8-mer playing a role in post-transcriptional regulation. Conclusions Our observations 1 shed light on the evolution of a putative regulatory motif across large phylogenetic distances; 2 are expected to facilitate the understanding of the modulation of ribosomal genes expression in Paramecium; and 3 reveal a largely unexplored--and presumably not restricted to Paramecium--association between the presence/absence of a DNA motif and the evolutionary fate of its host genes.
Kokkori, Sofia; Apostolidi, Maria; Tsakris, Athanassios; Pournaras, Spyros; Stathopoulos, Constantinos; Dinos, George
2014-01-01
Linezolid-dependent growth was recently reported in Staphylococcus epidermidis clinical strains carrying mutations associated with linezolid resistance. To investigate this unexpected behavior at the molecular level, we isolated active ribosomes from one of the linezolid-dependent strains and we compared them with ribosomes isolated from a wild-type strain. Both strains were grown in the absence and presence of linezolid. Detailed biochemical and structural analyses revealed essential differe...
Ribosomal RNA in the salivary gland of Sciara ocellaris during larval development
International Nuclear Information System (INIS)
Dessen, E.M.B.; Perondini, A.L.P.
1979-01-01
Ribosomal RNA in the salivary gland of Sciara ocellaris during larval development. The molecular weights of the precursor and of the 28S and 18S mature fractions of the ribosomal RNA estimated by poliacrilamid gel electrophoresis are 2.6 X 10 6 D, 1.4 X 10 6 D and 0.68 X 10 6 D, respectively. The in vivo processing of pre-rRNA is very fast since radioactivity could be detected in the mature fractions fifteen minutes after incorporation. The processing rate of salivary pre-rRNA increases after the stage of metamorphosis induction. The in vitro processing of the pre-rRNA is less rapid when compared to that in vivo, and no differences were found in RNAs [pt
Cukras, Anthony R; Southworth, Daniel R; Brunelle, Julie L; Culver, Gloria M; Green, Rachel
2003-08-01
Translocation of the mRNA:tRNA complex through the ribosome is promoted by elongation factor G (EF-G) during the translation cycle. Previous studies established that modification of ribosomal proteins with thiol-specific reagents promotes this event in the absence of EF-G. Here we identify two small subunit interface proteins S12 and S13 that are essential for maintenance of a pretranslocation state. Omission of these proteins using in vitro reconstitution procedures yields ribosomal particles that translate in the absence of enzymatic factors. Conversely, replacement of cysteine residues in these two proteins yields ribosomal particles that are refractive to stimulation with thiol-modifying reagents. These data support a model where S12 and S13 function as control elements for the more ancient rRNA- and tRNA-driven movements of translocation.
Saraiya, Ashesh A; Lamichhane, Tek N; Chow, Christine S; SantaLucia, John; Cunningham, Philip R
2008-02-22
The 970 loop (helix 31) of Escherichia coli 16S ribosomal RNA contains two modified nucleotides, m(2)G966 and m(5)C967. Positions A964, A969, and C970 are conserved among the Bacteria, Archaea, and Eukarya. The nucleotides present at positions 965, 966, 967, 968, and 971, however, are only conserved and unique within each domain. All organisms contain a modified nucleoside at position 966, but the type of the modification is domain specific. Biochemical and structure studies have placed this loop near the P site and have shown it to be involved in the decoding process and in binding the antibiotic tetracycline. To identify the functional components of this ribosomal RNA hairpin, the eight nucleotides of the 970 loop of helix 31 were subjected to saturation mutagenesis and 107 unique functional mutants were isolated and analyzed. Nonrandom nucleotide distributions were observed at each mutated position among the functional isolates. Nucleotide identity at positions 966 and 969 significantly affects ribosome function. Ribosomes with single mutations of m(2)G966 or m(5)C967 produce more protein in vivo than do wild-type ribosomes. Overexpression of initiation factor 3 specifically restored wild-type levels of protein synthesis to the 966 and 967 mutants, suggesting that modification of these residues is important for initiation factor 3 binding and for the proper initiation of protein synthesis.
Bøsling, Jacob; Poulsen, Susan M; Vester, Birte; Long, Katherine S
2003-09-01
The antibiotic tiamulin targets the 50S subunit of the bacterial ribosome and interacts at the peptidyl transferase center. Tiamulin-resistant Escherichia coli mutants were isolated in order to elucidate mechanisms of resistance to the drug. No mutations in the rRNA were selected as resistance determinants using a strain expressing only a plasmid-encoded rRNA operon. Selection in a strain with all seven chromosomal rRNA operons yielded a mutant with an A445G mutation in the gene coding for ribosomal protein L3, resulting in an Asn149Asp alteration. Complementation experiments and sequencing of transductants demonstrate that the mutation is responsible for the resistance phenotype. Chemical footprinting experiments show a reduced binding of tiamulin to mutant ribosomes. It is inferred that the L3 mutation, which points into the peptidyl transferase cleft, causes tiamulin resistance by alteration of the drug-binding site. This is the first report of a mechanism of resistance to tiamulin unveiled in molecular detail.
Arndt, E; Scholzen, T; Krömer, W; Hatakeyama, T; Kimura, M
1991-06-01
Approximately 40 ribosomal proteins from each Halobacterium marismortui and Bacillus stearothermophilus have been sequenced either by direct protein sequence analysis or by DNA sequence analysis of the appropriate genes. The comparison of the amino acid sequences from the archaebacterium H marismortui with the available ribosomal proteins from the eubacterial and eukaryotic kingdoms revealed four different groups of proteins: 24 proteins are related to both eubacterial as well as eukaryotic proteins. Eleven proteins are exclusively related to eukaryotic counterparts. For three proteins only eubacterial relatives-and for another three proteins no counterpart-could be found. The similarities of the halobacterial ribosomal proteins are in general somewhat higher to their eukaryotic than to their eubacterial counterparts. The comparison of B stearothermophilus proteins with their E coli homologues showed that the proteins evolved at different rates. Some proteins are highly conserved with 64-76% identity, others are poorly conserved with only 25-34% identical amino acid residues.
Benjdia, Alhosna; Guillot, Alain; Ruffié, Pauline; Leprince, Jérôme; Berteau, Olivier
2017-07-01
Ribosomally synthesized peptides are built out of L-amino acids, whereas D-amino acids are generally the hallmark of non-ribosomal synthetic processes. Here we show that the model bacterium Bacillus subtilis is able to produce a novel type of ribosomally synthesized and post-translationally modified peptide that contains D-amino acids, and which we propose to call epipeptides. We demonstrate that a two [4Fe-4S]-cluster radical S-adenosyl-L-methionine (SAM) enzyme converts L-amino acids into their D-counterparts by catalysing Cα-hydrogen-atom abstraction and using a critical cysteine residue as the hydrogen-atom donor. Unexpectedly, these D-amino acid residues proved to be essential for the activity of a peptide that induces the expression of LiaRS, a major component of the bacterial cell envelope stress-response system. Present in B. subtilis and in several members of the human microbiome, these epipeptides and radical SAM epimerases broaden the landscape of peptidyl structures accessible to living organisms.
DEFF Research Database (Denmark)
Douthwaite, S; Powers, T; Lee, J Y
1989-01-01
The helix spanning nucleotides 1198 to 1247 (helix 1200-1250) in Escherichia coli 23 S ribosomal RNA (rRNA) is functionally important in protein synthesis, and deletions in this region confer erythromycin resistance. In order to define the structural requirements for resistance, we have dissected...... deletion mutants show a sensitive phenotype. Deletions that extend into the base-pairing between GCC1208 and GGU1240 result in non-functional 23 S RNAs, which consequently do not confer resistance. A number of phylogenetically conserved nucleotides have been shown to be non-essential for 23 S RNA function....... However, removal of either these or non-conserved nucleotides from helix 1200-1250 measurably reduces the efficiency of 23 S RNA in forming functional ribosomes. We have used chemical probing and a modified primer extension method to investigate erythromycin binding to wild-type and resistant ribosomes...
Cukras, Anthony R; Green, Rachel
2005-05-27
The ribosomal protein S13 is found in the head region of the small subunit, where it interacts with the central protuberance of the large ribosomal subunit and with the P site-bound tRNA through its extended C terminus. The bridging interactions between the large and small subunits are dynamic, and are thought to be critical in orchestrating the molecular motions of the translation cycle. S13 provides a direct link between the tRNA-binding site and the movements in the head of the small subunit seen during translocation, thereby providing a possible pathway of signal transduction. We have created and characterized an rpsM(S13)-deficient strain of Escherichia coli and have found significant defects in subunit association, initiation and translocation through in vitro assays of S13-deficient ribosomes. Targeted mutagenesis of specific bridge and tRNA contact elements in S13 provides evidence that these two interaction domains play critical roles in maintaining the fidelity of translation. This ribosomal protein thus appears to play a non-essential, yet important role by modulating subunit interactions in multiple steps of the translation cycle.
The Ribosomal Protein uL22 Modulates the Shape of the Protein Exit Tunnel
DEFF Research Database (Denmark)
Wekselman, Itai; Zimmerman, Ella; Davidovich, Chen
2017-01-01
Erythromycin is a clinically useful antibiotic that binds to an rRNA pocket in the ribosomal exit tunnel. Commonly, resistance to erythromycin is acquired by alterations of rRNA nucleotides that interact with the drug. Mutations in the β hairpin of ribosomal protein uL22, which is rather distal...... of the β hairpin of the mutated uL22 toward the interior of the exit tunnel, triggering a cascade of structural alterations of rRNA nucleotides that propagate to the erythromycin binding pocket. Our findings support recent studies showing that the interactions between uL22 and specific sequences within...
Camargo, Hendricka; Nusspaumer, Gretel; Abia, David; Briceño, Verónica; Remacha, Miguel; Ballesta, Juan P G
2011-05-01
The eukaryotic ribosomal proteins P1 and P2 bind to protein P0 through their N-terminal domain to form the essential ribosomal stalk. A mutational analysis points to amino acids at positions 2 and 3 as determinants for the drastic difference of Saccharomyces cerevisiae P1 and P2 half-life, and suggest different degradation mechanisms for each protein type. Moreover, the capacity to form P1/P2 heterodimers is drastically affected by mutations in the P2β four initial amino acids, while these mutations have no effect on P1β. Binding of P2β and, to a lesser extent, P1β to the ribosome is also seriously affected showing the high relevance of the amino acids in the first turn of the NTD α-helix 1 for the stalk assembly. The negative effect of some mutations on ribosome binding can be reversed by the presence of the second P1/P2 couple in the ribosome, indicating a stabilizing structural influence between the two heterodimers. Unexpectedly, some mutations totally abolish heterodimer formation but allow significant ribosome binding and, therefore, a previous P1 and P2 association seems not to be an absolute requirement for stalk assembly. Homology modeling of the protein complexes suggests that the mutated residues can affect the overall protein conformation. © The Author(s) 2011. Published by Oxford University Press.
Hatakeyama, T; Kimura, M
1988-03-15
Ribosomal proteins were extracted from 50S ribosomal subunits of the archaebacterium Halobacterium marismortui by decreasing the concentration of Mg2+ and K+, and the proteins were separated and purified by ion-exchange column chromatography on DEAE-cellulose. Ten proteins were purified to homogeneity and three of these proteins were subjected to sequence analysis. The complete amino acid sequences of the ribosomal proteins L25, L29 and L31 were established by analyses of the peptides obtained by enzymatic digestion with trypsin, Staphylococcus aureus protease, chymotrypsin and lysylendopeptidase. Proteins L25, L29 and L31 consist of 84, 115 and 95 amino acid residues with the molecular masses of 9472 Da, 12293 Da and 10418 Da respectively. A comparison of their sequences with those of other large-ribosomal-subunit proteins from other organisms revealed that protein L25 from H. marismortui is homologous to protein L23 from Escherichia coli (34.6%), Bacillus stearothermophilus (41.8%), and tobacco chloroplasts (16.3%) as well as to protein L25 from yeast (38.0%). Proteins L29 and L31 do not appear to be homologous to any other ribosomal proteins whose structures are so far known.
Sharma, Neelam; Park, Sang-Wook; Vepachedu, Ramarao; Barbieri, Luigi; Ciani, Marialibera; Stirpe, Fiorenzo; Savary, Brett J; Vivanco, Jorge M
2004-01-01
Ribosome-inactivating proteins (RIPs) are N-glycosidases that remove a specific adenine from the sarcin/ricin loop of the large rRNA, thus arresting protein synthesis at the translocation step. In the present study, a protein termed tobacco RIP (TRIP) was isolated from tobacco (Nicotiana tabacum) leaves and purified using ion exchange and gel filtration chromatography in combination with yeast ribosome depurination assays. TRIP has a molecular mass of 26 kD as evidenced by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and showed strong N-glycosidase activity as manifested by the depurination of yeast rRNA. Purified TRIP showed immunoreactivity with antibodies of RIPs from Mirabilis expansa. TRIP released fewer amounts of adenine residues from ribosomal (Artemia sp. and rat ribosomes) and non-ribosomal substrates (herring sperm DNA, rRNA, and tRNA) compared with other RIPs. TRIP inhibited translation in wheat (Triticum aestivum) germ more efficiently than in rabbit reticulocytes, showing an IC50 at 30 ng in the former system. Antimicrobial assays using highly purified TRIP (50 microg mL(-1)) conducted against various fungi and bacterial pathogens showed the strongest inhibitory activity against Trichoderma reesei and Pseudomonas solancearum. A 15-amino acid internal polypeptide sequence of TRIP was identical with the internal sequences of the iron-superoxide dismutase (Fe-SOD) from wild tobacco (Nicotiana plumbaginifolia), Arabidopsis, and potato (Solanum tuberosum). Purified TRIP showed SOD activity, and Escherichia coli Fe-SOD was observed to have RIP activity too. Thus, TRIP may be considered a dual activity enzyme showing RIP-like activity and Fe-SOD characteristics.
Sequence analysis and over-expression of ribosomal protein S28 ...
African Journals Online (AJOL)
RPS28 is a component of the 40S small ribosomal subunit encoded by RPS28 gene, which is specific to eukaryotes. The cDNA and the genomic sequence of RPS28 were cloned successfully from the Giant Panda using RT-PCR technology and Touchdown-PCR, respectively. Both sequences were analyzed preliminarily ...
Kornak, Uwe; Mademan, Inès; Schinke, Marte; Voigt, Martin; Krawitz, Peter; Hecht, Jochen; Barvencik, Florian; Schinke, Thorsten; Gießelmann, Sebastian; Beil, F Timo; Pou-Serradell, Adolf; Vílchez, Juan J; Beetz, Christian; Deconinck, Tine; Timmerman, Vincent; Kaether, Christoph; De Jonghe, Peter; Hübner, Christian A; Gal, Andreas; Amling, Michael; Mundlos, Stefan; Baets, Jonathan; Kurth, Ingo
2014-03-01
Many neurodegenerative disorders present with sensory loss. In the group of hereditary sensory and autonomic neuropathies loss of nociception is one of the disease hallmarks. To determine underlying factors of sensory neurodegeneration we performed whole-exome sequencing in affected individuals with the disorder. In a family with sensory neuropathy with loss of pain perception and destruction of the pedal skeleton we report a missense mutation in a highly conserved amino acid residue of atlastin GTPase 3 (ATL3), an endoplasmic reticulum-shaping GTPase. The same mutation (p.Tyr192Cys) was identified in a second family with similar clinical outcome by screening a large cohort of 115 patients with hereditary sensory and autonomic neuropathies. Both families show an autosomal dominant pattern of inheritance and the mutation segregates with complete penetrance. ATL3 is a paralogue of ATL1, a membrane curvature-generating molecule that is involved in spastic paraplegia and hereditary sensory neuropathy. ATL3 proteins are enriched in three-way junctions, branch points of the endoplasmic reticulum that connect membranous tubules to a continuous network. Mutant ATL3 p.Tyr192Cys fails to localize to branch points, but instead disrupts the structure of the tubular endoplasmic reticulum, suggesting that the mutation exerts a dominant-negative effect. Identification of ATL3 as novel disease-associated gene exemplifies that long-term sensory neuronal maintenance critically depends on the structural organisation of the endoplasmic reticulum. It emphasizes that alterations in membrane shaping-proteins are one of the major emerging pathways in axonal degeneration and suggests that this group of molecules should be considered in neuroprotective strategies.
Anikaev, A Y; Korepanov, A P; Korobeinikova, A V; Kljashtorny, V G; Piendl, W; Nikonov, S V; Garber, M B; Gongadze, G M
2014-08-01
5S rRNA-binding ribosomal proteins of the L25 family are an evolutional acquisition of bacteria. Earlier we showed that (i) single replacements in the RNA-binding module of the protein of this family result in destabilization or complete impossibility to form a complex with 5S rRNA in vitro; (ii) ΔL25 ribosomes of Escherichia coli are less efficient in protein synthesis in vivo than the control ribosomes. In the present work, the efficiency of incorporation of the E. coli protein L25 with mutations in the 5S rRNA-binding region into the ribosome in vivo was studied. It was found that the mutations in L25 that abolish its ability to form the complex with free 5S rRNA do not prevent its correct and efficient incorporation into the ribosome. This is supported by the fact that even the presence of a very weakly retained mutant form of the protein in the ribosome has a positive effect on the activity of the translational machinery in vivo. All this suggests the existence of an alternative incorporation pathway for this protein into the ribosome, excluding the preliminary formation of the complex with 5S rRNA. At the same time, the stable L25-5S rRNA contact is important for the retention of the protein within the ribosome, and the conservative amino acid residues of the RNA-binding module play a key role in this.
International Nuclear Information System (INIS)
Nagahama, Masami; Yamazoe, Takeshi; Hara, Yoshimitsu; Tani, Katsuko; Tsuji, Akihiko; Tagaya, Mitsuo
2006-01-01
Nuclear VCP/p97-like protein 2 (NVL2) is a member of the chaperone-like AAA-ATPase family with two conserved ATP-binding modules. Our previous studies have shown that NVL2 is localized to the nucleolus by interacting with ribosomal protein L5 and may participate in ribosome synthesis, a process involving various non-ribosomal factors including chaperones and RNA helicases. Here, we show that NVL2 is associated with pre-ribosomal particles in the nucleus. Moreover, we used yeast two-hybrid and co-immunoprecipitation assays to identify an NVL2-interacting protein that could yield insights into NVL2 function in ribosome biogenesis. We found that NVL2 interacts with DOB1, a DExD/H-box RNA helicase, whose yeast homologue functions in a late stage of the 60S subunit synthesis. DOB1 can interact with a second ATP-binding module mutant of NVL2, which shows a dominant negative effect on ribosome synthesis. In contrast, it cannot interact with a first ATP-binding module mutant, which does not show the dominant negative effect. When the dominant negative mutant of NVL2 was overexpressed in cells, DOB1 appeared to remain associated with nuclear pre-ribosomal particles. Such accumulation was not observed upon overexpression of wild-type NVL2 or a nondominant-negative mutant. Taken together, our results suggest that NVL2 might regulate the association/dissociation reaction of DOB1 with pre-ribosomal particles by acting as a molecular chaperone
The use of 125iodine-labeled RNA for detection of the RNA binding to ribosomes
International Nuclear Information System (INIS)
Mori, Tomohiko; Fukuda, Mitsuru
1975-01-01
The in vitro labeling of RNA with radioactive iodine is the efficient method to obtain the RNA with high specific activity. The present paper reports on the application of this technique to the production of iodine-labeled RNA for use in the experiment of binding RNA to ribosomes. Tobacco mosaic virus (TMV) RNA was used as natural mRNA, and E. coli S-30 preparation was used as a source of ribosomes. The TMV-RNA was prepared by bentonite-phenol extraction from TMV, and the method used for the iodation of RNA was based on the procedure described by Getz et al. The iodine-labeled RNA was incubated in a cell-free protein synthesizing system (S-30) prepared from E. coli K-12. After the incubation, the reaction mixture was layered onto sucrose gradient, centrifuged, and fractionated into 18 fractions. Optical density at 260 nm was measured, and radioactivity was counted, for each fraction. The binding of mRNA to ribosomes occurred even at 0 deg C, and the occurrence of the nonspecific binding was also shown. Consequently, the specific binding, i.e. the formation of the initiation complex being involved in amino acid incorporation, may be estimated by subtracting the radioactivity associated with monosomes in the presence of both rRNA and ATA from that in the presence of rRNA only. It was shown that the iodine-labeled RNA can be used for the studies of binding RNA to ribosomes. (Kako, I.)
The functional half-life of an mRNA depends on the ribosome spacing in an early coding region
DEFF Research Database (Denmark)
Pedersen, Margit; Nissen, Søren; Mitarai, Namiko
2011-01-01
Bacterial mRNAs are translated by closely spaced ribosomes and degraded from the 5'-end, with half-lives of around 2 min at 37 °C in most cases. Ribosome-free or "naked" mRNA is known to be readily degraded, but the initial event that inactivates the mRNA functionally has not been fully described...
MATHEMATICAL AND COMPUTATIONAL MODELLING OF RIBOSOMAL MOVEMENT AND PROTEIN SYNTHESIS: AN OVERVIEW
Directory of Open Access Journals (Sweden)
Tobias von der Haar
2012-04-01
Full Text Available Translation or protein synthesis consists of a complex system of chemical reactions, which ultimately result in decoding of the mRNA and the production of a protein. The complexity of this reaction system makes it difficult to quantitatively connect its input parameters (such as translation factor or ribosome concentrations, codon composition of the mRNA, or energy availability to output parameters (such as protein synthesis rates or ribosome densities on mRNAs. Mathematical and computational models of translation have now been used for nearly five decades to investigate translation, and to shed light on the relationship between the different reactions in the system. This review gives an overview over the principal approaches used in the modelling efforts, and summarises some of the major findings that were made.
CLINICAL CASE OF TREATMENT WITH RIBOSOMAL COMPLEX IN CHILD WITH COMPROMISED IMMUNITY
Directory of Open Access Journals (Sweden)
A.A. Alekseeva
2011-01-01
Full Text Available The leading pathology in children is acute respiratory infections (ARI according to the expert data of WHO. The incidence of prolonged and recurrent types of ARI increases during recent years. Patients with these diseases subsequently form the group of children with compromised immunity. Immunogens and immunomodulators are the drugs of nonspecific prophylaxis which are used for the prevention of ARI. The group of bacterial immunomodulators is big but most well-studied systemic drug from this group is Ribomunyl. Ribosomal complex is effective and safe in pediatric practice. The article presents the clinical case of treatment with ribosomal complex in immunocompronised child with allergic pathology.Key words: children with compromised immunity, allergy, acute respiratory infections, treatment.(Voprosy sovremennoi pediatrii — Current Pediatrics. 2011; 10 (2: 211–215
International Nuclear Information System (INIS)
Huang, D.; Li, M.; He, S.
2015-01-01
ROP/RAC GTPases is a plant-specific subfamily of Rho GTPases that plays a versatile role in the regulation of plant growth, development, in hormone signal transduction and response to the environment. Prior to the present study, only one Rop gene in pepper has been described. However, with the recent release of the draft genome sequence of pepper allowes us to conduct a genome wide search to identify how many Rop family members existed in pepper genome. We carried out bioinformatics analysis to establish the conserved as well as divergent regions on the protein sequences, phylogenetically analysis and the corresponding result shows that, CaROPs could be distributed into four groups as described in the literature for their homologs in Arabidopsis. To understand the function of nine Rop genes in pepper, we accordingly studied the tissue, fruit development and ripening expression patterns of CaRop genes by obtained RNA-seq data from public database. From our analysis, we realized that the expression of CaRop genes shows no total tissue or developmental specific expression. Furthermore, gene expression profiles of CaRop in response to environment stresses and hormone treatment, such as inoculated with Ralstonia solanacearum, by heat stress as well as treated with four phytohormones respectively and evaluated with real time RT-PCR. The potential involvement of specific CaRop genes in growth, fruit development, ripening, environment stresses as well as hormone responses discussed and may lay the foundation for future functional analysis to unravel their biological roles. (author)
Resistance to Linezolid Caused by Modifications at Its Binding Site on the Ribosome
Long, Katherine S.
2012-01-01
Linezolid is an oxazolidinone antibiotic in clinical use for the treatment of serious infections of resistant Gram-positive bacteria. It inhibits protein synthesis by binding to the peptidyl transferase center on the ribosome. Almost all known resistance mechanisms involve small alterations to the linezolid binding site, so this review will therefore focus on the various changes that can adversely affect drug binding and confer resistance. High-resolution structures of linezolid bound to the 50S ribosomal subunit show that it binds in a deep cleft that is surrounded by 23S rRNA nucleotides. Mutation of 23S rRNA has for some time been established as a linezolid resistance mechanism. Although ribosomal proteins L3 and L4 are located further away from the bound drug, mutations in specific regions of these proteins are increasingly being associated with linezolid resistance. However, very little evidence has been presented to confirm this. Furthermore, recent findings on the Cfr methyltransferase underscore the modification of 23S rRNA as a highly effective and transferable form of linezolid resistance. On a positive note, detailed knowledge of the linezolid binding site has facilitated the design of a new generation of oxazolidinones that show improved properties against the known resistance mechanisms. PMID:22143525
Epidermal activation of the small GTPase Rac1 in psoriasis pathogenesis.
Winge, Mårten C G; Marinkovich, M Peter
2017-01-05
The small GTPase Ras-related C3 botulinum toxin substrate 1 (RAC1) plays a central role in skin homeostasis, including barrier function, wound healing and inflammatory responses. Psoriasis is a common skin disease characterized by deregulation of these functions, and affected skin exhibit keratinocyte hyperproliferation, inflammation and immune cell infiltration. Although psoriasis is often triggered by environmental stimulus, there is a strong genetic association with genes expressed in both immune cells and keratinocytes, of which several are linked to Rac1 signaling. Rac1 is highly active in human psoriatic lesional skin and keratinocytes, and keratinocyte-specific overexpression of an activated mutant of Rac1, Rac1 V12 , in a transgenic mouse model closely mimics the presentation of human psoriasis. Both Rac1 activation in keratinocytes and immune derived stimulus are required to drive psoriasiform signaling in transgenic mouse and human xenograft models of psoriasis. Therefore, understanding how increased Rac1 activation in psoriatic epidermis is regulated is central to understanding how the abnormal crosstalk between keratinocytes and immune cells is maintained.
A Conserved Role for Atlastin GTPases in Regulating Lipid Droplet Size
Directory of Open Access Journals (Sweden)
Robin W. Klemm
2013-05-01
Full Text Available Lipid droplets (LDs are the major fat storage organelles in eukaryotic cells, but how their size is regulated is unknown. Using genetic screens in C. elegans for LD morphology defects in intestinal cells, we found that mutations in atlastin, a GTPase required for homotypic fusion of endoplasmic reticulum (ER membranes, cause not only ER morphology defects, but also a reduction in LD size. Similar results were obtained after depletion of atlastin or expression of a dominant-negative mutant, whereas overexpression of atlastin had the opposite effect. Atlastin depletion in Drosophila fat bodies also reduced LD size and decreased triglycerides in whole animals, sensitizing them to starvation. In mammalian cells, co-overexpression of atlastin-1 and REEP1, a paralog of the ER tubule-shaping protein DP1/REEP5, generates large LDs. The effect of atlastin-1 on LD size correlates with its activity to promote membrane fusion in vitro. Our results indicate that atlastin-mediated fusion of ER membranes is important for LD size regulation.
The ribosomal protein uL22 modulates the shape of the nascent protein exit tunnel
DEFF Research Database (Denmark)
Wekselman, I.; Zimmerman, E.; Davidovich, C.
2017-01-01
in the entrance of theribosomal exit tunnel and interferes with the progression of nas-cent chains. Commonly, resistance to erythromycin is acquiredby alterations of rRNA nucleotides that interact with the drug.Mutations in theb-hairpin of ribosomal protein uL22, which israther distal to the erythromycin binding...... to erythromycin binding pocket and increases its flexi-bility. Based on our results, we suggest a feasble mechanism thatexplains how nanscent proteins can be translated when ery-thromycin is bound to the ribosome. Furthermore, our findingssupport recent studies showing that the interactions betweenuL22...
Structural Dynamics Control Allosteric Activation of Cytohesin Family Arf GTPase Exchange Factors
Energy Technology Data Exchange (ETDEWEB)
Malaby, Andrew W.; Das, Sanchaita; Chakravarthy, Srinivas; Irving, Thomas C.; Bilsel, Osman; Lambright, David G.
2018-01-01
Membrane dynamic processes including vesicle biogenesis depend on Arf guanosine triphosphatase (GTPase) activation by guanine nucleotide exchange factors (GEFs) containing a catalytic Sec7 domain and a membrane-targeting module such as a pleckstrin homology (PH) domain. The catalytic output of cytohesin family Arf GEFs is controlled by autoinhibitory interactions that impede accessibility of the exchange site in the Sec7 domain. These restraints can be relieved through activator Arf-GTP binding to an allosteric site comprising the PH domain and proximal autoinhibitory elements (Sec7-PH linker and C-terminal helix). Small-angle X-ray scattering and negative-stain electron microscopy were used to investigate the structural organization and conformational dynamics of cytohesin-3 (Grp1) in autoinhibited and active states. The results support a model in which hinge dynamics in the autoinhibited state expose the activator site for Arf-GTP binding, while subsequent C-terminal helix unlatching and repositioning unleash conformational entropy in the Sec7-PH linker to drive exposure of the exchange site.
Ribosomal PCR and DNA sequencing for detection and identification of bacteria
DEFF Research Database (Denmark)
Jensen, Kristine Helander; Dargis, Rimtas; Christensen, Jens Jørgen
2014-01-01
-haemolytic streptococci, especially within the mitis group. The data show that ribosomal PCR with subsequent DNA sequencing of the PCR product is a most valuable supplement to culture for identifying bacterial agents of both acute and prolonged infections. However, some bacteria, including non-haemolytic streptococci...
Computational discovery of specificity-conferring sites in non-ribosomal peptide synthetases
DEFF Research Database (Denmark)
Knudsen, Michael; Søndergaard, Dan Ariel; Tofting-Olesen, Claus
2016-01-01
Motivation: By using a class of large modular enzymes known as Non-Ribosomal Peptide Synthetases (NRPS), bacteria and fungi are capable of synthesizing a large variety of secondary metabolites, many of which are bioactive and have potential, pharmaceutical applications as e.g.~antibiotics. There ...
Onofrillo, Carmine; Galbiati, Alice; Montanaro, Lorenzo; Derenzini, Massimo
2017-01-17
Pre-ribosomal complex RPL5/RPL11/5S rRNA (5S RNP) is considered the central MDM2 inhibitory complex that control p53 stabilization during ribosome biogenesis inhibition. Despite its role is well defined, the dynamic of 5S RNP assembly still requires further characterization. In the present work, we report that MDM2 inhibition is dependent by a pre-existing population of 5S rRNA.
Mammalian knock out cells reveal prominent roles for atlastin GTPases in ER network morphology
Energy Technology Data Exchange (ETDEWEB)
Zhao, Guohua; Zhu, Peng-Peng; Renvoisé, Benoît; Maldonado-Báez, Lymarie; Park, Seong Hee; Blackstone, Craig, E-mail: blackstc@ninds.nih.gov
2016-11-15
Atlastins are large, membrane-bound GTPases that participate in the fusion of endoplasmic reticulum (ER) tubules to generate the polygonal ER network in eukaryotes. They also regulate lipid droplet size and inhibit bone morphogenetic protein (BMP) signaling, though mechanisms remain unclear. Humans have three atlastins (ATL1, ATL2, and ATL3), and ATL1 and ATL3 are mutated in autosomal dominant hereditary spastic paraplegia and hereditary sensory neuropathies. Cellular investigations of atlastin orthologs in most yeast, plants, flies and worms are facilitated by the presence of a single or predominant isoform, but loss-of-function studies in mammalian cells are complicated by multiple, broadly-expressed paralogs. We have generated mouse NIH-3T3 cells lacking all three mammalian atlastins (Atl1/2/3) using CRISPR/Cas9-mediated gene knockout (KO). ER morphology is markedly disrupted in these triple KO cells, with prominent impairment in formation of three-way ER tubule junctions. This phenotype can be rescued by expression of distant orthologs from Saccharomyces cerevisiae (Sey1p) and Arabidopsis (ROOT HAIR DEFECTIVE3) as well as any one of the three human atlastins. Minimal, if any, changes are observed in the morphology of mitochondria and the Golgi apparatus. Alterations in BMP signaling and increased sensitivity to ER stress are also noted, though effects appear more modest. Finally, atlastins appear required for the proper differentiation of NIH-3T3 cells into an adipocyte-like phenotype. These findings have important implications for the pathogenesis of hereditary spastic paraplegias and sensory neuropathies associated with atlastin mutations. - Highlights: • NIH-3T3 cells lacking all three atlastin paralogs were generated using CRISPR/Cas9. • Cells lacking all atlastin GTPases exhibit far fewer 3-way ER tubule junctions. • ER morphology defects in atlastin knockout cells are rescued by distant plant and yeast orthologs. • Atlastin knock out cells also
Mammalian knock out cells reveal prominent roles for atlastin GTPases in ER network morphology
International Nuclear Information System (INIS)
Zhao, Guohua; Zhu, Peng-Peng; Renvoisé, Benoît; Maldonado-Báez, Lymarie; Park, Seong Hee; Blackstone, Craig
2016-01-01
Atlastins are large, membrane-bound GTPases that participate in the fusion of endoplasmic reticulum (ER) tubules to generate the polygonal ER network in eukaryotes. They also regulate lipid droplet size and inhibit bone morphogenetic protein (BMP) signaling, though mechanisms remain unclear. Humans have three atlastins (ATL1, ATL2, and ATL3), and ATL1 and ATL3 are mutated in autosomal dominant hereditary spastic paraplegia and hereditary sensory neuropathies. Cellular investigations of atlastin orthologs in most yeast, plants, flies and worms are facilitated by the presence of a single or predominant isoform, but loss-of-function studies in mammalian cells are complicated by multiple, broadly-expressed paralogs. We have generated mouse NIH-3T3 cells lacking all three mammalian atlastins (Atl1/2/3) using CRISPR/Cas9-mediated gene knockout (KO). ER morphology is markedly disrupted in these triple KO cells, with prominent impairment in formation of three-way ER tubule junctions. This phenotype can be rescued by expression of distant orthologs from Saccharomyces cerevisiae (Sey1p) and Arabidopsis (ROOT HAIR DEFECTIVE3) as well as any one of the three human atlastins. Minimal, if any, changes are observed in the morphology of mitochondria and the Golgi apparatus. Alterations in BMP signaling and increased sensitivity to ER stress are also noted, though effects appear more modest. Finally, atlastins appear required for the proper differentiation of NIH-3T3 cells into an adipocyte-like phenotype. These findings have important implications for the pathogenesis of hereditary spastic paraplegias and sensory neuropathies associated with atlastin mutations. - Highlights: • NIH-3T3 cells lacking all three atlastin paralogs were generated using CRISPR/Cas9. • Cells lacking all atlastin GTPases exhibit far fewer 3-way ER tubule junctions. • ER morphology defects in atlastin knockout cells are rescued by distant plant and yeast orthologs. • Atlastin knock out cells also
Shcherbakov, D; Dontsova, M; Tribus, M; Garber, M; Piendl, W
2006-01-01
The ribosomal stalk complex, consisting of one molecule of L10 and four or six molecules of L12, is attached to 23S rRNA via protein L10. This complex forms the so-called 'L12 stalk' on the 50S ribosomal subunit. Ribosomal protein L11 binds to the same region of 23S rRNA and is located at the base of the 'L12 stalk'. The 'L12 stalk' plays a key role in the interaction of the ribosome with translation factors. In this study stalk complexes from mesophilic and (hyper)thermophilic species of the archaeal genus Methanococcus and from the Archaeon Sulfolobus solfataricus, as well as from the Bacteria Escherichia coli, Geobacillus stearothermophilus and Thermus thermophilus, were overproduced in E.coli and purified under non-denaturing conditions. Using filter-binding assays the affinities of the archaeal and bacterial complexes to their specific 23S rRNA target site were analyzed at different pH, ionic strength and temperature. Affinities of both archaeal and bacterial complexes for 23S rRNA vary by more than two orders of magnitude, correlating very well with the growth temperatures of the organisms. A cooperative effect of binding to 23S rRNA of protein L11 and the L10/L12(4) complex from mesophilic and thermophilic Archaea was shown to be temperature-dependent.
Lin, A; McNally, J; Wool, I G
1983-09-10
The covalent structure of the rat liver 60 S ribosomal subunit protein L37 was determined. Twenty-four tryptic peptides were purified and the sequence of each was established; they accounted for all 111 residues of L37. The sequence of the first 30 residues of L37, obtained previously by automated Edman degradation of the intact protein, provided the alignment of the first 9 tryptic peptides. Three peptides (CN1, CN2, and CN3) were produced by cleavage of protein L37 with cyanogen bromide. The sequence of CN1 (65 residues) was established from the sequence of secondary peptides resulting from cleavage with trypsin and chymotrypsin. The sequence of CN1 in turn served to order tryptic peptides 1 through 14. The sequence of CN2 (15 residues) was determined entirely by a micromanual procedure and allowed the alignment of tryptic peptides 14 through 18. The sequence of the NH2-terminal 28 amino acids of CN3 (31 residues) was determined; in addition the complete sequences of the secondary tryptic and chymotryptic peptides were done. The sequence of CN3 provided the order of tryptic peptides 18 through 24. Thus the sequence of the three cyanogen bromide peptides also accounted for the 111 residues of protein L37. The carboxyl-terminal amino acids were identified after carboxypeptidase A treatment. There is a disulfide bridge between half-cystinyl residues at positions 40 and 69. Rat liver ribosomal protein L37 is homologous with yeast YP55 and with Escherichia coli L34. Moreover, there is a segment of 17 residues in rat L37 that occurs, albeit with modifications, in yeast YP55 and in E. coli S4, L20, and L34.
Specific structural probing of plasmid-coded ribosomal RNAs from Escherichia coli
DEFF Research Database (Denmark)
Aagaard, C; Rosendahl, G; Dam, M
1991-01-01
The preferred method for construction and in vivo expression of mutagenised Escherichia coli ribosomal RNAs (rRNAs) is via high copy number plasmids. Transcription of wild-type rRNA from the seven chromosomal rrn operons in strains harbouring plasmid-coded mutant rRNAs leads to a heterogeneous...
Directory of Open Access Journals (Sweden)
Anirban Chakraborty
Full Text Available Ribosome is responsible for protein synthesis in all organisms and ribosomal proteins (RPs play important roles in the formation of a functional ribosome. L11 was recently shown to regulate p53 activity through a direct binding with MDM2 and abrogating the MDM2-induced p53 degradation in response to ribosomal stress. However, the studies were performed in cell lines and the significance of this tumor suppressor function of L11 has yet to be explored in animal models. To investigate the effects of the deletion of L11 and its physiological relevance to p53 activity, we knocked down the rpl11 gene in zebrafish and analyzed the p53 response. Contrary to the cell line-based results, our data indicate that an L11 deficiency in a model organism activates the p53 pathway. The L11-deficient embryos (morphants displayed developmental abnormalities primarily in the brain, leading to embryonic lethality within 6-7 days post fertilization. Extensive apoptosis was observed in the head region of the morphants, thus correlating the morphological defects with apparent cell death. A decrease in total abundance of genes involved in neural patterning of the brain was observed in the morphants, suggesting a reduction in neural progenitor cells. Upregulation of the genes involved in the p53 pathway were observed in the morphants. Simultaneous knockdown of the p53 gene rescued the developmental defects and apoptosis in the morphants. These results suggest that ribosomal dysfunction due to the loss of L11 activates a p53-dependent checkpoint response to prevent improper embryonic development.
Directory of Open Access Journals (Sweden)
Haiwei Cheng
Full Text Available Single chain variable fragments (scFvs against citrinin (CIT were selected from a scFv library constructed from the splenocytes of non-immunized mice by an improved eukaryotic ribosome display technology in this study. Bovine serum albumin (BSA/ CIT-BSA and ovalbumin (OVA/ CIT-OVA were used as the antigens to select specific anti-CIT scFvs. Eukaryotic in situ RT-PCR method was used to recover the selected mRNA after every affinity selection. After six rounds of ribosome display, expression vector pTIG-TRX carrying specific scFv DNAs were constructed and transformed into Escherichia coli BL21 (DE3 for protein expression. Thirteen positive clones were selected out of which three (designated 23, 68 and 109 showed high binding activity and specificity to CIT by indirect ELISA, while no clone showed binding activity with carrier proteins. The three scFvs showed high specificity to CIT and the cross reactivity with other mycotoxins was below 0.01% as determined by indirect competitive ELISA. These specific scFvs offer a potential novel immunoassay method for CIT residues. This study confirmed the effectiveness of the improved eukaryotic ribosome display system and could be used as a reference for the selection of scFvs specific to other small molecules using ribosome display.
Organization of Mitochondrial Gene Expression in Two Distinct Ribosome-Containing Assemblies
Directory of Open Access Journals (Sweden)
Kirsten Kehrein
2015-02-01
Full Text Available Mitochondria contain their own genetic system that provides subunits of the complexes driving oxidative phosphorylation. A quarter of the mitochondrial proteome participates in gene expression, but how all these factors are orchestrated and spatially organized is currently unknown. Here, we established a method to purify and analyze native and intact complexes of mitochondrial ribosomes. Quantitative mass spectrometry revealed extensive interactions of ribosomes with factors involved in all the steps of posttranscriptional gene expression. These interactions result in large expressosome-like assemblies that we termed mitochondrial organization of gene expression (MIOREX complexes. Superresolution microscopy revealed that most MIOREX complexes are evenly distributed throughout the mitochondrial network, whereas a subset is present as nucleoid-MIOREX complexes that unite the whole spectrum of organellar gene expression. Our work therefore provides a conceptual framework for the spatial organization of mitochondrial protein synthesis that likely developed to facilitate gene expression in the organelle.
Structure of a prehandover mammalian ribosomal SRP·SRP receptor targeting complex.
Kobayashi, Kan; Jomaa, Ahmad; Lee, Jae Ho; Chandrasekar, Sowmya; Boehringer, Daniel; Shan, Shu-Ou; Ban, Nenad
2018-04-20
Signal recognition particle (SRP) targets proteins to the endoplasmic reticulum (ER). SRP recognizes the ribosome synthesizing a signal sequence and delivers it to the SRP receptor (SR) on the ER membrane followed by the transfer of the signal sequence to the translocon. Here, we present the cryo-electron microscopy structure of the mammalian translating ribosome in complex with SRP and SR in a conformation preceding signal sequence handover. The structure visualizes all eukaryotic-specific SRP and SR proteins and reveals their roles in stabilizing this conformation by forming a large protein assembly at the distal site of SRP RNA. We provide biochemical evidence that the guanosine triphosphate hydrolysis of SRP·SR is delayed at this stage, possibly to provide a time window for signal sequence handover to the translocon. Copyright © 2018 The Authors, some rights reserved; exclusive licensee American Association for the Advancement of Science. No claim to original U.S. Government Works.
Labeled EF-Tus for rapid kinetic studies of pretranslocation complex formation
DEFF Research Database (Denmark)
Liu, Wei; Kavaliauskas, Darius; Schrader, Jared
2014-01-01
The universally conserved translation elongation factor EF-Tu delivers aminoacyl(aa)-tRNA in the form of an aa-tRNA·EF-Tu·GTP ternary complex (TC) to the ribosome where it binds to the cognate mRNA codon within the ribosomal A-site, leading to formation of a pretranslocation (PRE) complex. Here we...... describe preparation of QSY9 and Cy5 derivatives of the variant E348C-EF-Tu that are functional in translation elongation. Together with fluorophore derivatives of aa-tRNA and of ribosomal protein L11, located within the GTPase associated center (GAC), these labeled EF-Tus allow development of two new FRET...... assays that permit the dynamics of distance changes between EF-Tu and both L11 (Tu-L11 assay) and aa-tRNA (Tu-tRNA assay) to be determined during the decoding process. We use these assays to examine: (i) the relative rates of EF-Tu movement away from the GAC and from aa-tRNA during decoding, (ii...
International Nuclear Information System (INIS)
Firth, Andrew E.; Blitvich, Bradley J.; Wills, Norma M.; Miller, Cathy L.; Atkins, John F.
2010-01-01
Flaviviruses have a positive-sense, single-stranded RNA genome of ∼11 kb, encoding a large polyprotein that is cleaved to produce ∼10 mature proteins. Cell fusing agent virus, Kamiti River virus, Culex flavivirus and several recently discovered flaviviruses have no known vertebrate host and apparently infect only insects. We present compelling bioinformatic evidence for a 253-295 codon overlapping gene (designated fifo) conserved throughout these insect-specific flaviviruses and immunofluorescent detection of its product. Fifo overlaps the NS2A/NS2B coding sequence in the - 1/+ 2 reading frame and is most likely expressed as a trans-frame fusion protein via ribosomal frameshifting at a conserved GGAUUUY slippery heptanucleotide with 3'-adjacent RNA secondary structure (which stimulates efficient frameshifting in vitro). The discovery bears striking parallels to the recently discovered ribosomal frameshifting site in the NS2A coding sequence of the Japanese encephalitis serogroup of flaviviruses and suggests that programmed ribosomal frameshifting may be more widespread in flaviviruses than currently realized.
Structures of the E. coli translating ribosome with SRP and its receptor and with the translocon.
Jomaa, Ahmad; Boehringer, Daniel; Leibundgut, Marc; Ban, Nenad
2016-01-25
Co-translational protein targeting to membranes is a universally conserved process. Central steps include cargo recognition by the signal recognition particle and handover to the Sec translocon. Here we present snapshots of key co-translational-targeting complexes solved by cryo-electron microscopy at near-atomic resolution, establishing the molecular contacts between the Escherichia coli translating ribosome, the signal recognition particle and the translocon. Our results reveal the conformational changes that regulate the latching of the signal sequence, the release of the heterodimeric domains of the signal recognition particle and its receptor, and the handover of the signal sequence to the translocon. We also observe that the signal recognition particle and the translocon insert-specific structural elements into the ribosomal tunnel to remodel it, possibly to sense nascent chains. Our work provides structural evidence for a conformational state of the signal recognition particle and its receptor primed for translocon binding to the ribosome-nascent chain complex.
Bencun, Maja; Klinke, Olaf; Hotz-Wagenblatt, Agnes; Klaus, Severina; Tsai, Ming-Han; Poirey, Remy; Delecluse, Henri-Jacques
2018-04-06
The Epstein-Barr virus (EBV) genome encodes several hundred transcripts. We have used ribosome profiling to characterize viral translation in infected cells and map new translation initiation sites. We show here that EBV transcripts are translated with highly variable efficiency, owing to variable transcription and translation rates, variable ribosome recruitment to the leader region and coverage by monosomes versus polysomes. Some transcripts were hardly translated, others mainly carried monosomes, showed ribosome accumulation in leader regions and most likely represent non-coding RNAs. A similar process was visible for a subset of lytic genes including the key transactivators BZLF1 and BRLF1 in cells infected with weakly replicating EBV strains. This suggests that ribosome trapping, particularly in the leader region, represents a new checkpoint for the repression of lytic replication. We could identify 25 upstream open reading frames (uORFs) located upstream of coding transcripts that displayed 5' leader ribosome trapping, six of which were located in the leader region shared by many latent transcripts. These uORFs repressed viral translation and are likely to play an important role in the regulation of EBV translation.
Directory of Open Access Journals (Sweden)
Andrea Ciammaruconi
2008-01-01
Full Text Available We have identified a novel archaeal protein that apparently plays two distinct roles in ribosome metabolism. It is a polypeptide of about 18 kDa (termed Rbp18 that binds free cytosolic C/D box sRNAs in vivo and in vitro and behaves as a structural ribosomal protein, specifically a component of the 30S ribosomal subunit. As Rbp18 is selectively present in Crenarcheota and highly thermophilic Euryarchaeota, we propose that it serves to protect C/D box sRNAs from degradation and perhaps to stabilize thermophilic 30S subunits.
International Nuclear Information System (INIS)
Lu, Jian; Zhou, Zhongping; Zheng, Jianzhou; Zhang, Zhuyi; Lu, Rongzhu; Liu, Hanqing; Shi, Haifeng; Tu, Zhigang
2015-01-01
Cadmium is a toxic heavy metal present in the environment and in industrial materials. Cadmium has demonstrated carcinogenic activity that induces cell transformation, but how this occurs is unclear. We used 2D-DIGE and MALDI TOF/TOF MS combined with bioinformatics and immunoblotting to investigate the molecular mechanism of cadmium transformation. We found that small GTPases were critical for transformation. Additionally, proteins involved in mitochondrial transcription, DNA repair, and translation also had altered expression patterns in cadmium treated cells. Collectively, our results suggest that activation of small GTPases contributes to cadmium-induced transformation of colon cells. - Highlights: • Colon epithelial cell line is firstly successfully transformed by cadmium. • 2D-DIGE is applied to visualize the differentially expressed proteins. • RhoA plays an important role in cadmium induced malignant transformation. • Bioinformatic and experimental methods are combined to explore new mechanisms.
Energy Technology Data Exchange (ETDEWEB)
Lu, Jian, E-mail: lujian@ujs.edu.cn [School of Medicine, Jiangsu University, Zhenjiang 212013 (China); Institute of Life Sciences, Jiangsu University, Zhenjiang 212013 (China); Zhou, Zhongping [School of Medicine, Jiangsu University, Zhenjiang 212013 (China); Institute of Life Sciences, Jiangsu University, Zhenjiang 212013 (China); Zheng, Jianzhou [Department of Respiration Medicine, Changzhou No.2 People' s Hospital, Changzhou 213003 (China); Zhang, Zhuyi [School of Medicine, Jiangsu University, Zhenjiang 212013 (China); Institute of Life Sciences, Jiangsu University, Zhenjiang 212013 (China); Lu, Rongzhu [School of Medicine, Jiangsu University, Zhenjiang 212013 (China); Liu, Hanqing [School of Pharmacy, Jiangsu University, Zhenjiang 212013 (China); Shi, Haifeng [Institute of Life Sciences, Jiangsu University, Zhenjiang 212013 (China); Tu, Zhigang, E-mail: tuzg_ujs@ujs.edu.cn [Institute of Life Sciences, Jiangsu University, Zhenjiang 212013 (China)
2015-10-01
Cadmium is a toxic heavy metal present in the environment and in industrial materials. Cadmium has demonstrated carcinogenic activity that induces cell transformation, but how this occurs is unclear. We used 2D-DIGE and MALDI TOF/TOF MS combined with bioinformatics and immunoblotting to investigate the molecular mechanism of cadmium transformation. We found that small GTPases were critical for transformation. Additionally, proteins involved in mitochondrial transcription, DNA repair, and translation also had altered expression patterns in cadmium treated cells. Collectively, our results suggest that activation of small GTPases contributes to cadmium-induced transformation of colon cells. - Highlights: • Colon epithelial cell line is firstly successfully transformed by cadmium. • 2D-DIGE is applied to visualize the differentially expressed proteins. • RhoA plays an important role in cadmium induced malignant transformation. • Bioinformatic and experimental methods are combined to explore new mechanisms.
Rac1 GTPase activates the WAVE regulatory complex through two distinct binding sites
Brautigam, Chad A; Xing, Wenmin; Yang, Sheng; Henry, Lisa; Doolittle, Lynda K; Walz, Thomas
2017-01-01
The Rho GTPase Rac1 activates the WAVE regulatory complex (WRC) to drive Arp2/3 complex-mediated actin polymerization, which underpins diverse cellular processes. Here we report the structure of a WRC-Rac1 complex determined by cryo-electron microscopy. Surprisingly, Rac1 is not located at the binding site on the Sra1 subunit of the WRC previously identified by mutagenesis and biochemical data. Rather, it binds to a distinct, conserved site on the opposite end of Sra1. Biophysical and biochemical data on WRC mutants confirm that Rac1 binds to both sites, with the newly identified site having higher affinity and both sites required for WRC activation. Our data reveal that the WRC is activated by simultaneous engagement of two Rac1 molecules, suggesting a mechanism by which cells may sense the density of active Rac1 at membranes to precisely control actin assembly. PMID:28949297
Genetic diversity of Entamoeba: Novel ribosomal lineages from cockroaches.
Directory of Open Access Journals (Sweden)
Tetsuro Kawano
Full Text Available Our current taxonomic perspective on Entamoeba is largely based on small-subunit ribosomal RNA genes (SSU rDNA from Entamoeba species identified in vertebrate hosts with minor exceptions such as E. moshkovskii from sewage water and E. marina from marine sediment. Other Entamoeba species have also been morphologically identified and described from non-vertebrate species such as insects; however, their genetic diversity remains unknown. In order to further disclose the diversity of the genus, we investigated Entamoeba spp. in the intestines of three cockroach species: Periplaneta americana, Blaptica dubia, and Gromphadorhina oblongonota. We obtained 134 Entamoeba SSU rDNA sequences from 186 cockroaches by direct nested PCR using the DNA extracts of intestines from cockroaches, followed by scrutinized BLASTn screening and phylogenetic analyses. All the sequences identified in this study were distinct from those reported from known Entamoeba species, and considered as novel Entamoeba ribosomal lineages. Furthermore, they were positioned at the base of the clade of known Entamoeba species and displayed remarkable degree of genetic diversity comprising nine major groups in the three cockroach species. This is the first report of the diversity of SSU rDNA sequences from Entamoeba in non-vertebrate host species, and should help to understand the genetic diversity of the genus Entamoeba.
International Nuclear Information System (INIS)
1997-05-01
After a general presentation of radioactivity and radioactive wastes and of the French national agency for the management of radioactive wastes (ANDRA), this brochure gives a general overview of the Manche low- and medium-level radioactive waste disposal centre: principles of storage safety, waste containers (first confinement barrier), storage facility and cover (second confinement barrier), the underground (third confinement barrier), the impact of the centre on its environment, and the control of radioactivity in the vicinity of the centre. (J.S.)
Atkins, John F; Loughran, Gary; Bhatt, Pramod R; Firth, Andrew E; Baranov, Pavel V
2016-09-06
Genetic decoding is not 'frozen' as was earlier thought, but dynamic. One facet of this is frameshifting that often results in synthesis of a C-terminal region encoded by a new frame. Ribosomal frameshifting is utilized for the synthesis of additional products, for regulatory purposes and for translational 'correction' of problem or 'savior' indels. Utilization for synthesis of additional products occurs prominently in the decoding of mobile chromosomal element and viral genomes. One class of regulatory frameshifting of stable chromosomal genes governs cellular polyamine levels from yeasts to humans. In many cases of productively utilized frameshifting, the proportion of ribosomes that frameshift at a shift-prone site is enhanced by specific nascent peptide or mRNA context features. Such mRNA signals, which can be 5' or 3' of the shift site or both, can act by pairing with ribosomal RNA or as stem loops or pseudoknots even with one component being 4 kb 3' from the shift site. Transcriptional realignment at slippage-prone sequences also generates productively utilized products encoded trans-frame with respect to the genomic sequence. This too can be enhanced by nucleic acid structure. Together with dynamic codon redefinition, frameshifting is one of the forms of recoding that enriches gene expression. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.
Gamalinda, Michael; Jakovljevic, Jelena; Babiano, Reyes; Talkish, Jason; de la Cruz, Jesús; Woolford, John L
2013-02-01
Ribosome synthesis involves the coordinated folding and processing of pre-rRNAs with assembly of ribosomal proteins. In eukaryotes, these events are facilitated by trans-acting factors that propel ribosome maturation from the nucleolus to the cytoplasm. However, there is a gap in understanding how ribosomal proteins configure pre-ribosomes in vivo to enable processing to occur. Here, we have examined the role of adjacent yeast r-proteins L17, L35 and L37 in folding and processing of pre-rRNAs, and binding of other proteins within assembling ribosomes. These three essential ribosomal proteins, which surround the polypeptide exit tunnel, are required for 60S subunit formation as a consequence of their role in removal of the ITS2 spacer from 27SB pre-rRNA. L17-, L35- and L37-depleted cells exhibit turnover of aberrant pre-60S assembly intermediates. Although the structure of ITS2 does not appear to be grossly affected in their absence, these three ribosomal proteins are necessary for efficient recruitment of factors required for 27SB pre-rRNA processing, namely, Nsa2 and Nog2, which associate with pre-60S ribosomal particles containing 27SB pre-rRNAs. Altogether, these data support that L17, L35 and L37 are specifically required for a recruiting step immediately preceding removal of ITS2.
Spirin, Alexander S
2009-11-17
A model of the ATP-dependent unidirectional movement of the 43S ribosomal initiation complex (=40S ribosomal subunit + eIF1 + eIF1A + eIF2.GTP.Met-tRNA(i) + eIF3) during scanning of the 5'-untranslated region of eukaryotic mRNA is proposed. The model is based on the principles of molecular Brownian ratchet machines and explains several enigmatic data concerning the scanning complex. In this model, the one-dimensional diffusion of the ribosomal initiation complex along the mRNA chain is rectified into the net-unidirectional 5'-to-3' movement by the Feynman ratchet-and-pawl mechanism. The proposed mechanism is organized by the heterotrimeric protein eIF4F (=eIF4A + eIF4E + eIF4G), attached to the scanning ribosomal particle via eIF3, and the RNA-binding protein eIF4B that is postulated to play the role of the pawl. The energy for the useful work of the ratchet-and-pawl mechanism is supplied from ATP hydrolysis induced by the eIF4A subunit: ATP binding and its hydrolysis alternately change the affinities of eIF4A for eIF4B and for mRNA, resulting in the restriction of backward diffusional sliding of the 43S ribosomal complex along the mRNA chain, while stochastic movements ahead are allowed.
Willcocks, Margaret M; Zaini, Salmah; Chamond, Nathalie; Ulryck, Nathalie; Allouche, Delphine; Rajagopalan, Noemie; Davids, Nana A; Fahnøe, Ulrik; Hadsbjerg, Johanne; Rasmussen, Thomas Bruun; Roberts, Lisa O; Sargueil, Bruno; Belsham, Graham J; Locker, Nicolas
2017-12-15
Viral internal ribosomes entry site (IRES) elements coordinate the recruitment of the host translation machinery to direct the initiation of viral protein synthesis. Within hepatitis C virus (HCV)-like IRES elements, the sub-domain IIId(1) is crucial for recruiting the 40S ribosomal subunit. However, some HCV-like IRES elements possess an additional sub-domain, termed IIId2, whose function remains unclear. Herein, we show that IIId2 sub-domains from divergent viruses have different functions. The IIId2 sub-domain present in Seneca valley virus (SVV), a picornavirus, is dispensable for IRES activity, while the IIId2 sub-domains of two pestiviruses, classical swine fever virus (CSFV) and border disease virus (BDV), are required for 80S ribosomes assembly and IRES activity. Unlike in SVV, the deletion of IIId2 from the CSFV and BDV IRES elements impairs initiation of translation by inhibiting the assembly of 80S ribosomes. Consequently, this negatively affects the replication of CSFV and BDV. Finally, we show that the SVV IIId2 sub-domain is required for efficient viral RNA synthesis and growth of SVV, but not for IRES function. This study sheds light on the molecular evolution of viruses by clearly demonstrating that conserved RNA structures, within distantly related RNA viruses, have acquired different roles in the virus life cycles. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
DEFF Research Database (Denmark)
Knudsen, Charlotte Rohde; Clark, Brian F. C.
1996-01-01
Elongation factor Tu from Escherichia coli was mutated separately at positions Asp86 and Arg58, in order to shed light both on the GTPase mechanism of elongation factor Tu and on the binding of aminoacyl-tRNA. In addition, the binding of guanine nucleotides was investigated by determination...
Ionasescu, V; Zellweger, H; Burmeister, L
1976-11-01
The in vitro protein synthesis by polyribosomes extracted from biopsied muscle (vastus lateralis) was studied in 47 known carriers, 87 possible carriers and in 60 normal females. A significant increase in specific activity of monomeric ribosomes, total polyribosomes and collagen synthesis was found in 46 (97.8 per cent) known carriers and 47 (54 per cent) possible carriers of Duchenne muscular dytrophy. The latter showed an increase in ribosomal protein synthesis in 10 (52.6 per cent) of 19 mothers of isolated cases, 31 (53.3 per cent) of 58 sisters, and 6 (60 per cent) of other female relatives. Serum creatine phosphokinase was increased in 30 (63.8 per cent) of 47 known carriers.
Genes Involved in Human Ribosome Biogenesis areTranscriptionally Upregulated in Colorectal Cancer
DEFF Research Database (Denmark)
Mansilla, Francisco; Lamy, Philippe; Ørntoft, Torben Falck
2009-01-01
Microarray gene expression profiling comprising 168 colorectal adenocarcinomas and 10 normal mucosas showed that over 79% of the genes involved in human ribosome biogenesis are significantly upregulated (log2>0.5, p<10-3) when compared to normal mucosa. Overexpression was independent of microsate......Microarray gene expression profiling comprising 168 colorectal adenocarcinomas and 10 normal mucosas showed that over 79% of the genes involved in human ribosome biogenesis are significantly upregulated (log2>0.5, p... of microsatellite status. The promoters of the genes studied showed a significant enrichment for several transcription factor binding sites. There was a significant correlation between the number of binding site targets for these transcription factors and the observed gene transcript upregulation. The upregulation...
Croft, Daniel R.; Olson, Michael F.
2006-01-01
The members of the Rho GTPase family are well known for their regulation of actin cytoskeletal structures. In addition, they influence progression through the cell cycle. The RhoA and RhoC proteins regulate numerous effector proteins, with a central and vital signaling role mediated by the ROCK I and ROCK II serine/threonine kinases. The requirement for ROCK function in the proliferation of numerous cell types has been revealed by studies utilizing ROCK-selective inhibitors such as Y-27632. H...
Patrussi, Laura; Baldari, Cosima T
2016-01-01
Rab GTPases, which form the largest branch of the Ras GTPase superfamily, regulate almost every step of vesicle-mediated trafficking. Among them, Rab8 is an essential participant in primary cilium formation. In a report recently published in the Journal of Cell Science, Finetti and colleagues identify Rab8 as a novel player in vesicular traffic in the non-ciliated T lymphocytes, which contributes to the assembly of the specialized signaling platform known as the immune synapse. By interacting with the v-SNARE VAMP-3, Rab8 is indeed responsible for the final docking/fusion step in T cell receptor (TCR) recycling to the immune synapse. A second important take-home message which comes to light from this work is that VAMP-3 also interacts with Rab8 at the base of the cilium in NIH-3T3 cells, where it regulates ciliary growth and targeting of Smoothened at the plasma membrane. Hence the data presented in this report, in addition to identifying Rab8 as a novel player in vesicular traffic to the immune synapse, reveal how both ciliated and non-ciliated cells take advantage of a conserved pathway to build highly specific cellular structures.
The ideal Atomic Centre; Le Centre Atomique ideal
Energy Technology Data Exchange (ETDEWEB)
Mas, R [Commissariat a l' Energie Atomique, Saclay (France). Centre d' Etudes Nucleaires
1965-07-01
The author presents considerations which should prove to be of interest to all those who have to design, to construct and to operate a nuclear research centre. A large number of the ideas presented can also be applied to non-nuclear scientific research centres. In his report the author reviews: various problems with which the constructor is faced: ground-plan, infrastructure, buildings and the large units of scientific equipment in the centre, and those problems facing the director: maintenance, production, supplies, security. The author stresses the relationship which ought to exist between the research workers and the management. With this aim in view he proposes the creation of National School for Administration in Research which would train administrative executives for public or private organisations; they would be specialised in the fields of fundamental or applied research. (author) [French] L'auteur propose une base de reflexions a tous ceux qui doivent concevoir, realiser et faire vivre un Centre d'Etudes Nucleaires. Un grand nombre des idees exprimees peut d'ailleurs s'appliquer a un Centre d'Etudes Scientifiques non nucleaires. Dans son ouvrage, l'auteur passe en revue les differents problemes qui se posent au constructeur: plan, masse, infrastructure, batiments et grands appareils du Centre, et ceux qu'a a resoudre le directeur: entretien, fabrication, approvisionnements, securite. L'auteur insiste sur l'aspect des rapports qui doivent exister entre les chercheurs et ceux qui les administrent. Il propose a cette fin la creation d'une Ecole Nationale d'Administration de la Recherche qui formerait des cadres administratifs pour les organismes publics ou prives, specialises dans la Recherche fondamentale ou appliquee. (auteur)
Directory of Open Access Journals (Sweden)
Jennifer L Houmani
Full Text Available The ribosomal protein L22 is a component of the 60S eukaryotic ribosomal subunit. As an RNA-binding protein, it has been shown to interact with both cellular and viral RNAs including 28S rRNA and the Epstein-Barr virus encoded RNA, EBER-1. L22 is localized to the cell nucleus where it accumulates in nucleoli. Although previous studies demonstrated that a specific amino acid sequence is required for nucleolar localization, the RNA-binding domain has not been identified. Here, we investigated the hypothesis that the nucleolar accumulation of L22 is linked to its ability to bind RNA. To address this hypothesis, mutated L22 proteins were generated to assess the contribution of specific amino acids to RNA binding and protein localization. Using RNA-protein binding assays, we demonstrate that basic amino acids 80-93 are required for high affinity binding of 28S rRNA and EBER-1 by L22. Fluorescence localization studies using GFP-tagged mutated L22 proteins further reveal that basic amino acids 80-93 are critical for nucleolar accumulation and for incorporation into ribosomes. Our data support the growing consensus that the nucleolar accumulation of ribosomal proteins may not be mediated by a defined localization signal, but rather by specific interaction with established nucleolar components such as rRNA.
RINT-1 interacts with MSP58 within nucleoli and plays a role in ribosomal gene transcription
International Nuclear Information System (INIS)
Yang, Chuan-Pin; Kuo, Yu-Liang; Lee, Yi-Chao; Lee, Kuen-Haur; Chiang, Chi-Wu; Wang, Ju-Ming; Hsu, Che-Chia
2016-01-01
The nucleolus is the cellular site of ribosomal (r)DNA transcription and ribosome biogenesis. The 58-kDa microspherule protein (MSP58) is a nucleolar protein involved in rDNA transcription and cell proliferation. However, regulation of MSP58-mediated rDNA transcription remains unknown. Using a yeast two-hybrid system with MSP58 as bait, we isolated complementary (c)DNA encoding Rad50-interacting protein 1 (RINT-1), as a MSP58-binding protein. RINT-1 was implicated in the cell cycle checkpoint, membrane trafficking, Golgi apparatus and centrosome dynamic integrity, and telomere length control. Both in vitro and in vivo interaction assays showed that MSP58 directly interacts with RINT-1. Interestingly, microscopic studies revealed the co-localization of MSP58, RINT-1, and the upstream binding factor (UBF), a rRNA transcription factor, in the nucleolus. We showed that ectopic expression of MSP58 or RINT-1 resulted in decreased rRNA expression and rDNA promoter activity, whereas knockdown of MSP58 or RINT-1 by siRNA exerted the opposite effect. Coexpression of MSP58 and RINT-1 robustly decreased rRNA synthesis compared to overexpression of either protein alone, whereas depletion of RINT-1 from MSP58-transfected cells enhanced rRNA synthesis. We also found that MSP58, RINT-1, and the UBF were associated with the rDNA promoter using a chromatin immunoprecipitation assay. Because aberrant ribosome biogenesis contributes to neoplastic transformation, our results revealed a novel protein complex involved in the regulation of rRNA gene expression, suggesting a role for MSP58 and RINT-1 in cancer development. - Highlights: • RINT-1 is a novel MSP58-interacting protein. • RINT-1 is a nucleolar protein that suppresses ribosomal RNA gene transcription. • RINT-1 and MSP58 cooperate to suppress ribosomal RNA gene transcription. • RINT-1, MSP58, and UBF form a complex on the rDNA promoter.
The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus.
Hori, H; Osawa, S; Murao, K; Ishikura, H
1980-01-01
The nucleotide sequence of ribosomal 5S RNA from Micrococcus lysodeikticus is pGUUACGGCGGCUAUAGCGUGGGGGAAACGCCCGGCCGUAUAUCGAACCCGGAAGCUAAGCCCCAUAGCGCCGAUGGUUACUGUAACCGGGAGGUUGUGGGAGAGUAGGUCGCCGCCGUGAOH. When compared to other 5S RNAs, the sequence homology is greatest with Thermus aquaticus, and these two 5S RNAs reveal several features intermediate between those of typical gram-positive bacteria and gram-negative bacteria. PMID:6780979
Zhang, Yingchi; Yan, Jiyuan; Xu, Haoran; Yang, Yong; Li, Wenkai; Wu, Hua; Liu, Chaoxu
2018-05-21
The ability of mesenchymal stem cells (MSCs) to migrate to the desired tissues or lesions is crucial for stem cell-based regenerative medicine and tissue engineering. Optimal therapeutics for promoting MSC migration are expected to become an effective means for tissue regeneration. Electromagnetic fields (EMF), as a noninvasive therapy, can cause a lot of biological changes in MSCs. However, whether EMF can promote MSC migration has not yet been reported. We evaluated the effects of EMF on cell migration in human bone marrow-derived MSCs. With the use of Helmholtz coils and an EMF stimulator, 7.5, 15, 30, 50, and 70 Hz/1 mT EMF was generated. Additionally, we employed the L-type calcium channel blocker verapamil and the focal adhesion kinase (FAK) inhibitor PF-573228 to investigate the role of intracellular calcium content, cell adhesion proteins, and the Rho GTPase protein family (RhoA, Rac1, and Cdc42) in EMF-mediated MSC migration. Cell adhesion proteins (FAK, talin, and vinculin) were detected by Western blot analysis. The Rho GTPase protein family activities were assessed by G-LISA, and F-actin levels, which reflect actin cytoskeletal organization, were detected using immunofluorescence. All the 7.5, 15, 30, 50, and 70 Hz/1 mT EMF promoted MSC migration. EMF increased MSC migration in an intracellular calcium-dependent manner. Notably, EMF-enhanced migration was mediated by FAK activation, which was critical for the formation of focal contacts, as evidenced by increased talin and vinculin expression. Moreover, RhoA, Rac1, and Cdc42 were activated by FAK to increase cytoskeletal organization, thus promoting cell contraction. EMF promoted MSC migration by increasing intracellular calcium and activating the FAK/Rho GTPase signaling pathways. This study provides insights into the mechanisms of MSC migration and will enable the rational design of targeted therapies to improve MSC engraftment.
Directory of Open Access Journals (Sweden)
Carolina Varela Chavez
2016-03-01
Full Text Available Clostridium sordellii lethal toxin (TcsL is a powerful virulence factor responsible for severe toxic shock in man and animals. TcsL belongs to the large clostridial glucosylating toxin (LCGT family which inactivates small GTPases by glucosylation with uridine-diphosphate (UDP-glucose as a cofactor. Notably, TcsL modifies Rac and Ras GTPases, leading to drastic alteration of the actin cytoskeleton and cell viability. TcsL enters cells via receptor-mediated endocytosis and delivers the N-terminal glucosylating domain (TcsL-cat into the cytosol. TcsL-cat was found to preferentially bind to phosphatidylserine (PS-containing membranes and to increase the glucosylation of Rac anchored to the lipid membrane. We have previously reported that the N-terminal four helical bundle structure (1–93 domain recognizes a broad range of lipids, but that TcsL-cat specifically binds to PS and phosphatidic acid. Here, we show using mutagenesis that the PS binding site is localized on the tip of the four-helix bundle which is rich in positively-charged amino acids. Residues Y14, V15, F17, and R18 on loop 1, between helices 1 and 2, in coordination with R68 from loop 3, between helices 3 and 4, form a pocket which accommodates L-serine. The functional PS-binding site is required for TcsL-cat binding to the plasma membrane and subsequent cytotoxicity. TcsL-cat binding to PS facilitates a high enzymatic activity towards membrane-anchored Ras by about three orders of magnitude as compared to Ras in solution. The PS-binding site is conserved in LCGTs, which likely retain a common mechanism of binding to the membrane for their full activity towards membrane-bound GTPases.
Jaako, P; Ugale, A; Wahlestedt, M; Velasco-Hernandez, T; Cammenga, J; Lindström, M S; Bryder, D
2017-01-01
Mutations resulting in constitutive activation of signaling pathways that regulate ribosome biogenesis are among the most common genetic events in acute myeloid leukemia (AML). However, whether ribosome biogenesis presents as a therapeutic target to treat AML remains unexplored. Perturbations in ribosome biogenesis trigger the 5S ribonucleoprotein particle (RNP)-Mdm2-p53 ribosomal stress pathway, and induction of this pathway has been shown to have therapeutic efficacy in Myc-driven lymphoma. In the current study we address the physiological and therapeutic role of the 5S RNP-Mdm2-p53 pathway in AML. By utilizing mice that have defective ribosome biogenesis due to downregulation of ribosomal protein S19 (Rps19), we demonstrate that induction of the 5S RNP-Mdm2-p53 pathway significantly delays the initiation of AML. However, even a severe Rps19 deficiency that normally results in acute bone marrow failure has no consistent efficacy on already established disease. Finally, by using mice that harbor a mutation in the Mdm2 gene disrupting its binding to 5S RNP, we show that loss of the 5S RNP-Mdm2-p53 pathway is dispensable for development of AML. Our study suggests that induction of the 5S RNP-Mdm2-p53 ribosomal stress pathway holds limited potential as a single-agent therapy in the treatment of AML.
Fragmentation of the large subunit ribosomal RNA gene in oyster mitochondrial genomes
Directory of Open Access Journals (Sweden)
Milbury Coren A
2010-09-01
Full Text Available Abstract Background Discontinuous genes have been observed in bacteria, archaea, and eukaryotic nuclei, mitochondria and chloroplasts. Gene discontinuity occurs in multiple forms: the two most frequent forms result from introns that are spliced out of the RNA and the resulting exons are spliced together to form a single transcript, and fragmented gene transcripts that are not covalently attached post-transcriptionally. Within the past few years, fragmented ribosomal RNA (rRNA genes have been discovered in bilateral metazoan mitochondria, all within a group of related oysters. Results In this study, we have characterized this fragmentation with comparative analysis and experimentation. We present secondary structures, modeled using comparative sequence analysis of the discontinuous mitochondrial large subunit rRNA genes of the cupped oysters C. virginica, C. gigas, and C. hongkongensis. Comparative structure models for the large subunit rRNA in each of the three oyster species are generally similar to those for other bilateral metazoans. We also used RT-PCR and analyzed ESTs to determine if the two fragmented LSU rRNAs are spliced together. The two segments are transcribed separately, and not spliced together although they still form functional rRNAs and ribosomes. Conclusions Although many examples of discontinuous ribosomal genes have been documented in bacteria and archaea, as well as the nuclei, chloroplasts, and mitochondria of eukaryotes, oysters are some of the first characterized examples of fragmented bilateral animal mitochondrial rRNA genes. The secondary structures of the oyster LSU rRNA fragments have been predicted on the basis of previous comparative metazoan mitochondrial LSU rRNA structure models.
International Nuclear Information System (INIS)
Tai, Lin-Ru; Chou, Chang-Wei; Wu, Jing-Ying; Kirby, Ralph; Lin, Alan
2013-01-01
Using immuno-fluorescent probing and Western blotting analysis, we reveal the exclusive cytoplasm nature of the small subunit ribosomal protein S20. To illustrate the importance of the cellular compartmentation of S20 to the function of small subunit 40S, we created a nuclear resident S20 NLS mutant gene and examined polysome profile of cells that had been transfected with the S20 NLS gene. As a result, we observed the formation of recombinant 40S carried S20 NLS but this recombinant 40S was never found in the polysome, suggesting such a recombinant 40S was translation incompetent. Moreover, by the tactic of the energy depletion and restoration, we were able to restrain the nuclear-resided S20 NLS in the cytoplasm. Yet, along a progressive energy restoration, we observed the presence of recombinant 40S subunits carrying the S20 NLS in the polysome. This proves that S20 needs to be cytoplasmic in order to make a functional 40S subunit. Furthermore, it also implies that the assembly order of ribosomal protein in eukaryote is orderly regulated. - Highlights: • The step of S20 assembled on 40S is happened in the cytoplasm. • A small subunit assembled with a nuclear S20 NLS is translational incompetence. • Using energy depletion and recovery to manipulate the cellular compartment of S20 NLS . • Cytoplasm-retained S20 NLS is crucial for creating a functional small subunit
Llanos, Susana; Serrano, Manuel
2010-10-01
Perturbation of ribosomal biogenesis has recently emerged as a relevant p53-activating pathway. This pathway can be initiated by depletion of certain ribosomal proteins, which is followed by the binding and inhibition of MDM2 by a different subset of ribosomal proteins that includes L11. Here, we report that depletion of L37 leads to cell cycle arrest in a L11- and p53-dependent manner. DNA damage can initiate ribosomal stress, although little is known about the mechanisms involved. We have found that some genotoxic insults, namely, UV light and cisplatin, lead to proteasomal degradation of L37 in the nucleoplasm and to the ensuing L11-dependent stabilization of p53. Moreover, ectopic L37 overexpression can attenuate the DNA damage response mediated by p53. These results support the concept that DNA damage-induced proteasomal degradation of L37 constitutes a mechanistic link between DNA damage and the ribosomal stress pathway, and is a relevant contributing signaling pathway for the activation of p53 in response to DNA damage.
Rac1 and Cdc42 GTPases regulate shear stress-driven β-catenin signaling in osteoblasts
International Nuclear Information System (INIS)
Wan, Qiaoqiao; Cho, Eunhye; Yokota, Hiroki; Na, Sungsoo
2013-01-01
Highlights: •Shear stress increased TCF/LEF activity and stimulated β-catenin nuclear localization. •Rac1, Cdc42, and RhoA displayed distinct dynamic activity patterns under flow. •Rac1 and Cdc42, but not RhoA, regulate shear stress-driven TCF/LEF activation. •Cytoskeleton did not significantly affect shear stress-induced TCF/LEF activation. -- Abstract: Beta-catenin-dependent TCF/LEF (T-cell factor/lymphocyte enhancing factor) is known to be mechanosensitive and an important regulator for promoting bone formation. However, the functional connection between TCF/LEF activity and Rho family GTPases is not well understood in osteoblasts. Herein we investigated the molecular mechanisms underlying oscillatory shear stress-induced TCF/LEF activity in MC3T3-E1 osteoblast cells using live cell imaging. We employed fluorescence resonance energy transfer (FRET)-based and green fluorescent protein (GFP)-based biosensors, which allowed us to monitor signal transduction in living cells in real time. Oscillatory (1 Hz) shear stress (10 dynes/cm 2 ) increased TCF/LEF activity and stimulated translocation of β-catenin to the nucleus with the distinct activity patterns of Rac1 and Cdc42. The shear stress-induced TCF/LEF activity was blocked by the inhibition of Rac1 and Cdc42 with their dominant negative mutants or selective drugs, but not by a dominant negative mutant of RhoA. In contrast, constitutively active Rac1 and Cdc42 mutants caused a significant enhancement of TCF/LEF activity. Moreover, activation of Rac1 and Cdc42 increased the basal level of TCF/LEF activity, while their inhibition decreased the basal level. Interestingly, disruption of cytoskeletal structures or inhibition of myosin activity did not significantly affect shear stress-induced TCF/LEF activity. Although Rac1 is reported to be involved in β-catenin in cancer cells, the involvement of Cdc42 in β-catenin signaling in osteoblasts has not been identified. Our findings in this study demonstrate
Rac1 and Cdc42 GTPases regulate shear stress-driven β-catenin signaling in osteoblasts
Energy Technology Data Exchange (ETDEWEB)
Wan, Qiaoqiao; Cho, Eunhye [Department of Biomedical Engineering, Indiana University-Purdue University Indianapolis, Indianapolis, IN 46202 (United States); Yokota, Hiroki [Department of Biomedical Engineering, Indiana University-Purdue University Indianapolis, Indianapolis, IN 46202 (United States); Department of Anatomy and Cell Biology, Indiana University School of Medicine, Indianapolis, IN 46202 (United States); Na, Sungsoo, E-mail: sungna@iupui.edu [Department of Biomedical Engineering, Indiana University-Purdue University Indianapolis, Indianapolis, IN 46202 (United States)
2013-04-19
Highlights: •Shear stress increased TCF/LEF activity and stimulated β-catenin nuclear localization. •Rac1, Cdc42, and RhoA displayed distinct dynamic activity patterns under flow. •Rac1 and Cdc42, but not RhoA, regulate shear stress-driven TCF/LEF activation. •Cytoskeleton did not significantly affect shear stress-induced TCF/LEF activation. -- Abstract: Beta-catenin-dependent TCF/LEF (T-cell factor/lymphocyte enhancing factor) is known to be mechanosensitive and an important regulator for promoting bone formation. However, the functional connection between TCF/LEF activity and Rho family GTPases is not well understood in osteoblasts. Herein we investigated the molecular mechanisms underlying oscillatory shear stress-induced TCF/LEF activity in MC3T3-E1 osteoblast cells using live cell imaging. We employed fluorescence resonance energy transfer (FRET)-based and green fluorescent protein (GFP)-based biosensors, which allowed us to monitor signal transduction in living cells in real time. Oscillatory (1 Hz) shear stress (10 dynes/cm{sup 2}) increased TCF/LEF activity and stimulated translocation of β-catenin to the nucleus with the distinct activity patterns of Rac1 and Cdc42. The shear stress-induced TCF/LEF activity was blocked by the inhibition of Rac1 and Cdc42 with their dominant negative mutants or selective drugs, but not by a dominant negative mutant of RhoA. In contrast, constitutively active Rac1 and Cdc42 mutants caused a significant enhancement of TCF/LEF activity. Moreover, activation of Rac1 and Cdc42 increased the basal level of TCF/LEF activity, while their inhibition decreased the basal level. Interestingly, disruption of cytoskeletal structures or inhibition of myosin activity did not significantly affect shear stress-induced TCF/LEF activity. Although Rac1 is reported to be involved in β-catenin in cancer cells, the involvement of Cdc42 in β-catenin signaling in osteoblasts has not been identified. Our findings in this study demonstrate
Acidic ribosomal proteins and histone H3 from Leishmania present a high rate of divergence
Directory of Open Access Journals (Sweden)
Ysabel Montoya
2000-08-01
Full Text Available Another additional peculiarity in Leishmania will be discussed about of the amino acid divergence rate of three structural proteins: acidic ribosomal P1 and P2b proteins, and histone H3 by using multiple sequence alignment and dendrograms. These structural proteins present a high rate of divergence regarding to their homologous protein in Trypanosoma cruzi. At this regard, L. (V. peruviana P1 and T. cruzi P1 showed 57.4% of divergence rate. Likewise, L. (V. braziliensis histone H3 and acidic ribosomal P2 protein exhibited 31.8% and 41.7% respectively of rate of divergence in comparison with their homologous in T. cruzi.
mRNA decapping enzyme from ribosomes of Saccharomyces cerevisiae
International Nuclear Information System (INIS)
Stevens, A.
1980-01-01
By use of [ 3 H]methyl-5'-capped [ 14 C]mRNA from yeast as a substrate, a decapping enzyme activity has been detected in enzyme fractions derived from a high salt wash of ribosomes of Saccharomyces cerevisiae. The product of the decapping reaction is [ 3 H]m 7 GDP. That the enzyme is not a non-specific pyrophosphatase is suggested by the finding that the diphosphate product, m 7 GpppA(G), and UDP-glucose are not hydrolyzed
Mardirossian, Mario; Grzela, Renata; Giglione, Carmela; Meinnel, Thierry; Gennaro, Renato; Mergaert, Peter; Scocchi, Marco
2014-12-18
Antimicrobial peptides (AMPs) are molecules from innate immunity with high potential as novel anti-infective agents. Most of them inactivate bacteria through pore formation or membrane barrier disruption, but others cross the membrane without damages and act inside the cells, affecting vital processes. However, little is known about their intracellular bacterial targets. Here we report that Bac71-35, a proline-rich AMP belonging to the cathelicidin family, can reach high concentrations (up to 340 μM) inside the E. coli cytoplasm. The peptide specifically and completely inhibits in vitro translation in the micromolar concentration range. Experiments of incorporation of radioactive precursors in macromolecules with E. coli cells confirmed that Bac71-35 affects specifically protein synthesis. Ribosome coprecipitation and crosslinking assays showed that the peptide interacts with ribosomes, binding to a limited subset of ribosomal proteins. Overall, these results indicate that the killing mechanism of Bac71-35 is based on a specific block of protein synthesis. Copyright © 2014 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Alhosna Benjdia
2017-11-01
Full Text Available Ribosomally-synthesized and post-translationally modified peptides (RiPPs are a large and diverse family of natural products. They possess interesting biological properties such as antibiotic or anticancer activities, making them attractive for therapeutic applications. In contrast to polyketides and non-ribosomal peptides, RiPPs derive from ribosomal peptides and are post-translationally modified by diverse enzyme families. Among them, the emerging superfamily of radical SAM enzymes has been shown to play a major role. These enzymes catalyze the formation of a wide range of post-translational modifications some of them having no counterparts in living systems or synthetic chemistry. The investigation of radical SAM enzymes has not only illuminated unprecedented strategies used by living systems to tailor peptides into complex natural products but has also allowed to uncover novel RiPP families. In this review, we summarize the current knowledge on radical SAM enzymes catalyzing RiPP post-translational modifications and discuss their mechanisms and growing importance notably in the context of the human microbiota.
DEFF Research Database (Denmark)
He, Yangzi
and ligates the neighbouring exons to generate mature mRNAs. Prp43 is an RNA helicase of the DEAH/RHA family. In yeast, once mRNAs are released, Prp43 catalyzes the disassembly of spliceosomes. The 18S, 5.8S and 25S rRNAs are transcribed as a single polycistronic transcript—the 35S pre......-rRNA. It is nucleolytically cleaved and chemically modified to generate mature rRNAs, which assemble with ribosomal proteins to form the ribosome. Prp43 is required for the processing of the 18S rRNA. Using X-ray crystallography, I determined a high resolution structure of Prp43 bound to ADP, the first structure of a DEAH....../RHA helicase. It defined the conserved structural features of all DEAH/RHA helicases, and unveiled a novel nucleotide binding site. Additionally a preliminary low resolution structure of a ternary complex comprising Prp43, a non-hydrolyzable ATP analogue, and a single-stranded RNA, was obtained. The ribosome...
International Nuclear Information System (INIS)
1987-05-01
The Canadian Irradiation Centre is a non-profit cooperative project between Atomic Energy of Canada Limited, Radiochemical Company and Universite du Quebec, Institut Armand-Frappier, Centre for Applied Research in Food Science. The Centre's objectives are to develop, demonstrate and promote Canada's radiation processing technology and its applications by conducting applied research; training technical, professional and scientific personnel; educating industry and government; demonstrating operational and scientific procedures; developing processing procedures and standards, and performing product and market acceptance trials. This pamphlet outlines the history of radoation technology and the services offered by the Canadian Irradiation Centre
Brighenti, Elisa; Giannone, Ferdinando Antonino; Fornari, Francesca; Onofrillo, Carmine; Govoni, Marzia; Montanaro, Lorenzo; Treré, Davide; Derenzini, Massimo
2016-09-27
Chronic inflammation is a risk factor for the onset of cancer and the regular use of aspirin reduces the risk of cancer development. Here we showed that therapeutic dosages of aspirin counteract the pro-tumorigenic effects of the inflammatory cytokine interleukin(IL)-6 in cancer and non-cancer cell lines, and in mouse liver in vivo. We found that therapeutic dosages of aspirin prevented IL-6 from inducing the down-regulation of p53 expression and the acquisition of the epithelial mesenchymal transition (EMT) phenotypic changes in the cell lines. This was the result of a reduction in c-Myc mRNA transcription which was responsible for a down-regulation of the ribosomal protein S6 expression which, in turn, slowed down the rRNA maturation process, thus reducing the ribosome biogenesis rate. The perturbation of ribosome biogenesis hindered the Mdm2-mediated proteasomal degradation of p53, throughout the ribosomal protein-Mdm2-p53 pathway. P53 stabilization hindered the IL-6 induction of the EMT changes. The same effects were observed in livers from mice stimulated with IL-6 and treated with aspirin. It is worth noting that aspirin down-regulated ribosome biogenesis, stabilized p53 and up-regulated E-cadherin expression in unstimulated control cells also. In conclusion, these data showed that therapeutic dosages of aspirin increase the p53-mediated tumor-suppressor activity of the cells thus being in this way able to reduce the risk of cancer onset, either or not linked to chronic inflammatory processes.
Brighenti, Elisa; Giannone, Ferdinando Antonino; Fornari, Francesca; Onofrillo, Carmine; Govoni, Marzia; Montanaro, Lorenzo; Treré, Davide; Derenzini, Massimo
2016-01-01
Chronic inflammation is a risk factor for the onset of cancer and the regular use of aspirin reduces the risk of cancer development. Here we showed that therapeutic dosages of aspirin counteract the pro-tumorigenic effects of the inflammatory cytokine interleukin(IL)-6 in cancer and non-cancer cell lines, and in mouse liver in vivo. We found that therapeutic dosages of aspirin prevented IL-6 from inducing the down-regulation of p53 expression and the acquisition of the epithelial mesenchymal transition (EMT) phenotypic changes in the cell lines. This was the result of a reduction in c-Myc mRNA transcription which was responsible for a down-regulation of the ribosomal protein S6 expression which, in turn, slowed down the rRNA maturation process, thus reducing the ribosome biogenesis rate. The perturbation of ribosome biogenesis hindered the Mdm2-mediated proteasomal degradation of p53, throughout the ribosomal protein-Mdm2-p53 pathway. P53 stabilization hindered the IL-6 induction of the EMT changes. The same effects were observed in livers from mice stimulated with IL-6 and treated with aspirin. It is worth noting that aspirin down-regulated ribosome biogenesis, stabilized p53 and up-regulated E-cadherin expression in unstimulated control cells also. In conclusion, these data showed that therapeutic dosages of aspirin increase the p53-mediated tumor-suppressor activity of the cells thus being in this way able to reduce the risk of cancer onset, either or not linked to chronic inflammatory processes. PMID:27557515
2007-01-01
A new "CMS Centre" is being established on the CERN Meyrin site by the CMS collaboration. It will be a focal point for communications, where physicists will work together on data quality monitoring, detector calibration, offline analysis of physics events, and CMS computing operations. Construction of the CMS Centre begins in the historic Proton Synchrotron (PS) control room. The historic Proton Synchrotron (PS) control room, Opened by Niels Bohr in 1960, will be reused by CMS to built its control centre. TThe LHC@FNAL Centre, in operation at Fermilab in the US, will work very closely with the CMS Centre, as well as the CERN Control Centre. (Photo Fermilab)The historic Proton Synchrotron (PS) control room is about to start a new life. Opened by Niels Bohr in 1960, the room will be reused by CMS to built its control centre. When finished, it will resemble the CERN Contro...
Effect of mutations in the A site of 16 S rRNA on aminoglycoside antibiotic-ribosome interaction
DEFF Research Database (Denmark)
Recht, M I; Douthwaite, S; Dahlquist, K D
1999-01-01
antibiotics, which also interact with this region of rRNA. Mutations of certain nucleotides in rRNA reduce aminoglycoside binding affinity, as previously demonstrated using a model RNA oligonucleotide system. Here, predictions from the oligonucleotide system were tested in the ribosome by mutation...... for the aminoglycoside paromomycin, whereas no discernible reduction in affinity was observed with 1406 mutant ribosomes. These data are consistent with prior NMR structural determination of aminoglycoside interaction with the decoding region, and further our understanding of how aminoglycoside resistance can...
DEFF Research Database (Denmark)
Bason, Christian
2017-01-01
Design approaches are now being applied all over the world as a powerful approach to innovating public policies and services. Christian Bason, author of Leading public design: Discovering human-centred governance, argues that by bringing design methods into play, public managers can lead change...... with citizens at the centre, and discover a new model for steering public organisations: human-centred governance....
Reed, Shawna C O; Serio, Alisa W; Welch, Matthew D
2012-04-01
Rickettsiae are obligate intracellular pathogens that are transmitted to humans by arthropod vectors and cause diseases such as spotted fever and typhus. Although rickettsiae require the host cell actin cytoskeleton for invasion, the cytoskeletal proteins that mediate this process have not been completely described. To identify the host factors important during cell invasion by Rickettsia parkeri, a member of the spotted fever group (SFG), we performed an RNAi screen targeting 105 proteins in Drosophila melanogaster S2R+ cells. The screen identified 21 core proteins important for invasion, including the GTPases Rac1 and Rac2, the WAVE nucleation-promoting factor complex and the Arp2/3 complex. In mammalian cells, including endothelial cells, the natural targets of R. parkeri, the Arp2/3 complex was also crucial for invasion, while requirements for WAVE2 as well as Rho GTPases depended on the particular cell type. We propose that R. parkeri invades S2R+ arthropod cells through a primary pathway leading to actin nucleation, whereas invasion of mammalian endothelial cells occurs via redundant pathways that converge on the host Arp2/3 complex. Our results reveal a key role for the WAVE and Arp2/3 complexes, as well as a higher degree of variation than previously appreciated in actin nucleation pathways activated during Rickettsia invasion. © 2011 Blackwell Publishing Ltd.
Directory of Open Access Journals (Sweden)
Rodriguez-Tebar Alfredo
2011-02-01
Full Text Available Abstract Background Amyloid beta (Aβ is the main agent responsible for the advent and progression of Alzheimer's disease. This peptide can at least partially antagonize nerve growth factor (NGF signalling in neurons, which may be responsible for some of the effects produced by Aβ. Accordingly, better understanding the NGF signalling pathway may provide clues as to how to protect neurons from the toxic effects of Aβ. Results We show here that Aβ activates the RhoA GTPase by binding to p75NTR, thereby preventing the NGF-induced activation of protein tyrosine phosphatase 1B (PTP1B that is required for neuron survival. We also show that the inactivation of RhoA GTPase and the activation of PTP1B protect cultured hippocampal neurons against the noxious effects of Aβ. Indeed, either pharmacological inhibition of RhoA with C3 ADP ribosyl transferase or the transfection of cultured neurons with a dominant negative form of RhoA protects cultured hippocampal neurons from the effects of Aβ. In addition, over-expression of PTP1B also prevents the deleterious effects of Aβ on cultured hippocampal neurons. Conclusion Our findings indicate that potentiating the activity of NGF at the level of RhoA inactivation and PTP1B activation may represent a new means to combat the noxious effects of Aβ in Alzheimer's disease.
Spontaneous reverse movement of mRNA-bound tRNA through the ribosome.
Konevega, Andrey L; Fischer, Niels; Semenkov, Yuri P; Stark, Holger; Wintermeyer, Wolfgang; Rodnina, Marina V
2007-04-01
During the translocation step of protein synthesis, a complex of two transfer RNAs bound to messenger RNA (tRNA-mRNA) moves through the ribosome. The reaction is promoted by an elongation factor, called EF-G in bacteria, which, powered by GTP hydrolysis, induces an open, unlocked conformation of the ribosome that allows for spontaneous tRNA-mRNA movement. Here we show that, in the absence of EF-G, there is spontaneous backward movement, or retrotranslocation, of two tRNAs bound to mRNA. Retrotranslocation is driven by the gain in affinity when a cognate E-site tRNA moves into the P site, which compensates the affinity loss accompanying the movement of peptidyl-tRNA from the P to the A site. These results lend support to the diffusion model of tRNA movement during translocation. In the cell, tRNA movement is biased in the forward direction by EF-G, which acts as a Brownian ratchet and prevents backward movement.
Jaag, Hannah Miriam; Kawchuk, Lawrence; Rohde, Wolfgang; Fischer, Rainer; Emans, Neil; Prüfer, Dirk
2003-01-01
Potato leafroll polerovirus (PLRV) genomic RNA acts as a polycistronic mRNA for the production of proteins P0, P1, and P2 translated from the 5′-proximal half of the genome. Within the P1 coding region we identified a 5-kDa replication-associated protein 1 (Rap1) essential for viral multiplication. An internal ribosome entry site (IRES) with unusual structure and location was identified that regulates Rap1 translation. Core structural elements for internal ribosome entry include a conserved AUG codon and a downstream GGAGAGAGAGG motif with inverted symmetry. Reporter gene expression in potato protoplasts confirmed the internal ribosome entry function. Unlike known IRES motifs, the PLRV IRES is located completely within the coding region of Rap1 at the center of the PLRV genome. PMID:12835413
DEFF Research Database (Denmark)
Issinger, O G; Beier, H
1978-01-01
Electrophoresis of ribosomal proteins according to Kaltschmidt and Wittmann, 1970a, b (pH 8.6/pH 4.5 urea system) yielded 29 proteins for the small subunits and 35 and 37 proteins for the large subunits of Krebs II ascites and HeLa ribosomes, respectively. Analysis of the proteins according...... to a modified technique by Mets and Bogorad (1974) (pH 4.5/pH 8.6 SDS system) revealed 28 and 29 proteins in the small subunits and 37 and 38 proteins in the large subunits of Krebs II ascites and HeLa ribosomes. The molecular weights of the individual proteins were determined by: 1. "three-dimensional" gel...... using the pH 4.5/pH 8.6 SDS system. The molecular weights Krebs II ascites and HeLa ribosomal proteins are compared with those obtained by other authors for different mammalian species....