WorldWideScience

Sample records for ribosomal dna markers

  1. Nuclear ribosomal internal transcribed spacer (ITS) region as a universal DNA barcode marker for Fungi.

    Science.gov (United States)

    Schoch, Conrad L; Seifert, Keith A; Huhndorf, Sabine; Robert, Vincent; Spouge, John L; Levesque, C André; Chen, Wen

    2012-04-17

    Six DNA regions were evaluated as potential DNA barcodes for Fungi, the second largest kingdom of eukaryotic life, by a multinational, multilaboratory consortium. The region of the mitochondrial cytochrome c oxidase subunit 1 used as the animal barcode was excluded as a potential marker, because it is difficult to amplify in fungi, often includes large introns, and can be insufficiently variable. Three subunits from the nuclear ribosomal RNA cistron were compared together with regions of three representative protein-coding genes (largest subunit of RNA polymerase II, second largest subunit of RNA polymerase II, and minichromosome maintenance protein). Although the protein-coding gene regions often had a higher percent of correct identification compared with ribosomal markers, low PCR amplification and sequencing success eliminated them as candidates for a universal fungal barcode. Among the regions of the ribosomal cistron, the internal transcribed spacer (ITS) region has the highest probability of successful identification for the broadest range of fungi, with the most clearly defined barcode gap between inter- and intraspecific variation. The nuclear ribosomal large subunit, a popular phylogenetic marker in certain groups, had superior species resolution in some taxonomic groups, such as the early diverging lineages and the ascomycete yeasts, but was otherwise slightly inferior to the ITS. The nuclear ribosomal small subunit has poor species-level resolution in fungi. ITS will be formally proposed for adoption as the primary fungal barcode marker to the Consortium for the Barcode of Life, with the possibility that supplementary barcodes may be developed for particular narrowly circumscribed taxonomic groups.

  2. DNA replication stress restricts ribosomal DNA copy number.

    Science.gov (United States)

    Salim, Devika; Bradford, William D; Freeland, Amy; Cady, Gillian; Wang, Jianmin; Pruitt, Steven C; Gerton, Jennifer L

    2017-09-01

    Ribosomal RNAs (rRNAs) in budding yeast are encoded by ~100-200 repeats of a 9.1kb sequence arranged in tandem on chromosome XII, the ribosomal DNA (rDNA) locus. Copy number of rDNA repeat units in eukaryotic cells is maintained far in excess of the requirement for ribosome biogenesis. Despite the importance of the repeats for both ribosomal and non-ribosomal functions, it is currently not known how "normal" copy number is determined or maintained. To identify essential genes involved in the maintenance of rDNA copy number, we developed a droplet digital PCR based assay to measure rDNA copy number in yeast and used it to screen a yeast conditional temperature-sensitive mutant collection of essential genes. Our screen revealed that low rDNA copy number is associated with compromised DNA replication. Further, subculturing yeast under two separate conditions of DNA replication stress selected for a contraction of the rDNA array independent of the replication fork blocking protein, Fob1. Interestingly, cells with a contracted array grew better than their counterparts with normal copy number under conditions of DNA replication stress. Our data indicate that DNA replication stresses select for a smaller rDNA array. We speculate that this liberates scarce replication factors for use by the rest of the genome, which in turn helps cells complete DNA replication and continue to propagate. Interestingly, tumors from mini chromosome maintenance 2 (MCM2)-deficient mice also show a loss of rDNA repeats. Our data suggest that a reduction in rDNA copy number may indicate a history of DNA replication stress, and that rDNA array size could serve as a diagnostic marker for replication stress. Taken together, these data begin to suggest the selective pressures that combine to yield a "normal" rDNA copy number.

  3. DNA replication stress restricts ribosomal DNA copy number

    Science.gov (United States)

    Salim, Devika; Bradford, William D.; Freeland, Amy; Cady, Gillian; Wang, Jianmin

    2017-01-01

    Ribosomal RNAs (rRNAs) in budding yeast are encoded by ~100–200 repeats of a 9.1kb sequence arranged in tandem on chromosome XII, the ribosomal DNA (rDNA) locus. Copy number of rDNA repeat units in eukaryotic cells is maintained far in excess of the requirement for ribosome biogenesis. Despite the importance of the repeats for both ribosomal and non-ribosomal functions, it is currently not known how “normal” copy number is determined or maintained. To identify essential genes involved in the maintenance of rDNA copy number, we developed a droplet digital PCR based assay to measure rDNA copy number in yeast and used it to screen a yeast conditional temperature-sensitive mutant collection of essential genes. Our screen revealed that low rDNA copy number is associated with compromised DNA replication. Further, subculturing yeast under two separate conditions of DNA replication stress selected for a contraction of the rDNA array independent of the replication fork blocking protein, Fob1. Interestingly, cells with a contracted array grew better than their counterparts with normal copy number under conditions of DNA replication stress. Our data indicate that DNA replication stresses select for a smaller rDNA array. We speculate that this liberates scarce replication factors for use by the rest of the genome, which in turn helps cells complete DNA replication and continue to propagate. Interestingly, tumors from mini chromosome maintenance 2 (MCM2)-deficient mice also show a loss of rDNA repeats. Our data suggest that a reduction in rDNA copy number may indicate a history of DNA replication stress, and that rDNA array size could serve as a diagnostic marker for replication stress. Taken together, these data begin to suggest the selective pressures that combine to yield a “normal” rDNA copy number. PMID:28915237

  4. DNA replication stress restricts ribosomal DNA copy number.

    Directory of Open Access Journals (Sweden)

    Devika Salim

    2017-09-01

    Full Text Available Ribosomal RNAs (rRNAs in budding yeast are encoded by ~100-200 repeats of a 9.1kb sequence arranged in tandem on chromosome XII, the ribosomal DNA (rDNA locus. Copy number of rDNA repeat units in eukaryotic cells is maintained far in excess of the requirement for ribosome biogenesis. Despite the importance of the repeats for both ribosomal and non-ribosomal functions, it is currently not known how "normal" copy number is determined or maintained. To identify essential genes involved in the maintenance of rDNA copy number, we developed a droplet digital PCR based assay to measure rDNA copy number in yeast and used it to screen a yeast conditional temperature-sensitive mutant collection of essential genes. Our screen revealed that low rDNA copy number is associated with compromised DNA replication. Further, subculturing yeast under two separate conditions of DNA replication stress selected for a contraction of the rDNA array independent of the replication fork blocking protein, Fob1. Interestingly, cells with a contracted array grew better than their counterparts with normal copy number under conditions of DNA replication stress. Our data indicate that DNA replication stresses select for a smaller rDNA array. We speculate that this liberates scarce replication factors for use by the rest of the genome, which in turn helps cells complete DNA replication and continue to propagate. Interestingly, tumors from mini chromosome maintenance 2 (MCM2-deficient mice also show a loss of rDNA repeats. Our data suggest that a reduction in rDNA copy number may indicate a history of DNA replication stress, and that rDNA array size could serve as a diagnostic marker for replication stress. Taken together, these data begin to suggest the selective pressures that combine to yield a "normal" rDNA copy number.

  5. Testing the potential of a ribosomal 16S marker for DNA metabarcoding of insects

    Directory of Open Access Journals (Sweden)

    Vasco Elbrecht

    2016-04-01

    Full Text Available Cytochrome c oxidase I (COI is a powerful marker for DNA barcoding of animals, with good taxonomic resolution and a large reference database. However, when used for DNA metabarcoding, estimation of taxa abundances and species detection are limited due to primer bias caused by highly variable primer binding sites across the COI gene. Therefore, we explored the ability of the 16S ribosomal DNA gene as an alternative metabarcoding marker for species level assessments. Ten bulk samples, each containing equal amounts of tissue from 52 freshwater invertebrate taxa, were sequenced with the Illumina NextSeq 500 system. The 16S primers amplified three more insect species than the Folmer COI primers and amplified more equally, probably due to decreased primer bias. Estimation of biomass might be less biased with 16S than with COI, although variation in read abundances of two orders of magnitudes is still observed. According to these results, the marker choice depends on the scientific question. If the goal is to obtain a taxonomic identification at the species level, then COI is more appropriate due to established reference databases and known taxonomic resolution of this marker, knowing that a greater proportion of insects will be missed using COI Folmer primers. If the goal is to obtain a more comprehensive survey the 16S marker, which requires building a local reference database, or optimised degenerated COI primers could be more appropriate.

  6. Comparative analysis of chromosomal localization of ribosomal and telomeric DNA markers in three species of Pyrgomorphidae grasshoppers

    Directory of Open Access Journals (Sweden)

    Olesya G. Buleu

    2017-09-01

    Full Text Available The karyotypes of three species of Pyrgomorphidae grasshoppers were studied: Zonocerus elegans (Thunberg, 1815, Pyrgomorpha guentheri (Burr, 1899 and Atractomorpha lata (Mochulsky, 1866. Data on karyotypes of P. guentheri and Z. elegans are reported here for the first time. All species have karyotypes consisting of 19 acrocentric chromosomes in males and 20 acrocentric chromosomes in females (2n♂=19, NF=19; 2n♀=20, NF=20 and X0/XX sex determination system. A comparative analysis of the localization of C-heterochromatin, clusters of ribosomal DNA, and telomere repeats revealed inter-species diversity in these cytogenetic markers. These differences indicate that the karyotype divergence in the species studied is not associated with structural chromosome rearrangements, but with the evolution of repeated DNA sequences.

  7. Detection of Ribosomal DNA Sequence Polymorphisms in the Protist Plasmodiophora brassicae for the Identification of Geographical Isolates

    Directory of Open Access Journals (Sweden)

    Rawnak Laila

    2017-01-01

    Full Text Available Clubroot is a soil-borne disease caused by the protist Plasmodiophora brassicae (P. brassicae. It is one of the most economically important diseases of Brassica rapa and other cruciferous crops as it can cause remarkable yield reductions. Understanding P. brassicae genetics, and developing efficient molecular markers, is essential for effective detection of harmful races of this pathogen. Samples from 11 Korean field populations of P. brassicae (geographic isolates, collected from nine different locations in South Korea, were used in this study. Genomic DNA was extracted from the clubroot-infected samples to sequence the ribosomal DNA. Primers and probes for P. brassicae were designed using a ribosomal DNA gene sequence from a Japanese strain available in GenBank (accession number AB526843; isolate NGY. The nuclear ribosomal DNA (rDNA sequence of P. brassicae, comprising 6932 base pairs (bp, was cloned and sequenced and found to include the small subunits (SSUs and a large subunit (LSU, internal transcribed spacers (ITS1 and ITS2, and a 5.8s. Sequence variation was observed in both the SSU and LSU. Four markers showed useful differences in high-resolution melting analysis to identify nucleotide polymorphisms including single- nucleotide polymorphisms (SNPs, oligonucleotide polymorphisms, and insertions/deletions (InDels. A combination of three markers was able to distinguish the geographical isolates into two groups.

  8. Revealing pancrustacean relationships: phylogenetic analysis of ribosomal protein genes places Collembola (springtails) in a monophyletic Hexapoda and reinforces the discrepancy between mitochondrial and nuclear DNA markers.

    Science.gov (United States)

    Timmermans, M J T N; Roelofs, D; Mariën, J; van Straalen, N M

    2008-03-12

    In recent years, several new hypotheses on phylogenetic relations among arthropods have been proposed on the basis of DNA sequences. One of the challenged hypotheses is the monophyly of hexapods. This discussion originated from analyses based on mitochondrial DNA datasets that, due to an unusual positioning of Collembola, suggested that the hexapod body plan evolved at least twice. Here, we re-evaluate the position of Collembola using ribosomal protein gene sequences. In total 48 ribosomal proteins were obtained for the collembolan Folsomia candida. These 48 sequences were aligned with sequence data on 35 other ecdysozoans. Each ribosomal protein gene was available for 25% to 86% of the taxa. However, the total sequence information was unequally distributed over the taxa and ranged between 4% and 100%. A concatenated dataset was constructed (5034 inferred amino acids in length), of which ~66% of the positions were filled. Phylogenetic tree reconstructions, using Maximum Likelihood, Maximum Parsimony, and Bayesian methods, resulted in a topology that supports monophyly of Hexapoda. Although ribosomal proteins in general may not evolve independently, they once more appear highly valuable for phylogenetic reconstruction. Our analyses clearly suggest that Hexapoda is monophyletic. This underpins the inconsistency between nuclear and mitochondrial datasets when analyzing pancrustacean relationships. Caution is needed when applying mitochondrial markers in deep phylogeny.

  9. Eukaryotic ribosome display with in situ DNA recovery.

    Science.gov (United States)

    He, Mingyue; Edwards, Bryan M; Kastelic, Damjana; Taussig, Michael J

    2012-01-01

    Ribosome display is a cell-free display technology for in vitro selection and optimisation of proteins from large diversified libraries. It operates through the formation of stable protein-ribosome-mRNA (PRM) complexes and selection of ligand-binding proteins, followed by DNA recovery from the selected genetic information. Both prokaryotic and eukaryotic ribosome display systems have been developed. In this chapter, we describe the eukaryotic rabbit reticulocyte method in which a distinct in situ single-primer RT-PCR procedure is used to recover DNA from the selected PRM complexes without the need for prior disruption of the ribosome.

  10. D1/D2 domain of large-subunit ribosomal DNA for differentiation of Orpinomyces spp.

    Science.gov (United States)

    Dagar, Sumit S; Kumar, Sanjay; Mudgil, Priti; Singh, Rameshwar; Puniya, Anil K

    2011-09-01

    This study presents the suitability of D1/D2 domain of large-subunit (LSU) ribosomal DNA (rDNA) for differentiation of Orpinomyces joyonii and Orpinomyces intercalaris based on PCR-restriction fragment length polymorphism (RFLP). A variation of G/T in O. intercalaris created an additional restriction site for AluI, which was used as an RFLP marker. The results demonstrate adequate heterogeneity in the LSU rDNA for species-level differentiation.

  11. Revealing pancrustacean relationships: Phylogenetic analysis of ribosomal protein genes places Collembola (springtails in a monophyletic Hexapoda and reinforces the discrepancy between mitochondrial and nuclear DNA markers

    Directory of Open Access Journals (Sweden)

    Mariën J

    2008-03-01

    Full Text Available Abstract Background In recent years, several new hypotheses on phylogenetic relations among arthropods have been proposed on the basis of DNA sequences. One of the challenged hypotheses is the monophyly of hexapods. This discussion originated from analyses based on mitochondrial DNA datasets that, due to an unusual positioning of Collembola, suggested that the hexapod body plan evolved at least twice. Here, we re-evaluate the position of Collembola using ribosomal protein gene sequences. Results In total 48 ribosomal proteins were obtained for the collembolan Folsomia candida. These 48 sequences were aligned with sequence data on 35 other ecdysozoans. Each ribosomal protein gene was available for 25% to 86% of the taxa. However, the total sequence information was unequally distributed over the taxa and ranged between 4% and 100%. A concatenated dataset was constructed (5034 inferred amino acids in length, of which ~66% of the positions were filled. Phylogenetic tree reconstructions, using Maximum Likelihood, Maximum Parsimony, and Bayesian methods, resulted in a topology that supports monophyly of Hexapoda. Conclusion Although ribosomal proteins in general may not evolve independently, they once more appear highly valuable for phylogenetic reconstruction. Our analyses clearly suggest that Hexapoda is monophyletic. This underpins the inconsistency between nuclear and mitochondrial datasets when analyzing pancrustacean relationships. Caution is needed when applying mitochondrial markers in deep phylogeny.

  12. D1/D2 Domain of Large-Subunit Ribosomal DNA for Differentiation of Orpinomyces spp.▿

    Science.gov (United States)

    Dagar, Sumit S.; Kumar, Sanjay; Mudgil, Priti; Singh, Rameshwar; Puniya, Anil K.

    2011-01-01

    This study presents the suitability of D1/D2 domain of large-subunit (LSU) ribosomal DNA (rDNA) for differentiation of Orpinomyces joyonii and Orpinomyces intercalaris based on PCR-restriction fragment length polymorphism (RFLP). A variation of G/T in O. intercalaris created an additional restriction site for AluI, which was used as an RFLP marker. The results demonstrate adequate heterogeneity in the LSU rDNA for species-level differentiation. PMID:21784906

  13. Expression of protein-coding genes embedded in ribosomal DNA

    DEFF Research Database (Denmark)

    Johansen, Steinar D; Haugen, Peik; Nielsen, Henrik

    2007-01-01

    Ribosomal DNA (rDNA) is a specialised chromosomal location that is dedicated to high-level transcription of ribosomal RNA genes. Interestingly, rDNAs are frequently interrupted by parasitic elements, some of which carry protein genes. These are non-LTR retrotransposons and group II introns that e...... in the nucleolus....

  14. Complete nuclear ribosomal DNA sequence amplification and molecular analyses of Bangia (Bangiales, Rhodophyta) from China

    Science.gov (United States)

    Xu, Jiajie; Jiang, Bo; Chai, Sanming; He, Yuan; Zhu, Jianyi; Shen, Zonggen; Shen, Songdong

    2016-09-01

    Filamentous Bangia, which are distributed extensively throughout the world, have simple and similar morphological characteristics. Scientists can classify these organisms using molecular markers in combination with morphology. We successfully sequenced the complete nuclear ribosomal DNA, approximately 13 kb in length, from a marine Bangia population. We further analyzed the small subunit ribosomal DNA gene (nrSSU) and the internal transcribed spacer (ITS) sequence regions along with nine other marine, and two freshwater Bangia samples from China. Pairwise distances of the nrSSU and 5.8S ribosomal DNA gene sequences show the marine samples grouping together with low divergences (00.003; 0-0.006, respectively) from each other, but high divergences (0.123-0.126; 0.198, respectively) from freshwater samples. An exception is the marine sample collected from Weihai, which shows high divergence from both other marine samples (0.063-0.065; 0.129, respectively) and the freshwater samples (0.097; 0.120, respectively). A maximum likelihood phylogenetic tree based on a combined SSU-ITS dataset with maximum likelihood method shows the samples divided into three clades, with the two marine sample clades containing Bangia spp. from North America, Europe, Asia, and Australia; and one freshwater clade, containing Bangia atropurpurea from North America and China.

  15. cDNA, genomic sequence cloning and analysis of the ribosomal ...

    African Journals Online (AJOL)

    Ribosomal protein L37A (RPL37A) is a component of 60S large ribosomal subunit encoded by the RPL37A gene, which belongs to the family of ribosomal L37AE proteins, located in the cytoplasm. The complementary deoxyribonucleic acid (cDNA) and the genomic sequence of RPL37A were cloned successfully from giant ...

  16. DNA replication initiator Cdc6 also regulates ribosomal DNA transcription initiation.

    Science.gov (United States)

    Huang, Shijiao; Xu, Xiaowei; Wang, Guopeng; Lu, Guoliang; Xie, Wenbing; Tao, Wei; Zhang, Hongyin; Jiang, Qing; Zhang, Chuanmao

    2016-04-01

    RNA-polymerase-I-dependent ribosomal DNA (rDNA) transcription is fundamental to rRNA processing, ribosome assembly and protein synthesis. However, how this process is initiated during the cell cycle is not fully understood. By performing a proteomic analysis of transcription factors that bind RNA polymerase I during rDNA transcription initiation, we identified that the DNA replication initiator Cdc6 interacts with RNA polymerase I and its co-factors, and promotes rDNA transcription in G1 phase in an ATPase-activity-dependent manner. We further showed that Cdc6 is targeted to the nucleolus during late mitosis and G1 phase in a manner that is dependent on B23 (also known as nucleophosmin, NPM1), and preferentially binds to the rDNA promoter through its ATP-binding domain. Overexpression of Cdc6 increases rDNA transcription, whereas knockdown of Cdc6 results in a decreased association of both RNA polymerase I and the RNA polymerase I transcription factor RRN3 with rDNA, and a reduction of rDNA transcription. Furthermore, depletion of Cdc6 impairs the interaction between RRN3 and RNA polymerase I. Taken together, our data demonstrate that Cdc6 also serves as a regulator of rDNA transcription initiation, and indicate a mechanism by which initiation of rDNA transcription and DNA replication can be coordinated in cells. © 2016. Published by The Company of Biologists Ltd.

  17. Phylogenetic Information Content of Copepoda Ribosomal DNA Repeat Units: ITS1 and ITS2 Impact

    Science.gov (United States)

    Zagoskin, Maxim V.; Lazareva, Valentina I.; Grishanin, Andrey K.; Mukha, Dmitry V.

    2014-01-01

    The utility of various regions of the ribosomal repeat unit for phylogenetic analysis was examined in 16 species representing four families, nine genera, and two orders of the subclass Copepoda (Crustacea). Fragments approximately 2000 bp in length containing the ribosomal DNA (rDNA) 18S and 28S gene fragments, the 5.8S gene, and the internal transcribed spacer regions I and II (ITS1 and ITS2) were amplified and analyzed. The DAMBE (Data Analysis in Molecular Biology and Evolution) software was used to analyze the saturation of nucleotide substitutions; this test revealed the suitability of both the 28S gene fragment and the ITS1/ITS2 rDNA regions for the reconstruction of phylogenetic trees. Distance (minimum evolution) and probabilistic (maximum likelihood, Bayesian) analyses of the data revealed that the 28S rDNA and the ITS1 and ITS2 regions are informative markers for inferring phylogenetic relationships among families of copepods and within the Cyclopidae family and associated genera. Split-graph analysis of concatenated ITS1/ITS2 rDNA regions of cyclopoid copepods suggested that the Mesocyclops, Thermocyclops, and Macrocyclops genera share complex evolutionary relationships. This study revealed that the ITS1 and ITS2 regions potentially represent different phylogenetic signals. PMID:25215300

  18. Ribosomal DNA internal transcribed spacer 1 and internal ...

    African Journals Online (AJOL)

    USER

    2010-07-26

    Jul 26, 2010 ... in some East Asian countries such as China, Korea and. *Corresponding author. E-mail: soonkwan@kangwon.ac.kr. Tel: +82 33 250 6476. Fax: +82 33 250 6470. Abbreviations: nrDNA, Nuclear ribosomal DNA; ITS, internal transcribed spacer; PCR, polymerase chain reaction; BLAST, basic local alignment ...

  19. Development of identification process for insect group using radiation marker DNA

    International Nuclear Information System (INIS)

    Muraji, M.; Tamura, T.

    2004-01-01

    Detection of a band pattern for insect groups was tried by using radiation marked DNA clone. A rapid segregation process for poly-type DNA segment was investigated. A band pattern of silkworm was detected by analysis using DNA type transposon, K1.4. The exon regions on genes of hemiptera insect were segregated by in vitro cloning. Band patterns of the silkworm and the other insects were detected by identification process of DNA clone and radiation marker. Family singularity mutation existed in the inserted position of transposon. The family of insect was identified easily by the difference of the detection band patterns. Effective band pattern for family discrimination were obtained by analysis for a part of mitochondria DNA and ribosomal DNA. DNA segregation process was investigated by using the enriched library, also. (M. Suetake)

  20. Comparison of six simple methods for extracting ribosomal and mitochondrial DNA from Toxocara and Toxascaris nematodes.

    Science.gov (United States)

    Mikaeili, F; Kia, E B; Sharbatkhori, M; Sharifdini, M; Jalalizand, N; Heidari, Z; Zarei, Z; Stensvold, C R; Mirhendi, H

    2013-06-01

    Six simple methods for extraction of ribosomal and mitochondrial DNA from Toxocara canis, Toxocara cati and Toxascaris leonina were compared by evaluating the presence, appearance and intensity of PCR products visualized on agarose gels and amplified from DNA extracted by each of the methods. For each species, two isolates were obtained from the intestines of their respective hosts: T. canis and T. leonina from dogs, and T. cati from cats. For all isolates, total DNA was extracted using six different methods, including grinding, boiling, crushing, beating, freeze-thawing and the use of a commercial kit. To evaluate the efficacy of each method, the internal transcribed spacer (ITS) region and the cytochrome c oxidase subunit 1 (cox1) gene were chosen as representative markers for ribosomal and mitochondrial DNA, respectively. Among the six DNA extraction methods, the beating method was the most cost effective for all three species, followed by the commercial kit. Both methods produced high intensity bands on agarose gels and were characterized by no or minimal smear formation, depending on gene target; however, beating was less expensive. We therefore recommend the beating method for studies where costs need to be kept at low levels. Copyright © 2013 Elsevier Inc. All rights reserved.

  1. Nuclear ribosomal internal transcribed spacer (ITS) region as a universal DNA barcode marker for Fungi

    NARCIS (Netherlands)

    Schoch, C.L.; Seifert, K.A.; Huhndorf, S.; Robert, V.; Spouge, J.L.; Levesque, C.A.; Chen, W.; Crous, P.W.; Boekhout, T.; Damm, U.; Hoog, de G.S.; Eberhardt, U.; Groenewald, J.Z.; Groenewald, M.; Hagen, F.; Houbraken, J.; Quaedvlieg, W.; Stielow, B.; Vu, T.D.; Walther, G.

    2012-01-01

    Six DNA regions were evaluated as potential DNA barcodes for Fungi, the second largest kingdom of eukaryotic life, by a multinational, multilaboratory consortium. The region of the mitochondrial cytochrome c oxidase subunit 1 used as the animal barcode was excluded as a potential marker, because it

  2. Nuclear ribosomal internal transcribed spacer (ITS) region as a universal DNA barcode marker for Fungi

    Science.gov (United States)

    Six DNA regions were evaluated in a multi-national, multi-laboratory consortium as potential DNA barcodes for Fungi, the second largest kingdom of eukaryotic life. The region of the mitochondrial cytochrome c oxidase subunit 1 used as the animal barcode was excluded as a potential marker, because it...

  3. DNA Binding by the Ribosomal DNA Transcription Factor Rrn3 Is Essential for Ribosomal DNA Transcription*

    Science.gov (United States)

    Stepanchick, Ann; Zhi, Huijun; Cavanaugh, Alice H.; Rothblum, Katrina; Schneider, David A.; Rothblum, Lawrence I.

    2013-01-01

    The human homologue of yeast Rrn3 is an RNA polymerase I-associated transcription factor that is essential for ribosomal DNA (rDNA) transcription. The generally accepted model is that Rrn3 functions as a bridge between RNA polymerase I and the transcription factors bound to the committed template. In this model Rrn3 would mediate an interaction between the mammalian Rrn3-polymerase I complex and SL1, the rDNA transcription factor that binds to the core promoter element of the rDNA. In the course of studying the role of Rrn3 in recruitment, we found that Rrn3 was in fact a DNA-binding protein. Analysis of the sequence of Rrn3 identified a domain with sequence similarity to the DNA binding domain of heat shock transcription factor 2. Randomization, or deletion, of the amino acids in this region in Rrn3, amino acids 382–400, abrogated its ability to bind DNA, indicating that this domain was an important contributor to DNA binding by Rrn3. Control experiments demonstrated that these mutant Rrn3 constructs were capable of interacting with both rpa43 and SL1, two other activities demonstrated to be essential for Rrn3 function. However, neither of these Rrn3 mutants was capable of functioning in transcription in vitro. Moreover, although wild-type human Rrn3 complemented a yeast rrn3-ts mutant, the DNA-binding site mutant did not. These results demonstrate that DNA binding by Rrn3 is essential for transcription by RNA polymerase I. PMID:23393135

  4. DNA binding by the ribosomal DNA transcription factor rrn3 is essential for ribosomal DNA transcription.

    Science.gov (United States)

    Stepanchick, Ann; Zhi, Huijun; Cavanaugh, Alice H; Rothblum, Katrina; Schneider, David A; Rothblum, Lawrence I

    2013-03-29

    The human homologue of yeast Rrn3 is an RNA polymerase I-associated transcription factor that is essential for ribosomal DNA (rDNA) transcription. The generally accepted model is that Rrn3 functions as a bridge between RNA polymerase I and the transcription factors bound to the committed template. In this model Rrn3 would mediate an interaction between the mammalian Rrn3-polymerase I complex and SL1, the rDNA transcription factor that binds to the core promoter element of the rDNA. In the course of studying the role of Rrn3 in recruitment, we found that Rrn3 was in fact a DNA-binding protein. Analysis of the sequence of Rrn3 identified a domain with sequence similarity to the DNA binding domain of heat shock transcription factor 2. Randomization, or deletion, of the amino acids in this region in Rrn3, amino acids 382-400, abrogated its ability to bind DNA, indicating that this domain was an important contributor to DNA binding by Rrn3. Control experiments demonstrated that these mutant Rrn3 constructs were capable of interacting with both rpa43 and SL1, two other activities demonstrated to be essential for Rrn3 function. However, neither of these Rrn3 mutants was capable of functioning in transcription in vitro. Moreover, although wild-type human Rrn3 complemented a yeast rrn3-ts mutant, the DNA-binding site mutant did not. These results demonstrate that DNA binding by Rrn3 is essential for transcription by RNA polymerase I.

  5. Divergent evolutionary histories of DNA markers in a Hawaiian population of the coral Montipora capitata

    OpenAIRE

    Hollie M. Putnam; Diane K. Adams; Ehud Zelzion; Nicole E. Wagner; Huan Qiu; Tali Mass; Paul G. Falkowski; Ruth D. Gates; Debashish Bhattacharya

    2017-01-01

    We investigated intra- and inter-colony sequence variation in a population of the dominant Hawaiian coral Montipora capitata by analyzing marker gene and genomic data. Ribosomal ITS1 regions showed evidence of a reticulate history among the colonies, suggesting incomplete rDNA repeat homogenization. Analysis of the mitochondrial genome identified a major (M. capitata) and a minor (M. flabellata) haplotype in single polyp-derived sperm bundle DNA with some colonies containing 2?3 different mtD...

  6. Differences in a ribosomal DNA sequence of Strongylus species allows identification of single eggs.

    Science.gov (United States)

    Campbell, A J; Gasser, R B; Chilton, N B

    1995-03-01

    In the current study, molecular techniques were evaluated for the species identification of individual strongyle eggs. Adult worms of Strongylus edentatus, S. equinus and S. vulgaris were collected at necropsy from horses from Australia and the U.S.A. Genomic DNA was isolated and a ribosomal transcribed spacer (ITS-2) amplified and sequenced using polymerase chain reaction (PCR) techniques. The length of the ITS-2 sequence of S. edentatus, S. equinus and S. vulgaris ranged between 217 and 235 nucleotides. Extensive sequence analysis demonstrated a low degree (0-0.9%) of intraspecific variation in the ITS-2 for the Strongylus species examined, whereas the levels of interspecific differences (13-29%) were significantly greater. Interspecific differences in the ITS-2 sequences allowed unequivocal species identification of single worms and eggs using PCR-linked restriction fragment length polymorphism. These results demonstrate the potential of the ribosomal spacers as genetic markers for species identification of single strongyle eggs from horse faeces.

  7. [Identification of Clonorchis sinensis metacercariae based on PCR targeting ribosomal DNA ITS regions and COX1 gene].

    Science.gov (United States)

    Yang, Qing-Li; Shen, Ji-Qing; Jiang, Zhi-Hua; Yang, Yi-Chao; Li, Hong-Mei; Chen, Ying-Dan; Zhou, Xiao-Nong

    2014-06-01

    To identify Clonorchis sinensis metacercariae using PCR targeting ribosomal DNA ITS region and COX1 gene. Pseudorasbora parva were collected from Hengxian County of Guangxi at the end of May 2013. Single metacercaria of C. sinensis and other trematodes were separated from muscle tissue of P. parva by digestion method. Primers targeting ribosomal DNA ITS region and COX1 gene of C. sinensis were designed for PCR and the universal primers were used as control. The sensitivity and specificity of the PCR detection were analyzed. C. sinensis metacercariae at different stages were identified by PCR. DNA from single C. sinensis metacercaria was detected by PCR targeting ribosomal DNA ITS region and COX1 gene. The specific amplicans have sizes of 437/549, 156/249 and 195/166 bp, respectively. The ratio of the two positive numbers in PCR with universal primers and specific primers targeting C. sinensis ribosomal DNA ITS1 and ITS2 regions was 0.905 and 0.952, respectively. The target gene fragments were amplified by PCR using COX1 gene-specific primers. The PCR with specific primers did not show any non-specific amplification. However, the PCR with universal primers targeting ribosomal DNA ITS regions performed serious non-specific amplification. C. sinensis metacercariae at different stages are identified by morphological observation and PCR method. Species-specific primers targeting ribosomal DNA ITS region show higher sensitivity and specificity than the universal primers. PCR targeting COX1 gene shows similar sensitivity and specificity to PCR with specific primers targeting ribosomal DNA ITS regions.

  8. (Brassicaceae) based on nuclear ribosomal ITS DNA sequences

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Genetics; Volume 93; Issue 2. Phylogeny and biogeography of Alyssum (Brassicaceae) based on nuclear ribosomal ITS DNA sequences. Yan Li Yan Kong Zhe Zhang Yanqiang Yin Bin Liu Guanghui Lv Xiyong Wang. Research Article Volume 93 Issue 2 August 2014 pp 313-323 ...

  9. Absence of ribosomal DNA amplification in the meroistic (telotrophic) ovary of the large milkweed bug Oncopeltus fasciatus (Dallas) (Hemiptera: Lygaeidae)

    Science.gov (United States)

    1975-01-01

    In the typical meroistic insect ovary, the oocyte nucleus synthesizes little if any RNA. Nurse cells or trophocytes actively synthesize ribosomes which are transported to and accumulated by the oocyte. In the telotrophic ovary a morphological separation exists, the nurse cells being localized at the apical end of each ovariole and communicating with the ooocytes via nutritive cords. In order to determine whether the genes coding for ribosomal RNA (rRNA) are amplified in the telotrophic ovary of the milkweed bug Oncopeltus fasciatus, the percentages of the genome coding for ribosomal RNA in somatic cells, spermatogenic cells, ovarian follicles, and nurse cells were compared. The oocytes and most of the nurse cells of O. fasciatus are uninucleolate. DNA hybridizing with ribosomal RNA is localized in a satellite DNA, the density of which is 1.712 g/cm(-3). The density of main-band DNA is 1.694 g/cm(-3). The ribosomal DNA satellite accounts for approximately 0.2% of the DNA in somatic and gametogenic tissues of both males and females. RNA-DNA hybridization analysis demonstrates that approximately 0.03% of the DNA in somatic tissues, testis, ovarian follicles, and isolated nurse cells hybridizes with ribosomal RNA. The fact that the percentage of DNA hybridizing with rRNA is the same in somatic and in male and female gametogenic tissues indicates that amplification of ribosomal DNA does not occur in nurse cells and that if it occurs in oocytes, it represents less than a 50- fold increase in ribosomal DNA. An increase in total genome DNA accounted by polyploidization appears to provide for increasing the amount of ribosomal DNA in the nurse cells. PMID:1158969

  10. Organization of Replication of Ribosomal DNA in Saccharomyces cerevisiae

    NARCIS (Netherlands)

    Linskens, Maarten H.K.; Huberman, Joel A.

    1988-01-01

    Using recently developed replicon mapping techniques, we have analyzed the replication of the ribosomal DNA in Saccharomyces cerevisiae. The results show that (i) the functional origin of replication colocalizes with an autonomously replicating sequence element previously mapped to the

  11. Non-canonical ribosomal DNA segments in the human genome, and nucleoli functioning.

    Science.gov (United States)

    Kupriyanova, Natalia S; Netchvolodov, Kirill K; Sadova, Anastasia A; Cherepanova, Marina D; Ryskov, Alexei P

    2015-11-10

    Ribosomal DNA (rDNA) in the human genome is represented by tandem repeats of 43 kb nucleotide sequences that form nucleoli organizers (NORs) on each of five pairs of acrocentric chromosomes. RDNA-similar segments of different lengths are also present on (NOR)(-) chromosomes. Many of these segments contain nucleotide substitutions, supplementary microsatellite clusters, and extended deletions. Recently, it was shown that, in addition to ribosome biogenesis, nucleoli exhibit additional functions, such as cell-cycle regulation and response to stresses. In particular, several stress-inducible loci located in the ribosomal intergenic spacer (rIGS) produce stimuli-specific noncoding nucleolus RNAs. By mapping the 5'/3' ends of the rIGS segments scattered throughout (NOR)(-) chromosomes, we discovered that the bonds in the rIGS that were most often susceptible to disruption in the rIGS were adjacent to, or overlapped with stimuli-specific inducible loci. This suggests the interconnection of the two phenomena - nucleoli functioning and the scattering of rDNA-like sequences on (NOR)(-) chromosomes. Copyright © 2015 Elsevier B.V. All rights reserved.

  12. Investigation of the somaclonal and mutagen induced variability in barley by the application of protein and DNA markers

    International Nuclear Information System (INIS)

    Atanassov, A.; Todorovska, E.; Trifonova, A.; Petrova, M.; Marinova, E.; Gramatikova, M.; Valcheva, D.; Zaprianov, S.; Mersinkov, N.

    1998-01-01

    Barley, Hordeum vulgare L., is one of the most important crop species for Bulgaria. The characterisation of the genetic pool is of great necessity for the Bulgarian barley breeding programme which is directed toward improving quantitative and qualitative traits. Molecular markers [protein, restriction fragment length polymorphisms (RFLP) and randomly amplified polymorphic DNA (RAPD)] have been applied to characterise the Bulgarian barley cultivars and their regenerants. The changes in DNA loci coding for 26S, 5.8S and 18S rRNA repeats, C hordein locus and mitochondrial DNA organisation have been investigated. The potential for ribosomal DNA length polymorphism in Bulgarian barley cultivars appear to be limited to three different repeat lengths (10.2, 9.5 and 9.0kb) and three plant rDNA phenotypes. Polymorphism was not observed in ribosomal DNA repeat units in somaclonal variants. Variation concerning C hordein electrophoretic pattern was observed in one line from cultivar Jubiley. Analysis of the HorI locus reveals RFLPs in sequences coding for C hordeins in this line. Mitochondrial molecular markers are convenient for detection of DNA polymorphisms in the variant germplasm as well as for the somaclonal variants derived from it. Two lines from Ruen revealed polymorphic bands after hybridisation with mitochondrial DNA probe. RAPD assays have been carried out by using 20 different 10-mer primers. Heritable polymorphism in several tissue culture derived (TCD) lines was observed. RAPD assay is a sensitive and representative approach to distinguish the variability created by tissue culture and mutagenesis

  13. Expression Profiling of Ribosome Biogenesis Factors Reveals Nucleolin as a Novel Potential Marker to Predict Outcome in AML Patients.

    Directory of Open Access Journals (Sweden)

    Virginie Marcel

    Full Text Available Acute myeloid leukemia (AML is a heterogeneous disease. Prognosis is mainly influenced by patient age at diagnosis and cytogenetic alterations, two of the main factors currently used in AML patient risk stratification. However, additional criteria are required to improve the current risk classification and better adapt patient care. In neoplastic cells, ribosome biogenesis is increased to sustain the high proliferation rate and ribosome composition is altered to modulate specific gene expression driving tumorigenesis. Here, we investigated the usage of ribosome biogenesis factors as clinical markers in adult patients with AML. We showed that nucleoli, the nucleus compartments where ribosome production takes place, are modified in AML by analyzing a panel of AML and healthy donor cells using immunofluorescence staining. Using four AML series, including the TCGA dataset, altogether representing a total of about 270 samples, we showed that not all factors involved in ribosome biogenesis have clinical values although ribosome biogenesis is increased in AML. Interestingly, we identified the regulator of ribosome production nucleolin (NCL as over-expressed in AML blasts. Moreover, we found in two series that high NCL mRNA expression level was associated with a poor overall survival, particular in elderly patients. Multivariate analyses taking into account age and cytogenetic risk indicated that NCL expression in blast cells is an independent marker of reduced survival. Our study identifies NCL as a potential novel prognostic factor in AML. Altogether, our results suggest that the ribosome biogenesis pathway may be of interest as clinical markers in AML.

  14. Ribosomal DNA sequence heterogeneity reflects intraspecies phylogenies and predicts genome structure in two contrasting yeast species.

    Science.gov (United States)

    West, Claire; James, Stephen A; Davey, Robert P; Dicks, Jo; Roberts, Ian N

    2014-07-01

    The ribosomal RNA encapsulates a wealth of evolutionary information, including genetic variation that can be used to discriminate between organisms at a wide range of taxonomic levels. For example, the prokaryotic 16S rDNA sequence is very widely used both in phylogenetic studies and as a marker in metagenomic surveys and the internal transcribed spacer region, frequently used in plant phylogenetics, is now recognized as a fungal DNA barcode. However, this widespread use does not escape criticism, principally due to issues such as difficulties in classification of paralogous versus orthologous rDNA units and intragenomic variation, both of which may be significant barriers to accurate phylogenetic inference. We recently analyzed data sets from the Saccharomyces Genome Resequencing Project, characterizing rDNA sequence variation within multiple strains of the baker's yeast Saccharomyces cerevisiae and its nearest wild relative Saccharomyces paradoxus in unprecedented detail. Notably, both species possess single locus rDNA systems. Here, we use these new variation datasets to assess whether a more detailed characterization of the rDNA locus can alleviate the second of these phylogenetic issues, sequence heterogeneity, while controlling for the first. We demonstrate that a strong phylogenetic signal exists within both datasets and illustrate how they can be used, with existing methodology, to estimate intraspecies phylogenies of yeast strains consistent with those derived from whole-genome approaches. We also describe the use of partial Single Nucleotide Polymorphisms, a type of sequence variation found only in repetitive genomic regions, in identifying key evolutionary features such as genome hybridization events and show their consistency with whole-genome Structure analyses. We conclude that our approach can transform rDNA sequence heterogeneity from a problem to a useful source of evolutionary information, enabling the estimation of highly accurate phylogenies of

  15. Nuclear internal transcribed spacer-1 as a sensitive genetic marker for environmental DNA studies in common carp Cyprinus carpio.

    Science.gov (United States)

    Minamoto, Toshifumi; Uchii, Kimiko; Takahara, Teruhiko; Kitayoshi, Takumi; Tsuji, Satsuki; Yamanaka, Hiroki; Doi, Hideyuki

    2017-03-01

    The recently developed environmental DNA (eDNA) analysis has been used to estimate the distribution of aquatic vertebrates by using mitochondrial DNA (mtDNA) as a genetic marker. However, mtDNA markers have certain drawbacks such as variable copy number and maternal inheritance. In this study, we investigated the potential of using nuclear DNA (ncDNA) as a more reliable genetic marker for eDNA analysis by using common carp (Cyprinus carpio). We measured the copy numbers of cytochrome b (CytB) gene region of mtDNA and internal transcribed spacer 1 (ITS1) region of ribosomal DNA of ncDNA in various carp tissues and then compared the detectability of these markers in eDNA samples. In the DNA extracted from the brain and gill tissues and intestinal contents, CytB was detected at 95.1 ± 10.7 (mean ± 1 standard error), 29.7 ± 1.59 and 24.0 ± 4.33 copies per cell, respectively, and ITS1 was detected at 1760 ± 343, 2880 ± 503 and 1910 ± 352 copies per cell, respectively. In the eDNA samples from mesocosm, pond and lake water, the copy numbers of ITS1 were about 160, 300 and 150 times higher than those of CytB, respectively. The minimum volume of pond water required for quantification was 33 and 100 mL for ITS1 and CytB, respectively. These results suggested that ITS1 is a more sensitive genetic marker for eDNA studies of C. carpio. © 2016 John Wiley & Sons Ltd.

  16. cDNA, genomic sequence cloning and overexpression of ribosomal ...

    African Journals Online (AJOL)

    RPS16 of eukaryote is a component of the 40S small ribosomal subunit encoded by RPS16 gene and is also a homolog of prokaryotic RPS9. The cDNA and genomic sequence of RPS16 was cloned successfully for the first time from the Giant Panda (Ailuropoda melanoleuca) using reverse transcription-polymerase chain ...

  17. The NBS1-Treacle complex controls ribosomal RNA transcription in response to DNA damage

    DEFF Research Database (Denmark)

    Larsen, Dorthe H; Hari, Flurina; Clapperton, Julie A

    2014-01-01

    Chromosome breakage elicits transient silencing of ribosomal RNA synthesis, but the mechanisms involved remained elusive. Here we discover an in trans signalling mechanism that triggers pan-nuclear silencing of rRNA transcription in response to DNA damage. This is associated with transient...... recruitment of the Nijmegen breakage syndrome protein 1 (NBS1), a central regulator of DNA damage responses, into the nucleoli. We further identify TCOF1 (also known as Treacle), a nucleolar factor implicated in ribosome biogenesis and mutated in Treacher Collins syndrome, as an interaction partner of NBS1...

  18. Classification of plant associated bacteria using RIF, a computationally derived DNA marker.

    Directory of Open Access Journals (Sweden)

    Kevin L Schneider

    Full Text Available A DNA marker that distinguishes plant associated bacteria at the species level and below was derived by comparing six sequenced genomes of Xanthomonas, a genus that contains many important phytopathogens. This DNA marker comprises a portion of the dnaA replication initiation factor (RIF. Unlike the rRNA genes, dnaA is a single copy gene in the vast majority of sequenced bacterial genomes, and amplification of RIF requires genus-specific primers. In silico analysis revealed that RIF has equal or greater ability to differentiate closely related species of Xanthomonas than the widely used ribosomal intergenic spacer region (ITS. Furthermore, in a set of 263 Xanthomonas, Ralstonia and Clavibacter strains, the RIF marker was directly sequenced in both directions with a success rate approximately 16% higher than that for ITS. RIF frameworks for Xanthomonas, Ralstonia and Clavibacter were constructed using 682 reference strains representing different species, subspecies, pathovars, races, hosts and geographic regions, and contain a total of 109 different RIF sequences. RIF sequences showed subspecific groupings but did not place strains of X. campestris or X. axonopodis into currently named pathovars nor R. solanacearum strains into their respective races, confirming previous conclusions that pathovar and race designations do not necessarily reflect genetic relationships. The RIF marker also was sequenced for 24 reference strains from three genera in the Enterobacteriaceae: Pectobacterium, Pantoea and Dickeya. RIF sequences of 70 previously uncharacterized strains of Ralstonia, Clavibacter, Pectobacterium and Dickeya matched, or were similar to, those of known reference strains, illustrating the utility of the frameworks to classify bacteria below the species level and rapidly match unknown isolates to reference strains. The RIF sequence frameworks are available at the online RIF database, RIFdb, and can be queried for diagnostic purposes with RIF

  19. Ribosomal PCR and DNA sequencing for detection and identification of bacteria

    DEFF Research Database (Denmark)

    Jensen, Kristine Helander; Dargis, Rimtas; Christensen, Jens Jørgen

    2014-01-01

    -haemolytic streptococci, especially within the mitis group. The data show that ribosomal PCR with subsequent DNA sequencing of the PCR product is a most valuable supplement to culture for identifying bacterial agents of both acute and prolonged infections. However, some bacteria, including non-haemolytic streptococci...

  20. Identification of Nematodirus species (Nematoda: Molineidae) from wild ruminants in Italy using ribosomal DNA markers.

    Science.gov (United States)

    Gasser, R B; Rossi, L; Zhu, X

    1999-11-01

    The sequence of the second internal transcribed spacer of ribosomal DNA was determined for four species of Nematodirus (Nematodirus rupicaprae, Nematodirus oiratianus, Nematodirus davtiani alpinus and Nematodirus europaeus) from roe deer or alpine chamois. The second internal transcribed spacer of the four species varied in length from 228 to 236 bp, and the G + C contents ranged from 41 to 44%. While no intraspecific sequence variation was detected among multiple samples representing three of the taxa, sequence differences of 5.9-9.7% were detected among the four species, Nematodirus davtiani alpinus and N. rupicaprae were genetically most similar (94.1%), followed by N. oiratianus, N. europaeus and N. rupicaprae (91.1-91.5%), whereas N. oiratianus was genetically most different from N. davtiani alpinus. The interspecific sequence differences were exploited for the delineation of the four species by PCR-based restriction fragment length polymorphism (using two enzymes) and single-strand conformation polymorphism. The results have implications for diagnosis, epidemiology and for studying the systematics of the Nematodirinae.

  1. A Portrait of Ribosomal DNA Contacts with Hi-C Reveals 5S and 45S rDNA Anchoring Points in the Folded Human Genome.

    Science.gov (United States)

    Yu, Shoukai; Lemos, Bernardo

    2016-12-31

    Ribosomal RNAs (rRNAs) account for >60% of all RNAs in eukaryotic cells and are encoded in the ribosomal DNA (rDNA) arrays. The rRNAs are produced from two sets of loci: the 5S rDNA array resides exclusively on human chromosome 1, whereas the 45S rDNA array resides on the short arm of five human acrocentric chromosomes. The 45S rDNA gives origin to the nucleolus, the nuclear organelle that is the site of ribosome biogenesis. Intriguingly, 5S and 45S rDNA arrays exhibit correlated copy number variation in lymphoblastoid cells (LCLs). Here we examined the genomic architecture and repeat content of the 5S and 45S rDNA arrays in multiple human genome assemblies (including PacBio MHAP assembly) and ascertained contacts between the rDNA arrays and the rest of the genome using Hi-C datasets from two human cell lines (erythroleukemia K562 and lymphoblastoid cells). Our analyses revealed that 5S and 45S arrays each have thousands of contacts in the folded genome, with rDNA-associated regions and genes dispersed across all chromosomes. The rDNA contact map displayed conserved and disparate features between two cell lines, and pointed to specific chromosomes, genomic regions, and genes with evidence of spatial proximity to the rDNA arrays; the data also showed a lack of direct physical interaction between the 5S and 45S rDNA arrays. Finally, the analysis identified an intriguing organization in the 5S array with Alu and 5S elements adjacent to one another and organized in opposite orientation along the array. Portraits of genome folding centered on the ribosomal DNA array could help understand the emergence of concerted variation, the control of 5S and 45S expression, as well as provide insights into an organelle that contributes to the spatial localization of human chromosomes during interphase. © The Author(s) 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  2. Human circulating ribosomal DNA content significantly increases while circulating satellite III (1q12) content decreases under chronic occupational exposure to low-dose gamma- neutron and tritium beta-radiation

    Energy Technology Data Exchange (ETDEWEB)

    Korzeneva, Inna B., E-mail: inna.korzeneva@molgen.vniief.ru [Russian Federal Nuclear Center – All-Russian Research Institute of Experimental Physics (RFNC-VNIIEF) 607190 Sarov, 37 Mira ave., Nizhniy Novgorod Region (Russian Federation); Kostuyk, Svetlana V. [Research Centre for Medical Genetics, 115478 Moscow, 1 Moskvorechye str. (Russian Federation); Ershova, Elizaveta S. [Research Centre for Medical Genetics, 115478 Moscow, 1 Moskvorechye str. (Russian Federation); V. A. Negovsky Research Institute of General Reanimatology, Moscow, 107031 (Russian Federation); Skorodumova, Elena N.; Zhuravleva, Veronika F.; Pankratova, Galina V.; Volkova, Irina V.; Stepanova, Elena V. [Russian Federal Nuclear Center – All-Russian Research Institute of Experimental Physics (RFNC-VNIIEF) 607190 Sarov, 37 Mira ave., Nizhniy Novgorod Region (Russian Federation); Porokhovnik, Lev N. [Research Centre for Medical Genetics, 115478 Moscow, 1 Moskvorechye str. (Russian Federation); Veiko, Natalia N. [Research Centre for Medical Genetics, 115478 Moscow, 1 Moskvorechye str. (Russian Federation); V. A. Negovsky Research Institute of General Reanimatology, Moscow, 107031 (Russian Federation)

    2016-09-15

    Highlights: • A transcribed region of human ribosomal repeat is resistant to double-strand breaks in the environment of a raised endonuclease activity. • Hybridization-based techniques are preferable for the analysis of damaged and/or oxidized genomic fragments, rather than the qRT-PCR method. • A chronic exposure to the low-dose IR induces an elevation of the rDNA content in the human circulating cfDNA as compared to cellular DNA. • An exposure to IR entails a decrease of the level of the human circulating satellite III (1q12) as compared to cellular DNA (RsatIII index). • The RrDNA/RsatIII ratio is a potential marker of a chronic IR individual exposure. - Abstract: A single exposure to ionizing radiation (IR) results in an elevated cell-free DNA (cfDNA) content in the blood plasma. In this case, the cfDNA concentration can be a marker of the cell death in the organism. However, a chronic exposure to a low-dose IR enhances both the endonuclease activity and titer of antibodies to DNA in blood plasma, resulting in a decrease of the total concentration of circulating cfDNA in exposed people. In this case, the total cfDNA concentration should not be considered as a marker of the cell death in an exposed body. We assumed that a pool of the cfDNA circulating in the exposed people contains DNA fragments, which are resistant to a double-strand break formation in the environment of the elevated plasma endonuclease activity, and can be accumulated in the blood plasma. In order to test this hypothesis, we studied the content of GC-rich sequences (69%GC) of the transcribed region of human ribosomal repeat (rDNA), as well as the content of AT-rich repeat (63%AT) of satellite III (1q12) in the cfDNA samples obtained from 285 individuals. We have found that a chronic exposure to gamma-neutron radiation (N = 88) and tritium β-radiation (N = 88) evokes an increase of the rDNA content (RrDNA index) and a decrease of the satellite III content (RsatIII index) in the

  3. Human circulating ribosomal DNA content significantly increases while circulating satellite III (1q12) content decreases under chronic occupational exposure to low-dose gamma- neutron and tritium beta-radiation

    International Nuclear Information System (INIS)

    Korzeneva, Inna B.; Kostuyk, Svetlana V.; Ershova, Elizaveta S.; Skorodumova, Elena N.; Zhuravleva, Veronika F.; Pankratova, Galina V.; Volkova, Irina V.; Stepanova, Elena V.; Porokhovnik, Lev N.; Veiko, Natalia N.

    2016-01-01

    Highlights: • A transcribed region of human ribosomal repeat is resistant to double-strand breaks in the environment of a raised endonuclease activity. • Hybridization-based techniques are preferable for the analysis of damaged and/or oxidized genomic fragments, rather than the qRT-PCR method. • A chronic exposure to the low-dose IR induces an elevation of the rDNA content in the human circulating cfDNA as compared to cellular DNA. • An exposure to IR entails a decrease of the level of the human circulating satellite III (1q12) as compared to cellular DNA (RsatIII index). • The RrDNA/RsatIII ratio is a potential marker of a chronic IR individual exposure. - Abstract: A single exposure to ionizing radiation (IR) results in an elevated cell-free DNA (cfDNA) content in the blood plasma. In this case, the cfDNA concentration can be a marker of the cell death in the organism. However, a chronic exposure to a low-dose IR enhances both the endonuclease activity and titer of antibodies to DNA in blood plasma, resulting in a decrease of the total concentration of circulating cfDNA in exposed people. In this case, the total cfDNA concentration should not be considered as a marker of the cell death in an exposed body. We assumed that a pool of the cfDNA circulating in the exposed people contains DNA fragments, which are resistant to a double-strand break formation in the environment of the elevated plasma endonuclease activity, and can be accumulated in the blood plasma. In order to test this hypothesis, we studied the content of GC-rich sequences (69%GC) of the transcribed region of human ribosomal repeat (rDNA), as well as the content of AT-rich repeat (63%AT) of satellite III (1q12) in the cfDNA samples obtained from 285 individuals. We have found that a chronic exposure to gamma-neutron radiation (N = 88) and tritium β-radiation (N = 88) evokes an increase of the rDNA content (RrDNA index) and a decrease of the satellite III content (RsatIII index) in the

  4. Restless 5S: the re-arrangement(s) and evolution of the nuclear ribosomal DNA in land plants.

    Science.gov (United States)

    Wicke, Susann; Costa, Andrea; Muñoz, Jesùs; Quandt, Dietmar

    2011-11-01

    Among eukaryotes two types of nuclear ribosomal DNA (nrDNA) organization have been observed. Either all components, i.e. the small ribosomal subunit, 5.8S, large ribosomal subunit, and 5S occur tandemly arranged or the 5S rDNA forms a separate cluster of its own. Generalizations based on data derived from just a few model organisms have led to a superimposition of structural and evolutionary traits to the entire plant kingdom asserting that plants generally possess separate arrays. This study reveals that plant nrDNA organization into separate arrays is not a distinctive feature, but rather assignable almost solely to seed plants. We show that early diverging land plants and presumably streptophyte algae share a co-localization of all rRNA genes within one repeat unit. This raises the possibility that the state of rDNA gene co-localization had occurred in their common ancestor. Separate rDNA arrays were identified for all basal seed plants and water ferns, implying at least two independent 5S rDNA transposition events during land plant evolution. Screening for 5S derived Cassandra transposable elements which might have played a role during the transposition events, indicated that this retrotransposon is absent in early diverging vascular plants including early fern lineages. Thus, Cassandra can be rejected as a primary mechanism for 5S rDNA transposition in water ferns. However, the evolution of Cassandra and other eukaryotic 5S derived elements might have been a side effect of the 5S rDNA cluster formation. Structural analysis of the intergenic spacers of the ribosomal clusters revealed that transposition events partially affect spacer regions and suggests a slightly different transcription regulation of 5S rDNA in early land plants. 5S rDNA upstream regulatory elements are highly divergent or absent from the LSU-5S spacers of most early divergent land plant lineages. Several putative scenarios and mechanisms involved in the concerted relocation of hundreds of 5S

  5. Assessment of phylogenetic relationship of rare plant species collected from Saudi Arabia using internal transcribed spacer sequences of nuclear ribosomal DNA.

    Science.gov (United States)

    Al-Qurainy, F; Khan, S; Nadeem, M; Tarroum, M; Alaklabi, A

    2013-03-11

    The rare and endangered plants of any country are important genetic resources that often require urgent conservation measures. Assessment of phylogenetic relationships and evaluation of genetic diversity is very important prior to implementation of conservation strategies for saving rare and endangered plant species. We used internal transcribed spacer sequences of nuclear ribosomal DNA for the evaluation of sequence identity from the available taxa in the GenBank database by using the Basic Local Alignment Search Tool (BLAST). Two rare plant species viz, Heliotropium strigosum claded with H. pilosum (98% branch support) and Pancratium tortuosum claded with P. tenuifolium (61% branch support) clearly. However, some species, viz Scadoxus multiflorus, Commiphora myrrha and Senecio hadiensis showed close relationships with more than one species. We conclude that nuclear ribosomal internal transcribed spacer sequences are useful markers for phylogenetic study of these rare plant species in Saudi Arabia.

  6. Characterization of three different clusters of 18S-26S ribosomal DNA genes in the sea urchin P. lividus: Genetic and epigenetic regulation synchronous to 5S rDNA.

    Science.gov (United States)

    Bellavia, Daniele; Dimarco, Eufrosina; Caradonna, Fabio

    2016-04-15

    We previously reported the characterization 5S ribosomal DNA (rDNA) clusters in the common sea urchin Paracentrotus lividus and demonstrated the presence of DNA methylation-dependent silencing of embryo specific 5S rDNA cluster in adult tissue. In this work, we show genetic and epigenetic characterization of 18S-26S rDNA clusters in this specie. The results indicate the presence of three different 18S-26S rDNA clusters with different Non-Transcribed Spacer (NTS) regions that have different chromosomal localizations. Moreover, we show that the two largest clusters are hyper-methylated in the promoter-containing NTS regions in adult tissues, as in the 5S rDNA. These findings demonstrate an analogous epigenetic regulation in small and large rDNA clusters and support the logical synchronism in building ribosomes. In fact, all the ribosomal RNA genes must be synchronously and equally transcribed to perform their unique final product. Copyright © 2016 Elsevier B.V. All rights reserved.

  7. Sequence of a cloned cDNA encoding human ribosomal protein S11

    Energy Technology Data Exchange (ETDEWEB)

    Lott, J B; Mackie, G A

    1988-02-11

    The authors have isolated a cloned cDNA that encodes human ribosomal protein (rp) S11 by screening a human fibroblast cDNA library with a labelled 204 bp DNA fragment encompassing residues 212-416 of pRS11, a rat rp Sll cDNA clone. The human rp S11 cloned cDNA consists of 15 residues of the 5' leader, the entire coding sequence and all 51 residues of the 3' untranslated region. The predicted amino acid sequence of 158 residues is identical to rat rpS11. The nucleotide sequence in the coding region differs, however, from that in rat in the first position in two codons and in the third position in 44 codons.

  8. Use of DNA markers in forest tree improvement research

    Science.gov (United States)

    D.B. Neale; M.E. Devey; K.D. Jermstad; M.R. Ahuja; M.C. Alosi; K.A. Marshall

    1992-01-01

    DNA markers are rapidly being developed for forest trees. The most important markers are restriction fragment length polymorphisms (RFLPs), polymerase chain reaction- (PCR) based markers such as random amplified polymorphic DNA (RAPD), and fingerprinting markers. DNA markers can supplement isozyme markers for monitoring tree improvement activities such as; estimating...

  9. Depletion of ribosomal protein L37 occurs in response to DNA damage and activates p53 through the L11/MDM2 pathway.

    Science.gov (United States)

    Llanos, Susana; Serrano, Manuel

    2010-10-01

    Perturbation of ribosomal biogenesis has recently emerged as a relevant p53-activating pathway. This pathway can be initiated by depletion of certain ribosomal proteins, which is followed by the binding and inhibition of MDM2 by a different subset of ribosomal proteins that includes L11. Here, we report that depletion of L37 leads to cell cycle arrest in a L11- and p53-dependent manner. DNA damage can initiate ribosomal stress, although little is known about the mechanisms involved. We have found that some genotoxic insults, namely, UV light and cisplatin, lead to proteasomal degradation of L37 in the nucleoplasm and to the ensuing L11-dependent stabilization of p53. Moreover, ectopic L37 overexpression can attenuate the DNA damage response mediated by p53. These results support the concept that DNA damage-induced proteasomal degradation of L37 constitutes a mechanistic link between DNA damage and the ribosomal stress pathway, and is a relevant contributing signaling pathway for the activation of p53 in response to DNA damage.

  10. 16S partial gene mitochondrial DNA and internal transcribed spacers ribosomal DNA as differential markers of Trichuris discolor populations.

    Science.gov (United States)

    Callejón, R; Halajian, A; de Rojas, M; Marrugal, A; Guevara, D; Cutillas, C

    2012-05-25

    Comparative morphological, biometrical and molecular studies of Trichuris discolor isolated from Bos taurus from Spain and Iran was carried out. Furthermore, Trichuris ovis isolated from B. taurus and Capra hircus from Spain has been, molecularly, analyzed. Morphological studies revealed clear differences between T. ovis and T. discolor isolated from B. taurus but differences were not observed between populations of T. discolor isolated from different geographical regions. Nevertheless, the molecular studies based on the amplification and sequencing of the internal transcribed spacers 1 and 2 ribosomal DNA and 16S partial gene mitochondrial DNA showed clear differences between both populations of T. discolor from Spain and Iran suggesting two cryptic species. Phylogenetic studies corroborated these data. Thus, phylogenetic trees based on ITS1, ITS2 and 16S partial gene sequences showed that individuals of T. discolor from B. taurus from Iran clustered together and separated, with high bootstrap values, of T. discolor isolated from B. taurus from Spain, while populations of T. ovis from B. taurus and C. hircus from Spain clustered together but separated with high bootstrap values of both populations of T. discolor. Furthermore, a comparative phylogenetic study has been carried out with the ITS1and ITS2 sequences of Trichuris species from different hosts. Three clades were observed: the first clustered all the species of Trichuris parasitizing herbivores (T. discolor, T. ovis, Trichuris leporis and Trichuris skrjabini), the second clustered all the species of Trichuris parasitizing omnivores (Trichuris trichiura and Trichuris suis) and finally, the third clustered species of Trichuris parasitizing carnivores (Trichuris muris, Trichuris arvicolae and Trichuris vulpis). Copyright © 2011 Elsevier B.V. All rights reserved.

  11. 18S Ribosomal RNA Evaluation as Preanalytical Quality Control for Animal DNA

    Directory of Open Access Journals (Sweden)

    Cory Ann Leonard

    2016-01-01

    Full Text Available The 18S ribosomal RNA (rRNA gene is present in all eukaryotic cells. In this study, we evaluated the use of this gene to verify the presence of PCR-amplifiable host (animal DNA as an indicator of sufficient sample quality for quantitative real-time PCR (qPCR analysis. We compared (i samples from various animal species, tissues, and sample types, including swabs; (ii multiple DNA extraction methods; and (iii both fresh and formalin-fixed paraffin-embedded (FFPE samples. Results showed that 18S ribosomal RNA gene amplification was possible from all tissue samples evaluated, including avian, reptile, and FFPE samples and most swab samples. A single swine rectal swab, which showed sufficient DNA quantity and the demonstrated lack of PCR inhibitors, nonetheless was negative by 18S qPCR. Such a sample specifically illustrates the improvement of determination of sample integrity afforded by inclusion of 18S rRNA gene qPCR analysis in addition to spectrophotometric analysis and the use of internal controls for PCR inhibition. Other possible applications for the described 18S rRNA qPCR are preselection of optimal tissue specimens for studies or preliminary screening of archived samples prior to acceptance for biobanking projects.

  12. Sequencing of whole plastid genomes and nuclear ribosomal DNA of Diospyros species (Ebenaceae) endemic to New Caledonia: many species, little divergence.

    Science.gov (United States)

    Turner, Barbara; Paun, Ovidiu; Munzinger, Jérôme; Chase, Mark W; Samuel, Rosabelle

    2016-06-01

    Some plant groups, especially on islands, have been shaped by strong ancestral bottlenecks and rapid, recent radiation of phenotypic characters. Single molecular markers are often not informative enough for phylogenetic reconstruction in such plant groups. Whole plastid genomes and nuclear ribosomal DNA (nrDNA) are viewed by many researchers as sources of information for phylogenetic reconstruction of groups in which expected levels of divergence in standard markers are low. Here we evaluate the usefulness of these data types to resolve phylogenetic relationships among closely related Diospyros species. Twenty-two closely related Diospyros species from New Caledonia were investigated using whole plastid genomes and nrDNA data from low-coverage next-generation sequencing (NGS). Phylogenetic trees were inferred using maximum parsimony, maximum likelihood and Bayesian inference on separate plastid and nrDNA and combined matrices. The plastid and nrDNA sequences were, singly and together, unable to provide well supported phylogenetic relationships among the closely related New Caledonian Diospyros species. In the nrDNA, a 6-fold greater percentage of parsimony-informative characters compared with plastid DNA was found, but the total number of informative sites was greater for the much larger plastid DNA genomes. Combining the plastid and nuclear data improved resolution. Plastid results showed a trend towards geographical clustering of accessions rather than following taxonomic species. In plant groups in which multiple plastid markers are not sufficiently informative, an investigation at the level of the entire plastid genome may also not be sufficient for detailed phylogenetic reconstruction. Sequencing of complete plastid genomes and nrDNA repeats seems to clarify some relationships among the New Caledonian Diospyros species, but the higher percentage of parsimony-informative characters in nrDNA compared with plastid DNA did not help to resolve the phylogenetic tree

  13. Identification of tissue-embedded ascarid larvae by ribosomal DNA sequencing.

    Science.gov (United States)

    Ishiwata, Kenji; Shinohara, Akio; Yagi, Kinpei; Horii, Yoichiro; Tsuchiya, Kimiyuki; Nawa, Yukifumi

    2004-01-01

    Polymerase chain reaction (PCR) was applied to identify tissue-embedded ascarid nematode larvae. Two sequences of the internal transcribed spacer (ITS) regions of ribosomal DNA (rDNA), ITS1 and ITS2, of the ascarid parasites were amplified and compared with those of ascarid-nematodes registered in a DNA database (GenBank). The ITS sequences of the PCR products obtained from the ascarid parasite specimen in our laboratory were compatible with those of registered adult Ascaris and Toxocara parasites. PCR amplification of the ITS regions was sensitive enough to detect a single larva of Ascaris suum mixed with porcine liver tissue. Using this method, ascarid larvae embedded in the liver of a naturally infected turkey were identified as Toxocara canis. These results suggest that even a single larva embedded in tissues from patients with larva migrans could be identified by sequencing the ITS regions.

  14. Molecular species identification of Central European ground beetles (Coleoptera: Carabidae using nuclear rDNA expansion segments and DNA barcodes

    Directory of Open Access Journals (Sweden)

    Raupach Michael J

    2010-09-01

    Full Text Available Abstract Background The identification of vast numbers of unknown organisms using DNA sequences becomes more and more important in ecological and biodiversity studies. In this context, a fragment of the mitochondrial cytochrome c oxidase I (COI gene has been proposed as standard DNA barcoding marker for the identification of organisms. Limitations of the COI barcoding approach can arise from its single-locus identification system, the effect of introgression events, incomplete lineage sorting, numts, heteroplasmy and maternal inheritance of intracellular endosymbionts. Consequently, the analysis of a supplementary nuclear marker system could be advantageous. Results We tested the effectiveness of the COI barcoding region and of three nuclear ribosomal expansion segments in discriminating ground beetles of Central Europe, a diverse and well-studied invertebrate taxon. As nuclear markers we determined the 18S rDNA: V4, 18S rDNA: V7 and 28S rDNA: D3 expansion segments for 344 specimens of 75 species. Seventy-three species (97% of the analysed species could be accurately identified using COI, while the combined approach of all three nuclear markers provided resolution among 71 (95% of the studied Carabidae. Conclusion Our results confirm that the analysed nuclear ribosomal expansion segments in combination constitute a valuable and efficient supplement for classical DNA barcoding to avoid potential pitfalls when only mitochondrial data are being used. We also demonstrate the high potential of COI barcodes for the identification of even closely related carabid species.

  15. Molecular species identification of Central European ground beetles (Coleoptera: Carabidae) using nuclear rDNA expansion segments and DNA barcodes.

    Science.gov (United States)

    Raupach, Michael J; Astrin, Jonas J; Hannig, Karsten; Peters, Marcell K; Stoeckle, Mark Y; Wägele, Johann-Wolfgang

    2010-09-13

    The identification of vast numbers of unknown organisms using DNA sequences becomes more and more important in ecological and biodiversity studies. In this context, a fragment of the mitochondrial cytochrome c oxidase I (COI) gene has been proposed as standard DNA barcoding marker for the identification of organisms. Limitations of the COI barcoding approach can arise from its single-locus identification system, the effect of introgression events, incomplete lineage sorting, numts, heteroplasmy and maternal inheritance of intracellular endosymbionts. Consequently, the analysis of a supplementary nuclear marker system could be advantageous. We tested the effectiveness of the COI barcoding region and of three nuclear ribosomal expansion segments in discriminating ground beetles of Central Europe, a diverse and well-studied invertebrate taxon. As nuclear markers we determined the 18S rDNA: V4, 18S rDNA: V7 and 28S rDNA: D3 expansion segments for 344 specimens of 75 species. Seventy-three species (97%) of the analysed species could be accurately identified using COI, while the combined approach of all three nuclear markers provided resolution among 71 (95%) of the studied Carabidae. Our results confirm that the analysed nuclear ribosomal expansion segments in combination constitute a valuable and efficient supplement for classical DNA barcoding to avoid potential pitfalls when only mitochondrial data are being used. We also demonstrate the high potential of COI barcodes for the identification of even closely related carabid species.

  16. Remodeling of ribosomal genes in somatic cells by Xenopus egg extract

    Energy Technology Data Exchange (ETDEWEB)

    Ostrup, Olga, E-mail: osvarcova@gmail.com [Institute of Basic Animal and Veterinary Sciences, Faculty of Life Sciences, University of Copenhagen, Frederiksberg C (Denmark); Stem Cell Epigenetics Laboratory, Institute of Basic Medical Sciences, Faculty of Medicine, University of Oslo, Oslo (Norway); Norwegian Center for Stem Cell Research, Oslo (Norway); Hyttel, Poul; Klaerke, Dan A. [Institute of Basic Animal and Veterinary Sciences, Faculty of Life Sciences, University of Copenhagen, Frederiksberg C (Denmark); Collas, Philippe, E-mail: philc@medisin.uio.no [Stem Cell Epigenetics Laboratory, Institute of Basic Medical Sciences, Faculty of Medicine, University of Oslo, Oslo (Norway); Norwegian Center for Stem Cell Research, Oslo (Norway)

    2011-09-02

    Highlights: {yields} Xenopus egg extract remodels nuclei and alter cell growth characteristics. {yields} Ribosomal genes are reprogrammed within 6 h after extract exposure. {yields} rDNA reprogramming involves promoter targeting of SNF2H remodeling complex. {yields} Xenopus egg extract does not initiate stress-related response in somatic cells. {yields} Aza-cytidine elicits a stress-induced response in reprogrammed cells. -- Abstract: Extracts from Xenopus eggs can reprogram gene expression in somatic nuclei, however little is known about the earliest processes associated with the switch in the transcriptional program. We show here that an early reprogramming event is the remodeling of ribosomal chromatin and gene expression. This occurs within hours of extract treatment and is distinct from a stress response. Egg extract elicits remodeling of the nuclear envelope, chromatin and nucleolus. Nucleolar remodeling involves a rapid and stable decrease in ribosomal gene transcription, and promoter targeting of the nucleolar remodeling complex component SNF2H without affecting occupancy of the transcription factor UBF and the stress silencers SUV39H1 and SIRT1. During this process, nucleolar localization of UBF and SIRT1 is not altered. On contrary, azacytidine pre-treatment has an adverse effect on rDNA remodeling induced by extract and elicits a stress-type nuclear response. Thus, an early event of Xenopus egg extract-mediated nuclear reprogramming is the remodeling of ribosomal genes involving nucleolar remodeling complex. Condition-specific and rapid silencing of ribosomal genes may serve as a sensitive marker for evaluation of various reprogramming methods.

  17. Is ITS-2 rDNA suitable marker for genetic characterization of Sarcoptes mites from different wild animals in different geographic areas?

    Science.gov (United States)

    Alasaad, S; Soglia, D; Spalenza, V; Maione, S; Soriguer, R C; Pérez, J M; Rasero, R; Degiorgis, M P Ryser; Nimmervoll, H; Zhu, X Q; Rossi, L

    2009-02-05

    The present study examined the relationship among individual Sarcoptes scabiei mites from 13 wild mammalian populations belonging to nine species in four European countries using the second internal transcribed spacer (ITS-2) of nuclear ribosomal DNA (rDNA) as genetic marker. The ITS-2 plus primer flanking 5.8S and 28S rDNA (ITS-2+) was amplified from individual mites by polymerase chain reaction (PCR) and the amplicons were sequenced directly. A total of 148 ITS-2+ sequences of 404bp in length were obtained and 67 variable sites were identified (16.59%). UPGMA analyses did not show any geographical or host-specific clustering, and a similar outcome was obtained using population pairwise Fst statistics. These results demonstrated that ITS-2 rDNA does not appear to be suitable for examining genetic diversity among mite populations.

  18. Selection of antigenic markers on a GFP-Cκ fusion scaffold with high sensitivity by eukaryotic ribosome display

    International Nuclear Information System (INIS)

    Yang Yongmin; Barankiewicz, Teresa J.; He Mingyue; Taussig, Michael J.; Chen, Swey-Shen

    2007-01-01

    Ribosome display is a cell-free system permitting gene selection through the physical association of genetic material (mRNA) and its phenotypic (protein) product. While often used to select single-chain antibodies from large libraries by panning against immobilized antigens, we have adapted ribosome display for use in the 'reverse' format in order to select high affinity antigenic determinants against solid-phase antibody. To create an antigenic scaffold, DNA encoding green fluorescent protein (GFP) was fused to a light chain constant domain (Cκ) with stop codon deleted, and with 5' signals (T7 promoter, Kozak) enabling coupled transcription/translation in a eukaryotic cell-free system. Epitopes on either GFP (5') or Cκ (3') were selected by anti-GFP or anti-Cκ antibodies, respectively, coupled to magnetic beads. After selection, mRNA was amplified directly from protein-ribosome-mRNA (PRM) complexes by in situ PCR followed by internal amplification and reassembly PCR. As little as 10 fg of the 1 kb DNA construct, i.e. approximately 7500 molecules, could be recovered following a single round of interaction with solid-phase anti-GFP antibody. This platform is highly specific and sensitive for the antigen-antibody interaction and may permit selection and reshaping of high affinity antigenic variants of scaffold proteins

  19. [Association between inflammatory markers and microbial translocation in patients with human immunodeficiency virus infection taking antiretroviral treatment].

    Science.gov (United States)

    Reus Bañuls, Sergio; Portilla Sogorb, Joaquín; Sanchez-Paya, José; Boix Martínez, Vicente; Giner Oncina, Livia; Frances, Rubén; Such, José; Merino Lucas, Esperanza; Gimeno Gascón, Adelina

    2014-01-21

    Inflammatory biomarkers are increased in patients with human immunodeficiency virus (HIV) infection. Antiretroviral treatment (ART) improves some parameters but do not normalize them. The aim of this study is to determine those factors (including microbial translocation) associated with higher inflammation in HIV treated patients. Transversal observational study. HIV patients receiving ART with an HIV viral load (VL)<400 copies/mL. Selection of patients: consecutively between November 2011 and January 2012. Main variable: plasma levels of interleukin 6 (IL-6) and tumour necrosis factor α (TNF-α). Main explanatory variable: microbial translocation markers (16S ribosomal DNA and sCD14). Patients with IL-6 or TNF-α levels above percentile 75 (group 1) were compared with the rest of patients (group 2). Odds ratio (OR) were determined. Eighty-one patients were included (73% male, median age 45 years, 48% stage C). Twenty-six percent had chronic hepatitis C. Median CD4 cell was 493/mm(3) and 30% had detectable HIV VL. 16S ribosomal DNA was detected in 21% of patients. Factors associated with the higher levels of inflammatory markers were 16S ribosomal DNA (OR 77, P<.0001), sCD14 levels (P<.0001) and history of cardiovascular disease (OR 15, P<.01). In multivariate analysis, associations remained for 16S ribosomal DNA (OR 62, P<.0001) and previous cardiovascular disease (OR 25, P<.01). In patients with HIV infection receiving treatment, the higher levels of inflammatory markers are associated with microbial translocation and past cardiovascular events. Copyright © 2013 Elsevier España, S.L. All rights reserved.

  20. The efficiency of mitochondrial DNA markers in constructing genetic ...

    African Journals Online (AJOL)

    The efficiency of mitochondrial DNA markers in constructing genetic relationship among Oryx species. ... These data were used to provide the genetic kinship among different Oryx species. The complete cytochrome b gene ... Key words: Conservation, endangered species, Oryx, mitochondrial DNA (mtDNA) markers.

  1. Unexpected Diagnosis of Cerebral Toxoplasmosis by 16S and D2 Large-Subunit Ribosomal DNA PCR and Sequencing

    DEFF Research Database (Denmark)

    Kruse, Alexandra Yasmin Collin; Kvich, Lasse Andersson; Eickhardt-Dalbøge, Steffen Robert

    2015-01-01

    The protozoan parasite Toxoplasma gondii causes severe opportunistic infections. Here, we report an unexpected diagnosis of cerebral toxoplasmosis. T. gondii was diagnosed by 16S and D2 large-subunit (LSU) ribosomal DNA (rDNA) sequencing of a cerebral biopsy specimen and confirmed by T. gondii...

  2. Variability of chloroplast DNA and nuclear ribosomal DNA in cassava (Manihot esculenta Crantz) and its wild relatives.

    Science.gov (United States)

    Fregene, M A; Vargas, J; Ikea, J; Angel, F; Tohme, J; Asiedu, R A; Akoroda, M O; Roca, W M

    1994-11-01

    Chloroplast DNA (cp) and nuclear ribosomal DNA (rDNA) variation was investigated in 45 accessions of cultivated and wild Manihot species. Ten independent mutations, 8 point mutations and 2 length mutations were identified, using eight restriction enzymes and 12 heterologous cpDNA probes from mungbean. Restriction fragment length polymorphism analysis defined nine distinct chloroplast types, three of which were found among the cultivated accessions and six among the wild species. Cladistic analysis of the cpDNA data using parsimony yielded a hypothetical phylogeny of lineages among the cpDNAs of cassava and its wild relatives that is congruent with morphological evolutionary differentiation in the genus. The results of our survey of cpDNA, together with rDNA restriction site change at the intergenic spacer region and rDNA repeat unit length variation (using rDNA cloned fragments from taro as probe), suggest that cassava might have arisen from the domestication of wild tuberous accessions of some Manihot species, followed by intensive selection. M. esculenta subspp flabellifolia is probably a wild progenitor. Introgressive hybridization with wild forms and pressures to adapt to the widely varying climates and topography in which cassava is found might have enhanced the crop's present day variability.

  3. Single-strand conformation polymorphism (SSCP)-based mutation scanning approaches to fingerprint sequence variation in ribosomal DNA of ascaridoid nematodes.

    Science.gov (United States)

    Zhu, X Q; Gasser, R B

    1998-06-01

    In this study, we assessed single-strand conformation polymorphism (SSCP)-based approaches for their capacity to fingerprint sequence variation in ribosomal DNA (rDNA) of ascaridoid nematodes of veterinary and/or human health significance. The second internal transcribed spacer region (ITS-2) of rDNA was utilised as the target region because it is known to provide species-specific markers for this group of parasites. ITS-2 was amplified by PCR from genomic DNA derived from individual parasites and subjected to analysis. Direct SSCP analysis of amplicons from seven taxa (Toxocara vitulorum, Toxocara cati, Toxocara canis, Toxascaris leonina, Baylisascaris procyonis, Ascaris suum and Parascaris equorum) showed that the single-strand (ss) ITS-2 patterns produced allowed their unequivocal identification to species. While no variation in SSCP patterns was detected in the ITS-2 within four species for which multiple samples were available, the method allowed the direct display of four distinct sequence types of ITS-2 among individual worms of T. cati. Comparison of SSCP/sequencing with the methods of dideoxy fingerprinting (ddF) and restriction endonuclease fingerprinting (REF) revealed that also ddF allowed the definition of the four sequence types, whereas REF displayed three of four. The findings indicate the usefulness of the SSCP-based approaches for the identification of ascaridoid nematodes to species, the direct display of sequence variation in rDNA and the detection of population variation. The ability to fingerprint microheterogeneity in ITS-2 rDNA using such approaches also has implications for studying fundamental aspects relating to mutational change in rDNA.

  4. Advantages and Limitations of Ribosomal RNA PCR and DNA Sequencing for Identification of Bacteria in Cardiac Valves of Danish Patients

    DEFF Research Database (Denmark)

    Kemp, Michael; Bangsborg, Jette; Kjerulf, Anne

    2013-01-01

    of direct molecular identification should also address weaknesses, their relevance in the given setting, and possible improvements. In this study cardiac valves from 56 Danish patients referred for surgery for infective endocarditis were analysed by microscopy and culture as well as by PCR targeting part...... of the bacterial 16S rRNA gene followed by DNA sequencing of the PCR product. PCR and DNA sequencing identified significant bacteria in 49 samples from 43 patients, including five out of 13 culture-negative cases. No rare, exotic, or intracellular bacteria were identified. There was a general agreement between...... bacterial identity obtained by ribosomal PCR and DNA sequencing from the valves and bacterial isolates from blood culture. However, DNA sequencing of the 16S rRNA gene did not discriminate well among non-haemolytic streptococci, especially within the Streptococcus mitis group. Ribosomal PCR with subsequent...

  5. Selection of antigenic markers on a GFP-C{kappa} fusion scaffold with high sensitivity by eukaryotic ribosome display

    Energy Technology Data Exchange (ETDEWEB)

    Yongmin, Yang [Institute of Genetics, San Diego, CA 92121-2233 (United States); IgE Therapeutics, Inc., San Diego, CA 92121-2233 (United States); Barankiewicz, Teresa J [Institute of Genetics, San Diego, CA 92121-2233 (United States); IgE Therapeutics, Inc., San Diego, CA 92121-2233 (United States); Mingyue, He [Babraham Institute, Cambridge CB2 4AT (United Kingdom); Taussig, Michael J [Babraham Institute, Cambridge CB2 4AT (United Kingdom); Chen, Swey-Shen [Institute of Genetics, San Diego, CA 92121-2233 (United States) and IgE Therapeutics, Inc., San Diego, CA 92121-2233 (United States)

    2007-07-27

    Ribosome display is a cell-free system permitting gene selection through the physical association of genetic material (mRNA) and its phenotypic (protein) product. While often used to select single-chain antibodies from large libraries by panning against immobilized antigens, we have adapted ribosome display for use in the 'reverse' format in order to select high affinity antigenic determinants against solid-phase antibody. To create an antigenic scaffold, DNA encoding green fluorescent protein (GFP) was fused to a light chain constant domain (C{kappa}) with stop codon deleted, and with 5' signals (T7 promoter, Kozak) enabling coupled transcription/translation in a eukaryotic cell-free system. Epitopes on either GFP (5') or C{kappa} (3') were selected by anti-GFP or anti-C{kappa} antibodies, respectively, coupled to magnetic beads. After selection, mRNA was amplified directly from protein-ribosome-mRNA (PRM) complexes by in situ PCR followed by internal amplification and reassembly PCR. As little as 10 fg of the 1 kb DNA construct, i.e. approximately 7500 molecules, could be recovered following a single round of interaction with solid-phase anti-GFP antibody. This platform is highly specific and sensitive for the antigen-antibody interaction and may permit selection and reshaping of high affinity antigenic variants of scaffold proteins.

  6. Human circulating ribosomal DNA content significantly increases while circulating satellite III (1q12) content decreases under chronic occupational exposure to low-dose gamma- neutron and tritium beta-radiation.

    Science.gov (United States)

    Korzeneva, Inna B; Kostuyk, Svetlana V; Ershova, Elizaveta S; Skorodumova, Elena N; Zhuravleva, Veronika F; Pankratova, Galina V; Volkova, Irina V; Stepanova, Elena V; Porokhovnik, Lev N; Veiko, Natalia N

    A single exposure to ionizing radiation (IR) results in an elevated cell-free DNA (cfDNA) content in the blood plasma. In this case, the cfDNA concentration can be a marker of the cell death in the organism. However, a chronic exposure to a low-dose IR enhances both the endonuclease activity and titer of antibodies to DNA in blood plasma, resulting in a decrease of the total concentration of circulating cfDNA in exposed people. In this case, the total cfDNA concentration should not be considered as a marker of the cell death in an exposed body. We assumed that a pool of the cfDNA circulating in the exposed people contains DNA fragments, which are resistant to a double-strand break formation in the environment of the elevated plasma endonuclease activity, and can be accumulated in the blood plasma. In order to test this hypothesis, we studied the content of GC-rich sequences (69%GC) of the transcribed region of human ribosomal repeat (rDNA), as well as the content of AT-rich repeat (63%AT) of satellite III (1q12) in the cfDNA samples obtained from 285 individuals. We have found that a chronic exposure to gamma-neutron radiation (N=88) and tritium β-radiation (N=88) evokes an increase of the rDNA content (RrDNA index) and a decrease of the satellite III content (RsatIII index) in the circulating cfDNA as compared with the cfDNA of non-exposed people (N=109). Such index that simultaneously displays both the increase of rDNA content and decrease of satellite III content in the cfDNA (RrDNA/RsatIII) can be recommended as a marker of chronic processes in the body that involve the elevated cell death rate and/or increased blood plasma endonuclease activity. Copyright © 2016 Elsevier B.V. All rights reserved.

  7. Molecular characterization of Fasciola gigantica from Mauritania based on mitochondrial and nuclear ribosomal DNA sequences.

    Science.gov (United States)

    Amor, Nabil; Farjallah, Sarra; Salem, Mohamed; Lamine, Dia Mamadou; Merella, Paolo; Said, Khaled; Ben Slimane, Badreddine

    2011-10-01

    Fasciolosis caused by Fasciola hepatica and Fasciola gigantica (Platyhelminthes: Trematoda: Digenea) is considered the most important helminth infection of ruminants in tropical countries, causing considerable socioeconomic problems. From Africa, F. gigantica has been previously characterized from Burkina Faso, Senegal, Kenya, Zambia and Mali, while F. hepatica has been reported from Morocco and Tunisia, and both species have been observed from Ethiopia and Egypt on the basis of morphometric differences, while the use of molecular markers is necessary to distinguish exactly between species. Samples identified morphologically as F. gigantica (n=60) from sheep and cattle from different geographical localities of Mauritania were genetically characterized by sequences of the first (ITS-1), the 5.8S, and second (ITS-2) Internal Transcribed Spacers (ITS) of nuclear ribosomal DNA (rDNA) genes and the mitochondrial Cytochrome c Oxidase I (COI) gene. Comparison of the sequences of the Mauritanian samples with sequences of Fasciola spp. from GenBank confirmed that all samples belong to the species F. gigantica. The nucleotide sequencing of ITS rDNA of F. gigantica showed no nucleotide variation in the ITS-1, 5.8S, and ITS-2 rDNA sequences among all samples examined and those from Burkina Faso, Kenya, Egypt and Iran. The phylogenetic trees based on the ITS-1 and ITS-2 sequences showed a close relationship of the Mauritanian samples with isolates of F. gigantica from different localities of Africa and Asia. The COI genotypes of the Mauritanian specimens of F. gigantica had a high level of diversity, and they belonged to the F. gigantica phylogenically distinguishable clade. The present study is the first molecular characterization of F. gigantica in sheep and cattle from Mauritania, allowing a reliable approach for the genetic differentiation of Fasciola spp. and providing basis for further studies on liver flukes in the African countries. Copyright © 2011 Elsevier Inc. All

  8. Conservative fragments in bacterial 16S rRNA genes and primer design for 16S ribosomal DNA amplicons in metagenomic studies

    KAUST Repository

    Wang, Yong; Qian, Pei-Yuan

    2009-01-01

    Bacterial 16S ribosomal DNA (rDNA) amplicons have been widely used in the classification of uncultured bacteria inhabiting environmental niches. Primers targeting conservative regions of the rDNAs are used to generate amplicons of variant regions

  9. A dynamic ribosomal biogenesis response is not required for IGF-1-mediated hypertrophy of human primary myotubes.

    Science.gov (United States)

    Crossland, Hannah; Timmons, James A; Atherton, Philip J

    2017-12-01

    Increased ribosomal DNA transcription has been proposed to limit muscle protein synthesis, making ribosome biogenesis central to skeletal muscle hypertrophy. We examined the relationship between ribosomal RNA (rRNA) production and IGF-1-mediated myotube hypertrophy in vitro Primary skeletal myotubes were treated with IGF-1 (50 ng/ml) with or without 0.5 µM CX-5461 (CX), an inhibitor of RNA polymerase I. Myotube diameter, total protein, and RNA and DNA levels were measured along with markers of RNA polymerase I regulatory factors and regulators of protein synthesis. CX treatment reduced 45S pre-rRNA expression (-64 ± 5% vs. IGF-1; P IGF-1; P IGF-1-treated myotubes. IGF-1-mediated increases in myotube diameter (1.27 ± 0.09-fold, P IGF-1 treatment did not prevent early increases in AKT (+203 ± 39% vs. CX; P IGF-1, myotube diameter and protein accretion were sustained. Thus, while ribosome biogenesis represents a potential site for the regulation of skeletal muscle protein synthesis and muscle mass, it does not appear to be a prerequisite for IGF-1-induced myotube hypertrophy in vitro. -Crossland, H., Timmons, J. A., Atherton, P. J. A dynamic ribosomal biogenesis response is not required for IGF-1-mediated hypertrophy of human primary myotubes. © The Author(s).

  10. Extrachromosomal circles of satellite repeats and 5S ribosomal DNA in human cells

    Directory of Open Access Journals (Sweden)

    Cohen Sarit

    2010-03-01

    Full Text Available Abstract Background Extrachomosomal circular DNA (eccDNA is ubiquitous in eukaryotic organisms and was detected in every organism tested, including in humans. A two-dimensional gel electrophoresis facilitates the detection of eccDNA in preparations of genomic DNA. Using this technique we have previously demonstrated that most of eccDNA consists of exact multiples of chromosomal tandemly repeated DNA, including both coding genes and satellite DNA. Results Here we report the occurrence of eccDNA in every tested human cell line. It has heterogeneous mass ranging from less than 2 kb to over 20 kb. We describe eccDNA homologous to human alpha satellite and the SstI mega satellite. Moreover, we show, for the first time, circular multimers of the human 5S ribosomal DNA (rDNA, similar to previous findings in Drosophila and plants. We further demonstrate structures that correspond to intermediates of rolling circle replication, which emerge from the circular multimers of 5S rDNA and SstI satellite. Conclusions These findings, and previous reports, support the general notion that every chromosomal tandem repeat is prone to generate eccDNA in eukryoric organisms including humans. They suggest the possible involvement of eccDNA in the length variability observed in arrays of tandem repeats. The implications of eccDNA on genome biology may include mechanisms of centromere evolution, concerted evolution and homogenization of tandem repeats and genomic plasticity.

  11. Statistics of DNA Markers - RGP gmap | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available List Contact us RGP gmap Statistics of DNA Markers Data detail Data name Statistics of DNA Markers DOI 10.18...908/lsdba.nbdc00318-01-001 Description of data contents Statistics of DNA markers that were used to create t...iption Download License Update History of This Database Site Policy | Contact Us Statistics of DNA Markers - RGP gmap | LSDB Archive ...

  12. Tagging of blast resistance gene(s) to DNA markers and marker-assisted selection (MAS) in rice improvement

    International Nuclear Information System (INIS)

    Zhuang, J.Y.; Lu, J.; Qian, H.R.; Lin, H.X.; Zheng, K.L.

    1998-01-01

    This paper reports progress made on the tagging of blast resistance gene(s) to DNA markers and on the initiation of marker-assisted selection (MAS) for blast resistance in rice improvement. A pair of near isogenic lines, K8OR and K79S, were developed using a Chinese landrace Hong-jiao-zhan as the resistance donor. Ten putatively positive markers were identified by screening 177 mapped DNA markers. Using the F 2 population of 143 plants and the derived F 3 lines, three Restriction Fragment Length Polymorphism (RFLP) markers (RG81, RG869 and RZ397) on chromosome 12 of rice were identified to be closely linked to the blast resistance gene Pi-12(t). The genetic distance between Pi-12(t) and the closest marker RG869 was 5.1 cM. By employing the bulk segregant analysis (BSA) procedure, six of 199 arbitrary primers were found to produce positive Randomly Amplified Polymorphic DNA (RAPD) bands. Tight linkage between Pi-12(t) and three RAPD bands, each from a different primer, was confirmed after amplification of DNA of all F 2 individuals. Two fragments were cloned and sequenced, and two sequence characterised amplified re-ion (SCAR) markers were established. In two other F 3 populations, Xian-feng I/Tetep and Xian-feng, 1/Hong-jiao-zhan, the blast resistance was found to be controlled by interactions of two or more genes. One resistance gene was located in the vicinity of RG81 in both populations. Work to identify other gene(s) is currently under way. Marker assisted selection for blast resistance was initiated. Crosses were made between elite varieties and blast resistance donors to develop populations for DNA marker-assisted selection of blast resistance. In addition, 48 varieties widely used in current rice breeding programs were provided by rice breeders. DNA marker-based polymorphism among, these varieties and resistance donors were analysed to produce a database for future MAS program. (author)

  13. Ribosomal DNA variation in finger millet and wild species of Eleusine (Poaceae).

    Science.gov (United States)

    Hilu, K W; Johnson, J L

    1992-04-01

    Finger millet is an important cereal crop in the semi-arid regions of Africa and India. The crop belongs to the grass genus Eleusine, which includes nine annual and perennial species native to Africa except for the New World species E. tristachya. Ribosomal DNA (rDNA) variation in finger millet and related wild species was used to provide information on the origin of the genomes of this tetraploid crop and point out genetic relationships of the crop to other species in the genus. The restriction endonucleases used revealed a lack of variability in the rDNA spacer region in domesticated finger millet. All the rDNA variants of the crop were found in the proposed direct tetraploid ancestor, E. coracana subsp. africana. Wild and domesticated finger millet displayed the phenotypes found in diploid E. indica. Diploid Eleusine tristachya showed some similarity to the crop in some restriction sites. The remaining species were quite distinct in rDNA fragment patterns. The study supports the direct origin of finger millet from subspecies africana shows E. indica to be one of the genome donors of the crop, and demonstrates that none of the other species examined could have donated the second genome of the crop. The rDNA data raise the possibility that wild and domesticated finger millet could have originated as infraspecific polyploid hybrids from different varieties of E. indica.

  14. Systematic analysis and evolution of 5S ribosomal DNA in metazoans.

    Science.gov (United States)

    Vierna, J; Wehner, S; Höner zu Siederdissen, C; Martínez-Lage, A; Marz, M

    2013-11-01

    Several studies on 5S ribosomal DNA (5S rDNA) have been focused on a subset of the following features in mostly one organism: number of copies, pseudogenes, secondary structure, promoter and terminator characteristics, genomic arrangements, types of non-transcribed spacers and evolution. In this work, we systematically analyzed 5S rDNA sequence diversity in available metazoan genomes, and showed organism-specific and evolutionary-conserved features. Putatively functional sequences (12,766) from 97 organisms allowed us to identify general features of this multigene family in animals. Interestingly, we show that each mammal species has a highly conserved (housekeeping) 5S rRNA type and many variable ones. The genomic organization of 5S rDNA is still under debate. Here, we report the occurrence of several paralog 5S rRNA sequences in 58 of the examined species, and a flexible genome organization of 5S rDNA in animals. We found heterogeneous 5S rDNA clusters in several species, supporting the hypothesis of an exchange of 5S rDNA from one locus to another. A rather high degree of variation of upstream, internal and downstream putative regulatory regions appears to characterize metazoan 5S rDNA. We systematically studied the internal promoters and described three different types of termination signals, as well as variable distances between the coding region and the typical termination signal. Finally, we present a statistical method for detection of linkage among noncoding RNA (ncRNA) gene families. This method showed no evolutionary-conserved linkage among 5S rDNAs and any other ncRNA genes within Metazoa, even though we found 5S rDNA to be linked to various ncRNAs in several clades.

  15. Molecular phylogenetic analysis of Enterobius vermicularis and development of an 18S ribosomal DNA-targeted diagnostic PCR.

    Science.gov (United States)

    Zelck, Ulrike E; Bialek, Ralf; Weiss, Michael

    2011-04-01

    We genetically characterized pinworms obtained from 37 children from different regions of Germany and established new species-specific molecular diagnostic tools. No ribosomal DNA diversity was found; the phylogenetic position of Enterobius vermicularis within the Oxyurida order and its close relationship to the Ascaridida and Spirurida orders was confirmed.

  16. Structural and functional organization of ribosomal genes within the mammalian cell nucleolus.

    Science.gov (United States)

    Derenzini, Massimo; Pasquinelli, Gianandrea; O'Donohue, Marie-Françoise; Ploton, Dominique; Thiry, Marc

    2006-02-01

    Data on the in situ structural-functional organization of ribosomal genes in the mammalian cell nucleolus are reviewed here. Major findings on chromatin structure in situ come from investigations carried out using the Feulgen-like osmium ammine reaction as a highly specific electron-opaque DNA tracer. Intranucleolar chromatin shows three different levels of organization: compact clumps, fibers ranging from 11 to 30 nm, and loose agglomerates of extended DNA filaments. Both clumps and fibers of chromatin exhibit a nucleosomal organization that is lacking in the loose agglomerates of extended DNA filaments. In fact, these filaments constantly show a thickness of 2-3 nm, the same as a DNA double-helix molecule. The loose agglomerates of DNA filaments are located in the fibrillar centers, the interphase counterpart of metaphase NORs, therefore being constituted by ribosomal DNA. The extended, non-nucleosomal configuration of this rDNA has been shown to be independent of transcriptional activity and characterizes ribosome genes that are either transcribed or transcriptionally silent. Data reviewed are consistent with a model of control for ribosome gene activity that is not mediated by changes in chromatin structure. The presence of rDNA in mammalian cells always structurally ready for transcription might facilitate a more rapid adjustment of the ribosome production in response to the metabolic needs of the cell.

  17. Prognostic DNA Methylation Markers for Prostate Cancer

    Directory of Open Access Journals (Sweden)

    Siri H. Strand

    2014-09-01

    Full Text Available Prostate cancer (PC is the most commonly diagnosed neoplasm and the third most common cause of cancer-related death amongst men in the Western world. PC is a clinically highly heterogeneous disease, and distinction between aggressive and indolent disease is a major challenge for the management of PC. Currently, no biomarkers or prognostic tools are able to accurately predict tumor progression at the time of diagnosis. Thus, improved biomarkers for PC prognosis are urgently needed. This review focuses on the prognostic potential of DNA methylation biomarkers for PC. Epigenetic changes are hallmarks of PC and associated with malignant initiation as well as tumor progression. Moreover, DNA methylation is the most frequently studied epigenetic alteration in PC, and the prognostic potential of DNA methylation markers for PC has been demonstrated in multiple studies. The most promising methylation marker candidates identified so far include PITX2, C1orf114 (CCDC181 and the GABRE~miR-452~miR-224 locus, in addition to the three-gene signature AOX1/C1orf114/HAPLN3. Several other biomarker candidates have also been investigated, but with less stringent clinical validation and/or conflicting evidence regarding their possible prognostic value available at this time. Here, we review the current evidence for the prognostic potential of DNA methylation markers in PC.

  18. Strongylus asini (Nematoda, Strongyloidea): genetic relationships with other Strongylus species determined by ribosomal DNA.

    Science.gov (United States)

    Hung, G C; Jacobs, D E; Krecek, R C; Gasser, R B; Chilton, N B

    1996-12-01

    Genomic DNA was isolated from adult Strongylus asini collected from zebra. The second ribosomal transcribed spacer (ITS-2) was amplified and sequenced using polymerase chain reaction (PCR) based techniques. The DNA sequence was compared with previously published data for 3 related Strongylus species. A PCR-linked restriction fragment length polymorphism method allowed the 4 species to be differentiated unequivocally. The ITS-2 sequence of S. asini was found to be more similar to those of S. edentatus (87.1%) and S. equinus (95.3%) than to that of S vulgaris (73.9%). This result confirms that S. Asini and S vulgaris represent separate species and supports the retention of the 4 species within 1 genus.

  19. Molecular Phylogenetic Analysis of Enterobius vermicularis and Development of an 18S Ribosomal DNA-Targeted Diagnostic PCR▿

    Science.gov (United States)

    Zelck, Ulrike E.; Bialek, Ralf; Weiß, Michael

    2011-01-01

    We genetically characterized pinworms obtained from 37 children from different regions of Germany and established new species-specific molecular diagnostic tools. No ribosomal DNA diversity was found; the phylogenetic position of Enterobius vermicularis within the Oxyurida order and its close relationship to the Ascaridida and Spirurida orders was confirmed. PMID:21248085

  20. Accumulation of single-strand breaks doses not result in double-strand DNA breaks: peculiarity of transcribing fragment of human ribosomal operon that allows its detection in biological fluids at the death of various cells in organism

    International Nuclear Information System (INIS)

    Vejko, N.N.; Spitkovskij, D.M.

    2000-01-01

    The evidences of stability of the human ribosomal gene in the transcribing range (TR-rDNA) to fragmentation are presented in two groups of experiments: 1) in the case of availability of the fragments in the cells of sectional corpse material (necrosis and apoptosis) and by pathologies accompanied by the cells death through the apoptosis or necrosis mechanism; 2) in the model experiments, wherein the separated genomes DNA is subjected to the impact of nucleases initiating single-strand breaks (SB), or chemical introduction with a subsequent comparative analysis of stability to fragmentation of various DNA sequences including TR-rDNA. The DNA solutions were subjected to γ-radiation with the dose rate of 4.8 Gy/min. It is shown that in spite of the great number of the SBs the TR-rDNA is characterized by increased stability to fragmentation, which makes it possible to propose this DNA fragment for application as a cell death marker in biological fluids [ru

  1. A set of 14 DIP-SNP markers to detect unbalanced DNA mixtures.

    Science.gov (United States)

    Liu, Zhizhen; Liu, Jinding; Wang, Jiaqi; Chen, Deqing; Liu, Zidong; Shi, Jie; Li, Zeqin; Li, Wenyan; Zhang, Gengqian; Du, Bing

    2018-03-04

    Unbalanced DNA mixture is still a difficult problem for forensic practice. DIP-STRs are useful markers for detection of minor DNA but they are not widespread in the human genome and having long amplicons. In this study, we proposed a novel type of genetic marker, termed DIP-SNP. DIP-SNP refers to the combination of INDEL and SNP in less than 300bp length of human genome. The multiplex PCR and SNaPshot assay were established for 14 DIP-SNP markers in a Chinese Han population from Shanxi, China. This novel compound marker allows detection of the minor DNA contributor with sensitivity from 1:50 to 1:1000 in a DNA mixture of any gender with 1 ng-10 ng DNA template. Most of the DIP-SNP markers had a relatively high probability of informative alleles with an average I value of 0.33. In all, we proposed DIP-SNP as a novel kind of genetic marker for detection of minor contributor from unbalanced DNA mixture and established the detection method by associating the multiplex PCR and SNaPshot assay. DIP-SNP polymorphisms are promising markers for forensic or clinical mixture examination because they are shorter, widespread and higher sensitive. Copyright © 2018 Elsevier Inc. All rights reserved.

  2. Cytogenetic Analysis of Populus trichocarpa - Ribosomal DNA, Telomere Repeat Sequence, and Marker-selected BACs

    Science.gov (United States)

    M.N. lslam-Faridi; C.D. Nelson; S.P. DiFazio; L.E. Gunter; G.A. Tuskan

    2009-01-01

    The 185-285 rDNA and 55 rDNA loci in Populus trichocarpa were localized using fluorescent in situ hybridization (FISH). Two 185-285 rDNA sites and one 55 rDNA site were identified and located at the ends of 3 different chromosomes. FISH signals from the Arabidopsis-type telomere repeat sequence were observed at the distal ends of each chromosome. Six BAC clones...

  3. Random amplified polymorphic DNA (RAPD) markers reveal genetic ...

    African Journals Online (AJOL)

    The present study evaluated genetic variability of superior bael genotypes collected from different parts of Andaman Islands, India using fruit characters and random amplified polymorphic DNA (RAPD) markers. Genomic DNA extracted from leaf material using cetyl trimethyl ammonium bromide (CTAB) method was ...

  4. A ribosome without RNA

    Directory of Open Access Journals (Sweden)

    Harold S Bernhardt

    2015-11-01

    Full Text Available It was Francis Crick who first asked why the ribosome contains so much RNA, and discussed the implications of this for the direct flow of genetic information from DNA to protein. Remarkable advances in our understanding of the ribosome and protein synthesis, including the recent publication of two mammalian mitochondrial ribosome structures, have shed new light on this intriguing aspect of evolution in molecular biology. We examine here whether RNA is indispensable for coded protein synthesis, or whether an all-protein ‘ribosome’ (or ‘synthosome’ might be possible, with a protein enzyme catalyzing peptide synthesis, and release factor-like protein adaptors able to read a message composed of deoxyribonucleotides. We also compare the RNA world hypothesis with the alternative ‘proteins first’ hypothesis in terms of their different understandings of the evolution of the ribosome, and whether this might have been preceded by an ancestral form of nonribosomal peptide synthesis catalyzed by protein enzymes.

  5. Prenatal exclusion of Norrie disease with flanking DNA markers.

    Science.gov (United States)

    Gal, A; Uhlhaas, S; Glaser, D; Grimm, T

    1988-10-01

    Three polymorphic DNA markers linked to the locus of Norrie disease were used for indirect genotype analysis in a ten-wk-old fetus at risk for the disease. When haplotypes of the family members and the estimated recombination frequency between Norrie gene and each of the DNA marker loci DXS7, DXS84, and DXS146 were taken into account, the risk that the fetus had inherited the mutation was about 1%.

  6. Application of random amplified polymorphic DNA (RAPD) markers ...

    African Journals Online (AJOL)

    The random amplified polymorphic DNA (RAPD) technique has been widely applied to identify different varieties of plants for molecular breeding. However, application of RAPD markers to identify parthenogenesis in plants has not been reported. In this investigation, we used pedigree and RAPD markers to differentiate ...

  7. 16S/18S ribosomal DNA clone library analysis of rumen microbial diversity

    International Nuclear Information System (INIS)

    Wright, A.G.; Kiyoshi Tajima; Aminov, R.I.

    2005-01-01

    The rumen contains a complex ecosystem where billions of bacteria, archaea, protozoa and fungi reside. This diverse microbiota is well adapted to live in the rumen and play an important role in the digestion of feed and nutrient supply to the host in the form of microbial protein and volatile fatty acids. It is estimated that the rumen microbial population consists of about 10 6 protozoa/ml, 10 3 -10 7 fungi/ml, 10 10 bacteria/ml, and 10 9 methanogens/ml. To better understand the complex relationships in the rumen, it is necessary to gain an insight into the diversity of the rumen microbes and how the quantity and composition of rumen micro-organisms are altered by a number of different host factors such as age, genetics and diet. In the past, the diversity of micro-organisms from the digestive tracts of domesticated ruminants has been identified by classical microbiological techniques. However, given the fastidious growth requirements of rumen micro-organisms, it is reasonable to concede that the culture-dependent methods may select against some species, or taxonomic groups, leading researchers to underestimate the microbial diversity that is actually present in the rumen. In fact, it has been speculated that 90% of micro-organisms in nature have escaped traditional cultivation methods. Therefore, a major challenge in microbial ecology has been to assess the diversity and structure of natural microbial communities. The field of molecular biology has advanced with many innovative technological breakthroughs. The ability to extract and to isolate high-molecular weight DNA from rumen digesta, PCR amplify genes from specific microbial groups and obtain gene sequence data is now a routine event. The small subunit ribosomal RNA (SSU-rRNA) gene, called 16S in prokaryotes and 18S in eukaryotes, is the most widely used molecular marker to presumptively identify morphologically indistinguishable species, to infer their phylogenetic relationships, and to elucidate microbial

  8. Phylogenetic Diversity of Lactic Acid Bacteria Associated with Paddy Rice Silage as Determined by 16S Ribosomal DNA Analysis

    OpenAIRE

    Ennahar, Saïd; Cai, Yimin; Fujita, Yasuhito

    2003-01-01

    A total of 161 low-G+C-content gram-positive bacteria isolated from whole-crop paddy rice silage were classified and subjected to phenotypic and genetic analyses. Based on morphological and biochemical characters, these presumptive lactic acid bacterium (LAB) isolates were divided into 10 groups that included members of the genera Enterococcus, Lactobacillus, Lactococcus, Leuconostoc, Pediococcus, and Weissella. Analysis of the 16S ribosomal DNA (rDNA) was used to confirm the presence of the ...

  9. Diversification in insular plants: Inferring the phylogenetic relationship in Aeonium (Crassulaceae) using ITS sequences of nuclear ribosomal DNA

    DEFF Research Database (Denmark)

    Jorgensen, T.H.; Frydenberg, J.

    1999-01-01

    The ITS regions of nuclear ribosomal DNA were sequenced in 37 species of the genus Aeonium. A phylogeny obtained through the use of parsimony agrees to some extent with the sectional division of the genus and confirms the position of two newly described species. It also suggests the potential imp...

  10. Ribosomal DNA, heterochromatin, and correlation with genome size in diploid and polyploid North American endemic sagebrushes (Artemisia, Asteraceae)

    Science.gov (United States)

    Sonia Garcia; Teresa Garnatje; Jaume Pellicer; E. Durant McArthur; Sonja Siljak-Yakovlev; Joan Valles

    2009-01-01

    Subgenus Tridentatae (Artemisia, Asteraceae) can be considered a polyploid complex. Both polyploidy and hybridization have been documented in the Tridentatae. Fluorescent in situ hybridization (FISH) and fluorochrome banding were used to detect and analyze ribosomal DNA changes linked to polyploidization in this group by studying four diploidpolyploid species pairs. In...

  11. cpDNA microsatellite markers for Lemna minor (Araceae): Phylogeographic implications.

    Science.gov (United States)

    Wani, Gowher A; Shah, Manzoor A; Reshi, Zafar A; Atangana, Alain R; Khasa, Damase P

    2014-07-01

    A lack of genetic markers impedes our understanding of the population biology of Lemna minor. Thus, the development of appropriate genetic markers for L. minor promises to be highly useful for population genetic studies and for addressing other life history questions regarding the species. • For the first time, we characterized nine polymorphic and 24 monomorphic chloroplast microsatellite markers in L. minor using DNA samples of 26 individuals sampled from five populations in Kashmir and of 17 individuals from three populations in Quebec. Initially, we designed 33 primer pairs, which were tested on genomic DNA from natural populations. Nine loci provided markers with two alleles. Based on genotyping of the chloroplast DNA fragments from 43 sampled individuals, we identified one haplotype in Quebec and 11 haplotypes in Kashmir, of which one occurs in 56% of the genotypes, one in 8%, and nine in 4%, respectively. There was a maximum of two alleles per locus. • These new chloroplast microsatellite markers for L. minor and haplotype distribution patterns indicate a complex phylogeographic history that merits further investigation.

  12. Interplay of ribosomal DNA loci in nucleolar dominance: dominant NORs are up-regulated by chromatin dynamics in the wheat-rye system.

    Directory of Open Access Journals (Sweden)

    Manuela Silva

    Full Text Available BACKGROUND: Chromatin organizational and topological plasticity, and its functions in gene expression regulation, have been strongly revealed by the analysis of nucleolar dominance in hybrids and polyploids where one parental set of ribosomal RNA (rDNA genes that are clustered in nucleolar organizing regions (NORs, is rendered silent by epigenetic pathways and heterochromatization. However, information on the behaviour of dominant NORs is very sparse and needed for an integrative knowledge of differential gene transcription levels and chromatin specific domain interactions. METHODOLOGY/PRINCIPAL FINDINGS: Using molecular and cytological approaches in a wheat-rye addition line (wheat genome plus the rye nucleolar chromosome pair 1R, we investigated transcriptional activity and chromatin topology of the wheat dominant NORs in a nucleolar dominance situation. Herein we report dominant NORs up-regulation in the addition line through quantitative real-time PCR and silver-staining technique. Accompanying this modification in wheat rDNA trascription level, we also disclose that perinucleolar knobs of ribosomal chromatin are almost transcriptionally silent due to the residual detection of BrUTP incorporation in these domains, contrary to the marked labelling of intranucleolar condensed rDNA. Further, by comparative confocal analysis of nuclei probed to wheat and rye NORs, we found that in the wheat-rye addition line there is a significant decrease in the number of wheat-origin perinucleolar rDNA knobs, corresponding to a diminution of the rDNA heterochromatic fraction of the dominant (wheat NORs. CONCLUSIONS/SIGNIFICANCE: We demonstrate that inter-specific interactions leading to wheat-origin NOR dominance results not only on the silencing of rye origin NOR loci, but dominant NORs are also modified in their transcriptional activity and interphase organization. The results show a cross-talk between wheat and rye NORs, mediated by ribosomal chromatin

  13. Single Cell Analysis Linking Ribosomal (r)DNA and rRNA Copy Numbers to Cell Size and Growth Rate Provides Insights into Molecular Protistan Ecology.

    Science.gov (United States)

    Fu, Rao; Gong, Jun

    2017-11-01

    Ribosomal (r)RNA and rDNA have been golden molecular markers in microbial ecology. However, it remains poorly understood how ribotype copy number (CN)-based characteristics are linked with diversity, abundance, and activity of protist populations and communities observed at organismal levels. Here, we applied a single-cell approach to quantify ribotype CNs in two ciliate species reared at different temperatures. We found that in actively growing cells, the per-cell rDNA and rRNA CNs scaled with cell volume (CV) to 0.44 and 0.58 powers, respectively. The modeled rDNA and rRNA concentrations thus appear to be much higher in smaller than in larger cells. The observed rRNA:rDNA ratio scaled with CV 0.14 . The maximum growth rate could be well predicted by a combination of per-cell ribotype CN and temperature. Our empirical data and modeling on single-cell ribotype scaling are in agreement with both the metabolic theory of ecology and the growth rate hypothesis, providing a quantitative framework for linking cellular rDNA and rRNA CNs with body size, growth (activity), and biomass stoichiometry. This study also demonstrates that the expression rate of rRNA genes is constrained by cell size, and favors biomass rather than abundance-based interpretation of quantitative ribotype data in population and community ecology of protists. © 2017 The Authors. Journal of Eukaryotic Microbiology published by Wiley Periodicals, Inc. on behalf of International Society of Protistologists.

  14. Hypervariability of ribosomal DNA at multiple chromosomal sites in lake trout (Salvelinus namaycush).

    Science.gov (United States)

    Zhuo, L; Reed, K M; Phillips, R B

    1995-06-01

    Variation in the intergenic spacer (IGS) of the ribosomal DNA (rDNA) of lake trout (Salvelinus namaycush) was examined. Digestion of genomic DNA with restriction enzymes showed that almost every individual had a unique combination of length variants with most of this variation occurring within rather than between populations. Sequence analysis of a 2.3 kilobase (kb) EcoRI-DraI fragment spanning the 3' end of the 28S coding region and approximately 1.8 kb of the IGS revealed two blocks of repetitive DNA. Putative transcriptional termination sites were found approximately 220 bases (b) downstream from the end of the 28S coding region. Comparison of the 2.3-kb fragments with two longer (3.1 kb) fragments showed that the major difference in length resulted from variation in the number of short (89 b) repeats located 3' to the putative terminator. Repeat units within a single nucleolus organizer region (NOR) appeared relatively homogeneous and genetic analysis found variants to be stably inherited. A comparison of the number of spacer-length variants with the number of NORs found that the number of length variants per individual was always less than the number of NORs. Examination of spacer variants in five populations showed that populations with more NORs had more spacer variants, indicating that variants are present at different rDNA sites on nonhomologous chromosomes.

  15. Identification of body fluid-specific DNA methylation markers for use in forensic science.

    Science.gov (United States)

    Park, Jong-Lyul; Kwon, Oh-Hyung; Kim, Jong Hwan; Yoo, Hyang-Sook; Lee, Han-Chul; Woo, Kwang-Man; Kim, Seon-Young; Lee, Seung-Hwan; Kim, Yong Sung

    2014-11-01

    DNA methylation, which occurs at the 5'-position of the cytosine in CpG dinucleotides, has great potential for forensic identification of body fluids, because tissue-specific patterns of DNA methylation have been demonstrated, and DNA is less prone to degradation than proteins or RNA. Previous studies have reported several body fluid-specific DNA methylation markers, but DNA methylation differences are sometimes low in saliva and vaginal secretions. Moreover, specific DNA methylation markers in four types of body fluids (blood, saliva, semen, and vaginal secretions) have not been investigated with genome-wide profiling. Here, we investigated novel DNA methylation markers for identification of body fluids for use in forensic science using the Illumina HumanMethylation 450K bead array, which contains over 450,000 CpG sites. Using methylome data from 16 samples of blood, saliva, semen, and vaginal secretions, we first selected 2986 hypermethylated or hypomethylated regions that were specific for each type of body fluid. We then selected eight CpG sites as novel, forensically relevant DNA methylation markers: cg06379435 and cg08792630 for blood, cg26107890 and cg20691722 for saliva, cg23521140 and cg17610929 for semen, and cg01774894 and cg14991487 for vaginal secretions. These eight selected markers were evaluated in 80 body fluid samples using pyrosequencing, and all showed high sensitivity and specificity for identification of the target body fluid. We suggest that these eight DNA methylation markers may be good candidates for developing an effective molecular assay for identification of body fluids in forensic science. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  16. cpDNA Microsatellite Markers for Lemna minor (Araceae: Phylogeographic Implications

    Directory of Open Access Journals (Sweden)

    Gowher A. Wani

    2014-07-01

    Full Text Available Premise of the study: A lack of genetic markers impedes our understanding of the population biology of Lemna minor. Thus, the development of appropriate genetic markers for L. minor promises to be highly useful for population genetic studies and for addressing other life history questions regarding the species. Methods and Results: For the first time, we characterized nine polymorphic and 24 monomorphic chloroplast microsatellite markers in L. minor using DNA samples of 26 individuals sampled from five populations in Kashmir and of 17 individuals from three populations in Quebec. Initially, we designed 33 primer pairs, which were tested on genomic DNA from natural populations. Nine loci provided markers with two alleles. Based on genotyping of the chloroplast DNA fragments from 43 sampled individuals, we identified one haplotype in Quebec and 11 haplotypes in Kashmir, of which one occurs in 56% of the genotypes, one in 8%, and nine in 4%, respectively. There was a maximum of two alleles per locus. Conclusions: These new chloroplast microsatellite markers for L. minor and haplotype distribution patterns indicate a complex phylogeographic history that merits further investigation.

  17. The IGS-ETS in Bacillus (Insecta Phasmida: molecular characterization and the relevance of sex in ribosomal DNA evolution

    Directory of Open Access Journals (Sweden)

    Passamonti Marco

    2008-10-01

    Full Text Available Abstract Background DNA encoding for ribosomal RNA (rDNA is arranged in tandemly-repeated subunits, each containing ribosomal genes and non-coding spacers. Because tandemly-repeated, rDNA evolves under a balanced influence of selection and "concerted evolution", which homogenizes rDNA variants over the genome (through genomic turnover mechanisms and the population (through sexuality. Results In this paper we analyzed the IGS-ETS of the automictic parthenogen Bacillus atticus and the bisexual B. grandii, two closely related stick-insect species. Both species share the same IGS-ETS structure and sequence, including a peculiar head-to-tail array of putative transcription enhancers, here named Bag530. Sequence variability of both IGS-ETS and Bag530 evidenced a neat geographic and subspecific clustering in B. grandii, while B. atticus shows a little but evident geographic structure. This was an unexpected result, since the parthenogen B. atticus should lack sequence fixation through sexuality. In B. atticus a new variant might spread in a given geographic area through colonization by an all-female clone, but we cannot discard the hypothesis that B. atticus was actually a bisexual taxon in that area at the time the new variant appeared. Moreover, a gene conversion event between two Bag530 variants of B. grandii benazzii and B. grandii maretimi suggested that rRNA might evolve according to the so-called "library hypothesis" model, through differential amplification of rDNA variants in different taxa. Conclusion On the whole, Bacillus rDNA evolution appears to be under a complex array of interacting mechanisms: homogenization may be achieved through genomic turnover that stabilizes DNA-binding protein interactions but, simultaneously, new sequence variants can be adopted, either by direct appearance of newly mutated repeats, or by competition among repeats, so that both DNA-binding proteins and repeat variants drive each other's evolution. All this

  18. Tri-allelic SNP markers enable analysis of mixed and degraded DNA samples.

    Science.gov (United States)

    Westen, Antoinette A; Matai, Anuska S; Laros, Jeroen F J; Meiland, Hugo C; Jasper, Mandy; de Leeuw, Wiljo J F; de Knijff, Peter; Sijen, Titia

    2009-09-01

    For the analysis of degraded DNA in disaster victim identification (DVI) and criminal investigations, single nucleotide polymorphisms (SNPs) have been recognized as promising markers mainly because they can be analyzed in short sized amplicons. Most SNPs are bi-allelic and are thereby ineffective to detect mixtures, which may lead to incorrect genotyping. We developed an algorithm to find non-binary (i.e. tri-allelic or tetra-allelic) SNPs in the NCBI dbSNP database. We selected 31 potential tri-allelic SNPs with a minor allele frequency of at least 10%. The tri-allelic nature was confirmed for 15 SNPs residing on 14 different chromosomes. Multiplex SNaPshot assays were developed, and the allele frequencies of 16 SNPs were determined among 153 Dutch and 111 Netherlands Antilles reference samples. Using these multiplex SNP assays, the presence of a mixture of two DNA samples in a ratio up to 1:8 could be recognized reliably. Furthermore, we compared the genotyping efficiency of the tri-allelic SNP markers and short tandem repeat (STR) markers by analyzing artificially degraded DNA and DNA from 30 approximately 500-year-old bone and molar samples. In both types of degraded DNA samples, the larger sized STR amplicons failed to amplify whereas the tri-allelic SNP markers still provided valuable information. In conclusion, tri-allelic SNP markers are suited for the analysis of degraded DNA and enable the detection of a second DNA source in a sample.

  19. The D3-D5 region of large subunit ribosomal DNA provides good resolution of German limnic and terrestrial nematode communities

    NARCIS (Netherlands)

    Schenk, Janina; Hohberg, Karin; Helder, Hans; Ristau, Kai; Traunspurger, Walter

    2017-01-01

    Reliable and well-developed DNA barcode databases are indispensable for the identification of microscopic life. However, effectiveness of molecular barcoding in identifying terrestrial specimens, and nematodes in particular, has received little attention. In this study, ca 600 ribosomal large

  20. cDNA Cloning, expression and characterization of an allergenic 60s ribosomal protein of almond (prunus dulcis).

    Science.gov (United States)

    Abolhassani, Mohsen; Roux, Kenneth H

    2009-06-01

    Tree nuts, including almond (prunus dulcis) are a source of food allergens often associated with life-threatening allergic reactions in susceptible individuals. Although the proteins in almonds have been biochemically characterized, relatively little has been reported regarding the identity of the allergens involved in almond sensitivity. The present study was undertaken to identify the allergens of the almond by cDNA library approach. cDNA library of almond seeds was constructed in Uni-Zap XR lamda vector and expressed in E. coli XL-1 blue. Plaques were immunoscreened with pooled sera of allergic patients. The cDNA clone reacting significantly with specific IgE antibodies was selected and subcloned and subsequently expressed in E. coli. The amino acids deducted from PCR product of clone showed homology to 60s acidic ribosomal protein of almond. The expressed protein was 11,450 Dalton without leader sequence. Immunoreactivity of the recombinant 60s ribosomal protein (r60sRP) was evaluated with dot blot analysis using pooled and individual sera of allergic patients. The data showed that r60sRP and almond extract (as positive control) possess the ability to bind the IgE antibodies. The results showed that expressed protein is an almond allergen.Whether this r60sRP represents a major allergen of almond needs to be further studied which requires a large number of sera from the almond atopic patients and also need to determine the IgE-reactive frequencies of each individual allergen.

  1. Identification of Candida species by PCR and restriction fragment length polymorphism analysis of intergenic spacer regions of ribosomal DNA.

    OpenAIRE

    Williams, D W; Wilson, M J; Lewis, M A; Potts, A J

    1995-01-01

    The PCR was used to amplify a targeted region of the ribosomal DNA from 84 Candida isolates. Unique product sizes were obtained for Candida guilliermondii, Candida (Torulopsis) glabrata, and Candida pseudotropicalis. Isolates of Candida albicans, Candida tropicalis, Candida stellatoidea, Candida parapsilosis, and Candida krusei could be identified following restriction digestion of the PCR products.

  2. Diagnostic markers of urothelial cancer based on DNA methylation analysis

    International Nuclear Information System (INIS)

    Chihara, Yoshitomo; Hirao, Yoshihiko; Kanai, Yae; Fujimoto, Hiroyuki; Sugano, Kokichi; Kawashima, Kiyotaka; Liang, Gangning; Jones, Peter A; Fujimoto, Kiyohide; Kuniyasu, Hiroki

    2013-01-01

    Early detection and risk assessment are crucial for treating urothelial cancer (UC), which is characterized by a high recurrence rate, and necessitates frequent and invasive monitoring. We aimed to establish diagnostic markers for UC based on DNA methylation. In this multi-center study, three independent sample sets were prepared. First, DNA methylation levels at CpG loci were measured in the training sets (tumor samples from 91 UC patients, corresponding normal-appearing tissue from these patients, and 12 normal tissues from age-matched bladder cancer-free patients) using the Illumina Golden Gate methylation assay to identify differentially methylated loci. Next, these methylated loci were validated by quantitative DNA methylation by pyrosequencing, using another cohort of tissue samples (Tissue validation set). Lastly, methylation of these markers was analyzed in the independent urine samples (Urine validation set). ROC analysis was performed to evaluate the diagnostic accuracy of these 12 selected markers. Of the 1303 CpG sites, 158 were hyper ethylated and 356 were hypo ethylated in tumor tissues compared to normal tissues. In the panel analysis, 12 loci showed remarkable alterations between tumor and normal samples, with 94.3% sensitivity and 97.8% specificity. Similarly, corresponding normal tissue could be distinguished from normal tissues with 76.0% sensitivity and 100% specificity. Furthermore, the diagnostic accuracy for UC of these markers determined in urine samples was high, with 100% sensitivity and 100% specificity. Based on these preliminary findings, diagnostic markers based on differential DNA methylation at specific loci can be useful for non-invasive and reliable detection of UC and epigenetic field defect

  3. Phylogenetic relationships of the Gomphales based on nuc-25S-rDNA, mit-12S-rDNA, and mit-atp6-DNA combined sequences

    Science.gov (United States)

    Admir J. Giachini; Kentaro Hosaka; Eduardo Nouhra; Joseph Spatafora; James M. Trappe

    2010-01-01

    Phylogenetic relationships among Geastrales, Gomphales, Hysterangiales, and Phallales were estimated via combined sequences: nuclear large subunit ribosomal DNA (nuc-25S-rDNA), mitochondrial small subunit ribosomal DNA (mit-12S-rDNA), and mitochondrial atp6 DNA (mit-atp6-DNA). Eighty-one taxa comprising 19 genera and 58 species...

  4. Genetic variations and relationships of cultivated and weedy types of perilla species in Korea and Japan using multi DNA markers

    International Nuclear Information System (INIS)

    Sun, Y.; Zheng, S.; Lee, J.; Hong, S.

    2017-01-01

    The genus Perilla, known as an oil crop or a Chinese medicine, vegetable crop, is widely cultivated in East Asia. It occurs in two distinct varieties, var. frutescens and var. crispa, and their genetic relationship is still obscure. To understand the genetic diversity and relationships of the cultivated and weedy types of Perilla crops in Korea, Japan and China, we evaluated the genetic variation of 20 accessions by 3 rDNA markers. Among these three markers, the nuclear ribosomal DNA (nrDNA) internal transcribed spacers (ITS) region of Perilla crops showed less sequence variations than the 5S and 18S genes. There were abundant variable nucleotide sites appearing in the 5S and 18S genes. Especially in the 18S gene, the variable nucleotide sites showed specificity between some Perilla type and other varieties. JPN1 showed 6 special variable nucleotide sites differing from other varieties, resulting in the farthest phylogenetic relationship in the 18S tree. CHI15 shared 8 special variable sites, also showing far phylogenetic relationship with other varieties. According to the sequence analysis result, the cultivated types of Korean var. frutescens showed relatively more genetic diversity than those of Japanese var. frutescens, while Korean var. crispa showed lower genetic diversity than those of Japanese var. crispa. However, the intra- or inter-variety genetic distance did not have significant difference. This work provided more sequence resources of Perilla crops and evidences to evaluate the genetic variation and relationships. Our result would help molecular type identification, functional plant breeding and trait improvement of Perilla crops. (author)

  5. Diversity of ribosomal 16S DNA- and RNA-based bacterial community in an office building drinking water system.

    Science.gov (United States)

    Inkinen, J; Jayaprakash, B; Santo Domingo, J W; Keinänen-Toivola, M M; Ryu, H; Pitkänen, T

    2016-06-01

    Next-generation sequencing of 16S ribosomal RNA genes (rDNA) and ribosomal RNA (rRNA) was used to characterize water and biofilm microbiome collected from a drinking water distribution system of an office building after its first year of operation. The total bacterial community (rDNA) and active bacterial members (rRNA) sequencing databases were generated by Illumina MiSeq PE250 platform. As estimated by Chao1 index, species richness in cold water system was lower (180-260) in biofilms (Sphingomonas spp., Methylobacterium spp., Limnohabitans spp., Rhizobiales order) than in waters (250-580), (also Methylotenera spp.) (P = 0·005, n = 20). Similarly species richness (Chao1) was slightly higher (210-580) in rDNA libraries compared to rRNA libraries (150-400; P = 0·054, n = 24). Active Mycobacterium spp. was found in cross-linked polyethylene (PEX), but not in corresponding copper pipeline biofilm. Nonpathogenic Legionella spp. was found in rDNA libraries but not in rRNA libraries. Microbial communities differed between water and biofilms, between cold and hot water systems, locations in the building and between water rRNA and rDNA libraries, as shown by clear clusters in principal component analysis (PcoA). By using the rRNA method, we found that not all bacterial community members were active (e.g. Legionella spp.), whereas other members showed increased activity in some locations; for example, Pseudomonas spp. in hot water circulations' biofilm and order Rhizobiales and Limnohabitans spp. in stagnated locations' water and biofilm. rRNA-based methods may be better than rDNA-based methods for evaluating human health implications as rRNA methods can be used to describe the active bacterial fraction. This study indicates that copper as a pipeline material might have an adverse impact on the occurrence of Mycobacterium spp. The activity of Legionella spp. maybe questionable when detected solely by using DNA-based methods. © 2016 The Society for Applied

  6. Emerging functions of ribosomal proteins in gene-specific transcription and translation

    International Nuclear Information System (INIS)

    Lindstroem, Mikael S.

    2009-01-01

    Ribosomal proteins have remained highly conserved during evolution presumably reflecting often critical functions in ribosome biogenesis or mature ribosome function. In addition, several ribosomal proteins possess distinct extra-ribosomal functions in apoptosis, DNA repair and transcription. An increasing number of ribosomal proteins have been shown to modulate the trans-activation function of important regulatory proteins such as NF-κB, p53, c-Myc and nuclear receptors. Furthermore, a subset of ribosomal proteins can bind directly to untranslated regions of mRNA resulting in transcript-specific translational control outside of the ribosome itself. Collectively, these findings suggest that ribosomal proteins may have a wider functional repertoire within the cell than previously thought. The future challenge is to identify and validate these novel functions in the background of an often essential primary function in ribosome biogenesis and cell growth.

  7. Characterization of four species of Trichuris (Nematoda: Enoplida) by their second internal transcribed spacer ribosomal DNA sequence.

    Science.gov (United States)

    Oliveros, R; Cutillas, C; De Rojas, M; Arias, P

    2000-12-01

    Adult worms of Trichuris ovis and T. globulosa were collected from Ovis aries (sheep) and Capra hircus (goats). T. suis was isolated from Sus scrofa domestica (swine) and T. leporis was isolated from Lepus europaeus (rabbits) in Spain. Genomic DNA was isolated and a ribosomal internal transcribed spacer (ITS2) was amplified and sequenced using polymerase-chain-reaction (PCR) techniques. The ITS2 of T. ovis and T. globulosa was 407 nucleotides in length and had a GC content of about 62%. Furthermore, the ITS2 of T. suis and T. leporis was 534 and 418 nucleotides in length and had a GC content of about 64.8% and 62.4%, respectively. There was evidence of slight variation in the sequence within individuals of all species analyzed, indicating intraindividual variation in the sequence of different copies of the ribosomal DNA. Furthermore, low-level intraspecific variation was detected. Sequence analyses of ITS2 products of T. ovis and T. globulosa demonstrated no sequence difference between them. Nevertheless, differences were detected between the ITS2 sequences of T. suis, T. leporis, and T. ovis, indicating that Trichuris species can reliably be differentiated by their ITS2 sequences and PCR-linked restriction-fragment-length polymorphism (RFLP).

  8. cpDNA microsatellite markers for Lemna minor (Araceae): Phylogeographic implications1

    Science.gov (United States)

    Wani, Gowher A.; Shah, Manzoor A.; Reshi, Zafar A.; Atangana, Alain R.; Khasa, Damase P.

    2014-01-01

    • Premise of the study: A lack of genetic markers impedes our understanding of the population biology of Lemna minor. Thus, the development of appropriate genetic markers for L. minor promises to be highly useful for population genetic studies and for addressing other life history questions regarding the species. • Methods and Results: For the first time, we characterized nine polymorphic and 24 monomorphic chloroplast microsatellite markers in L. minor using DNA samples of 26 individuals sampled from five populations in Kashmir and of 17 individuals from three populations in Quebec. Initially, we designed 33 primer pairs, which were tested on genomic DNA from natural populations. Nine loci provided markers with two alleles. Based on genotyping of the chloroplast DNA fragments from 43 sampled individuals, we identified one haplotype in Quebec and 11 haplotypes in Kashmir, of which one occurs in 56% of the genotypes, one in 8%, and nine in 4%, respectively. There was a maximum of two alleles per locus. • Conclusions: These new chloroplast microsatellite markers for L. minor and haplotype distribution patterns indicate a complex phylogeographic history that merits further investigation. PMID:25202636

  9. Clinical identification of bacteria in human chronic wound infections: culturing vs. 16S ribosomal DNA sequencing

    Directory of Open Access Journals (Sweden)

    Rhoads Daniel D

    2012-11-01

    Full Text Available Abstract Background Chronic wounds affect millions of people and cost billions of dollars in the United States each year. These wounds harbor polymicrobial biofilm communities, which can be difficult to elucidate using culturing methods. Clinical molecular microbiological methods are increasingly being employed to investigate the microbiota of chronic infections, including wounds, as part of standard patient care. However, molecular testing is more sensitive than culturing, which results in markedly different results being reported to clinicians. This study compares the results of aerobic culturing and molecular testing (culture-free 16S ribosomal DNA sequencing, and it examines the relative abundance score that is generated by the molecular test and the usefulness of the relative abundance score in predicting the likelihood that the same organism would be detected by culture. Methods Parallel samples from 51 chronic wounds were studied using aerobic culturing and 16S DNA sequencing for the identification of bacteria. Results One hundred forty-five (145 unique genera were identified using molecular methods, and 68 of these genera were aerotolerant. Fourteen (14 unique genera were identified using aerobic culture methods. One-third (31/92 of the cultures were determined to be Staphylococcus aureus, Pseudomonas aeruginosa, and Enterococcus faecalis with higher relative abundance scores were more likely to be detected by culture as demonstrated with regression modeling. Conclusion Discordance between molecular and culture testing is often observed. However, culture-free 16S ribosomal DNA sequencing and its relative abundance score can provide clinicians with insight into which bacteria are most abundant in a sample and which are most likely to be detected by culture.

  10. Validation and use of DNA markers for sex determination in papaya (Carica papaya)

    International Nuclear Information System (INIS)

    Ejaz, M.; Iqbal, M.; Ahmed, I.

    2015-01-01

    Profitable papaya production requires female and hermaphrodite plants in higher number than male plants. This is only possible if sex of plants is determined at an early growth stage. The present study was conducted to validate sex-linked DNA markers using plants from two Pakistani papaya varieties and subsequently utilize them for determination of sex in juvenile papaya plants. One hundred and five plants (including 49 male and 56 female) of two Pakistani Papaya varieties at flowering stage were screened with six DNA markers viz., W-11, T12, SDP, Napf-76Napf-76, PKBT4 and PKBT5. All male plants exhibited amplification of sex-linked alleles with markers T12 and W11, whereas, 96% and 95% of female plants showed the absence of sex-linked allele with these markers, respectively. Markers SDP, PKBT5 and Napf-76 showed the presence of sex-linked alleles in 98%, 96% and 93% of male plants, respectively, whereas the same markers showed the absence of sex-linked alleles in 100%, 96% and 94% of female plants. One marker, PKBT4 could not produce expected PCR amplification reported previously. The five DNA markers were further used to screen 171 papaya seedlings. These markers clearly differentiated male and female sex types in the studied papaya plants. Results of our study are likely to facilitate Pakistani papaya breeders and growers to incorporate DNA based screening at juvenile stage to determine sex at early stage and to ensure profitable papaya production. (author)

  11. Tagging genes for drought resistance by DNA markers in wheat (abstract)

    International Nuclear Information System (INIS)

    Malik, T.A.; Rahman, S.; Zafar, Y.

    2005-01-01

    Wheat families (F/sub 3) raised from the seed of drought resistant and susceptible F/sub 2/ plants developed from the cross of drought resistant and susceptible parents were grown under greenhouse conditions in polyethylene tubes filled with soil and sand mixture. Drought stress was imposed and monitored at the seedling stage. The relative water content and net photosynthesis was recorded with increasing drought stress until a significant part of the seedling population had zero or negative net photosynthesis. The seedling with zero or negative net photosynthesis were named as drought susceptible and the seedlings at the same drought stress showing net photosynthesis were named as drought resistance. Twenty each of the most susceptible and resistant seedlings were selected for DNA extraction. Random Amplified Polymorphic DNA (RAPD) technique using bulked segregant analysis was used to identify DNA markers linked to drought resistance. The primers OPJ-05, OPJ-14, OPI-20 and OPA-19 produced polymorphic DNA fragments between the contrasting bulks. The polymorphic DNA fragment of 1.55kb produced by the primer OPA-19 was found linked to drought resistance. This DNA marker can be used in markers-assisted selection for drought resistance or to clone drought resistance gene. (author)

  12. Development of ITS sequence based molecular marker to distinguish, Tribulus terrestris L. (Zygophyllaceae) from its adulterants.

    Science.gov (United States)

    Balasubramani, Subramani Paranthaman; Murugan, Ramar; Ravikumar, Kaliamoorthy; Venkatasubramanian, Padma

    2010-09-01

    Tribulus terrestris L. (Zygophyllaceae) is one of the highly traded raw drugs and also used as a stimulative food additive in Europe and USA. While, Ayurvedic Pharmacopoeia of India recognizes T. terrestris as Goksura, Tribulus lanuginosus and T. subramanyamii are also traded by the same name raising issues of quality control. The nuclear ribosomal RNA genes and ITS (internal transcribed spacer) sequence were used to develop species-specific DNA markers. The species-specific markers efficiently amplified 295bp for T. terrestris (TT1F and TT1R), 300bp for T. lanuginosus (TL1F and TL1R) and 214bp for T. subramanyamii (TS1F and TS1R). These DNA markers can be used to distinguish T. terrestris from its adulterants. Copyright (c) 2010 Elsevier B.V. All rights reserved.

  13. Transcriptional activation of ribosomal RNA genes during compensatory renal hypertrophy

    International Nuclear Information System (INIS)

    Ouellette, A.J.; Moonka, R.; Zelenetz, A.; Malt, R.A.

    1986-01-01

    The overall rate of rDNA transcription increases by 50% during the first 24 hours of compensatory renal hypertrophy in the mouse. To study mechanisms of ribosome accumulation after uninephrectomy, transcription rates were measured in isolated kidneys by transcriptional runoff. 32 P-labeled nascent transcripts were hybridized to blots containing linearized, denatured cloned rDNA, and hybridization was quantitated autoradiographically and by direct counting. Overall transcriptional activity of rDNA was increased by 30% above control levels at 6 hrs after nephrectomy and by 50% at 12, 18, and 24 hrs after operation. Hybridizing RNA was insensitive to inhibiby alpha-amanitin, and no hybridization was detected to vector DNA. Thus, accelerated rDNA transcription is one regulatory element in the accretion of ribosomes in renal growth, and the regulatory event is an early event. Mechanisms of activation may include enhanced transcription of active genes or induction of inactive DNA

  14. Molecular Identification of Date Palm Cultivars Using Random Amplified Polymorphic DNA (RAPD) Markers.

    Science.gov (United States)

    Al-Khalifah, Nasser S; Shanavaskhan, A E

    2017-01-01

    Ambiguity in the total number of date palm cultivars across the world is pointing toward the necessity for an enumerative study using standard morphological and molecular markers. Among molecular markers, DNA markers are more suitable and ubiquitous to most applications. They are highly polymorphic in nature, frequently occurring in genomes, easy to access, and highly reproducible. Various molecular markers such as restriction fragment length polymorphism (RFLP), amplified fragment length polymorphism (AFLP), simple sequence repeats (SSR), inter-simple sequence repeats (ISSR), and random amplified polymorphic DNA (RAPD) markers have been successfully used as efficient tools for analysis of genetic variation in date palm. This chapter explains a stepwise protocol for extracting total genomic DNA from date palm leaves. A user-friendly protocol for RAPD analysis and a table showing the primers used in different molecular techniques that produce polymorphisms in date palm are also provided.

  15. Elucidating polyploidization of bermudagrasses as assessed by organelle and nuclear DNA markers.

    Science.gov (United States)

    Gulsen, Osman; Ceylan, Ahmet

    2011-12-01

    Clarification of relationships among ploidy series of Cynodon accessions could be beneficial to bermudagrass breeding programs, and would enhance our understanding of the evolutionary biology of this warm season grass species. This study was initiated to elucidate polyploidization among Cynodon accessions with different ploidy series collected from Turkey based on chloroplast and nuclear DNA. Forty Cynodon accessions including 7 diploids, 3 triploids, 10 tetraploids, 11 pentaploids, and 9 hexaploids were analyzed using chloroplast DNA restriction fragment-length polymorphism (cpDNA RFLP), chloroplast DNA simple sequence repeat (cpDNA SSR), and nuclear DNA markers based on neighbor-joining (NJ) and principle component analyses (PCA). All three-marker systems with two statistical algorithms clustered the diploids apart from the other ploidy levels. Assuming autopolyploidy, spontaneous polyploidization followed by rapid diversification among the higher ploidy levels than the diploids is likely in Cynodon's evolution. Few tetraploid and hexaploid accessions were clustered with or closely to the group of diploids, supporting the hypothesis above. Eleven haplotypes as estimated by cpDNA RFLP and SSR markers were detected. This study indicated that the diploids had different organelle genome from the rest of the ploidy series and provided valuable insight into relationships among ploidy series of Cynodon accessions based on cp and nuclear DNAs.

  16. Acrolein preferentially damages nucleolus eliciting ribosomal stress and apoptosis in human cancer cells.

    Science.gov (United States)

    Wang, Hsiang-Tsui; Chen, Tzu-Ying; Weng, Ching-Wen; Yang, Chun-Hsiang; Tang, Moon-Shong

    2016-12-06

    Acrolein (Acr) is a potent cytotoxic and DNA damaging agent which is ubiquitous in the environment and abundant in tobacco smoke. Acr is also an active cytotoxic metabolite of the anti-cancer drugs cyclophosphamide and ifosfamide. The mechanisms via which Acr exerts its anti-cancer activity and cytotoxicity are not clear. In this study, we found that Acr induces cytotoxicity and cell death in human cancer cells with different activities of p53. Acr preferentially binds nucleolar ribosomal DNA (rDNA) to form Acr-deoxyguanosine adducts, and induces oxidative damage to both rDNA and ribosomal RNA (rRNA). Acr triggers ribosomal stress responses, inhibits rRNA synthesis, reduces RNA polymerase I binding to the promoter of rRNA gene, disrupts nucleolar integrity, and impairs ribosome biogenesis and polysome formation. Acr causes an increase in MDM2 levels and phosphorylation of MDM2 in A549 and HeLa cells which are p53 active and p53 inactive, respectively. It enhances the binding of ribosomal protein RPL11 to MDM2 and reduces the binding of p53 and E2F-1 to MDM2 resulting in stabilization/activation of p53 in A549 cells and degradation of E2F-1 in A549 and HeLa cells. We propose that Acr induces ribosomal stress which leads to activation of MDM2 and RPL11-MDM2 binding, consequently, activates p53 and enhances E2F-1 degradation, and that taken together these two processes induce apoptosis and cell death.

  17. The primary structure of L37--a rat ribosomal protein with a zinc finger-like motif.

    Science.gov (United States)

    Chan, Y L; Paz, V; Olvera, J; Wool, I G

    1993-04-30

    The amino acid sequence of the rat 60S ribosomal subunit protein L37 was deduced from the sequence of nucleotides in a recombinant cDNA. Ribosomal protein L37 has 96 amino acids, the NH2-terminal methionine is removed after translation of the mRNA, and has a molecular weight of 10,939. Ribosomal protein L37 has a single zinc finger-like motif of the C2-C2 type. Hybridization of the cDNA to digests of nuclear DNA suggests that there are 13 or 14 copies of the L37 gene. The mRNA for the protein is about 500 nucleotides in length. Rat L37 is related to Saccharomyces cerevisiae ribosomal protein YL35 and to Caenorhabditis elegans L37. We have identified in the data base a DNA sequence that encodes the chicken homolog of rat L37.

  18. Alpha-momorcharin: a ribosome-inactivating protein from Momordica charantia, possessing DNA cleavage properties.

    Science.gov (United States)

    Wang, Shuzhen; Zheng, Yinzhen; Yan, Junjie; Zhu, Zhixuan; Wu, Zhihua; Ding, Yi

    2013-11-01

    Ribosome-inactivating proteins (RIPs) function to inhibit protein synthesis through the removal of specific adenine residues from eukaryotic ribosomal RNA and rending the 60S subunit unable to bind elongation factor 2. They have received much attention in biological and biomedical research due to their unique activities toward tumor cells, as well as the important roles in plant defense. Alpha-momorcharin (α-MC), a member of the type I family of RIPs, is rich in the seeds of Momordica charantia L. Previous studies demonstrated that α-MC is an effective antifungal and antibacterial protein. In this study, a detailed analysis of the DNase-like activity of α-MC was conducted. Results showed that the DNase-like activity toward plasmid DNA was time-dependent, temperature-related, and pH-stable. Moreover, a requirement for divalent metal ions in the catalytic domain of α-MC was confirmed. Additionally, Tyr(93) was found to be a critical residue for the DNase-like activity, while Tyr(134), Glu(183), Arg(186), and Trp(215) were activity-related residues. This study on the chemico-physical properties and mechanism of action of α-MC will improve its utilization in scientific research, as well as its potential industrial uses. These results may also assist in the characterization and elucidation of the DNase-like enzymatic properties of other RIPs.

  19. Salivary DNA and markers of oxidative stress in patients with chronic periodontitis.

    Science.gov (United States)

    Baňasová, Lenka; Kamodyová, Natália; Janšáková, Katarína; Tóthová, Ľubomíra; Stanko, Peter; Turňa, Ján; Celec, Peter

    2015-03-01

    Previous observational studies have shown that periodontal status is associated with salivary markers of oxidative damage. A direct comparison of periodontitis patients and controls using a wide palette of salivary markers of oxidative stress is lacking. Characteristics of salivary DNA in periodontitis are unknown. The aim of this study was to compare the salivary markers of oxidative stress and characteristics of salivary DNA between patients with chronic periodontitis and periodontitis-free controls. Saliva was collected from 23 patients with chronic periodontitis and 19 periodontitis-free controls. All participants underwent a clinical periodontal examination. Markers of oxidative and carbonyl stress were measured in saliva. Human and bacterial DNA was quantified, and human DNA integrity was assessed. Salivary thiobarbituric acid-reacting substances were higher in patients than in controls; at least in men, the difference was significant (p periodontitis patients. The results confirmed the association of salivary thiobarbituric acid-reacting substances with periodontitis. Lipid peroxidation in periodontitis seems to be caused by increased production of reactive oxygen species in men and by decreased antioxidant status in women. Whether lower salivary DNA integrity is involved in the pathogenesis of periodontitis remains to be elucidated. Salivary thiobarbituric acid-reacting substances are associated with periodontitis at least on a population level. Sex-specific causes of lipid peroxidation might point towards different pathogenic mechanisms.

  20. Application of DNA markers against illegal logging as a new tool for the Forest Guard Service

    OpenAIRE

    Nowakowska, Justyna A.

    2011-01-01

    DNA markers are currently the most precise tool for forest tree species identification and can be used for comparative analyses of plant material. Molecular diagnosis of evidence and reference material is based on comparing the structure of DNA markers duplicated in the PCR reaction and estimation of the DNA profiles obtained in studied wood samples. For this purpose, the microsatellite DNA markers are the most suitable tool because of their high polymorphism and accurate detection of structu...

  1. Potential of DNA sequences to identify zoanthids (Cnidaria: Zoantharia).

    Science.gov (United States)

    Sinniger, Frederic; Reimer, James D; Pawlowski, Jan

    2008-12-01

    The order Zoantharia is known for its chaotic taxonomy and difficult morphological identification. One method that potentially could help for examining such troublesome taxa is DNA barcoding, which identifies species using standard molecular markers. The mitochondrial cytochrome oxidase subunit I (COI) has been utilized to great success in groups such as birds and insects; however, its applicability in many other groups is controversial. Recently, some studies have suggested that barcoding is not applicable to anthozoans. Here, we examine the use of COI and mitochondrial 16S ribosomal DNA for zoanthid identification. Despite the absence of a clear barcoding gap, our results show that for most of 54 zoanthid samples, both markers could separate samples to the species, or species group, level, particularly when easily accessible ecological or distributional data were included. Additionally, we have used the short V5 region of mt 16S rDNA to identify eight old (13 to 50 years old) museum samples. We discuss advantages and disadvantages of COI and mt 16S rDNA as barcodes for Zoantharia, and recommend that either one or both of these markers be considered for zoanthid identification in the future.

  2. Novel extraction strategy of ribosomal RNA and genomic DNA from cheese for PCR-based investigations.

    Science.gov (United States)

    Bonaïti, Catherine; Parayre, Sandrine; Irlinger, Françoise

    2006-03-15

    Cheese microorganisms, such as bacteria and fungi, constitute a complex ecosystem that plays a central role in cheeses ripening. The molecular study of cheese microbial diversity and activity is essential but the extraction of high quality nucleic acid may be problematic: the cheese samples are characterised by a strong buffering capacity which negatively influenced the yield of the extracted rRNA. The objective of this study is to develop an effective method for the direct and simultaneous isolation of yeast and bacterial ribosomal RNA and genomic DNA from the same cheese samples. DNA isolation was based on a protocol used for nucleic acids isolation from anaerobic digestor, without preliminary washing step with the combined use of the action of chaotropic agent (acid guanidinium thiocyanate), detergents (SDS, N-lauroylsarcosine), chelating agent (EDTA) and a mechanical method (bead beating system). The DNA purification was carried out by two washing steps of phenol-chloroform. RNA was isolated successfully after the second acid extraction step by recovering it from the phenolic phase of the first acid extraction. The novel method yielded pure preparation of undegraded RNA accessible for reverse transcription-PCR. The extraction protocol of genomic DNA and rRNA was applicable to complex ecosystem of different cheese matrices.

  3. 16S Ribosomal DNA Characterization of Nitrogen-Fixing Bacteria Isolated from Banana (Musa spp.) and Pineapple (Ananas comosus (L.) Merril)

    Science.gov (United States)

    Magalhães Cruz, Leonardo; Maltempi de Souza, Emanuel; Weber, Olmar Baler; Baldani, José Ivo; Döbereiner, Johanna; de Oliveira Pedrosa, Fábio

    2001-01-01

    Nitrogen-fixing bacteria isolated from banana (Musa spp.) and pineapple (Ananas comosus (L.) Merril) were characterized by amplified 16S ribosomal DNA restriction analysis and 16S rRNA sequence analysis. Herbaspirillum seropedicae, Herbaspirillum rubrisubalbicans, Burkholderia brasilensis, and Burkholderia tropicalis were identified. Eight other types were placed in close proximity to these genera and other alpha and beta Proteobacteria. PMID:11319127

  4. Physical mapping of 5S and 18S ribosomal DNA in three species of Agave (Asparagales, Asparagaceae

    Directory of Open Access Journals (Sweden)

    Victor Manuel Gomez-Rodriguez

    2013-08-01

    Full Text Available Agave Linnaeus, 1753 is endemic of America and is considered one of the most important crops in Mexico due to its key role in the country’s economy. Cytogenetic analysis was carried out in A. tequilana Weber, 1902 ‘Azul’, A. cupreata Trelease et Berger, 1915 and A. angustifolia Haworth, 1812. The analysis showed that in all species the diploid chromosome number was 2n = 60, with bimodal karyotypes composed of five pairs of large chromosomes and 25 pairs of small chromosomes. Furthermore, different karyotypical formulae as well as a secondary constriction in a large chromosome pair were found in all species. Fluorescent in situ hybridization (FISH was used for physical mapping of 5S and 18S ribosomal DNA (rDNA. All species analyzed showed that 5S rDNA was located in both arms of a small chromosome pair, while 18S rDNA was associated with the secondary constriction of a large chromosome pair. Data of FISH analysis provides new information about the position and number of rDNA loci and helps for detection of hybrids in breeding programs as well as evolutionary studies.

  5. Physical mapping of 5S and 18S ribosomal DNA in three species of Agave (Asparagales, Asparagaceae).

    Science.gov (United States)

    Gomez-Rodriguez, Victor Manuel; Rodriguez-Garay, Benjamin; Palomino, Guadalupe; Martínez, Javier; Barba-Gonzalez, Rodrigo

    2013-01-01

    Agave Linnaeus, 1753 is endemic of America and is considered one of the most important crops in Mexico due to its key role in the country's economy. Cytogenetic analysis was carried out in Agave tequilana Weber, 1902 'Azul', Agave cupreata Trelease et Berger, 1915 and Agave angustifolia Haworth, 1812. The analysis showed that in all species the diploid chromosome number was 2n = 60, with bimodal karyotypes composed of five pairs of large chromosomes and 25 pairs of small chromosomes. Furthermore, different karyotypical formulae as well as a secondary constriction in a large chromosome pair were found in all species. Fluorescent in situ hybridization (FISH) was used for physical mapping of 5S and 18S ribosomal DNA (rDNA). All species analyzed showed that 5S rDNA was located in both arms of a small chromosome pair, while 18S rDNA was associated with the secondary constriction of a large chromosome pair. Data of FISH analysis provides new information about the position and number of rDNA loci and helps for detection of hybrids in breeding programs as well as evolutionary studies.

  6. Ribosomal DNA transcription in the dorsal raphe nucleus is increased in residual but not in paranoid schizophrenia.

    Science.gov (United States)

    Krzyżanowska, Marta; Steiner, Johann; Brisch, Ralf; Mawrin, Christian; Busse, Stefan; Braun, Katharina; Jankowski, Zbigniew; Bernstein, Hans-Gert; Bogerts, Bernhard; Gos, Tomasz

    2015-03-01

    The central serotonergic system is implicated in the pathogenesis of schizophrenia, where the imbalance between dopamine, serotonin and glutamate plays a key pathophysiological role. The dorsal raphe nucleus (DRN) is the main source of serotonergic innervation of forebrain limbic structures disturbed in schizophrenia patients. The study was carried out on paraffin-embedded brains from 17 (8 paranoid and 9 residual) schizophrenia patients and 28 matched controls without mental disorders. The transcriptional activity of ribosomal DNA (rDNA) in DRN neurons was evaluated by the AgNOR silver-staining method. An increased rDNA transcriptional activity was found in schizophrenia patients in the cumulative analysis of all DRN subnuclei (t test, P = 0.02). Further subgroup analysis revealed that it was an effect specific for residual schizophrenia versus paranoid schizophrenia or control groups (ANOVA, P = 0.002). This effect was confounded neither by suicide nor by antipsychotic medication. Our findings suggest that increased activity of rDNA in DRN neurons is a distinct phenomenon in schizophrenia, particularly in residual patients. An activation of the rDNA transcription in DRN neurons may represent a compensatory mechanism to overcome the previously described prefrontal serotonergic hypofunction in this diagnostic subgroup.

  7. Ribosomal RNA Genes Contribute to the Formation of Pseudogenes and Junk DNA in the Human Genome.

    Science.gov (United States)

    Robicheau, Brent M; Susko, Edward; Harrigan, Amye M; Snyder, Marlene

    2017-02-01

    Approximately 35% of the human genome can be identified as sequence devoid of a selected-effect function, and not derived from transposable elements or repeated sequences. We provide evidence supporting a known origin for a fraction of this sequence. We show that: 1) highly degraded, but near full length, ribosomal DNA (rDNA) units, including both 45S and Intergenic Spacer (IGS), can be found at multiple sites in the human genome on chromosomes without rDNA arrays, 2) that these rDNA sequences have a propensity for being centromere proximal, and 3) that sequence at all human functional rDNA array ends is divergent from canonical rDNA to the point that it is pseudogenic. We also show that small sequence strings of rDNA (from 45S + IGS) can be found distributed throughout the genome and are identifiable as an "rDNA-like signal", representing 0.26% of the q-arm of HSA21 and ∼2% of the total sequence of other regions tested. The size of sequence strings found in the rDNA-like signal intergrade into the size of sequence strings that make up the full-length degrading rDNA units found scattered throughout the genome. We conclude that the displaced and degrading rDNA sequences are likely of a similar origin but represent different stages in their evolution towards random sequence. Collectively, our data suggests that over vast evolutionary time, rDNA arrays contribute to the production of junk DNA. The concept that the production of rDNA pseudogenes is a by-product of concerted evolution represents a previously under-appreciated process; we demonstrate here its importance. © The Author(s) 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  8. Supplementary data: Development of nuclear DNA markers for ...

    Indian Academy of Sciences (India)

    Supplementary data: Development of nuclear DNA markers for evolutionary studies in Plasmodium falciparum. Celia Thomas, Sneh Shalini, N. Raghavendra, Meenakshi Choudhary, Anju Verma, Hema Joshi,. A. P. Dash and Aparup Das. J. Genet. 86, 65–68. Primer sequences for amplification of putatively neutral ...

  9. Genetic analyses of ribosomal loci of Anopheles minimus species from north east India.

    Science.gov (United States)

    Dutta, P; Khan, S A; Topno, R; Chowdhury, P; Baishya, M; Prakash, A; Bhattacharyya, D R; Mahanta, J

    2013-09-01

    Anopheles minimus is one of the major vectors for transmission of malaria disease in north eastern (NE) region of India. The minimus species complex of Minimus subgroup of Myzomyia series of anophelines were studied in malaria affected states--Assam and Arunachal Pradesh (AP) of NE India. Ribosomal DNA markers--second internal transcribed spacer (ITS2) and third domain (D3) of 28S gene were used to characterize An. minimus species. Sequence homogeneity was observed in D3 sequences of An.minimus specimens throughout both the states. However, a transversion in ITS2 sequence of single specimen collected from Assam-Meghalaya border areas illustrates possibility of intra population polymorphism in ITS2 sequence within the geographical region.

  10. Development of cost-effective Hordeum chilense DNA markers: molecular aids for marker-assisted cereal breeding.

    Science.gov (United States)

    Hernández, P; Dorado, G; Ramírez, M C; Laurie, D A; Snape, J W; Martín, A

    2003-01-01

    Hordeum chilense is a potential source of useful genes for wheat breeding. The use of this wild species to increase genetic variation in wheat will be greatly facilitated by marker-assisted introgression. In recent years, the search for the most suitable DNA marker system for tagging H. chilense genomic regions in a wheat background has lead to the development of RAPD and SCAR markers for this species. RAPDs represent an easy way of quickly generating suitable introgression markers, but their use is limited in heterogeneous wheat genetic backgrounds. SCARs are more specific assays, suitable for automatation or multiplexing. Direct sequencing of RAPD products is a cost-effective approach that reduces labour and costs for SCAR development. The use of SSR and STS primers originally developed for wheat and barley are additional sources of genetic markers. Practical applications of the different marker approaches for obtaining derived introgression products are described.

  11. Ribosomal DNA intergenic spacer sequence in foxtail millet, Setaria italica (L.) P. Beauv. and its characterization and application to typing of foxtail millet landraces.

    Science.gov (United States)

    Fukunaga, Kenji; Ichitani, Katsuyuki; Taura, Satoru; Sato, Muneharu; Kawase, Makoto

    2005-02-01

    We determined the sequence of ribosomal DNA (rDNA) intergenic spacer (IGS) of foxtail millet isolated in our previous study, and identified subrepeats in the polymorphic region. We also developed a PCR-based method for identifying rDNA types based on sequence information and assessed 153 accessions of foxtail millet. Results were congruent with our previous works. This study provides new findings regarding the geographical distribution of rDNA variants. This new method facilitates analyses of numerous foxtail millet accessions. It is helpful for typing of foxtail millet germplasms and elucidating the evolution of this millet.

  12. Genotyping of Giardia lamblia isolates from humans in China and Korea using ribosomal DNA Sequences.

    Science.gov (United States)

    Yong, T S; Park, S J; Hwang, U W; Yang, H W; Lee, K W; Min, D Y; Rim, H J; Wang, Y; Zheng, F

    2000-08-01

    Genetic characterization of a total of 15 Giardia lamblia isolates, 8 from Anhui Province, China (all from purified cysts) and 7 from Seoul, Korea (2 from axenic cultures and 5 from purified cysts), was performed by polymerase chain reaction amplification and sequencing of a 295-bp region near the 5' end of the small subunit ribosomal DNA (eukaryotic 16S rDNA). Phylogenetic analyses were subsequently conducted using sequence data obtained in this study, as well as sequences published from other Giardia isolates. The maximum parsimony method revealed that G. lamblia isolates from humans in China and Korea are divided into 2 major lineages, assemblages A and B. All 7 Korean isolates were grouped into assemblage A, whereas 4 Chinese isolates were grouped into assemblage A and 4 into assemblage B. Two Giardia microti isolates and 2 dog-derived Giardia isolates also grouped into assemblage B, whereas Giardia ardeae and Giardia muris were unique.

  13. Variation in Ribosomal DNA among Isolates of the Mycorrhizal Fungus Cenococcum Geophilum FR.

    Science.gov (United States)

    Lobuglio, Katherine Frances

    1990-01-01

    Cenococcum geophilum Fr., a cosmopolitan mycorrhizal fungus, is well-known for its extremely wide host and habitat range. The ecological diversity of C. geophilum sharply contrasts its present taxonomic status as a monotypic form -genus. Restriction fragment length polymorphisms (RFLPs) in nuclear ribosomal DNA (rDNA) was used to assess the degree of genetic variation among 72 isolates of C. geophilum. The probe used in this study was the rDNA repeat cloned from C. geophilum isolate A145 (pCG15). Length of the rDNA repeat was approximately 9 kb. The rDNA clone was mapped for 5 restriction endonucleases. Hybridization with cloned Saccharomyces cerevisiae rDNA (pSR118, and pSR125 containing the 18S, and 5.8-25S rRNA genes respectively), and alignment of restriction endonuclease sites conserved in the rDNA genes of other fungi, were used to position the corresponding rDNAs of C. geophilum. Southern hybridizations with EcoRI, HindIII, XhoI, and PstI digested DNAs indicated extensive variation among the C. geophilum isolates, greater than has been previously reported to occur within a fungal species. Most of the rDNA polymorphisms occurred in the IGS region. Restriction endonuclease site and length polymorphisms were also observed in the 5.8S-26S genic regions. Sixteen size categories of length mutations, 6 restriction endonuclease site additions, and 4 restriction endonuclease site deletions were determined using isolate A145 as a reference. The rDNA repeat length among the isolates varied from approximately 8.5 to 10.2 kb. RFLPs were also observed in the mitochondrial (mt) 24S rRNA gene and flanking regions of HindIII digested DNAs of C. geophilum isolates representing both geographically distinct and similar origins. Among the C. geophilum isolates analyzed there were fewer RFLPs in mt-DNA than in nuclear rDNA. EcoRI rDNA phenotypes between C. geophilum and Elaphomyces anthracinus, its proposed teleomorph or sexual state, did not correspond. In addition, the four

  14. Hirudinella ventricosa (Pallas, 1774) Baird, 1853 represents a species complex based on ribosomal DNA.

    Science.gov (United States)

    Calhoun, Dana M; Curran, Stephen S; Pulis, Eric E; Provaznik, Jennifer M; Franks, James S

    2013-10-01

    Digeneans in the genus Hirudinella de Blainville, 1828 (Hirudinellidae) from three species of pelagic fishes, Acanthocybium solandri (Cuvier), Makaira nigricans Lacépède and Thunnus albacares (Bonnaterre), and one benthic fish, Mulloidichthys martinicus (Cuvier), from the Gulf of Mexico are investigated using comparison of ribosomal DNA. Four species are identified based on molecular differences: Hirudinella ventricosa (Pallas, 1774) Baird, 1853 from A. solandri, Hirudinella ahi Yamaguti, 1970 from T. albacares, and two unidentified but distinct species of Hirudinella, herein referred to as Hirudinella sp. A (from both M. nigricans and M. martinicus) and Hirudinella sp. B from M. nigricans. Additionally, H. ahi, based tentatively on morphological identification, is reported from Thunnus thynnus (Linnaeus). This represents the first record of a hirudinellid from M. martinicus and the first record of H. ahi from T. thynnus. A phylogeny of some Hemiurata Skrjabin & Guschanskaja, 1954 using partial fragments of the 28S rDNA sequences is consistent with earlier phylogenies and the position of the Hirudinellidae Dollfus, 1932 is well-supported as a derived group most closely related to the Syncoeliidae Looss, 1899.

  15. Circulating tumour DNA methylation markers for diagnosis and prognosis of hepatocellular carcinoma

    Science.gov (United States)

    Xu, Rui-Hua; Wei, Wei; Krawczyk, Michal; Wang, Wenqiu; Luo, Huiyan; Flagg, Ken; Yi, Shaohua; Shi, William; Quan, Qingli; Li, Kang; Zheng, Lianghong; Zhang, Heng; Caughey, Bennett A.; Zhao, Qi; Hou, Jiayi; Zhang, Runze; Xu, Yanxin; Cai, Huimin; Li, Gen; Hou, Rui; Zhong, Zheng; Lin, Danni; Fu, Xin; Zhu, Jie; Duan, Yaou; Yu, Meixing; Ying, Binwu; Zhang, Wengeng; Wang, Juan; Zhang, Edward; Zhang, Charlotte; Li, Oulan; Guo, Rongping; Carter, Hannah; Zhu, Jian-Kang; Hao, Xiaoke; Zhang, Kang

    2017-11-01

    An effective blood-based method for the diagnosis and prognosis of hepatocellular carcinoma (HCC) has not yet been developed. Circulating tumour DNA (ctDNA) carrying cancer-specific genetic and epigenetic aberrations may enable a noninvasive `liquid biopsy' for diagnosis and monitoring of cancer. Here, we identified an HCC-specific methylation marker panel by comparing HCC tissue and normal blood leukocytes and showed that methylation profiles of HCC tumour DNA and matched plasma ctDNA are highly correlated. Using cfDNA samples from a large cohort of 1,098 HCC patients and 835 normal controls, we constructed a diagnostic prediction model that showed high diagnostic specificity and sensitivity (P < 0.001) and was highly correlated with tumour burden, treatment response, and stage. Additionally, we constructed a prognostic prediction model that effectively predicted prognosis and survival (P < 0.001). Together, these findings demonstrate in a large clinical cohort the utility of ctDNA methylation markers in the diagnosis, surveillance, and prognosis of HCC.

  16. Epigenetic markers in circulating cell-free DNA as prognostic markers for survival of castration-resistant prostate cancer patients.

    Science.gov (United States)

    Hendriks, Rianne J; Dijkstra, Siebren; Smit, Frank P; Vandersmissen, Johan; Van de Voorde, Hendrik; Mulders, Peter F A; van Oort, Inge M; Van Criekinge, Wim; Schalken, Jack A

    2018-04-01

    Noninvasive biomarkers to guide personalized treatment for castration-resistant prostate cancer (CRPC) are needed. In this study, we analyzed hypermethylation patterns of two genes (GSTP1 and APC) in plasma cell-free DNA (cfDNA) of CRPC patients. The aim of this study was to analyze the cfDNA concentrations and levels of the epigenetic markers and to assess the value of these biomarkers for prognosis. In this prospective study, patients were included before starting new treatment after developing CRPC. The blood samples were collected prior to start of the treatment and at three time points thereafter. cfDNA was extracted from 1.5 mL of plasma and before performing a methylation-specific PCR, bisulfate modification was carried out. The median levels of cfDNA, GSTP1, and APC copies in the baseline samples of CRPC patients (n = 47) were higher than in controls (n = 30). In the survival analysis, the group with baseline marker levels below median had significant less PCa-related deaths (P-values Prostate Published by Wiley Periodicals, Inc.

  17. Leaf margin phenotype-specific restriction-site-associated DNA-derived markers for pineapple (Ananas comosus L.).

    Science.gov (United States)

    Urasaki, Naoya; Goeku, Satoko; Kaneshima, Risa; Takamine, Tomonori; Tarora, Kazuhiko; Takeuchi, Makoto; Moromizato, Chie; Yonamine, Kaname; Hosaka, Fumiko; Terakami, Shingo; Matsumura, Hideo; Yamamoto, Toshiya; Shoda, Moriyuki

    2015-06-01

    To explore genome-wide DNA polymorphisms and identify DNA markers for leaf margin phenotypes, a restriction-site-associated DNA sequencing analysis was employed to analyze three bulked DNAs of F1 progeny from a cross between a 'piping-leaf-type' cultivar, 'Yugafu', and a 'spiny-tip-leaf-type' variety, 'Yonekura'. The parents were both Ananas comosus var. comosus. From the analysis, piping-leaf and spiny-tip-leaf gene-specific restriction-site-associated DNA sequencing tags were obtained and designated as PLSTs and STLSTs, respectively. The five PLSTs and two STSLTs were successfully converted to cleaved amplified polymorphic sequence (CAPS) or simple sequence repeat (SSR) markers using the sequence differences between alleles. Based on the genotyping of the F1 with two SSR and three CAPS markers, the five PLST markers were mapped in the vicinity of the P locus, with the closest marker, PLST1_SSR, being located 1.5 cM from the P locus. The two CAPS markers from STLST1 and STLST3 perfectly assessed the 'spiny-leaf type' as homozygotes of the recessive s allele of the S gene. The recombination value between the S locus and STLST loci was 2.4, and STLSTs were located 2.2 cM from the S locus. SSR and CAPS markers are applicable to marker-assisted selection of leaf margin phenotypes in pineapple breeding.

  18. Selection Of Drought Resistant Mutants In Rice Using DNA Markers

    International Nuclear Information System (INIS)

    Nguyen Duc Thanh; Le Thi Bich Thuy; Dang Thi Minh Lua

    2008-01-01

    In recent years, the marker - assisted selection (MAS) strategy have been used for selection of traits that are difficult and costly performed measurement and score. Selection for a well-developed root system could improve the drought resistance of rice as the plant would avoid water stress by absorbing water from the soil. There were several reports on map construction and identification of the markers tightly linked to morphological and physiological traits related to drought resistance in rice, in particular, root traits in upland and lowland rice (Champoux et al., 1995; Ray et al., 1996; Price et al., 1997, 2000; Yadav et al., 1997). In this report, we present the results on selection of drought resistance mutants in rice using the DNA markers tightly linked to root traits favorable for drought resistance. The mutant rice lines were obtained from irradiated seeds and calluses by gamma ray. The selection was performed at M2 mutants using the DNA markers linked to maximum root length (MRL), root weight to shoot weight ratio (RW/SR), and weight of deep root to shoot weight ratio (DRW/SR). The obtained results showed that there were many lines possessed drought resistant markers. In addition, there is a number of lines have altered genome. Several lines having drought markers proved to be more resistant to drought in green-house test. These lines could be useful for further test and development of drought resistant varieties. (author)

  19. TALE nickase mediates high efficient targeted transgene integration at the human multi-copy ribosomal DNA locus.

    Science.gov (United States)

    Wu, Yong; Gao, Tieli; Wang, Xiaolin; Hu, Youjin; Hu, Xuyun; Hu, Zhiqing; Pang, Jialun; Li, Zhuo; Xue, Jinfeng; Feng, Mai; Wu, Lingqian; Liang, Desheng

    2014-03-28

    Although targeted gene addition could be stimulated strikingly by a DNA double strand break (DSB) created by either zinc finger nucleases (ZFNs) or TALE nucleases (TALENs), the DSBs are really mutagenic and toxic to human cells. As a compromised solution, DNA single-strand break (SSB) or nick has been reported to mediate high efficient gene addition but with marked reduction of random mutagenesis. We previously demonstrated effective targeted gene addition at the human multicopy ribosomal DNA (rDNA) locus, a genomic safe harbor for the transgene with therapeutic potential. To improve the transgene integration efficiency by using TALENs while lowering the cytotoxicity of DSBs, we created both TALENs and TALE nickases (TALENickases) targeting this multicopy locus. A targeting vector which could integrate a GFP cassette at the rDNA locus was constructed and co-transfected with TALENs or TALENickases. Although the fraction of GFP positive cells using TALENs was greater than that using TALENickases during the first few days after transfection, it reduced to a level less than that using TALENickases after continuous culture. Our findings showed that the TALENickases were more effective than their TALEN counterparts at the multi-copy rDNA locus, though earlier studies using ZFNs and ZFNickases targeting the single-copy loci showed the reverse. Besides, TALENickases mediated the targeted integration of a 5.4 kb fragment at a frequency of up to 0.62% in HT1080 cells after drug selection, suggesting their potential application in targeted gene modification not being limited at the rDNA locus. Copyright © 2014 Elsevier Inc. All rights reserved.

  20. One fungus, which genes? Development and assessment of universal primers for potential secondary fungal DNA barcodes.

    Science.gov (United States)

    Stielow, J B; Lévesque, C A; Seifert, K A; Meyer, W; Iriny, L; Smits, D; Renfurm, R; Verkley, G J M; Groenewald, M; Chaduli, D; Lomascolo, A; Welti, S; Lesage-Meessen, L; Favel, A; Al-Hatmi, A M S; Damm, U; Yilmaz, N; Houbraken, J; Lombard, L; Quaedvlieg, W; Binder, M; Vaas, L A I; Vu, D; Yurkov, A; Begerow, D; Roehl, O; Guerreiro, M; Fonseca, A; Samerpitak, K; van Diepeningen, A D; Dolatabadi, S; Moreno, L F; Casaregola, S; Mallet, S; Jacques, N; Roscini, L; Egidi, E; Bizet, C; Garcia-Hermoso, D; Martín, M P; Deng, S; Groenewald, J Z; Boekhout, T; de Beer, Z W; Barnes, I; Duong, T A; Wingfield, M J; de Hoog, G S; Crous, P W; Lewis, C T; Hambleton, S; Moussa, T A A; Al-Zahrani, H S; Almaghrabi, O A; Louis-Seize, G; Assabgui, R; McCormick, W; Omer, G; Dukik, K; Cardinali, G; Eberhardt, U; de Vries, M; Robert, V

    2015-12-01

    The aim of this study was to assess potential candidate gene regions and corresponding universal primer pairs as secondary DNA barcodes for the fungal kingdom, additional to ITS rDNA as primary barcode. Amplification efficiencies of 14 (partially) universal primer pairs targeting eight genetic markers were tested across > 1 500 species (1 931 strains or specimens) and the outcomes of almost twenty thousand (19 577) polymerase chain reactions were evaluated. We tested several well-known primer pairs that amplify: i) sections of the nuclear ribosomal RNA gene large subunit (D1-D2 domains of 26/28S); ii) the complete internal transcribed spacer region (ITS1/2); iii) partial β -tubulin II (TUB2); iv) γ-actin (ACT); v) translation elongation factor 1-α (TEF1α); and vi) the second largest subunit of RNA-polymerase II (partial RPB2, section 5-6). Their PCR efficiencies were compared with novel candidate primers corresponding to: i) the fungal-specific translation elongation factor 3 (TEF3); ii) a small ribosomal protein necessary for t-RNA docking; iii) the 60S L10 (L1) RP; iv) DNA topoisomerase I (TOPI); v) phosphoglycerate kinase (PGK); vi) hypothetical protein LNS2; and vii) alternative sections of TEF1α. Results showed that several gene sections are accessible to universal primers (or primers universal for phyla) yielding a single PCR-product. Barcode gap and multi-dimensional scaling analyses revealed that some of the tested candidate markers have universal properties providing adequate infra- and inter-specific variation that make them attractive barcodes for species identification. Among these gene sections, a novel high fidelity primer pair for TEF1α, already widely used as a phylogenetic marker in mycology, has potential as a supplementary DNA barcode with superior resolution to ITS. Both TOPI and PGK show promise for the Ascomycota, while TOPI and LNS2 are attractive for the Pucciniomycotina, for which universal primers for ribosomal subunits often fail.

  1. The Ribosomal RNA is a Useful Marker to Visualize Rhizobia Interacting with Legume Plants

    Science.gov (United States)

    Rinaudi, Luciana; Isola, Maria C.; Giordano, Walter

    2004-01-01

    Symbiosis between rhizobia and leguminous plants leads to the formation of nitrogen-fixing root nodules. In the present article, we recommend the use of the ribosomal RNA (rRNA) isolated from legume nodules in an experimental class with the purpose of introducing students to the structure of eukaryotic and prokaryotic ribosomes and of…

  2. Identification of nucleosome assembly protein 1 (NAP1) as an interacting partner of plant ribosomal protein S6 (RPS6) and a positive regulator of rDNA transcription

    Energy Technology Data Exchange (ETDEWEB)

    Son, Ora [Department of Biological Science, Sookmyung Women' s University, Seoul 140-742 (Korea, Republic of); Kim, Sunghan [Department of Biological Science, Sookmyung Women' s University, Seoul 140-742 (Korea, Republic of); Department of Plant Science, Plant Genomics and Breeding Institute, Research Institute of Agriculture and Life Sciences, Seoul National University, Seoul 151-921 (Korea, Republic of); Shin, Yun-jeong [Department of Biological Science, Sookmyung Women' s University, Seoul 140-742 (Korea, Republic of); Kim, Woo-Young [College of Pharmacy, Sookmyung Women' s University, Seoul 140-742 (Korea, Republic of); Koh, Hee-Jong, E-mail: heejkoh@snu.ac.kr [Department of Plant Science, Plant Genomics and Breeding Institute, Research Institute of Agriculture and Life Sciences, Seoul National University, Seoul 151-921 (Korea, Republic of); Cheon, Choong-Ill, E-mail: ccheon@sookmyung.ac.kr [Department of Biological Science, Sookmyung Women' s University, Seoul 140-742 (Korea, Republic of)

    2015-09-18

    The ribosomal protein S6 (RPS6) is a downstream component of the signaling mediated by the target of rapamycin (TOR) kinase that acts as a central regulator of the key metabolic processes, such as protein translation and ribosome biogenesis, in response to various environmental cues. In our previous study, we identified a novel role of plant RPS6, which negatively regulates rDNA transcription, forming a complex with a plant-specific histone deacetylase, AtHD2B. Here we report that the Arabidopsis RPS6 interacts additionally with a histone chaperone, nucleosome assembly protein 1(AtNAP1;1). The interaction does not appear to preclude the association of RPS6 with AtHD2B, as the AtNAP1 was also able to interact with AtHD2B as well as with an RPS6-AtHD2B fusion protein in the BiFC assay and pulldown experiment. Similar to a positive effect of the ribosomal S6 kinase 1 (AtS6K1) on rDNA transcription observed in this study, overexpression or down regulation of the AtNAP1;1 resulted in concomitant increase and decrease, respectively, in rDNA transcription suggesting a positive regulatory role played by AtNAP1 in plant rDNA transcription, possibly through derepression of the negative effect of the RPS6-AtHD2B complex. - Highlights: • Nucleosome assembly protein 1 (AtNAP1) interacts with RPS6 as well as with AtHD2B. • rDNA transcription is regulated S6K1. • Overexpression or down regulation of AtNAP1 results in concomitant increase or decrease in rDNA transcription.

  3. A case study characterizing animal fecal sources in surface water using a mitochondrial DNA marker.

    Science.gov (United States)

    Bucci, John P; Shattuck, Michelle D; Aytur, Semra A; Carey, Richard; McDowell, William H

    2017-08-01

    Water quality impairment by fecal waste in coastal watersheds is a public health issue. The present study provided evidence for the use of a mitochondrial (mtDNA) marker to detect animal fecal sources in surface water. The accurate identification of fecal pollution is based on the notion that fecal microorganisms preferentially inhabit a host animal's gut environment. In contrast, mtDNA host-specific markers are inherent to eukaryotic host cells, which offers the advantage by detecting DNA from the host rather than its fecal bacteria. The present study focused on sampling water presumably from non-point sources (NPS), which can increase bacterial and nitrogen concentrations to receiving water bodies. Stream sampling sites located within the Piscataqua River Watershed (PRW), New Hampshire, USA, were sampled from a range of sites that experienced nitrogen inputs such as sewer and septic systems and suburban runoff. Three mitochondrial (mtDNA) gene marker assays (human, bovine, and canine) were tested from surface water. Nineteen sites were sampled during an 18-month period. Analyses of the combined single and multiplex assay results showed that the proportion of occurrence was highest for bovine (15.6%; n = 77) compared to canine (5.6%; n = 70) and human (5.7%; n = 107) mtDNA gene markers. For the human mtDNA marker, there was a statistically significant relationship between presence vs. absence and land use (Fisher's test p = 0.0031). This result was evident particularly for rural suburban septic, which showed the highest proportion of presence (19.2%) compared to the urban sewered (3.3%), suburban sewered (0%), and agricultural (0%) as well as forested septic (0%) sites. Although further testing across varied land use is needed, our study provides evidence for using the mtDNA marker in large watersheds.

  4. An environmental DNA marker for detecting nonnative brown trout (Salmo trutta)

    Science.gov (United States)

    K. J. Carim; T. M. Wilcox; M. Anderson; D. Lawrence; Michael Young; Kevin McKelvey; Michael Schwartz

    2016-01-01

    Brown trout (Salmo trutta) are widely introduced in western North America where their presence has led to declines of several native species. To assist conservation efforts aimed at early detection and eradication of this species, we developed a quantitative PCR marker to detect the presence of brown trout DNA in environmental samples. The marker strongly...

  5. Development of swine-specific DNA markers for biosensor-based halal authentication.

    Science.gov (United States)

    Ali, M E; Hashim, U; Kashif, M; Mustafa, S; Che Man, Y B; Abd Hamid, S B

    2012-06-29

    The pig (Sus scrofa) mitochondrial genome was targeted to design short (15-30 nucleotides) DNA markers that would be suitable for biosensor-based hybridization detection of target DNA. Short DNA markers are reported to survive harsh conditions in which longer ones are degraded into smaller fragments. The whole swine mitochondrial-genome was in silico digested with AluI restriction enzyme. Among 66 AluI fragments, five were selected as potential markers because of their convenient lengths, high degree of interspecies polymorphism and intraspecies conservatism. These were confirmed by NCBI blast analysis and ClustalW alignment analysis with 11 different meat-providing animal and fish species. Finally, we integrated a tetramethyl rhodamine-labeled 18-nucleotide AluI fragment into a 3-nm diameter citrate-tannate coated gold nanoparticle to develop a swine-specific hybrid nanobioprobe for the determination of pork adulteration in 2.5-h autoclaved pork-beef binary mixtures. This hybrid probe detected as low as 1% pork in deliberately contaminated autoclaved pork-beef binary mixtures and no cross-species detection was recorded, demonstrating the feasibility of this type of probe for biosensor-based detection of pork adulteration of halal and kosher foods.

  6. Dynamic distribution patterns of ribosomal DNA and chromosomal evolution in Paphiopedilum, a lady's slipper orchid

    Directory of Open Access Journals (Sweden)

    Albert Victor A

    2011-09-01

    Full Text Available Abstract Background Paphiopedilum is a horticulturally and ecologically important genus of ca. 80 species of lady's slipper orchids native to Southeast Asia. These plants have long been of interest regarding their chromosomal evolution, which involves a progressive aneuploid series based on either fission or fusion of centromeres. Chromosome number is positively correlated with genome size, so rearrangement processes must include either insertion or deletion of DNA segments. We have conducted Fluorescence In Situ Hybridization (FISH studies using 5S and 25S ribosomal DNA (rDNA probes to survey for rearrangements, duplications, and phylogenetically-correlated variation within Paphiopedilum. We further studied sequence variation of the non-transcribed spacers of 5S rDNA (5S-NTS to examine their complex duplication history, including the possibility that concerted evolutionary forces may homogenize diversity. Results 5S and 25S rDNA loci among Paphiopedilum species, representing all key phylogenetic lineages, exhibit a considerable diversity that correlates well with recognized evolutionary groups. 25S rDNA signals range from 2 (representing 1 locus to 9, the latter representing hemizygosity. 5S loci display extensive structural variation, and show from 2 specific signals to many, both major and minor and highly dispersed. The dispersed signals mainly occur at centromeric and subtelomeric positions, which are hotspots for chromosomal breakpoints. Phylogenetic analysis of cloned 5S rDNA non-transcribed spacer (5S-NTS sequences showed evidence for both ancient and recent post-speciation duplication events, as well as interlocus and intralocus diversity. Conclusions Paphiopedilum species display many chromosomal rearrangements - for example, duplications, translocations, and inversions - but only weak concerted evolutionary forces among highly duplicated 5S arrays, which suggests that double-strand break repair processes are dynamic and ongoing. These

  7. DNA damage markers in dermal fibroblasts in vitro reflect chronological donor age

    DEFF Research Database (Denmark)

    Waaijer, Mariëtte E C; Croco, Eleonora; Westendorp, Rudi G J

    2016-01-01

    The aging process is accompanied by an accumulation of cellular damage, which compromises the viability and function of cells and tissues. We aim to further explore the association between in vitro DNA damage markers and the chronological age of the donor, as well as long-lived family membership...... markers and long-lived family membership or cardiovascular disease. Results were comparable when fibroblasts were stressed in vitro with rotenone. In conclusion, we found that DNA damage foci of cultured fibroblasts are significantly associated with the chronological age, but not biological age...

  8. Molecular discrimination of lactobacilli used as starter and probiotic cultures by amplified ribosomal DNA restriction analysis.

    Science.gov (United States)

    Roy, D; Sirois, S; Vincent, D

    2001-04-01

    Lactic acid bacteria such as Lactobacillus helveticus, L. delbrueckii subsp. delbrueckii, L. delbrueckii subsp. lactis, L. delbrueckii subsp. bulgaricus, L. acidophilus, and L. casei related taxa which are widely used as starter or probiotic cultures can be identified by amplified ribosomal DNA restriction analysis (ARDRA). The genetic discrimination of the related species belonging to these groups was first obtained by PCR amplifications by using group-specific or species-specific 16S rDNA primers. The numerical analysis of the ARDRA patterns obtained by using CfoI, HinfI, Tru9I, and ScrFI was an efficient typing tool for identification of species of the L. acidophilus and L. casei complex. ARDRA by using CfoI was a reliable method for differentiation of L. delbrueckii subsp. bulgaricus and L. delbrueckii subsp. lactis. Finally, strains ATCC 393 and ATCC 15820 exhibited unique ARDRA patterns with CfoI and Tru9I restriction enzymes as compared with the other strains of L. casei, L. paracasei, and L. rhamnosus.

  9. Remodeling of ribosomal genes in somatic cells by Xenopus egg extract

    DEFF Research Database (Denmark)

    Østrup, Olga; Hyttel, Poul; Klærke, Dan Arne

    2011-01-01

    Extracts from Xenopus eggs can reprogram gene expression in somatic nuclei, however little is known about the earliest processes associated with the switch in the transcriptional program. We show here that an early reprogramming event is the remodeling of ribosomal chromatin and gene expression....... This occurs within hours of extract treatment and is distinct from a stress response. Egg extract elicits remodeling of the nuclear envelope, chromatin and nucleolus. Nucleolar remodeling involves a rapid and stable decrease in ribosomal gene transcription, and promoter targeting of the nucleolar remodeling...... and elicits a stress-type nuclear response. Thus, an early event of Xenopus egg extract-mediated nuclear reprogramming is the remodeling of ribosomal genes involving nucleolar remodeling complex. Condition-specific and rapid silencing of ribosomal genes may serve as a sensitive marker for evaluation...

  10. DNA Fingerprinting of Olive Varieties by Microsatellite Markers

    Directory of Open Access Journals (Sweden)

    Dunja Bandelj

    2002-01-01

    Full Text Available Microsatellites combine several features of an ultimate molecular marker and they are used increasingly in various plant genetic studies and applications. In this work we report on the utilisation of fourteen previously developed olive microsatellite markers for the identification and differentiation of a set of nineteen olive varieties. All analysed microsatellite markers revealed a high level of polymorphism that allowed unique genotyping of the examined varieties. Ninety-six alleles were detected at all 14 loci, which multiplied into a large number of observed genotypes, giving high discrimination value for varietal identification. A minimum number of three microsatellite markers was chosen for the rapid and unambiguous varietal identification of nineteen olive varieties and only two markers were sufficient for differentiation of five local varieties. DNA fingerprints of olive cultivars by means of microsatellites provided meaningful data, which can be extended by additional olive varieties or new microsatellites and used for accurate inter-laboratory comparison. The data obtained can be used for the varietal survey and construction of a database of all olive varieties grown in Slovenia providing also additional genetic information on the agronomic and quality characteristics of the olive varieties.

  11. DNA methylome profiling of maternal peripheral blood and placentas reveal potential fetal DNA markers for non-invasive prenatal testing.

    Science.gov (United States)

    Xiang, Yuqian; Zhang, Junyu; Li, Qiaoli; Zhou, Xinyao; Wang, Teng; Xu, Mingqing; Xia, Shihui; Xing, Qinghe; Wang, Lei; He, Lin; Zhao, Xinzhi

    2014-09-01

    Utilizing epigenetic (DNA methylation) differences to differentiate between maternal peripheral blood (PBL) and fetal (placental) DNA has been a promising strategy for non-invasive prenatal testing (NIPT). However, the differentially methylated regions (DMRs) have yet to be fully ascertained. In the present study, we performed genome-wide comparative methylome analysis between maternal PBL and placental DNA from pregnancies of first trimester by methylated DNA immunoprecipitation-sequencing (MeDIP-Seq) and Infinium HumanMethylation450 BeadChip assays. A total of 36 931 DMRs and 45 804 differentially methylated sites (DMSs) covering the whole genome, exclusive of the Y chromosome, were identified via MeDIP-Seq and Infinium 450k array, respectively, of which 3759 sites in 2188 regions were confirmed by both methods. Not only did we find the previously reported potential fetal DNA markers in our identified DMRs/DMSs but also we verified fully the identified DMRs/DMSs in the validation round by MassARRAY EpiTYPER. The screened potential fetal DNA markers may be used for NIPT on aneuploidies and other chromosomal diseases, such as cri du chat syndrome and velo-cardio-facial syndrome. In addition, these potential markers may have application in the early diagnosis of placental dysfunction, such as pre-eclampsia. © The Author 2014. Published by Oxford University Press on behalf of the European Society of Human Reproduction and Embryology. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  12. Evolutional dynamics of 45S and 5S ribosomal DNA in ancient allohexaploid Atropa belladonna.

    Science.gov (United States)

    Volkov, Roman A; Panchuk, Irina I; Borisjuk, Nikolai V; Hosiawa-Baranska, Marta; Maluszynska, Jolanta; Hemleben, Vera

    2017-01-23

    Polyploid hybrids represent a rich natural resource to study molecular evolution of plant genes and genomes. Here, we applied a combination of karyological and molecular methods to investigate chromosomal structure, molecular organization and evolution of ribosomal DNA (rDNA) in nightshade, Atropa belladonna (fam. Solanaceae), one of the oldest known allohexaploids among flowering plants. Because of their abundance and specific molecular organization (evolutionarily conserved coding regions linked to variable intergenic spacers, IGS), 45S and 5S rDNA are widely used in plant taxonomic and evolutionary studies. Molecular cloning and nucleotide sequencing of A. belladonna 45S rDNA repeats revealed a general structure characteristic of other Solanaceae species, and a very high sequence similarity of two length variants, with the only difference in number of short IGS subrepeats. These results combined with the detection of three pairs of 45S rDNA loci on separate chromosomes, presumably inherited from both tetraploid and diploid ancestor species, example intensive sequence homogenization that led to substitution/elimination of rDNA repeats of one parent. Chromosome silver-staining revealed that only four out of six 45S rDNA sites are frequently transcriptionally active, demonstrating nucleolar dominance. For 5S rDNA, three size variants of repeats were detected, with the major class represented by repeats containing all functional IGS elements required for transcription, the intermediate size repeats containing partially deleted IGS sequences, and the short 5S repeats containing severe defects both in the IGS and coding sequences. While shorter variants demonstrate increased rate of based substitution, probably in their transition into pseudogenes, the functional 5S rDNA variants are nearly identical at the sequence level, pointing to their origin from a single parental species. Localization of the 5S rDNA genes on two chromosome pairs further supports uniparental

  13. The D1-D2 region of the large subunit ribosomal DNA as barcode for ciliates.

    Science.gov (United States)

    Stoeck, T; Przybos, E; Dunthorn, M

    2014-05-01

    Ciliates are a major evolutionary lineage within the alveolates, which are distributed in nearly all habitats on our planet and are an essential component for ecosystem function, processes and stability. Accurate identification of these unicellular eukaryotes through, for example, microscopy or mating type reactions is reserved to few specialists. To satisfy the demand for a DNA barcode for ciliates, which meets the standard criteria for DNA barcodes defined by the Consortium for the Barcode of Life (CBOL), we here evaluated the D1-D2 region of the ribosomal DNA large subunit (LSU-rDNA). Primer universality for the phylum Ciliophora was tested in silico with available database sequences as well as in the laboratory with 73 ciliate species, which represented nine of 12 ciliate classes. Primers tested in this study were successful for all tested classes. To test the ability of the D1-D2 region to resolve conspecific and congeneric sequence divergence, 63 Paramecium strains were sampled from 24 mating species. The average conspecific D1-D2 variation was 0.18%, whereas congeneric sequence divergence averaged 4.83%. In pairwise genetic distance analyses, we identified a D1-D2 sequence divergence of DNA amplification of single cells and voucher deposition. In conclusion, the presented data pinpoint the D1-D2 region as an excellent candidate for an official CBOL barcode for ciliated protists. © 2013 John Wiley & Sons Ltd.

  14. Diversitas Genetik Anopheles balabacensis, Baisas di Berbagai Daerah Indonesia Berdasarkan Sekuen Gen ITS 2 DNA Ribosom

    Directory of Open Access Journals (Sweden)

    Widiarti Widiarti

    2016-05-01

    Full Text Available AbstractMalaria control is remain a challenge although various attempts have been conducted. One of the issues in controlling the vectors is the presence of species complex. The species complex is an example of genetic diversity. Anopheles balabacensis, Baisas reported as complex species in various countries, but has not been widely reported in Indonesia. In order to enhance malaria control, it is important to understand the vectors and its bioecology. The aim of the study were a. to identify An. balabacensis, Baisas suspected as species complex based on ribosomal DNA the second internal transcribed spacer (ITS2 gene sequences, b. to understand the genetic diversity of An. balabacensis, Baisas collected from endemic and non endemic regions distincted by geographical distance, c. to understand the genetic relationships (taxonomi distance among An. balabacensis, Baisas from difference regions in Indonesia through reconstructing the phylogenetic trees. The results showed that An. balabacensis, Baisas in Indonesia is identified as sympatric and allopatrik complex species. There were differences which was far enough in the genetic relationships among An. balabacensis populations collected from Pusuk Lestari in the area of Meninting Health Center, West Lombok, NTB. This differences were identified as sympatric complex. In addition, base on the relationship among An. leucosphyrus group, An balabacensis, Baisas collected from Berjoko Nunukan Regency showed that the species quite far compare to An. balabacensis, Baisas originally from Central Java and Lombok NTB.Keywords : An. balabacensis, genetic variation, the second Internal Transcribed Spacer (ITS2.AbstrakPenanggulangan malaria masih banyak menemui kendala walaupun berbagai upaya telah dilakukan. Salah satu kendala yang menyulitkan dalam pengendalian vektor adalah adanya spesies kompleks pada populasi nyamuk vektor. Spesies kompleks merupakan contoh diversitas genetik. Anopheles balabacensis

  15. DNA-based genetic markers for Rapid Cycling Brassica rapa (Fast Plants type designed for the teaching laboratory.

    Directory of Open Access Journals (Sweden)

    Eryn E. Slankster

    2012-06-01

    Full Text Available We have developed DNA-based genetic markers for rapid-cycling Brassica rapa (RCBr, also known as Fast Plants. Although markers for Brassica rapa already exist, ours were intentionally designed for use in a teaching laboratory environment. The qualities we selected for were robust amplification in PCR, polymorphism in RCBr strains, and alleles that can be easily resolved in simple agarose slab gels. We have developed two single nucleotide polymorphism (SNP based markers and 14 variable number tandem repeat (VNTR-type markers spread over four chromosomes. The DNA sequences of these markers represent variation in a wide range of genomic features. Among the VNTR-type markers, there are examples of variation in a nongenic region, variation within an intron, and variation in the coding sequence of a gene. Among the SNP-based markers there are examples of polymorphism in intronic DNA and synonymous substitution in a coding sequence. Thus these markers can serve laboratory exercises in both transmission genetics and molecular biology.

  16. Relationship between organization and function of ribosomal genes in Drosophila melanogaster

    International Nuclear Information System (INIS)

    Karpen, G.H.

    1987-01-01

    In most eukaryotic organisms, the genes that encode the 18S and 28S ribosomal RNAs (rDNA genes) are tandemly repeated, and are located in constitutive heterochromatin and/or centromeric or telomeric regions. P-element mediated transformation was used to investigate the relationship between rDNA organization and function in Drosophila melanogaster. Tritiated-uridine incorporation under heat shock conditions and in situ hybridization to rRNA were used to demonstrate that a single rDNA gene inserted into euchromatin can be transcribed at a high rate, in polytene nuclei. P-element-mediated transformation of a single Drosophila rDNA gene was also utilized to investigate the ability of ribosomal DNA to organize a nucleolus. Cytological approaches demonstrated that structures resembling the endogenous nucleoli were preferentially associated with four different sites of rDNA insertion, in polytene nuclei. These mini-nucleoli also contained components specific to the nucleolus, as shown by in situ hybridization to rRNA and indirect immunofluorescence with an antibody that binds to Drosophila nucleoli. The transformed genes were able to partially rescue mutant phenotypes due to a deficiency of rDNA, indicating that the mini-nucleoli were functional

  17. Intragenomic polymorphisms among high-copy loci: a genus-wide study of nuclear ribosomal DNA in Asclepias (Apocynaceae).

    Science.gov (United States)

    Weitemier, Kevin; Straub, Shannon C K; Fishbein, Mark; Liston, Aaron

    2015-01-01

    Despite knowledge that concerted evolution of high-copy loci is often imperfect, studies that investigate the extent of intragenomic polymorphisms and comparisons across a large number of species are rarely made. We present a bioinformatic pipeline for characterizing polymorphisms within an individual among copies of a high-copy locus. Results are presented for nuclear ribosomal DNA (nrDNA) across the milkweed genus, Asclepias. The 18S-26S portion of the nrDNA cistron of Asclepias syriaca served as a reference for assembly of the region from 124 samples representing 90 species of Asclepias. Reads were mapped back to each individual's consensus and at each position reads differing from the consensus were tallied using a custom perl script. Low frequency polymorphisms existed in all individuals (mean = 5.8%). Most nrDNA positions (91%) were polymorphic in at least one individual, with polymorphic sites being less frequent in subunit regions and loops. Highly polymorphic sites existed in each individual, with highest abundance in the "noncoding" ITS regions. Phylogenetic signal was present in the distribution of intragenomic polymorphisms across the genus. Intragenomic polymorphisms in nrDNA are common in Asclepias, being found at higher frequency than any other study to date. The high and variable frequency of polymorphisms across species highlights concerns that phylogenetic applications of nrDNA may be error-prone. The new analytical approach provided here is applicable to other taxa and other high-copy regions characterized by low coverage genome sequencing (genome skimming).

  18. Intraspecific differentiation of Paramecium novaurelia strains (Ciliophora, Protozoa) inferred from phylogenetic analysis of ribosomal and mitochondrial DNA variation.

    Science.gov (United States)

    Tarcz, Sebastian

    2013-01-01

    Paramecium novaurelia Beale and Schneller, 1954, was first found in Scotland and is known to occur mainly in Europe, where it is the most common species of the P. aurelia complex. In recent years, two non-European localities have been described: Turkey and the United States of America. This article presents the analysis of intraspecific variability among 25 strains of P. novaurelia with the application of ribosomal and mitochondrial loci (ITS1-5.8S-ITS2, 5' large subunit rDNA (5'LSU rDNA) and cytochrome c oxidase subunit 1 (COI) mtDNA). The mean distance observed for all of the studied P. novaurelia sequence pairs was p=0.008/0.016/0.092 (ITS1-5.8S-ITS2/5'LSU rDNA/COI). Phylogenetic trees (NJ/MP/BI) based on a comparison of all of the analysed sequences show that the studied strains of P. novaurelia form a distinct clade, separate from the P. caudatum outgroup, and are divided into two clusters (A and B) and two branches (C and D). The occurrence of substantial genetic differentiation within P. novaurelia, confirmed by the analysed DNA fragments, indicates a rapid evolution of particular species within the Paramecium genus. Copyright © 2012 Elsevier GmbH. All rights reserved.

  19. Are ribosomal DNA clusters rearrangement hotspots? A case study in the genus Mus (Rodentia, Muridae

    Directory of Open Access Journals (Sweden)

    Douzery Emmanuel JP

    2011-05-01

    Full Text Available Abstract Background Recent advances in comparative genomics have considerably improved our knowledge of the evolution of mammalian karyotype architecture. One of the breakthroughs was the preferential localization of evolutionary breakpoints in regions enriched in repetitive sequences (segmental duplications, telomeres and centromeres. In this context, we investigated the contribution of ribosomal genes to genome reshuffling since they are generally located in pericentromeric or subtelomeric regions, and form repeat clusters on different chromosomes. The target model was the genus Mus which exhibits a high rate of karyotypic change, a large fraction of which involves centromeres. Results The chromosomal distribution of rDNA clusters was determined by in situ hybridization of mouse probes in 19 species. Using a molecular-based reference tree, the phylogenetic distribution of clusters within the genus was reconstructed, and the temporal association between rDNA clusters, breakpoints and centromeres was tested by maximum likelihood analyses. Our results highlighted the following features of rDNA cluster dynamics in the genus Mus: i rDNA clusters showed extensive diversity in number between species and an almost exclusive pericentromeric location, ii a strong association between rDNA sites and centromeres was retrieved which may be related to their shared constraint of concerted evolution, iii 24% of the observed breakpoints mapped near an rDNA cluster, and iv a substantial rate of rDNA cluster change (insertion, deletion also occurred in the absence of chromosomal rearrangements. Conclusions This study on the dynamics of rDNA clusters within the genus Mus has revealed a strong evolutionary relationship between rDNA clusters and centromeres. Both of these genomic structures coincide with breakpoints in the genus Mus, suggesting that the accumulation of a large number of repeats in the centromeric region may contribute to the high level of chromosome

  20. An annotated genetic map of loblolly pine based on microsatellite and cDNA markers

    Directory of Open Access Journals (Sweden)

    Wimalanathan Kokulapalan

    2011-01-01

    Full Text Available Abstract Background Previous loblolly pine (Pinus taeda L. genetic linkage maps have been based on a variety of DNA polymorphisms, such as AFLPs, RAPDs, RFLPs, and ESTPs, but only a few SSRs (simple sequence repeats, also known as simple tandem repeats or microsatellites, have been mapped in P. taeda. The objective of this study was to integrate a large set of SSR markers from a variety of sources and published cDNA markers into a composite P. taeda genetic map constructed from two reference mapping pedigrees. A dense genetic map that incorporates SSR loci will benefit complete pine genome sequencing, pine population genetics studies, and pine breeding programs. Careful marker annotation using a variety of references further enhances the utility of the integrated SSR map. Results The updated P. taeda genetic map, with an estimated genome coverage of 1,515 cM(Kosambi across 12 linkage groups, incorporated 170 new SSR markers and 290 previously reported SSR, RFLP, and ESTP markers. The average marker interval was 3.1 cM. Of 233 mapped SSR loci, 84 were from cDNA-derived sequences (EST-SSRs and 149 were from non-transcribed genomic sequences (genomic-SSRs. Of all 311 mapped cDNA-derived markers, 77% were associated with NCBI Pta UniGene clusters, 67% with RefSeq proteins, and 62% with functional Gene Ontology (GO terms. Duplicate (i.e., redundant accessory and paralogous markers were tentatively identified by evaluating marker sequences by their UniGene cluster IDs, clone IDs, and relative map positions. The average gene diversity, He, among polymorphic SSR loci, including those that were not mapped, was 0.43 for 94 EST-SSRs and 0.72 for 83 genomic-SSRs. The genetic map can be viewed and queried at http://www.conifergdb.org/pinemap. Conclusions Many polymorphic and genetically mapped SSR markers are now available for use in P. taeda population genetics, studies of adaptive traits, and various germplasm management applications. Annotating mapped

  1. The use of DNA markers for rapid improvement of crops in Africa ...

    African Journals Online (AJOL)

    Genetic engineering and biotechnology are providing new tools for genetic improvement of food crops. Molecular DNA markers are some of these tools which can be used in various fields of plant breeding and germplasm management. For example, molecular markers have been used to confirm the identity of hybrids in ...

  2. Analysis of relationship between tumor markers and quantification of free DNA in serum of lung cancer patients

    International Nuclear Information System (INIS)

    Yang Shunfang; Zhang Peiling; Cao Jie; Zeng Jun; Dong Qianggang

    2006-01-01

    To evaluate the diagnostic value and relationship between five tumor markers (CA19- 9,CA125,CYFRA21-1 ,CEA,NSE) and free DNA in serum for lung cancer detection and try to find a new and more efficient tumor marker, the amounts of CA19-9, CA125, CYFRA21-1, CEA, NSE were determined by RIA and free DNA was determined by the use of quantitative real time PCR amplification of the human epidermal growth factor receptor (EGFR) in 52 lung cancer patients and 8 cases of benign pulmonary disease and 10 healthy controls. The resulls showed that average concentration of free DNA in serum of lung cancer patients, benign pulmo- nary disease and healthy controls was 107.6ng/mL, 76.86ng/mL and 18.8ng/mL, respective- ly. The diagnostic sensitivity, specificity and accuracy of free DNA for lung cancer were 71. 2%, 50% and 68.3%, same as the diagnostic value of combined detection of five tumor markers. The sensitivity, specificity and accuracy of the five tumor markers and free DNA combinend detection for lung cancer were 94.2%, 25% and 85%, respectively. The free DNA in the serum of lung cancer patients may be a new and better tumor marker. (authors)

  3. Chromosomal divergence and evolutionary inferences in Rhodniini based on the chromosomal location of ribosomal genes

    Directory of Open Access Journals (Sweden)

    Sebastian Pita

    2013-05-01

    Full Text Available In this study, we used fluorescence in situ hybridisation to determine the chromosomal location of 45S rDNA clusters in 10 species of the tribe Rhodniini (Hemiptera: Reduviidae: Triatominae. The results showed striking inter and intraspecific variability, with the location of the rDNA clusters restricted to sex chromosomes with two patterns: either on one (X chromosome or both sex chromosomes (X and Y chromosomes. This variation occurs within a genus that has an unchanging diploid chromosome number (2n = 22, including 20 autosomes and 2 sex chromosomes and a similar chromosome size and genomic DNA content, reflecting a genome dynamic not revealed by these chromosome traits. The rDNA variation in closely related species and the intraspecific polymorphism in Rhodnius ecuadoriensis suggested that the chromosomal position of rDNA clusters might be a useful marker to identify recently diverged species or populations. We discuss the ancestral position of ribosomal genes in the tribe Rhodniini and the possible mechanisms involved in the variation of the rDNA clusters, including the loss of rDNA loci on the Y chromosome, transposition and ectopic pairing. The last two processes involve chromosomal exchanges between both sex chromosomes, in contrast to the widely accepted idea that the achiasmatic sex chromosomes of Heteroptera do not interchange sequences.

  4. Molecular Markers Useful for Intraspecies Subtyping and Strain Differentiation of Dermatophytes.

    Science.gov (United States)

    Mochizuki, Takashi; Takeda, Kiminobu; Anzawa, Kazushi

    2017-02-01

    Dermatophytosis is a very common skin disorder and the most frequent infection encountered by practicing dermatologists. The identification, pathogenicity, biology, and epidemiology of dermatophytes, the causative agents of dermatophytosis, are of interest for both dermatologists and medical mycologists. Recent advances in molecular methods have provided new techniques for identifying dermatophytes, including intraspecies variations. Intraspecies subtyping and strain differentiation have made possible the tracking of infections, the identification of common sources of infections, recurrence or reinfection after treatment, and analysis of strain virulence and drug resistance. This review describes molecular methods of intraspecies subtyping and strain differentiation, including analyses of mitochondrial DNA and non-transcribed spacer regions of ribosomal RNA genes, random amplification of polymorphic DNA, and microsatellite markers, along with their advantages and limitations.

  5. Hybrid Origins of Citrus Varieties Inferred from DNA Marker Analysis of Nuclear and Organelle Genomes

    Science.gov (United States)

    Kitajima, Akira; Nonaka, Keisuke; Yoshioka, Terutaka; Ohta, Satoshi; Goto, Shingo; Toyoda, Atsushi; Fujiyama, Asao; Mochizuki, Takako; Nagasaki, Hideki; Kaminuma, Eli; Nakamura, Yasukazu

    2016-01-01

    Most indigenous citrus varieties are assumed to be natural hybrids, but their parentage has so far been determined in only a few cases because of their wide genetic diversity and the low transferability of DNA markers. Here we infer the parentage of indigenous citrus varieties using simple sequence repeat and indel markers developed from various citrus genome sequence resources. Parentage tests with 122 known hybrids using the selected DNA markers certify their transferability among those hybrids. Identity tests confirm that most variant strains are selected mutants, but we find four types of kunenbo (Citrus nobilis) and three types of tachibana (Citrus tachibana) for which we suggest different origins. Structure analysis with DNA markers that are in Hardy–Weinberg equilibrium deduce three basic taxa coinciding with the current understanding of citrus ancestors. Genotyping analysis of 101 indigenous citrus varieties with 123 selected DNA markers infers the parentages of 22 indigenous citrus varieties including Satsuma, Temple, and iyo, and single parents of 45 indigenous citrus varieties, including kunenbo, C. ichangensis, and Ichang lemon by allele-sharing and parentage tests. Genotyping analysis of chloroplast and mitochondrial genomes using 11 DNA markers classifies their cytoplasmic genotypes into 18 categories and deduces the combination of seed and pollen parents. Likelihood ratio analysis verifies the inferred parentages with significant scores. The reconstructed genealogy identifies 12 types of varieties consisting of Kishu, kunenbo, yuzu, koji, sour orange, dancy, kobeni mikan, sweet orange, tachibana, Cleopatra, willowleaf mandarin, and pummelo, which have played pivotal roles in the occurrence of these indigenous varieties. The inferred parentage of the indigenous varieties confirms their hybrid origins, as found by recent studies. PMID:27902727

  6. Circulating, cell-free DNA as a marker for exercise load in intermittent sports.

    Directory of Open Access Journals (Sweden)

    Nils Haller

    Full Text Available Attempts to establish a biomarker reflecting individual player load in intermittent sports such as football have failed so far. Increases in circulating DNA (cfDNA have been demonstrated in various endurance sports settings. While it has been proposed that cfDNA could be a suitable marker for player load in intermittent sports, the effects on cfDNA of repeated sprinting as an essential feature in intermittent sports are unknown. For the first time, we assessed both alterations of cfDNA due to repeated maximal sprints and due to a professional football game.Nine participants were subjected to a standardised sprint training session with cross-over design of five maximal sprints of 40 meters with either "short" (1 minute or "long" pauses (5 minutes. Capillary cfDNA and lactate were measured after every sprint and venous cfDNA before and after each series of sprints. Moreover, capillary cfDNA and lactate values were taken in 23 professional football players before and after incremental exercise testing, during the course of a training week at rest (baseline and in all 17 enrolled players following a season game.Lactate and venous cfDNA increased more pronounced during "short" compared to "long" (1.4-fold, p = 0.032 and 1.7-fold, p = 0.016 and cfDNA correlated significantly with lactate (r = 0.69; p<0.001. Incremental exercise testing increased cfDNA 7.0-fold (p<0.001. The season game increased cfDNA 22.7-fold (p<0.0001, while lactate showed a 2.0-fold (p = 0.09 increase compared to baseline. Fold-changes in cfDNA correlated with distance covered during game (spearman's r = 0.87, p = 0.0012, while no correlation between lactate and the tracking data could be found.We show for the first time that cfDNA could be an objective marker for distance covered in elite intermittent sports. In contrast to the potential of more established blood-based markers like IL-6, CK, or CRP, cfDNA shows by far the strongest fold-change and a high correlation with a

  7. Emergence of Tetracycline Resistance in Helicobacter pylori: Multiple Mutational Changes in 16S Ribosomal DNA and Other Genetic Loci

    Science.gov (United States)

    Dailidiene, Daiva; Bertoli, M. Teresita; Miciuleviciene, Jolanta; Mukhopadhyay, Asish K.; Dailide, Giedrius; Pascasio, Mario Alberto; Kupcinskas, Limas; Berg, Douglas E.

    2002-01-01

    Tetracycline is useful in combination therapies against the gastric pathogen Helicobacter pylori. We found 6 tetracycline-resistant (Tetr) strains among 159 clinical isolates (from El Salvador, Lithuania, and India) and obtained the following four results: (i) 5 of 6 Tetr isolates contained one or two nucleotide substitutions in one part of the primary tetracycline binding site in 16S rRNA (AGA965-967 [Escherichia coli coordinates] changed to gGA, AGc, guA, or gGc [lowercase letters are used to represent the base changes]), whereas the sixth (isolate Ind75) retained AGA965-967; (ii) PCR products containing mutant 16S ribosomal DNA (rDNA) alleles transformed recipient strains to Tetr phenotypes, but transformants containing alleles with single substitutions (gGA and AGc) were less resistant than their Tetr parents; (iii) each of 10 Tetr mutants of reference strain 26695 (in which mutations were induced with metronidazole, a mutagenic anti-H. pylori agent) contained the normal AGA965-967 sequence; and (iv) transformant derivatives of Ind75 and of one of the Tetr 26695 mutants that had acquired mutant rDNA alleles were resistant to tetracycline at levels higher than those to which either parent strain was resistant. Thus, tetracycline resistance in H. pylori results from an accumulation of changes that may affect tetracycline-ribosome affinity and/or other functions (perhaps porins or efflux pumps). We suggest that the rarity of tetracycline resistance among clinical isolates reflects this need for multiple mutations and perhaps also the deleterious effects of such mutations on fitness. Formally equivalent mutations with small but additive effects are postulated to contribute importantly to traits such as host specificity and virulence and to H. pylori's great genetic diversity. PMID:12435699

  8. The occurrence of Toxocara malaysiensis in cats in China, confirmed by sequence-based analyses of ribosomal DNA.

    Science.gov (United States)

    Li, Ming-Wei; Zhu, Xing-Quan; Gasser, Robin B; Lin, Rui-Qing; Sani, Rehana A; Lun, Zhao-Rong; Jacobs, Dennis E

    2006-10-01

    Non-isotopic polymerase chain reaction (PCR)-based single-strand conformation polymorphism and sequence analyses of the second internal transcribed spacer (ITS-2) of nuclear ribosomal DNA (rDNA) were utilized to genetically characterise ascaridoids from dogs and cats from China by comparison with those from other countries. The study showed that Toxocara canis, Toxocara cati, and Toxascaris leonina from China were genetically the same as those from other geographical origins. Specimens from cats from Guangzhou, China, which were morphologically consistent with Toxocara malaysiensis, were the same genetically as those from Malaysia, with the exception of a polymorphism in the ITS-2 but no unequivocal sequence difference. This is the first report of T. malaysiensis in cats outside of Malaysia (from where it was originally described), supporting the proposal that this species has a broader geographical distribution. The molecular approach employed provides a powerful tool for elucidating the biology, epidemiology, and zoonotic significance of T. malaysiensis.

  9. Genetic diversity of sago palm in Indonesia based on chloroplast DNA (cpDNA markers

    Directory of Open Access Journals (Sweden)

    MEMEN SURAHMAN

    2010-07-01

    Full Text Available Abbas B, Renwarin Y, Bintoro MH, Sudarsono, Surahman M, Ehara H (2010 Genetic diversity of sago palm in Indonesia based on chloroplast DNA (cpDNA markers. Biodiversitas 11: 112-117. Sago palm (Metroxylon sagu Rottb. was believed capable to accumulate high carbohydrate content in its trunk. The capability of sago palm producing high carbohydrate should be an appropriate criterion for defining alternative crops in anticipating food crisis. The objective of this research was to study genetic diversity of sago palm in Indonesia based on cpDNA markers. Total genome extraction was done following the Qiagen DNA isolation protocols 2003. Single Nucleotide Fragments (SNF analyses were performed by using ABI Prism GeneScanR 3.7. SNF analyses detected polymorphism revealing eleven alleles and ten haplotypes from total 97 individual samples of sago palm. Specific haplotypes were found in the population from Papua, Sulawesi, and Kalimantan. Therefore, the three islands will be considered as origin of sago palm diversities in Indonesia. The highest haplotype numbers and the highest specific haplotypes were found in the population from Papua suggesting this islands as the centre and the origin of sago palm diversities in Indonesia. The research had however no sufficient data yet to conclude the Papua origin of sago palm. Genetic hierarchies and differentiations of sago palm samples were observed significantly different within populations (P=0.04574, among populations (P=0.04772, and among populations within the island (P=0.03366, but among islands no significant differentiations were observed (P= 0.63069.

  10. Diverse Regulators of Human Ribosome Biogenesis Discovered by Changes in Nucleolar Number

    Directory of Open Access Journals (Sweden)

    Katherine I. Farley-Barnes

    2018-02-01

    Full Text Available Ribosome biogenesis is a highly regulated, essential cellular process. Although studies in yeast have established some of the biological principles of ribosome biogenesis, many of the intricacies of its regulation in higher eukaryotes remain unknown. To understand how ribosome biogenesis is globally integrated in human cells, we conducted a genome-wide siRNA screen for regulators of nucleolar number. We found 139 proteins whose depletion changed the number of nucleoli per nucleus from 2–3 to only 1 in human MCF10A cells. Follow-up analyses on 20 hits found many (90% to be essential for the nucleolar functions of rDNA transcription (7, pre-ribosomal RNA (pre-rRNA processing (16, and/or global protein synthesis (14. This genome-wide analysis exploits the relationship between nucleolar number and function to discover diverse cellular pathways that regulate the making of ribosomes and paves the way for further exploration of the links between ribosome biogenesis and human disease.

  11. Nuclear ribosomal internal transcribed spacer (ITS) region as a universal DNA barcode marker for Fungi

    Czech Academy of Sciences Publication Activity Database

    Schoch, C.L.; Seifert, K.A.; Huhndorf, S.; Robert, V.; Spouge, J.L.; Levesque, C.A.; Chen, W.; Bolchacova, E.; Voigt, K.; Crous, P.W.; Miller, A.N.; Wingfield, M. J.; Aime, M.C.; An, K.D.; Bai, F.Y.; Barreto, R.W.; Bergeron, M.J.; Blackwell, M.; Boekhout, T.; Bogale, M.; Boonyuen, N.; Burgaz, A.R.; Buyck, B.; Cai, L.; Cai, Q.; Cardinali, G.; Chaverri, P.; Coppins, B.J.; Crespo, A.; Cubas, P.; Cummings, C.; Damm, U.; de Beer, Z.W.; de Hoog, G.S.; Del-Prado, R.; Dentinger, B.; Dieguez-Uribeondo, J.; Divakar, P.K.; Douglas, B.; Duenas, M.; Duong, T.A.; Eberhardt, U.; Edwards, J.E.; Elshahed, M.S.; Fliegerová, Kateřina; Furtado, M.; Garcia, M.A.; Ge, Z.W.; Griffith, G.W.; Griffiths, K.; Groenewald, J.Z.; Groenewald, M.; Grube, M.; Gryzenhout, M.; Guo, L.D.; Hagen, F.; Hambleton, S.; Hamelin, R.C.; Hansen, K.; Harrold, P.; Heller, G.; Herrera, C.; Hirayama, K.; Hirooka, Y.; Ho, H.M.; Hoffmann, K.; Hofstetter, V.; Hognabba, F.; Hollingsworth, P.M.; Hong, S.B.; Hosaka, K.; Houbraken, J.; Hughes, K.; Huhtinen, S.; Hyde, K.D.; James, T.; Johnson, E.M.; Johnson, J.E.; Johnston, P.R.; Jones, E.B.; Kelly, L.J.; Kirk, P.M.; Knapp, D.G.; Koljalg, U.; Kovacs, G.M.; Kurtzman, C.P.; Landvik, S.; Leavitt, S.D.; Liggenstoffer, A.S.; Liimatainen, K.; Lombard, L.; Luangsa-Ard, J.J.; Lumbsch, H.T.; Maganti, H.; Maharachchikumbura, S.S.; Martin, M.P.; May, T.W.; McTaggart, A.R.; Methven, A.S.; Meyer, W.; Moncalvo, J.M.; Mongkolsamrit, S.; Nagy, L.G.; Nilsson, R.H.; Niskanen, T.; Nyilasi, I.; Okada, G.; Okane, I.; Olariaga, I.; Otte, J.; Papp, T.; Park, D.; Petkovits, T.; Pino-Bodas, R.; Quaedvlieg, W.; Raja, H.A.; Redecker, D.; Rintoul, T.; Ruibal, C.; Sarmiento-Ramirez, J.M.; Schmitt, I.; Schussler, A.; Shearer, C.; Sotome, K.; Stefani, F.O.; Stenroos, S.; Stielow, B.; Stockinger, H.; Suetrong, S.; Suh, S.O.; Sung, G.H.; Suzuki, M.; Tanaka, K.; Tedersoo, L.; Telleria, M.T.; Tretter, E.; Untereiner, W.A.; Urbina, H.; Vagvolgyi, C.; Vialle, A.; Vu, T.D.; Walther, G.; Wang, Q.M.; Wang, Y.; Weir, B.S.; Weiss, M.; White, M.M.; Xu, J.; Yahr, R.; Yang, Z.L.; Yurkov, A.; Zamora, J.C.; Zhang, N.; Zhuang, W.Y.; Schindel, D.

    2012-01-01

    Roč. 109, č. 16 (2012), s. 6241-6246 ISSN 0027-8424 Institutional research plan: CEZ:AV0Z50450515 Keywords : DNA barcoding * fungal biodiversity Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 9.737, year: 2012

  12. Differentiation of Actinobacillus pleuropneumoniae strains by sequence analysis of 16S rDNA and ribosomal intergenic regions, and development of a species specific oligonucleotide for in situ detection

    DEFF Research Database (Denmark)

    Fussing, Vivian; Paster, Bruce J.; Dewhirst, Floyd E.

    1998-01-01

    . The larger RIS's were different between the 3 species tested. The sequence of the 16S ribosomal gene was determined for 8 serotypes of A. pleuropneumoniae. These sequences showed only minor base differences, indicating a close genetic relatedness of these serotypes within the species. An oligonucleotide DNA...... probe designed from the 16S rRNA gene sequence of A. pleuropneumoniae was specific for all strains of the target species and did not cross react with A. lignieresii, the closest known relative of A. pleuropneumoniae. This species-specific DNA probe labeled with fluorescein was used for in situ......The aims of this study were to characterize and determine intraspecies and interspecies relatedness of Actinobacillus pleuropneumoniae to Actinobacillus lignieresii and Actinobacillus suis by sequence analysis of the ribosomal operon and to find a species-specific area for in situ detection of A...

  13. RINT-1 interacts with MSP58 within nucleoli and plays a role in ribosomal gene transcription

    International Nuclear Information System (INIS)

    Yang, Chuan-Pin; Kuo, Yu-Liang; Lee, Yi-Chao; Lee, Kuen-Haur; Chiang, Chi-Wu; Wang, Ju-Ming; Hsu, Che-Chia

    2016-01-01

    The nucleolus is the cellular site of ribosomal (r)DNA transcription and ribosome biogenesis. The 58-kDa microspherule protein (MSP58) is a nucleolar protein involved in rDNA transcription and cell proliferation. However, regulation of MSP58-mediated rDNA transcription remains unknown. Using a yeast two-hybrid system with MSP58 as bait, we isolated complementary (c)DNA encoding Rad50-interacting protein 1 (RINT-1), as a MSP58-binding protein. RINT-1 was implicated in the cell cycle checkpoint, membrane trafficking, Golgi apparatus and centrosome dynamic integrity, and telomere length control. Both in vitro and in vivo interaction assays showed that MSP58 directly interacts with RINT-1. Interestingly, microscopic studies revealed the co-localization of MSP58, RINT-1, and the upstream binding factor (UBF), a rRNA transcription factor, in the nucleolus. We showed that ectopic expression of MSP58 or RINT-1 resulted in decreased rRNA expression and rDNA promoter activity, whereas knockdown of MSP58 or RINT-1 by siRNA exerted the opposite effect. Coexpression of MSP58 and RINT-1 robustly decreased rRNA synthesis compared to overexpression of either protein alone, whereas depletion of RINT-1 from MSP58-transfected cells enhanced rRNA synthesis. We also found that MSP58, RINT-1, and the UBF were associated with the rDNA promoter using a chromatin immunoprecipitation assay. Because aberrant ribosome biogenesis contributes to neoplastic transformation, our results revealed a novel protein complex involved in the regulation of rRNA gene expression, suggesting a role for MSP58 and RINT-1 in cancer development. - Highlights: • RINT-1 is a novel MSP58-interacting protein. • RINT-1 is a nucleolar protein that suppresses ribosomal RNA gene transcription. • RINT-1 and MSP58 cooperate to suppress ribosomal RNA gene transcription. • RINT-1, MSP58, and UBF form a complex on the rDNA promoter.

  14. Nuclear ribosomal DNA diversity of a cotton pest ( Rotylenchulus ...

    African Journals Online (AJOL)

    The reniform nematode (Rotylenchulus reniformis) has emerged as a major cotton pest in the United States. A recent analysis of over 20 amphimictic populations of this pest from the US and three other countries has shown no sequence variation at the nuclear ribosomal internal transcribed spacer (ITS) despite the region's ...

  15. Intragenomic polymorphisms among high-copy loci: a genus-wide study of nuclear ribosomal DNA in Asclepias (Apocynaceae

    Directory of Open Access Journals (Sweden)

    Kevin Weitemier

    2015-01-01

    Full Text Available Despite knowledge that concerted evolution of high-copy loci is often imperfect, studies that investigate the extent of intragenomic polymorphisms and comparisons across a large number of species are rarely made. We present a bioinformatic pipeline for characterizing polymorphisms within an individual among copies of a high-copy locus. Results are presented for nuclear ribosomal DNA (nrDNA across the milkweed genus, Asclepias. The 18S-26S portion of the nrDNA cistron of Asclepias syriaca served as a reference for assembly of the region from 124 samples representing 90 species of Asclepias. Reads were mapped back to each individual’s consensus and at each position reads differing from the consensus were tallied using a custom perl script. Low frequency polymorphisms existed in all individuals (mean = 5.8%. Most nrDNA positions (91% were polymorphic in at least one individual, with polymorphic sites being less frequent in subunit regions and loops. Highly polymorphic sites existed in each individual, with highest abundance in the “noncoding” ITS regions. Phylogenetic signal was present in the distribution of intragenomic polymorphisms across the genus. Intragenomic polymorphisms in nrDNA are common in Asclepias, being found at higher frequency than any other study to date. The high and variable frequency of polymorphisms across species highlights concerns that phylogenetic applications of nrDNA may be error-prone. The new analytical approach provided here is applicable to other taxa and other high-copy regions characterized by low coverage genome sequencing (genome skimming.

  16. Molecular marker to identify radiolarian species -toward establishment of paleo-environmental proxy-

    Science.gov (United States)

    Ishitani, Y.

    2017-12-01

    Marine fossilized unicellular plankton are known to have many genetically divergent species (biological species) in the single morphological species and these biological species show the species-specific environments much more precisely than that of morphological species. Among these plankton, Radiolaria are one of the best candidates for time- and environmental-indicators in the modern and past oceans, because radiolarians are the only group which represent entire water column from shallow to deep waters. However, the ecology and evolution of radiolarian were traditionally studied in paleontology and paleoceanography by morphological species. Even Radiolaria has a huge potential for novel proxy of wide and deep environments, there is no criterion to identify the biological species. The motivation for this study is setting the quantitative delimitation to establish the biological species of radiolarians based on molecular data, for leading the future ecological and paleo-environmental study. Identification of the biological species by ribosomal DNA sequences are mainly based on two ways: one is the evolutionary distance of the small subunit (SSU) rDNA, the internal transcribed spacer region of ribosomal DNA (ITS1 and 2), and the large subunit (LSU) rDNA; and the other is the secondary structure of ITS2. In the present study, all four possible genetic markers (SSU, ITS1, ITS2, and LSU rDNA) were amplified from 232 individuals of five radiolarian morphological species and applied to examine the evolutionary distance and secondary structure of rDNA. Comprehensive survey clearly shows that evolutionary distance of ITS1 rDNA and the secondary structure of ITS2 is good to identify the species. Notably, evolutionary distance of ITS1 rDNA is possible to set the common delimitation to identify the biological species, as 0.225 substitution per site. The results show that the ITS1 and ITS 2 rDNA could be the criterion for radiolarian species identification.

  17. Optimization of ISSR Markers for Molecular DNA Fingerprinting in Aquilaria sp

    International Nuclear Information System (INIS)

    Azhar Mohamad; Muhammad Hanif Azhari; Siti Norhayati Ismail; Parween, K.S.A.S.

    2013-01-01

    Aquilaria sp. belongs to the Thymelaeaceae family and well distributed to Asia region. The species is a multipurpose use from root to shoot and becoming an economic important crop, which generates wide interest in understanding the genetic diversity of the species. Understanding of the effectiveness in differentiating DNA-based markers is an important step towards plant germplasm characterization and evaluation. It is becoming a prerequisite for more effective application of molecular marker techniques in breeding and mapping programs. Polymerase Chain Reaction (PCR)-based approaches are in demanding as its simplicity and requirement for only small quantities of sample genomic DNA. Inter-simple sequence repeats (ISRR) requires no prior genomic information as anchor template in producing multi-loci markers of tandem repeats for polymorphic patterns by PCR amplification which becoming a key of advantageous of ISSR primers. ISSR markers have shown rapid, simple, reproducible and inexpensive means in molecular taxonomy, conservation breeding and genetic diversity analysis. The ISSR for marker applications are essential to facilitate management, conservation and genetic improvement programs towards improvement of standard resin quality for perfume and or pharmaceutical industries. In this paper, a total of 100 ISSR primers were optimized by using Aquilaria malaccensis. Primers optimization resulted, 38 ISSR primers affirmative for the polymorphism evaluation study, which encountered both from specific and degenerate ISSR primers. Marker derived from ISSR profiling is a powerful method for identification and molecular classification of Aquilaria sp from species to accessions and further will useful in identifying any mutant lines derived from nature and/or mutagenesis activities. (author)

  18. DNA marker mining of ILSTS035 microsatellite locus on ...

    Indian Academy of Sciences (India)

    Unknown

    We describe tests for detecting and locating quantitative trait loci (QTL) for traits in Hanwoo cattle. From results of a permutation test to detect QTL for marbling, we selected the microsatellite locus ILSTS035 on chromosome 6 for further analysis. K-means clustering analysis applied to five traits and nine DNA markers in ...

  19. [Sequence of the ITS region of nuclear ribosomal DNA(nrDNA) in Xinjiang wild Dianthus and its phylogenetic relationship].

    Science.gov (United States)

    Zhang, Lu; Cai, You-Ming; Zhuge, Qiang; Zou, Hui-Yu; Huang, Min-Ren

    2002-06-01

    Xinjiang is a center of distribution and differentiation of genus Dianthus in China, and has a great deal of species resources. The sequences of ITS region (including ITS-1, 5.8S rDNA and ITS-2) of nuclear ribosomal DNA from 8 species of genus Dianthus wildly distributed in Xinjiang were determined by direct sequencing of PCR products. The result showed that the size of the ITS of Dianthus is from 617 to 621 bp, and the length variation is only 4 bp. There are very high homogeneous (97.6%-99.8%) sequences between species, and about 80% homogeneous sequences between genus Dianthus and outgroup. The sequences of ITS in genus Dianthus are relatively conservative. In general, there are more conversion than transition in the variation sites among genus Dianthus. The conversion rates are relatively high, and the ratios of conversion/transition are 1.0-3.0. On the basis of phylogenetic analysis of nucleotide sequences the species of Dianthus in China would be divided into three sections. There is a distant relationship between sect. Barbulatum Williams and sect. Dianthus and between sect. Barbulatum Williams and sect. Fimbriatum Williams, and there is a close relationship between sect. Dianthus and sect. Fimbriatum Williams. From the phylogenetic tree of ITS it was found that the origin of sect. Dianthusis is earlier than that of sect. Fimbriatum Williams and sect. Barbulatum Williams.

  20. Assessment of genome origins and genetic diversity in the genus Eleusine with DNA markers.

    Science.gov (United States)

    Salimath, S S; de Oliveira, A C; Godwin, I D; Bennetzen, J L

    1995-08-01

    Finger millet (Eleusine coracana), an allotetraploid cereal, is widely cultivated in the arid and semiarid regions of the world. Three DNA marker techniques, restriction fragment length polymorphism (RFLP), randomly amplified polymorphic DNA (RAPD), and inter simple sequence repeat amplification (ISSR), were employed to analyze 22 accessions belonging to 5 species of Eleusine. An 8 probe--3 enzyme RFLP combination, 18 RAPD primers, and 6 ISSR primers, respectively, revealed 14, 10, and 26% polymorphism in 17 accessions of E. coracana from Africa and Asia. These results indicated a very low level of DNA sequence variability in the finger millets but did allow each line to be distinguished. The different Eleusine species could be easily identified by DNA marker technology and the 16% intraspecific polymorphism exhibited by the two analyzed accessions of E. floccifolia suggested a much higher level of diversity in this species than in E. coracana. Between species, E. coracana and E. indica shared the most markers, while E. indica and E. tristachya shared a considerable number of markers, indicating that these three species form a close genetic assemblage within the Eleusine. Eleusine floccifolia and E. compressa were found to be the most divergent among the species examined. Comparison of RFLP, RAPD, and ISSR technologies, in terms of the quantity and quality of data output, indicated that ISSRs are particularly promising for the analysis of plant genome diversity.

  1. PCR Amplification of Ribosomal DNA for Species Identification in the Plant Pathogen Genus Phytophthora

    Science.gov (United States)

    Ristaino, Jean B.; Madritch, Michael; Trout, Carol L.; Parra, Gregory

    1998-01-01

    We have developed a PCR procedure to amplify DNA for quick identification of the economically important species from each of the six taxonomic groups in the plant pathogen genus Phytophthora. This procedure involves amplification of the 5.8S ribosomal DNA gene and internal transcribed spacers (ITS) with the ITS primers ITS 5 and ITS 4. Restriction digests of the amplified DNA products were conducted with the restriction enzymes RsaI, MspI, and HaeIII. Restriction fragment patterns were similar after digestions with RsaI for the following species: P. capsici and P. citricola; P. infestans, P. cactorum, and P. mirabilis; P. fragariae, P. cinnamomi, and P. megasperma from peach; P. palmivora, P. citrophthora, P. erythroseptica, and P. cryptogea; and P. megasperma from raspberry and P. sojae. Restriction digests with MspI separated P. capsici from P. citricola and separated P. cactorum from P. infestans and P. mirabilis. Restriction digests with HaeIII separated P. citrophthora from P. cryptogea, P. cinnamomi from P. fragariae and P. megasperma on peach, P. palmivora from P. citrophthora, and P. megasperma on raspberry from P. sojae. P. infestans and P. mirabilis digests were identical and P. cryptogea and P. erythroseptica digests were identical with all restriction enzymes tested. A unique DNA sequence from the ITS region I in P. capsici was used to develop a primer called PCAP. The PCAP primer was used in PCRs with ITS 1 and amplified only isolates of P. capsici, P. citricola, and P. citrophthora and not 13 other species in the genus. Restriction digests with MspI separated P. capsici from the other two species. PCR was superior to traditional isolation methods for detection of P. capsici in infected bell pepper tissue in field samples. The techniques described will provide a powerful tool for identification of the major species in the genus Phytophthora. PMID:9501434

  2. Evaluating the Feasibility of Five Candidate DNA Barcoding Loci for Philippine Lasianthus Jack (Lasiantheae: Rubiaceae).

    Science.gov (United States)

    Arshed, Muhammad Jefte C; Valdez, Marcos B; Alejandro, Grecebio Jonathan D

    2017-01-01

    The pantropical genus Lasianthus Jack is identified for high phenotypic plasticity making traditional taxonomic identification difficult. Having some members with important medicinal properties, a precise complimentary identification through DNA barcoding is needed for species delineation. In this study, 12 samples representing six Philippine Lasianthus species were used to determine the most efficient barcoding loci among the cpDNA markers ( mat K, rbc L, rps 16, and trn T-F) and nrDNA (ITS) based on the criteria of universality, discriminatory power, and resolution of species. The results revealed that ITS has the recommended primer universality, greatest interspecific divergences, and average resolution of species. Among the cpDNA markers, mat K and rbc L are recommended but with minimal resolution of species. While trn T-F showed moderate interspecific variations and resolution of Lasianthus species, rps 16 has the lowest interspecific divergence and resolution of species. Consequently, ITS is the potential ideal DNA barcode for Lasianthus species. ITS, mat K, and rps 16 markers have the excellent amplification and sequence qualityITS marker has the highest interspecific divergence with the maximum values, followed by mat K, rbc L, trn T-F, and rps 16, respectivelyAll markers except rps 16 yielded average resolution to Lasianthus speciesITS marker is the most ideal locus in terms of excellent universality, high interspecific discriminatory ability, and average species resolution. Abbreviations used: ITS: Internal Transcribe Spacer, mat K: maturase K, rbc L: ribulose-1,5-biphospahte-carboxylase, rps 16: ribosomal protein 16 small subunit gene.

  3. Molecular characterization of Fasciola spp. from the endemic area of northern Iran based on nuclear ribosomal DNA sequences.

    Science.gov (United States)

    Amor, Nabil; Halajian, Ali; Farjallah, Sarra; Merella, Paolo; Said, Khaled; Ben Slimane, Badreddine

    2011-07-01

    Fasciolosis caused by Fasciola spp. (Platyhelminthes: Trematoda: Digenea) is considered as the most important helminth infection of ruminants in tropical countries, causing considerable socioeconomic problems. In the endemic regions of the North of Iran, Fasciola hepatica and Fasciola gigantica have been previously characterized on the basis of morphometric differences, but the use of molecular markers is necessary to distinguish exactly between species and intermediate forms. Samples from buffaloes and goats from different localities of northern Iran were identified morphologically and then genetically characterized by sequences of the first (ITS-1) and second (ITS-2) Internal Transcribed Spacers (ITS) of nuclear ribosomal DNA (rDNA). Comparison of the ITS of the northern Iranian samples with sequences of Fasciola spp. from GenBank showed that the examined specimens had sequences identical to those of the most frequent haplotypes of F. hepatica (n=25, 48.1%) and F. gigantica (n=20, 38.45%), which differed from each other in different variable nucleotide positions of ITS region sequences, and their intermediate forms (n=7, 13.45%), which had nucleotides overlapped between the two Fasciola species in all the positions. The ITS sequences from populations of Fasciola isolates in buffaloes and goats had experienced introgression/hybridization as previously reported in isolates from other ruminants and humans. Based on ITS-1 and ITS-2 sequences, flukes are scattered in pure F. hepatica, F. gigantica and intermediate Fasciola clades, revealing that multiple genotypes of Fasciola are able to infect goats and buffaloes in North of Iran. Furthermore, the phylogenetic trees based upon the ITS-1 and ITS-2 sequences showed a close relationship of the Iranian samples with isolates of F. hepatica and F. gigantica from different localities of Africa and Asia. In the present study, the intergenic transcribed spacers ITS-1 and ITS-2 showed to be reliable approaches for the genetic

  4. Circulating, cell-free DNA as a marker for exercise load in intermittent sports

    OpenAIRE

    Haller, Nils; Helmig, Susanne; Taenny, Pascal; Petry, Julian; Schmidt, Sebastian; Simon, Perikles

    2018-01-01

    Background Attempts to establish a biomarker reflecting individual player load in intermittent sports such as football have failed so far. Increases in circulating DNA (cfDNA) have been demonstrated in various endurance sports settings. While it has been proposed that cfDNA could be a suitable marker for player load in intermittent sports, the effects on cfDNA of repeated sprinting as an essential feature in intermittent sports are unknown. For the first time, we assessed both alterations of ...

  5. DNA markers for forensic identification of non-human biological traces

    NARCIS (Netherlands)

    Wesselink, M.

    2018-01-01

    In this thesis, DNA markers are described that enable forensically relevant classification of three groups of non-human biological traces: fungi (Chapter 1), domestic cats (Chapters 2, 3 an d 4) and birch trees (Chapters 5 and 6). Because the forensic questions associated with these traces require

  6. Genetic Variability of Beauveria bassiana and a DNA Marker for Environmental Monitoring of a Highly Virulent Isolate Against Cosmopolites sordidus.

    Science.gov (United States)

    Ferri, D V; Munhoz, C F; Neves, P M O; Ferracin, L M; Sartori, D; Vieira, M L C; Fungaro, M H P

    2012-12-01

    The banana weevil Cosmopolites sordidus (Germar) is one of a number of pests that attack banana crops. The use of the entomopathogenic fungus Beauveria bassiana as a biological control agent for this pest may contribute towards reducing the application of chemical insecticides on banana crops. In this study, the genetic variability of a collection of Brazilian isolates of B. bassiana was evaluated. Samples were obtained from various geographic regions of Brazil, and from different hosts of the Curculionidae family. Based on the DNA fingerprints generated by RAPD and AFLP, we found that 92 and 88 % of the loci were polymorphic, respectively. The B. bassiana isolates were attributed to two genotypic clusters based on the RAPD data, and to three genotypic clusters, when analyzed with AFLP. The nucleotide sequences of nuclear ribosomal DNA intergenic spacers confirmed that all isolates are in fact B. bassiana. Analysis of molecular variance showed that variability among the isolates was not correlated with geographic origin or hosts. A RAPD-specific marker for isolate CG 1024, which is highly virulent to C. sordidus, was cloned and sequenced. Based on the sequences obtained, specific PCR primers BbasCG1024F (5'-TGC GGC TGA GGA GGA CT-3') and BbasCG1024R (5'-TGC GGC TGA GTG TAG AAC-3') were designed for detecting and monitoring this isolate in the field.

  7. Molecular Characterization and Analysis of 16S Ribosomal DNA in Some Isolates of Demodex folicullorum.

    Science.gov (United States)

    Daneshparvar, Afrooz; Mowlavi, Gholamreza; Mirjalali, Hamed; Hajjaran, Homa; Mobedi, Iraj; Naddaf, Saeed Reza; Shidfar, Mohammadreza; Sadat Makki, Mahsa

    2017-01-01

    Demodicosis is one of the most prevalent skin diseases resulting from infestation by Demodex mites. This parasite usually inhabits in follicular infundibulum or sebaceous duct and transmits through close contact with an infested host. This study was carried from September 2014 to January 2016 at Tehran University of Medical Sciences, Tehran, Iran. DNA extraction and amplification of 16S ribosomal RNA was performed on four isolates, already obtained from four different patients and identified morphologically though clearing with 10% Potassium hydroxide (KOH) and microscopical examination. Amplified fragments from the isolates were compared with GeneBank database and phylogenetic analysis was carried out using MEGA6 software. A 390 bp fragment of 16S rDNA was obtained in all isolates and analysis of generated sequences showed high similarity with those submitted to GenBank, previously. Intra-species similarity and distance also showed 99.983% and 0.017, respectively, for the studied isolates. Multiple alignments of the isolates showed Single Nucleotide Polymorphisms (SNPs) in 16S rRNA fragment. Phylogenetic analysis revealed that all 4 isolates clustered with other D. folliculorum, recovered from GenBank database. Our accession numbers KF875587 and KF875589 showed more similarity together in comparison with two other studied isolates. Mitochondrial 16S rDNA is one of the most suitable molecular barcodes for identification D. folliculorum and this fragment can use for intra-species characterization of the most human-infected mites.

  8. Molecular Characterization and Analysis of 16S Ribosomal DNA in some Isolates of Demodex folliculorum

    Directory of Open Access Journals (Sweden)

    Afrooz DANESHPARVAR

    2017-06-01

    Full Text Available Background: Demodicosis is one of the most prevalent skin diseases resulting from infestation by Demodex mites. This parasite usually inhabits in follicular infundibulum or sebaceous duct transmitted through close contact with an infested host.Methods: This study was carried from September 2014 to January 2016 at Tehran University of Medical Sciences, Tehran, Iran. DNA extraction and amplification of 16S ribosomal RNA was performed on four isolates, obtained from four patients and identified morphologically through clearing with 10% Potassium hydroxide (KOH and microscopical examination. Amplified fragments from the isolates were compared with GenBank database and phylogenetic analysis was carried out using MEGA6 software.Results: A 390 bp fragment of 16S rDNA was obtained in all isolates and analysis of generated sequences showed high similarity with those submitted to GenBank, previously. Intra-species similarity and distance also showed 99.983% and 0.017, respectively, for the studied isolates. Multiple alignments of the isolates showed Single Nucleotide Polymorphisms (SNPs in 16S rRNA fragment. Phylogenetic analysis revealed that all 4 isolates clustered with other D. folliculorum, recovered from GenBank database. Our accession numbers KF875587 and KF875589 showed more similarity together in comparison with two other studied isolates. Conclusion: Mitochondrial 16S rDNA is one of the most suitable molecular barcodes for identification D. folliculorum and this fragment can use for intra-species characterization of the most human-infected mites.

  9. Genetic diversity of Entamoeba: Novel ribosomal lineages from cockroaches.

    Directory of Open Access Journals (Sweden)

    Tetsuro Kawano

    Full Text Available Our current taxonomic perspective on Entamoeba is largely based on small-subunit ribosomal RNA genes (SSU rDNA from Entamoeba species identified in vertebrate hosts with minor exceptions such as E. moshkovskii from sewage water and E. marina from marine sediment. Other Entamoeba species have also been morphologically identified and described from non-vertebrate species such as insects; however, their genetic diversity remains unknown. In order to further disclose the diversity of the genus, we investigated Entamoeba spp. in the intestines of three cockroach species: Periplaneta americana, Blaptica dubia, and Gromphadorhina oblongonota. We obtained 134 Entamoeba SSU rDNA sequences from 186 cockroaches by direct nested PCR using the DNA extracts of intestines from cockroaches, followed by scrutinized BLASTn screening and phylogenetic analyses. All the sequences identified in this study were distinct from those reported from known Entamoeba species, and considered as novel Entamoeba ribosomal lineages. Furthermore, they were positioned at the base of the clade of known Entamoeba species and displayed remarkable degree of genetic diversity comprising nine major groups in the three cockroach species. This is the first report of the diversity of SSU rDNA sequences from Entamoeba in non-vertebrate host species, and should help to understand the genetic diversity of the genus Entamoeba.

  10. Development and evaluation of specific PCR primers targeting the ribosomal DNA-internal transcribed spacer (ITS) region of peritrich ciliates in environmental samples

    Science.gov (United States)

    Su, Lei; Zhang, Qianqian; Gong, Jun

    2017-07-01

    Peritrich ciliates are highly diverse and can be important bacterial grazers in aquatic ecosystems. Morphological identifications of peritrich species and assemblages in the environment are time-consuming and expertise-demanding. In this study, two peritrich-specific PCR primers were newly designed to amplify a fragment including the internal transcribed spacer (ITS) region of ribosomal rDNA from environmental samples. The primers showed high specificity in silico, and in tests with peritrich isolates and environmental DNA. Application of these primers in clone library construction and sequencing yielded exclusively sequences of peritrichs for water and sediment samples. We also found the ITS1, ITS2, ITS, D1 region of 28S rDNA, and ITS+D1 region co-varied with, and generally more variable than, the V9 region of 18S rDNA in peritrichs. The newly designed specific primers thus provide additional tools to study the molecular diversity, community composition, and phylogeography of these ecologically important protists in different systems.

  11. Circulating, cell-free DNA as a marker for exercise load in intermittent sports.

    Science.gov (United States)

    Haller, Nils; Helmig, Susanne; Taenny, Pascal; Petry, Julian; Schmidt, Sebastian; Simon, Perikles

    2018-01-01

    Attempts to establish a biomarker reflecting individual player load in intermittent sports such as football have failed so far. Increases in circulating DNA (cfDNA) have been demonstrated in various endurance sports settings. While it has been proposed that cfDNA could be a suitable marker for player load in intermittent sports, the effects on cfDNA of repeated sprinting as an essential feature in intermittent sports are unknown. For the first time, we assessed both alterations of cfDNA due to repeated maximal sprints and due to a professional football game. Nine participants were subjected to a standardised sprint training session with cross-over design of five maximal sprints of 40 meters with either "short" (1 minute) or "long" pauses (5 minutes). Capillary cfDNA and lactate were measured after every sprint and venous cfDNA before and after each series of sprints. Moreover, capillary cfDNA and lactate values were taken in 23 professional football players before and after incremental exercise testing, during the course of a training week at rest (baseline) and in all 17 enrolled players following a season game. Lactate and venous cfDNA increased more pronounced during "short" compared to "long" (1.4-fold, p = 0.032 and 1.7-fold, p = 0.016) and cfDNA correlated significantly with lactate (r = 0.69; psports. In contrast to the potential of more established blood-based markers like IL-6, CK, or CRP, cfDNA shows by far the strongest fold-change and a high correlation with a particular load related aspect in professional football.

  12. Dinoflagellate phylogeny as inferred from heat shock protein 90 and ribosomal gene sequences.

    Directory of Open Access Journals (Sweden)

    Mona Hoppenrath

    2010-10-01

    Full Text Available Interrelationships among dinoflagellates in molecular phylogenies are largely unresolved, especially in the deepest branches. Ribosomal DNA (rDNA sequences provide phylogenetic signals only at the tips of the dinoflagellate tree. Two reasons for the poor resolution of deep dinoflagellate relationships using rDNA sequences are (1 most sites are relatively conserved and (2 there are different evolutionary rates among sites in different lineages. Therefore, alternative molecular markers are required to address the deeper phylogenetic relationships among dinoflagellates. Preliminary evidence indicates that the heat shock protein 90 gene (Hsp90 will provide an informative marker, mainly because this gene is relatively long and appears to have relatively uniform rates of evolution in different lineages.We more than doubled the previous dataset of Hsp90 sequences from dinoflagellates by generating additional sequences from 17 different species, representing seven different orders. In order to concatenate the Hsp90 data with rDNA sequences, we supplemented the Hsp90 sequences with three new SSU rDNA sequences and five new LSU rDNA sequences. The new Hsp90 sequences were generated, in part, from four additional heterotrophic dinoflagellates and the type species for six different genera. Molecular phylogenetic analyses resulted in a paraphyletic assemblage near the base of the dinoflagellate tree consisting of only athecate species. However, Noctiluca was never part of this assemblage and branched in a position that was nested within other lineages of dinokaryotes. The phylogenetic trees inferred from Hsp90 sequences were consistent with trees inferred from rDNA sequences in that the backbone of the dinoflagellate clade was largely unresolved.The sequence conservation in both Hsp90 and rDNA sequences and the poor resolution of the deepest nodes suggests that dinoflagellates reflect an explosive radiation in morphological diversity in their recent

  13. Development, distribution and application of DNA markers for cereal research

    International Nuclear Information System (INIS)

    Qi, X.; Stephenson, P.; Devos, K.M.; Gale, M.D.

    2001-01-01

    DNA probes and primers are important resources for molecular genetic research and molecular breeding. Presently, more than 2500 wheat probes, 400 barley probes, 800 foxtail, pearl millet and finger millet probes, and approximately 150 wheat microsatellite (SSR) primer pairs have been developed and maintained in our DNA Resource Centre at the John Innes Centre (JIC). To accelerate probe and primer distribution, an 'anchor set' and a 'supplementary anchor set', containing 73 and 31 wheat RFLP probes, respectively, and a standard set of 42 primer pairs for wheat SSR markers were selected. Similarly, a set of 52 pearl millet probes has been selected for distribution. More than 8000 wheat RFLP probes, 2000 wheat SSR primer pairs, 700 millet probes and 200 barley probes have been distributed to more than 250 research groups in 40 countries. Our wheat and millet probes and other grass cDNA probes have been used for comparative genetic studies. The revealed conservation of gene content and gene order has been used to construct maps of many grass species and to predict the locations of key genes from one crop species to another. Developed SSR and AFLP markers in wheat, barley and millet are particularly suited for genetic diversity analyses and map construction. (author)

  14. Differential utility of the Bacteroidales DNA and RNA markers in the tiered approach for microbial source tracking in subtropical seawater.

    Science.gov (United States)

    Liu, Rulong; Cheng, Ken H F; Wong, Klaine; Cheng, Samuel C S; Lau, Stanley C K

    2015-07-01

    Source tracking of fecal pollution is an emerging component in water quality monitoring. It may be implemented in a tiered approach involving Escherichia coli and/or Enterococcus spp. as the standard fecal indicator bacteria (FIB) and the 16S rRNA gene markers of Bacteroidales as source identifiers. The relative population dynamics of the source identifiers and the FIB may strongly influence the implementation of such approach. Currently, the relative performance of DNA and RNA as detection targets of Bacteroidales markers in the tiered approach is not known. We compared the decay of the DNA and RNA of the total (AllBac) and ruminant specific (CF128) Bacteroidales markers with those of the FIB in seawater spiked with cattle feces. Four treatments of light and oxygen availability simulating the subtropical seawater of Hong Kong were tested. All Bacteroidales markers decayed significantly slower than the FIB in all treatments. Nonetheless, the concentrations of the DNA and RNA markers and E. coli correlated significantly in normoxic seawater independent of light availability, and in hypoxic seawater only under light. In hypoxic seawater without light, the concentrations of RNA but not DNA markers correlated with that of E. coli. Generally, the correlations between Enterococcus spp. and Bacteroidales were insignificant. These results suggest that either DNA or RNA markers may complement E. coli in the tiered approach for normoxic or hypoxic seawater under light. When light is absent, either DNA or RNA markers may serve for normoxic seawater, but only the RNA markers are suitable for hypoxic seawater.

  15. Soil Fungal Community Associated with Peat in Sarawak Identified Using 18S rDNA Marker

    International Nuclear Information System (INIS)

    Siti Ramlah Ahmad Ali; Sakinah Safari; Mohd Shawal Thakib; Shamsilawani Ahamed Bakeri; Nur Aziemah Ab Ghani

    2016-01-01

    Fungi are principal decomposing microorganisms in acidic environment of peat lands. A useful tool for molecular screening of soil fungal communities using the 18S ribosomal DNA primer has been proven capable of identifying a broad range of fungi species within Ascomycota, Basidiomycota, Zygomycota and Chytridiomycota. Currently, very little information is available on fungal communities in deep peat of Sarawak, Malaysia. In this study, we have isolated the fungi from soil samples taken in deep peat forests and oil palm cultivated areas. The fungal identity was undertaken using 18S ribosomal DNA primer which is EF4-F/ fung5-R. The microscopic structures were conducted to confirm the identity of the isolates. Based on this study, the fungal division most commonly found in deep peat is the Ascomycota. Aspergillus fumigatus was the most common species and more dominant in oil palm cultivated areas and logged-over forest than in primary forest. In the primary forest, the dominant species was the A. flavus, while Hypocrea atroviridis was commonly associated with oil palm cultivated areas and logged-over forest. Other species of fungi isolated in peat primary forests were Penicillium chrysogenum, Trichoderma sp., Phanerochaete sp., Mortierella chlamydospora, A. niger, A. alliaceus, etc. The in-depth difference in the fungal communities for the different sites will be further investigated using the next generation sequencing technology. (author)

  16. Ribosomal protein S14 transcripts are edited in Oenothera mitochondria.

    Science.gov (United States)

    Schuster, W; Unseld, M; Wissinger, B; Brennicke, A

    1990-01-01

    The gene encoding ribosomal protein S14 (rps14) in Oenothera mitochondria is located upstream of the cytochrome b gene (cob). Sequence analysis of independently derived cDNA clones covering the entire rps14 coding region shows two nucleotides edited from the genomic DNA to the mRNA derived sequences by C to U modifications. A third editing event occurs four nucleotides upstream of the AUG initiation codon and improves a potential ribosome binding site. A CGG codon specifying arginine in a position conserved in evolution between chloroplasts and E. coli as a UGG tryptophan codon is not edited in any of the cDNAs analysed. An inverted repeat 3' of an unidentified open reading frame is located upstream of the rps14 gene. The inverted repeat sequence is highly conserved at analogous regions in other Oenothera mitochondrial loci. Images PMID:2326162

  17. Genetic variation and DNA fingerprinting of durian types in Malaysia using simple sequence repeat (SSR) markers.

    Science.gov (United States)

    Siew, Ging Yang; Ng, Wei Lun; Tan, Sheau Wei; Alitheen, Noorjahan Banu; Tan, Soon Guan; Yeap, Swee Keong

    2018-01-01

    Durian ( Durio zibethinus ) is one of the most popular tropical fruits in Asia. To date, 126 durian types have been registered with the Department of Agriculture in Malaysia based on phenotypic characteristics. Classification based on morphology is convenient, easy, and fast but it suffers from phenotypic plasticity as a direct result of environmental factors and age. To overcome the limitation of morphological classification, there is a need to carry out genetic characterization of the various durian types. Such data is important for the evaluation and management of durian genetic resources in producing countries. In this study, simple sequence repeat (SSR) markers were used to study the genetic variation in 27 durian types from the germplasm collection of Universiti Putra Malaysia. Based on DNA sequences deposited in Genbank, seven pairs of primers were successfully designed to amplify SSR regions in the durian DNA samples. High levels of variation among the 27 durian types were observed (expected heterozygosity, H E  = 0.35). The DNA fingerprinting power of SSR markers revealed by the combined probability of identity (PI) of all loci was 2.3×10 -3 . Unique DNA fingerprints were generated for 21 out of 27 durian types using five polymorphic SSR markers (the other two SSR markers were monomorphic). We further tested the utility of these markers by evaluating the clonal status of shared durian types from different germplasm collection sites, and found that some were not clones. The findings in this preliminary study not only shows the feasibility of using SSR markers for DNA fingerprinting of durian types, but also challenges the current classification of durian types, e.g., on whether the different types should be called "clones", "varieties", or "cultivars". Such matters have a direct impact on the regulation and management of durian genetic resources in the region.

  18. Replication and meiotic transmission of yeast ribosomal RNA genes.

    Science.gov (United States)

    Brewer, B J; Zakian, V A; Fangman, W L

    1980-11-01

    The yeast Saccharomyces cerevisiae has approximately 120 genes for the ribosomal RNAs (rDNA) which are organized in tandem within chromosomal DNA. These multiple-copy genes are homogeneous in sequence but can undergo changes in copy number and topology. To determine if these changes reflect unusual features of rDNA metabolism, we have examined both the replication of rDNA in the mitotic cell cycle and the inheritance of rDNA during meiosis. The results indicate that rDNA behaves identically to chromosomal DNA: each rDNA unit is replicated once during the S phase of each cell cycle and each unit is conserved through meiosis. Therefore, the flexibility in copy number and topology of rDNA does not arise from the selective replication of units in each S phase nor by the selective inheritance of units in meiosis.

  19. Introducing W.A.T.E.R.S.: a workflow for the alignment, taxonomy, and ecology of ribosomal sequences.

    Science.gov (United States)

    Hartman, Amber L; Riddle, Sean; McPhillips, Timothy; Ludäscher, Bertram; Eisen, Jonathan A

    2010-06-12

    For more than two decades microbiologists have used a highly conserved microbial gene as a phylogenetic marker for bacteria and archaea. The small-subunit ribosomal RNA gene, also known as 16 S rRNA, is encoded by ribosomal DNA, 16 S rDNA, and has provided a powerful comparative tool to microbial ecologists. Over time, the microbial ecology field has matured from small-scale studies in a select number of environments to massive collections of sequence data that are paired with dozens of corresponding collection variables. As the complexity of data and tool sets have grown, the need for flexible automation and maintenance of the core processes of 16 S rDNA sequence analysis has increased correspondingly. We present WATERS, an integrated approach for 16 S rDNA analysis that bundles a suite of publicly available 16 S rDNA analysis software tools into a single software package. The "toolkit" includes sequence alignment, chimera removal, OTU determination, taxonomy assignment, phylogentic tree construction as well as a host of ecological analysis and visualization tools. WATERS employs a flexible, collection-oriented 'workflow' approach using the open-source Kepler system as a platform. By packaging available software tools into a single automated workflow, WATERS simplifies 16 S rDNA analyses, especially for those without specialized bioinformatics, programming expertise. In addition, WATERS, like some of the newer comprehensive rRNA analysis tools, allows researchers to minimize the time dedicated to carrying out tedious informatics steps and to focus their attention instead on the biological interpretation of the results. One advantage of WATERS over other comprehensive tools is that the use of the Kepler workflow system facilitates result interpretation and reproducibility via a data provenance sub-system. Furthermore, new "actors" can be added to the workflow as desired and we see WATERS as an initial seed for a sizeable and growing repository of interoperable

  20. Epizoanthus spp. associations revealed using DNA markers: a case study from Kochi, Japan.

    Science.gov (United States)

    Reimer, James Davis; Hirose, Mamiko; Nishisaka, Taiki; Sinniger, Frederic; Itani, Gyo

    2010-09-01

    Zoanthids (Cnidaria, Hexacorallia) of the genus Epizoanthus are often found in association with other marine invertebrates, including gastropods and hermit crabs. However, little information exists on the specificity and nature of these associations due to a lack of investigation into Epizoanthus species diversity, and the taxonomy of Epizoanthus is therefore confused. In this study, analyses of morphological data (tentacle number, polyp size, etc) and molecular data (mitochondrial cytochrome oxidase subunit 1 = COI, 16S ribosomal DNA = 16S rDNA) were used to examine Epizoanthus specimens from Tosa Bay, Kochi, Japan. The Epizoanthus specimens were found on both live gastropods (Gemmula unedo) and hermit crabs (Paguristes palythophilus) inhabiting G. unedo and G. cosmoi shells. While morphological analyses did not show clear differences between examined specimens, both COI and mt 16S rDNA clearly divided the specimens into two groups, one associated only with hermit crabs (= Epizoanthus sp. C), and another associated only with living gastropods (= Epizoanthus sp. S). Unexpectedly, DNA sequences from both groups did not match with two previously reported Epizoanthus species from Japan (E. indicus, E. ramosus), indicating they both may be undescribed species. These results highlight the utility of DNA "barcoding" of unknown zoanthids, and will provide a foundation for re-examinations of Epizoanthus species diversity and specificity, which will be critical in understanding the evolution of these unique marine invertebrates.

  1. Optimization Of ISSR Markers For DNA Fingerprinting In Stevia Rebaudiana Bertoni

    International Nuclear Information System (INIS)

    Lyena Watty Zuraine Ahmad; Lyena Watty Zuraine Ahmad; Azhar Mohamad; Mohamad Osman; Zarina Zainuddin; Fatin Izzati Mohd Khari

    2014-01-01

    ISSR or inter-simple sequence repeat is PCR based markers which required no prior DNA sequence knowledge of the studied organism. It has been proved to overcome limitations in other genetic marker techniques. In this study, 100 ISSR primers which comprised of 80 specific primers and 20 degenerate primers were used. All of the primers were tested on gradient temperatures from 45-55 degree Celsius. For positive amplification, 62 specific primers (77.5 %) and 18 degenerate primers (90.0 %) were recorded as working primers. The most efficient temperature for 25 primers was 55 degree Celsius. Marker derived from ISSR profiling is a powerful approach for identification and molecular classification of Stevia rebaudiana bertoni. (author)

  2. Activity-based in vitro selection of T4 DNA ligase

    International Nuclear Information System (INIS)

    Takahashi, Fumio; Funabashi, Hisakage; Mie, Masayasu; Endo, Yaeta; Sawasaki, Tatsuya; Aizawa, Masuo; Kobatake, Eiry

    2005-01-01

    Recent in vitro methodologies for selection and directed evolution of proteins have concentrated not only on proteins with affinity such as single-chain antibody but also on enzymes. We developed a display technology for selection of T4 DNA ligase on ribosome because an in vitro selection method for DNA ligase had never been developed. The 3' end of mRNA encoding the gene of active or inactive T4 DNA ligase-spacer peptide fusion protein was hybridized to dsDNA fragments with cohesive ends, the substrate of T4 DNA ligase. After in vitro translation of the mRNA-dsDNA complex in a rabbit reticulocyte system, a mRNA-dsDNA-ribosome-ligase complex was produced. T4 DNA ligase enzyme displayed on a ribosome, through addition of a spacer peptide, is able to react with dsDNA in the complex. The complex expressing active ligase was biotinylated by ligation with another biotinylated dsDNA probe and selected with streptavidin-coated magnetic beads. We effectively selected active T4 DNA ligase from a small amount of protein. The gene of the active T4 DNA ligase was enriched 40 times from a mixture of active and inactive genes using this selection strategy. This ribosomal display strategy may have high potential to be useful for selection of other enzymes associated with DNA

  3. DNA-based molecular markers as tools for the discovery of γ-induced mutants in cereals and soybean

    International Nuclear Information System (INIS)

    Bondarenco, E.; Bondarenco, V.; Barbacar, N.; Coretchi, L.

    2009-01-01

    γ-induced mutagenesis is one of the present techniques effective in producing crops with enhanced quality and novel properties. The fast detection of mutants can be nowadays assured by the employment of DNA-based molecular markers. Different kinds of molecular markers are being widely used all over the world to monitor DNA sequence variation and identification of desired traits. In the given paper we present a short overview of the types of molecular markers and the first steps of the attempt of their use for mutants' characterization in the Republic of Moldova (authors)

  4. Use of a D17Z1 oligonucleotide probe for human DNA quantitation prior to PCR analysis of polymorphic DNA markers

    Energy Technology Data Exchange (ETDEWEB)

    Walsh, S.; Alavaren, M.; Varlaro, J. [Roche Molecular Systems, Alameda, CA (United States)] [and others

    1994-09-01

    The alpha-satellite DNA locus D17Z1 contains primate-specific sequences which are repeated several hundred times per chromosome 17. A probe that was designed to hybridize to a subset of the D17Z1 sequence can be used for very sensitive and specific quantitation of human DNA. Sample human genomic DNA is immobilized on nylon membrane using a slot blot apparatus, and then hybridized with a biotinylated D17Z1 oligonucleotide probe. The subsequent binding of streptavidin-horseradish peroxidase to the bound probe allows for either calorimetric (TMB) or chemiluminescent (ECL) detection. Signals obtained for sample DNAs are then compared to the signals obtained for a series of human DNA standards. For either detection method, forty samples can be quantitated in less than two hours, with a sensitivity of 150 pg. As little as 20 pg of DNA can be quantitated when using chemiluminescent detection with longer film exposures. PCR analysis of several VNTR and STR markers has indicated that optimal typing results are generally obtained within a relatively narrow range of input DNA quantities. Too much input DNA can lead to PCR artifacts such as preferential amplification of smaller alleles, non-specific amplification products, and exaggeration of the DNA synthesis slippage products that are seen with STR markers. Careful quantitation of human genomic DNA prior to PCR can avoid or minimize these problems and ultimately give cleaner, more unambiguous PCR results.

  5. Condensin suppresses recombination and regulates double-strand break processing at the repetitive ribosomal DNA array to ensure proper chromosome segregation during meiosis in budding yeast

    Science.gov (United States)

    Li, Ping; Jin, Hui; Yu, Hong-Guo

    2014-01-01

    During meiosis, homologues are linked by crossover, which is required for bipolar chromosome orientation before chromosome segregation at anaphase I. The repetitive ribosomal DNA (rDNA) array, however, undergoes little or no meiotic recombination. Hyperrecombination can cause chromosome missegregation and rDNA copy number instability. We report here that condensin, a conserved protein complex required for chromosome organization, regulates double-strand break (DSB) formation and repair at the rDNA gene cluster during meiosis in budding yeast. Condensin is highly enriched at the rDNA region during prophase I, released at the prophase I/metaphase I transition, and reassociates with rDNA before anaphase I onset. We show that condensin plays a dual role in maintaining rDNA stability: it suppresses the formation of Spo11-mediated rDNA breaks, and it promotes DSB processing to ensure proper chromosome segregation. Condensin is unnecessary for the export of rDNA breaks outside the nucleolus but required for timely repair of meiotic DSBs. Our work reveals that condensin coordinates meiotic recombination with chromosome segregation at the repetitive rDNA sequence, thereby maintaining genome integrity. PMID:25103240

  6. Multi-locus DNA barcoding identifies matK as a suitable marker for species identification in Hibiscus L.

    Science.gov (United States)

    Poovitha, Sundar; Stalin, Nithaniyal; Balaji, Raju; Parani, Madasamy

    2016-12-01

    The genus Hibiscus L. includes several taxa of medicinal value and species used for the extraction of natural dyes. These applications require the use of authentic plant materials. DNA barcoding is a molecular method for species identification, which helps in reliable authentication by using one or more DNA barcode marker. In this study, we have collected 44 accessions, representing 16 species of Hibiscus, distributed in the southern peninsular India, to evaluate the discriminatory power of the two core barcodes rbcLa and matK together with the suggested additional regions trnH-psbA and ITS2. No intraspecies divergence was observed among the accessions studied. Interspecies divergence was 0%-9.6% with individual markers, which increased to 0%-12.5% and 0.8%-20.3% when using two- and three-marker combinations, respectively. Differentiation of all the species of Hibiscus was possible with the matK DNA barcode marker. Also, in two-marker combinations, only those combinations with matK differentiated all the species. Though all the three-marker combinations showed 100% species differentiation, species resolution was consistently better when the matK marker formed part of the combination. These results clearly showed that matK is more suitable when compared to rbcLa, trnH-psbA, and ITS2 for species identification in Hibiscus.

  7. Development and small-scale validation of a novel pigeon-associated mitochondrial DNA source tracking marker for the detection of fecal contamination in harvested rainwater.

    Science.gov (United States)

    Waso, M; Khan, S; Khan, W

    2018-02-15

    The current study was aimed at designing and validating (on a small-scale) a novel pigeon mitochondrial DNA (mtDNA) microbial source tracking (MST) marker for the detection of pigeon fecal matter in harvested rainwater. The pigeon mtDNA MST marker was designed to target the mtDNA Cytochrome b gene by employing mismatch amplification mutation assay kinetics. The pigeon marker was validated by screening 69 non-pigeon and 9 pigeon fecal samples. The host-sensitivity of the assay was determined as 1.00 while the host-specificity of the assay was 0.96. Harvested rainwater samples (n=60) were screened for the prevalence of the marker with the mtDNA Cytochrome b marker detected in 78% of the samples. Bayes' theorem was applied to calculate the conditional probability of the marker detecting true pigeon contamination and the marker subsequently displayed a 99% probability of detecting true pigeon contamination in the harvested rainwater samples. In addition, the mtDNA Cytochrome b marker displayed high concurrence frequencies versus heterotrophic bacteria (78.3%), E. coli (73.3%), total coliforms (71.1%) and fecal coliforms (66.7%). This study thus validates that targeting mtDNA for the design of source tracking markers may be a valuable tool to detect avian fecal contamination in environmental waters. Copyright © 2017 Elsevier B.V. All rights reserved.

  8. A quantitative PCR approach for determining the ribosomal DNA copy number in the genome of Agave tequila Weber

    Directory of Open Access Journals (Sweden)

    Jorge Rubio-Piña

    2016-07-01

    Conclusions: Results show that the proposed method a can correctly detect the rDNA copy number, b could be used as species-specific markers and c might help in understanding the genetic diversity, genome organization and evolution of this species.

  9. Genetic diversity and DNA fingerprinting in jute (Corchorus spp. based on SSR markers

    Directory of Open Access Journals (Sweden)

    Liwu Zhang

    2015-10-01

    Full Text Available Genetic diversity analysis and DNA finger printing are very useful in breeding programs, seed conservation and management. Jute (Corchorus spp. is the second most important natural fiber crop after cotton. DNA fingerprinting studies in jute using SSR markers are limited. In this study, 58 jute accessions, including two control varieties (Huangma 179 and Kuanyechangguo from the official variety registry in China were evaluated with 28 pairs of SSR primers. A total of 184 polymorphic loci were identified. Each primer detected 3 to 15 polymorphic loci, with an average of 6.6. The 58 jute accessions were DNA-fingerprinted with 67 SSR markers from the 28 primer pairs. These markers differentiated the 58 jute accessions from one another, with CoSSR305-120 and CoSSR174-195 differentiating Huangma 179 and Kuanyechangguo, respectively. NTSYS-pc2.10 software was used to analyze the genetic diversity in the 58 jute accessions. Their genetic similarity coefficients ranged from 0.520 to 0.910 with an average of 0.749, indicating relatively great genetic diversity among them. The 58 jute accessions were divided into four groups with the coefficient 0.710 used as a value for classification, consistent with their species and pedigrees. All these results may be useful both for protection of intellectual property rights of jute accessions and for jute improvement.

  10. Genetic diversity and DNA fingerprinting in jute(Corchorus spp.) based on SSR markers

    Institute of Scientific and Technical Information of China (English)

    Liwu; Zhang; Rongrong; Cai; Minhang; Yuan; Aifen; Tao; Jiantang; Xu; Lihui; Lin; Pingping; Fang; Jianmin; Qi

    2015-01-01

    Genetic diversity analysis and DNA finger printing are very useful in breeding programs,seed conservation and management. Jute(Corchorus spp.) is the second most important natural fiber crop after cotton. DNA fingerprinting studies in jute using SSR markers are limited. In this study, 58 jute accessions, including two control varieties(Huangma 179 and Kuanyechangguo) from the official variety registry in China were evaluated with 28 pairs of SSR primers. A total of 184 polymorphic loci were identified. Each primer detected 3 to 15 polymorphic loci, with an average of 6.6. The 58 jute accessions were DNA-fingerprinted with 67 SSR markers from the 28 primer pairs. These markers differentiated the 58 jute accessions from one another, with Co SSR305-120 and Co SSR174-195 differentiating Huangma 179 and Kuanyechangguo, respectively. NTSYS-pc2.10 software was used to analyze the genetic diversity in the 58 jute accessions. Their genetic similarity coefficients ranged from 0.520 to 0.910 with an average of 0.749, indicating relatively great genetic diversity among them. The 58 jute accessions were divided into four groups with the coefficient 0.710 used as a value for classification, consistent with their species and pedigrees. All these results may be useful both for protection of intellectual property rights of jute accessions and for jute improvement.

  11. 5S ribosomal RNA database Y2K.

    Science.gov (United States)

    Szymanski, M; Barciszewska, M Z; Barciszewski, J; Erdmann, V A

    2000-01-01

    This paper presents the updated version (Y2K) of the database of ribosomal 5S ribonucleic acids (5S rRNA) and their genes (5S rDNA), http://rose.man/poznan.pl/5SData/index.html. This edition of the database contains 1985primary structures of 5S rRNA and 5S rDNA. They include 60 archaebacterial, 470 eubacterial, 63 plastid, nine mitochondrial and 1383 eukaryotic sequences. The nucleotide sequences of the 5S rRNAs or 5S rDNAs are divided according to the taxonomic position of the source organisms.

  12. Extraction of Total DNA and RNA from Marine Filter Samples and Generation of a cDNA as Universal Template for Marker Gene Studies.

    Science.gov (United States)

    Schneider, Dominik; Wemheuer, Franziska; Pfeiffer, Birgit; Wemheuer, Bernd

    2017-01-01

    Microbial communities play an important role in marine ecosystem processes. Although the number of studies targeting marker genes such as the 16S rRNA gene has been increased in the last few years, the vast majority of marine diversity is rather unexplored. Moreover, most studies focused on the entire bacterial community and thus disregarded active microbial community players. Here, we describe a detailed protocol for the simultaneous extraction of DNA and RNA from marine water samples and for the generation of cDNA from the isolated RNA which can be used as a universal template in various marker gene studies.

  13. HDP2: a ribosomal DNA (NTS-ETS) sequence as a target for species-specific molecular diagnosis of intestinal taeniasis in humans.

    Science.gov (United States)

    Flores, María D; Gonzalez, Luis M; Hurtado, Carolina; Motta, Yamileth Monje; Domínguez-Hidalgo, Cristina; Merino, Francisco Jesús; Perteguer, María J; Gárate, Teresa

    2018-02-27

    Taenia solium, T. asiatica and T. saginata tapeworms cause human taeniasis and are the origin of porcine and bovine cysticercosis. Furthermore, T. solium eggs can cause human cysticercosis, with neurocysticercosis being the most serious form of the disease. These helminth infections are neglected tropical diseases and are endemic in several countries in the Americas, Asia and Africa. As a result of globalization, migration in particular, the infections have been extending to non-endemic territories. Species-specific diagnosis of taeniasis is subject to drawbacks that could be resolved using molecular approaches. In the present study, conventional and real-time amplification protocols (cPCR and qPCR) based on the T. saginata HDP2 sequence were applied in the differential diagnosis of taeniasis (T. saginata, T. solium) in both fecal samples and proglottids expelled by patients. The HDP2 homolog in T. solium was cloned and characterized. Semi-nested cPCR and qPCR (Sn-HDP2 cPCR and Sn-HDP2 qPCR) amplified T. saginata and T. solium DNA, with an analytical sensitivity of 40 and 400 fg, respectively, and identically in both protocols. Eighteen taeniasis patients were diagnosed directly with T. saginata or T. solium, either from proglottids or fecal samples with/without eggs (detected using microscopy), based on the optimized Sn-HDP2 qPCR. After cloning, the T. solium HDP2 homolog sequence was confirmed to be a ribosomal sequence. The HDP2 fragment corresponded to a non-transcribed sequence/external transcribed repeat (NTS/ETS) of ribosomal DNA. Compared with the T. saginata HDP2 homolog, the T solium HDP2 sequence lacked the first 900 nt at the 5' end and showed nucleotide substitutions and small deletions. Sn-HDP2 cPCR and Sn-HDP2 qPCR were set up for the diagnosis of human taeniasis, using proglottids and fecal samples from affected patients. The new Sn-HDP2 qPCR protocol was the best option, as it directly differentiated T. saginata from T. solium. The diagnosis of

  14. Phylogenetic utility of ribosomal genes for reconstructing the phylogeny of five Chinese satyrine tribes (Lepidoptera, Nymphalidae

    Directory of Open Access Journals (Sweden)

    Mingsheng Yang

    2015-03-01

    Full Text Available Satyrinae is one of twelve subfamilies of the butterfly family Nymphalidae, which currently includes nine tribes. However, phylogenetic relationships among them remain largely unresolved, though different researches have been conducted based on both morphological and molecular data. However, ribosomal genes have never been used in tribe level phylogenetic analyses of Satyrinae. In this study we investigate for the first time the phylogenetic relationships among the tribes Elymniini, Amathusiini, Zetherini and Melanitini which are indicated to be a monophyletic group, and the Satyrini, using two ribosomal genes (28s rDNA and 16s rDNA and four protein-coding genes (EF-1α, COI, COII and Cytb. We mainly aim to assess the phylogenetic informativeness of the ribosomal genes as well as clarify the relationships among different tribes. Our results show the two ribosomal genes generally have the same high phylogenetic informativeness compared with EF-1α; and we infer the 28s rDNA would show better informativeness if the 28s rDNA sequence data for each sampling taxon are obtained in this study. The placement of the monotypic genus Callarge Leech in Zetherini is confirmed for the first time based on molecular evidence. In addition, our maximum likelihood (ML and Bayesian inference (BI trees consistently show that the involved Satyrinae including the Amathusiini is monophyletic with high support values. Although the relationships among the five tribes are identical among ML and BI analyses and are mostly strongly-supported in BI analysis, those in ML analysis are lowly- or moderately- supported. Therefore, the relationships among the related five tribes recovered herein need further verification based on more sampling taxa.

  15. DNA fingerprinting of some pakistani date palm (phoenix dactylifera L.) cultive ARS using issr markers

    International Nuclear Information System (INIS)

    Mirbahar, A.; Khan, S.; Markhand, G.S.

    2016-01-01

    Date palm is one of the oldest cultivated and economically important fruit trees. First time Inter Simple Sequence Repeats (ISSR) markers were used with twenty five economically important date palm cultivars of Pakistan for DNA fingerprinting analysis. Samples were collected from four provinces of Pakistan i.e., Sindh, Punjab, Khyber Pakhtoonkhwa and Balochistan. The study was carried out using seven ISSR markers. The twenty five date palm cultivars showed variation at the DNA level. The ISSR primers showed high polymorphism (84%) in the studied date palm cultivars. Dice similarity index was in range from 0.608 to 0.980 and Unweighted Pair Group Method with Arithmetic Mean (UPGMA) divided twenty five date palm cultivars into two main clusters and sub-clusters. However ISSR markers efficiently discriminated for assessing genetic diversity among commercial Pakistani date palm cultivars. (author)

  16. Ribosomal protein methyltransferases in the yeast Saccharomyces cerevisiae: Roles in ribosome biogenesis and translation.

    Science.gov (United States)

    Al-Hadid, Qais; White, Jonelle; Clarke, Steven

    2016-02-12

    A significant percentage of the methyltransferasome in Saccharomyces cerevisiae and higher eukaryotes is devoted to methylation of the translational machinery. Methylation of the RNA components of the translational machinery has been studied extensively and is important for structure stability, ribosome biogenesis, and translational fidelity. However, the functional effects of ribosomal protein methylation by their cognate methyltransferases are still largely unknown. Previous work has shown that the ribosomal protein Rpl3 methyltransferase, histidine protein methyltransferase 1 (Hpm1), is important for ribosome biogenesis and translation elongation fidelity. In this study, yeast strains deficient in each of the ten ribosomal protein methyltransferases in S. cerevisiae were examined for potential defects in ribosome biogenesis and translation. Like Hpm1-deficient cells, loss of four of the nine other ribosomal protein methyltransferases resulted in defects in ribosomal subunit synthesis. All of the mutant strains exhibited resistance to the ribosome inhibitors anisomycin and/or cycloheximide in plate assays, but not in liquid culture. Translational fidelity assays measuring stop codon readthrough, amino acid misincorporation, and programmed -1 ribosomal frameshifting, revealed that eight of the ten enzymes are important for translation elongation fidelity and the remaining two are necessary for translation termination efficiency. Altogether, these results demonstrate that ribosomal protein methyltransferases in S. cerevisiae play important roles in ribosome biogenesis and translation. Copyright © 2016 Elsevier Inc. All rights reserved.

  17. Use of molecular markers for the study of wild fungus basidiomycetes

    Directory of Open Access Journals (Sweden)

    Blanca Estela Gómez Luna

    2012-09-01

    Full Text Available Molecular marker techniques in the study of wild basidiomycete, are increasingly applied to ecology projects, with special focus on analysis of genetic diversity. Often require specialized methods for extracting the DNA of organisms of natural environments, because of the complex compounds that are (carbohydrate polymers and contaminants from the environment (soil particles. Biological materials used were basidiocarps collected in the forest of Santa Rosa, Guanajuato. And mycelium isolated from these basidiocarps. In this work we used a DNA extraction method that allowed the PCR amplification, restriction enzyme digestion and Southern hybridization by non-radioactive method. The results were obtained: Amplification of the ITS1 region of ribosomal unit of the different species of Basidiomycetes. It was possible to observe the genetic diversity among different species of basidiomycetes and the mycelia. Furthermore, the results also suggest differences in DNA methylation between the vegetative mycelium and mycelium of basidiocarp. Finally it is noteworthy that there were no previous work on the application of methods of non-radioactive Southern hybridization for analysis of wild Basidiomycetes and this pioneering work in applying this technique.

  18. Sequence analysis and over-expression of ribosomal protein S28 ...

    African Journals Online (AJOL)

    RPS28 is a component of the 40S small ribosomal subunit encoded by RPS28 gene, which is specific to eukaryotes. The cDNA and the genomic sequence of RPS28 were cloned successfully from the Giant Panda using RT-PCR technology and Touchdown-PCR, respectively. Both sequences were analyzed preliminarily ...

  19. Bacterial community composition in different sediments from the Eastern Mediterranean Sea: a comparison of four 16S ribosomal DNA clone libraries.

    Science.gov (United States)

    Polymenakou, Paraskevi N; Bertilsson, Stefan; Tselepides, Anastasios; Stephanou, Euripides G

    2005-10-01

    The regional variability of sediment bacterial community composition and diversity was studied by comparative analysis of four large 16S ribosomal DNA (rDNA) clone libraries from sediments in different regions of the Eastern Mediterranean Sea (Thermaikos Gulf, Cretan Sea, and South lonian Sea). Amplified rDNA restriction analysis of 664 clones from the libraries indicate that the rDNA richness and evenness was high: for example, a near-1:1 relationship among screened clones and number of unique restriction patterns when up to 190 clones were screened for each library. Phylogenetic analysis of 207 bacterial 16S rDNA sequences from the sediment libraries demonstrated that Gamma-, Delta-, and Alphaproteobacteria, Holophaga/Acidobacteria, Planctomycetales, Actinobacteria, Bacteroidetes, and Verrucomicrobia were represented in all four libraries. A few clones also grouped with the Betaproteobacteria, Nitrospirae, Spirochaetales, Chlamydiae, Firmicutes, and candidate division OPl 1. The abundance of sequences affiliated with Gammaproteobacteria was higher in libraries from shallow sediments in the Thermaikos Gulf (30 m) and the Cretan Sea (100 m) compared to the deeper South Ionian station (2790 m). Most sequences in the four sediment libraries clustered with uncultured 16S rDNA phylotypes from marine habitats, and many of the closest matches were clones from hydrocarbon seeps, benzene-mineralizing consortia, sulfate reducers, sulk oxidizers, and ammonia oxidizers. LIBSHUFF statistics of 16S rDNA gene sequences from the four libraries revealed major differences, indicating either a very high richness in the sediment bacterial communities or considerable variability in bacterial community composition among regions, or both.

  20. Cross-linking of streptomycin to the 16S ribosomal RNA of Escherichia coli

    International Nuclear Information System (INIS)

    Gravel, M.; Melancon, P.; Barkier-Gingras, L.

    1987-01-01

    [ 3 H]Dihydrostreptomycin was cross-linked to the 30S ribosomal subunit from Escherichia coli with the bifunctional reagent nitrogen mustard. The cross-linking primarily involved the 16S RNA. To localize the site of cross-linking of streptomycin to the 16S RNA, the authors hybridized RNA labeled with streptomycin to restriction fragments of the 16S RNA gene. Labeled RNA hybridized to DNA fragments corresponding to bases 892-917 and bases 1394-1415. These two segments of the ribosomal RNA must by juxtaposed in the ribosome, since there is a single binding site for streptomycin. This region has been implicated both in the decoding site and in the binding of initiation factor IF-3, indicating its functional importance

  1. Neuron-Like Networks Between Ribosomal Proteins Within the Ribosome

    Science.gov (United States)

    Poirot, Olivier; Timsit, Youri

    2016-05-01

    From brain to the World Wide Web, information-processing networks share common scale invariant properties. Here, we reveal the existence of neural-like networks at a molecular scale within the ribosome. We show that with their extensions, ribosomal proteins form complex assortative interaction networks through which they communicate through tiny interfaces. The analysis of the crystal structures of 50S eubacterial particles reveals that most of these interfaces involve key phylogenetically conserved residues. The systematic observation of interactions between basic and aromatic amino acids at the interfaces and along the extension provides new structural insights that may contribute to decipher the molecular mechanisms of signal transmission within or between the ribosomal proteins. Similar to neurons interacting through “molecular synapses”, ribosomal proteins form a network that suggest an analogy with a simple molecular brain in which the “sensory-proteins” innervate the functional ribosomal sites, while the “inter-proteins” interconnect them into circuits suitable to process the information flow that circulates during protein synthesis. It is likely that these circuits have evolved to coordinate both the complex macromolecular motions and the binding of the multiple factors during translation. This opens new perspectives on nanoscale information transfer and processing.

  2. A nuclear ribosomal DNA pseudogene in triatomines opens a new research field of fundamental and applied implications in Chagas disease

    Directory of Open Access Journals (Sweden)

    María Angeles Zuriaga

    2015-05-01

    Full Text Available A pseudogene, designated as "ps(5.8S+ITS-2", paralogous to the 5.8S gene and internal transcribed spacer (ITS-2 of the nuclear ribosomal DNA (rDNA, has been recently found in many triatomine species distributed throughout North America, Central America and northern South America. Among characteristics used as criteria for pseudogene verification, secondary structures and free energy are highlighted, showing a lower fit between minimum free energy, partition function and centroid structures, although in given cases the fit only appeared to be slightly lower. The unique characteristics of "ps(5.8S+ITS-2" as a processed or retrotransposed pseudogenic unit of the ghost type are reviewed, with emphasis on its potential functionality compared to the functionality of genes and spacers of the normal rDNA operon. Besides the technical problem of the risk for erroneous sequence results, the usefulness of "ps(5.8S+ITS-2" for specimen classification, phylogenetic analyses and systematic/taxonomic studies should be highlighted, based on consistence and retention index values, which in pseudogenic sequence trees were higher than in functional sequence trees. Additionally, intraindividual, interpopulational and interspecific differences in pseudogene amount and the fact that it is a pseudogene in the nuclear rDNA suggests a potential relationships with fitness, behaviour and adaptability of triatomine vectors and consequently its potential utility in Chagas disease epidemiology and control.

  3. Serum ALT levels as a surrogate marker for serum HBV DNA levels in HBeAg-negative pregnant women.

    Science.gov (United States)

    Sangfelt, Per; Von Sydow, Madeleine; Uhnoo, Ingrid; Weiland, Ola; Lindh, Gudrun; Fischler, Björn; Lindgren, Susanne; Reichard, Olle

    2004-01-01

    In Stockholm, Sweden, the majority of pregnant women positive for hepatitis B surface antigen (HBsAg) are hepatitis Be antigen (HBeAg) negative. Newborns to HBeAg positive mothers receive vaccination and hepatitis B immunoglobulin (HBIg). Newborns to HBeAg negative mothers receive vaccine and HBIg only if the mothers have elevated ALT levels. The aim of this study was to retrospectively evaluate ALT levels as a surrogate marker for HBV DNA levels in HBeAg negative carrier mothers. Altogether 8947 pregnant women were screened for HBV markers from 1999 to 2001 at the Virology Department, Karolinska Hospital. Among mothers screened 192 tested positive for HBsAg (2.2%). 13 of these samples could not be retrieved. Of the remaining 179 sera, 8 (4%) tested positive for HBeAg and 171 (95.5%) were HBeAg negative. Among the HBeAg negative mothers, 9 had HBV DNA levels > 10(5) copies/ml, and of these 7 had normal ALT levels indicating low sensitivity of an elevated ALT level as a surrogate marker for high HBV DNA level. Furthermore, no correlation was found between ALT and HBV DNA levels. Hence, it is concluded that the use of ALT as a surrogate marker for high viral replication in HBeAg negative mothers could be questioned.

  4. Forensic botany II, DNA barcode for land plants: Which markers after the international agreement?

    Science.gov (United States)

    Ferri, G; Corradini, B; Ferrari, F; Santunione, A L; Palazzoli, F; Alu', M

    2015-03-01

    The ambitious idea of using a short piece of DNA for large-scale species identification (DNA barcoding) is already a powerful tool for scientists and the application of this standard technique seems promising in a range of fields including forensic genetics. While DNA barcoding enjoyed a remarkable success for animal identification through cytochrome c oxidase I (COI) analysis, the attempts to identify a single barcode for plants remained a vain hope for a longtime. From the beginning, the Consortium for the Barcode of Life (CBOL) showed a lack of agreement on a core plant barcode, reflecting the diversity of viewpoints. Different research groups advocated various markers with divergent set of criteria until the recent publication by the CBOL-Plant Working Group. After a four-year effort, in 2009 the International Team concluded to agree on standard markers promoting a multilocus solution (rbcL and matK), with 70-75% of discrimination to the species level. In 2009 our group firstly proposed the broad application of DNA barcoding principles as a tool for identification of trace botanical evidence through the analysis of two chloroplast loci (trnH-psbA and trnL-trnF) in plant species belonging to local flora. Difficulties and drawbacks that were encountered included a poor coverage of species in specific databases and the lack of authenticated reference sequences for the selected markers. Successful preliminary results were obtained providing an approach to progressively identify unknown plant specimens to a given taxonomic rank, usable by any non-specialist botanist or in case of a shortage of taxonomic expertise. Now we considered mandatory to update and to compare our previous findings with the new selected plastid markers (matK+rbcL), taking into account forensic requirements. Features of all the four loci (the two previously analyzed trnH-psbA+trnL-trnF and matK+rbcL) were compared singly and in multilocus solutions to assess the most suitable combination for

  5. Differentiating Authentic Adenophorae Radix from Its Adulterants in Commercially-Processed Samples Using Multiplexed ITS Sequence-Based SCAR Markers

    Directory of Open Access Journals (Sweden)

    Byeong Cheol Moon

    2017-06-01

    Full Text Available Determining the precise botanical origin of a traditional herbal medicine is important for basic quality control. In both the Chinese and Korean herbal pharmacopoeia, authentic Adenophorae Radix is defined as the roots of Adenophora stricta and Adenophora triphylla. However, the roots of Codonopsis lanceolata, Codonopsis pilosula, and Glehnia littoralis are frequently distributed as Adenophorae Radix in Korean herbal markets. Unfortunately, correctly identifying dried roots is difficult using conventional methods because the roots of those species are morphologically similar. Therefore, we developed DNA-based markers for the identification of authentic Adenophorae Radix and its common adulterants in commercially-processed samples. To develop a reliable method to discriminate between Adenophorae Radix and its adulterants, we sequenced the nuclear ribosomal DNA internal transcribed spacers (nrDNA-ITS and designed sequence-characterized amplified region (SCAR primers specific to the authentic and adulterant species. Using these primers, we developed SCAR markers for each species and established a multiplex-PCR method that can authenticate the four herbal medicines in a single PCR reaction. Furthermore, we confirmed that commercially-processed herbal medicines, which often have degraded DNA, could be assessed with our method. Therefore, our method is a reliable genetic tool to protect against adulteration and to standardize the quality of Adenophorae Radix.

  6. GEOGRAPHIC DISTRIBUTION OF MOLECULAR VARIANCE WITHIN THE BLUE MARLIN (MAKAIRA NIGRICANS): A HIERARCHICAL ANALYSIS OF ALLOZYME, SINGLE-COPY NUCLEAR DNA, AND MITOCHONDRIAL DNA MARKERS.

    Science.gov (United States)

    Buonaccorsi, Vincent P; Reece, Kimberly S; Morgan, Lee W; Graves, John E

    1999-04-01

    This study presents a comparative hierarchical analysis of variance applied to three classes of molecular markers within the blue marlin (Makaira nigricans). Results are reported from analyses of four polymorphic allozyme loci, four polymorphic anonymously chosen single-copy nuclear DNA (scnDNA) loci, and previously reported restriction fragment length polymorphisms (RFLPs) of mitochondrial DNA (mtDNA). Samples were collected within and among the Atlantic and Pacific Oceans over a period of several years. Although moderate levels of genetic variation were detected at both polymorphic allozyme (H = 0.30) and scnDNA loci (H = 0.37), mtDNA markers were much more diverse (h = 0.85). Allele frequencies were significantly different between Atlantic and Pacific Ocean samples at three of four allozyme loci and three of four scnDNA loci. Estimates of allozyme genetic differentiation (θ O ) ranged from 0.00 to 0.15, with a mean of 0.08. The θ O values for scnDNA loci were similar to those of allozymes, ranging from 0.00 to 0.12 with a mean of 0.09. MtDNA RFLP divergence between oceans (θ O = 0.39) was significantly greater than divergence detected at nuclear loci (95% nuclear confidence interval = 0.04-0.11). The fourfold smaller effective population size of mtDNA and male-mediated gene flow may account for the difference observed between nuclear and mitochondrial divergence estimates. © 1999 The Society for the Study of Evolution.

  7. Molecular taxonomy of cupped oysters (Crassostrea, Saccostrea, and Striostrea) in Thailand based on COI, 16S, and 18S rDNA polymorphism.

    Science.gov (United States)

    Klinbunga, S; Khamnamtong, B; Puanglarp, N; Jarayabhand, P; Yoosukh, W; Menasveta, P

    2005-01-01

    Genetic diversity of oysters Crassostrea belcheri (Sowerby, 1871), C. iredalei (Faustino, 1932), Saccostrea cucullata (Born, 1778), S. forskali (Gmelin, 1791), and Striostrea (Parastriostrea) mytiloides (Lamarck, 1819) (Ostreoida, Mollusca) was analyzed by polymerase chain reaction - restriction fragment length polymorphism (PCR-RFLP) of 16S ribosomal DNA with AcsI, AluI, DdeI, DraI, RsaI, and TaqI, 18S ribosomal DNA with HinfI, and cytochrome oxidase subunit I with AcsI, DdeI and MboI. A total of 54 composite haplotypes were observed. Species-diagnostic markers were specifically found in C. belcheri, C. iredalei, and S. cucullata, but not in S. forskali and Striostrea mytiloides, which shared common composite haplotypes. Neighbor-joining trees constructed from genetic distances between pairs of composite haplotypes and species indicated large genetic differences between Crassostrea and Saccostrea (including Striostrea mytiloides), but closer relationships were observed within each genus. Four groups of unidentified oysters (Crassostrea sp. and Saccostrea sp. groups 1, 2, and 3) were also genetically analyzed. Fixed RFLP markers were found in Crassostrea sp. and Saccostrea sp. group 2, but not in Saccostrea sp. groups 1 and 3. Phylogenetic and genetic heterogeneity analyses indicated that Crassostrea sp. and Saccostrea sp. group 2 should be considered as newly unidentified oyster species in Thailand.

  8. Analysis of the first and second internal transcribed spacer sequences of the ribosomal DNA in Biomphalaria tenagophila complex (Mollusca: Planorbidae

    Directory of Open Access Journals (Sweden)

    Teofânia HDA Vidigal

    2004-03-01

    Full Text Available The first and second internal transcribed spacer regions (ITS1 and ITS2 of the ribosomal DNA of Biomphalaria tenagophila complex (B. tenagophila, B. occidentalis, and B. t. guaibensis were sequenced and compared. The alignment lengths of these regions were about 655 bp and 481 bp, respectively. Phylogenetic relationships among the Biomphalaria species were inferred by Maximum Parsimony and Neighbor-joining methods. The phylogenetic trees produced, in most of the cases, were in accordance with morphological systematics and other molecular data previously obtained by polymerase chain reaction and restriction fragment length polymorphism analysis. The present results provide support for the proposal that B. tenagophila represents a complex comprising B. tenagophila, B. occidentalis and B. t. guaibensis.

  9. The ribosome biogenesis factor Nol11 is required for optimal rDNA transcription and craniofacial development in Xenopus.

    Directory of Open Access Journals (Sweden)

    John N Griffin

    2015-03-01

    Full Text Available The production of ribosomes is ubiquitous and fundamental to life. As such, it is surprising that defects in ribosome biogenesis underlie a growing number of symptomatically distinct inherited disorders, collectively called ribosomopathies. We previously determined that the nucleolar protein, NOL11, is essential for optimal pre-rRNA transcription and processing in human tissue culture cells. However, the role of NOL11 in the development of a multicellular organism remains unknown. Here, we reveal a critical function for NOL11 in vertebrate ribosome biogenesis and craniofacial development. Nol11 is strongly expressed in the developing cranial neural crest (CNC of both amphibians and mammals, and knockdown of Xenopus nol11 results in impaired pre-rRNA transcription and processing, increased apoptosis, and abnormal development of the craniofacial cartilages. Inhibition of p53 rescues this skeletal phenotype, but not the underlying ribosome biogenesis defect, demonstrating an evolutionarily conserved control mechanism through which ribosome-impaired craniofacial cells are removed. Excessive activation of this mechanism impairs craniofacial development. Together, our findings reveal a novel requirement for Nol11 in craniofacial development, present the first frog model of a ribosomopathy, and provide further insight into the clinically important relationship between specific ribosome biogenesis proteins and craniofacial cell survival.

  10. Crosstalk between the nucleolus and the DNA damage response.

    Science.gov (United States)

    Ogawa, L M; Baserga, S J

    2017-02-28

    Nucleolar function and the cellular response to DNA damage have long been studied as distinct disciplines. New research and a new appreciation for proteins holding multiple functional roles, however, is beginning to change the way we think about the crosstalk among distinct cellular processes. Here, we focus on the crosstalk between the DNA damage response and the nucleolus, including a comprehensive review of the literature that reveals a role for conventional DNA repair proteins in ribosome biogenesis, and conversely, ribosome biogenesis proteins in DNA repair. Furthermore, with recent advances in nucleolar proteomics and a growing list of proteins that localize to the nucleolus, it is likely that we will continue to identify new DNA repair proteins with a nucleolar-specific role. Given the importance of ribosome biogenesis and DNA repair in essential cellular processes and the role that they play in diverse pathologies, continued elucidation of the overlap between these two disciplines will be essential to the advancement of both fields and to the development of novel therapeutics.

  11. Mitochondrial ribosomal protein S18-2 evokes chromosomal instability and transforms primary rat skin fibroblasts

    KAUST Repository

    Kashuba, Elena; Carbone, Ennio; Di Fabrizio, Enzo M.; Tirinato, Luca; Petruchek, Maria; Drummond, Catherine; Kovalevska, Larysa; Gurrapu, Sreeharsha; Mushtaq, Muhammad; Darekar, Suhas D.

    2015-01-01

    We have shown earlier that overexpression of the human mitochondrial ribosomal protein MRPS18-2 (S18-2) led to immortalization of primary rat embryonic fibroblasts. The derived cells expressed the embryonic stem cell markers, and cellular pathways

  12. RINT-1 interacts with MSP58 within nucleoli and plays a role in ribosomal gene transcription.

    Science.gov (United States)

    Yang, Chuan-Pin; Kuo, Yu-Liang; Lee, Yi-Chao; Lee, Kuen-Haur; Chiang, Chi-Wu; Wang, Ju-Ming; Hsu, Che-Chia; Chang, Wen-Chang; Lin, Ding-Yen

    2016-09-16

    The nucleolus is the cellular site of ribosomal (r)DNA transcription and ribosome biogenesis. The 58-kDa microspherule protein (MSP58) is a nucleolar protein involved in rDNA transcription and cell proliferation. However, regulation of MSP58-mediated rDNA transcription remains unknown. Using a yeast two-hybrid system with MSP58 as bait, we isolated complementary (c)DNA encoding Rad50-interacting protein 1 (RINT-1), as a MSP58-binding protein. RINT-1 was implicated in the cell cycle checkpoint, membrane trafficking, Golgi apparatus and centrosome dynamic integrity, and telomere length control. Both in vitro and in vivo interaction assays showed that MSP58 directly interacts with RINT-1. Interestingly, microscopic studies revealed the co-localization of MSP58, RINT-1, and the upstream binding factor (UBF), a rRNA transcription factor, in the nucleolus. We showed that ectopic expression of MSP58 or RINT-1 resulted in decreased rRNA expression and rDNA promoter activity, whereas knockdown of MSP58 or RINT-1 by siRNA exerted the opposite effect. Coexpression of MSP58 and RINT-1 robustly decreased rRNA synthesis compared to overexpression of either protein alone, whereas depletion of RINT-1 from MSP58-transfected cells enhanced rRNA synthesis. We also found that MSP58, RINT-1, and the UBF were associated with the rDNA promoter using a chromatin immunoprecipitation assay. Because aberrant ribosome biogenesis contributes to neoplastic transformation, our results revealed a novel protein complex involved in the regulation of rRNA gene expression, suggesting a role for MSP58 and RINT-1 in cancer development. Copyright © 2016 Elsevier Inc. All rights reserved.

  13. Defective replication initiation results in locus specific chromosome breakage and a ribosomal RNA deficiency in yeast.

    Directory of Open Access Journals (Sweden)

    Joseph C Sanchez

    2017-10-01

    Full Text Available A form of dwarfism known as Meier-Gorlin syndrome (MGS is caused by recessive mutations in one of six different genes (ORC1, ORC4, ORC6, CDC6, CDT1, and MCM5. These genes encode components of the pre-replication complex, which assembles at origins of replication prior to S phase. Also, variants in two additional replication initiation genes have joined the list of causative mutations for MGS (Geminin and CDC45. The identity of the causative MGS genetic variants strongly suggests that some aspect of replication is amiss in MGS patients; however, little evidence has been obtained regarding what aspect of chromosome replication is faulty. Since the site of one of the missense mutations in the human ORC4 alleles is conserved between humans and yeast, we sought to determine in what way this single amino acid change affects the process of chromosome replication, by introducing the comparable mutation into yeast (orc4Y232C. We find that yeast cells with the orc4Y232C allele have a prolonged S-phase, due to compromised replication initiation at the ribosomal DNA (rDNA locus located on chromosome XII. The inability to initiate replication at the rDNA locus results in chromosome breakage and a severely reduced rDNA copy number in the survivors, presumably helping to ensure complete replication of chromosome XII. Although reducing rDNA copy number may help ensure complete chromosome replication, orc4Y232C cells struggle to meet the high demand for ribosomal RNA synthesis. This finding provides additional evidence linking two essential cellular pathways-DNA replication and ribosome biogenesis.

  14. Defective replication initiation results in locus specific chromosome breakage and a ribosomal RNA deficiency in yeast.

    Science.gov (United States)

    Sanchez, Joseph C; Kwan, Elizabeth X; Pohl, Thomas J; Amemiya, Haley M; Raghuraman, M K; Brewer, Bonita J

    2017-10-01

    A form of dwarfism known as Meier-Gorlin syndrome (MGS) is caused by recessive mutations in one of six different genes (ORC1, ORC4, ORC6, CDC6, CDT1, and MCM5). These genes encode components of the pre-replication complex, which assembles at origins of replication prior to S phase. Also, variants in two additional replication initiation genes have joined the list of causative mutations for MGS (Geminin and CDC45). The identity of the causative MGS genetic variants strongly suggests that some aspect of replication is amiss in MGS patients; however, little evidence has been obtained regarding what aspect of chromosome replication is faulty. Since the site of one of the missense mutations in the human ORC4 alleles is conserved between humans and yeast, we sought to determine in what way this single amino acid change affects the process of chromosome replication, by introducing the comparable mutation into yeast (orc4Y232C). We find that yeast cells with the orc4Y232C allele have a prolonged S-phase, due to compromised replication initiation at the ribosomal DNA (rDNA) locus located on chromosome XII. The inability to initiate replication at the rDNA locus results in chromosome breakage and a severely reduced rDNA copy number in the survivors, presumably helping to ensure complete replication of chromosome XII. Although reducing rDNA copy number may help ensure complete chromosome replication, orc4Y232C cells struggle to meet the high demand for ribosomal RNA synthesis. This finding provides additional evidence linking two essential cellular pathways-DNA replication and ribosome biogenesis.

  15. Detection of Variation in Long-Term Micropropagated Mature Pistachio via DNA-Based Molecular Markers.

    Science.gov (United States)

    Akdemir, Hülya; Suzerer, Veysel; Tilkat, Engin; Onay, Ahmet; Çiftçi, Yelda Ozden

    2016-12-01

    Determination of genetic stability of in vitro-grown plantlets is needed for safe and large-scale production of mature trees. In this study, genetic variation of long-term micropropagated mature pistachio developed through direct shoot bud regeneration using apical buds (protocol A) and in vitro-derived leaves (protocol B) was assessed via DNA-based molecular markers. Randomly amplified polymorphic DNA (RAPD), inter-simple sequence repeat (ISSR), and amplified fragment length polymorphism (AFLP) were employed, and the obtained PIC values from RAPD (0.226), ISSR (0.220), and AFLP (0.241) showed that micropropagation of pistachio for different periods of time resulted in "reasonable polymorphism" among donor plant and its 18 clones. Mantel's test showed a consistence polymorphism level between marker systems based on similarity matrices. In conclusion, this is the first study on occurrence of genetic variability in long-term micropropagated mature pistachio plantlets. The obtained results clearly indicated that different marker approaches used in this study are reliable for assessing tissue culture-induced variations in long-term cultured pistachio plantlets.

  16. Development of Insertion and Deletion Markers for Bottle Gourd Based on Restriction Site-associated DNA Sequencing Data

    Directory of Open Access Journals (Sweden)

    Xinyi WU

    2017-01-01

    Full Text Available Bottle gourd is an important cucurbit crop worldwide. To provide more available molecular markers for this crop, a bioinformatic approach was employed to develop insertion–deletions (InDels markers in bottle gourd based on restriction site-associated DNA sequencing (RAD-Seq data. A total of 892 Indels were predicted, with the length varying from 1 bp to 167 bp. Single-nucleotide InDels were the predominant types of InDels. To validate these InDels, PCR primers were designed from 162 loci where InDels longer than 2 bp were predicated. A total of 112 InDels were found to be polymorphic among 9 bottle gourd accessions under investigation. The rate of prediction accuracy was thus at a high level of 72.7%. DNA fingerprinting for 4 cultivars were performed using 8 selected Indels markers, demonstrating the usefulness of these markers.

  17. Silencing of ribosomal protein S9 elicits a multitude of cellular responses inhibiting the growth of cancer cells subsequent to p53 activation.

    Directory of Open Access Journals (Sweden)

    Mikael S Lindström

    Full Text Available BACKGROUND: Disruption of the nucleolus often leads to activation of the p53 tumor suppressor pathway through inhibition of MDM2 that is mediated by a limited set of ribosomal proteins including RPL11 and RPL5. The effects of ribosomal protein loss in cultured mammalian cells have not been thoroughly investigated. Here we characterize the cellular stress response caused by depletion of ribosomal protein S9 (RPS9. METHODOLOGY/PRINCIPAL FINDINGS: Depletion of RPS9 impaired production of 18S ribosomal RNA and induced p53 activity. It promoted p53-dependent morphological differentiation of U343MGa Cl2:6 glioma cells as evidenced by intensified expression of glial fibrillary acidic protein and profound changes in cell shape. U2OS osteosarcoma cells displayed a limited senescence response with increased expression of DNA damage response markers, whereas HeLa cervical carcinoma cells underwent cell death by apoptosis. Knockdown of RPL11 impaired p53-dependent phenotypes in the different RPS9 depleted cell cultures. Importantly, knockdown of RPS9 or RPL11 also markedly inhibited cell proliferation through p53-independent mechanisms. RPL11 binding to MDM2 was retained despite decreased levels of RPL11 protein following nucleolar stress. In these settings, RPL11 was critical for maintaining p53 protein stability but was not strictly required for p53 protein synthesis. CONCLUSIONS: p53 plays an important role in the initial restriction of cell proliferation that occurs in response to decreased level of RPS9. Our results do not exclude the possibility that other nucleolar stress sensing molecules act upstream or in parallel to RPL11 to activate p53. Inhibiting the expression of certain ribosomal proteins, such as RPS9, could be one efficient way to reinitiate differentiation processes or to induce senescence or apoptosis in rapidly proliferating tumor cells.

  18. Molecular characterization of Anthurium genotypes by using DNA fingerprinting and SPAR markers.

    Science.gov (United States)

    Souza Neto, J D; Soares, T C B; Motta, L B; Cabral, P D S; Silva, J A

    2014-07-02

    We characterized single primer amplification reaction (SPAR) molecular markers from 20 genotypes of Anthurium andraeanum Lind., including 3 from commercial varieties and 17 from 2 communities in the State of Espírito Santo, Brazil. Twenty-four SPAR, consisting of 7 random amplified polymorphic DNA and 17 inter-simple sequence repeat markers were used to estimate the genetic diversity of 20 Anthurium accessions. The set of SPAR markers generated 288 bands and showed an average polymorphism percentage of 93.39%, ranging from 71.43 to 100%. The polymorphism information content (PIC) of the random amplified polymorphic DNA primers averaged 0.364 and ranged from 0.258 to 0.490. Primer OPF 06 showed the lowest PIC, while OPAM 14 was the highest. The average PIC of the inter-simple sequence repeat primers was 0.299, with values ranging from 0.196 to 0.401. Primer UBC 845 had the lowest PIC (0.196), while primer UCB 810 had the highest (0.401). By using the complement of Jaccard's similarity index and unweighted pair group method with arithmetic mean clustering, 5 clusters were formed with a cophenetic correlation coefficient of 0.8093, indicating an acceptable clustering consistency. However, no genotype clustering patterns agreed with the morphological data. The Anthurium genotypes investigated in this study are a germplasm source for conservational research and may be used in improvement programs for this species.

  19. ATM-dependent E2F1 accumulation in the nucleolus is an indicator of ribosomal stress in early response to DNA damage.

    Science.gov (United States)

    Jin, Ya-Qiong; An, Guo-Shun; Ni, Ju-Hua; Li, Shu-Yan; Jia, Hong-Ti

    2014-01-01

    The nucleolus plays a major role in ribosome biogenesis. Most genotoxic agents disrupt nucleolar structure and function, which results in the stabilization/activation of p53, inducing cell cycle arrest or apoptosis. Likewise, transcription factor E2F1 as a DNA damage responsive protein also plays roles in cell cycle arrest, DNA repair, or apoptosis in response to DNA damage through transcriptional response and protein-protein interaction. Furthermore, E2F1 is known to be involved in regulating rRNA transcription. However, how E2F1 displays in coordinating DNA damage and nucleolar stress is unclear. In this study, we demonstrate that ATM-dependent E2F1 accumulation in the nucleolus is a characteristic feature of nucleolar stress in early response to DNA damage. We found that at the early stage of DNA damage, E2F1 accumulation in the nucleolus was an ATM-dependent and a common event in p53-suficient and -deficient cells. Increased nucleolar E2F1 was sequestered by the nucleolar protein p14ARF, which repressed E2F1-dependent rRNA transcription initiation, and was coupled with S phase. Our data indicate that early accumulation of E2F1 in the nucleolus is an indicator for nucleolar stress and a component of ATM pathway, which presumably buffers elevation of E2F1 in the nucleoplasm and coordinates the diversifying mechanisms of E2F1 acts in cell cycle progression and apoptosis in early response to DNA damage.

  20. Assessment of four molecular markers as potential DNA barcodes for red algae Kappaphycus Doty and Eucheuma J. Agardh (Solieriaceae, Rhodophyta).

    Science.gov (United States)

    Tan, Ji; Lim, Phaik-Eem; Phang, Siew-Moi; Hong, Dang Diem; Sunarpi, H; Hurtado, Anicia Q

    2012-01-01

    DNA barcoding has been a major advancement in the field of taxonomy, seeing much effort put into the barcoding of wide taxa of organisms, macro and microalgae included. The mitochondrial-encoded cox1 and plastid-encoded rbcL has been proposed as potential DNA barcodes for rhodophytes, but are yet to be tested on the commercially important carrageenophytes Kappaphycus and Eucheuma. This study gauges the effectiveness of four markers, namely the mitochondrial cox1, cox2, cox2-3 spacer and the plastid rbcL in DNA barcoding on selected Kappaphycus and Eucheuma from Southeast Asia. Marker assessments were performed using established distance and tree-based identification criteria from earlier studies. Barcoding patterns on a larger scale were simulated by empirically testing on the commonly used cox2-3 spacer. The phylogeny of these rhodophytes was also briefly described. In this study, the cox2 marker which satisfies the prerequisites of DNA barcodes was found to exhibit moderately high interspecific divergences with no intraspecific variations, thus a promising marker for the DNA barcoding of Kappaphycus and Eucheuma. However, the already extensively used cox2-3 spacer was deemed to be in overall more appropriate as a DNA barcode for these two genera. On a wider scale, cox1 and rbcL were still better DNA barcodes across the rhodophyte taxa when practicality and cost-efficiency were taken into account. The phylogeny of Kappaphycus and Eucheuma were generally similar to those earlier reported. Still, the application of DNA barcoding has demonstrated our relatively poor taxonomic comprehension of these seaweeds, thus suggesting more in-depth efforts in taxonomic restructuring as well as establishment.

  1. [Genomic DNA fingerprints of Legionella pneumophila serogroup 2 strains as an epidemiologic marker].

    Science.gov (United States)

    Bender-Beck, L; Mühlenberg, W; Lück, P C; Ott, M; Horbach, I; Fehrenbach, F J; Wewalka, G; Hacker, J

    1995-08-01

    Using pulsed-field gel electrophoresis, DNA fingerprints of eleven Legionella pneumophila isolates of serogroup 2 were generated. It was shown that two strains from a patient suffering from pneumonia as well as three environmental strains isolated from the shower in the hotel where the patient stayed 5 days before his illness were identical. Six strains of the same serogroup isolated from other sources were clearly separated. Thus, DNA fingerprints by pulsed-field gel electrophoresis are excellent epidemiological markers for the rarely occurring serogroup 2 of Legionella pneumophila.

  2. A new genus of athecate interstitial dinoflagellates, Togula gen. nov., previously encompassed within Amphidinium sensu lato: Inferred from light and electron microscopy and phylogenetic analyses of partial large subunit ribosomal DNA sequences

    DEFF Research Database (Denmark)

    Jørgensen, Mårten Flø; Murray, Shauna; Daugbjerg, Niels

    2004-01-01

    was not closely related to other genera included in the molecular phylogenetic analyses, but formed a highly supported clade in Bayesian analysis together with the six small-sized strains. The six strains also formed a highly supported clade, consisting of two closely related, albeit distinct, clades. Light......The recent emendation of Amphidinium (Dinophyceae), which now only consists of species with minute left-deflected epicone, has left more than 100 species without a clear generic affiliation. In the present study, a strain identified as one of the species with a divergent epicone type, Amphidinium...... subunit ribosomal DNA as well as in size and shape. Based on morphological similarity and partial large subunit ribosomal DNA evidence, we erect the new genus, Togula gen. nov. with the emended type species Togula britannica (Herdman) comb. nov. Based on differences in division pattern and partial large...

  3. Mitochondrial DNA Marker EST00083 Is Not Associated with High vs. Average IQ in a German Sample.

    Science.gov (United States)

    Moises, Hans W.; Yang, Liu; Kohnke, Michael; Vetter, Peter; Neppert, Jurgen; Petrill, Stephen A.; Plomin, Robert

    1998-01-01

    Tested the association of a mitochondrial DNA marker (EST00083) with high IQ in a sample of 47 German adults with high IQ scores and 77 adults with IQs estimated at lower than 110. Results do not support the hypothesis that high IQ is associated with this marker. (SLD)

  4. Circulating cell-free DNA: an up-coming molecular marker in exercise physiology.

    Science.gov (United States)

    Breitbach, Sarah; Tug, Suzan; Simon, Perikles

    2012-07-01

    The phenomenon of circulating cell-free DNA (cfDNA) concentrations is of importance for many biomedical disciplines including the field of exercise physiology. Increases of cfDNA due to exercise are described to be a potential hallmark for the overtraining syndrome and might be related to, or trigger adaptations of, immune function induced by strenuous exercise. At the same time, exercise provides a practicable model for studying the phenomenon of cfDNA that is described to be of pathophysiological relevance for different topics in clinical medicine like autoimmune diseases and cancer. In this review, we are summarizing the current knowledge of exercise-based acute and chronic alterations in cfDNA levels and their physiological significance. The effects of acute exercise on cfDNA concentrations have been investigated in resistance exercises and in continuous, stepwise and interval endurance exercises of different durations. cfDNA concentrations peaked immediately after acute exercise and showed a rapid return to baseline levels. Typical markers of skeletal muscle damage (creatine kinase, uric acid, C-reactive protein) show delayed kinetics compared with the cfDNA peak response. Exercise parameters such as intensity, duration or average energy expenditure do not explain the extent of increasing cfDNA concentrations after strenuous exercise. This could be due to complex processes inside the human organism during and after physical activity. Therefore, we hypothesize composite effects of different physiological stress parameters that come along with exercise to be responsible for increasing cfDNA concentrations. We suggest that due to acute stress, cfDNA levels increase rapidly by a spontaneous active or passive release mechanism that is not yet known. As a result of the rapid and parallel increase of cfDNA and lactate in an incremental treadmill test leading to exhaustion within 15-20 minutes, it is unlikely that cfDNA is released into the plasma by typical necrosis

  5. Epigenetic up-regulation of ribosome biogenesis and more aggressive phenotype triggered by the lack of the histone demethylase JHDM1B in mammary epithelial cells.

    Science.gov (United States)

    Galbiati, Alice; Penzo, Marianna; Bacalini, Maria Giulia; Onofrillo, Carmine; Guerrieri, Ania Naila; Garagnani, Paolo; Franceschi, Claudio; Treré, Davide; Montanaro, Lorenzo

    2017-06-06

    The alterations of ribosome biogenesis and protein synthesis play a direct role in the development of tumors. The accessibility and transcription of ribosomal genes is controlled at several levels, with their epigenetic regulation being one of the most important. Here we explored the JmjC domain-containing histone demethylase 1B (JHDM1B) function in the epigenetic control of rDNA transcription. Since JHDM1B is a negative regulator of gene transcription, we focused on the effects induced by JHDM1B knock-down (KD). We studied the consequences of stable inducible JHDM1B silencing in cell lines derived from transformed and untransformed mammary epithelial cells. In these cellular models, prolonged JHDM1B downregulation triggered a surge of 45S pre-rRNA transcription and processing, associated with a re-modulation of the H3K36me2 levels at rDNA loci and with changes in DNA methylation of specific CpG sites in rDNA genes. We also found that after JHDM1B KD, cells showed a higher ribosome content: which were engaged in mRNA translation. JHDM1B KD and the consequent stimulation of ribosomes biogenesis conferred more aggressive features to the tested cellular models, which acquired a greater clonogenic, staminal and invasive potential. Taken together, these data indicate that the reduction of JHDM1B leads to a more aggressive cellular phenotype in mammary gland cells, by virtue of its negative regulatory activity on ribosome biogenesis.

  6. The value of using DNA markers for beef bull selection in the seedstock sector.

    Science.gov (United States)

    Van Eenennaam, A L; van der Werf, J H J; Goddard, M E

    2011-02-01

    The objective of this study was to estimate the value derived from using DNA information to increase the accuracy of beef sire selection in a closed seedstock herd. Breeding objectives for commercial production systems targeting 2 diverse markets were examined using multiple-trait selection indexes developed for the Australian cattle industry. Indexes included those for both maternal (self-replacing) and terminal herds targeting either a domestic market, where steers are finished on pasture, or the export market, where steers are finished on concentrate rations in feedlots and marbling has a large value. Selection index theory was used to predict the response to conventional selection based on phenotypic performance records, and this was compared with including information from 2 hypothetical marker panels. In 1 case the marker panel explained a percentage of additive genetic variance equal to the heritability for all traits in the breeding objective and selection criteria, and in the other case to one-half of this amount. Discounted gene flow methodology was used to calculate the value derived from the use of superior bulls selected using DNA test information and performance recording over that derived from conventional selection using performance recording alone. Results were ultimately calculated as discounted returns per DNA test purchased by the seedstock operator. The DNA testing using these hypothetical marker panels increased the selection response between 29 to 158%. The value of this improvement above that obtained using traditional performance recording ranged from $89 to 565 per commercial bull, and $5,332 to 27,910 per stud bull. Assuming that the entire bull calf crop was tested to achieve these gains, the value of the genetic gain derived from DNA testing ranged from $204 to 1,119 per test. All values assumed that the benefits derived from using superior bulls were efficiently transferred along the production chain to the seedstock producer incurring

  7. A comparison of molecular markers to detect Lutzomyia longipalpis naturally infected with Leishmania (Leishmania infantum

    Directory of Open Access Journals (Sweden)

    Kárita Cláudia Freitas-Lidani

    2014-07-01

    Full Text Available The aim of the present study was to detect natural infection by Leishmania (Leishmania infantum in Lutzomyia longipalpis captured in Barcarena, state of Pará, Brazil, through the use of three primer sets. With this approach, it is unnecessary to previously dissect the sandfly specimens. DNA of 280 Lu. longipalpis female specimens were extracted from the whole insects. PCR primers for kinetoplast minicircle DNA (kDNA, the mini-exon gene and the small subunit ribosomal RNA (SSU-rRNA gene of Leishmania were used, generating fragments of 400 bp, 780 bp and 603 bp, respectively. Infection by the parasite was found with the kDNA primer in 8.6% of the cases, with the mini-exon gene primer in 7.1% of the cases and with the SSU-rRNA gene primer in 5.3% of the cases. These data show the importance of polymerase chain reaction as a tool for investigating the molecular epidemiology of visceral leishmaniasis by estimating the risk of disease transmission in endemic areas, with the kDNA primer representing the most reliable marker for the parasite.

  8. The utility of mtDNA and rDNA for barcoding and phylogeny of plant-parasitic nematodes from Longidoridae (Nematoda, Enoplea).

    Science.gov (United States)

    Palomares-Rius, J E; Cantalapiedra-Navarrete, C; Archidona-Yuste, A; Subbotin, S A; Castillo, P

    2017-09-07

    The traditional identification of plant-parasitic nematode species by morphology and morphometric studies is very difficult because of high morphological variability that can lead to considerable overlap of many characteristics and their ambiguous interpretation. For this reason, it is essential to implement approaches to ensure accurate species identification. DNA barcoding aids in identification and advances species discovery. This study sought to unravel the use of the mitochondrial marker cytochrome c oxidase subunit 1 (coxI) as barcode for Longidoridae species identification, and as a phylogenetic marker. The results showed that mitochondrial and ribosomal markers could be used as barcoding markers, except for some species from the Xiphinema americanum group. The ITS1 region showed a promising role in barcoding for species identification because of the clear molecular variability among species. Some species presented important molecular variability in coxI. The analysis of the newly provided sequences and the sequences deposited in GenBank showed plausible misidentifications, and the use of voucher species and topotype specimens is a priority for this group of nematodes. The use of coxI and D2 and D3 expansion segments of the 28S rRNA gene did not clarify the phylogeny at the genus level.

  9. Phylogenetic study of Geitlerinema and Microcystis (Cyanobacteria) using PC-IGS and 16S-23S ITS as markers: investigation of horizontal gene transfer.

    Science.gov (United States)

    Piccin-Santos, Viviane; Brandão, Marcelo Mendes; Bittencourt-Oliveira, Maria Do Carmo

    2014-08-01

    Selection of genes that have not been horizontally transferred for prokaryote phylogenetic inferences is regarded as a challenging task. The markers internal transcribed spacer of ribosomal genes (16S-23S ITS) and phycocyanin intergenic spacer (PC-IGS), based on the operons of ribosomal and phycocyanin genes respectively, are among the most used markers in cyanobacteria. The region of the ribosomal genes has been considered stable, whereas the phycocyanin operon may have undergone horizontal transfer. To investigate the occurrence of horizontal transfer of PC-IGS, phylogenetic trees of Geitlerinema and Microcystis strains were generated using PC-IGS and 16S-23S ITS and compared. Phylogenetic trees based on the two markers were mostly congruent for Geitlerinema and Microcystis, indicating a common evolutionary history among ribosomal and phycocyanin genes with no evidence for horizontal transfer of PC-IGS. Thus, PC-IGS is a suitable marker, along with 16S-23S ITS for phylogenetic studies of cyanobacteria. © 2014 Phycological Society of America.

  10. INTERNAL TRANSCRIBED SPACER (ITS), AN IDEAL DNA BARCODE FOR SPECIES DISCRIMINATION IN CRAWFURDIA WALL. (GENTIANACEAE).

    Science.gov (United States)

    Zhang, Dequan; Jiang, Bei; Duan, Lizhen; Zhou, Nong

    2016-01-01

    DNA barcoding is a technique used to identify species based on species-specific differences in short regions of their DNA. It is widely used in species discrimination of medicinal plants and traditional medicines. In the present study, four potential DNA barcodes, namely rbcL , matK , trnH-psbA and ITS (nuclear ribosomal internal transcribed spacer) were adopted for species discrimination in Crawfurdia Wall (Genetiaceae). Identification ability of these DNA barcodes and combinations were evaluated using three classic methods (Distance, Blast and Tree-Building). As a result, ITS, trnH-psbA and rbcL regions showed great universality for a success rate of 100%; whereas matK was disappointing for which only 65% samples gained useful DNA sequences. ITS region, which could clearly and effectively identify the five species in Crawfurdia , performed very well in this study. On the contrary, trnH-psbA and rbcL performed poorly in discrimination among these species. ITS marker was an ideal DNA barcode in Crawfurdia and it should be incorporated into one of the core barcodes for seed plants.

  11. Gene conversion of ribosomal DNA in Nicotiana tabacum is associated with undermethylated, decondensed and probably active gene units.

    Science.gov (United States)

    Lim, K Y; Kovarik, A; Matýăsek, R; Bezdĕk, M; Lichtenstein, C P; Leitch, A R

    2000-06-01

    We examined the structure, intranuclear distribution and activity of ribosomal DNA (rDNA) in Nicotiana sylvestris (2n = 2x = 24) and N. tomentosiformis (2n = 2x = 24) and compared these with patterns in N. tabacum (tobacco, 2n = 4x = 48). We also examined a long-established N. tabacum culture, TBY-2. Nicotiana tabacum is an allotetraploid thought to be derived from ancestors of N. sylvestris (S-genome donor) and N. tomentosiformis (T-genome donor). Nicotiana sylvestris has three rDNA loci, one locus each on chromosomes 10, 11, and 12. In root-tip meristematic interphase cells, the site on chromosome 12 remains condensed and inactive, while the sites on chromosomes 10 and 11 show activity at the proximal end of the locus only. Nicotiana tomentosiformis has one major locus on chromosome 3 showing activity and a minor, inactive locus on chromosome 11. In N. tabacum cv. 095-55, there are four rDNA loci on T3, S10, S11/t and S12 (S11/t carries a small T-genome translocation). The locus on S12 remains condensed and inactive in root-tip meristematic cells while the others show activity, including decondensation at interphase and secondary constrictions at metaphase. Nicotiana tabacum DNA digested with methylcytosine-sensitive enzymes revealed a hybridisation pattern for rDNA that resembled that of N. tomentosiformis and not N. sylvestris. The data indicate that active, undermethylated genes are of the N. tomentosiformis type. Since S-genome chromosomes of N. tabacum show rDNA expression, the result indicates rDNA gene conversion of the active rDNA units on these chromosomes. Gene conversion in N. tabacum is consistent with the results of previous work. However, using primers specific for the S-genome rDNA intergenic sequences (IGS) in the polymerase chain reaction (PCR) show that rDNA gene conversion has not gone to completion in N. tabacum. Furthermore, using methylation-insensitive restriction enzymes we demonstrate that about 8% of the rDNA units remain of the N

  12. Enhanced expression of melanoma progression markers in mouse model of sleep apnea

    Directory of Open Access Journals (Sweden)

    S. Perini

    2016-07-01

    Full Text Available Introduction: Obstructive sleep apnea has been associated with higher cancer incidence and mortality. Increased melanoma aggressivity was reported in obstructive sleep apnea patients. Mice exposed to intermittent hypoxia (IH mimicking sleep apnea show enhanced melanoma growth. Markers of melanoma progression have not been investigated in this model. Objective: The present study examined whether IH affects markers of melanoma tumor progression. Methods: Mice were exposed to isocapnic IH to a nadir of 8% oxygen fraction for 14 days. One million B16F10 melanoma cells were injected subcutaneously. Immunohistochemistry staining for Ki-67, PCNA, S100-beta, HMB-45, Melan-A, TGF-beta, Caspase-1, and HIF-1alpha were quantified using Photoshop. Results: Percentage of positive area stained was higher in IH than sham IH group for Caspase-1, Ki-67, PCNA, and Melan-A. The greater expression of several markers of tumor aggressiveness, including markers of ribosomal RNA transcription (Ki-67 and of DNA synthesis (PCNA, in mice exposed to isocapnic IH than in controls provide molecular evidence for a apnea–cancer relationship. Conclusions: These findings have potential repercussions in the understanding of differences in clinical course of tumors in obstructive sleep apnea patients. Further investigation is necessary to confirm mechanisms of these descriptive results. Keywords: Apnea, Melanoma, Biological markers

  13. Diagnostic value of stool DNA testing for multiple markers of colorectal cancer and advanced adenoma: a meta-analysis.

    Science.gov (United States)

    Yang, Hua; Xia, Bing-Qing; Jiang, Bo; Wang, Guozhen; Yang, Yi-Peng; Chen, Hao; Li, Bing-Sheng; Xu, An-Gao; Huang, Yun-Bo; Wang, Xin-Ying

    2013-08-01

    The diagnostic value of stool DNA (sDNA) testing for colorectal neoplasms remains controversial. To compensate for the lack of large-scale unbiased population studies, a meta-analysis was performed to evaluate the diagnostic value of sDNA testing for multiple markers of colorectal cancer (CRC) and advanced adenoma. The PubMed, Science Direct, Biosis Review, Cochrane Library and Embase databases were systematically searched in January 2012 without time restriction. Meta-analysis was performed using a random-effects model using sensitivity, specificity, diagnostic OR (DOR), summary ROC curves, area under the curve (AUC), and 95% CIs as effect measures. Heterogeneity was measured using the χ(2) test and Q statistic; subgroup analysis was also conducted. A total of 20 studies comprising 5876 individuals were eligible. There was no heterogeneity for CRC, but adenoma and advanced adenoma harboured considerable heterogeneity influenced by risk classification and various detection markers. Stratification analysis according to risk classification showed that multiple markers had a high DOR for the high-risk subgroups of both CRC (sensitivity 0.759 [95% CI 0.711 to 0.804]; specificity 0.883 [95% CI 0.846 to 0.913]; AUC 0.906) and advanced adenoma (sensitivity 0.683 [95% CI 0.584 to 0.771]; specificity 0.918 [95% CI 0.866 to 0.954]; AUC 0.946) but not for the average-risk subgroups of either. In the methylation subgroup, sDNA testing had significantly higher DOR for CRC (sensitivity 0.753 [95% CI 0.685 to 0.812]; specificity 0.913 [95% CI 0.860 to 0.950]; AUC 0.918) and advanced adenoma (sensitivity 0.623 [95% CI 0.527 to 0.712]; specificity 0.926 [95% CI 0.882 to 0.958]; AUC 0.910) compared with the mutation subgroup. There was no significant heterogeneity among studies for subgroup analysis. sDNA testing for multiple markers had strong diagnostic significance for CRC and advanced adenoma in high-risk subjects. Methylation makers had more diagnostic value than mutation

  14. Elevated levels of urinary markers of oxidatively generated DNA and RNA damage in bipolar disorder

    DEFF Research Database (Denmark)

    Munkholm, Klaus; Poulsen, Henrik Enghusen; Kessing, Lars Vedel

    2015-01-01

    OBJECTIVES: The pathophysiological mechanisms underlying bipolar disorder and its multi-system nature are unclear. Oxidatively generated damage to nucleosides has been demonstrated in metabolic disorders; however, the extent to which this occurs in bipolar disorder in vivo is unknown. We...... investigated oxidatively generated damage to DNA and RNA in patients with bipolar disorder and its relationship with the affective phase compared with healthy control subjects. METHODS: Urinary excretion of 8-oxo-7,8-dihydro-2'-deoxyguanosine (8-oxodG) and 8-oxo-7,8-dihydroguanosine (8-oxoGuo), markers...... of oxidatively generated DNA and RNA damage, respectively, was measured in 37 rapid cycling patients with bipolar disorder and in 40 age- and gender-matched healthy control subjects. Employing a longitudinal design, repeated measurements of both markers were evaluated in various affective phases in patients...

  15. A ribosomal RNA gene intergenic spacer based PCR and DGGE fingerprinting method for the analysis of specific rhizobial communities in soil

    NARCIS (Netherlands)

    de Oliveira, VM; Manfio, GP; Coutinho, HLD; Keijzer-Wolters, AC; van Elsas, JD

    A direct molecular method for assessing the diversity of specific populations of rhizobia in soil, based on nested PCR amplification of 16S-23S ribosomal RNA gene (rDNA) intergenic spacer (IGS) sequences, was developed. Initial generic amplification of bacterial rDNA IGS sequences from soil DNA was

  16. A ribosomal RNA gene intergenic spacer based PCR and DGGE fingerprinting method for the analysis of specific rhizobial communities in soil

    NARCIS (Netherlands)

    Oliveira, de V.M.; Manfio, G.P.; Coutinho, H.L.D.; Keijzer-Wolters, A.C.; Elsas, van J.D.

    2006-01-01

    A direct molecular method for assessing the diversity of specific populations of rhizobia in soil, based on nested PCR amplification of 16S-23S ribosomal RNA gene (rDNA) intergenic spacer (IGS) sequences, was developed. Initial generic amplification of bacterial rDNA IGS sequences from soil DNA was

  17. Development and Molecular Characterization of Novel Polymorphic Genomic DNA SSR Markers in Lentinula edodes.

    Science.gov (United States)

    Moon, Suyun; Lee, Hwa-Yong; Shim, Donghwan; Kim, Myungkil; Ka, Kang-Hyeon; Ryoo, Rhim; Ko, Han-Gyu; Koo, Chang-Duck; Chung, Jong-Wook; Ryu, Hojin

    2017-06-01

    Sixteen genomic DNA simple sequence repeat (SSR) markers of Lentinula edodes were developed from 205 SSR motifs present in 46.1-Mb long L. edodes genome sequences. The number of alleles ranged from 3-14 and the major allele frequency was distributed from 0.17-0.96. The values of observed and expected heterozygosity ranged from 0.00-0.76 and 0.07-0.90, respectively. The polymorphic information content value ranged from 0.07-0.89. A dendrogram, based on 16 SSR markers clustered by the paired hierarchical clustering' method, showed that 33 shiitake cultivars could be divided into three major groups and successfully identified. These SSR markers will contribute to the efficient breeding of this species by providing diversity in shiitake varieties. Furthermore, the genomic information covered by the markers can provide a valuable resource for genetic linkage map construction, molecular mapping, and marker-assisted selection in the shiitake mushroom.

  18. Phylogenetic diversity of lactic acid bacteria associated with paddy rice silage as determined by 16S ribosomal DNA analysis.

    Science.gov (United States)

    Ennahar, Saïd; Cai, Yimin; Fujita, Yasuhito

    2003-01-01

    A total of 161 low-G+C-content gram-positive bacteria isolated from whole-crop paddy rice silage were classified and subjected to phenotypic and genetic analyses. Based on morphological and biochemical characters, these presumptive lactic acid bacterium (LAB) isolates were divided into 10 groups that included members of the genera Enterococcus, Lactobacillus, Lactococcus, Leuconostoc, Pediococcus, and WEISSELLA: Analysis of the 16S ribosomal DNA (rDNA) was used to confirm the presence of the predominant groups indicated by phenotypic analysis and to determine the phylogenetic affiliation of representative strains. The virtually complete 16S rRNA gene was PCR amplified and sequenced. The sequences from the various LAB isolates showed high degrees of similarity to those of the GenBank reference strains (between 98.7 and 99.8%). Phylogenetic trees based on the 16S rDNA sequence displayed high consistency, with nodes supported by high bootstrap values. With the exception of one species, the genetic data was in agreement with the phenotypic identification. The prevalent LAB, predominantly homofermentative (66%), consisted of Lactobacillus plantarum (24%), Lactococcus lactis (22%), Leuconostoc pseudomesenteroides (20%), Pediococcus acidilactici (11%), Lactobacillus brevis (11%), Enterococcus faecalis (7%), Weissella kimchii (3%), and Pediococcus pentosaceus (2%). The present study, the first to fully document rice-associated LAB, showed a very diverse community of LAB with a relatively high number of species involved in the fermentation process of paddy rice silage. The comprehensive 16S rDNA-based approach to describing LAB community structure was valuable in revealing the large diversity of bacteria inhabiting paddy rice silage and enabling the future design of appropriate inoculants aimed at improving its fermentation quality.

  19. Myb-binding protein 1a (Mybbp1a) regulates levels and processing of pre-ribosomal RNA.

    Science.gov (United States)

    Hochstatter, Julia; Hölzel, Michael; Rohrmoser, Michaela; Schermelleh, Lothar; Leonhardt, Heinrich; Keough, Rebecca; Gonda, Thomas J; Imhof, Axel; Eick, Dirk; Längst, Gernot; Németh, Attila

    2012-07-13

    Ribosomal RNA gene transcription, co-transcriptional processing, and ribosome biogenesis are highly coordinated processes that are tightly regulated during cell growth. In this study we discovered that Mybbp1a is associated with both the RNA polymerase I complex and the ribosome biogenesis machinery. Using a reporter assay that uncouples transcription and RNA processing, we show that Mybbp1a represses rRNA gene transcription. In addition, overexpression of the protein reduces RNA polymerase I loading on endogenous rRNA genes as revealed by chromatin immunoprecipitation experiments. Accordingly, depletion of Mybbp1a results in an accumulation of the rRNA precursor in vivo but surprisingly also causes growth arrest of the cells. This effect can be explained by the observation that the modulation of Mybbp1a protein levels results in defects in pre-rRNA processing within the cell. Therefore, the protein may play a dual role in the rRNA metabolism, potentially linking and coordinating ribosomal DNA transcription and pre-rRNA processing to allow for the efficient synthesis of ribosomes.

  20. Reconstruction of molecular phylogeny of closely related Amorphophallus species of India using plastid DNA marker and fingerprinting approaches.

    Science.gov (United States)

    Gholave, Avinash R; Pawar, Kiran D; Yadav, Shrirang R; Bapat, Vishwas A; Jadhav, Jyoti P

    2017-01-01

    Plastid DNA markers sequencing and DNA fingerprinting approaches were used and compared for resolving molecular phylogeny of closely related, previously unexplored Amorphophallus species of India. The utility of individual plastid markers namely rbcL , matK , trnH - psbA , trnLC - trnLD , their combined dataset and two fingerprinting techniques viz. RAPD and ISSR were tested for their efficacy to resolves Amorphophallus species into three sections specific clades namely Rhaphiophallus , Conophallus and Amorphophallus . In the present study, sequences of these four plastid DNA regions as well as RAPD and ISSR profiles of 16 Amorphophallus species together with six varieties of two species were generated and analyzed. Maximum likelihood and Bayesian Inference based construction of phylogenetic trees indicated that among the four plastid DNA regions tested individually and their combined dataset, rbcL was found best suited for resolving closely related Amorphophallus species into section specific clades. When analyzed individually, rbcL exhibited better discrimination ability than matK , trnH - psbA , trnLC - trnLD and combination of all four tested plastid markers. Among two fingerprinting techniques used, the resolution of Amorphophallus species using RAPD was better than ISSR and combination of RAPD +ISSR and in congruence with resolution based on rbcL .

  1. Cockayne syndrome group A and B proteins converge on transcription-linked resolution of non-B DNA.

    Science.gov (United States)

    Scheibye-Knudsen, Morten; Tseng, Anne; Borch Jensen, Martin; Scheibye-Alsing, Karsten; Fang, Evandro Fei; Iyama, Teruaki; Bharti, Sanjay Kumar; Marosi, Krisztina; Froetscher, Lynn; Kassahun, Henok; Eckley, David Mark; Maul, Robert W; Bastian, Paul; De, Supriyo; Ghosh, Soumita; Nilsen, Hilde; Goldberg, Ilya G; Mattson, Mark P; Wilson, David M; Brosh, Robert M; Gorospe, Myriam; Bohr, Vilhelm A

    2016-11-01

    Cockayne syndrome is a neurodegenerative accelerated aging disorder caused by mutations in the CSA or CSB genes. Although the pathogenesis of Cockayne syndrome has remained elusive, recent work implicates mitochondrial dysfunction in the disease progression. Here, we present evidence that loss of CSA or CSB in a neuroblastoma cell line converges on mitochondrial dysfunction caused by defects in ribosomal DNA transcription and activation of the DNA damage sensor poly-ADP ribose polymerase 1 (PARP1). Indeed, inhibition of ribosomal DNA transcription leads to mitochondrial dysfunction in a number of cell lines. Furthermore, machine-learning algorithms predict that diseases with defects in ribosomal DNA (rDNA) transcription have mitochondrial dysfunction, and, accordingly, this is found when factors involved in rDNA transcription are knocked down. Mechanistically, loss of CSA or CSB leads to polymerase stalling at non-B DNA in a neuroblastoma cell line, in particular at G-quadruplex structures, and recombinant CSB can melt G-quadruplex structures. Indeed, stabilization of G-quadruplex structures activates PARP1 and leads to accelerated aging in Caenorhabditis elegans In conclusion, this work supports a role for impaired ribosomal DNA transcription in Cockayne syndrome and suggests that transcription-coupled resolution of secondary structures may be a mechanism to repress spurious activation of a DNA damage response.

  2. Microsatellite DNA markers for delineating population structure and kinship among the endangered Kirtland’s warbler (Dendroica kirtlandii)

    Science.gov (United States)

    TIM L. KING; MICHAEL S. EACKLES; ANNE P. HENDERSON; CAROL I. BOCETTI; DAVE CURRIE; JR WUNDERLE

    2005-01-01

    We document the isolation and characterization of 23 microsatellite DNA markers for the endangered Kirtland’s warbler (Dendroica kirtlandii), a Nearctic/Neotropical migrant passerine. This suite of markers revealed moderate to high levels of allelic diversity (averaging 7.7 alleles per locus) and heterozygosity (averaging 72%). Genotypic frequencies at 22 of 23 (95%)...

  3. Association between Urinary Excretion of Cortisol and Markers of Oxidatively Damaged DNA and RNA in Humans

    DEFF Research Database (Denmark)

    Joergensen, Anders; Broedbaek, Kasper; Weimann, Allan

    2011-01-01

    Chronic psychological stress is associated with accelerated aging, but the underlying biological mechanisms are not known. Prolonged elevations of the stress hormone cortisol is suspected to play a critical role. Through its actions, cortisol may potentially induce oxidatively generated damage...... to cellular constituents such as DNA and RNA, a phenomenon which has been implicated in aging processes. We investigated the relationship between 24 h excretion of urinary cortisol and markers of oxidatively generated DNA and RNA damage, 8-oxo-7,8-dihydro-2'-deoxyguanosine and 8-oxo-7,8-dihydroguanosine......, in a sample of 220 elderly men and women (age 65 - 83 years). We found a robust association between the excretion of cortisol and the oxidation markers (R(2)¿=¿0.15, P...

  4. Rust resistance evaluation of advanced wheat (triticum aestivum l.) genotypes using pcr-based dna markers

    International Nuclear Information System (INIS)

    Rahman, S.U.; Younis, M.; Iqbal, M.Z.; Nawaz, M.

    2014-01-01

    The most effective and environmental friendly approach for the control of wheat rust disease is the use of resistant genotypes. The present study was conducted to explore rust resistance potential of 85 elite wheat genotypes (36 varieties and 49 advanced lines) using various types of DNA markers like STS, SCAR and SSR. DNA markers linked with different genes conferring resistance to rusts (Leaf rust=Lr, Yellow rust=Yr and Stem rust=Sr) were employed in this study. A total of 18 genes, consisting of eleven Lr (lr1, lr10, lr19, lr21, lr28, lr34, lr39, lr46, lr47, lr51 and lr52), four Yr (yr5, yr18, yr26 and yr29) and three Sr genes (sr2, sr29, and sr36) were studied through linked DNA markers. Maximum number of Lr genes was found in 17 advanced lines and 9 varieties, Yr genes in 26 advanced lines and 20 wheat varieties, and Sr genes in 43 advanced lines and 27 varieties. Minimum number of Lr genes was found in advanced line D-97 and variety Kohinoor-83, Yr genes in wheat variety Bwp-97 and Sr genes in 6 advanced lines and 8 varieties. Molecular data revealed that genotypes having same origin, from a specified area showed resistance for similar type of genes. In this study, an average similarity of 84% was recorded among wheat genotypes. Out of 18 loci, 15 were found to be polymorphic. (author)

  5. Viral-Cellular DNA Junctions as Molecular Markers for Assessing Intra-Tumor Heterogeneity in Cervical Cancer and for the Detection of Circulating Tumor DNA

    Directory of Open Access Journals (Sweden)

    Katrin Carow

    2017-09-01

    Full Text Available The development of cervical cancer is frequently accompanied by the integration of human papillomaviruses (HPV DNA into the host genome. Viral-cellular junction sequences, which arise in consequence, are highly tumor specific. By using these fragments as markers for tumor cell origin, we examined cervical cancer clonality in the context of intra-tumor heterogeneity. Moreover, we assessed the potential of these fragments as molecular tumor markers and analyzed their suitability for the detection of circulating tumor DNA in sera of cervical cancer patients. For intra-tumor heterogeneity analyses tumors of 8 patients with up to 5 integration sites per tumor were included. Tumor islands were micro-dissected from cryosections of several tissue blocks representing different regions of the tumor. Each micro-dissected tumor area served as template for a single junction-specific PCR. For the detection of circulating tumor-DNA (ctDNA junction-specific PCR-assays were applied to sera of 21 patients. Samples were collected preoperatively and during the course of disease. In 7 of 8 tumors the integration site(s were shown to be homogenously distributed throughout different tumor regions. Only one tumor displayed intra-tumor heterogeneity. In 5 of 21 analyzed preoperative serum samples we specifically detected junction fragments. Junction-based detection of ctDNA was significantly associated with reduced recurrence-free survival. Our study provides evidence that HPV-DNA integration is as an early step in cervical carcinogenesis. Clonality with respect to HPV integration opens new perspectives for the application of viral-cellular junction sites as molecular biomarkers in a clinical setting such as disease monitoring.

  6. Sequence analysis of the 5.8S ribosomal DNA and internal transcribed spacers (ITS1 and ITS2) from five species of the Oxalis tuberosa alliance.

    Science.gov (United States)

    Tosto, D S; Hopp, H E

    1996-01-01

    The internal transcribed spacer region (ITS1 and ITS2) of the 18S-25S nuclear ribosomal DNA sequence and the intervening 5.8S region from five species of the genus Oxalis was amplified by polymerase chain reaction and subjected to direct DNA sequencing. On the basis of cytogenetic studies some species of this genus were postulated to be related by the number of chromosomes. Sequence homologies in the ITS1, 5.8S and ITS2 among species are in good agreement with previous relationships established on the basis of chromosome numbers. We also identified a highly conserved sequence of six bp in the ITS1, reported to be present in a wide range of flowering plants, but not in the Oxalidaceae family to which the genus Oxalis belongs to.

  7. DNA Profiles of MTG (Moderat Tahan Gano) Oil Palm Variety Based on SSR Marker

    Science.gov (United States)

    Putri, L. A. P.; Setiado, H.; Hardianti, R.

    2017-03-01

    The oil palm, an economically important tree in Indonesia, has been one of the world’s major sources of edible oil and a significant precursor of biodiesel fuel. The objectives of this study were to know DNA profile of commercial MTG (Moderat Tahan Gano) oil palm variety collections. A total of 10 trees MTG oil palm variety were used for analysis. In this experiment, the DNA profile diversity was assessed using mEgCIR0174 and SSR-1 loci of oil palm’s specific SSR markers. The results of the experiment indicated out of 3 alleles of pcr product of mEgCIR0174 (198, 203 and 208 bp) and SSR-1 (201, 217 and 232 bp). These preliminary results demonstrated SSR marker can be used to evaluate genetic relatedness among trees of MTG (Moderat Tahan Gano) oil palm variety derived from different crossing or difference to desease resistance trait or misslabeled.

  8. Molecular phylogeny of Acer monspessulanum L. subspecies from Iran inferred using the ITS region of nuclear ribosomal DNA

    Directory of Open Access Journals (Sweden)

    HANIF KHADEMI

    2016-04-01

    Full Text Available Abstract. Khademi H, Mehregan I, Assadi M, Nejadsatari T, Zarre S. 2015. Molecular phylogeny of Acer monspessulanum L. subspecies from Iran inferred using the ITS region of nuclear ribosomal DNA. Biodiversitas 17: 16-23. This study was carried out on the Acer monspessulanum complex growing wild in Iran. Internal transcribed spacer (ITS sequences for 75 samples representing five different subspecies of Acer monspessulanum were analyzed. Beside this, 86 previously published ITS sequences from GenBank were used to test the monophyly of the complex worldwide. Phylogenetic analyses were conducted using Bayesian inference and maximum parsimony. The results indicate that most samples of A. monspessulanum species from Iran were part of a monophyletic clade with 8 samples of A. ibericum from Georgia, A. hyrcanum from Iran and one of A. sempervirens from Greece (PP= 1; BS= 79%. Our results indicate that use of morphological characteristics coupled with molecular data will be most effective.

  9. Identification of a panel of sensitive and specific DNA methylation markers for lung adenocarcinoma

    Directory of Open Access Journals (Sweden)

    Hagen Jeffrey A

    2007-10-01

    Full Text Available Abstract Background Lung cancer is the number one cancer killer of both men and women in the United States. Three quarters of lung cancer patients are diagnosed with regionally or distantly disseminated disease; their 5-year survival is only 15%. DNA hypermethylation at promoter CpG islands shows great promise as a cancer-specific marker that would complement visual lung cancer screening tools such as spiral CT, improving early detection. In lung cancer patients, such hypermethylation is detectable in a variety of samples ranging from tumor material to blood and sputum. To date the penetrance of DNA methylation at any single locus has been too low to provide great clinical sensitivity. We used the real-time PCR-based method MethyLight to examine DNA methylation quantitatively at twenty-eight loci in 51 primary human lung adenocarcinomas, 38 adjacent non-tumor lung samples, and 11 lung samples from non-lung cancer patients. Results We identified thirteen loci showing significant differential DNA methylation levels between tumor and non-tumor lung; eight of these show highly significant hypermethylation in adenocarcinoma: CDH13, CDKN2A EX2, CDX2, HOXA1, OPCML, RASSF1, SFPR1, and TWIST1 (p-value Conclusion The identification of eight CpG island loci showing highly significant hypermethylation in lung adenocarcinoma provides strong candidates for evaluation in patient remote media such as plasma and sputum. The four most highly ranked loci, CDKN2A EX2, CDX2, HOXA1 and OPCML, which show significant DNA methylation even in stage IA tumor samples, merit further investigation as some of the most promising lung adenocarcinoma markers identified to date.

  10. Ribosomal and hematopoietic defects in induced pluripotent stem cells derived from Diamond Blackfan anemia patients.

    Science.gov (United States)

    Garçon, Loïc; Ge, Jingping; Manjunath, Shwetha H; Mills, Jason A; Apicella, Marisa; Parikh, Shefali; Sullivan, Lisa M; Podsakoff, Gregory M; Gadue, Paul; French, Deborah L; Mason, Philip J; Bessler, Monica; Weiss, Mitchell J

    2013-08-08

    Diamond Blackfan anemia (DBA) is a congenital disorder with erythroid (Ery) hypoplasia and tissue morphogenic abnormalities. Most DBA cases are caused by heterozygous null mutations in genes encoding ribosomal proteins. Understanding how haploinsufficiency of these ubiquitous proteins causes DBA is hampered by limited availability of tissues from affected patients. We generated induced pluripotent stem cells (iPSCs) from fibroblasts of DBA patients carrying mutations in RPS19 and RPL5. Compared with controls, DBA fibroblasts formed iPSCs inefficiently, although we obtained 1 stable clone from each fibroblast line. RPS19-mutated iPSCs exhibited defects in 40S (small) ribosomal subunit assembly and production of 18S ribosomal RNA (rRNA). Upon induced differentiation, the mutant clone exhibited globally impaired hematopoiesis, with the Ery lineage affected most profoundly. RPL5-mutated iPSCs exhibited defective 60S (large) ribosomal subunit assembly, accumulation of 12S pre-rRNA, and impaired erythropoiesis. In both mutant iPSC lines, genetic correction of ribosomal protein deficiency via complementary DNA transfer into the "safe harbor" AAVS1 locus alleviated abnormalities in ribosome biogenesis and hematopoiesis. Our studies show that pathological features of DBA are recapitulated by iPSCs, provide a renewable source of cells to model various tissue defects, and demonstrate proof of principle for genetic correction strategies in patient stem cells.

  11. 5S rRNA and ribosome.

    Science.gov (United States)

    Gongadze, G M

    2011-12-01

    5S rRNA is an integral component of the ribosome of all living organisms. It is known that the ribosome without 5S rRNA is functionally inactive. However, the question about the specific role of this RNA in functioning of the translation apparatus is still open. This review presents a brief history of the discovery of 5S rRNA and studies of its origin and localization in the ribosome. The previously expressed hypotheses about the role of this RNA in the functioning of the ribosome are discussed considering the unique location of 5S rRNA in the ribosome and its intermolecular contacts. Based on analysis of the current data on ribosome structure and its functional complexes, the role of 5S rRNA as an intermediary between ribosome functional domains is discussed.

  12. In vitro degradation of ribosomes.

    Science.gov (United States)

    Mora, G; Rivas, A

    1976-12-01

    The cytoplasmic ribosomes from Euglena gracilis var. bacillaris are found to be of two types taking into consideration their stability "in vitro". In the group of unstable ribosomes the large subunit is degraded. The other group apparently does not suffer any degradation under the conditions described. However the RNAs extracted from both types of ribosomes are degraded during sucrose density gradients. The degradation of the largest RNA species has been reported previously, but no comment has been made about the stability of the ribosome itself.

  13. Sensitive voltammetric detection of DNA damage at carbon electrodes using DNA repair enzymes and an electroactive osmium marker

    Czech Academy of Sciences Publication Activity Database

    Havran, Luděk; Vacek, Jan; Cahová, Kateřina; Fojta, Miroslav

    2008-01-01

    Roč. 391, č. 5 (2008), s. 1751-1758 ISSN 1618-2642 R&D Projects: GA AV ČR(CZ) IAA4004402; GA AV ČR(CZ) IAA400040611; GA ČR(CZ) GA203/07/1195; GA MŠk(CZ) LC06035 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : DNA damage * electroactive marker * carbon electrodes Subject RIV: BO - Biophysics Impact factor: 3.328, year: 2008

  14. Conservative fragments in bacterial 16S rRNA genes and primer design for 16S ribosomal DNA amplicons in metagenomic studies

    KAUST Repository

    Wang, Yong

    2009-10-09

    Bacterial 16S ribosomal DNA (rDNA) amplicons have been widely used in the classification of uncultured bacteria inhabiting environmental niches. Primers targeting conservative regions of the rDNAs are used to generate amplicons of variant regions that are informative in taxonomic assignment. One problem is that the percentage coverage and application scope of the primers used in previous studies are largely unknown. In this study, conservative fragments of available rDNA sequences were first mined and then used to search for candidate primers within the fragments by measuring the coverage rate defined as the percentage of bacterial sequences containing the target. Thirty predicted primers with a high coverage rate (>90%) were identified, which were basically located in the same conservative regions as known primers in previous reports, whereas 30% of the known primers were associated with a coverage rate of <90%. The application scope of the primers was also examined by calculating the percentages of failed detections in bacterial phyla. Primers A519-539, E969- 983, E1063-1081, U515 and E517, are highly recommended because of their high coverage in almost all phyla. As expected, the three predominant phyla, Firmicutes, Gemmatimonadetes and Proteobacteria, are best covered by the predicted primers. The primers recommended in this report shall facilitate a comprehensive and reliable survey of bacterial diversity in metagenomic studies. © 2009 Wang, Qian.

  15. Filipino DNA variation at 12 X-chromosome short tandem repeat markers.

    Science.gov (United States)

    Salvador, Jazelyn M; Apaga, Dame Loveliness T; Delfin, Frederick C; Calacal, Gayvelline C; Dennis, Sheila Estacio; De Ungria, Maria Corazon A

    2018-06-08

    Demands for solving complex kinship scenarios where only distant relatives are available for testing have risen in the past years. In these instances, other genetic markers such as X-chromosome short tandem repeat (X-STR) markers are employed to supplement autosomal and Y-chromosomal STR DNA typing. However, prior to use, the degree of STR polymorphism in the population requires evaluation through generation of an allele or haplotype frequency population database. This population database is also used for statistical evaluation of DNA typing results. Here, we report X-STR data from 143 unrelated Filipino male individuals who were genotyped via conventional polymerase chain reaction-capillary electrophoresis (PCR-CE) using the 12 X-STR loci included in the Investigator ® Argus X-12 kit (Qiagen) and via massively parallel sequencing (MPS) of seven X-STR loci included in the ForenSeq ™ DNA Signature Prep kit of the MiSeq ® FGx ™ Forensic Genomics System (Illumina). Allele calls between PCR-CE and MPS systems were consistent (100% concordance) across seven overlapping X-STRs. Allele and haplotype frequencies and other parameters of forensic interest were calculated based on length (PCR-CE, 12 X-STRs) and sequence (MPS, seven X-STRs) variations observed in the population. Results of our study indicate that the 12 X-STRs in the PCR-CE system are highly informative for the Filipino population. MPS of seven X-STR loci identified 73 X-STR alleles compared with 55 X-STR alleles that were identified solely by length via PCR-CE. Of the 73 sequence-based alleles observed, six alleles have not been reported in the literature. The population data presented here may serve as a reference Philippine frequency database of X-STRs for forensic casework applications. Copyright © 2018 Elsevier B.V. All rights reserved.

  16. Concordance of Hypermethylated DNA and the Tumor Markers CA 15-3, CEA, and TPA in Serum during Monitoring of Patients with Advanced Breast Cancer

    Directory of Open Access Journals (Sweden)

    Søren Kristiansen

    2015-01-01

    Full Text Available The serological protein tumor markers CA 15-3, CEA, and TPA are frequently used to monitor tumor burden among metastatic breast cancer patients. Breast cancer is associated with global DNA hypomethylation and hypermethylation of some promoter regions. No monitoring study has yet investigated the interrelationship between protein tumor markers, the global DNA hypomethylation, and hypermethylated genes in serum from patients with advanced disease. Twenty-nine patients with histologically proven advanced breast cancer received first-line chemotherapy with epirubicin. Samples were collected prior to each treatment and prospectively analyzed for CA 15-3, CEA, and TPA. The same samples were retrospectively analyzed for the concentration of hypermethylated RASSF1A and for global DNA hypomethylation using LINE-1. Among patients with elevated concentrations of the protein markers, concordance could be observed between serial changes of the hypermethylated RASSF1A gene and the protein markers. Among patients with lower concentrations, RASSF1A could only be detected periodically. There was discordance between changes of the hypomethylated LINE-1 as compared to the protein markers. Circulating hypermethylated RASSF1A and protein markers may have similar kinetics during monitoring of tumor burden. Further investigations are needed to determine whether any of the hypermethylated DNA genes may provide predictive information during monitoring.

  17. Concordance of Hypermethylated DNA and the Tumor Markers CA 15-3, CEA, and TPA in Serum during Monitoring of Patients with Advanced Breast Cancer.

    Science.gov (United States)

    Kristiansen, Søren; Jørgensen, Lars Mønster; Hansen, Morten Høgh; Nielsen, Dorte; Sölétormos, György

    2015-01-01

    The serological protein tumor markers CA 15-3, CEA, and TPA are frequently used to monitor tumor burden among metastatic breast cancer patients. Breast cancer is associated with global DNA hypomethylation and hypermethylation of some promoter regions. No monitoring study has yet investigated the interrelationship between protein tumor markers, the global DNA hypomethylation, and hypermethylated genes in serum from patients with advanced disease. Twenty-nine patients with histologically proven advanced breast cancer received first-line chemotherapy with epirubicin. Samples were collected prior to each treatment and prospectively analyzed for CA 15-3, CEA, and TPA. The same samples were retrospectively analyzed for the concentration of hypermethylated RASSF1A and for global DNA hypomethylation using LINE-1. Among patients with elevated concentrations of the protein markers, concordance could be observed between serial changes of the hypermethylated RASSF1A gene and the protein markers. Among patients with lower concentrations, RASSF1A could only be detected periodically. There was discordance between changes of the hypomethylated LINE-1 as compared to the protein markers. Circulating hypermethylated RASSF1A and protein markers may have similar kinetics during monitoring of tumor burden. Further investigations are needed to determine whether any of the hypermethylated DNA genes may provide predictive information during monitoring.

  18. The dual challenges of generality and specificity when developing environmental DNA markers for species and subspecies of Oncorhynchus

    Science.gov (United States)

    Taylor M. Wilcox; Kellie J. Carim; Kevin S. McKelvey; Michael Young; Michael K. Schwartz

    2015-01-01

    Environmental DNA (eDNA) sampling is a powerful tool for detecting invasive and native aquatic species. Often, species of conservation interest co-occur with other, closely related taxa. Here, we developed qPCR (quantitative PCR) markers which distinguish westslope cutthroat trout (Oncorhynchus clarkii lewsi), Yellowstone cutthroat trout (O. clarkii bouvieri...

  19. Low variation in ribosomal DNA and internal transcribed spacers of the symbiotic fungi of leaf-cutting ants (Attini: Formicidae

    Directory of Open Access Journals (Sweden)

    Silva-Pinhati A.C.O.

    2004-01-01

    Full Text Available Leaf-cutting ants of the genera Atta and Acromyrmex (tribe Attini are symbiotic with basidiomycete fungi of the genus Leucoagaricus (tribe Leucocoprineae, which they cultivate on vegetable matter inside their nests. We determined the variation of the 28S, 18S, and 5.8S ribosomal DNA (rDNA gene loci and the rapidly evolving internal transcribed spacers 1 and 2 (ITS1 and ITS2 of 15 sympatric and allopatric fungi associated with colonies of 11 species of leafcutter ants living up to 2,600 km apart in Brazil. We found that the fungal rDNA and ITS sequences from different species of ants were identical (or nearly identical to each other, whereas 10 GenBank Leucoagaricus species showed higher ITS variation. Our findings suggest that Atta and Acromyrmex leafcutters living in geographic sites that are very distant from each other cultivate a single fungal species made up of closely related lineages of Leucoagaricus gongylophorus. We discuss the strikingly high similarity in the ITS1 and ITS2 regions of the Atta and Acromyrmex symbiotic L. gongylophorus studied by us, in contrast to the lower similarity displayed by their non-symbiotic counterparts. We suggest that the similarity of our L. gongylophorus isolates is an indication of the recent association of the fungus with these ants, and propose that both the intense lateral transmission of fungal material within leafcutter nests and the selection of more adapted fungal strains are involved in the homogenization of the symbiotic fungal stock.

  20. A Deconvolution Protocol for ChIP-Seq Reveals Analogous Enhancer Structures on the Mouse and Human Ribosomal RNA Genes

    Directory of Open Access Journals (Sweden)

    Jean-Clement Mars

    2018-01-01

    Full Text Available The combination of Chromatin Immunoprecipitation and Massively Parallel Sequencing, or ChIP-Seq, has greatly advanced our genome-wide understanding of chromatin and enhancer structures. However, its resolution at any given genetic locus is limited by several factors. In applying ChIP-Seq to the study of the ribosomal RNA genes, we found that a major limitation to resolution was imposed by the underlying variability in sequence coverage that very often dominates the protein–DNA interaction profiles. Here, we describe a simple numerical deconvolution approach that, in large part, corrects for this variability, and significantly improves both the resolution and quantitation of protein–DNA interaction maps deduced from ChIP-Seq data. This approach has allowed us to determine the in vivo organization of the RNA polymerase I preinitiation complexes that form at the promoters and enhancers of the mouse (Mus musculus and human (Homo sapiens ribosomal RNA genes, and to reveal a phased binding of the HMG-box factor UBF across the rDNA. The data identify and map a “Spacer Promoter” and associated stalled polymerase in the intergenic spacer of the human ribosomal RNA genes, and reveal a very similar enhancer structure to that found in rodents and lower vertebrates.

  1. Short tandem repeat (STR) DNA markers are hypervariable and informative in Cannabis sativa: implications for forensic investigations.

    Science.gov (United States)

    Gilmore, Simon; Peakall, Rod; Robertson, James

    2003-01-09

    Short tandem repeat (STR) markers are the DNA marker of choice in forensic analysis of human DNA. Here we extend the application of STR markers to Cannabis sativa and demonstrate their potential for forensic investigations. Ninety-three individual cannabis plants, representing drug and fibre accessions of widespread origin were profiled with five STR makers. A total of 79 alleles were detected across the five loci. All but four individuals from a single drug-type accession had a unique multilocus genotype. An analysis of molecular variance (AMOVA) revealed significant genetic variation among accessions, with an average of 25% genetic differentiation. By contrast, only 6% genetic difference was detected between drug and fibre crop accessions and it was not possible to unequivocally assign plants as either drug or fibre type. However, our results suggest that drug strains may typically possess lower genetic diversity than fibre strains, which may ultimately provide a means of genetic delineation. Our findings demonstrate the promise of cannabis STR markers to provide information on: (1) agronomic type, (2) the geographical origin of drug seizures, and (3) evidence of conspiracy in production of clonally propagated drug crops.

  2. Molecular Characterization of Fasciola Samples Using Sequences of Second Internal Transcribed Spacer-rDNA in Different Geographical Localities of Sistan and Balouchestan Province, Iran

    Directory of Open Access Journals (Sweden)

    Mahsa Shahbakhsh

    2016-02-01

    Full Text Available Background: The Fasciola trematodes are the most common liver flukes, living in a range of animals with global distribution and resulting in profound economic loss and public health challenges. Previous studies have indicated that the sequences of the second internal transcribed spacer (ITS-2 of ribosomal DNA (rDNA provide reliable genetic markers for molecular systemic studies of Fasciola. Objectives: The objective of the present study was to characterize Fasciola samples from different geographical regions of Sistan and Balouchestan province using sequences of second internal transcribed spacer (ITS-2 of ribosomal DNA (rDNA. Materials and Methods: Twenty adult trematodes were collected from the livers of slaughtered infected cattle. Total genomic DNA was extracted and ITS-2 rDNA targets were amplified by polymerase chain reaction (PCR. All samples were sequenced and investigated using the ClustalW2 sequence alignment tool and MEGA software. The sequences of some Iranian and non-Iranian isolates were used for comparison, in order to evaluate the variation in sequence homology between geographically different trematode populations. Results: The results of comparing the ITS-2 sequences with the BLAST GenBank database showed one type of sequence for F. hepatica and three different types of sequences for F. gigantica in the specimens. Conclusions: The present study demonstrated that Fasciola samples from cattle in two geographical locations in Sistan and Balouchestan province represented no genetic diversity in F. hepatica and high genetic variation in F. gigantica.

  3. Ribosomal studies on the 70S ribosome of E.coli by means of neutron scattering

    International Nuclear Information System (INIS)

    Burkhardt, N.

    1997-01-01

    Ribosomes are ribonucleo-protein complexes, which catalyse proteinbiosynthesis in all living organisms. Currently, most of the structural models of the prokaryotic 70S ribosome rely on electron microscopy and describe mainly the outer shape of the particle. Neutron scattering can provide information on the internal structure of the ribosome. Parts of the structure can be contrasted for neutrons by means of an isotopic exchange of the naturally occurring hydrogen ( 1 H) for deuterium ( 2 H), allowing direct measurements in situ. Specifically deuterium-labeled ribosomes (E. coli) were prepared and analysed with neutron scattering. The biochemical methods were established and combined to a generally applicable preparation system. This allows labeling of all ribosomal components in any combination. A systematic analysis of the protein and RNA phases resulted in the development of a new model for the 70S ribosome. This model describes not only the outer shape of the particle, but displays also an experimentally determined internal protein-RNA distribution and the border of subunits for the first time (four-phase model; resolution: 50A). Models of the 70S ribosome from other studies were evaluated and ranked according to consistency with the measured scattering data. Applying a new neutron scattering technique of particular sensitivity, the proton-spin contrast-variation, single proteins could be measured and localized. The positions of the proteins S6 and S10 were determined, providing the first coordinates of protein mass centers within the 70S ribosome. (orig.) [de

  4. Detection and Quantification of Ribosome Inhibition by Aminoglycoside Antibiotics in Living Bacteria Using an Orthogonal Ribosome-Controlled Fluorescent Reporter.

    Science.gov (United States)

    Huang, Shijie; Zhu, Xuechen; Melançon, Charles E

    2016-01-15

    The ribosome is the quintessential antibacterial drug target, with many structurally and mechanistically distinct classes of antibacterial agents acting by inhibiting ribosome function. Detecting and quantifying ribosome inhibition by small molecules and investigating their binding modes and mechanisms of action are critical to antibacterial drug discovery and development efforts. To develop a ribosome inhibition assay that is operationally simple, yet provides direct information on the drug target and the mechanism of action, we have developed engineered E. coli strains harboring an orthogonal ribosome-controlled green fluorescent protein (GFP) reporter that produce fluorescent signal when the orthogonal ribosome is inhibited. As a proof of concept, we demonstrate that these strains, when coexpressing homogeneous populations of aminoglycoside resistant ribosomes, act as sensitive and quantitative detectors of ribosome inhibition by a set of 12 structurally diverse aminoglycoside antibiotics. We suggest that this strategy can be extended to quantifying ribosome inhibition by other drug classes.

  5. Phylogeny of Alternaria fungi known to produce host-specific toxins on the basis of variation in internal transcribed spacers of ribosomal DNA.

    Science.gov (United States)

    Kusaba, M; Tsuge, T

    1995-10-01

    The internal transcribed spacer regions (ITS1 and ITS2) of ribosomal DNA from Alternaria species, including seven fungi known to produce host-specific toxins, were analyzed by polymerase chain reaction-amplification and direct sequencing. Phylogenetic analysis of the sequence data by the Neighbor-joining method showed that the seven toxin-producing fungi belong to a monophyletic group together with A. alternata. In contract, A. dianthi, A. panax, A. dauci, A. bataticola, A. porri, A. sesami and A. solani, species that can be morphologically distinguished from A. alternata, could be clearly separated from A. alternata by phylogenetic of the ITS variation. These results suggest that Alternaria pathogens which produce host-specific toxins are pathogenic variants within a single variable species, A. alternata.

  6. The ribosome can prevent aggregation of partially folded protein intermediates: studies using the Escherichia coli ribosome.

    Directory of Open Access Journals (Sweden)

    Bani Kumar Pathak

    Full Text Available BACKGROUND: Molecular chaperones that support de novo folding of proteins under non stress condition are classified as chaperone 'foldases' that are distinct from chaperone' holdases' that provide high affinity binding platform for unfolded proteins and prevent their aggregation specifically under stress conditions. Ribosome, the cellular protein synthesis machine can act as a foldase chaperone that can bind unfolded proteins and release them in folding competent state. The peptidyl transferase center (PTC located in the domain V of the 23S rRNA of Escherichia coli ribosome (bDV RNA is the chaperoning center of the ribosome. It has been proposed that via specific interactions between the RNA and refolding proteins, the chaperone provides information for the correct folding of unfolded polypeptide chains. RESULTS: We demonstrate using Escherichia coli ribosome and variants of its domain V RNA that the ribosome can bind to partially folded intermediates of bovine carbonic anhydrase II (BCAII and lysozyme and suppress aggregation during their refolding. Using mutants of domain V RNA we demonstrate that the time for which the chaperone retains the bound protein is an important factor in determining its ability to suppress aggregation and/or support reactivation of protein. CONCLUSION: The ribosome can behave like a 'holdase' chaperone and has the ability to bind and hold back partially folded intermediate states of proteins from participating in the aggregation process. Since the ribosome is an essential organelle that is present in large numbers in all living cells, this ability of the ribosome provides an energetically inexpensive way to suppress cellular aggregation. Further, this ability of the ribosome might also be crucial in the context that the ribosome is one of the first chaperones to be encountered by a large nascent polypeptide chains that have a tendency to form partially folded intermediates immediately following their synthesis.

  7. Characterization of genetic diversity in chickpea using SSR markers, Start Codon Targeted Polymorphism (SCoT) and Conserved DNA-Derived Polymorphism (CDDP).

    Science.gov (United States)

    Hajibarat, Zahra; Saidi, Abbas; Hajibarat, Zohreh; Talebi, Reza

    2015-07-01

    To evaluate the genetic diversity among 48 genotypes of chickpea comprising cultivars, landraces and internationally developed improved lines genetic distances were evaluated using three different molecular marker techniques: Simple Sequence Repeat (SSR); Start Codon Targeted (SCoT) and Conserved DNA-derived Polymorphism (CDDP). Average polymorphism information content (PIC) for SSR, SCoT and CDDP markers was 0.47, 0.45 and 0.45, respectively, and this revealed that three different marker types were equal for the assessment of diversity amongst genotypes. Cluster analysis for SSR and SCoT divided the genotypes in to three distinct clusters and using CDDP markers data, genotypes grouped in to five clusters. There were positive significant correlation (r = 0.43, P SSR markers. These results suggest that efficiency of SSR, SCOT and CDDP markers was relatively the same in fingerprinting of chickpea genotypes. To our knowledge, this is the first detailed report of using targeted DNA region molecular marker (CDDP) for genetic diversity analysis in chickpea in comparison with SCoT and SSR markers. Overall, our results are able to prove the suitability of SCoT and CDDP markers for genetic diversity analysis in chickpea for their high rates of polymorphism and their potential for genome diversity and germplasm conservation.

  8. A suite of microsatellite markers optimized for amplification of DNA from Addax (Addax nasomaculatus) blood preserved on FTA cards.

    Science.gov (United States)

    Heim, Brett C; Ivy, Jamie A; Latch, Emily K

    2012-01-01

    The addax (Addax nasomaculatus) is a critically endangered antelope that is currently maintained in zoos through regional, conservation breeding programs. As for many captive species, incomplete pedigree data currently impedes the ability of addax breeding programs to confidently manage the genetics of captive populations and to select appropriate animals for reintroduction. Molecular markers are often used to improve pedigree resolution, thereby improving the long-term effectiveness of genetic management. When developing a suite of molecular markers, it is important to consider the source of DNA, as the utility of markers may vary across DNA sources. In this study, we optimized a suite of microsatellite markers for use in genotyping captive addax blood samples collected on FTA cards. We amplified 66 microsatellite loci previously described in other Artiodactyls. Sixteen markers amplified a single product in addax, but only 5 of these were found to be polymorphic in a sample of 37 addax sampled from a captive herd at Fossil Rim Wildlife Center in the US. The suite of microsatellite markers developed in this study provides a new tool for the genetic management of captive addax, and demonstrates that FTA cards can be a useful means of sample storage, provided appropriate loci are used in downstream analyses. © 2011 Wiley Periodicals, Inc.

  9. X linked neonatal centronuclear/myotubular myopathy: evidence for linkage to Xq28 DNA marker loci.

    OpenAIRE

    Thomas, N S; Williams, H; Cole, G; Roberts, K; Clarke, A; Liechti-Gallati, S; Braga, S; Gerber, A; Meier, C; Moser, H

    1990-01-01

    We have studied the inheritance of several polymorphic Xq27/28 DNA marker loci in two three generation families with the X linked neonatal lethal form of centronuclear/myotubular myopathy (XL MTM). We found complete linkage of XLMTM to all four informative Xq28 markers analysed, with GCP/RCP (Z = 3.876, theta = 0.00), with DXS15 (Z = 3.737, theta = 0.00), with DXS52 (Z = 2.709, theta = 0.00), and with F8C (Z = 1.020, theta = 0.00). In the absence of any observable recombination, we are unable...

  10. Biological significance of 5S rRNA import into human mitochondria: role of ribosomal protein MRP-L18

    Science.gov (United States)

    Smirnov, Alexandre; Entelis, Nina; Martin, Robert P.; Tarassov, Ivan

    2011-01-01

    5S rRNA is an essential component of ribosomes of all living organisms, the only known exceptions being mitochondrial ribosomes of fungi, animals, and some protists. An intriguing situation distinguishes mammalian cells: Although the mitochondrial genome contains no 5S rRNA genes, abundant import of the nuclear DNA-encoded 5S rRNA into mitochondria was reported. Neither the detailed mechanism of this pathway nor its rationale was clarified to date. In this study, we describe an elegant molecular conveyor composed of a previously identified human 5S rRNA import factor, rhodanese, and mitochondrial ribosomal protein L18, thanks to which 5S rRNA molecules can be specifically withdrawn from the cytosolic pool and redirected to mitochondria, bypassing the classic nucleolar reimport pathway. Inside mitochondria, the cytosolic 5S rRNA is shown to be associated with mitochondrial ribosomes. PMID:21685364

  11. A Sequence-Specific Interaction between the Saccharomyces cerevisiae rRNA Gene Repeats and a Locus Encoding an RNA Polymerase I Subunit Affects Ribosomal DNA Stability

    Science.gov (United States)

    Cahyani, Inswasti; Cridge, Andrew G.; Engelke, David R.; Ganley, Austen R. D.

    2014-01-01

    The spatial organization of eukaryotic genomes is linked to their functions. However, how individual features of the global spatial structure contribute to nuclear function remains largely unknown. We previously identified a high-frequency interchromosomal interaction within the Saccharomyces cerevisiae genome that occurs between the intergenic spacer of the ribosomal DNA (rDNA) repeats and the intergenic sequence between the locus encoding the second largest RNA polymerase I subunit and a lysine tRNA gene [i.e., RPA135-tK(CUU)P]. Here, we used quantitative chromosome conformation capture in combination with replacement mapping to identify a 75-bp sequence within the RPA135-tK(CUU)P intergenic region that is involved in the interaction. We demonstrate that the RPA135-IGS1 interaction is dependent on the rDNA copy number and the Msn2 protein. Surprisingly, we found that the interaction does not govern RPA135 transcription. Instead, replacement of a 605-bp region within the RPA135-tK(CUU)P intergenic region results in a reduction in the RPA135-IGS1 interaction level and fluctuations in rDNA copy number. We conclude that the chromosomal interaction that occurs between the RPA135-tK(CUU)P and rDNA IGS1 loci stabilizes rDNA repeat number and contributes to the maintenance of nucleolar stability. Our results provide evidence that the DNA loci involved in chromosomal interactions are composite elements, sections of which function in stabilizing the interaction or mediating a functional outcome. PMID:25421713

  12. Integrating microsatellite DNA markers and otolith geochemistry to assess population structure of European hake (Merluccius merluccius)

    Science.gov (United States)

    Tanner, Susanne E.; Pérez, Montse; Presa, Pablo; Thorrold, Simon R.; Cabral, Henrique N.

    2014-04-01

    Population structure and natal origins of European hake were investigated using microsatellite DNA markers and otolith geochemistry data. Five microsatellites were sequenced and otolith core geochemical composition was determined from age-1 hake collected in the northeast Atlantic Ocean and the Mediterranean Sea. Microsatellites provided evidence of a major genetic split in the vicinity of the Strait of Gibraltar, separating the Atlantic and the Mediterranean populations, with the exception of the Gulf of Cádiz. Based on classification models using otolith core geochemical values, individual natal origins were identified, although with an increased error rate. Coupling genotype and otolith data increased the classification accuracy of individuals to their potential natal origins while providing evidence of movement between the northern and southern stock units in the Atlantic Ocean. Information obtained by the two natural markers on population structure of European hake was complementary as the two markers act at different spatio-temporal scales. Otolith geochemistry provides information over an ecological time frame and on a fine spatial scale, while microsatellite DNA markers report on gene flow over evolutionary time scales and therefore act on a broader spatio-temporal resolution. Thus, this study confirmed the value of otolith geochemistry to complement the assessment of early life stage dispersal in populations with high gene flow and low genetic divergence.

  13. Comparative polymorphism of sterlet fertilizers (Acipenser Ruthenus for microsatellite DNA markers

    Directory of Open Access Journals (Sweden)

    Ольга Олексіївна Малишева

    2015-11-01

    Full Text Available Based on microsatellite DNA markers in three (LG-19, LS-68 and LS-39 it is examined intraspecific genetic structure of sterlet fertilizers. As a result of this work it was found that this group of fish is in a balanced state in terms of the genetic polymorphism. On the basis of certain individual differences in allelic variants have been selected and combined the parental pairs for alternative genotypes. The results of the research allow optimize further work on the reproduction of sturgeon under artificial cultivation

  14. Identification of forensically important Chrysomya (Diptera: Calliphoridae) species using the second ribosomal internal transcribed spacer (ITS2).

    Science.gov (United States)

    Nelson, Leigh A; Wallman, James F; Dowton, Mark

    2008-05-20

    The identification of forensically important blowflies of the genus Chrysomya (Diptera: Calliphoridae) may be hampered by their close morphological similarities, especially as immatures. In contrast to most previous studies, the utility of a nuclear rather than mitochondrial genetic marker was investigated to solve this problem. The second internal transcribed spacer (ITS2) of ribosomal DNA (rDNA) was amplified and sequenced from all nine Chrysomya species known from Australia. Difficulties encountered with direct sequencing of ITS2 for Chrysomya flavifrons necessitated cloning prior to sequencing for this species, which revealed a low level (0-0.23%) of intraindividual variation. Five restriction enzymes (DraI, BsaXI, BciVI, AseI and HinfI) were identified that were able to differentiate most members of the genus by polymerase chain reaction (PCR) restriction fragment length polymorphism (PCR-RFLP). The PCR-RFLP analysis revealed characteristic restriction profiles for all species except the closely related species pairs Chrysomya latifrons+Chrysomya semimetallica and Chrysomya incisuralis+Chrysomya rufifacies. Ch. incisuralis and Ch. rufifacies were able to be separated using the size differences resulting from amplification of the entire ITS region. The lack of intraspecific ITS2 sequence variation among eight Ch. incisuralis specimens was verified by the identical restriction profiles generated from these specimens. A DNA-based approach, such as PCR-RFLP, has the capacity to be useful for the identification of forensic entomological evidence in cases where morphological characters are unreliable.

  15. Authentication of ruta graveolens and its adulterant using internal transcribed spacer (its) sequences of nuclear ribosomal DNA

    International Nuclear Information System (INIS)

    Qurainy, F.A.; Khan, S.; Ali, M.A.; Hemaid, M.A.; Ashraf, M.

    2011-01-01

    Ruta graveolens L. (Rutaceae) is commonly known as 'Sudab' which is well known for hippocratic medicine and is commonly used in indigenous health-care system in India. Euphorbia dracunculoides Lam. (Euphorbiaceae) in raw drug trading has almost similar morphology to R. graveolens in dried state, is being sold locally or used clinically as an adulterant of R. graveolens (genuine) at a relatively low price under the same name 'Sudab' which has ultimately reduced the efficacy and quality of this herb. The internal transcribed spacer (ITS) sequence of nuclear ribosomal DNA gene of genuine and adulterant were sequenced and analyzed to assess species admixture in raw drug trading of genuine herbal drug. The BLAST search results of ITS sequence of genuine sample of 'Sudab' i.e., R. graveolens showed 99% similarity to the sequence of R. graveolens, however, E. dracunculoides showed 100% similarity to the species of Euphorbia and did not show any similarity with R. graveolens. The sequence alignment of both species was entirely different to each other. Phylogenetic analysis based on ITS sequence of adulterant sample i.e., E. dracunculoides together with sequences of Euphorbia species available in the GenBank has also clearly showed its nesting within the Euphorbia tree. The generated ITS sequences of both samples in the present study may be referred hereafter as species-specific DNA barcode signature, which can be used in authenticating and validating the exact species identities to discriminate the genuine sample of 'Sudab' from its adulterants if any available to guarantee the quality and purity of this drug in the herbal drug market. (author)

  16. Characterization of 35 novel microsatellite DNA markers from the duck (Anas platyrhynchos genome and cross-amplification in other birds

    Directory of Open Access Journals (Sweden)

    Xu Ke

    2005-07-01

    Full Text Available Abstract In order to study duck microsatellites, we constructed a library enriched for (CAn, (CAGn, (GCCn and (TTTCn. A total of 35 pairs of primers from these microsatellites were developed and used to detect polymorphisms in 31 unrelated Peking ducks. Twenty-eight loci were polymorphic and seven loci were monomorphic. A total of 117 alleles were observed from these polymorphic microsatellite markers, which ranged from 2 to 14 with an average of 4.18 per locus. The frequencies of the 117 alleles ranged from 0.02 to 0.98. The highest heterozygosity (0.97 was observed at the CAUD019 microsatellite locus and the lowest heterozygosity (0.04 at the CAUD008 locus, and 11 loci had heterozygosities greater than 0.50 (46.43%. The polymorphism information content (PIC of 28 loci ranged from 0.04 to 0.88 with an average of 0.42. All the above markers were used to screen the polymorphism in other bird species. Two markers produced specific monomorphic products with the chicken DNA. Fourteen markers generated specific fragments with the goose DNA: 5 were polymorphic and 9 were monomorphic. But no specific product was detected with the peacock DNA. Based on sequence comparisons of the flanking sequence and repeat, we conclude that 2 chicken loci and 14 goose loci were true homologous loci of the duck loci. The microsatellite markers identified and characterized in the present study will contribute to the genetic map, quantitative traits mapping, and phylogenetic analysis in the duck and goose.

  17. Polymorphic DNA microsatellite markers for forensic individual identification and parentage analyses of seven threatened species of parrots (family Psittacidae).

    Science.gov (United States)

    Jan, Catherine; Fumagalli, Luca

    2016-01-01

    The parrot family represents one of the bird group with the largest number of endangered species, as a result of habitat destruction and illegal trade. This illicit traffic involves the smuggling of eggs and animals, and the laundering through captive breeding facilities of wild-caught animals. Despite the huge potential of wildlife DNA forensics to determine with conclusive evidence illegal trade, current usage of DNA profiling approaches in parrots has been limited by the lack of suitable molecular markers specifically developed for the focal species and by low cross-species polymorphism. In this study, we isolated DNA microsatellite markers in seven parrot species threatened with extinction (Amazona brasiliensis, A. oratrix, A. pretrei, A. rhodocorytha, Anodorhynchus leari, Ara rubrogenys and Primolius couloni). From an enriched genomic library followed by 454 pyrosequencing, we characterized a total of 106 polymorphic microsatellite markers (mostly tetranucleotides) in the seven species and tested them across an average number of 19 individuals per species. The mean number of alleles per species and across loci varied from 6.4 to 8.3, with the mean observed heterozygosities ranging from 0.65 to 0.84. Identity and parentage exclusion probabilities were highly discriminatory. The high variability displayed by these microsatellite loci demonstrates their potential utility to perform individual genotyping and parentage analyses, in order to develop a DNA testing framework to determine illegal traffic in these threatened species.

  18. Ribosomal DNA-binding proteins in the nucleolus of Physarum polycephalum

    International Nuclear Information System (INIS)

    Graham-Lorence, S.E.

    1987-01-01

    In Physarum polycephalum, the nucleoli are extra chromosomal structures containing 200 to 400 copies of a linear 60 kilobase palindromic rDNA molecule. These rDNA molecules are organized into minichromosomes which apparently are held within a nucleolar protein matrix. To obtained evidence for attachment of the rDNA to such a matrix, both intact and lithium diiodosalicylate/NaCl-extracted nucleoli were digested for various lengths of time with micrococcal nuclease, so that portions of the rDNA molecules not attached within the nucleolar structure would be released. Nucleolar DNA-binding proteins were determined by blotting electrophoretically separated proteins from SDS-polyacrylamide gels onto nitrocellulose paper and probing them with radiolabeled DNA. In addition to the histones and lexosome proteins, eight DNA-binding proteins were identified having molecular weights of 25, 38, 47, 53, 55, 67, and 70 kD, with the 47, 53, 67, and 70 kD proteins requiring Ca 2+ for binding

  19. The potential role of ribosomal protein S5 on cell cycle arrest and initiation of murine erythroleukemia cell differentiation.

    Science.gov (United States)

    Matragkou, Christina N; Papachristou, Eleni T; Tezias, Sotirios S; Tsiftsoglou, Asterios S; Choli-Papadopoulou, Theodora; Vizirianakis, Ioannis S

    2008-07-01

    Evidence now exists to indicate that some ribosomal proteins besides being structural components of the ribosomal subunits are involved in the regulation of cell differentiation and apoptosis. As we have shown earlier, initiation of erythroid differentiation of murine erythroleukemia (MEL) cells is associated with transcriptional inactivation of genes encoding ribosomal RNAs and ribosomal proteins S5 (RPS5) and L35a. In this study, we extended these observations and investigated whether transfection of MEL cells with RPS5 cDNA affects the onset of initiation of erythroid maturation and their entrance in cell cycle arrest. Stably transfected MEL cloned cells (MEL-C14 and MEL-C56) were established and assessed for their capacity to produce RPS5 RNA transcript and its translated product. The impact of RPS5 cDNA transfection on the RPS5 gene expression patterns and the accumulation of RPS5 protein in inducible transfected MEL cells were correlated with their ability to: (a) initiate differentiation, (b) enter cell cycle arrest at G(1)/G(0) phase, and (c) modulate the level of cyclin-dependent kinases CDK2, CDK4, and CDK6. The data presented indicate that deregulation of RPS5 gene expression (constitutive expression) affects RPS5 protein level and delays both the onset of initiation of erythroid maturation and entrance in cell cycle arrest in inducer-treated MEL cells. 2008 Wiley-Liss, Inc.

  20. Plant rDNA database: ribosomal DNA loci information goes online

    Czech Academy of Sciences Publication Activity Database

    Garcia, S.; Garnatje, T.; Kovařík, Aleš

    2012-01-01

    Roč. 121, č. 4 (2012), s. 389-394 ISSN 0009-5915 R&D Projects: GA ČR(CZ) GAP501/10/0208; GA ČR GBP501/12/G090 Institutional research plan: CEZ:AV0Z50040702 Keywords : rDNA loci * FISH * database Subject RIV: BO - Biophysics Impact factor: 3.340, year: 2012

  1. Inferring Genetic Variation and Demographic History of Michelia yunnanensis Franch. (Magnoliaceae from Chloroplast DNA Sequences and Microsatellite Markers

    Directory of Open Access Journals (Sweden)

    Shikang Shen

    2017-04-01

    Full Text Available Michelia yunnanensis Franch., is a traditional ornamental, aromatic, and medicinal shrub that endemic to Yunnan Province in southwest China. Although the species has a large distribution pattern and is abundant in Yunnan Province, the populations are dramatically declining because of overexploitation and habitat destruction. Studies on the genetic variation and demography of endemic species are necessary to develop effective conservation and management strategies. To generate such knowledge, we used 3 pairs of universal cpDNA markers and 10 pairs of microsatellite markers to assess the genetic diversity, genetic structure, and demographic history of 7 M. yunnanensis populations. We calculated a total of 88 alleles for 10 polymorphic loci and 10 haplotypes for a combined 2,089 bp of cpDNA. M. yunnanensis populations showed high genetic diversity (Ho = 0.551 for nuclear markers and Hd = 0.471 for cpDNA markers and low genetic differentiation (FST = 0.058. Geographical structure was not found among M. yunnanensis populations. Genetic distance and geographic distance were not correlated (P > 0.05, which indicated that geographic isolation is not the primary cause of the low genetic differentiation of M. yunnanensis. Additionally, M. yunnanensis populations contracted ~20,000–30,000 years ago, and no recent expansion occurred in current populations. Results indicated that the high genetic diversity of the species and within its populations holds promise for effective genetic resource management and sustainable utilization. Thus, we suggest that the conservation and management of M. yunnanensis should address exotic overexploitation and habitat destruction.

  2. Stenostomum cf. leucops (Platyhelminthes in Thailand: a surface observation using scanning electron microscopy and phylogenetic analysis based on 18S ribosomal DNA sequences

    Directory of Open Access Journals (Sweden)

    Arin Ngamniyom

    2016-02-01

    Full Text Available The genus Stenostomum contains small turbellaria that are widely distributed in freshwater environments worldwide. However, there are only rare reports or studies of this genus from Thailand. Therefore, the objective of this study was to report S. cf. leucops in Thailand collected from Pathum Thani Province. The worm morphology and surface topography using scanning electron microscopy were determined. Moreover, the phylogenetic tree of S. cf. leucops was analysed with 17 flatworms based on the 18S ribosomal DNA sequences. The phylogenetic relationship shared a common ancestry of Catenulida species, and S. cf. leucops displayed a monophyletic pattern within Stenostomum spp. The results of the morphological and molecular data are discussed. These results may increase the knowledge of freshwater microturbellarians in Thailand.

  3. Cell cycle, differentiation and tissue-independent expression of ribosomal protein L37.

    Science.gov (United States)

    Su, S; Bird, R C

    1995-09-15

    A unique human cDNA (hG1.16) that encodes a mRNA of 450 nucleotides was isolated from a subtractive library derived from HeLa cells. The relative expression level of hG1.16 during different cell-cycle phases was determined by Northern-blot analysis of cells synchronized by double-thymidine block and serum deprivation/refeeding. hG1.16 was constitutively expressed during all phases of the cell cycle, including the quiescent phase when even most constitutively expressed genes experience some suppression of expression. The expression level of hG1.16 did not change during terminal differentiation of myoblasts to myotubes, during which cells become permanently post-mitotic. Examination of other tissues revealed that the relative expression level of hG1.16 was constitutive in all embryonic mouse tissues examined, including brain, eye, heart, kidney, liver, lung and skeletal muscle. This was unusual in that expression was not down-modulated during differentiation and did not vary appreciably between tissue types. Analysis by inter-species Northern-blot analysis revealed that hG1.16 was highly conserved among all vertebrates studied (from fish to humans but not in insects). DNA sequence analysis of hG1.16 revealed a high level of similarity to rat ribosomal protein L37, identifying hG1.16 as a new member of this multigene family. The deduced amino acid sequence of hG1.16 was identical to rat ribosomal protein L37 that contained 97 amino acids, many of which are highly positively charged (15 arginine and 14 lysine residues with a predicted M(r) of 11,065). hG1.16 protein has a single C2-C2 zinc-finger-like motif which is also present in rat ribosomal protein L37. Using primers designed from the sequence of hG1.16, unique bovine and rat cDNAs were also isolated by 5'-rapid-amplification of cDNA ends. DNA sequences of bovine and rat G1.16, clones were 92.8% and 92.2% similar to human G1.16 while the deduced amino acid sequences derived from bovine and rat cDNAs each differed

  4. Use of DNA Markers for Investigating Sources of Bacteria in Contaminated Ground Water: Wooster Township, Wayne County, Ohio

    Science.gov (United States)

    Dumouchelle, Denise H.

    2006-01-01

    In 2004, a public-health nuisance was declared by the Wayne County Board of Health in the Scenic Heights Drive-Batdorf Road area of Wooster Township, Wayne County, Ohio, because of concerns about the safety of water from local wells. Repeated sampling had detected the presence of fecal-indicator bacteria and elevated nitrate concentrations. In June 2006, the U.S. Geological Survey (USGS), in cooperation with the Ohio Environmental Protection Agency (Ohio EPA), collected and analyzed samples from some of the affected wells to help investigate the possibility of human-origin bacterial contamination. Water samples from 12 wells and 5 home sewage-treatment systems (HSTS) were collected. Bromide concentrations were determined in samples from the 12 wells. Samples from 5 of the 12 wells were analyzed for wastewater compounds. Total coliform, enterococci and Escherichia coli (E. coli) bacteria concentrations were determined for samples from 8 of the 12 wells. In addition, two microbial source-tracking tools that employ DNA markers were used on samples from several wells and a composite sample of water from five septic tanks. The DNA markers from the Enterococcus faecium species and the order Bacteroidales are associated with specific sources, either human or ruminant sources. Bromide concentrations ranged from 0.04 to 0.18 milligrams per liter (mg/L). No wastewater compounds were detected at concentrations above the reporting limits. Samples from the 12 wells also were collected by Ohio EPA and analyzed for chloride and nitrate. Chloride concentrations ranged from 12.6 to 61.6 mg/L and nitrate concentrations ranged from 2.34 to 11.9 mg/L (as N). Total coliforms and enterococci were detected in samples from 8 wells, at concentrations from 2 to 200 colony-forming units per 100 milliliters (CFU/100 mL) and 0.5 to 17 CFU/100 mL, respectively. E. coli were detected in samples from three of the eight wells, at concentrations of 1 or 2 CFU/100 mL. Tests for the human

  5. The ribosomal protein Rpl22 controls ribosome composition by directly repressing expression of its own paralog, Rpl22l1.

    Directory of Open Access Journals (Sweden)

    Monique N O'Leary

    Full Text Available Most yeast ribosomal protein genes are duplicated and their characterization has led to hypotheses regarding the existence of specialized ribosomes with different subunit composition or specifically-tailored functions. In yeast, ribosomal protein genes are generally duplicated and evidence has emerged that paralogs might have specific roles. Unlike yeast, most mammalian ribosomal proteins are thought to be encoded by a single gene copy, raising the possibility that heterogenous populations of ribosomes are unique to yeast. Here, we examine the roles of the mammalian Rpl22, finding that Rpl22(-/- mice have only subtle phenotypes with no significant translation defects. We find that in the Rpl22(-/- mouse there is a compensatory increase in Rpl22-like1 (Rpl22l1 expression and incorporation into ribosomes. Consistent with the hypothesis that either ribosomal protein can support translation, knockdown of Rpl22l1 impairs growth of cells lacking Rpl22. Mechanistically, Rpl22 regulates Rpl22l1 directly by binding to an internal hairpin structure and repressing its expression. We propose that ribosome specificity may exist in mammals, providing evidence that one ribosomal protein can influence composition of the ribosome by regulating its own paralog.

  6. Global functional analysis of nucleophosmin in Taxol response, cancer, chromatin regulation, and ribosomal DNA transcription

    International Nuclear Information System (INIS)

    Bergstralh, Daniel T.; Conti, Brian J.; Moore, Chris B.; Brickey, W. June; Taxman, Debra J.; Ting, Jenny P.-Y.

    2007-01-01

    Analysis of lung cancer response to chemotherapeutic agents showed the accumulation of a Taxol-induced protein that reacted with an anti-phospho-MEK1/2 antibody. Mass spectroscopy identified the protein as nucleophosmin/B23 (NPM), a multifunctional protein with diverse roles: ribosome biosynthesis, p53 regulation, nuclear-cytoplasmic shuttling, and centrosome duplication. Our work demonstrates that following cellular exposure to mitosis-arresting agents, NPM is phosphorylated and its chromatographic property is altered, suggesting changes in function during mitosis. To determine the functional relevance of NPM, its expression in tumor cells was reduced by siRNA. Cells with reduced NPM were treated with Taxol followed by microarray profiling accompanied by gene/protein pathway analyses. These studies demonstrate several expected and unexpected consequences of NPM depletion. The predominant downstream effectors of NPM are genes involved in cell proliferation, cancer, and the cell cycle. In congruence with its role in cancer, NPM is over-expressed in primary malignant lung cancer tissues. We also demonstrate a role for NPM in the expression of genes encoding SET (TAF1β) and the histone methylase SET8. Additionally, we show that NPM is required for a previously unobserved G2/M upregulation of TAF1A, which encodes the rDNA transcription factor TAF I 48. These results demonstrate multi-faceted functions of NPM that can affect cancer cells

  7. Synthetic peptides and ribosomal proteins as substrate for 60S ribosomal protein kinase from yeast cells

    DEFF Research Database (Denmark)

    Grankowski, N; Gasior, E; Issinger, O G

    1993-01-01

    Kinetic studies on the 60S protein kinase were conducted with synthetic peptides and ribosomal proteins as substrate. Peptide RRREEESDDD proved to be the best synthetic substrate for this enzyme. The peptide has a sequence of amino acids which most closely resembles the structure of potential...... phosphorylation sites in natural substrates, i.e., acidic ribosomal proteins. The superiority of certain kinetic parameters for 60S kinase obtained with the native whole 80S ribosomes over those of the isolated fraction of acidic ribosomal proteins indicates that the affinity of 60S kinase to the specific protein...

  8. Close sequence identity between ribosomal DNA episomes of the ...

    Indian Academy of Sciences (India)

    Unknown

    The restriction map of the E. dispar rDNA circle showed close simi- larity to EhR1 .... for 30 cycles in a DNA Thermal cycler (MJ Research,. USA). 3. .... by asterisk. The gaps show the variation between E. dispar and E. histolytica sequences.

  9. Refining DNA Barcoding Coupled High Resolution Melting for Discrimination of 12 Closely Related Croton Species.

    Directory of Open Access Journals (Sweden)

    Maslin Osathanunkul

    Full Text Available DNA barcoding coupled high resolution melting (Bar-HRM is an emerging method for species discrimination based on DNA dissociation kinetics. The aim of this work was to evaluate the suitability of different primer sets, derived from selected DNA regions, for Bar-HRM analysis of species in Croton (Euphorbiaceae, one of the largest genera of plants with over 1,200 species. Seven primer pairs were evaluated (matK, rbcL1, rbcL2, rbcL3, rpoC, trnL and ITS1 from four plastid regions, matK, rbcL, rpoC, and trnL, and the nuclear ribosomal marker ITS1. The primer pair derived from the ITS1 region was the single most effective region for the identification of the tested species, whereas the rbcL1 primer pair gave the lowest resolution. It was observed that the ITS1 barcode was the most useful DNA barcoding region overall for species discrimination out of all of the regions and primers assessed. Our Bar-HRM results here also provide further support for the hypothesis that both sequence and base composition affect DNA duplex stability.

  10. Variation in the number of nucleoli and incomplete homogenization of 18S ribosomal DNA sequences in leaf cells of the cultivated Oriental ginseng (Panax ginseng Meyer).

    Science.gov (United States)

    Chelomina, Galina N; Rozhkovan, Konstantin V; Voronova, Anastasia N; Burundukova, Olga L; Muzarok, Tamara I; Zhuravlev, Yuri N

    2016-04-01

    Wild ginseng, Panax ginseng Meyer, is an endangered species of medicinal plants. In the present study, we analyzed variations within the ribosomal DNA (rDNA) cluster to gain insight into the genetic diversity of the Oriental ginseng, P. ginseng, at artificial plant cultivation. The roots of wild P. ginseng plants were sampled from a nonprotected natural population of the Russian Far East. The slides were prepared from leaf tissues using the squash technique for cytogenetic analysis. The 18S rDNA sequences were cloned and sequenced. The distribution of nucleotide diversity, recombination events, and interspecific phylogenies for the total 18S rDNA sequence data set was also examined. In mesophyll cells, mononucleolar nuclei were estimated to be dominant (75.7%), while the remaining nuclei contained two to four nucleoli. Among the analyzed 18S rDNA clones, 20% were identical to the 18S rDNA sequence of P. ginseng from Japan, and other clones differed in one to six substitutions. The nucleotide polymorphism was more expressed at the positions 440-640 bp, and distributed in variable regions, expansion segments, and conservative elements of core structure. The phylogenetic analysis confirmed conspecificity of ginseng plants cultivated in different regions, with two fixed mutations between P. ginseng and other species. This study identified the evidences of the intragenomic nucleotide polymorphism in the 18S rDNA sequences of P. ginseng. These data suggest that, in cultivated plants, the observed genome instability may influence the synthesis of biologically active compounds, which are widely used in traditional medicine.

  11. Cockayne syndrome group A and B proteins converge on transcription-linked resolution of non-B DNA

    DEFF Research Database (Denmark)

    Scheibye-Knudsen, Morten; Tseng, Anne; Jensen, Martin Borch

    2016-01-01

    of CSA or CSB in a neuroblastoma cell line converges on mitochondrial dysfunction caused by defects in ribosomal DNA transcription and activation of the DNA damage sensor poly-ADP ribose polymerase 1 (PARP1). Indeed, inhibition of ribosomal DNA transcription leads to mitochondrial dysfunction in a number...... to polymerase stalling at non-B DNA in a neuroblastoma cell line, in particular at G-quadruplex structures, and recombinant CSB can melt G-quadruplex structures. Indeed, stabilization of G-quadruplex structures activates PARP1 and leads to accelerated aging in Caenorhabditis elegans. In conclusion, this work...

  12. DNA Barcoding for Identification of "Candidatus Phytoplasmas" Using a Fragment of the Elongation Factor Tu Gene

    DEFF Research Database (Denmark)

    Makarova, Olga; Contaldo, Nicoletta; Paltrinieri, Samanta

    2012-01-01

    Background Phytoplasmas are bacterial phytopathogens responsible for significant losses in agricultural production worldwide. Several molecular markers are available for identification of groups or strains of phytoplasmas. However, they often cannot be used for identification of phytoplasmas from...... different groups simultaneously or are too long for routine diagnostics. DNA barcoding recently emerged as a convenient tool for species identification. Here, the development of a universal DNA barcode based on the elongation factor Tu (tuf) gene for phytoplasma identification is reported. Methodology....../Principal Findings We designed a new set of primers and amplified a 420–444 bp fragment of tuf from all 91 phytoplasmas strains tested (16S rRNA groups -I through -VII, -IX through -XII, -XV, and -XX). Comparison of NJ trees constructed from the tuf barcode and a 1.2 kbp fragment of the 16S ribosomal gene revealed...

  13. Effectiveness of ITS and sub-regions as DNA barcode markers for the identification of Basidiomycota (Fungi).

    Science.gov (United States)

    Badotti, Fernanda; de Oliveira, Francislon Silva; Garcia, Cleverson Fernando; Vaz, Aline Bruna Martins; Fonseca, Paula Luize Camargos; Nahum, Laila Alves; Oliveira, Guilherme; Góes-Neto, Aristóteles

    2017-02-23

    Fungi are among the most abundant and diverse organisms on Earth. However, a substantial amount of the species diversity, relationships, habitats, and life strategies of these microorganisms remain to be discovered and characterized. One important factor hindering progress is the difficulty in correctly identifying fungi. Morphological and molecular characteristics have been applied in such tasks. Later, DNA barcoding has emerged as a new method for the rapid and reliable identification of species. The nrITS region is considered the universal barcode of Fungi, and the ITS1 and ITS2 sub-regions have been applied as metabarcoding markers. In this study, we performed a large-scale analysis of all the available Basidiomycota sequences from GenBank. We carried out a rigorous trimming of the initial dataset based in methodological principals of DNA Barcoding. Two different approaches (PCI and barcode gap) were used to determine the performance of the complete ITS region and sub-regions. For most of the Basidiomycota genera, the three genomic markers performed similarly, i.e., when one was considered a good marker for the identification of a genus, the others were also; the same results were observed when the performance was insufficient. However, based on barcode gap analyses, we identified genomic markers that had a superior identification performance than the others and genomic markers that were not indicated for the identification of some genera. Notably, neither the complete ITS nor the sub-regions were useful in identifying 11 of the 113 Basidiomycota genera. The complex phylogenetic relationships and the presence of cryptic species in some genera are possible explanations of this limitation and are discussed. Knowledge regarding the efficiency and limitations of the barcode markers that are currently used for the identification of organisms is crucial because it benefits research in many areas. Our study provides information that may guide researchers in choosing

  14. Development of polymorphic genic-SSR markers by cDNA library sequencing in boxwood, Buxus spp. (Buxaceae)

    Science.gov (United States)

    Genic microsatellites or simple sequence repeat (genic-SSR) markers were developed in boxwood (Buxus taxa) for genetic diversity analysis, identification of taxa, and to facilitate breeding. cDNA libraries were developed from mRNA extracted from leaves of Buxus sempervirens ‘Vardar Valley’ and seque...

  15. Modified method for combined DNA and RNA isolation from peanut and other oil seeds.

    Science.gov (United States)

    Dang, Phat M; Chen, Charles Y

    2013-02-01

    Isolation of good quality RNA and DNA from seeds is difficult due to high levels of polysaccharides, polyphenols, and lipids that can degrade or co-precipitate with nucleic acids. Standard RNA extraction methods utilizing guanidinium-phenol-chloroform extraction has not shown to be successful. RNA isolation from plant seeds is a prerequisite for many seed specific gene expression studies and DNA is necessary in marker-assisted selection and other genetic studies. We describe a modified method to isolate both RNA and DNA from the same seed tissue and have been successful with several oil seeds including peanut, soybean, sunflower, canola, and oil radish. An additional LiCl precipitation step was added to isolate both RNA and DNA from the same seed tissues. High quality nucleic acids were observed based on A(260)/A(280) and A(260)/A(230) ratios above 2.0 and distinct bands on gel-electrophoresis. RNA was shown to be suitable for reverse transcriptase polymerase chain reaction based on actin or 60S ribosomal primer amplification and DNA was shown to have a single band on gel-electrophoresis analysis. This result shows that RNA and DNA isolated using this method can be appropriate for molecular studies in peanut and other oil containing seeds.

  16. Primary structures of ribosomal proteins from the archaebacterium Halobacterium marismortui and the eubacterium Bacillus stearothermophilus.

    Science.gov (United States)

    Arndt, E; Scholzen, T; Krömer, W; Hatakeyama, T; Kimura, M

    1991-06-01

    Approximately 40 ribosomal proteins from each Halobacterium marismortui and Bacillus stearothermophilus have been sequenced either by direct protein sequence analysis or by DNA sequence analysis of the appropriate genes. The comparison of the amino acid sequences from the archaebacterium H marismortui with the available ribosomal proteins from the eubacterial and eukaryotic kingdoms revealed four different groups of proteins: 24 proteins are related to both eubacterial as well as eukaryotic proteins. Eleven proteins are exclusively related to eukaryotic counterparts. For three proteins only eubacterial relatives-and for another three proteins no counterpart-could be found. The similarities of the halobacterial ribosomal proteins are in general somewhat higher to their eukaryotic than to their eubacterial counterparts. The comparison of B stearothermophilus proteins with their E coli homologues showed that the proteins evolved at different rates. Some proteins are highly conserved with 64-76% identity, others are poorly conserved with only 25-34% identical amino acid residues.

  17. Introgression evidence and phylogenetic relationships among three (ParaMisgurnus species as revealed by mitochondrial and nuclear DNA markers

    Directory of Open Access Journals (Sweden)

    Jakovlić I.

    2013-01-01

    Full Text Available The taxonomy of (ParaMisgurnus genera is still debated. We therefore used mitochondrial and nuclear DNA markers to analyze the phylogenetic relationships among Misgurnus anguillicaudatus, Paramisgurnus dabryanus and Misgurnus fossilis. Differing phylogenetic signals from mitochondrial and nuclear marker data suggest an introgression event in the history of M. anguillicaudatus and M. mohoity. No substantial genetic evidence was found that Paramisgurnus dabryanus should be classified as a separate genus.

  18. Polymorphic DNA microsatellite markers for forensic individual identification and parentage analyses of seven threatened species of parrots (family Psittacidae

    Directory of Open Access Journals (Sweden)

    Catherine Jan

    2016-09-01

    Full Text Available The parrot family represents one of the bird group with the largest number of endangered species, as a result of habitat destruction and illegal trade. This illicit traffic involves the smuggling of eggs and animals, and the laundering through captive breeding facilities of wild-caught animals. Despite the huge potential of wildlife DNA forensics to determine with conclusive evidence illegal trade, current usage of DNA profiling approaches in parrots has been limited by the lack of suitable molecular markers specifically developed for the focal species and by low cross-species polymorphism. In this study, we isolated DNA microsatellite markers in seven parrot species threatened with extinction (Amazona brasiliensis, A. oratrix, A. pretrei, A. rhodocorytha, Anodorhynchus leari, Ara rubrogenys and Primolius couloni. From an enriched genomic library followed by 454 pyrosequencing, we characterized a total of 106 polymorphic microsatellite markers (mostly tetranucleotides in the seven species and tested them across an average number of 19 individuals per species. The mean number of alleles per species and across loci varied from 6.4 to 8.3, with the mean observed heterozygosities ranging from 0.65 to 0.84. Identity and parentage exclusion probabilities were highly discriminatory. The high variability displayed by these microsatellite loci demonstrates their potential utility to perform individual genotyping and parentage analyses, in order to develop a DNA testing framework to determine illegal traffic in these threatened species.

  19. Identification, characterization and structure analysis of a type I ribosome-inactivating protein from Sapium sebiferum (Euphorbiaceae)

    Energy Technology Data Exchange (ETDEWEB)

    Wu, Ying [Key Laboratory of Ion Beam Bioengineering and Bioenergy Forest Research Center of State Forestry Administration, Hefei Institutes of Physical Science, Chinese Academy of Sciences, Hefei 230031, Anhui (China); School of Life Sciences, University of Science and Technology of China, Hefei 230027, Anhui (China); College of Food and Bioengineering, Henan University of Science and Technology, Luoyang 471023, Henan (China); Mao, Yingji [Key Laboratory of Ion Beam Bioengineering and Bioenergy Forest Research Center of State Forestry Administration, Hefei Institutes of Physical Science, Chinese Academy of Sciences, Hefei 230031, Anhui (China); School of Life Sciences, University of Science and Technology of China, Hefei 230027, Anhui (China); Jin, Shan; Hou, Jinyan; Du, Hua [Key Laboratory of Ion Beam Bioengineering and Bioenergy Forest Research Center of State Forestry Administration, Hefei Institutes of Physical Science, Chinese Academy of Sciences, Hefei 230031, Anhui (China); Yang, Minglei, E-mail: yml888@mail.ustc.edu.cn [Key Laboratory of Ion Beam Bioengineering and Bioenergy Forest Research Center of State Forestry Administration, Hefei Institutes of Physical Science, Chinese Academy of Sciences, Hefei 230031, Anhui (China); Wu, Lifang, E-mail: lfwu@ipp.ac.cn [Key Laboratory of Ion Beam Bioengineering and Bioenergy Forest Research Center of State Forestry Administration, Hefei Institutes of Physical Science, Chinese Academy of Sciences, Hefei 230031, Anhui (China); School of Life Sciences, University of Science and Technology of China, Hefei 230027, Anhui (China)

    2015-08-07

    Ribosome-inactivating proteins (RIPs) are N-glycosidases (EC3.2.2.22) that universally inactivate the ribosome, thereby inhibiting protein biosynthesis. In this study, a novel type I RIPs named SEBIN was identified in Sapium sebiferum. Nuclear acid depurine experiment showed that SEBIN had rRNA N-Glycosidase activity. Further experiment indicated that SEBIN significantly inhibited Caenorhabditis elegans development as well as resulted in worm cell apoptosis. This is the first report to evaluate RIPs toxicity using C. elegans. We proposed that SEBIN may impaire C. elegans reproduction in a DNA-damage manner besides traditional protein synthesis inhibition approach. The predicted 3D structure was modeled using threading and ab initio modeling, and the r-RNA binding residue of SEBIN was identified through the protein-ligand docking approach. It showed the amino acid residues, Glu195, Asn81, Ala82, Tyr83, Glu164, Ser163, Ile159 and Arg167, played critical roles in catalytic process. Our results provided the theoretical foundation of structure–function relationships between enzymatic properties, toxicity and structural characterization of SEBIN. - Graphical abstract: Superposition of main chains of ricin (cyan) and SEBIN (brown), and adenine binding site residues of SEBIN. - Highlights: • A Ribosome-inactivating proteins gene (SEBIN) was isolated from Sapium sebiferum. • SEBIN had DNase activity besides widely reported ribosome inactivation via N-glycosidases activity. • SEBIN significantly inhibited Caenorhabditis elegans development in vivo. • SEBIN may impaire C. elegans reproduction in a DNA-damage manner with the aid of mutant strains hus-1 and clk-2. • The possible active sites between SEBIN and the adenine of rRNA were predicted.

  20. Identification, characterization and structure analysis of a type I ribosome-inactivating protein from Sapium sebiferum (Euphorbiaceae)

    International Nuclear Information System (INIS)

    Wu, Ying; Mao, Yingji; Jin, Shan; Hou, Jinyan; Du, Hua; Yang, Minglei; Wu, Lifang

    2015-01-01

    Ribosome-inactivating proteins (RIPs) are N-glycosidases (EC3.2.2.22) that universally inactivate the ribosome, thereby inhibiting protein biosynthesis. In this study, a novel type I RIPs named SEBIN was identified in Sapium sebiferum. Nuclear acid depurine experiment showed that SEBIN had rRNA N-Glycosidase activity. Further experiment indicated that SEBIN significantly inhibited Caenorhabditis elegans development as well as resulted in worm cell apoptosis. This is the first report to evaluate RIPs toxicity using C. elegans. We proposed that SEBIN may impaire C. elegans reproduction in a DNA-damage manner besides traditional protein synthesis inhibition approach. The predicted 3D structure was modeled using threading and ab initio modeling, and the r-RNA binding residue of SEBIN was identified through the protein-ligand docking approach. It showed the amino acid residues, Glu195, Asn81, Ala82, Tyr83, Glu164, Ser163, Ile159 and Arg167, played critical roles in catalytic process. Our results provided the theoretical foundation of structure–function relationships between enzymatic properties, toxicity and structural characterization of SEBIN. - Graphical abstract: Superposition of main chains of ricin (cyan) and SEBIN (brown), and adenine binding site residues of SEBIN. - Highlights: • A Ribosome-inactivating proteins gene (SEBIN) was isolated from Sapium sebiferum. • SEBIN had DNase activity besides widely reported ribosome inactivation via N-glycosidases activity. • SEBIN significantly inhibited Caenorhabditis elegans development in vivo. • SEBIN may impaire C. elegans reproduction in a DNA-damage manner with the aid of mutant strains hus-1 and clk-2. • The possible active sites between SEBIN and the adenine of rRNA were predicted

  1. The efficacy of 16S ribosomal DNA sequencing in the diagnosis of bacteria from blood, bone and synovial fluid samples of children with musculoskeletal infections.

    Science.gov (United States)

    Hashavya, S; Gross, I; Michael-Gayego, A; Simanovsky, N; Lamdan, R

    2018-04-01

    Musculoskeletal infections are among the most common bacterial infections in children leading to hospitalization, invasive procedures and prolonged antibiotic administration. Blood, synovial and sometimes tissue cultures are essential for the diagnosis and treatment of musculoskeletal infections; 16S ribosomal DNA (rDNA) sequencing is a novel diagnostic tool for the detection of bacteria.While the yield of 16S rDNA sequencing in synovial fluid was previously assessed, data regarding the efficacy of this method from blood samples or partially treated children with suspected musculoskeletal infections is lacking.In this study we assessed the yield of 16S rDNA sequencing in blood, bone and synovial samples of children with musculoskeletal infections. Blood, synovial and bone samples were collected from children with suspected musculoskeletal infections and analyzed for the presence of 16S rDNA, the results were then compared with the benchmark microbial cultures. During the study period, 41 children (18 boys and 23 girls) with suspected acute musculoskeletal infection were enrolled. A positive blood culture was found in 6/31 cases (19.4%) with methicillin-susceptible Staphylococcus aureus being the most commonly isolated bacterium. No significant 16S rDNA detection in blood samples was recorded.Synovial fluid culture was positive in 6/28 samples (21%), Kingella kingae being the most common pathogen. When using the 16S rDNA sequencing method, the rate of positive results in synovial fluid was higher with bacterial detection in 12/23 (52%) samples. The 16S rDNA sequencing method was also able to identify pathogens in samples taken from partially treated children where cultures were negative with 16S rDNA detection in 5/5 samples. Although 16S rDNA sequencing may increase the yield of bacterial detection in synovial samples of patients with musculoskeletal infections, there is no benefit from applying this method on blood samples. The 16S rDNA sequencing method may be

  2. An annotated genetic map of loblolly pine based on microsatellite and cDNA markers

    Science.gov (United States)

    Craig S. Echt; Surya Saha; Konstantin V. Krutovsky; Kokulapalan Wimalanathan; John E. Erpelding; Chun Liang; C Dana Nelson

    2011-01-01

    Previous loblolly pine (Pinus taeda L.) genetic linkage maps have been based on a variety of DNA polymorphisms, such as AFLPs, RAPDs, RFLPs, and ESTPs, but only a few SSRs (simple sequence repeats), also known as simple tandem repeats or microsatellites, have been mapped in P. taeda. The objective of this study was to integrate a large set of SSR markers from a variety...

  3. The chloroplast DNA locus psbZ-trnfM as a potential barcode marker in Phoenix L. (Arecaceae

    Directory of Open Access Journals (Sweden)

    Marco Ballardini

    2013-12-01

    Full Text Available The genus Phoenix (Arecaceae comprises 14 species distributed from Cape Verde Islands to SE Asia. It includes the economically important species Phoenix dactylifera. The paucity of differential morphological and anatomical useful characters, and interspecific hybridization, make identification of Phoenix species difficult. In this context, the development of reliable DNA markers for species and hybrid identification would be of great utility. Previous studies identified a 12 bp polymorphic chloroplast minisatellite in the trnG(GCC-trnfM(CAU spacer, and showed its potential for species identification in Phoenix. In this work, in order to develop an efficient DNA barcode marker for Phoenix, a longer cpDNA region (700 bp comprising the mentioned minisatellite, and located between the psbZ and trnfM(CAU genes, was sequenced. One hundred and thirty-six individuals, representing all Phoenix species except P. andamanensis, were analysed. The minisatellite showed 2-7 repetitions of the 12 bp motif, with 1-3 out of seven haplotypes per species. Phoenix reclinata and P. canariensis had species-specific haplotypes. Additional polymorphisms were found in the flanking regions of the minisatellite, including substitutions, indels and homopolymers. All this information allowed us to identify unambiguously eight out of the 13 species, and overall 80% of the individuals sampled. Phoenix rupicola and P. theophrasti had the same haplotype, and so had P. atlantica, P. dactylifera, and P. sylvestris (the “date palm complex” sensu Pintaud et al. 2013. For these species, additional molecular markers will be required for their unambiguous identification. The psbZ-trnfM(CAU region therefore could be considered as a good basis for the establishment of a DNA barcoding system in Phoenix, and is potentially useful for the identification of the female parent in Phoenix hybrids.

  4. The first determination of Trichuris sp. from roe deer by amplification and sequenation of the ITS1-5.8S-ITS2 segment of ribosomal DNA.

    Science.gov (United States)

    Salaba, O; Rylková, K; Vadlejch, J; Petrtýl, M; Scháňková, S; Brožová, A; Jankovská, I; Jebavý, L; Langrová, I

    2013-03-01

    Trichuris nematodes were isolated from roe deer (Capreolus capreolus). At first, nematodes were determined using morphological and biometrical methods. Subsequently genomic DNA was isolated and the ITS1-5.8S-ITS2 segment from ribosomal DNA (RNA) was amplified and sequenced using PCR techniques. With u sing morphological and biometrical methods, female nematodes were identified as Trichuris globulosa, and the only male was identified as Trichuris ovis. The females were classified into four morphotypes. However, analysis of the internal transcribed spacers (ITS1-5.8S-ITS2) of specimens did not confirm this classification. Moreover, the female individuals morphologically determined as T. globulosa were molecularly identified as Trichuris discolor. In the case of the only male molecular analysis match the result of the molecular identification. Furthermore, a comparative phylogenetic study was carried out with the ITS1 and ITS2 sequences of the Trichuris species from various hosts. A comparison of biometric information from T. discolor individuals from this study was also conducted.

  5. Virtual Ribosome - a comprehensive DNA translation tool with support for integration of sequence feature annotation

    DEFF Research Database (Denmark)

    Wernersson, Rasmus

    2006-01-01

    of alternative start codons. ( ii) Integration of sequences feature annotation - in particular, native support for working with files containing intron/ exon structure annotation. The software is available for both download and online use at http://www.cbs.dtu.dk/services/VirtualRibosome/....

  6. Natural hybridization in tropical spikerushes of Eleocharis subgenus Limnochloa (Cyperaceae): Evidence from morphology and DNA markers

    Czech Academy of Sciences Publication Activity Database

    Košnar, J.; Košnar, Ji.; Macek, Petr; Herbstová, Miroslava; Rejmánková, E.; Stech, M.

    2010-01-01

    Roč. 97, č. 7 (2010), s. 1229-1240 ISSN 0002-9122 Institutional research plan: CEZ:AV0Z60050516; CEZ:AV0Z50510513 Keywords : Belize * Cyperaceae * DNA markers * hybridization Subject RIV: EB - Genetics ; Molecular Biology; EB - Genetics ; Molecular Biology (BU-J) Impact factor: 3.052, year: 2010

  7. Phylogenetic relationships of click beetles (Coleoptera: Elateridae) inferred from 28S ribosomal DNA: insights into the evolution of bioluminescence in Elateridae.

    Science.gov (United States)

    Sagegami-Oba, Reiko; Oba, Yuichi; Ohira, Hitoo

    2007-02-01

    Although the taxonomy of click beetles (family Elateridae) has been studied extensively, inconsistencies remain. We examine here the relationships between species of Elateridae based on partial sequences of nuclear 28S ribosomal DNA. Specimens were collected primarily from Japan, while luminous click beetles were also sampled from Central and South America to investigate the origins of bioluminescence in Elateridae. Neighbor-joining, maximum-parsimony, and maximum-likelihood analyses produced a consistent basal topology with high statistical support that is partially congruent with the results of previous investigations based on the morphological characteristics of larvae and adults. The most parsimonious reconstruction of the "luminous" and "nonluminous" states, based on the present molecular phylogeny, indicates that the ancestral state of Elateridae was nonluminous. This suggests that the bioluminescence in click beetle evolved independent of that of other luminous beetles, such as Lampyridae, despite their common mechanisms of bioluminescence.

  8. Validation of eDNA markers for New Zealand mudsnail surveillance and initial eDNA monitoring at Mississippi River Basin sites

    Science.gov (United States)

    Merkes, Christopher; Turnquist, Keith N.; Rees, Christopher B.; Amberg, Jon J.

    2015-01-01

    The performance of newly developed New Zealand mudsnail (Potamopyrgus antipodarum; NZMS) genetic markers for environmental (eDNA) analysis of water were compared across two laboratories. The genetic markers were tested in four quantitative polymerase chain reaction assays targeting two regions of the NZMS mitochondrial genome, specifically the cytochrome c oxidase subunit 1 (coi) and cytochrome b (cytb) genes. In a blind study, analysts tested each sample eight times with each assay. There were 10 expected-negative samples from the Black River in La Crosse, Wisconsin, 10 expected-positive samples from the Black Earth Creek in Black Earth, Wisconsin, and 10 known-positive samples from the Black River spiked with NZMS DNA. Previously extracted samples, kept at the Upper Midwest Environmental Sciences Center, were pooled by sample location and then equal quantities were distributed between the Upper Midwest Environmental Sciences Center and the Molecular Conservation Genetics Laboratory at the University of Wisconsin-Stevens Point for analysis. The assays tested were (1) the assay targeting cytb with a minor groove binder probe described by Goldberg and others (2013), (2) the cytb assay with a modified double-quenched probe, (3) an assay targeting coi with a double-quenched probe, and (4) a duplex reaction combining the modified cytb assay and the coi assay. Samples were considered positive for the presence of NZMS DNA when quantitative polymerase chain reaction amplification and probe signal was higher than the normalized threshold value above baseline fluorescence. For the duplex assay, samples were considered positive only when both probe signals were higher than the normalized threshold value above baseline fluorescence. Positive results were then confirmed by sequencing the products.

  9. Structure of Ribosomal Silencing Factor Bound to Mycobacterium tuberculosis Ribosome.

    Science.gov (United States)

    Li, Xiaojun; Sun, Qingan; Jiang, Cai; Yang, Kailu; Hung, Li-Wei; Zhang, Junjie; Sacchettini, James C

    2015-10-06

    The ribosomal silencing factor RsfS slows cell growth by inhibiting protein synthesis during periods of diminished nutrient availability. The crystal structure of Mycobacterium tuberculosis (Mtb) RsfS, together with the cryo-electron microscopy (EM) structure of the large subunit 50S of Mtb ribosome, reveals how inhibition of protein synthesis by RsfS occurs. RsfS binds to the 50S at L14, which, when occupied, blocks the association of the small subunit 30S. Although Mtb RsfS is a dimer in solution, only a single subunit binds to 50S. The overlap between the dimer interface and the L14 binding interface confirms that the RsfS dimer must first dissociate to a monomer in order to bind to L14. RsfS interacts primarily through electrostatic and hydrogen bonding to L14. The EM structure shows extended rRNA density that it is not found in the Escherichia coli ribosome, the most striking of these being the extended RNA helix of H54a. Copyright © 2015 Elsevier Ltd. All rights reserved.

  10. Identification of Fasciola flukes in Thailand based on their spermatogenesis and nuclear ribosomal DNA, and their intraspecific relationships based on mitochondrial DNA.

    Science.gov (United States)

    Chaichanasak, Pannigan; Ichikawa, Madoka; Sobhon, Prasert; Itagaki, Tadashi

    2012-12-01

    We analyzed 147 Fasciola flukes obtained from cattle in Thailand based on their spermatogenetic ability, and nuclear ribosomal internal transcribed spacer 1 (ITS1) and mitochondrial nicotiamide adenine dinucleotide dehydrogenase subunit 1 (ND1) genes as molecular markers. One hundred twenty-eight flukes, which had abundant sperm in their seminal vesicles (spermic) and showed the PCR-RFLP pattern of F. gigantica in the ITS1, were accurately identified as F. gigantica. The other 19 flukes that had no sperm in their seminal vesicles were aspermic Fasciola sp. with the RFLP patterns identical to that of F. gigantica. Twenty-nine ND1 haplotypes (Fg-ND1-Thai 2-30) were distinguished in the 128 F. gigantica flukes and were divided into haplotypes unique to Thailand and those common to other countries, suggesting the possibility that ancestral haplotypes were introduced into Thailand. Three haplotypes (Fg-ND1-Thai 7, 9 and 27) appeared to be the major haplotypes found in F. gigantica from Thailand. Only one haplotype (Fg-ND1-Thai 1) was found in the 19 aspermic Fasciola sp. flukes obtained from geographical regions, and the nucleotide sequence of Fg-ND1-Thai 1 was identical to that of the aspermic Fasciola sp. from Japan, Korea, China, Vietnam and Myanmar, suggesting that they were descendants with a common provenance and expanded to these countries in the relatively recent past. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

  11. Molecular phylogeny of Oncaeidae (Copepoda using nuclear ribosomal internal transcribed spacer (ITS rDNA.

    Directory of Open Access Journals (Sweden)

    Iole Di Capua

    Full Text Available Copepods belonging to the Oncaeidae family are commonly and abundantly found in marine zooplankton. In the Mediterranean Sea, forty-seven oncaeid species occur, of which eleven in the Gulf of Naples. In this Gulf, several Oncaea species were morphologically analysed and described at the end of the XIX century by W. Giesbrecht. In the same area, oncaeids are being investigated over seasonal and inter-annual scales at the long-term coastal station LTER-MC. In the present work, we identified six oncaeid species using the nuclear ribosomal internal transcribed spacers (ITS rDNA and the mitochondrial cytochrome c oxidase subunit I (mtCOI. Phylogenetic analyses based on these two genomic regions validated the sisterhood of the genera Triconia and the Oncaea sensu stricto. ITS1 and ITS2 phylogenies produced incongruent results about the position of Oncaea curta, calling for further investigations on this species. We also characterised the ITS2 region by secondary structure predictions and found that all the sequences analysed presented the distinct eukaryotic hallmarks. A Compensatory Base Change search corroborated the close relationship between O. venusta and O. curta and between O. media and O. venusta already identified by ITS phylogenies. The present results, which stem from the integration of molecular and morphological taxonomy, represent an encouraging step towards an improved knowledge of copepod biodiversity: The two complementary approaches, when applied to long-term copepod monitoring, will also help to better understanding their genetic variations and ecological niches of co-occurring species.

  12. Ribosomal studies on the 70S ribosome of E.coli by means of neutron scattering; Strukturuntersuchungen am 70S-Ribosom von E.coli unter Anwendung von Neutronenstreuung

    Energy Technology Data Exchange (ETDEWEB)

    Burkhardt, N. [GKSS-Forschungszentrum Geesthacht GmbH (Germany). Inst. fuer Werkstofforschung

    1997-12-31

    Ribosomes are ribonucleo-protein complexes, which catalyse proteinbiosynthesis in all living organisms. Currently, most of the structural models of the prokaryotic 70S ribosome rely on electron microscopy and describe mainly the outer shape of the particle. Neutron scattering can provide information on the internal structure of the ribosome. Parts of the structure can be contrasted for neutrons by means of an isotopic exchange of the naturally occurring hydrogen ({sup 1}H) for deuterium ({sup 2}H), allowing direct measurements in situ. Specifically deuterium-labeled ribosomes (E. coli) were prepared and analysed with neutron scattering. The biochemical methods were established and combined to a generally applicable preparation system. This allows labeling of all ribosomal components in any combination. A systematic analysis of the protein and RNA phases resulted in the development of a new model for the 70S ribosome. This model describes not only the outer shape of the particle, but displays also an experimentally determined internal protein-RNA distribution and the border of subunits for the first time (four-phase model; resolution: 50A). Models of the 70S ribosome from other studies were evaluated and ranked according to consistency with the measured scattering data. Applying a new neutron scattering technique of particular sensitivity, the proton-spin contrast-variation, single proteins could be measured and localized. The positions of the proteins S6 and S10 were determined, providing the first coordinates of protein mass centers within the 70S ribosome. (orig.) [Deutsch] Ribosomen sind Ribonukleinsaeure-Protein Komplexe, die in allen lebenden Organismen die Proteinbiosynthese katalysieren. Strukturmodelle fuer das prokaryontische 70S-Ribosom beruhen derzeit vorwiegend auf elektronenmikroskopischen Untersuchungen und beschreiben im wesentlichen die aeussere Oberflaeche des Partikels. Informationen ueber die innere Struktur des Ribosoms koennen Messungen mit

  13. Ribosomal studies on the 70S ribosome of E.coli by means of neutron scattering; Strukturuntersuchungen am 70S-Ribosom von E.coli unter Anwendung von Neutronenstreuung

    Energy Technology Data Exchange (ETDEWEB)

    Burkhardt, N [GKSS-Forschungszentrum Geesthacht GmbH (Germany). Inst. fuer Werkstofforschung

    1998-12-31

    Ribosomes are ribonucleo-protein complexes, which catalyse proteinbiosynthesis in all living organisms. Currently, most of the structural models of the prokaryotic 70S ribosome rely on electron microscopy and describe mainly the outer shape of the particle. Neutron scattering can provide information on the internal structure of the ribosome. Parts of the structure can be contrasted for neutrons by means of an isotopic exchange of the naturally occurring hydrogen ({sup 1}H) for deuterium ({sup 2}H), allowing direct measurements in situ. Specifically deuterium-labeled ribosomes (E. coli) were prepared and analysed with neutron scattering. The biochemical methods were established and combined to a generally applicable preparation system. This allows labeling of all ribosomal components in any combination. A systematic analysis of the protein and RNA phases resulted in the development of a new model for the 70S ribosome. This model describes not only the outer shape of the particle, but displays also an experimentally determined internal protein-RNA distribution and the border of subunits for the first time (four-phase model; resolution: 50A). Models of the 70S ribosome from other studies were evaluated and ranked according to consistency with the measured scattering data. Applying a new neutron scattering technique of particular sensitivity, the proton-spin contrast-variation, single proteins could be measured and localized. The positions of the proteins S6 and S10 were determined, providing the first coordinates of protein mass centers within the 70S ribosome. (orig.) [Deutsch] Ribosomen sind Ribonukleinsaeure-Protein Komplexe, die in allen lebenden Organismen die Proteinbiosynthese katalysieren. Strukturmodelle fuer das prokaryontische 70S-Ribosom beruhen derzeit vorwiegend auf elektronenmikroskopischen Untersuchungen und beschreiben im wesentlichen die aeussere Oberflaeche des Partikels. Informationen ueber die innere Struktur des Ribosoms koennen Messungen mit

  14. Phylogeny of the Celastraceae inferred from 26S nuclear ribosomal DNA, phytochrome B, rbcL, atpB, and morphology.

    Science.gov (United States)

    Simmons, M P; Savolainen, V; Clevinger, C C; Archer, R H; Davis, J I

    2001-06-01

    Phylogenetic relationships within Celastraceae (spindle-tree family) were inferred from nucleotide sequence characters from the 5' end of 26S nuclear ribosomal DNA (including expansion segments D1-D3; 84 species sampled), phytochrome B (58 species), rbcL (31 species), atpB (23 species), and morphology (94 species). Among taxa of questionable affinity, Forsellesia is a member of Crossosomataceae, and Goupia is excluded from Celastraceae. However, Brexia, Canotia, Lepuropetalon, Parnassia, Siphonodon, and Stackhousiaceae are supported as members of Celastraceae. Gymnosporia and Tricerma are distinct from Maytenus, Cassine is supported as distinct from Elaeodendron, and Dicarpellum is distinct from Salacia. Catha, Maytenus, and Pristimera are not resolved as natural genera. Hippocrateaceae (including Plagiopteron and Lophopetalum) are a clade nested within a paraphyletic Celastraceae. These data also suggest that the Loesener's classification of Celastraceae sensu stricto and Hallé's classification of Hippocrateaceae are artificial. The diversification of the fruit and aril within Celastraceae appears to be complex, with multiple origins of most fruit and aril forms. Copyright 2001 Academic Press.

  15. Differential Stoichiometry among Core Ribosomal Proteins

    Directory of Open Access Journals (Sweden)

    Nikolai Slavov

    2015-11-01

    Full Text Available Understanding the regulation and structure of ribosomes is essential to understanding protein synthesis and its dysregulation in disease. While ribosomes are believed to have a fixed stoichiometry among their core ribosomal proteins (RPs, some experiments suggest a more variable composition. Testing such variability requires direct and precise quantification of RPs. We used mass spectrometry to directly quantify RPs across monosomes and polysomes of mouse embryonic stem cells (ESC and budding yeast. Our data show that the stoichiometry among core RPs in wild-type yeast cells and ESC depends both on the growth conditions and on the number of ribosomes bound per mRNA. Furthermore, we find that the fitness of cells with a deleted RP-gene is inversely proportional to the enrichment of the corresponding RP in polysomes. Together, our findings support the existence of ribosomes with distinct protein composition and physiological function.

  16. Assessing Date Palm Genetic Diversity Using Different Molecular Markers.

    Science.gov (United States)

    Atia, Mohamed A M; Sakr, Mahmoud M; Adawy, Sami S

    2017-01-01

    Molecular marker technologies which rely on DNA analysis provide powerful tools to assess biodiversity at different levels, i.e., among and within species. A range of different molecular marker techniques have been developed and extensively applied for detecting variability in date palm at the DNA level. Recently, the employment of gene-targeting molecular marker approaches to study biodiversity and genetic variations in many plant species has increased the attention of researchers interested in date palm to carry out phylogenetic studies using these novel marker systems. Molecular markers are good indicators of genetic distances among accessions, because DNA-based markers are neutral in the face of selection. Here we describe the employment of multidisciplinary molecular marker approaches: amplified fragment length polymorphism (AFLP), start codon targeted (SCoT) polymorphism, conserved DNA-derived polymorphism (CDDP), intron-targeted amplified polymorphism (ITAP), simple sequence repeats (SSR), and random amplified polymorphic DNA (RAPD) to assess genetic diversity in date palm.

  17. Evolutionary dynamics of a conserved sequence motif in the ribosomal genes of the ciliate Paramecium.

    Science.gov (United States)

    Catania, Francesco; Lynch, Michael

    2010-05-04

    In protozoa, the identification of preserved motifs by comparative genomics is often impeded by difficulties to generate reliable alignments for non-coding sequences. Moreover, the evolutionary dynamics of regulatory elements in 3' untranslated regions (both in protozoa and metazoa) remains a virtually unexplored issue. By screening Paramecium tetraurelia's 3' untranslated regions for 8-mers that were previously found to be preserved in mammalian 3' UTRs, we detect and characterize a motif that is distinctly conserved in the ribosomal genes of this ciliate. The motif appears to be conserved across Paramecium aurelia species but is absent from the ribosomal genes of four additional non-Paramecium species surveyed, including another ciliate, Tetrahymena thermophila. Motif-free ribosomal genes retain fewer paralogs in the genome and appear to be lost more rapidly relative to motif-containing genes. Features associated with the discovered preserved motif are consistent with this 8-mer playing a role in post-transcriptional regulation. Our observations 1) shed light on the evolution of a putative regulatory motif across large phylogenetic distances; 2) are expected to facilitate the understanding of the modulation of ribosomal genes expression in Paramecium; and 3) reveal a largely unexplored--and presumably not restricted to Paramecium--association between the presence/absence of a DNA motif and the evolutionary fate of its host genes.

  18. Evolutionary and dispersal history of Triatoma infestans, main vector of Chagas disease, by chromosomal markers.

    Science.gov (United States)

    Panzera, Francisco; Ferreiro, María J; Pita, Sebastián; Calleros, Lucía; Pérez, Ruben; Basmadjián, Yester; Guevara, Yenny; Brenière, Simone Frédérique; Panzera, Yanina

    2014-10-01

    Chagas disease, one of the most important vector-borne diseases in the Americas, is caused by Trypanosoma cruzi and transmitted to humans by insects of the subfamily Triatominae. An effective control of this disease depends on elimination of vectors through spraying with insecticides. Genetic research can help insect control programs by identifying and characterizing vector populations. In southern Latin America, Triatoma infestans is the main vector and presents two distinct lineages, known as Andean and non-Andean chromosomal groups, that are highly differentiated by the amount of heterochromatin and genome size. Analyses with nuclear and mitochondrial sequences are not conclusive about resolving the origin and spread of T. infestans. The present paper includes the analyses of karyotypes, heterochromatin distribution and chromosomal mapping of the major ribosomal cluster (45S rDNA) to specimens throughout the distribution range of this species, including pyrethroid-resistant populations. A total of 417 specimens from seven different countries were analyzed. We show an unusual wide rDNA variability related to number and chromosomal position of the ribosomal genes, never before reported in species with holocentric chromosomes. Considering the chromosomal groups previously described, the ribosomal patterns are associated with a particular geographic distribution. Our results reveal that the differentiation process between both T. infestans chromosomal groups has involved significant genomic reorganization of essential coding sequences, besides the changes in heterochromatin and genomic size previously reported. The chromosomal markers also allowed us to detect the existence of a hybrid zone occupied by individuals derived from crosses between both chromosomal groups. Our genetic studies support the hypothesis of an Andean origin for T. infestans, and suggest that pyrethroid-resistant populations from the Argentinean-Bolivian border are most likely the result of

  19. Control of ribosome formation in rat heart

    International Nuclear Information System (INIS)

    Russo, L.A.

    1987-01-01

    Diabetes of 9 days duration produced a 17% diminution in the rate of total protein synthesis in rat hearts perfused as Langendorff preparations supplied with glucose, plasma levels of amino acids, and 400 μU/ml insulin. This reduction was attributable to a decrease in efficiency of protein synthesis and total RNA content. Total messenger RNA content decreased in diabetic hearts in proportion to the reduction in total RNA. Diabetes also resulted in diminished ribosome content as reflected by the induction in total RNA. Ribosome production was investigated by monitoring incorporation of [ 3 H]phenylalanine into the proteins of cytoplasmic ribosomes. Rates of ribosome formation in diabetic hearts were as fast as control rates in the presence of insulin, and were faster than control rates in the absence of the hormone. These results indicated that ribosome content fell in diabetic hearts despite unchanged or faster rates of ribosome formation

  20. Cryo-EM structure of the archaeal 50S ribosomal subunit in complex with initiation factor 6 and implications for ribosome evolution

    DEFF Research Database (Denmark)

    Greber, Basil J; Boehringer, Daniel; Godinic-Mikulcic, Vlatka

    2012-01-01

    additional components of the translation machinery with eukaryotes that are absent in bacteria. One of these translation factors is initiation factor 6 (IF6), which associates with the large ribosomal subunit. We have reconstructed the 50S ribosomal subunit from the archaeon Methanothermobacter...... between this archaeal ribosome and eukaryotic ribosomes but are mostly absent in bacteria and in some archaeal lineages. Furthermore, the structure reveals that, in spite of highly divergent evolutionary trajectories of the ribosomal particle and the acquisition of novel functions of IF6 in eukaryotes......, the molecular binding of IF6 on the ribosome is conserved between eukaryotes and archaea. The structure also provides a snapshot of the reductive evolution of the archaeal ribosome and offers new insights into the evolution of the translation system in archaea....

  1. Changes in markers of oxidative stress and DNA damage in human visceral adipose tissue from subjects with obesity and type 2 diabetes.

    Science.gov (United States)

    Jones, D A; Prior, S L; Barry, J D; Caplin, S; Baxter, J N; Stephens, J W

    2014-12-01

    In the past 30 years, prevalence of obesity has almost trebled resulting in an increased incidence of type 2 diabetes mellitus and other co-morbidities. Visceral adipose tissue is believed to play a vital role, but underlying mechanisms remain unclear. Our aim was to investigate changes in markers of oxidative damage in human visceral adipose tissue to determine levels of oxidative burden that may be attributed to obesity and/or diabetes. Visceral adipose tissue samples from 61 subjects undergoing abdominal surgery grouped as lean, obese and obese with type 2 diabetes mellitus, were examined using 3 different markers of oxidative stress. Malondialdehyde (MDA) concentration was measured as a marker of lipid peroxidation, telomere length and Comet assay as markers of oxidative DNA damage. No significant difference in MDA concentration, telomere length and DNA damage was observed between groups, although longer telomere lengths were seen in the obese with diabetes group compared to the obese group (Pstress and DNA damage was observed in samples from subjects with type 2 diabetes mellitus. Further work is required to investigate this further, however this phenomenon may be due to an up regulation of antioxidant defences in adipose tissue. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  2. Identification of three randomly amplified polymorphic DNA-polymerase chain reaction markers for distinguishing Asian and North American Gypsy Moths (Lepidoptera: Lymantriidae)

    Science.gov (United States)

    David E. Schreiber; Karen J. Garner; James M. Slavicek

    1997-01-01

    Gypsy moths originating in Asia have recently been introduced into North America, making it necessary to develop markers for distinguishing the Asian strain from the established North American population. We have identified 3 randomly amplified polymorphic DNA-polymerase chain reaction generated (RAPD-PCR) markers which are specific for either Asian or North American...

  3. Quantification of Circulating Free DNA as a Diagnostic Marker in Gall Bladder Cancer.

    Science.gov (United States)

    Kumari, Swati; Tewari, Shikha; Husain, Nuzhat; Agarwal, Akash; Pandey, Anshuman; Singhal, Ashish; Lohani, Mohtashim

    2017-01-01

    Gall bladder Carcinoma (GBC) is the fifth most common cancer of the digestive tract and frequently diagnosed in late stage of disease. Estimation of circulating free DNA (cfDNA) in serum has been applied as a "liquid biopsy" in several deep seated malignancies. Its value in diagnosis of gall bladder carcinoma has not been studied. The present study was designed to assess the role of cfDNA in the diagnosis of GBC and correlate levels with the TNM stage. Serum was collected from 34 patients with GBC and 39 age and sex matched controls including 22 cholecystitis and 17 healthy individuals. Serum cfDNA levels were measured through quantitative polymerase chain reaction (qPCR) by amplification of β-globin gene. Performance of the assay was calculated through the receiver operating characteristic (ROC) curve. The cfDNA level was significantly lower in healthy controls and cholecystitis (89.32 ± 59.76 ng/ml, 174.21 ± 99.93 ng/ml) compared to GBC (1245.91 ± 892.46 ng/ml, p = <0.001). The cfDNA level was significantly associated with TNM stage, lymph node involvement and jaundice (0.002, 0.027, and 0.041, respectively). Area under curve of ROC analysis for cancer group versus healthy and cholecystitis group was 1.00 and 0.983 with sensitivity of 100 %, 88.24 % and specificity of 100 % respectively. Quantitative analysis of cfDNA may distinguish cholecystitis and gall bladder carcinoma and may serve as new diagnostic, noninvasive marker adjunct to imaging for the diagnosis of GBC.

  4. Kinetic pathway of 40S ribosomal subunit recruitment to hepatitis C virus internal ribosome entry site.

    Science.gov (United States)

    Fuchs, Gabriele; Petrov, Alexey N; Marceau, Caleb D; Popov, Lauren M; Chen, Jin; O'Leary, Seán E; Wang, Richard; Carette, Jan E; Sarnow, Peter; Puglisi, Joseph D

    2015-01-13

    Translation initiation can occur by multiple pathways. To delineate these pathways by single-molecule methods, fluorescently labeled ribosomal subunits are required. Here, we labeled human 40S ribosomal subunits with a fluorescent SNAP-tag at ribosomal protein eS25 (RPS25). The resulting ribosomal subunits could be specifically labeled in living cells and in vitro. Using single-molecule Förster resonance energy transfer (FRET) between RPS25 and domain II of the hepatitis C virus (HCV) internal ribosome entry site (IRES), we measured the rates of 40S subunit arrival to the HCV IRES. Our data support a single-step model of HCV IRES recruitment to 40S subunits, irreversible on the initiation time scale. We furthermore demonstrated that after binding, the 40S:HCV IRES complex is conformationally dynamic, undergoing slow large-scale rearrangements. Addition of translation extracts suppresses these fluctuations, funneling the complex into a single conformation on the 80S assembly pathway. These findings show that 40S:HCV IRES complex formation is accompanied by dynamic conformational rearrangements that may be modulated by initiation factors.

  5. Amino acid-dependent signaling via S6K1 and MYC is essential for regulation of rDNA transcription

    Science.gov (United States)

    Kang, Jian; Kusnadi, Eric P.; Ogden, Allison J.; Hicks, Rodney J.; Bammert, Lukas; Kutay, Ulrike; Hung, Sandy; Sanij, Elaine; Hannan, Ross D.; Hannan, Katherine M.; Pearson, Richard B.

    2016-01-01

    Dysregulation of RNA polymerase I (Pol I)-dependent ribosomal DNA (rDNA) transcription is a consistent feature of malignant transformation that can be targeted to treat cancer. Understanding how rDNA transcription is coupled to the availability of growth factors and nutrients will provide insight into how ribosome biogenesis is maintained in a tumour environment characterised by limiting nutrients. We demonstrate that modulation of rDNA transcription initiation, elongation and rRNA processing is an immediate, co-regulated response to altered amino acid abundance, dependent on both mTORC1 activation of S6K1 and MYC activity. Growth factors regulate rDNA transcription initiation while amino acids modulate growth factor-dependent rDNA transcription by primarily regulating S6K1-dependent rDNA transcription elongation and processing. Thus, we show for the first time amino acids regulate rRNA synthesis by a distinct, post-initiation mechanism, providing a novel model for integrated control of ribosome biogenesis that has implications for understanding how this process is dysregulated in cancer. PMID:27385002

  6. Crystallization of ribosomes from Thermus thermophilus

    International Nuclear Information System (INIS)

    Karpova, E.A.; Serdyuk, I.N.; Tarkhovskii, Yu.S.; Orlova, E.V.; Borovyagin, V.L.

    1987-01-01

    An understanding of the molecular bases of the process of protein biosynthesis on the ribosome requires a knowledge of its structure with high three-dimensional resolution involving the method of x-ray crystallographic analysis. The authors report on the production of crystals of the 70S ribosomes from a new source - the highly thermophilic bacterium Thermus thermophilus. Ribosomes for crystallization were obtained from Th. thermophilus strain HB8 by two washings in buffer with high ionic strength. The ribosome preparation was investigated for homogeneity by the method of high-speed sedimentation in a buffer containing 15 mM MgCl 2 , 50 mM NH 4 Cl, and 10 MM Tris-HCl, pH 7.5. Analysis showed that the preparation if homogeneous. The same preparation was investigated for intactness of ribosomal RNA by the method of gel electrophoresis in 2.75% acrylamide 0.5% agarose gel in a buffer containing 30 mM Tris, 30 mM NaH 2 PO 4 , 10 mM EDTA, 1-2% SDS, and 6 M urea. Analysis showed that the preparation possesses intact 16S and 23S RNA. The latter did not degrade, at least in a week of exposure of the ribosomes in buffer solution at 5 0 C. The ribosome preparation had no appreciable RNase activity, which was verified by incubating 4.5 micrograms of ribosomes with 3 micrograms of 14 C-labeled 16S rRna (50 0 C, 90 min) in a buffer containing 10 mM MgCl 2 , 100 mM NH 4 Cl, and 10 mM Tris-HCl, pH/sub 20 0 / 7.5. The incubated nonhydrolyzed RNA was precipitated with 5% trichloroacetic acid and applied on a GF/C filter. The radioactivity was determined in a toluene scintillator on an LS-100C counter

  7. Regulation of rDNA stability by sumoylation

    DEFF Research Database (Denmark)

    Eckert-Boulet, Nadine; Lisby, Michael

    2009-01-01

    Repair of DNA lesions by homologous recombination relies on the copying of genetic information from an intact homologous sequence. However, many eukaryotic genomes contain repetitive sequences such as the ribosomal gene locus (rDNA), which poses a risk for illegitimate recombination. Therefore, t......6 complex and sumoylation of Rad52, which directs DNA double-strand breaks in the rDNA to relocalize from within the nucleolus to the nucleoplasm before association with the recombination machinery. The relocalization before repair is important for maintaining rDNA stability. The focus...

  8. Ribosomal DNA sequence analysis of different geographically distributed Aloe Vera plants: Comparison with clonally regenerated plants

    International Nuclear Information System (INIS)

    Yagi, A.; Sato, Y.; Miwa, Y.; Kabbash, A.; Moustafa, S.; Shimomura, K.; El-Bassuony, A.

    2006-01-01

    A comparison of the sequences in an internally transcribed spacer (ITS) 1 region of rDNA between clonally regenerated A.vera and same species in Japan, USA and Egypt revealed the presence of two types of nucleotide sequences, 252 and 254 bps. Based on the findings in the ITS 1 region, A.vera having 252 and 254 bps clearly showed a stable sequence similarity, suggesting high conversation of the base peak sequence in the ITS 1 region. However, frequent base substitutions in the 252 bps samples leaves that came from callus tissue and micropropagated plants were observed around the regions of nucleotide positions 66, 99 and 199-201. The minor deviation in clonally regenerated A.vera may be due to the stage of regeneration and cell specification in cases of the callus tissue. In the present study, the base peak sequence of the Its 1 region of rDNA was adopted as a molecular marker for differentiating A.vera plants from geographically distributed and clonally regenerated A.vera plants and it was suggested that the base peak substitutions in the ITS 1 region may arise from the different nutritional and environmental factors in cultivation and plant growth stages. (author)

  9. Cryo-EM Structure of the Archaeal 50S Ribosomal Subunit in Complex with Initiation Factor 6 and Implications for Ribosome Evolution

    Science.gov (United States)

    Greber, Basil J.; Boehringer, Daniel; Godinic-Mikulcic, Vlatka; Crnkovic, Ana; Ibba, Michael; Weygand-Durasevic, Ivana; Ban, Nenad

    2013-01-01

    Translation of mRNA into proteins by the ribosome is universally conserved in all cellular life. The composition and complexity of the translation machinery differ markedly between the three domains of life. Organisms from the domain Archaea show an intermediate level of complexity, sharing several additional components of the translation machinery with eukaryotes that are absent in bacteria. One of these translation factors is initiation factor 6 (IF6), which associates with the large ribosomal subunit. We have reconstructed the 50S ribosomal subunit from the archaeon Methanothermobacter thermautotrophicus in complex with archaeal IF6 at 6.6 Å resolution using cryo-electron microscopy (EM). The structure provides detailed architectural insights into the 50S ribosomal subunit from a methanogenic archaeon through identification of the rRNA expansion segments and ribosomal proteins that are shared between this archaeal ribosome and eukaryotic ribosomes but are mostly absent in bacteria and in some archaeal lineages. Furthermore, the structure reveals that, in spite of highly divergent evolutionary trajectories of the ribosomal particle and the acquisition of novel functions of IF6 in eukaryotes, the molecular binding of IF6 on the ribosome is conserved between eukaryotes and archaea. The structure also provides a snapshot of the reductive evolution of the archaeal ribosome and offers new insights into the evolution of the translation system in archaea. PMID:22306461

  10. Electron microscopic in situ hybridization and autoradiography: Localization and transcription of rDNA in human lymphocyte nucleoli

    International Nuclear Information System (INIS)

    Wachtler, F.; Mosgoeller, W.S.; Schwarzacher, H.G.

    1990-01-01

    The distribution of ribosomal DNA (rDNA) in the nucleoli of human lymphocytes was revealed by in situ hybridization with a nonautoradiographic procedure at the electron microscopic level. rDNA is located in the dense fibrillar component of the nucleolus but not in the fibrillar centers. In the same cells the incorporation of tritiated uridine takes place in the dense fibrillar component of the nucleolus as seen by autoradiography followed by gold latensification. From these findings it can be concluded that the transcription of ribosomal DNA takes place in the dense fibrillar component of the nucleolus

  11. [Structural organization of 5S ribosomal DNA of Rosa rugosa].

    Science.gov (United States)

    Tynkevych, Iu O; Volkov, R A

    2014-01-01

    In order to clarify molecular organization of the genomic region encoding 5S rRNA in diploid species Rosa rugosa several 5S rDNA repeated units were cloned and sequenced. Analysis of the obtained sequences revealed that only one length variant of 5S rDNA repeated units, which contains intact promoter elements in the intergenic spacer region (IGS) and appears to be transcriptionally active is present in the genome. Additionally, a limited number of 5S rDNA pseudogenes lacking a portion of coding sequence and the complete IGS was detected. A high level of sequence similarity (from 93.7 to 97.5%) between the IGS of major 5S rDNA variants of East Asian R. rugosa and North American R. nitida was found indicating comparatively recent divergence of these species.

  12. IMPLEMENTATION OF DNA MARKERS TO IMPROVE BREEDING OF FORAGE LEGUMES

    Directory of Open Access Journals (Sweden)

    S. Grljušić

    2008-09-01

    Full Text Available The low rates of estimated genetic gains in forage legumes breeding have emphasized the need for new breeding methods that would increase efficiency in forage selection and provide reliable improvement. Information on application of molecular methodologies and tools for the enhancement of the current empirical phenotype-based selection moved us toward implementation of DNA markers to our breeding activities. Firstly, attention was given to identification of genetic variability within the forage species involved in program and comparison of conventional and molecular marker efficiency in variability evaluation. RAPDs were used (i to estimate availability of alfalfa (Medicago sativa L. and Medicago falcata L. genetic variation and (ii to identify changes of red clover (Trifolium pratense L. variability after natural selection. SSRs were applied to evaluate diversity within and among field pea (Pisum sativum L. var. arvense and sativum groups/varieties. A total of 90 (alfalfa or 92 (red clover polymorphic bands was found by RAPDs. Total number of SSR alleles recorded was 118. The average Roger's distance per species/genus estimated was 0.29 (red clover, 0.33 (alfalfa and 0.51 (field pea. 2D PCo analysis of each species/genus separated materials into respective groups. A high degree of genetic variation within populations/varieties of each investigated species was found by AMOVA. The correspondence between pairs of matrices based on the morphological and molecular data was significant (p=0.95 only for red clover. RAPD and SSR data have given valuable information on genetic structure of materials and provided a description that determines heterogeneity. Further studies will be focused on identifying quantitative trait loci and marker assisted selection.

  13. High-resolution microscopy of active ribosomal genes and key members of the rRNA processing machinery inside nucleolus-like bodies of fully-grown mouse oocytes.

    Science.gov (United States)

    Shishova, Kseniya V; Khodarovich, Yuriy M; Lavrentyeva, Elena A; Zatsepina, Olga V

    2015-10-01

    Nucleolus-like bodies (NLBs) of fully-grown (germinal vesicle, GV) mammalian oocytes are traditionally considered as morphologically distinct entities, which, unlike normal nucleoli, contain transcribed ribosomal genes (rDNA) solely at their surface. In the current study, we for the first time showed that active ribosomal genes are present not only on the surface but also inside NLBs of the NSN-type oocytes. The "internal" rRNA synthesis was evidenced by cytoplasmic microinjections of BrUTP as precursor and by fluorescence in situ hybridization with a probe to the short-lived 5'ETS segment of the 47S pre-rRNA. We further showed that in the NLB mass of NSN-oocytes, distribution of active rDNA, RNA polymerase I (UBF) and rRNA processing (fibrillarin) protein factors, U3 snoRNA, pre-rRNAs and 18S/28S rRNAs is remarkably similar to that in somatic nucleoli capable to make pre-ribosomes. Overall, these observations support the occurrence of rDNA transcription, rRNA processing and pre-ribosome assembly in the NSN-type NLBs and so that their functional similarity to normal nucleoli. Unlike the NSN-type NLBs, the NLBs of more mature SN-oocytes do not contain transcribed rRNA genes, U3 snoRNA, pre-rRNAs, 18S and 28S rRNAs. These results favor the idea that in a process of transformation of NSN-oocytes to SN-oocytes, NLBs cease to produce pre-ribosomes and, moreover, lose their rRNAs. We also concluded that a denaturing fixative 70% ethanol used in the study to fix oocytes could be more appropriate for light microscopy analysis of nucleolar RNAs and proteins in mammalian fully-grown oocytes than a commonly used cross-linking aldehyde fixative, formalin. Copyright © 2015 Elsevier Inc. All rights reserved.

  14. Ellagic Acid-Changed Epigenome of Ribosomal Genes and Condensed RPA194-Positive Regions of Nucleoli in Tumour Cells.

    Science.gov (United States)

    Legartová, S; Sbardella, G; Kozubek, S; Bártová, E

    2015-01-01

    We studied the effect of ellagic acid (EA) on the morphology of nucleoli and on the pattern of major proteins of the nucleolus. After EA treatment of HeLa cells, we observed condensation of nucleoli as documented by the pattern of argyrophilic nucleolar organizer regions (AgNORs). EA also induced condensation of RPA194-positive nucleolar regions, but no morphological changes were observed in nucleolar compartments positive for UBF1/2 proteins or fibrillarin. Studied morphological changes induced by EA were compared with the morphology of control, non-treated cells and with pronounced condensation of all nucleolar domains caused by actinomycin D (ACT-D) treatment. Similarly as ACT-D, but in a lesser extent, EA induced an increased number of 53BP1-positive DNA lesions. However, the main marker of DNA lesions, γH2AX, was not accumulated in body-like nuclear structures. An increased level of γH2AX was found by immunofluorescence and Western blots only after EA treatment. Intriguingly, the levels of fibrillarin, UBF1/2 and γH2AX were increased at the promoters of ribosomal genes, while 53BP1 and CARM1 levels were decreased by EA treatment at these genomic regions. In the entire genome, EA reduced H3R17 dimethylation. Taken together, ellagic acid is capable of significantly changing the nucleolar morphology and protein levels inside the nucleolus.

  15. Ribosomal history reveals origins of modern protein synthesis.

    Directory of Open Access Journals (Sweden)

    Ajith Harish

    Full Text Available The origin and evolution of the ribosome is central to our understanding of the cellular world. Most hypotheses posit that the ribosome originated in the peptidyl transferase center of the large ribosomal subunit. However, these proposals do not link protein synthesis to RNA recognition and do not use a phylogenetic comparative framework to study ribosomal evolution. Here we infer evolution of the structural components of the ribosome. Phylogenetic methods widely used in morphometrics are applied directly to RNA structures of thousands of molecules and to a census of protein structures in hundreds of genomes. We find that components of the small subunit involved in ribosomal processivity evolved earlier than the catalytic peptidyl transferase center responsible for protein synthesis. Remarkably, subunit RNA and proteins coevolved, starting with interactions between the oldest proteins (S12 and S17 and the oldest substructure (the ribosomal ratchet in the small subunit and ending with the rise of a modern multi-subunit ribosome. Ancestral ribonucleoprotein components show similarities to in vitro evolved RNA replicase ribozymes and protein structures in extant replication machinery. Our study therefore provides important clues about the chicken-or-egg dilemma associated with the central dogma of molecular biology by showing that ribosomal history is driven by the gradual structural accretion of protein and RNA structures. Most importantly, results suggest that functionally important and conserved regions of the ribosome were recruited and could be relics of an ancient ribonucleoprotein world.

  16. Mitochondrial genome evolution in Alismatales: Size reduction and extensive loss of ribosomal protein genes

    DEFF Research Database (Denmark)

    Petersen, Gitte; Cuenca, Argelia; Zervas, Athanasios

    2017-01-01

    The order Alismatales is a hotspot for evolution of plant mitochondrial genomes characterized by remarkable differences in genome size, substitution rates, RNA editing, retrotranscription, gene loss and intron loss. Here we have sequenced the complete mitogenomes of Zostera marina and Stratiotes...... aloides, which together with previously sequenced mitogenomes from Butomus and Spirodela, provide new evolutionary evidence of genome size reduction, gene loss and transfer to the nucleus. The Zostera mitogenome includes a large portion of DNA transferred from the plastome, yet it is the smallest known...... mitogenome from a non-parasitic plant. Using a broad sample of the Alismatales, the evolutionary history of ribosomal protein gene loss is analyzed. In Zostera almost all ribosomal protein genes are lost from the mitogenome, but only some can be found in the nucleus....

  17. DNA markers provide insight about common lime in historicalplantings

    DEFF Research Database (Denmark)

    Hansen, Ole Kim; Thomsen, Pernille; Rasmussen, Christine Waage

    2014-01-01

    As part of the restoration process of an avenue of common lime (Tilia × europaea) from 1760 in the Royal Danish Gardens, all remaining trees were genotyped with DNA markers before they were felled. As such, information about the nature of the plant material (clonal versus non-clonal) and mode...... of propagation was obtained, revealing that a single clone constituted 92% of the remaining trees (106 out of 115). Five trees were of another clone, while the remaining four trees had unique genotypes. Mode of clonal propagation was most likely layering since the genotype of the crown and the roots...... of a subsample of the trees had the same genotype. Trees from four other locations with historical avenues/plantings from the 17th century were also genotyped. The two clones registered in the first location were also found at the other four locations. Of 76 trees from the other historical avenues...

  18. DNA markers linked to the major salinity tolerance locus of traditional rice, Pokkali (abstract)

    International Nuclear Information System (INIS)

    Rehman, S.; Seraj, Z.I.; Das, D.K.; Salam, M.A.

    2005-01-01

    The major QTL for salinity tolerance traits, of the traditional rice salt tolerant benchmark Pokkali, referred to as 'Saltol' was located within a large 16cM loci of rice chromosome 1 by previous workers at IRRI. This was done by using a recombinant inbred population between Pokkali and sensitive IR29 (Total RILs=275). These workers had identified the flanking markers, RM23 and RM9, as the limits of 'Saltol'. By designing primers between these two markers, and using a subset of the same RILs, we were able to identify a 5cM region, which was completely linked to the tolerance of seedlings. Further work with a subset of another NIL population raised at IRRI between Pokkali and recurring IR29 at the BC/sub 3/F/sub 2/ stage has narrowed down the linked region to about 0.3cM, each at 4 different locations within the 5cM loc. This was done by scoring the tolerance of the seedlings and determining the percent of progeny that showed the tolerant allele at the specified maker locus. Thirty seedlings from each of 10 BC/sub 3/F/sub 2/ progeny were scored. Only the most tolerant and sensitive seedlings were used for DNA isolation and amplification. The work was derived from complex crosses involving Pokkali as the tolerance donor. Three common loci linked to salinity tolerance were found to be the same in the NILs and the breeding population. DNA markers homologous to these 3 loci will be confirmed for their ability to identify tolerant progeny in breeding populations. (author)

  19. Evidence that yeast SGS1, DNA2, SRS2, and FOB1 interact to maintain rDNA stability

    International Nuclear Information System (INIS)

    Tao Weitao; Budd, Martin; Campbell, Judith L.

    2003-01-01

    We and others have proposed that faulty processing of arrested replication forks leads to increases in recombination and chromosome instability in Saccharomyces cerevisiae. Now we use the ribosomal DNA locus, which is a good model for all stages of DNA replication, to test this hypothesis. We showed previously that DNA replication pausing at the ribosomal DNA replication fork barrier (RFB) is accompanied by the occurrence of double-strand breaks near the RFB. Both pausing and breakage are elevated in the hypomorphic dna2-2 helicase mutant. Deletion of FOB1 suppresses the elevated pausing and DSB formation. Our current work shows that mutation inactivating Sgs1, the yeast RecQ helicase ortholog, also causes accumulation of stalled replication forks and DSBs at the rDNA RFB. Either deletion of FOB1, which suppresses fork blocking and certain types of rDNA recombination, or an increase in SIR2 gene dosage, which suppresses rDNA recombination, reduces the number of forks persisting at the RFB. Although dna2-2 sgs1Δ double mutants are conditionally lethal, they do not show enhanced rDNA defects compared to sgs1Δ alone. However, surprisingly, the dna2-2 sgs1Δ lethality is suppressed by deletion of FOB1. On the other hand, the dna2-2 sgs1Δ lethality is only partially suppressed by deletion of rad51Δ. We propose that the replication-associated defects that we document in the rDNA are characteristic of similar events occurring either stochastically throughout the genome or at other regions where replication forks move slowly or stall, such as telomeres, centromeres, or replication slow zones

  20. Evidence that yeast SGS1, DNA2, SRS2, and FOB1 interact to maintain rDNA stability

    Energy Technology Data Exchange (ETDEWEB)

    Tao Weitao; Budd, Martin; Campbell, Judith L

    2003-11-27

    We and others have proposed that faulty processing of arrested replication forks leads to increases in recombination and chromosome instability in Saccharomyces cerevisiae. Now we use the ribosomal DNA locus, which is a good model for all stages of DNA replication, to test this hypothesis. We showed previously that DNA replication pausing at the ribosomal DNA replication fork barrier (RFB) is accompanied by the occurrence of double-strand breaks near the RFB. Both pausing and breakage are elevated in the hypomorphic dna2-2 helicase mutant. Deletion of FOB1 suppresses the elevated pausing and DSB formation. Our current work shows that mutation inactivating Sgs1, the yeast RecQ helicase ortholog, also causes accumulation of stalled replication forks and DSBs at the rDNA RFB. Either deletion of FOB1, which suppresses fork blocking and certain types of rDNA recombination, or an increase in SIR2 gene dosage, which suppresses rDNA recombination, reduces the number of forks persisting at the RFB. Although dna2-2 sgs1{delta} double mutants are conditionally lethal, they do not show enhanced rDNA defects compared to sgs1{delta} alone. However, surprisingly, the dna2-2 sgs1{delta} lethality is suppressed by deletion of FOB1. On the other hand, the dna2-2 sgs1{delta} lethality is only partially suppressed by deletion of rad51{delta}. We propose that the replication-associated defects that we document in the rDNA are characteristic of similar events occurring either stochastically throughout the genome or at other regions where replication forks move slowly or stall, such as telomeres, centromeres, or replication slow zones.

  1. Serum hepatitis B core-related antigen is a satisfactory surrogate marker of intrahepatic covalently closed circular DNA in chronic hepatitis B.

    Science.gov (United States)

    Chen, En-Qiang; Feng, Shu; Wang, Meng-Lan; Liang, Ling-Bo; Zhou, Ling-Yun; Du, Ling-Yao; Yan, Li-Bo; Tao, Chuan-Min; Tang, Hong

    2017-03-14

    Recently, hepatitis B core-related antigen (HBcrAg) has been suggested as an additional marker of hepatitis B virus (HBV) infection. This study aimed to investigate whether serum quantitative HBcrAg (qHBcrAg) was a satisfactory surrogate marker of intrahepatic covalently closed circular DNA (cccDNA). A total of 139 patients with liver biopsy were enrolled, consisting of 59 patients in immune tolerance (IT) phase, 52 patients in immune clearance (IC) phase, 18 patients in low-replication (LR) phase, and 10 patients in reactivation phase. All patients in IC phase have received entecavir (ETV) therapy, and 32 of them undergone a second liver biopsy at 24 months. Among those patients, qHBcrAg was strongly correlated with intrahepatic cccDNA, which is superior to that of qHBsAg and HBV DNA. And similar findings were also observed in patients in IT, IC, LR and reactivation phases. Among the 32 ETV-treated patients with a second liver biopsy in IC phase, the decline of intrahepatic cccDNA was accompanied by changes in both qHBcrAg and qHBsAg. However, as compared to qHBsAg, the change of qHBcrAg was more strongly associated with intrahepatic cccDNA-decline. In summary, serum qHBcrAg should be a satisfactory surrogate of intrahepatic HBV cccDNA in CHB patients.

  2. Dine marker har DNA

    DEFF Research Database (Denmark)

    Eckholdt, Annette; Winding, Anne; Krogh, Paul Henning

    2017-01-01

    Ordet "biodiversitet" og at det er noget, vi skal have mere af, nævnes hyppigt. Men hvad er biodiversitet, og hvordan måles det? Agrologisk har bedt et par eksperter fra Aarhus Universitet forklare, hvordan et DNA-aftryk af jord og vand kan erstatte optællinger i felten og sige noget om biodivers......Ordet "biodiversitet" og at det er noget, vi skal have mere af, nævnes hyppigt. Men hvad er biodiversitet, og hvordan måles det? Agrologisk har bedt et par eksperter fra Aarhus Universitet forklare, hvordan et DNA-aftryk af jord og vand kan erstatte optællinger i felten og sige noget om...

  3. Post-transcriptional regulation of ribosome biogenesis in yeast

    Directory of Open Access Journals (Sweden)

    Isabelle C. Kos-Braun

    2017-05-01

    Full Text Available Most microorganisms are exposed to the constantly and often rapidly changing environment. As such they evolved mechanisms to balance their metabolism and energy expenditure with the resources available to them. When resources become scarce or conditions turn out to be unfavourable for growth, cells reduce their metabolism and energy usage to survive. One of the major energy consuming processes in the cell is ribosome biogenesis. Unsurprisingly, cells encountering adverse conditions immediately shut down production of new ribosomes. It is well established that nutrient depletion leads to a rapid repression of transcription of the genes encoding ribosomal proteins, ribosome biogenesis factors as well as ribosomal RNA (rRNA. However, if pre-rRNA processing and ribosome assembly are regulated post-transcriptionally remains largely unclear. We have recently uncovered that the yeast Saccharomyces cerevisiae rapidly switches between two alternative pre-rRNA processing pathways depending on the environmental conditions. Our findings reveal a new level of complexity in the regulation of ribosome biogenesis.

  4. Ribosomal Antibiotics: Contemporary Challenges

    Directory of Open Access Journals (Sweden)

    Tamar Auerbach-Nevo

    2016-06-01

    Full Text Available Most ribosomal antibiotics obstruct distinct ribosomal functions. In selected cases, in addition to paralyzing vital ribosomal tasks, some ribosomal antibiotics are involved in cellular regulation. Owing to the global rapid increase in the appearance of multi-drug resistance in pathogenic bacterial strains, and to the extremely slow progress in developing new antibiotics worldwide, it seems that, in addition to the traditional attempts at improving current antibiotics and the intensive screening for additional natural compounds, this field should undergo substantial conceptual revision. Here, we highlight several contemporary issues, including challenging the common preference of broad-range antibiotics; the marginal attention to alterations in the microbiome population resulting from antibiotics usage, and the insufficient awareness of ecological and environmental aspects of antibiotics usage. We also highlight recent advances in the identification of species-specific structural motifs that may be exploited for the design and the creation of novel, environmental friendly, degradable, antibiotic types, with a better distinction between pathogens and useful bacterial species in the microbiome. Thus, these studies are leading towards the design of “pathogen-specific antibiotics,” in contrast to the current preference of broad range antibiotics, partially because it requires significant efforts in speeding up the discovery of the unique species motifs as well as the clinical pathogen identification.

  5. DNA fingerprinting and diversity analysis in Aus genotypes using microsatellite markers

    Directory of Open Access Journals (Sweden)

    MD. MONIRUL ISLAM

    2015-08-01

    Full Text Available DNA fingerprinting and genetic diversity of 94 Aus (6 BRRI released Aus variety and 88 local Aus landraces genotypes were carried out to protect the Aus landraces from biopiracy. A total of 91 microsatellite markers were tested for screening the genotypes. Among 91 amplified products, 56% have polymorphic bands giving 195 alleles. The number of alleles per locus ranged from four (RM25 and RM147 to twenty seven (RM519, where average allele number was 9.76. The Polymorphism Information Contents (PIC lied between 0.455 (RM5 to 0.934 (RM519. Most robust marker was found RM519 since it provided the highest PIC value (0.934. Pair-wise genetic dissimilarity co-efficient showed the lowest genetic dissimilarity was found BRRI dhan42 and BRRI dhan43 and the highest genetic dissimilarity was found local landraces each other. Here it is shown that most Aus landraces is recognized to have broad genetic base. Thus it is recommended to use these landraces for future breeding program or include new and untouched local landraces to incorporate new genes and broaden genetic base.

  6. Effect of primary and secondary radicals on chain breaks in ribosomal RNA in E. coli ribosomes

    International Nuclear Information System (INIS)

    Singh, H.; Bishop, J.

    1984-01-01

    It has been shown previously that, in dilute aerated solutions, ribosomes are inactivated by OH radicals and by secondary radicals produced from added alcohols (Singh and Vadasz 1983 a). In de-aerated solutions, both radicalH and e - sub(aq) also inactivate ribosomes (Singh and Vadasz 1983 b). The results of these studies and other on different systems (Adams et al. 1973, Aldrich and Cundall 1969, Dewey and Stein 1970, Masuda et al. 1971, Nabben et al. 1982, 1983, Samuni et al. 1980, Singh and Singh 1982) have shown that damage to biological systems occurs by diverse mechanisms. One of these mechanisms involves chain breaks in RNA (Pollard and Weller 1967). The purpose of this study was to determine which of the primary and secondary radicals cause chain breaks in ribosomal RNA (rRNA) within the ribosomes. (author)

  7. A STUDY OF SILVER STAINING NUCLEOLAR ORGANISING REGIONS AGNOR SCORE AS PROGNOSTIC MARKER IN BREAST LESIONS IN A TERTIARY CARE HOSPITAL IN HYDERABAD

    Directory of Open Access Journals (Sweden)

    Bhavani Shankar Nithyananda

    2017-10-01

    Full Text Available BACKGROUND Nucleolar Organising Regions (NORS are segments of DNA closely associated with nucleolus, which code for ribosomal DNA consisting of non-histone proteins, which are argyrophilic. They are demonstrated as black, brown spots on staining with silver colloidal staining technique. Hence, they are called AgNORs. The assessment of AgNORs correlates with rate of proliferation, cell cycle time, since shorter the cell cycle, greater the ribosomal activity and protein synthesis higher AgNOR count. 1 AgNORs have been studied on NHL, GIT neoplasms, skin, gynaecological neoplasms, pulmonary neoplasms, prostate, bladder and breast cancer. In breast cancer, AgNOR can be used for early detection, grading and staging of disease. In this study, we have tried to correlate AgNOR character to morphological prognostic markers. MATERIALS AND METHODS A total of 159 cases presenting with lump in the breast were included in the study. Specimens were subjected to histopathological examination. Sections cut three micron thickness were stained for AgNOR with silver colloidal AgNOR staining technique. AgNOR count was done on both benign and malignant lesions. RESULTS Benign breast lesions were more common compared to malignant lesions. The age of the patients ranged from 15-79 yrs. The mean age for benign lesions was 31 yrs. and for malignant lesions 43 yrs. The most common benign lesion was fibroadenoma and most common malignant lesion was infiltrating ductal carcinoma. AgNOR spots were seen as black/brown spots. AgNOR score was higher in malignant lesions when compared to benign lesions. Among malignant lesions, AgNOR score was found to be higher in high grade, metastatic tumours. CONCLUSION AgNOR count is a useful technique, which can supplement other prognostic markers like Ki-67, mitotic index. A long follow up study is required to confirm the prognostic utility of AgNOR count done in this study

  8. DNA barcoding for identification of 'Candidatus Phytoplasmas' using a fragment of the elongation factor Tu gene.

    Directory of Open Access Journals (Sweden)

    Olga Makarova

    Full Text Available Phytoplasmas are bacterial phytopathogens responsible for significant losses in agricultural production worldwide. Several molecular markers are available for identification of groups or strains of phytoplasmas. However, they often cannot be used for identification of phytoplasmas from different groups simultaneously or are too long for routine diagnostics. DNA barcoding recently emerged as a convenient tool for species identification. Here, the development of a universal DNA barcode based on the elongation factor Tu (tuf gene for phytoplasma identification is reported.We designed a new set of primers and amplified a 420-444 bp fragment of tuf from all 91 phytoplasmas strains tested (16S rRNA groups -I through -VII, -IX through -XII, -XV, and -XX. Comparison of NJ trees constructed from the tuf barcode and a 1.2 kbp fragment of the 16S ribosomal gene revealed that the tuf tree is highly congruent with the 16S rRNA tree and had higher inter- and intra- group sequence divergence. Mean K2P inter-/intra- group divergences of the tuf barcode did not overlap and had approximately one order of magnitude difference for most groups, suggesting the presence of a DNA barcoding gap. The use of the tuf barcode allowed separation of main ribosomal groups and most of their subgroups. Phytoplasma tuf barcodes were deposited in the NCBI GenBank and Q-bank databases.This study demonstrates that DNA barcoding principles can be applied for identification of phytoplasmas. Our findings suggest that the tuf barcode performs as well or better than a 1.2 kbp fragment of the 16S rRNA gene and thus provides an easy procedure for phytoplasma identification. The obtained sequences were used to create a publicly available reference database that can be used by plant health services and researchers for online phytoplasma identification.

  9. Autosomal and mtDNA Markers Affirm the Distinctiveness of Lions in West and Central Africa.

    Science.gov (United States)

    Bertola, Laura D; Tensen, Laura; van Hooft, Pim; White, Paula A; Driscoll, Carlos A; Henschel, Philipp; Caragiulo, Anthony; Dias-Freedman, Isabela; Sogbohossou, Etotépé A; Tumenta, Pricelia N; Jirmo, Tuqa H; de Snoo, Geert R; de Iongh, Hans H; Vrieling, Klaas

    2015-01-01

    The evolutionary history of a species is key for understanding the taxonomy and for the design of effective management strategies for species conservation. The knowledge about the phylogenetic position of the lion (Panthera leo) in West/Central Africa is largely based on mitochondrial markers. Previous studies using mtDNA only have shown this region to hold a distinct evolutionary lineage. In addition, anthropogenic factors have led to a strong decline in West/Central African lion numbers, thus, the conservation value of these populations is particularly high. Here, we investigate whether autosomal markers are concordant with previously described phylogeographic patterns, and confirm the unique position of the West/Central African lion. Analysis of 20 microsatellites and 1,454 bp of the mitochondrial DNA in 16 lion populations representing the entire geographic range of the species found congruence in both types of markers, identifying four clusters: 1) West/Central Africa, 2) East Africa, 3) Southern Africa and 4) India. This is not in line with the current taxonomy, as defined by the IUCN, which only recognizes an African and an Asiatic subspecies. There are no indications that genetic diversity in West/Central Africa lions is lower than in either East or Southern Africa, however, given this genetic distinction and the recent declines of lion numbers in this region, we strongly recommend prioritization of conservation projects in West/Central Africa. As the current taxonomic nomenclature does not reflect the evolutionary history of the lion, we suggest that a taxonomic revision of the lion is warranted.

  10. Autosomal and mtDNA Markers Affirm the Distinctiveness of Lions in West and Central Africa.

    Directory of Open Access Journals (Sweden)

    Laura D Bertola

    Full Text Available The evolutionary history of a species is key for understanding the taxonomy and for the design of effective management strategies for species conservation. The knowledge about the phylogenetic position of the lion (Panthera leo in West/Central Africa is largely based on mitochondrial markers. Previous studies using mtDNA only have shown this region to hold a distinct evolutionary lineage. In addition, anthropogenic factors have led to a strong decline in West/Central African lion numbers, thus, the conservation value of these populations is particularly high. Here, we investigate whether autosomal markers are concordant with previously described phylogeographic patterns, and confirm the unique position of the West/Central African lion. Analysis of 20 microsatellites and 1,454 bp of the mitochondrial DNA in 16 lion populations representing the entire geographic range of the species found congruence in both types of markers, identifying four clusters: 1 West/Central Africa, 2 East Africa, 3 Southern Africa and 4 India. This is not in line with the current taxonomy, as defined by the IUCN, which only recognizes an African and an Asiatic subspecies. There are no indications that genetic diversity in West/Central Africa lions is lower than in either East or Southern Africa, however, given this genetic distinction and the recent declines of lion numbers in this region, we strongly recommend prioritization of conservation projects in West/Central Africa. As the current taxonomic nomenclature does not reflect the evolutionary history of the lion, we suggest that a taxonomic revision of the lion is warranted.

  11. Autosomal and mtDNA Markers Affirm the Distinctiveness of Lions in West and Central Africa

    Science.gov (United States)

    Bertola, Laura D.; Tensen, Laura; van Hooft, Pim; White, Paula A.; Driscoll, Carlos A.; Henschel, Philipp; Caragiulo, Anthony; Dias-Freedman, Isabela; Sogbohossou, Etotépé A.; Tumenta, Pricelia N.; Jirmo, Tuqa H.; de Snoo, Geert R.

    2015-01-01

    The evolutionary history of a species is key for understanding the taxonomy and for the design of effective management strategies for species conservation. The knowledge about the phylogenetic position of the lion (Panthera leo) in West/Central Africa is largely based on mitochondrial markers. Previous studies using mtDNA only have shown this region to hold a distinct evolutionary lineage. In addition, anthropogenic factors have led to a strong decline in West/Central African lion numbers, thus, the conservation value of these populations is particularly high. Here, we investigate whether autosomal markers are concordant with previously described phylogeographic patterns, and confirm the unique position of the West/Central African lion. Analysis of 20 microsatellites and 1,454 bp of the mitochondrial DNA in 16 lion populations representing the entire geographic range of the species found congruence in both types of markers, identifying four clusters: 1) West/Central Africa, 2) East Africa, 3) Southern Africa and 4) India. This is not in line with the current taxonomy, as defined by the IUCN, which only recognizes an African and an Asiatic subspecies. There are no indications that genetic diversity in West/Central Africa lions is lower than in either East or Southern Africa, however, given this genetic distinction and the recent declines of lion numbers in this region, we strongly recommend prioritization of conservation projects in West/Central Africa. As the current taxonomic nomenclature does not reflect the evolutionary history of the lion, we suggest that a taxonomic revision of the lion is warranted. PMID:26466139

  12. Intelligent DNA-based molecular diagnostics using linked genetic markers

    Energy Technology Data Exchange (ETDEWEB)

    Pathak, D.K.; Perlin, M.W.; Hoffman, E.P.

    1994-12-31

    This paper describes a knowledge-based system for molecular diagnostics, and its application to fully automated diagnosis of X-linked genetic disorders. Molecular diagnostic information is used in clinical practice for determining genetic risks, such as carrier determination and prenatal diagnosis. Initially, blood samples are obtained from related individuals, and PCR amplification is performed. Linkage-based molecular diagnosis then entails three data analysis steps. First, for every individual, the alleles (i.e., DNA composition) are determined at specified chromosomal locations. Second, the flow of genetic material among the individuals is established. Third, the probability that a given individual is either a carrier of the disease or affected by the disease is determined. The current practice is to perform each of these three steps manually, which is costly, time consuming, labor-intensive, and error-prone. As such, the knowledge-intensive data analysis and interpretation supersede the actual experimentation effort as the major bottleneck in molecular diagnostics. By examining the human problem solving for the task, we have designed and implemented a prototype knowledge-based system capable of fully automating linkage-based molecular diagnostics in X-linked genetic disorders, including Duchenne Muscular Dystrophy (DMD). Our system uses knowledge-based interpretation of gel electrophoresis images to determine individual DNA marker labels, a constraint satisfaction search for consistent genetic flow among individuals, and a blackboard-style problem solver for risk assessment. We describe the system`s successful diagnosis of DMD carrier and affected individuals from raw clinical data.

  13. cDNA Cloning, Overexpression, Purification and Pharmacologic Evaluation for Anticancer Activity of Ribosomal Protein L23A Gene (RPL23A from the Giant Panda

    Directory of Open Access Journals (Sweden)

    Si-Nan Zhang

    2012-02-01

    Full Text Available RPL23A gene encodes a ribosomal protein that is a component of the 60S subunit. The protein belongs to the L23P family of ribosomal proteins, which is located in the cytoplasm. The purpose of this paper was to explore the structure and anti-cancer function of ribosomal protein L23A (RPL23A gene of the Giant Panda (Ailuropoda melanoleuca. The cDNA of RPL23A was cloned successfully from the Giant Panda using RT-PCR technology. We constructed a recombinant expression vector containing RPL23A cDNA and over-expressed it in Escherichia coli using pET28a plasmids. The expression product obtained was purified by using Ni chelating affinity chromatography. Recombinant protein of RPL23A obtained from the experiment acted on Hep-2 cells and human HepG-2 cells, then the growth inhibitory effect of these cells was observed by MTT (3-[4,5-dimethyl-2-thiazolyl]-2,5-diphenyl-2H-tetrazolium bromide assay. The result indicated that the length of the fragment cloned is 506 bp, and it contains an open-reading frame (ORF of 471 bp encoding 156 amino acids. Primary structure analysis revealed that the molecular weight of the putative RPL23A protein is 17.719 kDa with a theoretical pI 11.16. The molecular weight of the recombinant protein RPL23A is 21.265 kDa with a theoretical pI 10.57. The RPL23A gene can be really expressed in E. coli and the RPL23A protein, fusioned with the N-terminally His-tagged protein, gave rise to the accumulation of an expected 22 KDa polypeptide. The data showed that the recombinant protein RPL23A had a time- and dose-dependency on the cell growth inhibition rate. The data also indicated that the effect at low concentrations was better than at high concentrations on Hep-2 cells, and that the concentration of 0.185 μg/mL had the best rate of growth inhibition of 36.31%. All results of the experiment revealed that the recombinant protein RPL23A exhibited anti-cancer function on the Hep-2 cells. The study provides a scientific basis and aids

  14. Placeholder factors in ribosome biogenesis: please, pave my way

    Directory of Open Access Journals (Sweden)

    Francisco J. Espinar-Marchena

    2017-04-01

    Full Text Available The synthesis of cytoplasmic eukaryotic ribosomes is an extraordinarily energy-demanding cellular activity that occurs progressively from the nucleolus to the cytoplasm. In the nucleolus, precursor rRNAs associate with a myriad of trans-acting factors and some ribosomal proteins to form pre-ribosomal particles. These factors include snoRNPs, nucleases, ATPases, GTPases, RNA helicases, and a vast list of proteins with no predicted enzymatic activity. Their coordinate activity orchestrates in a spatiotemporal manner the modification and processing of precursor rRNAs, the rearrangement reactions required for the formation of productive RNA folding intermediates, the ordered assembly of the ribosomal proteins, and the export of pre-ribosomal particles to the cytoplasm; thus, providing speed, directionality and accuracy to the overall process of formation of translation-competent ribosomes. Here, we review a particular class of trans-acting factors known as “placeholders”. Placeholder factors temporarily bind selected ribosomal sites until these have achieved a structural context that is appropriate for exchanging the placeholder with another site-specific binding factor. By this strategy, placeholders sterically prevent premature recruitment of subsequently binding factors, premature formation of structures, avoid possible folding traps, and act as molecular clocks that supervise the correct progression of pre-ribosomal particles into functional ribosomal subunits. We summarize the current understanding of those factors that delay the assembly of distinct ribosomal proteins or subsequently bind key sites in pre-ribosomal particles. We also discuss recurrent examples of RNA-protein and protein-protein mimicry between rRNAs and/or factors, which have clear functional implications for the ribosome biogenesis pathway.

  15. Comparing COI and ITS as DNA barcode markers for mushrooms and allies (Agaricomycotina).

    Science.gov (United States)

    Dentinger, Bryn T M; Didukh, Maryna Y; Moncalvo, Jean-Marc

    2011-01-01

    DNA barcoding is an approach to rapidly identify species using short, standard genetic markers. The mitochondrial cytochrome oxidase I gene (COI) has been proposed as the universal barcode locus, but its utility for barcoding in mushrooms (ca. 20,000 species) has not been established. We succeeded in generating 167 partial COI sequences (~450 bp) representing ~100 morphospecies from ~650 collections of Agaricomycotina using several sets of new primers. Large introns (~1500 bp) at variable locations were detected in ~5% of the sequences we obtained. We suspect that widespread presence of large introns is responsible for our low PCR success (~30%) with this locus. We also sequenced the nuclear internal transcribed spacer rDNA regions (ITS) to compare with COI. Among the small proportion of taxa for which COI could be sequenced, COI and ITS perform similarly as a barcode. However, in a densely sampled set of closely related taxa, COI was less divergent than ITS and failed to distinguish all terminal clades. Given our results and the wealth of ITS data already available in public databases, we recommend that COI be abandoned in favor of ITS as the primary DNA barcode locus in mushrooms.

  16. Evolutionary dynamics of a conserved sequence motif in the ribosomal genes of the ciliate Paramecium

    Directory of Open Access Journals (Sweden)

    Lynch Michael

    2010-05-01

    Full Text Available Abstract Background In protozoa, the identification of preserved motifs by comparative genomics is often impeded by difficulties to generate reliable alignments for non-coding sequences. Moreover, the evolutionary dynamics of regulatory elements in 3' untranslated regions (both in protozoa and metazoa remains a virtually unexplored issue. Results By screening Paramecium tetraurelia's 3' untranslated regions for 8-mers that were previously found to be preserved in mammalian 3' UTRs, we detect and characterize a motif that is distinctly conserved in the ribosomal genes of this ciliate. The motif appears to be conserved across Paramecium aurelia species but is absent from the ribosomal genes of four additional non-Paramecium species surveyed, including another ciliate, Tetrahymena thermophila. Motif-free ribosomal genes retain fewer paralogs in the genome and appear to be lost more rapidly relative to motif-containing genes. Features associated with the discovered preserved motif are consistent with this 8-mer playing a role in post-transcriptional regulation. Conclusions Our observations 1 shed light on the evolution of a putative regulatory motif across large phylogenetic distances; 2 are expected to facilitate the understanding of the modulation of ribosomal genes expression in Paramecium; and 3 reveal a largely unexplored--and presumably not restricted to Paramecium--association between the presence/absence of a DNA motif and the evolutionary fate of its host genes.

  17. X linked neonatal centronuclear/myotubular myopathy: evidence for linkage to Xq28 DNA marker loci.

    Science.gov (United States)

    Thomas, N S; Williams, H; Cole, G; Roberts, K; Clarke, A; Liechti-Gallati, S; Braga, S; Gerber, A; Meier, C; Moser, H

    1990-05-01

    We have studied the inheritance of several polymorphic Xq27/28 DNA marker loci in two three generation families with the X linked neonatal lethal form of centronuclear/myotubular myopathy (XL MTM). We found complete linkage of XLMTM to all four informative Xq28 markers analysed, with GCP/RCP (Z = 3.876, theta = 0.00), with DXS15 (Z = 3.737, theta = 0.00), with DXS52 (Z = 2.709, theta = 0.00), and with F8C (Z = 1.020, theta = 0.00). In the absence of any observable recombination, we are unable to sublocalise the XLMTM locus further within the Xq28 region. This evidence for an Xq28 localisation may allow us to carry out useful genetic counselling within such families.

  18. Mitochondrial genome sequencing and development of genetic markers for the detection of DNA of invasive bighead and silver carp (Hypophthalmichthys nobilis and H. molitrix in environmental water samples from the United States.

    Directory of Open Access Journals (Sweden)

    Heather L Farrington

    Full Text Available Invasive Asian bighead and silver carp (Hypophthalmichthys nobilis and H. molitrix pose a substantial threat to North American aquatic ecosystems. Recently, environmental DNA (eDNA, genetic material shed by organisms into their environment that can be detected by non-invasive sampling strategies and genetic assays, has gained recognition as a tool for tracking the invasion front of these species toward the Great Lakes. The goal of this study was to develop new species-specific conventional PCR (cPCR and quantitative (qPCR markers for detection of these species in North American surface waters. We first generated complete mitochondrial genome sequences from 33 bighead and 29 silver carp individuals collected throughout their introduced range. These sequences were aligned with those from other common and closely related fish species from the Illinois River watershed to identify and design new species-specific markers for the detection of bighead and silver carp DNA in environmental water samples. We then tested these genetic markers in the laboratory for species-specificity and sensitivity. Newly developed markers performed well in field trials, did not have any false positive detections, and many markers had much higher detection rates and sensitivity compared to the markers currently used in eDNA surveillance programs. We also explored the use of multiple genetic markers to determine whether it would improve detection rates, results of which showed that using multiple highly sensitive markers should maximize detection rates in environmental samples. The new markers developed in this study greatly expand the number of species-specific genetic markers available to track the invasion front of bighead and silver carp and will improve the resolution of these assays. Additionally, the use of the qPCR markers developed in this study may reduce sample processing time and cost of eDNA monitoring for these species.

  19. Elevated expression of ribosomal protein genes L37, RPP-1, and S2 in the presence of mutant p53.

    Science.gov (United States)

    Loging, W T; Reisman, D

    1999-11-01

    The wild-type p53 protein is a DNA-binding transcription factor that activates genes such as p21, MDM2, GADD45, and Bax that are required for the regulation of cell cycle progression or apoptosis in response to DNA damage. Mutant forms of p53, which are transforming oncogenes and are expressed at high levels in tumor cells, generally have a reduced binding affinity for the consensus DNA sequence. Interestingly, some p53 mutants that are no longer effective at binding to the consensus DNA sequence and transactivating promoters containing this target site have acquired the ability to transform cells in culture, in part through their ability to transactivate promoters of a number of genes that are not targets of the wild-type protein. Certain p53 mutants are therefore considered to be gain-of-function mutants and appear to be promoting proliferation or transforming cells through their ability to alter the expression of novel sets of genes. Our goal is to identify genes that have altered expression in the presence of a specific mutant p53 (Arg to Trp mutation at codon 248) protein. Through examining differential gene expression in cells devoid of p53 expression and in cells that express high levels of mutant p53 protein, we have identified three ribosomal protein genes that have elevated expression in response to mutant p53. Consistent with these findings, the overexpression of a number of ribosomal protein genes in human tumors and evidence for their contribution to oncogenic transformation have been reported previously, although the mechanism leading to this overexpression has remained elusive. We show results that indicate that expression of these specific ribosomal protein genes is increased in the presence of the R248W p53 mutant, which provides a mechanism for their overexpression in human tumors.

  20. Genetic characterization of Moroccan and the exotic bread wheat cultivars using functional and random DNA markers linked to the agronomic traits for genomics-assisted improvement.

    Science.gov (United States)

    Henkrar, Fatima; El-Haddoury, Jamal; Ouabbou, Hassan; Bendaou, Najib; Udupa, Sripada M

    2016-06-01

    Genetic characterization, diversity analysis and estimate of the genetic relationship among varieties using functional and random DNA markers linked to agronomic traits can provide relevant guidelines in selecting parents and designing new breeding strategies for marker-assisted wheat cultivar improvement. Here, we characterize 20 Moroccan and 19 exotic bread wheat (Triticum aestivum L.) cultivars using 47 functional and 7 linked random DNA markers associated with 21 loci of the most important traits for wheat breeding. The functional marker analysis revealed that 35, 45, and 10 % of the Moroccan cultivars, respectively have the rust resistance genes (Lr34/Yr18/Pm38), dwarfing genes (Rht1b or Rht2b alleles) and the leaf rust resistance gene (Lr68). The marker alleles for genes Lr37/Yr17/Sr38, Sr24 and Yr36 were present only in the exotic cultivars and absent in Moroccan cultivars. 25 % of cultivars had 1BL.1RS translocation. 70 % of the wheat cultivars had Ppo-D1a and Ppo-A1b associated with low polyphenol oxidase activity. 10 % of cultivars showed presence of a random DNA marker allele (175 bp) linked to Hessian fly resistance gene H22. The majority of the Moroccan cultivars were carrying alleles that impart good bread making quality. Neighbor joining (NJ) and principal coordinate analysis based on the marker data revealed a clear differentiation between elite Moroccan and exotic wheat cultivars. The results of this study are useful for selecting suitable parents for making targeted crosses in marker-assisted wheat breeding and enhancing genetic diversity in the wheat cultivars.

  1. Application of a clustering-based peak alignment algorithm to analyze various DNA fingerprinting data.

    Science.gov (United States)

    Ishii, Satoshi; Kadota, Koji; Senoo, Keishi

    2009-09-01

    DNA fingerprinting analysis such as amplified ribosomal DNA restriction analysis (ARDRA), repetitive extragenic palindromic PCR (rep-PCR), ribosomal intergenic spacer analysis (RISA), and denaturing gradient gel electrophoresis (DGGE) are frequently used in various fields of microbiology. The major difficulty in DNA fingerprinting data analysis is the alignment of multiple peak sets. We report here an R program for a clustering-based peak alignment algorithm, and its application to analyze various DNA fingerprinting data, such as ARDRA, rep-PCR, RISA, and DGGE data. The results obtained by our clustering algorithm and by BioNumerics software showed high similarity. Since several R packages have been established to statistically analyze various biological data, the distance matrix obtained by our R program can be used for subsequent statistical analyses, some of which were not previously performed but are useful in DNA fingerprinting studies.

  2. On the intracellular trafficking of mouse S5 ribosomal protein from cytoplasm to nucleoli.

    Science.gov (United States)

    Matragkou, Ch; Papachristou, H; Karetsou, Z; Papadopoulos, G; Papamarcaki, T; Vizirianakis, I S; Tsiftsoglou, A S; Choli-Papadopoulou, T

    2009-10-09

    The non-ribosomal functions of mammalian ribosomal proteins have recently attracted worldwide attention. The mouse ribosomal protein S5 (rpS5) derived from ribosomal material is an assembled non-phosphorylated protein. The free form of rpS5 protein, however, undergoes phosphorylation. In this study, we have (a) investigated the potential role of phosphorylation in rpS5 protein transport into the nucleus and then into nucleoli and (b) determined which of the domains of rpS5 are involved in this intracellular trafficking. In vitro PCR mutagenesis of mouse rpS5 cDNA, complemented by subsequent cloning and expression of rpS5 truncated recombinant forms, produced in fusion with green fluorescent protein, permitted the investigation of rpS5 intracellular trafficking in HeLa cells using confocal microscopy complemented by Western blot analysis. Our results indicate the following: (a) rpS5 protein enters the nucleus via the region 38-50 aa that forms a random coil as revealed by molecular dynamic simulation. (b) Immunoprecipitation of rpS5 with casein kinase II and immobilized metal affinity chromatography analysis complemented by in vitro kinase assay revealed that phosphorylation of rpS5 seems to be indispensable for its transport from nucleus to nucleoli; upon entering the nucleus, Thr-133 phosphorylation triggers Ser-24 phosphorylation by casein kinase II, thus promoting entrance of rpS5 into the nucleoli. Another important role of rpS5 N-terminal region is proposed to be the regulation of protein's cellular level. The repetitively co-appearance of a satellite C-terminal band below the entire rpS5 at the late stationary phase, and not at the early logarithmic phase, of cell growth suggests a specific degradation balancing probably the unassembled ribosomal protein molecules with those that are efficiently assembled to ribosomal subunits. Overall, these data provide new insights on the structural and functional domains within the rpS5 molecule that contribute to its

  3. DNA-based approaches to identify forest fungi in Pacific Islands: A pilot study

    Science.gov (United States)

    Anna E. Case; Sara M. Ashiglar; Phil G. Cannon; Ernesto P. Militante; Edwin R. Tadiosa; Mutya Quintos-Manalo; Nelson M. Pampolina; John W. Hanna; Fred E. Brooks; Amy L. Ross-Davis; Mee-Sook Kim; Ned B. Klopfenstein

    2013-01-01

    DNA-based diagnostics have been successfully used to characterize diverse forest fungi (e.g., Hoff et al. 2004, Kim et al. 2006, Glaeser & Lindner 2011). DNA sequencing of the internal transcribed spacer (ITS) and large subunit (LSU) regions of nuclear ribosomal DNA (rDNA) has proved especially useful (Sonnenberg et al. 2007, Seifert 2009, Schoch et al. 2012) for...

  4. DNA landmarks for genetic relatedness and diversity assessment in Pakistani wheat genotypes using RAPD markers

    International Nuclear Information System (INIS)

    Siddiqui, M.F.; Iqbal, S.; Naz, N.; Khan, S.; Erum, S.

    2010-01-01

    DNA profiles from 10 Pakistani wheat genotypes were evaluated for diversity assessment based on RAPD markers. A total of 79 DNA fragments were generated by 10 RAPD primers, with an average of 7.9 bands primer-1. Of these, 64 fragments (81%) were polymorphic among 10 genotypes. Genetic diversity was evaluated via UPGMA cluster analysis by constructing dendrogram, which were used for the calculation of similarity coefficients between these genotypes. The greatest similarity (95%) was observed between PR-94 and PR-95, whereas PR-96 with PR-90 showed the lowest similarity (60%). Adoption of this technology would be useful to the plant protection regulatory systems, especially for plant variety identification and registration of new plant varieties, breeding programs and protection purposes. (author)

  5. DNA landmarks for genetic relatedness and diversity assessment in Pakistani wheat genotypes using RAPD markers

    Energy Technology Data Exchange (ETDEWEB)

    Siddiqui, M F; Iqbal, S; Naz, N; Khan, S [Federal Seed Certification and Registration Dept., Islamabad (Pakistan); Erum, S [National Agricultural Research Centre, Islamabad (Pakistan). Plant Genetic Resources Inst.

    2010-04-15

    DNA profiles from 10 Pakistani wheat genotypes were evaluated for diversity assessment based on RAPD markers. A total of 79 DNA fragments were generated by 10 RAPD primers, with an average of 7.9 bands primer-1. Of these, 64 fragments (81%) were polymorphic among 10 genotypes. Genetic diversity was evaluated via UPGMA cluster analysis by constructing dendrogram, which were used for the calculation of similarity coefficients between these genotypes. The greatest similarity (95%) was observed between PR-94 and PR-95, whereas PR-96 with PR-90 showed the lowest similarity (60%). Adoption of this technology would be useful to the plant protection regulatory systems, especially for plant variety identification and registration of new plant varieties, breeding programs and protection purposes. (author)

  6. The linked units of 5S rDNA and U1 snDNA of razor shells (Mollusca: Bivalvia: Pharidae).

    Science.gov (United States)

    Vierna, J; Jensen, K T; Martínez-Lage, A; González-Tizón, A M

    2011-08-01

    The linkage between 5S ribosomal DNA and other multigene families has been detected in many eukaryote lineages, but whether it provides any selective advantage remains unclear. In this work, we report the occurrence of linked units of 5S ribosomal DNA (5S rDNA) and U1 small nuclear DNA (U1 snDNA) in 10 razor shell species (Mollusca: Bivalvia: Pharidae) from four different genera. We obtained several clones containing partial or complete repeats of both multigene families in which both types of genes displayed the same orientation. We provide a comprehensive collection of razor shell 5S rDNA clones, both with linked and nonlinked organisation, and the first bivalve U1 snDNA sequences. We predicted the secondary structures and characterised the upstream and downstream conserved elements, including a region at -25 nucleotides from both 5S rDNA and U1 snDNA transcription start sites. The analysis of 5S rDNA showed that some nontranscribed spacers (NTSs) are more closely related to NTSs from other species (and genera) than to NTSs from the species they were retrieved from, suggesting birth-and-death evolution and ancestral polymorphism. Nucleotide conservation within the functional regions suggests the involvement of purifying selection, unequal crossing-overs and gene conversions. Taking into account this and other studies, we discuss the possible mechanisms by which both multigene families could have become linked in the Pharidae lineage. The reason why 5S rDNA is often found linked to other multigene families seems to be the result of stochastic processes within genomes in which its high copy number is determinant.

  7. Use of Simple Sequence Repeat (SSR) markers for DNA fingerprinting and diversity analysis of sugarcane (Saccharum spp.) cultivars resistant and susceptible to red rot

    Science.gov (United States)

    In recent years SSR markers have been used widely for the genetic analysis. The objective of present research was to use SSR markers to develop DNA-based genetic identification and analyze genetic relationship of sugarcane cultivars grown in Pakistan either resistant or susceptible to red rot. Twent...

  8. Defective ribosome assembly in Shwachman-Diamond syndrome.

    Science.gov (United States)

    Wong, Chi C; Traynor, David; Basse, Nicolas; Kay, Robert R; Warren, Alan J

    2011-10-20

    Shwachman-Diamond syndrome (SDS), a recessive leukemia predisposition disorder characterized by bone marrow failure, exocrine pancreatic insufficiency, skeletal abnormalities and poor growth, is caused by mutations in the highly conserved SBDS gene. Here, we test the hypothesis that defective ribosome biogenesis underlies the pathogenesis of SDS. We create conditional mutants in the essential SBDS ortholog of the ancient eukaryote Dictyostelium discoideum using temperature-sensitive, self-splicing inteins, showing that mutant cells fail to grow at the restrictive temperature because ribosomal subunit joining is markedly impaired. Remarkably, wild type human SBDS complements the growth and ribosome assembly defects in mutant Dictyostelium cells, but disease-associated human SBDS variants are defective. SBDS directly interacts with the GTPase elongation factor-like 1 (EFL1) on nascent 60S subunits in vivo and together they catalyze eviction of the ribosome antiassociation factor eukaryotic initiation factor 6 (eIF6), a prerequisite for the translational activation of ribosomes. Importantly, lymphoblasts from SDS patients harbor a striking defect in ribosomal subunit joining whose magnitude is inversely proportional to the level of SBDS protein. These findings in Dictyostelium and SDS patient cells provide compelling support for the hypothesis that SDS is a ribosomopathy caused by corruption of an essential cytoplasmic step in 60S subunit maturation.

  9. Identification of pork contamination in meatball using genetic marker mitochondrial DNA cytochrome b gene by duplex-PCR

    Science.gov (United States)

    Novianty, E.; Kartikasari, L. R.; Lee, J. H.; Cahyadi, M.

    2017-04-01

    Meat based food products have a big opportunity to mix and adulterated with other meats. Muslim communities are prohibited to consume pork-containing product or other pig derivatives in food. Therefore, the high sensitivity, fast, cheap and accurate approach is needed to detect pig contamination in raw meat and meat-processed product such as meatball. The aim of this study was to identify pork contamination in meatball using genetic marker of mitochondrial DNA cytochrome b gene by duplex-PCR. Samples were prepared and designed by following the proportions 0, 1, 5, 10, 25% of pork in meatballs, respectively. The DNA genome was extracted from meatballs and polymerase chain reaction (PCR) was performed using species specific primer to isolate mt-DNA cytochrome b gene. The results showed that the DNA genome was successfully isolated from pork, beef, and contaminated meatballs. Furthermore, 2% agarose gels was able to visualize of duplex-PCR to identify pork contamination in meatballs up to very small proportion (1%). It can be concluded that duplex-PCR of mt-DNA cytochrome b gene was very sensitive to identify pork contamination in meatball with the presence of specific 398 bp DNA band.

  10. Taxonomic confirmation of mud crab species (genus Scylla) in Bangladesh by nuclear and mitochondrial DNA markers.

    Science.gov (United States)

    Sarower, Mohammed Golam; Shahriar, Sheik Istiak Md; Nakamura, Hiromasa; Rouf, Muhammad Abdur; Okada, Shigeru

    2017-11-01

    Taxonomy of mud crabs genus Scylla has been misidentified for several years due to their high morphological plasticity. Several reports concerning mud crab have been published with misleading identification in Bangladesh. In this study, partial fragments of nuclear and mitochondrial DNA of Scylla species obtained from four locations along the Bangladesh coast were used to resolve taxonomical ambiguity of mud crab species. A single PCR product from the nuclear first internal transcribed spacer (ITS-1) marker and phylogenetic trees constructed based on 16S rDNA sequences indicated that all Scylla species obtained in this study were S. olivacea. Both molecular data and morphological characters revealed that S. olivacea is the only major species in Bangladesh coastal waters. Further, the 16S rDNA haplotypes significantly differed with known S. serrata by 33%. From this study it is clear that 'S. serrata' commonly reported from Bangladesh should be S. olivacea.

  11. A search for markers of sugarcane evolution

    Directory of Open Access Journals (Sweden)

    M. Bacci Jr.

    2001-12-01

    Full Text Available To determine the phylogenetic relationship between sugarcane cultivars and other members of the Saccharinae subtribe, we identified the fast evolving ITS1-5.8S-ITS2 (ITS = internal transcribed spacer; 5.8S = 5.8S ribosomal DNA region of the sugarcane genome in the Sugarcane Expressed Sequence Tag (SUCEST genome project database. Parsimony analysis utilizing this region and homologs belonging to the 23 closely related Andropogoneae currently deposited in the GenBank database has shown sugarcane as the sister group of Saccharum sinense. However, because there are few parsimony-informative characters and high homoplasy in the ITS1-5.8S-ITS2 region we were not able to determine with confidence the phylogenetic relationship between sugarcane and some of the remaining members of Saccharine subtribe. To find alternatives for the phylogenetic reconstruction of sugarcane evolutionary history, we selected 17 markers (nuclear, chloroplastic or mitochondrial from the SUCEST database of which apha-tubulin, ribosomal protein L16 (rpl16 and DNA-directed RNA polymerase beta chain (rpoC2 were found to have a low incidence of polymorphism and comparable, or even faster, rates of evolution than the ITS1-5.8S-ITS2 region. We suggest that these markers should be considered as preferential choices for phylogenetic studies of Saccharinae subtribe.Com o propósito de determinar a relação filogenética entre a cana-de-açúcar e membros da subtribo Saccharinae, a região gênica nuclear ITS1-5,8S-ITS2 (ITS: espaçador interno transcrito; 5,8S: DNA ribossomal 5.8S, com alta taxa evolutiva, foi identificada no banco de dados do projeto genoma "Sugarcane Expressed Sequence Tag" (SUCEST. Uma análise através do método de parcimônia, utilizando esta região e seqüências homólogas de 23 Andropogoneae retiradas da base de dados GenBank, indicou que a cana-de-açúcar é o grupo-irmão de Saccharum sinense. No entanto, devido à pequena quantidade de caracteres

  12. Impact of deep coalescence on the reliability of species tree inference from different types of DNA markers in mammals.

    Directory of Open Access Journals (Sweden)

    Alejandro Sánchez-Gracia

    Full Text Available An important challenge for phylogenetic studies of closely related species is the existence of deep coalescence and gene tree heterogeneity. However, their effects can vary between species and they are often neglected in phylogenetic analyses. In addition, a practical problem in the reconstruction of shallow phylogenies is to determine the most efficient set of DNA markers for a reliable estimation. To address these questions, we conducted a multilocus simulation study using empirical values of nucleotide diversity and substitution rates obtained from a wide range of mammals and evaluated the performance of both gene tree and species tree approaches to recover the known speciation times and topological relationships. We first show that deep coalescence can be a serious problem, more than usually assumed, for the estimation of speciation times in mammals using traditional gene trees. Furthermore, we tested the performance of different sets of DNA markers in the determination of species trees using a coalescent approach. Although the best estimates of speciation times were obtained, as expected, with the use of an increasing number of nuclear loci, our results show that similar estimations can be obtained with a much lower number of genes and the incorporation of a mitochondrial marker, with its high information content. Thus, the use of the combined information of both nuclear and mitochondrial markers in a species tree framework is the most efficient option to estimate recent speciation times and, consequently, the underlying species tree.

  13. Histone and ribosomal RNA repetitive gene clusters of the boll weevil are linked in a tandem array.

    Science.gov (United States)

    Roehrdanz, R; Heilmann, L; Senechal, P; Sears, S; Evenson, P

    2010-08-01

    Histones are the major protein component of chromatin structure. The histone family is made up of a quintet of proteins, four core histones (H2A, H2B, H3 & H4) and the linker histones (H1). Spacers are found between the coding regions. Among insects this quintet of genes is usually clustered and the clusters are tandemly repeated. Ribosomal DNA contains a cluster of the rRNA sequences 18S, 5.8S and 28S. The rRNA genes are separated by the spacers ITS1, ITS2 and IGS. This cluster is also tandemly repeated. We found that the ribosomal RNA repeat unit of at least two species of Anthonomine weevils, Anthonomus grandis and Anthonomus texanus (Coleoptera: Curculionidae), is interspersed with a block containing the histone gene quintet. The histone genes are situated between the rRNA 18S and 28S genes in what is known as the intergenic spacer region (IGS). The complete reiterated Anthonomus grandis histone-ribosomal sequence is 16,248 bp.

  14. Complete chloroplast genome and 45S nrDNA sequences of the medicinal plant species Glycyrrhiza glabra and Glycyrrhiza uralensis.

    Science.gov (United States)

    Kang, Sang-Ho; Lee, Jeong-Hoon; Lee, Hyun Oh; Ahn, Byoung Ohg; Won, So Youn; Sohn, Seong-Han; Kim, Jung Sun

    2017-10-06

    Glycyrrhiza uralensis and G. glabra, members of the Fabaceae, are medicinally important species that are native to Asia and Europe. Extracts from these plants are widely used as natural sweeteners because of their much greater sweetness than sucrose. In this study, the three complete chloroplast genomes and five 45S nuclear ribosomal (nr)DNA sequences of these two licorice species and an interspecific hybrid are presented. The chloroplast genomes of G. glabra, G. uralensis and G. glabra × G. uralensis were 127,895 bp, 127,716 bp and 127,939 bp, respectively. The three chloroplast genomes harbored 110 annotated genes, including 76 protein-coding genes, 30 tRNA genes and 4 rRNA genes. The 45S nrDNA sequences were either 5,947 or 5,948 bp in length. Glycyrrhiza glabra and G. glabra × G. uralensis showed two types of nrDNA, while G. uralensis contained a single type. The complete 45S nrDNA sequence unit contains 18S rRNA, ITS1, 5.8S rRNA, ITS2 and 26S rRNA. We identified simple sequence repeat and tandem repeat sequences. We also developed four reliable markers for analysis of Glycyrrhiza diversity authentication.

  15. Identification of Genes Enriched in GnRH Neurons by Translating Ribosome Affinity Purification and RNAseq in Mice.

    Science.gov (United States)

    Burger, Laura L; Vanacker, Charlotte; Phumsatitpong, Chayarndorn; Wagenmaker, Elizabeth R; Wang, Luhong; Olson, David P; Moenter, Suzanne M

    2018-04-01

    Gonadotropin-releasing hormone (GnRH) neurons are a nexus of fertility regulation. We used translating ribosome affinity purification coupled with RNA sequencing to examine messenger RNAs of GnRH neurons in adult intact and gonadectomized (GDX) male and female mice. GnRH neuron ribosomes were tagged with green fluorescent protein (GFP) and GFP-labeled polysomes isolated by immunoprecipitation, producing one RNA fraction enhanced for GnRH neuron transcripts and one RNA fraction depleted. Complementary DNA libraries were created from each fraction and 50-base, paired-end sequencing done and differential expression (enhanced fraction/depleted fraction) determined with a threshold of >1.5- or <0.66-fold (false discovery rate P ≤ 0.05). A core of ∼840 genes was differentially expressed in GnRH neurons in all treatments, including enrichment for Gnrh1 (∼40-fold), and genes critical for GnRH neuron and/or gonadotrope development. In contrast, non-neuronal transcripts were not enriched or were de-enriched. Several epithelial markers were also enriched, consistent with the olfactory epithelial origins of GnRH neurons. Interestingly, many synaptic transmission pathways were de-enriched, in accordance with relatively low innervation of GnRH neurons. The most striking difference between intact and GDX mice of both sexes was a marked downregulation of genes associated with oxidative phosphorylation and upregulation of glucose transporters in GnRH neurons from GDX mice. This may suggest that GnRH neurons switch to an alternate fuel to increase adenosine triphosphate production in the absence of negative feedback when GnRH release is elevated. Knowledge of the GnRH neuron translatome and its regulation can guide functional studies and can be extended to disease states, such as polycystic ovary syndrome.

  16. DNA barcodes identify Central Asian Colias butterflies (Lepidoptera, Pieridae).

    Science.gov (United States)

    Laiho, Juha; Ståhls, Gunilla

    2013-12-30

    A majority of the known Colias species (Lepidoptera: Pieridae, Coliadinae) occur in the mountainous regions of Central-Asia, vast areas that are hard to access, rendering the knowledge of many species limited due to the lack of extensive sampling. Two gene regions, the mitochondrial COI 'barcode' region and the nuclear ribosomal protein RpS2 gene region were used for exploring the utility of these DNA markers for species identification. A comprehensive sampling of COI barcodes for Central Asian Colias butterflies showed that the barcodes facilitated identification of most of the included species. Phylogenetic reconstruction based on parsimony and Neighbour-Joining recovered most species as monophyletic entities. For the RpS2 gene region species-specific sequences were registered for some of the included Colias spp. Nevertheless, this gene region was not deemed useful as additional molecular 'barcode'. A parsimony analysis of the combined COI and RpS2 data did not support the current subgeneric classification based on morphological characteristics.

  17. The Arabidopsis gene DIG6 encodes a large 60S subunit nuclear export GTPase 1 that is involved in ribosome biogenesis and affects multiple auxin-regulated development processes

    KAUST Repository

    Zhao, Huayan

    2015-08-13

    The circularly permuted GTPase large subunit GTPase 1 (LSG1) is involved in the maturation step of the 60S ribosome and is essential for cell viability in yeast. Here, an Arabidopsis mutant dig6 (drought inhibited growth of lateral roots) was isolated. The mutant exhibited multiple auxin-related phenotypes, which included reduced lateral root number, altered leaf veins, and shorter roots. Genetic mapping combined with next-generation DNA sequencing identified that the mutation occurred in AtLSG1-2. This gene was highly expressed in regions of auxin accumulation. Ribosome profiling revealed that a loss of function of AtLSG1-2 led to decreased levels of monosomes, further demonstrating its role in ribosome biogenesis. Quantitative proteomics showed that the expression of certain proteins involved in ribosome biogenesis was differentially regulated, indicating that ribosome biogenesis processes were impaired in the mutant. Further investigations showed that an AtLSG1-2 deficiency caused the alteration of auxin distribution, response, and transport in plants. It is concluded that AtLSG1-2 is integral to ribosome biogenesis, consequently affecting auxin homeostasis and plant development.

  18. The Arabidopsis gene DIG6 encodes a large 60S subunit nuclear export GTPase 1 that is involved in ribosome biogenesis and affects multiple auxin-regulated development processes

    KAUST Repository

    Zhao, Huayan; Lü , Shiyou; Li, Ruixi; Chen, Tao; Zhang, Huoming; Cui, Peng; Ding, Feng; Liu, Pei; Wang, Guangchao; Xia, Yiji; Running, Mark P.; Xiong, Liming

    2015-01-01

    The circularly permuted GTPase large subunit GTPase 1 (LSG1) is involved in the maturation step of the 60S ribosome and is essential for cell viability in yeast. Here, an Arabidopsis mutant dig6 (drought inhibited growth of lateral roots) was isolated. The mutant exhibited multiple auxin-related phenotypes, which included reduced lateral root number, altered leaf veins, and shorter roots. Genetic mapping combined with next-generation DNA sequencing identified that the mutation occurred in AtLSG1-2. This gene was highly expressed in regions of auxin accumulation. Ribosome profiling revealed that a loss of function of AtLSG1-2 led to decreased levels of monosomes, further demonstrating its role in ribosome biogenesis. Quantitative proteomics showed that the expression of certain proteins involved in ribosome biogenesis was differentially regulated, indicating that ribosome biogenesis processes were impaired in the mutant. Further investigations showed that an AtLSG1-2 deficiency caused the alteration of auxin distribution, response, and transport in plants. It is concluded that AtLSG1-2 is integral to ribosome biogenesis, consequently affecting auxin homeostasis and plant development.

  19. Human C4orf14 interacts with the mitochondrial nucleoid and is involved in the biogenesis of the small mitochondrial ribosomal subunit.

    Science.gov (United States)

    He, J; Cooper, H M; Reyes, A; Di Re, M; Kazak, L; Wood, S R; Mao, C C; Fearnley, I M; Walker, J E; Holt, I J

    2012-07-01

    The bacterial homologue of C4orf14, YqeH, has been linked to assembly of the small ribosomal subunit. Here, recombinant C4orf14 isolated from human cells, co-purified with the small, 28S subunit of the mitochondrial ribosome and the endogenous protein co-fractionated with the 28S subunit in sucrose gradients. Gene silencing of C4orf14 specifically affected components of the small subunit, leading to decreased protein synthesis in the organelle. The GTPase of C4orf14 was critical to its interaction with the 28S subunit, as was GTP. Therefore, we propose that C4orf14, with bound GTP, binds to components of the 28S subunit facilitating its assembly, and GTP hydrolysis acts as the release mechanism. C4orf14 was also found to be associated with human mitochondrial nucleoids, and C4orf14 gene silencing caused mitochondrial DNA depletion. In vitro C4orf14 is capable of binding to DNA. The association of C4orf14 with mitochondrial translation factors and the mitochondrial nucleoid suggests that the 28S subunit is assembled at the mitochondrial nucleoid, enabling the direct transfer of messenger RNA from the nucleoid to the ribosome in the organelle.

  20. Isolation and characterization of an RIP (ribosome-inactivating protein)-like protein from tobacco with dual enzymatic activity.

    Science.gov (United States)

    Sharma, Neelam; Park, Sang-Wook; Vepachedu, Ramarao; Barbieri, Luigi; Ciani, Marialibera; Stirpe, Fiorenzo; Savary, Brett J; Vivanco, Jorge M

    2004-01-01

    Ribosome-inactivating proteins (RIPs) are N-glycosidases that remove a specific adenine from the sarcin/ricin loop of the large rRNA, thus arresting protein synthesis at the translocation step. In the present study, a protein termed tobacco RIP (TRIP) was isolated from tobacco (Nicotiana tabacum) leaves and purified using ion exchange and gel filtration chromatography in combination with yeast ribosome depurination assays. TRIP has a molecular mass of 26 kD as evidenced by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and showed strong N-glycosidase activity as manifested by the depurination of yeast rRNA. Purified TRIP showed immunoreactivity with antibodies of RIPs from Mirabilis expansa. TRIP released fewer amounts of adenine residues from ribosomal (Artemia sp. and rat ribosomes) and non-ribosomal substrates (herring sperm DNA, rRNA, and tRNA) compared with other RIPs. TRIP inhibited translation in wheat (Triticum aestivum) germ more efficiently than in rabbit reticulocytes, showing an IC50 at 30 ng in the former system. Antimicrobial assays using highly purified TRIP (50 microg mL(-1)) conducted against various fungi and bacterial pathogens showed the strongest inhibitory activity against Trichoderma reesei and Pseudomonas solancearum. A 15-amino acid internal polypeptide sequence of TRIP was identical with the internal sequences of the iron-superoxide dismutase (Fe-SOD) from wild tobacco (Nicotiana plumbaginifolia), Arabidopsis, and potato (Solanum tuberosum). Purified TRIP showed SOD activity, and Escherichia coli Fe-SOD was observed to have RIP activity too. Thus, TRIP may be considered a dual activity enzyme showing RIP-like activity and Fe-SOD characteristics.

  1. Species identification of medicinal pteridophytes by a DNA barcode marker, the chloroplast psbA-trnH intergenic region.

    Science.gov (United States)

    Ma, Xin-Ye; Xie, Cai-Xiang; Liu, Chang; Song, Jing-Yuan; Yao, Hui; Luo, Kun; Zhu, Ying-Jie; Gao, Ting; Pang, Xiao-Hui; Qian, Jun; Chen, Shi-Lin

    2010-01-01

    Medicinal pteridophytes are an important group used in traditional Chinese medicine; however, there is no simple and universal way to differentiate various species of this group by morphological traits. A novel technology termed "DNA barcoding" could discriminate species by a standard DNA sequence with universal primers and sufficient variation. To determine whether DNA barcoding would be effective for differentiating pteridophyte species, we first analyzed five DNA sequence markers (psbA-trnH intergenic region, rbcL, rpoB, rpoC1, and matK) using six chloroplast genomic sequences from GeneBank and found psbA-trnH intergenic region the best candidate for availability of universal primers. Next, we amplified the psbA-trnH region from 79 samples of medicinal pteridophyte plants. These samples represented 51 species from 24 families, including all the authentic pteridophyte species listed in the Chinese pharmacopoeia (2005 version) and some commonly used adulterants. We found that the sequence of the psbA-trnH intergenic region can be determined with both high polymerase chain reaction (PCR) amplification efficiency (94.1%) and high direct sequencing success rate (81.3%). Combined with GeneBank data (54 species cross 12 pteridophyte families), species discriminative power analysis showed that 90.2% of species could be separated/identified successfully by the TaxonGap method in conjunction with the Basic Local Alignment Search Tool 1 (BLAST1) method. The TaxonGap method results further showed that, for 37 out of 39 separable species with at least two samples each, between-species variation was higher than the relevant within-species variation. Thus, the psbA-trnH intergenic region is a suitable DNA marker for species identification in medicinal pteridophytes.

  2. Genetic markers and their application in livestock breeding in South ...

    African Journals Online (AJOL)

    The ultimate use of DNA markers would be to identify quantitative trait loci (QTL) in order to practice genotypic selection. This paper reviews DNA markers (RAPD, DFP, RFLP AFLP, minisatellites, microsatellites, SNP) and provides a brief overview of the current application of these markers in animal breeding.

  3. Application of plant DNA markers in forensic botany: genetic comparison of Quercus evidence leaves to crime scene trees using microsatellites.

    Science.gov (United States)

    Craft, Kathleen J; Owens, Jeffrey D; Ashley, Mary V

    2007-01-05

    As highly polymorphic DNA markers become increasingly available for a wide range of plant and animal species, there will be increasing opportunities for applications to forensic investigations. To date, however, relatively few studies have reported using DNA profiles of non-human species to place suspects at or near crime scenes. Here we describe an investigation of a double homicide of a female and her near-term fetus. Leaf material taken from a suspect's vehicle was identified to be that of sand live oak, Quercus geminata, the same tree species that occurred near a shallow grave where the victims were found. Quercus-specific DNA microsatellites were used to genotype both dried and fresh material from trees located near the burial site and from the material taken from the suspect's car. Samples from the local population of Q. geminata were also collected and genotyped in order to demonstrate that genetic variation at four microsatellite loci was sufficient to assign leaves to an individual tree with high statistical certainty. The cumulative average probability of identity for these four loci was 2.06x10(-6). DNA was successfully obtained from the dried leaf material although PCR amplification was more difficult than amplification of DNA from fresh leaves. The DNA profiles of the dried leaves from the suspect's car did not match those of the trees near the crime scene. Although this investigation did not provide evidence that could be used against the suspect, it does demonstrate the potential for plant microsatellite markers providing physical evidence that links plant materials to live plants at or near crime scenes.

  4. Import of desired nucleic acid sequences using addressing motif of mitochondrial ribosomal 5S-rRNA for fluorescent in vivo hybridization of mitochondrial DNA and RNA.

    Science.gov (United States)

    Zelenka, Jaroslav; Alán, Lukáš; Jabůrek, Martin; Ježek, Petr

    2014-04-01

    Based on the matrix-addressing sequence of mitochondrial ribosomal 5S-rRNA (termed MAM), which is naturally imported into mitochondria, we have constructed an import system for in vivo targeting of mitochondrial DNA (mtDNA) or mt-mRNA, in order to provide fluorescence hybridization of the desired sequences. Thus DNA oligonucleotides were constructed, containing the 5'-flanked T7 RNA polymerase promoter. After in vitro transcription and fluorescent labeling with Alexa Fluor(®) 488 or 647 dye, we obtained the fluorescent "L-ND5 probe" containing MAM and exemplar cargo, i.e., annealing sequence to a short portion of ND5 mRNA and to the light-strand mtDNA complementary to the heavy strand nd5 mt gene (5'-end 21 base pair sequence). For mitochondrial in vivo fluorescent hybridization, HepG2 cells were treated with dequalinium micelles, containing the fluorescent probes, bringing the probes proximally to the mitochondrial outer membrane and to the natural import system. A verification of import into the mitochondrial matrix of cultured HepG2 cells was provided by confocal microscopy colocalizations. Transfections using lipofectamine or probes without 5S-rRNA addressing MAM sequence or with MAM only were ineffective. Alternatively, the same DNA oligonucleotides with 5'-CACC overhang (substituting T7 promoter) were transcribed from the tetracycline-inducible pENTRH1/TO vector in human embryonic kidney T-REx®-293 cells, while mitochondrial matrix localization after import of the resulting unlabeled RNA was detected by PCR. The MAM-containing probe was then enriched by three-order of magnitude over the natural ND5 mRNA in the mitochondrial matrix. In conclusion, we present a proof-of-principle for mitochondrial in vivo hybridization and mitochondrial nucleic acid import.

  5. Heterogeneous Ribosomes Preferentially Translate Distinct Subpools of mRNAs Genome-wide.

    Science.gov (United States)

    Shi, Zhen; Fujii, Kotaro; Kovary, Kyle M; Genuth, Naomi R; Röst, Hannes L; Teruel, Mary N; Barna, Maria

    2017-07-06

    Emerging studies have linked the ribosome to more selective control of gene regulation. However, an outstanding question is whether ribosome heterogeneity at the level of core ribosomal proteins (RPs) exists and enables ribosomes to preferentially translate specific mRNAs genome-wide. Here, we measured the absolute abundance of RPs in translating ribosomes and profiled transcripts that are enriched or depleted from select subsets of ribosomes within embryonic stem cells. We find that heterogeneity in RP composition endows ribosomes with differential selectivity for translating subpools of transcripts, including those controlling metabolism, cell cycle, and development. As an example, mRNAs enriched in binding to RPL10A/uL1-containing ribosomes are shown to require RPL10A/uL1 for their efficient translation. Within several of these transcripts, this level of regulation is mediated, at least in part, by internal ribosome entry sites. Together, these results reveal a critical functional link between ribosome heterogeneity and the post-transcriptional circuitry of gene expression. Copyright © 2017 Elsevier Inc. All rights reserved.

  6. Evolutionary Dynamics of 5S rDNA and Recurrent Association of Transposable Elements in Electric Fish of the Family Gymnotidae (Gymnotiformes): The Case of Gymnotus mamiraua.

    Science.gov (United States)

    da Silva, Maelin; Barbosa, Patricia; Artoni, Roberto F; Feldberg, Eliana

    2016-01-01

    Gymnotidae is a family of electric fish endemic to the Neotropics consisting of 2 genera: Electrophorus and Gymnotus. The genus Gymnotus is widely distributed and is found in all of the major Brazilian river systems. Physical and molecular mapping data for the ribosomal DNA (rDNA) in this genus are still scarce, with its chromosomal location known in only 11 species. As other species of Gymnotus with 2n = 54 chromosomes from the Paraná-Paraguay basin, G. mamiraua was found to have a large number of 5S rDNA sites. Isolation and cloning of the 5S rDNA sequences from G. mamiraua identified a fragment of a transposable element similar to the Tc1/mariner transposon associated with a non-transcribed spacer. Double fluorescence in situ hybridization analysis of this element and the 5S rDNA showed that they were colocalized on several chromosomes, in addition to acting as nonsyntenic markers on others. Our data show the association between these sequences and suggest that the Tc1 retrotransposon may be the agent that drives the spread of these 5S rDNA-like sequences in the G. mamiraua genome. © 2016 S. Karger AG, Basel.

  7. Tissue-selective effects of nucleolar stress and rDNA damage in developmental disorders.

    Science.gov (United States)

    Calo, Eliezer; Gu, Bo; Bowen, Margot E; Aryan, Fardin; Zalc, Antoine; Liang, Jialiang; Flynn, Ryan A; Swigut, Tomek; Chang, Howard Y; Attardi, Laura D; Wysocka, Joanna

    2018-02-01

    Many craniofacial disorders are caused by heterozygous mutations in general regulators of housekeeping cellular functions such as transcription or ribosome biogenesis. Although it is understood that many of these malformations are a consequence of defects in cranial neural crest cells, a cell type that gives rise to most of the facial structures during embryogenesis, the mechanism underlying cell-type selectivity of these defects remains largely unknown. By exploring molecular functions of DDX21, a DEAD-box RNA helicase involved in control of both RNA polymerase (Pol) I- and II-dependent transcriptional arms of ribosome biogenesis, we uncovered a previously unappreciated mechanism linking nucleolar dysfunction, ribosomal DNA (rDNA) damage, and craniofacial malformations. Here we demonstrate that genetic perturbations associated with Treacher Collins syndrome, a craniofacial disorder caused by heterozygous mutations in components of the Pol I transcriptional machinery or its cofactor TCOF1 (ref. 1), lead to relocalization of DDX21 from the nucleolus to the nucleoplasm, its loss from the chromatin targets, as well as inhibition of rRNA processing and downregulation of ribosomal protein gene transcription. These effects are cell-type-selective, cell-autonomous, and involve activation of p53 tumour-suppressor protein. We further show that cranial neural crest cells are sensitized to p53-mediated apoptosis, but blocking DDX21 loss from the nucleolus and chromatin rescues both the susceptibility to apoptosis and the craniofacial phenotypes associated with Treacher Collins syndrome. This mechanism is not restricted to cranial neural crest cells, as blood formation is also hypersensitive to loss of DDX21 functions. Accordingly, ribosomal gene perturbations associated with Diamond-Blackfan anaemia disrupt DDX21 localization. At the molecular level, we demonstrate that impaired rRNA synthesis elicits a DNA damage response, and that rDNA damage results in tissue-selective and

  8. Effect of sodium fluoride on the amount of polyribosomes, single ribosomes and ribosomal subunits in a cellular slime mold, Dictyostelium discoideum

    Energy Technology Data Exchange (ETDEWEB)

    Sameshima, M; Ito, K; Iwabuchi, M

    1972-01-01

    In the slime mold, Dictyostelium discoideum, when the rate of protein synthesis was decreased by NaF, free 80-S ribosomes accumulated at the expense of polyribosomes, while 60-S and 40-S ribosomal subunits remained almost constant. The same level of ribosomal subunits was also maintained in cells after incubation with cycloheximide or at the stationary phase of growth.

  9. Phylogenetic analysis of subgenus vigna species using nuclear ribosomal RNA ITS: evidence of hybridization among Vigna unguiculata subspecies.

    Science.gov (United States)

    Vijaykumar, Archana; Saini, Ajay; Jawali, Narendra

    2010-01-01

    Molecular phylogeny among species belonging to subgenus Vigna (genus Vigna) was inferred based on internal transcribed spacer (ITS) sequences of 18S-5.8S-26S ribosomal RNA gene unit. Analysis showed a total of 356 polymorphic sites of which approximately 80% were parsimony informative. Phylogenetic reconstruction by neighbor joining and maximum parsimony methods placed the 57 Vigna accessions (belonging to 15 species) into 5 major clades. Five species viz. Vigna heterophylla, Vigna pubigera, Vigna parkeri, Vigna laurentii, and Vigna gracilis whose position in the subgenus was previously not known were placed in the section Vigna. A single accession (Vigna unguiculata ssp. tenuis, NI 1637) harbored 2 intragenomic ITS variants, indicative of 2 different types of ribosomal DNA (rDNA) repeat units. ITS variant type-I was close to ITS from V. unguiculata ssp. pubescens, whereas type-II was close to V. unguiculata ssp. tenuis. Transcript analysis clearly demonstrates that in accession NI 1637, rDNA repeat units with only type-II ITS variants are transcriptionally active. Evidence from sequence analysis (of 5.8S, ITS1, and ITS2) and secondary structure analysis (of ITS1 and ITS2) indicates that the type-I ITS variant probably does not belong to the pseudogenic rDNA repeat units. The results from phylogenetic and transcript analysis suggest that the rDNA units with the type-I ITS may have introgressed as a result of hybridization (between ssp. tenuis and ssp. pubescens); however, it has been epigenetically silenced. The results also demonstrate differential evolution of ITS sequence among wild and cultivated forms of V. unguiculata.

  10. Application of DNA based marker mutations for improvement of cereals and other sexually reproduced crop plants. Proceedings of a final research co-ordination meeting

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1998-03-01

    The Co-ordinated Research Programme (CRP) on the Application of DNA Based Marker Mutations for Improvement of Cereals and Other Sexually Reproduced Crop Plants represents the first of three CRPs dealing with the application of molecular markers to mutations and plant breeding and was implemented between 1992 and 1996. A second companion CRP entitled Use of Novel DNA Fingerprinting Techniques for the Detection and Characterization of Genetic Variation in Vegetatively Propagated Crops devoted to the application of molecular markers in vegetatively propagated crops species was implemented between 1993 and 1997. One positive consequence of these two CRPs has been the implementation of a third CRP entitled Radioactively Labeled DNA Probes for Crop Improvement, which began in 1995 and aims to provide enabling technologies, in the form of probes and primers, to laboratories in developing countries. The rapid development of molecular marker technologies has also resulted in a dramatic increase in request from developing Member States for technical co-operation projects utilizing molecular markers to improve local varieties for biotic and abiotic stresses and other traits of relevance. With the intensified use of induced mutations in genetic studies, it will be important to continue the important work of understanding induced mutations at the molecular level. Evidence of the progress made in implementing molecular marker technologies in laboratories around the world is presented in this publication, which contains the results presented by the participants at the fourth and final Research Co-ordination Meeting of the CRP held in Vienna, 4-8 November 1996. The FAO and IAEA wish to express their sincere appreciation to the participants of the meeting for their work during the project period resulting in the summary and scientific reports presented in this publication. Refs, figs, tabs.

  11. Application of DNA based marker mutations for improvement of cereals and other sexually reproduced crop plants. Proceedings of a final research co-ordination meeting

    International Nuclear Information System (INIS)

    1998-03-01

    The Co-ordinated Research Programme (CRP) on the Application of DNA Based Marker Mutations for Improvement of Cereals and Other Sexually Reproduced Crop Plants represents the first of three CRPs dealing with the application of molecular markers to mutations and plant breeding and was implemented between 1992 and 1996. A second companion CRP entitled Use of Novel DNA Fingerprinting Techniques for the Detection and Characterization of Genetic Variation in Vegetatively Propagated Crops devoted to the application of molecular markers in vegetatively propagated crops species was implemented between 1993 and 1997. One positive consequence of these two CRPs has been the implementation of a third CRP entitled Radioactively Labeled DNA Probes for Crop Improvement, which began in 1995 and aims to provide enabling technologies, in the form of probes and primers, to laboratories in developing countries. The rapid development of molecular marker technologies has also resulted in a dramatic increase in request from developing Member States for technical co-operation projects utilizing molecular markers to improve local varieties for biotic and abiotic stresses and other traits of relevance. With the intensified use of induced mutations in genetic studies, it will be important to continue the important work of understanding induced mutations at the molecular level. Evidence of the progress made in implementing molecular marker technologies in laboratories around the world is presented in this publication, which contains the results presented by the participants at the fourth and final Research Co-ordination Meeting of the CRP held in Vienna, 4-8 November 1996. The FAO and IAEA wish to express their sincere appreciation to the participants of the meeting for their work during the project period resulting in the summary and scientific reports presented in this publication

  12. Ribosome dynamics and tRNA movement by time-resolved electron cryomicroscopy.

    Science.gov (United States)

    Fischer, Niels; Konevega, Andrey L; Wintermeyer, Wolfgang; Rodnina, Marina V; Stark, Holger

    2010-07-15

    The translocation step of protein synthesis entails large-scale rearrangements of the ribosome-transfer RNA (tRNA) complex. Here we have followed tRNA movement through the ribosome during translocation by time-resolved single-particle electron cryomicroscopy (cryo-EM). Unbiased computational sorting of cryo-EM images yielded 50 distinct three-dimensional reconstructions, showing the tRNAs in classical, hybrid and various novel intermediate states that provide trajectories and kinetic information about tRNA movement through the ribosome. The structures indicate how tRNA movement is coupled with global and local conformational changes of the ribosome, in particular of the head and body of the small ribosomal subunit, and show that dynamic interactions between tRNAs and ribosomal residues confine the path of the tRNAs through the ribosome. The temperature dependence of ribosome dynamics reveals a surprisingly flat energy landscape of conformational variations at physiological temperature. The ribosome functions as a Brownian machine that couples spontaneous conformational changes driven by thermal energy to directed movement.

  13. Alkaline Extraction of DNA from Pathogenic Fungi for PCR-RFLP Analysis

    OpenAIRE

    Matsumoto, Masaru; Mishima, Shinobu; Matsuyama, Nobuaki; 松元, 賢; 松山, 宣明

    1997-01-01

    For the preparation of DNA samples from fungal mycelia alkaline extraction method was applied and assessed its usefulness for PCR-RFLP analysis. Using alkaline treatment protocols, 18S ribosomal DNAs (rDNA) derived from fungal genomic DNA of Pyricularia oryzae, P. zingiberi, Rhizoctonia solani and R. oryzae were PCR-amplified and digested with Hha I, Msp I and Hae ill. RFLP analysis with HhaI showed the divergent polymorphism between genus Pyricularia and Rhizoctonia. The alkaline DNA extract...

  14. Evolution and perspectives of cultivar identification and traceability from tree to oil and table olives by means of DNA markers.

    Science.gov (United States)

    Pasqualone, Antonella; Montemurro, Cinzia; di Rienzo, Valentina; Summo, Carmine; Paradiso, Vito Michele; Caponio, Francesco

    2016-08-01

    In recent years, an increasing number of typicality marks has been awarded to high-quality olive oils produced from local cultivars. In this case, quality control requires effective varietal checks of the starting materials. Moreover, accurate cultivar identification is essential in vegetative-propagated plants distributed by nurseries and is a pre-requisite to register new cultivars. Food genomics provides many tools for cultivar identification and traceability from tree to oil and table olives. The results of the application of different classes of DNA markers to olive with the purpose of checking cultivar identity and variability of plant material are extensively discussed in this review, with special regard to repeatability issues and polymorphism degree. The characterization of olive germplasm from all countries of the Mediterranean basin and from less studied geographical areas is described and innovative high-throughput molecular tools to manage reference collections are reviewed. Then the transferability of DNA markers to processed products - virgin olive oils and table olives - is overviewed to point out strengths and weaknesses, with special regard to (i) the influence of processing steps and storage time on the quantity and quality of residual DNA, (ii) recent advances to overcome the bottleneck of DNA extraction from processed products, (iii) factors affecting whole comparability of DNA profiles between fresh plant materials and end-products, (iv) drawbacks in the analysis of multi-cultivar versus single-cultivar end-products and (v) the potential of quantitative polymerase chain reaction (PCR)-based techniques. © 2016 Society of Chemical Industry. © 2016 Society of Chemical Industry.

  15. Staining Against Phospho-H2AX (gamma-H2AX) as a Marker for DNA Damage and Genomic Instability in Cancer Tissues and Cells

    NARCIS (Netherlands)

    Nagelkerke, A.P.; Span, P.N.

    2016-01-01

    Phospho-H2AX or gamma-H2AX- is a marker of DNA double-stranded breaks and can therefore be used to monitor DNA repair after, for example, irradiation. In addition, positive staining for phospho-H2AX may indicate genomic instability and telomere dysfunction in tumour cells and tissues. Here, we

  16. The mitochondrial outer membrane protein MDI promotes local protein synthesis and mtDNA replication.

    Science.gov (United States)

    Zhang, Yi; Chen, Yong; Gucek, Marjan; Xu, Hong

    2016-05-17

    Early embryonic development features rapid nuclear DNA replication cycles, but lacks mtDNA replication. To meet the high-energy demands of embryogenesis, mature oocytes are furnished with vast amounts of mitochondria and mtDNA However, the cellular machinery driving massive mtDNA replication in ovaries remains unknown. Here, we describe a Drosophila AKAP protein, MDI that recruits a translation stimulator, La-related protein (Larp), to the mitochondrial outer membrane in ovaries. The MDI-Larp complex promotes the synthesis of a subset of nuclear-encoded mitochondrial proteins by cytosolic ribosomes on the mitochondrial surface. MDI-Larp's targets include mtDNA replication factors, mitochondrial ribosomal proteins, and electron-transport chain subunits. Lack of MDI abolishes mtDNA replication in ovaries, which leads to mtDNA deficiency in mature eggs. Targeting Larp to the mitochondrial outer membrane independently of MDI restores local protein synthesis and rescues the phenotypes of mdi mutant flies. Our work suggests that a selective translational boost by the MDI-Larp complex on the outer mitochondrial membrane might be essential for mtDNA replication and mitochondrial biogenesis during oogenesis. Published 2016. This article is a U.S. Government work and is in the public domain in the USA.

  17. The Phosphorylation of Ribosomal Protein in Lemna minor

    Science.gov (United States)

    Trewavas, A.

    1973-01-01

    Sterile cultures of Lemna minor have been labeled with 32P1, and the ribosomal proteins have been examined for radioactivity. In relatively short term labeling a radioactive protein was found which ran as a single component in both urea/acetic acid and sodium lauryl sulfate gel electrophoresis. Acid hydrolysis of the labeled protein permitted the isolation of serine phosphate. After labeling to equilibrium with 32P1, calculation indicated only 0.6 to 0.75 atom of this protein phosphorus per ribosome. The phosphorylated protein is found in both polysomes and “derived” monomers and appears to be located in the ribosomal small subunit. Its apparent molecular weight is 42,000. Addition of growth-inhibiting concentrations of abscisic acid does not alter the apparent degree of labeling of this protein in 5 hours, but after 24 hours of treatment the total protein phosphorus was reduced from 0.75 atom of phosphorus per ribosome to 0.36 atom of phosphorus per ribosome. PMID:16658405

  18. A computational investigation on the connection between dynamics properties of ribosomal proteins and ribosome assembly.

    Directory of Open Access Journals (Sweden)

    Brittany Burton

    Full Text Available Assembly of the ribosome from its protein and RNA constituents has been studied extensively over the past 50 years, and experimental evidence suggests that prokaryotic ribosomal proteins undergo conformational changes during assembly. However, to date, no studies have attempted to elucidate these conformational changes. The present work utilizes computational methods to analyze protein dynamics and to investigate the linkage between dynamics and binding of these proteins during the assembly of the ribosome. Ribosomal proteins are known to be positively charged and we find the percentage of positive residues in r-proteins to be about twice that of the average protein: Lys+Arg is 18.7% for E. coli and 21.2% for T. thermophilus. Also, positive residues constitute a large proportion of RNA contacting residues: 39% for E. coli and 46% for T. thermophilus. This affirms the known importance of charge-charge interactions in the assembly of the ribosome. We studied the dynamics of three primary proteins from E. coli and T. thermophilus 30S subunits that bind early in the assembly (S15, S17, and S20 with atomic molecular dynamic simulations, followed by a study of all r-proteins using elastic network models. Molecular dynamics simulations show that solvent-exposed proteins (S15 and S17 tend to adopt more stable solution conformations than an RNA-embedded protein (S20. We also find protein residues that contact the 16S rRNA are generally more mobile in comparison with the other residues. This is because there is a larger proportion of contacting residues located in flexible loop regions. By the use of elastic network models, which are computationally more efficient, we show that this trend holds for most of the 30S r-proteins.

  19. Phosphorylation of acidic ribosomal proteins from rabbit reticulocytes by a ribosome-associated casein kinase

    DEFF Research Database (Denmark)

    Issinger, O G

    1977-01-01

    Two acidic proteins from 80-S ribosomes were isolated and purified to homogeneity. The purified acidic proteins could be phosphorylated by casein kinase using [gamma-32P]ATP and [gamma-32P]GTP as a phosphoryl donor. The proteins became phosphorylated in situ, too. Sodium dodecyl sulfate polyacryl......Two acidic proteins from 80-S ribosomes were isolated and purified to homogeneity. The purified acidic proteins could be phosphorylated by casein kinase using [gamma-32P]ATP and [gamma-32P]GTP as a phosphoryl donor. The proteins became phosphorylated in situ, too. Sodium dodecyl sulfate...

  20. On the control of ribosomal protein biosynthesis in Escherichia coli

    International Nuclear Information System (INIS)

    Pichon, J.; Marvaldi, J.; Coeroli, C.; Cozzone, A.; Marchis-Mouren, G.

    1977-01-01

    The rate of individual ribosomal protein synthesis relative to total protein synthesis has been determined in Escherichia coli rel + and rel - cells, under valyl-tRNA deprivation. These strains have a temperature-sensitive valyl-tRNA synthetase. Starvation was obtained following transfer of the cells to non-permissive temperature. Ribosomal proteins were obtained by treatment of either total lysates of freeze-thawed lysozyme spheroplasts or ammonium sulphate precipitate of ribosomes, with acetic acid. Differential labelling of the ribosomal proteins was observed in both strains: proteins from the rel + strain appear more labelled than those from the rel - strain, the rate of labelling of individual proteins being about the same in both strains. Moreover ribosomal proteins were found as stable during starvation as total protein. It is thus concluded that in starving cells individual ribosomal proteins are not synthesized at equal rates. This indicates that the synthesis of ribosomal proteins is not only under the control of the rel gene

  1. Replication and Transcription of Eukaryotic DNA in Esherichia coli

    Science.gov (United States)

    Morrow, John F.; Cohen, Stanley N.; Chang, Annie C. Y.; Boyer, Herbert W.; Goodman, Howard M.; Helling, Robert B.

    1974-01-01

    Fragments of amplified Xenopus laevis DNA, coding for 18S and 28S ribosomal RNA and generated by EcoRI restriction endonuclease, have been linked in vitro to the bacterial plasmid pSC101; and the recombinant molecular species have been introduced into E. coli by transformation. These recombinant plasmids, containing both eukaryotic and prokaryotic DNA, replicate stably in E. coli. RNA isolated from E. coli minicells harboring the plasmids hybridizes to amplified X. laevis rDNA. Images PMID:4600264

  2. DDX4 (DEAD box polypeptide 4) colocalizes with cancer stem cell marker CD133 in ovarian cancers

    International Nuclear Information System (INIS)

    Kim, Ki Hyung; Kang, Yun-Jeong; Jo, Jin-Ok; Ock, Mee Sun; Moon, Soo Hyun; Suh, Dong Soo; Yoon, Man Soo; Park, Eun-Sil; Jeong, Namkung; Eo, Wan-Kyu; Kim, Heung Yeol; Cha, Hee-Jae

    2014-01-01

    Highlights: • Germ cell marker DDX4 was significantly increased in ovarian cancer. • Ovarian cancer stem cell marker CD133 was significantly increased in ovarian cancer. • DDX4 and CD133 were mostly colocalized in various types of ovarian cancer tissues. • CD133 positive ovarian cancer cells also express DDX4 whereas CD133-negative cells did not possess DDX4. • Germ cell marker DDX4 has the potential of ovarian cancer stem cell marker. - Abstract: DDX4 (DEAD box polypeptide 4), characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), is an RNA helicase which is implicated in various cellular processes involving the alteration of RNA secondary structure, such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. DDX4 is known to be a germ cell-specific protein and is used as a sorting marker of germline stem cells for the production of oocytes. A recent report about DDX4 in ovarian cancer showed that DDX4 is overexpressed in epithelial ovarian cancer and disrupts a DNA damage-induced G2 checkpoint. We investigated the relationship between DDX4 and ovarian cancer stem cells by analyzing the expression patterns of DDX4 and the cancer stem cell marker CD133 in ovarian cancers via tissue microarray. Both DDX4 and CD133 were significantly increased in ovarian cancer compared to benign tumors, and showed similar patterns of expression. In addition, DDX4 and CD133 were mostly colocalized in various types of ovarian cancer tissues. Furthermore, almost all CD133 positive ovarian cancer cells also express DDX4 whereas CD133-negative cells did not possess DDX4, suggesting a strong possibility that DDX4 plays an important role in cancer stem cells, and/or can be used as an ovarian cancer stem cell marker

  3. New STS molecular markers for assessment of genetic diversity and DNA fingerprinting in hop (Humulus lupulus L.).

    Science.gov (United States)

    Patzak, Josef; Vrba, Lukás; Matousek, Jaroslav

    2007-01-01

    Molecular markers have been increasingly used in genetic studies of crop species for their applicability in breeding programs. In this work, we report on the development of new sequence-tagged site (STS) markers based on sequence information from several identified hop (Humulus lupulus L.) genes. We demonstrate the usefulness of these STS markers and compare them to SSRs for identifying hop genotypes and estimating genetic diversity in a collection of 68 hop cultivars from around the world. We found 3 individual gene variants (A, B, C) of the chs_H1 gene in this collection. The most frequent gene variant, B (AJ304877), was not detected in Mt. Hood, Glacier, and Horizon (US) cultivars. Gene variant A came from an American germplasm through wild hops. We found length polymorphism in intron 1 of the chs2 gene, and 4 different amplified markers were detected in PCRs. The chs3 gene was found in only one third of the cultivars. None of the variants of the studied CHS genes were found in Humulus japonicus. We detected 5 major gene variants of DNA-binding protein in the collection of H. lupulus cultivars and 2 others in H. japonicus. We also found 3 individual gene variants of an endochitinase gene. The distribution of gene variants did not correlate with any resistance. We proved that developed STS markers can be successfully used for the analysis of genetic diversity and can substitute and supplement SSR markers in hop.

  4. Protocols for 16S rDNA Array Analyses of Microbial Communities by Sequence-Specific Labeling of DNA Probes

    Directory of Open Access Journals (Sweden)

    Knut Rudi

    2003-01-01

    Full Text Available Analyses of complex microbial communities are becoming increasingly important. Bottlenecks in these analyses, however, are the tools to actually describe the biodiversity. Novel protocols for DNA array-based analyses of microbial communities are presented. In these protocols, the specificity obtained by sequence-specific labeling of DNA probes is combined with the possibility of detecting several different probes simultaneously by DNA array hybridization. The gene encoding 16S ribosomal RNA was chosen as the target in these analyses. This gene contains both universally conserved regions and regions with relatively high variability. The universally conserved regions are used for PCR amplification primers, while the variable regions are used for the specific probes. Protocols are presented for DNA purification, probe construction, probe labeling, and DNA array hybridizations.

  5. Several genes encoding ribosomal proteins are over-expressed in prostate-cancer cell lines: confirmation of L7a and L37 over-expression in prostate-cancer tissue samples.

    Science.gov (United States)

    Vaarala, M H; Porvari, K S; Kyllönen, A P; Mustonen, M V; Lukkarinen, O; Vihko, P T

    1998-09-25

    A cDNA library specific for mRNA over-expressed in prostate cancer was generated by subtractive hybridization of transcripts originating from prostatic hyperplasia and cancer tissues. cDNA encoding ribosomal proteins L4, L5, L7a, L23a, L30, L37, S14 and S18 was found to be present among 100 analyzed clones. Levels of ribosomal mRNA were significantly higher at least in one of the prostate-cancer cell lines, LNCaP, DU-145 and PC-3, than in hyperplastic tissue, as determined by slot-blot hybridization. Furthermore, L23a- and S14-transcript levels were significantly elevated in PC-3 cells as compared with those in the normal prostate epithelial cell line PrEC. Generally, dramatic changes in the mRNA content of the ribosomal proteins were not detected, the most evident over-expression being that of L37 mRNA, which was 3.4 times more abundant in LNCaP cells than in hyperplastic prostate tissue. The over-expression of L7a and L37 mRNA was confirmed in prostate-cancer tissue samples by in situ hybridization. Elevated cancer-related expression of L4 and L30 has not been reported, but levels of the other ribosomal proteins are known to be increased in several types of cancers. These results therefore suggest that prostate cancer is comparable with other types of cancers, in that a larger pool of some ribosomal proteins is gained during the transformation process, by an unknown mechanism.

  6. In Profile: Models of Ribosome Biogenesis Defects and Regulation of Protein Synthesis

    NARCIS (Netherlands)

    Essers, P.B.M.

    2013-01-01

    Ribosomes are the mediators of protein synthesis in the cell and therefore crucial to proper cell function. In addition, ribosomes are highly abundant, with ribosomal RNA making up 80% of the RNA in the cell. A large amount of resources go into maintaining this pool of ribosomes, so ribosome

  7. The primary structures of ribosomal proteins S14 and S16 from the archaebacterium Halobacterium marismortui. Comparison with eubacterial and eukaryotic ribosomal proteins.

    Science.gov (United States)

    Kimura, J; Kimura, M

    1987-09-05

    The amino acid sequences of two ribosomal proteins, S14 and S16, from the archaebacterium Halobacterium marismortui have been determined. Sequence data were obtained by the manual and solid-phase sequencing of peptides derived from enzymatic digestions with trypsin, chymotrypsin, pepsin, and Staphylococcus aureus protease as well as by chemical cleavage with cyanogen bromide. Proteins S14 and S16 contain 109 and 126 amino acid residues and have Mr values of 11,964 and 13,515, respectively. Comparison of the sequences with those of ribosomal proteins from other organisms demonstrates that S14 has a significant homology with the rat liver ribosomal protein S11 (36% identity) as well as with the Escherichia coli ribosomal protein S17 (37%), and that S16 is related to the yeast ribosomal protein YS22 (40%) and proteins S8 from E. coli (28%) and Bacillus stearothermophilus (30%). A comparison of the amino acid residues in the homologous regions of halophilic and nonhalophilic ribosomal proteins reveals that halophilic proteins have more glutamic acids, asparatic acids, prolines, and alanines, and less lysines, arginines, and isoleucines than their nonhalophilic counterparts. These amino acid substitutions probably contribute to the structural stability of halophilic ribosomal proteins.

  8. Human ribosomal protein L37 has motifs predicting serine/threonine phosphorylation and a zinc-finger domain.

    Science.gov (United States)

    Barnard, G F; Staniunas, R J; Puder, M; Steele, G D; Chen, L B

    1994-08-02

    Ribosomal protein L37 mRNA is overexpressed in colon cancer. The nucleotide sequences of human L37 from several tumor and normal, colon and liver cDNA sources were determined to be identical. L37 mRNA was approximately 375 nucleotides long encoding 97 amino acids with M(r) = 11,070, pI = 12.6, multiple potential serine/threonine phosphorylation sites and a zinc-finger domain. The human sequence is compared to other species.

  9. Molecular markers of oocyte differentiation in European eel during hormonally induced oogenesis.

    Science.gov (United States)

    Rojo-Bartolomé, Iratxe; Martínez-Miguel, Leticia; Lafont, Anne-Gaëlle; Vílchez, M Carmen; Asturiano, Juan F; Pérez, Luz; Cancio, Ibon

    2017-09-01

    Reproduction in captivity is a key study issue in Anguilla anguilla as a possible solution for its dwindling population. Understanding the mechanisms controlling the production of ribosomal building blocks during artificially induced oocyte maturation could be particularly interesting. Transcription levels of ribosomal biogenesis associated genes could be used as markers to monitor oogenesis. Eels from the Albufera Lagoon were injected with carp pituitary extract for 15weeks and ovaries in previtellogenic (PV) stage (non-injected), in early-, mid-, late-vitellogenesis (EV, MV, LV), as well as in migratory nucleus stage (MN) were analysed. 5S rRNA and related genes were highly transcribed in ovaries with PV oocytes. As oocytes developed, transcriptional levels of genes related to 5S rRNA production (gtf3a), accumulation (gtf3a, 42sp43) and nucleocytoplasmic transport (rpl5, rpl11) and the 5S/18S rRNA index decreased (PV>EV>MV>LV>MN). On the contrary, 18S rRNA was at its highest at MN stage while ubtf1 in charge of activating RNA-polymerase I and synthesising 18S rRNA behaved as 5S related genes. Individuals that did not respond (NR) to the treatment showed 5S/18S index values similar to PV females, while studied genes showed EV/LV-like transcription levels. Therefore, NR females fail to express the largest rRNAs, which could thus be taken as markers of successful vitellogenesis progression. In conclusion, we have proved that the transcriptional dynamics of ribosomal genes provides useful tools to characterize induced ovarian development in European eels. In the future, such markers should be studied as putative indicators of response to hormonal treatments and of the quality of obtained eel oocytes. Copyright © 2017. Published by Elsevier Inc.

  10. NINJA-OPS: Fast Accurate Marker Gene Alignment Using Concatenated Ribosomes.

    Directory of Open Access Journals (Sweden)

    Gabriel A Al-Ghalith

    2016-01-01

    Full Text Available The explosion of bioinformatics technologies in the form of next generation sequencing (NGS has facilitated a massive influx of genomics data in the form of short reads. Short read mapping is therefore a fundamental component of next generation sequencing pipelines which routinely match these short reads against reference genomes for contig assembly. However, such techniques have seldom been applied to microbial marker gene sequencing studies, which have mostly relied on novel heuristic approaches. We propose NINJA Is Not Just Another OTU-Picking Solution (NINJA-OPS, or NINJA for short, a fast and highly accurate novel method enabling reference-based marker gene matching (picking Operational Taxonomic Units, or OTUs. NINJA takes advantage of the Burrows-Wheeler (BW alignment using an artificial reference chromosome composed of concatenated reference sequences, the "concatesome," as the BW input. Other features include automatic support for paired-end reads with arbitrary insert sizes. NINJA is also free and open source and implements several pre-filtering methods that elicit substantial speedup when coupled with existing tools. We applied NINJA to several published microbiome studies, obtaining accuracy similar to or better than previous reference-based OTU-picking methods while achieving an order of magnitude or more speedup and using a fraction of the memory footprint. NINJA is a complete pipeline that takes a FASTA-formatted input file and outputs a QIIME-formatted taxonomy-annotated BIOM file for an entire MiSeq run of human gut microbiome 16S genes in under 10 minutes on a dual-core laptop.

  11. Hypoxic stress-induced changes in ribosomes of maize seedling roots

    International Nuclear Information System (INIS)

    Bailey-Serres, J.; Freeling, M.

    1990-01-01

    The hypoxic stress response of Zea mays L. seedling roots involves regulation of gene expression at transcriptional and posttranscriptional levels. We investigated the effect of hypoxia on the translational machinery of seedling roots. The levels of monoribosomes and ribosomal subunits increased dramatically within 1 hour of stress. Prolonged hypoxia resulted in continued accumulation of nontranslating ribosomes, as well as increased levels of small polyribosomes. The return of seedlings to normal aerobic conditions resulted in recovery of normal polyribosome levels. Comparison of ribosomal proteins from control and hypoxic roots revealed differences in quantity and electrophoretic mobility. In vivo labeling of roots with [ 35 S]methionine revealed variations in newly synthesized ribosomal proteins. In vivo labeling of roots with [ 32 P]orthophosphate revealed a major reduction in the phosphorylation of a 31 kilodalton ribosomal protein in hypoxic stressed roots. In vitro phosphorylation of ribosomal proteins by endogenous kinases was used to probe for differences in ribosome structure and composition. The patterns of in vitro kinased phosphoproteins of ribosomes from control and hypoxic roots were not identical. Variation in phosphoproteins of polyribosomes from control and hypoxic roots, as well as among polyribosomes from hypoxic roots were observed. These results indicate that modification of the translational machinery occurs in response to hypoxic stress

  12. Partial characterization of ribosomal operons of Lactobacillus delbrueckii UFV H2b20 Caracterização parcial de operons ribossomais de Lactobacillus delbrueckii UFV H2b20

    Directory of Open Access Journals (Sweden)

    Juliana Teixeira de Magalhães

    2005-06-01

    Full Text Available Ribosomal operons are great tools for microbe community characterization and for microorganisms relationship study, particularly in the case of the acid lactic bacteria. The ribosomal operon of the probiotic strain Lactobacillus delbrueckii UFV H2b20 was partially characterized. A genomic library of this strain was constructed and the clones with partial ribosomal operon were sub-cloned using the shot-gun method for subsequent sequencing with the forward primer. The sequence analysis revealed that the 3' end of the rDNA 16S was following by the short spacer region 1 (16S-23S and that the 3' end of the rDNA 23S was following by the short spacer region 2 (23S-5S, which preceded the rDNA 5S. In the flanking region of the rDNA 5S gene of this operon rrn, a region encoding six tRNAs was detected.Operons ribossomais têm sido instrumentos importantes na caracterização de comunidades microbianas e no estudo de relacionamentos entre microrganismos, principalmente em bactérias do ácido láctico. Operons ribossomais da linhagem probiótica, Lactobacillus delbrueckii UFV H2b20, foram parcialmente caracterizados. Um banco genômico da linhagem foi construído e os clones, contendo parte do operon ribossomal, foram subclonados pelo método de "shot gun", para em seguida serem seqüenciados com primer "forward". As seqüências indicaram a presença da extremidade 3' do rDNA 16S seguida da região espaçadora curta 1 (16S-23S e a presença da extremidade 3' do rDNA 23S seguido da região espaçadora 2 (23S-5S, que por sua vez precedia o rDNA 5S. Adjacente ao gene rDNA 5S deste operon rrn uma região codificadora de 6 tRNAs foi detectada.

  13. Ribosomes slide on lysine-encoding homopolymeric A stretches

    Science.gov (United States)

    Koutmou, Kristin S; Schuller, Anthony P; Brunelle, Julie L; Radhakrishnan, Aditya; Djuranovic, Sergej; Green, Rachel

    2015-01-01

    Protein output from synonymous codons is thought to be equivalent if appropriate tRNAs are sufficiently abundant. Here we show that mRNAs encoding iterated lysine codons, AAA or AAG, differentially impact protein synthesis: insertion of iterated AAA codons into an ORF diminishes protein expression more than insertion of synonymous AAG codons. Kinetic studies in E. coli reveal that differential protein production results from pausing on consecutive AAA-lysines followed by ribosome sliding on homopolymeric A sequence. Translation in a cell-free expression system demonstrates that diminished output from AAA-codon-containing reporters results from premature translation termination on out of frame stop codons following ribosome sliding. In eukaryotes, these premature termination events target the mRNAs for Nonsense-Mediated-Decay (NMD). The finding that ribosomes slide on homopolymeric A sequences explains bioinformatic analyses indicating that consecutive AAA codons are under-represented in gene-coding sequences. Ribosome ‘sliding’ represents an unexpected type of ribosome movement possible during translation. DOI: http://dx.doi.org/10.7554/eLife.05534.001 PMID:25695637

  14. Molecular Identification and Phylogenetic Relationships of Pleurotus spp. Diversity in Malaysia by ITS Marker

    International Nuclear Information System (INIS)

    Zaiton Abdul Kadir; Azhar Mohamad; Nie, H.J.

    2016-01-01

    Pleurotus species is an edible mushroom in Malaysia which is commonly known as Oyster mushroom and grow by small holder farmers. This species is important for nutraceutical, pharmaceutical and cosmoceutical industries. However, there is some mis identification due to phenotypic variation in which the species shared some similarities due to environmental factors, and thus create troublesome. Thus, eleven isolates of Pleurotus sample which comprise of 4 different species were collected from different locations in Malaysia were used for strain and species identification including mutant line Pleurotus. Pleurotus pulmonarius coded as ATCC 62887 was used as a reference. Total genomic DNA was extracted, quantified and amplified by using rDNA-ITS (Ribosomal DNA Internal Transcribed Spacers) ITS8-F: 5"'AGTCGTAACAAGGTTTCCGTAGGTG3"' and ITS6-R: 5"'TTCCCGCTTCACTCGC-AGT3"'primers. The PCR products were directly sequenced for BLAST evaluation. Phylogenetic (UPGMA) was constructed by using CLC Sequence Viewer 6.8.1. It clearly shown distinct clades of the Pleurotus species and strains. Pleurotus pulmonarius were found to be grouped in one group while Pleurotus florida and Pleurotus columbinus were in the other different clade. For Pleurotus geesteranus, which has the most nucleotide similarity and morphology with Pleurotus pulmonarius, was grouped in its own clade and was single isolated. Thus, ITS marker found to be reliable, rapid, robust and reproducible approach in screening of Pleurotus species and its variants for taxonomical purposes and phylogenetic analysis. (author)

  15. Revealing pancrustacean relationships: Phylogenetic analysis of ribosomal protein genes places Collembola (springtails) in a monophyletic Hexapoda and reinforces the discrepancy between mitochondrial and nuclear DNA markers.

    NARCIS (Netherlands)

    Timmermans, M.J.T.N.; Roelofs, D.; Mariën, A.G.H.; van Straalen, N.M.

    2008-01-01

    Background. In recent years, several new hypotheses on phylogenetic relations among arthropods have been proposed on the basis of DNA sequences. One of the challenged hypotheses is the monophyly of hexapods. This discussion originated from analyses based on mitochondrial DNA datasets that, due to an

  16. Revealing pancrustacean relationships : phylogenetic analysis of ribosomal protein genes places Collembola (springtails) in a monophyletic Hexapoda and reinforces the discrepancy between mitochondrial and nuclear DNA markers

    NARCIS (Netherlands)

    Timmermans, M J T N; Roelofs, D; Mariën, J; van Straalen, N M

    2008-01-01

    BACKGROUND: In recent years, several new hypotheses on phylogenetic relations among arthropods have been proposed on the basis of DNA sequences. One of the challenged hypotheses is the monophyly of hexapods. This discussion originated from analyses based on mitochondrial DNA datasets that, due to an

  17. 8-oxo-7,8-dihydroguanine level - the DNA oxidative stress marker - recognized by fluorescence image analysis in sporadic uterine adenocarcinomas in women.

    Science.gov (United States)

    Postawski, Krzysztof; Przadka-Rabaniuk, Dorota; Piersiak, Tomasz

    2013-01-01

    In the case of carcinogenesis in human endometrium no information exists on tissue concentration of 8-oxo-7,8-dihydroguanine, the DNA oxidative stress marker This was the main reason to undertake the investigation of this DNA modification in human uterine estrogen-dependent tissue cancers. In order to estimate the level of oxidative damage, 8-oxo-7,8-dihydroguanine was determined directly in cells of tissue microscope slides using OxyDNA Assay Kit, Fluorometric. Cells were investigated under confocal microscope. Images of individual cells were captured by computer-interfaced digital photography and analyzed for fluorescence intensities (continuous inverted 8-bit gray-scale = 0 [black]-255 [white]). Fluorescence scores were calculated for each of 13 normal endometrial samples and 31 uterine adenocarcinoma specimens. Finally the level of the oxidative stress marker was also analyzed according to histological and clinical features of the neoplasms. The obtained data revealed that: 8-oxo-7,8-dihydroguanine levels were higher in uterine adenocarcinomas than in normal endometrial samples (48,32 vs. 38,64; p<0,001); in contrast to normal endometrium there was no correlation between age and DNA oxidative modification content in uterine cancer; highest mean fluorescence intensity was recognized in G2 endometrial adenocarcinomas; level of 8-oxo-7,8-dihydroguanine does not depend on Body Mass Index (BMI) and cancer uterine wall infiltration or tumor FIGO stage. Our study indicates that accumulation of the oxidized DNA base may contribute to the development of endometrial neoplasia, however oxidative DNA damage does not seem to increase with tumor progression.

  18. The Unexplored Mechanisms and Regulatory Functions of Ribosomal Translocation

    Science.gov (United States)

    Alejo, Jose Luis

    In every cell, protein synthesis is carried out by the ribosome, a complex macromolecular RNA-protein assembly. Decades of structural and kinetic studies have increased our understanding of ribosome initiation, decoding, translocation and termination. Yet, the underlying mechanism of these fundamental processes has yet to be fully delineated. Hence, the molecular basis of regulation remains obscure. Here, single-molecule fluorescence methods are applied to decipher the mechanism and regulatory roles of the multi-step process of directional substrate translocation on the ribosome that accompanies every round of protein synthesis. In Chapter 1, single-molecule fluorescence resonance energy transfer (smFRET) is introduced as a tool for studying bacterial ribosome translocation. Chapter 2 details the experimental methods. In Chapter 3, the elongation factor G(EF-G)-catalyzed movement of substrates through the ribosome is examined from several perspectives or signals reporting on various degrees of freedom of ribosome dynamics. Two ribosomal states interconvert in the presence of EF-G(GDP), displaying novel head domain motions, until relocking takes place. In Chapter 4, in order to test if the mentioned fluctuations leading to relocking are correlated to the engagement of the P-site by the peptidyl-tRNA, the translocation of miscoded tRNAs is studied. Severe defects in the relocking stages of translocation reveal the correlation between this new stage of translocation and P-site tRNA engagement.

  19. Generation and application of SSR markers in avocado

    International Nuclear Information System (INIS)

    Sharon, D.; Lavi, U.; Cregan, P.B.; Hillel, J.

    1998-01-01

    Simple Sequence Repeat (SSR) DNA markers were generated and applied to avocado. An SSR marker is based on a pair of primers which are synthesized on the basis of DNA sequences flanking a micro satellite. These markers are PCR based, quite polymorphic and abundant in several species. These are the markers, of choice in the human genome. The number of SSR markers in the avocado genome was calculated to be about 45,000, with the A/T micro satellite being the most frequent (1 in 40 kb). SSR markers are quite expensive to generate due to the required multi-step procedure; Screening a genomic library, about 66% of the positive clones turned out after sequencing to be SSR containing clones. In only about 55% of these, was it possible to synthesize primers and, of this group, only about 50% of the markers were useful for typing a specific family. Typing of five avocado cultivars using 59 SSR markers results in one to eight alleles per locus, mean heterozygosity ranging between 0.51 and 0.66 and gene diversity ranging between 0.42 and 0.66. The SSR markers were used to estimate the genetic relationships between various Persea species. The number of alleles in these species ranged between five and twelve with heterozygosity levels between 0.11-0.78 and gene diversity between 0.69-0.89. A preliminary genetic map, based on these SSR markers together with some DNA fingerprints (DFP) and randomly amplified polymorphic DNA (RAPD) markers, was drawn. The map consists of 12 linkage group having two to five markers each. Linkage analysis with several quantitative trait loci (QTLs) was performed by genetic typing and phenotypic assessment of the progeny of a controlled cross. The results of the interval mapping suggest that the gene(s) coding for the existence of fibers in the flesh, are probably linked to linkage group 3. (author)

  20. Generation and application of SSR markers in avocado

    Energy Technology Data Exchange (ETDEWEB)

    Sharon, D; Lavi, U [Institute of Horticulture, ARO Volcani Center, Bet-Dagan (Israel); Cregan, P B [United States Department of Agriculture, Agricultural Research Service, Beltsville, Maryland (United States); Hillel, J [Faculty of Agriculture, Hebrew University of Jerusalem, Rehovot (Israel)

    1998-10-01

    Simple Sequence Repeat (SSR) DNA markers were generated and applied to avocado. An SSR marker is based on a pair of primers which are synthesized on the basis of DNA sequences flanking a micro satellite. These markers are PCR based, quite polymorphic and abundant in several species. These are the markers, of choice in the human genome. The number of SSR markers in the avocado genome was calculated to be about 45,000, with the A/T micro satellite being the most frequent (1 in 40 kb). SSR markers are quite expensive to generate due to the required multi-step procedure; Screening a genomic library, about 66% of the positive clones turned out after sequencing to be SSR containing clones. In only about 55% of these, was it possible to synthesize primers and, of this group, only about 50% of the markers were useful for typing a specific family. Typing of five avocado cultivars using 59 SSR markers results in one to eight alleles per locus, mean heterozygosity ranging between 0.51 and 0.66 and gene diversity ranging between 0.42 and 0.66. The SSR markers were used to estimate the genetic relationships between various Persea species. The number of alleles in these species ranged between five and twelve with heterozygosity levels between 0.11-0.78 and gene diversity between 0.69-0.89. A preliminary genetic map, based on these SSR markers together with some DNA fingerprints (DFP) and randomly amplified polymorphic DNA (RAPD) markers, was drawn. The map consists of 12 linkage group having two to five markers each. Linkage analysis with several quantitative trait loci (QTLs) was performed by genetic typing and phenotypic assessment of the progeny of a controlled cross. The results of the interval mapping suggest that the gene(s) coding for the existence of fibers in the flesh, are probably linked to linkage group 3. (author) 20 refs, 3 figs, 8 tabs

  1. MtDNA COI-COII marker and drone congregation area: an efficient method to establish and monitor honeybee (Apis mellifera L.) conservation centres.

    Science.gov (United States)

    Bertrand, Bénédicte; Alburaki, Mohamed; Legout, Hélène; Moulin, Sibyle; Mougel, Florence; Garnery, Lionel

    2015-05-01

    Honeybee subspecies have been affected by human activities in Europe over the past few decades. One such example is the importation of nonlocal subspecies of bees which has had an adverse impact on the geographical repartition and subsequently on the genetic diversity of the black honeybee Apis mellifera mellifera. To restore the original diversity of this local honeybee subspecies, different conservation centres were set up in Europe. In this study, we established a black honeybee conservation centre Conservatoire de l'Abeille Noire d'Ile de France (CANIF) in the region of Ile-de-France, France. CANIF's honeybee colonies were intensively studied over a 3-year period. This study included a drone congregation area (DCA) located in the conservation centre. MtDNA COI-COII marker was used to evaluate the genetic diversity of CANIF's honeybee populations and the drones found and collected from the DCA. The same marker (mtDNA) was used to estimate the interactions and the haplotype frequency between CANIF's honeybee populations and 10 surrounding honeybee apiaries located outside of the CANIF. Our results indicate that the colonies of the conservation centre and the drones of the DCA show similar stable profiles compared to the surrounding populations with lower level of introgression. The mtDNA marker used on both DCA and colonies of the conservation centre seems to be an efficient approach to monitor and maintain the genetic diversity of the protected honeybee populations. © 2014 John Wiley & Sons Ltd.

  2. Y-chromosomal DNA markers for discrimination of chemical substance and effluent effects on sexual differentiation in salmon.

    OpenAIRE

    Afonso, Luis O B; Smith, Jack L; Ikonomou, Michael G; Devlin, Robert H

    2002-01-01

    Chinook salmon alevins were exposed during their labile period for sex differentiation to different concentrations of bleached kraft mill effluent (BKME), primary sewage effluent, secondary sewage effluent (SE), 17ss-estradiol, testosterone, and nonylphenol. After exposure for 29 days post hatching (DPH), fish were allowed to grow until 103 and 179 DPH, at which time their genetic sex was determined using Y-chromosomal DNA markers and their gonadal sex was determined by histology. Independent...

  3. Epigenetic silencing of nucleolar rRNA genes in Alzheimer's disease.

    Directory of Open Access Journals (Sweden)

    Maciej Pietrzak

    Full Text Available Ribosomal deficits are documented in mild cognitive impairment (MCI, which often represents an early stage Alzheimer's disease (AD, as well as in advanced AD. The nucleolar rRNA genes (rDNA, transcription of which is critical for ribosomal biogenesis, are regulated by epigenetic silencing including promoter CpG methylation.To assess whether CpG methylation of the rDNA promoter was dysregulated across the AD spectrum, we analyzed brain samples from 10 MCI-, 23 AD-, and, 24 age-matched control individuals using bisulfite mapping. The rDNA promoter became hypermethylated in cerebro-cortical samples from MCI and AD groups. In parietal cortex, the rDNA promoter was hypermethylated more in MCI than in advanced AD. The cytosine methylation of total genomic DNA was similar in AD, MCI, and control samples. Consistent with a notion that hypermethylation-mediated silencing of the nucleolar chromatin stabilizes rDNA loci, preventing their senescence-associated loss, genomic rDNA content was elevated in cerebrocortical samples from MCI and AD groups.In conclusion, rDNA hypermethylation could be a new epigenetic marker of AD. Moreover, silencing of nucleolar chromatin may occur during early stages of AD pathology and play a role in AD-related ribosomal deficits and, ultimately, dementia.

  4. A Nuclear Ribosomal DNA Phylogeny of Acer Inferred with Maximum Likelihood, Splits Graphs, and Motif Analysis of 606 Sequences

    Directory of Open Access Journals (Sweden)

    Guido W. Grimm

    2006-01-01

    Full Text Available The multi-copy internal transcribed spacer (ITS region of nuclear ribosomal DNA is widely used to infer phylogenetic relationships among closely related taxa. Here we use maximum likelihood (ML and splits graph analyses to extract phylogenetic information from ~ 600 mostly cloned ITS sequences, representing 81 species and subspecies of Acer, and both species of its sister Dipteronia. Additional analyses compared sequence motifs in Acer and several hundred Anacardiaceae, Burseraceae, Meliaceae, Rutaceae, and Sapindaceae ITS sequences in GenBank. We also assessed the effects of using smaller data sets of consensus sequences with ambiguity coding (accounting for within-species variation instead of the full (partly redundant original sequences. Neighbor-nets and bipartition networks were used to visualize conflict among character state patterns. Species clusters observed in the trees and networks largely agree with morphology-based classifications; of de Jong’s (1994 16 sections, nine are supported in neighbor-net and bipartition networks, and ten by sequence motifs and the ML tree; of his 19 series, 14 are supported in networks, motifs, and the ML tree. Most nodes had higher bootstrap support with matrices of 105 or 40 consensus sequences than with the original matrix. Within-taxon ITS divergence did not differ between diploid and polyploid Acer, and there was little evidence of differentiated parental ITS haplotypes, suggesting that concerted evolution in Acer acts rapidly.

  5. A Nuclear Ribosomal DNA Phylogeny of Acer Inferred with Maximum Likelihood, Splits Graphs, and Motif Analysis of 606 Sequences

    Science.gov (United States)

    Grimm, Guido W.; Renner, Susanne S.; Stamatakis, Alexandros; Hemleben, Vera

    2007-01-01

    The multi-copy internal transcribed spacer (ITS) region of nuclear ribosomal DNA is widely used to infer phylogenetic relationships among closely related taxa. Here we use maximum likelihood (ML) and splits graph analyses to extract phylogenetic information from ~ 600 mostly cloned ITS sequences, representing 81 species and subspecies of Acer, and both species of its sister Dipteronia. Additional analyses compared sequence motifs in Acer and several hundred Anacardiaceae, Burseraceae, Meliaceae, Rutaceae, and Sapindaceae ITS sequences in GenBank. We also assessed the effects of using smaller data sets of consensus sequences with ambiguity coding (accounting for within-species variation) instead of the full (partly redundant) original sequences. Neighbor-nets and bipartition networks were used to visualize conflict among character state patterns. Species clusters observed in the trees and networks largely agree with morphology-based classifications; of de Jong’s (1994) 16 sections, nine are supported in neighbor-net and bipartition networks, and ten by sequence motifs and the ML tree; of his 19 series, 14 are supported in networks, motifs, and the ML tree. Most nodes had higher bootstrap support with matrices of 105 or 40 consensus sequences than with the original matrix. Within-taxon ITS divergence did not differ between diploid and polyploid Acer, and there was little evidence of differentiated parental ITS haplotypes, suggesting that concerted evolution in Acer acts rapidly. PMID:19455198

  6. Replicative age induces mitotic recombination in the ribosomal RNA gene cluster of Saccharomyces cerevisiae.

    Directory of Open Access Journals (Sweden)

    Derek L Lindstrom

    2011-03-01

    Full Text Available Somatic mutations contribute to the development of age-associated disease. In earlier work, we found that, at high frequency, aging Saccharomyces cerevisiae diploid cells produce daughters without mitochondrial DNA, leading to loss of respiration competence and increased loss of heterozygosity (LOH in the nuclear genome. Here we used the recently developed Mother Enrichment Program to ask whether aging cells that maintain the ability to produce respiration-competent daughters also experience increased genomic instability. We discovered that this population exhibits a distinct genomic instability phenotype that primarily affects the repeated ribosomal RNA gene array (rDNA array. As diploid cells passed their median replicative life span, recombination rates between rDNA arrays on homologous chromosomes progressively increased, resulting in mutational events that generated LOH at >300 contiguous open reading frames on the right arm of chromosome XII. We show that, while these recombination events were dependent on the replication fork block protein Fob1, the aging process that underlies this phenotype is Fob1-independent. Furthermore, we provide evidence that this aging process is not driven by mechanisms that modulate rDNA recombination in young cells, including loss of cohesion within the rDNA array or loss of Sir2 function. Instead, we suggest that the age-associated increase in rDNA recombination is a response to increasing DNA replication stress generated in aging cells.

  7. Unstable structure of ribosomal particles synthesized in. gamma. -irradiated Escherichia coli

    Energy Technology Data Exchange (ETDEWEB)

    Fujita, H; Morita, K [National Inst. of Radiological Sciences, Chiba (Japan)

    1975-06-01

    Stability of Escherichia coli ribosomes newly synthesized after ..gamma..-irradiation was compared with that of normal ribosomes. The ribosomal particles around 70-S synthesized in irradiated cells were more sensitive to digestion by pancreatic ribonuclease A. A larger number of the salt-unstable '50-S' precursor particles existed in the extract from irradiated cells than in the extract from unirradiated cells. These facts suggest that ribosomal particles, synthesized during an earlier stage in irradiated cells, maintain an incomplete structure even though they are not distinguishable from normal ribosomes by means of sucrose density-gradient centrifugation.

  8. Label-Free Quantitation of Ribosomal Proteins from Bacillus subtilis for Antibiotic Research.

    Science.gov (United States)

    Schäkermann, Sina; Prochnow, Pascal; Bandow, Julia E

    2017-01-01

    Current research is focusing on ribosome heterogeneity as a response to changing environmental conditions and stresses, such as antibiotic stress. Altered stoichiometry and composition of ribosomal proteins as well as association of additional protein factors are mechanisms for shaping the protein expression profile or hibernating ribosomes. Here, we present a method for the isolation of ribosomes to analyze antibiotic-induced changes in the composition of ribosomes in Bacillus subtilis or other bacteria. Ribosomes and associated proteins are isolated by ultracentrifugation and proteins are identified and quantified using label-free mass spectrometry.

  9. A comparative study of ribosomal proteins: linkage between amino acid distribution and ribosomal assembly

    International Nuclear Information System (INIS)

    Lott, Brittany Burton; Wang, Yongmei; Nakazato, Takuya

    2013-01-01

    Assembly of the ribosome from its protein and RNA constituents must occur quickly and efficiently in order to synthesize the proteins necessary for all cellular activity. Since the early 1960’s, certain characteristics of possible assembly pathways have been elucidated, yet the mechanisms that govern the precise recognition events remain unclear. We utilize a comparative analysis to investigate the amino acid composition of ribosomal proteins (r-proteins) with respect to their role in the assembly process. We compared small subunit (30S) r-protein sequences to those of other housekeeping proteins from 560 bacterial species and searched for correlations between r-protein amino acid content and factors such as assembly binding order, environmental growth temperature, protein size, and contact with ribosomal RNA (rRNA) in the 30S complex. We find r-proteins have a significantly high percent of positive residues, which are highly represented at rRNA contact sites. An inverse correlation between the percent of positive residues and r-protein size was identified and is mainly due to the content of Lysine residues, rather than Arginine. Nearly all r-proteins carry a net positive charge, but no statistical correlation between the net charge and the binding order was detected. Thermophilic (high-temperature) r-proteins contain increased Arginine, Isoleucine, and Tyrosine, and decreased Serine and Threonine compared to mesophilic (lower-temperature), reflecting a known distinction between thermophiles and mesophiles, possibly to account for protein thermostability. However, this difference in amino acid content does not extend to rRNA contact sites, as the proportions of thermophilic and mesophilic contact residues are not significantly different. Given the significantly higher level of positively charged residues in r-proteins and at contact sites, we conclude that ribosome assembly relies heavily on an electrostatic component of interaction. However, the binding order of

  10. Architecture of the large subunit of the mammalian mitochondrial ribosome.

    Science.gov (United States)

    Greber, Basil J; Boehringer, Daniel; Leitner, Alexander; Bieri, Philipp; Voigts-Hoffmann, Felix; Erzberger, Jan P; Leibundgut, Marc; Aebersold, Ruedi; Ban, Nenad

    2014-01-23

    Mitochondrial ribosomes synthesize a number of highly hydrophobic proteins encoded on the genome of mitochondria, the organelles in eukaryotic cells that are responsible for energy conversion by oxidative phosphorylation. The ribosomes in mammalian mitochondria have undergone massive structural changes throughout their evolution, including ribosomal RNA shortening and acquisition of mitochondria-specific ribosomal proteins. Here we present the three-dimensional structure of the 39S large subunit of the porcine mitochondrial ribosome determined by cryo-electron microscopy at 4.9 Å resolution. The structure, combined with data from chemical crosslinking and mass spectrometry experiments, reveals the unique features of the 39S subunit at near-atomic resolution and provides detailed insight into the architecture of the polypeptide exit site. This region of the mitochondrial ribosome has been considerably remodelled compared to its bacterial counterpart, providing a specialized platform for the synthesis and membrane insertion of the highly hydrophobic protein components of the respiratory chain.

  11. Fine resolution mapping of double-strand break sites for human ribosomal DNA units

    Directory of Open Access Journals (Sweden)

    Bernard J. Pope

    2016-12-01

    Full Text Available DNA breakage arises during a variety of biological processes, including transcription, replication and genome rearrangements. In the context of disease, extensive fragmentation of DNA has been described in cancer cells and during early stages of neurodegeneration (Stephens et al., 2011 Stephens et al. (2011 [5]; Blondet et al., 2001 Blondet et al. (2001 [1]. Stults et al. (2009 Stults et al. (2009 [6] reported that human rDNA gene clusters are hotspots for recombination and that rDNA restructuring is among the most common chromosomal alterations in adult solid tumours. As such, analysis of rDNA regions is likely to have significant prognostic and predictive value, clinically. Tchurikov et al. (2015a, 2016 Tchurikov et al. (2015a, 2016 [7,9] have made major advances in this direction, reporting that sites of human genome double-strand breaks (DSBs occur frequently at sites in rDNA that are tightly linked with active transcription - the authors used a RAFT (rapid amplification of forum termini protocol that selects for blunt-ended sites. They reported the relative frequency of these rDNA DSBs within defined co-ordinate ‘windows’ of varying size and made these data (as well as the relevant ‘raw’ sequencing information available to the public (Tchurikov et al., 2015b. Assay designs targeting rDNA DSB hotspots will benefit greatly from the publication of break sites at greater resolution. Here, we re-analyse public RAFT data and make available rDNA DSB co-ordinates to the single-nucleotide level.

  12. Hierarchical recruitment of ribosomal proteins and assembly factors remodels nucleolar pre-60S ribosomes.

    Science.gov (United States)

    Biedka, Stephanie; Micic, Jelena; Wilson, Daniel; Brown, Hailey; Diorio-Toth, Luke; Woolford, John L

    2018-04-24

    Ribosome biogenesis involves numerous preribosomal RNA (pre-rRNA) processing events to remove internal and external transcribed spacer sequences, ultimately yielding three mature rRNAs. Removal of the internal transcribed spacer 2 spacer RNA is the final step in large subunit pre-rRNA processing and begins with endonucleolytic cleavage at the C 2 site of 27SB pre-rRNA. C 2 cleavage requires the hierarchical recruitment of 11 ribosomal proteins and 14 ribosome assembly factors. However, the function of these proteins in C 2 cleavage remained unclear. In this study, we have performed a detailed analysis of the effects of depleting proteins required for C 2 cleavage and interpreted these results using cryo-electron microscopy structures of assembling 60S subunits. This work revealed that these proteins are required for remodeling of several neighborhoods, including two major functional centers of the 60S subunit, suggesting that these remodeling events form a checkpoint leading to C 2 cleavage. Interestingly, when C 2 cleavage is directly blocked by depleting or inactivating the C 2 endonuclease, assembly progresses through all other subsequent steps. © 2018 Biedka et al.

  13. Phylogenetic relationships and generic delimitation in Inuleae subtribe Inulinae (Asteraceae) based on ITS and cpDNA sequence data

    DEFF Research Database (Denmark)

    Englund, Marcus; Pornpongrungrueng, Pimwadee; Gustafsson, Mats

    2009-01-01

    Phylogenetic relationships in Inuleae subtribe Inulinae (Asteraceae) were investigated. DNA sequence data from three chloroplast regions (ndhF, trnL-F and psbA-trnH) and the nuclear ribosomal internal transcribed spacer (ITS) region were analysed separately and in combination using parsimony...... and Bayesian inference. A total of 163 ingroup taxa were included, of which 60 were sampled for all four markers. Conflicts between chloroplast and nuclear data were assessed using partitioned Bremer support (PBS). Rather than averaging PBS over several trees from constrained searches, individual trees were...... considered by evaluating PBS ranges. Criteria to be used in the detection of a significant conflict between data partitions are proposed. Three nodes in the total data tree were found to encompass significant conflict that could result from ancient hybridization. Neither of the large, heterogeneous...

  14. gamma. radiation effect on the functional properties of the cotton ribosomes

    Energy Technology Data Exchange (ETDEWEB)

    Ibragimov, A P; Safarov, Sh

    1973-01-01

    A study is made of the action of radiation on the functional properties of ribosomes in irradiated organisms and on isolated ribosomes exposed to different doses. With increase in dose there occurs a reduction in the incorporation of labelled amino acids by the ribosomes released from irradiated sprouts and also during irradiation of isolated ribosomes. The study covered the functional activity of ribosomes irradiated at different doses with the use of synthetic poly-U and poly-A matrices synthesizing polyphenylalanine and polylysine, depending on the irradiation dose. The inhibition of the activity of the protein synthesis system at high doses is due to structural and functional changes in ribosomes and also to disturbance in the biosynthesis and functions of the messenger RNA.

  15. Repeated reunions and splits feature the highly dynamic evolution of 5S and 35S ribosomal RNA genes (rDNA) in the Asteraceae family.

    Science.gov (United States)

    Garcia, Sònia; Panero, José L; Siroky, Jiri; Kovarik, Ales

    2010-08-16

    In flowering plants and animals the most common ribosomal RNA genes (rDNA) organisation is that in which 35S (encoding 18S-5.8S-26S rRNA) and 5S genes are physically separated occupying different chromosomal loci. However, recent observations established that both genes have been unified to a single 35S-5S unit in the genus Artemisia (Asteraceae), a genomic arrangement typical of primitive eukaryotes such as yeast, among others. Here we aim to reveal the origin, distribution and mechanisms leading to the linked organisation of rDNA in the Asteraceae by analysing unit structure (PCR, Southern blot, sequencing), gene copy number (quantitative PCR) and chromosomal position (FISH) of 5S and 35S rRNA genes in approximately 200 species representing the family diversity and other closely related groups. Dominant linked rDNA genotype was found within three large groups in subfamily Asteroideae: tribe Anthemideae (93% of the studied cases), tribe Gnaphalieae (100%) and in the "Heliantheae alliance" (23%). The remaining five tribes of the Asteroideae displayed canonical non linked arrangement of rDNA, as did the other groups in the Asteraceae. Nevertheless, low copy linked genes were identified among several species that amplified unlinked units. The conserved position of functional 5S insertions downstream from the 26S gene suggests a unique, perhaps retrotransposon-mediated integration event at the base of subfamily Asteroideae. Further evolution likely involved divergence of 26S-5S intergenic spacers, amplification and homogenisation of units across the chromosomes and concomitant elimination of unlinked arrays. However, the opposite trend, from linked towards unlinked arrangement was also surmised in few species indicating possible reversibility of these processes. Our results indicate that nearly 25% of Asteraceae species may have evolved unusual linked arrangement of rRNA genes. Thus, in plants, fundamental changes in intrinsic structure of rDNA units, their copy

  16. Modeling the Sensitivity of Field Surveys for Detection of Environmental DNA (eDNA.

    Directory of Open Access Journals (Sweden)

    Martin T Schultz

    Full Text Available The environmental DNA (eDNA method is the practice of collecting environmental samples and analyzing them for the presence of a genetic marker specific to a target species. Little is known about the sensitivity of the eDNA method. Sensitivity is the probability that the target marker will be detected if it is present in the water body. Methods and tools are needed to assess the sensitivity of sampling protocols, design eDNA surveys, and interpret survey results. In this study, the sensitivity of the eDNA method is modeled as a function of ambient target marker concentration. The model accounts for five steps of sample collection and analysis, including: 1 collection of a filtered water sample from the source; 2 extraction of DNA from the filter and isolation in a purified elution; 3 removal of aliquots from the elution for use in the polymerase chain reaction (PCR assay; 4 PCR; and 5 genetic sequencing. The model is applicable to any target species. For demonstration purposes, the model is parameterized for bighead carp (Hypophthalmichthys nobilis and silver carp (H. molitrix assuming sampling protocols used in the Chicago Area Waterway System (CAWS. Simulation results show that eDNA surveys have a high false negative rate at low concentrations of the genetic marker. This is attributed to processing of water samples and division of the extraction elution in preparation for the PCR assay. Increases in field survey sensitivity can be achieved by increasing sample volume, sample number, and PCR replicates. Increasing sample volume yields the greatest increase in sensitivity. It is recommended that investigators estimate and communicate the sensitivity of eDNA surveys to help facilitate interpretation of eDNA survey results. In the absence of such information, it is difficult to evaluate the results of surveys in which no water samples test positive for the target marker. It is also recommended that invasive species managers articulate concentration

  17. Interaction of tRNA with Eukaryotic Ribosome

    Directory of Open Access Journals (Sweden)

    Dmitri Graifer

    2015-03-01

    Full Text Available This paper is a review of currently available data concerning interactions of tRNAs with the eukaryotic ribosome at various stages of translation. These data include the results obtained by means of cryo-electron microscopy and X-ray crystallography applied to various model ribosomal complexes, site-directed cross-linking with the use of tRNA derivatives bearing chemically or photochemically reactive groups in the CCA-terminal fragment and chemical probing of 28S rRNA in the region of the peptidyl transferase center. Similarities and differences in the interactions of tRNAs with prokaryotic and eukaryotic ribosomes are discussed with concomitant consideration of the extent of resemblance between molecular mechanisms of translation in eukaryotes and bacteria.

  18. Real-time PCR quantification of arbuscular mycorrhizal fungi: does the use of nuclear or mitochondrial markers make a difference?

    Czech Academy of Sciences Publication Activity Database

    Voříšková, A.; Jansa, J.; Püschel, D.; Krüger, Manuela; Cajthaml, T.; Vosátka, M.; Janoušková, M.

    2017-01-01

    Roč. 27, č. 6 (2017), s. 577-585 ISSN 0940-6360 Institutional support: RVO:61389030 Keywords : Arbuscular mycorrhizal fungi * Isolate discrimination * Microsymbiont screening * Mitochondrial DNA * Molecular genetic quantification * Nuclear ribosomal DNA * plfa * Real-time PCR Subject RIV: EA - Cell Biology OBOR OECD: Cell biology Impact factor: 3.047, year: 2016

  19. Who's there? - First morphological and DNA barcoding catalogue of the shallow Hawai'ian sponge fauna.

    Science.gov (United States)

    Núñez Pons, Laura; Calcinai, Barbara; Gates, Ruth D

    2017-01-01

    The sponge fauna has been largely overlooked in the Archipelago of Hawai'i, notwithstanding the paramount role of this taxon in marine ecosystems. The lack of knowledge about Porifera populations inhabiting the Hawai'ian reefs limits the development of ecological studies aimed at understanding the functioning of these marine systems. Consequently, this project addresses this gap by describing the most representative sponge species in the shallow waters of the enigmatic bay of Kane'ohe Bay, in O'ahu Island. A total of 30 species (28 demosponges and two calcareous sponges) living associated to the reef structures are here reported. Six of these species are new records to the Hawai'ian Porifera catalogue and are suspected to be recent introductions to these islands. Morphological descriptions of the voucher specimens are provided, along with sequencing data of two partitions involving the mitochondrial cytochrome oxidase subunit 1 (COI) marker and a fragment covering partial (18S and 28S) and full (ITS-1, 5.8S and ITS-2) nuclear ribosomal genes. Species delimitations based on genetic distances were calculated to valitate how taxonomic assignments from DNA barcoding aligned with morphological identifications. Of the 60 sequences submitted to GenBank ~88% are the first sequencing records for the corresponding species and genetic marker. This work compiles the first catalogue combining morphological characters with DNA barcoding of Hawai'ian sponges, and contributes to the repository of public databases through the Sponge Barcoding Project initiative.

  20. Who's there? - First morphological and DNA barcoding catalogue of the shallow Hawai'ian sponge fauna.

    Directory of Open Access Journals (Sweden)

    Laura Núñez Pons

    Full Text Available The sponge fauna has been largely overlooked in the Archipelago of Hawai'i, notwithstanding the paramount role of this taxon in marine ecosystems. The lack of knowledge about Porifera populations inhabiting the Hawai'ian reefs limits the development of ecological studies aimed at understanding the functioning of these marine systems. Consequently, this project addresses this gap by describing the most representative sponge species in the shallow waters of the enigmatic bay of Kane'ohe Bay, in O'ahu Island. A total of 30 species (28 demosponges and two calcareous sponges living associated to the reef structures are here reported. Six of these species are new records to the Hawai'ian Porifera catalogue and are suspected to be recent introductions to these islands. Morphological descriptions of the voucher specimens are provided, along with sequencing data of two partitions involving the mitochondrial cytochrome oxidase subunit 1 (COI marker and a fragment covering partial (18S and 28S and full (ITS-1, 5.8S and ITS-2 nuclear ribosomal genes. Species delimitations based on genetic distances were calculated to valitate how taxonomic assignments from DNA barcoding aligned with morphological identifications. Of the 60 sequences submitted to GenBank ~88% are the first sequencing records for the corresponding species and genetic marker. This work compiles the first catalogue combining morphological characters with DNA barcoding of Hawai'ian sponges, and contributes to the repository of public databases through the Sponge Barcoding Project initiative.

  1. cDNA, genomic sequence cloning and overexpression of ribosomal ...

    African Journals Online (AJOL)

    PRECIOUS

    2009-11-02

    Nov 2, 2009 ... basic machinery of protein synthesis and regulation, but also in various ... The genomic DNA was isolated from Giant Panda muscle tissue according to the ... for 45 s, 72°C for 2 min in the first cycle and the anneal temperature deceased 0.2°C ..... edition, Cold Spring Harbor aboratory Press. Cold Spring ...

  2. Macrolide antibiotic interaction and resistance on the bacterial ribosome.

    Science.gov (United States)

    Poehlsgaard, Jacob; Douthwaite, Stephen

    2003-02-01

    Our understanding of the fine structure of many antibiotic target sites has reached a new level of enlightenment in the last couple of years due to the advent, by X-ray crystallography, of high-resolution structures of the bacterial ribosome. Many classes of clinically useful antibiotics bind to the ribosome to inhibit bacterial protein synthesis. Macrolide, lincosamide and streptogramin B (MLSB) antibiotics form one of the largest groups, and bind to the same site on the 50S ribosomal subunit. Here, we review the molecular details of the ribosomal MLSB site to put into perspective the main points from a wealth of biochemical and genetic data that have been collected over several decades. The information is now available to understand, at atomic resolution, how macrolide antibiotics interact with their ribosomal target, how the target is altered to confer resistance, and in which directions we need to look if we are to rationally design better drugs to overcome the extant resistance mechanisms.

  3. Cis-regulatory RNA elements that regulate specialized ribosome activity.

    Science.gov (United States)

    Xue, Shifeng; Barna, Maria

    2015-01-01

    Recent evidence has shown that the ribosome itself can play a highly regulatory role in the specialized translation of specific subpools of mRNAs, in particular at the level of ribosomal proteins (RP). However, the mechanism(s) by which this selection takes place has remained poorly understood. In our recent study, we discovered a combination of unique RNA elements in the 5'UTRs of mRNAs that allows for such control by the ribosome. These mRNAs contain a Translation Inhibitory Element (TIE) that inhibits general cap-dependent translation, and an Internal Ribosome Entry Site (IRES) that relies on a specific RP for activation. The unique combination of an inhibitor of general translation and an activator of specialized translation is key to ribosome-mediated control of gene expression. Here we discuss how these RNA regulatory elements provide a new level of control to protein expression and their implications for gene expression, organismal development and evolution.

  4. High and uneven levels of 45S rDNA site-number variation across wild populations of a diploid plant genus (Anacyclus, Asteraceae).

    Science.gov (United States)

    Rosato, Marcela; Álvarez, Inés; Nieto Feliner, Gonzalo; Rosselló, Josep A

    2017-01-01

    The nuclear genome harbours hundreds to several thousand copies of ribosomal DNA. Despite their essential role in cellular ribogenesis few studies have addressed intrapopulation, interpopulation and interspecific levels of rDNA variability in wild plants. Some studies have assessed the extent of rDNA variation at the sequence and copy-number level with large sampling in several species. However, comparable studies on rDNA site number variation in plants, assessed with extensive hierarchical sampling at several levels (individuals, populations, species) are lacking. In exploring the possible causes for ribosomal loci dynamism, we have used the diploid genus Anacyclus (Asteraceae) as a suitable system to examine the evolution of ribosomal loci. To this end, the number and chromosomal position of 45S rDNA sites have been determined in 196 individuals from 47 populations in all Anacyclus species using FISH. The 45S rDNA site-number has been assessed in a significant sample of seed plants, which usually exhibit rather consistent features, except for polyploid plants. In contrast, the level of rDNA site-number variation detected in Anacyclus is outstanding in the context of angiosperms particularly regarding populations of the same species. The number of 45S rDNA sites ranged from four to 11, accounting for 14 karyological ribosomal phenotypes. Our results are not even across species and geographical areas, and show that there is no clear association between the number of 45S rDNA loci and the life cycle in Anacyclus. A single rDNA phenotype was detected in several species, but a more complex pattern that included intra-specific and intra-population polymorphisms was recorded in A. homogamos, A. clavatus and A. valentinus, three weedy species showing large and overlapping distribution ranges. It is likely that part of the cytogenetic changes and inferred dynamism found in these species have been triggered by genomic rearrangements resulting from contemporary

  5. Yeast ribosomal proteins

    International Nuclear Information System (INIS)

    Otaka, E.; Kobata, K.

    1978-01-01

    The cytoplasmic 80s ribosomal proteins from the cells of yeast Saccharomyces cerevisiae were analyzed by SDS two-dimensional polyacrylamide gel electrophoresis. Seventyfour proteins were identified and consecutively numbered from 1 to 74. Upon oxidation of the 80s proteins with performic acid, ten proteins (no. 15, 20, 35, 40, 44, 46, 49, 51, 54 and 55) were dislocated on the gel without change of the total number of protein spots. Five proteins (no. 8, 14, 16, 36 and 74) were phosphorylated in vivo as seen in 32 P-labelling experiments. The large and small subunits separated in low magnesium medium were analyzed by the above gel electrophoresis. At least forty-five and twenty-eight proteins were assumed to be in the large and small subunits, respectively. All proteins found in the 80s ribosomes, except for no. 3, were detected in either subunit without appearance of new spots. The acidic protein no. 3 seems to be lost during subunit dissociation. (orig.) [de

  6. DNA fingerprinting sets for four southern pines

    Science.gov (United States)

    Craig Echt; Sedley Josserand

    2018-01-01

    DNA markers can provide valuable genetic information for forest tree research, breeding, conservation, and restoration programs. When properly evaluated, selected sets of DNA markers can be used to efficiently get information about genetic diversity in regions, forests, or stands, or in seed lots and orchards. Selected markers also can be used to determine parentage or...

  7. cDNA, genomic sequence cloning and overexpression of ribosomal protein S25 gene (RPS25) from the Giant Panda.

    Science.gov (United States)

    Hao, Yan-Zhe; Hou, Wan-Ru; Hou, Yi-Ling; Du, Yu-Jie; Zhang, Tian; Peng, Zheng-Song

    2009-11-01

    RPS25 is a component of the 40S small ribosomal subunit encoded by RPS25 gene, which is specific to eukaryotes. Studies in reference to RPS25 gene from animals were handful. The Giant Panda (Ailuropoda melanoleuca), known as a "living fossil", are increasingly concerned by the world community. Studies on RPS25 of the Giant Panda could provide scientific data for inquiring into the hereditary traits of the gene and formulating the protective strategy for the Giant Panda. The cDNA of the RPS25 cloned from Giant Panda is 436 bp in size, containing an open reading frame of 378 bp encoding 125 amino acids. The length of the genomic sequence is 1,992 bp, which was found to possess four exons and three introns. Alignment analysis indicated that the nucleotide sequence of the coding sequence shows a high homology to those of Homo sapiens, Bos taurus, Mus musculus and Rattus norvegicus as determined by Blast analysis, 92.6, 94.4, 89.2 and 91.5%, respectively. Primary structure analysis revealed that the molecular weight of the putative RPS25 protein is 13.7421 kDa with a theoretical pI 10.12. Topology prediction showed there is one N-glycosylation site, one cAMP and cGMP-dependent protein kinase phosphorylation site, two Protein kinase C phosphorylation sites and one Tyrosine kinase phosphorylation site in the RPS25 protein of the Giant Panda. The RPS25 gene was overexpressed in E. coli BL21 and Western Blotting of the RPS25 protein was also done. The results indicated that the RPS25 gene can be really expressed in E. coli and the RPS25 protein fusioned with the N-terminally his-tagged form gave rise to the accumulation of an expected 17.4 kDa polypeptide. The cDNA and the genomic sequence of RPS25 were cloned successfully for the first time from the Giant Panda using RT-PCR technology and Touchdown-PCR, respectively, which were both sequenced and analyzed preliminarily; then the cDNA of the RPS25 gene was overexpressed in E. coli BL21 and immunoblotted, which is the first

  8. Fascioliasis transmission by Lymnaea neotropica confirmed by nuclear rDNA and mtDNA sequencing in Argentina.

    Science.gov (United States)

    Mera y Sierra, Roberto; Artigas, Patricio; Cuervo, Pablo; Deis, Erika; Sidoti, Laura; Mas-Coma, Santiago; Bargues, Maria Dolores

    2009-12-03

    Fascioliasis is widespread in livestock in Argentina. Among activities included in a long-term initiative to ascertain which are the fascioliasis areas of most concern, studies were performed in a recreational farm, including liver fluke infection in different domestic animal species, classification of the lymnaeid vector and verification of natural transmission of fascioliasis by identification of the intramolluscan trematode larval stages found in naturally infected snails. The high prevalences in the domestic animals appeared related to only one lymnaeid species present. Lymnaeid and trematode classification was verified by means of nuclear ribosomal DNA and mitochondrial DNA marker sequencing. Complete sequences of 18S rRNA gene and rDNA ITS-2 and ITS-1, and a fragment of the mtDNA cox1 gene demonstrate that the Argentinian lymnaeid belongs to the species Lymnaea neotropica. Redial larval stages found in a L. neotropica specimen were ascribed to Fasciola hepatica after analysis of the complete ITS-1 sequence. The finding of L. neotropica is the first of this lymnaeid species not only in Argentina but also in Southern Cone countries. The total absence of nucleotide differences between the sequences of specimens from Argentina and the specimens from the Peruvian type locality at the levels of rDNA 18S, ITS-2 and ITS-1, and the only one mutation at the mtDNA cox1 gene suggest a very recent spread. The ecological characteristics of this lymnaeid, living in small, superficial water collections frequented by livestock, suggest that it may be carried from one place to another by remaining in dried mud stuck to the feet of transported animals. The presence of L. neotropica adds pronounced complexity to the transmission and epidemiology of fascioliasis in Argentina, due to the great difficulties in distinguishing, by traditional malacological methods, between the three similar lymnaeid species of the controversial Galba/Fossaria group present in this country: L. viatrix

  9. Conserved Organisation of 45S rDNA Sites and rDNA Gene Copy Number among Major Clades of Early Land Plants

    Czech Academy of Sciences Publication Activity Database

    Rosato, M.; Kovařík, Aleš; Garilleti, R.; Rosselló, J. A.

    2016-01-01

    Roč. 11, č. 9 (2016), č. článku e0162544. E-ISSN 1932-6203 R&D Projects: GA ČR GBP501/12/G090 Institutional support: RVO:68081707 Keywords : molecular cytogenetic analyses * nuclear ribosomal dna Subject RIV: BO - Biophysics Impact factor: 2.806, year: 2016

  10. [Norrie syndrome: identification of carriers by segregation analysis with flanking DNA markers].

    Science.gov (United States)

    Körner, J; Uhlhaas, S; Neugebauer, M; Gal, A

    1989-01-01

    Norrie disease is an X-linked recessive disorder. Affected males present with congenital blindness. Additionally, hearing loss and psychotic behavior may occur at any time. Since carriers are clinically healthy, they can only be identified by genetic means. Daughters of carriers or sisters of affected males have an à priori 50% risk of being carriers themselves. Close linkage has been found between the Norrie disease locus (NDP) and the DNA locus DXS7 mapped to Xp11.3. For genetic counselling, this linkage relationship allows carriers of the disease to be identified in informative families. We describe a large pedigree with Norrie disease. Segregation analysis was carried out with DXS7 and a second flanking marker, DXS255, both linked to NDP. In this way, three females at risk were identified who had a high probability of being carriers for Norrie disease.

  11. Karyotype characterization of Mugil incilis Hancock, 1830 (Mugiliformes: Mugilidae, including a description of an unusual co-localization of major and minor ribosomal genes in the family

    Directory of Open Access Journals (Sweden)

    Anne Kathrin Hett

    Full Text Available This study reports the description of the karyotype of Mugil incilis from Venezuela. The chromosome complement is composed of 48 acrocentric chromosomes, which uniformly decrease in size. Therefore, the homologues can not be clearly identified, with the exception of one of the largest chromosome pairs, classified as number 1, whose homologues may show a subcentromeric secondary constriction, and of chromosome pair number 24, which is considerably smaller than the others. C-banding showed heterochromatic blocks at the centromeric/pericentromeric regions of all chromosomes, which were more conspicuous on chromosomes 1, given the C-positive signals include the secondary constrictions. AgNO3 and fluorescent in situ hybridization (FISH with 45S rDNA demonstrated that the nucleolus organizer regions are indeed located on the secondary constrictions of chromosome pair number 1. FISH with 5S rDNA revealed that the minor ribosomal genes are located on this same chromosome pair, near the NORs, though signals are closer to the centromeres and of smaller size, compared to those of the major ribosomal gene clusters. This is the first description of co-localization of major and minor ribosomal genes in the family. Data are discussed from a cytotaxonomic and phylogenetic perspective.

  12. Trapping the ribosome to control gene expression.

    Science.gov (United States)

    Boehringer, Daniel; Ban, Nenad

    2007-09-21

    Protein synthesis is often regulated by structured mRNAs that interact with ribosomes. In this issue of Cell, Marzi et al. (2007) provide insights into the autoregulation of protein S15 by visualizing the folded repressor mRNA on the ribosome stalled in the preinitiation state. These results have implications for our understanding of the mechanism of translation initiation in general.

  13. A 2-megabase physical contig incorporating 43 DNA markers on the human X chromosome at p11.23-p11.22 from ZNF21 to DXS255

    Energy Technology Data Exchange (ETDEWEB)

    Boycott, K.M.; Bech-Hansen, N.T. [Univ. of Calgary, Alberta (Canada); Halley, G.R.; Schlessinger, D. [Washington Univ. School of Medicine, St. Louis, MO (United States)

    1996-05-01

    A comprehensive physical contig of yeast artificial chromosomes (YACs) and cosmid clones between ZNF21 and DXS255 has been constructed, spanning 2 Mb within the region Xp11.23-p11.22. As a portion of the region was found to be particularly unstable in yeast, the integrity of the contig is dependent on additional information provided by the sequence-tagged site (STS) content of cosmid clones and DNA marker retention in conventional and radiation hybrids. The contig was formatted with 43 DNA markers, including 19 new STSs from YAC insert ends and an internal Alu-PCR product. The density of STSs across the contig ranges from one marker every 20 kb to one every 60 kb, with an average density of one marker every 50 kb. The relative order of previously known gene and expressed sequence tags in this region is predicted to be Xpter-ZNF21-DXS7465E (MG66)-DXS7927E (MG81)-WASP, DXS1011E, DXS7467E (MG21)-DXS-7466E (MG44)-GATA1-DXS7469E (Xp664)-TFE3-SYP (DXS1007E)-Xcen. This contig extends the coverage in Xp11 and provides a framework for the future identification and mapping of new genes, as well as the resources for developing DNA sequencing templates. 47 refs., 1 fig., 4 tabs.

  14. Is the extraction by Whatman FTA filter matrix technology and sequencing of large ribosomal subunit D1-D2 region sufficient for identification of clinical fungi?

    Science.gov (United States)

    Kiraz, Nuri; Oz, Yasemin; Aslan, Huseyin; Erturan, Zayre; Ener, Beyza; Akdagli, Sevtap Arikan; Muslumanoglu, Hamza; Cetinkaya, Zafer

    2015-10-01

    Although conventional identification of pathogenic fungi is based on the combination of tests evaluating their morphological and biochemical characteristics, they can fail to identify the less common species or the differentiation of closely related species. In addition these tests are time consuming, labour-intensive and require experienced personnel. We evaluated the feasibility and sufficiency of DNA extraction by Whatman FTA filter matrix technology and DNA sequencing of D1-D2 region of the large ribosomal subunit gene for identification of clinical isolates of 21 yeast and 160 moulds in our clinical mycology laboratory. While the yeast isolates were identified at species level with 100% homology, 102 (63.75%) clinically important mould isolates were identified at species level, 56 (35%) isolates at genus level against fungal sequences existing in DNA databases and two (1.25%) isolates could not be identified. Consequently, Whatman FTA filter matrix technology was a useful method for extraction of fungal DNA; extremely rapid, practical and successful. Sequence analysis strategy of D1-D2 region of the large ribosomal subunit gene was found considerably sufficient in identification to genus level for the most clinical fungi. However, the identification to species level and especially discrimination of closely related species may require additional analysis. © 2015 Blackwell Verlag GmbH.

  15. A Listeria monocytogenes RNA helicase essential for growth and ribosomal maturation at low temperatures uses its C terminus for appropriate interaction with the ribosome.

    Science.gov (United States)

    Netterling, Sakura; Vaitkevicius, Karolis; Nord, Stefan; Johansson, Jörgen

    2012-08-01

    Listeria monocytogenes, a Gram-positive food-borne human pathogen, is able to grow at temperatures close to 0°C and is thus of great concern for the food industry. In this work, we investigated the physiological role of one DExD-box RNA helicase in Listeria monocytogenes. The RNA helicase Lmo1722 was required for optimal growth at low temperatures, whereas it was dispensable at 37°C. A Δlmo1722 strain was less motile due to downregulation of the major subunit of the flagellum, FlaA, caused by decreased flaA expression. By ribosomal fractionation experiments, it was observed that Lmo1722 was mainly associated with the 50S subunit of the ribosome. Absence of Lmo1722 decreased the fraction of 50S ribosomal subunits and mature 70S ribosomes and affected the processing of the 23S precursor rRNA. The ribosomal profile could be restored to wild-type levels in a Δlmo1722 strain expressing Lmo1722. Interestingly, the C-terminal part of Lmo1722 was redundant for low-temperature growth, motility, 23S rRNA processing, and appropriate ribosomal maturation. However, Lmo1722 lacking the C terminus showed a reduced affinity for the 50S and 70S fractions, suggesting that the C terminus is important for proper guidance of Lmo1722 to the 50S subunit. Taken together, our results show that the Listeria RNA helicase Lmo1722 is essential for growth at low temperatures, motility, and rRNA processing and is important for ribosomal maturation, being associated mainly with the 50S subunit of the ribosome.

  16. Development of New Microsatellite DNA Markers from Apostichopus japonicus and Their Cross-Species Application in Parastichopus parvimensis and Pathallus mollis

    Directory of Open Access Journals (Sweden)

    Guiping Chen

    2011-09-01

    Full Text Available Twenty microsatellite DNA markers were developed for sea cucumber and used to investigate polymorphisms of 60 wild Apostichopus japonicus individuals collected from China. It revealed that all the markers were polymorphic. A total of 164 alleles were detected at 20 loci. The number of alleles per locus varied from 3 to 17 with an average of 8.2, and the expected heterozygosities of each locus ranged from 0.03 to 0.89 with an average of 0.64. Cross-species amplification was also conducted in Parastichopus parvimensis collected from the United States and Pathallus mollis collected from Peru. The result showed that 17 loci amplified Parastichopus parvimensis DNAs while only 4 loci could amplify Pathallus mollis DNAs. All of the polymorphic markers would be useful for future genetic breeding and the assessment of genetic variation within sea cucumbers.

  17. Studies of the effects of ultraviolet radiation on the structural integrities of ribosomal RNA components of the Escherichia coli 50S ribosomal subunit

    International Nuclear Information System (INIS)

    Gorelic, L.; Parker, D.

    1978-01-01

    The effects of 254-nm radiation on the structural integrities of free and 50S ribosome-bound 5S and 23S ribosomal ribonucleic acids (rRNA) have been elucidated. Irradiation of aqueous solutions of Escherichia coli 50S ribosomes with 253.7-nm radiation results in the formation of single-strand breaks in double-stranded regions of the 23S rRNA component, but not in rRNA chain scission, and destabilization of the secondary structure of the 23S rRNA toward denaturation. The minimum doses of 253.7-nm radiation required for the first detection of the two effects are 7 x 10 19 quanta for the production of single-strand breaks in double-stranded regions of the 23S rRNA, and 19 quanta for destabilization of the 23S rRNA secondary structure. Free 23S rRNA is resistant toward photoinduced chain breakage at doses of 253.7-nm radiation up to at least 2.3 x 10 20 and is much less sensitive toward destabilization of secondary structure than ribosome-bound 23S rRNA. In contrast to the photosensitivity of 50S ribosome-bound 23S rRNA toward chain breakage, 50S ribosome-bound 5S rRNA is resistant toward chain breakage at doses of 253.7-nm radiation up to at least 2.3 x 10 20 quanta. Ribosome-bound 5S and 23S rRNA are also not photosensitive toward intermolecular 5S/23S rRNA cross-linkage

  18. Determination of Trichuris skrjabini by sequencing of the ITS1-5.8S-ITS2 segment of the ribosomal DNA: comparative molecular study of different species of trichurids.

    Science.gov (United States)

    Cutillas, C; Oliveros, R; de Rojas, M; Guevara, D C

    2004-06-01

    Adults of Trichuris skrjahini have been isolated from the cecum of caprine hosts (Capra hircus), Trichuris ovis and Trichuris globulosa from Ovis aries (sheep) and C. hircus (goats), and Trichuris leporis from Lepus europaeus (rabbits) in Spain. Genomic DNA was isolated and the ITS1-5.8S-ITS2 segment from the ribosomal DNA (rDNA) was amplified and sequenced by polymerase chain reaction (PCR) techniques. The ITS1 of T. skrjabini, T. ovis, T. globulosa, and T. leporis was 495, 757, 757, and 536 nucleotides in length, respectively, and had G + C contents of 59.6, 58.7, 58.7, and 60.8%, respectively. Intraindividual variation was detected in the ITSI sequences of the 4 species. Furthermore, the 5.8S sequences of T. skrjabini, T. ovis, T. globulosa, and T. leporis were compared. A total of 157, 152, 153, and 157 nucleotides in length was observed in the 5.8S sequences of these 4 species, respectively. There were no sequence differences of ITS1 and 5.8S products between T. ovis and T. globulosa. Nevertheless, clear differences were detected between the ITS1 sequences of T. skrjabini, T. ovis, T. leporis, Trichuris muris, and T. arvicolae. The ITS2 fragment from the rDNA of T. skrjabini was sequenced. A comparative study of the ITS2 sequence of T. skrjabini with the previously published ITS2 sequence data of T. ovis, T. leporis, T. muris, and T. arvicolae suggested that the combined use of sequence data from both spacers would be useful in the molecular characterization of trichurid parasites.

  19. Development and evaluation of a 16S ribosomal DNA array-based approach for describing complex microbial communities in ready-to-eat vegetable salads packed in a modified atmosphere.

    Science.gov (United States)

    Rudi, Knut; Flateland, Signe L; Hanssen, Jon Fredrik; Bengtsson, Gunnar; Nissen, Hilde

    2002-03-01

    There is a clear need for new approaches in the field of microbial community analyses, since the methods used can be severely biased. We have developed a DNA array-based method that targets 16S ribosomal DNA (rDNA), enabling the direct detection and quantification of microorganisms from complex communities without cultivation. The approach is based on the construction of specific probes from the 16S rDNA sequence data retrieved directly from the communities. The specificity of the assay is obtained through a combination of DNA array hybridization and enzymatic labeling of the constructed probes. Cultivation-dependent assays (enrichment and plating) and cultivation-independent assays (direct fluorescence microscopy and scanning electron microscopy) were used as reference methods in the development and evaluation of the method. The description of microbial communities in ready-to-eat vegetable salads in a modified atmosphere was used as the experimental model. Comparisons were made with respect to the effect of storage at different temperatures for up to 12 days and with respect to the geographic origin of the crisphead lettuce (Spanish or Norwegian), the main salad component. The conclusion drawn from the method comparison was that the DNA array-based method gave an accurate description of the microbial communities. Pseudomonas spp. dominated both of the salad batches, containing either Norwegian or Spanish lettuce, before storage and after storage at 4 degrees C. The Pseudomonas population also dominated the batch containing Norwegian lettuce after storage at 10 degrees C. On the contrary, Enterobacteriaceae and lactic acid bacteria dominated the microbial community of the batch containing Spanish lettuce after storage at 10 degrees C. In that batch, the Enterobacteriaceae also were abundant after storage at 4 degrees C as well as before storage. The practical implications of these results are that microbial communities in ready-to-eat vegetable salads can be

  20. Mitochondrial DNA markers of loggerhead marine turtles (Caretta caretta (Testudines: Cheloniidae nesting at Kyparissia Bay, Greece, confirm the western Greece unit and regional structuring

    Directory of Open Access Journals (Sweden)

    Carlos Carreras

    2014-03-01

    Full Text Available Genetic markers have been widely used in marine turtles to assess population structuring and origin of individuals in common feeding grounds, which are key elements for understanding their ecology and for developing conservation strategies. However, these analyses are very sensitive to missing information, especially from abundant nesting sites. Kyparissia Bay (western Greece hosts the second largest Mediterranean nesting aggregation of the loggerhead turtle (Caretta caretta, but the genetic profile of this nesting site has not, as yet, been described using the extended version of the historically used mitochondrial DNA (mtDNA marker. This marker was genotyped for 36 individuals nesting at Kyparissia Bay and haplotype frequencies obtained were compared with published data from other Mediterranean nesting sites. The results confirmed the connection between Kyparissia and other western Greek nesting sites and the isolation of this western Greek group from other Mediterranean nesting areas. As a consequence of this isolation, this abundant group of nesting aggregations (almost 30% of the Mediterranean stock is not likely to significantly contribute to the recovery of other declining Mediterranean units.

  1. Mitochondrial ribosomal protein S18-2 evokes chromosomal instability and transforms primary rat skin fibroblasts

    KAUST Repository

    Kashuba, Elena

    2015-05-12

    We have shown earlier that overexpression of the human mitochondrial ribosomal protein MRPS18-2 (S18-2) led to immortalization of primary rat embryonic fibroblasts. The derived cells expressed the embryonic stem cell markers, and cellular pathways that control cell proliferation, oxidative phosphorylation, cellular respiration, and other redox reactions were activated in the immortalized cells. Here we report that, upon overexpression of S18-2 protein, primary rat skin fibroblasts underwent cell transformation. Cells passed more than 300 population doublings, and two out of three tested clones gave rise to tumors in experimental animals. Transformed cells showed anchorage-independent growth and loss of contact inhibition; they expressed epithelial markers, such as E-cadherin and β-catenin. Transformed cells showed increased telomerase activity, disturbance of the cell cycle, and chromosomal instability. Taken together, our data suggest that S18-2 is a newly identified oncoprotein that may be involved in cancerogenesis.

  2. PFR²: a curated database of planktonic foraminifera 18S ribosomal DNA as a resource for studies of plankton ecology, biogeography and evolution.

    Science.gov (United States)

    Morard, Raphaël; Darling, Kate F; Mahé, Frédéric; Audic, Stéphane; Ujiié, Yurika; Weiner, Agnes K M; André, Aurore; Seears, Heidi A; Wade, Christopher M; Quillévéré, Frédéric; Douady, Christophe J; Escarguel, Gilles; de Garidel-Thoron, Thibault; Siccha, Michael; Kucera, Michal; de Vargas, Colomban

    2015-11-01

    Planktonic foraminifera (Rhizaria) are ubiquitous marine pelagic protists producing calcareous shells with conspicuous morphology. They play an important role in the marine carbon cycle, and their exceptional fossil record serves as the basis for biochronostratigraphy and past climate reconstructions. A major worldwide sampling effort over the last two decades has resulted in the establishment of multiple large collections of cryopreserved individual planktonic foraminifera samples. Thousands of 18S rDNA partial sequences have been generated, representing all major known morphological taxa across their worldwide oceanic range. This comprehensive data coverage provides an opportunity to assess patterns of molecular ecology and evolution in a holistic way for an entire group of planktonic protists. We combined all available published and unpublished genetic data to build PFR(2), the Planktonic foraminifera Ribosomal Reference database. The first version of the database includes 3322 reference 18S rDNA sequences belonging to 32 of the 47 known morphospecies of extant planktonic foraminifera, collected from 460 oceanic stations. All sequences have been rigorously taxonomically curated using a six-rank annotation system fully resolved to the morphological species level and linked to a series of metadata. The PFR(2) website, available at http://pfr2.sb-roscoff.fr, allows downloading the entire database or specific sections, as well as the identification of new planktonic foraminiferal sequences. Its novel, fully documented curation process integrates advances in morphological and molecular taxonomy. It allows for an increase in its taxonomic resolution and assures that integrity is maintained by including a complete contingency tracking of annotations and assuring that the annotations remain internally consistent. © 2015 John Wiley & Sons Ltd.

  3. Prospects of molecular markers in Fusarium species diversity

    DEFF Research Database (Denmark)

    Nayaka, S. Chandra; Wulff, Ednar Gadelha; Udayashankar, A.C.

    2011-01-01

    focuses of various molecular-based techniques employed to study the diversity of Fusarium species causing diseases in major food crops. An introduction of fusarial diseases and their mycotoxins and molecular-marker-based methods for detection introduce the concept of marker application. Various well...... for generation of probes and their use in phylogeny of Fusarium spp. are also presented. The concluding part emphasizes the value of molecular markers for assessing genetic variability and reveals that molecular tools are indispensable for providing information not only of one Fusarium species but on whole......-known molecular techniques such as random amplified polymorphic DNA, amplification fragment length polymorphism, etc. to more modern ones such as DNA microarrays, DNA barcoding, and pyrosequencing and their application form the core of the review. Target regions in the genome which can be potential candidates...

  4. Molecular Diagnostics of Arthroconidial Yeasts, Frequent Pulmonary Opportunists.

    Science.gov (United States)

    Kaplan, Engin; Al-Hatmi, Abdullah M S; Ilkit, Macit; Gerrits van den Ende, A H G; Hagen, Ferry; Meis, Jacques F; de Hoog, G Sybren

    2018-01-01

    Magnusiomyces capitatus and Saprochaete clavata are members of the clade of arthroconidial yeasts that represent emerging opportunistic pulmonary pathogens in immunocompromised patients. Given that standard ribosomal DNA (rDNA) identification often provides confusing results, in this study, we analyzed 34 isolates with the goal of finding new genetic markers for classification using multilocus sequencing and amplified fragment length polymorphism (AFLP). The interspecific similarity obtained using rDNA markers (the internal transcribed spacer [ITS] and large subunit regions) was in the range of 96 to 99%, whereas that obtained using protein-coding loci ( Rbp2 , Act , and Tef1α ) was lower at 89.4 to 95.2%. Ultimately, Rbp2 was selected as the best marker for species distinction. On the basis of cloned ITS data, some strains proved to be misidentified in comparison with the identities obtained with phenotypic characters, protein sequences, and AFLP profiles, indicating that different copies of the ribosomal operon were present in a single species. Antifungal susceptibility testing revealed that voriconazole had the lowest MIC against M. capitatus , while amphotericin B had the lowest MIC against S. clavata Both species exhibited in vitro resistance to fluconazole and micafungin. Copyright © 2017 American Society for Microbiology.

  5. Control of ribosome traffic by position-dependent choice of synonymous codons

    DEFF Research Database (Denmark)

    Mitarai, Namiko; Pedersen, Steen

    2013-01-01

    Messenger RNA (mRNA) encodes a sequence of amino acids by using codons. For most amino acids, there are multiple synonymous codons that can encode the amino acid. The translation speed can vary from one codon to another, thus there is room for changing the ribosome speed while keeping the amino...... acid sequence and hence the resulting protein. Recently, it has been noticed that the choice of the synonymous codon, via the resulting distribution of slow- and fast-translated codons, affects not only on the average speed of one ribosome translating the mRNA but also might have an effect on nearby...... ribosomes by affecting the appearance of 'traffic jams' where multiple ribosomes collide and form queues. To test this 'context effect' further, we here investigate the effect of the sequence of synonymous codons on the ribosome traffic by using a ribosome traffic model with codon-dependent rates, estimated...

  6. Charge Segregation and Low Hydrophobicity Are Key Features of Ribosomal Proteins from Different Organisms*

    Science.gov (United States)

    Fedyukina, Daria V.; Jennaro, Theodore S.; Cavagnero, Silvia

    2014-01-01

    Ribosomes are large and highly charged macromolecular complexes consisting of RNA and proteins. Here, we address the electrostatic and nonpolar properties of ribosomal proteins that are important for ribosome assembly and interaction with other cellular components and may influence protein folding on the ribosome. We examined 50 S ribosomal subunits from 10 species and found a clear distinction between the net charge of ribosomal proteins from halophilic and non-halophilic organisms. We found that ∼67% ribosomal proteins from halophiles are negatively charged, whereas only up to ∼15% of ribosomal proteins from non-halophiles share this property. Conversely, hydrophobicity tends to be lower for ribosomal proteins from halophiles than for the corresponding proteins from non-halophiles. Importantly, the surface electrostatic potential of ribosomal proteins from all organisms, especially halophiles, has distinct positive and negative regions across all the examined species. Positively and negatively charged residues of ribosomal proteins tend to be clustered in buried and solvent-exposed regions, respectively. Hence, the majority of ribosomal proteins is characterized by a significant degree of intramolecular charge segregation, regardless of the organism of origin. This key property enables the ribosome to accommodate proteins within its complex scaffold regardless of their overall net charge. PMID:24398678

  7. Environmental DNA (eDNA metabarcoding assays to detect invasive invertebrate species in the Great Lakes.

    Directory of Open Access Journals (Sweden)

    Katy E Klymus

    Full Text Available Describing and monitoring biodiversity comprise integral parts of ecosystem management. Recent research coupling metabarcoding and environmental DNA (eDNA demonstrate that these methods can serve as important tools for surveying biodiversity, while significantly decreasing the time, expense and resources spent on traditional survey methods. The literature emphasizes the importance of genetic marker development, as the markers dictate the applicability, sensitivity and resolution ability of an eDNA assay. The present study developed two metabarcoding eDNA assays using the mtDNA 16S RNA gene with Illumina MiSeq platform to detect invertebrate fauna in the Laurentian Great Lakes and surrounding waterways, with a focus for use on invasive bivalve and gastropod species monitoring. We employed careful primer design and in vitro testing with mock communities to assess ability of the markers to amplify and sequence targeted species DNA, while retaining rank abundance information. In our mock communities, read abundances reflected the initial input abundance, with regressions having significant slopes (p<0.05 and high coefficients of determination (R2 for all comparisons. Tests on field environmental samples revealed similar ability of our markers to measure relative abundance. Due to the limited reference sequence data available for these invertebrate species, care must be taken when analyzing results and identifying sequence reads to species level. These markers extend eDNA metabarcoding research for molluscs and appear relevant to other invertebrate taxa, such as rotifers and bryozoans. Furthermore, the sphaeriid mussel assay is group-specific, exclusively amplifying bivalves in the Sphaeridae family and providing species-level identification. Our assays provide useful tools for managers and conservation scientists, facilitating early detection of invasive species as well as improving resolution of mollusc diversity.

  8. GTPases and the origin of the ribosome

    Directory of Open Access Journals (Sweden)

    Smith Temple F

    2010-05-01

    Full Text Available Abstract Background This paper is an attempt to trace the evolution of the ribosome through the evolution of the universal P-loop GTPases that are involved with the ribosome in translation and with the attachment of the ribosome to the membrane. The GTPases involved in translation in Bacteria/Archaea are the elongation factors EFTu/EF1, the initiation factors IF2/aeIF5b + aeIF2, and the elongation factors EFG/EF2. All of these GTPases also contain the OB fold also found in the non GTPase IF1 involved in initiation. The GTPase involved in the signal recognition particle in most Bacteria and Archaea is SRP54. Results 1 The Elongation Factors of the Archaea based on structural considerations of the domains have the following evolutionary path: EF1→ aeIF2 → EF2. The evolution of the aeIF5b was a later event; 2 the Elongation Factors of the Bacteria based on the topological considerations of the GTPase domain have a similar evolutionary path: EFTu→ IF→2→EFG. These evolutionary sequences reflect the evolution of the LSU followed by the SSU to form the ribosome; 3 the OB-fold IF1 is a mimic of an ancient tRNA minihelix. Conclusion The evolution of translational GTPases of both the Archaea and Bacteria point to the evolution of the ribosome. The elongation factors, EFTu/EF1, began as a Ras-like GTPase bringing the activated minihelix tRNA to the Large Subunit Unit. The initiation factors and elongation factor would then have evolved from the EFTu/EF1 as the small subunit was added to the evolving ribosome. The SRP has an SRP54 GTPase and a specific RNA fold in its RNA component similar to the PTC. We consider the SRP to be a remnant of an ancient form of an LSU bound to a membrane. Reviewers This article was reviewed by George Fox, Leonid Mirny and Chris Sander.

  9. Genome-Wide DNA Copy Number Analysis of Acute Lymphoblastic Leukemia Identifies New Genetic Markers Associated with Clinical Outcome.

    Directory of Open Access Journals (Sweden)

    Maribel Forero-Castro

    Full Text Available Identifying additional genetic alterations associated with poor prognosis in acute lymphoblastic leukemia (ALL is still a challenge.To characterize the presence of additional DNA copy number alterations (CNAs in children and adults with ALL by whole-genome oligonucleotide array (aCGH analysis, and to identify their associations with clinical features and outcome. Array-CGH was carried out in 265 newly diagnosed ALLs (142 children and 123 adults. The NimbleGen CGH 12x135K array (Roche was used to analyze genetic gains and losses. CNAs were analyzed with GISTIC and aCGHweb software. Clinical and biological variables were analyzed. Three of the patients showed chromothripsis (cth6, cth14q and cth15q. CNAs were associated with age, phenotype, genetic subtype and overall survival (OS. In the whole cohort of children, the losses on 14q32.33 (p = 0.019 and 15q13.2 (p = 0.04 were related to shorter OS. In the group of children without good- or poor-risk cytogenetics, the gain on 1p36.11 was a prognostic marker independently associated with shorter OS. In adults, the gains on 19q13.2 (p = 0.001 and Xp21.1 (p = 0.029, and the loss of 17p (p = 0.014 were independent markers of poor prognosis with respect to OS. In summary, CNAs are frequent in ALL and are associated with clinical parameters and survival. Genome-wide DNA copy number analysis allows the identification of genetic markers that predict clinical outcome, suggesting that detection of these genetic lesions will be useful in the management of patients newly diagnosed with ALL.

  10. Seventeen copies of the human 37 kDa laminin receptor precursor/p40 ribosome-associated protein gene are processed pseudogenes arisen from retropositional events

    DEFF Research Database (Denmark)

    Jackers, P; Clausse, N; Fernandez, M

    1996-01-01

    A cDNA coding for a 37 kDa polypeptide has been identified in several species as both the potential precursor of the 67 kDa laminin receptor (37LRP) and a putative ribosome-associated protein (p40). Interestingly, increased expression of this polypeptide (37LRP/p40) is consistently observed...

  11. Intragenomic sequence variation at the ITS1 - ITS2 region and at the 18S and 28S nuclear ribosomal DNA genes of the New Zealand mud snail, Potamopyrgus antipodarum (Hydrobiidae: mollusca)

    Science.gov (United States)

    Hoy, Marshal S.; Rodriguez, Rusty J.

    2013-01-01

    Molecular genetic analysis was conducted on two populations of the invasive non-native New Zealand mud snail (Potamopyrgus antipodarum), one from a freshwater ecosystem in Devil's Lake (Oregon, USA) and the other from an ecosystem of higher salinity in the Columbia River estuary (Hammond Harbor, Oregon, USA). To elucidate potential genetic differences between the two populations, three segments of nuclear ribosomal DNA (rDNA), the ITS1-ITS2 regions and the 18S and 28S rDNA genes were cloned and sequenced. Variant sequences within each individual were found in all three rDNA segments. Folding models were utilized for secondary structure analysis and results indicated that there were many sequences which contained structure-altering polymorphisms, which suggests they could be nonfunctional pseudogenes. In addition, analysis of molecular variance (AMOVA) was used for hierarchical analysis of genetic variance to estimate variation within and among populations and within individuals. AMOVA revealed significant variation in the ITS region between the populations and among clones within individuals, while in the 5.8S rDNA significant variation was revealed among individuals within the two populations. High levels of intragenomic variation were found in the ITS regions, which are known to be highly variable in many organisms. More interestingly, intragenomic variation was also found in the 18S and 28S rDNA, which has rarely been observed in animals and is so far unreported in Mollusca. We postulate that in these P. antipodarum populations the effects of concerted evolution are diminished due to the fact that not all of the rDNA genes in their polyploid genome should be essential for sustaining cellular function. This could lead to a lessening of selection pressures, allowing mutations to accumulate in some copies, changing them into variant sequences.                   

  12. Applicability of SCAR markers to food genomics: olive oil traceability.

    Science.gov (United States)

    Pafundo, Simona; Agrimonti, Caterina; Maestri, Elena; Marmiroli, Nelson

    2007-07-25

    DNA analysis with molecular markers has opened a shortcut toward a genomic comprehension of complex organisms. The availability of micro-DNA extraction methods, coupled with selective amplification of the smallest extracted fragments with molecular markers, could equally bring a breakthrough in food genomics: the identification of original components in food. Amplified fragment length polymorphisms (AFLPs) have been instrumental in plant genomics because they may allow rapid and reliable analysis of multiple and potentially polymorphic sites. Nevertheless, their direct application to the analysis of DNA extracted from food matrixes is complicated by the low quality of DNA extracted: its high degradation and the presence of inhibitors of enzymatic reactions. The conversion of an AFLP fragment to a robust and specific single-locus PCR-based marker, therefore, could extend the use of molecular markers to large-scale analysis of complex agro-food matrixes. In the present study is reported the development of sequence characterized amplified regions (SCARs) starting from AFLP profiles of monovarietal olive oils analyzed on agarose gel; one of these was used to identify differences among 56 olive cultivars. All the developed markers were purposefully amplified in olive oils to apply them to olive oil traceability.

  13. Recombinogenic engineering of conjugative plasmids with fluorescent marker cassettes

    DEFF Research Database (Denmark)

    Reisner, A.; Molin, Søren; Zechner, E.L.

    2002-01-01

    An efficient approach for the insertion of fluorescent marker genes with sequence specificity into conjugative plasmids in Escherichia coli is described. For this purpose, homologous recombination of linear double-stranded targeting DNA was mediated by the bacteriophage lambda recombination...... resistance genes and fluorescent markers. The choice of 5' non-homologous extensions in primer pairs used for amplifying the marker cassettes determines the site specificity of the targeting DNA. This methodology is applicable to the modification of all plasmids that replicate in E coli and is not restricted...

  14. Nonviral Gene Targeting at rDNA Locus of Human Mesenchymal Stem Cells

    Directory of Open Access Journals (Sweden)

    Youjin Hu

    2013-01-01

    Full Text Available Background. Genetic modification, such as the addition of exogenous genes to the MSC genome, is crucial to their use as cellular vehicles. Due to the risks associated with viral vectors such as insertional mutagenesis, the safer nonviral vectors have drawn a great deal of attention. Methods. VEGF, bFGF, vitamin C, and insulin-transferrin-selenium-X were supplemented in the MSC culture medium. The cells’ proliferation and survival capacity was measured by MTT, determination of the cumulative number of cells, and a colony-forming efficiency assay. The plasmid pHr2-NL was constructed and nucleofected into MSCs. The recombinants were selected using G418 and characterized using PCR and Southern blotting. Results. BFGF is critical to MSC growth and it acted synergistically with vitamin C, VEGF, and ITS-X, causing the cells to expand significantly. The neomycin gene was targeted to the rDNA locus of human MSCs using a nonviral human ribosomal targeting vector. The recombinant MSCs retained multipotential differentiation capacity, typical levels of hMSC surface marker expression, and a normal karyotype, and none were tumorigenic in nude mice. Conclusions. Exogenous genes can be targeted to the rDNA locus of human MSCs while maintaining the characteristics of MSCs. This is the first nonviral gene targeting of hMSCs.

  15. cDNA, genomic cloning and sequence analysis of ribosomal protein ...

    African Journals Online (AJOL)

    enoh

    2012-03-13

    Mar 13, 2012 ... cDNA and the genomic sequence of RPS4X were cloned successfully from ... S4 genes plays a role in Turner syndrome; however, this ..... Project of Educational Committee of Sichuan Province ... Molecular biology of the cell.

  16. A novel two T-DNA binary vector allows efficient generation of marker-free transgenic plants in three elite cultivars of rice (Oryza sativa L.).

    Science.gov (United States)

    Breitler, Jean-Christophe; Meynard, Donaldo; Van Boxtel, Jos; Royer, Monique; Bonnot, François; Cambillau, Laurence; Guiderdoni, Emmanuel

    2004-06-01

    A pilot binary vector was constructed to assess the potential of the 2 T-DNA system for generating selectable marker-free progeny plants in three elite rice cultivars (ZhongZuo321, Ariete and Khao Dawk Mali 105) known to exhibit contrasting amenabilities to transformation. The first T-DNA of the vector, delimited by Agrobacterium tumefaciens borders, contains the hygromycin phosphotransferase (hpt) selectable gene and the green fluorescent protein (gfp) reporter gene while the second T-DNA, delimited by Agrobacterium rhizogenes borders, bears the phosphinothricin acetyl transferase (bar) gene, featuring the gene of interest. 82-90% of the hygromycin-resistant primary transformants exhibited tolerance to ammonium glufosinate mediated by the bar gene suggesting very high co-transformation frequency in the three cultivars. All of the regenerated plants were analyzed by Southern blot which confirmed co-integration of the T-DNAs at frequencies consistent with those of co-expression and allowed determination of copy number for each gene as well as detection of two different vector backbone fragments extending between the two T-DNAs. Hygromycin susceptible, ammonium glufosinate tolerant phenotypes represented 14.4, 17.4 and 14.3% of the plants in T1 progenies of ZZ321, Ariete and KDML105 primary transformants, respectively. We developed a statistical model for deducing from the observed copy number of each T-DNA in T0 plants and phenotypic segregations in T1 progenies the most likely constitution and linkage of the T-DNA integration locus. Statistical analysis identified in 40 out of 42 lines a most likely linkage configuration theoretically allowing genetic separation of the two T-DNA types and out segregation of the T-DNA bearing the bar gene. Overall, though improvements of the technology would be beneficial, the 2 T-DNA system appeared to be a useful approach to generate selectable marker-free rice plants with a consistent frequency among cultivars.

  17. Genetic diversity of Clavispora lusitaniae isolated from Agave fourcroydes Lem, as revealed by DNA fingerprinting.

    Science.gov (United States)

    Pérez-Brito, Daisy; Magaña-Alvarez, Anuar; Lappe-Oliveras, Patricia; Cortes-Velazquez, Alberto; Torres-Calzada, Claudia; Herrera-Suarez, Teófilo; Larqué-Saavedra, Alfonso; Tapia-Tussell, Raul

    2015-01-01

    This study characterized Clavispora lusitaniae strains isolated from different stages of the processing and early fermentation of a henequen (Agave fourcroydes) spirit produced in Yucatan, Mexico using a molecular technique. Sixteen strains identified based on morphological features, obtained from different substrates, were typed molecularly. Nine different versions of the divergent D1/D2 domain of the large-subunit ribosomal DNA sequence were identified among the C. lusitaniae strains. The greatest degree of polymorphism was found in the 90-bp structural motif of the D2 domain. The MSP-PCR technique was able to differentiate 100% of the isolates. This study provides significant insight into the genetic diversity of the mycobiota present during the henequen fermentation process, especially that of C. lusitaniae, for which only a few studies in plants have been published. The applied MSP-PCR markers were very efficient in revealing olymorphisms between isolates of this species.

  18. Phylogeography of the common vampire bat (Desmodus rotundus: Marked population structure, Neotropical Pleistocene vicariance and incongruence between nuclear and mtDNA markers

    Directory of Open Access Journals (Sweden)

    Morgante João S

    2009-12-01

    Full Text Available Abstract Background The common vampire bat Desmodus rotundus is an excellent model organism for studying ecological vicariance in the Neotropics due to its broad geographic range and its preference for forested areas as roosting sites. With the objective of testing for Pleistocene ecological vicariance, we sequenced a mitocondrial DNA (mtDNA marker and two nuclear markers (RAG2 and DRB to try to understand how Pleistocene glaciations affected the distribution of intraspecific lineages in this bat. Results Five reciprocally monophyletic clades were evident in the mitochondrial gene tree, and in most cases with high bootstrap support: Central America (CA, Amazon and Cerrado (AMC, Pantanal (PAN, Northern Atlantic Forest (NAF and Southern Atlantic Forest (SAF. The Atlantic forest clades formed a monophyletic clade with high bootstrap support, creating an east/west division for this species in South America. On the one hand, all coalescent and non-coalescent estimates point to a Pleistocene time of divergence between the clades. On the other hand, the nuclear markers showed extensive sharing of haplotypes between distant localities, a result compatible with male-biased gene flow. In order to test if the disparity between the mitochondrial and nuclear markers was due to the difference in mutation rate and effective size, we performed a coalescent simulation to examine the feasibility that, given the time of separation between the observed lineages, even with a gene flow rate close to zero, there would not be reciprocal monophyly for a neutral nuclear marker. We used the observed values of theta and an estimated mutation rate for the nuclear marker gene to perform 1000 iterations of the simulation. The results of this simulation were inconclusive: the number of iterations with and without reciprocal monophyly of one or more clades are similar. Conclusions We therefore conclude that the pattern exhibited by the common vampire bat, with marked

  19. Plasmid marker rescue transformation proceeds by breakage-reunion in Bacillus subtilis

    International Nuclear Information System (INIS)

    Weinrauch, Y.; Dubnau, D.

    1987-01-01

    Bacillus subtilis carrying a plasmid which replicates with a copy number of about 1 was transformed with linearized homologous plasmid DNA labeled with the heavy isotopes 2 H and 15 N, in the presence of 32 Pi and 6-(p-hydroxyphenylazo)-uracil to inhibit DNA replication. Plasmid DNA was isolated from the transformed culture and fractionated in cesium chloride density gradients. The distribution of total and donor plasmid DNA was examined, using specific hybridization probes. The synthesis of new DNA, associated with the integration of donor moiety, was also monitored. Donor-specific sequences were present at a density intermediate between that of light and hybrid DNA. This recombinant DNA represented 1.4% of total plasmid DNA. The latter value corresponded well with the transforming activity (1.7%) obtained for the donor marker. Newly synthesized material associated with plasmid DNA at the recombinant density amounted to a minor portion of the recombinant plasmid DNA. These data suggest that, like chromosomal transformation, plasmid marker rescue transformation does not require replication for the integration of donor markers and, also like chromosomal transformation, proceeds by a breakage-reunion mechanism. The extent of donor DNA replacement of recipient DNA per plasmid molecule of 54 kilobases (27 kilobase pairs) was estimated as 16 kilobases

  20. [Correlation between five RNA markers of rat's skin and PMI at different temperatures].

    Science.gov (United States)

    Pan, Hui; Zhang, Heng; Lü, Ye-hui; Ma, Jian-long; Ma, Kai-jun; Chen, Long

    2014-08-01

    To explore the correlation between postmortem interval (PMI) and five RNA markers of rat's skin--β-actin, glyceraldehyde-3-phosphate dehydrogenase (GAPDH), 18S ribosomal RNA(18S rRNA), 5S ribosomal RNA (5S rRNA), and microRNA-203 (miR-203), at different temperatures. Eighteen SD rats were randomly divided into three environmental temperature groups: 4 °C, 15 °C and 35 °C, respectively. Skin samples were taken at 11 time points from 0 h to 120 h post-mortem. The total RNA was extracted from the skin samples and the five RNA levels were detected by real-time fluorescent quantitative PCR. Proper internal reference was selected by geNorm software. Regression analysis of the RNA markers was conducted by GraphPad software. 5S rRNA and miR-203 were most suitable internal references. A good linear relationship between PMI and RNA levels (β-actin and GAPDH) was observed in two groups (4 °C and 15 °C), whereas the S type curve relationship between the expression levels of the two markers (β-actin and GAPDH) and PMI was observed in the 35 °C group. The partial linear relationship between 18S rRNA and PMI was observed in the groups (15 °C and 35 °C). Skin could be a suitable material for extracting RNA. The RNA expression levels of β-actin and GAPDH correlate well with PMI, and these RNA markers of skin tissue could be additional indice for the estimation of PMI.