cDNA, genomic sequence cloning and analysis of the ribosomal ...
African Journals Online (AJOL)
Ribosomal protein L37A (RPL37A) is a component of 60S large ribosomal subunit encoded by the RPL37A gene, which belongs to the family of ribosomal L37AE proteins, located in the cytoplasm. The complementary deoxyribonucleic acid (cDNA) and the genomic sequence of RPL37A were cloned successfully from giant ...
(Brassicaceae) based on nuclear ribosomal ITS DNA sequences
Indian Academy of Sciences (India)
Home; Journals; Journal of Genetics; Volume 93; Issue 2. Phylogeny and biogeography of Alyssum (Brassicaceae) based on nuclear ribosomal ITS DNA sequences. Yan Li Yan Kong Zhe Zhang Yanqiang Yin Bin Liu Guanghui Lv Xiyong Wang. Research Article Volume 93 Issue 2 August 2014 pp 313-323 ...
cDNA, genomic sequence cloning and overexpression of ribosomal ...
African Journals Online (AJOL)
RPS16 of eukaryote is a component of the 40S small ribosomal subunit encoded by RPS16 gene and is also a homolog of prokaryotic RPS9. The cDNA and genomic sequence of RPS16 was cloned successfully for the first time from the Giant Panda (Ailuropoda melanoleuca) using reverse transcription-polymerase chain ...
Sequence of a cloned cDNA encoding human ribosomal protein S11
Energy Technology Data Exchange (ETDEWEB)
Lott, J B; Mackie, G A
1988-02-11
The authors have isolated a cloned cDNA that encodes human ribosomal protein (rp) S11 by screening a human fibroblast cDNA library with a labelled 204 bp DNA fragment encompassing residues 212-416 of pRS11, a rat rp Sll cDNA clone. The human rp S11 cloned cDNA consists of 15 residues of the 5' leader, the entire coding sequence and all 51 residues of the 3' untranslated region. The predicted amino acid sequence of 158 residues is identical to rat rpS11. The nucleotide sequence in the coding region differs, however, from that in rat in the first position in two codons and in the third position in 44 codons.
Ribosomal PCR and DNA sequencing for detection and identification of bacteria
DEFF Research Database (Denmark)
Jensen, Kristine Helander; Dargis, Rimtas; Christensen, Jens Jørgen
2014-01-01
-haemolytic streptococci, especially within the mitis group. The data show that ribosomal PCR with subsequent DNA sequencing of the PCR product is a most valuable supplement to culture for identifying bacterial agents of both acute and prolonged infections. However, some bacteria, including non-haemolytic streptococci...
Identification of tissue-embedded ascarid larvae by ribosomal DNA sequencing.
Ishiwata, Kenji; Shinohara, Akio; Yagi, Kinpei; Horii, Yoichiro; Tsuchiya, Kimiyuki; Nawa, Yukifumi
2004-01-01
Polymerase chain reaction (PCR) was applied to identify tissue-embedded ascarid nematode larvae. Two sequences of the internal transcribed spacer (ITS) regions of ribosomal DNA (rDNA), ITS1 and ITS2, of the ascarid parasites were amplified and compared with those of ascarid-nematodes registered in a DNA database (GenBank). The ITS sequences of the PCR products obtained from the ascarid parasite specimen in our laboratory were compatible with those of registered adult Ascaris and Toxocara parasites. PCR amplification of the ITS regions was sensitive enough to detect a single larva of Ascaris suum mixed with porcine liver tissue. Using this method, ascarid larvae embedded in the liver of a naturally infected turkey were identified as Toxocara canis. These results suggest that even a single larva embedded in tissues from patients with larva migrans could be identified by sequencing the ITS regions.
Directory of Open Access Journals (Sweden)
Rawnak Laila
2017-01-01
Full Text Available Clubroot is a soil-borne disease caused by the protist Plasmodiophora brassicae (P. brassicae. It is one of the most economically important diseases of Brassica rapa and other cruciferous crops as it can cause remarkable yield reductions. Understanding P. brassicae genetics, and developing efficient molecular markers, is essential for effective detection of harmful races of this pathogen. Samples from 11 Korean field populations of P. brassicae (geographic isolates, collected from nine different locations in South Korea, were used in this study. Genomic DNA was extracted from the clubroot-infected samples to sequence the ribosomal DNA. Primers and probes for P. brassicae were designed using a ribosomal DNA gene sequence from a Japanese strain available in GenBank (accession number AB526843; isolate NGY. The nuclear ribosomal DNA (rDNA sequence of P. brassicae, comprising 6932 base pairs (bp, was cloned and sequenced and found to include the small subunits (SSUs and a large subunit (LSU, internal transcribed spacers (ITS1 and ITS2, and a 5.8s. Sequence variation was observed in both the SSU and LSU. Four markers showed useful differences in high-resolution melting analysis to identify nucleotide polymorphisms including single- nucleotide polymorphisms (SNPs, oligonucleotide polymorphisms, and insertions/deletions (InDels. A combination of three markers was able to distinguish the geographical isolates into two groups.
Xu, Jiajie; Jiang, Bo; Chai, Sanming; He, Yuan; Zhu, Jianyi; Shen, Zonggen; Shen, Songdong
2016-09-01
Filamentous Bangia, which are distributed extensively throughout the world, have simple and similar morphological characteristics. Scientists can classify these organisms using molecular markers in combination with morphology. We successfully sequenced the complete nuclear ribosomal DNA, approximately 13 kb in length, from a marine Bangia population. We further analyzed the small subunit ribosomal DNA gene (nrSSU) and the internal transcribed spacer (ITS) sequence regions along with nine other marine, and two freshwater Bangia samples from China. Pairwise distances of the nrSSU and 5.8S ribosomal DNA gene sequences show the marine samples grouping together with low divergences (00.003; 0-0.006, respectively) from each other, but high divergences (0.123-0.126; 0.198, respectively) from freshwater samples. An exception is the marine sample collected from Weihai, which shows high divergence from both other marine samples (0.063-0.065; 0.129, respectively) and the freshwater samples (0.097; 0.120, respectively). A maximum likelihood phylogenetic tree based on a combined SSU-ITS dataset with maximum likelihood method shows the samples divided into three clades, with the two marine sample clades containing Bangia spp. from North America, Europe, Asia, and Australia; and one freshwater clade, containing Bangia atropurpurea from North America and China.
DNA replication stress restricts ribosomal DNA copy number.
Salim, Devika; Bradford, William D; Freeland, Amy; Cady, Gillian; Wang, Jianmin; Pruitt, Steven C; Gerton, Jennifer L
2017-09-01
Ribosomal RNAs (rRNAs) in budding yeast are encoded by ~100-200 repeats of a 9.1kb sequence arranged in tandem on chromosome XII, the ribosomal DNA (rDNA) locus. Copy number of rDNA repeat units in eukaryotic cells is maintained far in excess of the requirement for ribosome biogenesis. Despite the importance of the repeats for both ribosomal and non-ribosomal functions, it is currently not known how "normal" copy number is determined or maintained. To identify essential genes involved in the maintenance of rDNA copy number, we developed a droplet digital PCR based assay to measure rDNA copy number in yeast and used it to screen a yeast conditional temperature-sensitive mutant collection of essential genes. Our screen revealed that low rDNA copy number is associated with compromised DNA replication. Further, subculturing yeast under two separate conditions of DNA replication stress selected for a contraction of the rDNA array independent of the replication fork blocking protein, Fob1. Interestingly, cells with a contracted array grew better than their counterparts with normal copy number under conditions of DNA replication stress. Our data indicate that DNA replication stresses select for a smaller rDNA array. We speculate that this liberates scarce replication factors for use by the rest of the genome, which in turn helps cells complete DNA replication and continue to propagate. Interestingly, tumors from mini chromosome maintenance 2 (MCM2)-deficient mice also show a loss of rDNA repeats. Our data suggest that a reduction in rDNA copy number may indicate a history of DNA replication stress, and that rDNA array size could serve as a diagnostic marker for replication stress. Taken together, these data begin to suggest the selective pressures that combine to yield a "normal" rDNA copy number.
DNA replication stress restricts ribosomal DNA copy number
Salim, Devika; Bradford, William D.; Freeland, Amy; Cady, Gillian; Wang, Jianmin
2017-01-01
Ribosomal RNAs (rRNAs) in budding yeast are encoded by ~100–200 repeats of a 9.1kb sequence arranged in tandem on chromosome XII, the ribosomal DNA (rDNA) locus. Copy number of rDNA repeat units in eukaryotic cells is maintained far in excess of the requirement for ribosome biogenesis. Despite the importance of the repeats for both ribosomal and non-ribosomal functions, it is currently not known how “normal” copy number is determined or maintained. To identify essential genes involved in the maintenance of rDNA copy number, we developed a droplet digital PCR based assay to measure rDNA copy number in yeast and used it to screen a yeast conditional temperature-sensitive mutant collection of essential genes. Our screen revealed that low rDNA copy number is associated with compromised DNA replication. Further, subculturing yeast under two separate conditions of DNA replication stress selected for a contraction of the rDNA array independent of the replication fork blocking protein, Fob1. Interestingly, cells with a contracted array grew better than their counterparts with normal copy number under conditions of DNA replication stress. Our data indicate that DNA replication stresses select for a smaller rDNA array. We speculate that this liberates scarce replication factors for use by the rest of the genome, which in turn helps cells complete DNA replication and continue to propagate. Interestingly, tumors from mini chromosome maintenance 2 (MCM2)-deficient mice also show a loss of rDNA repeats. Our data suggest that a reduction in rDNA copy number may indicate a history of DNA replication stress, and that rDNA array size could serve as a diagnostic marker for replication stress. Taken together, these data begin to suggest the selective pressures that combine to yield a “normal” rDNA copy number. PMID:28915237
DNA replication stress restricts ribosomal DNA copy number.
Directory of Open Access Journals (Sweden)
Devika Salim
2017-09-01
Full Text Available Ribosomal RNAs (rRNAs in budding yeast are encoded by ~100-200 repeats of a 9.1kb sequence arranged in tandem on chromosome XII, the ribosomal DNA (rDNA locus. Copy number of rDNA repeat units in eukaryotic cells is maintained far in excess of the requirement for ribosome biogenesis. Despite the importance of the repeats for both ribosomal and non-ribosomal functions, it is currently not known how "normal" copy number is determined or maintained. To identify essential genes involved in the maintenance of rDNA copy number, we developed a droplet digital PCR based assay to measure rDNA copy number in yeast and used it to screen a yeast conditional temperature-sensitive mutant collection of essential genes. Our screen revealed that low rDNA copy number is associated with compromised DNA replication. Further, subculturing yeast under two separate conditions of DNA replication stress selected for a contraction of the rDNA array independent of the replication fork blocking protein, Fob1. Interestingly, cells with a contracted array grew better than their counterparts with normal copy number under conditions of DNA replication stress. Our data indicate that DNA replication stresses select for a smaller rDNA array. We speculate that this liberates scarce replication factors for use by the rest of the genome, which in turn helps cells complete DNA replication and continue to propagate. Interestingly, tumors from mini chromosome maintenance 2 (MCM2-deficient mice also show a loss of rDNA repeats. Our data suggest that a reduction in rDNA copy number may indicate a history of DNA replication stress, and that rDNA array size could serve as a diagnostic marker for replication stress. Taken together, these data begin to suggest the selective pressures that combine to yield a "normal" rDNA copy number.
DEFF Research Database (Denmark)
Kemp, Michael; Bangsborg, Jette; Kjerulf, Anne
2013-01-01
of direct molecular identification should also address weaknesses, their relevance in the given setting, and possible improvements. In this study cardiac valves from 56 Danish patients referred for surgery for infective endocarditis were analysed by microscopy and culture as well as by PCR targeting part...... of the bacterial 16S rRNA gene followed by DNA sequencing of the PCR product. PCR and DNA sequencing identified significant bacteria in 49 samples from 43 patients, including five out of 13 culture-negative cases. No rare, exotic, or intracellular bacteria were identified. There was a general agreement between...... bacterial identity obtained by ribosomal PCR and DNA sequencing from the valves and bacterial isolates from blood culture. However, DNA sequencing of the 16S rRNA gene did not discriminate well among non-haemolytic streptococci, especially within the Streptococcus mitis group. Ribosomal PCR with subsequent...
Differences in a ribosomal DNA sequence of Strongylus species allows identification of single eggs.
Campbell, A J; Gasser, R B; Chilton, N B
1995-03-01
In the current study, molecular techniques were evaluated for the species identification of individual strongyle eggs. Adult worms of Strongylus edentatus, S. equinus and S. vulgaris were collected at necropsy from horses from Australia and the U.S.A. Genomic DNA was isolated and a ribosomal transcribed spacer (ITS-2) amplified and sequenced using polymerase chain reaction (PCR) techniques. The length of the ITS-2 sequence of S. edentatus, S. equinus and S. vulgaris ranged between 217 and 235 nucleotides. Extensive sequence analysis demonstrated a low degree (0-0.9%) of intraspecific variation in the ITS-2 for the Strongylus species examined, whereas the levels of interspecific differences (13-29%) were significantly greater. Interspecific differences in the ITS-2 sequences allowed unequivocal species identification of single worms and eggs using PCR-linked restriction fragment length polymorphism. These results demonstrate the potential of the ribosomal spacers as genetic markers for species identification of single strongyle eggs from horse faeces.
West, Claire; James, Stephen A; Davey, Robert P; Dicks, Jo; Roberts, Ian N
2014-07-01
The ribosomal RNA encapsulates a wealth of evolutionary information, including genetic variation that can be used to discriminate between organisms at a wide range of taxonomic levels. For example, the prokaryotic 16S rDNA sequence is very widely used both in phylogenetic studies and as a marker in metagenomic surveys and the internal transcribed spacer region, frequently used in plant phylogenetics, is now recognized as a fungal DNA barcode. However, this widespread use does not escape criticism, principally due to issues such as difficulties in classification of paralogous versus orthologous rDNA units and intragenomic variation, both of which may be significant barriers to accurate phylogenetic inference. We recently analyzed data sets from the Saccharomyces Genome Resequencing Project, characterizing rDNA sequence variation within multiple strains of the baker's yeast Saccharomyces cerevisiae and its nearest wild relative Saccharomyces paradoxus in unprecedented detail. Notably, both species possess single locus rDNA systems. Here, we use these new variation datasets to assess whether a more detailed characterization of the rDNA locus can alleviate the second of these phylogenetic issues, sequence heterogeneity, while controlling for the first. We demonstrate that a strong phylogenetic signal exists within both datasets and illustrate how they can be used, with existing methodology, to estimate intraspecies phylogenies of yeast strains consistent with those derived from whole-genome approaches. We also describe the use of partial Single Nucleotide Polymorphisms, a type of sequence variation found only in repetitive genomic regions, in identifying key evolutionary features such as genome hybridization events and show their consistency with whole-genome Structure analyses. We conclude that our approach can transform rDNA sequence heterogeneity from a problem to a useful source of evolutionary information, enabling the estimation of highly accurate phylogenies of
DEFF Research Database (Denmark)
Kruse, Alexandra Yasmin Collin; Kvich, Lasse Andersson; Eickhardt-Dalbøge, Steffen Robert
2015-01-01
The protozoan parasite Toxoplasma gondii causes severe opportunistic infections. Here, we report an unexpected diagnosis of cerebral toxoplasmosis. T. gondii was diagnosed by 16S and D2 large-subunit (LSU) ribosomal DNA (rDNA) sequencing of a cerebral biopsy specimen and confirmed by T. gondii...
Oliveros, R; Cutillas, C; De Rojas, M; Arias, P
2000-12-01
Adult worms of Trichuris ovis and T. globulosa were collected from Ovis aries (sheep) and Capra hircus (goats). T. suis was isolated from Sus scrofa domestica (swine) and T. leporis was isolated from Lepus europaeus (rabbits) in Spain. Genomic DNA was isolated and a ribosomal internal transcribed spacer (ITS2) was amplified and sequenced using polymerase-chain-reaction (PCR) techniques. The ITS2 of T. ovis and T. globulosa was 407 nucleotides in length and had a GC content of about 62%. Furthermore, the ITS2 of T. suis and T. leporis was 534 and 418 nucleotides in length and had a GC content of about 64.8% and 62.4%, respectively. There was evidence of slight variation in the sequence within individuals of all species analyzed, indicating intraindividual variation in the sequence of different copies of the ribosomal DNA. Furthermore, low-level intraspecific variation was detected. Sequence analyses of ITS2 products of T. ovis and T. globulosa demonstrated no sequence difference between them. Nevertheless, differences were detected between the ITS2 sequences of T. suis, T. leporis, and T. ovis, indicating that Trichuris species can reliably be differentiated by their ITS2 sequences and PCR-linked restriction-fragment-length polymorphism (RFLP).
DEFF Research Database (Denmark)
Jorgensen, T.H.; Frydenberg, J.
1999-01-01
The ITS regions of nuclear ribosomal DNA were sequenced in 37 species of the genus Aeonium. A phylogeny obtained through the use of parsimony agrees to some extent with the sectional division of the genus and confirms the position of two newly described species. It also suggests the potential imp...
Genotyping of Giardia lamblia isolates from humans in China and Korea using ribosomal DNA Sequences.
Yong, T S; Park, S J; Hwang, U W; Yang, H W; Lee, K W; Min, D Y; Rim, H J; Wang, Y; Zheng, F
2000-08-01
Genetic characterization of a total of 15 Giardia lamblia isolates, 8 from Anhui Province, China (all from purified cysts) and 7 from Seoul, Korea (2 from axenic cultures and 5 from purified cysts), was performed by polymerase chain reaction amplification and sequencing of a 295-bp region near the 5' end of the small subunit ribosomal DNA (eukaryotic 16S rDNA). Phylogenetic analyses were subsequently conducted using sequence data obtained in this study, as well as sequences published from other Giardia isolates. The maximum parsimony method revealed that G. lamblia isolates from humans in China and Korea are divided into 2 major lineages, assemblages A and B. All 7 Korean isolates were grouped into assemblage A, whereas 4 Chinese isolates were grouped into assemblage A and 4 into assemblage B. Two Giardia microti isolates and 2 dog-derived Giardia isolates also grouped into assemblage B, whereas Giardia ardeae and Giardia muris were unique.
Directory of Open Access Journals (Sweden)
Rhoads Daniel D
2012-11-01
Full Text Available Abstract Background Chronic wounds affect millions of people and cost billions of dollars in the United States each year. These wounds harbor polymicrobial biofilm communities, which can be difficult to elucidate using culturing methods. Clinical molecular microbiological methods are increasingly being employed to investigate the microbiota of chronic infections, including wounds, as part of standard patient care. However, molecular testing is more sensitive than culturing, which results in markedly different results being reported to clinicians. This study compares the results of aerobic culturing and molecular testing (culture-free 16S ribosomal DNA sequencing, and it examines the relative abundance score that is generated by the molecular test and the usefulness of the relative abundance score in predicting the likelihood that the same organism would be detected by culture. Methods Parallel samples from 51 chronic wounds were studied using aerobic culturing and 16S DNA sequencing for the identification of bacteria. Results One hundred forty-five (145 unique genera were identified using molecular methods, and 68 of these genera were aerotolerant. Fourteen (14 unique genera were identified using aerobic culture methods. One-third (31/92 of the cultures were determined to be Staphylococcus aureus, Pseudomonas aeruginosa, and Enterococcus faecalis with higher relative abundance scores were more likely to be detected by culture as demonstrated with regression modeling. Conclusion Discordance between molecular and culture testing is often observed. However, culture-free 16S ribosomal DNA sequencing and its relative abundance score can provide clinicians with insight into which bacteria are most abundant in a sample and which are most likely to be detected by culture.
Stepanchick, Ann; Zhi, Huijun; Cavanaugh, Alice H.; Rothblum, Katrina; Schneider, David A.; Rothblum, Lawrence I.
2013-01-01
The human homologue of yeast Rrn3 is an RNA polymerase I-associated transcription factor that is essential for ribosomal DNA (rDNA) transcription. The generally accepted model is that Rrn3 functions as a bridge between RNA polymerase I and the transcription factors bound to the committed template. In this model Rrn3 would mediate an interaction between the mammalian Rrn3-polymerase I complex and SL1, the rDNA transcription factor that binds to the core promoter element of the rDNA. In the course of studying the role of Rrn3 in recruitment, we found that Rrn3 was in fact a DNA-binding protein. Analysis of the sequence of Rrn3 identified a domain with sequence similarity to the DNA binding domain of heat shock transcription factor 2. Randomization, or deletion, of the amino acids in this region in Rrn3, amino acids 382–400, abrogated its ability to bind DNA, indicating that this domain was an important contributor to DNA binding by Rrn3. Control experiments demonstrated that these mutant Rrn3 constructs were capable of interacting with both rpa43 and SL1, two other activities demonstrated to be essential for Rrn3 function. However, neither of these Rrn3 mutants was capable of functioning in transcription in vitro. Moreover, although wild-type human Rrn3 complemented a yeast rrn3-ts mutant, the DNA-binding site mutant did not. These results demonstrate that DNA binding by Rrn3 is essential for transcription by RNA polymerase I. PMID:23393135
Stepanchick, Ann; Zhi, Huijun; Cavanaugh, Alice H; Rothblum, Katrina; Schneider, David A; Rothblum, Lawrence I
2013-03-29
The human homologue of yeast Rrn3 is an RNA polymerase I-associated transcription factor that is essential for ribosomal DNA (rDNA) transcription. The generally accepted model is that Rrn3 functions as a bridge between RNA polymerase I and the transcription factors bound to the committed template. In this model Rrn3 would mediate an interaction between the mammalian Rrn3-polymerase I complex and SL1, the rDNA transcription factor that binds to the core promoter element of the rDNA. In the course of studying the role of Rrn3 in recruitment, we found that Rrn3 was in fact a DNA-binding protein. Analysis of the sequence of Rrn3 identified a domain with sequence similarity to the DNA binding domain of heat shock transcription factor 2. Randomization, or deletion, of the amino acids in this region in Rrn3, amino acids 382-400, abrogated its ability to bind DNA, indicating that this domain was an important contributor to DNA binding by Rrn3. Control experiments demonstrated that these mutant Rrn3 constructs were capable of interacting with both rpa43 and SL1, two other activities demonstrated to be essential for Rrn3 function. However, neither of these Rrn3 mutants was capable of functioning in transcription in vitro. Moreover, although wild-type human Rrn3 complemented a yeast rrn3-ts mutant, the DNA-binding site mutant did not. These results demonstrate that DNA binding by Rrn3 is essential for transcription by RNA polymerase I.
Organization of Replication of Ribosomal DNA in Saccharomyces cerevisiae
Linskens, Maarten H.K.; Huberman, Joel A.
1988-01-01
Using recently developed replicon mapping techniques, we have analyzed the replication of the ribosomal DNA in Saccharomyces cerevisiae. The results show that (i) the functional origin of replication colocalizes with an autonomously replicating sequence element previously mapped to the
Sequence analysis and over-expression of ribosomal protein S28 ...
African Journals Online (AJOL)
RPS28 is a component of the 40S small ribosomal subunit encoded by RPS28 gene, which is specific to eukaryotes. The cDNA and the genomic sequence of RPS28 were cloned successfully from the Giant Panda using RT-PCR technology and Touchdown-PCR, respectively. Both sequences were analyzed preliminarily ...
Zhang, Lu; Cai, You-Ming; Zhuge, Qiang; Zou, Hui-Yu; Huang, Min-Ren
2002-06-01
Xinjiang is a center of distribution and differentiation of genus Dianthus in China, and has a great deal of species resources. The sequences of ITS region (including ITS-1, 5.8S rDNA and ITS-2) of nuclear ribosomal DNA from 8 species of genus Dianthus wildly distributed in Xinjiang were determined by direct sequencing of PCR products. The result showed that the size of the ITS of Dianthus is from 617 to 621 bp, and the length variation is only 4 bp. There are very high homogeneous (97.6%-99.8%) sequences between species, and about 80% homogeneous sequences between genus Dianthus and outgroup. The sequences of ITS in genus Dianthus are relatively conservative. In general, there are more conversion than transition in the variation sites among genus Dianthus. The conversion rates are relatively high, and the ratios of conversion/transition are 1.0-3.0. On the basis of phylogenetic analysis of nucleotide sequences the species of Dianthus in China would be divided into three sections. There is a distant relationship between sect. Barbulatum Williams and sect. Dianthus and between sect. Barbulatum Williams and sect. Fimbriatum Williams, and there is a close relationship between sect. Dianthus and sect. Fimbriatum Williams. From the phylogenetic tree of ITS it was found that the origin of sect. Dianthusis is earlier than that of sect. Fimbriatum Williams and sect. Barbulatum Williams.
Amor, Nabil; Farjallah, Sarra; Salem, Mohamed; Lamine, Dia Mamadou; Merella, Paolo; Said, Khaled; Ben Slimane, Badreddine
2011-10-01
Fasciolosis caused by Fasciola hepatica and Fasciola gigantica (Platyhelminthes: Trematoda: Digenea) is considered the most important helminth infection of ruminants in tropical countries, causing considerable socioeconomic problems. From Africa, F. gigantica has been previously characterized from Burkina Faso, Senegal, Kenya, Zambia and Mali, while F. hepatica has been reported from Morocco and Tunisia, and both species have been observed from Ethiopia and Egypt on the basis of morphometric differences, while the use of molecular markers is necessary to distinguish exactly between species. Samples identified morphologically as F. gigantica (n=60) from sheep and cattle from different geographical localities of Mauritania were genetically characterized by sequences of the first (ITS-1), the 5.8S, and second (ITS-2) Internal Transcribed Spacers (ITS) of nuclear ribosomal DNA (rDNA) genes and the mitochondrial Cytochrome c Oxidase I (COI) gene. Comparison of the sequences of the Mauritanian samples with sequences of Fasciola spp. from GenBank confirmed that all samples belong to the species F. gigantica. The nucleotide sequencing of ITS rDNA of F. gigantica showed no nucleotide variation in the ITS-1, 5.8S, and ITS-2 rDNA sequences among all samples examined and those from Burkina Faso, Kenya, Egypt and Iran. The phylogenetic trees based on the ITS-1 and ITS-2 sequences showed a close relationship of the Mauritanian samples with isolates of F. gigantica from different localities of Africa and Asia. The COI genotypes of the Mauritanian specimens of F. gigantica had a high level of diversity, and they belonged to the F. gigantica phylogenically distinguishable clade. The present study is the first molecular characterization of F. gigantica in sheep and cattle from Mauritania, allowing a reliable approach for the genetic differentiation of Fasciola spp. and providing basis for further studies on liver flukes in the African countries. Copyright © 2011 Elsevier Inc. All
Non-canonical ribosomal DNA segments in the human genome, and nucleoli functioning.
Kupriyanova, Natalia S; Netchvolodov, Kirill K; Sadova, Anastasia A; Cherepanova, Marina D; Ryskov, Alexei P
2015-11-10
Ribosomal DNA (rDNA) in the human genome is represented by tandem repeats of 43 kb nucleotide sequences that form nucleoli organizers (NORs) on each of five pairs of acrocentric chromosomes. RDNA-similar segments of different lengths are also present on (NOR)(-) chromosomes. Many of these segments contain nucleotide substitutions, supplementary microsatellite clusters, and extended deletions. Recently, it was shown that, in addition to ribosome biogenesis, nucleoli exhibit additional functions, such as cell-cycle regulation and response to stresses. In particular, several stress-inducible loci located in the ribosomal intergenic spacer (rIGS) produce stimuli-specific noncoding nucleolus RNAs. By mapping the 5'/3' ends of the rIGS segments scattered throughout (NOR)(-) chromosomes, we discovered that the bonds in the rIGS that were most often susceptible to disruption in the rIGS were adjacent to, or overlapped with stimuli-specific inducible loci. This suggests the interconnection of the two phenomena - nucleoli functioning and the scattering of rDNA-like sequences on (NOR)(-) chromosomes. Copyright © 2015 Elsevier B.V. All rights reserved.
Admir J. Giachini; Kentaro Hosaka; Eduardo Nouhra; Joseph Spatafora; James M. Trappe
2010-01-01
Phylogenetic relationships among Geastrales, Gomphales, Hysterangiales, and Phallales were estimated via combined sequences: nuclear large subunit ribosomal DNA (nuc-25S-rDNA), mitochondrial small subunit ribosomal DNA (mit-12S-rDNA), and mitochondrial atp6 DNA (mit-atp6-DNA). Eighty-one taxa comprising 19 genera and 58 species...
Fukunaga, Kenji; Ichitani, Katsuyuki; Taura, Satoru; Sato, Muneharu; Kawase, Makoto
2005-02-01
We determined the sequence of ribosomal DNA (rDNA) intergenic spacer (IGS) of foxtail millet isolated in our previous study, and identified subrepeats in the polymorphic region. We also developed a PCR-based method for identifying rDNA types based on sequence information and assessed 153 accessions of foxtail millet. Results were congruent with our previous works. This study provides new findings regarding the geographical distribution of rDNA variants. This new method facilitates analyses of numerous foxtail millet accessions. It is helpful for typing of foxtail millet germplasms and elucidating the evolution of this millet.
Al-Qurainy, F; Khan, S; Nadeem, M; Tarroum, M; Alaklabi, A
2013-03-11
The rare and endangered plants of any country are important genetic resources that often require urgent conservation measures. Assessment of phylogenetic relationships and evaluation of genetic diversity is very important prior to implementation of conservation strategies for saving rare and endangered plant species. We used internal transcribed spacer sequences of nuclear ribosomal DNA for the evaluation of sequence identity from the available taxa in the GenBank database by using the Basic Local Alignment Search Tool (BLAST). Two rare plant species viz, Heliotropium strigosum claded with H. pilosum (98% branch support) and Pancratium tortuosum claded with P. tenuifolium (61% branch support) clearly. However, some species, viz Scadoxus multiflorus, Commiphora myrrha and Senecio hadiensis showed close relationships with more than one species. We conclude that nuclear ribosomal internal transcribed spacer sequences are useful markers for phylogenetic study of these rare plant species in Saudi Arabia.
Zhu, X Q; Gasser, R B
1998-06-01
In this study, we assessed single-strand conformation polymorphism (SSCP)-based approaches for their capacity to fingerprint sequence variation in ribosomal DNA (rDNA) of ascaridoid nematodes of veterinary and/or human health significance. The second internal transcribed spacer region (ITS-2) of rDNA was utilised as the target region because it is known to provide species-specific markers for this group of parasites. ITS-2 was amplified by PCR from genomic DNA derived from individual parasites and subjected to analysis. Direct SSCP analysis of amplicons from seven taxa (Toxocara vitulorum, Toxocara cati, Toxocara canis, Toxascaris leonina, Baylisascaris procyonis, Ascaris suum and Parascaris equorum) showed that the single-strand (ss) ITS-2 patterns produced allowed their unequivocal identification to species. While no variation in SSCP patterns was detected in the ITS-2 within four species for which multiple samples were available, the method allowed the direct display of four distinct sequence types of ITS-2 among individual worms of T. cati. Comparison of SSCP/sequencing with the methods of dideoxy fingerprinting (ddF) and restriction endonuclease fingerprinting (REF) revealed that also ddF allowed the definition of the four sequence types, whereas REF displayed three of four. The findings indicate the usefulness of the SSCP-based approaches for the identification of ascaridoid nematodes to species, the direct display of sequence variation in rDNA and the detection of population variation. The ability to fingerprint microheterogeneity in ITS-2 rDNA using such approaches also has implications for studying fundamental aspects relating to mutational change in rDNA.
Li, Ming-Wei; Zhu, Xing-Quan; Gasser, Robin B; Lin, Rui-Qing; Sani, Rehana A; Lun, Zhao-Rong; Jacobs, Dennis E
2006-10-01
Non-isotopic polymerase chain reaction (PCR)-based single-strand conformation polymorphism and sequence analyses of the second internal transcribed spacer (ITS-2) of nuclear ribosomal DNA (rDNA) were utilized to genetically characterise ascaridoids from dogs and cats from China by comparison with those from other countries. The study showed that Toxocara canis, Toxocara cati, and Toxascaris leonina from China were genetically the same as those from other geographical origins. Specimens from cats from Guangzhou, China, which were morphologically consistent with Toxocara malaysiensis, were the same genetically as those from Malaysia, with the exception of a polymorphism in the ITS-2 but no unequivocal sequence difference. This is the first report of T. malaysiensis in cats outside of Malaysia (from where it was originally described), supporting the proposal that this species has a broader geographical distribution. The molecular approach employed provides a powerful tool for elucidating the biology, epidemiology, and zoonotic significance of T. malaysiensis.
DEFF Research Database (Denmark)
Fussing, Vivian; Paster, Bruce J.; Dewhirst, Floyd E.
1998-01-01
. The larger RIS's were different between the 3 species tested. The sequence of the 16S ribosomal gene was determined for 8 serotypes of A. pleuropneumoniae. These sequences showed only minor base differences, indicating a close genetic relatedness of these serotypes within the species. An oligonucleotide DNA...... probe designed from the 16S rRNA gene sequence of A. pleuropneumoniae was specific for all strains of the target species and did not cross react with A. lignieresii, the closest known relative of A. pleuropneumoniae. This species-specific DNA probe labeled with fluorescein was used for in situ......The aims of this study were to characterize and determine intraspecies and interspecies relatedness of Actinobacillus pleuropneumoniae to Actinobacillus lignieresii and Actinobacillus suis by sequence analysis of the ribosomal operon and to find a species-specific area for in situ detection of A...
International Nuclear Information System (INIS)
Qurainy, F.A.; Khan, S.; Ali, M.A.; Hemaid, M.A.; Ashraf, M.
2011-01-01
Ruta graveolens L. (Rutaceae) is commonly known as 'Sudab' which is well known for hippocratic medicine and is commonly used in indigenous health-care system in India. Euphorbia dracunculoides Lam. (Euphorbiaceae) in raw drug trading has almost similar morphology to R. graveolens in dried state, is being sold locally or used clinically as an adulterant of R. graveolens (genuine) at a relatively low price under the same name 'Sudab' which has ultimately reduced the efficacy and quality of this herb. The internal transcribed spacer (ITS) sequence of nuclear ribosomal DNA gene of genuine and adulterant were sequenced and analyzed to assess species admixture in raw drug trading of genuine herbal drug. The BLAST search results of ITS sequence of genuine sample of 'Sudab' i.e., R. graveolens showed 99% similarity to the sequence of R. graveolens, however, E. dracunculoides showed 100% similarity to the species of Euphorbia and did not show any similarity with R. graveolens. The sequence alignment of both species was entirely different to each other. Phylogenetic analysis based on ITS sequence of adulterant sample i.e., E. dracunculoides together with sequences of Euphorbia species available in the GenBank has also clearly showed its nesting within the Euphorbia tree. The generated ITS sequences of both samples in the present study may be referred hereafter as species-specific DNA barcode signature, which can be used in authenticating and validating the exact species identities to discriminate the genuine sample of 'Sudab' from its adulterants if any available to guarantee the quality and purity of this drug in the herbal drug market. (author)
Eukaryotic ribosome display with in situ DNA recovery.
He, Mingyue; Edwards, Bryan M; Kastelic, Damjana; Taussig, Michael J
2012-01-01
Ribosome display is a cell-free display technology for in vitro selection and optimisation of proteins from large diversified libraries. It operates through the formation of stable protein-ribosome-mRNA (PRM) complexes and selection of ligand-binding proteins, followed by DNA recovery from the selected genetic information. Both prokaryotic and eukaryotic ribosome display systems have been developed. In this chapter, we describe the eukaryotic rabbit reticulocyte method in which a distinct in situ single-primer RT-PCR procedure is used to recover DNA from the selected PRM complexes without the need for prior disruption of the ribosome.
Flores, María D; Gonzalez, Luis M; Hurtado, Carolina; Motta, Yamileth Monje; Domínguez-Hidalgo, Cristina; Merino, Francisco Jesús; Perteguer, María J; Gárate, Teresa
2018-02-27
Taenia solium, T. asiatica and T. saginata tapeworms cause human taeniasis and are the origin of porcine and bovine cysticercosis. Furthermore, T. solium eggs can cause human cysticercosis, with neurocysticercosis being the most serious form of the disease. These helminth infections are neglected tropical diseases and are endemic in several countries in the Americas, Asia and Africa. As a result of globalization, migration in particular, the infections have been extending to non-endemic territories. Species-specific diagnosis of taeniasis is subject to drawbacks that could be resolved using molecular approaches. In the present study, conventional and real-time amplification protocols (cPCR and qPCR) based on the T. saginata HDP2 sequence were applied in the differential diagnosis of taeniasis (T. saginata, T. solium) in both fecal samples and proglottids expelled by patients. The HDP2 homolog in T. solium was cloned and characterized. Semi-nested cPCR and qPCR (Sn-HDP2 cPCR and Sn-HDP2 qPCR) amplified T. saginata and T. solium DNA, with an analytical sensitivity of 40 and 400 fg, respectively, and identically in both protocols. Eighteen taeniasis patients were diagnosed directly with T. saginata or T. solium, either from proglottids or fecal samples with/without eggs (detected using microscopy), based on the optimized Sn-HDP2 qPCR. After cloning, the T. solium HDP2 homolog sequence was confirmed to be a ribosomal sequence. The HDP2 fragment corresponded to a non-transcribed sequence/external transcribed repeat (NTS/ETS) of ribosomal DNA. Compared with the T. saginata HDP2 homolog, the T solium HDP2 sequence lacked the first 900 nt at the 5' end and showed nucleotide substitutions and small deletions. Sn-HDP2 cPCR and Sn-HDP2 qPCR were set up for the diagnosis of human taeniasis, using proglottids and fecal samples from affected patients. The new Sn-HDP2 qPCR protocol was the best option, as it directly differentiated T. saginata from T. solium. The diagnosis of
Close sequence identity between ribosomal DNA episomes of the ...
Indian Academy of Sciences (India)
Unknown
The restriction map of the E. dispar rDNA circle showed close simi- larity to EhR1 .... for 30 cycles in a DNA Thermal cycler (MJ Research,. USA). 3. .... by asterisk. The gaps show the variation between E. dispar and E. histolytica sequences.
Expression of protein-coding genes embedded in ribosomal DNA
DEFF Research Database (Denmark)
Johansen, Steinar D; Haugen, Peik; Nielsen, Henrik
2007-01-01
Ribosomal DNA (rDNA) is a specialised chromosomal location that is dedicated to high-level transcription of ribosomal RNA genes. Interestingly, rDNAs are frequently interrupted by parasitic elements, some of which carry protein genes. These are non-LTR retrotransposons and group II introns that e...... in the nucleolus....
Tosto, D S; Hopp, H E
1996-01-01
The internal transcribed spacer region (ITS1 and ITS2) of the 18S-25S nuclear ribosomal DNA sequence and the intervening 5.8S region from five species of the genus Oxalis was amplified by polymerase chain reaction and subjected to direct DNA sequencing. On the basis of cytogenetic studies some species of this genus were postulated to be related by the number of chromosomes. Sequence homologies in the ITS1, 5.8S and ITS2 among species are in good agreement with previous relationships established on the basis of chromosome numbers. We also identified a highly conserved sequence of six bp in the ITS1, reported to be present in a wide range of flowering plants, but not in the Oxalidaceae family to which the genus Oxalis belongs to.
Hung, G C; Jacobs, D E; Krecek, R C; Gasser, R B; Chilton, N B
1996-12-01
Genomic DNA was isolated from adult Strongylus asini collected from zebra. The second ribosomal transcribed spacer (ITS-2) was amplified and sequenced using polymerase chain reaction (PCR) based techniques. The DNA sequence was compared with previously published data for 3 related Strongylus species. A PCR-linked restriction fragment length polymorphism method allowed the 4 species to be differentiated unequivocally. The ITS-2 sequence of S. asini was found to be more similar to those of S. edentatus (87.1%) and S. equinus (95.3%) than to that of S vulgaris (73.9%). This result confirms that S. Asini and S vulgaris represent separate species and supports the retention of the 4 species within 1 genus.
DEFF Research Database (Denmark)
Wernersson, Rasmus
2006-01-01
of alternative start codons. ( ii) Integration of sequences feature annotation - in particular, native support for working with files containing intron/ exon structure annotation. The software is available for both download and online use at http://www.cbs.dtu.dk/services/VirtualRibosome/....
Turner, Barbara; Paun, Ovidiu; Munzinger, Jérôme; Chase, Mark W; Samuel, Rosabelle
2016-06-01
Some plant groups, especially on islands, have been shaped by strong ancestral bottlenecks and rapid, recent radiation of phenotypic characters. Single molecular markers are often not informative enough for phylogenetic reconstruction in such plant groups. Whole plastid genomes and nuclear ribosomal DNA (nrDNA) are viewed by many researchers as sources of information for phylogenetic reconstruction of groups in which expected levels of divergence in standard markers are low. Here we evaluate the usefulness of these data types to resolve phylogenetic relationships among closely related Diospyros species. Twenty-two closely related Diospyros species from New Caledonia were investigated using whole plastid genomes and nrDNA data from low-coverage next-generation sequencing (NGS). Phylogenetic trees were inferred using maximum parsimony, maximum likelihood and Bayesian inference on separate plastid and nrDNA and combined matrices. The plastid and nrDNA sequences were, singly and together, unable to provide well supported phylogenetic relationships among the closely related New Caledonian Diospyros species. In the nrDNA, a 6-fold greater percentage of parsimony-informative characters compared with plastid DNA was found, but the total number of informative sites was greater for the much larger plastid DNA genomes. Combining the plastid and nuclear data improved resolution. Plastid results showed a trend towards geographical clustering of accessions rather than following taxonomic species. In plant groups in which multiple plastid markers are not sufficiently informative, an investigation at the level of the entire plastid genome may also not be sufficient for detailed phylogenetic reconstruction. Sequencing of complete plastid genomes and nrDNA repeats seems to clarify some relationships among the New Caledonian Diospyros species, but the higher percentage of parsimony-informative characters in nrDNA compared with plastid DNA did not help to resolve the phylogenetic tree
Hashavya, S; Gross, I; Michael-Gayego, A; Simanovsky, N; Lamdan, R
2018-04-01
Musculoskeletal infections are among the most common bacterial infections in children leading to hospitalization, invasive procedures and prolonged antibiotic administration. Blood, synovial and sometimes tissue cultures are essential for the diagnosis and treatment of musculoskeletal infections; 16S ribosomal DNA (rDNA) sequencing is a novel diagnostic tool for the detection of bacteria.While the yield of 16S rDNA sequencing in synovial fluid was previously assessed, data regarding the efficacy of this method from blood samples or partially treated children with suspected musculoskeletal infections is lacking.In this study we assessed the yield of 16S rDNA sequencing in blood, bone and synovial samples of children with musculoskeletal infections. Blood, synovial and bone samples were collected from children with suspected musculoskeletal infections and analyzed for the presence of 16S rDNA, the results were then compared with the benchmark microbial cultures. During the study period, 41 children (18 boys and 23 girls) with suspected acute musculoskeletal infection were enrolled. A positive blood culture was found in 6/31 cases (19.4%) with methicillin-susceptible Staphylococcus aureus being the most commonly isolated bacterium. No significant 16S rDNA detection in blood samples was recorded.Synovial fluid culture was positive in 6/28 samples (21%), Kingella kingae being the most common pathogen. When using the 16S rDNA sequencing method, the rate of positive results in synovial fluid was higher with bacterial detection in 12/23 (52%) samples. The 16S rDNA sequencing method was also able to identify pathogens in samples taken from partially treated children where cultures were negative with 16S rDNA detection in 5/5 samples. Although 16S rDNA sequencing may increase the yield of bacterial detection in synovial samples of patients with musculoskeletal infections, there is no benefit from applying this method on blood samples. The 16S rDNA sequencing method may be
Chelomina, Galina N; Rozhkovan, Konstantin V; Voronova, Anastasia N; Burundukova, Olga L; Muzarok, Tamara I; Zhuravlev, Yuri N
2016-04-01
Wild ginseng, Panax ginseng Meyer, is an endangered species of medicinal plants. In the present study, we analyzed variations within the ribosomal DNA (rDNA) cluster to gain insight into the genetic diversity of the Oriental ginseng, P. ginseng, at artificial plant cultivation. The roots of wild P. ginseng plants were sampled from a nonprotected natural population of the Russian Far East. The slides were prepared from leaf tissues using the squash technique for cytogenetic analysis. The 18S rDNA sequences were cloned and sequenced. The distribution of nucleotide diversity, recombination events, and interspecific phylogenies for the total 18S rDNA sequence data set was also examined. In mesophyll cells, mononucleolar nuclei were estimated to be dominant (75.7%), while the remaining nuclei contained two to four nucleoli. Among the analyzed 18S rDNA clones, 20% were identical to the 18S rDNA sequence of P. ginseng from Japan, and other clones differed in one to six substitutions. The nucleotide polymorphism was more expressed at the positions 440-640 bp, and distributed in variable regions, expansion segments, and conservative elements of core structure. The phylogenetic analysis confirmed conspecificity of ginseng plants cultivated in different regions, with two fixed mutations between P. ginseng and other species. This study identified the evidences of the intragenomic nucleotide polymorphism in the 18S rDNA sequences of P. ginseng. These data suggest that, in cultivated plants, the observed genome instability may influence the synthesis of biologically active compounds, which are widely used in traditional medicine.
Directory of Open Access Journals (Sweden)
Guido W. Grimm
2006-01-01
Full Text Available The multi-copy internal transcribed spacer (ITS region of nuclear ribosomal DNA is widely used to infer phylogenetic relationships among closely related taxa. Here we use maximum likelihood (ML and splits graph analyses to extract phylogenetic information from ~ 600 mostly cloned ITS sequences, representing 81 species and subspecies of Acer, and both species of its sister Dipteronia. Additional analyses compared sequence motifs in Acer and several hundred Anacardiaceae, Burseraceae, Meliaceae, Rutaceae, and Sapindaceae ITS sequences in GenBank. We also assessed the effects of using smaller data sets of consensus sequences with ambiguity coding (accounting for within-species variation instead of the full (partly redundant original sequences. Neighbor-nets and bipartition networks were used to visualize conflict among character state patterns. Species clusters observed in the trees and networks largely agree with morphology-based classifications; of de Jong’s (1994 16 sections, nine are supported in neighbor-net and bipartition networks, and ten by sequence motifs and the ML tree; of his 19 series, 14 are supported in networks, motifs, and the ML tree. Most nodes had higher bootstrap support with matrices of 105 or 40 consensus sequences than with the original matrix. Within-taxon ITS divergence did not differ between diploid and polyploid Acer, and there was little evidence of differentiated parental ITS haplotypes, suggesting that concerted evolution in Acer acts rapidly.
Grimm, Guido W.; Renner, Susanne S.; Stamatakis, Alexandros; Hemleben, Vera
2007-01-01
The multi-copy internal transcribed spacer (ITS) region of nuclear ribosomal DNA is widely used to infer phylogenetic relationships among closely related taxa. Here we use maximum likelihood (ML) and splits graph analyses to extract phylogenetic information from ~ 600 mostly cloned ITS sequences, representing 81 species and subspecies of Acer, and both species of its sister Dipteronia. Additional analyses compared sequence motifs in Acer and several hundred Anacardiaceae, Burseraceae, Meliaceae, Rutaceae, and Sapindaceae ITS sequences in GenBank. We also assessed the effects of using smaller data sets of consensus sequences with ambiguity coding (accounting for within-species variation) instead of the full (partly redundant) original sequences. Neighbor-nets and bipartition networks were used to visualize conflict among character state patterns. Species clusters observed in the trees and networks largely agree with morphology-based classifications; of de Jong’s (1994) 16 sections, nine are supported in neighbor-net and bipartition networks, and ten by sequence motifs and the ML tree; of his 19 series, 14 are supported in networks, motifs, and the ML tree. Most nodes had higher bootstrap support with matrices of 105 or 40 consensus sequences than with the original matrix. Within-taxon ITS divergence did not differ between diploid and polyploid Acer, and there was little evidence of differentiated parental ITS haplotypes, suggesting that concerted evolution in Acer acts rapidly. PMID:19455198
Directory of Open Access Journals (Sweden)
Teofânia HDA Vidigal
2004-03-01
Full Text Available The first and second internal transcribed spacer regions (ITS1 and ITS2 of the ribosomal DNA of Biomphalaria tenagophila complex (B. tenagophila, B. occidentalis, and B. t. guaibensis were sequenced and compared. The alignment lengths of these regions were about 655 bp and 481 bp, respectively. Phylogenetic relationships among the Biomphalaria species were inferred by Maximum Parsimony and Neighbor-joining methods. The phylogenetic trees produced, in most of the cases, were in accordance with morphological systematics and other molecular data previously obtained by polymerase chain reaction and restriction fragment length polymorphism analysis. The present results provide support for the proposal that B. tenagophila represents a complex comprising B. tenagophila, B. occidentalis and B. t. guaibensis.
Amor, Nabil; Halajian, Ali; Farjallah, Sarra; Merella, Paolo; Said, Khaled; Ben Slimane, Badreddine
2011-07-01
Fasciolosis caused by Fasciola spp. (Platyhelminthes: Trematoda: Digenea) is considered as the most important helminth infection of ruminants in tropical countries, causing considerable socioeconomic problems. In the endemic regions of the North of Iran, Fasciola hepatica and Fasciola gigantica have been previously characterized on the basis of morphometric differences, but the use of molecular markers is necessary to distinguish exactly between species and intermediate forms. Samples from buffaloes and goats from different localities of northern Iran were identified morphologically and then genetically characterized by sequences of the first (ITS-1) and second (ITS-2) Internal Transcribed Spacers (ITS) of nuclear ribosomal DNA (rDNA). Comparison of the ITS of the northern Iranian samples with sequences of Fasciola spp. from GenBank showed that the examined specimens had sequences identical to those of the most frequent haplotypes of F. hepatica (n=25, 48.1%) and F. gigantica (n=20, 38.45%), which differed from each other in different variable nucleotide positions of ITS region sequences, and their intermediate forms (n=7, 13.45%), which had nucleotides overlapped between the two Fasciola species in all the positions. The ITS sequences from populations of Fasciola isolates in buffaloes and goats had experienced introgression/hybridization as previously reported in isolates from other ruminants and humans. Based on ITS-1 and ITS-2 sequences, flukes are scattered in pure F. hepatica, F. gigantica and intermediate Fasciola clades, revealing that multiple genotypes of Fasciola are able to infect goats and buffaloes in North of Iran. Furthermore, the phylogenetic trees based upon the ITS-1 and ITS-2 sequences showed a close relationship of the Iranian samples with isolates of F. hepatica and F. gigantica from different localities of Africa and Asia. In the present study, the intergenic transcribed spacers ITS-1 and ITS-2 showed to be reliable approaches for the genetic
DNA replication initiator Cdc6 also regulates ribosomal DNA transcription initiation.
Huang, Shijiao; Xu, Xiaowei; Wang, Guopeng; Lu, Guoliang; Xie, Wenbing; Tao, Wei; Zhang, Hongyin; Jiang, Qing; Zhang, Chuanmao
2016-04-01
RNA-polymerase-I-dependent ribosomal DNA (rDNA) transcription is fundamental to rRNA processing, ribosome assembly and protein synthesis. However, how this process is initiated during the cell cycle is not fully understood. By performing a proteomic analysis of transcription factors that bind RNA polymerase I during rDNA transcription initiation, we identified that the DNA replication initiator Cdc6 interacts with RNA polymerase I and its co-factors, and promotes rDNA transcription in G1 phase in an ATPase-activity-dependent manner. We further showed that Cdc6 is targeted to the nucleolus during late mitosis and G1 phase in a manner that is dependent on B23 (also known as nucleophosmin, NPM1), and preferentially binds to the rDNA promoter through its ATP-binding domain. Overexpression of Cdc6 increases rDNA transcription, whereas knockdown of Cdc6 results in a decreased association of both RNA polymerase I and the RNA polymerase I transcription factor RRN3 with rDNA, and a reduction of rDNA transcription. Furthermore, depletion of Cdc6 impairs the interaction between RRN3 and RNA polymerase I. Taken together, our data demonstrate that Cdc6 also serves as a regulator of rDNA transcription initiation, and indicate a mechanism by which initiation of rDNA transcription and DNA replication can be coordinated in cells. © 2016. Published by The Company of Biologists Ltd.
Dinoflagellate phylogeny as inferred from heat shock protein 90 and ribosomal gene sequences.
Directory of Open Access Journals (Sweden)
Mona Hoppenrath
2010-10-01
Full Text Available Interrelationships among dinoflagellates in molecular phylogenies are largely unresolved, especially in the deepest branches. Ribosomal DNA (rDNA sequences provide phylogenetic signals only at the tips of the dinoflagellate tree. Two reasons for the poor resolution of deep dinoflagellate relationships using rDNA sequences are (1 most sites are relatively conserved and (2 there are different evolutionary rates among sites in different lineages. Therefore, alternative molecular markers are required to address the deeper phylogenetic relationships among dinoflagellates. Preliminary evidence indicates that the heat shock protein 90 gene (Hsp90 will provide an informative marker, mainly because this gene is relatively long and appears to have relatively uniform rates of evolution in different lineages.We more than doubled the previous dataset of Hsp90 sequences from dinoflagellates by generating additional sequences from 17 different species, representing seven different orders. In order to concatenate the Hsp90 data with rDNA sequences, we supplemented the Hsp90 sequences with three new SSU rDNA sequences and five new LSU rDNA sequences. The new Hsp90 sequences were generated, in part, from four additional heterotrophic dinoflagellates and the type species for six different genera. Molecular phylogenetic analyses resulted in a paraphyletic assemblage near the base of the dinoflagellate tree consisting of only athecate species. However, Noctiluca was never part of this assemblage and branched in a position that was nested within other lineages of dinokaryotes. The phylogenetic trees inferred from Hsp90 sequences were consistent with trees inferred from rDNA sequences in that the backbone of the dinoflagellate clade was largely unresolved.The sequence conservation in both Hsp90 and rDNA sequences and the poor resolution of the deepest nodes suggests that dinoflagellates reflect an explosive radiation in morphological diversity in their recent
cDNA, genomic cloning and sequence analysis of ribosomal protein ...
African Journals Online (AJOL)
enoh
2012-03-13
Mar 13, 2012 ... cDNA and the genomic sequence of RPS4X were cloned successfully from ... S4 genes plays a role in Turner syndrome; however, this ..... Project of Educational Committee of Sichuan Province ... Molecular biology of the cell.
Ribosomal RNA Genes Contribute to the Formation of Pseudogenes and Junk DNA in the Human Genome.
Robicheau, Brent M; Susko, Edward; Harrigan, Amye M; Snyder, Marlene
2017-02-01
Approximately 35% of the human genome can be identified as sequence devoid of a selected-effect function, and not derived from transposable elements or repeated sequences. We provide evidence supporting a known origin for a fraction of this sequence. We show that: 1) highly degraded, but near full length, ribosomal DNA (rDNA) units, including both 45S and Intergenic Spacer (IGS), can be found at multiple sites in the human genome on chromosomes without rDNA arrays, 2) that these rDNA sequences have a propensity for being centromere proximal, and 3) that sequence at all human functional rDNA array ends is divergent from canonical rDNA to the point that it is pseudogenic. We also show that small sequence strings of rDNA (from 45S + IGS) can be found distributed throughout the genome and are identifiable as an "rDNA-like signal", representing 0.26% of the q-arm of HSA21 and ∼2% of the total sequence of other regions tested. The size of sequence strings found in the rDNA-like signal intergrade into the size of sequence strings that make up the full-length degrading rDNA units found scattered throughout the genome. We conclude that the displaced and degrading rDNA sequences are likely of a similar origin but represent different stages in their evolution towards random sequence. Collectively, our data suggests that over vast evolutionary time, rDNA arrays contribute to the production of junk DNA. The concept that the production of rDNA pseudogenes is a by-product of concerted evolution represents a previously under-appreciated process; we demonstrate here its importance. © The Author(s) 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.
Ribosomal DNA internal transcribed spacer 1 and internal ...
African Journals Online (AJOL)
USER
2010-07-26
Jul 26, 2010 ... in some East Asian countries such as China, Korea and. *Corresponding author. E-mail: soonkwan@kangwon.ac.kr. Tel: +82 33 250 6476. Fax: +82 33 250 6470. Abbreviations: nrDNA, Nuclear ribosomal DNA; ITS, internal transcribed spacer; PCR, polymerase chain reaction; BLAST, basic local alignment ...
Systematic analysis and evolution of 5S ribosomal DNA in metazoans.
Vierna, J; Wehner, S; Höner zu Siederdissen, C; Martínez-Lage, A; Marz, M
2013-11-01
Several studies on 5S ribosomal DNA (5S rDNA) have been focused on a subset of the following features in mostly one organism: number of copies, pseudogenes, secondary structure, promoter and terminator characteristics, genomic arrangements, types of non-transcribed spacers and evolution. In this work, we systematically analyzed 5S rDNA sequence diversity in available metazoan genomes, and showed organism-specific and evolutionary-conserved features. Putatively functional sequences (12,766) from 97 organisms allowed us to identify general features of this multigene family in animals. Interestingly, we show that each mammal species has a highly conserved (housekeeping) 5S rRNA type and many variable ones. The genomic organization of 5S rDNA is still under debate. Here, we report the occurrence of several paralog 5S rRNA sequences in 58 of the examined species, and a flexible genome organization of 5S rDNA in animals. We found heterogeneous 5S rDNA clusters in several species, supporting the hypothesis of an exchange of 5S rDNA from one locus to another. A rather high degree of variation of upstream, internal and downstream putative regulatory regions appears to characterize metazoan 5S rDNA. We systematically studied the internal promoters and described three different types of termination signals, as well as variable distances between the coding region and the typical termination signal. Finally, we present a statistical method for detection of linkage among noncoding RNA (ncRNA) gene families. This method showed no evolutionary-conserved linkage among 5S rDNAs and any other ncRNA genes within Metazoa, even though we found 5S rDNA to be linked to various ncRNAs in several clades.
Nuclear and chloroplast-encoded small subunit ribosomal DNA sequences were obtainedfrom several strains of the toxic dinoflagellate Gymnodinium galatheanum. Phylogenetic analyses andcomparison of sequences indicate that the chloroplast sequences show a higher degree of se...
Timmermans, M J T N; Roelofs, D; Mariën, J; van Straalen, N M
2008-03-12
In recent years, several new hypotheses on phylogenetic relations among arthropods have been proposed on the basis of DNA sequences. One of the challenged hypotheses is the monophyly of hexapods. This discussion originated from analyses based on mitochondrial DNA datasets that, due to an unusual positioning of Collembola, suggested that the hexapod body plan evolved at least twice. Here, we re-evaluate the position of Collembola using ribosomal protein gene sequences. In total 48 ribosomal proteins were obtained for the collembolan Folsomia candida. These 48 sequences were aligned with sequence data on 35 other ecdysozoans. Each ribosomal protein gene was available for 25% to 86% of the taxa. However, the total sequence information was unequally distributed over the taxa and ranged between 4% and 100%. A concatenated dataset was constructed (5034 inferred amino acids in length), of which ~66% of the positions were filled. Phylogenetic tree reconstructions, using Maximum Likelihood, Maximum Parsimony, and Bayesian methods, resulted in a topology that supports monophyly of Hexapoda. Although ribosomal proteins in general may not evolve independently, they once more appear highly valuable for phylogenetic reconstruction. Our analyses clearly suggest that Hexapoda is monophyletic. This underpins the inconsistency between nuclear and mitochondrial datasets when analyzing pancrustacean relationships. Caution is needed when applying mitochondrial markers in deep phylogeny.
Directory of Open Access Journals (Sweden)
Passamonti Marco
2008-10-01
Full Text Available Abstract Background DNA encoding for ribosomal RNA (rDNA is arranged in tandemly-repeated subunits, each containing ribosomal genes and non-coding spacers. Because tandemly-repeated, rDNA evolves under a balanced influence of selection and "concerted evolution", which homogenizes rDNA variants over the genome (through genomic turnover mechanisms and the population (through sexuality. Results In this paper we analyzed the IGS-ETS of the automictic parthenogen Bacillus atticus and the bisexual B. grandii, two closely related stick-insect species. Both species share the same IGS-ETS structure and sequence, including a peculiar head-to-tail array of putative transcription enhancers, here named Bag530. Sequence variability of both IGS-ETS and Bag530 evidenced a neat geographic and subspecific clustering in B. grandii, while B. atticus shows a little but evident geographic structure. This was an unexpected result, since the parthenogen B. atticus should lack sequence fixation through sexuality. In B. atticus a new variant might spread in a given geographic area through colonization by an all-female clone, but we cannot discard the hypothesis that B. atticus was actually a bisexual taxon in that area at the time the new variant appeared. Moreover, a gene conversion event between two Bag530 variants of B. grandii benazzii and B. grandii maretimi suggested that rRNA might evolve according to the so-called "library hypothesis" model, through differential amplification of rDNA variants in different taxa. Conclusion On the whole, Bacillus rDNA evolution appears to be under a complex array of interacting mechanisms: homogenization may be achieved through genomic turnover that stabilizes DNA-binding protein interactions but, simultaneously, new sequence variants can be adopted, either by direct appearance of newly mutated repeats, or by competition among repeats, so that both DNA-binding proteins and repeat variants drive each other's evolution. All this
Schoch, Conrad L; Seifert, Keith A; Huhndorf, Sabine; Robert, Vincent; Spouge, John L; Levesque, C André; Chen, Wen
2012-04-17
Six DNA regions were evaluated as potential DNA barcodes for Fungi, the second largest kingdom of eukaryotic life, by a multinational, multilaboratory consortium. The region of the mitochondrial cytochrome c oxidase subunit 1 used as the animal barcode was excluded as a potential marker, because it is difficult to amplify in fungi, often includes large introns, and can be insufficiently variable. Three subunits from the nuclear ribosomal RNA cistron were compared together with regions of three representative protein-coding genes (largest subunit of RNA polymerase II, second largest subunit of RNA polymerase II, and minichromosome maintenance protein). Although the protein-coding gene regions often had a higher percent of correct identification compared with ribosomal markers, low PCR amplification and sequencing success eliminated them as candidates for a universal fungal barcode. Among the regions of the ribosomal cistron, the internal transcribed spacer (ITS) region has the highest probability of successful identification for the broadest range of fungi, with the most clearly defined barcode gap between inter- and intraspecific variation. The nuclear ribosomal large subunit, a popular phylogenetic marker in certain groups, had superior species resolution in some taxonomic groups, such as the early diverging lineages and the ascomycete yeasts, but was otherwise slightly inferior to the ITS. The nuclear ribosomal small subunit has poor species-level resolution in fungi. ITS will be formally proposed for adoption as the primary fungal barcode marker to the Consortium for the Barcode of Life, with the possibility that supplementary barcodes may be developed for particular narrowly circumscribed taxonomic groups.
Cutillas, C; Oliveros, R; de Rojas, M; Guevara, D C
2004-06-01
Adults of Trichuris skrjahini have been isolated from the cecum of caprine hosts (Capra hircus), Trichuris ovis and Trichuris globulosa from Ovis aries (sheep) and C. hircus (goats), and Trichuris leporis from Lepus europaeus (rabbits) in Spain. Genomic DNA was isolated and the ITS1-5.8S-ITS2 segment from the ribosomal DNA (rDNA) was amplified and sequenced by polymerase chain reaction (PCR) techniques. The ITS1 of T. skrjabini, T. ovis, T. globulosa, and T. leporis was 495, 757, 757, and 536 nucleotides in length, respectively, and had G + C contents of 59.6, 58.7, 58.7, and 60.8%, respectively. Intraindividual variation was detected in the ITSI sequences of the 4 species. Furthermore, the 5.8S sequences of T. skrjabini, T. ovis, T. globulosa, and T. leporis were compared. A total of 157, 152, 153, and 157 nucleotides in length was observed in the 5.8S sequences of these 4 species, respectively. There were no sequence differences of ITS1 and 5.8S products between T. ovis and T. globulosa. Nevertheless, clear differences were detected between the ITS1 sequences of T. skrjabini, T. ovis, T. leporis, Trichuris muris, and T. arvicolae. The ITS2 fragment from the rDNA of T. skrjabini was sequenced. A comparative study of the ITS2 sequence of T. skrjabini with the previously published ITS2 sequence data of T. ovis, T. leporis, T. muris, and T. arvicolae suggested that the combined use of sequence data from both spacers would be useful in the molecular characterization of trichurid parasites.
Directory of Open Access Journals (Sweden)
Mariën J
2008-03-01
Full Text Available Abstract Background In recent years, several new hypotheses on phylogenetic relations among arthropods have been proposed on the basis of DNA sequences. One of the challenged hypotheses is the monophyly of hexapods. This discussion originated from analyses based on mitochondrial DNA datasets that, due to an unusual positioning of Collembola, suggested that the hexapod body plan evolved at least twice. Here, we re-evaluate the position of Collembola using ribosomal protein gene sequences. Results In total 48 ribosomal proteins were obtained for the collembolan Folsomia candida. These 48 sequences were aligned with sequence data on 35 other ecdysozoans. Each ribosomal protein gene was available for 25% to 86% of the taxa. However, the total sequence information was unequally distributed over the taxa and ranged between 4% and 100%. A concatenated dataset was constructed (5034 inferred amino acids in length, of which ~66% of the positions were filled. Phylogenetic tree reconstructions, using Maximum Likelihood, Maximum Parsimony, and Bayesian methods, resulted in a topology that supports monophyly of Hexapoda. Conclusion Although ribosomal proteins in general may not evolve independently, they once more appear highly valuable for phylogenetic reconstruction. Our analyses clearly suggest that Hexapoda is monophyletic. This underpins the inconsistency between nuclear and mitochondrial datasets when analyzing pancrustacean relationships. Caution is needed when applying mitochondrial markers in deep phylogeny.
The primary structure of L37--a rat ribosomal protein with a zinc finger-like motif.
Chan, Y L; Paz, V; Olvera, J; Wool, I G
1993-04-30
The amino acid sequence of the rat 60S ribosomal subunit protein L37 was deduced from the sequence of nucleotides in a recombinant cDNA. Ribosomal protein L37 has 96 amino acids, the NH2-terminal methionine is removed after translation of the mRNA, and has a molecular weight of 10,939. Ribosomal protein L37 has a single zinc finger-like motif of the C2-C2 type. Hybridization of the cDNA to digests of nuclear DNA suggests that there are 13 or 14 copies of the L37 gene. The mRNA for the protein is about 500 nucleotides in length. Rat L37 is related to Saccharomyces cerevisiae ribosomal protein YL35 and to Caenorhabditis elegans L37. We have identified in the data base a DNA sequence that encodes the chicken homolog of rat L37.
Zelenka, Jaroslav; Alán, Lukáš; Jabůrek, Martin; Ježek, Petr
2014-04-01
Based on the matrix-addressing sequence of mitochondrial ribosomal 5S-rRNA (termed MAM), which is naturally imported into mitochondria, we have constructed an import system for in vivo targeting of mitochondrial DNA (mtDNA) or mt-mRNA, in order to provide fluorescence hybridization of the desired sequences. Thus DNA oligonucleotides were constructed, containing the 5'-flanked T7 RNA polymerase promoter. After in vitro transcription and fluorescent labeling with Alexa Fluor(®) 488 or 647 dye, we obtained the fluorescent "L-ND5 probe" containing MAM and exemplar cargo, i.e., annealing sequence to a short portion of ND5 mRNA and to the light-strand mtDNA complementary to the heavy strand nd5 mt gene (5'-end 21 base pair sequence). For mitochondrial in vivo fluorescent hybridization, HepG2 cells were treated with dequalinium micelles, containing the fluorescent probes, bringing the probes proximally to the mitochondrial outer membrane and to the natural import system. A verification of import into the mitochondrial matrix of cultured HepG2 cells was provided by confocal microscopy colocalizations. Transfections using lipofectamine or probes without 5S-rRNA addressing MAM sequence or with MAM only were ineffective. Alternatively, the same DNA oligonucleotides with 5'-CACC overhang (substituting T7 promoter) were transcribed from the tetracycline-inducible pENTRH1/TO vector in human embryonic kidney T-REx®-293 cells, while mitochondrial matrix localization after import of the resulting unlabeled RNA was detected by PCR. The MAM-containing probe was then enriched by three-order of magnitude over the natural ND5 mRNA in the mitochondrial matrix. In conclusion, we present a proof-of-principle for mitochondrial in vivo hybridization and mitochondrial nucleic acid import.
Choe, Se-Eun; Nguyen, Thuy Thi-Dieu; Kang, Tae-Gyu; Kweon, Chang-Hee; Kang, Seung-Won
2011-09-01
Nuclear ribosomal DNA sequence of the second internal transcribed spacer (ITS-2) has been used efficiently to identify the liver fluke species collected from different hosts and various geographic regions. ITS-2 sequences of 19 Fasciola samples collected from Korean native cattle were determined and compared. Sequence comparison including ITS-2 sequences of isolates from this study and reference sequences from Fasciola hepatica and Fasciola gigantica and intermediate Fasciola in Genbank revealed seven identical variable sites of investigated isolates. Among 19 samples, 12 individuals had ITS-2 sequences completely identical to that of pure F. hepatica, five possessed the sequences identical to F. gigantica type, whereas two shared the sequence of both F. hepatica and F. gigantica. No variations in length and nucleotide composition of ITS-2 sequence were observed within isolates that belonged to F. hepatica or F. gigantica. At the position of 218, five Fasciola containing a single-base substitution (C>T) formed a distinct branch inside the F. gigantica-type group which was similar to those of Asian-origin isolates. The phylogenetic tree of the Fasciola spp. based on complete ITS-2 sequences from this study and other representative isolates in different locations clearly showed that pure F. hepatica, F. gigantica type and intermediate Fasciola were observed. The result also provided additional genetic evidence for the existence of three forms of Fasciola isolated from native cattle in Korea by genetic approach using ITS-2 sequence.
Hao, Yan-Zhe; Hou, Wan-Ru; Hou, Yi-Ling; Du, Yu-Jie; Zhang, Tian; Peng, Zheng-Song
2009-11-01
RPS25 is a component of the 40S small ribosomal subunit encoded by RPS25 gene, which is specific to eukaryotes. Studies in reference to RPS25 gene from animals were handful. The Giant Panda (Ailuropoda melanoleuca), known as a "living fossil", are increasingly concerned by the world community. Studies on RPS25 of the Giant Panda could provide scientific data for inquiring into the hereditary traits of the gene and formulating the protective strategy for the Giant Panda. The cDNA of the RPS25 cloned from Giant Panda is 436 bp in size, containing an open reading frame of 378 bp encoding 125 amino acids. The length of the genomic sequence is 1,992 bp, which was found to possess four exons and three introns. Alignment analysis indicated that the nucleotide sequence of the coding sequence shows a high homology to those of Homo sapiens, Bos taurus, Mus musculus and Rattus norvegicus as determined by Blast analysis, 92.6, 94.4, 89.2 and 91.5%, respectively. Primary structure analysis revealed that the molecular weight of the putative RPS25 protein is 13.7421 kDa with a theoretical pI 10.12. Topology prediction showed there is one N-glycosylation site, one cAMP and cGMP-dependent protein kinase phosphorylation site, two Protein kinase C phosphorylation sites and one Tyrosine kinase phosphorylation site in the RPS25 protein of the Giant Panda. The RPS25 gene was overexpressed in E. coli BL21 and Western Blotting of the RPS25 protein was also done. The results indicated that the RPS25 gene can be really expressed in E. coli and the RPS25 protein fusioned with the N-terminally his-tagged form gave rise to the accumulation of an expected 17.4 kDa polypeptide. The cDNA and the genomic sequence of RPS25 were cloned successfully for the first time from the Giant Panda using RT-PCR technology and Touchdown-PCR, respectively, which were both sequenced and analyzed preliminarily; then the cDNA of the RPS25 gene was overexpressed in E. coli BL21 and immunoblotted, which is the first
Cahyani, Inswasti; Cridge, Andrew G.; Engelke, David R.; Ganley, Austen R. D.
2014-01-01
The spatial organization of eukaryotic genomes is linked to their functions. However, how individual features of the global spatial structure contribute to nuclear function remains largely unknown. We previously identified a high-frequency interchromosomal interaction within the Saccharomyces cerevisiae genome that occurs between the intergenic spacer of the ribosomal DNA (rDNA) repeats and the intergenic sequence between the locus encoding the second largest RNA polymerase I subunit and a lysine tRNA gene [i.e., RPA135-tK(CUU)P]. Here, we used quantitative chromosome conformation capture in combination with replacement mapping to identify a 75-bp sequence within the RPA135-tK(CUU)P intergenic region that is involved in the interaction. We demonstrate that the RPA135-IGS1 interaction is dependent on the rDNA copy number and the Msn2 protein. Surprisingly, we found that the interaction does not govern RPA135 transcription. Instead, replacement of a 605-bp region within the RPA135-tK(CUU)P intergenic region results in a reduction in the RPA135-IGS1 interaction level and fluctuations in rDNA copy number. We conclude that the chromosomal interaction that occurs between the RPA135-tK(CUU)P and rDNA IGS1 loci stabilizes rDNA repeat number and contributes to the maintenance of nucleolar stability. Our results provide evidence that the DNA loci involved in chromosomal interactions are composite elements, sections of which function in stabilizing the interaction or mediating a functional outcome. PMID:25421713
M.N. lslam-Faridi; C.D. Nelson; S.P. DiFazio; L.E. Gunter; G.A. Tuskan
2009-01-01
The 185-285 rDNA and 55 rDNA loci in Populus trichocarpa were localized using fluorescent in situ hybridization (FISH). Two 185-285 rDNA sites and one 55 rDNA site were identified and located at the ends of 3 different chromosomes. FISH signals from the Arabidopsis-type telomere repeat sequence were observed at the distal ends of each chromosome. Six BAC clones...
DEFF Research Database (Denmark)
O'Donnell, Kerry; Gueidan, C; Sink, S
2009-01-01
We constructed a two-locus database, comprising partial translation elongation factor (EF-1alpha) gene sequences and nearly full-length sequences of the nuclear ribosomal intergenic spacer region (IGS rDNA) for 850 isolates spanning the phylogenetic breadth of the Fusarium oxysporum species compl...... of the IGS rDNA sequences may be non-orthologous. We also evaluated enniatin, fumonisin and moniliformin mycotoxin production in vitro within a phylogenetic framework....
Yang, Qing-Li; Shen, Ji-Qing; Jiang, Zhi-Hua; Yang, Yi-Chao; Li, Hong-Mei; Chen, Ying-Dan; Zhou, Xiao-Nong
2014-06-01
To identify Clonorchis sinensis metacercariae using PCR targeting ribosomal DNA ITS region and COX1 gene. Pseudorasbora parva were collected from Hengxian County of Guangxi at the end of May 2013. Single metacercaria of C. sinensis and other trematodes were separated from muscle tissue of P. parva by digestion method. Primers targeting ribosomal DNA ITS region and COX1 gene of C. sinensis were designed for PCR and the universal primers were used as control. The sensitivity and specificity of the PCR detection were analyzed. C. sinensis metacercariae at different stages were identified by PCR. DNA from single C. sinensis metacercaria was detected by PCR targeting ribosomal DNA ITS region and COX1 gene. The specific amplicans have sizes of 437/549, 156/249 and 195/166 bp, respectively. The ratio of the two positive numbers in PCR with universal primers and specific primers targeting C. sinensis ribosomal DNA ITS1 and ITS2 regions was 0.905 and 0.952, respectively. The target gene fragments were amplified by PCR using COX1 gene-specific primers. The PCR with specific primers did not show any non-specific amplification. However, the PCR with universal primers targeting ribosomal DNA ITS regions performed serious non-specific amplification. C. sinensis metacercariae at different stages are identified by morphological observation and PCR method. Species-specific primers targeting ribosomal DNA ITS region show higher sensitivity and specificity than the universal primers. PCR targeting COX1 gene shows similar sensitivity and specificity to PCR with specific primers targeting ribosomal DNA ITS regions.
Evolutional dynamics of 45S and 5S ribosomal DNA in ancient allohexaploid Atropa belladonna.
Volkov, Roman A; Panchuk, Irina I; Borisjuk, Nikolai V; Hosiawa-Baranska, Marta; Maluszynska, Jolanta; Hemleben, Vera
2017-01-23
Polyploid hybrids represent a rich natural resource to study molecular evolution of plant genes and genomes. Here, we applied a combination of karyological and molecular methods to investigate chromosomal structure, molecular organization and evolution of ribosomal DNA (rDNA) in nightshade, Atropa belladonna (fam. Solanaceae), one of the oldest known allohexaploids among flowering plants. Because of their abundance and specific molecular organization (evolutionarily conserved coding regions linked to variable intergenic spacers, IGS), 45S and 5S rDNA are widely used in plant taxonomic and evolutionary studies. Molecular cloning and nucleotide sequencing of A. belladonna 45S rDNA repeats revealed a general structure characteristic of other Solanaceae species, and a very high sequence similarity of two length variants, with the only difference in number of short IGS subrepeats. These results combined with the detection of three pairs of 45S rDNA loci on separate chromosomes, presumably inherited from both tetraploid and diploid ancestor species, example intensive sequence homogenization that led to substitution/elimination of rDNA repeats of one parent. Chromosome silver-staining revealed that only four out of six 45S rDNA sites are frequently transcriptionally active, demonstrating nucleolar dominance. For 5S rDNA, three size variants of repeats were detected, with the major class represented by repeats containing all functional IGS elements required for transcription, the intermediate size repeats containing partially deleted IGS sequences, and the short 5S repeats containing severe defects both in the IGS and coding sequences. While shorter variants demonstrate increased rate of based substitution, probably in their transition into pseudogenes, the functional 5S rDNA variants are nearly identical at the sequence level, pointing to their origin from a single parental species. Localization of the 5S rDNA genes on two chromosome pairs further supports uniparental
Directory of Open Access Journals (Sweden)
Arin Ngamniyom
2016-02-01
Full Text Available The genus Stenostomum contains small turbellaria that are widely distributed in freshwater environments worldwide. However, there are only rare reports or studies of this genus from Thailand. Therefore, the objective of this study was to report S. cf. leucops in Thailand collected from Pathum Thani Province. The worm morphology and surface topography using scanning electron microscopy were determined. Moreover, the phylogenetic tree of S. cf. leucops was analysed with 17 flatworms based on the 18S ribosomal DNA sequences. The phylogenetic relationship shared a common ancestry of Catenulida species, and S. cf. leucops displayed a monophyletic pattern within Stenostomum spp. The results of the morphological and molecular data are discussed. These results may increase the knowledge of freshwater microturbellarians in Thailand.
Catania, Francesco; Lynch, Michael
2010-05-04
In protozoa, the identification of preserved motifs by comparative genomics is often impeded by difficulties to generate reliable alignments for non-coding sequences. Moreover, the evolutionary dynamics of regulatory elements in 3' untranslated regions (both in protozoa and metazoa) remains a virtually unexplored issue. By screening Paramecium tetraurelia's 3' untranslated regions for 8-mers that were previously found to be preserved in mammalian 3' UTRs, we detect and characterize a motif that is distinctly conserved in the ribosomal genes of this ciliate. The motif appears to be conserved across Paramecium aurelia species but is absent from the ribosomal genes of four additional non-Paramecium species surveyed, including another ciliate, Tetrahymena thermophila. Motif-free ribosomal genes retain fewer paralogs in the genome and appear to be lost more rapidly relative to motif-containing genes. Features associated with the discovered preserved motif are consistent with this 8-mer playing a role in post-transcriptional regulation. Our observations 1) shed light on the evolution of a putative regulatory motif across large phylogenetic distances; 2) are expected to facilitate the understanding of the modulation of ribosomal genes expression in Paramecium; and 3) reveal a largely unexplored--and presumably not restricted to Paramecium--association between the presence/absence of a DNA motif and the evolutionary fate of its host genes.
1975-01-01
In the typical meroistic insect ovary, the oocyte nucleus synthesizes little if any RNA. Nurse cells or trophocytes actively synthesize ribosomes which are transported to and accumulated by the oocyte. In the telotrophic ovary a morphological separation exists, the nurse cells being localized at the apical end of each ovariole and communicating with the ooocytes via nutritive cords. In order to determine whether the genes coding for ribosomal RNA (rRNA) are amplified in the telotrophic ovary of the milkweed bug Oncopeltus fasciatus, the percentages of the genome coding for ribosomal RNA in somatic cells, spermatogenic cells, ovarian follicles, and nurse cells were compared. The oocytes and most of the nurse cells of O. fasciatus are uninucleolate. DNA hybridizing with ribosomal RNA is localized in a satellite DNA, the density of which is 1.712 g/cm(-3). The density of main-band DNA is 1.694 g/cm(-3). The ribosomal DNA satellite accounts for approximately 0.2% of the DNA in somatic and gametogenic tissues of both males and females. RNA-DNA hybridization analysis demonstrates that approximately 0.03% of the DNA in somatic tissues, testis, ovarian follicles, and isolated nurse cells hybridizes with ribosomal RNA. The fact that the percentage of DNA hybridizing with rRNA is the same in somatic and in male and female gametogenic tissues indicates that amplification of ribosomal DNA does not occur in nurse cells and that if it occurs in oocytes, it represents less than a 50- fold increase in ribosomal DNA. An increase in total genome DNA accounted by polyploidization appears to provide for increasing the amount of ribosomal DNA in the nurse cells. PMID:1158969
Hartman, Amber L; Riddle, Sean; McPhillips, Timothy; Ludäscher, Bertram; Eisen, Jonathan A
2010-06-12
For more than two decades microbiologists have used a highly conserved microbial gene as a phylogenetic marker for bacteria and archaea. The small-subunit ribosomal RNA gene, also known as 16 S rRNA, is encoded by ribosomal DNA, 16 S rDNA, and has provided a powerful comparative tool to microbial ecologists. Over time, the microbial ecology field has matured from small-scale studies in a select number of environments to massive collections of sequence data that are paired with dozens of corresponding collection variables. As the complexity of data and tool sets have grown, the need for flexible automation and maintenance of the core processes of 16 S rDNA sequence analysis has increased correspondingly. We present WATERS, an integrated approach for 16 S rDNA analysis that bundles a suite of publicly available 16 S rDNA analysis software tools into a single software package. The "toolkit" includes sequence alignment, chimera removal, OTU determination, taxonomy assignment, phylogentic tree construction as well as a host of ecological analysis and visualization tools. WATERS employs a flexible, collection-oriented 'workflow' approach using the open-source Kepler system as a platform. By packaging available software tools into a single automated workflow, WATERS simplifies 16 S rDNA analyses, especially for those without specialized bioinformatics, programming expertise. In addition, WATERS, like some of the newer comprehensive rRNA analysis tools, allows researchers to minimize the time dedicated to carrying out tedious informatics steps and to focus their attention instead on the biological interpretation of the results. One advantage of WATERS over other comprehensive tools is that the use of the Kepler workflow system facilitates result interpretation and reproducibility via a data provenance sub-system. Furthermore, new "actors" can be added to the workflow as desired and we see WATERS as an initial seed for a sizeable and growing repository of interoperable
The D1-D2 region of the large subunit ribosomal DNA as barcode for ciliates.
Stoeck, T; Przybos, E; Dunthorn, M
2014-05-01
Ciliates are a major evolutionary lineage within the alveolates, which are distributed in nearly all habitats on our planet and are an essential component for ecosystem function, processes and stability. Accurate identification of these unicellular eukaryotes through, for example, microscopy or mating type reactions is reserved to few specialists. To satisfy the demand for a DNA barcode for ciliates, which meets the standard criteria for DNA barcodes defined by the Consortium for the Barcode of Life (CBOL), we here evaluated the D1-D2 region of the ribosomal DNA large subunit (LSU-rDNA). Primer universality for the phylum Ciliophora was tested in silico with available database sequences as well as in the laboratory with 73 ciliate species, which represented nine of 12 ciliate classes. Primers tested in this study were successful for all tested classes. To test the ability of the D1-D2 region to resolve conspecific and congeneric sequence divergence, 63 Paramecium strains were sampled from 24 mating species. The average conspecific D1-D2 variation was 0.18%, whereas congeneric sequence divergence averaged 4.83%. In pairwise genetic distance analyses, we identified a D1-D2 sequence divergence of DNA amplification of single cells and voucher deposition. In conclusion, the presented data pinpoint the D1-D2 region as an excellent candidate for an official CBOL barcode for ciliated protists. © 2013 John Wiley & Sons Ltd.
Evolutionary dynamics of a conserved sequence motif in the ribosomal genes of the ciliate Paramecium
Directory of Open Access Journals (Sweden)
Lynch Michael
2010-05-01
Full Text Available Abstract Background In protozoa, the identification of preserved motifs by comparative genomics is often impeded by difficulties to generate reliable alignments for non-coding sequences. Moreover, the evolutionary dynamics of regulatory elements in 3' untranslated regions (both in protozoa and metazoa remains a virtually unexplored issue. Results By screening Paramecium tetraurelia's 3' untranslated regions for 8-mers that were previously found to be preserved in mammalian 3' UTRs, we detect and characterize a motif that is distinctly conserved in the ribosomal genes of this ciliate. The motif appears to be conserved across Paramecium aurelia species but is absent from the ribosomal genes of four additional non-Paramecium species surveyed, including another ciliate, Tetrahymena thermophila. Motif-free ribosomal genes retain fewer paralogs in the genome and appear to be lost more rapidly relative to motif-containing genes. Features associated with the discovered preserved motif are consistent with this 8-mer playing a role in post-transcriptional regulation. Conclusions Our observations 1 shed light on the evolution of a putative regulatory motif across large phylogenetic distances; 2 are expected to facilitate the understanding of the modulation of ribosomal genes expression in Paramecium; and 3 reveal a largely unexplored--and presumably not restricted to Paramecium--association between the presence/absence of a DNA motif and the evolutionary fate of its host genes.
Subbotin, S A; Vierstraete, A; De Ley, P; Rowe, J; Waeyenberge, L; Moens, M; Vanfleteren, J R
2001-10-01
The ITS1, ITS2, and 5.8S gene sequences of nuclear ribosomal DNA from 40 taxa of the family Heteroderidae (including the genera Afenestrata, Cactodera, Heterodera, Globodera, Punctodera, Meloidodera, Cryphodera, and Thecavermiculatus) were sequenced and analyzed. The ITS regions displayed high levels of sequence divergence within Heteroderinae and compared to outgroup taxa. Unlike recent findings in root knot nematodes, ITS sequence polymorphism does not appear to complicate phylogenetic analysis of cyst nematodes. Phylogenetic analyses with maximum-parsimony, minimum-evolution, and maximum-likelihood methods were performed with a range of computer alignments, including elision and culled alignments. All multiple alignments and phylogenetic methods yielded similar basic structure for phylogenetic relationships of Heteroderidae. The cyst-forming nematodes are represented by six main clades corresponding to morphological characters and host specialization, with certain clades assuming different positions depending on alignment procedure and/or method of phylogenetic inference. Hypotheses of monophyly of Punctoderinae and Heteroderinae are, respectively, strongly and moderately supported by the ITS data across most alignments. Close relationships were revealed between the Avenae and the Sacchari groups and between the Humuli group and the species H. salixophila within Heteroderinae. The Goettingiana group occupies a basal position within this subfamily. The validity of the genera Afenestrata and Bidera was tested and is discussed based on molecular data. We conclude that ITS sequence data are appropriate for studies of relationships within the different species groups and less so for recovery of more ancient speciations within Heteroderidae. Copyright 2001 Academic Press.
Kiraz, Nuri; Oz, Yasemin; Aslan, Huseyin; Erturan, Zayre; Ener, Beyza; Akdagli, Sevtap Arikan; Muslumanoglu, Hamza; Cetinkaya, Zafer
2015-10-01
Although conventional identification of pathogenic fungi is based on the combination of tests evaluating their morphological and biochemical characteristics, they can fail to identify the less common species or the differentiation of closely related species. In addition these tests are time consuming, labour-intensive and require experienced personnel. We evaluated the feasibility and sufficiency of DNA extraction by Whatman FTA filter matrix technology and DNA sequencing of D1-D2 region of the large ribosomal subunit gene for identification of clinical isolates of 21 yeast and 160 moulds in our clinical mycology laboratory. While the yeast isolates were identified at species level with 100% homology, 102 (63.75%) clinically important mould isolates were identified at species level, 56 (35%) isolates at genus level against fungal sequences existing in DNA databases and two (1.25%) isolates could not be identified. Consequently, Whatman FTA filter matrix technology was a useful method for extraction of fungal DNA; extremely rapid, practical and successful. Sequence analysis strategy of D1-D2 region of the large ribosomal subunit gene was found considerably sufficient in identification to genus level for the most clinical fungi. However, the identification to species level and especially discrimination of closely related species may require additional analysis. © 2015 Blackwell Verlag GmbH.
International Nuclear Information System (INIS)
Chambers, C.; Dutta, S.K.
1983-01-01
High molecular nuclear DNAs were isolated from three developmental cell types of N. crassa: conidia, mycelia and germinated conidia, and from mycelial cells of two other heterothallic species, N. intermedia and N. sitophila. These nuclear DNAs were treated with several restriction enzymes: EcoR1, Bam H1, Hind III, Hinc II, Bgl II, Sma I and Pst 1. All seven restriction enzymes were tested on 0.7% agarose gels. EcoR1, Hind III, Pst 1, and Hinc II showed band differences among the species, but not among the cell types. Southern blot transfers of restricted DNA gels were then hybridized with 32 P-labelled pMF2 rDNAs (probe). This later DNA was prepared from N. crassa rDNA cloned into pBR322 plasmid, obtained from Dr. Robert Metzenberg of the University of Wisconsin. Autoradiograms of these hybrids between southern blots and probe DNA revealed similar rDNA band patterns confirming the observations on restriction gels. In the case of EcoR1 restriction analysis there were differences in fragments on 0.7% agarose gel, but after hybridization of southern blots no differences in band patterns were seen in autoradiograms. This raises the question whether the background bands were all of rDNA sequences. These studies are being continued using ITS (internal transcribed spacer) sequences of N. crassa rDNAs cloned in pBR322 plasmid
Kimura, M; Kimura, J; Hatakeyama, T
1988-11-21
The complete amino acid sequences of ribosomal proteins S11 from the Gram-positive eubacterium Bacillus stearothermophilus and of S19 from the archaebacterium Halobacterium marismortui have been determined. A search for homologous sequences of these proteins revealed that they belong to the ribosomal protein S11 family. Homologous proteins have previously been sequenced from Escherichia coli as well as from chloroplast, yeast and mammalian ribosomes. A pairwise comparison of the amino acid sequences showed that Bacillus protein S11 shares 68% identical residues with S11 from Escherichia coli and a slightly lower homology (52%) with the homologous chloroplast protein. The halophilic protein S19 is more related to the eukaryotic (45-49%) than to the eubacterial counterparts (35%).
Magalhães Cruz, Leonardo; Maltempi de Souza, Emanuel; Weber, Olmar Baler; Baldani, José Ivo; Döbereiner, Johanna; de Oliveira Pedrosa, Fábio
2001-01-01
Nitrogen-fixing bacteria isolated from banana (Musa spp.) and pineapple (Ananas comosus (L.) Merril) were characterized by amplified 16S ribosomal DNA restriction analysis and 16S rRNA sequence analysis. Herbaspirillum seropedicae, Herbaspirillum rubrisubalbicans, Burkholderia brasilensis, and Burkholderia tropicalis were identified. Eight other types were placed in close proximity to these genera and other alpha and beta Proteobacteria. PMID:11319127
Directory of Open Access Journals (Sweden)
Knut Rudi
2003-01-01
Full Text Available Analyses of complex microbial communities are becoming increasingly important. Bottlenecks in these analyses, however, are the tools to actually describe the biodiversity. Novel protocols for DNA array-based analyses of microbial communities are presented. In these protocols, the specificity obtained by sequence-specific labeling of DNA probes is combined with the possibility of detecting several different probes simultaneously by DNA array hybridization. The gene encoding 16S ribosomal RNA was chosen as the target in these analyses. This gene contains both universally conserved regions and regions with relatively high variability. The universally conserved regions are used for PCR amplification primers, while the variable regions are used for the specific probes. Protocols are presented for DNA purification, probe construction, probe labeling, and DNA array hybridizations.
Śliwińska-Jewsiewicka, A; Kuciński, M; Kirtiklis, L; Dobosz, S; Ocalewicz, K; Jankun, Malgorzata
2015-08-01
Brook trout Salvelinus fontinalis (Mitchill, 1814) chromosomes have been analyzed using conventional and molecular cytogenetic techniques enabling characteristics and chromosomal location of heterochromatin, nucleolus organizer regions (NORs), ribosomal RNA-encoding genes and telomeric DNA sequences. The C-banding and chromosome digestion with the restriction endonucleases demonstrated distribution and heterogeneity of the heterochromatin in the brook trout genome. DNA sequences of the ribosomal RNA genes, namely the nucleolus-forming 28S (major) and non-nucleolus-forming 5S (minor) rDNAs, were physically mapped using fluorescence in situ hybridization (FISH) and primed in situ labelling. The minor rDNA locus was located on the subtelo-acrocentric chromosome pair No. 9, whereas the major rDNA loci were dispersed on 14 chromosome pairs, showing a considerable inter-individual variation in the number and location. The major and minor rDNA loci were located at different chromosomes. Multichromosomal location (3-6 sites) of the NORs was demonstrated by silver nitrate (AgNO3) impregnation. All Ag-positive i.e. active NORs corresponded to the GC-rich blocks of heterochromatin. FISH with telomeric probe showed the presence of the interstitial telomeric site (ITS) adjacent to the NOR/28S rDNA site on the chromosome 11. This ITS was presumably remnant of the chromosome rearrangement(s) leading to the genomic redistribution of the rDNA sequences. Comparative analysis of the cytogenetic data among several related salmonid species confirmed huge variation in the number and the chromosomal location of rRNA gene clusters in the Salvelinus genome.
Ribosomal protein S14 transcripts are edited in Oenothera mitochondria.
Schuster, W; Unseld, M; Wissinger, B; Brennicke, A
1990-01-01
The gene encoding ribosomal protein S14 (rps14) in Oenothera mitochondria is located upstream of the cytochrome b gene (cob). Sequence analysis of independently derived cDNA clones covering the entire rps14 coding region shows two nucleotides edited from the genomic DNA to the mRNA derived sequences by C to U modifications. A third editing event occurs four nucleotides upstream of the AUG initiation codon and improves a potential ribosome binding site. A CGG codon specifying arginine in a position conserved in evolution between chloroplasts and E. coli as a UGG tryptophan codon is not edited in any of the cDNAs analysed. An inverted repeat 3' of an unidentified open reading frame is located upstream of the rps14 gene. The inverted repeat sequence is highly conserved at analogous regions in other Oenothera mitochondrial loci. Images PMID:2326162
Zhao, Ya-E; Xu, Ji-Ru; Hu, Li; Wu, Li-Ping; Wang, Zheng-Hang
2012-05-01
The study for the first time attempted to accomplish 18S ribosomal DNA (rDNA) complete sequence amplification and analysis for three Demodex species (Demodex folliculorum, Demodex brevis and Demodex canis) based on gDNA extraction from individual mites. The mites were treated by DNA Release Additive and Hot Start II DNA Polymerase so as to promote mite disruption and increase PCR specificity. Determination of D. folliculorum gDNA showed that the gDNA yield reached the highest at 1 mite, tending to descend with the increase of mite number. The individual mite gDNA was successfully used for 18S rDNA fragment (about 900 bp) amplification examination. The alignments of 18S rDNA complete sequences of individual mite samples and those of pooled mite samples ( ≥ 1000mites/sample) showed over 97% identities for each species, indicating that the gDNA extracted from a single individual mite was as satisfactory as that from pooled mites for PCR amplification. Further pairwise sequence analyses showed that average divergence, genetic distance, transition/transversion or phylogenetic tree could not effectively identify the three Demodex species, largely due to the differentiation in the D. canis isolates. It can be concluded that the individual Demodex mite gDNA can satisfy the molecular study of Demodex. 18S rDNA complete sequence is suitable for interfamily identification in Cheyletoidea, but whether it is suitable for intrafamily identification cannot be confirmed until the ascertainment of the types of Demodex mites parasitizing in dogs. Copyright © 2012 Elsevier Inc. All rights reserved.
Pchelin, Ivan M; Zlatogursky, Vasily V; Rudneva, Mariya V; Chilina, Galina A; Rezaei-Matehkolaei, Ali; Lavnikevich, Dmitry M; Vasilyeva, Natalya V; Taraskina, Anastasia E
2016-09-01
Trichophyton spp. are important causative agents of superficial mycoses. The phylogeny of the genus and accurate strain identification, based on the ribosomal ITS region sequencing, are still under development. The present work is aimed at (i) inferring the genus phylogeny from partial ITS, LSU and BT2 sequences (ii) description of ribosomal ITS region polymorphism in 15 strains of Trichophyton interdigitale. We performed DNA sequence-based species identification and phylogenetic analysis on 48 strains belonging to the genus Trichophyton. Phylogenetic relationships were inferred by maximum likelihood and Bayesian methods on concatenated ITS, LSU and BT2 sequences. Ribosomal ITS region polymorphisms were assessed directly on the alignment. By phylogenetic reconstruction, we reveal major anthropophilic and zoophilic species clusters in the genus Trichophyton. We describe several sequences of the ITS region of T. interdigitale, which do not fit in the traditional polymorphism scheme and propose emendations in this scheme for discrimination between ITS sequence types in T. interdigitale. The new polymorphism scheme will allow inclusion of a wider spectrum of isolates while retaining its explanatory power. This scheme was also found to be partially congruent with NTS typing technique. © 2016 Blackwell Verlag GmbH.
Dijk, J; van den Broek, R; Nasiulas, G; Beck, A; Reinhardt, R; Wittmann-Liebold, B
1987-08-01
The amino-terminal sequence of ribosomal protein L10 from Halobacterium marismortui has been determined up to residue 54, using both a liquid- and a gas-phase sequenator. The two sequences are in good agreement. The protein is clearly homologous to protein HcuL10 from the related strain Halobacterium cutirubrum. Furthermore, a weaker but distinct homology to ribosomal protein L6 from Escherichia coli and Bacillus stearothermophilus can be detected. In addition to 7 identical amino acids in the first 36 residues in all four sequences a number of conservative replacements occurs, of mainly hydrophobic amino acids. In this common region the pattern of conserved amino acids suggests the presence of a beta-alpha fold as it occurs in ribosomal proteins L12 and L30. Furthermore, several potential cases of homology to other ribosomal components of the three ur-kingdoms have been found.
Inkinen, J; Jayaprakash, B; Santo Domingo, J W; Keinänen-Toivola, M M; Ryu, H; Pitkänen, T
2016-06-01
Next-generation sequencing of 16S ribosomal RNA genes (rDNA) and ribosomal RNA (rRNA) was used to characterize water and biofilm microbiome collected from a drinking water distribution system of an office building after its first year of operation. The total bacterial community (rDNA) and active bacterial members (rRNA) sequencing databases were generated by Illumina MiSeq PE250 platform. As estimated by Chao1 index, species richness in cold water system was lower (180-260) in biofilms (Sphingomonas spp., Methylobacterium spp., Limnohabitans spp., Rhizobiales order) than in waters (250-580), (also Methylotenera spp.) (P = 0·005, n = 20). Similarly species richness (Chao1) was slightly higher (210-580) in rDNA libraries compared to rRNA libraries (150-400; P = 0·054, n = 24). Active Mycobacterium spp. was found in cross-linked polyethylene (PEX), but not in corresponding copper pipeline biofilm. Nonpathogenic Legionella spp. was found in rDNA libraries but not in rRNA libraries. Microbial communities differed between water and biofilms, between cold and hot water systems, locations in the building and between water rRNA and rDNA libraries, as shown by clear clusters in principal component analysis (PcoA). By using the rRNA method, we found that not all bacterial community members were active (e.g. Legionella spp.), whereas other members showed increased activity in some locations; for example, Pseudomonas spp. in hot water circulations' biofilm and order Rhizobiales and Limnohabitans spp. in stagnated locations' water and biofilm. rRNA-based methods may be better than rDNA-based methods for evaluating human health implications as rRNA methods can be used to describe the active bacterial fraction. This study indicates that copper as a pipeline material might have an adverse impact on the occurrence of Mycobacterium spp. The activity of Legionella spp. maybe questionable when detected solely by using DNA-based methods. © 2016 The Society for Applied
Directory of Open Access Journals (Sweden)
Mahsa Shahbakhsh
2016-02-01
Full Text Available Background: The Fasciola trematodes are the most common liver flukes, living in a range of animals with global distribution and resulting in profound economic loss and public health challenges. Previous studies have indicated that the sequences of the second internal transcribed spacer (ITS-2 of ribosomal DNA (rDNA provide reliable genetic markers for molecular systemic studies of Fasciola. Objectives: The objective of the present study was to characterize Fasciola samples from different geographical regions of Sistan and Balouchestan province using sequences of second internal transcribed spacer (ITS-2 of ribosomal DNA (rDNA. Materials and Methods: Twenty adult trematodes were collected from the livers of slaughtered infected cattle. Total genomic DNA was extracted and ITS-2 rDNA targets were amplified by polymerase chain reaction (PCR. All samples were sequenced and investigated using the ClustalW2 sequence alignment tool and MEGA software. The sequences of some Iranian and non-Iranian isolates were used for comparison, in order to evaluate the variation in sequence homology between geographically different trematode populations. Results: The results of comparing the ITS-2 sequences with the BLAST GenBank database showed one type of sequence for F. hepatica and three different types of sequences for F. gigantica in the specimens. Conclusions: The present study demonstrated that Fasciola samples from cattle in two geographical locations in Sistan and Balouchestan province represented no genetic diversity in F. hepatica and high genetic variation in F. gigantica.
The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus.
Hori, H; Osawa, S; Murao, K; Ishikura, H
1980-01-01
The nucleotide sequence of ribosomal 5S RNA from Micrococcus lysodeikticus is pGUUACGGCGGCUAUAGCGUGGGGGAAACGCCCGGCCGUAUAUCGAACCCGGAAGCUAAGCCCCAUAGCGCCGAUGGUUACUGUAACCGGGAGGUUGUGGGAGAGUAGGUCGCCGCCGUGAOH. When compared to other 5S RNAs, the sequence homology is greatest with Thermus aquaticus, and these two 5S RNAs reveal several features intermediate between those of typical gram-positive bacteria and gram-negative bacteria. PMID:6780979
Hoy, Marshal S.; Rodriguez, Rusty J.
2013-01-01
Molecular genetic analysis was conducted on two populations of the invasive non-native New Zealand mud snail (Potamopyrgus antipodarum), one from a freshwater ecosystem in Devil's Lake (Oregon, USA) and the other from an ecosystem of higher salinity in the Columbia River estuary (Hammond Harbor, Oregon, USA). To elucidate potential genetic differences between the two populations, three segments of nuclear ribosomal DNA (rDNA), the ITS1-ITS2 regions and the 18S and 28S rDNA genes were cloned and sequenced. Variant sequences within each individual were found in all three rDNA segments. Folding models were utilized for secondary structure analysis and results indicated that there were many sequences which contained structure-altering polymorphisms, which suggests they could be nonfunctional pseudogenes. In addition, analysis of molecular variance (AMOVA) was used for hierarchical analysis of genetic variance to estimate variation within and among populations and within individuals. AMOVA revealed significant variation in the ITS region between the populations and among clones within individuals, while in the 5.8S rDNA significant variation was revealed among individuals within the two populations. High levels of intragenomic variation were found in the ITS regions, which are known to be highly variable in many organisms. More interestingly, intragenomic variation was also found in the 18S and 28S rDNA, which has rarely been observed in animals and is so far unreported in Mollusca. We postulate that in these P. antipodarum populations the effects of concerted evolution are diminished due to the fact that not all of the rDNA genes in their polyploid genome should be essential for sustaining cellular function. This could lead to a lessening of selection pressures, allowing mutations to accumulate in some copies, changing them into variant sequences.
DEFF Research Database (Denmark)
Skovgaard, Alf; Meyer, Stefan; Overton, Julia Lynne
2010-01-01
An enigmatic protistan endoparasite found in eggs and larvae of cod Gadus morhua and turbot Psetta maxima was isolated from Baltic cod larvae, and DNA was extracted for sequencing of the parasite's small Subunit ribosomal RNA (SSU rRNA) gene. The endoparasite has previously been suggested...... to be related to Ichthyodinium chabelardi, a dinoflagellate-like protist that parasitizes yolk sacs of embryos and larvae of a variety of fish species. Comparison of a 1535 bp long fragment of the SSU rRNA gene of the cod endoparasite showed absolute identify with I. chabelardi, demonstrating that the 2...
The NBS1-Treacle complex controls ribosomal RNA transcription in response to DNA damage
DEFF Research Database (Denmark)
Larsen, Dorthe H; Hari, Flurina; Clapperton, Julie A
2014-01-01
Chromosome breakage elicits transient silencing of ribosomal RNA synthesis, but the mechanisms involved remained elusive. Here we discover an in trans signalling mechanism that triggers pan-nuclear silencing of rRNA transcription in response to DNA damage. This is associated with transient...... recruitment of the Nijmegen breakage syndrome protein 1 (NBS1), a central regulator of DNA damage responses, into the nucleoli. We further identify TCOF1 (also known as Treacle), a nucleolar factor implicated in ribosome biogenesis and mutated in Treacher Collins syndrome, as an interaction partner of NBS1...
Genetic diversity of Entamoeba: Novel ribosomal lineages from cockroaches.
Directory of Open Access Journals (Sweden)
Tetsuro Kawano
Full Text Available Our current taxonomic perspective on Entamoeba is largely based on small-subunit ribosomal RNA genes (SSU rDNA from Entamoeba species identified in vertebrate hosts with minor exceptions such as E. moshkovskii from sewage water and E. marina from marine sediment. Other Entamoeba species have also been morphologically identified and described from non-vertebrate species such as insects; however, their genetic diversity remains unknown. In order to further disclose the diversity of the genus, we investigated Entamoeba spp. in the intestines of three cockroach species: Periplaneta americana, Blaptica dubia, and Gromphadorhina oblongonota. We obtained 134 Entamoeba SSU rDNA sequences from 186 cockroaches by direct nested PCR using the DNA extracts of intestines from cockroaches, followed by scrutinized BLASTn screening and phylogenetic analyses. All the sequences identified in this study were distinct from those reported from known Entamoeba species, and considered as novel Entamoeba ribosomal lineages. Furthermore, they were positioned at the base of the clade of known Entamoeba species and displayed remarkable degree of genetic diversity comprising nine major groups in the three cockroach species. This is the first report of the diversity of SSU rDNA sequences from Entamoeba in non-vertebrate host species, and should help to understand the genetic diversity of the genus Entamoeba.
Early Lyme disease with spirochetemia - diagnosed by DNA sequencing
Directory of Open Access Journals (Sweden)
Jones William
2010-11-01
Full Text Available Abstract Background A sensitive and analytically specific nucleic acid amplification test (NAAT is valuable in confirming the diagnosis of early Lyme disease at the stage of spirochetemia. Findings Venous blood drawn from patients with clinical presentations of Lyme disease was tested for the standard 2-tier screen and Western Blot serology assay for Lyme disease, and also by a nested polymerase chain reaction (PCR for B. burgdorferi sensu lato 16S ribosomal DNA. The PCR amplicon was sequenced for B. burgdorferi genomic DNA validation. A total of 130 patients visiting emergency room (ER or Walk-in clinic (WALKIN, and 333 patients referred through the private physicians' offices were studied. While 5.4% of the ER/WALKIN patients showed DNA evidence of spirochetemia, none (0% of the patients referred from private physicians' offices were DNA-positive. In contrast, while 8.4% of the patients referred from private physicians' offices were positive for the 2-tier Lyme serology assay, only 1.5% of the ER/WALKIN patients were positive for this antibody test. The 2-tier serology assay missed 85.7% of the cases of early Lyme disease with spirochetemia. The latter diagnosis was confirmed by DNA sequencing. Conclusion Nested PCR followed by automated DNA sequencing is a valuable supplement to the standard 2-tier antibody assay in the diagnosis of early Lyme disease with spirochetemia. The best time to test for Lyme spirochetemia is when the patients living in the Lyme disease endemic areas develop unexplained symptoms or clinical manifestations that are consistent with Lyme disease early in the course of their illness.
Directory of Open Access Journals (Sweden)
Olesya G. Buleu
2017-09-01
Full Text Available The karyotypes of three species of Pyrgomorphidae grasshoppers were studied: Zonocerus elegans (Thunberg, 1815, Pyrgomorpha guentheri (Burr, 1899 and Atractomorpha lata (Mochulsky, 1866. Data on karyotypes of P. guentheri and Z. elegans are reported here for the first time. All species have karyotypes consisting of 19 acrocentric chromosomes in males and 20 acrocentric chromosomes in females (2n♂=19, NF=19; 2n♀=20, NF=20 and X0/XX sex determination system. A comparative analysis of the localization of C-heterochromatin, clusters of ribosomal DNA, and telomere repeats revealed inter-species diversity in these cytogenetic markers. These differences indicate that the karyotype divergence in the species studied is not associated with structural chromosome rearrangements, but with the evolution of repeated DNA sequences.
Zhuo, L; Reed, K M; Phillips, R B
1995-06-01
Variation in the intergenic spacer (IGS) of the ribosomal DNA (rDNA) of lake trout (Salvelinus namaycush) was examined. Digestion of genomic DNA with restriction enzymes showed that almost every individual had a unique combination of length variants with most of this variation occurring within rather than between populations. Sequence analysis of a 2.3 kilobase (kb) EcoRI-DraI fragment spanning the 3' end of the 28S coding region and approximately 1.8 kb of the IGS revealed two blocks of repetitive DNA. Putative transcriptional termination sites were found approximately 220 bases (b) downstream from the end of the 28S coding region. Comparison of the 2.3-kb fragments with two longer (3.1 kb) fragments showed that the major difference in length resulted from variation in the number of short (89 b) repeats located 3' to the putative terminator. Repeat units within a single nucleolus organizer region (NOR) appeared relatively homogeneous and genetic analysis found variants to be stably inherited. A comparison of the number of spacer-length variants with the number of NORs found that the number of length variants per individual was always less than the number of NORs. Examination of spacer variants in five populations showed that populations with more NORs had more spacer variants, indicating that variants are present at different rDNA sites on nonhomologous chromosomes.
Taxonomy and phylogeny of the genus citrus based on the nuclear ribosomal dna its region sequence
International Nuclear Information System (INIS)
Sun, Y.L.
2015-01-01
The genus Citrus (Aurantioideae, Rutaceae) is the sole source of the citrus fruits of commerce showing high economic values. In this study, the taxonomy and phylogeny of Citrus species is evaluated using sequence analysis of the ITS region of nrDNA. This study is based on 26 plants materials belonging to 22 Citrus species having wild, domesticated, and cultivated species. Through DNA alignment of the ITS sequence, ITS1 and ITS2 regions showed relatively high variations of sequence length and nucleotide among these Citrus species. According to previous six-tribe discrimination theory by Swingle and Reece, the grouping in our ITS phylogenetic tree reconstructed by ITS sequences was not related to tribe discrimination but species discrimination. However, the molecular analysis could provide more information on citrus taxonomy. Combined with ITS sequences of other subgenera in then true citrus fruit tree group, the ITS phylogenetic tree indicated subgenera Citrus was monophyletic and nearer to Fortunella, Poncirus, and Clymenia compared to Microcitrus and Eremocitrus. Abundant sequence variations of the ITS region shown in this study would help species identification and tribe differentiation of the genus Citrus. (author)
Nuclear ribosomal DNA diversity of a cotton pest ( Rotylenchulus ...
African Journals Online (AJOL)
The reniform nematode (Rotylenchulus reniformis) has emerged as a major cotton pest in the United States. A recent analysis of over 20 amphimictic populations of this pest from the US and three other countries has shown no sequence variation at the nuclear ribosomal internal transcribed spacer (ITS) despite the region's ...
Kröber, Magdalena; Bekel, Thomas; Diaz, Naryttza N; Goesmann, Alexander; Jaenicke, Sebastian; Krause, Lutz; Miller, Dimitri; Runte, Kai J; Viehöver, Prisca; Pühler, Alfred; Schlüter, Andreas
2009-06-01
The phylogenetic structure of the microbial community residing in a fermentation sample from a production-scale biogas plant fed with maize silage, green rye and liquid manure was analysed by an integrated approach using clone library sequences and metagenome sequence data obtained by 454-pyrosequencing. Sequencing of 109 clones from a bacterial and an archaeal 16S-rDNA amplicon library revealed that the obtained nucleotide sequences are similar but not identical to 16S-rDNA database sequences derived from different anaerobic environments including digestors and bioreactors. Most of the bacterial 16S-rDNA sequences could be assigned to the phylum Firmicutes with the most abundant class Clostridia and to the class Bacteroidetes, whereas most archaeal 16S-rDNA sequences cluster close to the methanogen Methanoculleus bourgensis. Further sequences of the archaeal library most probably represent so far non-characterised species within the genus Methanoculleus. A similar result derived from phylogenetic analysis of mcrA clone sequences. The mcrA gene product encodes the alpha-subunit of methyl-coenzyme-M reductase involved in the final step of methanogenesis. BLASTn analysis applying stringent settings resulted in assignment of 16S-rDNA metagenome sequence reads to 62 16S-rDNA amplicon sequences thus enabling frequency of abundance estimations for 16S-rDNA clone library sequences. Ribosomal Database Project (RDP) Classifier processing of metagenome 16S-rDNA reads revealed abundance of the phyla Firmicutes, Bacteroidetes and Euryarchaeota and the orders Clostridiales, Bacteroidales and Methanomicrobiales. Moreover, a large fraction of 16S-rDNA metagenome reads could not be assigned to lower taxonomic ranks, demonstrating that numerous microorganisms in the analysed fermentation sample of the biogas plant are still unclassified or unknown.
Tarcz, Sebastian
2013-01-01
Paramecium novaurelia Beale and Schneller, 1954, was first found in Scotland and is known to occur mainly in Europe, where it is the most common species of the P. aurelia complex. In recent years, two non-European localities have been described: Turkey and the United States of America. This article presents the analysis of intraspecific variability among 25 strains of P. novaurelia with the application of ribosomal and mitochondrial loci (ITS1-5.8S-ITS2, 5' large subunit rDNA (5'LSU rDNA) and cytochrome c oxidase subunit 1 (COI) mtDNA). The mean distance observed for all of the studied P. novaurelia sequence pairs was p=0.008/0.016/0.092 (ITS1-5.8S-ITS2/5'LSU rDNA/COI). Phylogenetic trees (NJ/MP/BI) based on a comparison of all of the analysed sequences show that the studied strains of P. novaurelia form a distinct clade, separate from the P. caudatum outgroup, and are divided into two clusters (A and B) and two branches (C and D). The occurrence of substantial genetic differentiation within P. novaurelia, confirmed by the analysed DNA fragments, indicates a rapid evolution of particular species within the Paramecium genus. Copyright © 2012 Elsevier GmbH. All rights reserved.
Gasser, R B; Rossi, L; Zhu, X
1999-11-01
The sequence of the second internal transcribed spacer of ribosomal DNA was determined for four species of Nematodirus (Nematodirus rupicaprae, Nematodirus oiratianus, Nematodirus davtiani alpinus and Nematodirus europaeus) from roe deer or alpine chamois. The second internal transcribed spacer of the four species varied in length from 228 to 236 bp, and the G + C contents ranged from 41 to 44%. While no intraspecific sequence variation was detected among multiple samples representing three of the taxa, sequence differences of 5.9-9.7% were detected among the four species, Nematodirus davtiani alpinus and N. rupicaprae were genetically most similar (94.1%), followed by N. oiratianus, N. europaeus and N. rupicaprae (91.1-91.5%), whereas N. oiratianus was genetically most different from N. davtiani alpinus. The interspecific sequence differences were exploited for the delineation of the four species by PCR-based restriction fragment length polymorphism (using two enzymes) and single-strand conformation polymorphism. The results have implications for diagnosis, epidemiology and for studying the systematics of the Nematodirinae.
Su, Lei; Zhang, Qianqian; Gong, Jun
2017-07-01
Peritrich ciliates are highly diverse and can be important bacterial grazers in aquatic ecosystems. Morphological identifications of peritrich species and assemblages in the environment are time-consuming and expertise-demanding. In this study, two peritrich-specific PCR primers were newly designed to amplify a fragment including the internal transcribed spacer (ITS) region of ribosomal rDNA from environmental samples. The primers showed high specificity in silico, and in tests with peritrich isolates and environmental DNA. Application of these primers in clone library construction and sequencing yielded exclusively sequences of peritrichs for water and sediment samples. We also found the ITS1, ITS2, ITS, D1 region of 28S rDNA, and ITS+D1 region co-varied with, and generally more variable than, the V9 region of 18S rDNA in peritrichs. The newly designed specific primers thus provide additional tools to study the molecular diversity, community composition, and phylogeography of these ecologically important protists in different systems.
High-Resolution Analysis of Coronavirus Gene Expression by RNA Sequencing and Ribosome Profiling.
Irigoyen, Nerea; Firth, Andrew E; Jones, Joshua D; Chung, Betty Y-W; Siddell, Stuart G; Brierley, Ian
2016-02-01
Members of the family Coronaviridae have the largest genomes of all RNA viruses, typically in the region of 30 kilobases. Several coronaviruses, such as Severe acute respiratory syndrome-related coronavirus (SARS-CoV) and Middle East respiratory syndrome-related coronavirus (MERS-CoV), are of medical importance, with high mortality rates and, in the case of SARS-CoV, significant pandemic potential. Other coronaviruses, such as Porcine epidemic diarrhea virus and Avian coronavirus, are important livestock pathogens. Ribosome profiling is a technique which exploits the capacity of the translating ribosome to protect around 30 nucleotides of mRNA from ribonuclease digestion. Ribosome-protected mRNA fragments are purified, subjected to deep sequencing and mapped back to the transcriptome to give a global "snap-shot" of translation. Parallel RNA sequencing allows normalization by transcript abundance. Here we apply ribosome profiling to cells infected with Murine coronavirus, mouse hepatitis virus, strain A59 (MHV-A59), a model coronavirus in the same genus as SARS-CoV and MERS-CoV. The data obtained allowed us to study the kinetics of virus transcription and translation with exquisite precision. We studied the timecourse of positive and negative-sense genomic and subgenomic viral RNA production and the relative translation efficiencies of the different virus ORFs. Virus mRNAs were not found to be translated more efficiently than host mRNAs; rather, virus translation dominates host translation at later time points due to high levels of virus transcripts. Triplet phasing of the profiling data allowed precise determination of translated reading frames and revealed several translated short open reading frames upstream of, or embedded within, known virus protein-coding regions. Ribosome pause sites were identified in the virus replicase polyprotein pp1a ORF and investigated experimentally. Contrary to expectations, ribosomes were not found to pause at the ribosomal
High-Resolution Analysis of Coronavirus Gene Expression by RNA Sequencing and Ribosome Profiling.
Directory of Open Access Journals (Sweden)
Nerea Irigoyen
2016-02-01
Full Text Available Members of the family Coronaviridae have the largest genomes of all RNA viruses, typically in the region of 30 kilobases. Several coronaviruses, such as Severe acute respiratory syndrome-related coronavirus (SARS-CoV and Middle East respiratory syndrome-related coronavirus (MERS-CoV, are of medical importance, with high mortality rates and, in the case of SARS-CoV, significant pandemic potential. Other coronaviruses, such as Porcine epidemic diarrhea virus and Avian coronavirus, are important livestock pathogens. Ribosome profiling is a technique which exploits the capacity of the translating ribosome to protect around 30 nucleotides of mRNA from ribonuclease digestion. Ribosome-protected mRNA fragments are purified, subjected to deep sequencing and mapped back to the transcriptome to give a global "snap-shot" of translation. Parallel RNA sequencing allows normalization by transcript abundance. Here we apply ribosome profiling to cells infected with Murine coronavirus, mouse hepatitis virus, strain A59 (MHV-A59, a model coronavirus in the same genus as SARS-CoV and MERS-CoV. The data obtained allowed us to study the kinetics of virus transcription and translation with exquisite precision. We studied the timecourse of positive and negative-sense genomic and subgenomic viral RNA production and the relative translation efficiencies of the different virus ORFs. Virus mRNAs were not found to be translated more efficiently than host mRNAs; rather, virus translation dominates host translation at later time points due to high levels of virus transcripts. Triplet phasing of the profiling data allowed precise determination of translated reading frames and revealed several translated short open reading frames upstream of, or embedded within, known virus protein-coding regions. Ribosome pause sites were identified in the virus replicase polyprotein pp1a ORF and investigated experimentally. Contrary to expectations, ribosomes were not found to pause at the
SINA: accurate high-throughput multiple sequence alignment of ribosomal RNA genes.
Pruesse, Elmar; Peplies, Jörg; Glöckner, Frank Oliver
2012-07-15
In the analysis of homologous sequences, computation of multiple sequence alignments (MSAs) has become a bottleneck. This is especially troublesome for marker genes like the ribosomal RNA (rRNA) where already millions of sequences are publicly available and individual studies can easily produce hundreds of thousands of new sequences. Methods have been developed to cope with such numbers, but further improvements are needed to meet accuracy requirements. In this study, we present the SILVA Incremental Aligner (SINA) used to align the rRNA gene databases provided by the SILVA ribosomal RNA project. SINA uses a combination of k-mer searching and partial order alignment (POA) to maintain very high alignment accuracy while satisfying high throughput performance demands. SINA was evaluated in comparison with the commonly used high throughput MSA programs PyNAST and mothur. The three BRAliBase III benchmark MSAs could be reproduced with 99.3, 97.6 and 96.1 accuracy. A larger benchmark MSA comprising 38 772 sequences could be reproduced with 98.9 and 99.3% accuracy using reference MSAs comprising 1000 and 5000 sequences. SINA was able to achieve higher accuracy than PyNAST and mothur in all performed benchmarks. Alignment of up to 500 sequences using the latest SILVA SSU/LSU Ref datasets as reference MSA is offered at http://www.arb-silva.de/aligner. This page also links to Linux binaries, user manual and tutorial. SINA is made available under a personal use license.
5S ribosomal RNA database Y2K.
Szymanski, M; Barciszewska, M Z; Barciszewski, J; Erdmann, V A
2000-01-01
This paper presents the updated version (Y2K) of the database of ribosomal 5S ribonucleic acids (5S rRNA) and their genes (5S rDNA), http://rose.man/poznan.pl/5SData/index.html. This edition of the database contains 1985primary structures of 5S rRNA and 5S rDNA. They include 60 archaebacterial, 470 eubacterial, 63 plastid, nine mitochondrial and 1383 eukaryotic sequences. The nucleotide sequences of the 5S rRNAs or 5S rDNAs are divided according to the taxonomic position of the source organisms.
Yu, Shoukai; Lemos, Bernardo
2016-12-31
Ribosomal RNAs (rRNAs) account for >60% of all RNAs in eukaryotic cells and are encoded in the ribosomal DNA (rDNA) arrays. The rRNAs are produced from two sets of loci: the 5S rDNA array resides exclusively on human chromosome 1, whereas the 45S rDNA array resides on the short arm of five human acrocentric chromosomes. The 45S rDNA gives origin to the nucleolus, the nuclear organelle that is the site of ribosome biogenesis. Intriguingly, 5S and 45S rDNA arrays exhibit correlated copy number variation in lymphoblastoid cells (LCLs). Here we examined the genomic architecture and repeat content of the 5S and 45S rDNA arrays in multiple human genome assemblies (including PacBio MHAP assembly) and ascertained contacts between the rDNA arrays and the rest of the genome using Hi-C datasets from two human cell lines (erythroleukemia K562 and lymphoblastoid cells). Our analyses revealed that 5S and 45S arrays each have thousands of contacts in the folded genome, with rDNA-associated regions and genes dispersed across all chromosomes. The rDNA contact map displayed conserved and disparate features between two cell lines, and pointed to specific chromosomes, genomic regions, and genes with evidence of spatial proximity to the rDNA arrays; the data also showed a lack of direct physical interaction between the 5S and 45S rDNA arrays. Finally, the analysis identified an intriguing organization in the 5S array with Alu and 5S elements adjacent to one another and organized in opposite orientation along the array. Portraits of genome folding centered on the ribosomal DNA array could help understand the emergence of concerted variation, the control of 5S and 45S expression, as well as provide insights into an organelle that contributes to the spatial localization of human chromosomes during interphase. © The Author(s) 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.
International Nuclear Information System (INIS)
Yagi, A.; Sato, Y.; Miwa, Y.; Kabbash, A.; Moustafa, S.; Shimomura, K.; El-Bassuony, A.
2006-01-01
A comparison of the sequences in an internally transcribed spacer (ITS) 1 region of rDNA between clonally regenerated A.vera and same species in Japan, USA and Egypt revealed the presence of two types of nucleotide sequences, 252 and 254 bps. Based on the findings in the ITS 1 region, A.vera having 252 and 254 bps clearly showed a stable sequence similarity, suggesting high conversation of the base peak sequence in the ITS 1 region. However, frequent base substitutions in the 252 bps samples leaves that came from callus tissue and micropropagated plants were observed around the regions of nucleotide positions 66, 99 and 199-201. The minor deviation in clonally regenerated A.vera may be due to the stage of regeneration and cell specification in cases of the callus tissue. In the present study, the base peak sequence of the Its 1 region of rDNA was adopted as a molecular marker for differentiating A.vera plants from geographically distributed and clonally regenerated A.vera plants and it was suggested that the base peak substitutions in the ITS 1 region may arise from the different nutritional and environmental factors in cultivation and plant growth stages. (author)
International Nuclear Information System (INIS)
Lipsius, Edgar; Walter, Korden; Leicher, Torsten; Phlippen, Wolfgang; Bisotti, Marc-Angelo; Kruppa, Joachim
2005-01-01
Over 1 billion years ago, the animal kingdom diverged from the fungi. Nevertheless, a high sequence homology of 62% exists between human ribosomal protein S6 and S6A of Saccharomyces cerevisiae. To investigate whether this similarity in primary structure is mirrored in corresponding functional protein domains, the nuclear and nucleolar targeting signals were delineated in yeast S6A and compared to the known human S6 signals. The complete sequence of S6A and cDNA fragments was fused to the 5'-end of the LacZ gene, the constructs were transiently expressed in COS cells, and the subcellular localization of the fusion proteins was detected by indirect immunofluorescence. One bipartite and two monopartite nuclear localization signals as well as two nucleolar binding domains were identified in yeast S6A, which are located at homologous regions in human S6 protein. Remarkably, the number, nature, and position of these targeting signals have been conserved, albeit their amino acid sequences have presumably undergone a process of co-evolution with their corresponding rRNAs
Abolhassani, Mohsen; Roux, Kenneth H
2009-06-01
Tree nuts, including almond (prunus dulcis) are a source of food allergens often associated with life-threatening allergic reactions in susceptible individuals. Although the proteins in almonds have been biochemically characterized, relatively little has been reported regarding the identity of the allergens involved in almond sensitivity. The present study was undertaken to identify the allergens of the almond by cDNA library approach. cDNA library of almond seeds was constructed in Uni-Zap XR lamda vector and expressed in E. coli XL-1 blue. Plaques were immunoscreened with pooled sera of allergic patients. The cDNA clone reacting significantly with specific IgE antibodies was selected and subcloned and subsequently expressed in E. coli. The amino acids deducted from PCR product of clone showed homology to 60s acidic ribosomal protein of almond. The expressed protein was 11,450 Dalton without leader sequence. Immunoreactivity of the recombinant 60s ribosomal protein (r60sRP) was evaluated with dot blot analysis using pooled and individual sera of allergic patients. The data showed that r60sRP and almond extract (as positive control) possess the ability to bind the IgE antibodies. The results showed that expressed protein is an almond allergen.Whether this r60sRP represents a major allergen of almond needs to be further studied which requires a large number of sera from the almond atopic patients and also need to determine the IgE-reactive frequencies of each individual allergen.
Directory of Open Access Journals (Sweden)
Albert Victor A
2011-09-01
Full Text Available Abstract Background Paphiopedilum is a horticulturally and ecologically important genus of ca. 80 species of lady's slipper orchids native to Southeast Asia. These plants have long been of interest regarding their chromosomal evolution, which involves a progressive aneuploid series based on either fission or fusion of centromeres. Chromosome number is positively correlated with genome size, so rearrangement processes must include either insertion or deletion of DNA segments. We have conducted Fluorescence In Situ Hybridization (FISH studies using 5S and 25S ribosomal DNA (rDNA probes to survey for rearrangements, duplications, and phylogenetically-correlated variation within Paphiopedilum. We further studied sequence variation of the non-transcribed spacers of 5S rDNA (5S-NTS to examine their complex duplication history, including the possibility that concerted evolutionary forces may homogenize diversity. Results 5S and 25S rDNA loci among Paphiopedilum species, representing all key phylogenetic lineages, exhibit a considerable diversity that correlates well with recognized evolutionary groups. 25S rDNA signals range from 2 (representing 1 locus to 9, the latter representing hemizygosity. 5S loci display extensive structural variation, and show from 2 specific signals to many, both major and minor and highly dispersed. The dispersed signals mainly occur at centromeric and subtelomeric positions, which are hotspots for chromosomal breakpoints. Phylogenetic analysis of cloned 5S rDNA non-transcribed spacer (5S-NTS sequences showed evidence for both ancient and recent post-speciation duplication events, as well as interlocus and intralocus diversity. Conclusions Paphiopedilum species display many chromosomal rearrangements - for example, duplications, translocations, and inversions - but only weak concerted evolutionary forces among highly duplicated 5S arrays, which suggests that double-strand break repair processes are dynamic and ongoing. These
Polymenakou, Paraskevi N; Bertilsson, Stefan; Tselepides, Anastasios; Stephanou, Euripides G
2005-10-01
The regional variability of sediment bacterial community composition and diversity was studied by comparative analysis of four large 16S ribosomal DNA (rDNA) clone libraries from sediments in different regions of the Eastern Mediterranean Sea (Thermaikos Gulf, Cretan Sea, and South lonian Sea). Amplified rDNA restriction analysis of 664 clones from the libraries indicate that the rDNA richness and evenness was high: for example, a near-1:1 relationship among screened clones and number of unique restriction patterns when up to 190 clones were screened for each library. Phylogenetic analysis of 207 bacterial 16S rDNA sequences from the sediment libraries demonstrated that Gamma-, Delta-, and Alphaproteobacteria, Holophaga/Acidobacteria, Planctomycetales, Actinobacteria, Bacteroidetes, and Verrucomicrobia were represented in all four libraries. A few clones also grouped with the Betaproteobacteria, Nitrospirae, Spirochaetales, Chlamydiae, Firmicutes, and candidate division OPl 1. The abundance of sequences affiliated with Gammaproteobacteria was higher in libraries from shallow sediments in the Thermaikos Gulf (30 m) and the Cretan Sea (100 m) compared to the deeper South Ionian station (2790 m). Most sequences in the four sediment libraries clustered with uncultured 16S rDNA phylotypes from marine habitats, and many of the closest matches were clones from hydrocarbon seeps, benzene-mineralizing consortia, sulfate reducers, sulk oxidizers, and ammonia oxidizers. LIBSHUFF statistics of 16S rDNA gene sequences from the four libraries revealed major differences, indicating either a very high richness in the sediment bacterial communities or considerable variability in bacterial community composition among regions, or both.
Restless 5S: the re-arrangement(s) and evolution of the nuclear ribosomal DNA in land plants.
Wicke, Susann; Costa, Andrea; Muñoz, Jesùs; Quandt, Dietmar
2011-11-01
Among eukaryotes two types of nuclear ribosomal DNA (nrDNA) organization have been observed. Either all components, i.e. the small ribosomal subunit, 5.8S, large ribosomal subunit, and 5S occur tandemly arranged or the 5S rDNA forms a separate cluster of its own. Generalizations based on data derived from just a few model organisms have led to a superimposition of structural and evolutionary traits to the entire plant kingdom asserting that plants generally possess separate arrays. This study reveals that plant nrDNA organization into separate arrays is not a distinctive feature, but rather assignable almost solely to seed plants. We show that early diverging land plants and presumably streptophyte algae share a co-localization of all rRNA genes within one repeat unit. This raises the possibility that the state of rDNA gene co-localization had occurred in their common ancestor. Separate rDNA arrays were identified for all basal seed plants and water ferns, implying at least two independent 5S rDNA transposition events during land plant evolution. Screening for 5S derived Cassandra transposable elements which might have played a role during the transposition events, indicated that this retrotransposon is absent in early diverging vascular plants including early fern lineages. Thus, Cassandra can be rejected as a primary mechanism for 5S rDNA transposition in water ferns. However, the evolution of Cassandra and other eukaryotic 5S derived elements might have been a side effect of the 5S rDNA cluster formation. Structural analysis of the intergenic spacers of the ribosomal clusters revealed that transposition events partially affect spacer regions and suggests a slightly different transcription regulation of 5S rDNA in early land plants. 5S rDNA upstream regulatory elements are highly divergent or absent from the LSU-5S spacers of most early divergent land plant lineages. Several putative scenarios and mechanisms involved in the concerted relocation of hundreds of 5S
de Oliveira, VM; Manfio, GP; Coutinho, HLD; Keijzer-Wolters, AC; van Elsas, JD
A direct molecular method for assessing the diversity of specific populations of rhizobia in soil, based on nested PCR amplification of 16S-23S ribosomal RNA gene (rDNA) intergenic spacer (IGS) sequences, was developed. Initial generic amplification of bacterial rDNA IGS sequences from soil DNA was
Oliveira, de V.M.; Manfio, G.P.; Coutinho, H.L.D.; Keijzer-Wolters, A.C.; Elsas, van J.D.
2006-01-01
A direct molecular method for assessing the diversity of specific populations of rhizobia in soil, based on nested PCR amplification of 16S-23S ribosomal RNA gene (rDNA) intergenic spacer (IGS) sequences, was developed. Initial generic amplification of bacterial rDNA IGS sequences from soil DNA was
Bellavia, Daniele; Dimarco, Eufrosina; Caradonna, Fabio
2016-04-15
We previously reported the characterization 5S ribosomal DNA (rDNA) clusters in the common sea urchin Paracentrotus lividus and demonstrated the presence of DNA methylation-dependent silencing of embryo specific 5S rDNA cluster in adult tissue. In this work, we show genetic and epigenetic characterization of 18S-26S rDNA clusters in this specie. The results indicate the presence of three different 18S-26S rDNA clusters with different Non-Transcribed Spacer (NTS) regions that have different chromosomal localizations. Moreover, we show that the two largest clusters are hyper-methylated in the promoter-containing NTS regions in adult tissues, as in the 5S rDNA. These findings demonstrate an analogous epigenetic regulation in small and large rDNA clusters and support the logical synchronism in building ribosomes. In fact, all the ribosomal RNA genes must be synchronously and equally transcribed to perform their unique final product. Copyright © 2016 Elsevier B.V. All rights reserved.
Tengs, T; Bowers, H A; Ziman, A P; Stoecker, D K; Oldach, D W
2001-02-01
Nuclear and chloroplast-encoded small subunit ribosomal DNA sequences were obtained from several strains of the toxic dinoflagellate Gymnodinium galatheanum. Phylogenetic analyses and comparison of sequences indicate that the chloroplast sequences show a higher degree of sequence divergence than the nuclear homologue. The chloroplast sequences were chosen as targets for the development of a 5'--3' exonuclease assay for detection of the organism. The assay has a very high degree of specificity and has been used to screen environmental water samples from a fish farm where the presence of this dinoflagellate species has previously been associated with fish kills. Various hypotheses for the derived nature of the chloroplast sequences are discussed, as well as what is known about the toxicity of the species.
Cruz, V P; Oliveira, C; Foresti, F
2015-01-01
5S rDNA genes of the stingray Potamotrygon motoro were PCR replicated, purified, cloned and sequenced. Two distinct classes of segments of different sizes were obtained. The smallest, with 342 bp units, was classified as class I, and the largest, with 1900 bp units, was designated as class II. Alignment with the consensus sequences for both classes showed changes in a few bases in the 5S rDNA genes. TATA-like sequences were detected in the nontranscribed spacer (NTS) regions of class I and a microsatellite (GCT) 10 sequence was detected in the NTS region of class II. The results obtained can help to understand the molecular organization of ribosomal genes and the mechanism of gene dispersion.
[Characterization of Black and Dichothrix Cyanobacteria Based on the 16S Ribosomal RNA Gene Sequence
Ortega, Maya
2010-01-01
My project focuses on characterizing different cyanobacteria in thrombolitic mats found on the island of Highborn Cay, Bahamas. Thrombolites are interesting ecosystems because of the ability of bacteria in these mats to remove carbon dioxide from the atmosphere and mineralize it as calcium carbonate. In the future they may be used as models to develop carbon sequestration technologies, which could be used as part of regenerative life systems in space. These thrombolitic communities are also significant because of their similarities to early communities of life on Earth. I targeted two cyanobacteria in my research, Dichothrix spp. and whatever black is, since they are believed to be important to carbon sequestration in these thrombolitic mats. The goal of my summer research project was to molecularly identify these two cyanobacteria. DNA was isolated from each organism through mat dissections and DNA extractions. I ran Polymerase Chain Reactions (PCR) to amplify the 16S ribosomal RNA (rRNA) gene in each cyanobacteria. This specific gene is found in almost all bacteria and is highly conserved, meaning any changes in the sequence are most likely due to evolution. As a result, the 16S rRNA gene can be used for bacterial identification of different species based on the sequence of their 16S rRNA gene. Since the exact sequence of the Dichothrix gene was unknown, I designed different primers that flanked the gene based on the known sequences from other taxonomically similar cyanobacteria. Once the 16S rRNA gene was amplified, I cloned the gene into specialized Escherichia coli cells and sent the gene products for sequencing. Once the sequence is obtained, it will be added to a genetic database for future reference to and classification of other Dichothrix sp.
Llanos, Susana; Serrano, Manuel
2010-10-01
Perturbation of ribosomal biogenesis has recently emerged as a relevant p53-activating pathway. This pathway can be initiated by depletion of certain ribosomal proteins, which is followed by the binding and inhibition of MDM2 by a different subset of ribosomal proteins that includes L11. Here, we report that depletion of L37 leads to cell cycle arrest in a L11- and p53-dependent manner. DNA damage can initiate ribosomal stress, although little is known about the mechanisms involved. We have found that some genotoxic insults, namely, UV light and cisplatin, lead to proteasomal degradation of L37 in the nucleoplasm and to the ensuing L11-dependent stabilization of p53. Moreover, ectopic L37 overexpression can attenuate the DNA damage response mediated by p53. These results support the concept that DNA damage-induced proteasomal degradation of L37 constitutes a mechanistic link between DNA damage and the ribosomal stress pathway, and is a relevant contributing signaling pathway for the activation of p53 in response to DNA damage.
Calhoun, Dana M; Curran, Stephen S; Pulis, Eric E; Provaznik, Jennifer M; Franks, James S
2013-10-01
Digeneans in the genus Hirudinella de Blainville, 1828 (Hirudinellidae) from three species of pelagic fishes, Acanthocybium solandri (Cuvier), Makaira nigricans Lacépède and Thunnus albacares (Bonnaterre), and one benthic fish, Mulloidichthys martinicus (Cuvier), from the Gulf of Mexico are investigated using comparison of ribosomal DNA. Four species are identified based on molecular differences: Hirudinella ventricosa (Pallas, 1774) Baird, 1853 from A. solandri, Hirudinella ahi Yamaguti, 1970 from T. albacares, and two unidentified but distinct species of Hirudinella, herein referred to as Hirudinella sp. A (from both M. nigricans and M. martinicus) and Hirudinella sp. B from M. nigricans. Additionally, H. ahi, based tentatively on morphological identification, is reported from Thunnus thynnus (Linnaeus). This represents the first record of a hirudinellid from M. martinicus and the first record of H. ahi from T. thynnus. A phylogeny of some Hemiurata Skrjabin & Guschanskaja, 1954 using partial fragments of the 28S rDNA sequences is consistent with earlier phylogenies and the position of the Hirudinellidae Dollfus, 1932 is well-supported as a derived group most closely related to the Syncoeliidae Looss, 1899.
International Nuclear Information System (INIS)
Mori, Y.; Sato, Y.; Takamatsu, S.
2000-01-01
Phylogenetic relationships of Erysiphales within Ascomycota were inferred from the newly determined sequences of the 18S rDNA and partial sequences of the 28S rDNA including the D1 and D2 regions of 10 Erysiphales taxa. Phylogenetic analyses revealed that the Erysiphales form a distinct clade among ascomycetous fungi suggesting that the Erysiphales diverged from a single ancestral taxon. The Myxotrichaceae of the Onygenales was distantly related to the other onygenalean families and was the sister group to the Erysiphales calde, with which it combined to form a clade. The Erysiphales/Myxotrichaceae clade was also closely related to some discomycetous fungi (Leotiales, Cyttariales and Thelebolaceae) including taxa that form cleistothecial ascomata. The present molecular analyses as well as previously reported morphological observations suggest the possible existence of a novel evolutionary pathway from cleistothecial discomycetous fungi to Erysiphales and Myxotrichaceae. However, since most of these fungi, except for the Erysiphales, are saprophytic on dung and/or plant materials, the questions of how and why an obligate biotroph like the Erysiphales radiated from the saprophytic fungi remain to be addressed. We also estimated the radiation time of the Erysiphales using the 18S rDNA sequences and the two molecular clockes that have been previously reported. The calculation showed that the Erysiphales split from the Myxotrichaceae 190–127 myr ago. Since the radiation time of the Erysiphales does not exceed 230 myr ago, even when allowance is made for the uncertainty of the molecular clocks, it is possible to consider that the Erysiphales evolved after the radiation of angiosperms. The results of our calculation also showed that the first radiation within the Erysiphales (138–92 myr ago) coincided with the date of a major diversification of angiosperms (130–90 myr ago). These results may support our early assumption that the radiation of the Erysiphales
Repeated DNA sequences in fungi
Energy Technology Data Exchange (ETDEWEB)
Dutta, S K
1974-11-01
Several fungal species, representatives of all broad groups like basidiomycetes, ascomycetes and phycomycetes, were examined for the nature of repeated DNA sequences by DNA:DNA reassociation studies using hydroxyapatite chromatography. All of the fungal species tested contained 10 to 20 percent repeated DNA sequences. There are approximately 100 to 110 copies of repeated DNA sequences of approximately 4 x 10/sup 7/ daltons piece size of each. Repeated DNA sequence homoduplexes showed on average 5/sup 0/C difference of T/sub e/50 (temperature at which 50 percent duplexes dissociate) values from the corresponding homoduplexes of unfractionated whole DNA. It is suggested that a part of repetitive sequences in fungi constitutes mitochondrial DNA and a part of it constitutes nuclear DNA. (auth)
Directory of Open Access Journals (Sweden)
María Angeles Zuriaga
2015-05-01
Full Text Available A pseudogene, designated as "ps(5.8S+ITS-2", paralogous to the 5.8S gene and internal transcribed spacer (ITS-2 of the nuclear ribosomal DNA (rDNA, has been recently found in many triatomine species distributed throughout North America, Central America and northern South America. Among characteristics used as criteria for pseudogene verification, secondary structures and free energy are highlighted, showing a lower fit between minimum free energy, partition function and centroid structures, although in given cases the fit only appeared to be slightly lower. The unique characteristics of "ps(5.8S+ITS-2" as a processed or retrotransposed pseudogenic unit of the ghost type are reviewed, with emphasis on its potential functionality compared to the functionality of genes and spacers of the normal rDNA operon. Besides the technical problem of the risk for erroneous sequence results, the usefulness of "ps(5.8S+ITS-2" for specimen classification, phylogenetic analyses and systematic/taxonomic studies should be highlighted, based on consistence and retention index values, which in pseudogenic sequence trees were higher than in functional sequence trees. Additionally, intraindividual, interpopulational and interspecific differences in pseudogene amount and the fact that it is a pseudogene in the nuclear rDNA suggests a potential relationships with fitness, behaviour and adaptability of triatomine vectors and consequently its potential utility in Chagas disease epidemiology and control.
Draisma, S.G A; Prud'homme van Reine, W.F; Stam, W.T.; Olsen, J.L.
To better assess the current state of phaeophycean phylogeny, we compiled all currently available rbcL, 18S, and 26S rDNA sequences from the EMBL/GenBank database and added 21 new rbcL sequences of our own. We then developed three new alignments designed to maximize taxon sampling while minimizing
Takeo, Toshinori; Tanaka, Tetsuya; Matsubayashi, Makoto; Maeda, Hiroki; Kusakisako, Kodai; Matsui, Toshihiro; Mochizuki, Masami; Matsuo, Tomohide
2014-08-01
Previously, we characterized an undocumented strain of Eimeria krijgsmanni by morphological and biological features. Here, we present a detailed molecular phylogenetic analysis of this organism. Namely, 18S ribosomal RNA gene (rDNA) sequences of E. krijgsmanni were analyzed to incorporate this species into a comprehensive Eimeria phylogeny. As a result, partial 18S rDNA sequence from E. krijgsmanni was successfully determined, and two different types, Type A and Type B, that differed by 1 base pair were identified. E. krijgsmanni was originally isolated from a single oocyst, and thus the result show that the two types might have allelic sequence heterogeneity in the 18S rDNA. Based on phylogenetic analyses, the two types of E. krijgsmanni 18S rDNA formed one of two clades among murine Eimeria spp.; these Eimeria clades reflected morphological similarity among the Eimeria spp. This is the third molecular phylogenetic characterization of a murine Eimeria spp. in addition to E. falciformis and E. papillata. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.
Callejón, R; Halajian, A; de Rojas, M; Marrugal, A; Guevara, D; Cutillas, C
2012-05-25
Comparative morphological, biometrical and molecular studies of Trichuris discolor isolated from Bos taurus from Spain and Iran was carried out. Furthermore, Trichuris ovis isolated from B. taurus and Capra hircus from Spain has been, molecularly, analyzed. Morphological studies revealed clear differences between T. ovis and T. discolor isolated from B. taurus but differences were not observed between populations of T. discolor isolated from different geographical regions. Nevertheless, the molecular studies based on the amplification and sequencing of the internal transcribed spacers 1 and 2 ribosomal DNA and 16S partial gene mitochondrial DNA showed clear differences between both populations of T. discolor from Spain and Iran suggesting two cryptic species. Phylogenetic studies corroborated these data. Thus, phylogenetic trees based on ITS1, ITS2 and 16S partial gene sequences showed that individuals of T. discolor from B. taurus from Iran clustered together and separated, with high bootstrap values, of T. discolor isolated from B. taurus from Spain, while populations of T. ovis from B. taurus and C. hircus from Spain clustered together but separated with high bootstrap values of both populations of T. discolor. Furthermore, a comparative phylogenetic study has been carried out with the ITS1and ITS2 sequences of Trichuris species from different hosts. Three clades were observed: the first clustered all the species of Trichuris parasitizing herbivores (T. discolor, T. ovis, Trichuris leporis and Trichuris skrjabini), the second clustered all the species of Trichuris parasitizing omnivores (Trichuris trichiura and Trichuris suis) and finally, the third clustered species of Trichuris parasitizing carnivores (Trichuris muris, Trichuris arvicolae and Trichuris vulpis). Copyright © 2011 Elsevier B.V. All rights reserved.
Are ribosomal DNA clusters rearrangement hotspots? A case study in the genus Mus (Rodentia, Muridae
Directory of Open Access Journals (Sweden)
Douzery Emmanuel JP
2011-05-01
Full Text Available Abstract Background Recent advances in comparative genomics have considerably improved our knowledge of the evolution of mammalian karyotype architecture. One of the breakthroughs was the preferential localization of evolutionary breakpoints in regions enriched in repetitive sequences (segmental duplications, telomeres and centromeres. In this context, we investigated the contribution of ribosomal genes to genome reshuffling since they are generally located in pericentromeric or subtelomeric regions, and form repeat clusters on different chromosomes. The target model was the genus Mus which exhibits a high rate of karyotypic change, a large fraction of which involves centromeres. Results The chromosomal distribution of rDNA clusters was determined by in situ hybridization of mouse probes in 19 species. Using a molecular-based reference tree, the phylogenetic distribution of clusters within the genus was reconstructed, and the temporal association between rDNA clusters, breakpoints and centromeres was tested by maximum likelihood analyses. Our results highlighted the following features of rDNA cluster dynamics in the genus Mus: i rDNA clusters showed extensive diversity in number between species and an almost exclusive pericentromeric location, ii a strong association between rDNA sites and centromeres was retrieved which may be related to their shared constraint of concerted evolution, iii 24% of the observed breakpoints mapped near an rDNA cluster, and iv a substantial rate of rDNA cluster change (insertion, deletion also occurred in the absence of chromosomal rearrangements. Conclusions This study on the dynamics of rDNA clusters within the genus Mus has revealed a strong evolutionary relationship between rDNA clusters and centromeres. Both of these genomic structures coincide with breakpoints in the genus Mus, suggesting that the accumulation of a large number of repeats in the centromeric region may contribute to the high level of chromosome
Mera y Sierra, Roberto; Artigas, Patricio; Cuervo, Pablo; Deis, Erika; Sidoti, Laura; Mas-Coma, Santiago; Bargues, Maria Dolores
2009-12-03
Fascioliasis is widespread in livestock in Argentina. Among activities included in a long-term initiative to ascertain which are the fascioliasis areas of most concern, studies were performed in a recreational farm, including liver fluke infection in different domestic animal species, classification of the lymnaeid vector and verification of natural transmission of fascioliasis by identification of the intramolluscan trematode larval stages found in naturally infected snails. The high prevalences in the domestic animals appeared related to only one lymnaeid species present. Lymnaeid and trematode classification was verified by means of nuclear ribosomal DNA and mitochondrial DNA marker sequencing. Complete sequences of 18S rRNA gene and rDNA ITS-2 and ITS-1, and a fragment of the mtDNA cox1 gene demonstrate that the Argentinian lymnaeid belongs to the species Lymnaea neotropica. Redial larval stages found in a L. neotropica specimen were ascribed to Fasciola hepatica after analysis of the complete ITS-1 sequence. The finding of L. neotropica is the first of this lymnaeid species not only in Argentina but also in Southern Cone countries. The total absence of nucleotide differences between the sequences of specimens from Argentina and the specimens from the Peruvian type locality at the levels of rDNA 18S, ITS-2 and ITS-1, and the only one mutation at the mtDNA cox1 gene suggest a very recent spread. The ecological characteristics of this lymnaeid, living in small, superficial water collections frequented by livestock, suggest that it may be carried from one place to another by remaining in dried mud stuck to the feet of transported animals. The presence of L. neotropica adds pronounced complexity to the transmission and epidemiology of fascioliasis in Argentina, due to the great difficulties in distinguishing, by traditional malacological methods, between the three similar lymnaeid species of the controversial Galba/Fossaria group present in this country: L. viatrix
18S Ribosomal RNA Evaluation as Preanalytical Quality Control for Animal DNA
Directory of Open Access Journals (Sweden)
Cory Ann Leonard
2016-01-01
Full Text Available The 18S ribosomal RNA (rRNA gene is present in all eukaryotic cells. In this study, we evaluated the use of this gene to verify the presence of PCR-amplifiable host (animal DNA as an indicator of sufficient sample quality for quantitative real-time PCR (qPCR analysis. We compared (i samples from various animal species, tissues, and sample types, including swabs; (ii multiple DNA extraction methods; and (iii both fresh and formalin-fixed paraffin-embedded (FFPE samples. Results showed that 18S ribosomal RNA gene amplification was possible from all tissue samples evaluated, including avian, reptile, and FFPE samples and most swab samples. A single swine rectal swab, which showed sufficient DNA quantity and the demonstrated lack of PCR inhibitors, nonetheless was negative by 18S qPCR. Such a sample specifically illustrates the improvement of determination of sample integrity afforded by inclusion of 18S rRNA gene qPCR analysis in addition to spectrophotometric analysis and the use of internal controls for PCR inhibition. Other possible applications for the described 18S rRNA qPCR are preselection of optimal tissue specimens for studies or preliminary screening of archived samples prior to acceptance for biobanking projects.
Ali, M A; Al-Hemaid, F M; Lee, J; Hatamleh, A A; Gyulai, G; Rahman, M O
2015-10-02
The present study explored the systematic inventory of Echinops L. (Asteraceae) of Saudi Arabia, with special reference to the molecular typing of Echinops abuzinadianus Chaudhary, an endemic species to Saudi Arabia, based on the internal transcribed spacer (ITS) sequences (ITS1-5.8S-ITS2) of nuclear ribosomal DNA. A sequence similarity search using BLAST and a phylogenetic analysis of the ITS sequence of E. abuzinadianus revealed a high level of sequence similarity with E. glaberrimus DC. (section Ritropsis). The novel primary sequence and the secondary structure of ITS2 of E. abuzinadianus could potentially be used for molecular genotyping.
Hiramatsu, K; Harada, K; Tsuneyama, K; Sasaki, M; Fujita, S; Hashimoto, T; Kaneko, S; Kobayashi, K; Nakanuma, Y
2000-07-01
The etiopathogenesis of bile duct lesion in primary biliary cirrhosis is unknown, though the participation of bacteria and/or their components and products is suspected. In this study, we tried to detect and identify bacteria in the bile of patients with primary biliary cirrhosis by polymerase chain reaction using universal bacterial primers of the 16S ribosomal RNA gene. Gallbladder bile samples from 15 patients with primary biliary cirrhosis, 5 with primary sclerosing cholangitis, 5 with hepatitis C virus-related liver cirrhosis, 11 with cholecystolithiasis, and from 12 normal adult gallbladders were used. In addition to the culture study, partial bacterial 16S ribosomal RNA gene was amplified by polymerase chain reaction (PCR) taking advantage of universal primers that can amplify the gene of almost all bacterial species, and the amplicons were cloned and sequenced. Sequence homology with specific bacterial species was analyzed by database research. Bacterial contamination at every step of the bile sampling, DNA extraction and PCR study was avoided. Furthermore, to confirm whether bacterial DNA is detectable in liver explants, the same analysis was performed using 10 liver explants of patients with primary biliary cirrhosis. In primary biliary cirrhosis, 75% (p<0.0001) of 100 clones were identified as so-called gram-positive cocci while these cocci were positive in only 5% in cholecystolithiasis (p<0.0001). In cholecystolithiasis gram-negative rods were predominant instead. One bacterial species detected in a normal adult was not related to those detected in primary biliary cirrhosis and cholecystolithiasis patients. No bacterial DNA was detected by PCR amplification in 10 liver explants of patients with primary biliary cirrhosis. The present results raise several possible roles of gram-positive bacteria in bile in the etiopathogenesis of primary biliary cirrhosis. However, these results could also reflect an epiphenomenon due to decreased bile flow in the
Arndt, E; Scholzen, T; Krömer, W; Hatakeyama, T; Kimura, M
1991-06-01
Approximately 40 ribosomal proteins from each Halobacterium marismortui and Bacillus stearothermophilus have been sequenced either by direct protein sequence analysis or by DNA sequence analysis of the appropriate genes. The comparison of the amino acid sequences from the archaebacterium H marismortui with the available ribosomal proteins from the eubacterial and eukaryotic kingdoms revealed four different groups of proteins: 24 proteins are related to both eubacterial as well as eukaryotic proteins. Eleven proteins are exclusively related to eukaryotic counterparts. For three proteins only eubacterial relatives-and for another three proteins no counterpart-could be found. The similarities of the halobacterial ribosomal proteins are in general somewhat higher to their eukaryotic than to their eubacterial counterparts. The comparison of B stearothermophilus proteins with their E coli homologues showed that the proteins evolved at different rates. Some proteins are highly conserved with 64-76% identity, others are poorly conserved with only 25-34% identical amino acid residues.
Kang, Sang-Ho; Lee, Jeong-Hoon; Lee, Hyun Oh; Ahn, Byoung Ohg; Won, So Youn; Sohn, Seong-Han; Kim, Jung Sun
2017-10-06
Glycyrrhiza uralensis and G. glabra, members of the Fabaceae, are medicinally important species that are native to Asia and Europe. Extracts from these plants are widely used as natural sweeteners because of their much greater sweetness than sucrose. In this study, the three complete chloroplast genomes and five 45S nuclear ribosomal (nr)DNA sequences of these two licorice species and an interspecific hybrid are presented. The chloroplast genomes of G. glabra, G. uralensis and G. glabra × G. uralensis were 127,895 bp, 127,716 bp and 127,939 bp, respectively. The three chloroplast genomes harbored 110 annotated genes, including 76 protein-coding genes, 30 tRNA genes and 4 rRNA genes. The 45S nrDNA sequences were either 5,947 or 5,948 bp in length. Glycyrrhiza glabra and G. glabra × G. uralensis showed two types of nrDNA, while G. uralensis contained a single type. The complete 45S nrDNA sequence unit contains 18S rRNA, ITS1, 5.8S rRNA, ITS2 and 26S rRNA. We identified simple sequence repeat and tandem repeat sequences. We also developed four reliable markers for analysis of Glycyrrhiza diversity authentication.
D1/D2 domain of large-subunit ribosomal DNA for differentiation of Orpinomyces spp.
Dagar, Sumit S; Kumar, Sanjay; Mudgil, Priti; Singh, Rameshwar; Puniya, Anil K
2011-09-01
This study presents the suitability of D1/D2 domain of large-subunit (LSU) ribosomal DNA (rDNA) for differentiation of Orpinomyces joyonii and Orpinomyces intercalaris based on PCR-restriction fragment length polymorphism (RFLP). A variation of G/T in O. intercalaris created an additional restriction site for AluI, which was used as an RFLP marker. The results demonstrate adequate heterogeneity in the LSU rDNA for species-level differentiation.
Directory of Open Access Journals (Sweden)
Mark Meekan
2017-12-01
Full Text Available The whale shark (Rhincodon typus is an iconic and endangered species with a broad distribution spanning warm-temperate and tropical oceans. Effective conservation management of the species requires an understanding of the degree of genetic connectivity among populations, which is hampered by the need for sampling that involves invasive techniques. Here, the feasibility of minimally-invasive sampling was explored by isolating and sequencing whale shark DNA from a commensal or possibly parasitic copepod, Pandarus rhincodonicus that occurs on the skin of the host. We successfully recovered mitochondrial control region DNA sequences (~1,000 bp of the host via DNA extraction and polymerase chain reaction from whole copepod specimens. DNA sequences obtained from multiple copepods collected from the same shark exhibited 100% sequence similarity, suggesting a persistent association of copepods with individual hosts. Newly-generated mitochondrial haplotypes of whale shark hosts derived from the copepods were included in an analysis of the genetic structure of the global population of whale sharks (644 sequences; 136 haplotypes. Our results supported those of previous studies and suggested limited genetic structuring across most of the species range, but the presence of a genetically unique and potentially isolated population in the Atlantic Ocean. Furthermore, we recovered the mitogenome and nuclear ribosomal genes of a whale shark using a shotgun sequencing approach on copepod tissue. The recovered mitogenome is the third mitogenome reported for the species and the first from the Mozambique population. Our invertebrate DNA (iDNA approach could be used to better understand the population structure of whale sharks, particularly in the Atlantic Ocean, and also for genetic analyses of other elasmobranchs parasitized by pandarid copepods.
The sequence specificity of UV-induced DNA damage in a systematically altered DNA sequence.
Khoe, Clairine V; Chung, Long H; Murray, Vincent
2018-06-01
The sequence specificity of UV-induced DNA damage was investigated in a specifically designed DNA plasmid using two procedures: end-labelling and linear amplification. Absorption of UV photons by DNA leads to dimerisation of pyrimidine bases and produces two major photoproducts, cyclobutane pyrimidine dimers (CPDs) and pyrimidine(6-4)pyrimidone photoproducts (6-4PPs). A previous study had determined that two hexanucleotide sequences, 5'-GCTC*AC and 5'-TATT*AA, were high intensity UV-induced DNA damage sites. The UV clone plasmid was constructed by systematically altering each nucleotide of these two hexanucleotide sequences. One of the main goals of this study was to determine the influence of single nucleotide alterations on the intensity of UV-induced DNA damage. The sequence 5'-GCTC*AC was designed to examine the sequence specificity of 6-4PPs and the highest intensity 6-4PP damage sites were found at 5'-GTTC*CC nucleotides. The sequence 5'-TATT*AA was devised to investigate the sequence specificity of CPDs and the highest intensity CPD damage sites were found at 5'-TTTT*CG nucleotides. It was proposed that the tetranucleotide DNA sequence, 5'-YTC*Y (where Y is T or C), was the consensus sequence for the highest intensity UV-induced 6-4PP adduct sites; while it was 5'-YTT*C for the highest intensity UV-induced CPD damage sites. These consensus tetranucleotides are composed entirely of consecutive pyrimidines and must have a DNA conformation that is highly productive for the absorption of UV photons. Crown Copyright © 2018. Published by Elsevier B.V. All rights reserved.
Hatakeyama, T; Kimura, M
1988-03-15
Ribosomal proteins were extracted from 50S ribosomal subunits of the archaebacterium Halobacterium marismortui by decreasing the concentration of Mg2+ and K+, and the proteins were separated and purified by ion-exchange column chromatography on DEAE-cellulose. Ten proteins were purified to homogeneity and three of these proteins were subjected to sequence analysis. The complete amino acid sequences of the ribosomal proteins L25, L29 and L31 were established by analyses of the peptides obtained by enzymatic digestion with trypsin, Staphylococcus aureus protease, chymotrypsin and lysylendopeptidase. Proteins L25, L29 and L31 consist of 84, 115 and 95 amino acid residues with the molecular masses of 9472 Da, 12293 Da and 10418 Da respectively. A comparison of their sequences with those of other large-ribosomal-subunit proteins from other organisms revealed that protein L25 from H. marismortui is homologous to protein L23 from Escherichia coli (34.6%), Bacillus stearothermophilus (41.8%), and tobacco chloroplasts (16.3%) as well as to protein L25 from yeast (38.0%). Proteins L29 and L31 do not appear to be homologous to any other ribosomal proteins whose structures are so far known.
[Structural organization of 5S ribosomal DNA of Rosa rugosa].
Tynkevych, Iu O; Volkov, R A
2014-01-01
In order to clarify molecular organization of the genomic region encoding 5S rRNA in diploid species Rosa rugosa several 5S rDNA repeated units were cloned and sequenced. Analysis of the obtained sequences revealed that only one length variant of 5S rDNA repeated units, which contains intact promoter elements in the intergenic spacer region (IGS) and appears to be transcriptionally active is present in the genome. Additionally, a limited number of 5S rDNA pseudogenes lacking a portion of coding sequence and the complete IGS was detected. A high level of sequence similarity (from 93.7 to 97.5%) between the IGS of major 5S rDNA variants of East Asian R. rugosa and North American R. nitida was found indicating comparatively recent divergence of these species.
Phylogenetic Information Content of Copepoda Ribosomal DNA Repeat Units: ITS1 and ITS2 Impact
Zagoskin, Maxim V.; Lazareva, Valentina I.; Grishanin, Andrey K.; Mukha, Dmitry V.
2014-01-01
The utility of various regions of the ribosomal repeat unit for phylogenetic analysis was examined in 16 species representing four families, nine genera, and two orders of the subclass Copepoda (Crustacea). Fragments approximately 2000 bp in length containing the ribosomal DNA (rDNA) 18S and 28S gene fragments, the 5.8S gene, and the internal transcribed spacer regions I and II (ITS1 and ITS2) were amplified and analyzed. The DAMBE (Data Analysis in Molecular Biology and Evolution) software was used to analyze the saturation of nucleotide substitutions; this test revealed the suitability of both the 28S gene fragment and the ITS1/ITS2 rDNA regions for the reconstruction of phylogenetic trees. Distance (minimum evolution) and probabilistic (maximum likelihood, Bayesian) analyses of the data revealed that the 28S rDNA and the ITS1 and ITS2 regions are informative markers for inferring phylogenetic relationships among families of copepods and within the Cyclopidae family and associated genera. Split-graph analysis of concatenated ITS1/ITS2 rDNA regions of cyclopoid copepods suggested that the Mesocyclops, Thermocyclops, and Macrocyclops genera share complex evolutionary relationships. This study revealed that the ITS1 and ITS2 regions potentially represent different phylogenetic signals. PMID:25215300
Kehie, Mechuselie; Kumaria, Suman; Devi, Khumuckcham Sangeeta; Tandon, Pramod
2016-02-01
Sequences of the Internal Transcribed Spacer (ITS1-5.8S-ITS2) of nuclear ribosomal DNAs were explored to study the genetic diversity and molecular evolution of Naga King Chili. Our study indicated the occurrence of nucleotide polymorphism and haplotypic diversity in the ITS regions. The present study demonstrated that the variability of ITS1 with respect to nucleotide diversity and sequence polymorphism exceeded that of ITS2. Sequence analysis of 5.8S gene revealed a much conserved region in all the accessions of Naga King Chili. However, strong phylogenetic information of this species is the distinct 13 bp deletion in the 5.8S gene which discriminated Naga King Chili from the rest of the Capsicum sp. Neutrality test results implied a neutral variation, and population seems to be evolving at drift-mutation equilibrium and free from directed selection pressure. Furthermore, mismatch analysis showed multimodal curve indicating a demographic equilibrium. Phylogenetic relationships revealed by Median Joining Network (MJN) analysis denoted a clear discrimination of Naga King Chili from its closest sister species (Capsicum chinense and Capsicum frutescens). The absence of star-like network of haplotypes suggested an ancient population expansion of this chili.
Replication and meiotic transmission of yeast ribosomal RNA genes.
Brewer, B J; Zakian, V A; Fangman, W L
1980-11-01
The yeast Saccharomyces cerevisiae has approximately 120 genes for the ribosomal RNAs (rDNA) which are organized in tandem within chromosomal DNA. These multiple-copy genes are homogeneous in sequence but can undergo changes in copy number and topology. To determine if these changes reflect unusual features of rDNA metabolism, we have examined both the replication of rDNA in the mitotic cell cycle and the inheritance of rDNA during meiosis. The results indicate that rDNA behaves identically to chromosomal DNA: each rDNA unit is replicated once during the S phase of each cell cycle and each unit is conserved through meiosis. Therefore, the flexibility in copy number and topology of rDNA does not arise from the selective replication of units in each S phase nor by the selective inheritance of units in meiosis.
Cell cycle, differentiation and tissue-independent expression of ribosomal protein L37.
Su, S; Bird, R C
1995-09-15
A unique human cDNA (hG1.16) that encodes a mRNA of 450 nucleotides was isolated from a subtractive library derived from HeLa cells. The relative expression level of hG1.16 during different cell-cycle phases was determined by Northern-blot analysis of cells synchronized by double-thymidine block and serum deprivation/refeeding. hG1.16 was constitutively expressed during all phases of the cell cycle, including the quiescent phase when even most constitutively expressed genes experience some suppression of expression. The expression level of hG1.16 did not change during terminal differentiation of myoblasts to myotubes, during which cells become permanently post-mitotic. Examination of other tissues revealed that the relative expression level of hG1.16 was constitutive in all embryonic mouse tissues examined, including brain, eye, heart, kidney, liver, lung and skeletal muscle. This was unusual in that expression was not down-modulated during differentiation and did not vary appreciably between tissue types. Analysis by inter-species Northern-blot analysis revealed that hG1.16 was highly conserved among all vertebrates studied (from fish to humans but not in insects). DNA sequence analysis of hG1.16 revealed a high level of similarity to rat ribosomal protein L37, identifying hG1.16 as a new member of this multigene family. The deduced amino acid sequence of hG1.16 was identical to rat ribosomal protein L37 that contained 97 amino acids, many of which are highly positively charged (15 arginine and 14 lysine residues with a predicted M(r) of 11,065). hG1.16 protein has a single C2-C2 zinc-finger-like motif which is also present in rat ribosomal protein L37. Using primers designed from the sequence of hG1.16, unique bovine and rat cDNAs were also isolated by 5'-rapid-amplification of cDNA ends. DNA sequences of bovine and rat G1.16, clones were 92.8% and 92.2% similar to human G1.16 while the deduced amino acid sequences derived from bovine and rat cDNAs each differed
Chiba, Satoshi
1999-04-01
An endemic land snail genus Mandarina of the oceanic Bonin (Ogasawara) Islands shows exceptionally rapid evolution not only of morphological and ecological traits, but of DNA sequence. A phylogenetic relationship based on mitochondrial DNA (mtDNA) sequences suggests that morphological differences equivalent to the differences between families were produced between Mandarina and its ancestor during the Pleistocene. The inferred phylogeny shows that species with similar morphologies and life habitats appeared repeatedly and independently in different lineages and islands at different times. Sequential adaptive radiations occurred in different islands of the Bonin Islands and species occupying arboreal, semiarboreal, and terrestrial habitat arose independently in each island. Because of a close relationship between shell morphology and life habitat, independent evolution of the same life habitat in different islands created species possesing the same shell morphology in different islands and lineages. This rapid evolution produced some incongruences between phylogenetic relationship and species taxonomy. Levels of sequence divergence of mtDNA among the species of Mandarina is extremely high. The maximum level of sequence divergence at 16S and 12S ribosomal RNA sequence within Mandarina are 18.7% and 17.7%, respectively, and this suggests that evolution of mtDNA of Mandarina is extremely rapid, more than 20 times faster than the standard rate in other animals. The present examination reveals that evolution of morphological and ecological traits occurs at extremely high rates in the time of adaptive radiation, especially in fragmented environments. © 1999 The Society for the Study of Evolution.
D1/D2 Domain of Large-Subunit Ribosomal DNA for Differentiation of Orpinomyces spp.▿
Dagar, Sumit S.; Kumar, Sanjay; Mudgil, Priti; Singh, Rameshwar; Puniya, Anil K.
2011-01-01
This study presents the suitability of D1/D2 domain of large-subunit (LSU) ribosomal DNA (rDNA) for differentiation of Orpinomyces joyonii and Orpinomyces intercalaris based on PCR-restriction fragment length polymorphism (RFLP). A variation of G/T in O. intercalaris created an additional restriction site for AluI, which was used as an RFLP marker. The results demonstrate adequate heterogeneity in the LSU rDNA for species-level differentiation. PMID:21784906
Ennahar, Saïd; Cai, Yimin; Fujita, Yasuhito
2003-01-01
A total of 161 low-G+C-content gram-positive bacteria isolated from whole-crop paddy rice silage were classified and subjected to phenotypic and genetic analyses. Based on morphological and biochemical characters, these presumptive lactic acid bacterium (LAB) isolates were divided into 10 groups that included members of the genera Enterococcus, Lactobacillus, Lactococcus, Leuconostoc, Pediococcus, and WEISSELLA: Analysis of the 16S ribosomal DNA (rDNA) was used to confirm the presence of the predominant groups indicated by phenotypic analysis and to determine the phylogenetic affiliation of representative strains. The virtually complete 16S rRNA gene was PCR amplified and sequenced. The sequences from the various LAB isolates showed high degrees of similarity to those of the GenBank reference strains (between 98.7 and 99.8%). Phylogenetic trees based on the 16S rDNA sequence displayed high consistency, with nodes supported by high bootstrap values. With the exception of one species, the genetic data was in agreement with the phenotypic identification. The prevalent LAB, predominantly homofermentative (66%), consisted of Lactobacillus plantarum (24%), Lactococcus lactis (22%), Leuconostoc pseudomesenteroides (20%), Pediococcus acidilactici (11%), Lactobacillus brevis (11%), Enterococcus faecalis (7%), Weissella kimchii (3%), and Pediococcus pentosaceus (2%). The present study, the first to fully document rice-associated LAB, showed a very diverse community of LAB with a relatively high number of species involved in the fermentation process of paddy rice silage. The comprehensive 16S rDNA-based approach to describing LAB community structure was valuable in revealing the large diversity of bacteria inhabiting paddy rice silage and enabling the future design of appropriate inoculants aimed at improving its fermentation quality.
Highly divergent 16S rRNA sequences in ribosomal operons of Scytonema hyalinum (Cyanobacteria.
Directory of Open Access Journals (Sweden)
Jeffrey R Johansen
Full Text Available A highly divergent 16S rRNA gene was found in one of the five ribosomal operons present in a species complex currently circumscribed as Scytonema hyalinum (Nostocales, Cyanobacteria using clone libraries. If 16S rRNA sequence macroheterogeneity among ribosomal operons due to insertions, deletions or truncation is excluded, the sequence heterogeneity observed in S. hyalinum was the highest observed in any prokaryotic species thus far (7.3-9.0%. The secondary structure of the 16S rRNA molecules encoded by the two divergent operons was nearly identical, indicating possible functionality. The 23S rRNA gene was examined for a few strains in this complex, and it was also found to be highly divergent from the gene in Type 2 operons (8.7%, and likewise had nearly identical secondary structure between the Type 1 and Type 2 operons. Furthermore, the 16S-23S ITS showed marked differences consistent between operons among numerous strains. Both operons have promoter sequences that satisfy consensus requirements for functional prokaryotic transcription initiation. Horizontal gene transfer from another unknown heterocytous cyanobacterium is considered the most likely explanation for the origin of this molecule, but does not explain the ultimate origin of this sequence, which is very divergent from all 16S rRNA sequences found thus far in cyanobacteria. The divergent sequence is highly conserved among numerous strains of S. hyalinum, suggesting adaptive advantage and selective constraint of the divergent sequence.
Biosensors for DNA sequence detection
Vercoutere, Wenonah; Akeson, Mark
2002-01-01
DNA biosensors are being developed as alternatives to conventional DNA microarrays. These devices couple signal transduction directly to sequence recognition. Some of the most sensitive and functional technologies use fibre optics or electrochemical sensors in combination with DNA hybridization. In a shift from sequence recognition by hybridization, two emerging single-molecule techniques read sequence composition using zero-mode waveguides or electrical impedance in nanoscale pores.
Mitochondrial genome sequence of the potato powdery scab pathogen Spongospora subterranea.
Gutiérrez, Pablo; Bulman, Simon; Alzate, Juan; Ortíz, Mary Carmen; Marín, Mauricio
2016-01-01
Spongospora subterranea is a soil-borne obligate parasite responsible for potato powdery scab disease. S. subterranea is a member of the order Plasmodiophorida, a protist taxa that is related to Cercozoa and Foraminifera but the fine details of these relationships remain unresolved. Currently there is only one available complete mtDNA sequence of a cercozoan, Bigelowiella natans. In this work, the mitochondrial sequence of a S. subterranea isolate infecting an Andean variety of S. tuberosum ssp. andigena (Diacol-Capiro) is presented. The mtDNA codes for 16 proteins of the respiratory chain, 11 ribosomal proteins, 3 ribosomal RNAs, 24 tRNAs, a RNA processing RNaseP, a RNA-directed polymerase, and two proteins of unknown function. This is the first report of a mtDNA genome sequence from a plasmodiophorid and will be useful in clarifying the phylogenetic relationship of this group to other members in the supergroup Rhizaria once more mtDNA sequences are available.
"First generation" automated DNA sequencing technology.
Slatko, Barton E; Kieleczawa, Jan; Ju, Jingyue; Gardner, Andrew F; Hendrickson, Cynthia L; Ausubel, Frederick M
2011-10-01
Beginning in the 1980s, automation of DNA sequencing has greatly increased throughput, reduced costs, and enabled large projects to be completed more easily. The development of automation technology paralleled the development of other aspects of DNA sequencing: better enzymes and chemistry, separation and imaging technology, sequencing protocols, robotics, and computational advancements (including base-calling algorithms with quality scores, database developments, and sequence analysis programs). Despite the emergence of high-throughput sequencing platforms, automated Sanger sequencing technology remains useful for many applications. This unit provides background and a description of the "First-Generation" automated DNA sequencing technology. It also includes protocols for using the current Applied Biosystems (ABI) automated DNA sequencing machines. © 2011 by John Wiley & Sons, Inc.
Kusaba, M; Tsuge, T
1995-10-01
The internal transcribed spacer regions (ITS1 and ITS2) of ribosomal DNA from Alternaria species, including seven fungi known to produce host-specific toxins, were analyzed by polymerase chain reaction-amplification and direct sequencing. Phylogenetic analysis of the sequence data by the Neighbor-joining method showed that the seven toxin-producing fungi belong to a monophyletic group together with A. alternata. In contract, A. dianthi, A. panax, A. dauci, A. bataticola, A. porri, A. sesami and A. solani, species that can be morphologically distinguished from A. alternata, could be clearly separated from A. alternata by phylogenetic of the ITS variation. These results suggest that Alternaria pathogens which produce host-specific toxins are pathogenic variants within a single variable species, A. alternata.
Weitemier, Kevin; Straub, Shannon C K; Fishbein, Mark; Liston, Aaron
2015-01-01
Despite knowledge that concerted evolution of high-copy loci is often imperfect, studies that investigate the extent of intragenomic polymorphisms and comparisons across a large number of species are rarely made. We present a bioinformatic pipeline for characterizing polymorphisms within an individual among copies of a high-copy locus. Results are presented for nuclear ribosomal DNA (nrDNA) across the milkweed genus, Asclepias. The 18S-26S portion of the nrDNA cistron of Asclepias syriaca served as a reference for assembly of the region from 124 samples representing 90 species of Asclepias. Reads were mapped back to each individual's consensus and at each position reads differing from the consensus were tallied using a custom perl script. Low frequency polymorphisms existed in all individuals (mean = 5.8%). Most nrDNA positions (91%) were polymorphic in at least one individual, with polymorphic sites being less frequent in subunit regions and loops. Highly polymorphic sites existed in each individual, with highest abundance in the "noncoding" ITS regions. Phylogenetic signal was present in the distribution of intragenomic polymorphisms across the genus. Intragenomic polymorphisms in nrDNA are common in Asclepias, being found at higher frequency than any other study to date. The high and variable frequency of polymorphisms across species highlights concerns that phylogenetic applications of nrDNA may be error-prone. The new analytical approach provided here is applicable to other taxa and other high-copy regions characterized by low coverage genome sequencing (genome skimming).
Gutiérrez, Pablo; Alzate, Juan; Yepes, Mauricio Salazar; Marín, Mauricio
2016-01-01
Colletotrichum lindemuthianum is the causal agent of anthracnose in common bean (Phaseolus vulgaris), one of the most limiting factors for this crop in South and Central America. In this work, the mitochondrial sequence of a Colombian isolate of C. lindemuthianum obtained from a common bean plant (var. Cargamanto) with anthracnose symptoms is presented. The mtDNA codes for 13 proteins of the respiratory chain, 1 ribosomal protein, 2 homing endonucleases, 2 ribosomal RNAs and 28 tRNAs. This is the first report of a complete mtDNA genome sequence from C. lindemuthianum.
Directory of Open Access Journals (Sweden)
HANIF KHADEMI
2016-04-01
Full Text Available Abstract. Khademi H, Mehregan I, Assadi M, Nejadsatari T, Zarre S. 2015. Molecular phylogeny of Acer monspessulanum L. subspecies from Iran inferred using the ITS region of nuclear ribosomal DNA. Biodiversitas 17: 16-23. This study was carried out on the Acer monspessulanum complex growing wild in Iran. Internal transcribed spacer (ITS sequences for 75 samples representing five different subspecies of Acer monspessulanum were analyzed. Beside this, 86 previously published ITS sequences from GenBank were used to test the monophyly of the complex worldwide. Phylogenetic analyses were conducted using Bayesian inference and maximum parsimony. The results indicate that most samples of A. monspessulanum species from Iran were part of a monophyletic clade with 8 samples of A. ibericum from Georgia, A. hyrcanum from Iran and one of A. sempervirens from Greece (PP= 1; BS= 79%. Our results indicate that use of morphological characteristics coupled with molecular data will be most effective.
Lifescience Database Archive (English)
Full Text Available List Contact us Budding yeast cDNA sequencing project cDNA sequence quality data Data detail Data name cDNA sequence quality... data DOI 10.18908/lsdba.nbdc00838-003 Description of data contents Phred's quality score. P...tion Download License Update History of This Database Site Policy | Contact Us cDNA sequence quality
Testing the potential of a ribosomal 16S marker for DNA metabarcoding of insects
Directory of Open Access Journals (Sweden)
Vasco Elbrecht
2016-04-01
Full Text Available Cytochrome c oxidase I (COI is a powerful marker for DNA barcoding of animals, with good taxonomic resolution and a large reference database. However, when used for DNA metabarcoding, estimation of taxa abundances and species detection are limited due to primer bias caused by highly variable primer binding sites across the COI gene. Therefore, we explored the ability of the 16S ribosomal DNA gene as an alternative metabarcoding marker for species level assessments. Ten bulk samples, each containing equal amounts of tissue from 52 freshwater invertebrate taxa, were sequenced with the Illumina NextSeq 500 system. The 16S primers amplified three more insect species than the Folmer COI primers and amplified more equally, probably due to decreased primer bias. Estimation of biomass might be less biased with 16S than with COI, although variation in read abundances of two orders of magnitudes is still observed. According to these results, the marker choice depends on the scientific question. If the goal is to obtain a taxonomic identification at the species level, then COI is more appropriate due to established reference databases and known taxonomic resolution of this marker, knowing that a greater proportion of insects will be missed using COI Folmer primers. If the goal is to obtain a more comprehensive survey the 16S marker, which requires building a local reference database, or optimised degenerated COI primers could be more appropriate.
Mikaeili, F; Kia, E B; Sharbatkhori, M; Sharifdini, M; Jalalizand, N; Heidari, Z; Zarei, Z; Stensvold, C R; Mirhendi, H
2013-06-01
Six simple methods for extraction of ribosomal and mitochondrial DNA from Toxocara canis, Toxocara cati and Toxascaris leonina were compared by evaluating the presence, appearance and intensity of PCR products visualized on agarose gels and amplified from DNA extracted by each of the methods. For each species, two isolates were obtained from the intestines of their respective hosts: T. canis and T. leonina from dogs, and T. cati from cats. For all isolates, total DNA was extracted using six different methods, including grinding, boiling, crushing, beating, freeze-thawing and the use of a commercial kit. To evaluate the efficacy of each method, the internal transcribed spacer (ITS) region and the cytochrome c oxidase subunit 1 (cox1) gene were chosen as representative markers for ribosomal and mitochondrial DNA, respectively. Among the six DNA extraction methods, the beating method was the most cost effective for all three species, followed by the commercial kit. Both methods produced high intensity bands on agarose gels and were characterized by no or minimal smear formation, depending on gene target; however, beating was less expensive. We therefore recommend the beating method for studies where costs need to be kept at low levels. Copyright © 2013 Elsevier Inc. All rights reserved.
DNA Polymerases Drive DNA Sequencing-by-Synthesis Technologies: Both Past and Present
Directory of Open Access Journals (Sweden)
Cheng-Yao eChen
2014-06-01
Full Text Available Next-generation sequencing (NGS technologies have revolutionized modern biological and biomedical research. The engines responsible for this innovation are DNA polymerases; they catalyze the biochemical reaction for deriving template sequence information. In fact, DNA polymerase has been a cornerstone of DNA sequencing from the very beginning. E. coli DNA polymerase I proteolytic (Klenow fragment was originally utilized in Sanger's dideoxy chain terminating DNA sequencing chemistry. From these humble beginnings followed an explosion of organism-specific, genome sequence information accessible via public database. Family A/B DNA polymerases from mesophilic/thermophilic bacteria/archaea were modified and tested in today's standard capillary electrophoresis (CE and NGS sequencing platforms. These enzymes were selected for their efficient incorporation of bulky dye-terminator and reversible dye-terminator nucleotides respectively. Third generation, real-time single molecule sequencing platform requires slightly different enzyme properties. Enterobacterial phage ⱷ29 DNA polymerase copies long stretches of DNA and possesses a unique capability to efficiently incorporate terminal phosphate-labeled nucleoside polyphosphates. Furthermore, ⱷ29 enzyme has also been utilized in emerging DNA sequencing technologies including nanopore-, and protein-transistor-based sequencing. DNA polymerase is, and will continue to be, a crucial component of sequencing technologies.
Adams, Gerard C; Surve-Iyer, Rupa S; Iezzoni, Amy F
2002-01-01
Leucostoma species that are the causal agents of Cytospora canker of stone and pome fruit trees were studied in detail. DNA sequence of the internal transcribed spacer regions and the 5.8S of the nuclear ribosomal DNA operon (ITS rDNA) supplied sufficient characters to assess the phylogenetic relationships among species of Leucostoma, Valsa, Valsella, and related anamorphs in Cytospora. Parsimony analysis of the aligned sequence divided Cytospora isolates from fruit trees into clades that generally agreed with the morphological species concepts, and with some of the phenetic groupings (PG 1-6) identified previously by isozyme analysis and cultural characteristics. Phylogenetic analysis inferred that isolates of L. persoonii formed two well-resolved clades distinct from isolates of L. cinctum. Phylogenetic analysis of the ITS rDNA, isozyme analysis, and cultural characteristics supported the inference that L. persoonii groups PG 2 and PG 3 were populations of a new species apparently more genetically different from L. persoonii PG 1 than from isolates representative of L. massariana, L. niveum, L. translucens, and Valsella melastoma. The new species, L. parapersoonii, was described. A diverse collection of isolates of L. cinctum, L. persoonii, and L. parapersoonii were examined for genetic variation using restriction fragment length polymorphism (RFLP) analysis of the ITS rDNA and the five prime end of the large subunit of the rDNA (LSU rDNA). HinfI and HpaII endonucleases were each useful in dividing the Leucostoma isolates into RFLP profiles corresponding to the isozyme phenetic groups, PG 1-6. RFLP analysis was more effective than isozyme analysis in uncovering variation among isolates of L. persoonii PG 1, but less effective within L. cinctum populations. Isolates representative of seven of the L. persoonii formae speciales proposed by G. Défago in 1935 were found to be genetically diverse isolates of PG 1. Two large insertions, 415 and 309 nucleotides long, in
Fregene, M A; Vargas, J; Ikea, J; Angel, F; Tohme, J; Asiedu, R A; Akoroda, M O; Roca, W M
1994-11-01
Chloroplast DNA (cp) and nuclear ribosomal DNA (rDNA) variation was investigated in 45 accessions of cultivated and wild Manihot species. Ten independent mutations, 8 point mutations and 2 length mutations were identified, using eight restriction enzymes and 12 heterologous cpDNA probes from mungbean. Restriction fragment length polymorphism analysis defined nine distinct chloroplast types, three of which were found among the cultivated accessions and six among the wild species. Cladistic analysis of the cpDNA data using parsimony yielded a hypothetical phylogeny of lineages among the cpDNAs of cassava and its wild relatives that is congruent with morphological evolutionary differentiation in the genus. The results of our survey of cpDNA, together with rDNA restriction site change at the intergenic spacer region and rDNA repeat unit length variation (using rDNA cloned fragments from taro as probe), suggest that cassava might have arisen from the domestication of wild tuberous accessions of some Manihot species, followed by intensive selection. M. esculenta subspp flabellifolia is probably a wild progenitor. Introgressive hybridization with wild forms and pressures to adapt to the widely varying climates and topography in which cassava is found might have enhanced the crop's present day variability.
Suzuki, Motofumi; Nakase, Takashi
2002-02-01
To clarify phylogenetic relationships among ubiquinone 7 (Q7)-forming species of the genus Candida, we analyzed the nearly complete sequences of 18S ribosomal RNA genes (18S rDNAs) from fifty strains (including 46 type strains) of Candida species, and from 8 type strains of species/varieties of the genera Issatchenkia, Pichia and Saturnispora. Q7-forming Candida species were divided into three major groups (Group I, II, and III) and were phylogenetically distant from a group that includes the type species of the genus Candida. Group I included four clusters with basal branches that were weakly supported. The first cluster comprised C. vartiovaarae, C. maritima, C. utilis, C. freyschussii, C. odintsovae, C. melinii, C. quercuum, Williopsis saturnus var. saturnus, and W. mucosa. The second cluster comprised C. norvegica, C. montana, C. stellimalicola, C. solani, C. berthetii, and C. dendrica. Williopsis pratensis, W. californica, Pichia opuntiae and 2 related species, P. amethionina (two varieties), and P. caribaea were also included in this cluster. The third cluster comprised C. pelliculosa (anamorph of P. anomala), C. nitrativorans, and C. silvicultrix. The fourth cluster comprised C. wickerhamii and C. peltata, which were placed in the P. holstii - C. ernobii clade with Q8-containing species. Group II comprised C. pignaliae, C. nemodendra, C. methanolovescens, C. maris, C. sonorensis, C. pini, C. llanquihuensis, C. cariosilignicola, C. ovalis, C. succiphila (including its two synonyms), C. methanosorbosa, C. nitratophila, C. nanaspora, C. boidinii (including its two synonyms), W. salicorniae, and P. methanolica. Group III was composed of four clusters with strong bootstrap support. The first cluster comprised C. valida (anamorph of P. membranifaciens), C. ethanolica, C. pseudolambica, C. citrea, C. inconspicua, C. norvegensis, C. rugopelliculosa, and C. lambica. Three species and two varieties of the genus Issatchenkia were also included in this cluster. The
Sequence characterization of 5S ribosomal RNA from eight gram positive procaryotes
Woese, C. R.; Luehrsen, K. R.; Pribula, C. D.; Fox, G. E.
1976-01-01
Complete nucleotide sequences are presented for 5S rRNA from Bacillus subtilis, B. firmus, B. pasteurii, B. brevis, Lactobacillus brevis, and Streptococcus faecalis, and 5S rRNA oligonucleotide catalogs and partial sequence data are given for B. cereus and Sporosarcina ureae. These data demonstrate a striking consistency of 5S rRNA primary and secondary structure within a given bacterial grouping. An exception is B. brevis, in which the 5S rRNA sequence varies significantly from that of other bacilli in the tuned helix and the procaryotic loop. The localization of these variations suggests that B. brevis occupies an ecological niche that selects such changes. It is noted that this organism produces antibiotics which affect ribosome function.
Regulation of rDNA stability by sumoylation
DEFF Research Database (Denmark)
Eckert-Boulet, Nadine; Lisby, Michael
2009-01-01
Repair of DNA lesions by homologous recombination relies on the copying of genetic information from an intact homologous sequence. However, many eukaryotic genomes contain repetitive sequences such as the ribosomal gene locus (rDNA), which poses a risk for illegitimate recombination. Therefore, t......6 complex and sumoylation of Rad52, which directs DNA double-strand breaks in the rDNA to relocalize from within the nucleolus to the nucleoplasm before association with the recombination machinery. The relocalization before repair is important for maintaining rDNA stability. The focus...
Gouveia, Juceli Gonzalez; Wolf, Ivan Rodrigo; de Moraes-Manécolo, Vivian Patrícia Oliveira; Bardella, Vanessa Belline; Ferracin, Lara Munique; Giuliano-Caetano, Lucia; da Rosa, Renata; Dias, Ana Lúcia
2016-12-01
Sequences of 5S ribosomal RNA (rRNA) are extensively used in fish cytogenomic studies, once they have a flexible organization at the chromosomal level, showing inter- and intra-specific variation in number and position in karyotypes. Sequences from the genome of Imparfinis schubarti (Heptapteridae) were isolated, aiming to understand the organization of 5S rDNA families in the fish genome. The isolation of 5S rDNA from the genome of I. schubarti was carried out by reassociation kinetics (C 0 t) and PCR amplification. The obtained sequences were cloned for the construction of a micro-library. The obtained clones were sequenced and hybridized in I. schubarti and Microglanis cottoides (Pseudopimelodidae) for chromosome mapping. An analysis of the sequence alignments with other fish groups was accomplished. Both methods were effective when using 5S rDNA for hybridization in I. schubarti genome. However, the C 0 t method enabled the use of a complete 5S rRNA gene, which was also successful in the hybridization of M. cottoides. Nevertheless, this gene was obtained only partially by PCR. The hybridization results and sequence analyses showed that intact 5S regions are more appropriate for the probe operation, due to conserved structure and motifs. This study contributes to a better understanding of the organization of multigene families in catfish's genomes.
Rapid Multiplex Small DNA Sequencing on the MinION Nanopore Sequencing Platform
Directory of Open Access Journals (Sweden)
Shan Wei
2018-05-01
Full Text Available Real-time sequencing of short DNA reads has a wide variety of clinical and research applications including screening for mutations, target sequences and aneuploidy. We recently demonstrated that MinION, a nanopore-based DNA sequencing device the size of a USB drive, could be used for short-read DNA sequencing. In this study, an ultra-rapid multiplex library preparation and sequencing method for the MinION is presented and applied to accurately test normal diploid and aneuploidy samples’ genomic DNA in under three hours, including library preparation and sequencing. This novel method shows great promise as a clinical diagnostic test for applications requiring rapid short-read DNA sequencing.
Sheik, Cody S; Reese, Brandi Kiel; Twing, Katrina I; Sylvan, Jason B; Grim, Sharon L; Schrenk, Matthew O; Sogin, Mitchell L; Colwell, Frederick S
2018-01-01
Earth's subsurface environment is one of the largest, yet least studied, biomes on Earth, and many questions remain regarding what microorganisms are indigenous to the subsurface. Through the activity of the Census of Deep Life (CoDL) and the Deep Carbon Observatory, an open access 16S ribosomal RNA gene sequence database from diverse subsurface environments has been compiled. However, due to low quantities of biomass in the deep subsurface, the potential for incorporation of contaminants from reagents used during sample collection, processing, and/or sequencing is high. Thus, to understand the ecology of subsurface microorganisms (i.e., the distribution, richness, or survival), it is necessary to minimize, identify, and remove contaminant sequences that will skew the relative abundances of all taxa in the sample. In this meta-analysis, we identify putative contaminants associated with the CoDL dataset, recommend best practices for removing contaminants from samples, and propose a series of best practices for subsurface microbiology sampling. The most abundant putative contaminant genera observed, independent of evenness across samples, were Propionibacterium , Aquabacterium , Ralstonia , and Acinetobacter . While the top five most frequently observed genera were Pseudomonas , Propionibacterium , Acinetobacter , Ralstonia , and Sphingomonas . The majority of the most frequently observed genera (high evenness) were associated with reagent or potential human contamination. Additionally, in DNA extraction blanks, we observed potential archaeal contaminants, including methanogens, which have not been discussed in previous contamination studies. Such contaminants would directly affect the interpretation of subsurface molecular studies, as methanogenesis is an important subsurface biogeochemical process. Utilizing previously identified contaminant genera, we found that ∼27% of the total dataset were identified as contaminant sequences that likely originate from DNA
Directory of Open Access Journals (Sweden)
Kevin Weitemier
2015-01-01
Full Text Available Despite knowledge that concerted evolution of high-copy loci is often imperfect, studies that investigate the extent of intragenomic polymorphisms and comparisons across a large number of species are rarely made. We present a bioinformatic pipeline for characterizing polymorphisms within an individual among copies of a high-copy locus. Results are presented for nuclear ribosomal DNA (nrDNA across the milkweed genus, Asclepias. The 18S-26S portion of the nrDNA cistron of Asclepias syriaca served as a reference for assembly of the region from 124 samples representing 90 species of Asclepias. Reads were mapped back to each individual’s consensus and at each position reads differing from the consensus were tallied using a custom perl script. Low frequency polymorphisms existed in all individuals (mean = 5.8%. Most nrDNA positions (91% were polymorphic in at least one individual, with polymorphic sites being less frequent in subunit regions and loops. Highly polymorphic sites existed in each individual, with highest abundance in the “noncoding” ITS regions. Phylogenetic signal was present in the distribution of intragenomic polymorphisms across the genus. Intragenomic polymorphisms in nrDNA are common in Asclepias, being found at higher frequency than any other study to date. The high and variable frequency of polymorphisms across species highlights concerns that phylogenetic applications of nrDNA may be error-prone. The new analytical approach provided here is applicable to other taxa and other high-copy regions characterized by low coverage genome sequencing (genome skimming.
Shu, Fan-Fan; Lv, Rui-Qing; Zhang, Yi-Fang; Duan, Gang; Wu, Ding-Yu; Li, Bi-Feng; Yang, Jian-Fa; Zou, Feng-Cai
2012-08-01
On mainland China, liver flukes of Fasciola spp. (Digenea: Fasciolidae) can cause serious acute and chronic morbidity in numerous species of mammals such as sheep, goats, cattle, and humans. The objective of the present study was to examine the taxonomic identity of Fasciola species in Yunnan province by sequences of the first and second internal transcribed spacers (ITS-1 and ITS-2) of nuclear ribosomal DNA (rDNA). The ITS rDNA was amplified from 10 samples representing Fasciola species in cattle from 2 geographical locations in Yunnan Province, by polymerase chain reaction (PCR), and the products were sequenced directly. The lengths of the ITS-1 and ITS-2 sequences were 422 and 361-362 base pairs, respectively, for all samples sequenced. Using ITS sequences, 2 Fasciola species were revealed, namely Fasciola hepatica and Fasciola gigantica. This is the first demonstration of F. gigantica in cattle in Yunnan Province, China using a molecular approach; our findings have implications for studying the population genetic characterization of the Chinese Fasciola species and for the prevention and control of Fasciola spp. in this province.
Daneshparvar, Afrooz; Mowlavi, Gholamreza; Mirjalali, Hamed; Hajjaran, Homa; Mobedi, Iraj; Naddaf, Saeed Reza; Shidfar, Mohammadreza; Sadat Makki, Mahsa
2017-01-01
Demodicosis is one of the most prevalent skin diseases resulting from infestation by Demodex mites. This parasite usually inhabits in follicular infundibulum or sebaceous duct and transmits through close contact with an infested host. This study was carried from September 2014 to January 2016 at Tehran University of Medical Sciences, Tehran, Iran. DNA extraction and amplification of 16S ribosomal RNA was performed on four isolates, already obtained from four different patients and identified morphologically though clearing with 10% Potassium hydroxide (KOH) and microscopical examination. Amplified fragments from the isolates were compared with GeneBank database and phylogenetic analysis was carried out using MEGA6 software. A 390 bp fragment of 16S rDNA was obtained in all isolates and analysis of generated sequences showed high similarity with those submitted to GenBank, previously. Intra-species similarity and distance also showed 99.983% and 0.017, respectively, for the studied isolates. Multiple alignments of the isolates showed Single Nucleotide Polymorphisms (SNPs) in 16S rRNA fragment. Phylogenetic analysis revealed that all 4 isolates clustered with other D. folliculorum, recovered from GenBank database. Our accession numbers KF875587 and KF875589 showed more similarity together in comparison with two other studied isolates. Mitochondrial 16S rDNA is one of the most suitable molecular barcodes for identification D. folliculorum and this fragment can use for intra-species characterization of the most human-infected mites.
Directory of Open Access Journals (Sweden)
Afrooz DANESHPARVAR
2017-06-01
Full Text Available Background: Demodicosis is one of the most prevalent skin diseases resulting from infestation by Demodex mites. This parasite usually inhabits in follicular infundibulum or sebaceous duct transmitted through close contact with an infested host.Methods: This study was carried from September 2014 to January 2016 at Tehran University of Medical Sciences, Tehran, Iran. DNA extraction and amplification of 16S ribosomal RNA was performed on four isolates, obtained from four patients and identified morphologically through clearing with 10% Potassium hydroxide (KOH and microscopical examination. Amplified fragments from the isolates were compared with GenBank database and phylogenetic analysis was carried out using MEGA6 software.Results: A 390 bp fragment of 16S rDNA was obtained in all isolates and analysis of generated sequences showed high similarity with those submitted to GenBank, previously. Intra-species similarity and distance also showed 99.983% and 0.017, respectively, for the studied isolates. Multiple alignments of the isolates showed Single Nucleotide Polymorphisms (SNPs in 16S rRNA fragment. Phylogenetic analysis revealed that all 4 isolates clustered with other D. folliculorum, recovered from GenBank database. Our accession numbers KF875587 and KF875589 showed more similarity together in comparison with two other studied isolates. Conclusion: Mitochondrial 16S rDNA is one of the most suitable molecular barcodes for identification D. folliculorum and this fragment can use for intra-species characterization of the most human-infected mites.
Li, Ping; Jin, Hui; Yu, Hong-Guo
2014-01-01
During meiosis, homologues are linked by crossover, which is required for bipolar chromosome orientation before chromosome segregation at anaphase I. The repetitive ribosomal DNA (rDNA) array, however, undergoes little or no meiotic recombination. Hyperrecombination can cause chromosome missegregation and rDNA copy number instability. We report here that condensin, a conserved protein complex required for chromosome organization, regulates double-strand break (DSB) formation and repair at the rDNA gene cluster during meiosis in budding yeast. Condensin is highly enriched at the rDNA region during prophase I, released at the prophase I/metaphase I transition, and reassociates with rDNA before anaphase I onset. We show that condensin plays a dual role in maintaining rDNA stability: it suppresses the formation of Spo11-mediated rDNA breaks, and it promotes DSB processing to ensure proper chromosome segregation. Condensin is unnecessary for the export of rDNA breaks outside the nucleolus but required for timely repair of meiotic DSBs. Our work reveals that condensin coordinates meiotic recombination with chromosome segregation at the repetitive rDNA sequence, thereby maintaining genome integrity. PMID:25103240
Dailidiene, Daiva; Bertoli, M. Teresita; Miciuleviciene, Jolanta; Mukhopadhyay, Asish K.; Dailide, Giedrius; Pascasio, Mario Alberto; Kupcinskas, Limas; Berg, Douglas E.
2002-01-01
Tetracycline is useful in combination therapies against the gastric pathogen Helicobacter pylori. We found 6 tetracycline-resistant (Tetr) strains among 159 clinical isolates (from El Salvador, Lithuania, and India) and obtained the following four results: (i) 5 of 6 Tetr isolates contained one or two nucleotide substitutions in one part of the primary tetracycline binding site in 16S rRNA (AGA965-967 [Escherichia coli coordinates] changed to gGA, AGc, guA, or gGc [lowercase letters are used to represent the base changes]), whereas the sixth (isolate Ind75) retained AGA965-967; (ii) PCR products containing mutant 16S ribosomal DNA (rDNA) alleles transformed recipient strains to Tetr phenotypes, but transformants containing alleles with single substitutions (gGA and AGc) were less resistant than their Tetr parents; (iii) each of 10 Tetr mutants of reference strain 26695 (in which mutations were induced with metronidazole, a mutagenic anti-H. pylori agent) contained the normal AGA965-967 sequence; and (iv) transformant derivatives of Ind75 and of one of the Tetr 26695 mutants that had acquired mutant rDNA alleles were resistant to tetracycline at levels higher than those to which either parent strain was resistant. Thus, tetracycline resistance in H. pylori results from an accumulation of changes that may affect tetracycline-ribosome affinity and/or other functions (perhaps porins or efflux pumps). We suggest that the rarity of tetracycline resistance among clinical isolates reflects this need for multiple mutations and perhaps also the deleterious effects of such mutations on fitness. Formally equivalent mutations with small but additive effects are postulated to contribute importantly to traits such as host specificity and virulence and to H. pylori's great genetic diversity. PMID:12435699
Microbial analysis of bite marks by sequence comparison of streptococcal DNA.
Directory of Open Access Journals (Sweden)
Darnell M Kennedy
Full Text Available Bite mark injuries often feature in violent crimes. Conventional morphometric methods for the forensic analysis of bite marks involve elements of subjective interpretation that threaten the credibility of this field. Human DNA recovered from bite marks has the highest evidentiary value, however recovery can be compromised by salivary components. This study assessed the feasibility of matching bacterial DNA sequences amplified from experimental bite marks to those obtained from the teeth responsible, with the aim of evaluating the capability of three genomic regions of streptococcal DNA to discriminate between participant samples. Bite mark and teeth swabs were collected from 16 participants. Bacterial DNA was extracted to provide the template for PCR primers specific for streptococcal 16S ribosomal RNA (16S rRNA gene, 16S-23S intergenic spacer (ITS and RNA polymerase beta subunit (rpoB. High throughput sequencing (GS FLX 454, followed by stringent quality filtering, generated reads from bite marks for comparison to those generated from teeth samples. For all three regions, the greatest overlaps of identical reads were between bite mark samples and the corresponding teeth samples. The average proportions of reads identical between bite mark and corresponding teeth samples were 0.31, 0.41 and 0.31, and for non-corresponding samples were 0.11, 0.20 and 0.016, for 16S rRNA, ITS and rpoB, respectively. The probabilities of correctly distinguishing matching and non-matching teeth samples were 0.92 for ITS, 0.99 for 16S rRNA and 1.0 for rpoB. These findings strongly support the tenet that bacterial DNA amplified from bite marks and teeth can provide corroborating information in the identification of assailants.
cDNA, genomic sequence cloning and overexpression of ribosomal ...
African Journals Online (AJOL)
PRECIOUS
2009-11-02
Nov 2, 2009 ... basic machinery of protein synthesis and regulation, but also in various ... The genomic DNA was isolated from Giant Panda muscle tissue according to the ... for 45 s, 72°C for 2 min in the first cycle and the anneal temperature deceased 0.2°C ..... edition, Cold Spring Harbor aboratory Press. Cold Spring ...
Directory of Open Access Journals (Sweden)
Jean-Clement Mars
2018-01-01
Full Text Available The combination of Chromatin Immunoprecipitation and Massively Parallel Sequencing, or ChIP-Seq, has greatly advanced our genome-wide understanding of chromatin and enhancer structures. However, its resolution at any given genetic locus is limited by several factors. In applying ChIP-Seq to the study of the ribosomal RNA genes, we found that a major limitation to resolution was imposed by the underlying variability in sequence coverage that very often dominates the protein–DNA interaction profiles. Here, we describe a simple numerical deconvolution approach that, in large part, corrects for this variability, and significantly improves both the resolution and quantitation of protein–DNA interaction maps deduced from ChIP-Seq data. This approach has allowed us to determine the in vivo organization of the RNA polymerase I preinitiation complexes that form at the promoters and enhancers of the mouse (Mus musculus and human (Homo sapiens ribosomal RNA genes, and to reveal a phased binding of the HMG-box factor UBF across the rDNA. The data identify and map a “Spacer Promoter” and associated stalled polymerase in the intergenic spacer of the human ribosomal RNA genes, and reveal a very similar enhancer structure to that found in rodents and lower vertebrates.
DNA fingerprinting, DNA barcoding, and next generation sequencing technology in plants.
Sucher, Nikolaus J; Hennell, James R; Carles, Maria C
2012-01-01
DNA fingerprinting of plants has become an invaluable tool in forensic, scientific, and industrial laboratories all over the world. PCR has become part of virtually every variation of the plethora of approaches used for DNA fingerprinting today. DNA sequencing is increasingly used either in combination with or as a replacement for traditional DNA fingerprinting techniques. A prime example is the use of short, standardized regions of the genome as taxon barcodes for biological identification of plants. Rapid advances in "next generation sequencing" (NGS) technology are driving down the cost of sequencing and bringing large-scale sequencing projects into the reach of individual investigators. We present an overview of recent publications that demonstrate the use of "NGS" technology for DNA fingerprinting and DNA barcoding applications.
Wang, Yong; Qian, Pei-Yuan
2009-01-01
Bacterial 16S ribosomal DNA (rDNA) amplicons have been widely used in the classification of uncultured bacteria inhabiting environmental niches. Primers targeting conservative regions of the rDNAs are used to generate amplicons of variant regions
Rackwitz, Jenny; Bald, Ilko
2018-03-26
During cancer radiation therapy high-energy radiation is used to reduce tumour tissue. The irradiation produces a shower of secondary low-energy (DNA very efficiently by dissociative electron attachment. Recently, it was suggested that low-energy electron-induced DNA strand breaks strongly depend on the specific DNA sequence with a high sensitivity of G-rich sequences. Here, we use DNA origami platforms to expose G-rich telomere sequences to low-energy (8.8 eV) electrons to determine absolute cross sections for strand breakage and to study the influence of sequence modifications and topology of telomeric DNA on the strand breakage. We find that the telomeric DNA 5'-(TTA GGG) 2 is more sensitive to low-energy electrons than an intermixed sequence 5'-(TGT GTG A) 2 confirming the unique electronic properties resulting from G-stacking. With increasing length of the oligonucleotide (i.e., going from 5'-(GGG ATT) 2 to 5'-(GGG ATT) 4 ), both the variety of topology and the electron-induced strand break cross sections increase. Addition of K + ions decreases the strand break cross section for all sequences that are able to fold G-quadruplexes or G-intermediates, whereas the strand break cross section for the intermixed sequence remains unchanged. These results indicate that telomeric DNA is rather sensitive towards low-energy electron-induced strand breakage suggesting significant telomere shortening that can also occur during cancer radiation therapy. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Wang, Yong
2009-10-09
Bacterial 16S ribosomal DNA (rDNA) amplicons have been widely used in the classification of uncultured bacteria inhabiting environmental niches. Primers targeting conservative regions of the rDNAs are used to generate amplicons of variant regions that are informative in taxonomic assignment. One problem is that the percentage coverage and application scope of the primers used in previous studies are largely unknown. In this study, conservative fragments of available rDNA sequences were first mined and then used to search for candidate primers within the fragments by measuring the coverage rate defined as the percentage of bacterial sequences containing the target. Thirty predicted primers with a high coverage rate (>90%) were identified, which were basically located in the same conservative regions as known primers in previous reports, whereas 30% of the known primers were associated with a coverage rate of <90%. The application scope of the primers was also examined by calculating the percentages of failed detections in bacterial phyla. Primers A519-539, E969- 983, E1063-1081, U515 and E517, are highly recommended because of their high coverage in almost all phyla. As expected, the three predominant phyla, Firmicutes, Gemmatimonadetes and Proteobacteria, are best covered by the predicted primers. The primers recommended in this report shall facilitate a comprehensive and reliable survey of bacterial diversity in metagenomic studies. © 2009 Wang, Qian.
Ristaino, Jean B.; Madritch, Michael; Trout, Carol L.; Parra, Gregory
1998-01-01
We have developed a PCR procedure to amplify DNA for quick identification of the economically important species from each of the six taxonomic groups in the plant pathogen genus Phytophthora. This procedure involves amplification of the 5.8S ribosomal DNA gene and internal transcribed spacers (ITS) with the ITS primers ITS 5 and ITS 4. Restriction digests of the amplified DNA products were conducted with the restriction enzymes RsaI, MspI, and HaeIII. Restriction fragment patterns were similar after digestions with RsaI for the following species: P. capsici and P. citricola; P. infestans, P. cactorum, and P. mirabilis; P. fragariae, P. cinnamomi, and P. megasperma from peach; P. palmivora, P. citrophthora, P. erythroseptica, and P. cryptogea; and P. megasperma from raspberry and P. sojae. Restriction digests with MspI separated P. capsici from P. citricola and separated P. cactorum from P. infestans and P. mirabilis. Restriction digests with HaeIII separated P. citrophthora from P. cryptogea, P. cinnamomi from P. fragariae and P. megasperma on peach, P. palmivora from P. citrophthora, and P. megasperma on raspberry from P. sojae. P. infestans and P. mirabilis digests were identical and P. cryptogea and P. erythroseptica digests were identical with all restriction enzymes tested. A unique DNA sequence from the ITS region I in P. capsici was used to develop a primer called PCAP. The PCAP primer was used in PCRs with ITS 1 and amplified only isolates of P. capsici, P. citricola, and P. citrophthora and not 13 other species in the genus. Restriction digests with MspI separated P. capsici from the other two species. PCR was superior to traditional isolation methods for detection of P. capsici in infected bell pepper tissue in field samples. The techniques described will provide a powerful tool for identification of the major species in the genus Phytophthora. PMID:9501434
16S/18S ribosomal DNA clone library analysis of rumen microbial diversity
International Nuclear Information System (INIS)
Wright, A.G.; Kiyoshi Tajima; Aminov, R.I.
2005-01-01
The rumen contains a complex ecosystem where billions of bacteria, archaea, protozoa and fungi reside. This diverse microbiota is well adapted to live in the rumen and play an important role in the digestion of feed and nutrient supply to the host in the form of microbial protein and volatile fatty acids. It is estimated that the rumen microbial population consists of about 10 6 protozoa/ml, 10 3 -10 7 fungi/ml, 10 10 bacteria/ml, and 10 9 methanogens/ml. To better understand the complex relationships in the rumen, it is necessary to gain an insight into the diversity of the rumen microbes and how the quantity and composition of rumen micro-organisms are altered by a number of different host factors such as age, genetics and diet. In the past, the diversity of micro-organisms from the digestive tracts of domesticated ruminants has been identified by classical microbiological techniques. However, given the fastidious growth requirements of rumen micro-organisms, it is reasonable to concede that the culture-dependent methods may select against some species, or taxonomic groups, leading researchers to underestimate the microbial diversity that is actually present in the rumen. In fact, it has been speculated that 90% of micro-organisms in nature have escaped traditional cultivation methods. Therefore, a major challenge in microbial ecology has been to assess the diversity and structure of natural microbial communities. The field of molecular biology has advanced with many innovative technological breakthroughs. The ability to extract and to isolate high-molecular weight DNA from rumen digesta, PCR amplify genes from specific microbial groups and obtain gene sequence data is now a routine event. The small subunit ribosomal RNA (SSU-rRNA) gene, called 16S in prokaryotes and 18S in eukaryotes, is the most widely used molecular marker to presumptively identify morphologically indistinguishable species, to infer their phylogenetic relationships, and to elucidate microbial
Salaba, O; Rylková, K; Vadlejch, J; Petrtýl, M; Scháňková, S; Brožová, A; Jankovská, I; Jebavý, L; Langrová, I
2013-03-01
Trichuris nematodes were isolated from roe deer (Capreolus capreolus). At first, nematodes were determined using morphological and biometrical methods. Subsequently genomic DNA was isolated and the ITS1-5.8S-ITS2 segment from ribosomal DNA (RNA) was amplified and sequenced using PCR techniques. With u sing morphological and biometrical methods, female nematodes were identified as Trichuris globulosa, and the only male was identified as Trichuris ovis. The females were classified into four morphotypes. However, analysis of the internal transcribed spacers (ITS1-5.8S-ITS2) of specimens did not confirm this classification. Moreover, the female individuals morphologically determined as T. globulosa were molecularly identified as Trichuris discolor. In the case of the only male molecular analysis match the result of the molecular identification. Furthermore, a comparative phylogenetic study was carried out with the ITS1 and ITS2 sequences of the Trichuris species from various hosts. A comparison of biometric information from T. discolor individuals from this study was also conducted.
Lee, Shih-Chieh; Wang, Chia-Hsiang; Yen, Cheng-En; Chang, Chieh
2017-04-01
The major aim of made tea identification is to identify the variety and provenance of the tea plant. The present experiment used 113 tea plants [Camellia sinensis (L.) O. Kuntze] housed at the Tea Research and Extension Substation, from which 113 internal transcribed spacer 2 (ITS2) fragments, 104 trnL intron, and 98 trnL-trnF intergenic sequence region DNA sequences were successfully sequenced. The similarity of the ITS2 nucleotide sequences between tea plants housed at the Tea Research and Extension Substation was 0.379-0.994. In this polymerase chain reaction-amplified noncoding region, no varieties possessed identical sequences. Compared with the trnL intron and trnL-trnF intergenic sequence fragments of chloroplast cpDNA, the proportion of ITS2 nucleotide sequence variation was large and is more suitable for establishing a DNA barcode database to identify tea plant varieties. After establishing the database, 30 imported teas and 35 domestic made teas were used in this model system to explore the feasibility of using ITS2 sequences to identify the varieties and provenances of made teas. A phylogenetic tree was constructed using ITS2 sequences with the unweighted pair group method with arithmetic mean, which indicated that the same variety of tea plant is likely to be successfully categorized into one cluster, but contamination from other tea plants was also detected. This result provides molecular evidence that the similarity between important tea varieties in Taiwan remains high. We suggest a direct, wide collection of made tea and original samples of tea plants to establish an ITS2 sequence molecular barcode identification database to identify the varieties and provenances of tea plants. The DNA barcode comparison method can satisfy the need for a rapid, low-cost, frontline differentiation of the large amount of made teas from Taiwan and abroad, and can provide molecular evidence of their varieties and provenances. Copyright © 2016. Published by Elsevier B.V.
Directory of Open Access Journals (Sweden)
V. R. Després
2007-12-01
Full Text Available This study explores the applicability of DNA analyses for the characterization of primary biogenic aerosol (PBA particles in the atmosphere. Samples of fine particulate matter (PM2.5 and total suspended particulates (TSP have been collected on different types of filter materials at urban, rural, and high-alpine locations along an altitude transect in the south of Germany (Munich, Hohenpeissenberg, Mt. Zugspitze.
From filter segments loaded with about one milligram of air particulate matter, DNA could be extracted and DNA sequences could be determined for bacteria, fungi, plants and animals. Sequence analyses were used to determine the identity of biological organisms, and terminal restriction fragment length polymorphism analyses (T-RFLP were applied to estimate diversities and relative abundances of bacteria. Investigations of blank and background samples showed that filter materials have to be decontaminated prior to use, and that the sampling and handling procedures have to be carefully controlled to avoid artifacts in the analyses.
Mass fractions of DNA in PM2.5 were found to be around 0.05% in urban, rural, and high-alpine aerosols. The average concentration of DNA determined for urban air was on the order of ~7 ng m−3, indicating that human adults may inhale about one microgram of DNA per day (corresponding to ~108 haploid bacterial genomes or ~105 haploid human genomes, respectively.
Most of the bacterial sequences found in PM2.5 were from Proteobacteria (42 and some from Actinobacteria (10 and Firmicutes (1. The fungal sequences were characteristic for Ascomycota (3 and Basidiomycota (1, which are known to actively discharge spores into the atmosphere. The plant sequences could be attributed to green plants (2 and moss spores (2, while animal DNA was found only for one unicellular eukaryote (protist.
A novel constraint for thermodynamically designing DNA sequences.
Directory of Open Access Journals (Sweden)
Qiang Zhang
Full Text Available Biotechnological and biomolecular advances have introduced novel uses for DNA such as DNA computing, storage, and encryption. For these applications, DNA sequence design requires maximal desired (and minimal undesired hybridizations, which are the product of a single new DNA strand from 2 single DNA strands. Here, we propose a novel constraint to design DNA sequences based on thermodynamic properties. Existing constraints for DNA design are based on the Hamming distance, a constraint that does not address the thermodynamic properties of the DNA sequence. Using a unique, improved genetic algorithm, we designed DNA sequence sets which satisfy different distance constraints and employ a free energy gap based on a minimum free energy (MFE to gauge DNA sequences based on set thermodynamic properties. When compared to the best constraints of the Hamming distance, our method yielded better thermodynamic qualities. We then used our improved genetic algorithm to obtain lower-bound DNA sequence sets. Here, we discuss the effects of novel constraint parameters on the free energy gap.
How and why DNA barcodes underestimate the diversity of microbial eukaryotes.
Directory of Open Access Journals (Sweden)
Gwenael Piganeau
Full Text Available BACKGROUND: Because many picoplanktonic eukaryotic species cannot currently be maintained in culture, direct sequencing of PCR-amplified 18S ribosomal gene DNA fragments from filtered sea-water has been successfully used to investigate the astounding diversity of these organisms. The recognition of many novel planktonic organisms is thus based solely on their 18S rDNA sequence. However, a species delimited by its 18S rDNA sequence might contain many cryptic species, which are highly differentiated in their protein coding sequences. PRINCIPAL FINDINGS: Here, we investigate the issue of species identification from one gene to the whole genome sequence. Using 52 whole genome DNA sequences, we estimated the global genetic divergence in protein coding genes between organisms from different lineages and compared this to their ribosomal gene sequence divergences. We show that this relationship between proteome divergence and 18S divergence is lineage dependent. Unicellular lineages have especially low 18S divergences relative to their protein sequence divergences, suggesting that 18S ribosomal genes are too conservative to assess planktonic eukaryotic diversity. We provide an explanation for this lineage dependency, which suggests that most species with large effective population sizes will show far less divergence in 18S than protein coding sequences. CONCLUSIONS: There is therefore a trade-off between using genes that are easy to amplify in all species, but which by their nature are highly conserved and underestimate the true number of species, and using genes that give a better description of the number of species, but which are more difficult to amplify. We have shown that this trade-off differs between unicellular and multicellular organisms as a likely consequence of differences in effective population sizes. We anticipate that biodiversity of microbial eukaryotic species is underestimated and that numerous "cryptic species" will become
DEFF Research Database (Denmark)
Petersen, Gitte; Cuenca, Argelia; Zervas, Athanasios
2017-01-01
The order Alismatales is a hotspot for evolution of plant mitochondrial genomes characterized by remarkable differences in genome size, substitution rates, RNA editing, retrotranscription, gene loss and intron loss. Here we have sequenced the complete mitogenomes of Zostera marina and Stratiotes...... aloides, which together with previously sequenced mitogenomes from Butomus and Spirodela, provide new evolutionary evidence of genome size reduction, gene loss and transfer to the nucleus. The Zostera mitogenome includes a large portion of DNA transferred from the plastome, yet it is the smallest known...... mitogenome from a non-parasitic plant. Using a broad sample of the Alismatales, the evolutionary history of ribosomal protein gene loss is analyzed. In Zostera almost all ribosomal protein genes are lost from the mitogenome, but only some can be found in the nucleus....
Tarcz, Sebastian; Potekhin, Alexey; Rautian, Maria; Przyboś, Ewa
2012-05-01
This is the first phylogenetic study of the intraspecific variability within Paramecium multimicronucleatum with the application of two-loci analysis (ITS1-5.8S-ITS2-5'LSU rDNA and COI mtDNA) carried out on numerous strains originated from different continents. The species has been shown to have a complex structure of several sibling species within taxonomic species. Our analysis revealed the existence of 10 haplotypes for the rDNA fragment and 15 haplotypes for the COI fragment in the studied material. The mean distance for all of the studied P. multimicronucleatum sequence pairs was p=0.025/0.082 (rDNA/COI). Despite the greater variation of the COI fragment, the COI-derived tree topology is similar to the tree topology constructed on the basis of the rDNA fragment. P. multimicronucleatum strains are divided into three main clades. The tree based on COI fragment analysis presents a greater resolution of the studied P. multimicronucleatum strains. Our results indicate that the strains of P. multimicronucleatum that appear in different clades on the trees could belong to different syngens. Copyright © 2012 Elsevier Inc. All rights reserved.
Extrachromosomal circles of satellite repeats and 5S ribosomal DNA in human cells
Directory of Open Access Journals (Sweden)
Cohen Sarit
2010-03-01
Full Text Available Abstract Background Extrachomosomal circular DNA (eccDNA is ubiquitous in eukaryotic organisms and was detected in every organism tested, including in humans. A two-dimensional gel electrophoresis facilitates the detection of eccDNA in preparations of genomic DNA. Using this technique we have previously demonstrated that most of eccDNA consists of exact multiples of chromosomal tandemly repeated DNA, including both coding genes and satellite DNA. Results Here we report the occurrence of eccDNA in every tested human cell line. It has heterogeneous mass ranging from less than 2 kb to over 20 kb. We describe eccDNA homologous to human alpha satellite and the SstI mega satellite. Moreover, we show, for the first time, circular multimers of the human 5S ribosomal DNA (rDNA, similar to previous findings in Drosophila and plants. We further demonstrate structures that correspond to intermediates of rolling circle replication, which emerge from the circular multimers of 5S rDNA and SstI satellite. Conclusions These findings, and previous reports, support the general notion that every chromosomal tandem repeat is prone to generate eccDNA in eukryoric organisms including humans. They suggest the possible involvement of eccDNA in the length variability observed in arrays of tandem repeats. The implications of eccDNA on genome biology may include mechanisms of centromere evolution, concerted evolution and homogenization of tandem repeats and genomic plasticity.
Luo, Jianxun; Yin, Hong; Liu, Zhijie; Yang, Dongying; Guan, Guiquan; Liu, Aihong; Ma, Miling; Dang, Shengzhi; Lu, Bingyi; Sun, Caiqin; Bai, Qi; Lu, Wenshun; Chen, Puyan
2005-10-10
The 18S small subunit ribosomal RNA (18S rRNA) gene of an unnamed Babesia species (designated B. U sp.) was sequenced and analyzed in an attempt to distinguish it from other Babesia species in China. The target DNA segment was amplified by polymerase chain reaction (PCR). The PCR product was ligated to the pGEM-T Easy vector for sequencing. It was found that the length of the 18S rRNA gene of all B. U sp. Kashi 1 and B. U sp. Kashi 2 was 1699 bp and 1689 bp. Two phylogenetic trees were, respectively, inferred based on 18S rRNA sequence of the Chinese bovine Babesia isolates and all of Babesia species available in GenBank. The first tree showed that B. U sp. was situated in the branch between B. major Yili and B. bovis Shannxian, and the second tree revealed that B. U sp. was confined to the same group as B. caballi. The percent identity of B. U sp. with other Chinese Babesia species was between 74.2 and 91.8, while the percent identity between two B. U sp. isolates was 99.7. These results demonstrated that this B. U sp. is different from other Babesia species, but that two B. U sp. isolates obtained with nymphal and adultal Hyalomma anatolicum anatolicum tick belong to the same species.
Fractals in DNA sequence analysis
Institute of Scientific and Technical Information of China (English)
Yu Zu-Guo(喻祖国); Vo Anh; Gong Zhi-Min(龚志民); Long Shun-Chao(龙顺潮)
2002-01-01
Fractal methods have been successfully used to study many problems in physics, mathematics, engineering, finance,and even in biology. There has been an increasing interest in unravelling the mysteries of DNA; for example, how can we distinguish coding and noncoding sequences, and the problems of classification and evolution relationship of organisms are key problems in bioinformatics. Although much research has been carried out by taking into consideration the long-range correlations in DNA sequences, and the global fractal dimension has been used in these works by other people, the models and methods are somewhat rough and the results are not satisfactory. In recent years, our group has introduced a time series model (statistical point of view) and a visual representation (geometrical point of view)to DNA sequence analysis. We have also used fractal dimension, correlation dimension, the Hurst exponent and the dimension spectrum (multifractal analysis) to discuss problems in this field. In this paper, we introduce these fractal models and methods and the results of DNA sequence analysis.
Fast and secure retrieval of DNA sequences
2014-01-01
Sequence models are retrieved from a sequences index. The sequence models model DNA or RNA sequences stored in a database, and each comprises a finite memory tree source model and parameters for the finite memory tree source model. One or more DNA or RNA sequences stored in the database are
Miller, Robert J H; Chow, Barbara; Pillai, Dylan; Church, Deirdre
2016-04-12
The study aimed to explore the sensitivity and specificity of a novel fast 16S rDNA PCR and sequencing assay for the improved diagnosis of infective endocarditis (IE) in patients with suspected native or prosthetic heart valve (HV) infection over a multi-year period at our cardiovascular center. Sixty-eight patients were prospectively enrolled who underwent HV replacement for suspected or confirmed IE between February 1, 2009 and September 1, 2014. Patient demographics, medical co-morbidities, Duke's criteria, culture results, and antibiotic therapy were collected by detailed chart reviews. Dual-priming oligonucleotide primers targeted to 500 bps of the V1-V3 region of the 16S rRNA gene were used to perform fast broad-range 16S rDNA PCR and Sanger sequencing on ribosomal DNA extracted from HV tissues. The performance/diagnostic efficiency of the molecular test was evaluated against blood cultures and Gram stain and culture of HV tissue in patients' with definite IE according to Duke's criteria. Fifty patients (73.5%) had definite IE and another 8 (11.8%) had possible IE according to Duke's criteria. Cardiac surgery was delayed an average of 15.4 days from the time of the patient's last positive blood culture, and appropriate antibiotic therapy was given in the pre-operative period. While 44/50 (88%) patients had a positive blood culture, HV tissue culture was only positive in 23 (46%) of them. Molecular testing of all HV tissues had sensitivity, specificity, NPV and PPV of 92, 77.8, 77.8 and 92% compared to 44, 100, 39.1 and 100% respectively for culture for diagnosis of definite IE. For prosthetic HV tissue, 16S rDNA PCR had sensitivity of 93% and specificity of 83% compared to 35 and 100% respectively for culture. A literature review showed that the diagnostic accuracy of our novel fast broad-range 16S rDNA PCR assay was similar or better than that of previously published studies. This novel fast broad-range 16S rDNA PCR/sequencing test had superior sensitivity
Energy Technology Data Exchange (ETDEWEB)
Cook-Deegan, R.M. [Georgetown Univ., Kennedy Inst. of Ethics, Washington, DC (United States); Venter, J.C. [National Inst. of Neurological Disorders and Strokes, Bethesda, MD (United States); Gilbert, W. [Harvard Univ., Cambridge, MA (United States); Mulligan, J. [Stanford Univ., CA (United States); Mansfield, B.K. [Oak Ridge National Lab., TN (United States)
1991-06-19
This conference focused on DNA sequencing, genetic linkage mapping, physical mapping, informatics and bioethics. Several were used to study this sequencing and mapping. This article also discusses computer hardware and software aiding in the mapping of genes.
Nucleotide sequence preservation of human mitochondrial DNA
International Nuclear Information System (INIS)
Monnat, R.J. Jr.; Loeb, L.A.
1985-01-01
Recombinant DNA techniques have been used to quantitate the amount of nucleotide sequence divergence in the mitochondrial DNA population of individual normal humans. Mitochondrial DNA was isolated from the peripheral blood lymphocytes of five normal humans and cloned in M13 mp11; 49 kilobases of nucleotide sequence information was obtained from 248 independently isolated clones from the five normal donors. Both between- and within-individual differences were identified. Between-individual differences were identified in approximately = to 1/200 nucleotides. In contrast, only one within-individual difference was identified in 49 kilobases of nucleotide sequence information. This high degree of mitochondrial nucleotide sequence homogeneity in human somatic cells is in marked contrast to the rapid evolutionary divergence of human mitochondrial DNA and suggests the existence of mechanisms for the concerted preservation of mammalian mitochondrial DNA sequences in single organisms
A DNA Structure-Based Bionic Wavelet Transform and Its Application to DNA Sequence Analysis
Directory of Open Access Journals (Sweden)
Fei Chen
2003-01-01
Full Text Available DNA sequence analysis is of great significance for increasing our understanding of genomic functions. An important task facing us is the exploration of hidden structural information stored in the DNA sequence. This paper introduces a DNA structure-based adaptive wavelet transform (WT – the bionic wavelet transform (BWT – for DNA sequence analysis. The symbolic DNA sequence can be separated into four channels of indicator sequences. An adaptive symbol-to-number mapping, determined from the structural feature of the DNA sequence, was introduced into WT. It can adjust the weight value of each channel to maximise the useful energy distribution of the whole BWT output. The performance of the proposed BWT was examined by analysing synthetic and real DNA sequences. Results show that BWT performs better than traditional WT in presenting greater energy distribution. This new BWT method should be useful for the detection of the latent structural features in future DNA sequence analysis.
Tamadoni Jahromi, S.; Mohd Noor, S. A.; Pirian, K.; Dehghani, R.; Nazemi, M.; Khazaali, A.
2016-01-01
In this study, mitochondrial DNA analysis using 16S ribosomal DNA (rDNA) was performed to investigate the phylogeny relationship of Trichiurus lepturus in the Persian Gulf compared to the other investigated area. The amplification of 16S rDNA resulted in a product of 600 bp in all samples. The results showed that the isolated strain belongs to T. lepturus showing 42 divergence sites among the same reported partial sequences of 16S rRNA gene from the other area (West Atlantic and Indo-Pacific area). Phylogeny results showed that all 18 haplotypes of the species clustered into five clades with reasonably high bootstrap support of values (>64%). Overall, the tree topology for both phylogenetic and phenetic trees for 16S rDNA was similar. Both trees exposed two major clusters, one wholly containing the haplotypes of the T. lepturus species belonging to Indo-Pacific area with two major sister groups including Persian Gulf specimen and the other cleared the Western Atlantic and Japan individuals clustered in another distinct clade supporting the differentiation between the two areas. Phylogenic relationship observed between the Persian Gulf and the other Indo-Pacific Individuals suggested homogeneity between two mentioned areas. PMID:27822250
Directory of Open Access Journals (Sweden)
Widiarti Widiarti
2016-05-01
Full Text Available AbstractMalaria control is remain a challenge although various attempts have been conducted. One of the issues in controlling the vectors is the presence of species complex. The species complex is an example of genetic diversity. Anopheles balabacensis, Baisas reported as complex species in various countries, but has not been widely reported in Indonesia. In order to enhance malaria control, it is important to understand the vectors and its bioecology. The aim of the study were a. to identify An. balabacensis, Baisas suspected as species complex based on ribosomal DNA the second internal transcribed spacer (ITS2 gene sequences, b. to understand the genetic diversity of An. balabacensis, Baisas collected from endemic and non endemic regions distincted by geographical distance, c. to understand the genetic relationships (taxonomi distance among An. balabacensis, Baisas from difference regions in Indonesia through reconstructing the phylogenetic trees. The results showed that An. balabacensis, Baisas in Indonesia is identified as sympatric and allopatrik complex species. There were differences which was far enough in the genetic relationships among An. balabacensis populations collected from Pusuk Lestari in the area of Meninting Health Center, West Lombok, NTB. This differences were identified as sympatric complex. In addition, base on the relationship among An. leucosphyrus group, An balabacensis, Baisas collected from Berjoko Nunukan Regency showed that the species quite far compare to An. balabacensis, Baisas originally from Central Java and Lombok NTB.Keywords : An. balabacensis, genetic variation, the second Internal Transcribed Spacer (ITS2.AbstrakPenanggulangan malaria masih banyak menemui kendala walaupun berbagai upaya telah dilakukan. Salah satu kendala yang menyulitkan dalam pengendalian vektor adalah adanya spesies kompleks pada populasi nyamuk vektor. Spesies kompleks merupakan contoh diversitas genetik. Anopheles balabacensis
Kimura, J; Kimura, M
1987-09-05
The amino acid sequences of two ribosomal proteins, S14 and S16, from the archaebacterium Halobacterium marismortui have been determined. Sequence data were obtained by the manual and solid-phase sequencing of peptides derived from enzymatic digestions with trypsin, chymotrypsin, pepsin, and Staphylococcus aureus protease as well as by chemical cleavage with cyanogen bromide. Proteins S14 and S16 contain 109 and 126 amino acid residues and have Mr values of 11,964 and 13,515, respectively. Comparison of the sequences with those of ribosomal proteins from other organisms demonstrates that S14 has a significant homology with the rat liver ribosomal protein S11 (36% identity) as well as with the Escherichia coli ribosomal protein S17 (37%), and that S16 is related to the yeast ribosomal protein YS22 (40%) and proteins S8 from E. coli (28%) and Bacillus stearothermophilus (30%). A comparison of the amino acid residues in the homologous regions of halophilic and nonhalophilic ribosomal proteins reveals that halophilic proteins have more glutamic acids, asparatic acids, prolines, and alanines, and less lysines, arginines, and isoleucines than their nonhalophilic counterparts. These amino acid substitutions probably contribute to the structural stability of halophilic ribosomal proteins.
Polymorphic DNA sequences of the fungal honey bee pathogen Ascosphaera apis
DEFF Research Database (Denmark)
Jensen, Annette B; Welker, Dennis L; Kryger, Per
2012-01-01
The pathogenic fungus Ascosphaera apis is ubiquitous in honey bee populations. We used the draft genome assembly of this pathogen to search for polymorphic intergenic loci that could be used to differentiate haplotypes. Primers were developed for five such loci, and the species specificities were...... verified using DNA from nine closely related species. The sequence variation was compared among 12 A. apis isolates at each of these loci, and two additional loci, the internal transcribed spacer of the ribosomal RNA (ITS) and a variable part of the elongation factor 1α (Ef1α). The degree of variation...... was then compared among the different loci, and three were found to have the greatest detection power for identifying A. apis haplotypes. The described loci can help to resolve strain differences and population genetic structures, to elucidate host–pathogen interaction and to test evolutionary hypotheses...
International Nuclear Information System (INIS)
Mie, Masayasu; Shimizu, Shun; Takahashi, Fumio; Kobatake, Eiry
2008-01-01
The 5'-untranslated region (5'-UTR) of mRNAs functions as a translation enhancer, promoting translation efficiency. Many in vitro translation systems exhibit a reduced efficiency in protein translation due to decreased translation initiation. The use of a 5'-UTR sequence with high translation efficiency greatly enhances protein production in these systems. In this study, we have developed an in vitro selection system that favors 5'-UTRs with high translation efficiency using a ribosome display technique. A 5'-UTR random library, comprised of 5'-UTRs tagged with a His-tag and Renilla luciferase (R-luc) fusion, were in vitro translated in rabbit reticulocytes. By limiting the translation period, only mRNAs with high translation efficiency were translated. During translation, mRNA, ribosome and translated R-luc with His-tag formed ternary complexes. They were collected with translated His-tag using Ni-particles. Extracted mRNA from ternary complex was amplified using RT-PCR and sequenced. Finally, 5'-UTR with high translation efficiency was obtained from random 5'-UTR library
EGNAS: an exhaustive DNA sequence design algorithm
Directory of Open Access Journals (Sweden)
Kick Alfred
2012-06-01
Full Text Available Abstract Background The molecular recognition based on the complementary base pairing of deoxyribonucleic acid (DNA is the fundamental principle in the fields of genetics, DNA nanotechnology and DNA computing. We present an exhaustive DNA sequence design algorithm that allows to generate sets containing a maximum number of sequences with defined properties. EGNAS (Exhaustive Generation of Nucleic Acid Sequences offers the possibility of controlling both interstrand and intrastrand properties. The guanine-cytosine content can be adjusted. Sequences can be forced to start and end with guanine or cytosine. This option reduces the risk of “fraying” of DNA strands. It is possible to limit cross hybridizations of a defined length, and to adjust the uniqueness of sequences. Self-complementarity and hairpin structures of certain length can be avoided. Sequences and subsequences can optionally be forbidden. Furthermore, sequences can be designed to have minimum interactions with predefined strands and neighboring sequences. Results The algorithm is realized in a C++ program. TAG sequences can be generated and combined with primers for single-base extension reactions, which were described for multiplexed genotyping of single nucleotide polymorphisms. Thereby, possible foldback through intrastrand interaction of TAG-primer pairs can be limited. The design of sequences for specific attachment of molecular constructs to DNA origami is presented. Conclusions We developed a new software tool called EGNAS for the design of unique nucleic acid sequences. The presented exhaustive algorithm allows to generate greater sets of sequences than with previous software and equal constraints. EGNAS is freely available for noncommercial use at http://www.chm.tu-dresden.de/pc6/EGNAS.
Barnard, G F; Staniunas, R J; Puder, M; Steele, G D; Chen, L B
1994-08-02
Ribosomal protein L37 mRNA is overexpressed in colon cancer. The nucleotide sequences of human L37 from several tumor and normal, colon and liver cDNA sources were determined to be identical. L37 mRNA was approximately 375 nucleotides long encoding 97 amino acids with M(r) = 11,070, pI = 12.6, multiple potential serine/threonine phosphorylation sites and a zinc-finger domain. The human sequence is compared to other species.
Ribosomal DNA variation in finger millet and wild species of Eleusine (Poaceae).
Hilu, K W; Johnson, J L
1992-04-01
Finger millet is an important cereal crop in the semi-arid regions of Africa and India. The crop belongs to the grass genus Eleusine, which includes nine annual and perennial species native to Africa except for the New World species E. tristachya. Ribosomal DNA (rDNA) variation in finger millet and related wild species was used to provide information on the origin of the genomes of this tetraploid crop and point out genetic relationships of the crop to other species in the genus. The restriction endonucleases used revealed a lack of variability in the rDNA spacer region in domesticated finger millet. All the rDNA variants of the crop were found in the proposed direct tetraploid ancestor, E. coracana subsp. africana. Wild and domesticated finger millet displayed the phenotypes found in diploid E. indica. Diploid Eleusine tristachya showed some similarity to the crop in some restriction sites. The remaining species were quite distinct in rDNA fragment patterns. The study supports the direct origin of finger millet from subspecies africana shows E. indica to be one of the genome donors of the crop, and demonstrates that none of the other species examined could have donated the second genome of the crop. The rDNA data raise the possibility that wild and domesticated finger millet could have originated as infraspecific polyploid hybrids from different varieties of E. indica.
International Nuclear Information System (INIS)
Robb, F.T.
1998-01-01
'The major objective of the research is to provide appropriate sequences and to assemble a high-density DNA array of oligonucleotides that can be used for rapid profiling of microbial populations from polluted areas. The sequences to be assigned to the DNA array are chosen from from cloned genomic DNA sequences (the ribosomal operon, described below) from groundwater at DOE sites containing organic solvents. The sites, Hanford Nuclear Plant and Lawrence Livermore Site 300, have well characterized pollutant histories, which have been provided by the collaborators. At this mid-point of the project, over 60 unique sequence classes of intergenic spacer region have been identified from the first sample site. The use of these sequences as hybridization probes, and their frequency of occurrence, allow a clear distinction between bacterial communities before and after remediation by acetate/nitrate pumping. The authors have developed the hybridization conditions for identifying PCR products in a 96 well format, a versatile alignment and visualization program (acronym: MALIGN) developed by Dr. Dennis Maeder, has been used to align the ISRs, which are variable in length and sometimes in position of the tRNAs. Finally, in collaboration with Dr. W. Chen and Dr. J. Zhou at ORNL, they have significant evidence that mass spectrometer analysis can be used to determine the lengths of PCR amplified intergenic spacer DNA.'
Sequence periodicity in nucleosomal DNA and intrinsic curvature.
Nair, T Murlidharan
2010-05-17
Most eukaryotic DNA contained in the nucleus is packaged by wrapping DNA around histone octamers. Histones are ubiquitous and bind most regions of chromosomal DNA. In order to achieve smooth wrapping of the DNA around the histone octamer, the DNA duplex should be able to deform and should possess intrinsic curvature. The deformability of DNA is a result of the non-parallelness of base pair stacks. The stacking interaction between base pairs is sequence dependent. The higher the stacking energy the more rigid the DNA helix, thus it is natural to expect that sequences that are involved in wrapping around the histone octamer should be unstacked and possess intrinsic curvature. Intrinsic curvature has been shown to be dictated by the periodic recurrence of certain dinucleotides. Several genome-wide studies directed towards mapping of nucleosome positions have revealed periodicity associated with certain stretches of sequences. In the current study, these sequences have been analyzed with a view to understand their sequence-dependent structures. Higher order DNA structures and the distribution of molecular bend loci associated with 146 base nucleosome core DNA sequence from C. elegans and chicken have been analyzed using the theoretical model for DNA curvature. The curvature dispersion calculated by cyclically permuting the sequences revealed that the molecular bend loci were delocalized throughout the nucleosome core region and had varying degrees of intrinsic curvature. The higher order structures associated with nucleosomes of C.elegans and chicken calculated from the sequences revealed heterogeneity with respect to the deviation of the DNA axis. The results points to the possibility of context dependent curvature of varying degrees to be associated with nucleosomal DNA.
DNA sequence modeling based on context trees
Kusters, C.J.; Ignatenko, T.; Roland, J.; Horlin, F.
2015-01-01
Genomic sequences contain instructions for protein and cell production. Therefore understanding and identification of biologically and functionally meaningful patterns in DNA sequences is of paramount importance. Modeling of DNA sequences in its turn can help to better understand and identify such
Sequencing of chloroplast genome using whole cellular DNA and Solexa sequencing technology
Directory of Open Access Journals (Sweden)
Jian eWu
2012-11-01
Full Text Available Sequencing of the chloroplast genome using traditional sequencing methods has been difficult because of its size (>120 kb and the complicated procedures required to prepare templates. To explore the feasibility of sequencing the chloroplast genome using DNA extracted from whole cells and Solexa sequencing technology, we sequenced whole cellular DNA isolated from leaves of three Brassica rapa accessions with one lane per accession. In total, 246 Mb, 362Mb, 361 Mb sequence data were generated for the three accessions Chiifu-401-42, Z16 and FT, respectively. Microreads were assembled by reference-guided assembly using the cpDNA sequences of B. rapa, Arabidopsis thaliana, and Nicotiana tabacum. We achieved coverage of more than 99.96% of the cp genome in the three tested accessions using the B. rapa sequence as the reference. When A. thaliana or N. tabacum sequences were used as references, 99.7–99.8% or 95.5–99.7% of the B. rapa chloroplast genome was covered, respectively. These results demonstrated that sequencing of whole cellular DNA isolated from young leaves using the Illumina Genome Analyzer is an efficient method for high-throughput sequencing of chloroplast genome.
Zelck, Ulrike E; Bialek, Ralf; Weiss, Michael
2011-04-01
We genetically characterized pinworms obtained from 37 children from different regions of Germany and established new species-specific molecular diagnostic tools. No ribosomal DNA diversity was found; the phylogenetic position of Enterobius vermicularis within the Oxyurida order and its close relationship to the Ascaridida and Spirurida orders was confirmed.
Sequence of human protamine 2 cDNA
Energy Technology Data Exchange (ETDEWEB)
Domenjoud, L; Fronia, C; Uhde, F; Engel, W [Universitaet Goettingen (West Germany)
1988-08-11
The authors report the cloning and sequencing of a cDNA clone for human protamine 2 (hp2), isolated from a human testis cDNA library cloned in the vector {lambda}-gt11. A 66mer oligonucleotide, that corresponds to an amino acid sequence which is highly conserved between hp2 and mouse protamine 2 (mp2) served as hybridization probe. The homology between the amino acid sequence deduced from our cDNA and the published amino acid sequence for hp2 is 100%.
Control of ribosome traffic by position-dependent choice of synonymous codons
International Nuclear Information System (INIS)
Mitarai, Namiko; Pedersen, Steen
2013-01-01
Messenger RNA (mRNA) encodes a sequence of amino acids by using codons. For most amino acids, there are multiple synonymous codons that can encode the amino acid. The translation speed can vary from one codon to another, thus there is room for changing the ribosome speed while keeping the amino acid sequence and hence the resulting protein. Recently, it has been noticed that the choice of the synonymous codon, via the resulting distribution of slow- and fast-translated codons, affects not only on the average speed of one ribosome translating the mRNA but also might have an effect on nearby ribosomes by affecting the appearance of ‘traffic jams’ where multiple ribosomes collide and form queues. To test this ‘context effect’ further, we here investigate the effect of the sequence of synonymous codons on the ribosome traffic by using a ribosome traffic model with codon-dependent rates, estimated from experiments. We compare the ribosome traffic on wild-type (WT) sequences and sequences where the synonymous codons were swapped randomly. By simulating translation of 87 genes, we demonstrate that the WT sequences, especially those with a high bias in codon usage, tend to have the ability to reduce ribosome collisions, hence optimizing the cellular investment in the translation apparatus. The magnitude of such reduction of the translation time might have a significant impact on the cellular growth rate and thereby have importance for the survival of the species. (paper)
Bacterial identification and subtyping using DNA microarray and DNA sequencing.
Al-Khaldi, Sufian F; Mossoba, Magdi M; Allard, Marc M; Lienau, E Kurt; Brown, Eric D
2012-01-01
The era of fast and accurate discovery of biological sequence motifs in prokaryotic and eukaryotic cells is here. The co-evolution of direct genome sequencing and DNA microarray strategies not only will identify, isotype, and serotype pathogenic bacteria, but also it will aid in the discovery of new gene functions by detecting gene expressions in different diseases and environmental conditions. Microarray bacterial identification has made great advances in working with pure and mixed bacterial samples. The technological advances have moved beyond bacterial gene expression to include bacterial identification and isotyping. Application of new tools such as mid-infrared chemical imaging improves detection of hybridization in DNA microarrays. The research in this field is promising and future work will reveal the potential of infrared technology in bacterial identification. On the other hand, DNA sequencing by using 454 pyrosequencing is so cost effective that the promise of $1,000 per bacterial genome sequence is becoming a reality. Pyrosequencing technology is a simple to use technique that can produce accurate and quantitative analysis of DNA sequences with a great speed. The deposition of massive amounts of bacterial genomic information in databanks is creating fingerprint phylogenetic analysis that will ultimately replace several technologies such as Pulsed Field Gel Electrophoresis. In this chapter, we will review (1) the use of DNA microarray using fluorescence and infrared imaging detection for identification of pathogenic bacteria, and (2) use of pyrosequencing in DNA cluster analysis to fingerprint bacterial phylogenetic trees.
High-Throughput Block Optical DNA Sequence Identification.
Sagar, Dodderi Manjunatha; Korshoj, Lee Erik; Hanson, Katrina Bethany; Chowdhury, Partha Pratim; Otoupal, Peter Britton; Chatterjee, Anushree; Nagpal, Prashant
2018-01-01
Optical techniques for molecular diagnostics or DNA sequencing generally rely on small molecule fluorescent labels, which utilize light with a wavelength of several hundred nanometers for detection. Developing a label-free optical DNA sequencing technique will require nanoscale focusing of light, a high-throughput and multiplexed identification method, and a data compression technique to rapidly identify sequences and analyze genomic heterogeneity for big datasets. Such a method should identify characteristic molecular vibrations using optical spectroscopy, especially in the "fingerprinting region" from ≈400-1400 cm -1 . Here, surface-enhanced Raman spectroscopy is used to demonstrate label-free identification of DNA nucleobases with multiplexed 3D plasmonic nanofocusing. While nanometer-scale mode volumes prevent identification of single nucleobases within a DNA sequence, the block optical technique can identify A, T, G, and C content in DNA k-mers. The content of each nucleotide in a DNA block can be a unique and high-throughput method for identifying sequences, genes, and other biomarkers as an alternative to single-letter sequencing. Additionally, coupling two complementary vibrational spectroscopy techniques (infrared and Raman) can improve block characterization. These results pave the way for developing a novel, high-throughput block optical sequencing method with lossy genomic data compression using k-mer identification from multiplexed optical data acquisition. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Asymmetric epigenetic modification and elimination of rDNA sequences by polyploidization in wheat.
Guo, Xiang; Han, Fangpu
2014-11-01
rRNA genes consist of long tandem repeats clustered on chromosomes, and their products are important functional components of the ribosome. In common wheat (Triticum aestivum), rDNA loci from the A and D genomes were largely lost during the evolutionary process. This biased DNA elimination may be related to asymmetric transcription and epigenetic modifications caused by the polyploid formation. Here, we observed both sets of parental nucleolus organizing regions (NORs) were expressed after hybridization, but asymmetric silencing of one parental NOR was immediately induced by chromosome doubling, and reversing the ploidy status could not reactivate silenced NORs. Furthermore, increased CHG and CHH DNA methylation on promoters was accompanied by asymmetric silencing of NORs. Enrichment of H3K27me3 and H3K9me2 modifications was also observed to be a direct response to increased DNA methylation and transcriptional inactivation of NOR loci. Both A and D genome NOR loci with these modifications started to disappear in the S4 generation and were completely eliminated by the S7 generation in synthetic tetraploid wheat. Our results indicated that asymmetric epigenetic modification and elimination of rDNA sequences between different donor genomes may lead to stable allopolyploid wheat with increased differentiation and diversity. © 2014 American Society of Plant Biologists. All rights reserved.
Structural and functional organization of ribosomal genes within the mammalian cell nucleolus.
Derenzini, Massimo; Pasquinelli, Gianandrea; O'Donohue, Marie-Françoise; Ploton, Dominique; Thiry, Marc
2006-02-01
Data on the in situ structural-functional organization of ribosomal genes in the mammalian cell nucleolus are reviewed here. Major findings on chromatin structure in situ come from investigations carried out using the Feulgen-like osmium ammine reaction as a highly specific electron-opaque DNA tracer. Intranucleolar chromatin shows three different levels of organization: compact clumps, fibers ranging from 11 to 30 nm, and loose agglomerates of extended DNA filaments. Both clumps and fibers of chromatin exhibit a nucleosomal organization that is lacking in the loose agglomerates of extended DNA filaments. In fact, these filaments constantly show a thickness of 2-3 nm, the same as a DNA double-helix molecule. The loose agglomerates of DNA filaments are located in the fibrillar centers, the interphase counterpart of metaphase NORs, therefore being constituted by ribosomal DNA. The extended, non-nucleosomal configuration of this rDNA has been shown to be independent of transcriptional activity and characterizes ribosome genes that are either transcribed or transcriptionally silent. Data reviewed are consistent with a model of control for ribosome gene activity that is not mediated by changes in chromatin structure. The presence of rDNA in mammalian cells always structurally ready for transcription might facilitate a more rapid adjustment of the ribosome production in response to the metabolic needs of the cell.
Zelck, Ulrike E.; Bialek, Ralf; Weiß, Michael
2011-01-01
We genetically characterized pinworms obtained from 37 children from different regions of Germany and established new species-specific molecular diagnostic tools. No ribosomal DNA diversity was found; the phylogenetic position of Enterobius vermicularis within the Oxyurida order and its close relationship to the Ascaridida and Spirurida orders was confirmed. PMID:21248085
Hatakeyama, T; Hatakeyama, T
1990-07-06
The complete amino acid sequences of the ribosomal proteins HL30 and HmaL5 from the archaebacterium Halobacterium marismortui were determined. Protein HL30 was found to be acetylated at its N-terminal amino acid and shows homology to the eukaryotic ribosomal proteins YL34 from yeast and RL31 from rat. Protein HmaL5 was homologous to the protein L5 from Escherichia coli and Bacillus stearothermophilus as well as to YL16 from yeast. HmaL5 shows more similarities to its eukaryotic counterpart than to eubacterial ones.
Compressing DNA sequence databases with coil
Directory of Open Access Journals (Sweden)
Hendy Michael D
2008-05-01
Full Text Available Abstract Background Publicly available DNA sequence databases such as GenBank are large, and are growing at an exponential rate. The sheer volume of data being dealt with presents serious storage and data communications problems. Currently, sequence data is usually kept in large "flat files," which are then compressed using standard Lempel-Ziv (gzip compression – an approach which rarely achieves good compression ratios. While much research has been done on compressing individual DNA sequences, surprisingly little has focused on the compression of entire databases of such sequences. In this study we introduce the sequence database compression software coil. Results We have designed and implemented a portable software package, coil, for compressing and decompressing DNA sequence databases based on the idea of edit-tree coding. coil is geared towards achieving high compression ratios at the expense of execution time and memory usage during compression – the compression time represents a "one-off investment" whose cost is quickly amortised if the resulting compressed file is transmitted many times. Decompression requires little memory and is extremely fast. We demonstrate a 5% improvement in compression ratio over state-of-the-art general-purpose compression tools for a large GenBank database file containing Expressed Sequence Tag (EST data. Finally, coil can efficiently encode incremental additions to a sequence database. Conclusion coil presents a compelling alternative to conventional compression of flat files for the storage and distribution of DNA sequence databases having a narrow distribution of sequence lengths, such as EST data. Increasing compression levels for databases having a wide distribution of sequence lengths is a direction for future work.
Genetic analyses of ribosomal loci of Anopheles minimus species from north east India.
Dutta, P; Khan, S A; Topno, R; Chowdhury, P; Baishya, M; Prakash, A; Bhattacharyya, D R; Mahanta, J
2013-09-01
Anopheles minimus is one of the major vectors for transmission of malaria disease in north eastern (NE) region of India. The minimus species complex of Minimus subgroup of Myzomyia series of anophelines were studied in malaria affected states--Assam and Arunachal Pradesh (AP) of NE India. Ribosomal DNA markers--second internal transcribed spacer (ITS2) and third domain (D3) of 28S gene were used to characterize An. minimus species. Sequence homogeneity was observed in D3 sequences of An.minimus specimens throughout both the states. However, a transversion in ITS2 sequence of single specimen collected from Assam-Meghalaya border areas illustrates possibility of intra population polymorphism in ITS2 sequence within the geographical region.
Ribosomes slide on lysine-encoding homopolymeric A stretches
Koutmou, Kristin S; Schuller, Anthony P; Brunelle, Julie L; Radhakrishnan, Aditya; Djuranovic, Sergej; Green, Rachel
2015-01-01
Protein output from synonymous codons is thought to be equivalent if appropriate tRNAs are sufficiently abundant. Here we show that mRNAs encoding iterated lysine codons, AAA or AAG, differentially impact protein synthesis: insertion of iterated AAA codons into an ORF diminishes protein expression more than insertion of synonymous AAG codons. Kinetic studies in E. coli reveal that differential protein production results from pausing on consecutive AAA-lysines followed by ribosome sliding on homopolymeric A sequence. Translation in a cell-free expression system demonstrates that diminished output from AAA-codon-containing reporters results from premature translation termination on out of frame stop codons following ribosome sliding. In eukaryotes, these premature termination events target the mRNAs for Nonsense-Mediated-Decay (NMD). The finding that ribosomes slide on homopolymeric A sequences explains bioinformatic analyses indicating that consecutive AAA codons are under-represented in gene-coding sequences. Ribosome ‘sliding’ represents an unexpected type of ribosome movement possible during translation. DOI: http://dx.doi.org/10.7554/eLife.05534.001 PMID:25695637
EVOLUTION OF NUCLEAR RDNA ITS SEQUENCES IN THE CLADOPHORA ALBIDA/SERICEA CLADE (CHLOROPHYTA)
BAKKER, FT; OLSEN, JL; STAM, WT
Ribosomal DNA ITS sequences were compared among 13 different species and biogeographic isolates from the monophyletic ''abbida/sericea clade'' in the green algal genus Cladophora. Six distinct ITS sequence types were found, characterized by multiple insertions and deletions and high levels of
DNA Sequencing by Capillary Electrophoresis
Karger, Barry L.; Guttman, Andras
2009-01-01
Sequencing of human and other genomes has been at the center of interest in the biomedical field over the past several decades and is now leading toward an era of personalized medicine. During this time, DNA sequencing methods have evolved from the labor intensive slab gel electrophoresis, through automated multicapillary electrophoresis systems using fluorophore labeling with multispectral imaging, to the “next generation” technologies of cyclic array, hybridization based, nanopore and single molecule sequencing. Deciphering the genetic blueprint and follow-up confirmatory sequencing of Homo sapiens and other genomes was only possible by the advent of modern sequencing technologies that was a result of step by step advances with a contribution of academics, medical personnel and instrument companies. While next generation sequencing is moving ahead at break-neck speed, the multicapillary electrophoretic systems played an essential role in the sequencing of the Human Genome, the foundation of the field of genomics. In this prospective, we wish to overview the role of capillary electrophoresis in DNA sequencing based in part of several of our articles in this journal. PMID:19517496
DEFF Research Database (Denmark)
Grankowski, N; Gasior, E; Issinger, O G
1993-01-01
Kinetic studies on the 60S protein kinase were conducted with synthetic peptides and ribosomal proteins as substrate. Peptide RRREEESDDD proved to be the best synthetic substrate for this enzyme. The peptide has a sequence of amino acids which most closely resembles the structure of potential...... phosphorylation sites in natural substrates, i.e., acidic ribosomal proteins. The superiority of certain kinetic parameters for 60S kinase obtained with the native whole 80S ribosomes over those of the isolated fraction of acidic ribosomal proteins indicates that the affinity of 60S kinase to the specific protein...
DEFF Research Database (Denmark)
Jørgensen, Mårten Flø; Murray, Shauna; Daugbjerg, Niels
2004-01-01
was not closely related to other genera included in the molecular phylogenetic analyses, but formed a highly supported clade in Bayesian analysis together with the six small-sized strains. The six strains also formed a highly supported clade, consisting of two closely related, albeit distinct, clades. Light......The recent emendation of Amphidinium (Dinophyceae), which now only consists of species with minute left-deflected epicone, has left more than 100 species without a clear generic affiliation. In the present study, a strain identified as one of the species with a divergent epicone type, Amphidinium...... subunit ribosomal DNA as well as in size and shape. Based on morphological similarity and partial large subunit ribosomal DNA evidence, we erect the new genus, Togula gen. nov. with the emended type species Togula britannica (Herdman) comb. nov. Based on differences in division pattern and partial large...
On site DNA barcoding by nanopore sequencing.
Directory of Open Access Journals (Sweden)
Michele Menegon
Full Text Available Biodiversity research is becoming increasingly dependent on genomics, which allows the unprecedented digitization and understanding of the planet's biological heritage. The use of genetic markers i.e. DNA barcoding, has proved to be a powerful tool in species identification. However, full exploitation of this approach is hampered by the high sequencing costs and the absence of equipped facilities in biodiversity-rich countries. In the present work, we developed a portable sequencing laboratory based on the portable DNA sequencer from Oxford Nanopore Technologies, the MinION. Complementary laboratory equipment and reagents were selected to be used in remote and tough environmental conditions. The performance of the MinION sequencer and the portable laboratory was tested for DNA barcoding in a mimicking tropical environment, as well as in a remote rainforest of Tanzania lacking electricity. Despite the relatively high sequencing error-rate of the MinION, the development of a suitable pipeline for data analysis allowed the accurate identification of different species of vertebrates including amphibians, reptiles and mammals. In situ sequencing of a wild frog allowed us to rapidly identify the species captured, thus confirming that effective DNA barcoding in the field is possible. These results open new perspectives for real-time-on-site DNA sequencing thus potentially increasing opportunities for the understanding of biodiversity in areas lacking conventional laboratory facilities.
Winnowing DNA for rare sequences: highly specific sequence and methylation based enrichment.
Directory of Open Access Journals (Sweden)
Jason D Thompson
Full Text Available Rare mutations in cell populations are known to be hallmarks of many diseases and cancers. Similarly, differential DNA methylation patterns arise in rare cell populations with diagnostic potential such as fetal cells circulating in maternal blood. Unfortunately, the frequency of alleles with diagnostic potential, relative to wild-type background sequence, is often well below the frequency of errors in currently available methods for sequence analysis, including very high throughput DNA sequencing. We demonstrate a DNA preparation and purification method that through non-linear electrophoretic separation in media containing oligonucleotide probes, achieves 10,000 fold enrichment of target DNA with single nucleotide specificity, and 100 fold enrichment of unmodified methylated DNA differing from the background by the methylation of a single cytosine residue.
Winnowing DNA for rare sequences: highly specific sequence and methylation based enrichment.
Thompson, Jason D; Shibahara, Gosuke; Rajan, Sweta; Pel, Joel; Marziali, Andre
2012-01-01
Rare mutations in cell populations are known to be hallmarks of many diseases and cancers. Similarly, differential DNA methylation patterns arise in rare cell populations with diagnostic potential such as fetal cells circulating in maternal blood. Unfortunately, the frequency of alleles with diagnostic potential, relative to wild-type background sequence, is often well below the frequency of errors in currently available methods for sequence analysis, including very high throughput DNA sequencing. We demonstrate a DNA preparation and purification method that through non-linear electrophoretic separation in media containing oligonucleotide probes, achieves 10,000 fold enrichment of target DNA with single nucleotide specificity, and 100 fold enrichment of unmodified methylated DNA differing from the background by the methylation of a single cytosine residue.
DNA-based approaches to identify forest fungi in Pacific Islands: A pilot study
Anna E. Case; Sara M. Ashiglar; Phil G. Cannon; Ernesto P. Militante; Edwin R. Tadiosa; Mutya Quintos-Manalo; Nelson M. Pampolina; John W. Hanna; Fred E. Brooks; Amy L. Ross-Davis; Mee-Sook Kim; Ned B. Klopfenstein
2013-01-01
DNA-based diagnostics have been successfully used to characterize diverse forest fungi (e.g., Hoff et al. 2004, Kim et al. 2006, Glaeser & Lindner 2011). DNA sequencing of the internal transcribed spacer (ITS) and large subunit (LSU) regions of nuclear ribosomal DNA (rDNA) has proved especially useful (Sonnenberg et al. 2007, Seifert 2009, Schoch et al. 2012) for...
Highly multiplexed targeted DNA sequencing from single nuclei.
Leung, Marco L; Wang, Yong; Kim, Charissa; Gao, Ruli; Jiang, Jerry; Sei, Emi; Navin, Nicholas E
2016-02-01
Single-cell DNA sequencing methods are challenged by poor physical coverage, high technical error rates and low throughput. To address these issues, we developed a single-cell DNA sequencing protocol that combines flow-sorting of single nuclei, time-limited multiple-displacement amplification (MDA), low-input library preparation, DNA barcoding, targeted capture and next-generation sequencing (NGS). This approach represents a major improvement over our previous single nucleus sequencing (SNS) Nature Protocols paper in terms of generating higher-coverage data (>90%), thereby enabling the detection of genome-wide variants in single mammalian cells at base-pair resolution. Furthermore, by pooling 48-96 single-cell libraries together for targeted capture, this approach can be used to sequence many single-cell libraries in parallel in a single reaction. This protocol greatly reduces the cost of single-cell DNA sequencing, and it can be completed in 5-6 d by advanced users. This single-cell DNA sequencing protocol has broad applications for studying rare cells and complex populations in diverse fields of biological research and medicine.
Directory of Open Access Journals (Sweden)
Mingsheng Yang
2015-03-01
Full Text Available Satyrinae is one of twelve subfamilies of the butterfly family Nymphalidae, which currently includes nine tribes. However, phylogenetic relationships among them remain largely unresolved, though different researches have been conducted based on both morphological and molecular data. However, ribosomal genes have never been used in tribe level phylogenetic analyses of Satyrinae. In this study we investigate for the first time the phylogenetic relationships among the tribes Elymniini, Amathusiini, Zetherini and Melanitini which are indicated to be a monophyletic group, and the Satyrini, using two ribosomal genes (28s rDNA and 16s rDNA and four protein-coding genes (EF-1α, COI, COII and Cytb. We mainly aim to assess the phylogenetic informativeness of the ribosomal genes as well as clarify the relationships among different tribes. Our results show the two ribosomal genes generally have the same high phylogenetic informativeness compared with EF-1α; and we infer the 28s rDNA would show better informativeness if the 28s rDNA sequence data for each sampling taxon are obtained in this study. The placement of the monotypic genus Callarge Leech in Zetherini is confirmed for the first time based on molecular evidence. In addition, our maximum likelihood (ML and Bayesian inference (BI trees consistently show that the involved Satyrinae including the Amathusiini is monophyletic with high support values. Although the relationships among the five tribes are identical among ML and BI analyses and are mostly strongly-supported in BI analysis, those in ML analysis are lowly- or moderately- supported. Therefore, the relationships among the related five tribes recovered herein need further verification based on more sampling taxa.
Directory of Open Access Journals (Sweden)
Harold S Bernhardt
2015-11-01
Full Text Available It was Francis Crick who first asked why the ribosome contains so much RNA, and discussed the implications of this for the direct flow of genetic information from DNA to protein. Remarkable advances in our understanding of the ribosome and protein synthesis, including the recent publication of two mammalian mitochondrial ribosome structures, have shed new light on this intriguing aspect of evolution in molecular biology. We examine here whether RNA is indispensable for coded protein synthesis, or whether an all-protein ‘ribosome’ (or ‘synthosome’ might be possible, with a protein enzyme catalyzing peptide synthesis, and release factor-like protein adaptors able to read a message composed of deoxyribonucleotides. We also compare the RNA world hypothesis with the alternative ‘proteins first’ hypothesis in terms of their different understandings of the evolution of the ribosome, and whether this might have been preceded by an ancestral form of nonribosomal peptide synthesis catalyzed by protein enzymes.
Control of ribosome traffic by position-dependent choice of synonymous codons
DEFF Research Database (Denmark)
Mitarai, Namiko; Pedersen, Steen
2013-01-01
Messenger RNA (mRNA) encodes a sequence of amino acids by using codons. For most amino acids, there are multiple synonymous codons that can encode the amino acid. The translation speed can vary from one codon to another, thus there is room for changing the ribosome speed while keeping the amino...... acid sequence and hence the resulting protein. Recently, it has been noticed that the choice of the synonymous codon, via the resulting distribution of slow- and fast-translated codons, affects not only on the average speed of one ribosome translating the mRNA but also might have an effect on nearby...... ribosomes by affecting the appearance of 'traffic jams' where multiple ribosomes collide and form queues. To test this 'context effect' further, we here investigate the effect of the sequence of synonymous codons on the ribosome traffic by using a ribosome traffic model with codon-dependent rates, estimated...
PIMS sequencing extension: a laboratory information management system for DNA sequencing facilities
Directory of Open Access Journals (Sweden)
Baldwin Stephen A
2011-03-01
Full Text Available Abstract Background Facilities that provide a service for DNA sequencing typically support large numbers of users and experiment types. The cost of services is often reduced by the use of liquid handling robots but the efficiency of such facilities is hampered because the software for such robots does not usually integrate well with the systems that run the sequencing machines. Accordingly, there is a need for software systems capable of integrating different robotic systems and managing sample information for DNA sequencing services. In this paper, we describe an extension to the Protein Information Management System (PIMS that is designed for DNA sequencing facilities. The new version of PIMS has a user-friendly web interface and integrates all aspects of the sequencing process, including sample submission, handling and tracking, together with capture and management of the data. Results The PIMS sequencing extension has been in production since July 2009 at the University of Leeds DNA Sequencing Facility. It has completely replaced manual data handling and simplified the tasks of data management and user communication. Samples from 45 groups have been processed with an average throughput of 10000 samples per month. The current version of the PIMS sequencing extension works with Applied Biosystems 3130XL 96-well plate sequencer and MWG 4204 or Aviso Theonyx liquid handling robots, but is readily adaptable for use with other combinations of robots. Conclusions PIMS has been extended to provide a user-friendly and integrated data management solution for DNA sequencing facilities that is accessed through a normal web browser and allows simultaneous access by multiple users as well as facility managers. The system integrates sequencing and liquid handling robots, manages the data flow, and provides remote access to the sequencing results. The software is freely available, for academic users, from http://www.pims-lims.org/.
PIMS sequencing extension: a laboratory information management system for DNA sequencing facilities.
Troshin, Peter V; Postis, Vincent Lg; Ashworth, Denise; Baldwin, Stephen A; McPherson, Michael J; Barton, Geoffrey J
2011-03-07
Facilities that provide a service for DNA sequencing typically support large numbers of users and experiment types. The cost of services is often reduced by the use of liquid handling robots but the efficiency of such facilities is hampered because the software for such robots does not usually integrate well with the systems that run the sequencing machines. Accordingly, there is a need for software systems capable of integrating different robotic systems and managing sample information for DNA sequencing services. In this paper, we describe an extension to the Protein Information Management System (PIMS) that is designed for DNA sequencing facilities. The new version of PIMS has a user-friendly web interface and integrates all aspects of the sequencing process, including sample submission, handling and tracking, together with capture and management of the data. The PIMS sequencing extension has been in production since July 2009 at the University of Leeds DNA Sequencing Facility. It has completely replaced manual data handling and simplified the tasks of data management and user communication. Samples from 45 groups have been processed with an average throughput of 10000 samples per month. The current version of the PIMS sequencing extension works with Applied Biosystems 3130XL 96-well plate sequencer and MWG 4204 or Aviso Theonyx liquid handling robots, but is readily adaptable for use with other combinations of robots. PIMS has been extended to provide a user-friendly and integrated data management solution for DNA sequencing facilities that is accessed through a normal web browser and allows simultaneous access by multiple users as well as facility managers. The system integrates sequencing and liquid handling robots, manages the data flow, and provides remote access to the sequencing results. The software is freely available, for academic users, from http://www.pims-lims.org/.
Entropic fluctuations in DNA sequences
Thanos, Dimitrios; Li, Wentian; Provata, Astero
2018-03-01
The Local Shannon Entropy (LSE) in blocks is used as a complexity measure to study the information fluctuations along DNA sequences. The LSE of a DNA block maps the local base arrangement information to a single numerical value. It is shown that despite this reduction of information, LSE allows to extract meaningful information related to the detection of repetitive sequences in whole chromosomes and is useful in finding evolutionary differences between organisms. More specifically, large regions of tandem repeats, such as centromeres, can be detected based on their low LSE fluctuations along the chromosome. Furthermore, an empirical investigation of the appropriate block sizes is provided and the relationship of LSE properties with the structure of the underlying repetitive units is revealed by using both computational and mathematical methods. Sequence similarity between the genomic DNA of closely related species also leads to similar LSE values at the orthologous regions. As an application, the LSE covariance function is used to measure the evolutionary distance between several primate genomes.
International Nuclear Information System (INIS)
Aris, J.P.; Blobel, G.
1991-01-01
The authors have isolated a 1.1-kilobase cDNA clone that encodes human fibrillarin by screening a hepatoma library in parallel with DNA probes derived from the fibrillarin genes of Saccharomyces cerevisiae (NOP1) and Xenopus laevis. RNA blot analysis indicates that the corresponding mRNA is ∼1,300 nucleotides in length. Human fibrillarin expressed in vitro migrates on SDS gels as a 36-kDa protein that is specifically immunoprecipitated by antisera from humans with scleroderma autoimmune disease. Human fibrillarin contains an amino-terminal repetitive domain ∼75-80 amino acids in length that is rich in glycine and arginine residues and is similar to amino-terminal domains in the yeast and Xenopus fibrillarins. The occurrence of a putative RNA-binding domain and an RNP consensus sequence within the protein is consistent with the association of fibrillarin with small nucleolar RNAs. Protein sequence alignments show that 67% of amino acids from human fibrillarin are identical to those in yeast fibrillarin and that 81% are identical to those in Xenopus fibrillarin. This identity suggests the evolutionary conservation of an important function early in the pathway for ribosome biosynthesis
Ennahar, Saïd; Cai, Yimin; Fujita, Yasuhito
2003-01-01
A total of 161 low-G+C-content gram-positive bacteria isolated from whole-crop paddy rice silage were classified and subjected to phenotypic and genetic analyses. Based on morphological and biochemical characters, these presumptive lactic acid bacterium (LAB) isolates were divided into 10 groups that included members of the genera Enterococcus, Lactobacillus, Lactococcus, Leuconostoc, Pediococcus, and Weissella. Analysis of the 16S ribosomal DNA (rDNA) was used to confirm the presence of the ...
Sonia Garcia; Teresa Garnatje; Jaume Pellicer; E. Durant McArthur; Sonja Siljak-Yakovlev; Joan Valles
2009-01-01
Subgenus Tridentatae (Artemisia, Asteraceae) can be considered a polyploid complex. Both polyploidy and hybridization have been documented in the Tridentatae. Fluorescent in situ hybridization (FISH) and fluorochrome banding were used to detect and analyze ribosomal DNA changes linked to polyploidization in this group by studying four diploidpolyploid species pairs. In...
DNA Replication Profiling Using Deep Sequencing.
Saayman, Xanita; Ramos-Pérez, Cristina; Brown, Grant W
2018-01-01
Profiling of DNA replication during progression through S phase allows a quantitative snap-shot of replication origin usage and DNA replication fork progression. We present a method for using deep sequencing data to profile DNA replication in S. cerevisiae.
Effects of sequence on DNA wrapping around histones
Ortiz, Vanessa
2011-03-01
A central question in biophysics is whether the sequence of a DNA strand affects its mechanical properties. In epigenetics, these are thought to influence nucleosome positioning and gene expression. Theoretical and experimental attempts to answer this question have been hindered by an inability to directly resolve DNA structure and dynamics at the base-pair level. In our previous studies we used a detailed model of DNA to measure the effects of sequence on the stability of naked DNA under bending. Sequence was shown to influence DNA's ability to form kinks, which arise when certain motifs slide past others to form non-native contacts. Here, we have now included histone-DNA interactions to see if the results obtained for naked DNA are transferable to the problem of nucleosome positioning. Different DNA sequences interacting with the histone protein complex are studied, and their equilibrium and mechanical properties are compared among themselves and with the naked case. NLM training grant to the Computation and Informatics in Biology and Medicine Training Program (NLM T15LM007359).
Szymanski, Maciej; Karlowski, Wojciech M
2016-01-01
In eukaryotes, ribosomal 5S rRNAs are products of multigene families organized within clusters of tandemly repeated units. Accumulation of genomic data obtained from a variety of organisms demonstrated that the potential 5S rRNA coding sequences show a large number of variants, often incompatible with folding into a correct secondary structure. Here, we present results of an analysis of a large set of short RNA sequences generated by the next generation sequencing techniques, to address the problem of heterogeneity of the 5S rRNA transcripts in Arabidopsis and identification of potentially functional rRNA-derived fragments.
Molecular design of sequence specific DNA alkylating agents.
Minoshima, Masafumi; Bando, Toshikazu; Shinohara, Ken-ichi; Sugiyama, Hiroshi
2009-01-01
Sequence-specific DNA alkylating agents have great interest for novel approach to cancer chemotherapy. We designed the conjugates between pyrrole (Py)-imidazole (Im) polyamides and DNA alkylating chlorambucil moiety possessing at different positions. The sequence-specific DNA alkylation by conjugates was investigated by using high-resolution denaturing polyacrylamide gel electrophoresis (PAGE). The results showed that polyamide chlorambucil conjugates alkylate DNA at flanking adenines in recognition sequences of Py-Im polyamides, however, the reactivities and alkylation sites were influenced by the positions of conjugation. In addition, we synthesized conjugate between Py-Im polyamide and another alkylating agent, 1-(chloromethyl)-5-hydroxy-1,2-dihydro-3H-benz[e]indole (seco-CBI). DNA alkylation reactivies by both alkylating polyamides were almost comparable. In contrast, cytotoxicities against cell lines differed greatly. These comparative studies would promote development of appropriate sequence-specific DNA alkylating polyamides against specific cancer cells.
Sequence analysis of Leukemia DNA
Nacong, Nasria; Lusiyanti, Desy; Irawan, Muhammad. Isa
2018-03-01
Cancer is a very deadly disease, one of which is leukemia disease or better known as blood cancer. The cancer cell can be detected by taking DNA in laboratory test. This study focused on local alignment of leukemia and non leukemia data resulting from NCBI in the form of DNA sequences by using Smith-Waterman algorithm. SmithWaterman algorithm was invented by TF Smith and MS Waterman in 1981. These algorithms try to find as much as possible similarity of a pair of sequences, by giving a negative value to the unequal base pair (mismatch), and positive values on the same base pair (match). So that will obtain the maximum positive value as the end of the alignment, and the minimum value as the initial alignment. This study will use sequences of leukemia and 3 sequences of non leukemia.
Histone and ribosomal RNA repetitive gene clusters of the boll weevil are linked in a tandem array.
Roehrdanz, R; Heilmann, L; Senechal, P; Sears, S; Evenson, P
2010-08-01
Histones are the major protein component of chromatin structure. The histone family is made up of a quintet of proteins, four core histones (H2A, H2B, H3 & H4) and the linker histones (H1). Spacers are found between the coding regions. Among insects this quintet of genes is usually clustered and the clusters are tandemly repeated. Ribosomal DNA contains a cluster of the rRNA sequences 18S, 5.8S and 28S. The rRNA genes are separated by the spacers ITS1, ITS2 and IGS. This cluster is also tandemly repeated. We found that the ribosomal RNA repeat unit of at least two species of Anthonomine weevils, Anthonomus grandis and Anthonomus texanus (Coleoptera: Curculionidae), is interspersed with a block containing the histone gene quintet. The histone genes are situated between the rRNA 18S and 28S genes in what is known as the intergenic spacer region (IGS). The complete reiterated Anthonomus grandis histone-ribosomal sequence is 16,248 bp.
Multiple tag labeling method for DNA sequencing
Mathies, R.A.; Huang, X.C.; Quesada, M.A.
1995-07-25
A DNA sequencing method is described which uses single lane or channel electrophoresis. Sequencing fragments are separated in the lane and detected using a laser-excited, confocal fluorescence scanner. Each set of DNA sequencing fragments is separated in the same lane and then distinguished using a binary coding scheme employing only two different fluorescent labels. Also described is a method of using radioisotope labels. 5 figs.
Vijaykumar, Archana; Saini, Ajay; Jawali, Narendra
2010-01-01
Molecular phylogeny among species belonging to subgenus Vigna (genus Vigna) was inferred based on internal transcribed spacer (ITS) sequences of 18S-5.8S-26S ribosomal RNA gene unit. Analysis showed a total of 356 polymorphic sites of which approximately 80% were parsimony informative. Phylogenetic reconstruction by neighbor joining and maximum parsimony methods placed the 57 Vigna accessions (belonging to 15 species) into 5 major clades. Five species viz. Vigna heterophylla, Vigna pubigera, Vigna parkeri, Vigna laurentii, and Vigna gracilis whose position in the subgenus was previously not known were placed in the section Vigna. A single accession (Vigna unguiculata ssp. tenuis, NI 1637) harbored 2 intragenomic ITS variants, indicative of 2 different types of ribosomal DNA (rDNA) repeat units. ITS variant type-I was close to ITS from V. unguiculata ssp. pubescens, whereas type-II was close to V. unguiculata ssp. tenuis. Transcript analysis clearly demonstrates that in accession NI 1637, rDNA repeat units with only type-II ITS variants are transcriptionally active. Evidence from sequence analysis (of 5.8S, ITS1, and ITS2) and secondary structure analysis (of ITS1 and ITS2) indicates that the type-I ITS variant probably does not belong to the pseudogenic rDNA repeat units. The results from phylogenetic and transcript analysis suggest that the rDNA units with the type-I ITS may have introgressed as a result of hybridization (between ssp. tenuis and ssp. pubescens); however, it has been epigenetically silenced. The results also demonstrate differential evolution of ITS sequence among wild and cultivated forms of V. unguiculata.
Directory of Open Access Journals (Sweden)
Manuela Silva
Full Text Available BACKGROUND: Chromatin organizational and topological plasticity, and its functions in gene expression regulation, have been strongly revealed by the analysis of nucleolar dominance in hybrids and polyploids where one parental set of ribosomal RNA (rDNA genes that are clustered in nucleolar organizing regions (NORs, is rendered silent by epigenetic pathways and heterochromatization. However, information on the behaviour of dominant NORs is very sparse and needed for an integrative knowledge of differential gene transcription levels and chromatin specific domain interactions. METHODOLOGY/PRINCIPAL FINDINGS: Using molecular and cytological approaches in a wheat-rye addition line (wheat genome plus the rye nucleolar chromosome pair 1R, we investigated transcriptional activity and chromatin topology of the wheat dominant NORs in a nucleolar dominance situation. Herein we report dominant NORs up-regulation in the addition line through quantitative real-time PCR and silver-staining technique. Accompanying this modification in wheat rDNA trascription level, we also disclose that perinucleolar knobs of ribosomal chromatin are almost transcriptionally silent due to the residual detection of BrUTP incorporation in these domains, contrary to the marked labelling of intranucleolar condensed rDNA. Further, by comparative confocal analysis of nuclei probed to wheat and rye NORs, we found that in the wheat-rye addition line there is a significant decrease in the number of wheat-origin perinucleolar rDNA knobs, corresponding to a diminution of the rDNA heterochromatic fraction of the dominant (wheat NORs. CONCLUSIONS/SIGNIFICANCE: We demonstrate that inter-specific interactions leading to wheat-origin NOR dominance results not only on the silencing of rye origin NOR loci, but dominant NORs are also modified in their transcriptional activity and interphase organization. The results show a cross-talk between wheat and rye NORs, mediated by ribosomal chromatin
Human Chromosome 7: DNA Sequence and Biology
Scherer, Stephen W.; Cheung, Joseph; MacDonald, Jeffrey R.; Osborne, Lucy R.; Nakabayashi, Kazuhiko; Herbrick, Jo-Anne; Carson, Andrew R.; Parker-Katiraee, Layla; Skaug, Jennifer; Khaja, Razi; Zhang, Junjun; Hudek, Alexander K.; Li, Martin; Haddad, May; Duggan, Gavin E.
2003-01-01
DNA sequence and annotation of the entire human chromosome 7, encompassing nearly 158 million nucleotides of DNA and 1917 gene structures, are presented. To generate a higher order description, additional structural features such as imprinted genes, fragile sites, and segmental duplications were integrated at the level of the DNA sequence with medical genetic data, including 440 chromosome rearrangement breakpoints associated with disease. This approach enabled the discovery of candidate gene...
PREDICTION OF CHROMATIN STATES USING DNA SEQUENCE PROPERTIES
Bahabri, Rihab R.
2013-06-01
Activities of DNA are to a great extent controlled epigenetically through the internal struc- ture of chromatin. This structure is dynamic and is influenced by different modifications of histone proteins. Various combinations of epigenetic modification of histones pinpoint to different functional regions of the DNA determining the so-called chromatin states. How- ever, the characterization of chromatin states by the DNA sequence properties remains largely unknown. In this study we aim to explore whether DNA sequence patterns in the human genome can characterize different chromatin states. Using DNA sequence motifs we built binary classifiers for each chromatic state to eval- uate whether a given genomic sequence is a good candidate for belonging to a particular chromatin state. Of four classification algorithms (C4.5, Naive Bayes, Random Forest, and SVM) used for this purpose, the decision tree based classifiers (C4.5 and Random Forest) yielded best results among those we evaluated. Our results suggest that in general these models lack sufficient predictive power, although for four chromatin states (insulators, het- erochromatin, and two types of copy number variation) we found that presence of certain motifs in DNA sequences does imply an increased probability that such a sequence is one of these chromatin states.
Directory of Open Access Journals (Sweden)
Hossein ALAEI
2013-01-01
Full Text Available Eleven samples of the most important pistachio rust (caused by Pileolaria terebinthi (DC. Cast.,, which causes disease on Beneh (Pistacia atlantica Desf. subsp. mutica (Fisch. & Mey. Rech. F and Kasoor (Pistacia khinjuk Stocks., were collected from herbarium specimens and pistachio fields at the Pistachio Research Institute in Rafsanjan, Iran. The complete sequences of ribosomal DNA internal transcribed spacers ITS1 and ITS2 (rDNA ITS from the samples were determined and analysed. In general, very little rDNA ITS sequence variation was observed between rDNA ITS sequences of P. terebinthi samples. The length of the PCR fragments was 621 bp (for ITS1F-ITS4 and 1177 bp (for ITS1F-rust1, and consisted of 67 bp at the 3 ́ end of 18S rDNA, 93 bp of ITS1 region, 154 bp of 5.8S rDNA, 246 bp of the ITS2 region, 57 bp (for ITS1F-ITS4 and 613 bp (for ITS1F-rust1 at the 5 ́ end of the 28S rDNA. Restriction fragment length polymorphisms (RFLPs of the rDNA-ITS region were used to identify Pileolaria terebinthi. Three strong bands of 105, 134 and 381 bp and five bands of 105, 134, 200, 301 and 437 bp are observed for the fragment of “ITS1F-ITS4” and “ITS1F-rust1”, respectively. A PCR-RFLP diagnostic technique provided effective identification of the species by a unique pattern with the specific restriction enzyme XapI (ApoI.
Morard, Raphaël; Darling, Kate F; Mahé, Frédéric; Audic, Stéphane; Ujiié, Yurika; Weiner, Agnes K M; André, Aurore; Seears, Heidi A; Wade, Christopher M; Quillévéré, Frédéric; Douady, Christophe J; Escarguel, Gilles; de Garidel-Thoron, Thibault; Siccha, Michael; Kucera, Michal; de Vargas, Colomban
2015-11-01
Planktonic foraminifera (Rhizaria) are ubiquitous marine pelagic protists producing calcareous shells with conspicuous morphology. They play an important role in the marine carbon cycle, and their exceptional fossil record serves as the basis for biochronostratigraphy and past climate reconstructions. A major worldwide sampling effort over the last two decades has resulted in the establishment of multiple large collections of cryopreserved individual planktonic foraminifera samples. Thousands of 18S rDNA partial sequences have been generated, representing all major known morphological taxa across their worldwide oceanic range. This comprehensive data coverage provides an opportunity to assess patterns of molecular ecology and evolution in a holistic way for an entire group of planktonic protists. We combined all available published and unpublished genetic data to build PFR(2), the Planktonic foraminifera Ribosomal Reference database. The first version of the database includes 3322 reference 18S rDNA sequences belonging to 32 of the 47 known morphospecies of extant planktonic foraminifera, collected from 460 oceanic stations. All sequences have been rigorously taxonomically curated using a six-rank annotation system fully resolved to the morphological species level and linked to a series of metadata. The PFR(2) website, available at http://pfr2.sb-roscoff.fr, allows downloading the entire database or specific sections, as well as the identification of new planktonic foraminiferal sequences. Its novel, fully documented curation process integrates advances in morphological and molecular taxonomy. It allows for an increase in its taxonomic resolution and assures that integrity is maintained by including a complete contingency tracking of annotations and assuring that the annotations remain internally consistent. © 2015 John Wiley & Sons Ltd.
Googling DNA sequences on the World Wide Web.
Hajibabaei, Mehrdad; Singer, Gregory A C
2009-11-10
New web-based technologies provide an excellent opportunity for sharing and accessing information and using web as a platform for interaction and collaboration. Although several specialized tools are available for analyzing DNA sequence information, conventional web-based tools have not been utilized for bioinformatics applications. We have developed a novel algorithm and implemented it for searching species-specific genomic sequences, DNA barcodes, by using popular web-based methods such as Google. We developed an alignment independent character based algorithm based on dividing a sequence library (DNA barcodes) and query sequence to words. The actual search is conducted by conventional search tools such as freely available Google Desktop Search. We implemented our algorithm in two exemplar packages. We developed pre and post-processing software to provide customized input and output services, respectively. Our analysis of all publicly available DNA barcode sequences shows a high accuracy as well as rapid results. Our method makes use of conventional web-based technologies for specialized genetic data. It provides a robust and efficient solution for sequence search on the web. The integration of our search method for large-scale sequence libraries such as DNA barcodes provides an excellent web-based tool for accessing this information and linking it to other available categories of information on the web.
Graphene nanodevices for DNA sequencing
Heerema, S.J.; Dekker, C.
2016-01-01
Fast, cheap, and reliable DNA sequencing could be one of the most disruptive innovations of this decade, as it will pave the way for personalized medicine. In pursuit of such technology, a variety of nanotechnology-based approaches have been explored and established, including sequencing with
U.S. Environmental Protection Agency — DNA sequence data for several genetic loci. This dataset is not publicly accessible because: It's already publicly available on GenBank. It can be accessed through...
Characteristics of alternating current hopping conductivity in DNA sequences
Institute of Scientific and Technical Information of China (English)
Ma Song-Shan; Xu Hui; Wang Huan-You; Guo Rui
2009-01-01
This paper presents a model to describe alternating current (AC) conductivity of DNA sequences,in which DNA is considered as a one-dimensional (1D) disordered system,and electrons transport via hopping between localized states.It finds that AC conductivity in DNA sequences increases as the frequency of the external electric field rises,and it takes the form of σac(ω)~ω2 ln2(1/ω).Also AC conductivity of DNA sequences increases with the increase of temperature,this phenomenon presents characteristics of weak temperature-dependence.Meanwhile,the AC conductivity in an off diagonally correlated case is much larger than that in the uncorrelated case of the Anderson limit in low temperatures,which indicates that the off-diagonal correlations in DNA sequences have a great effect on the AC conductivity,while at high temperature the off-diagonal correlations no longer play a vital role in electric transport. In addition,the proportion of nucleotide pairs p also plays an important role in AC electron transport of DNA sequences.For p<0.5,the conductivity of DNA sequence decreases with the increase of p,while for p > 0.5,the conductivity increases with the increase of p.
Oppen, M J; Willis, B L; Vugt, H W; Miller, D J
2000-09-01
Although Acropora is the most species-rich genus of the scleractinian (stony) corals, only three species occur in the Caribbean: A. cervicornis, A. palmata and A. prolifera. Based on overall coral morphology, abundance and distribution patterns, it has been suggested that A. prolifera may be a hybrid between A. cervicornis and A. palmata. The species boundaries among these three morphospecies were examined using DNA sequence analyses of the nuclear Pax-C 46/47 intron and the ribosomal DNA Internal Transcribed Spacer (ITS1 and ITS2) and 5.8S regions. Moderate levels of sequence variability were observed in the ITS and 5.8S sequences (up to 5.2% overall sequence difference), but variability within species was as large as between species and all three species carried similar sequences. Since this is unlikely to represent a shared ancestral polymorphism, the data suggest that introgressive hybridization occurs among the three species. For the Pax-C intron, A. cervicornis and A. palmata had very distinct allele frequencies and A. cervicornis carried a unique allele at a frequency of 0.769 (although sequence differences between alleles were small). All A. prolifera colonies examined were heterozygous for the Pax-C intron, whereas heterozygosity was only 0.286 and 0.333 for A. cervicornis and A. palmata, respectively. These data support the hypothesis that A. prolifera is the product of hybridization between two species that have a different allelic composition for the Pax-C intron, i.e. A. cervicornis and A. palmata. We therefore suggest that A. prolifera is a hybrid between A. cervicornis and A. palmata, which backcrosses with the parental species at low frequency.
Zywicki, Marek; Bakowska-Zywicka, Kamilla; Polacek, Norbert
2012-05-01
The exploration of the non-protein-coding RNA (ncRNA) transcriptome is currently focused on profiling of microRNA expression and detection of novel ncRNA transcription units. However, recent studies suggest that RNA processing can be a multi-layer process leading to the generation of ncRNAs of diverse functions from a single primary transcript. Up to date no methodology has been presented to distinguish stable functional RNA species from rapidly degraded side products of nucleases. Thus the correct assessment of widespread RNA processing events is one of the major obstacles in transcriptome research. Here, we present a novel automated computational pipeline, named APART, providing a complete workflow for the reliable detection of RNA processing products from next-generation-sequencing data. The major features include efficient handling of non-unique reads, detection of novel stable ncRNA transcripts and processing products and annotation of known transcripts based on multiple sources of information. To disclose the potential of APART, we have analyzed a cDNA library derived from small ribosome-associated RNAs in Saccharomyces cerevisiae. By employing the APART pipeline, we were able to detect and confirm by independent experimental methods multiple novel stable RNA molecules differentially processed from well known ncRNAs, like rRNAs, tRNAs or snoRNAs, in a stress-dependent manner.
An improved high throughput sequencing method for studying oomycete communities
DEFF Research Database (Denmark)
Sapkota, Rumakanta; Nicolaisen, Mogens
2015-01-01
the usefulness of the method not only in soil DNA but also in a plant DNA background. In conclusion, we demonstrate a successful approach for pyrosequencing of oomycete communities using ITS1 as the barcode sequence with well-known primers for oomycete DNA amplification....... communities. Thewell-known primer sets ITS4, ITS6 and ITS7were used in the study in a semi-nested PCR approach to target the internal transcribed spacer (ITS) 1 of ribosomal DNA in a next generation sequencing protocol. These primers have been used in similar studies before, butwith limited success.......Wewere able to increase the proportion of retrieved oomycete sequences dramaticallymainly by increasing the annealing temperature during PCR. The optimized protocol was validated using three mock communities and the method was further evaluated using total DNA from 26 soil samples collected from different...
Directory of Open Access Journals (Sweden)
Luiz Carlos Correa
2003-04-01
Full Text Available A definição e a caracterização de regiões de origens de replicação nos eucariotos superiores são ainda controversas. A iniciação da replicação é sítio-específica em alguns sistemas e, em outros, parece estar contida em regiões extensas. Regiões rDNA são modelos atrativos para o estudo de origens de replicação pela sua organização in tandem, reduzindo a área de estudo para o espaço restrito que codifica uma unidade de transcrição. Neste trabalho nós isolamos e caracterizamos parcialmente um clone que contém uma sequência ribossomal do fungo aquático Blastocladiella emersonii, Be97M20. Southern blots mostraram diversos sítios para enzimas de restrição Eco RI, HindIII e SalI. Northern blot de RNA total hibridado contra uma sonda feita com Be97M20 confirmou a sua homologia com o gene ribossomal 18S. A caracterização detalhada, incluindo o mapeamento de restrição completo, subclonagem, sequenciamento e análise em géis bidimensionais proverão informações adicionais importantes sobre a estrutura e dinâmica desta regiãoThe definition and the characterization of replication origins regions in higher eukaryotes are still controversial. The initiation of the replication is site-specific in some systems but seems to occur in large regions in others. Because of its in tandem organization, reducing the area to the restricted space that codifies an unit of transcription, rDNA regions are attractive models to study replication origins. In this work we isolated and started to characterize a clone that contains a ribosomal sequence from the aquatic fungus B. emersonii, Be97M20. Southern blots showed several sites for the restrition enzymes Eco RI, HindIII and SalI. A northern blot of total RNA, hybridized against a probe made from Be97M20, confirmed its homology with the ribosomal 18S gene. The detailed characterization, including complete restriction map, subcloning, sequence and analysis on bidimensional gels will
Lima-Filho, P A; Bertollo, L A C; Cioffi, M B; Costa, G W W F; Molina, W F
2014-01-01
Karyotype analyses of the cryptobenthic marine species Ctenogobius boleosoma and C. smaragdus were performed by means of classical and molecular cytogenetics, including physical mapping of the multigene 18S and 5S rDNA families. C. boleosoma has 2n = 44 chromosomes (2 submetacentrics + 42 acrocentrics; FN = 46) with a single chromosome pair each carrying 18S and 5S ribosomal sites; whereas C. smaragdus has 2n = 48 chromosomes (2 submetacentrics + 46 acrocentrics; FN = 50), also with a single pair bearing 18S rDNA, but an extensive increase in the number of GC-rich 5S rDNA sites in 21 chromosome pairs. The highly divergent karyotypes among Ctenogobius species contrast with observations in several other marine fish groups, demonstrating an accelerated rate of chromosomal evolution mediated by both chromosomal rearrangements and the extensive dispersion of 5S rDNA sequences in the genome. © 2014 S. Karger AG, Basel.
Schenk, Janina; Hohberg, Karin; Helder, Hans; Ristau, Kai; Traunspurger, Walter
2017-01-01
Reliable and well-developed DNA barcode databases are indispensable for the identification of microscopic life. However, effectiveness of molecular barcoding in identifying terrestrial specimens, and nematodes in particular, has received little attention. In this study, ca 600 ribosomal large
DNA Nucleotide Sequence Restricted by the RI Endonuclease
Hedgpeth, Joe; Goodman, Howard M.; Boyer, Herbert W.
1972-01-01
The sequence of DNA base pairs adjacent to the phosphodiester bonds cleaved by the RI restriction endonuclease in unmodified DNA from coliphage λ has been determined. The 5′-terminal nucleotide labeled with 32P and oligonucleotides up to the heptamer were analyzed from a pancreatic DNase digest. The following sequence of nucleotides adjacent to the RI break made in λ DNA was deduced from these data and from the 3′-dinucleotide sequence and nearest-neighbor analysis obtained from repair synthesis with the DNA polymerase of Rous sarcoma virus [Formula: see text] The RI endonuclease cleavage of the phosphodiester bonds (indicated by arrows) generates 5′-phosphoryls and short cohesive termini of four nucleotides, pApApTpT. The most striking feature of the sequence is its symmetry. PMID:4343974
An extended sequence specificity for UV-induced DNA damage.
Chung, Long H; Murray, Vincent
2018-01-01
The sequence specificity of UV-induced DNA damage was determined with a higher precision and accuracy than previously reported. UV light induces two major damage adducts: cyclobutane pyrimidine dimers (CPDs) and pyrimidine(6-4)pyrimidone photoproducts (6-4PPs). Employing capillary electrophoresis with laser-induced fluorescence and taking advantages of the distinct properties of the CPDs and 6-4PPs, we studied the sequence specificity of UV-induced DNA damage in a purified DNA sequence using two approaches: end-labelling and a polymerase stop/linear amplification assay. A mitochondrial DNA sequence that contained a random nucleotide composition was employed as the target DNA sequence. With previous methodology, the UV sequence specificity was determined at a dinucleotide or trinucleotide level; however, in this paper, we have extended the UV sequence specificity to a hexanucleotide level. With the end-labelling technique (for 6-4PPs), the consensus sequence was found to be 5'-GCTC*AC (where C* is the breakage site); while with the linear amplification procedure, it was 5'-TCTT*AC. With end-labelling, the dinucleotide frequency of occurrence was highest for 5'-TC*, 5'-TT* and 5'-CC*; whereas it was 5'-TT* for linear amplification. The influence of neighbouring nucleotides on the degree of UV-induced DNA damage was also examined. The core sequences consisted of pyrimidine nucleotides 5'-CTC* and 5'-CTT* while an A at position "1" and C at position "2" enhanced UV-induced DNA damage. Crown Copyright © 2017. Published by Elsevier B.V. All rights reserved.
Sequence dependence of electron-induced DNA strand breakage revealed by DNA nanoarrays
DEFF Research Database (Denmark)
Keller, Adrian; Rackwitz, Jenny; Cauët, Emilie
2014-01-01
The electronic structure of DNA is determined by its nucleotide sequence, which is for instance exploited in molecular electronics. Here we demonstrate that also the DNA strand breakage induced by low-energy electrons (18 eV) depends on the nucleotide sequence. To determine the absolute cross sec...
Zhao, Xing; Liang, Ai-Ping
2016-09-01
The first complete DNA sequence of the mitochondrial genome (mitogenome) of Leptobelus gazelle (Membracoidea: Hemiptera) is determined in this study. The circular molecule is 16,007 bp in its full length, which encodes a set of 37 genes, including 13 proteins, 2 ribosomal RNAs, 22 transfer RNAs, and contains an A + T-rich region (CR). The gene numbers, content, and organization of L. gazelle are similar to other typical metazoan mitogenomes. Twelve of the 13 PCGs are initiated with ATR methionine or ATT isoleucine codons, except the atp8 gene that uses the ATC isoleucine as start signal. Ten of the 13 PCGs have complete termination codons, either TAA (nine genes) or TAG (cytb). The remaining 3 PCGs (cox1, cox2 and nad5) have incomplete termination codons T (AA). All of the 22 tRNAs can be folded in the form of a typical clover-leaf structure. The complete mitogenome sequence data of L. gazelle is useful for the phylogenetic and biogeographic studies of the Membracoidea and Hemiptera.
Characteristics of alternating current hopping conductivity in DNA sequences
International Nuclear Information System (INIS)
Song-Shan, Ma; Hui, Xu; Huan-You, Wang; Rui, Guo
2009-01-01
This paper presents a model to describe alternating current (AC) conductivity of DNA sequences, in which DNA is considered as a one-dimensional (1D) disordered system, and electrons transport via hopping between localized states. It finds that AC conductivity in DNA sequences increases as the frequency of the external electric field rises, and it takes the form of ø ac (ω) ∼ ω 2 ln 2 (1/ω). Also AC conductivity of DNA sequences increases with the increase of temperature, this phenomenon presents characteristics of weak temperature-dependence. Meanwhile, the AC conductivity in an off-diagonally correlated case is much larger than that in the uncorrelated case of the Anderson limit in low temperatures, which indicates that the off-diagonal correlations in DNA sequences have a great effect on the AC conductivity, while at high temperature the off-diagonal correlations no longer play a vital role in electric transport. In addition, the proportion of nucleotide pairs p also plays an important role in AC electron transport of DNA sequences. For p < 0.5, the conductivity of DNA sequence decreases with the increase of p, while for p ≥ 0.5, the conductivity increases with the increase of p. (cross-disciplinary physics and related areas of science and technology)
Sequence-dependent DNA deformability studied using molecular dynamics simulations.
Fujii, Satoshi; Kono, Hidetoshi; Takenaka, Shigeori; Go, Nobuhiro; Sarai, Akinori
2007-01-01
Proteins recognize specific DNA sequences not only through direct contact between amino acids and bases, but also indirectly based on the sequence-dependent conformation and deformability of the DNA (indirect readout). We used molecular dynamics simulations to analyze the sequence-dependent DNA conformations of all 136 possible tetrameric sequences sandwiched between CGCG sequences. The deformability of dimeric steps obtained by the simulations is consistent with that by the crystal structures. The simulation results further showed that the conformation and deformability of the tetramers can highly depend on the flanking base pairs. The conformations of xATx tetramers show the most rigidity and are not affected by the flanking base pairs and the xYRx show by contrast the greatest flexibility and change their conformations depending on the base pairs at both ends, suggesting tetramers with the same central dimer can show different deformabilities. These results suggest that analysis of dimeric steps alone may overlook some conformational features of DNA and provide insight into the mechanism of indirect readout during protein-DNA recognition. Moreover, the sequence dependence of DNA conformation and deformability may be used to estimate the contribution of indirect readout to the specificity of protein-DNA recognition as well as nucleosome positioning and large-scale behavior of nucleic acids.
International Nuclear Information System (INIS)
Vejko, N.N.; Spitkovskij, D.M.
2000-01-01
The evidences of stability of the human ribosomal gene in the transcribing range (TR-rDNA) to fragmentation are presented in two groups of experiments: 1) in the case of availability of the fragments in the cells of sectional corpse material (necrosis and apoptosis) and by pathologies accompanied by the cells death through the apoptosis or necrosis mechanism; 2) in the model experiments, wherein the separated genomes DNA is subjected to the impact of nucleases initiating single-strand breaks (SB), or chemical introduction with a subsequent comparative analysis of stability to fragmentation of various DNA sequences including TR-rDNA. The DNA solutions were subjected to γ-radiation with the dose rate of 4.8 Gy/min. It is shown that in spite of the great number of the SBs the TR-rDNA is characterized by increased stability to fragmentation, which makes it possible to propose this DNA fragment for application as a cell death marker in biological fluids [ru
Nedelcu, Aurora M.; Lee, Robert W.; Lemieux, Claude; Gray, Michael W.; Burger, Gertraud
2000-01-01
Two distinct mitochondrial genome types have been described among the green algal lineages investigated to date: a reduced–derived, Chlamydomonas-like type and an ancestral, Prototheca-like type. To determine if this unexpected dichotomy is real or is due to insufficient or biased sampling and to define trends in the evolution of the green algal mitochondrial genome, we sequenced and analyzed the mitochondrial DNA (mtDNA) of Scenedesmus obliquus. This genome is 42,919 bp in size and encodes 42 conserved genes (i.e., large and small subunit rRNA genes, 27 tRNA and 13 respiratory protein-coding genes), four additional free-standing open reading frames with no known homologs, and an intronic reading frame with endonuclease/maturase similarity. No 5S rRNA or ribosomal protein-coding genes have been identified in Scenedesmus mtDNA. The standard protein-coding genes feature a deviant genetic code characterized by the use of UAG (normally a stop codon) to specify leucine, and the unprecedented use of UCA (normally a serine codon) as a signal for termination of translation. The mitochondrial genome of Scenedesmus combines features of both green algal mitochondrial genome types: the presence of a more complex set of protein-coding and tRNA genes is shared with the ancestral type, whereas the lack of 5S rRNA and ribosomal protein-coding genes as well as the presence of fragmented and scrambled rRNA genes are shared with the reduced–derived type of mitochondrial genome organization. Furthermore, the gene content and the fragmentation pattern of the rRNA genes suggest that this genome represents an intermediate stage in the evolutionary process of mitochondrial genome streamlining in green algae. [The sequence data described in this paper have been submitted to the GenBank data library under accession no. AF204057.] PMID:10854413
Laser mass spectrometry for DNA sequencing, disease diagnosis, and fingerprinting
Energy Technology Data Exchange (ETDEWEB)
Winston Chen, C.H.; Taranenko, N.I.; Zhu, Y.F.; Chung, C.N.; Allman, S.L.
1997-03-01
Since laser mass spectrometry has the potential for achieving very fast DNA analysis, the authors recently applied it to DNA sequencing, DNA typing for fingerprinting, and DNA screening for disease diagnosis. Two different approaches for sequencing DNA have been successfully demonstrated. One is to sequence DNA with DNA ladders produced from Snager`s enzymatic method. The other is to do direct sequencing without DNA ladders. The need for quick DNA typing for identification purposes is critical for forensic application. The preliminary results indicate laser mass spectrometry can possibly be used for rapid DNA fingerprinting applications at a much lower cost than gel electrophoresis. Population screening for certain genetic disease can be a very efficient step to reducing medical costs through prevention. Since laser mass spectrometry can provide very fast DNA analysis, the authors applied laser mass spectrometry to disease diagnosis. Clinical samples with both base deletion and point mutation have been tested with complete success.
Sagegami-Oba, Reiko; Oba, Yuichi; Ohira, Hitoo
2007-02-01
Although the taxonomy of click beetles (family Elateridae) has been studied extensively, inconsistencies remain. We examine here the relationships between species of Elateridae based on partial sequences of nuclear 28S ribosomal DNA. Specimens were collected primarily from Japan, while luminous click beetles were also sampled from Central and South America to investigate the origins of bioluminescence in Elateridae. Neighbor-joining, maximum-parsimony, and maximum-likelihood analyses produced a consistent basal topology with high statistical support that is partially congruent with the results of previous investigations based on the morphological characteristics of larvae and adults. The most parsimonious reconstruction of the "luminous" and "nonluminous" states, based on the present molecular phylogeny, indicates that the ancestral state of Elateridae was nonluminous. This suggests that the bioluminescence in click beetle evolved independent of that of other luminous beetles, such as Lampyridae, despite their common mechanisms of bioluminescence.
Williams, D W; Wilson, M J; Lewis, M A; Potts, A J
1995-01-01
The PCR was used to amplify a targeted region of the ribosomal DNA from 84 Candida isolates. Unique product sizes were obtained for Candida guilliermondii, Candida (Torulopsis) glabrata, and Candida pseudotropicalis. Isolates of Candida albicans, Candida tropicalis, Candida stellatoidea, Candida parapsilosis, and Candida krusei could be identified following restriction digestion of the PCR products.
Sequence-specific DNA alkylation by tandem Py-Im polyamide conjugates.
Taylor, Rhys Dylan; Kawamoto, Yusuke; Hashiya, Kaori; Bando, Toshikazu; Sugiyama, Hiroshi
2014-09-01
Tandem N-methylpyrrole-N-methylimidazole (Py-Im) polyamides with good sequence-specific DNA-alkylating activities have been designed and synthesized. Three alkylating tandem Py-Im polyamides with different linkers, which each contained the same moiety for the recognition of a 10 bp DNA sequence, were evaluated for their reactivity and selectivity by DNA alkylation, using high-resolution denaturing gel electrophoresis. All three conjugates displayed high reactivities for the target sequence. In particular, polyamide 1, which contained a β-alanine linker, displayed the most-selective sequence-specific alkylation towards the target 10 bp DNA sequence. The tandem Py-Im polyamide conjugates displayed greater sequence-specific DNA alkylation than conventional hairpin Py-Im polyamide conjugates (4 and 5). For further research, the design of tandem Py-Im polyamide conjugates could play an important role in targeting specific gene sequences. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Smith, David J.; Burton, Aaron; Castro-Wallace, Sarah; John, Kristen; Stahl, Sarah E.; Dworkin, Jason Peter; Lupisella, Mark L.
2016-01-01
On the International Space Station (ISS), technologies capable of rapid microbial identification and disease diagnostics are not currently available. NASA still relies upon sample return for comprehensive, molecular-based sample characterization. Next-generation DNA sequencing is a powerful approach for identifying microorganisms in air, water, and surfaces onboard spacecraft. The Biomolecule Sequencer payload, manifested to SpaceX-9 and scheduled on the Increment 4748 research plan (June 2016), will assess the functionality of a commercially-available next-generation DNA sequencer in the microgravity environment of ISS. The MinION device from Oxford Nanopore Technologies (Oxford, UK) measures picoamp changes in electrical current dependent on nucleotide sequences of the DNA strand migrating through nanopores in the system. The hardware is exceptionally small (9.5 x 3.2 x 1.6 cm), lightweight (120 grams), and powered only by a USB connection. For the ISS technology demonstration, the Biomolecule Sequencer will be powered by a Microsoft Surface Pro3. Ground-prepared samples containing lambda bacteriophage, Escherichia coli, and mouse genomic DNA, will be launched and stored frozen on the ISS until experiment initiation. Immediately prior to sequencing, a crew member will collect and thaw frozen DNA samples, connect the sequencer to the Surface Pro3, inject thawed samples into a MinION flow cell, and initiate sequencing. At the completion of the sequencing run, data will be downlinked for ground analysis. Identical, synchronous ground controls will be used for data comparisons to determine sequencer functionality, run-time sequence, current dynamics, and overall accuracy. We will present our latest results from the ISS flight experiment the first time DNA has ever been sequenced in space and discuss the many potential applications of the Biomolecule Sequencer for environmental monitoring, medical diagnostics, higher fidelity and more adaptable Space Biology Human
Elevated expression of ribosomal protein genes L37, RPP-1, and S2 in the presence of mutant p53.
Loging, W T; Reisman, D
1999-11-01
The wild-type p53 protein is a DNA-binding transcription factor that activates genes such as p21, MDM2, GADD45, and Bax that are required for the regulation of cell cycle progression or apoptosis in response to DNA damage. Mutant forms of p53, which are transforming oncogenes and are expressed at high levels in tumor cells, generally have a reduced binding affinity for the consensus DNA sequence. Interestingly, some p53 mutants that are no longer effective at binding to the consensus DNA sequence and transactivating promoters containing this target site have acquired the ability to transform cells in culture, in part through their ability to transactivate promoters of a number of genes that are not targets of the wild-type protein. Certain p53 mutants are therefore considered to be gain-of-function mutants and appear to be promoting proliferation or transforming cells through their ability to alter the expression of novel sets of genes. Our goal is to identify genes that have altered expression in the presence of a specific mutant p53 (Arg to Trp mutation at codon 248) protein. Through examining differential gene expression in cells devoid of p53 expression and in cells that express high levels of mutant p53 protein, we have identified three ribosomal protein genes that have elevated expression in response to mutant p53. Consistent with these findings, the overexpression of a number of ribosomal protein genes in human tumors and evidence for their contribution to oncogenic transformation have been reported previously, although the mechanism leading to this overexpression has remained elusive. We show results that indicate that expression of these specific ribosomal protein genes is increased in the presence of the R248W p53 mutant, which provides a mechanism for their overexpression in human tumors.
Identification of Meconopsis species by a DNA barcode sequence ...
African Journals Online (AJOL)
Deoxyribonucleic acid (DNA) barcoding is a novel technology that uses a standard DNA sequence to facilitate species identification. Species identification is necessary for the authentication of traditional plant based medicines. Although a consensus has not been agreed regarding which DNA sequences can be used as ...
Emerging functions of ribosomal proteins in gene-specific transcription and translation
International Nuclear Information System (INIS)
Lindstroem, Mikael S.
2009-01-01
Ribosomal proteins have remained highly conserved during evolution presumably reflecting often critical functions in ribosome biogenesis or mature ribosome function. In addition, several ribosomal proteins possess distinct extra-ribosomal functions in apoptosis, DNA repair and transcription. An increasing number of ribosomal proteins have been shown to modulate the trans-activation function of important regulatory proteins such as NF-κB, p53, c-Myc and nuclear receptors. Furthermore, a subset of ribosomal proteins can bind directly to untranslated regions of mRNA resulting in transcript-specific translational control outside of the ribosome itself. Collectively, these findings suggest that ribosomal proteins may have a wider functional repertoire within the cell than previously thought. The future challenge is to identify and validate these novel functions in the background of an often essential primary function in ribosome biogenesis and cell growth.
Directory of Open Access Journals (Sweden)
Fiz-Palacios Omar
2008-12-01
Full Text Available Abstract Background Differences in plant annual/perennial habit are hypothesized to cause a generation time effect on divergence rates. Previous studies that compared rates of divergence for internal transcribed spacer (ITS1 and ITS2 sequences of nuclear ribosomal DNA (nrDNA in angiosperms have reached contradictory conclusions about whether differences in generation times (or other life history features are associated with divergence rate heterogeneity. We compared annual/perennial ITS divergence rates using published sequence data, employing sampling criteria to control for possible artifacts that might obscure any actual rate variation caused by annual/perennial differences. Results Relative rate tests employing ITS sequences from 16 phylogenetically-independent annual/perennial species pairs rejected rate homogeneity in only a few comparisons, with annuals more frequently exhibiting faster substitution rates. Treating branch length differences categorically (annual faster or perennial faster regardless of magnitude with a sign test often indicated an excess of annuals with faster substitution rates. Annuals showed an approximately 1.6-fold rate acceleration in nucleotide substitution models for ITS. Relative rates of three nuclear loci and two chloroplast regions for the annual Arabidopsis thaliana compared with two closely related Arabidopsis perennials indicated that divergence was faster for the annual. In contrast, A. thaliana ITS divergence rates were sometimes faster and sometimes slower than the perennial. In simulations, divergence rate differences of at least 3.5-fold were required to reject rate constancy in > 80 % of replicates using a nucleotide substitution model observed for the combination of ITS1 and ITS2. Simulations also showed that categorical treatment of branch length differences detected rate heterogeneity > 80% of the time with a 1.5-fold or greater rate difference. Conclusion Although rate homogeneity was not rejected
Levenshtein error-correcting barcodes for multiplexed DNA sequencing
Buschmann, Tilo; Bystrykh, Leonid V.
2013-01-01
Background: High-throughput sequencing technologies are improving in quality, capacity and costs, providing versatile applications in DNA and RNA research. For small genomes or fraction of larger genomes, DNA samples can be mixed and loaded together on the same sequencing track. This so-called
SWORDS: A statistical tool for analysing large DNA sequences
Indian Academy of Sciences (India)
Unknown
These techniques are based on frequency distributions of DNA words in a large sequence, and have been packaged into a software called SWORDS. Using sequences available in ... tions with the cellular processes like recombination, replication .... in DNA sequences using certain specific probability laws. (Pevzner et al ...
Analysis of T-DNA/Host-Plant DNA Junction Sequences in Single-Copy Transgenic Barley Lines
Directory of Open Access Journals (Sweden)
Joanne G. Bartlett
2014-01-01
Full Text Available Sequencing across the junction between an integrated transfer DNA (T-DNA and a host plant genome provides two important pieces of information. The junctions themselves provide information regarding the proportion of T-DNA which has integrated into the host plant genome, whilst the transgene flanking sequences can be used to study the local genetic environment of the integrated transgene. In addition, this information is important in the safety assessment of GM crops and essential for GM traceability. In this study, a detailed analysis was carried out on the right-border T-DNA junction sequences of single-copy independent transgenic barley lines. T-DNA truncations at the right-border were found to be relatively common and affected 33.3% of the lines. In addition, 14.3% of lines had rearranged construct sequence after the right border break-point. An in depth analysis of the host-plant flanking sequences revealed that a significant proportion of the T-DNAs integrated into or close to known repetitive elements. However, this integration into repetitive DNA did not have a negative effect on transgene expression.
McCutchen-Maloney, Sandra L.
2002-01-01
Chimeric proteins having both DNA mutation binding activity and nuclease activity are synthesized by recombinant technology. The proteins are of the general formula A-L-B and B-L-A where A is a peptide having DNA mutation binding activity, L is a linker and B is a peptide having nuclease activity. The chimeric proteins are useful for detection and identification of DNA sequence variations including DNA mutations (including DNA damage and mismatches) by binding to the DNA mutation and cutting the DNA once the DNA mutation is detected.
Quantum-Sequencing: Fast electronic single DNA molecule sequencing
Casamada Ribot, Josep; Chatterjee, Anushree; Nagpal, Prashant
2014-03-01
A major goal of third-generation sequencing technologies is to develop a fast, reliable, enzyme-free, high-throughput and cost-effective, single-molecule sequencing method. Here, we present the first demonstration of unique ``electronic fingerprint'' of all nucleotides (A, G, T, C), with single-molecule DNA sequencing, using Quantum-tunneling Sequencing (Q-Seq) at room temperature. We show that the electronic state of the nucleobases shift depending on the pH, with most distinct states identified at acidic pH. We also demonstrate identification of single nucleotide modifications (methylation here). Using these unique electronic fingerprints (or tunneling data), we report a partial sequence of beta lactamase (bla) gene, which encodes resistance to beta-lactam antibiotics, with over 95% success rate. These results highlight the potential of Q-Seq as a robust technique for next-generation sequencing.
Masny, Aleksander; Jagiełło, Agata; Płucienniczak, Grażyna; Golab, Elzbieta
2012-09-01
Ribo HRM, a single-tube PCR and high resolution melting (HRM) assay for detection of polymorphisms in the large subunit ribosomal DNA expansion segment V, was developed on a Trichinella model. Four Trichinella species: T. spiralis (isolates ISS3 and ISS160), T. nativa (isolates ISS10 and ISS70), T. britovi (isolates ISS2 and ISS392) and T. pseudospiralis (isolates ISS13 and ISS1348) were genotyped. Cloned allelic variants of the expansion segment V were used as standards to prepare reference HRM curves characteristic for single sequences and mixtures of several cloned sequences imitating allelic composition detected in Trichinella isolates. Using the primer pair Tsr1 and Trich1bi, it was possible to amplify a fragment of the ESV and detect PCR products obtained from the genomic DNA of pools of larvae belonging to the four investigated species: T. pseudospiralis, T. spiralis, T. britovi and T. nativa, in a single tube Real-Time PCR reaction. Differences in the shape of the HRM curves of Trichinella isolates suggested the presence of differences between examined isolates of T. nativa, T. britovi and T. pseudospiralis species. No differences were observed between T. spiralis isolates. The presence of polymorphisms within the amplified ESV sequence fragment of T. nativa T. britovi and T. pseudospiralis was confirmed by sequencing of the cloned PCR products. Novel sequences were discovered and deposited in GenBank (GenBank IDs: JN971020-JN971027, JN120902.1, JN120903.1, JN120904.1, JN120906.1, JN120905.1). Screening the ESV region of Trichinella for polymorphism is possible using the genotyping assay Ribo HRM at the current state of its development. The Ribo HRM assay could be useful in phylogenetic studies of the Trichinella genus. Copyright © 2012 Elsevier B.V. All rights reserved.
Sharma, Neelam; Park, Sang-Wook; Vepachedu, Ramarao; Barbieri, Luigi; Ciani, Marialibera; Stirpe, Fiorenzo; Savary, Brett J; Vivanco, Jorge M
2004-01-01
Ribosome-inactivating proteins (RIPs) are N-glycosidases that remove a specific adenine from the sarcin/ricin loop of the large rRNA, thus arresting protein synthesis at the translocation step. In the present study, a protein termed tobacco RIP (TRIP) was isolated from tobacco (Nicotiana tabacum) leaves and purified using ion exchange and gel filtration chromatography in combination with yeast ribosome depurination assays. TRIP has a molecular mass of 26 kD as evidenced by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and showed strong N-glycosidase activity as manifested by the depurination of yeast rRNA. Purified TRIP showed immunoreactivity with antibodies of RIPs from Mirabilis expansa. TRIP released fewer amounts of adenine residues from ribosomal (Artemia sp. and rat ribosomes) and non-ribosomal substrates (herring sperm DNA, rRNA, and tRNA) compared with other RIPs. TRIP inhibited translation in wheat (Triticum aestivum) germ more efficiently than in rabbit reticulocytes, showing an IC50 at 30 ng in the former system. Antimicrobial assays using highly purified TRIP (50 microg mL(-1)) conducted against various fungi and bacterial pathogens showed the strongest inhibitory activity against Trichoderma reesei and Pseudomonas solancearum. A 15-amino acid internal polypeptide sequence of TRIP was identical with the internal sequences of the iron-superoxide dismutase (Fe-SOD) from wild tobacco (Nicotiana plumbaginifolia), Arabidopsis, and potato (Solanum tuberosum). Purified TRIP showed SOD activity, and Escherichia coli Fe-SOD was observed to have RIP activity too. Thus, TRIP may be considered a dual activity enzyme showing RIP-like activity and Fe-SOD characteristics.
Directory of Open Access Journals (Sweden)
Silva-Pinhati A.C.O.
2004-01-01
Full Text Available Leaf-cutting ants of the genera Atta and Acromyrmex (tribe Attini are symbiotic with basidiomycete fungi of the genus Leucoagaricus (tribe Leucocoprineae, which they cultivate on vegetable matter inside their nests. We determined the variation of the 28S, 18S, and 5.8S ribosomal DNA (rDNA gene loci and the rapidly evolving internal transcribed spacers 1 and 2 (ITS1 and ITS2 of 15 sympatric and allopatric fungi associated with colonies of 11 species of leafcutter ants living up to 2,600 km apart in Brazil. We found that the fungal rDNA and ITS sequences from different species of ants were identical (or nearly identical to each other, whereas 10 GenBank Leucoagaricus species showed higher ITS variation. Our findings suggest that Atta and Acromyrmex leafcutters living in geographic sites that are very distant from each other cultivate a single fungal species made up of closely related lineages of Leucoagaricus gongylophorus. We discuss the strikingly high similarity in the ITS1 and ITS2 regions of the Atta and Acromyrmex symbiotic L. gongylophorus studied by us, in contrast to the lower similarity displayed by their non-symbiotic counterparts. We suggest that the similarity of our L. gongylophorus isolates is an indication of the recent association of the fungus with these ants, and propose that both the intense lateral transmission of fungal material within leafcutter nests and the selection of more adapted fungal strains are involved in the homogenization of the symbiotic fungal stock.
Torque measurements reveal sequence-specific cooperative transitions in supercoiled DNA
Oberstrass, Florian C.; Fernandes, Louis E.; Bryant, Zev
2012-01-01
B-DNA becomes unstable under superhelical stress and is able to adopt a wide range of alternative conformations including strand-separated DNA and Z-DNA. Localized sequence-dependent structural transitions are important for the regulation of biological processes such as DNA replication and transcription. To directly probe the effect of sequence on structural transitions driven by torque, we have measured the torsional response of a panel of DNA sequences using single molecule assays that employ nanosphere rotational probes to achieve high torque resolution. The responses of Z-forming d(pGpC)n sequences match our predictions based on a theoretical treatment of cooperative transitions in helical polymers. “Bubble” templates containing 50–100 bp mismatch regions show cooperative structural transitions similar to B-DNA, although less torque is required to disrupt strand–strand interactions. Our mechanical measurements, including direct characterization of the torsional rigidity of strand-separated DNA, establish a framework for quantitative predictions of the complex torsional response of arbitrary sequences in their biological context. PMID:22474350
Directed PCR-free engineering of highly repetitive DNA sequences
Directory of Open Access Journals (Sweden)
Preissler Steffen
2011-09-01
Full Text Available Abstract Background Highly repetitive nucleotide sequences are commonly found in nature e.g. in telomeres, microsatellite DNA, polyadenine (poly(A tails of eukaryotic messenger RNA as well as in several inherited human disorders linked to trinucleotide repeat expansions in the genome. Therefore, studying repetitive sequences is of biological, biotechnological and medical relevance. However, cloning of such repetitive DNA sequences is challenging because specific PCR-based amplification is hampered by the lack of unique primer binding sites resulting in unspecific products. Results For the PCR-free generation of repetitive DNA sequences we used antiparallel oligonucleotides flanked by restriction sites of Type IIS endonucleases. The arrangement of recognition sites allowed for stepwise and seamless elongation of repetitive sequences. This facilitated the assembly of repetitive DNA segments and open reading frames encoding polypeptides with periodic amino acid sequences of any desired length. By this strategy we cloned a series of polyglutamine encoding sequences as well as highly repetitive polyadenine tracts. Such repetitive sequences can be used for diverse biotechnological applications. As an example, the polyglutamine sequences were expressed as His6-SUMO fusion proteins in Escherichia coli cells to study their aggregation behavior in vitro. The His6-SUMO moiety enabled affinity purification of the polyglutamine proteins, increased their solubility, and allowed controlled induction of the aggregation process. We successfully purified the fusions proteins and provide an example for their applicability in filter retardation assays. Conclusion Our seamless cloning strategy is PCR-free and allows the directed and efficient generation of highly repetitive DNA sequences of defined lengths by simple standard cloning procedures.
Energy Technology Data Exchange (ETDEWEB)
Korzeneva, Inna B., E-mail: inna.korzeneva@molgen.vniief.ru [Russian Federal Nuclear Center – All-Russian Research Institute of Experimental Physics (RFNC-VNIIEF) 607190 Sarov, 37 Mira ave., Nizhniy Novgorod Region (Russian Federation); Kostuyk, Svetlana V. [Research Centre for Medical Genetics, 115478 Moscow, 1 Moskvorechye str. (Russian Federation); Ershova, Elizaveta S. [Research Centre for Medical Genetics, 115478 Moscow, 1 Moskvorechye str. (Russian Federation); V. A. Negovsky Research Institute of General Reanimatology, Moscow, 107031 (Russian Federation); Skorodumova, Elena N.; Zhuravleva, Veronika F.; Pankratova, Galina V.; Volkova, Irina V.; Stepanova, Elena V. [Russian Federal Nuclear Center – All-Russian Research Institute of Experimental Physics (RFNC-VNIIEF) 607190 Sarov, 37 Mira ave., Nizhniy Novgorod Region (Russian Federation); Porokhovnik, Lev N. [Research Centre for Medical Genetics, 115478 Moscow, 1 Moskvorechye str. (Russian Federation); Veiko, Natalia N. [Research Centre for Medical Genetics, 115478 Moscow, 1 Moskvorechye str. (Russian Federation); V. A. Negovsky Research Institute of General Reanimatology, Moscow, 107031 (Russian Federation)
2016-09-15
Highlights: • A transcribed region of human ribosomal repeat is resistant to double-strand breaks in the environment of a raised endonuclease activity. • Hybridization-based techniques are preferable for the analysis of damaged and/or oxidized genomic fragments, rather than the qRT-PCR method. • A chronic exposure to the low-dose IR induces an elevation of the rDNA content in the human circulating cfDNA as compared to cellular DNA. • An exposure to IR entails a decrease of the level of the human circulating satellite III (1q12) as compared to cellular DNA (RsatIII index). • The RrDNA/RsatIII ratio is a potential marker of a chronic IR individual exposure. - Abstract: A single exposure to ionizing radiation (IR) results in an elevated cell-free DNA (cfDNA) content in the blood plasma. In this case, the cfDNA concentration can be a marker of the cell death in the organism. However, a chronic exposure to a low-dose IR enhances both the endonuclease activity and titer of antibodies to DNA in blood plasma, resulting in a decrease of the total concentration of circulating cfDNA in exposed people. In this case, the total cfDNA concentration should not be considered as a marker of the cell death in an exposed body. We assumed that a pool of the cfDNA circulating in the exposed people contains DNA fragments, which are resistant to a double-strand break formation in the environment of the elevated plasma endonuclease activity, and can be accumulated in the blood plasma. In order to test this hypothesis, we studied the content of GC-rich sequences (69%GC) of the transcribed region of human ribosomal repeat (rDNA), as well as the content of AT-rich repeat (63%AT) of satellite III (1q12) in the cfDNA samples obtained from 285 individuals. We have found that a chronic exposure to gamma-neutron radiation (N = 88) and tritium β-radiation (N = 88) evokes an increase of the rDNA content (RrDNA index) and a decrease of the satellite III content (RsatIII index) in the
International Nuclear Information System (INIS)
Korzeneva, Inna B.; Kostuyk, Svetlana V.; Ershova, Elizaveta S.; Skorodumova, Elena N.; Zhuravleva, Veronika F.; Pankratova, Galina V.; Volkova, Irina V.; Stepanova, Elena V.; Porokhovnik, Lev N.; Veiko, Natalia N.
2016-01-01
Highlights: • A transcribed region of human ribosomal repeat is resistant to double-strand breaks in the environment of a raised endonuclease activity. • Hybridization-based techniques are preferable for the analysis of damaged and/or oxidized genomic fragments, rather than the qRT-PCR method. • A chronic exposure to the low-dose IR induces an elevation of the rDNA content in the human circulating cfDNA as compared to cellular DNA. • An exposure to IR entails a decrease of the level of the human circulating satellite III (1q12) as compared to cellular DNA (RsatIII index). • The RrDNA/RsatIII ratio is a potential marker of a chronic IR individual exposure. - Abstract: A single exposure to ionizing radiation (IR) results in an elevated cell-free DNA (cfDNA) content in the blood plasma. In this case, the cfDNA concentration can be a marker of the cell death in the organism. However, a chronic exposure to a low-dose IR enhances both the endonuclease activity and titer of antibodies to DNA in blood plasma, resulting in a decrease of the total concentration of circulating cfDNA in exposed people. In this case, the total cfDNA concentration should not be considered as a marker of the cell death in an exposed body. We assumed that a pool of the cfDNA circulating in the exposed people contains DNA fragments, which are resistant to a double-strand break formation in the environment of the elevated plasma endonuclease activity, and can be accumulated in the blood plasma. In order to test this hypothesis, we studied the content of GC-rich sequences (69%GC) of the transcribed region of human ribosomal repeat (rDNA), as well as the content of AT-rich repeat (63%AT) of satellite III (1q12) in the cfDNA samples obtained from 285 individuals. We have found that a chronic exposure to gamma-neutron radiation (N = 88) and tritium β-radiation (N = 88) evokes an increase of the rDNA content (RrDNA index) and a decrease of the satellite III content (RsatIII index) in the
Simmons, M P; Savolainen, V; Clevinger, C C; Archer, R H; Davis, J I
2001-06-01
Phylogenetic relationships within Celastraceae (spindle-tree family) were inferred from nucleotide sequence characters from the 5' end of 26S nuclear ribosomal DNA (including expansion segments D1-D3; 84 species sampled), phytochrome B (58 species), rbcL (31 species), atpB (23 species), and morphology (94 species). Among taxa of questionable affinity, Forsellesia is a member of Crossosomataceae, and Goupia is excluded from Celastraceae. However, Brexia, Canotia, Lepuropetalon, Parnassia, Siphonodon, and Stackhousiaceae are supported as members of Celastraceae. Gymnosporia and Tricerma are distinct from Maytenus, Cassine is supported as distinct from Elaeodendron, and Dicarpellum is distinct from Salacia. Catha, Maytenus, and Pristimera are not resolved as natural genera. Hippocrateaceae (including Plagiopteron and Lophopetalum) are a clade nested within a paraphyletic Celastraceae. These data also suggest that the Loesener's classification of Celastraceae sensu stricto and Hallé's classification of Hippocrateaceae are artificial. The diversification of the fruit and aril within Celastraceae appears to be complex, with multiple origins of most fruit and aril forms. Copyright 2001 Academic Press.
International Nuclear Information System (INIS)
Mardis, E.R.; Roe, B.A.
1989-01-01
Automated procedures have been developed for both the simultaneous isolation of 96 single-stranded M13 chimeric template DNAs in less than two hours, and for simultaneously pipetting 24 dideoxynucleotide sequencing reactions on a commercially available laboratory workstation. The DNA sequencing results obtained by either radiolabeled or fluorescent methods are consistent with the premise that automation of these portions of DNA sequencing projects will improve the reproducibility of the DNA isolation and the procedures for these normally labor-intensive steps provides an approach for rapid acquisition of large amounts of high quality, reproducible DNA sequence data
Directory of Open Access Journals (Sweden)
David Maddison
2011-11-01
Full Text Available The phylogeny of ground beetles of supertribe Trechitae is inferred using DNA sequences of genes that code for 28S ribosomal RNA, 18S ribosomal RNA, and wingless. Within the outgroups, austral psydrines are inferred to be monophyletic, and separate from the three genera of true Psydrina (Psydrus, Nomius, Laccocenus; the austral psydrines are formally removed from Psydrini and are treated herein as their own tribe, Moriomorphini Sloane. All three genes place Gehringia with Psydrina. Trechitae is inferred to be monophyletic, and sister to Patrobini.Within trechites, evidence is presented that Tasmanitachoides is not a tachyine, but is instead a member of Trechini. Perileptus is a member of subtribe Trechodina. Against Erwin’s hypothesis of anillines as a polyphyletic lineage derived from the tachyine genus Paratachys, the anillines sampled are monophyletic, and not related to Paratachys. Zolini, Pogonini, Tachyina, and Xystosomina are all monophyletic, with the latter two being sister groups. The relationships of the subtribe Bembidiina were studied in greater detail. Phrypeus is only distantly related to Bembidion, and there is no evidence from sequence data that it belongs within Bembidiina. Three groups that have been recently considered to be outside of the large genus Bembidion are shown to be derived members of Bembidion, related to subgroups: Cillenus is related to the Ocydromus complex of Bembidion, Zecillenus is related to the New Zealand subgenus Zeplataphus, and Hydrium is close to subgenus Metallina. The relationships among major lineages of Trechitae are not, however, resolved with these data.
Sequencing intractable DNA to close microbial genomes.
Directory of Open Access Journals (Sweden)
Richard A Hurt
Full Text Available Advancement in high throughput DNA sequencing technologies has supported a rapid proliferation of microbial genome sequencing projects, providing the genetic blueprint for in-depth studies. Oftentimes, difficult to sequence regions in microbial genomes are ruled "intractable" resulting in a growing number of genomes with sequence gaps deposited in databases. A procedure was developed to sequence such problematic regions in the "non-contiguous finished" Desulfovibrio desulfuricans ND132 genome (6 intractable gaps and the Desulfovibrio africanus genome (1 intractable gap. The polynucleotides surrounding each gap formed GC rich secondary structures making the regions refractory to amplification and sequencing. Strand-displacing DNA polymerases used in concert with a novel ramped PCR extension cycle supported amplification and closure of all gap regions in both genomes. The developed procedures support accurate gene annotation, and provide a step-wise method that reduces the effort required for genome finishing.
Sequencing Intractable DNA to Close Microbial Genomes
Energy Technology Data Exchange (ETDEWEB)
Hurt, Jr., Richard Ashley [ORNL; Brown, Steven D [ORNL; Podar, Mircea [ORNL; Palumbo, Anthony Vito [ORNL; Elias, Dwayne A [ORNL
2012-01-01
Advancement in high throughput DNA sequencing technologies has supported a rapid proliferation of microbial genome sequencing projects, providing the genetic blueprint for for in-depth studies. Oftentimes, difficult to sequence regions in microbial genomes are ruled intractable resulting in a growing number of genomes with sequence gaps deposited in databases. A procedure was developed to sequence such difficult regions in the non-contiguous finished Desulfovibrio desulfuricans ND132 genome (6 intractable gaps) and the Desulfovibrio africanus genome (1 intractable gap). The polynucleotides surrounding each gap formed GC rich secondary structures making the regions refractory to amplification and sequencing. Strand-displacing DNA polymerases used in concert with a novel ramped PCR extension cycle supported amplification and closure of all gap regions in both genomes. These developed procedures support accurate gene annotation, and provide a step-wise method that reduces the effort required for genome finishing.
Sequence Dependent Interactions Between DNA and Single-Walled Carbon Nanotubes
Roxbury, Daniel
It is known that single-stranded DNA adopts a helical wrap around a single-walled carbon nanotube (SWCNT), forming a water-dispersible hybrid molecule. The ability to sort mixtures of SWCNTs based on chirality (electronic species) has recently been demonstrated using special short DNA sequences that recognize certain matching SWCNTs of specific chirality. This thesis investigates the intricacies of DNA-SWCNT sequence-specific interactions through both experimental and molecular simulation studies. The DNA-SWCNT binding strengths were experimentally quantified by studying the kinetics of DNA replacement by a surfactant on the surface of particular SWCNTs. Recognition ability was found to correlate strongly with measured binding strength, e.g. DNA sequence (TAT)4 was found to bind 20 times stronger to the (6,5)-SWCNT than sequence (TAT)4T. Next, using replica exchange molecular dynamics (REMD) simulations, equilibrium structures formed by (a) single-strands and (b) multiple-strands of 12-mer oligonucleotides adsorbed on various SWCNTs were explored. A number of structural motifs were discovered in which the DNA strand wraps around the SWCNT and 'stitches' to itself via hydrogen bonding. Great variability among equilibrium structures was observed and shown to be directly influenced by DNA sequence and SWCNT type. For example, the (6,5)-SWCNT DNA recognition sequence, (TAT)4, was found to wrap in a tight single-stranded right-handed helical conformation. In contrast, DNA sequence T12 forms a beta-barrel left-handed structure on the same SWCNT. These are the first theoretical indications that DNA-based SWCNT selectivity can arise on a molecular level. In a biomedical collaboration with the Mayo Clinic, pathways for DNA-SWCNT internalization into healthy human endothelial cells were explored. Through absorbance spectroscopy, TEM imaging, and confocal fluorescence microscopy, we showed that intracellular concentrations of SWCNTs far exceeded those of the incubation
Transcriptional activation of ribosomal RNA genes during compensatory renal hypertrophy
International Nuclear Information System (INIS)
Ouellette, A.J.; Moonka, R.; Zelenetz, A.; Malt, R.A.
1986-01-01
The overall rate of rDNA transcription increases by 50% during the first 24 hours of compensatory renal hypertrophy in the mouse. To study mechanisms of ribosome accumulation after uninephrectomy, transcription rates were measured in isolated kidneys by transcriptional runoff. 32 P-labeled nascent transcripts were hybridized to blots containing linearized, denatured cloned rDNA, and hybridization was quantitated autoradiographically and by direct counting. Overall transcriptional activity of rDNA was increased by 30% above control levels at 6 hrs after nephrectomy and by 50% at 12, 18, and 24 hrs after operation. Hybridizing RNA was insensitive to inhibiby alpha-amanitin, and no hybridization was detected to vector DNA. Thus, accelerated rDNA transcription is one regulatory element in the accretion of ribosomes in renal growth, and the regulatory event is an early event. Mechanisms of activation may include enhanced transcription of active genes or induction of inactive DNA
Recurrence plot analysis of DNA sequences
Energy Technology Data Exchange (ETDEWEB)
Wu Zuobing [State Key Laboratory of Nonlinear Mechanics, Institute of Mechanics, Chinese Academy of Sciences, Beijing 100080 (China)]. E-mail: wuzb@lnm.imech.ac.cn
2004-11-15
Recurrence plot technique of DNA sequences is established on metric representation and employed to analyze correlation structure of nucleotide strings. It is found that, in the transference of nucleotide strings, a human DNA fragment has a major correlation distance, but a yeast chromosome's correlation distance has a constant increasing.
RDNAnalyzer: A tool for DNA secondary structure prediction and sequence analysis.
Afzal, Muhammad; Shahid, Ahmad Ali; Shehzadi, Abida; Nadeem, Shahid; Husnain, Tayyab
2012-01-01
RDNAnalyzer is an innovative computer based tool designed for DNA secondary structure prediction and sequence analysis. It can randomly generate the DNA sequence or user can upload the sequences of their own interest in RAW format. It uses and extends the Nussinov dynamic programming algorithm and has various application for the sequence analysis. It predicts the DNA secondary structure and base pairings. It also provides the tools for routinely performed sequence analysis by the biological scientists such as DNA replication, reverse compliment generation, transcription, translation, sequence specific information as total number of nucleotide bases, ATGC base contents along with their respective percentages and sequence cleaner. RDNAnalyzer is a unique tool developed in Microsoft Visual Studio 2008 using Microsoft Visual C# and Windows Presentation Foundation and provides user friendly environment for sequence analysis. It is freely available. http://www.cemb.edu.pk/sw.html RDNAnalyzer - Random DNA Analyser, GUI - Graphical user interface, XAML - Extensible Application Markup Language.
van Keulen, H; Campbell, S R; Erlandsen, S L; Jarroll, E L
1991-06-01
In an attempt to study Giardia at the DNA sequence level, the rRNA genes of three species, Giardia duodenalis, Giardia ardeae and Giardia muris were cloned and restriction enzyme maps were constructed. The rDNA repeats of these Giardia show completely different restriction enzyme recognition patterns. The size of the rDNA repeat ranges from approximately 5.6 kb in G. duodenalis to 7.6 kb in both G. muris and G. ardeae. These size differences are mainly attributable to the variation in length of the spacer. Minor differences exist among these Giardia in the sizes of their small subunit rRNA and the internal transcribed spacer between small and large subunit rRNA. The genetic maps were constructed by sequence analysis of the DNA around the 5' and 3' ends of the mature rRNA genes and between the rRNA covering the 5.8S rRNA gene and internal transcribed spacer. Comparison of the 5.8S rDNA and 3' end of large subunit rDNA from these three Giardia species showed considerable sequence variation, but the rDNA sequences of G. duodenalis and G. ardeae appear more closely related to each other than to G. muris.
Wang, Hsiang-Tsui; Chen, Tzu-Ying; Weng, Ching-Wen; Yang, Chun-Hsiang; Tang, Moon-Shong
2016-12-06
Acrolein (Acr) is a potent cytotoxic and DNA damaging agent which is ubiquitous in the environment and abundant in tobacco smoke. Acr is also an active cytotoxic metabolite of the anti-cancer drugs cyclophosphamide and ifosfamide. The mechanisms via which Acr exerts its anti-cancer activity and cytotoxicity are not clear. In this study, we found that Acr induces cytotoxicity and cell death in human cancer cells with different activities of p53. Acr preferentially binds nucleolar ribosomal DNA (rDNA) to form Acr-deoxyguanosine adducts, and induces oxidative damage to both rDNA and ribosomal RNA (rRNA). Acr triggers ribosomal stress responses, inhibits rRNA synthesis, reduces RNA polymerase I binding to the promoter of rRNA gene, disrupts nucleolar integrity, and impairs ribosome biogenesis and polysome formation. Acr causes an increase in MDM2 levels and phosphorylation of MDM2 in A549 and HeLa cells which are p53 active and p53 inactive, respectively. It enhances the binding of ribosomal protein RPL11 to MDM2 and reduces the binding of p53 and E2F-1 to MDM2 resulting in stabilization/activation of p53 in A549 cells and degradation of E2F-1 in A549 and HeLa cells. We propose that Acr induces ribosomal stress which leads to activation of MDM2 and RPL11-MDM2 binding, consequently, activates p53 and enhances E2F-1 degradation, and that taken together these two processes induce apoptosis and cell death.
Chromatid interchanges at intrachromosomal telomeric DNA sequences
International Nuclear Information System (INIS)
Fernandez, J.L.; Vazquez-Gundin, F.; Bilbao, A.; Gosalvez, J.; Goyanes, V.
1997-01-01
Chinese hamster Don cells were exposed to X-rays, mitomycin C and teniposide (VM-26) to induce chromatid exchanges (quadriradials and triradials). After fluorescence in situ hybridization (FISH) of telomere sequences it was found that interstitial telomere-like DNA sequence arrays presented around five times more breakage-rearrangements than the genome overall. This high recombinogenic capacity was independent of the clastogen, suggesting that this susceptibility is not related to the initial mechanisms of DNA damage. (author)
Development of a defined-sequence DNA system for use in DNA misrepair studies
International Nuclear Information System (INIS)
Sutton, S.; Tobias, C.A.
1984-01-01
The authors have developed a system that allows them to study cellular DNA repair processes at the molecular level. In particular, the authors are using this system to examine the consequences of a misrepair of radiation-induced DNA damage, as a function of dose. The cells being used are specially engineered haploid yeast cells. Maintained in the cells, at one copy per cell, is a cen plasmid, a plasmid that behaves like a functional chromosome. This plasmid carries a small defined sequence of DNA from the E. coli lac z gene. It is this lac z region (called the alpha region) that serves as the target for radiation damage. Two copies of the complimentary portion of the lac z gene are integrated into the yeast genome. Irradiated cells are screened for possible mutation in the alpha region by testing the cells' ability to hydrolyze xgal, a lactose substrate. The DNA of interest is then extracted from the cells, sequenced, and the sequence is compared to that of the control. Unlike the usual defined-sequence DNA systems, theirs is an in vivo system. A disadvantage is the relatively high background mutation rate. Results achieved with this system, as well as future applications, are discussed
Papp, T; Acs, Klára; Nyilasi, Ildikó; Nagy, Erzsébet; Vágvölgyi, Cs
2003-01-01
The complete ITS (internal transcribed spacer) region coding the ITS1, the ITS2 and the 5.8S rDNA was amplified by polymerase chain reaction from two strains of Gilbertella persicaria, six strains in the Mucoraceae (Mucor piriformis, M. rouxii, M. circinelloides, Rhizomucor miehei, R. pusillus and R. tauricus) and four strains representing three species of the Choanephoraceae (Blakeslea trispora, Choanephora infundibulifera and Poitrasia circinans). Sequences of the amplified DNA fragments were determined and analysed. G. persicaria belongs to the monogeneric family (Gilbertellaceae), however, originally it was described as Choanephora persicaria. The goal of this study was to reveal the phylogenetic relationship among fungi belonging to Gilbertellaceae, Choanephoraceae and Mucoraceae. Our results support that the "intermediate" position of this family is between Choanephoraceae and Mucoraceae.
Directory of Open Access Journals (Sweden)
Wei Shi
2017-01-01
Full Text Available To explore the biosystematics of the Calligonum mongolicum complex (Polygonaceae, the flowering phenological period, breeding and pollination characters and seed set of the complex (C. Mongolicum Turze, C. chinense A. Los., C. gobicum A. Los., C. pumilum A. Los. and C. zaidamense A. Los. were documented in the Turpan Eremophyte Botanical Garden, China. The sequences of the nuclear ribosomal ITS and ETS region were employed to differentiate the C. mongolicum complex and other species in sect. Medusae. The results showed species of the C. mongolicum complex occupied overlapping flowering periods and had consistent pollination agents. Their breeding systems are all self-compatible, tend to be out-crossing and they interbreed amongst each other (out-crossing index, OCI = 4.The crosses within and amongst species had high seed sets (44 - 65%. Phylogenetic analyses of Calligonum sect. Medusae and the network analysis of nrDNA (ITS and ETS in the complex suggest interbreeding amongst “species” within the complex and provide evidence for taxonomically merging the five species in the complex. The detected hybridisation, occurring within the complex, suggests the need to improve traditional methods of ex situ plant conservation in botanical gardens for maintaining genetic diversity of Calligonum within and amongst species from different geographic areas.
Adenoviral DNA replication: DNA sequences and enzymes required for initiation in vitro
International Nuclear Information System (INIS)
Stillman, B.W.; Tamanoi, F.
1983-01-01
In this paper evidence is provided that the 140,000-dalton DNA polymerase is encoded by the adenoviral genome and is required for the initiation of DNA replication in vitro. The DNA sequences in the template DNA that are required for the initiation of replication have also been identified, using both plasmid DNAs and synthetic oligodeoxyribonucleotides. 48 references, 7 figures, 1 table
Detection of DNA specific sequences of Spongospora subterranea in soil and potato tubers
Directory of Open Access Journals (Sweden)
Cristian Oswaldo Saavedra Rodríguez
2004-01-01
Full Text Available A test has been developed for early identification of the casual agent for potato powdery scab (Spongospora subterranea fs subterranea. Identification was carried out in seeds and soil where this tuber is grown. A polymerase chain reaction (PCR was set up for detecting 372, 390 and 391 bp ribosomal DNA internal transcribed spacer sequences (ITS in the S. subterraneagenome. A method for extracting and purifying DNA from infected plant material (potato root nodes and pustules on the potato was standardised. Plant tissue was obtained by potato tuber propagation using an inoculum from the pathogen in greenhouse conditions. After the PCR had been optimised and its sensitivity determined, a molecular methodology was validated by examining plant material infected with S. subterranea and soil samples infested with the pathogen obtained from the departments of Cundinamarca and Nariño. The PCR detected S. subterranea DNA from infected material and soil samples (all thirty samples from the experimental area analysed proved PCR positive. These results show that this molecular method was not just useful for the early detection of the pathogen in soil samples but as a tool for detecting or determining the possible presence of this micro-organism in places that have been declared f ree of S. subterranea and an effective form of quality control in producing the certif ied potato seed. Key words: Powdery scab, cystosori, internal transcribed spacer, PCR, plasmodiophorid.
Wang, Shuzhen; Zheng, Yinzhen; Yan, Junjie; Zhu, Zhixuan; Wu, Zhihua; Ding, Yi
2013-11-01
Ribosome-inactivating proteins (RIPs) function to inhibit protein synthesis through the removal of specific adenine residues from eukaryotic ribosomal RNA and rending the 60S subunit unable to bind elongation factor 2. They have received much attention in biological and biomedical research due to their unique activities toward tumor cells, as well as the important roles in plant defense. Alpha-momorcharin (α-MC), a member of the type I family of RIPs, is rich in the seeds of Momordica charantia L. Previous studies demonstrated that α-MC is an effective antifungal and antibacterial protein. In this study, a detailed analysis of the DNase-like activity of α-MC was conducted. Results showed that the DNase-like activity toward plasmid DNA was time-dependent, temperature-related, and pH-stable. Moreover, a requirement for divalent metal ions in the catalytic domain of α-MC was confirmed. Additionally, Tyr(93) was found to be a critical residue for the DNase-like activity, while Tyr(134), Glu(183), Arg(186), and Trp(215) were activity-related residues. This study on the chemico-physical properties and mechanism of action of α-MC will improve its utilization in scientific research, as well as its potential industrial uses. These results may also assist in the characterization and elucidation of the DNase-like enzymatic properties of other RIPs.
Manchado, Manuel; Infante, Carlos; Asensio, Esther; Cañavate, Jose Pedro; Douglas, Susan E
2007-07-03
Ribosomal proteins (RPs) are key components of ribosomes, the cellular organelle responsible for protein biosynthesis in cells. Their levels can vary as a function of organism growth and development; however, some RPs have been associated with other cellular processes or extraribosomal functions. Their high representation in cDNA libraries has resulted in the increase of RP sequences available from different organisms and their proposal as appropriate molecular markers for phylogenetic analysis. The development of large-scale genomics of Senegalese sole (Solea senegalensis) and Atlantic halibut (Hippoglossus hippoglossus), two commercially important flatfish species, has made possible the identification and systematic analysis of the complete set of RP sequences for the small (40S) ribosome subunit. Amino acid sequence comparisons showed a high similarity both between these two flatfish species and with respect to other fish and human. EST analysis revealed the existence of two and four RPS27 genes in Senegalese sole and Atlantic halibut, respectively. Phylogenetic analysis clustered RPS27 in two separate clades with their fish and mammalian counterparts. Steady-state transcript levels for eight RPs (RPS2, RPS3a, RPS15, RPS27-1, RPS27-2, RPS27a, RPS28, and RPS29) in sole were quantitated during larval development and in tissues, using a real-time PCR approach. All eight RPs exhibited different expression patterns in tissues with the lowest levels in brain. On the contrary, RP transcripts increased co-ordinately after first larval feeding reducing progressively during the metamorphic process. The genomic resources and knowledge developed in this survey will provide new insights into the evolution of Pleuronectiformes. Expression data will contribute to a better understanding of RP functions in fish, especially the mechanisms that govern growth and development in larvae, with implications in aquaculture.
Directory of Open Access Journals (Sweden)
Cañavate Jose
2007-07-01
Full Text Available Abstract Background Ribosomal proteins (RPs are key components of ribosomes, the cellular organelle responsible for protein biosynthesis in cells. Their levels can vary as a function of organism growth and development; however, some RPs have been associated with other cellular processes or extraribosomal functions. Their high representation in cDNA libraries has resulted in the increase of RP sequences available from different organisms and their proposal as appropriate molecular markers for phylogenetic analysis. Results The development of large-scale genomics of Senegalese sole (Solea senegalensis and Atlantic halibut (Hippoglossus hippoglossus, two commercially important flatfish species, has made possible the identification and systematic analysis of the complete set of RP sequences for the small (40S ribosome subunit. Amino acid sequence comparisons showed a high similarity both between these two flatfish species and with respect to other fish and human. EST analysis revealed the existence of two and four RPS27 genes in Senegalese sole and Atlantic halibut, respectively. Phylogenetic analysis clustered RPS27 in two separate clades with their fish and mammalian counterparts. Steady-state transcript levels for eight RPs (RPS2, RPS3a, RPS15, RPS27-1, RPS27-2, RPS27a, RPS28, and RPS29 in sole were quantitated during larval development and in tissues, using a real-time PCR approach. All eight RPs exhibited different expression patterns in tissues with the lowest levels in brain. On the contrary, RP transcripts increased co-ordinately after first larval feeding reducing progressively during the metamorphic process. Conclusion The genomic resources and knowledge developed in this survey will provide new insights into the evolution of Pleuronectiformes. Expression data will contribute to a better understanding of RP functions in fish, especially the mechanisms that govern growth and development in larvae, with implications in aquaculture.
RANDNA: a random DNA sequence generator.
Piva, Francesco; Principato, Giovanni
2006-01-01
Monte Carlo simulations are useful to verify the significance of data. Genomic regularities, such as the nucleotide correlations or the not uniform distribution of the motifs throughout genomic or mature mRNA sequences, exist and their significance can be checked by means of the Monte Carlo test. The test needs good quality random sequences in order to work, moreover they should have the same nucleotide distribution as the sequences in which the regularities have been found. Random DNA sequences are also useful to estimate the background score of an alignment, that is a threshold below which the resulting score is merely due to chance. We have developed RANDNA, a free software which allows to produce random DNA or RNA sequences setting both their length and the percentage of nucleotide composition. Sequences having the same nucleotide distribution of exonic, intronic or intergenic sequences can be generated. Its graphic interface makes it possible to easily set the parameters that characterize the sequences being produced and saved in a text format file. The pseudo-random number generator function of Borland Delphi 6 is used, since it guarantees a good randomness, a long cycle length and a high speed. We have checked the quality of sequences generated by the software, by means of well-known tests, both by themselves and versus genuine random sequences. We show the good quality of the generated sequences. The software, complete with examples and documentation, is freely available to users from: http://www.introni.it/en/software.
Cloning and expression of cDNA coding for bouganin.
den Hartog, Marcel T; Lubelli, Chiara; Boon, Louis; Heerkens, Sijmie; Ortiz Buijsse, Antonio P; de Boer, Mark; Stirpe, Fiorenzo
2002-03-01
Bouganin is a ribosome-inactivating protein that recently was isolated from Bougainvillea spectabilis Willd. In this work, the cloning and expression of the cDNA encoding for bouganin is described. From the cDNA, the amino-acid sequence was deduced, which correlated with the primary sequence data obtained by amino-acid sequencing on the native protein. Bouganin is synthesized as a pro-peptide consisting of 305 amino acids, the first 26 of which act as a leader signal while the 29 C-terminal amino acids are cleaved during processing of the molecule. The mature protein consists of 250 amino acids. Using the cDNA sequence encoding the mature protein of 250 amino acids, a recombinant protein was expressed, purified and characterized. The recombinant molecule had similar activity in a cell-free protein synthesis assay and had comparable toxicity on living cells as compared to the isolated native bouganin.
A new version of the RDP (Ribosomal Database Project)
Maidak, B. L.; Cole, J. R.; Parker, C. T. Jr; Garrity, G. M.; Larsen, N.; Li, B.; Lilburn, T. G.; McCaughey, M. J.; Olsen, G. J.; Overbeek, R.;
1999-01-01
The Ribosomal Database Project (RDP-II), previously described by Maidak et al. [ Nucleic Acids Res. (1997), 25, 109-111], is now hosted by the Center for Microbial Ecology at Michigan State University. RDP-II is a curated database that offers ribosomal RNA (rRNA) nucleotide sequence data in aligned and unaligned forms, analysis services, and associated computer programs. During the past two years, data alignments have been updated and now include >9700 small subunit rRNA sequences. The recent development of an ObjectStore database will provide more rapid updating of data, better data accuracy and increased user access. RDP-II includes phylogenetically ordered alignments of rRNA sequences, derived phylogenetic trees, rRNA secondary structure diagrams, and various software programs for handling, analyzing and displaying alignments and trees. The data are available via anonymous ftp (ftp.cme.msu. edu) and WWW (http://www.cme.msu.edu/RDP). The WWW server provides ribosomal probe checking, approximate phylogenetic placement of user-submitted sequences, screening for possible chimeric rRNA sequences, automated alignment, and a suggested placement of an unknown sequence on an existing phylogenetic tree. Additional utilities also exist at RDP-II, including distance matrix, T-RFLP, and a Java-based viewer of the phylogenetic trees that can be used to create subtrees.
Google matrix analysis of DNA sequences.
Kandiah, Vivek; Shepelyansky, Dima L
2013-01-01
For DNA sequences of various species we construct the Google matrix [Formula: see text] of Markov transitions between nearby words composed of several letters. The statistical distribution of matrix elements of this matrix is shown to be described by a power law with the exponent being close to those of outgoing links in such scale-free networks as the World Wide Web (WWW). At the same time the sum of ingoing matrix elements is characterized by the exponent being significantly larger than those typical for WWW networks. This results in a slow algebraic decay of the PageRank probability determined by the distribution of ingoing elements. The spectrum of [Formula: see text] is characterized by a large gap leading to a rapid relaxation process on the DNA sequence networks. We introduce the PageRank proximity correlator between different species which determines their statistical similarity from the view point of Markov chains. The properties of other eigenstates of the Google matrix are also discussed. Our results establish scale-free features of DNA sequence networks showing their similarities and distinctions with the WWW and linguistic networks.
Google matrix analysis of DNA sequences.
Directory of Open Access Journals (Sweden)
Vivek Kandiah
Full Text Available For DNA sequences of various species we construct the Google matrix [Formula: see text] of Markov transitions between nearby words composed of several letters. The statistical distribution of matrix elements of this matrix is shown to be described by a power law with the exponent being close to those of outgoing links in such scale-free networks as the World Wide Web (WWW. At the same time the sum of ingoing matrix elements is characterized by the exponent being significantly larger than those typical for WWW networks. This results in a slow algebraic decay of the PageRank probability determined by the distribution of ingoing elements. The spectrum of [Formula: see text] is characterized by a large gap leading to a rapid relaxation process on the DNA sequence networks. We introduce the PageRank proximity correlator between different species which determines their statistical similarity from the view point of Markov chains. The properties of other eigenstates of the Google matrix are also discussed. Our results establish scale-free features of DNA sequence networks showing their similarities and distinctions with the WWW and linguistic networks.
Grohmann, L; Brennicke, A; Schuster, W
1992-01-01
The Oenothera mitochondrial genome contains only a gene fragment for ribosomal protein S12 (rps12), while other plants encode a functional gene in the mitochondrion. The complete Oenothera rps12 gene is located in the nucleus. The transit sequence necessary to target this protein to the mitochondrion is encoded by a 5'-extension of the open reading frame. Comparison of the amino acid sequence encoded by the nuclear gene with the polypeptides encoded by edited mitochondrial cDNA and genomic sequences of other plants suggests that gene transfer between mitochondrion and nucleus started from edited mitochondrial RNA molecules. Mechanisms and requirements of gene transfer and activation are discussed. Images PMID:1454526
Chaos game representation (CGR)-walk model for DNA sequences
International Nuclear Information System (INIS)
Jie, Gao; Zhen-Yuan, Xu
2009-01-01
Chaos game representation (CGR) is an iterative mapping technique that processes sequences of units, such as nucleotides in a DNA sequence or amino acids in a protein, in order to determine the coordinates of their positions in a continuous space. This distribution of positions has two features: one is unique, and the other is source sequence that can be recovered from the coordinates so that the distance between positions may serve as a measure of similarity between the corresponding sequences. A CGR-walk model is proposed based on CGR coordinates for the DNA sequences. The CGR coordinates are converted into a time series, and a long-memory ARFIMA (p, d, q) model, where ARFIMA stands for autoregressive fractionally integrated moving average, is introduced into the DNA sequence analysis. This model is applied to simulating real CGR-walk sequence data of ten genomic sequences. Remarkably long-range correlations are uncovered in the data, and the results from these models are reasonably fitted with those from the ARFIMA (p, d, q) model. (cross-disciplinary physics and related areas of science and technology)
Aguilar, William; Paz, Manuel M; Vargas, Anayatzinc; Clement, Cristina C; Cheng, Shu-Yuan; Champeil, Elise
2018-04-20
Mitomycin C (MC), a potent antitumor drug, and decarbamoylmitomycin C (DMC), a derivative lacking the carbamoyl group, form highly cytotoxic DNA interstrand crosslinks. The major interstrand crosslink formed by DMC is the C1'' epimer of the major crosslink formed by MC. The molecular basis for the stereochemical configuration exhibited by DMC was investigated using biomimetic synthesis. The formation of DNA-DNA crosslinks by DMC is diastereospecific and diastereodivergent: Only the 1''S-diastereomer of the initially formed monoadduct can form crosslinks at GpC sequences, and only the 1''R-diastereomer of the monoadduct can form crosslinks at CpG sequences. We also show that CpG and GpC sequences react with divergent diastereoselectivity in the first alkylation step: 1"S stereochemistry is favored at GpC sequences and 1''R stereochemistry is favored at CpG sequences. Therefore, the first alkylation step results, at each sequence, in the selective formation of the diastereomer able to generate an interstrand DNA-DNA crosslink after the "second arm" alkylation. Examination of the known DNA adduct pattern obtained after treatment of cancer cell cultures with DMC indicates that the GpC sequence is the major target for the formation of DNA-DNA crosslinks in vivo by this drug. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Assessing the fidelity of ancient DNA sequences amplified from nuclear genes
DEFF Research Database (Denmark)
Binladen, Jonas; Wiuf, Carsten Henrik; Gilbert, M. Thomas P.
2006-01-01
To date, the field of ancient DNA has relied almost exclusively on mitochondrial DNA (mtDNA) sequences. However, a number of recent studies have reported the successful recovery of ancient nuclear DNA (nuDNA) sequences, thereby allowing the characterization of genetic loci directly involved...... in phenotypic traits of extinct taxa. It is well documented that postmortem damage in ancient mtDNA can lead to the generation of artifactual sequences. However, as yet no one has thoroughly investigated the damage spectrum in ancient nuDNA. By comparing clone sequences from 23 fossil specimens, recovered from...... adenine), respectively. Type 2 transitions are by far the most dominant and increase relative to those of type 1 with damage load. The results suggest that the deamination of cytosine (and 5-methyl cytosine) to uracil (and thymine) is the main cause of miscoding lesions in both ancient mtDNA and nu...
Thermodynamics of sequence-specific binding of PNA to DNA
DEFF Research Database (Denmark)
Ratilainen, T; Holmén, A; Tuite, E
2000-01-01
For further characterization of the hybridization properties of peptide nucleic acids (PNAs), the thermodynamics of hybridization of mixed sequence PNA-DNA duplexes have been studied. We have characterized the binding of PNA to DNA in terms of binding affinity (perfectly matched duplexes) and seq......For further characterization of the hybridization properties of peptide nucleic acids (PNAs), the thermodynamics of hybridization of mixed sequence PNA-DNA duplexes have been studied. We have characterized the binding of PNA to DNA in terms of binding affinity (perfectly matched duplexes...
Novel extraction strategy of ribosomal RNA and genomic DNA from cheese for PCR-based investigations.
Bonaïti, Catherine; Parayre, Sandrine; Irlinger, Françoise
2006-03-15
Cheese microorganisms, such as bacteria and fungi, constitute a complex ecosystem that plays a central role in cheeses ripening. The molecular study of cheese microbial diversity and activity is essential but the extraction of high quality nucleic acid may be problematic: the cheese samples are characterised by a strong buffering capacity which negatively influenced the yield of the extracted rRNA. The objective of this study is to develop an effective method for the direct and simultaneous isolation of yeast and bacterial ribosomal RNA and genomic DNA from the same cheese samples. DNA isolation was based on a protocol used for nucleic acids isolation from anaerobic digestor, without preliminary washing step with the combined use of the action of chaotropic agent (acid guanidinium thiocyanate), detergents (SDS, N-lauroylsarcosine), chelating agent (EDTA) and a mechanical method (bead beating system). The DNA purification was carried out by two washing steps of phenol-chloroform. RNA was isolated successfully after the second acid extraction step by recovering it from the phenolic phase of the first acid extraction. The novel method yielded pure preparation of undegraded RNA accessible for reverse transcription-PCR. The extraction protocol of genomic DNA and rRNA was applicable to complex ecosystem of different cheese matrices.
Next-generation sequencing offers new insights into DNA degradation
DEFF Research Database (Denmark)
Overballe-Petersen, Søren; Orlando, Ludovic Antoine Alexandre; Willerslev, Eske
2012-01-01
The processes underlying DNA degradation are central to various disciplines, including cancer research, forensics and archaeology. The sequencing of ancient DNA molecules on next-generation sequencing platforms provides direct measurements of cytosine deamination, depurination and fragmentation...... rates that previously were obtained only from extrapolations of results from in vitro kinetic experiments performed over short timescales. For example, recent next-generation sequencing of ancient DNA reveals purine bases as one of the main targets of postmortem hydrolytic damage, through base...... elimination and strand breakage. It also shows substantially increased rates of DNA base-loss at guanosine. In this review, we argue that the latter results from an electron resonance structure unique to guanosine rather than adenosine having an extra resonance structure over guanosine as previously suggested....
Enhanced throughput for infrared automated DNA sequencing
Middendorf, Lyle R.; Gartside, Bill O.; Humphrey, Pat G.; Roemer, Stephen C.; Sorensen, David R.; Steffens, David L.; Sutter, Scott L.
1995-04-01
Several enhancements have been developed and applied to infrared automated DNA sequencing resulting in significantly higher throughput. A 41 cm sequencing gel (31 cm well- to-read distance) combines high resolution of DNA sequencing fragments with optimized run times yielding two runs per day of 500 bases per sample. A 66 cm sequencing gel (56 cm well-to-read distance) produces sequence read lengths of up to 1000 bases for ds and ss templates using either T7 polymerase or cycle-sequencing protocols. Using a multichannel syringe to load 64 lanes allows 16 samples (compatible with 96-well format) to be visualized for each run. The 41 cm gel configuration allows 16,000 bases per day (16 samples X 500 bases/sample X 2 ten hour runs/day) to be sequenced with the advantages of infrared technology. Enhancements to internal labeling techniques using an infrared-labeled dATP molecule (Boehringer Mannheim GmbH, Penzberg, Germany; Sequenase (U.S. Biochemical) have also been made. The inclusion of glycerol in the sequencing reactions yields greatly improved results for some primer and template combinations. The inclusion of (alpha) -Thio-dNTP's in the labeling reaction increases signal intensity two- to three-fold.
Methylation patterns of repetitive DNA sequences in germ cells of Mus musculus.
Sanford, J; Forrester, L; Chapman, V; Chandley, A; Hastie, N
1984-03-26
The major and the minor satellite sequences of Mus musculus were undermethylated in both sperm and oocyte DNAs relative to the amount of undermethylation observed in adult somatic tissue DNA. This hypomethylation was specific for satellite sequences in sperm DNA. Dispersed repetitive and low copy sequences show a high degree of methylation in sperm DNA; however, a dispersed repetitive sequence was undermethylated in oocyte DNA. This finding suggests a difference in the amount of total genomic DNA methylation between sperm and oocyte DNA. The methylation levels of the minor satellite sequences did not change during spermiogenesis, and were not associated with the onset of meiosis or a specific stage in sperm development.
Wittmann-Liebold, B; Geissler, A W; Lin, A; Wool, I G
1979-01-01
The sequence of the amino-terminal region of eleven rat liver ribosomal proteins--S4, S6, S8, L6, L7a, L18, L27, L30, L37a, and L39--was determined. The analysis confirmed the homogeneity of the proteins and suggests that they are unique, since no extensive common sequences were found. The N-terminal regions of the rat liver proteins were compared with amino acid sequences in Saccharomyces cerevisiae and in Escherichia coli ribosomal proteins. It seems likely that the proteins L37 from rat liver and Y55 from yeast ribosomes are homologous. It is possible that rat liver L7a or L37a or both are related to S cerevisiae Y44, although the similar sequences are at the amino-terminus of the rat liver proteins and in an internal region of Y44. A number of similarities in the sequences of rat liver and E coli ribosomal proteins have been found; however, it is not yet possible to say whether they connote a common ancestry.
Physical mapping of 5S and 18S ribosomal DNA in three species of Agave (Asparagales, Asparagaceae
Directory of Open Access Journals (Sweden)
Victor Manuel Gomez-Rodriguez
2013-08-01
Full Text Available Agave Linnaeus, 1753 is endemic of America and is considered one of the most important crops in Mexico due to its key role in the country’s economy. Cytogenetic analysis was carried out in A. tequilana Weber, 1902 ‘Azul’, A. cupreata Trelease et Berger, 1915 and A. angustifolia Haworth, 1812. The analysis showed that in all species the diploid chromosome number was 2n = 60, with bimodal karyotypes composed of five pairs of large chromosomes and 25 pairs of small chromosomes. Furthermore, different karyotypical formulae as well as a secondary constriction in a large chromosome pair were found in all species. Fluorescent in situ hybridization (FISH was used for physical mapping of 5S and 18S ribosomal DNA (rDNA. All species analyzed showed that 5S rDNA was located in both arms of a small chromosome pair, while 18S rDNA was associated with the secondary constriction of a large chromosome pair. Data of FISH analysis provides new information about the position and number of rDNA loci and helps for detection of hybrids in breeding programs as well as evolutionary studies.
Physical mapping of 5S and 18S ribosomal DNA in three species of Agave (Asparagales, Asparagaceae).
Gomez-Rodriguez, Victor Manuel; Rodriguez-Garay, Benjamin; Palomino, Guadalupe; Martínez, Javier; Barba-Gonzalez, Rodrigo
2013-01-01
Agave Linnaeus, 1753 is endemic of America and is considered one of the most important crops in Mexico due to its key role in the country's economy. Cytogenetic analysis was carried out in Agave tequilana Weber, 1902 'Azul', Agave cupreata Trelease et Berger, 1915 and Agave angustifolia Haworth, 1812. The analysis showed that in all species the diploid chromosome number was 2n = 60, with bimodal karyotypes composed of five pairs of large chromosomes and 25 pairs of small chromosomes. Furthermore, different karyotypical formulae as well as a secondary constriction in a large chromosome pair were found in all species. Fluorescent in situ hybridization (FISH) was used for physical mapping of 5S and 18S ribosomal DNA (rDNA). All species analyzed showed that 5S rDNA was located in both arms of a small chromosome pair, while 18S rDNA was associated with the secondary constriction of a large chromosome pair. Data of FISH analysis provides new information about the position and number of rDNA loci and helps for detection of hybrids in breeding programs as well as evolutionary studies.
Krzyżanowska, Marta; Steiner, Johann; Brisch, Ralf; Mawrin, Christian; Busse, Stefan; Braun, Katharina; Jankowski, Zbigniew; Bernstein, Hans-Gert; Bogerts, Bernhard; Gos, Tomasz
2015-03-01
The central serotonergic system is implicated in the pathogenesis of schizophrenia, where the imbalance between dopamine, serotonin and glutamate plays a key pathophysiological role. The dorsal raphe nucleus (DRN) is the main source of serotonergic innervation of forebrain limbic structures disturbed in schizophrenia patients. The study was carried out on paraffin-embedded brains from 17 (8 paranoid and 9 residual) schizophrenia patients and 28 matched controls without mental disorders. The transcriptional activity of ribosomal DNA (rDNA) in DRN neurons was evaluated by the AgNOR silver-staining method. An increased rDNA transcriptional activity was found in schizophrenia patients in the cumulative analysis of all DRN subnuclei (t test, P = 0.02). Further subgroup analysis revealed that it was an effect specific for residual schizophrenia versus paranoid schizophrenia or control groups (ANOVA, P = 0.002). This effect was confounded neither by suicide nor by antipsychotic medication. Our findings suggest that increased activity of rDNA in DRN neurons is a distinct phenomenon in schizophrenia, particularly in residual patients. An activation of the rDNA transcription in DRN neurons may represent a compensatory mechanism to overcome the previously described prefrontal serotonergic hypofunction in this diagnostic subgroup.
Golczyk, Hieronim; Hasterok, Robert; Szklarczyk, Marek
2010-12-01
High- and low-stringency FISH and base-specific fluorescence were performed on the permanent translocation heterozygote Rhoeo spathacea (2n = 12). Our results indicate that 45S rDNA arrays, rDNA-related sequences and other GC-rich DNA fraction(s) are located within the pericentromeric regions of all twelve chromosomes, usually colocalizing with the chromomycin A(3)-positive bands. Homogenization of the pericentromeric regions appears to result from the concerted spread of GC-rich sequences, with differential amplification likely. We found new 5S rDNA patterns, which suggest a variability in the breakpoints and in the consequent chromosome reorganizations. It was found that the large 5S rDNA locus residing on each of the 8E and 9E arms consisted of two smaller loci. On each of the two chromosome arms 3b and 4b, in addition to the major subtelomeric 5S rDNA locus, a new minor locus was found interstitially about 40% along the arm length. The arrangement of cytotogenetic landmarks and chromosome arm measurements are discussed with regard to genome repatterning in Rhoeo.
Barionovi, D; Giorgi, S; Stoeger, A R; Ruppitsch, W; Scortichini, M
2006-05-01
The three main aims of the study were the assessment of the genetic relationship between a deviating Erwinia amylovora strain isolated from Amelanchier sp. (Maloideae) grown in Canada and other strains from Maloideae and Rosoideae, the investigation of the variability of the PstI fragment of the pEA29 plasmid using restriction fragment length polymorphism (RFLP) analysis and the determination of the number of short-sequence DNA repeats (SSR) by DNA sequence analysis in representative strains. Ninety-three strains obtained from 12 plant genera and different geographical locations were examined by repetitive-sequences PCR using Enterobacterial Repetitive Intergenic Consensus, BOX and Repetitive Extragenic Palindromic primer sets. Upon the unweighted pair group method with arithmetic mean analysis, a deviating strain from Amelanchier sp. was analysed using amplified ribosomal DNA restriction analysis (ARDRA) analysis and the sequencing of the 16S rDNA gene. This strain showed 99% similarity to other E. amylovora strains in the 16S gene and the same banding pattern with ARDRA. The RFLP analysis of pEA29 plasmid using MspI and Sau3A restriction enzymes showed a higher variability than that previously observed and no clear-cut grouping of the strains was possible. The number of SSR units reiterated two to 12 times. The strains obtained from pear orchards showing for the first time symptoms of fire blight had a low number of SSR units. The strains from Maloideae exhibit a wider genetic variability than previously thought. The RFLP analysis of a fragment of the pEA29 plasmid would not seem a reliable method for typing E. amylovora strains. A low number of SSR units was observed with first epidemics of fire blight. The current detection techniques are mainly based on the genetic similarities observed within the strains from the cultivated tree-fruit crops. For a more reliable detection of the fire blight pathogen also in wild and ornamentals Rosaceous plants the genetic
International Nuclear Information System (INIS)
Mauldin, S.K.; Getts, R.C.; Perez, M.L.; DiRienzo, S.; Stamato, T.D.
2003-01-01
Full text: We find that nuclear protein extracts from mammalian cells contain an activity that allows DNA ends to associate with circular pUC18 plasmid DNA. This activity requires the catalytic subunit of DNA-PK (DNA-PKcs) and Ku since it was not observed in mutants lacking Ku or DNA-PKcs but was observed when purified Ku/DNA-PKcs was added to these mutant extracts. Competition experiments between pUC18 and pUC18 plasmids containing various nuclear matrix attachment region (MAR) sequences suggest that DNA ends preferentially associate with plasmids containing MAR DNA sequences. At a 1:5 mass ratio of MAR to pUC18, approximately equal amounts of DNA end binding to the two plasmids were observed, while at a 1:1 ratio no pUC18 end-binding was observed. Calculation of relative binding activities indicates that DNA-end binding activities to MAR sequences was 7 to 21 fold higher than pUC18. Western analysis of proteins bound to pUC18 and MAR plasmids indicates that XRCC4, DNA ligase IV, scaffold attachment factor A, topoisomerase II, and poly(ADP-ribose) polymerase preferentially associate with the MAR plasmid in the absence or presence of DNA ends. In contrast, Ku and DNA-PKcs were found on the MAR plasmid only in the presence of DNA ends. After electroporation of a 32P-labeled DNA probe into human cells and cell fractionation, 87% of the total intercellular radioactivity remained in nuclei after a 0.5M NaCl extraction suggesting the probe was strongly bound in the nucleus. The above observations raise the possibility that DNA-PK targets DNA-ends to a repair and/or DNA damage signaling complex which is assembled on MAR sites in the nucleus
Potential of DNA sequences to identify zoanthids (Cnidaria: Zoantharia).
Sinniger, Frederic; Reimer, James D; Pawlowski, Jan
2008-12-01
The order Zoantharia is known for its chaotic taxonomy and difficult morphological identification. One method that potentially could help for examining such troublesome taxa is DNA barcoding, which identifies species using standard molecular markers. The mitochondrial cytochrome oxidase subunit I (COI) has been utilized to great success in groups such as birds and insects; however, its applicability in many other groups is controversial. Recently, some studies have suggested that barcoding is not applicable to anthozoans. Here, we examine the use of COI and mitochondrial 16S ribosomal DNA for zoanthid identification. Despite the absence of a clear barcoding gap, our results show that for most of 54 zoanthid samples, both markers could separate samples to the species, or species group, level, particularly when easily accessible ecological or distributional data were included. Additionally, we have used the short V5 region of mt 16S rDNA to identify eight old (13 to 50 years old) museum samples. We discuss advantages and disadvantages of COI and mt 16S rDNA as barcodes for Zoantharia, and recommend that either one or both of these markers be considered for zoanthid identification in the future.
Huh, Iksoo; Wu, Xin; Park, Taesung; Yi, Soojin V
2017-07-21
DNA methylation is one of the most extensively studied epigenetic modifications of genomic DNA. In recent years, sequencing of bisulfite-converted DNA, particularly via next-generation sequencing technologies, has become a widely popular method to study DNA methylation. This method can be readily applied to a variety of species, dramatically expanding the scope of DNA methylation studies beyond the traditionally studied human and mouse systems. In parallel to the increasing wealth of genomic methylation profiles, many statistical tools have been developed to detect differentially methylated loci (DMLs) or differentially methylated regions (DMRs) between biological conditions. We discuss and summarize several key properties of currently available tools to detect DMLs and DMRs from sequencing of bisulfite-converted DNA. However, the majority of the statistical tools developed for DML/DMR analyses have been validated using only mammalian data sets, and less priority has been placed on the analyses of invertebrate or plant DNA methylation data. We demonstrate that genomic methylation profiles of non-mammalian species are often highly distinct from those of mammalian species using examples of honey bees and humans. We then discuss how such differences in data properties may affect statistical analyses. Based on these differences, we provide three specific recommendations to improve the power and accuracy of DML and DMR analyses of invertebrate data when using currently available statistical tools. These considerations should facilitate systematic and robust analyses of DNA methylation from diverse species, thus advancing our understanding of DNA methylation. © The Author 2017. Published by Oxford University Press.
Next Generation DNA Sequencing and the Future of Genomic Medicine
Anderson, Matthew W.; Schrijver, Iris
2010-01-01
In the years since the first complete human genome sequence was reported, there has been a rapid development of technologies to facilitate high-throughput sequence analysis of DNA (termed “next-generation” sequencing). These novel approaches to DNA sequencing offer the promise of complete genomic analysis at a cost feasible for routine clinical diagnostics. However, the ability to more thoroughly interrogate genomic sequence raises a number of important issues with regard to result interpreta...
Coghlan, Megan L.; Haile, James; Houston, Jayne; Murray, Dáithí C.; White, Nicole E.; Moolhuijzen, Paula; Bellgard, Matthew I.; Bunce, Michael
2012-01-01
Traditional Chinese medicine (TCM) has been practiced for thousands of years, but only within the last few decades has its use become more widespread outside of Asia. Concerns continue to be raised about the efficacy, legality, and safety of many popular complementary alternative medicines, including TCMs. Ingredients of some TCMs are known to include derivatives of endangered, trade-restricted species of plants and animals, and therefore contravene the Convention on International Trade in Endangered Species (CITES) legislation. Chromatographic studies have detected the presence of heavy metals and plant toxins within some TCMs, and there are numerous cases of adverse reactions. It is in the interests of both biodiversity conservation and public safety that techniques are developed to screen medicinals like TCMs. Targeting both the p-loop region of the plastid trnL gene and the mitochondrial 16S ribosomal RNA gene, over 49,000 amplicon sequence reads were generated from 15 TCM samples presented in the form of powders, tablets, capsules, bile flakes, and herbal teas. Here we show that second-generation, high-throughput sequencing (HTS) of DNA represents an effective means to genetically audit organic ingredients within complex TCMs. Comparison of DNA sequence data to reference databases revealed the presence of 68 different plant families and included genera, such as Ephedra and Asarum, that are potentially toxic. Similarly, animal families were identified that include genera that are classified as vulnerable, endangered, or critically endangered, including Asiatic black bear (Ursus thibetanus) and Saiga antelope (Saiga tatarica). Bovidae, Cervidae, and Bufonidae DNA were also detected in many of the TCM samples and were rarely declared on the product packaging. This study demonstrates that deep sequencing via HTS is an efficient and cost-effective way to audit highly processed TCM products and will assist in monitoring their legality and safety especially when
Liu, Bin; Liu, Fule; Fang, Longyun; Wang, Xiaolong; Chou, Kuo-Chen
2015-04-15
In order to develop powerful computational predictors for identifying the biological features or attributes of DNAs, one of the most challenging problems is to find a suitable approach to effectively represent the DNA sequences. To facilitate the studies of DNAs and nucleotides, we developed a Python package called representations of DNAs (repDNA) for generating the widely used features reflecting the physicochemical properties and sequence-order effects of DNAs and nucleotides. There are three feature groups composed of 15 features. The first group calculates three nucleic acid composition features describing the local sequence information by means of kmers; the second group calculates six autocorrelation features describing the level of correlation between two oligonucleotides along a DNA sequence in terms of their specific physicochemical properties; the third group calculates six pseudo nucleotide composition features, which can be used to represent a DNA sequence with a discrete model or vector yet still keep considerable sequence-order information via the physicochemical properties of its constituent oligonucleotides. In addition, these features can be easily calculated based on both the built-in and user-defined properties via using repDNA. The repDNA Python package is freely accessible to the public at http://bioinformatics.hitsz.edu.cn/repDNA/. bliu@insun.hit.edu.cn or kcchou@gordonlifescience.org Supplementary data are available at Bioinformatics online. © The Author 2014. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.
Next Generation Sequencing of Ancient DNA: Requirements, Strategies and Perspectives
Directory of Open Access Journals (Sweden)
Michael Knapp
2010-07-01
Full Text Available The invention of next-generation-sequencing has revolutionized almost all fields of genetics, but few have profited from it as much as the field of ancient DNA research. From its beginnings as an interesting but rather marginal discipline, ancient DNA research is now on its way into the centre of evolutionary biology. In less than a year from its invention next-generation-sequencing had increased the amount of DNA sequence data available from extinct organisms by several orders of magnitude. Ancient DNA research is now not only adding a temporal aspect to evolutionary studies and allowing for the observation of evolution in real time, it also provides important data to help understand the origins of our own species. Here we review progress that has been made in next-generation-sequencing of ancient DNA over the past five years and evaluate sequencing strategies and future directions.
Lestari, D.; Bustamam, A.; Novianti, T.; Ardaneswari, G.
2017-07-01
DNA sequence can be defined as a succession of letters, representing the order of nucleotides within DNA, using a permutation of four DNA base codes including adenine (A), guanine (G), cytosine (C), and thymine (T). The precise code of the sequences is determined using DNA sequencing methods and technologies, which have been developed since the 1970s and currently become highly developed, advanced and highly throughput sequencing technologies. So far, DNA sequencing has greatly accelerated biological and medical research and discovery. However, in some cases DNA sequencing could produce any ambiguous and not clear enough sequencing results that make them quite difficult to be determined whether these codes are A, T, G, or C. To solve these problems, in this study we can introduce other representation of DNA codes namely Quaternion Q = (PA, PT, PG, PC), where PA, PT, PG, PC are the probability of A, T, G, C bases that could appear in Q and PA + PT + PG + PC = 1. Furthermore, using Quaternion representations we are able to construct the improved scoring matrix for global sequence alignment processes, by applying a dot product method. Moreover, this scoring matrix produces better and higher quality of the match and mismatch score between two DNA base codes. In implementation, we applied the Needleman-Wunsch global sequence alignment algorithm using Octave, to analyze our target sequence which contains some ambiguous sequence data. The subject sequences are the DNA sequences of Streptococcus pneumoniae families obtained from the Genebank, meanwhile the target DNA sequence are received from our collaborator database. As the results we found the Quaternion representations improve the quality of the sequence alignment score and we can conclude that DNA sequence target has maximum similarity with Streptococcus pneumoniae.
DNA watermarks in non-coding regulatory sequences
Directory of Open Access Journals (Sweden)
Pyka Martin
2009-07-01
Full Text Available Abstract Background DNA watermarks can be applied to identify the unauthorized use of genetically modified organisms. It has been shown that coding regions can be used to encrypt information into living organisms by using the DNA-Crypt algorithm. Yet, if the sequence of interest presents a non-coding DNA sequence, either the function of a resulting functional RNA molecule or a regulatory sequence, such as a promoter, could be affected. For our studies we used the small cytoplasmic RNA 1 in yeast and the lac promoter region of Escherichia coli. Findings The lac promoter was deactivated by the integrated watermark. In addition, the RNA molecules displayed altered configurations after introducing a watermark, but surprisingly were functionally intact, which has been verified by analyzing the growth characteristics of both wild type and watermarked scR1 transformed yeast cells. In a third approach we introduced a second overlapping watermark into the lac promoter, which did not affect the promoter activity. Conclusion Even though the watermarked RNA and one of the watermarked promoters did not show any significant differences compared to the wild type RNA and wild type promoter region, respectively, it cannot be generalized that other RNA molecules or regulatory sequences behave accordingly. Therefore, we do not recommend integrating watermark sequences into regulatory regions.
Tsuji, K; Tsien, H C; Hanson, R S; DePalma, S R; Scholtz, R; LaRoche, S
1990-01-01
16S ribosomal RNAs (rRNA) of 12 methylotrophic bacteria have been almost completely sequenced to establish their phylogenetic relationships. Methylotrophs that are physiologically related are phylogenetically diverse and are scattered among the purple eubacteria (class Proteobacteria). Group I methylotrophs can be classified in the beta- and the gamma-subdivisions and group II methylotrophs in the alpha-subdivision of the purple eubacteria, respectively. Pink-pigmented facultative and non-pigmented obligate group II methylotrophs form two distinctly separate branches within the alpha-subdivision. The secondary structures of the 16S rRNA sequences of 'Methylocystis parvus' strain OBBP, 'Methylosinus trichosporium' strain OB3b, 'Methylosporovibrio methanica' strain 81Z and Hyphomicrobium sp. strain DM2 are similar, and these non-pigmented obligate group II methylotrophs form one tight cluster in the alpha-subdivision. The pink-pigmented facultative methylotrophs, Methylobacterium extorquens strain AM1, Methylobacterium sp. strain DM4 and Methylobacterium organophilum strain XX form another cluster within the alpha-subdivision. Although similar in phenotypic characteristics, Methylobacterium organophilum strain XX and Methylobacterium extorquens strain AM1 are clearly distinguishable by their 16S rRNA sequences. The group I methylotrophs, Methylophilus methylotrophus strain AS1 and methylotrophic species DM11, which do not utilize methane, are similar in 16S rRNA sequence to bacteria in the beta-subdivision. The methane-utilizing, obligate group I methanotrophs, Methylococcus capsulatus strain BATH and Methylomonas methanica, are placed in the gamma-subdivision. The results demonstrate that it is possible to distinguish and classify the methylotrophic bacteria using 16S rRNA sequence analysis.
Mitochondrial DNA sequence evolution in shorebird populations
Wenink, P.W.
1994-01-01
This thesis describes the global molecular population structure of two shorebird species, in particular of the dunlin, Calidris alpina, by means of comparative sequence analysis of the most variable part of the mitochondrial DNA (mtDNA) genome. There are several reasons
Anaplasma phagocytophilum in Danish sheep: confirmation by DNA sequencing
Directory of Open Access Journals (Sweden)
Thamsborg Stig M
2009-12-01
Full Text Available Abstract Background The presence of Anaplasma phagocytophilum, an Ixodes ricinus transmitted bacterium, was investigated in two flocks of Danish grazing lambs. Direct PCR detection was performed on DNA extracted from blood and serum with subsequent confirmation by DNA sequencing. Methods 31 samples obtained from clinically normal lambs in 2000 from Fussingø, Jutland and 12 samples from ten lambs and two ewes from a clinical outbreak at Feddet, Zealand in 2006 were included in the study. Some of the animals from Feddet had shown clinical signs of polyarthritis and general unthriftiness prior to sampling. DNA extraction was optimized from blood and serum and detection achieved by a 16S rRNA targeted PCR with verification of the product by DNA sequencing. Results Five DNA extracts were found positive by PCR, including two samples from 2000 and three from 2006. For both series of samples the product was verified as A. phagocytophilum by DNA sequencing. Conclusions A. phagocytophilum was detected by molecular methods for the first time in Danish grazing lambs during the two seasons investigated (2000 and 2006.
Isolation of a sex-linked DNA sequence in cranes.
Duan, W; Fuerst, P A
2001-01-01
A female-specific DNA fragment (CSL-W; crane sex-linked DNA on W chromosome) was cloned from female whooping cranes (Grus americana). From the nucleotide sequence of CSL-W, a set of polymerase chain reaction (PCR) primers was identified which amplify a 227-230 bp female-specific fragment from all existing crane species and some other noncrane species. A duplicated versions of the DNA segment, which is found to have a larger size (231-235 bp) than CSL-W in both sexes, was also identified, and was designated CSL-NW (crane sex-linked DNA on non-W chromosome). The nucleotide similarity between the sequences of CSL-W and CSL-NW from whooping cranes was 86.3%. The CSL primers do not amplify any sequence from mammalian DNA, limiting the potential for contamination from human sources. Using the CSL primers in combination with a quick DNA extraction method allows the noninvasive identification of crane gender in less than 10 h. A test of the methodology was carried out on fully developed body feathers from 18 captive cranes and resulted in 100% successful identification.
DEFF Research Database (Denmark)
Stadler, M.; Fournier, J.; Læssøe, Thomas
2008-01-01
pallidum is thus regarded as a later synonym of E. mesentericum. Therefore, the latter name is transferred to Xylaria. A key to entonaemoid Xylariaceae is provided. Colour reactions (NH3, KOH) of the ectostroma were applied to a limited number of Xylaria spp., but metabolite profiles of cultures appear......The genus Entonaema comprises Xylariaceae with hollow, gelatinous stromata that accumulate liquid. Some of its species, including the type species, appear related to Daldinia from a polyphasic approach, comprising morphological studies, comparisons of ribosomal DNA sequences, and high performance...
Directory of Open Access Journals (Sweden)
Maria Dolores Bargues
2012-02-01
Full Text Available Freshwater lymnaeid snails are crucial in defining transmission and epidemiology of fascioliasis. In South America, human endemic areas are related to high altitudes in Andean regions. The species Lymnaea diaphana has, however, been involved in low altitude areas of Chile, Argentina and Peru where human infection also occurs. Complete nuclear ribosomal DNA 18S, internal transcribed spacer (ITS-2 and ITS-1 and fragments of mitochondrial DNA 16S and cytochrome c oxidase (cox1 genes of L. diaphana specimens from its type locality offered 1,848, 495, 520, 424 and 672 bp long sequences. Comparisons with New and Old World Galba/Fossaria, Palaearctic stagnicolines, Nearctic stagnicolines, Old World Radix and Pseudosuccinea allowed to conclude that (i L. diaphana shows sequences very different from all other lymnaeids, (ii each marker allows its differentiation, except cox1 amino acid sequence, and (iii L. diaphana is not a fossarine lymnaeid, but rather an archaic relict form derived from the oldest North American stagnicoline ancestors. Phylogeny and large genetic distances support the genus Pectinidens as the first stagnicoline representative in the southern hemisphere, including colonization of extreme world regions, as most southern Patagonia, long time ago. The phylogenetic link of L. diaphana with the stagnicoline group may give light to the aforementioned peculiar low altitude epidemiological scenario of fascioliasis.
Spreadsheet-based program for alignment of overlapping DNA sequences.
Anbazhagan, R; Gabrielson, E
1999-06-01
Molecular biology laboratories frequently face the challenge of aligning small overlapping DNA sequences derived from a long DNA segment. Here, we present a short program that can be used to adapt Excel spreadsheets as a tool for aligning DNA sequences, regardless of their orientation. The program runs on any Windows or Macintosh operating system computer with Excel 97 or Excel 98. The program is available for use as an Excel file, which can be downloaded from the BioTechniques Web site. Upon execution, the program opens a specially designed customized workbook and is capable of identifying overlapping regions between two sequence fragments and displaying the sequence alignment. It also performs a number of specialized functions such as recognition of restriction enzyme cutting sites and CpG island mapping without costly specialized software.
Methylation patterns of repetitive DNA sequences in germ cells of Mus musculus.
Sanford, J; Forrester, L; Chapman, V; Chandley, A; Hastie, N
1984-01-01
The major and the minor satellite sequences of Mus musculus were undermethylated in both sperm and oocyte DNAs relative to the amount of undermethylation observed in adult somatic tissue DNA. This hypomethylation was specific for satellite sequences in sperm DNA. Dispersed repetitive and low copy sequences show a high degree of methylation in sperm DNA; however, a dispersed repetitive sequence was undermethylated in oocyte DNA. This finding suggests a difference in the amount of total genomic...
Caramelli, David; Milani, Lucio; Vai, Stefania; Modi, Alessandra; Pecchioli, Elena; Girardi, Matteo; Pilli, Elena; Lari, Martina; Lippi, Barbara; Ronchitelli, Annamaria; Mallegni, Francesco; Casoli, Antonella; Bertorelle, Giorgio; Barbujani, Guido
2008-01-01
Background DNA sequences from ancient speciments may in fact result from undetected contamination of the ancient specimens by modern DNA, and the problem is particularly challenging in studies of human fossils. Doubts on the authenticity of the available sequences have so far hampered genetic comparisons between anatomically archaic (Neandertal) and early modern (Cro-Magnoid) Europeans. Methodology/Principal Findings We typed the mitochondrial DNA (mtDNA) hypervariable region I in a 28,000 years old Cro-Magnoid individual from the Paglicci cave, in Italy (Paglicci 23) and in all the people who had contact with the sample since its discovery in 2003. The Paglicci 23 sequence, determined through the analysis of 152 clones, is the Cambridge reference sequence, and cannot possibly reflect contamination because it differs from all potentially contaminating modern sequences. Conclusions/Significance: The Paglicci 23 individual carried a mtDNA sequence that is still common in Europe, and which radically differs from those of the almost contemporary Neandertals, demonstrating a genealogical continuity across 28,000 years, from Cro-Magnoid to modern Europeans. Because all potential sources of modern DNA contamination are known, the Paglicci 23 sample will offer a unique opportunity to get insight for the first time into the nuclear genes of early modern Europeans. PMID:18628960
Directory of Open Access Journals (Sweden)
David Caramelli
Full Text Available BACKGROUND: DNA sequences from ancient specimens may in fact result from undetected contamination of the ancient specimens by modern DNA, and the problem is particularly challenging in studies of human fossils. Doubts on the authenticity of the available sequences have so far hampered genetic comparisons between anatomically archaic (Neandertal and early modern (Cro-Magnoid Europeans. METHODOLOGY/PRINCIPAL FINDINGS: We typed the mitochondrial DNA (mtDNA hypervariable region I in a 28,000 years old Cro-Magnoid individual from the Paglicci cave, in Italy (Paglicci 23 and in all the people who had contact with the sample since its discovery in 2003. The Paglicci 23 sequence, determined through the analysis of 152 clones, is the Cambridge reference sequence, and cannot possibly reflect contamination because it differs from all potentially contaminating modern sequences. CONCLUSIONS/SIGNIFICANCE: The Paglicci 23 individual carried a mtDNA sequence that is still common in Europe, and which radically differs from those of the almost contemporary Neandertals, demonstrating a genealogical continuity across 28,000 years, from Cro-Magnoid to modern Europeans. Because all potential sources of modern DNA contamination are known, the Paglicci 23 sample will offer a unique opportunity to get insight for the first time into the nuclear genes of early modern Europeans.
Variation in Ribosomal DNA among Isolates of the Mycorrhizal Fungus Cenococcum Geophilum FR.
Lobuglio, Katherine Frances
1990-01-01
Cenococcum geophilum Fr., a cosmopolitan mycorrhizal fungus, is well-known for its extremely wide host and habitat range. The ecological diversity of C. geophilum sharply contrasts its present taxonomic status as a monotypic form -genus. Restriction fragment length polymorphisms (RFLPs) in nuclear ribosomal DNA (rDNA) was used to assess the degree of genetic variation among 72 isolates of C. geophilum. The probe used in this study was the rDNA repeat cloned from C. geophilum isolate A145 (pCG15). Length of the rDNA repeat was approximately 9 kb. The rDNA clone was mapped for 5 restriction endonucleases. Hybridization with cloned Saccharomyces cerevisiae rDNA (pSR118, and pSR125 containing the 18S, and 5.8-25S rRNA genes respectively), and alignment of restriction endonuclease sites conserved in the rDNA genes of other fungi, were used to position the corresponding rDNAs of C. geophilum. Southern hybridizations with EcoRI, HindIII, XhoI, and PstI digested DNAs indicated extensive variation among the C. geophilum isolates, greater than has been previously reported to occur within a fungal species. Most of the rDNA polymorphisms occurred in the IGS region. Restriction endonuclease site and length polymorphisms were also observed in the 5.8S-26S genic regions. Sixteen size categories of length mutations, 6 restriction endonuclease site additions, and 4 restriction endonuclease site deletions were determined using isolate A145 as a reference. The rDNA repeat length among the isolates varied from approximately 8.5 to 10.2 kb. RFLPs were also observed in the mitochondrial (mt) 24S rRNA gene and flanking regions of HindIII digested DNAs of C. geophilum isolates representing both geographically distinct and similar origins. Among the C. geophilum isolates analyzed there were fewer RFLPs in mt-DNA than in nuclear rDNA. EcoRI rDNA phenotypes between C. geophilum and Elaphomyces anthracinus, its proposed teleomorph or sexual state, did not correspond. In addition, the four
Toward a Better Compression for DNA Sequences Using Huffman Encoding.
Al-Okaily, Anas; Almarri, Badar; Al Yami, Sultan; Huang, Chun-Hsi
2017-04-01
Due to the significant amount of DNA data that are being generated by next-generation sequencing machines for genomes of lengths ranging from megabases to gigabases, there is an increasing need to compress such data to a less space and a faster transmission. Different implementations of Huffman encoding incorporating the characteristics of DNA sequences prove to better compress DNA data. These implementations center on the concepts of selecting frequent repeats so as to force a skewed Huffman tree, as well as the construction of multiple Huffman trees when encoding. The implementations demonstrate improvements on the compression ratios for five genomes with lengths ranging from 5 to 50 Mbp, compared with the standard Huffman tree algorithm. The research hence suggests an improvement on all such DNA sequence compression algorithms that use the conventional Huffman encoding. The research suggests an improvement on all DNA sequence compression algorithms that use the conventional Huffman encoding. Accompanying software is publicly available (AL-Okaily, 2016 ).
Mouse tetranectin: cDNA sequence, tissue-specific expression, and chromosomal mapping
DEFF Research Database (Denmark)
Ibaraki, K; Kozak, C A; Wewer, U M
1995-01-01
regulation, mouse tetranectin cDNA was cloned from a 16-day-old mouse embryo library. Sequence analysis revealed a 992-bp cDNA with an open reading frame of 606 bp, which is identical in length to the human tetranectin cDNA. The deduced amino acid sequence showed high homology to the human cDNA with 76......(s) of tetranectin. The sequence analysis revealed a difference in both sequence and size of the noncoding regions between mouse and human cDNAs. Northern analysis of the various tissues from mouse, rat, and cow showed the major transcript(s) to be approximately 1 kb, which is similar in size to that observed...
Directory of Open Access Journals (Sweden)
Zdepski Anna
2011-05-01
Full Text Available Abstract Background High throughput sequencing (HTS technologies have revolutionized the field of genomics by drastically reducing the cost of sequencing, making it feasible for individual labs to sequence or resequence plant genomes. Obtaining high quality, high molecular weight DNA from plants poses significant challenges due to the high copy number of chloroplast and mitochondrial DNA, as well as high levels of phenolic compounds and polysaccharides. Multiple methods have been used to isolate DNA from plants; the CTAB method is commonly used to isolate total cellular DNA from plants that contain nuclear DNA, as well as chloroplast and mitochondrial DNA. Alternatively, DNA can be isolated from nuclei to minimize chloroplast and mitochondrial DNA contamination. Results We describe optimized protocols for isolation of nuclear DNA from eight different plant species encompassing both monocot and eudicot species. These protocols use nuclei isolation to minimize chloroplast and mitochondrial DNA contamination. We also developed a protocol to determine the number of chloroplast and mitochondrial DNA copies relative to the nuclear DNA using quantitative real time PCR (qPCR. We compared DNA isolated from nuclei to total cellular DNA isolated with the CTAB method. As expected, DNA isolated from nuclei consistently yielded nuclear DNA with fewer chloroplast and mitochondrial DNA copies, as compared to the total cellular DNA prepared with the CTAB method. This protocol will allow for analysis of the quality and quantity of nuclear DNA before starting a plant whole genome sequencing or resequencing experiment. Conclusions Extracting high quality, high molecular weight nuclear DNA in plants has the potential to be a bottleneck in the era of whole genome sequencing and resequencing. The methods that are described here provide a framework for researchers to extract and quantify nuclear DNA in multiple types of plants.
Statistical assignment of DNA sequences using Bayesian phylogenetics
DEFF Research Database (Denmark)
Terkelsen, Kasper Munch; Boomsma, Wouter Krogh; Huelsenbeck, John P.
2008-01-01
We provide a new automated statistical method for DNA barcoding based on a Bayesian phylogenetic analysis. The method is based on automated database sequence retrieval, alignment, and phylogenetic analysis using a custom-built program for Bayesian phylogenetic analysis. We show on real data...... that the method outperforms Blast searches as a measure of confidence and can help eliminate 80% of all false assignment based on best Blast hit. However, the most important advance of the method is that it provides statistically meaningful measures of confidence. We apply the method to a re......-analysis of previously published ancient DNA data and show that, with high statistical confidence, most of the published sequences are in fact of Neanderthal origin. However, there are several cases of chimeric sequences that are comprised of a combination of both Neanderthal and modern human DNA....
Efficiency of ITS Sequences for DNA Barcoding in Passiflora (Passifloraceae
Directory of Open Access Journals (Sweden)
Giovanna Câmara Giudicelli
2015-04-01
Full Text Available DNA barcoding is a technique for discriminating and identifying species using short, variable, and standardized DNA regions. Here, we tested for the first time the performance of plastid and nuclear regions as DNA barcodes in Passiflora. This genus is a largely variable, with more than 900 species of high ecological, commercial, and ornamental importance. We analyzed 1034 accessions of 222 species representing the four subgenera of Passiflora and evaluated the effectiveness of five plastid regions and three nuclear datasets currently employed as DNA barcodes in plants using barcoding gap, applied similarity-, and tree-based methods. The plastid regions were able to identify less than 45% of species, whereas the nuclear datasets were efficient for more than 50% using “best match” and “best close match” methods of TaxonDNA software. All subgenera presented higher interspecific pairwise distances and did not fully overlap with the intraspecific distance, and similarity-based methods showed better results than tree-based methods. The nuclear ribosomal internal transcribed spacer 1 (ITS1 region presented a higher discrimination power than the other datasets and also showed other desirable characteristics as a DNA barcode for this genus. Therefore, we suggest that this region should be used as a starting point to identify Passiflora species.
Sequence of a cDNA encoding turtle high mobility group 1 protein.
Zheng, Jifang; Hu, Bi; Wu, Duansheng
2005-07-01
In order to understand sequence information about turtle HMG1 gene, a cDNA encoding HMG1 protein of the Chinese soft-shell turtle (Pelodiscus sinensis) was amplified by RT-PCR from kidney total RNA, and was cloned, sequenced and analyzed. The results revealed that the open reading frame (ORF) of turtle HMG1 cDNA is 606 bp long. The ORF codifies 202 amino acid residues, from which two DNA-binding domains and one polyacidic region are derived. The DNA-binding domains share higher amino acid identity with homologues sequences of chicken (96.5%) and mammalian (74%) than homologues sequence of rainbow trout (67%). The polyacidic region shows 84.6% amino acid homology with the equivalent region of chicken HMG1 cDNA. Turtle HMG1 protein contains 3 Cys residues located at completely conserved positions. Conservation in sequence and structure suggests that the functions of turtle HMG1 cDNA may be highly conserved during evolution. To our knowledge, this is the first report of HMG1 cDNA sequence in any reptilian.
Dialects of the DNA Uptake Sequence in Neisseriaceae
Frye, Stephan A.; Nilsen, Mariann; Tønjum, Tone; Ambur, Ole Herman
2013-01-01
In all sexual organisms, adaptations exist that secure the safe reassortment of homologous alleles and prevent the intrusion of potentially hazardous alien DNA. Some bacteria engage in a simple form of sex known as transformation. In the human pathogen Neisseria meningitidis and in related bacterial species, transformation by exogenous DNA is regulated by the presence of a specific DNA Uptake Sequence (DUS), which is present in thousands of copies in the respective genomes. DUS affects transformation by limiting DNA uptake and recombination in favour of homologous DNA. The specific mechanisms of DUS–dependent genetic transformation have remained elusive. Bioinformatic analyses of family Neisseriaceae genomes reveal eight distinct variants of DUS. These variants are here termed DUS dialects, and their effect on interspecies commutation is demonstrated. Each of the DUS dialects is remarkably conserved within each species and is distributed consistent with a robust Neisseriaceae phylogeny based on core genome sequences. The impact of individual single nucleotide transversions in DUS on meningococcal transformation and on DNA binding and uptake is analysed. The results show that a DUS core 5′-CTG-3′ is required for transformation and that transversions in this core reduce DNA uptake more than two orders of magnitude although the level of DNA binding remains less affected. Distinct DUS dialects are efficient barriers to interspecies recombination in N. meningitidis, N. elongata, Kingella denitrificans, and Eikenella corrodens, despite the presence of the core sequence. The degree of similarity between the DUS dialect of the recipient species and the donor DNA directly correlates with the level of transformation and DNA binding and uptake. Finally, DUS–dependent transformation is documented in the genera Eikenella and Kingella for the first time. The results presented here advance our understanding of the function and evolution of DUS and genetic transformation
Dialects of the DNA uptake sequence in Neisseriaceae.
Directory of Open Access Journals (Sweden)
Stephan A Frye
2013-04-01
Full Text Available In all sexual organisms, adaptations exist that secure the safe reassortment of homologous alleles and prevent the intrusion of potentially hazardous alien DNA. Some bacteria engage in a simple form of sex known as transformation. In the human pathogen Neisseria meningitidis and in related bacterial species, transformation by exogenous DNA is regulated by the presence of a specific DNA Uptake Sequence (DUS, which is present in thousands of copies in the respective genomes. DUS affects transformation by limiting DNA uptake and recombination in favour of homologous DNA. The specific mechanisms of DUS-dependent genetic transformation have remained elusive. Bioinformatic analyses of family Neisseriaceae genomes reveal eight distinct variants of DUS. These variants are here termed DUS dialects, and their effect on interspecies commutation is demonstrated. Each of the DUS dialects is remarkably conserved within each species and is distributed consistent with a robust Neisseriaceae phylogeny based on core genome sequences. The impact of individual single nucleotide transversions in DUS on meningococcal transformation and on DNA binding and uptake is analysed. The results show that a DUS core 5'-CTG-3' is required for transformation and that transversions in this core reduce DNA uptake more than two orders of magnitude although the level of DNA binding remains less affected. Distinct DUS dialects are efficient barriers to interspecies recombination in N. meningitidis, N. elongata, Kingella denitrificans, and Eikenella corrodens, despite the presence of the core sequence. The degree of similarity between the DUS dialect of the recipient species and the donor DNA directly correlates with the level of transformation and DNA binding and uptake. Finally, DUS-dependent transformation is documented in the genera Eikenella and Kingella for the first time. The results presented here advance our understanding of the function and evolution of DUS and genetic
Cloning, sequencing, and expression of cDNA for human β-glucuronidase
International Nuclear Information System (INIS)
Oshima, A.; Kyle, J.W.; Miller, R.D.
1987-01-01
The authors report here the cDNA sequence for human placental β-glucuronidase (β-D-glucuronoside glucuronosohydrolase, EC 3.2.1.31) and demonstrate expression of the human enzyme in transfected COS cells. They also sequenced a partial cDNA clone from human fibroblasts that contained a 153-base-pair deletion within the coding sequence and found a second type of cDNA clone from placenta that contained the same deletion. Nuclease S1 mapping studies demonstrated two types of mRNAs in human placenta that corresponded to the two types of cDNA clones isolated. The NH 2 -terminal amino acid sequence determined for human spleen β-glucuronidase agreed with that inferred from the DNA sequence of the two placental clones, beginning at amino acid 23, suggesting a cleaved signal sequence of 22 amino acids. When transfected into COS cells, plasmids containing either placental clone expressed an immunoprecipitable protein that contained N-linked oligosaccharides as evidenced by sensitivity to endoglycosidase F. However, only transfection with the clone containing the 153-base-pair segment led to expression of human β-glucuronidase activity. These studies provide the sequence for the full-length cDNA for human β-glucuronidase, demonstrate the existence of two populations of mRNA for β-glucuronidase in human placenta, only one of which specifies a catalytically active enzyme, and illustrate the importance of expression studies in verifying that a cDNA is functionally full-length
Directory of Open Access Journals (Sweden)
Iole Di Capua
Full Text Available Copepods belonging to the Oncaeidae family are commonly and abundantly found in marine zooplankton. In the Mediterranean Sea, forty-seven oncaeid species occur, of which eleven in the Gulf of Naples. In this Gulf, several Oncaea species were morphologically analysed and described at the end of the XIX century by W. Giesbrecht. In the same area, oncaeids are being investigated over seasonal and inter-annual scales at the long-term coastal station LTER-MC. In the present work, we identified six oncaeid species using the nuclear ribosomal internal transcribed spacers (ITS rDNA and the mitochondrial cytochrome c oxidase subunit I (mtCOI. Phylogenetic analyses based on these two genomic regions validated the sisterhood of the genera Triconia and the Oncaea sensu stricto. ITS1 and ITS2 phylogenies produced incongruent results about the position of Oncaea curta, calling for further investigations on this species. We also characterised the ITS2 region by secondary structure predictions and found that all the sequences analysed presented the distinct eukaryotic hallmarks. A Compensatory Base Change search corroborated the close relationship between O. venusta and O. curta and between O. media and O. venusta already identified by ITS phylogenies. The present results, which stem from the integration of molecular and morphological taxonomy, represent an encouraging step towards an improved knowledge of copepod biodiversity: The two complementary approaches, when applied to long-term copepod monitoring, will also help to better understanding their genetic variations and ecological niches of co-occurring species.
Recurrence time statistics: versatile tools for genomic DNA sequence analysis.
Cao, Yinhe; Tung, Wen-Wen; Gao, J B
2004-01-01
With the completion of the human and a few model organisms' genomes, and the genomes of many other organisms waiting to be sequenced, it has become increasingly important to develop faster computational tools which are capable of easily identifying the structures and extracting features from DNA sequences. One of the more important structures in a DNA sequence is repeat-related. Often they have to be masked before protein coding regions along a DNA sequence are to be identified or redundant expressed sequence tags (ESTs) are to be sequenced. Here we report a novel recurrence time based method for sequence analysis. The method can conveniently study all kinds of periodicity and exhaustively find all repeat-related features from a genomic DNA sequence. An efficient codon index is also derived from the recurrence time statistics, which has the salient features of being largely species-independent and working well on very short sequences. Efficient codon indices are key elements of successful gene finding algorithms, and are particularly useful for determining whether a suspected EST belongs to a coding or non-coding region. We illustrate the power of the method by studying the genomes of E. coli, the yeast S. cervisivae, the nematode worm C. elegans, and the human, Homo sapiens. Computationally, our method is very efficient. It allows us to carry out analysis of genomes on the whole genomic scale by a PC.
DEFF Research Database (Denmark)
Englund, Marcus; Pornpongrungrueng, Pimwadee; Gustafsson, Mats
2009-01-01
Phylogenetic relationships in Inuleae subtribe Inulinae (Asteraceae) were investigated. DNA sequence data from three chloroplast regions (ndhF, trnL-F and psbA-trnH) and the nuclear ribosomal internal transcribed spacer (ITS) region were analysed separately and in combination using parsimony...... and Bayesian inference. A total of 163 ingroup taxa were included, of which 60 were sampled for all four markers. Conflicts between chloroplast and nuclear data were assessed using partitioned Bremer support (PBS). Rather than averaging PBS over several trees from constrained searches, individual trees were...... considered by evaluating PBS ranges. Criteria to be used in the detection of a significant conflict between data partitions are proposed. Three nodes in the total data tree were found to encompass significant conflict that could result from ancient hybridization. Neither of the large, heterogeneous...
Order and correlations in genomic DNA sequences. The spectral approach
International Nuclear Information System (INIS)
Lobzin, Vasilii V; Chechetkin, Vladimir R
2000-01-01
The structural analysis of genomic DNA sequences is discussed in the framework of the spectral approach, which is sufficiently universal due to the reciprocal correspondence and mutual complementarity of Fourier transform length scales. The spectral characteristics of random sequences of the same nucleotide composition possess the property of self-averaging for relatively short sequences of length M≥100-300. Comparison with the characteristics of random sequences determines the statistical significance of the structural features observed. Apart from traditional applications to the search for hidden periodicities, spectral methods are also efficient in studying mutual correlations in DNA sequences. By combining spectra for structure factors and correlation functions, not only integral correlations can be estimated but also their origin identified. Using the structural spectral entropy approach, the regularity of a sequence can be quantitatively assessed. A brief introduction to the problem is also presented and other major methods of DNA sequence analysis described. (reviews of topical problems)
Directory of Open Access Journals (Sweden)
Juliana Teixeira de Magalhães
2005-06-01
Full Text Available Ribosomal operons are great tools for microbe community characterization and for microorganisms relationship study, particularly in the case of the acid lactic bacteria. The ribosomal operon of the probiotic strain Lactobacillus delbrueckii UFV H2b20 was partially characterized. A genomic library of this strain was constructed and the clones with partial ribosomal operon were sub-cloned using the shot-gun method for subsequent sequencing with the forward primer. The sequence analysis revealed that the 3' end of the rDNA 16S was following by the short spacer region 1 (16S-23S and that the 3' end of the rDNA 23S was following by the short spacer region 2 (23S-5S, which preceded the rDNA 5S. In the flanking region of the rDNA 5S gene of this operon rrn, a region encoding six tRNAs was detected.Operons ribossomais têm sido instrumentos importantes na caracterização de comunidades microbianas e no estudo de relacionamentos entre microrganismos, principalmente em bactérias do ácido láctico. Operons ribossomais da linhagem probiótica, Lactobacillus delbrueckii UFV H2b20, foram parcialmente caracterizados. Um banco genômico da linhagem foi construído e os clones, contendo parte do operon ribossomal, foram subclonados pelo método de "shot gun", para em seguida serem seqüenciados com primer "forward". As seqüências indicaram a presença da extremidade 3' do rDNA 16S seguida da região espaçadora curta 1 (16S-23S e a presença da extremidade 3' do rDNA 23S seguido da região espaçadora 2 (23S-5S, que por sua vez precedia o rDNA 5S. Adjacente ao gene rDNA 5S deste operon rrn uma região codificadora de 6 tRNAs foi detectada.
Zhu, Ke-Cheng; Liang, Yin-Yin; Wu, Na; Guo, Hua-Yang; Zhang, Nan; Jiang, Shi-Gui; Zhang, Dian-Chang
2017-01-01
To further comprehend the genome features of Cephalloscyllium umbratile (Carcharhiniformes), an endangered species, the complete mitochondrial DNA (mtDNA) was firstly sequenced and annotated. The full-length mtDNA of C. umbratile was 16,697 bp and contained ribosomal RNA (rRNA) genes, 13 protein-coding genes (PCGs), 23 transfer RNA (tRNA) genes, and a major non-coding control region. Each PCG was initiated by an authoritative ATN codon, except for COX1 initiated by a GTG codon. Seven of 13 PC...
International Nuclear Information System (INIS)
Osanya, A.; Majiwa, P.A.O.; Kinyanjui, P.W.
2006-01-01
Specific oligonucleotide primers based on conserved nucleotide sequences of 18s ribisomal RNA (18s rRNA) gene of Trypanosoma brucei, Leishmania donovani, Triponema aequale and Lagenidium gigantum have been designed and used in the ploymerase chain reaction (PCR) to amplify genomic DNA from four different clones each representing a different genotypic group of T. congolence. PCR products of approximately 1Kb were generated using as template DNA from each of the trypanosomes. The PCR products cross-hybridized with genomic DNA from T.brucei, T. simiae and the four genotypes of T.congolense implying significant sequence homology of 18S rRNA gene among trypanosomes. The nucleotide sequence of a segment of the PCR products were determined by direct sequencing to provide partial nucleotide sequence of the 18s rRNA gene in each T.congolense genotypic group. The sequences obtained together with those that have been published for T.brucei reveals that although most regions show inter and intra species nucleotide identity, there are several sites where deletions, insertions and base changes have occured in nucleotide sequence of of T.brucei and the four genotypes of T.congolense.(author)
Network clustering coefficient approach to DNA sequence analysis
Energy Technology Data Exchange (ETDEWEB)
Gerhardt, Guenther J.L. [Universidade Federal do Rio Grande do Sul-Hospital de Clinicas de Porto Alegre, Rua Ramiro Barcelos 2350/sala 2040/90035-003 Porto Alegre (Brazil); Departamento de Fisica e Quimica da Universidade de Caxias do Sul, Rua Francisco Getulio Vargas 1130, 95001-970 Caxias do Sul (Brazil); Lemke, Ney [Programa Interdisciplinar em Computacao Aplicada, Unisinos, Av. Unisinos, 950, 93022-000 Sao Leopoldo, RS (Brazil); Corso, Gilberto [Departamento de Biofisica e Farmacologia, Centro de Biociencias, Universidade Federal do Rio Grande do Norte, Campus Universitario, 59072 970 Natal, RN (Brazil)]. E-mail: corso@dfte.ufrn.br
2006-05-15
In this work we propose an alternative DNA sequence analysis tool based on graph theoretical concepts. The methodology investigates the path topology of an organism genome through a triplet network. In this network, triplets in DNA sequence are vertices and two vertices are connected if they occur juxtaposed on the genome. We characterize this network topology by measuring the clustering coefficient. We test our methodology against two main bias: the guanine-cytosine (GC) content and 3-bp (base pairs) periodicity of DNA sequence. We perform the test constructing random networks with variable GC content and imposed 3-bp periodicity. A test group of some organisms is constructed and we investigate the methodology in the light of the constructed random networks. We conclude that the clustering coefficient is a valuable tool since it gives information that is not trivially contained in 3-bp periodicity neither in the variable GC content.
Mapping Base Modifications in DNA by Transverse-Current Sequencing
Alvarez, Jose R.; Skachkov, Dmitry; Massey, Steven E.; Kalitsov, Alan; Velev, Julian P.
2018-02-01
Sequencing DNA modifications and lesions, such as methylation of cytosine and oxidation of guanine, is even more important and challenging than sequencing the genome itself. The traditional methods for detecting DNA modifications are either insensitive to these modifications or require additional processing steps to identify a particular type of modification. Transverse-current sequencing in nanopores can potentially identify the canonical bases and base modifications in the same run. In this work, we demonstrate that the most common DNA epigenetic modifications and lesions can be detected with any predefined accuracy based on their tunneling current signature. Our results are based on simulations of the nanopore tunneling current through DNA molecules, calculated using nonequilibrium electron-transport methodology within an effective multiorbital model derived from first-principles calculations, followed by a base-calling algorithm accounting for neighbor current-current correlations. This methodology can be integrated with existing experimental techniques to improve base-calling fidelity.
Farjami, Elaheh; Clima, Lilia; Gothelf, Kurt V; Ferapontova, Elena E
2010-06-01
A DNA molecular beacon approach was used for the analysis of interactions between DNA and Methylene Blue (MB) as a redox indicator of a hybridization event. DNA hairpin structures of different length and guanine (G) content were immobilized onto gold electrodes in their folded states through the alkanethiol linker at the 5'-end. Binding of MB to the folded hairpin DNA was electrochemically studied and compared with binding to the duplex structure formed by hybridization of the hairpin DNA to a complementary DNA strand. Variation of the electrochemical signal from the DNA-MB complex was shown to depend primarily on the DNA length and sequence used: the G-C base pairs were the preferential sites of MB binding in the duplex. For short 20 nts long DNA sequences, the increased electrochemical response from MB bound to the duplex structure was consistent with the increased amount of bound and electrochemically readable MB molecules (i.e. MB molecules that are available for the electron transfer (ET) reaction with the electrode). With longer DNA sequences, the balance between the amounts of the electrochemically readable MB molecules bound to the hairpin DNA and to the hybrid was opposite: a part of the MB molecules bound to the long-sequence DNA duplex seem to be electrochemically mute due to long ET distance. The increasing electrochemical response from MB bound to the short-length DNA hybrid contrasts with the decreasing signal from MB bound to the long-length DNA hybrid and allows an "off"-"on" genosensor development.
Wu, Yong; Gao, Tieli; Wang, Xiaolin; Hu, Youjin; Hu, Xuyun; Hu, Zhiqing; Pang, Jialun; Li, Zhuo; Xue, Jinfeng; Feng, Mai; Wu, Lingqian; Liang, Desheng
2014-03-28
Although targeted gene addition could be stimulated strikingly by a DNA double strand break (DSB) created by either zinc finger nucleases (ZFNs) or TALE nucleases (TALENs), the DSBs are really mutagenic and toxic to human cells. As a compromised solution, DNA single-strand break (SSB) or nick has been reported to mediate high efficient gene addition but with marked reduction of random mutagenesis. We previously demonstrated effective targeted gene addition at the human multicopy ribosomal DNA (rDNA) locus, a genomic safe harbor for the transgene with therapeutic potential. To improve the transgene integration efficiency by using TALENs while lowering the cytotoxicity of DSBs, we created both TALENs and TALE nickases (TALENickases) targeting this multicopy locus. A targeting vector which could integrate a GFP cassette at the rDNA locus was constructed and co-transfected with TALENs or TALENickases. Although the fraction of GFP positive cells using TALENs was greater than that using TALENickases during the first few days after transfection, it reduced to a level less than that using TALENickases after continuous culture. Our findings showed that the TALENickases were more effective than their TALEN counterparts at the multi-copy rDNA locus, though earlier studies using ZFNs and ZFNickases targeting the single-copy loci showed the reverse. Besides, TALENickases mediated the targeted integration of a 5.4 kb fragment at a frequency of up to 0.62% in HT1080 cells after drug selection, suggesting their potential application in targeted gene modification not being limited at the rDNA locus. Copyright © 2014 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Ana M Xet-Mull
2004-09-01
Full Text Available Tagosodes orizicolus Muir (Homoptera: Delphacidae, the endemic delphacid species of tropical America carries yeast-like symbiotes (YLS in the abdominal fat bodies and the ovarial tissues, like other rice planthoppers of Asia. These YLS are obligate symbiotes, which are transmitted transovarially, and maintain a mutualistic relationship with the insect host. This characteristic has made in vitro culture and classification of YLS rather difficult using conventional methods. Nevertheless, microorganisms of similar characteristics have been successfully classified by using molecular taxonomy. In the present work, the YLS of Tagosodes orizicolus(YLSTo were purified on Percoll® gradients, and specific segments of 18S rDNA were amplified by PCR, cloned and sequenced. Sequences were aligned by means of the CLUSTAL V (DNASTAR program; phylogenetic trees were constructed with the Phylogeny Inference Package (PHYLIP, showing that YLSTo belong to the fungi class Pyrenomycetes, phylum Ascomycota. Similarities between 98% and 100% were observed among YLS of the rice delphacids Tagosodes orizicolus, Nilaparvata lugens, Laodelphax striatellus and Sogatella furcifera, and between 89.8% and 90.8% when comparing the above to YLS of the aphid Hamiltonaphis styraci. These comparisons revealed that delphacid YLS are a highly conserved monophyletic group within the Pyrenomycetes and are closely related to Hypomyces chrysospermus. Rev. Biol. Trop. 52(3: 777-785. Epub 2004 Dic 15.Tagosodes orizicolus Muir (Homoptera: Delphacidae es una especie endémica de América tropical que al igual que otros saltahojas de Asia, tiene simbiontes levaduriformes (YLS, por sus siglas en Inglés en los cuerpos grasos del abdomen y en los tejidos de los ovarios. Los YLS son simbiontes obligados que se transmiten transovarialmente y que mantienen relaciones mutualística con el insecto hospedero. Esta característica ha hecho muy difícil su cultivo in vitro y por ende su clasificaci
Lim, K Y; Kovarik, A; Matýăsek, R; Bezdĕk, M; Lichtenstein, C P; Leitch, A R
2000-06-01
We examined the structure, intranuclear distribution and activity of ribosomal DNA (rDNA) in Nicotiana sylvestris (2n = 2x = 24) and N. tomentosiformis (2n = 2x = 24) and compared these with patterns in N. tabacum (tobacco, 2n = 4x = 48). We also examined a long-established N. tabacum culture, TBY-2. Nicotiana tabacum is an allotetraploid thought to be derived from ancestors of N. sylvestris (S-genome donor) and N. tomentosiformis (T-genome donor). Nicotiana sylvestris has three rDNA loci, one locus each on chromosomes 10, 11, and 12. In root-tip meristematic interphase cells, the site on chromosome 12 remains condensed and inactive, while the sites on chromosomes 10 and 11 show activity at the proximal end of the locus only. Nicotiana tomentosiformis has one major locus on chromosome 3 showing activity and a minor, inactive locus on chromosome 11. In N. tabacum cv. 095-55, there are four rDNA loci on T3, S10, S11/t and S12 (S11/t carries a small T-genome translocation). The locus on S12 remains condensed and inactive in root-tip meristematic cells while the others show activity, including decondensation at interphase and secondary constrictions at metaphase. Nicotiana tabacum DNA digested with methylcytosine-sensitive enzymes revealed a hybridisation pattern for rDNA that resembled that of N. tomentosiformis and not N. sylvestris. The data indicate that active, undermethylated genes are of the N. tomentosiformis type. Since S-genome chromosomes of N. tabacum show rDNA expression, the result indicates rDNA gene conversion of the active rDNA units on these chromosomes. Gene conversion in N. tabacum is consistent with the results of previous work. However, using primers specific for the S-genome rDNA intergenic sequences (IGS) in the polymerase chain reaction (PCR) show that rDNA gene conversion has not gone to completion in N. tabacum. Furthermore, using methylation-insensitive restriction enzymes we demonstrate that about 8% of the rDNA units remain of the N
Holton, R.W; Boele-Bos, S.A.; Stam, W.T.
The nuclear small-subunit ribosomal DNA sequence from the freshwater red alga Boldia erythrosiphon Herndon emend Howard et Parker was determined. Phylogenetic analysis confirms the positioning of this species within the bangiophycidean order of the Compsopogonales. The results strongly suggest that
Zhao, Huayan
2015-08-13
The circularly permuted GTPase large subunit GTPase 1 (LSG1) is involved in the maturation step of the 60S ribosome and is essential for cell viability in yeast. Here, an Arabidopsis mutant dig6 (drought inhibited growth of lateral roots) was isolated. The mutant exhibited multiple auxin-related phenotypes, which included reduced lateral root number, altered leaf veins, and shorter roots. Genetic mapping combined with next-generation DNA sequencing identified that the mutation occurred in AtLSG1-2. This gene was highly expressed in regions of auxin accumulation. Ribosome profiling revealed that a loss of function of AtLSG1-2 led to decreased levels of monosomes, further demonstrating its role in ribosome biogenesis. Quantitative proteomics showed that the expression of certain proteins involved in ribosome biogenesis was differentially regulated, indicating that ribosome biogenesis processes were impaired in the mutant. Further investigations showed that an AtLSG1-2 deficiency caused the alteration of auxin distribution, response, and transport in plants. It is concluded that AtLSG1-2 is integral to ribosome biogenesis, consequently affecting auxin homeostasis and plant development.
Zhao, Huayan; Lü , Shiyou; Li, Ruixi; Chen, Tao; Zhang, Huoming; Cui, Peng; Ding, Feng; Liu, Pei; Wang, Guangchao; Xia, Yiji; Running, Mark P.; Xiong, Liming
2015-01-01
The circularly permuted GTPase large subunit GTPase 1 (LSG1) is involved in the maturation step of the 60S ribosome and is essential for cell viability in yeast. Here, an Arabidopsis mutant dig6 (drought inhibited growth of lateral roots) was isolated. The mutant exhibited multiple auxin-related phenotypes, which included reduced lateral root number, altered leaf veins, and shorter roots. Genetic mapping combined with next-generation DNA sequencing identified that the mutation occurred in AtLSG1-2. This gene was highly expressed in regions of auxin accumulation. Ribosome profiling revealed that a loss of function of AtLSG1-2 led to decreased levels of monosomes, further demonstrating its role in ribosome biogenesis. Quantitative proteomics showed that the expression of certain proteins involved in ribosome biogenesis was differentially regulated, indicating that ribosome biogenesis processes were impaired in the mutant. Further investigations showed that an AtLSG1-2 deficiency caused the alteration of auxin distribution, response, and transport in plants. It is concluded that AtLSG1-2 is integral to ribosome biogenesis, consequently affecting auxin homeostasis and plant development.
Energy Technology Data Exchange (ETDEWEB)
Son, Ora [Department of Biological Science, Sookmyung Women' s University, Seoul 140-742 (Korea, Republic of); Kim, Sunghan [Department of Biological Science, Sookmyung Women' s University, Seoul 140-742 (Korea, Republic of); Department of Plant Science, Plant Genomics and Breeding Institute, Research Institute of Agriculture and Life Sciences, Seoul National University, Seoul 151-921 (Korea, Republic of); Shin, Yun-jeong [Department of Biological Science, Sookmyung Women' s University, Seoul 140-742 (Korea, Republic of); Kim, Woo-Young [College of Pharmacy, Sookmyung Women' s University, Seoul 140-742 (Korea, Republic of); Koh, Hee-Jong, E-mail: heejkoh@snu.ac.kr [Department of Plant Science, Plant Genomics and Breeding Institute, Research Institute of Agriculture and Life Sciences, Seoul National University, Seoul 151-921 (Korea, Republic of); Cheon, Choong-Ill, E-mail: ccheon@sookmyung.ac.kr [Department of Biological Science, Sookmyung Women' s University, Seoul 140-742 (Korea, Republic of)
2015-09-18
The ribosomal protein S6 (RPS6) is a downstream component of the signaling mediated by the target of rapamycin (TOR) kinase that acts as a central regulator of the key metabolic processes, such as protein translation and ribosome biogenesis, in response to various environmental cues. In our previous study, we identified a novel role of plant RPS6, which negatively regulates rDNA transcription, forming a complex with a plant-specific histone deacetylase, AtHD2B. Here we report that the Arabidopsis RPS6 interacts additionally with a histone chaperone, nucleosome assembly protein 1(AtNAP1;1). The interaction does not appear to preclude the association of RPS6 with AtHD2B, as the AtNAP1 was also able to interact with AtHD2B as well as with an RPS6-AtHD2B fusion protein in the BiFC assay and pulldown experiment. Similar to a positive effect of the ribosomal S6 kinase 1 (AtS6K1) on rDNA transcription observed in this study, overexpression or down regulation of the AtNAP1;1 resulted in concomitant increase and decrease, respectively, in rDNA transcription suggesting a positive regulatory role played by AtNAP1 in plant rDNA transcription, possibly through derepression of the negative effect of the RPS6-AtHD2B complex. - Highlights: • Nucleosome assembly protein 1 (AtNAP1) interacts with RPS6 as well as with AtHD2B. • rDNA transcription is regulated S6K1. • Overexpression or down regulation of AtNAP1 results in concomitant increase or decrease in rDNA transcription.
DNA sequences from the quagga, an extinct member of the horse family.
Higuchi, R; Bowman, B; Freiberger, M; Ryder, O A; Wilson, A C
To determine whether DNA survives and can be recovered from the remains of extinct creatures, we have examined dried muscle from a museum specimen of the quagga, a zebra-like species (Equus quagga) that became extinct in 1883 (ref. 1). We report that DNA was extracted from this tissue in amounts approaching 1% of that expected from fresh muscle, and that the DNA was of relatively low molecular weight. Among the many clones obtained from the quagga DNA, two containing pieces of mitochondrial DNA (mtDNA) were sequenced. These sequences, comprising 229 nucleotide pairs, differ by 12 base substitutions from the corresponding sequences of mtDNA from a mountain zebra, an extant member of the genus Equus. The number, nature and locations of the substitutions imply that there has been little or no postmortem modification of the quagga DNA sequences, and that the two species had a common ancestor 3-4 Myr ago, consistent with fossil evidence concerning the age of the genus Equus.
Substrate sequence selectivity of APOBEC3A implicates intra-DNA interactions.
Silvas, Tania V; Hou, Shurong; Myint, Wazo; Nalivaika, Ellen; Somasundaran, Mohan; Kelch, Brian A; Matsuo, Hiroshi; Kurt Yilmaz, Nese; Schiffer, Celia A
2018-05-14
The APOBEC3 (A3) family of human cytidine deaminases is renowned for providing a first line of defense against many exogenous and endogenous retroviruses. However, the ability of these proteins to deaminate deoxycytidines in ssDNA makes A3s a double-edged sword. When overexpressed, A3s can mutate endogenous genomic DNA resulting in a variety of cancers. Although the sequence context for mutating DNA varies among A3s, the mechanism for substrate sequence specificity is not well understood. To characterize substrate specificity of A3A, a systematic approach was used to quantify the affinity for substrate as a function of sequence context, length, secondary structure, and solution pH. We identified the A3A ssDNA binding motif as (T/C)TC(A/G), which correlated with enzymatic activity. We also validated that A3A binds RNA in a sequence specific manner. A3A bound tighter to substrate binding motif within a hairpin loop compared to linear oligonucleotide, suggesting A3A affinity is modulated by substrate structure. Based on these findings and previously published A3A-ssDNA co-crystal structures, we propose a new model with intra-DNA interactions for the molecular mechanism underlying A3A sequence preference. Overall, the sequence and structural preferences identified for A3A leads to a new paradigm for identifying A3A's involvement in mutation of endogenous or exogenous DNA.
DNA cross-linking by dehydromonocrotaline lacks apparent base sequence preference.
Rieben, W Kurt; Coulombe, Roger A
2004-12-01
Pyrrolizidine alkaloids (PAs) are ubiquitous plant toxins, many of which, upon oxidation by hepatic mixed-function oxidases, become reactive bifunctional pyrrolic electrophiles that form DNA-DNA and DNA-protein cross-links. The anti-mitotic, toxic, and carcinogenic action of PAs is thought to be caused, at least in part, by these cross-links. We wished to determine whether the activated PA pyrrole dehydromonocrotaline (DHMO) exhibits base sequence preferences when cross-linked to a set of model duplex poly A-T 14-mer oligonucleotides with varying internal and/or end 5'-d(CG), 5'-d(GC), 5'-d(TA), 5'-d(CGCG), or 5'-d(GCGC) sequences. DHMO-DNA cross-links were assessed by electrophoretic mobility shift assay (EMSA) of 32P endlabeled oligonucleotides and by HPLC analysis of cross-linked DNAs enzymatically digested to their constituent deoxynucleosides. The degree of DNA cross-links depended upon the concentration of the pyrrole, but not on the base sequence of the oligonucleotide target. Likewise, HPLC chromatograms of cross-linked and digested DNAs showed no discernible sequence preference for any nucleotide. Added glutathione, tyrosine, cysteine, and aspartic acid, but not phenylalanine, threonine, serine, lysine, or methionine competed with DNA as alternate nucleophiles for cross-linking by DHMO. From these data it appears that DHMO exhibits no strong base preference when forming cross-links with DNA, and that some cellular nucleophiles can inhibit DNA cross-link formation.
[Whole Genome Sequencing of Human mtDNA Based on Ion Torrent PGM™ Platform].
Cao, Y; Zou, K N; Huang, J P; Ma, K; Ping, Y
2017-08-01
To analyze and detect the whole genome sequence of human mitochondrial DNA (mtDNA) by Ion Torrent PGM™ platform and to study the differences of mtDNA sequence in different tissues. Samples were collected from 6 unrelated individuals by forensic postmortem examination, including chest blood, hair, costicartilage, nail, skeletal muscle and oral epithelium. Amplification of whole genome sequence of mtDNA was performed by 4 pairs of primer. Libraries were constructed with Ion Shear™ Plus Reagents kit and Ion Plus Fragment Library kit. Whole genome sequencing of mtDNA was performed using Ion Torrent PGM™ platform. Sanger sequencing was used to determine the heteroplasmy positions and the mutation positions on HVⅠ region. The whole genome sequence of mtDNA from all samples were amplified successfully. Six unrelated individuals belonged to 6 different haplotypes. Different tissues in one individual had heteroplasmy difference. The heteroplasmy positions and the mutation positions on HVⅠ region were verified by Sanger sequencing. After a consistency check by the Kappa method, it was found that the results of mtDNA sequence had a high consistency in different tissues. The testing method used in present study for sequencing the whole genome sequence of human mtDNA can detect the heteroplasmy difference in different tissues, which have good consistency. The results provide guidance for the further applications of mtDNA in forensic science. Copyright© by the Editorial Department of Journal of Forensic Medicine
The architecture of mammalian ribosomal protein promoters
Directory of Open Access Journals (Sweden)
Perry Robert P
2005-02-01
Full Text Available Abstract Background Mammalian ribosomes contain 79 different proteins encoded by widely scattered single copy genes. Coordinate expression of these genes at transcriptional and post-transcriptional levels is required to ensure a roughly equimolar accumulation of ribosomal proteins. To date, detailed studies of only a very few ribosomal protein (rp promoters have been made. To elucidate the general features of rp promoter architecture, I made a detailed sequence comparison of the promoter regions of the entire set of orthologous human and mouse rp genes. Results A striking evolutionarily conserved feature of most rp genes is the separation by an intron of the sequences involved in transcriptional and translational regulation from the sequences with protein encoding function. Another conserved feature is the polypyrimidine initiator, which conforms to the consensus (Y2C+1TY(T2(Y3. At least 60 % of the rp promoters contain a largely conserved TATA box or A/T-rich motif, which should theoretically have TBP-binding capability. A remarkably high proportion of the promoters contain conserved binding sites for transcription factors that were previously implicated in rp gene expression, namely upstream GABP and Sp1 sites and downstream YY1 sites. Over 80 % of human and mouse rp genes contain a transposable element residue within 900 bp of 5' flanking sequence; very little sequence identity between human and mouse orthologues was evident more than 200 bp upstream of the transcriptional start point. Conclusions This analysis has provided some valuable insights into the general architecture of mammalian rp promoters and has identified parameters that might coordinately regulate the transcriptional activity of certain subsets of rp genes.
Sequence context effects on 8-methoxypsoralen photobinding to defined DNA fragments
International Nuclear Information System (INIS)
Sage, E.; Moustacchi, E.
1987-01-01
The photoreaction of 8-methoxypsoralen (8-MOP) with DNA fragments of defined sequence was studied. The authors took advantage of the blockage by bulky adducts of the 3'-5'-exonuclease activity associated with the T4 DNA polymerase. The action of the exonuclease is stopped by biadducts as well as by monoadducts. The termination products were analyzed on sequencing gels. A strong sequence specificity was observed in the DNA photobinding of 8-MOP. The exonuclease terminates its digestion near thymine residues, mainly at potentially cross-linkable sites. There is an increasing reactivity of thymine residues in the order T < TT << TTT in a GC environment. For thymine residues in cross-linkable sites, the reactivity follows the order AT << TA ∼ TAT << ATA < ATAT < ATATAA. Repeated A-T sequences are hot spots for the photochemical reaction of 8-MOP with DNA. Both monoadducts and interstrand cross-links are formed preferentially in 5'-TpA sites. The results highlight the role of the sequence and consequently of the conformation around a potential site in the photobinding of 8-MOP to DNA
Beati, Lorenza; Cáceres, Abraham G; Lee, Jamie A; Munstermann, Leonard E
2004-02-01
Lutzomyia spp. are New World phlebotomine sand flies, many of which are involved in the transmission of human diseases, such as leishmaniases and bartonellosis. The systematic classification of the approximately 400 species in the genus has been based on morphological characters, but the relationships within the genus are still very much in question. We have inferred phylogenies of 32 species of phlebotomine sand flies belonging to seven sub-genera and two species groups, by using fragments of the mitochondrial small subunit (12SrRNA) and of the nuclear large subunit (28SrRNA) ribosomal gene sequences. The subgenus Helcocyrtomyia and the Verrucarum species group, prominent representatives of the Peruvian sand fly fauna, were represented by 11 and 7 species, respectively. Although based on a limited number of taxa, the resulting phylogenies, based on 837 characters, provide an initial phylogenetic backbone for the progressive reconstruction of infrageneric relationships within Lutzomyia.
Management of High-Throughput DNA Sequencing Projects: Alpheus.
Miller, Neil A; Kingsmore, Stephen F; Farmer, Andrew; Langley, Raymond J; Mudge, Joann; Crow, John A; Gonzalez, Alvaro J; Schilkey, Faye D; Kim, Ryan J; van Velkinburgh, Jennifer; May, Gregory D; Black, C Forrest; Myers, M Kathy; Utsey, John P; Frost, Nicholas S; Sugarbaker, David J; Bueno, Raphael; Gullans, Stephen R; Baxter, Susan M; Day, Steve W; Retzel, Ernest F
2008-12-26
High-throughput DNA sequencing has enabled systems biology to begin to address areas in health, agricultural and basic biological research. Concomitant with the opportunities is an absolute necessity to manage significant volumes of high-dimensional and inter-related data and analysis. Alpheus is an analysis pipeline, database and visualization software for use with massively parallel DNA sequencing technologies that feature multi-gigabase throughput characterized by relatively short reads, such as Illumina-Solexa (sequencing-by-synthesis), Roche-454 (pyrosequencing) and Applied Biosystem's SOLiD (sequencing-by-ligation). Alpheus enables alignment to reference sequence(s), detection of variants and enumeration of sequence abundance, including expression levels in transcriptome sequence. Alpheus is able to detect several types of variants, including non-synonymous and synonymous single nucleotide polymorphisms (SNPs), insertions/deletions (indels), premature stop codons, and splice isoforms. Variant detection is aided by the ability to filter variant calls based on consistency, expected allele frequency, sequence quality, coverage, and variant type in order to minimize false positives while maximizing the identification of true positives. Alpheus also enables comparisons of genes with variants between cases and controls or bulk segregant pools. Sequence-based differential expression comparisons can be developed, with data export to SAS JMP Genomics for statistical analysis.
DNA sequence responsible for the amplification of adjacent genes.
Pasion, S G; Hartigan, J A; Kumar, V; Biswas, D K
1987-10-01
A 10.3-kb DNA fragment in the 5'-flanking region of the rat prolactin (rPRL) gene was isolated from F1BGH(1)2C1, a strain of rat pituitary tumor cells (GH cells) that produces prolactin in response to 5-bromodeoxyuridine (BrdU). Following transfection and integration into genomic DNA of recipient mouse L cells, this DNA induced amplification of the adjacent thymidine kinase gene from Herpes simplex virus type 1 (HSV1TK). We confirmed the ability of this "Amplicon" sequence to induce amplification of other linked or unlinked genes in DNA-mediated gene transfer studies. When transferred into the mouse L cells with the 10.3-5'rPRL gene sequence of BrdU-responsive cells, both the human growth hormone and the HSV1TK genes are amplified in response to 5-bromodeoxyuridine. This observation is substantiated by BrdU-induced amplification of the cotransferred bacterial Neo gene. Cotransfection studies reveal that the BrdU-induced amplification capability is associated with a 4-kb DNA sequence in the 5'-flanking region of the rPRL gene of BrdU-responsive cells. These results demonstrate that genes of heterologous origin, linked or unlinked, and selected or unselected, can be coamplified when located within the amplification boundary of the Amplicon sequence.
Directory of Open Access Journals (Sweden)
Meetha P Gould
Full Text Available Recent advances in sequencing technology allow for accurate detection of mitochondrial sequence variants, even those in low abundance at heteroplasmic sites. Considerable sequencing cost savings can be achieved by enriching samples for mitochondrial (relative to nuclear DNA. Reduction in nuclear DNA (nDNA content can also help to avoid false positive variants resulting from nuclear mitochondrial sequences (numts. We isolate intact mitochondrial organelles from both human cell lines and blood components using two separate methods: a magnetic bead binding protocol and differential centrifugation. DNA is extracted and further enriched for mitochondrial DNA (mtDNA by an enzyme digest. Only 1 ng of the purified DNA is necessary for library preparation and next generation sequence (NGS analysis. Enrichment methods are assessed and compared using mtDNA (versus nDNA content as a metric, measured by using real-time quantitative PCR and NGS read analysis. Among the various strategies examined, the optimal is differential centrifugation isolation followed by exonuclease digest. This strategy yields >35% mtDNA reads in blood and cell lines, which corresponds to hundreds-fold enrichment over baseline. The strategy also avoids false variant calls that, as we show, can be induced by the long-range PCR approaches that are the current standard in enrichment procedures. This optimization procedure allows mtDNA enrichment for efficient and accurate massively parallel sequencing, enabling NGS from samples with small amounts of starting material. This will decrease costs by increasing the number of samples that may be multiplexed, ultimately facilitating efforts to better understand mitochondria-related diseases.
GALAVANI, Hossein; GHOLIZADEH, Saber; HAZRATI TAPPEH, Khosrow
2016-01-01
Background: Fascioliasis, caused by Fasciola hepatica and F. gigantica, has medical and economic importance in the world. Molecular approaches comparing traditional methods using for identification and characterization of Fasciola spp. are precise and reliable. The aims of current study were molecular characterization of Fasciola spp. in West Azerbaijan Province, Iran and then comparative analysis of them using GenBank sequences. Methods: A total number of 580 isolates were collected from different hosts in five cities of West Azerbaijan Province, in 2014 from 90 slaughtered cattle (n=50) and sheep (n=40). After morphological identification and DNA extraction, designing specific primer were used to amplification of ITS1, 5.8s and ITS2 regions, 50 samples were conducted to sequence, randomly. Result: Using morphometric characters 99.14% and 0.86% of isolates identified as F. hepatica and F. gigantica, respectively. PCR amplification of 1081 bp fragment and sequencing result showed 100% similarity with F. hepatica in ITS1 (428 bp), 5.8s (158 bp), and ITS2 (366 bp) regions. Sequence comparison among current study sequences and GenBank data showed 98% identity with 11 nucleotide mismatches. However, in phylogenetic tree F. hepatica sequences of West Azerbaijan Province, Iran, were in a close relationship with Iranian, Asian, and African isolates. Conclusions: Only F. hepatica species is distributed among sheep and cattle in West Azerbaijan Province Iran. However, 5 and 6 bp variation in ITS1 and ITS2 regions, respectively, is not enough to separate of Fasciola spp. Therefore, more studies are essential for designing new molecular markers to correct species identification. PMID:27095969
Roy, D; Sirois, S; Vincent, D
2001-04-01
Lactic acid bacteria such as Lactobacillus helveticus, L. delbrueckii subsp. delbrueckii, L. delbrueckii subsp. lactis, L. delbrueckii subsp. bulgaricus, L. acidophilus, and L. casei related taxa which are widely used as starter or probiotic cultures can be identified by amplified ribosomal DNA restriction analysis (ARDRA). The genetic discrimination of the related species belonging to these groups was first obtained by PCR amplifications by using group-specific or species-specific 16S rDNA primers. The numerical analysis of the ARDRA patterns obtained by using CfoI, HinfI, Tru9I, and ScrFI was an efficient typing tool for identification of species of the L. acidophilus and L. casei complex. ARDRA by using CfoI was a reliable method for differentiation of L. delbrueckii subsp. bulgaricus and L. delbrueckii subsp. lactis. Finally, strains ATCC 393 and ATCC 15820 exhibited unique ARDRA patterns with CfoI and Tru9I restriction enzymes as compared with the other strains of L. casei, L. paracasei, and L. rhamnosus.
Kim, Chang-Kug; Seol, Young-Joo; Perumal, Sampath; Lee, Jonghoon; Waminal, Nomar Espinosa; Jayakodi, Murukarthick; Lee, Sang-Choon; Jin, Seungwoo; Choi, Beom-Soon; Yu, Yeisoo; Ko, Ho-Cheol; Choi, Ji-Weon; Ryu, Kyoung-Yul; Sohn, Seong-Han; Parkin, Isobel; Yang, Tae-Jin
2018-05-09
The concept of U's triangle, which revealed the importance of polyploidization in plant genome evolution, described natural allopolyploidization events in Brassica using three diploids [B. rapa (A genome), B. nigra (B), and B. oleracea (C)] and derived allotetraploids [B. juncea (AB genome), B. napus (AC), and B. carinata (BC)]. However, comprehensive understanding of Brassica genome evolution has not been fully achieved. Here, we performed low-coverage (2-6×) whole-genome sequencing of 28 accessions of Brassica as well as of Raphanus sativus [R genome] to explore the evolution of six Brassica species based on chloroplast genome and ribosomal DNA variations. Our phylogenomic analyses led to two main conclusions. (1) Intra-species-level chloroplast genome variations are low in the three allotetraploids (2~7 SNPs), but rich and variable in each diploid species (7~193 SNPs). (2) Three allotetraploids maintain two 45SnrDNA types derived from both ancestral species with maternal dominance. Furthermore, this study sheds light on the maternal origin of the AC chloroplast genome. Overall, this study clarifies the genetic relationships of U's triangle species based on a comprehensive genomics approach and provides important genomic resources for correlative and evolutionary studies.
Neuhof, Andrea; Rolls, Melissa M.; Jungnickel, Berit; Kalies, Kai-Uwe; Rapoport, Tom A.
1998-01-01
Most secretory and membrane proteins are sorted by signal sequences to the endoplasmic reticulum (ER) membrane early during their synthesis. Targeting of the ribosome-nascent chain complex (RNC) involves the binding of the signal sequence to the signal recognition particle (SRP), followed by an interaction of ribosome-bound SRP with the SRP receptor. However, ribosomes can also independently bind to the ER translocation channel formed by the Sec61p complex. To explain the specificity of membrane targeting, it has therefore been proposed that nascent polypeptide-associated complex functions as a cytosolic inhibitor of signal sequence- and SRP-independent ribosome binding to the ER membrane. We report here that SRP-independent binding of RNCs to the ER membrane can occur in the presence of all cytosolic factors, including nascent polypeptide-associated complex. Nontranslating ribosomes competitively inhibit SRP-independent membrane binding of RNCs but have no effect when SRP is bound to the RNCs. The protective effect of SRP against ribosome competition depends on a functional signal sequence in the nascent chain and is also observed with reconstituted proteoliposomes containing only the Sec61p complex and the SRP receptor. We conclude that cytosolic factors do not prevent the membrane binding of ribosomes. Instead, specific ribosome targeting to the Sec61p complex is provided by the binding of SRP to RNCs, followed by an interaction with the SRP receptor, which gives RNC–SRP complexes a selective advantage in membrane targeting over nontranslating ribosomes. PMID:9436994
Manaka, Akihiro; Tokue, Yutaka; Murakami, Masami
2017-01-01
Background Nosocomial infection is one of the most common complications within health care facilities. Certain studies have reported outbreaks resulting from contaminated hospital environments. Although the identification of bacteria in the environment can readily be achieved using culturing methods, these methods detect live bacteria. Sequencing of the 16S ribosomal RNA (16S rRNA) gene is recognized to be effective for bacterial identification. In this study, we surveyed wards where drug-res...
An automated annotation tool for genomic DNA sequences using
Indian Academy of Sciences (India)
Genomic sequence data are often available well before the annotated sequence is published. We present a method for analysis of genomic DNA to identify coding sequences using the GeneScan algorithm and characterize these resultant sequences by BLAST. The routines are used to develop a system for automated ...
Novel DNA sequence detection method based on fluorescence energy transfer
International Nuclear Information System (INIS)
Kobayashi, S.; Tamiya, E.; Karube, I.
1987-01-01
Recently the detection of specific DNA sequence, DNA analysis, has been becoming more important for diagnosis of viral genomes causing infections disease and human sequences related to inherited disorders. These methods typically involve electrophoresis, the immobilization of DNA on a solid support, hybridization to a complementary probe, the detection using labeled with /sup 32/P or nonisotopically with a biotin-avidin-enzyme system, and so on. These techniques are highly effective, but they are very time-consuming and expensive. A principle of fluorescene energy transfer is that the light energy from an excited donor (fluorophore) is transferred to an acceptor (fluorophore), if the acceptor exists in the vicinity of the donor and the excitation spectrum of donor overlaps the emission spectrum of acceptor. In this study, the fluorescence energy transfer was applied to the detection of specific DNA sequence using the hybridization method. The analyte, single-stranded DNA labeled with the donor fluorophore is hybridized to a probe DNA labeled with the acceptor. Because of the complementary DNA duplex formation, two fluorophores became to be closed to each other, and the fluorescence energy transfer was occurred
mtDNA sequence diversity of Hazara ethnic group from Pakistan.
Rakha, Allah; Fatima; Peng, Min-Sheng; Adan, Atif; Bi, Rui; Yasmin, Memona; Yao, Yong-Gang
2017-09-01
The present study was undertaken to investigate mitochondrial DNA (mtDNA) control region sequences of Hazaras from Pakistan, so as to generate mtDNA reference database for forensic casework in Pakistan and to analyze phylogenetic relationship of this particular ethnic group with geographically proximal populations. Complete mtDNA control region (nt 16024-576) sequences were generated through Sanger Sequencing for 319 Hazara individuals from Quetta, Baluchistan. The population sample set showed a total of 189 distinct haplotypes, belonging mainly to West Eurasian (51.72%), East & Southeast Asian (29.78%) and South Asian (18.50%) haplogroups. Compared with other populations from Pakistan, the Hazara population had a relatively high haplotype diversity (0.9945) and a lower random match probability (0.0085). The dataset has been incorporated into EMPOP database under accession number EMP00680. The data herein comprises the largest, and likely most thoroughly examined, control region mtDNA dataset from Hazaras of Pakistan. Copyright © 2017 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Tamás Petkovits
Full Text Available Although the fungal order Mortierellales constitutes one of the largest classical groups of Zygomycota, its phylogeny is poorly understood and no modern taxonomic revision is currently available. In the present study, 90 type and reference strains were used to infer a comprehensive phylogeny of Mortierellales from the sequence data of the complete ITS region and the LSU and SSU genes with a special attention to the monophyly of the genus Mortierella. Out of 15 alternative partitioning strategies compared on the basis of Bayes factors, the one with the highest number of partitions was found optimal (with mixture models yielding the best likelihood and tree length values, implying a higher complexity of evolutionary patterns in the ribosomal genes than generally recognized. Modeling the ITS1, 5.8S, and ITS2, loci separately improved model fit significantly as compared to treating all as one and the same partition. Further, within-partition mixture models suggests that not only the SSU, LSU and ITS regions evolve under qualitatively and/or quantitatively different constraints, but that significant heterogeneity can be found within these loci also. The phylogenetic analysis indicated that the genus Mortierella is paraphyletic with respect to the genera Dissophora, Gamsiella and Lobosporangium and the resulting phylogeny contradict previous, morphology-based sectional classification of Mortierella. Based on tree structure and phenotypic traits, we recognize 12 major clades, for which we attempt to summarize phenotypic similarities. M. longicollis is closely related to the outgroup taxon Rhizopus oryzae, suggesting that it belongs to the Mucorales. Our results demonstrate that traits used in previous classifications of the Mortierellales are highly homoplastic and that the Mortierellales is in a need of a reclassification, where new, phylogenetically informative phenotypic traits should be identified, with molecular phylogenies playing a decisive role.
International Nuclear Information System (INIS)
Lott, Brittany Burton; Wang, Yongmei; Nakazato, Takuya
2013-01-01
Assembly of the ribosome from its protein and RNA constituents must occur quickly and efficiently in order to synthesize the proteins necessary for all cellular activity. Since the early 1960’s, certain characteristics of possible assembly pathways have been elucidated, yet the mechanisms that govern the precise recognition events remain unclear. We utilize a comparative analysis to investigate the amino acid composition of ribosomal proteins (r-proteins) with respect to their role in the assembly process. We compared small subunit (30S) r-protein sequences to those of other housekeeping proteins from 560 bacterial species and searched for correlations between r-protein amino acid content and factors such as assembly binding order, environmental growth temperature, protein size, and contact with ribosomal RNA (rRNA) in the 30S complex. We find r-proteins have a significantly high percent of positive residues, which are highly represented at rRNA contact sites. An inverse correlation between the percent of positive residues and r-protein size was identified and is mainly due to the content of Lysine residues, rather than Arginine. Nearly all r-proteins carry a net positive charge, but no statistical correlation between the net charge and the binding order was detected. Thermophilic (high-temperature) r-proteins contain increased Arginine, Isoleucine, and Tyrosine, and decreased Serine and Threonine compared to mesophilic (lower-temperature), reflecting a known distinction between thermophiles and mesophiles, possibly to account for protein thermostability. However, this difference in amino acid content does not extend to rRNA contact sites, as the proportions of thermophilic and mesophilic contact residues are not significantly different. Given the significantly higher level of positively charged residues in r-proteins and at contact sites, we conclude that ribosome assembly relies heavily on an electrostatic component of interaction. However, the binding order of
VoSeq: a voucher and DNA sequence web application.
Directory of Open Access Journals (Sweden)
Carlos Peña
Full Text Available There is an ever growing number of molecular phylogenetic studies published, due to, in part, the advent of new techniques that allow cheap and quick DNA sequencing. Hence, the demand for relational databases with which to manage and annotate the amassing DNA sequences, genes, voucher specimens and associated biological data is increasing. In addition, a user-friendly interface is necessary for easy integration and management of the data stored in the database back-end. Available databases allow management of a wide variety of biological data. However, most database systems are not specifically constructed with the aim of being an organizational tool for researchers working in phylogenetic inference. We here report a new software facilitating easy management of voucher and sequence data, consisting of a relational database as back-end for a graphic user interface accessed via a web browser. The application, VoSeq, includes tools for creating molecular datasets of DNA or amino acid sequences ready to be used in commonly used phylogenetic software such as RAxML, TNT, MrBayes and PAUP, as well as for creating tables ready for publishing. It also has inbuilt BLAST capabilities against all DNA sequences stored in VoSeq as well as sequences in NCBI GenBank. By using mash-ups and calls to web services, VoSeq allows easy integration with public services such as Yahoo! Maps, Flickr, Encyclopedia of Life (EOL and GBIF (by generating data-dumps that can be processed with GBIF's Integrated Publishing Toolkit.
Fidelity and mutational spectrum of Pfu DNA polymerase on a human mitochondrial DNA sequence.
André, P; Kim, A; Khrapko, K; Thilly, W G
1997-08-01
The study of rare genetic changes in human tissues requires specialized techniques. Point mutations at fractions at or below 10(-6) must be observed to discover even the most prominent features of the point mutational spectrum. PCR permits the increase in number of mutant copies but does so at the expense of creating many additional mutations or "PCR noise". Thus, each DNA sequence studied must be characterized with regard to the DNA polymerase and conditions used to avoid interpreting a PCR-generated mutation as one arising in human tissue. The thermostable DNA polymerase derived from Pyrococcus furiosus designated Pfu has the highest fidelity of any DNA thermostable polymerase studied to date, and this property recommends it for analyses of tissue mutational spectra. Here, we apply constant denaturant capillary electrophoresis (CDCE) to separate and isolate the products of DNA amplification. This new strategy permitted direct enumeration and identification of point mutations created by Pfu DNA polymerase in a 96-bp low melting domain of a human mitochondrial sequence despite the very low mutant fractions generated in the PCR process. This sequence, containing part of the tRNA glycine and NADH dehydrogenase subunit 3 genes, is the target of our studies of mitochondrial mutagenesis in human cells and tissues. Incorrectly synthesized sequences were separated from the wild type as mutant/wild-type heteroduplexes by sequential enrichment on CDCE. An artificially constructed mutant was used as an internal standard to permit calculation of the mutant fraction. Our study found that the average error rate (mutations per base pair duplication) of Pfu was 6.5 x 10(-7), and five of its more frequent mutations (hot spots) consisted of three transversions (GC-->TA, AT-->TA, and AT-->CG), one transition (AT-->GC), and one 1-bp deletion (in an AAAAAA sequence). To achieve an even higher sensitivity, the amount of Pfu-induced mutants must be reduced.
Spectral entropy criteria for structural segmentation in genomic DNA sequences
International Nuclear Information System (INIS)
Chechetkin, V.R.; Lobzin, V.V.
2004-01-01
The spectral entropy is calculated with Fourier structure factors and characterizes the level of structural ordering in a sequence of symbols. It may efficiently be applied to the assessment and reconstruction of the modular structure in genomic DNA sequences. We present the relevant spectral entropy criteria for the local and non-local structural segmentation in DNA sequences. The results are illustrated with the model examples and analysis of intervening exon-intron segments in the protein-coding regions
Relationship between organization and function of ribosomal genes in Drosophila melanogaster
International Nuclear Information System (INIS)
Karpen, G.H.
1987-01-01
In most eukaryotic organisms, the genes that encode the 18S and 28S ribosomal RNAs (rDNA genes) are tandemly repeated, and are located in constitutive heterochromatin and/or centromeric or telomeric regions. P-element mediated transformation was used to investigate the relationship between rDNA organization and function in Drosophila melanogaster. Tritiated-uridine incorporation under heat shock conditions and in situ hybridization to rRNA were used to demonstrate that a single rDNA gene inserted into euchromatin can be transcribed at a high rate, in polytene nuclei. P-element-mediated transformation of a single Drosophila rDNA gene was also utilized to investigate the ability of ribosomal DNA to organize a nucleolus. Cytological approaches demonstrated that structures resembling the endogenous nucleoli were preferentially associated with four different sites of rDNA insertion, in polytene nuclei. These mini-nucleoli also contained components specific to the nucleolus, as shown by in situ hybridization to rRNA and indirect immunofluorescence with an antibody that binds to Drosophila nucleoli. The transformed genes were able to partially rescue mutant phenotypes due to a deficiency of rDNA, indicating that the mini-nucleoli were functional
Functional role of a highly repetitive DNA sequence in anchorage of the mouse genome.
Neuer-Nitsche, B; Lu, X N; Werner, D
1988-09-12
The major portion of the eukaryotic genome consists of various categories of repetitive DNA sequences which have been studied with respect to their base compositions, organizations, copy numbers, transcription and species specificities; their biological roles, however, are still unclear. A novel quality of a highly repetitive mouse DNA sequence is described which points to a functional role: All copies (approximately 50,000 per haploid genome) of this DNA sequence reside on genomic Alu I DNA fragments each associated with nuclear polypeptides that are not released from DNA by proteinase K, SDS and phenol extraction. By this quality the repetitive DNA sequence is classified as a member of the sub-set of DNA sequences involved in tight DNA-polypeptide complexes which have been previously shown to be components of the subnuclear structure termed 'nuclear matrix'. From these results it has to be concluded that the repetitive DNA sequence characterized in this report represents or comprises a signal for a large number of site specific attachment points of the mouse genome in the nuclear matrix.
Hatakeyama, T; Hatakeyama, T; Kimura, M
1988-11-21
The complete amino acid sequences of ribosomal proteins L16, L23 and L33 from the archaebacterium Halobacterium marismortui were determined. The sequences were established by manual sequencing of peptides produced with several proteases as well as by cleavage with dilute HCl. Proteins L16, L23 and L33 consist of 119, 154 and 69 amino acid residues, and their molecular masses are 13,538, 16,812 and 7620 Da, respectively. The comparison of their sequences with those of ribosomal proteins from other organisms revealed that L23 and L33 are related to eubacterial ribosomal proteins from Escherichia coli and Bacillus stearothermophilus, while protein L16 was found to be homologous to a eukaryotic ribosomal protein from yeast. These results provide information about the special phylogenetic position of archaebacteria.
Directory of Open Access Journals (Sweden)
E. Coluccia
2011-05-01
Full Text Available Muraenidae is a species-rich family, with relationships among genera and species and taxonomy that have not been completely clarified. Few cytogenetic studies have been conducted on this family, and all of them showed the same diploid chromosome number (2n=42 but with conspicuous karyotypic variation among species. The Mediterranean moray eel Gymnothorax unicolor was previously cytogenetically studied using classical techniques that allowed the characterization of its karyotype structure and the constitutive heterochromatin and argyrophilic nucleolar organizer regions (Ag-NORs distribution pattern. In the present study, we describe two new repetitive elements (called GuMboI and GuDdeI obtained from restricted genomic DNA of G. unicolor that were characterized by Southern blot and physically localized by in situ hybridization on metaphase chromosomes. As they are highly repetitive DNA sequences, they map in heterochromatic regions. However, while GuDdeI was localized in the centromeric regions, the GuMboI fraction was distributed on some centromeres and was co-localized with the nucleolus organizer region (NOR. Comparative analysis with other Mediterranean species such as Muraena helena pointed out that these DNA fractions are species-specific and could potentially be used for species discrimination. As a new contribution to the karyotype of this species, we found that the major ribosomal genes are localized on acrocentric chromosome 9 and that the telomeres of each chromosome are composed of a tandem repeat derived from a poly-TTAGGG DNA sequence, as it occurs in most vertebrate species. The results obtained add new information useful in comparative genomics at the chromosomal level and contribute to the cytogenetic knowledge regarding this fish family, which has not been extensively studied.
Capillary gel electrophoresis for rapid, high resolution DNA sequencing.
Swerdlow, H; Gesteland, R
1990-01-01
Capillary gel electrophoresis has been demonstrated for the separation and detection of DNA sequencing samples. Enzymatic dideoxy nucleotide chain termination was employed, using fluorescently tagged oligonucleotide primers and laser based on-column detection (limit of detection is 6,000 molecules per peak). Capillary gel separations were shown to be three times faster, with better resolution (2.4 x), and higher separation efficiency (5.4 x) than a conventional automated slab gel DNA sequenci...
Noninvasive prenatal paternity testing (NIPAT) through maternal plasma DNA sequencing
DEFF Research Database (Denmark)
Jiang, Haojun; Xie, Yifan; Li, Xuchao
2016-01-01
developed a noninvasive prenatal paternity testing (NIPAT) based on SNP typing with maternal plasma DNA sequencing. We evaluated the influence factors (minor allele frequency (MAF), the number of total SNP, fetal fraction and effective sequencing depth) and designed three different selective SNP panels......Short tandem repeats (STRs) and single nucleotide polymorphisms (SNPs) have been already used to perform noninvasive prenatal paternity testing from maternal plasma DNA. The frequently used technologies were PCR followed by capillary electrophoresis and SNP typing array, respectively. Here, we...... paternity test using STR multiplex system. Our study here proved that the maternal plasma DNA sequencing-based technology is feasible and accurate in determining paternity, which may provide an alternative in forensic application in the future....
Method for priming and DNA sequencing
Energy Technology Data Exchange (ETDEWEB)
Mugasimangalam, R.C.; Ulanovsky, L.E.
1997-12-01
A method is presented for improving the priming specificity of an oligonucleotide primer that is non-unique in a nucleic acid template which includes selecting a continuous stretch of several nucleotides in the template DNA where one of the four bases does not occur in the stretch. This also includes bringing the template DNA in contract with a non-unique primer partially or fully complimentary to the sequence immediately upstream of the selected sequence stretch. This results in polymerase-mediated differential extension of the primer in the presence of a subset of deoxyribonucleotide triphosphates that does not contain the base complementary to the base absent in the selected sequence stretch. These reactions occur at a temperature sufficiently low for allowing the extension of the non-unique primer. The method causes polymerase-mediated extension reactions in the presence of all four natural deoxyribonucleotide triphosphates or modifications. At this high temperature discrimination occurs against priming sites of the non-unique primer where the differential extension has not made the primer sufficiently stable to prime. However, the primer extended at the selected stretch is sufficiently stable to prime.
Khan, Mohammad Ibrahim; Sheel, Chotan
2013-01-01
Storage of sequence data is a big concern as the amount of data generated is exponential in nature at several locations. Therefore, there is a need to develop techniques to store data using compression algorithm. Here we describe optimal storage algorithm (OPTSDNA) for storing large amount of DNA sequences of varying length. This paper provides performance analysis of optimal storage algorithm (OPTSDNA) of a distributed bioinformatics computing system for analysis of DNA sequences. OPTSDNA algorithm is used for storing various sizes of DNA sequences into database. DNA sequences of different lengths were stored by using this algorithm. These input DNA sequences are varied in size from very small to very large. Storage size is calculated by this algorithm. Response time is also calculated in this work. The efficiency and performance of the algorithm is high (in size calculation with percentage) when compared with other known with sequential approach.
The cDNA sequence of a neutral horseradish peroxidase.
Bartonek-Roxå, E; Eriksson, H; Mattiasson, B
1991-02-16
A cDNA clone encoding a horseradish (Armoracia rusticana) peroxidase has been isolated and characterized. The cDNA contains 1378 nucleotides excluding the poly(A) tail and the deduced protein contains 327 amino acids which includes a 28 amino acid leader sequence. The predicted amino acid sequence is nine amino acids shorter than the major isoenzyme belonging to the horseradish peroxidase C group (HRP-C) and the sequence shows 53.7% identity with this isoenzyme. The described clone encodes nine cysteines of which eight correspond well with the cysteines found in HRP-C. Five potential N-glycosylation sites with the general sequence Asn-X-Thr/Ser are present in the deduced sequence. Compared to the earlier described HRP-C this is three glycosylation sites less. The shorter sequence and fewer N-glycosylation sites give the native isoenzyme a molecular weight of several thousands less than the horseradish peroxidase C isoenzymes. Comparison with the net charge value of HRP-C indicates that the described cDNA clone encodes a peroxidase which has either the same or a slightly less basic pI value, depending on whether the encoded protein is N-terminally blocked or not. This excludes the possibility that HRP-n could belong to either the HRP-A, -D or -E groups. The low sequence identity (53.7%) with HRP-C indicates that the described clone does not belong to the HRP-C isoenzyme group and comparison of the total amino acid composition with the HRP-B group does not place the described clone within this isoenzyme group. Our conclusion is that the described cDNA clone encodes a neutral horseradish peroxidase which belongs to a new, not earlier described, horseradish peroxidase group.
D.J. Glass; N. Takebayashi; L. Olson; D.L. Taylor
2013-01-01
The number of sequences from both formally described taxa and uncultured environmental DNA deposited in the International Nucleotide Sequence Databases has increased substantially over the last two decades. Although the majority of these sequences represent authentic gene copies, there is evidence of DNA artifacts in these databases as well. These include lab artifacts...
Real sequence effects on the search dynamics of transcription factors on DNA
DEFF Research Database (Denmark)
Bauer, Maximilian; Rasmussen, Emil S.; Lomholt, Michael A.
2015-01-01
Recent experiments show that transcription factors (TFs) indeed use the facilitated diffusion mechanism to locate their target sequences on DNA in living bacteria cells: TFs alternate between sliding motion along DNA and relocation events through the cytoplasm. From simulations and theoretical...... analysis we study the TF-sliding motion for a large section of the DNA-sequence of a common E. coli strain, based on the two-state TF-model with a fast-sliding search state and a recognition state enabling target detection. For the probability to detect the target before dissociating from DNA the TF...... on the underlying nucleotide sequence is varied. A moderate dependence maximises the capability to distinguish between the main operator and similar sequences. Moreover, these auxiliary operators serve as starting points for DNA looping with the main operator, yielding a spectrum of target detection times spanning...
High-Throughput Analysis of T-DNA Location and Structure Using Sequence Capture.
Inagaki, Soichi; Henry, Isabelle M; Lieberman, Meric C; Comai, Luca
2015-01-01
Agrobacterium-mediated transformation of plants with T-DNA is used both to introduce transgenes and for mutagenesis. Conventional approaches used to identify the genomic location and the structure of the inserted T-DNA are laborious and high-throughput methods using next-generation sequencing are being developed to address these problems. Here, we present a cost-effective approach that uses sequence capture targeted to the T-DNA borders to select genomic DNA fragments containing T-DNA-genome junctions, followed by Illumina sequencing to determine the location and junction structure of T-DNA insertions. Multiple probes can be mixed so that transgenic lines transformed with different T-DNA types can be processed simultaneously, using a simple, index-based pooling approach. We also developed a simple bioinformatic tool to find sequence read pairs that span the junction between the genome and T-DNA or any foreign DNA. We analyzed 29 transgenic lines of Arabidopsis thaliana, each containing inserts from 4 different T-DNA vectors. We determined the location of T-DNA insertions in 22 lines, 4 of which carried multiple insertion sites. Additionally, our analysis uncovered a high frequency of unconventional and complex T-DNA insertions, highlighting the needs for high-throughput methods for T-DNA localization and structural characterization. Transgene insertion events have to be fully characterized prior to use as commercial products. Our method greatly facilitates the first step of this characterization of transgenic plants by providing an efficient screen for the selection of promising lines.
Sequence-based prediction of protein-binding sites in DNA: comparative study of two SVM models.
Park, Byungkyu; Im, Jinyong; Tuvshinjargal, Narankhuu; Lee, Wook; Han, Kyungsook
2014-11-01
As many structures of protein-DNA complexes have been known in the past years, several computational methods have been developed to predict DNA-binding sites in proteins. However, its inverse problem (i.e., predicting protein-binding sites in DNA) has received much less attention. One of the reasons is that the differences between the interaction propensities of nucleotides are much smaller than those between amino acids. Another reason is that DNA exhibits less diverse sequence patterns than protein. Therefore, predicting protein-binding DNA nucleotides is much harder than predicting DNA-binding amino acids. We computed the interaction propensity (IP) of nucleotide triplets with amino acids using an extensive dataset of protein-DNA complexes, and developed two support vector machine (SVM) models that predict protein-binding nucleotides from sequence data alone. One SVM model predicts protein-binding nucleotides using DNA sequence data alone, and the other SVM model predicts protein-binding nucleotides using both DNA and protein sequences. In a 10-fold cross-validation with 1519 DNA sequences, the SVM model that uses DNA sequence data only predicted protein-binding nucleotides with an accuracy of 67.0%, an F-measure of 67.1%, and a Matthews correlation coefficient (MCC) of 0.340. With an independent dataset of 181 DNAs that were not used in training, it achieved an accuracy of 66.2%, an F-measure 66.3% and a MCC of 0.324. Another SVM model that uses both DNA and protein sequences achieved an accuracy of 69.6%, an F-measure of 69.6%, and a MCC of 0.383 in a 10-fold cross-validation with 1519 DNA sequences and 859 protein sequences. With an independent dataset of 181 DNAs and 143 proteins, it showed an accuracy of 67.3%, an F-measure of 66.5% and a MCC of 0.329. Both in cross-validation and independent testing, the second SVM model that used both DNA and protein sequence data showed better performance than the first model that used DNA sequence data. To the best of
Choi, In-Wook; Kim, Hwang-Yong; Quan, Juan-Hua; Ryu, Jae-Gee; Sun, Rubing; Lee, Young-Ha
2015-10-01
Fascioliasis, a food-borne trematode zoonosis, is a disease primarily in cattle and sheep and occasionally in humans. Water dropwort (Oenanthe javanica), an aquatic perennial herb, is a common second intermediate host of Fasciola, and the fresh stems and leaves are widely used as a seasoning in the Korean diet. However, no information regarding Fasciola species contamination in water dropwort is available. Here, we collected 500 samples of water dropwort in 3 areas in Korea during February and March 2015, and the water dropwort contamination of Fasciola species was monitored by DNA sequencing analysis of the Fasciola hepatica and Fasciola gigantica specific mitochondrial cytochrome c oxidase subunit 1 (cox1) and nuclear ribosomal internal transcribed spacer 2 (ITS-2). Among the 500 samples assessed, the presence of F. hepatica cox1 and 1TS-2 markers were detected in 2 samples, and F. hepatica contamination was confirmed by sequencing analysis. The nucleotide sequences of cox1 PCR products from the 2 F. hepatica-contaminated samples were 96.5% identical to the F. hepatica cox1 sequences in GenBank, whereas F. gigantica cox1 sequences were 46.8% similar with the sequence detected from the cox1 positive samples. However, F. gigantica cox1 and ITS-2 markers were not detected by PCR in the 500 samples of water dropwort. Collectively, in this survey of the water dropwort contamination with Fasciola species, very low prevalence of F. hepatica contamination was detected in the samples.
cDNA sequences of two inducible T-cell genes
Energy Technology Data Exchange (ETDEWEB)
Kwon, B.S. (Indiana Univ. School of Medicine, Indianapolis (USA) Guthrie Research Institute, Sayre, PA (USA)); Weissman, S.M. (Yale Univ., New Haven, CT (USA))
1989-03-01
The authors have previously described a set of human T-lymphocyte-specific cDNA clones isolated by a modified differential screening procedure. Apparent full-length cDNAs containing the sequences of 14 of the 16 initial isolates were sequenced and were found to represent five different species of mRNA; three of the five species were identical to previously reported cDNA sequences of preproenkephalin, T-cell-replacing factor, and a serine esterase, respectively. The other two species, 4-1BB and L2G25B, were inducible sequences found in mRNA from both a cytolytic T-lymphocyte and a helper T-lymphocyte clone and were not previously described in T-cell mRNA; these mRNA sequences encode peptides of 256 and 92 amino acids, respectively. Both peptides contain putative leader sequences. The protein encoded by 4-1BB also has a potential membrane anchor segment and other features also seen in known receptor proteins.
Perina, Alejandra; Seoane, David; González-Tizón, Ana M; Rodríguez-Fariña, Fernanda; Martínez-Lage, Andrés
2011-10-17
The 5S ribosomal DNA (5S rDNA) is organized in tandem arrays with repeat units that consist of a transcribing region (5S) and a variable nontranscribed spacer (NTS), in higher eukaryotes. Until recently the 5S rDNA was thought to be subject to concerted evolution, however, in several taxa, sequence divergence levels between the 5S and the NTS were found higher than expected under this model. So, many studies have shown that birth-and-death processes and selection can drive the evolution of 5S rDNA. In analyses of 5S rDNA evolution is found several 5S rDNA types in the genome, with low levels of nucleotide variation in the 5S and a spacer region highly divergent. Molecular organization and nucleotide sequence of the 5S ribosomal DNA multigene family (5S rDNA) were investigated in three Pollicipes species in an evolutionary context. The nucleotide sequence variation revealed that several 5S rDNA variants occur in Pollicipes genomes. They are clustered in up to seven different types based on differences in their nontranscribed spacers (NTS). Five different units of 5S rDNA were characterized in P. pollicipes and two different units in P. elegans and P. polymerus. Analysis of these sequences showed that identical types were shared among species and that two pseudogenes were present. We predicted the secondary structure and characterized the upstream and downstream conserved elements. Phylogenetic analysis showed an among-species clustering pattern of 5S rDNA types. These results suggest that the evolution of Pollicipes 5S rDNA is driven by birth-and-death processes with strong purifying selection.
International Nuclear Information System (INIS)
Steenbergh, P.H.
1979-01-01
The purpose of the investigations described is the determination of nucleotide sequences at the molecular ends of the linear adenovirus type 5 DNA. Knowledge of the primary structure at the termini of this DNA molecule is of particular interest in the study of the mechanism of replication of adenovirus DNA. The initiation- and termination sites of adenovirus DNA replication are located at the ends of the DNA molecule. (Auth.)
Bugno-Poniewierska, Monika; Solek, Przemysław; Wronski, Mariusz; Potocki, Leszek; Jezewska-Witkowska, Grażyna; Wnuk, Maciej
2014-12-01
The molecular structure of B chromosomes (Bs) is relatively well studied. Previous research demonstrates that Bs of various species usually contain two types of repetitive DNA sequences, satellite DNA and ribosomal DNA, but Bs also contain genes encoding histone proteins and many others. However, many questions remain regarding the origin and function of these chromosomes. Here, we focused on the comparative cytogenetic characteristics of the red fox and Chinese raccoon dog B chromosomes with particular attention to the distribution of repetitive DNA sequences and their methylation status. We confirmed that the small Bs of the red fox show a typical fluorescent telomeric distal signal, whereas medium-sized Bs of the Chinese raccoon dog were characterized by clusters of telomeric sequences along their length. We also found different DNA methylation patterns for the B chromosomes of both species. Therefore, we concluded that DNA methylation may maintain the transcriptional inactivation of DNA sequences localized to B chromosomes and may prevent genetic unbalancing and several negative phenotypic effects. © 2014 The Authors.
Targeting and tracing of specific DNA sequences with dTALEs in living cells
Thanisch, Katharina; Schneider, Katrin; Morbitzer, Robert; Solovei, Irina; Lahaye, Thomas; Bultmann, Sebastian; Leonhardt, Heinrich
2014-01-01
Epigenetic regulation of gene expression involves, besides DNA and histone modifications, the relative positioning of DNA sequences within the nucleus. To trace specific DNA sequences in living cells, we used programmable sequence-specific DNA binding of designer transcription activator-like effectors (dTALEs). We designed a recombinant dTALE (msTALE) with variable repeat domains to specifically bind a 19-bp target sequence of major satellite DNA. The msTALE was fused with green fluorescent protein (GFP) and stably expressed in mouse embryonic stem cells. Hybridization with a major satellite probe (3D-fluorescent in situ hybridization) and co-staining for known cellular structures confirmed in vivo binding of the GFP-msTALE to major satellite DNA present at nuclear chromocenters. Dual tracing of major satellite DNA and the replication machinery throughout S-phase showed co-localization during mid to late S-phase, directly demonstrating the late replication timing of major satellite DNA. Fluorescence bleaching experiments indicated a relatively stable but still dynamic binding, with mean residence times in the range of minutes. Fluorescently labeled dTALEs open new perspectives to target and trace DNA sequences and to monitor dynamic changes in subnuclear positioning as well as interactions with functional nuclear structures during cell cycle progression and cellular differentiation. PMID:24371265
Targeting and tracing of specific DNA sequences with dTALEs in living cells.
Thanisch, Katharina; Schneider, Katrin; Morbitzer, Robert; Solovei, Irina; Lahaye, Thomas; Bultmann, Sebastian; Leonhardt, Heinrich
2014-04-01
Epigenetic regulation of gene expression involves, besides DNA and histone modifications, the relative positioning of DNA sequences within the nucleus. To trace specific DNA sequences in living cells, we used programmable sequence-specific DNA binding of designer transcription activator-like effectors (dTALEs). We designed a recombinant dTALE (msTALE) with variable repeat domains to specifically bind a 19-bp target sequence of major satellite DNA. The msTALE was fused with green fluorescent protein (GFP) and stably expressed in mouse embryonic stem cells. Hybridization with a major satellite probe (3D-fluorescent in situ hybridization) and co-staining for known cellular structures confirmed in vivo binding of the GFP-msTALE to major satellite DNA present at nuclear chromocenters. Dual tracing of major satellite DNA and the replication machinery throughout S-phase showed co-localization during mid to late S-phase, directly demonstrating the late replication timing of major satellite DNA. Fluorescence bleaching experiments indicated a relatively stable but still dynamic binding, with mean residence times in the range of minutes. Fluorescently labeled dTALEs open new perspectives to target and trace DNA sequences and to monitor dynamic changes in subnuclear positioning as well as interactions with functional nuclear structures during cell cycle progression and cellular differentiation.
Directory of Open Access Journals (Sweden)
Moore JE
2006-01-01
Full Text Available Abstract Background At present, six accessible sequences of 16S rDNA from Taylorella equigenitalis (T. equigenitalis are available, whose sequence differences occur at a few nucleotide positions. Thus it is important to determine these sequences from additional strains in other countries, if possible, in order to clarify any anomalies regarding 16S rDNA sequence heterogeneity. Here, we clone and sequence the approximate full-length 16S rDNA from additional strains of T. equigenitalis isolated in Japan, Australia and France and compare these sequences to the existing published sequences. Results Clarification of any anomalies regarding 16S rDNA sequence heterogeneity of T. equigenitalis was carried out. When cloning, sequencing and comparison of the approximate full-length 16S rDNA from 17 strains of T. equigenitalis isolated in Japan, Australia and France, nucleotide sequence differences were demonstrated at the six loci in the 1,469 nucleotide sequence. Moreover, 12 polymorphic sites occurred among 23 sequences of the 16S rDNA, including the six reference sequences. Conclusion High sequence similarity (99.5% or more was observed throughout, except from nucleotide positions 138 to 501 where substitutions and deletions were noted.
Matsuda, M; Tazumi, A; Kagawa, S; Sekizuka, T; Murayama, O; Moore, JE; Millar, BC
2006-01-01
Background At present, six accessible sequences of 16S rDNA from Taylorella equigenitalis (T. equigenitalis) are available, whose sequence differences occur at a few nucleotide positions. Thus it is important to determine these sequences from additional strains in other countries, if possible, in order to clarify any anomalies regarding 16S rDNA sequence heterogeneity. Here, we clone and sequence the approximate full-length 16S rDNA from additional strains of T. equigenitalis isolated in Japan, Australia and France and compare these sequences to the existing published sequences. Results Clarification of any anomalies regarding 16S rDNA sequence heterogeneity of T. equigenitalis was carried out. When cloning, sequencing and comparison of the approximate full-length 16S rDNA from 17 strains of T. equigenitalis isolated in Japan, Australia and France, nucleotide sequence differences were demonstrated at the six loci in the 1,469 nucleotide sequence. Moreover, 12 polymorphic sites occurred among 23 sequences of the 16S rDNA, including the six reference sequences. Conclusion High sequence similarity (99.5% or more) was observed throughout, except from nucleotide positions 138 to 501 where substitutions and deletions were noted. PMID:16398935
The linked units of 5S rDNA and U1 snDNA of razor shells (Mollusca: Bivalvia: Pharidae).
Vierna, J; Jensen, K T; Martínez-Lage, A; González-Tizón, A M
2011-08-01
The linkage between 5S ribosomal DNA and other multigene families has been detected in many eukaryote lineages, but whether it provides any selective advantage remains unclear. In this work, we report the occurrence of linked units of 5S ribosomal DNA (5S rDNA) and U1 small nuclear DNA (U1 snDNA) in 10 razor shell species (Mollusca: Bivalvia: Pharidae) from four different genera. We obtained several clones containing partial or complete repeats of both multigene families in which both types of genes displayed the same orientation. We provide a comprehensive collection of razor shell 5S rDNA clones, both with linked and nonlinked organisation, and the first bivalve U1 snDNA sequences. We predicted the secondary structures and characterised the upstream and downstream conserved elements, including a region at -25 nucleotides from both 5S rDNA and U1 snDNA transcription start sites. The analysis of 5S rDNA showed that some nontranscribed spacers (NTSs) are more closely related to NTSs from other species (and genera) than to NTSs from the species they were retrieved from, suggesting birth-and-death evolution and ancestral polymorphism. Nucleotide conservation within the functional regions suggests the involvement of purifying selection, unequal crossing-overs and gene conversions. Taking into account this and other studies, we discuss the possible mechanisms by which both multigene families could have become linked in the Pharidae lineage. The reason why 5S rDNA is often found linked to other multigene families seems to be the result of stochastic processes within genomes in which its high copy number is determinant.
Mitochondrial DNA sequence variation in Finnish patients with matrilineal diabetes mellitus
Directory of Open Access Journals (Sweden)
Soini Heidi K
2012-07-01
Full Text Available Abstract Background The genetic background of type 2 diabetes is complex involving contribution by both nuclear and mitochondrial genes. There is an excess of maternal inheritance in patients with type 2 diabetes and, furthermore, diabetes is a common symptom in patients with mutations in mitochondrial DNA (mtDNA. Polymorphisms in mtDNA have been reported to act as risk factors in several complex diseases. Findings We examined the nucleotide variation in complete mtDNA sequences of 64 Finnish patients with matrilineal diabetes. We used conformation sensitive gel electrophoresis and sequencing to detect sequence variation. We analysed the pathogenic potential of nonsynonymous variants detected in the sequences and examined the role of the m.16189 T>C variant. Controls consisted of non-diabetic subjects ascertained in the same population. The frequency of mtDNA haplogroup V was 3-fold higher in patients with diabetes. Patients harboured many nonsynonymous mtDNA substitutions that were predicted to be possibly or probably damaging. Furthermore, a novel m.13762 T>G in MTND5 leading to p.Ser476Ala and several rare mtDNA variants were found. Haplogroup H1b harbouring m.16189 T > C and m.3010 G > A was found to be more frequent in patients with diabetes than in controls. Conclusions Mildly deleterious nonsynonymous mtDNA variants and rare population-specific haplotypes constitute genetic risk factors for maternally inherited diabetes.
Huang, Chien-Hsun; Lee, Fwu-Ling; Liou, Jong-Shian
2010-03-01
The Lactobacillus plantarum group comprises five very closely related species. Some species of this group are considered to be probiotic and widely applied in the food industry. In this study, we compared the use of two different molecular markers, the 16S rRNA and dnaK gene, for discriminating phylogenetic relationships amongst L. plantarum strains using sequencing and DNA fingerprinting. The average sequence similarity for the dnaK gene (89.2%) among five type strains was significantly less than that for the 16S rRNA (99.4%). This result demonstrates that the dnaK gene sequence provided higher resolution than the 16S rRNA and suggests that the dnaK could be used as an additional phylogenetic marker for L. plantarum. Species-specific profiles of the Lactobacillus strains were obtained with RAPD and RFLP methods. Our data indicate that phylogenetic relationships between these strains are easily resolved using sequencing of the dnaK gene or DNA fingerprinting assays.
The nucleotide sequence of human transition protein 1 cDNA
Energy Technology Data Exchange (ETDEWEB)
Luerssen, H; Hoyer-Fender, S; Engel, W [Universitaet Goettingen (West Germany)
1988-08-11
The authors have screened a human testis cDNA library with an oligonucleotide of 81 mer prepared according to a part of the published nucleotide sequence of the rat transition protein TP 1. They have isolated a cDNA clone with the length of 441 bp containing the coding region of 162 bp for human transition protein 1. There is about 84% homology in the coding region of the sequence compared to rat. The human cDNA-clone encodes a polypeptide of 54 amino acids of which 7 are different to that of rat.
Kuznedelov, K D; Timoshkin, O A
1995-01-01
Polymerase chain reaction and direct sequencing of the 5'-end region of the 18S ribosomal RNA gene were used to infer phylogenetic relationship among turbellarian flatworms from Lake Baikal. Representatives of 5 orders (Tricladida--10 spp., Lecithoepitheliata--5 spp., Prolecithophora--3 spp., Proseriata and Kalyptorhynchia one for each) were studied; nucleotide sequence of more than 340 nucleotides was determined for each species. Consensus sequence for each order having more than one representative species was determined. Distance matrix and maximum parsimony approaches were applied to infer phylogenies. Bootstrap procedure was used to estimate confidence limits, at the 100% level by bootstrapping, the group of three orders: Kalyptorhynchia, Proseriata and Lecithoepitheliata was found to be monophyletic. However, subsets inside the group had no significant support to be preferred or rejected. Our data do not support traditional systematics which joins two suborders Tricladida and Proseriata into the single order Seriata, and also do not support comparative anatomical data which show close relationship of Lecithoepitheliata and lower Prolecithophora.
Diverse Regulators of Human Ribosome Biogenesis Discovered by Changes in Nucleolar Number
Directory of Open Access Journals (Sweden)
Katherine I. Farley-Barnes
2018-02-01
Full Text Available Ribosome biogenesis is a highly regulated, essential cellular process. Although studies in yeast have established some of the biological principles of ribosome biogenesis, many of the intricacies of its regulation in higher eukaryotes remain unknown. To understand how ribosome biogenesis is globally integrated in human cells, we conducted a genome-wide siRNA screen for regulators of nucleolar number. We found 139 proteins whose depletion changed the number of nucleoli per nucleus from 2–3 to only 1 in human MCF10A cells. Follow-up analyses on 20 hits found many (90% to be essential for the nucleolar functions of rDNA transcription (7, pre-ribosomal RNA (pre-rRNA processing (16, and/or global protein synthesis (14. This genome-wide analysis exploits the relationship between nucleolar number and function to discover diverse cellular pathways that regulate the making of ribosomes and paves the way for further exploration of the links between ribosome biogenesis and human disease.
Thermus Thermophilus as a Model System for the Study of Ribosomal Antibiotic Resistance
Gregory, Steven T.
2018-03-01
Ribosomes are the intracellular ribonucleoprotein machines responsible for the translation of mRNA sequence into protein sequence. As an essential cell component, the ribosome is the target of numerous antibiotics that bind to critical functional sites to impair protein synthesis. Mutations causing resistance to antibiotics arise in antibiotic binding sites, and an understanding of the basis of resistance will be an essential component of efforts to develop new antibiotics by rational drug design. We have identified a number of antibiotic-resistance mutations in ribosomal genes of the thermophilic bacterium Thermus thermophilus. This species offers two primary advantages for examining the structural basis of antibiotic-resistance, in particular, its potential for genetic manipulation and the suitability of its ribosomes for analysis by X-ray crystallography. Mutations we have identified in this organism are in many instances identical to those found in other bacterial species, including important pathogens, a result of the extreme conservation of ribosome functional sites. Here I summarize the advantages of this organism as a model system to study antibiotic-resistance mechanisms at the molecular level.
Van den Eynde, H.; De Baere, R.; Shah, H. N.; Gharbia, S. E.; Fox, G. E.; Michalik, J.; Van de Peer, Y.; De Wachter, R.
1989-01-01
The 5S ribosomal ribonucleic acid (rRNA) sequences were determined for Bacteroides fragilis, Bacteroides thetaiotaomicron, Bacteroides capillosus, Bacteroides veroralis, Porphyromonas gingivalis, Anaerorhabdus furcosus, Fusobacterium nucleatum, Fusobacterium mortiferum, and Fusobacterium varium. A dendrogram constructed by a clustering algorithm from these sequences, which were aligned with all other hitherto known eubacterial 5S rRNA sequences, showed differences as well as similarities with respect to results derived from 16S rRNA analyses. In the 5S rRNA dendrogram, Bacteroides clustered together with Cytophaga and Fusobacterium, as in 16S rRNA analyses. Intraphylum relationships deduced from 5S rRNAs suggested that Bacteroides is specifically related to Cytophaga rather than to Fusobacterium, as was suggested by 16S rRNA analyses. Previous taxonomic considerations concerning the genus Bacteroides, based on biochemical and physiological data, were confirmed by the 5S rRNA sequence analysis.
Scalable whole-exome sequencing of cell-free DNA reveals high concordance with metastatic tumors.
Adalsteinsson, Viktor A; Ha, Gavin; Freeman, Samuel S; Choudhury, Atish D; Stover, Daniel G; Parsons, Heather A; Gydush, Gregory; Reed, Sarah C; Rotem, Denisse; Rhoades, Justin; Loginov, Denis; Livitz, Dimitri; Rosebrock, Daniel; Leshchiner, Ignaty; Kim, Jaegil; Stewart, Chip; Rosenberg, Mara; Francis, Joshua M; Zhang, Cheng-Zhong; Cohen, Ofir; Oh, Coyin; Ding, Huiming; Polak, Paz; Lloyd, Max; Mahmud, Sairah; Helvie, Karla; Merrill, Margaret S; Santiago, Rebecca A; O'Connor, Edward P; Jeong, Seong H; Leeson, Rachel; Barry, Rachel M; Kramkowski, Joseph F; Zhang, Zhenwei; Polacek, Laura; Lohr, Jens G; Schleicher, Molly; Lipscomb, Emily; Saltzman, Andrea; Oliver, Nelly M; Marini, Lori; Waks, Adrienne G; Harshman, Lauren C; Tolaney, Sara M; Van Allen, Eliezer M; Winer, Eric P; Lin, Nancy U; Nakabayashi, Mari; Taplin, Mary-Ellen; Johannessen, Cory M; Garraway, Levi A; Golub, Todd R; Boehm, Jesse S; Wagle, Nikhil; Getz, Gad; Love, J Christopher; Meyerson, Matthew
2017-11-06
Whole-exome sequencing of cell-free DNA (cfDNA) could enable comprehensive profiling of tumors from blood but the genome-wide concordance between cfDNA and tumor biopsies is uncertain. Here we report ichorCNA, software that quantifies tumor content in cfDNA from 0.1× coverage whole-genome sequencing data without prior knowledge of tumor mutations. We apply ichorCNA to 1439 blood samples from 520 patients with metastatic prostate or breast cancers. In the earliest tested sample for each patient, 34% of patients have ≥10% tumor-derived cfDNA, sufficient for standard coverage whole-exome sequencing. Using whole-exome sequencing, we validate the concordance of clonal somatic mutations (88%), copy number alterations (80%), mutational signatures, and neoantigens between cfDNA and matched tumor biopsies from 41 patients with ≥10% cfDNA tumor content. In summary, we provide methods to identify patients eligible for comprehensive cfDNA profiling, revealing its applicability to many patients, and demonstrate high concordance of cfDNA and metastatic tumor whole-exome sequencing.
High-Throughput Analysis of T-DNA Location and Structure Using Sequence Capture.
Directory of Open Access Journals (Sweden)
Soichi Inagaki
Full Text Available Agrobacterium-mediated transformation of plants with T-DNA is used both to introduce transgenes and for mutagenesis. Conventional approaches used to identify the genomic location and the structure of the inserted T-DNA are laborious and high-throughput methods using next-generation sequencing are being developed to address these problems. Here, we present a cost-effective approach that uses sequence capture targeted to the T-DNA borders to select genomic DNA fragments containing T-DNA-genome junctions, followed by Illumina sequencing to determine the location and junction structure of T-DNA insertions. Multiple probes can be mixed so that transgenic lines transformed with different T-DNA types can be processed simultaneously, using a simple, index-based pooling approach. We also developed a simple bioinformatic tool to find sequence read pairs that span the junction between the genome and T-DNA or any foreign DNA. We analyzed 29 transgenic lines of Arabidopsis thaliana, each containing inserts from 4 different T-DNA vectors. We determined the location of T-DNA insertions in 22 lines, 4 of which carried multiple insertion sites. Additionally, our analysis uncovered a high frequency of unconventional and complex T-DNA insertions, highlighting the needs for high-throughput methods for T-DNA localization and structural characterization. Transgene insertion events have to be fully characterized prior to use as commercial products. Our method greatly facilitates the first step of this characterization of transgenic plants by providing an efficient screen for the selection of promising lines.
Food Fish Identification from DNA Extraction through Sequence Analysis
Hallen-Adams, Heather E.
2015-01-01
This experiment exposed 3rd and 4th y undergraduates and graduate students taking a course in advanced food analysis to DNA extraction, polymerase chain reaction (PCR), and DNA sequence analysis. Students provided their own fish sample, purchased from local grocery stores, and the class as a whole extracted DNA, which was then subjected to PCR,…
Directory of Open Access Journals (Sweden)
Raupach Michael J
2010-09-01
Full Text Available Abstract Background The identification of vast numbers of unknown organisms using DNA sequences becomes more and more important in ecological and biodiversity studies. In this context, a fragment of the mitochondrial cytochrome c oxidase I (COI gene has been proposed as standard DNA barcoding marker for the identification of organisms. Limitations of the COI barcoding approach can arise from its single-locus identification system, the effect of introgression events, incomplete lineage sorting, numts, heteroplasmy and maternal inheritance of intracellular endosymbionts. Consequently, the analysis of a supplementary nuclear marker system could be advantageous. Results We tested the effectiveness of the COI barcoding region and of three nuclear ribosomal expansion segments in discriminating ground beetles of Central Europe, a diverse and well-studied invertebrate taxon. As nuclear markers we determined the 18S rDNA: V4, 18S rDNA: V7 and 28S rDNA: D3 expansion segments for 344 specimens of 75 species. Seventy-three species (97% of the analysed species could be accurately identified using COI, while the combined approach of all three nuclear markers provided resolution among 71 (95% of the studied Carabidae. Conclusion Our results confirm that the analysed nuclear ribosomal expansion segments in combination constitute a valuable and efficient supplement for classical DNA barcoding to avoid potential pitfalls when only mitochondrial data are being used. We also demonstrate the high potential of COI barcodes for the identification of even closely related carabid species.
Raupach, Michael J; Astrin, Jonas J; Hannig, Karsten; Peters, Marcell K; Stoeckle, Mark Y; Wägele, Johann-Wolfgang
2010-09-13
The identification of vast numbers of unknown organisms using DNA sequences becomes more and more important in ecological and biodiversity studies. In this context, a fragment of the mitochondrial cytochrome c oxidase I (COI) gene has been proposed as standard DNA barcoding marker for the identification of organisms. Limitations of the COI barcoding approach can arise from its single-locus identification system, the effect of introgression events, incomplete lineage sorting, numts, heteroplasmy and maternal inheritance of intracellular endosymbionts. Consequently, the analysis of a supplementary nuclear marker system could be advantageous. We tested the effectiveness of the COI barcoding region and of three nuclear ribosomal expansion segments in discriminating ground beetles of Central Europe, a diverse and well-studied invertebrate taxon. As nuclear markers we determined the 18S rDNA: V4, 18S rDNA: V7 and 28S rDNA: D3 expansion segments for 344 specimens of 75 species. Seventy-three species (97%) of the analysed species could be accurately identified using COI, while the combined approach of all three nuclear markers provided resolution among 71 (95%) of the studied Carabidae. Our results confirm that the analysed nuclear ribosomal expansion segments in combination constitute a valuable and efficient supplement for classical DNA barcoding to avoid potential pitfalls when only mitochondrial data are being used. We also demonstrate the high potential of COI barcodes for the identification of even closely related carabid species.
Jomaa, Ahmad; Fu, Yu-Hsien Hwang; Boehringer, Daniel; Leibundgut, Marc; Shan, Shu-Ou; Ban, Nenad
2017-05-19
During co-translational protein targeting, the signal recognition particle (SRP) binds to the translating ribosome displaying the signal sequence to deliver it to the SRP receptor (SR) on the membrane, where the signal peptide is transferred to the translocon. Using electron cryo-microscopy, we have determined the structure of a quaternary complex of the translating Escherichia coli ribosome, the SRP-SR in the 'activated' state and the translocon. Our structure, supported by biochemical experiments, reveals that the SRP RNA adopts a kinked and untwisted conformation to allow repositioning of the 'activated' SRP-SR complex on the ribosome. In addition, we observe the translocon positioned through interactions with the SR in the vicinity of the ribosome exit tunnel where the signal sequence is extending beyond its hydrophobic binding groove of the SRP M domain towards the translocon. Our study provides new insights into the mechanism of signal sequence transfer from the SRP to the translocon.
Sproul, John S; Maddison, David R
2017-11-01
Despite advances that allow DNA sequencing of old museum specimens, sequencing small-bodied, historical specimens can be challenging and unreliable as many contain only small amounts of fragmented DNA. Dependable methods to sequence such specimens are especially critical if the specimens are unique. We attempt to sequence small-bodied (3-6 mm) historical specimens (including nomenclatural types) of beetles that have been housed, dried, in museums for 58-159 years, and for which few or no suitable replacement specimens exist. To better understand ideal approaches of sample preparation and produce preparation guidelines, we compared different library preparation protocols using low amounts of input DNA (1-10 ng). We also explored low-cost optimizations designed to improve library preparation efficiency and sequencing success of historical specimens with minimal DNA, such as enzymatic repair of DNA. We report successful sample preparation and sequencing for all historical specimens despite our low-input DNA approach. We provide a list of guidelines related to DNA repair, bead handling, reducing adapter dimers and library amplification. We present these guidelines to facilitate more economical use of valuable DNA and enable more consistent results in projects that aim to sequence challenging, irreplaceable historical specimens. © 2017 John Wiley & Sons Ltd.
Phylogenetic study on Shiraia bambusicola by rDNA sequence analyses.
Cheng, Tian-Fan; Jia, Xiao-Ming; Ma, Xiao-Hang; Lin, Hai-Ping; Zhao, Yu-Hua
2004-01-01
In this study, 18S rDNA and ITS-5.8S rDNA regions of four Shiraia bambusicola isolates collected from different species of bamboos were amplified by PCR with universal primer pairs NS1/NS8 and ITS5/ITS4, respectively, and sequenced. Phylogenetic analyses were conducted on three selected datasets of rDNA sequences. Maximum parsimony, distance and maximum likelihood criteria were used to infer trees. Morphological characteristics were also observed. The positioning of Shiraia in the order Pleosporales was well supported by bootstrap, which agreed with the placement by Amano (1980) according to their morphology. We did not find significant inter-hostal differences among these four isolates from different species of bamboos. From the results of analyses and comparison of their rDNA sequences, we conclude that Shiraia should be classified into Pleosporales as Amano (1980) proposed and suggest that it might be positioned in the family Phaeosphaeriaceae. Copyright 2004 WILEY-VCH Verlag GmbH & Co.
Lin, A; McNally, J; Wool, I G
1983-09-10
The covalent structure of the rat liver 60 S ribosomal subunit protein L37 was determined. Twenty-four tryptic peptides were purified and the sequence of each was established; they accounted for all 111 residues of L37. The sequence of the first 30 residues of L37, obtained previously by automated Edman degradation of the intact protein, provided the alignment of the first 9 tryptic peptides. Three peptides (CN1, CN2, and CN3) were produced by cleavage of protein L37 with cyanogen bromide. The sequence of CN1 (65 residues) was established from the sequence of secondary peptides resulting from cleavage with trypsin and chymotrypsin. The sequence of CN1 in turn served to order tryptic peptides 1 through 14. The sequence of CN2 (15 residues) was determined entirely by a micromanual procedure and allowed the alignment of tryptic peptides 14 through 18. The sequence of the NH2-terminal 28 amino acids of CN3 (31 residues) was determined; in addition the complete sequences of the secondary tryptic and chymotryptic peptides were done. The sequence of CN3 provided the order of tryptic peptides 18 through 24. Thus the sequence of the three cyanogen bromide peptides also accounted for the 111 residues of protein L37. The carboxyl-terminal amino acids were identified after carboxypeptidase A treatment. There is a disulfide bridge between half-cystinyl residues at positions 40 and 69. Rat liver ribosomal protein L37 is homologous with yeast YP55 and with Escherichia coli L34. Moreover, there is a segment of 17 residues in rat L37 that occurs, albeit with modifications, in yeast YP55 and in E. coli S4, L20, and L34.
Spliced DNA Sequences in the Paramecium Germline: Their Properties and Evolutionary Potential
Catania, Francesco; McGrath, Casey L.; Doak, Thomas G.; Lynch, Michael
2013-01-01
Despite playing a crucial role in germline-soma differentiation, the evolutionary significance of developmentally regulated genome rearrangements (DRGRs) has received scant attention. An example of DRGR is DNA splicing, a process that removes segments of DNA interrupting genic and/or intergenic sequences. Perhaps, best known for shaping immune-system genes in vertebrates, DNA splicing plays a central role in the life of ciliated protozoa, where thousands of germline DNA segments are eliminated after sexual reproduction to regenerate a functional somatic genome. Here, we identify and chronicle the properties of 5,286 sequences that putatively undergo DNA splicing (i.e., internal eliminated sequences [IESs]) across the genomes of three closely related species of the ciliate Paramecium (P. tetraurelia, P. biaurelia, and P. sexaurelia). The study reveals that these putative IESs share several physical characteristics. Although our results are consistent with excision events being largely conserved between species, episodes of differential IES retention/excision occur, may have a recent origin, and frequently involve coding regions. Our findings indicate interconversion between somatic—often coding—DNA sequences and noncoding IESs, and provide insights into the role of DNA splicing in creating potentially functional genetic innovation. PMID:23737328
Energy Technology Data Exchange (ETDEWEB)
Hou, Xiaomin; Meehan, Edward J.; Xie, Jieming; Huang, Mingdong; Chen, Minghuang; Chen, Liqing (UAH); (Fujian); (Chinese Aca. Sci.)
2008-10-27
A novel type 1 ribosome-inactivating protein (RIP) designated cucurmosin was isolated from the sarcocarp of Cucurbita moschata (pumpkin). Besides rRNA N-glycosidase activity, cucurmosin exhibits strong cytotoxicities to three cancer cell lines of both human and murine origins, but low toxicity to normal cells. Plant genomic DNA extracted from the tender leaves was amplified by PCR between primers based on the N-terminal sequence and X-ray sequence of the C-terminal. The complete mature protein sequence was obtained from N-terminal protein sequencing and partial DNA sequencing, confirmed by high resolution crystal structure analysis. The crystal structure of cucurmosin has been determined at 1.04 {angstrom}, a resolution that has never been achieved before for any RIP. The structure contains two domains: a large N-terminal domain composed of seven {alpha}-helices and eight {beta}-strands, and a smaller C-terminal domain consisting of three {alpha}-helices and two {beta}-strands. The high resolution structure established a glycosylation pattern of GlcNAc{sub 2}Man3Xyl. Asn225 was identified as a glycosylation site. Residues Tyr70, Tyr109, Glu158 and Arg161 define the active site of cucurmosin as an RNA N-glycosidase. The structural basis of cytotoxicity difference between cucurmosin and trichosanthin is discussed.
RINT-1 interacts with MSP58 within nucleoli and plays a role in ribosomal gene transcription
International Nuclear Information System (INIS)
Yang, Chuan-Pin; Kuo, Yu-Liang; Lee, Yi-Chao; Lee, Kuen-Haur; Chiang, Chi-Wu; Wang, Ju-Ming; Hsu, Che-Chia
2016-01-01
The nucleolus is the cellular site of ribosomal (r)DNA transcription and ribosome biogenesis. The 58-kDa microspherule protein (MSP58) is a nucleolar protein involved in rDNA transcription and cell proliferation. However, regulation of MSP58-mediated rDNA transcription remains unknown. Using a yeast two-hybrid system with MSP58 as bait, we isolated complementary (c)DNA encoding Rad50-interacting protein 1 (RINT-1), as a MSP58-binding protein. RINT-1 was implicated in the cell cycle checkpoint, membrane trafficking, Golgi apparatus and centrosome dynamic integrity, and telomere length control. Both in vitro and in vivo interaction assays showed that MSP58 directly interacts with RINT-1. Interestingly, microscopic studies revealed the co-localization of MSP58, RINT-1, and the upstream binding factor (UBF), a rRNA transcription factor, in the nucleolus. We showed that ectopic expression of MSP58 or RINT-1 resulted in decreased rRNA expression and rDNA promoter activity, whereas knockdown of MSP58 or RINT-1 by siRNA exerted the opposite effect. Coexpression of MSP58 and RINT-1 robustly decreased rRNA synthesis compared to overexpression of either protein alone, whereas depletion of RINT-1 from MSP58-transfected cells enhanced rRNA synthesis. We also found that MSP58, RINT-1, and the UBF were associated with the rDNA promoter using a chromatin immunoprecipitation assay. Because aberrant ribosome biogenesis contributes to neoplastic transformation, our results revealed a novel protein complex involved in the regulation of rRNA gene expression, suggesting a role for MSP58 and RINT-1 in cancer development. - Highlights: • RINT-1 is a novel MSP58-interacting protein. • RINT-1 is a nucleolar protein that suppresses ribosomal RNA gene transcription. • RINT-1 and MSP58 cooperate to suppress ribosomal RNA gene transcription. • RINT-1, MSP58, and UBF form a complex on the rDNA promoter.
Korzeneva, Inna B; Kostuyk, Svetlana V; Ershova, Elizaveta S; Skorodumova, Elena N; Zhuravleva, Veronika F; Pankratova, Galina V; Volkova, Irina V; Stepanova, Elena V; Porokhovnik, Lev N; Veiko, Natalia N
A single exposure to ionizing radiation (IR) results in an elevated cell-free DNA (cfDNA) content in the blood plasma. In this case, the cfDNA concentration can be a marker of the cell death in the organism. However, a chronic exposure to a low-dose IR enhances both the endonuclease activity and titer of antibodies to DNA in blood plasma, resulting in a decrease of the total concentration of circulating cfDNA in exposed people. In this case, the total cfDNA concentration should not be considered as a marker of the cell death in an exposed body. We assumed that a pool of the cfDNA circulating in the exposed people contains DNA fragments, which are resistant to a double-strand break formation in the environment of the elevated plasma endonuclease activity, and can be accumulated in the blood plasma. In order to test this hypothesis, we studied the content of GC-rich sequences (69%GC) of the transcribed region of human ribosomal repeat (rDNA), as well as the content of AT-rich repeat (63%AT) of satellite III (1q12) in the cfDNA samples obtained from 285 individuals. We have found that a chronic exposure to gamma-neutron radiation (N=88) and tritium β-radiation (N=88) evokes an increase of the rDNA content (RrDNA index) and a decrease of the satellite III content (RsatIII index) in the circulating cfDNA as compared with the cfDNA of non-exposed people (N=109). Such index that simultaneously displays both the increase of rDNA content and decrease of satellite III content in the cfDNA (RrDNA/RsatIII) can be recommended as a marker of chronic processes in the body that involve the elevated cell death rate and/or increased blood plasma endonuclease activity. Copyright © 2016 Elsevier B.V. All rights reserved.
Utility of 16S rDNA Sequencing for Identification of Rare Pathogenic Bacteria.
Loong, Shih Keng; Khor, Chee Sieng; Jafar, Faizatul Lela; AbuBakar, Sazaly
2016-11-01
Phenotypic identification systems are established methods for laboratory identification of bacteria causing human infections. Here, the utility of phenotypic identification systems was compared against 16S rDNA identification method on clinical isolates obtained during a 5-year study period, with special emphasis on isolates that gave unsatisfactory identification. One hundred and eighty-seven clinical bacteria isolates were tested with commercial phenotypic identification systems and 16S rDNA sequencing. Isolate identities determined using phenotypic identification systems and 16S rDNA sequencing were compared for similarity at genus and species level, with 16S rDNA sequencing as the reference method. Phenotypic identification systems identified ~46% (86/187) of the isolates with identity similar to that identified using 16S rDNA sequencing. Approximately 39% (73/187) and ~15% (28/187) of the isolates showed different genus identity and could not be identified using the phenotypic identification systems, respectively. Both methods succeeded in determining the species identities of 55 isolates; however, only ~69% (38/55) of the isolates matched at species level. 16S rDNA sequencing could not determine the species of ~20% (37/187) of the isolates. The 16S rDNA sequencing is a useful method over the phenotypic identification systems for the identification of rare and difficult to identify bacteria species. The 16S rDNA sequencing method, however, does have limitation for species-level identification of some bacteria highlighting the need for better bacterial pathogen identification tools. © 2016 Wiley Periodicals, Inc.
ABI Base Recall: Automatic Correction and Ends Trimming of DNA Sequences.
Elyazghi, Zakaria; Yazouli, Loubna El; Sadki, Khalid; Radouani, Fouzia
2017-12-01
Automated DNA sequencers produce chromatogram files in ABI format. When viewing chromatograms, some ambiguities are shown at various sites along the DNA sequences, because the program implemented in the sequencing machine and used to call bases cannot always precisely determine the right nucleotide, especially when it is represented by either a broad peak or a set of overlaying peaks. In such cases, a letter other than A, C, G, or T is recorded, most commonly N. Thus, DNA sequencing chromatograms need manual examination: checking for mis-calls and truncating the sequence when errors become too frequent. The purpose of this paper is to develop a program allowing the automatic correction of these ambiguities. This application is a Web-based program powered by Shiny and runs under R platform for an easy exploitation. As a part of the interface, we added the automatic ends clipping option, alignment against reference sequences, and BLAST. To develop and test our tool, we collected several bacterial DNA sequences from different laboratories within Institut Pasteur du Maroc and performed both manual and automatic correction. The comparison between the two methods was carried out. As a result, we note that our program, ABI base recall, accomplishes good correction with a high accuracy. Indeed, it increases the rate of identity and coverage and minimizes the number of mismatches and gaps, hence it provides solution to sequencing ambiguities and saves biologists' time and labor.
Probing DNA in nanopores via tunneling: from sequencing to ``quantum'' analogies
di Ventra, Massimiliano
2012-02-01
Fast and low-cost DNA sequencing methods would revolutionize medicine: a person could have his/her full genome sequenced so that drugs could be tailored to his/her specific illnesses; doctors could know in advance patients' likelihood to develop a given ailment; cures to major diseases could be found faster [1]. However, this goal of ``personalized medicine'' is hampered today by the high cost and slow speed of DNA sequencing methods. In this talk, I will discuss the sequencing protocol we suggest which requires the measurement of the distributions of transverse currents during the translocation of single-stranded DNA into nanopores [2-5]. I will support our conclusions with a combination of molecular dynamics simulations coupled to quantum mechanical calculations of electrical current in experimentally realizable systems [2-5]. I will also discuss recent experiments that support these theoretical predictions. In addition, I will show how this relatively unexplored area of research at the interface between solids, liquids, and biomolecules at the nanometer length scale is a fertile ground to study quantum phenomena that have a classical counterpart, such as ionic quasi-particles, ionic ``quantized'' conductance [6,7] and Coulomb blockade [8]. Work supported in part by NIH. [4pt] [1] M. Zwolak, M. Di Ventra, Physical Approaches to DNA Sequencing and Detection, Rev. Mod. Phys. 80, 141 (2008).[0pt] [2] M. Zwolak and M. Di Ventra, Electronic signature of DNA nucleotides via transverse transport, Nano Lett. 5, 421 (2005).[0pt] [3] J. Lagerqvist, M. Zwolak, and M. Di Ventra, Fast DNA sequencing via transverse electronic transport, Nano Lett. 6, 779 (2006).[0pt] [4] J. Lagerqvist, M. Zwolak, and M. Di Ventra, Influence of the environment and probes on rapid DNA sequencing via transverse electronic transport, Biophys. J. 93, 2384 (2007).[0pt] [5] M. Krems, M. Zwolak, Y.V. Pershin, and M. Di Ventra, Effect of noise on DNA sequencing via transverse electronic transport
A sequence-dependent rigid-base model of DNA
Gonzalez, O.; Petkevičiutė, D.; Maddocks, J. H.
2013-02-01
A novel hierarchy of coarse-grain, sequence-dependent, rigid-base models of B-form DNA in solution is introduced. The hierarchy depends on both the assumed range of energetic couplings, and the extent of sequence dependence of the model parameters. A significant feature of the models is that they exhibit the phenomenon of frustration: each base cannot simultaneously minimize the energy of all of its interactions. As a consequence, an arbitrary DNA oligomer has an intrinsic or pre-existing stress, with the level of this frustration dependent on the particular sequence of the oligomer. Attention is focussed on the particular model in the hierarchy that has nearest-neighbor interactions and dimer sequence dependence of the model parameters. For a Gaussian version of this model, a complete coarse-grain parameter set is estimated. The parameterized model allows, for an oligomer of arbitrary length and sequence, a simple and explicit construction of an approximation to the configuration-space equilibrium probability density function for the oligomer in solution. The training set leading to the coarse-grain parameter set is itself extracted from a recent and extensive database of a large number of independent, atomic-resolution molecular dynamics (MD) simulations of short DNA oligomers immersed in explicit solvent. The Kullback-Leibler divergence between probability density functions is used to make several quantitative assessments of our nearest-neighbor, dimer-dependent model, which is compared against others in the hierarchy to assess various assumptions pertaining both to the locality of the energetic couplings and to the level of sequence dependence of its parameters. It is also compared directly against all-atom MD simulation to assess its predictive capabilities. The results show that the nearest-neighbor, dimer-dependent model can successfully resolve sequence effects both within and between oligomers. For example, due to the presence of frustration, the model can
A sequence-dependent rigid-base model of DNA.
Gonzalez, O; Petkevičiūtė, D; Maddocks, J H
2013-02-07
A novel hierarchy of coarse-grain, sequence-dependent, rigid-base models of B-form DNA in solution is introduced. The hierarchy depends on both the assumed range of energetic couplings, and the extent of sequence dependence of the model parameters. A significant feature of the models is that they exhibit the phenomenon of frustration: each base cannot simultaneously minimize the energy of all of its interactions. As a consequence, an arbitrary DNA oligomer has an intrinsic or pre-existing stress, with the level of this frustration dependent on the particular sequence of the oligomer. Attention is focussed on the particular model in the hierarchy that has nearest-neighbor interactions and dimer sequence dependence of the model parameters. For a Gaussian version of this model, a complete coarse-grain parameter set is estimated. The parameterized model allows, for an oligomer of arbitrary length and sequence, a simple and explicit construction of an approximation to the configuration-space equilibrium probability density function for the oligomer in solution. The training set leading to the coarse-grain parameter set is itself extracted from a recent and extensive database of a large number of independent, atomic-resolution molecular dynamics (MD) simulations of short DNA oligomers immersed in explicit solvent. The Kullback-Leibler divergence between probability density functions is used to make several quantitative assessments of our nearest-neighbor, dimer-dependent model, which is compared against others in the hierarchy to assess various assumptions pertaining both to the locality of the energetic couplings and to the level of sequence dependence of its parameters. It is also compared directly against all-atom MD simulation to assess its predictive capabilities. The results show that the nearest-neighbor, dimer-dependent model can successfully resolve sequence effects both within and between oligomers. For example, due to the presence of frustration, the model can
RevTrans: multiple alignment of coding DNA from aligned amino acid sequences
DEFF Research Database (Denmark)
Wernersson, Rasmus; Pedersen, Anders Gorm
2003-01-01
The simple fact that proteins are built from 20 amino acids while DNA only contains four different bases, means that the 'signal-to-noise ratio' in protein sequence alignments is much better than in alignments of DNA. Besides this information-theoretical advantage, protein alignments also benefit...... proteins. It is therefore preferable to align coding DNA at the amino acid level and it is for this purpose we have constructed the program RevTrans. RevTrans constructs a multiple DNA alignment by: (i) translating the DNA; (ii) aligning the resulting peptide sequences; and (iii) building a multiple DNA...
Czech Academy of Sciences Publication Activity Database
Brabec, Jan; Kuchta, Roman; Scholz, Tomáš; Littlewood, D. T. J.
2016-01-01
Roč. 46, č. 9 (2016), s. 555-562 ISSN 0020-7519 R&D Projects: GA MŠk(CZ) EE2.3.30.0032; GA ČR GA15-14198S Grant - others:GA MŠk(CZ) LM2010005 Institutional support: RVO:60077344 Keywords : Schyzocotyle acheilognathi * Asian fish tapeworm * Bothriocephalus acheilognathi * invasive parasite * mitochondrial genome * ribosomal RNA * illumina sequencing * phylogeny Subject RIV: EG - Zoology Impact factor: 3.730, year: 2016
Xie, Ping
2015-10-09
Proteins in the cell are synthesized by a ribosome translating the genetic information encoded on the single-stranded messenger RNA (mRNA). It has been shown that the ribosome can also translate through the duplex region of the mRNA by unwinding the duplex. Here, based on our proposed model of the ribosome translation through the mRNA duplex we study theoretically the distribution of dwell times of the ribosome translation through the mRNA duplex under the effect of a pulling force externally applied to the ends of the mRNA to unzip the duplex. We provide quantitative explanations of the available single molecule experimental data on the distribution of dwell times with both short and long durations, on rescuing of the long paused ribosomes by raising the pulling force to unzip the duplex, on translational arrests induced by the mRNA duplex and Shine-Dalgarno(SD)-like sequence in the mRNA. The functional consequences of the pauses or arrests caused by the mRNA duplex and the SD sequence are discussed and compared with those obtained from other types of pausing, such as those induced by "hungry" codons or interactions of specific sequences in the nascent chain with the ribosomal exit tunnel.
1994-08-10
technological advances, especially DNA polymerase chain reaction (peR), molecular cloning and rapid nuc1eotide sequencing. These advances have allowed...containing 0.15% saponin and set on ice for 2· minutes. After washing and centrifugation twice, as described above, the pellets were dissolved in...incubated at 370C for 60 minutes. DNA was further processed by standard procedures [Maniatis et al., 1982]. Briefly, the lysed sample was extracted
Yoshidome, Tomofumi; Endo, Masayuki; Kashiwazaki, Gengo; Hidaka, Kumi; Bando, Toshikazu; Sugiyama, Hiroshi
2012-03-14
We demonstrate a novel strategy for visualizing sequence-selective alkylation of target double-stranded DNA (dsDNA) using a synthetic pyrrole-imidazole (PI) polyamide in a designed DNA origami scaffold. Doubly functionalized PI polyamide was designed by introduction of an alkylating agent 1-(chloromethyl)-5-hydroxy-1,2-dihydro-3H-benz[e]indole (seco-CBI) and biotin for sequence-selective alkylation at the target sequence and subsequent streptavidin labeling, respectively. Selective alkylation of the target site in the substrate DNA was observed by analysis using sequencing gel electrophoresis. For the single-molecule observation of the alkylation by functionalized PI polyamide using atomic force microscopy (AFM), the target position in the dsDNA (∼200 base pairs) was alkylated and then visualized by labeling with streptavidin. Newly designed DNA origami scaffold named "five-well DNA frame" carrying five different dsDNA sequences in its cavities was used for the detailed analysis of the sequence-selectivity and alkylation. The 64-mer dsDNAs were introduced to five individual wells, in which target sequence AGTXCCA/TGGYACT (XY = AT, TA, GC, CG) was employed as fully matched (X = G) and one-base mismatched (X = A, T, C) sequences. The fully matched sequence was alkylated with 88% selectivity over other mismatched sequences. In addition, the PI polyamide failed to attach to the target sequence lacking the alkylation site after washing and streptavidin treatment. Therefore, the PI polyamide discriminated the one mismatched nucleotide at the single-molecule level, and alkylation anchored the PI polyamide to the target dsDNA.
Polyfluorophore Labels on DNA: Dramatic Sequence Dependence of Quenching
Teo, Yin Nah; Wilson, James N.
2010-01-01
We describe studies carried out in the DNA context to test how a common fluorescence quencher, dabcyl, interacts with oligodeoxynu-cleoside fluorophores (ODFs)—a system of stacked, electronically interacting fluorophores built on a DNA scaffold. We tested twenty different tetrameric ODF sequences containing varied combinations and orderings of pyrene (Y), benzopyrene (B), perylene (E), dimethylaminostilbene (D), and spacer (S) monomers conjugated to the 3′ end of a DNA oligomer. Hybridization of this probe sequence to a dabcyl-labeled complementary strand resulted in strong quenching of fluorescence in 85% of the twenty ODF sequences. The high efficiency of quenching was also established by their large Stern–Volmer constants (KSV) of between 2.1 × 104 and 4.3 × 105M−1, measured with a free dabcyl quencher. Interestingly, quenching of ODFs displayed strong sequence dependence. This was particularly evident in anagrams of ODF sequences; for example, the sequence BYDS had a KSV that was approximately two orders of magnitude greater than that of BSDY, which has the same dye composition. Other anagrams, for example EDSY and ESYD, also displayed different responses upon quenching by dabcyl. Analysis of spectra showed that apparent excimer and exciplex emission bands were quenched with much greater efficiency compared to monomer emission bands by at least an order of magnitude. This suggests an important role played by delocalized excited states of the π stack of fluorophores in the amplified quenching of fluorescence. PMID:19780115
Kiraz, Nuri; Oz, Yasemin; Aslan, Huseyin; Muslumanoglu, Hamza
2014-02-01
Since C. dubliniensis is similar to C. albicans phenotypically, it can be misidentified as C. albicans. We aimed to investigate the prevalence of C. dubliniensis among isolates previously identified as C. albicans in our stocks and to compare the phenotypic methods and DNA sequencing of D1/D2 region on the ribosomal large subunit (rLSU) gene. A total of 850 isolates included in this study. Phenotypic identification was performed based on germ tube formation, chlamydospore production, colony colors on chromogenic agar, inability of growth at 45 °C and growth on hypertonic Sabouraud dextrose agar. Eighty isolates compatible with C. dubliniensis by at least one phenotypic test were included in the sequence analysis. Nested PCR amplification of D1/D2 region of the rLSU gene was performed after the fungal DNA extraction by Whatman FTA filter paper technology. The sequencing analysis of PCR products carried out by an automated capillary gel electrophoresis device. The rate of C. dubliniensis was 2.35 % (n = 20) among isolates previously described as C. albicans. Consequently, none of the phenotypic tests provided satisfactory performance alone in our study, and molecular methods required special equipment and high cost. Thus, at least two phenotypic methods can be used for identification of C. dubliniensis, and molecular methods can be used for confirmation.
Templated Chemistry for Sequence-Specific Fluorogenic Detection of Duplex DNA
Li, Hao; Franzini, Raphael M.; Bruner, Christopher; Kool, Eric T.
2015-01-01
We describe the development of templated fluorogenic chemistry for detection of specific sequences of duplex DNA in solution. In this approach, two modified homopyrimidine oligodeoxynucleotide probes are designed to bind by triple helix formation at adjacent positions on a specific purine-rich target sequence of duplex DNA. One fluorescein-labeled probe contains an α-azidoether linker to a fluorescence quencher; the second (trigger) probe carries a triarylphosphine, designed to reduce the azide and cleave the linker. The data showed that at pH 5.6 these probes yielded a strong fluorescence signal within minutes on addition to a complementary homopurine duplex DNA target. The signal increased by a factor of ca. 60, and was completely dependent on the presence of the target DNA. Replacement of cytosine in the probes with pseudoisocytosine allowed the templated chemistry to proceed readily at pH 7. Single nucleotide mismatches in the target oligonucleotide slowed the templated reaction considerably, demonstrating high sequence selectivity. The use of templated fluorogenic chemistry for detection of duplex DNAs has not been previously reported and may allow detection of double stranded DNA, at least for homopurine-homopyrimidine target sites, under native, non-disturbing conditions. PMID:20859985
DNA Extraction Protocols for Whole-Genome Sequencing in Marine Organisms.
Panova, Marina; Aronsson, Henrik; Cameron, R Andrew; Dahl, Peter; Godhe, Anna; Lind, Ulrika; Ortega-Martinez, Olga; Pereyra, Ricardo; Tesson, Sylvie V M; Wrange, Anna-Lisa; Blomberg, Anders; Johannesson, Kerstin
2016-01-01
The marine environment harbors a large proportion of the total biodiversity on this planet, including the majority of the earths' different phyla and classes. Studying the genomes of marine organisms can bring interesting insights into genome evolution. Today, almost all marine organismal groups are understudied with respect to their genomes. One potential reason is that extraction of high-quality DNA in sufficient amounts is challenging for many marine species. This is due to high polysaccharide content, polyphenols and other secondary metabolites that will inhibit downstream DNA library preparations. Consequently, protocols developed for vertebrates and plants do not always perform well for invertebrates and algae. In addition, many marine species have large population sizes and, as a consequence, highly variable genomes. Thus, to facilitate the sequence read assembly process during genome sequencing, it is desirable to obtain enough DNA from a single individual, which is a challenge in many species of invertebrates and algae. Here, we present DNA extraction protocols for seven marine species (four invertebrates, two algae, and a marine yeast), optimized to provide sufficient DNA quality and yield for de novo genome sequencing projects.
Biedka, Stephanie; Micic, Jelena; Wilson, Daniel; Brown, Hailey; Diorio-Toth, Luke; Woolford, John L
2018-04-24
Ribosome biogenesis involves numerous preribosomal RNA (pre-rRNA) processing events to remove internal and external transcribed spacer sequences, ultimately yielding three mature rRNAs. Removal of the internal transcribed spacer 2 spacer RNA is the final step in large subunit pre-rRNA processing and begins with endonucleolytic cleavage at the C 2 site of 27SB pre-rRNA. C 2 cleavage requires the hierarchical recruitment of 11 ribosomal proteins and 14 ribosome assembly factors. However, the function of these proteins in C 2 cleavage remained unclear. In this study, we have performed a detailed analysis of the effects of depleting proteins required for C 2 cleavage and interpreted these results using cryo-electron microscopy structures of assembling 60S subunits. This work revealed that these proteins are required for remodeling of several neighborhoods, including two major functional centers of the 60S subunit, suggesting that these remodeling events form a checkpoint leading to C 2 cleavage. Interestingly, when C 2 cleavage is directly blocked by depleting or inactivating the C 2 endonuclease, assembly progresses through all other subsequent steps. © 2018 Biedka et al.
Directory of Open Access Journals (Sweden)
Md. Rezaul Karim
2012-03-01
Full Text Available Mining interesting patterns from DNA sequences is one of the most challenging tasks in bioinformatics and computational biology. Maximal contiguous frequent patterns are preferable for expressing the function and structure of DNA sequences and hence can capture the common data characteristics among related sequences. Biologists are interested in finding frequent orderly arrangements of motifs that are responsible for similar expression of a group of genes. In order to reduce mining time and complexity, however, most existing sequence mining algorithms either focus on finding short DNA sequences or require explicit specification of sequence lengths in advance. The challenge is to find longer sequences without specifying sequence lengths in advance. In this paper, we propose an efficient approach to mining maximal contiguous frequent patterns from large DNA sequence datasets. The experimental results show that our proposed approach is memory-efficient and mines maximal contiguous frequent patterns within a reasonable time.
Nelson, Leigh A; Wallman, James F; Dowton, Mark
2008-05-20
The identification of forensically important blowflies of the genus Chrysomya (Diptera: Calliphoridae) may be hampered by their close morphological similarities, especially as immatures. In contrast to most previous studies, the utility of a nuclear rather than mitochondrial genetic marker was investigated to solve this problem. The second internal transcribed spacer (ITS2) of ribosomal DNA (rDNA) was amplified and sequenced from all nine Chrysomya species known from Australia. Difficulties encountered with direct sequencing of ITS2 for Chrysomya flavifrons necessitated cloning prior to sequencing for this species, which revealed a low level (0-0.23%) of intraindividual variation. Five restriction enzymes (DraI, BsaXI, BciVI, AseI and HinfI) were identified that were able to differentiate most members of the genus by polymerase chain reaction (PCR) restriction fragment length polymorphism (PCR-RFLP). The PCR-RFLP analysis revealed characteristic restriction profiles for all species except the closely related species pairs Chrysomya latifrons+Chrysomya semimetallica and Chrysomya incisuralis+Chrysomya rufifacies. Ch. incisuralis and Ch. rufifacies were able to be separated using the size differences resulting from amplification of the entire ITS region. The lack of intraspecific ITS2 sequence variation among eight Ch. incisuralis specimens was verified by the identical restriction profiles generated from these specimens. A DNA-based approach, such as PCR-RFLP, has the capacity to be useful for the identification of forensic entomological evidence in cases where morphological characters are unreliable.
DNA sequence+shape kernel enables alignment-free modeling of transcription factor binding.
Ma, Wenxiu; Yang, Lin; Rohs, Remo; Noble, William Stafford
2017-10-01
Transcription factors (TFs) bind to specific DNA sequence motifs. Several lines of evidence suggest that TF-DNA binding is mediated in part by properties of the local DNA shape: the width of the minor groove, the relative orientations of adjacent base pairs, etc. Several methods have been developed to jointly account for DNA sequence and shape properties in predicting TF binding affinity. However, a limitation of these methods is that they typically require a training set of aligned TF binding sites. We describe a sequence + shape kernel that leverages DNA sequence and shape information to better understand protein-DNA binding preference and affinity. This kernel extends an existing class of k-mer based sequence kernels, based on the recently described di-mismatch kernel. Using three in vitro benchmark datasets, derived from universal protein binding microarrays (uPBMs), genomic context PBMs (gcPBMs) and SELEX-seq data, we demonstrate that incorporating DNA shape information improves our ability to predict protein-DNA binding affinity. In particular, we observe that (i) the k-spectrum + shape model performs better than the classical k-spectrum kernel, particularly for small k values; (ii) the di-mismatch kernel performs better than the k-mer kernel, for larger k; and (iii) the di-mismatch + shape kernel performs better than the di-mismatch kernel for intermediate k values. The software is available at https://bitbucket.org/wenxiu/sequence-shape.git. rohs@usc.edu or william-noble@uw.edu. Supplementary data are available at Bioinformatics online. © The Author(s) 2017. Published by Oxford University Press.
Petkevičiūtė, D; Pasi, M; Gonzalez, O; Maddocks, J H
2014-11-10
cgDNA is a package for the prediction of sequence-dependent configuration-space free energies for B-form DNA at the coarse-grain level of rigid bases. For a fragment of any given length and sequence, cgDNA calculates the configuration of the associated free energy minimizer, i.e. the relative positions and orientations of each base, along with a stiffness matrix, which together govern differences in free energies. The model predicts non-local (i.e. beyond base-pair step) sequence dependence of the free energy minimizer. Configurations can be input or output in either the Curves+ definition of the usual helical DNA structural variables, or as a PDB file of coordinates of base atoms. We illustrate the cgDNA package by comparing predictions of free energy minimizers from (a) the cgDNA model, (b) time-averaged atomistic molecular dynamics (or MD) simulations, and (c) NMR or X-ray experimental observation, for (i) the Dickerson-Drew dodecamer and (ii) three oligomers containing A-tracts. The cgDNA predictions are rather close to those of the MD simulations, but many orders of magnitude faster to compute. Both the cgDNA and MD predictions are in reasonable agreement with the available experimental data. Our conclusion is that cgDNA can serve as a highly efficient tool for studying structural variations in B-form DNA over a wide range of sequences. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.
Comparison of microbial DNA enrichment tools for metagenomic whole genome sequencing.
Thoendel, Matthew; Jeraldo, Patricio R; Greenwood-Quaintance, Kerryl E; Yao, Janet Z; Chia, Nicholas; Hanssen, Arlen D; Abdel, Matthew P; Patel, Robin
2016-08-01
Metagenomic whole genome sequencing for detection of pathogens in clinical samples is an exciting new area for discovery and clinical testing. A major barrier to this approach is the overwhelming ratio of human to pathogen DNA in samples with low pathogen abundance, which is typical of most clinical specimens. Microbial DNA enrichment methods offer the potential to relieve this limitation by improving this ratio. Two commercially available enrichment kits, the NEBNext Microbiome DNA Enrichment Kit and the Molzym MolYsis Basic kit, were tested for their ability to enrich for microbial DNA from resected arthroplasty component sonicate fluids from prosthetic joint infections or uninfected sonicate fluids spiked with Staphylococcus aureus. Using spiked uninfected sonicate fluid there was a 6-fold enrichment of bacterial DNA with the NEBNext kit and 76-fold enrichment with the MolYsis kit. Metagenomic whole genome sequencing of sonicate fluid revealed 13- to 85-fold enrichment of bacterial DNA using the NEBNext enrichment kit. The MolYsis approach achieved 481- to 9580-fold enrichment, resulting in 7 to 59% of sequencing reads being from the pathogens known to be present in the samples. These results demonstrate the usefulness of these tools when testing clinical samples with low microbial burden using next generation sequencing. Copyright © 2016 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Sarah M Hykin
Full Text Available For 150 years or more, specimens were routinely collected and deposited in natural history collections without preserving fresh tissue samples for genetic analysis. In the case of most herpetological specimens (i.e. amphibians and reptiles, attempts to extract and sequence DNA from formalin-fixed, ethanol-preserved specimens-particularly for use in phylogenetic analyses-has been laborious and largely ineffective due to the highly fragmented nature of the DNA. As a result, tens of thousands of specimens in herpetological collections have not been available for sequence-based phylogenetic studies. Massively parallel High-Throughput Sequencing methods and the associated bioinformatics, however, are particularly suited to recovering meaningful genetic markers from severely degraded/fragmented DNA sequences such as DNA damaged by formalin-fixation. In this study, we compared previously published DNA extraction methods on three tissue types subsampled from formalin-fixed specimens of Anolis carolinensis, followed by sequencing. Sufficient quality DNA was recovered from liver tissue, making this technique minimally destructive to museum specimens. Sequencing was only successful for the more recently collected specimen (collected ~30 ybp. We suspect this could be due either to the conditions of preservation and/or the amount of tissue used for extraction purposes. For the successfully sequenced sample, we found a high rate of base misincorporation. After rigorous trimming, we successfully mapped 27.93% of the cleaned reads to the reference genome, were able to reconstruct the complete mitochondrial genome, and recovered an accurate phylogenetic placement for our specimen. We conclude that the amount of DNA available, which can vary depending on specimen age and preservation conditions, will determine if sequencing will be successful. The technique described here will greatly improve the value of museum collections by making many formalin-fixed specimens
Hykin, Sarah M; Bi, Ke; McGuire, Jimmy A
2015-01-01
For 150 years or more, specimens were routinely collected and deposited in natural history collections without preserving fresh tissue samples for genetic analysis. In the case of most herpetological specimens (i.e. amphibians and reptiles), attempts to extract and sequence DNA from formalin-fixed, ethanol-preserved specimens-particularly for use in phylogenetic analyses-has been laborious and largely ineffective due to the highly fragmented nature of the DNA. As a result, tens of thousands of specimens in herpetological collections have not been available for sequence-based phylogenetic studies. Massively parallel High-Throughput Sequencing methods and the associated bioinformatics, however, are particularly suited to recovering meaningful genetic markers from severely degraded/fragmented DNA sequences such as DNA damaged by formalin-fixation. In this study, we compared previously published DNA extraction methods on three tissue types subsampled from formalin-fixed specimens of Anolis carolinensis, followed by sequencing. Sufficient quality DNA was recovered from liver tissue, making this technique minimally destructive to museum specimens. Sequencing was only successful for the more recently collected specimen (collected ~30 ybp). We suspect this could be due either to the conditions of preservation and/or the amount of tissue used for extraction purposes. For the successfully sequenced sample, we found a high rate of base misincorporation. After rigorous trimming, we successfully mapped 27.93% of the cleaned reads to the reference genome, were able to reconstruct the complete mitochondrial genome, and recovered an accurate phylogenetic placement for our specimen. We conclude that the amount of DNA available, which can vary depending on specimen age and preservation conditions, will determine if sequencing will be successful. The technique described here will greatly improve the value of museum collections by making many formalin-fixed specimens available for
Hawlitschek, Oliver; Porch, Nick; Hendrich, Lars; Balke, Michael
2011-02-09
DNA sequencing techniques used to estimate biodiversity, such as DNA barcoding, may reveal cryptic species. However, disagreements between barcoding and morphological data have already led to controversy. Species delimitation should therefore not be based on mtDNA alone. Here, we explore the use of nDNA and bioclimatic modelling in a new species of aquatic beetle revealed by mtDNA sequence data. The aquatic beetle fauna of Australia is characterised by high degrees of endemism, including local radiations such as the genus Antiporus. Antiporus femoralis was previously considered to exist in two disjunct, but morphologically indistinguishable populations in south-western and south-eastern Australia. We constructed a phylogeny of Antiporus and detected a deep split between these populations. Diagnostic characters from the highly variable nuclear protein encoding arginine kinase gene confirmed the presence of two isolated populations. We then used ecological niche modelling to examine the climatic niche characteristics of the two populations. All results support the status of the two populations as distinct species. We describe the south-western species as Antiporus occidentalis sp.n. In addition to nDNA sequence data and extended use of mitochondrial sequences, ecological niche modelling has great potential for delineating morphologically cryptic species.
Statistical properties and fractals of nucleotide clusters in DNA sequences
International Nuclear Information System (INIS)
Sun Tingting; Zhang Linxi; Chen Jin; Jiang Zhouting
2004-01-01
Statistical properties of nucleotide clusters in DNA sequences and their fractals are investigated in this paper. The average size of nucleotide clusters in non-coding sequence is larger than that in coding sequence. We investigate the cluster-size distribution P(S) for human chromosomes 21 and 22, and the results are different from previous works. The cluster-size distribution P(S 1 +S 2 ) with the total size of sequential Pu-cluster and Py-cluster S 1 +S 2 is studied. We observe that P(S 1 +S 2 ) follows an exponential decay both in coding and non-coding sequences. However, we get different results for human chromosomes 21 and 22. The probability distribution P(S 1 ,S 2 ) of nucleotide clusters with the size of sequential Pu-cluster and Py-cluster S 1 and S 2 respectively, is also examined. In the meantime, some of the linear correlations are obtained in the double logarithmic plots of the fluctuation F(l) versus nucleotide cluster distance l along the DNA chain. The power spectrums of nucleotide clusters are also discussed, and it is concluded that the curves are flat and hardly changed and the 1/3 frequency is neither observed in coding sequence nor in non-coding sequence. These investigations can provide some insights into the nucleotide clusters of DNA sequences
DEFF Research Database (Denmark)
Kang, Nam Seon; Jeong, Hae Jin; Moestrup, Øjvind
2010-01-01
The mixotrophic dinoflagellate Paragymnodinium shiwhaense n. gen., n. sp. is described from living cells and from cells prepared by light, scanning electron, and transmission electron microscopy. In addition, sequences of the small subunit (SSU) and large subunit (LSU) rDNA and photosynthetic...... extension-like furrow. The cingulum is as wide as 0.2-0.3 x cell length and displaced by 0.2-0.3 x cell length. Cell length and width of live cells fed Amphidinium carterae were 8.4-19.3 and 6.1-16.0 mu m, respectively. Paragymnodinium shiwhaense does not have a nuclear envelope chamber nor a nuclear...... fibrous connective (NFC). Cells contain chloroplasts, nematocysts, trichocysts, and peduncle, though eyespots, pyrenoids, and pusules are absent. The main accessory pigment is peridinin. The sequence of the SSU rDNA of this dinoflagellate (GenBank AM408889) is 4% different from that of Gymnodinium...
DNA interaction with platinum-based cytostatics revealed by DNA sequencing.
Smerkova, Kristyna; Vaculovic, Tomas; Vaculovicova, Marketa; Kynicky, Jindrich; Brtnicky, Martin; Eckschlager, Tomas; Stiborova, Marie; Hubalek, Jaromir; Adam, Vojtech
2017-12-15
The main mechanism of action of platinum-based cytostatic drugs - cisplatin, oxaliplatin and carboplatin - is the formation of DNA cross-links, which restricts the transcription due to the disability of DNA to enter the active site of the polymerase. The polymerase chain reaction (PCR) was employed as a simplified model of the amplification process in the cell nucleus. PCR with fluorescently labelled dideoxynucleotides commonly employed for DNA sequencing was used to monitor the effect of platinum-based cytostatics on DNA in terms of decrease in labeling efficiency dependent on a presence of the DNA-drug cross-link. It was found that significantly different amounts of the drugs - cisplatin (0.21 μg/mL), oxaliplatin (5.23 μg/mL), and carboplatin (71.11 μg/mL) - were required to cause the same quenching effect (50%) on the fluorescent labelling of 50 μg/mL of DNA. Moreover, it was found that even though the amounts of the drugs was applied to the reaction mixture differing by several orders of magnitude, the amount of incorporated platinum, quantified by inductively coupled plasma mass spectrometry, was in all cases at the level of tenths of μg per 5 μg of DNA. Copyright © 2017 Elsevier Inc. All rights reserved.
Bokma, E; Spiering, M; Chow, KS; Mulder, PPMFA; Subroto, T; Beintema, JJ
Hevamine is a chitinase from the rubber tree Hevea brasiliensis and belongs to the family 18 glycosyl hydrolases. This paper describes the cloning of hevamine DNA and cDNA sequences. Hevamine contains a signal peptide at the N-terminus and a putative vacuolar targeting sequence at the C-terminus
Roche genome sequencer FLX based high-throughput sequencing of ancient DNA
DEFF Research Database (Denmark)
Alquezar-Planas, David E; Fordyce, Sarah Louise
2012-01-01
Since the development of so-called "next generation" high-throughput sequencing in 2005, this technology has been applied to a variety of fields. Such applications include disease studies, evolutionary investigations, and ancient DNA. Each application requires a specialized protocol to ensure...... that the data produced is optimal. Although much of the procedure can be followed directly from the manufacturer's protocols, the key differences lie in the library preparation steps. This chapter presents an optimized protocol for the sequencing of fossil remains and museum specimens, commonly referred...
Hollie M. Putnam; Diane K. Adams; Ehud Zelzion; Nicole E. Wagner; Huan Qiu; Tali Mass; Paul G. Falkowski; Ruth D. Gates; Debashish Bhattacharya
2017-01-01
We investigated intra- and inter-colony sequence variation in a population of the dominant Hawaiian coral Montipora capitata by analyzing marker gene and genomic data. Ribosomal ITS1 regions showed evidence of a reticulate history among the colonies, suggesting incomplete rDNA repeat homogenization. Analysis of the mitochondrial genome identified a major (M. capitata) and a minor (M. flabellata) haplotype in single polyp-derived sperm bundle DNA with some colonies containing 2?3 different mtD...
Ultrasensitive DNA sequence detection using nanoscale ZnO sensor arrays
Energy Technology Data Exchange (ETDEWEB)
Kumar, Nitin; Dorfman, Adam; Hahm, Jong-in [Department of Chemical Engineering, Pennsylvania State University, 160 Fenske Laboratory, University Park, PA 16802 (United States)
2006-06-28
We report that engineered nanoscale zinc oxide structures can be effectively used for the identification of the biothreat agent, Bacillus anthracis by successfully discriminating its DNA sequence from other genetically related species. We explore both covalent and non-covalent linking schemes in order to couple probe DNA strands to the zinc oxide nanostructures. Hybridization reactions are performed with various concentrations of target DNA strands whose sequence is unique to Bacillus anthracis. The use of zinc oxide nanomaterials greatly enhances the fluorescence signal collected after carrying out duplex formation reaction. Specifically, the covalent strategy allows detection of the target species at sample concentrations at a level as low as a few femtomolar as compared to the detection sensitivity in the tens of nanomolar range when using the non-covalent scheme. The presence of the underlying zinc oxide nanomaterials is critical in achieving increased fluorescence detection of hybridized DNA and, therefore, accomplishing rapid and extremely sensitive identification of the biothreat agent. We also demonstrate the easy integration potential of nanoscale zinc oxide into high density arrays by using various types of zinc oxide sensor prototypes in the DNA sequence detection. When combined with conventional automatic sample handling apparatus and computerized fluorescence detection equipment, our approach can greatly promote the use of zinc oxide nanomaterials as signal enhancing platforms for rapid, multiplexed, high-throughput, highly sensitive, DNA sensor arrays.
Ultrasensitive DNA sequence detection using nanoscale ZnO sensor arrays
International Nuclear Information System (INIS)
Kumar, Nitin; Dorfman, Adam; Hahm, Jong-in
2006-01-01
We report that engineered nanoscale zinc oxide structures can be effectively used for the identification of the biothreat agent, Bacillus anthracis by successfully discriminating its DNA sequence from other genetically related species. We explore both covalent and non-covalent linking schemes in order to couple probe DNA strands to the zinc oxide nanostructures. Hybridization reactions are performed with various concentrations of target DNA strands whose sequence is unique to Bacillus anthracis. The use of zinc oxide nanomaterials greatly enhances the fluorescence signal collected after carrying out duplex formation reaction. Specifically, the covalent strategy allows detection of the target species at sample concentrations at a level as low as a few femtomolar as compared to the detection sensitivity in the tens of nanomolar range when using the non-covalent scheme. The presence of the underlying zinc oxide nanomaterials is critical in achieving increased fluorescence detection of hybridized DNA and, therefore, accomplishing rapid and extremely sensitive identification of the biothreat agent. We also demonstrate the easy integration potential of nanoscale zinc oxide into high density arrays by using various types of zinc oxide sensor prototypes in the DNA sequence detection. When combined with conventional automatic sample handling apparatus and computerized fluorescence detection equipment, our approach can greatly promote the use of zinc oxide nanomaterials as signal enhancing platforms for rapid, multiplexed, high-throughput, highly sensitive, DNA sensor arrays
cDNA sequencing improves the detection of P53 missense mutations in colorectal cancer
International Nuclear Information System (INIS)
Szybka, Malgorzata; Kordek, Radzislaw; Zakrzewska, Magdalena; Rieske, Piotr; Pasz-Walczak, Grazyna; Kulczycka-Wojdala, Dominika; Zawlik, Izabela; Stawski, Robert; Jesionek-Kupnicka, Dorota; Liberski, Pawel P
2009-01-01
Recently published data showed discrepancies beteween P53 cDNA and DNA sequencing in glioblastomas. We hypothesised that similar discrepancies may be observed in other human cancers. To this end, we analyzed 23 colorectal cancers for P53 mutations and gene expression using both DNA and cDNA sequencing, real-time PCR and immunohistochemistry. We found P53 gene mutations in 16 cases (15 missense and 1 nonsense). Two of the 15 cases with missense mutations showed alterations based only on cDNA, and not DNA sequencing. Moreover, in 6 of the 15 cases with a cDNA mutation those mutations were difficult to detect in the DNA sequencing, so the results of DNA analysis alone could be misinterpreted if the cDNA sequencing results had not also been available. In all those 15 cases, we observed a higher ratio of the mutated to the wild type template by cDNA analysis, but not by the DNA analysis. Interestingly, a similar overexpression of P53 mRNA was present in samples with and without P53 mutations. In terms of colorectal cancer, those discrepancies might be explained under three conditions: 1, overexpression of mutated P53 mRNA in cancer cells as compared with normal cells; 2, a higher content of cells without P53 mutation (normal cells and cells showing K-RAS and/or APC but not P53 mutation) in samples presenting P53 mutation; 3, heterozygous or hemizygous mutations of P53 gene. Additionally, for heterozygous mutations unknown mechanism(s) causing selective overproduction of mutated allele should also be considered. Our data offer new clues for studying discrepancy in P53 cDNA and DNA sequencing analysis
Soysa, Radika; Tran, Khoa D; Ullman, Buddy; Yates, Phillip A
2015-12-01
We have designed a novel series of integrating ribosomal RNA promoter vectors with five incrementally different constitutive expression profiles, covering a 250-fold range. Differential expression was achieved by placing different combinations of synthetic or leishmanial DNA sequences upstream and downstream of the transgene coding sequence in order to modulate pre-mRNA processing efficiency and mRNA stability, respectively. All of the vectors have extensive multiple cloning sites, and versions are available for producing N- or C- terminal GFP fusions at each of the possible relative expression levels. In addition, the modular configuration of the vectors allows drug resistance cassettes and other components to be readily exchanged. In toto, these vectors should be useful additions to the toolkit available for molecular and genetic studies of Leishmania donovani. Copyright © 2016 Elsevier B.V. All rights reserved.
Application of synthetic DNA probes to the analysis of DNA sequence variants in man
International Nuclear Information System (INIS)
Wallace, R.B.; Petz, L.D.; Yam, P.Y.
1986-01-01
Oligonucleotide probes provide a tool to discriminate between any two alleles on the basis of hybridization. Random sampling of the genome with different oligonucleotide probes should reveal polymorphism in a certain percentage of the cases. In the hope of identifying polymorphic regions more efficiently, we chose to take advantage of the proposed hypermutability of repeated DNA sequences and the specificity of oligonucleotide hybridization. Since, under appropriate conditions, oligonucleotide probes require complete base pairing for hybridization to occur, they will only hybridize to a subset of the members of a repeat family when all members of the family are not identical. The results presented here suggest that oligonucleotide hybridization can be used to extend the genomic sequences that can be tested for the presence of RFLPs. This expands the tools available to human genetics. In addition, the results suggest that repeated DNA sequences are indeed more polymorphic than single-copy sequences. 28 references, 2 figures
Remodeling of ribosomal genes in somatic cells by Xenopus egg extract
Energy Technology Data Exchange (ETDEWEB)
Ostrup, Olga, E-mail: osvarcova@gmail.com [Institute of Basic Animal and Veterinary Sciences, Faculty of Life Sciences, University of Copenhagen, Frederiksberg C (Denmark); Stem Cell Epigenetics Laboratory, Institute of Basic Medical Sciences, Faculty of Medicine, University of Oslo, Oslo (Norway); Norwegian Center for Stem Cell Research, Oslo (Norway); Hyttel, Poul; Klaerke, Dan A. [Institute of Basic Animal and Veterinary Sciences, Faculty of Life Sciences, University of Copenhagen, Frederiksberg C (Denmark); Collas, Philippe, E-mail: philc@medisin.uio.no [Stem Cell Epigenetics Laboratory, Institute of Basic Medical Sciences, Faculty of Medicine, University of Oslo, Oslo (Norway); Norwegian Center for Stem Cell Research, Oslo (Norway)
2011-09-02
Highlights: {yields} Xenopus egg extract remodels nuclei and alter cell growth characteristics. {yields} Ribosomal genes are reprogrammed within 6 h after extract exposure. {yields} rDNA reprogramming involves promoter targeting of SNF2H remodeling complex. {yields} Xenopus egg extract does not initiate stress-related response in somatic cells. {yields} Aza-cytidine elicits a stress-induced response in reprogrammed cells. -- Abstract: Extracts from Xenopus eggs can reprogram gene expression in somatic nuclei, however little is known about the earliest processes associated with the switch in the transcriptional program. We show here that an early reprogramming event is the remodeling of ribosomal chromatin and gene expression. This occurs within hours of extract treatment and is distinct from a stress response. Egg extract elicits remodeling of the nuclear envelope, chromatin and nucleolus. Nucleolar remodeling involves a rapid and stable decrease in ribosomal gene transcription, and promoter targeting of the nucleolar remodeling complex component SNF2H without affecting occupancy of the transcription factor UBF and the stress silencers SUV39H1 and SIRT1. During this process, nucleolar localization of UBF and SIRT1 is not altered. On contrary, azacytidine pre-treatment has an adverse effect on rDNA remodeling induced by extract and elicits a stress-type nuclear response. Thus, an early event of Xenopus egg extract-mediated nuclear reprogramming is the remodeling of ribosomal genes involving nucleolar remodeling complex. Condition-specific and rapid silencing of ribosomal genes may serve as a sensitive marker for evaluation of various reprogramming methods.
PNA Directed Sequence Addressed Self-Assembly of DNA Nanostructures
DEFF Research Database (Denmark)
Nielsen, Peter E.
2008-01-01
sequence specifically recognize another PNA oligomer. We describe how such three domain PNAs have utility for assembling dsDNA grid and clover leaf structures, and in combination with SNAP-tag technol. of protein dsDNA structures. (c) 2008 American Institute of Physics. [on SciFinder (R)] Udgivelsesdato...
Sequence and transcription analysis of the human cytomegalovirus DNA polymerase gene
International Nuclear Information System (INIS)
Kouzarides, T.; Bankier, A.T.; Satchwell, S.C.; Weston, K.; Tomlinson, P.; Barrell, B.G.
1987-01-01
DNA sequence analysis has revealed that the gene coding for the human cytomegalovirus (HCMV) DNA polymerase is present within the long unique region of the virus genome. Identification is based on extensive amino acid homology between the predicted HCMV open reading frame HFLF2 and the DNA polymerase of herpes simplex virus type 1. The authors present here a 5280 base-pair DNA sequence containing the HCMV pol gene, along with the analysis of transcripts encoded within this region. Since HCMV pol also shows homology to the predicted Epstein-Barr virus pol, they were able to analyze the extent of homology between the DNA polymerases of three distantly related herpes viruses, HCMV, Epstein-Barr virus, and herpes simplex virus. The comparison shows that these DNA polymerases exhibit considerable amino acid homology and highlights a number of highly conserved regions; two such regions show homology to sequences within the adenovirus type 2 DNA polymerase. The HCMV pol gene is flanked by open reading frames with homology to those of other herpes viruses; upstream, there is a reading frame homologous to the glycoprotein B gene of herpes simplex virus type I and Epstein-Barr virus, and downstream there is a reading frame homologous to BFLF2 of Epstein-Barr virus
Special Issue: Next Generation DNA Sequencing
Directory of Open Access Journals (Sweden)
Paul Richardson
2010-10-01
Full Text Available Next Generation Sequencing (NGS refers to technologies that do not rely on traditional dideoxy-nucleotide (Sanger sequencing where labeled DNA fragments are physically resolved by electrophoresis. These new technologies rely on different strategies, but essentially all of them make use of real-time data collection of a base level incorporation event across a massive number of reactions (on the order of millions versus 96 for capillary electrophoresis for instance. The major commercial NGS platforms available to researchers are the 454 Genome Sequencer (Roche, Illumina (formerly Solexa Genome analyzer, the SOLiD system (Applied Biosystems/Life Technologies and the Heliscope (Helicos Corporation. The techniques and different strategies utilized by these platforms are reviewed in a number of the papers in this special issue. These technologies are enabling new applications that take advantage of the massive data produced by this next generation of sequencing instruments. [...
Navigating the tip of the genomic iceberg: Next-generation sequencing for plant systematics.
Straub, Shannon C K; Parks, Matthew; Weitemier, Kevin; Fishbein, Mark; Cronn, Richard C; Liston, Aaron
2012-02-01
Just as Sanger sequencing did more than 20 years ago, next-generation sequencing (NGS) is poised to revolutionize plant systematics. By combining multiplexing approaches with NGS throughput, systematists may no longer need to choose between more taxa or more characters. Here we describe a genome skimming (shallow sequencing) approach for plant systematics. Through simulations, we evaluated optimal sequencing depth and performance of single-end and paired-end short read sequences for assembly of nuclear ribosomal DNA (rDNA) and plastomes and addressed the effect of divergence on reference-guided plastome assembly. We also used simulations to identify potential phylogenetic markers from low-copy nuclear loci at different sequencing depths. We demonstrated the utility of genome skimming through phylogenetic analysis of the Sonoran Desert clade (SDC) of Asclepias (Apocynaceae). Paired-end reads performed better than single-end reads. Minimum sequencing depths for high quality rDNA and plastome assemblies were 40× and 30×, respectively. Divergence from the reference significantly affected plastome assembly, but relatively similar references are available for most seed plants. Deeper rDNA sequencing is necessary to characterize intragenomic polymorphism. The low-copy fraction of the nuclear genome was readily surveyed, even at low sequencing depths. Nearly 160000 bp of sequence from three organelles provided evidence of phylogenetic incongruence in the SDC. Adoption of NGS will facilitate progress in plant systematics, as whole plastome and rDNA cistrons, partial mitochondrial genomes, and low-copy nuclear markers can now be efficiently obtained for molecular phylogenetics studies.
Spectral sum rules and search for periodicities in DNA sequences
International Nuclear Information System (INIS)
Chechetkin, V.R.
2011-01-01
Periodic patterns play the important regulatory and structural roles in genomic DNA sequences. Commonly, the underlying periodicities should be understood in a broad statistical sense, since the corresponding periodic patterns have been strongly distorted by the random point mutations and insertions/deletions during molecular evolution. The latent periodicities in DNA sequences can be efficiently displayed by Fourier transform. The criteria of significance for observed periodicities are obtained via the comparison versus the counterpart characteristics of the reference random sequences. We show that the restrictions imposed on the significance criteria by the rigorous spectral sum rules can be rationally described with De Finetti distribution. This distribution provides the convenient intermediate asymptotic form between Rayleigh distribution and exact combinatoric theory. - Highlights: → We study the significance criteria for latent periodicities in DNA sequences. → The constraints imposed by sum rules can be described with De Finetti distribution. → It is intermediate between Rayleigh distribution and exact combinatoric theory. → Theory is applicable to the study of correlations between different periodicities. → The approach can be generalized to the arbitrary discrete Fourier transform.
Genomic signal processing methods for computation of alignment-free distances from DNA sequences.
Borrayo, Ernesto; Mendizabal-Ruiz, E Gerardo; Vélez-Pérez, Hugo; Romo-Vázquez, Rebeca; Mendizabal, Adriana P; Morales, J Alejandro
2014-01-01
Genomic signal processing (GSP) refers to the use of digital signal processing (DSP) tools for analyzing genomic data such as DNA sequences. A possible application of GSP that has not been fully explored is the computation of the distance between a pair of sequences. In this work we present GAFD, a novel GSP alignment-free distance computation method. We introduce a DNA sequence-to-signal mapping function based on the employment of doublet values, which increases the number of possible amplitude values for the generated signal. Additionally, we explore the use of three DSP distance metrics as descriptors for categorizing DNA signal fragments. Our results indicate the feasibility of employing GAFD for computing sequence distances and the use of descriptors for characterizing DNA fragments.
Directory of Open Access Journals (Sweden)
Marcus eLudwig
2011-03-01
Full Text Available The genome of the unicellular, euryhaline cyanobacterium Synechococcus sp. PCC 7002 encodes about 3200 proteins. Transcripts were detected for nearly all annotated open reading frames by a global transcriptomic analysis by Next-Generation (SOLiDTM sequencing of cDNA. In the cDNA samples sequenced, ~90% of the mapped sequences were derived from the 16S and 23S ribosomal RNAs and ~10% of the sequences were derived from mRNAs. In cells grown photoautotrophically under standard conditions (38 °C, 1% (v/v CO2 in air, 250 µmol photons m-2 s-1, the highest transcript levels (up to 2% of the total mRNA for the most abundantly transcribed genes (e. g., cpcAB, psbA, psaA were generally derived from genes encoding structural components of the photosynthetic apparatus. High light exposure for one hour caused changes in transcript levels for genes encoding proteins of the photosynthetic apparatus, Type-1 NADH dehydrogenase complex and ATP synthase, whereas dark incubation for one hour resulted in a global decrease in transcript levels for photosynthesis-related genes and an increase in transcript levels for genes involved in carbohydrate degradation. Transcript levels for pyruvate kinase and the pyruvate dehydrogenase complex decreased sharply in cells incubated in the dark. Under dark anoxic (fermentative conditions, transcript changes indicated a global decrease in transcripts for respiratory proteins and suggested that cells employ an alternative phosphoenolpyruvate degradation pathway via phosphoenolpyruvate synthase (ppsA and the pyruvate:ferredoxin oxidoreductase (nifJ. Finally, the data suggested that an apparent operon involved in tetrapyrrole biosynthesis and fatty acid desaturation, acsF2-ho2-hemN2-desF, may be regulated by oxygen concentration.
High-resolution characterization of sequence signatures due to non-random cleavage of cell-free DNA.
Chandrananda, Dineika; Thorne, Natalie P; Bahlo, Melanie
2015-06-17
High-throughput sequencing of cell-free DNA fragments found in human plasma has been used to non-invasively detect fetal aneuploidy, monitor organ transplants and investigate tumor DNA. However, many biological properties of this extracellular genetic material remain unknown. Research that further characterizes circulating DNA could substantially increase its diagnostic value by allowing the application of more sophisticated bioinformatics tools that lead to an improved signal to noise ratio in the sequencing data. In this study, we investigate various features of cell-free DNA in plasma using deep-sequencing data from two pregnant women (>70X, >50X) and compare them with matched cellular DNA. We utilize a descriptive approach to examine how the biological cleavage of cell-free DNA affects different sequence signatures such as fragment lengths, sequence motifs at fragment ends and the distribution of cleavage sites along the genome. We show that the size distributions of these cell-free DNA molecules are dependent on their autosomal and mitochondrial origin as well as the genomic location within chromosomes. DNA mapping to particular microsatellites and alpha repeat elements display unique size signatures. We show how cell-free fragments occur in clusters along the genome, localizing to nucleosomal arrays and are preferentially cleaved at linker regions by correlating the mapping locations of these fragments with ENCODE annotation of chromatin organization. Our work further demonstrates that cell-free autosomal DNA cleavage is sequence dependent. The region spanning up to 10 positions on either side of the DNA cleavage site show a consistent pattern of preference for specific nucleotides. This sequence motif is present in cleavage sites localized to nucleosomal cores and linker regions but is absent in nucleosome-free mitochondrial DNA. These background signals in cell-free DNA sequencing data stem from the non-random biological cleavage of these fragments. This
AU2EU : Privacy-preserving matching of DNA sequences
Ignatenko, T.; Petkovic, M.; Naccache, D.; Sauveron, D.
2014-01-01
Advances in DNA sequencing create new opportunities for the use of DNA data in healthcare for diagnostic and treatment purposes, but also in many other health and well-being services. This brings new challenges with regard to the protection and use of this sensitive data. Thus, special technical
cDNA sequences of two apolipoproteins from lamprey
International Nuclear Information System (INIS)
Pontes, M.; Xu, X.; Graham, D.; Riley, M.; Doolittle, R.F.
1987-01-01
The messages for two small but abundant apolipoproteins found in lamprey blood plasma were cloned with the aid of oligonucleotide probes based on amino-terminal sequences. In both cases, numerous clones were identified in a lamprey liver cDNA library, consistent with the great abundance of these proteins in lamprey blood. One of the cDNAs (LAL1) has a coding region of 105 amino acids that corresponds to a 21-residue signal peptide, a putative 8-residue propeptide, and the 76-residue mature protein found in blood. The other cDNA (LAL2) codes for a total of 191 residues, the first 23 of which constitute a signal peptide. The two proteins, which occur in the high-density lipoprotein fraction of ultracentrifuged plasma, have amino acid compositions similar to those of apolipoproteins found in mammalian blood; computer analysis indicates that the sequences are largely helix-permissive. When the sequences were searched against an amino acid sequence data base, rat apolipoprotein IV was the best matching candidate in both cases. Although a reasonable alignment can be made with that sequence and LAL1, definitive assignment of the two lamprey proteins to typical mammalian classes cannot be made at this point
de Oliveira, Valéria Maia; Manfio, Gilson Paulo; da Costa Coutinho, Heitor Luiz; Keijzer-Wolters, Anneke Christina; van Elsas, Jan Dirk
2006-03-01
A direct molecular method for assessing the diversity of specific populations of rhizobia in soil, based on nested PCR amplification of 16S-23S ribosomal RNA gene (rDNA) intergenic spacer (IGS) sequences, was developed. Initial generic amplification of bacterial rDNA IGS sequences from soil DNA was followed by specific amplification of (1) sequences affiliated with Rhizobium leguminosarum "sensu lato" and (2) R. tropici. Using analysis of the amplified sequences in clone libraries obtained on the basis of soil DNA, this two-sided method was shown to be very specific for rhizobial subpopulations in soil. It was then further validated as a direct fingerprinting tool of the target rhizobia based on denaturing gradient gel electrophoresis (DGGE). The PCR-DGGE approach was applied to soils from fields in Brazil cultivated with common bean (Phaseolus vulgaris) under conventional or no-tillage practices. The community fingerprints obtained allowed the direct analysis of the respective rhizobial community structures in soil samples from the two contrasting agricultural practices. Data obtained with both primer sets revealed clustering of the community structures of the target rhizobial types along treatment. Moreover, the DGGE profiles obtained with the R. tropici primer set indicated that the abundance and diversity of these organisms were favoured under NT practices. These results suggest that the R. leguminosarum-as well as R. tropici-targeted IGS-based nested PCR and DGGE are useful tools for monitoring the effect of agricultural practices on these and related rhizobial subpopulations in soils.
Micropatterning stretched and aligned DNA for sequence-specific nanolithography
Petit, Cecilia Anna Paulette
Techniques for fabricating nanostructured materials can be categorized as either "top-down" or "bottom-up". Top-down techniques use lithography and contact printing to create patterned surfaces and microfluidic channels that can corral and organize nanoscale structures, such as molecules and nanorods in contrast; bottom-up techniques use self-assembly or molecular recognition to direct the organization of materials. A central goal in nanotechnology is the integration of bottom-up and top-down assembly strategies for materials development, device design; and process integration. With this goal in mind, we have developed strategies that will allow this integration by using DNA as a template for nanofabrication; two top-down approaches allow the placement of these templates, while the bottom-up technique uses the specific sequence of bases to pattern materials along each strand of DNA. Our first top-down approach, termed combing of molecules in microchannels (COMMIC), produces microscopic patterns of stretched and aligned molecules of DNA on surfaces. This process consists of passing an air-water interface over end adsorbed molecules inside microfabricated channels. The geometry of the microchannel directs the placement of the DNA molecules, while the geometry of the airwater interface directs the local orientation and curvature of the molecules. We developed another top-down strategy for creating micropatterns of stretched and aligned DNA using surface chemistry. Because DNA stretching occurs on hydrophobic surfaces, this technique uses photolithography to pattern vinyl-terminated silanes on glass When these surface-, are immersed in DNA solution, molecules adhere preferentially to the silanized areas. This approach has also proven useful in patterning protein for cell adhesion studies. Finally, we describe the use of these stretched and aligned molecules of DNA as templates for the subsequent bottom-up construction of hetero-structures through hybridization
Sequence-specific RNA Photocleavage by Single-stranded DNA in Presence of Riboflavin
Zhao, Yongyun; Chen, Gangyi; Yuan, Yi; Li, Na; Dong, Juan; Huang, Xin; Cui, Xin; Tang, Zhuo
2015-10-01
Constant efforts have been made to develop new method to realize sequence-specific RNA degradation, which could cause inhibition of the expression of targeted gene. Herein, by using an unmodified short DNA oligonucleotide for sequence recognition and endogenic small molecue, vitamin B2 (riboflavin) as photosensitizer, we report a simple strategy to realize the sequence-specific photocleavage of targeted RNA. The DNA strand is complimentary to the target sequence to form DNA/RNA duplex containing a G•U wobble in the middle. The cleavage reaction goes through oxidative elimination mechanism at the nucleoside downstream of U of the G•U wobble in duplex to obtain unnatural RNA terminal, and the whole process is under tight control by using light as switch, which means the cleavage could be carried out according to specific spatial and temporal requirements. The biocompatibility of this method makes the DNA strand in combination with riboflavin a promising molecular tool for RNA manipulation.
DNA Sequences of RAPD Fragments in the Egyptian cotton ...
African Journals Online (AJOL)
Random Amplified Polymorphic DNAs (RAPDs) is a DNA polymorphism assay based on the amplification of random DNA segments with single primers of arbitrary nucleotide sequence. Despite the fact that the RAPD technique has become a very powerful tool and has found use in numerous applications, yet, the nature of ...
Next generation sequencing of DNA-launched Chikungunya vaccine virus
Energy Technology Data Exchange (ETDEWEB)
Hidajat, Rachmat; Nickols, Brian [Medigen, Inc., 8420 Gas House Pike, Suite S, Frederick, MD 21701 (United States); Forrester, Naomi [Institute for Human Infections and Immunity, Sealy Center for Vaccine Development and Department of Pathology, University of Texas Medical Branch, GNL, 301 University Blvd., Galveston, TX 77555 (United States); Tretyakova, Irina [Medigen, Inc., 8420 Gas House Pike, Suite S, Frederick, MD 21701 (United States); Weaver, Scott [Institute for Human Infections and Immunity, Sealy Center for Vaccine Development and Department of Pathology, University of Texas Medical Branch, GNL, 301 University Blvd., Galveston, TX 77555 (United States); Pushko, Peter, E-mail: ppushko@medigen-usa.com [Medigen, Inc., 8420 Gas House Pike, Suite S, Frederick, MD 21701 (United States)
2016-03-15
Chikungunya virus (CHIKV) represents a pandemic threat with no approved vaccine available. Recently, we described a novel vaccination strategy based on iDNA® infectious clone designed to launch a live-attenuated CHIKV vaccine from plasmid DNA in vitro or in vivo. As a proof of concept, we prepared iDNA plasmid pCHIKV-7 encoding the full-length cDNA of the 181/25 vaccine. The DNA-launched CHIKV-7 virus was prepared and compared to the 181/25 virus. Illumina HiSeq2000 sequencing revealed that with the exception of the 3′ untranslated region, CHIKV-7 viral RNA consistently showed a lower frequency of single-nucleotide polymorphisms than the 181/25 RNA including at the E2-12 and E2-82 residues previously identified as attenuating mutations. In the CHIKV-7, frequencies of reversions at E2-12 and E2-82 were 0.064% and 0.086%, while in the 181/25, frequencies were 0.179% and 0.133%, respectively. We conclude that the DNA-launched virus has a reduced probability of reversion mutations, thereby enhancing vaccine safety. - Highlights: • Chikungunya virus (CHIKV) is an emerging pandemic threat. • In vivo DNA-launched attenuated CHIKV is a novel vaccine technology. • DNA-launched virus was sequenced using HiSeq2000 and compared to the 181/25 virus. • DNA-launched virus has lower frequency of SNPs at E2-12 and E2-82 attenuation loci.
Next generation sequencing of DNA-launched Chikungunya vaccine virus
International Nuclear Information System (INIS)
Hidajat, Rachmat; Nickols, Brian; Forrester, Naomi; Tretyakova, Irina; Weaver, Scott; Pushko, Peter
2016-01-01
Chikungunya virus (CHIKV) represents a pandemic threat with no approved vaccine available. Recently, we described a novel vaccination strategy based on iDNA® infectious clone designed to launch a live-attenuated CHIKV vaccine from plasmid DNA in vitro or in vivo. As a proof of concept, we prepared iDNA plasmid pCHIKV-7 encoding the full-length cDNA of the 181/25 vaccine. The DNA-launched CHIKV-7 virus was prepared and compared to the 181/25 virus. Illumina HiSeq2000 sequencing revealed that with the exception of the 3′ untranslated region, CHIKV-7 viral RNA consistently showed a lower frequency of single-nucleotide polymorphisms than the 181/25 RNA including at the E2-12 and E2-82 residues previously identified as attenuating mutations. In the CHIKV-7, frequencies of reversions at E2-12 and E2-82 were 0.064% and 0.086%, while in the 181/25, frequencies were 0.179% and 0.133%, respectively. We conclude that the DNA-launched virus has a reduced probability of reversion mutations, thereby enhancing vaccine safety. - Highlights: • Chikungunya virus (CHIKV) is an emerging pandemic threat. • In vivo DNA-launched attenuated CHIKV is a novel vaccine technology. • DNA-launched virus was sequenced using HiSeq2000 and compared to the 181/25 virus. • DNA-launched virus has lower frequency of SNPs at E2-12 and E2-82 attenuation loci.
Gholami, Akram; Subramaniam, Shweta; Geeta, R; Pandey, Arun K
2017-06-01
Alysicarpus Necker ex Desvaux (Fabaceae, Desmodieae) consists of ~30 species that are distributed in tropical and subtropical regions of theworld. In India, the genus is represented by ca. 18 species, ofwhich seven are endemic. Sequences of the nuclear Internal transcribed spacer from38 accessions representing 16 Indian specieswere subjected to phylogenetic analyses. The ITS sequence data strongly support the monophyly of the genus Alysicarpus. Analyses revealed four major well-supported clades within Alysicarpus. Ancestral state reconstructions were done for two morphological characters, namely calyx length in relation to pod (macrocalyx and microcalyx) and pod surface ornamentation (transversely rugose and nonrugose). The present study is the first report on molecular systematics of Indian Alysicarpus.
A microfluidic DNA library preparation platform for next-generation sequencing.
Kim, Hanyoup; Jebrail, Mais J; Sinha, Anupama; Bent, Zachary W; Solberg, Owen D; Williams, Kelly P; Langevin, Stanley A; Renzi, Ronald F; Van De Vreugde, James L; Meagher, Robert J; Schoeniger, Joseph S; Lane, Todd W; Branda, Steven S; Bartsch, Michael S; Patel, Kamlesh D
2013-01-01
Next-generation sequencing (NGS) is emerging as a powerful tool for elucidating genetic information for a wide range of applications. Unfortunately, the surging popularity of NGS has not yet been accompanied by an improvement in automated techniques for preparing formatted sequencing libraries. To address this challenge, we have developed a prototype microfluidic system for preparing sequencer-ready DNA libraries for analysis by Illumina sequencing. Our system combines droplet-based digital microfluidic (DMF) sample handling with peripheral modules to create a fully-integrated, sample-in library-out platform. In this report, we use our automated system to prepare NGS libraries from samples of human and bacterial genomic DNA. E. coli libraries prepared on-device from 5 ng of total DNA yielded excellent sequence coverage over the entire bacterial genome, with >99% alignment to the reference genome, even genome coverage, and good quality scores. Furthermore, we produced a de novo assembly on a previously unsequenced multi-drug resistant Klebsiella pneumoniae strain BAA-2146 (KpnNDM). The new method described here is fast, robust, scalable, and automated. Our device for library preparation will assist in the integration of NGS technology into a wide variety of laboratories, including small research laboratories and clinical laboratories.
A microfluidic DNA library preparation platform for next-generation sequencing.
Directory of Open Access Journals (Sweden)
Hanyoup Kim
Full Text Available Next-generation sequencing (NGS is emerging as a powerful tool for elucidating genetic information for a wide range of applications. Unfortunately, the surging popularity of NGS has not yet been accompanied by an improvement in automated techniques for preparing formatted sequencing libraries. To address this challenge, we have developed a prototype microfluidic system for preparing sequencer-ready DNA libraries for analysis by Illumina sequencing. Our system combines droplet-based digital microfluidic (DMF sample handling with peripheral modules to create a fully-integrated, sample-in library-out platform. In this report, we use our automated system to prepare NGS libraries from samples of human and bacterial genomic DNA. E. coli libraries prepared on-device from 5 ng of total DNA yielded excellent sequence coverage over the entire bacterial genome, with >99% alignment to the reference genome, even genome coverage, and good quality scores. Furthermore, we produced a de novo assembly on a previously unsequenced multi-drug resistant Klebsiella pneumoniae strain BAA-2146 (KpnNDM. The new method described here is fast, robust, scalable, and automated. Our device for library preparation will assist in the integration of NGS technology into a wide variety of laboratories, including small research laboratories and clinical laboratories.
Sequence Dependencies of DNA Deformability and Hydration in the Minor Groove
Yonetani, Yoshiteru; Kono, Hidetoshi
2009-01-01
Abstract DNA deformability and hydration are both sequence-dependent and are essential in specific DNA sequence recognition by proteins. However, the relationship between the two is not well understood. Here, systematic molecular dynamics simulations of 136 DNA sequences that differ from each other in their central tetramer revealed that sequence dependence of hydration is clearly correlated with that of deformability. We show that this correlation can be illustrated by four typical cases. Most rigid basepair steps are highly likely to form an ordered hydration pattern composed of one water molecule forming a bridge between the bases of distinct strands, but a few exceptions favor another ordered hydration composed of two water molecules forming such a bridge. Steps with medium deformability can display both of these hydration patterns with frequent transition. Highly flexible steps do not have any stable hydration pattern. A detailed picture of this correlation demonstrates that motions of hydration water molecules and DNA bases are tightly coupled with each other at the atomic level. These results contribute to our understanding of the entropic contribution from water molecules in protein or drug binding and could be applied for the purpose of predicting binding sites. PMID:19686662
Pericentric satellite DNA sequences in Pipistrellus pipistrellus (Vespertilionidae; Chiroptera).
Barragán, M J L; Martínez, S; Marchal, J A; Fernández, R; Bullejos, M; Díaz de la Guardia, R; Sánchez, A
2003-09-01
This paper reports the molecular and cytogenetic characterization of a HindIII family of satellite DNA in the bat species Pipistrellus pipistrellus. This satellite is organized in tandem repeats of 418 bp monomer units, and represents approximately 3% of the whole genome. The consensus sequence from five cloned monomer units has an A-T content of 62.20%. We have found differences in the ladder pattern of bands between two populations of the same species. These differences are probably because of the absence of the target sites for the HindIII enzyme in most monomer units of one population, but not in the other. Fluorescent in situ hybridization (FISH) localized the satellite DNA in the pericentromeric regions of all autosomes and the X chromosome, but it was absent from the Y chromosome. Digestion of genomic DNAs with HpaII and its isoschizomer MspI demonstrated that these repetitive DNA sequences are not methylated. Other bat species were tested for the presence of this repetitive DNA. It was absent in five Vespertilionidae and one Rhinolophidae species, indicating that it could be a species/genus specific, repetitive DNA family.
Comparative d2/d3 LSU–rDNA sequence study of some Iranian ...
African Journals Online (AJOL)
SERVER
2007-11-05
Nov 5, 2007 ... segments yielded one fragment at over all sequenced isolates as 787 bp in size. The DNA sequences were aligned .... expansion segments of the 28S rDNA subunit (D2/D3. LSU-rDNA) are the ... isolated from different geographical location from tea shrubs infested roots of Guilan province, Iran (Table 1).
Vinuesa, Pablo; Rademaker, Jan L. W.; de Bruijn, Frans J.; Werner, Dietrich
1998-01-01
We present a phylogenetic analysis of nine strains of symbiotic nitrogen-fixing bacteria isolated from nodules of tagasaste (Chamaecytisus proliferus) and other endemic woody legumes of the Canary Islands, Spain. These and several reference strains were characterized genotypically at different levels of taxonomic resolution by computer-assisted analysis of 16S ribosomal DNA (rDNA) PCR-restriction fragment length polymorphisms (PCR-RFLPs), 16S-23S rDNA intergenic spacer (IGS) RFLPs, and repetitive extragenic palindromic PCR (rep-PCR) genomic fingerprints with BOX, ERIC, and REP primers. Cluster analysis of 16S rDNA restriction patterns with four tetrameric endonucleases grouped the Canarian isolates with the two reference strains, Bradyrhizobium japonicum USDA 110spc4 and Bradyrhizobium sp. strain (Centrosema) CIAT 3101, resolving three genotypes within these bradyrhizobia. In the analysis of IGS RFLPs with three enzymes, six groups were found, whereas rep-PCR fingerprinting revealed an even greater genotypic diversity, with only two of the Canarian strains having similar fingerprints. Furthermore, we show that IGS RFLPs and even very dissimilar rep-PCR fingerprints can be clustered into phylogenetically sound groupings by combining them with 16S rDNA RFLPs in computer-assisted cluster analysis of electrophoretic patterns. The DNA sequence analysis of a highly variable 264-bp segment of the 16S rRNA genes of these strains was found to be consistent with the fingerprint-based classification. Three different DNA sequences were obtained, one of which was not previously described, and all belonged to the B. japonicum/Rhodopseudomonas rDNA cluster. Nodulation assays revealed that none of the Canarian isolates nodulated Glycine max or Leucaena leucocephala, but all nodulated Acacia pendula, C. proliferus, Macroptilium atropurpureum, and Vigna unguiculata. PMID:9603820
Integration of hepatitis B virus DNA in chromosome-specific satellite sequences
International Nuclear Information System (INIS)
Shaul, Y.; Garcia, P.D.; Schonberg, S.; Rutter, W.J.
1986-01-01
The authors previously reported the cloning and detailed analysis of the integrated hepatitis B virus sequences in a human hepatoma cell line. They report here the integration of at least one of hepatitis B virus at human satellite DNA sequences. The majority of the cellular sequences identified by this satellite were organized as a multimeric composition of a 0.6-kilobase EcoRI fragment. This clone hybridized in situ almost exclusively to the centromeric heterochromatin of chromosomes 1 and 16 and to a lower extent to chromosome 2 and to the heterochromatic region of the Y chromosome. The immediate flanking host sequence appeared as a hierarchy of repeating units which were almost identical to a previously reported human satellite III DNA sequence