Research reactors spent fuel management in the Nuclear Research Institute Rez

Energy Technology Data Exchange (ETDEWEB)

Rychecky, J. [Nuclear Research Institute, 25068 Rez (Czech Republic)

2001-07-01

In Czech Republic 3 research and testing nuclear reactors are operated at present time, with the biggest one being the Nuclear Research Institute (NRI) reactor LVR-15, operated with maximum power 10 MW. This reactor serves as a radiation source for material testing, producing of ionizing radiation sources, theoretical studies, and, most recently, for boron neutron capture therapy. Another NRI reactor LR-0 is a reactor of zero power used mainly for the studies of WWER 1000 spent fuel criticality. For training of students the reactor called VRABEC (VR-1), operated also with very low power, serves since 1990 at the Faculty of Nuclear Engineering, of Czech Technical University. The similar testing type reactor (SR-0), already decommissioned, was also used since 1974 to 1989 in Skoda, Nuclear Machinery, Plzen. This contribution summarizes the present state of the spent fuel (SF) management of these nuclear reactors. As the SF management is different for very low or zero power reactors and power reactors, the first type will be only briefly discussed, and then the main attention will be devoted to SF management of the NRI experimental reactor LVR-15.

Determining the axial power profile of partly flooded fuel in a compact core assembled in reactor LR-0

International Nuclear Information System (INIS)

Košťál, Michal; Švadlenková, Marie; Baroň, Petr; Rypar, Vojtěch; Milčák, Ján

2016-01-01

Highlights: • Fission density in partly flooded compact core. • Calculation of fission density axial profile. • Significant calculational under prediction of experimental axial profile. - Abstract: Measurement and calculation of the axial power profile near the boundary of a moderated and non-moderated core is used to analyze the suitability of the neutron-physical process description, mainly the angular cross-section of a water-moderated uranium system. This is also an important issue because it affects the radiation situation above the partly flooded core of a water-moderated reactor. Axial power profiles of various fuel pins irradiated on reactor LR-0 were measured and the results were compared with MCNP6 code calculations using the ENDF/B-VII.0 nuclear data library. The calculated power profile in positions above the moderator level significantly underestimates experimental results. This might be caused by an improper description of the angular distribution of scattered neutrons in a water-moderated uranium system.

WWER-440 local power peaking experiment with/without Hf inserts in the LR-0 reactor

International Nuclear Information System (INIS)

Josek, R.; Hudec, F.; Rypar, V.

2006-01-01

One of the known issues of the WWER-440 reactors is the control rod coupler induced power peaking in the neighbouring fuel assemblies. The effect has been discovered some years ago and is believed to be the cause of several fuel failures during operation in WWER-440 reactors. The effect itself is due to over-moderation and small absorption in the region of control rod coupler, leading to increase in thermal neutron flux and hence to power flare-up in the neighbouring fuel pins. The fuel vendor tackled the problem by attaching hafnium inserts on the inside of the control assembly box. The experiment performed in the LR-0 reactor was focused on the axial and radial power profiles in the vicinity of the control assembly with and without the hafnium inserts. The results of measurements with zero boron concentration are presented. The hafnium insert causes a decrease in peaking factor of about 30% in selected pins close to the control assembly. The measurements are compared with calculations performed with the MCNP-4C code. The compared variables are: the axial fission density distributions; peking factors and peaking factor decrease due to Hf insert. The MCNP results are accurate with respect to the experimental results. A series of benchmarks is being prepared on the basis of these measurements

Calculation with MCNP of capture photon flux in VVER-1000 experimental reactor.

Science.gov (United States)

Töre, Candan; Ortego, Pedro

2005-01-01

The aim of this study is to obtain by Monte Carlo method the high energy photon flux due to neutron capture in the internals and vessel layers of the experimental reactor LR-0 located in REZ, Czech Republic, and loaded with VVER-1000 fuel. The calclated neutron, photon and photon to neutron flux ratio are compared with experimental measurements performed with a multi-parameter stilbene detector. The results show clear underestimation of photon flux in downcomer and some overestimation at vessel surface and 1/4 thickness but a good fitting for deeper points in vessel.

The research of materials and water chemistry for supercritical water-cooled reactors in Research Centre Rez

International Nuclear Information System (INIS)

Zychova, Marketa; Fukac, Rostislav; Vsolak, Rudolf; Vojacek, Ales; Ruzickova, Mariana; Vonkova, Katerina

2012-09-01

Research Centre Rez (CVR) is R and D company based in the Czech Republic. It was established as the subsidiary of the Nuclear Research Institute Rez plc. One of the main activities of CVR is the research of materials and chemistry for the generation IV reactor systems - especially the supercritical water-cooled one. For these experiments is CVR equipped by a supercritical water loop (SCWL) and a supercritical water autoclave (SCWA) serving for research of material and Supercritical Water-cooled Reactor (SCWR) environment compatibility experiments. SCWL is a research facility designed to material, water chemistry, radiolysis and other testing in SCWR environment, SCWA serves for complementary and supporting experiments. SCWL consists of auxiliary circuits (ensuring the required parameters as temperature, pressure and chemical conditions in the irradiation channel, purification and measurements) and irradiation channel (where specimens are exposed to the SCWR environment). The design of the loop is based on many years of experience with loop design for various types of corrosion/water chemistry experiments. Designed conditions in the test area of SCWL are 600 deg. C and 25 MPa. SCWL was designed in 2008 within the High Performance Light Water Reactor Phase 2 project and built during 2008 and 2009. The trial operations were performed in 2010 and 2011 and were divided into three phases - the first phase to verify the functionality of auxiliary circuits of the loop, the second phase to verify the complete facility (auxiliary circuits and functional irradiation channel internals) and the third phase to verify the feasibility of corrosion tests with the complete equipment and specimens. All three trial operations were very successful - designed conditions and parameters were reached. (authors)

LALR(1) : LL(1) = LR(0) : LL(0)

NARCIS (Netherlands)

Kruseman Aretz, F.E.J.; Emde Boas, van P.; Hemker, P.W.; Hoffman, W.; Houwen, van der P.J.; Pfluger, P.R.

1992-01-01

It is shown that LL(l) and LALR(l) acceptors can be obtained by restricting the action tables of the corresponding LL(O) and LR(O) acceptors to those entries that are accessed in at least one accepting sequence (of a sentence from the language). It follows that a number of properties that are easily

New developments in instrumentation for strain scanning in NPI Rez

CERN Document Server

Vrána, M; Lukás, P; Dubsky, J; Wagner, V

2000-01-01

Two high-resolution neutron diffractometers dedicated to strain /stress investigations in polycrystalline materials are routinely operated at the medium-power reactor LVR-15 in Rez and are also opened for external users. Good luminosity of the diffractometers and a sufficiently high-resolution (FWHM of the instrumental Delta d/d - profile can be less than 2*10/sup -3/ at d/sub hkl/=0.2 nm) permit investigations of both the macro- and microstrains in the sample gauge volumes of several cubic millimetres. Excellent properties and abilities of the neutron diffraction strain scanners are documented by some results of experimental measurements. (11 refs).

Power peak in vicinity of WWER-440 control assembly

International Nuclear Information System (INIS)

Mikus, J.

2002-01-01

This paper presents information concerning the WWER-440 local power peaking problem induced by a control assembly and corresponding investigation possibilities on the light-water zero-power reactor LR-O at the Nuclear Research Institute Rez plc. Brief description of the disposable CA model, experimental arrangement and conditions on the LR-O reactor, preparation of the relevant measurements in the WWER-440 type cores with CA model, as well as some preliminary results of the fission density distribution obtained in a core without boron and with fuel assemblies having profiled enrichment are mentioned too (Author)

A prospective validation of the IOTA logistic regression models (LR1 and LR2) in comparison to subjective pattern recognition for the diagnosis of ovarian cancer.

Science.gov (United States)

Nunes, Natalie; Ambler, Gareth; Hoo, Wee-Liak; Naftalin, Joel; Foo, Xulin; Widschwendter, Martin; Jurkovic, Davor

2013-11-01

This study aimed to assess the accuracy of the International Ovarian Tumour Analysis (IOTA) logistic regression models (LR1 and LR2) and that of subjective pattern recognition (PR) for the diagnosis of ovarian cancer. This was a prospective single-center study in a general gynecology unit of a tertiary hospital during 33 months. There were 292 consecutive women who underwent surgery after an ultrasound diagnosis of an adnexal tumor. All examinations were by a single level 2 ultrasound operator, according to the IOTA guidelines. The malignancy likelihood was calculated using the IOTA LR1 and LR2. The women were then examined separately by an expert operator using subjective PR. These were compared to operative findings and histology. The sensitivity, specificity, area under the curve (AUC), and accuracy of the 3 methods were calculated and compared. The AUCs for LR1 and LR2 were 0.94 [95% confidence interval (CI), 0.92-0.97] and 0.93 (95% CI, 0.90-0.96), respectively. Subjective PR gave a positive likelihood ratio (LR+ve) of 13.9 (95% CI, 7.84-24.6) and a LR-ve of 0.049 (95% CI, 0.022-0.107). The corresponding LR+ve and LR-ve for LR1 were 3.33 (95% CI, 2.85-3.55) and 0.03 (95% CI, 0.01-0.10), and for LR2 were 3.58 (95% CI, 2.77-4.63) and 0.052 (95% CI, 0.022-0.123). The accuracy of PR was 0.942 (95% CI, 0.908-0.966), which was significantly higher when compared with 0.829 (95% CI, 0.781-0.870) for LR1 and 0.836 (95% CI, 0.788-0.872) for LR2 (P IOTA LR1 and LR2 were similar in nonexpert's hands when compared to the original and validation IOTA studies. The PR method was the more accurate test to diagnose ovarian cancer than either of the IOTA models.

Calculations of fission rate distribution in the core of WWER-1000 mock-up on the LR-0 reactor using alternative methods and comparison with results of measurements

International Nuclear Information System (INIS)

Zaritskiy, S.; Kovalishin, A.; Tsvetkov, T.; Rypar, V.; Svadlenkova, M.

2011-01-01

General review of experimental and calculation researches on WWER-440 and WWER-1000 mock-ups on the reactor LR-0 was introduced on the twentieth Symposium AER. The experimental core fission rate distribution was obtained by means of gamma-scanning of the fuel pins - 140La single peak (1596 keV) measurements and wide energy range (approximately 600-900 keV) measurements. Altogether from 260 to 500 fuel pins were scanned in different experiments. The measurements were arranged in the middle of the fuel (the active part of pin). Pin-to-pin calculations of the WWER-1000 mock-up core fission rate distribution were performed with several codes: Monte Carlo codes MCU-REA/2 and MCNPX with different nuclear data libraries, diffusion code RADAR (63 energy groups library) and code SVL based on Surface Harmonics Method (69 energy groups). Calculated data are compared with experimental ones. The obtained results allow developing the benchmark for core calculations methodologies, evaluating and validating source reliability for the out-of-core (inside and outside pressure vessel) neutron transport calculations. (Authors)

Unifying LL and LR parsing

NARCIS (Netherlands)

W.H.L.M. Pijls (Wim)

1993-01-01

textabstractIn parsing theory, LL parsing and LR parsing are regarded to be two distinct methods. In this paper the relation between these methods is clarified.As shown in literature on parsing theory, for every context-free grammar, a so-called non-deterministic LR(0) automaton can be constructed.

El genio maligno de Suárez: Suárez y Descartes

OpenAIRE

Baciero Ruiz, Francisco Tadeo

2007-01-01

[ES] Tradicionalmente se ha considerado la filosofía cartesiana como un comienzo casi absoluto en la historia de la Filosofía. Sin embargo, las conocidas hipótesis del “genio maligno” y del “Dios engañador”, parte fundamental del artificio de la “duda metódica” en las Meditaciones metafísicas, se encuentran en la Disputación metafísica 9 de Suárez (la única mención de Suárez en todo Descartes, precisamente en las “Respuestas” a las Meditaciones). Parece claro, a partir de la correspondencia d...

Renewable Energy Zone (REZ) Transmission Planning Process

Energy Technology Data Exchange (ETDEWEB)

Lee, Nathan [National Renewable Energy Laboratory (NREL), Golden, CO (United States)

2018-03-08

A REZ is a geographical area that enables the development of profitable, cost-effective, grid-connected renewable energy (RE). The REZ Transmission Planning Process is a proactive approach to plan, approve, and build transmission infrastructure connecting REZs to the power system which helps to increase the share of solar, wind and other RE resources in the power system while maintaining reliability and economics, and focuses on large-scale wind and solar resources that can be developed in sufficient quantities to warrant transmission system expansion and upgrades.

The hydration enthalpies of Md3+ and Lr3+

International Nuclear Information System (INIS)

Bruechle, W.; Schaedel, M.; Scherer, U.W.; Kratz, J.V.

1987-10-01

Lawrencium (3-min 260 Lr) and lighter actinides were produced in the bombardement of a 249 Bk target with 18 O ions and loaded onto a cation exchange column in 0.05 M α-hydroxy-isobutyrate solution at pH = 4.85 together with the radioactive lanthanide tracers 166 Ho, 171 Er, and 171 Tm. In elutions with 0.12 M α-hydroxy-isobutyrate solution (pH = 4.85) trivalent Lr was eluted exactly together with the Er tracer and Md close to Ho. Lr elutes much later than expected based on the known elution positions of the lighter actinides and the expected analogy to the elution positions of the homologous lanthanides. From the measured elution positions, ionic radii were calculated for Lr 3+ and Md 3+ . Semiempirical models allow the calculation of the heat of hydration from the ionic radii, resulting in ΔH hyd ≅ - 3654 kJ/mol for Md 3+ and ΔH hyd ≅ - 3689 kJ/mol for Lr 3+ . (orig.)

Antilisterial activity of a broad-spectrum bacteriocin, enterocin LR/6 from Enterococcus faecium LR/6.

Science.gov (United States)

Kumar, Manoj; Srivastava, Sheela

2010-10-01

Enterocin LR/6, a purified bacteriocin, exhibited broad inhibitory spectrum both against related as well as some food-borne pathogens such as Listeria monocytogenes, Yersinia enterocolitica, Aeromonas sp., Shigella sp., and Bacillus licheniformis. In this investigation, we have focused on L. monocytogenes as the target organism, as it is not only an important pathogen but can also survive over a wide range of environmental conditions such as refrigeration temperature, low pH, and high-salt concentration. This allows the pathogen to overcome many food preservation and safety barriers and poses a potential risk to human health. The enterocin LR/6 showed a bactericidal action against L. monocytogenes and completely inhibited the growth on agar plates, supplemented with 200 AU/ml of enterocin LR/6. The effectiveness of enterocin LR/6 in completely killing a population of acid-adapted (pH 5.2, 2 h) L. monocytogenes exposed to different temperatures (4-37 degrees C), pH (2.5-8.0), and osmotic (up to 30% NaCl) stress is reported here. This paper focuses on the key issue of killing of the acid-adapted L. monocytogenes cells under adverse environmental conditions.

Santiago Pérez: el dramaturgo

Directory of Open Access Journals (Sweden)

Marina Lamus Obregón

2001-09-01

Full Text Available La vida de Santiago Pérez como escritor de poemas y dramas fue muy corta y pertenece a sus años de juventud. En la edad madura esta incursión la consideró un pecado que lo hacía ruborizar: por ello compraba los libros editados por la generosidad de Lorenzo María Lleras y los quemaba. Y es que el "señorito" Santiago Pérez, alumno aventajado del colegio del Espíritu Santo y después profesor de literatura y filosofía, recibió también de su maestro, don Lorenzo María Lleras, influencia política, literaria y teatral.

Monitoring of microcystin-LR in Luvuvhu River catchment ...

African Journals Online (AJOL)

The main aim of this study is to assess the levels of microcystin-LR in Luvuvhu River catchment and to assess the physicochemical parameters that may promote the growth of cyanobacteria. The level of microcystin-LR in some of the sampling sites was <0.18 ìg/l except for one site (Luvuvhu River just before the confluence ...

RA-0 reactor. New neutronic calculations; Reactor RA-0. Nuevos calculos neutronicos

Energy Technology Data Exchange (ETDEWEB)

Rumis, D; Leszczynski, F

1991-12-31

An updating of the neutronic calculations performed at the RA-0 reactor, located at the Natural, Physical and Exact Sciences Faculty of Cordoba National University, are herein described. The techniques used for the calculation of a reactor like the RA-0 allows prediction in detail of the flux behaviour in the core`s interior and in the reflector, which will be helpful for experiments design. In particular, the use of WIMSD4 code to make calculations on the reactor implies a novelty in the possible applications of this code to solve the problems that arise in practice. (Author). [Espanol] En este trabajo se actualizan los calculos neutronicos realizados para el reactor RA-0, instalado en la Facultad de Ciencias Exactas, Fisicas y Naturales de la Universidad Nacional de Cordoba. Se describen los calculos realizados hasta la fecha y los resultados obtenidos. Las tecnicas incorporadas al calculo de un reactor como el RA-0 permiten predecir en detalle el comportamiento del flujo en el interior del nucleo y en el reflector, lo que sera una importante ayuda en el diseno de experimentos. En particular, el empleo del codigo WIMSD4 para calculos del reactor completo constituye una novedad en las posibles aplicaciones de ese codigo para resolver problemas que se presentan en la practica. (Autor).

Progress report '84

International Nuclear Information System (INIS)

Havelka, St.

1985-01-01

The most important achievements are summed up of the Nuclear Research Institute in Rez in 1984. They are as follows: mobile cementation lines for the disposal of liquid radioactive wastes, completion of the basic line for the reprocessing of spent fuel, reconstruction of the semi-hot cell for the production of thalium 210 Tl, the dummy experiment on the LR-0 reactor which made it possible to define the effect of neutron dose on the service life of a reactor pressure vessel; research was also carried out related to the nuclear safety of PWR reactors, to reactor physics, technology and materials, the fuel cycle, neutron activation analysis and neutron radiography. In the field of production and services there are research results in the manufacture of radiopharmaceuticals and semiconductor detectors, in standardization and in irradiation, computation and information services. Also mentioned is the fulfilment of the Institute's social programme. (M.D.)

MSR - SPHINX concept program Eros (Experimental zero power Salt reactor SR-0) - The proposed experimental program as a basis for validation of reactor physics methods

Energy Technology Data Exchange (ETDEWEB)

Hron, M.; Juricek, V.; Kyncl, J.; Mikisek, M.; Rypar, V. [Nuclear Research Institute Rez plc, Rez (Czech Republic)

2007-07-01

The Molten Salt Reactor (MSR) - SPHINX (SPent Hot fuel Incinerator by Neutron fluX) concept solves this principal problem of spent fuel treatment by means of so-called nuclear incineration. It means the burning of fissionable part of its inventory and transmutation of other problematic radionuclides by use of nuclear reactions with neutrons in a MSR-SPHINX system. This reactor system is an actinide burner (most in resonance neutron spectrum) and a radionuclide transmuter in a well-thermalized neutron spectrum. In the frame of the physical part, there are computational analyses and experimental activities. The experimental program has been focused, in its first stage, on a short-term irradiation of small size samples of molten-salt systems as well as structural materials proposed for the MSR blanket in the field of high neutron flux of research reactors. The proposed next stage of the program will focus on a large-scale experimental verification of design inputs by use of MSR-type inserting zones into the existing light water moderated experimental reactor LR-0, which may allow us to modify it into the experimental zero power salt reactor SR-0. There will be a detail description of the proposed program given in the paper together with the so far performed experiments and their first results. These realized experiments help us also to verify computational codes used, and to recognize some anomalies related to molten fluorides utilization. (authors)

Vitoria y Suárez: el Derecho Internacional

Directory of Open Access Journals (Sweden)

Adolfo J. Sánchez Hidalgo

2017-09-01

Full Text Available Este artículo pretende mostrar la convivencia de dos estructuras de pensamiento en la escolástica española y, especialmente, en Suárez. Vitoria presenta una visión comunitaria del orden internacional y sus enseñanzas serán transmitidas a Suárez, quien, al contrario, presenta una visión societaria del orden internacional. Esta diferencia no es una casualidad, sino un auténtico cambio de paradigma en el sabio granadino, que hace de él un autor más próximo a la modernidad que a la tradición escolástica. Gracias a un estudio comparado mostraremos el punto de inflexión que supone Suárez en el tránsito hacia la modernidad y su idea de un orden mundial fundado en una sociedad de Estados.

Microcystin-LR Induced Immunotoxicity in Mammals

Directory of Open Access Journals (Sweden)

Yaqoob Lone

2016-01-01

Full Text Available Microcystins are toxic molecules produced by cyanobacterial blooms due to water eutrophication. Exposure to microcystins is a global health problem because of its association with various other pathological effects and people all over the world are exposed to microcystins on a regular basis. Evidence shows that microcystin-LR (MC-LR may adversely affect the immune system, but its specific effects on immune functions are lacking. In the present review, immunotoxicological effects associated with MC-LR in animals, humans, and in vitro models have been reported. Overall, the data shows that chronic exposure to MC-LR has the potential to impair vital immune responses which could lead to increased risk of various diseases including cancers. Studies in animal and in vitro models have provided some pivotal understanding into the potential mechanisms of MC-LR related immunotoxicity suggesting that further investigation, particularly in humans, is required to better understand the relationship between development of disease and the MC-LR exposure.

Technical Potential Assessment for the Renewable Energy Zone (REZ) Process: A GIS-Based Approach

Energy Technology Data Exchange (ETDEWEB)

Lee, Nathan [National Renewable Energy Laboratory (NREL), Golden, CO (United States); Roberts, Billy J [National Renewable Energy Laboratory (NREL), Golden, CO (United States)

2018-04-05

Geographic Information Systems (GIS)-based energy resource and technical potential assessments identify areas capable of supporting high levels of renewable energy (RE) development as part of a Renewable Energy Zone (REZ) Transmission Planning process. This document expands on the REZ Process to aid practitioners in conducting GIS-based RE resource and technical potential assessments. The REZ process is an approach to plan, approve, and build transmission infrastructure that connects REZs - geographic areas that have high-quality RE resources, suitable topography and land-use designations, and demonstrated developer interest - to the power system. The REZ process helps to increase the share of solar photovoltaic (PV), wind, and other resources while also maintaining reliability and economics.

Oxidação de microcistinas-LR em águas pelo íon ferrato(VI Aqueous oxidation of microcystin-LR by ferrate(VI

Directory of Open Access Journals (Sweden)

Sérgio João de Luca

2010-03-01

Full Text Available Toxinas de cianobactérias têm se tornado um grave problema na produção segura de água para consumo humano e animal. Técnicas convencionais de tratamento falham em atingir padrões de potabilidade. O ferrato(VI de potássio, um composto oxidante e coagulante, mostra potencialidade no tratamento de águas contaminadas. Neste trabalho, são apresentados resultados da oxidação pelo ferrato(VI de uma toxina gerada por cianobactérias, a microcistina-LR. Ensaios de cinética de oxidação e de teste de jarros mostram um valor médio de 0,012 min-1 para a constante de taxa de reação de pseudoprimeira ordem, para concentrações de MC-LR de 100 a 200 µg.L-1 na água bruta. Dosagens de 1,6 a 5,0 mg.L-1 de ferrato(VI sugerem o atendimento ao padrão de potabilidade para microcistinas, mostrando que o oxidante poderá ser empregado como coadjuvante no tratamento de água.Algae toxins are becoming a severe problem in the water treatment industry, especially for human and animal consumption. Traditional treatment processes have failed in complying with water supply standards. Potassium ferrate(VI is a powerful oxidant, disinfectant and, also, a coagulant. In this paper, the results of microcystin-LR oxidation by ferrate(VI ion are presented. Kinetic and jar tests showed a average value of 0,012 min-1 for the pseudo first order reaction rate constant, for 100 and 200 µg.L-1 concentration of MC-LR. Ferrate(VI dosages between 1.6 and 5.0 mg.L-1 suggest that water supply standards for MC-LR can be reached, which means that the oxidant may be employed as coadjuvant in water treatment.

Measurement with SR-0 experimental modules of the SPHINX nuclear transmutation system. Variants 2008

International Nuclear Information System (INIS)

Rypar, Vojtech; Juricek, Vlastimil; Svadlenkova, Marie; Heraltova, Lenka; Viererbl, Ladislav; Lahodova, Zdena

2008-12-01

Experiments were performed with two LR-0 rector core arrangements and 3 variants of SR-0 insertion modules with a view to establishing the critical parameters of the reactor cores for the 3 module variants comprising different materials and different numbers of LR-0 fuel pins. The effect of the materials on the photon dose distribution and, on the axial and radial neutron field distributions (via 140 Ba and 140 La activities) was examined and the reaction rate distribution of activation foils inside the experimental module was measured

Renewable Energy Zone (REZ) Transmission Planning Process: A Guidebook for Practitioners

Energy Technology Data Exchange (ETDEWEB)

Lee, Nathan [National Renewable Energy Laboratory (NREL), Golden, CO (United States); Flores-Espino, Francisco [National Renewable Energy Laboratory (NREL), Golden, CO (United States); Hurlbut, David J. [National Renewable Energy Laboratory (NREL), Golden, CO (United States)

2017-09-05

Achieving clean energy goals may require new investments in transmission, especially if planners anticipate economic growth and increased demand for electricity. The renewable energy zone (REZ) transmission planning process can help policymakers ensure their infrastructure investments achieve national goals in the most economical manner. Policymakers, planners, and system operators around the world have used variations of the REZ process to chart the expansion of their transmission networks and overcome the barriers of traditional transmission planning. This guidebook seeks to help power system planners, key decision makers, and stakeholders understand and use the REZ transmission planning process to integrate transmission expansion planning and renewable energy generation planning.

Detoxification of microcystin-LR in water by Portulaca oleracea cv.

Science.gov (United States)

Isobe, Takatoshi; Okuhata, Hiroshi; Miyasaka, Hitoshi; Jeon, Bong-Seok; Park, Ho-Dong

2014-03-01

Microcystin-LR (0.02 μg/ml) in the hydroculture medium of Portulaca oleracea cv., became below the detection level (<0.0001 μg/ml) by HPLC analysis after 7 days. The toxicity of microcystin estimated with protein phosphatase inhibition assay, however, remained at 37% of the initial level, indicating that microcystin-LR was transformed by P. oleracea cv. into unknown compound(s) of lower toxicity. Copyright © 2013 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

Solving LR Conflicts Through Context Aware Scanning

Science.gov (United States)

Leon, C. Rodriguez; Forte, L. Garcia

2011-09-01

This paper presents a new algorithm to compute the exact list of tokens expected by any LR syntax analyzer at any point of the scanning process. The lexer can, at any time, compute the exact list of valid tokens to return only tokens in this set. In the case than more than one matching token is in the valid set, the lexer can resort to a nested LR parser to disambiguate. Allowing nested LR parsing requires some slight modifications when building the LR parsing tables. We also show how LR parsers can parse conflictive and inherently ambiguous languages using a combination of nested parsing and context aware scanning. These expanded lexical analyzers can be generated from high level specifications.

Neutron and photon spectrometry in mixed radiation fields

International Nuclear Information System (INIS)

Jancar, A.; Kopecky, Z.; Veskrna, M.

2014-01-01

Spectrometric measurements of the mixed fields of neutron and photon radiation in the workplaces with the L-R-0 research reactor located in the UJV Rez and with the Van de Graaff accelerator, located in the UTEF laboratories Prague, are presented in this paper. The experimental spectrometric measurements were performed using a newly developed digital measuring system, based on the technology of analog-digital converters with a very high sampling frequency (up to 2 GHz), in connection with organic scintillation detector, type BC-501A, and stilbene detector. The results of experimental measurements show high quality of spectrometry mixed fields of neutron and photon radiation across the wide dynamic range of measured energy. (authors)

Characterization of plastic nuclear track detectors on solid state, CR-39 and LR-115 and its possibilities application on thermal and fast neutron dosimetry

International Nuclear Information System (INIS)

Vallejo Delgado, L.R.

1989-01-01

This work is an study about the use feasibility of plastic nuclear track detectors, LR 115, II-B (of Eastmann Kodak Co) and CR-39 (of American Acrylics and Plastics), for thermal and fast neutron dosimetry, respectively. The LR-115 with converter (n, alpha) was exposed to thermal neutrons with energy of 0,046 e V, proceeding from nuclear reactor RECH-1 of Nuclear Energy Chilean Commission. The irradiated films were submited to a chemical etching with NaOH, plus a washing and brushing. The CR-39 with polyethylene irradiator, was exposed to fast neutrons proceeding of calibrated sources of Am-Se. The irradiated plates were submited to a chemical pre-etching with KOH and a electrochemical post-etching. (author)

Sindicatos en Ciudad Juárez: Historia y debilidad sindical

Directory of Open Access Journals (Sweden)

Cirila Quintero Ramírez

1996-01-01

Full Text Available This work analyzes the evolution of the labor unions in Ciudad Juárez for three decades of the maquiladora industry. Postulates as a main idea, the existence of a weakening of the labor unions in the rnaquiladoras as a consequence of two central factors: the absence of a labor union trajectory in the region, and the persistence of economical activities in Ciudad Juárez that depend on the American economy, and the existence of a factionalism inter and intralabor union in the main workers associations in the city, that has permitted the defeal of not onIy the official movements, but the independent ones too. The weakening ol the labor union. has also conducted to a policy ol apathy, conformity, and ol high colaboration with the investors, that has tumed the labor unions in Ciudad Juárez into an expression of subordinated labor unions, that legitimates their perrnanency in the rnaquiladoras are mostly to their link with investors than with their members. This article allows us to see two future sceneries in the city ol Ciudad Juárez: the accentuation of this kind of behavior in labor unions, or the disappearance ol labor unions in the maquiladoras.

SIMÓN TALAVERA SUÁREZ [Material gráfico

OpenAIRE

Anonymous

2002-01-01

RETRATO DE SIMÓN TALAVERA SUÁREZ CON UN ENJAMBRE DE ABEJAS, EN CORRALILLOS. SIMÓN TALAVERA SUÁREZ LLEVA DESDE LOS 7 AÑOS EN EL OFICIO DE APICULTOR, SE TRATA DE UNA TRADICIÓN FAMILIAR. LA APICULTURA O EL CULTIVO DE ABEJAS ES UNA ACTIVIDAD AGROPECUARIA ORIENTADA A LA CRIANZA ABEJAS Y A PRESTARLES LOS CUIDADOS NECESARIOS CON EL OBJETO DE OBTENER LOS PRODUCTOS QUE SON CAPACES DE ELABORAR Y RECOLECTAR. Copia digital. Madrid : Ministerio de Educación, Cultura y Deporte. Subdirección Gener...

Decommissioning of evaporation technology for processing liquid radioactive waste in UJV Rez, a. s

International Nuclear Information System (INIS)

Tous, M.; Otcovsky, T.; Podlaha, J.

2015-01-01

The UJV Rez, a. s. is the main leader in processing institutional radioactive waste (RAW) in the Czech Republic and the Waste Management Department has been established since the research reactor VVR-S (now LVR-15) was put in operation. Due to the large activities in nuclear research and engineering in the past, a big capacity of waste management technologies was needed. The low pressure compactor for volume reduction of solid RAW, as well as chemical pre-treatment technology of liquid RAW were installed and later the evaporation technology for effective processing the liquid RAW with the cementation and bituminization unit for final conditioning of concentrated liquid RAW were used. During the years of research reactor operation and research activities in UJV Rez, a. s. there were two installed evaporation technologies in row. After the latest evaporator lifetime, changes in liquid RAW production and together with higher decontamination factor requirements, this technology was decided to be decommissioned. The decommissioned evaporation technology was installed and put in operation in 1991. This technology was used for processing liquid aqueous RAW produced from internal research activities and of course for external producers and institutions (e.g. universities, medicine, research institutes, industry). The approved decommissioning plan was prepared and the licence for immediate decommissioning was obtained in 2012. Then the decommissioning project started. The preparing stages as dosimetric survey, expected material balance and of course initial decontamination activities were performed. Evaporation technology dismantling and processing the arising RAW were done by the internal staff of Waste Management Department. The total volume of produced RAW was 49,5 m 3 of RAW. The secondary liquid RAW (from decontamination) of amount 1,4 m 3 , contaminated sludge of amount 0,5 m 3 , solid RAW (construction steel) of amount 39,1 m 3 , solid compressible RAW (protective

Comprehensive insights into microcystin-LR effects on hepatic lipid metabolism using cross-omics technologies

International Nuclear Information System (INIS)

Zhang, Zongyao; Zhang, Xu-Xiang; Wu, Bing; Yin, Jinbao; Yu, Yunjiang; Yang, Liuyan

2016-01-01

Highlights: • Use of cross-omics technologies to evaluate toxic effects of microcystin-LR. • Disturbance of hepatic lipid metabolism by oral exposure to microcystin-LR. • Crucial roles of gut microbial community shift in the metabolic disturbance induced by microcystin-LR. - Abstract: Microcystin-LR (MC-LR) can induce hepatic tissue damages and molecular toxicities, but its effects on lipid metabolism remain unknown. This study investigated the effects of MC-LR exposure on mice lipid metabolism and uncovered the underlying mechanism through metabonomic, transcriptomic and metagenomic analyses after administration of mice with MC-LR by gavage for 28 d. Increased liver weight and abdominal fat weight, and evident hepatic lipid vacuoles accumulation were observed in the mice fed with 0.2 mg/kg/d MC-LR. Serum nuclear magnetic resonance analysis showed that MC-LR treatment altered the levels of serum metabolites including triglyceride, unsaturated fatty acid (UFA) and very low density lipoprotein. Digital Gene Expression technology was used to reveal differential expression of hepatic transcriptomes, demonstrating that MC-LR treatment disturbed hepatic UFA biosynthesis and activated peroxisome proliferator-activated receptor (PPAR) signaling pathways via Pparγ, Fabp1 and Fabp2 over-expression. Metagenomic analyses of gut microbiota revealed that MC-LR exposure also increased abundant ratio of Firmicutes vs. Bacteroidetes in gut and altered biosynthetic pathways of various microbial metabolic and pro-inflammatory molecules. In conclusion, oral MC-LR exposure can induce hepatic lipid metabolism disorder mediated by UFA biosynthesis and PPAR activation, and gut microbial community shift may play an important role in the metabolic disturbance.

Comprehensive insights into microcystin-LR effects on hepatic lipid metabolism using cross-omics technologies

Energy Technology Data Exchange (ETDEWEB)

Zhang, Zongyao [State Key Laboratory of Pollution Control and Resource Reuse, School of the Environment, Nanjing University, Nanjing 210023 (China); Center for Environmental Health Research, South China Institute of Environmental Sciences, The Ministry of Environmental Protection of PRC, Guangzhou 510655 (China); Zhang, Xu-Xiang, E-mail: zhangxx@nju.edu.cn [State Key Laboratory of Pollution Control and Resource Reuse, School of the Environment, Nanjing University, Nanjing 210023 (China); Wu, Bing; Yin, Jinbao [State Key Laboratory of Pollution Control and Resource Reuse, School of the Environment, Nanjing University, Nanjing 210023 (China); Yu, Yunjiang [Center for Environmental Health Research, South China Institute of Environmental Sciences, The Ministry of Environmental Protection of PRC, Guangzhou 510655 (China); Yang, Liuyan, E-mail: yangly@nju.edu.cn [State Key Laboratory of Pollution Control and Resource Reuse, School of the Environment, Nanjing University, Nanjing 210023 (China)

2016-09-05

Highlights: • Use of cross-omics technologies to evaluate toxic effects of microcystin-LR. • Disturbance of hepatic lipid metabolism by oral exposure to microcystin-LR. • Crucial roles of gut microbial community shift in the metabolic disturbance induced by microcystin-LR. - Abstract: Microcystin-LR (MC-LR) can induce hepatic tissue damages and molecular toxicities, but its effects on lipid metabolism remain unknown. This study investigated the effects of MC-LR exposure on mice lipid metabolism and uncovered the underlying mechanism through metabonomic, transcriptomic and metagenomic analyses after administration of mice with MC-LR by gavage for 28 d. Increased liver weight and abdominal fat weight, and evident hepatic lipid vacuoles accumulation were observed in the mice fed with 0.2 mg/kg/d MC-LR. Serum nuclear magnetic resonance analysis showed that MC-LR treatment altered the levels of serum metabolites including triglyceride, unsaturated fatty acid (UFA) and very low density lipoprotein. Digital Gene Expression technology was used to reveal differential expression of hepatic transcriptomes, demonstrating that MC-LR treatment disturbed hepatic UFA biosynthesis and activated peroxisome proliferator-activated receptor (PPAR) signaling pathways via Pparγ, Fabp1 and Fabp2 over-expression. Metagenomic analyses of gut microbiota revealed that MC-LR exposure also increased abundant ratio of Firmicutes vs. Bacteroidetes in gut and altered biosynthetic pathways of various microbial metabolic and pro-inflammatory molecules. In conclusion, oral MC-LR exposure can induce hepatic lipid metabolism disorder mediated by UFA biosynthesis and PPAR activation, and gut microbial community shift may play an important role in the metabolic disturbance.

Dynamics of Total Microcystin LR Concentration in Three Subtropical Hydroelectric Generation Reservoirs in Uruguay, South America.

Science.gov (United States)

González-Piana, Mauricio; Fabián, Daniel; Piccardo, Andrea; Chalar, Guillermo

2017-10-01

This study analyzed the temporal dynamics of total microcystin LR concentrations between the years of 2012 and 2015 in the Bonete, Baygorria and Palmar hydroelectric generation reservoirs in the central region of the Negro River, Uruguay. The three reservoirs showed differents total microcystin LR concentration, with no significant differences among them. Over 20 sampling dates, the three reservoirs exhibited total microcystin LR concentrations on eight occasions that corresponded to a slight to moderate human health risk according to WHO guideline values for recreational waters. By determining the concentration of microcystin LR in cyanobacterial biomass, we identified cyanobacterial populations that occurred over time with varying degrees of toxin production (maximal 85.4 µg/mm 3 ). The microcystin LR concentration in Bonete was positively correlated with temperature (r = 0.587) and cyanobacterial biomass (r = 0.736), in Baygorria with cyanobacterial biomass (r = 0.521), and in Palmar with temperature (r = 0.500) and negatively correlated with ammonia (r = -0.492). Action is needed to reduce the presence of toxic cyanobacteria in these systems. A decrease in the use of agrochemicals and management changes in the reservoir basins could be successful long-term measures.

LR: Compact connectivity representation for triangle meshes

Energy Technology Data Exchange (ETDEWEB)

Gurung, T; Luffel, M; Lindstrom, P; Rossignac, J

2011-01-28

We propose LR (Laced Ring) - a simple data structure for representing the connectivity of manifold triangle meshes. LR provides the option to store on average either 1.08 references per triangle or 26.2 bits per triangle. Its construction, from an input mesh that supports constant-time adjacency queries, has linear space and time complexity, and involves ordering most vertices along a nearly-Hamiltonian cycle. LR is best suited for applications that process meshes with fixed connectivity, as any changes to the connectivity require the data structure to be rebuilt. We provide an implementation of the set of standard random-access, constant-time operators for traversing a mesh, and show that LR often saves both space and traversal time over competing representations.

Homogeneous time-resolved fluoroimmunoassay of microcystin-LR using layered WS2 nanosheets as a transducer

Science.gov (United States)

Qin, Xiaodan; Wang, Yuanxiu; Song, Bo; Wang, Xin; Ma, Hua; Yuan, Jingli

2017-06-01

A homogeneous time-resolved fluoroimmunoassay method for rapid and sensitive detection of microcystin-LR (MC-LR) in water samples was developed based on the interaction between water-soluble WS2 nanosheets and the conjugate of MC-LR with a luminescent Eu3+ complex BHHBCB-Eu3+ (BHHBCB: 1,2-bis[4‧-(1″,1″,1″,2″,2″,3″,3″-heptafluoro-4″,6″-hexanedion-6″-yl)- benzyl]-4-chlorosulfobenzene). The large lateral dimensions and high surface areas of two-dimensional layered WS2 nanosheets enable easy adsorption of the MC-LR-BHHBCB-Eu3+ conjugate, that lead to efficient quenching of the luminescence of Eu3+ complex via energy transfer or electron transfer process. However, the addition of monoclonal anti-MC-LR antibody can induce the formation of MC-LR-BHHBCB-Eu3+/antibody immune complex, which prevents the interaction between WS2 nanosheets and MC-LR-BHHBCB-Eu3+ to result in the restoration of Eu3+ luminescence. This signal transduction mechanism made it possible for analysis of the target MC-LR in a homogeneous system. The present method has advantages of rapidity and simplicity since the B/F (bound reagent/free reagent) separation steps, the solid-phase carrier and antibody labeling or modification process are not necessary. The proposed immunosensing system displayed a wide linear range, good precision and accuracy, and comparable sensitivity with a detection limit of 0.3 μg l-1, which satisfied the World Health Organization (WHO) provisional guideline limit of 1.0 μg l-1 for MC-LR in drinking water.

Suárez on the Lower External Senses

Czech Academy of Sciences Publication Activity Database

Heider, Daniel

2016-01-01

Roč. 64, Suppl. (2016), s. 81-102 ISSN 0015-1831 Institutional support: RVO:67985955 Keywords : Suárez * Aristotle * the lower external senses * sensible species Subject RIV: AA - Philosophy ; Religion

Short communication: Emergence of a new race of leaf rust with combined virulence to Lr14a and Lr72 genes on durum wheat

Energy Technology Data Exchange (ETDEWEB)

Soleiman, N.H; Solis, I.; Soliman, M.H.; Sillero, J.C.; Villegas, D.; Alvaro, F.; Royo, C.; Serra, J.; Ammar, K.; Martínez-Moreno, F.

2016-11-01

Leaf rust is a foliar disease caused by the fungus Puccinia triticina that may severely reduce durum wheat yield. Resistance to this pathogen is common in modern durum germplasm but is frequently based on Lr72 and Lr14a. After accounts of races with virulence to Lr14a gene in France in 2000, the present study reports the detection in 2013 for the first time of a new race with virulence to Lr14a and Lr72. The aim of this work was to characterize the virulence pattern of four Spanish isolates with virulence to Lr14a, and to discuss the consequences of this presence. Rusted leaves from cultivars ‘Don Jaime’ (Lr14a) and ‘Gallareta’ (Lr72) were collected in 2013 in the field at two Spanish sites, one in the south (near Cadiz) and another in the north (near Girona). Spores from single pustule for each cultivar and site were multiplied on susceptible cultivar ‘Don Rafael’. Then, the four isolates were inoculated on a set of 19 isogenic lines Thatcher to characterize their virulence spectrum. All isolates presented the same virulence pattern. They were virulent on both Lr14a and Lr72 and the race was named DBB/BS. This race was very similar to those reported in 2009-11, but with added virulence to Lr14a. The resistance based on Lr14a has therefore been overcome in Spain, by a new race that has likely emerged via stepwise mutation from the local predominating races. This information is important to guide breeders in their breeding programmes and gene deployment strategies. (Author)

Molecular and analysis of a phenylalanine ammonia-lyase gene (LrPAL2) from Lycoris radiata.

Science.gov (United States)

Jiang, Yumei; Xia, Bing; Liang, Lijian; Li, Xiaodan; Xu, Sheng; Peng, Feng; Wang, Ren

2013-03-01

Phenylalanine ammonia-lyase (PAL), the first enzyme of phenylpropanoid biosynthesis, participates in the biosynthesis of flavonoids, lignins, stilbenes and many other compounds. In this study, we cloned a 2,326 bp full-length PAL2 gene from Lycoris radiata by using degenerate oligonucleotide primer PCR (DOP-PCR) and the rapid amplification of cDNA ends method. The cDNA contains a 2,124 bp coding region encoding 707 amino acids. The LrPAL2 shares about 77.0 % nucleic acid identity and 83 % amino acid identity with LrPAL1. Furthermore, genome sequence analysis demonstrated that LrPAL2 gene contains one intron and two exons. The 5' flanking sequence of LrPAL2 was also cloned by self-formed adaptor PCR (SEFA-PCR), and a group of putative cis-acting elements such as TATA box, CAAT box, G box, TC-rich repeats, CGTCA motif and TCA-element were identified. The LrPAL2 was detected in all tissues examined, with high abundance in bulbs at leaf sprouting stage and in petals at blooming stage. Besides, LrPAL2 drastically responded to MJ, SNP and UV, moderately responded to GA and SA, and a little increased under wounding. Comparison of LrPAL2 expression and LrPAL1 expression demonstrated that LrPAL2 can be more significantly induced than LrPAL1 under the above treatments, and LrPAL2 transcripts accumulated prominently at blooming stage, especially in petals, while LrPAL1 transcripts did not accumulated significantly at blooming stage. All these results suggested that LrPAL2 might play distinct roles in different branches of the phenylpropanoid pathway.

A simple highly sensitive and selective aptamer-based colorimetric sensor for environmental toxins microcystin-LR in water samples.

Science.gov (United States)

Li, Xiuyan; Cheng, Ruojie; Shi, Huijie; Tang, Bo; Xiao, Hanshuang; Zhao, Guohua

2016-03-05

A simple and highly sensitive aptamer-based colorimetric sensor was developed for selective detection of Microcystin-LR (MC-LR). The aptamer (ABA) was employed as recognition element which could bind MC-LR with high-affinity, while gold nanoparticles (AuNPs) worked as sensing materials whose plasma resonance absorption peaks red shifted upon binding of the targets at a high concentration of sodium chloride. With the addition of MC-LR, the random coil aptamer adsorbed on Au NPs altered into regulated structure to form MC-LR-aptamer complexes and broke away from the surface of Au NPs, leading to the aggregation of AuNPs, and the color converted from red to blue due to the interparticle plasmon coupling. Results showed that our aptamer-based colorimetric sensor exhibited rapid and sensitive detection performance for MC-LR with linear range from 0.5 nM to 7.5 μM and the detection limit reached 0.37 nM. Meanwhile, the pollutants usually coexisting with MC-LR in pollutant water samples had not demonstrated disturbance for detecting of MC-LR. The mechanism was also proposed suggesting that high affinity interaction between aptamer and MC-LR significantly enhanced the sensitivity and selectivity for MC-LR detection. Besides, the established method was utilized in analyzing real water samples and splendid sensitivity and selectivity were obtained as well. Copyright © 2015 Elsevier B.V. All rights reserved.

LRSYS, PASCAL LR(1) Parser Generator System

International Nuclear Information System (INIS)

O'Hair, K.

1991-01-01

Description of program or function: LRSYS is a complete LR(1) parser generator system written entirely in a portable subset of Pascal. The system, LRSYS, includes a grammar analyzer program (LR) which reads a context-free (BNF) grammar as input and produces LR(1) parsing tables as output, a lexical analyzer generator (LEX) which reads regular expressions created by the REG process as input and produces lexical tables as output, and various parser skeletons that get merged with the tables to produce complete parsers (SMAKE). Current parser skeletons include Pascal, FORTRAN 77, and C. In addition, the CRAY1, DEC VAX11 version contains LRLTRAN and CFT- FORTRAN 77 skeletons. Other language skeletons can easily be added to the system. LRSYS is based on the LR program (NESC Abstract 822)

Life-cycle exposure to microcystin-LR interferes with the reproductive endocrine system of male zebrafish.

Science.gov (United States)

Su, Yujing; Li, Li; Hou, Jie; Wu, Ning; Lin, Wang; Li, Guangyu

2016-06-01

Recently, MC-LR reproductive toxicity drew great attention. Limited information was available on endocrine-disrupting effects of MC-LR on the reproduction system in fish. In the present study, zebrafish hatchlings (5 d post-fertilization) were exposed to 0, 0.3, 3 and 30μg/L MC-LR for 90 d until they reached sexual maturity. Male zebrafish were selected, and changes in growth and developmental parameters, testicular histological structure as well as the levels of gonadal steroid hormones were studied along with the related-gene transcriptional responses in the hypothalamic-pituitary-gonadal axis (HPG-axis). The results, for the first time, show a life cycle exposure to MC-LR causes growth inhibition, testicular damage and delayed sperm maturation. A significant decrease in T/E2 ratio indicated that MC-LR disrupted sex steroid hormones balance. The changes in transcriptional responses of HPG-axis related genes revealed that MC-LR promoted the conversion of T to E2 in circulating blood. It was also noted that vtg1 mRNA expression in the liver was up-regulated, which implied that MC-LR could induce estrogenic-like effects at environmentally relevant concentrations and long-term exposure. Our findings indicated that a life cycle exposure to MC-LR causes endocrine disruption with organic and functional damage of the testis, which might compromise the quality of life for the survivors and pose a potent threat on fish reproduction and thus population dynamics in MCs-contaminated aquatic environments. Copyright © 2016 Elsevier B.V. All rights reserved.

Prospective evaluation of IOTA logistic regression models LR1 and LR2 in comparison with subjective pattern recognition for diagnosis of ovarian cancer in an outpatient setting.

Science.gov (United States)

Nunes, N; Ambler, G; Foo, X; Widschwendter, M; Jurkovic, D

2018-06-01

To determine whether International Ovarian Tumor Analysis (IOTA) logistic regression models LR1 and LR2 developed for the preoperative diagnosis of ovarian cancer could also be used to differentiate between benign and malignant adnexal tumors in the population of women attending gynecology outpatient clinics. This was a single-center prospective observational study of consecutive women attending our gynecological diagnostic outpatient unit, recruited between May 2009 and January 2012. All the women were first examined by a Level-II ultrasound operator. In those diagnosed with adnexal tumors, the IOTA-LR1/2 protocol was used to evaluate the masses. The LR1 and LR2 models were then used to assess the risk of malignancy. Subsequently, the women were also examined by a Level-III examiner, who used pattern recognition to differentiate between benign and malignant tumors. Women with an ultrasound diagnosis of malignancy were offered surgery, while asymptomatic women with presumed benign lesions were offered conservative management with a minimum follow-up of 12 months. The initial diagnosis was compared with two reference standards: histological findings and/or a comparative assessment of tumor morphology on follow-up ultrasound scans. All women for whom the tumor classification on follow-up changed from benign to malignant were offered surgery. In the final analysis, 489 women who had either or both of the reference standards were included. Their mean age was 50 years (range, 16-91 years) and 45% were postmenopausal. Of the included women, 342/489 (69.9%) had surgery and 147/489 (30.1%) were managed conservatively. The malignancy rate was 137/489 (28.0%). Overall, sensitivities of LR1 and LR2 for the diagnosis of malignancy were 97.1% (95% CI, 92.7-99.2%) and 94.9% (95% CI, 89.8-97.9%) and specificities were 77.3% (95% CI, 72.5-81.5%) and 76.7% (95% CI, 71.9-81.0%), respectively (P > 0.05). In comparison with pattern recognition (sensitivity 94.2% (95% CI, 88

Consideraciones sobre Infortunios de Alonso Ramírez

Directory of Open Access Journals (Sweden)

Leonor Taiano

2010-12-01

Full Text Available This article attempts to provide new perspectives for approaching the study of Infortunios de Alonso Ramírez. Several researches about the text have given to Sigüenza y Góngora a character of strangeness to it, which would reduce him to the role of mere amanuensis, indicating that the discursive elaboration belongs to Ramirez. In view of that, I have performed a textual analysis, supported on the book's title and the final passage of the account, that I consider important elements that can offer a new perception on this issue. I base my research, additionally, on the study of its context of publication under the patronage of the New Spain viceroy, as well as the similarities of Infortunios de Alonso Ramírez with other contemporary texts.

Characteristics of UV-MicroO3 Reactor and Its Application to Microcystins Degradation during Surface Water Treatment

Directory of Open Access Journals (Sweden)

Guangcan Zhu

2015-01-01

Full Text Available The UV-ozone (UV-O3 process is not widely applied in wastewater and potable water treatment partly for the relatively high cost since complicated UV radiation and ozone generating systems are utilized. The UV-microozone (UV-microO3, a new advanced process that can solve the abovementioned problems, was introduced in this study. The effects of air flux, air pressure, and air humidity on generation and concentration of O3 in UV-microO3 reactor were investigated. The utilization of this UV-microO3 reactor in microcystins (MCs degradation was also carried out. Experimental results indicated that the optimum air flux in the reactor equipped with 37 mm diameter quartz tube was determined to be 18∼25 L/h for efficient O3 generation. The air pressure and humidity in UV-microO3 reactor should be low enough in order to get optimum O3 output. Moreover, microcystin-RR, YR, and LR (MC-RR, MC-YR, and MC-LR could be degraded effectively by UV-microO3 process. The degradation of different MCs was characterized by first-order reaction kinetics. The pseudofirst-order kinetic constants for MC-RR, MC-YR, and MC-LR degradation were 0.0093, 0.0215, and 0.0286 min−1, respectively. Glucose had no influence on MC degradation through UV-microO3. The UV-microO3 process is hence recommended as a suitable advanced treatment method for dissolved MCs degradation.

Effects of microcystin-LR, cylindrospermopsin and a microcystin-LR/cylindrospermopsin mixture on growth, oxidative stress and mineral content in lettuce plants (Lactuca sativa L.).

Science.gov (United States)

Freitas, Marisa; Azevedo, Joana; Pinto, Edgar; Neves, Joana; Campos, Alexandre; Vasconcelos, Vitor

2015-06-01

Toxic cyanobacterial blooms are documented worldwide as an emerging environmental concern. Recent studies support the hypothesis that microcystin-LR (MC-LR) and cylindrospermopsin (CYN) produce toxic effects in crop plants. Lettuce (Lactuca sativa L.) is an important commercial leafy vegetable that supplies essential elements for human nutrition; thus, the study of its sensitivity to MC-LR, CYN and a MC-LR/CYN mixture is of major relevance. This study aimed to assess the effects of environmentally relevant concentrations (1, 10 and 100 µg/L) of MC-LR, CYN and a MC-LR/CYN mixture on growth, antioxidant defense system and mineral content in lettuce plants. In almost all treatments, an increase in root fresh weight was obtained; however, the fresh weight of leaves was significantly decreased in plants exposed to 100 µg/L concentrations of each toxin and the toxin mixture. Overall, GST activity was significantly increased in roots, contrary to GPx activity, which decreased in roots and leaves. The mineral content in lettuce leaves changed due to its exposure to cyanotoxins; in general, the mineral content decreased with MC-LR and increased with CYN, and apparently these effects are time and concentration-dependent. The effects of the MC-LR/CYN mixture were almost always similar to the single cyanotoxins, although MC-LR seems to be more toxic than CYN. Our results suggest that lettuce plants in non-early stages of development are able to cope with lower concentrations of MC-LR, CYN and the MC-LR/CYN mixture; however, higher concentrations (100 µg/L) can affect both lettuce yield and nutritional quality. Copyright © 2015 Elsevier Inc. All rights reserved.

Microcystin-LR nanobody screening from an alpaca phage display nanobody library and its expression and application.

Science.gov (United States)

Xu, Chongxin; Yang, Ying; Liu, Liwen; Li, Jianhong; Liu, Xiaoqin; Zhang, Xiao; Liu, Yuan; Zhang, Cunzheng; Liu, Xianjin

2018-04-30

Microcystin-LR (MC-LR) is a type of biotoxin that pollutes the ecological environment and food. The study aimed to obtain new nanobodies from phage nanobody library for determination of MC-LR. The toxin was conjugated to keyhole limpet haemocyanin (KLH) and bovine serum albumin (BSA), respectively, then the conjugates were used as coated antigens for enrichment (coated MC-LR-KLH) and screening (coated MC-LR-BSA) of MC-LR phage nanobodies from an alpaca phage display nanobody library. The antigen-specific phage particles were enriched effectively with four rounds of biopanning. At the last round of enrichment, total 20 positive monoclonal phage nanobodies were obtained from the library, which were analyzed after monoclonal phage enzyme linked immunosorbent assay (ELISA), colony PCR and DNA sequencing. The most three positive nanobody genes, ANAb12, ANAb9 and ANAb7 were cloned into pET26b vector, then the nanobodies were expressed in Escherichia coli BL21 respectively. After being purified, the molecular weight (M.W.) of all nanobodies were approximate 15kDa with sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE). The purified nanobodies, ANAb12, ANAb9 and ANAb7 were used to establish the indirect competitive ELISA (IC-ELISA) for MC-LR, and their half-maximum inhibition concentrations (IC 50 ) were 0.87, 1.17 and 1.47μg/L, their detection limits (IC 10 ) were 0.06, 0.08 and 0.12μg/L, respectively. All of them showed strong cross-reactivity (CRs) of 82.7-116.9% for MC-RR, MC-YR and MC-WR, and weak CRs of less than 4.56% for MC-LW, less than 0.1% for MC-LY and MC-LF. It was found that all the IC-ELISAs for MC-LR spiked in tap water samples detection were with good accuracy, stability and repeatability, their recoveries were 84.0-106.5%, coefficient of variations (CVs) were 3.4-10.6%. These results showed that IC-ELISA based on the nanobodies from the alpaca phage display antibody library were promising for high sensitive determination of multiple

Microcystin-LR in surface water of Ponjavica river

Directory of Open Access Journals (Sweden)

Natić Dejan

2012-01-01

Full Text Available Background/Aim. Cyanobacterial toxins befall a group of various compounds according to chemical structure and health effects on people and animals. The most significant in this large group of compounds are microcystins. Their presence in water used for human consumption causes serious health problems, liver beeing the target organ. Microcystins are spread all over the world. Waterblooms of cyanobacterias and their cyanotoxins are also common in the majority of surface waters in Serbia. The aim of this study was to propose HPLC method for determination of mikrocystin-LR, to validate the method and to use it for determination of microcystin-LR in the surface water of the river Ponjavica. The Ponjavica is very eutrophic water and has ideal conditions for the cyanobacterial growth. Methods. Sample of water form the Ponjavica river were collected during the summer 2008. Coupled columns (HLB, Sep-Pak, were used for sample preparation and HPLC/PDA method was used for quantification of microcystin- LR. Results. Parameters of validation show that the proposed method is simple, fast, sensitive (0.1 mg/L and selective with the yield of 89%-92%. The measuring uncertainty of

A 3D graphene-based biosensor as an early microcystin-LR screening tool in sources of drinking water supply

International Nuclear Information System (INIS)

Zhang, Wei; Han, Changseok; Jia, Baoping; Saint, Christopher; Nadagouda, Mallikarjuna; Falaras, Polycarpos; Sygellou, Labrini; Vogiazi, Vasileia; Dionysiou, Dionysios D.

2017-01-01

Highlights: • 3D graphene-based biosensors can detect MC-LR with remarkable sensitivity. • Good linear correlation between electron-transfer resistance and MC-LR concentration. • A detection limit of 0.04 μg/L MC-LR was accomplished. - Abstract: Recent advances in graphene synthesis and understanding of properties have led to enormous applications in a variety of areas. Graphene and its unique electrical properties can favor electrochemical biosensor applications for aqueous toxin monitoring. Graphene-based biosensors can be used as an alternative to time-consuming, expensive and non-portable conventional methods of analysis involved in water quality monitoring and assessment. In this work, we showcased a three-dimensional (3D) graphene-based biosensor for microcystin-LR (MC-LR) detection and quantification. We report the efficient functionalization and immobilization of microcystin-LR and its antibodies on the facile synthesized CVD 3D graphene. The modified graphene electrodes were characterized by X-ray photoelectron spectroscopy and micro-Raman spectroscopy. Cyclic voltammetry and electrochemical impedance spectroscopy were used to electrochemically characterize the biochemical events on the electrodes. Specifically, as-prepared 3D graphene-based biosensors can detect MC-LR with remarkable sensitivity due to its macro-porous structure and large surface area, and high conductivity. A very good linear correlation of the electron-transfer resistance (R"2 = 0.93) was achieved over 0.05 and 20 μg/L MC-LR concentration range. Also, a detection limit of 0.05 μg/L was accomplished, which is much lower than the World Health Organization (WHO) provisional guideline limit of MC-LR concentration (i.e. 1 μg/L) in drinking water.

Effects of different algaecides on the photosynthetic capacity, cell integrity and microcystin-LR release of Microcystis aeruginosa

Energy Technology Data Exchange (ETDEWEB)

Zhou, Shiqing [State Key Laboratory of Pollution Control and Resource Reuse, Tongji University, Shanghai 200092 (China); Shao, Yisheng, E-mail: yishengshao@163.com [State Key Laboratory of Pollution Control and Resource Reuse, Tongji University, Shanghai 200092 (China); China Academy of Urban Planning and Design, Beijing 100037 (China); Gao, Naiyun [State Key Laboratory of Pollution Control and Resource Reuse, Tongji University, Shanghai 200092 (China); Deng, Yang [Department of Earth and Environmental Studies, Montclair State University, Montclair NJ 07043 (United States); Qiao, Junlian; Ou, Huase; Deng, Jing [State Key Laboratory of Pollution Control and Resource Reuse, Tongji University, Shanghai 200092 (China)

2013-10-01

Bench scale tests were conducted to study the effects of four common algaecides, including copper sulfate, hydrogen peroxide, diuron and ethyl 2-methylacetoacetate (EMA) on the photosynthetic capacity, cell integrity and microcystin-LR (MC-LR) release of Microcystis aeruginosa. The release of potassium (K{sup +}) from cell membrane during algaecide exposure was also analyzed. The three typical photosynthetic parameters, including the effective quantum yield (φ{sub e}), photosynthetic efficiency (α) and maximal electron transport rate (rETR{sub max}), were measured by a pulse amplitude modulated (PAM) fluorometry. Results showed that the photosynthetic capacity was all inhibited by the four algaecides, to different degrees, by limiting the energy capture in photosynthesis, and blocking the electron transfer chain in primary reaction. For example, at high diuron concentration (7.5 mg L{sup −1}), φ{sub e}, α and rETR{sub max} decreased from 0.46 to 0.19 (p < 0.01), from 0.20 to 0.01 (p < 0.01) μmol electrons m{sup −2} s{sup −1}/μmol photons m{sup −2} s{sup −1}, and from 160.7 to 0.1 (p < 0.001) μmol m{sup −2} s{sup −1} compared with the control group after 96 h of exposure, respectively. Furthermore, the increase of algaecide dose could lead to the cell lysis, as well as release of intracellular MC-LR that enhanced the accumulation of extracellular MC-LR. The order of MC-LR release potential for the four algaecides was CuSO{sub 4} > H{sub 2}O{sub 2} > diuron > EMA. Highlights: • PAM was used to investigate the effects of algaecides on Microcystis aeruginosa. • We estimate the release of potassium (K{sup +}) from cell membrane for cell lysis. • The risk of microcystin-LR release was evaluated after algaecides exposure. • The order of MC-LR release potential was copper sulfate > hydrogen peroxide > diuron > ethyl 2-methylacetoacetate.

Effect of calcium and magnesium on the antimicrobial action of enterocin LR/6 produced by Enterococcus faecium LR/6.

Science.gov (United States)

Kumar, Manoj; Srivastava, Sheela

2011-06-01

Enterococci are well-known producers of antimicrobial peptides (enterocins) that possess potential as biopreservatives in food. In this study, divalent cations and release of intracellular potassium were used to assess the mechanism of interaction and killing of enterocin LR/6 produced by Enterococcus faecium LR/6 on three target Gram-positive and Gram-negative bacteria, namely Micrococcus luteus, Enterococcus sp. strain LR/3 and Escherichia coli K-12. Whilst treatment with enterocin LR/6 in all cases led to a significant loss of viability, suggesting a bactericidal mode of action, E. coli K-12 showed better tolerance than the other two strains. Bacteriocins have generally been reported to create pores in the membrane of sensitive cells and this function is diminished by divalent cations. In this study it was shown that Ca(2+) and Mg(2+) markedly improved the viability of enterocin LR/6-treated cells in a concentration-dependent manner. K(+) release as a sign of membrane leakiness was higher in M. luteus compared with the other two test strains. In agreement with the viability response, pre-exposure to Ca(2+) and Mg(2+) substantially reduced the amount of K(+) leakage by M. luteus and Enterococcus sp.; in the case of E. coli K-12, no leakage of K(+) was recorded. These results suggest that enterocin LR/6, which possesses good antibacterial potential, may not be very effective as a preservative in foods containing high concentrations of calcium and magnesium. Copyright © 2011 Elsevier B.V. and the International Society of Chemotherapy. All rights reserved.

RA-0 reactor. New neutronic calculations

International Nuclear Information System (INIS)

Rumis, D.; Leszczynski, F.

1990-01-01

An updating of the neutronic calculations performed at the RA-0 reactor, located at the Natural, Physical and Exact Sciences Faculty of Cordoba National University, are herein described. The techniques used for the calculation of a reactor like the RA-0 allows prediction in detail of the flux behaviour in the core's interior and in the reflector, which will be helpful for experiments design. In particular, the use of WIMSD4 code to make calculations on the reactor implies a novelty in the possible applications of this code to solve the problems that arise in practice. (Author) [es

Ultrasound-based logistic regression model LR2 versus magnetic resonance imaging for discriminating between benign and malignant adnexal masses: a prospective study.

Science.gov (United States)

Shimada, Kanane; Matsumoto, Koji; Mimura, Takashi; Ishikawa, Tetsuya; Munechika, Jiro; Ohgiya, Yoshimitsu; Kushima, Miki; Hirose, Yusuke; Asami, Yuka; Iitsuka, Chiaki; Miyamoto, Shingo; Onuki, Mamiko; Tsunoda, Hajime; Matsuoka, Ryu; Ichizuka, Kiyotake; Sekizawa, Akihiko

2018-06-01

The diagnostic performances of the International Ovarian Tumor Analysis (IOTA) ultrasound-based logistic regression model (LR2) and magnetic resonance imaging (MRI) in discriminating between benign and malignant adnexal masses have not been directly compared in a single study. Using the IOTA LR2 model and subjective interpretation of MRI findings by experienced radiologists, 265 consecutive patients with adnexal masses were preoperatively evaluated in two hospitals between February 2014 and December 2015. Definitive histological diagnosis of excised tissues was used as a gold standard. From the 265 study subjects, 54 (20.4%) tumors were histologically diagnosed as malignant (including 11 borderline and 3 metastatic tumors). Preoperative diagnoses of malignant tumors showed 91.7% total agreement between IOTA LR2 and MRI, with a kappa value of 0.77 [95% confidence interval (CI), 0.68-0.86]. Sensitivity of IOTA LR2 (0.94, 95% CI, 0.85-0.98) for predicting malignant tumors was similar to that of MRI (0.96, 95% CI, 0.87-0.99; P = 0.99), whereas specificity of IOTA LR2 (0.98, 95% CI, 0.95-0.99) was significantly higher than that of MRI (0.91, 95% CI, 0.87-0.95; P = 0.002). Combined IOTA LR2 and MRI results gave the greatest sensitivity (1.00, 95% CI, 0.93-1.00) and had similar specificity (0.91, 95% CI, 0.86-0.94) to MRI. The IOTA LR2 model had a similar sensitivity to MRI for discriminating between benign and malignant tumors and a higher specificity compared with MRI. Our findings suggest that the IOTA LR2 model, either alone or in conjunction with MRI, should be included in preoperative evaluation of adnexal masses.

Approximate Solution of LR Fuzzy Sylvester Matrix Equations

Directory of Open Access Journals (Sweden)

Xiaobin Guo

2013-01-01

Full Text Available The fuzzy Sylvester matrix equation AX~+X~B=C~ in which A,B are m×m and n×n crisp matrices, respectively, and C~ is an m×n LR fuzzy numbers matrix is investigated. Based on the Kronecker product of matrices, we convert the fuzzy Sylvester matrix equation into an LR fuzzy linear system. Then we extend the fuzzy linear system into two systems of linear equations according to the arithmetic operations of LR fuzzy numbers. The fuzzy approximate solution of the original fuzzy matrix equation is obtained by solving the crisp linear systems. The existence condition of the LR fuzzy solution is also discussed. Some examples are given to illustrate the proposed method.

Ginés Pérez y su O Crux

Directory of Open Access Journals (Sweden)

Climent, José

2002-12-01

Full Text Available The exact names attributed to Ginés Pérez were never at all clear. His first appointment to the Cathedral in Valencia complicated matters even more when he was referred to with the Christian name of what appeared to be "Juan", which only added to the confusion as it lead us to believe that he was the only candidate to apply for that position. Today, however, we now know his true and full names: he was called Ginés Pérez de la Parra. We also know, for the first time, the exact date of his death. The quality of his compositions not only contributed to their popularity but gave rise to the works of other composers being attributed to him. The authorship of the majority of his compositions are considered anonymous, though they can be located in diverse archives. Even so, we cannot find a single copy of the O Crux attributed to his name, despite the numerous copies and their variants that abound in Region of Valencia.El nombre de Ginés Pérez nunca ha tenido la claridad de debía. Su primer nombramiento en la catedral de Valencia ya lo confunde añadiéndole el “Juan” lo que ya siembra confusión, además de sugerirnos que, posiblemente, fue llamado para ocupar el puesto sin oposición. Hoy conocemos toda su filiación: Ginés Pérez de la Parra, así como la fecha de su muerte, totalmente equivocada hasta ahora. La valía de sus composiciones motivó, además de la difusión de su obra, la atribución de composiciones de otros autores. La mayor parte de sus composiciones constan como "anónimos", si bien pueden encontrarse en distintos archivos. Del presente O crux, sin embargo, no hemos podido encontrar ninguna copia con su nombre, pese a las múltiples copias, con sus variantes, existentes en la Comunidad Valenciana.

Santiago Pérez Triana

Directory of Open Access Journals (Sweden)

Sergio Elías Ortíz

1958-09-01

Full Text Available El nombre de Santiago Pérez Triana, aunque suena en el ambiente colombiano, algunas veces confundido con el de su ilustre padre, como el de un escritor notable y hasta como un orador de fama internacional, no se lo conoce, a nuestro juicio, en todo lo que vale y pesa, no digamos en el dominio de las letras castellanas, pero ni siquiera en su propia patria de origen, excepto en pequeño círculo intelectuales capacitado para valorar a conciencia los quilates de pensador de este hombre prodigioso que paseó su inteligencia sobre temas, diversos , con capacidad múltiple, e ilustración inagotable.

Combined toxicity of microcystin-LR and copper on lettuce (Lactuca sativa L.).

Science.gov (United States)

Cao, Qing; Steinman, Alan D; Wan, Xiang; Xie, Liqiang

2018-05-10

Microcystins and copper commonly co-exist in the natural environment, but their combined toxicity remains unclear, especially in terrestrial plants. The present study investigated the toxicity effects of microcystin-LR (0, 5, 50, 500, 1000 μg L -1 ) and copper (0, 50, 500, 1000, 2000 μg L -1 ), both individually and in mixture, on the germination, growth and oxidative response of lettuce. The bioaccumulation of microcystin-LR and copper was also evaluated. Results showed that the decrease in lettuce germination induced by copper alone was not significantly different from that induced by the mixture, and the combined toxicity assessment showed a simple additive effect. Lettuce growth was not significantly reduced by microcystin-LR alone, whereas it was significantly reduced by copper alone and the mixture when copper concentration was higher than 500 μg L -1 . High concentrations of microcystin-LR (1000 μg L -1 ) and copper (≥50 μg L -1 ),as well as their mixture (≥50 + 500 μg L -1 ), induced oxidative stress in lettuce. A synergistic effect on the growth and antioxidative system of lettuce was observed when exposed to low concentrations of the mixture (≤50 + 500 μg L -1 ), whereas an antagonistic effect was observed at high concentrations (≥1000 + 2000 μg L -1 ). Moreover, the interaction of microcystin-LR and copper can increase their accumulation in lettuce. Our results suggest that the toxicity effects of microcystin-LR and copper are exacerbated when they co-exist in the natural environment at low concentrations, which not only negatively affects plant growth but also poses a potential risk to human health via the food chain. Copyright © 2018. Published by Elsevier Ltd.

Radon concentrations in some Egyptian dwellings using LR 115 detectors

International Nuclear Information System (INIS)

Hussein, A.S.

2007-01-01

Radon, a well-established risk factor for human lung cancer, is present at low concentrations in most homes. Consequently, many countries have established national guidelines for residential radon concentrations. This survey provides additional information about indoor radon concentrations in Egypt. Indoor radon survey of a total of 15 randomly selected houses in Qena city, Upper Egypt was carried out. LR 115 detectors were exposed for one year, covering all the seasons. The estimated indoor radon levels varied from 19 to 59 Bq m 3 with an average of 40 Bq m 3 . Using the bare and filtered LR 115 detectors, the average equilibrium factor F was assessed as 0.30 indoors. An average annual effective dose of 0.40 mSv has been estimated and was found to be lower than the ICRP-65

Adsorption of microcystin-LR on mesoporous carbons and its potential use in drinking water source.

Science.gov (United States)

Park, Jeong-Ann; Jung, Sung-Mok; Yi, In-Geol; Choi, Jae-Woo; Kim, Song-Bae; Lee, Sang-Hyup

2017-06-01

Microcystin-LR (MC-LR) is a common toxin derived from cyanobacterial blooms an effective, rapid and non-toxic method needs to be developed for its removal from drinking water treatment plants (DWTP). For an adsorption-based method, mesoporous carbon can be a promising supplemental adsorbent. The effect of mesoporous carbon (MC1, MC2, and MC3) properties and water quality parameters on the adsorption of MC-LR were investigated and the results were analyzed by kinetic, isotherm, thermodynamic, Derjaguin-Landau-Verwey-Overbeek (DLVO), and intraparticle diffusion models. MC1 was the most appropriate type for the removal of MC-LR with a maximum adsorption capacity of 35,670.49 μg/g. Adsorption of MC-LR is a spontaneous reaction dominated by van der Waals interactions. Pore sizes of 8.5-14 nm enhance the pore diffusion of MC-LR from the surface to the mesopores of MC1. The adsorption capacity was not sensitive to changes in the pH (3.2-8.0) and the existence of organic matter (2-5 mg/L). Furthermore, the final concentration of MC-LR was below the WHO guideline level after a 10-min reaction with 20 mg/L of MC1 in the Nak-Dong River, a drinking water source. The MC-LR adsorption mainly competed with humic substances (500-1000 g/mole); however, they did not have a great effect on adsorption. Copyright © 2017. Published by Elsevier Ltd.

Measurements of reactor-relevant electromagnetic effects with the FELIX facility

International Nuclear Information System (INIS)

Turner, L.R.; Hua, T.Q.; Knott, M.J.; Lee, S.Y.; McGhee, D.G.; Wehrle, R.B.

1986-01-01

In predicting the electromagnetic consequences of a plasma disruption in a tokamak reactor design, a two-dimensional electromagnetic model of the first wall, blanket, and shield (FWBS) system is typically used. The response to a decaying plasma current is then found to be dominated by a single eddy-current mode, with a single L/R time. Recent experiments with the Fusion ELectromagnetic Induction eXperiment (FELIX) facility at Argonne National Laboratory suggest that such modeling can be used to design against electromagnetic forces and torques, but only if a range of values is used for both tau, the plasma decay time, and tau 0 , the L/R time of the FWBS system

Determination of microcystin-LR in drinking water using UPLC tandem mass spectrometry-matrix effects and measurement.

Science.gov (United States)

Li, Wei; Duan, Jinming; Niu, Chaoying; Qiang, Naichen; Mulcahy, Dennis

2011-10-01

A simple detection method using ultra-performance liquid chromatography electrospray ionisation tandem mass spectrometry (UPLC-ESI-MS-MS) coupled with the sample dilution method for determining trace microcystin-LR (MC-LR) in drinking water is presented. The limit of detection (LOD) was 0.04 µg/L and the limit of quantitation (LOQ) was 0.1 µg/L. Water matrix effects of ionic strength, dissolved organic carbon (DOC) and pH were examined. The results indicate that signal detection intensity for MC-LR was significantly suppressed as the ionic strength increased from ultrapure water condition, whereas it increased slightly with solution pH and DOC at low concentrations. However, addition of methanol (MeOH) into the sample was able to counter the signal suppression effects. In this study, dilution of the tap water sample by adding 4% MeOH (v/v) was observed to be adequate to compensate for the signal suppression. The recoveries of the samples fortified with MC-LR (0.2, 1, and 10 µg/L) for three different tap water samples ranged from 84.4% to 112.9%.

The Swedish Zero Power Reactor R0

Energy Technology Data Exchange (ETDEWEB)

Landergaard, Olof; Cavallin, Kaj; Jonsson, Georg

1961-05-15

The reactor R0 is a critical facility built for heavy water and natural uranium or fuel of low enrichment,, The first criticality was achieved September 25, 1959. During a first period of more than two years the R0 will be operated as a bare reactor in order to simplify interpretation of results. The reactor tank is 3. 2 m high and 2. 25 m in diameter. The fuel suspension system is quite flexible in order to facilitate fuel exchange and lattice variations. The temperature of the water can be varied between about 10 and 90 C by means of a heater and a cooler placed in the external circulating system. The instrumentation of the reactor has to meet the safety requirements not only during operation but also during rearrangements of the core in the shut-down state. Therefore, the shut-down state is always defined by a certain low 'safe' moderator level in the reactor tank. A number of safety rods are normally kept above the moderator ready for action. For manual or automatic control of the reactor power a specially designed piston pump is needed, by which the moderator level is varied. The pump speed is controlled from the reactor power error by means of a Ward-Leonard system. Moderator level measurement is made by means of a water gauge with an accuracy of {+-} 0. 1 mm.

The Swedish Zero Power Reactor R0

International Nuclear Information System (INIS)

Landergaard, Olof; Cavallin, Kaj; Jonsson, Georg

1961-05-01

The reactor R0 is a critical facility built for heavy water and natural uranium or fuel of low enrichment,, The first criticality was achieved September 25, 1959. During a first period of more than two years the R0 will be operated as a bare reactor in order to simplify interpretation of results. The reactor tank is 3. 2 m high and 2. 25 m in diameter. The fuel suspension system is quite flexible in order to facilitate fuel exchange and lattice variations. The temperature of the water can be varied between about 10 and 90 C by means of a heater and a cooler placed in the external circulating system. The instrumentation of the reactor has to meet the safety requirements not only during operation but also during rearrangements of the core in the shut-down state. Therefore, the shut-down state is always defined by a certain low 'safe' moderator level in the reactor tank. A number of safety rods are normally kept above the moderator ready for action. For manual or automatic control of the reactor power a specially designed piston pump is needed, by which the moderator level is varied. The pump speed is controlled from the reactor power error by means of a Ward-Leonard system. Moderator level measurement is made by means of a water gauge with an accuracy of ± 0. 1 mm

Linear regression and sensitivity analysis in nuclear reactor design

International Nuclear Information System (INIS)

Kumar, Akansha; Tsvetkov, Pavel V.; McClarren, Ryan G.

2015-01-01

Highlights: • Presented a benchmark for the applicability of linear regression to complex systems. • Applied linear regression to a nuclear reactor power system. • Performed neutronics, thermal–hydraulics, and energy conversion using Brayton’s cycle for the design of a GCFBR. • Performed detailed sensitivity analysis to a set of parameters in a nuclear reactor power system. • Modeled and developed reactor design using MCNP, regression using R, and thermal–hydraulics in Java. - Abstract: The paper presents a general strategy applicable for sensitivity analysis (SA), and uncertainity quantification analysis (UA) of parameters related to a nuclear reactor design. This work also validates the use of linear regression (LR) for predictive analysis in a nuclear reactor design. The analysis helps to determine the parameters on which a LR model can be fit for predictive analysis. For those parameters, a regression surface is created based on trial data and predictions are made using this surface. A general strategy of SA to determine and identify the influential parameters those affect the operation of the reactor is mentioned. Identification of design parameters and validation of linearity assumption for the application of LR of reactor design based on a set of tests is performed. The testing methods used to determine the behavior of the parameters can be used as a general strategy for UA, and SA of nuclear reactor models, and thermal hydraulics calculations. A design of a gas cooled fast breeder reactor (GCFBR), with thermal–hydraulics, and energy transfer has been used for the demonstration of this method. MCNP6 is used to simulate the GCFBR design, and perform the necessary criticality calculations. Java is used to build and run input samples, and to extract data from the output files of MCNP6, and R is used to perform regression analysis and other multivariate variance, and analysis of the collinearity of data

L-R asymmetry in gut's

International Nuclear Information System (INIS)

Karadayi, H.R.

1982-01-01

An idea of L-R asymmetry is proposed for the grand unification schemes. The idea provides an intrinsic mechanism to obtain standard model charges of fermions in the case of more than one weak gauge boson. It is elaborated within a scheme based on the partial symmetry SU(4)sub(C)xSU(2)sub(L)xSU(2)sub(R) where the coupling constants gsub(L) and gsub(R) corresponding to the chiral SU(2) factors are assumed to be different from each other. Then, the embedding of this structure within the simple symmetry SO(10) is shown. In both cases, a consistent description of vector particle masses is given. These two schemes are considered as primary models to realize the L-R asymmetry idea due to the lack of family unification. However, in a subsequent work, we will show that the SO(14) unification of the three families can be obtained within the framework of L-R asymmetry. All formulations are carried out with the aid of a mathematical method that we recently proposed for the Lie algebra representations of classical groups. (author)

Roles of miRNAs in microcystin-LR-induced Sertoli cell toxicity

Energy Technology Data Exchange (ETDEWEB)

Zhou, Yuan [Immunology and Reproduction Biology Laboratory & State Key Laboratory of Analytical Chemistry for Life Science, Medical School, Nanjing University, Nanjing, Jiangsu 210093 (China); Jiangsu Key Laboratory of Molecular Medicine, Nanjing University, Nanjing, Jiangsu 210093 (China); Wang, Hui [The Centre for Individualized Medication, Linköping University Hospital, Linköping University, Linköping SE-58185 (Sweden); Wang, Cong [Immunology and Reproduction Biology Laboratory & State Key Laboratory of Analytical Chemistry for Life Science, Medical School, Nanjing University, Nanjing, Jiangsu 210093 (China); Jiangsu Key Laboratory of Molecular Medicine, Nanjing University, Nanjing, Jiangsu 210093 (China); Qiu, Xuefeng [Department of Urology, Affiliated Drum Tower Hospital, School of Medicine, Nanjing University, Nanjing 210008 (China); Benson, Mikael [The Centre for Individualized Medication, Linköping University Hospital, Linköping University, Linköping SE-58185 (Sweden); Yin, Xiaoqin [Immunology and Reproduction Biology Laboratory & State Key Laboratory of Analytical Chemistry for Life Science, Medical School, Nanjing University, Nanjing, Jiangsu 210093 (China); Jiangsu Key Laboratory of Molecular Medicine, Nanjing University, Nanjing, Jiangsu 210093 (China); Xiang, Zou [Department of Microbiology and Immunology, Mucosal Immunobiology and Vaccine Research Center, Institute of Biomedicine, University of Gothenburg, Gothenburg (Sweden); Li, Dongmei, E-mail: lidm@nju.edu.cn [Immunology and Reproduction Biology Laboratory & State Key Laboratory of Analytical Chemistry for Life Science, Medical School, Nanjing University, Nanjing, Jiangsu 210093 (China); Jiangsu Key Laboratory of Molecular Medicine, Nanjing University, Nanjing, Jiangsu 210093 (China); and others

2015-08-15

Microcystin (MC)-LR, a cyclic heptapeptide, is a potent reproductive system toxin. To understand the molecular mechanisms of MC-induced reproductive system cytotoxicity, we evaluated global changes of miRNA and mRNA expression in mouse Sertoli cells following MC-LR treatment. Our results revealed that the exposure to MC-LR resulted in an altered miRNA expression profile that might be responsible for the modulation of mRNA expression. Bio-functional analysis indicated that the altered genes were involved in specific cellular processes, including cell death and proliferation. Target gene analysis suggested that junction injury in Sertoli cells exposed to MC-LR might be mediated by miRNAs through the regulation of the Sertoli cell-Sertoli cell pathway. Collectively, these findings may enhance our understanding on the modes of action of MC-LR on mouse Sertoli cells as well as the molecular mechanisms underlying the toxicity of MC-LR on the male reproductive system. - Highlights: • miRNAs were altered in Sertoli cells exposed to MC-LR. • Alerted genes were involved in different cell functions including the cell morphology. • MC-LR adversely affected Sertoli cell junction formation through the regulating miRNAs.

Adaptive local surface refinement based on LR NURBS and its application to contact

Science.gov (United States)

Zimmermann, Christopher; Sauer, Roger A.

2017-12-01

A novel adaptive local surface refinement technique based on Locally Refined Non-Uniform Rational B-Splines (LR NURBS) is presented. LR NURBS can model complex geometries exactly and are the rational extension of LR B-splines. The local representation of the parameter space overcomes the drawback of non-existent local refinement in standard NURBS-based isogeometric analysis. For a convenient embedding into general finite element codes, the Bézier extraction operator for LR NURBS is formulated. An automatic remeshing technique is presented that allows adaptive local refinement and coarsening of LR NURBS. In this work, LR NURBS are applied to contact computations of 3D solids and membranes. For solids, LR NURBS-enriched finite elements are used to discretize the contact surfaces with LR NURBS finite elements, while the rest of the body is discretized by linear Lagrange finite elements. For membranes, the entire surface is discretized by LR NURBS. Various numerical examples are shown, and they demonstrate the benefit of using LR NURBS: Compared to uniform refinement, LR NURBS can achieve high accuracy at lower computational cost.

Evaluation of the transfer and the accumulation of microcystins in tomato (Solanum lycopersicum cultivar MicroTom) tissues using a cyanobacterial extract containing microcystins and the radiolabeled microcystin-LR ("1"4C-MC-LR)

International Nuclear Information System (INIS)

Corbel, Sylvain; Mougin, Christian; Nélieu, Sylvie; Delarue, Ghislaine; Bouaïcha, Noureddine

2016-01-01

Microcystins are the most common cyanotoxins and may be expected wherever blooms of cyanobacteria occur in surface waters. Their persistence both in the irrigation water and in the soil can lead to their transfer and bioaccumulation into agricultural plants. The aim of this work was to investigate microcystin accumulation in Solanum lycopersicum cultivar MicroTom. The plant was exposed to either Microcystis aeruginosa crude extracts containing up to 100 μg eq. MC-LR L"−"1 in a soil–plant system for 90 days or pure radiolabeled "1"4C-MC-LR in a hydroponic condition for 48 h. Toxin bioaccumulation in the soil and different plant tissues was assessed both by the PP2A inhibition assay and by liquid chromatography-mass spectrometry (LC/MS/MS). After 90 days of exposure, microcystins persisted in the soil and their free extractable concentrations accumulated were very low varying between 1.6 and 3.9 μg eq. MC-LR kg"−"1 DW. Free MC-LR was detected only in roots and leaves with concentrations varying between 4.5 and 8.1 μg kg"−"1 DW and between 0.29 and 0.55 μg kg"−"1 DW, respectively. By using radioactivity ("1"4C-MC-LR), the results have reported a growing accumulation of toxins within the organs roots > leaves > stems and allowed them to confirm the absence of MC-LR in fruits after 48 h of exposure. The bioconcentration factor (BCF) was 13.6 in roots, 4.5 in leaves, and 1.4 in stems. On the other hand, the results highlight the presence of two radioactive fractions in different plant tissues. The non-extractable fraction of radioactivity, corresponding to the covalently bound MC-LR, was higher than that of the extractable fraction only in roots and leaves reaching 56% and 71% of the total accumulated toxin, respectively. Therefore, results raise that monitoring programs must monitor the presence of MCs in the irrigation water to avoid the transfer and accumulation of these toxins in crops. - Graphical abstract: Bioconcentration factors in organs of the

Evaluation of the transfer and the accumulation of microcystins in tomato (Solanum lycopersicum cultivar MicroTom) tissues using a cyanobacterial extract containing microcystins and the radiolabeled microcystin-LR ({sup 14}C-MC-LR)

Energy Technology Data Exchange (ETDEWEB)

Corbel, Sylvain [INRA, UMR1402 ECOSYS, F-78850 Thiverval-Grignon (France); AgroParisTech, UMR1402 ECOSYS, F-78850 Thiverval-Grignon (France); Laboratoire Ecologie, Systématique et Evolution, UMR8079, Univ. Paris-Sud/CNRS/AgroParisTech, Université Paris-Sud, F-91405 Orsay (France); Mougin, Christian; Nélieu, Sylvie; Delarue, Ghislaine [INRA, UMR1402 ECOSYS, F-78850 Thiverval-Grignon (France); AgroParisTech, UMR1402 ECOSYS, F-78850 Thiverval-Grignon (France); Bouaïcha, Noureddine, E-mail: noureddine.bouaicha@u-psud.fr [Laboratoire Ecologie, Systématique et Evolution, UMR8079, Univ. Paris-Sud/CNRS/AgroParisTech, Université Paris-Sud, F-91405 Orsay (France)

2016-01-15

Microcystins are the most common cyanotoxins and may be expected wherever blooms of cyanobacteria occur in surface waters. Their persistence both in the irrigation water and in the soil can lead to their transfer and bioaccumulation into agricultural plants. The aim of this work was to investigate microcystin accumulation in Solanum lycopersicum cultivar MicroTom. The plant was exposed to either Microcystis aeruginosa crude extracts containing up to 100 μg eq. MC-LR L{sup −1} in a soil–plant system for 90 days or pure radiolabeled {sup 14}C-MC-LR in a hydroponic condition for 48 h. Toxin bioaccumulation in the soil and different plant tissues was assessed both by the PP2A inhibition assay and by liquid chromatography-mass spectrometry (LC/MS/MS). After 90 days of exposure, microcystins persisted in the soil and their free extractable concentrations accumulated were very low varying between 1.6 and 3.9 μg eq. MC-LR kg{sup −1} DW. Free MC-LR was detected only in roots and leaves with concentrations varying between 4.5 and 8.1 μg kg{sup −1} DW and between 0.29 and 0.55 μg kg{sup −1} DW, respectively. By using radioactivity ({sup 14}C-MC-LR), the results have reported a growing accumulation of toxins within the organs roots > leaves > stems and allowed them to confirm the absence of MC-LR in fruits after 48 h of exposure. The bioconcentration factor (BCF) was 13.6 in roots, 4.5 in leaves, and 1.4 in stems. On the other hand, the results highlight the presence of two radioactive fractions in different plant tissues. The non-extractable fraction of radioactivity, corresponding to the covalently bound MC-LR, was higher than that of the extractable fraction only in roots and leaves reaching 56% and 71% of the total accumulated toxin, respectively. Therefore, results raise that monitoring programs must monitor the presence of MCs in the irrigation water to avoid the transfer and accumulation of these toxins in crops. - Graphical abstract: Bioconcentration

The uptake kinetics and immunotoxic effects of microcystin-LR in human and chicken peripheral blood lymphocytes in vitro

International Nuclear Information System (INIS)

Lankoff, Anna; Carmichael, Wayne W.; Grasman, Keith A.; Yuan, Moucun

2004-01-01

Microcystin-LR is a cyanobacterial heptapeptide that presents acute and chronic hazards to animal and human health. We investigated the influence of this toxin on human and chicken immune system modulation in vitro. Peripheral blood lymphocytes were treated with microcystin-LR at environmentally relevant doses of 1, 10 and 25 μg/ml for 12, 24, 48, 72 h (for proliferation assay cells were treated for 72 h). T-cell and B-cell proliferation as well as apoptosis and necrosis were determined in human and chicken samples. IL-2 and IL-6 production by human lymphocytes also was measured. In addition, uptake kinetics of microcystin-LR into human and chicken peripheral blood lymphocytes were calculated by Liquid Chromatography (LS) /Mass Spectrometry (MS) analysis. At the highest dose microcystin-LR decreased T-cell proliferation and all doses of microcystin-LR inhibited B-cell proliferation. The frequency of apoptotic and necrotic cells increased in a dose and time-dependent manner. Human lymphocytes responded to stimulation with microcystin-LR by increased production of IL-6 and decreased production of IL-2. Human lymphocytes were able to uptake from 0.014 to 1.663 μg/ml and chicken lymphocytes from 0.035 to 1.733 μg/ml of the microcystin-LR added to the cultures, depending on the treatment time and dose. In conclusion, microcystin-LR acted as an immunomodulator in cytokine production and down-regulated lymphocyte functions by induction of apoptosis and necrosis. However, further studies dealing with the influence of microcystin-LR on expression cytokine genes and transcription factors are necessary to confirm these hypotheses

The language of human law in the thought of Francisco Suárez

Directory of Open Access Journals (Sweden)

Fernando Centenera Sánchez-Seco

2018-05-01

Full Text Available The subject of this article is the language of human law in the thought of Francisco Suárez. Its chief focus is on the Treatise on Laws and on God the Lawgiver and its views on the prescriptive nature of legislative language, written and spoken language, the lexical-semantic level, and linguistic clarity from the viewpoints of convenience, the essence of the law and justice. The issues Suárez deals with in relation to these points have continued to attract attention up to the present day, and a reading of the Treatise confirms the impression that some of them are still valid. Accordingly, as well as setting out, describing and offering a guide to understanding Suárez ideas, the article offers a comparative and contemplative analysis of them, without forgetting that their author belonged to the early modern period.

Radon concentrations in some Egyptian dwellings using LR 115 detectors

Energy Technology Data Exchange (ETDEWEB)

Hussein, A S [Radiation Protection Department, Nuclear Power Plants Authority, Cairo (Egypt)

2007-06-15

Radon, a well-established risk factor for human lung cancer, is present at low concentrations in most homes. Consequently, many countries have established national guidelines for residential radon concentrations. This survey provides additional information about indoor radon concentrations in Egypt. Indoor radon survey of a total of 15 randomly selected houses in Qena city, Upper Egypt was carried out. LR 115 detectors were exposed for one year, covering all the seasons. The estimated indoor radon levels varied from 19 to 59 Bq m{sup 3} with an average of 40 Bq m{sup 3}. Using the bare and filtered LR 115 detectors, the average equilibrium factor F was assessed as 0.30 indoors. An average annual effective dose of 0.40 mSv has been estimated and was found to be lower than the ICRP-65.

Synthesis of visible light sensitized S, N and C co-doped polymorphic TiO2 for Microcystin-LR MC-LR removal

Science.gov (United States)

Microcystin-LR (MC-LR) is considered as one of the most widespread and toxic cyanotoxins, which had been discovered to be hepatotoxic, cytotoxic and neurotoxic. It is the only cyanotoxin that has been proposed by Word Health Organization (WHO) for a provisional guideline (1 ppb) ...

Development of an ELISA and Immunochromatographic Strip for Highly Sensitive Detection of Microcystin-LR

Directory of Open Access Journals (Sweden)

Liqiang Liu

2014-08-01

Full Text Available A monoclonal antibody for microcystin–leucine–arginine (MC-LR was produced by cell fusion. The immunogen was synthesized in two steps. First, ovalbumin/ bovine serum albumin was conjugated with 6-acetylthiohexanoic acid using a carbodiimide EDC (1-ethyl-3-[3-dimethylaminopropyl]carbodiimide hydrochloride/ NHS (N-hydroxysulfosuccinimide reaction. After dialysis, the protein was reacted with MC-LR based on a free radical reaction under basic solution conditions. The protein conjugate was used for immunization based on low volume. The antibodies were identified by indirect competitive (icELISA and were subjected to tap water and lake water analysis. The concentration causing 50% inhibition of binding of MC-LR (IC50 by the competitive indirect ELISA was 0.27 ng/mL. Cross-reactivity to the MC-RR, MC-YR and MC-WR was good. The tap water and lake water matrices had no effect on the detection limit. The analytical recovery of MC-LR in the water samples in the icELISA was 94%–110%. Based on this antibody, an immunochromatographic biosensor was developed with a cut-off value of 1 ng/mL, which could satisfy the requirement of the World Health Organization for MC-LR detection in drinking water. This biosensor could be therefore be used as a fast screening tool in the field detection of MC-LR.

Effects of different algaecides on the photosynthetic capacity, cell integrity and microcystin-LR release of Microcystis aeruginosa

International Nuclear Information System (INIS)

Zhou, Shiqing; Shao, Yisheng; Gao, Naiyun; Deng, Yang; Qiao, Junlian; Ou, Huase; Deng, Jing

2013-01-01

Bench scale tests were conducted to study the effects of four common algaecides, including copper sulfate, hydrogen peroxide, diuron and ethyl 2-methylacetoacetate (EMA) on the photosynthetic capacity, cell integrity and microcystin-LR (MC-LR) release of Microcystis aeruginosa. The release of potassium (K + ) from cell membrane during algaecide exposure was also analyzed. The three typical photosynthetic parameters, including the effective quantum yield (φ e ), photosynthetic efficiency (α) and maximal electron transport rate (rETR max ), were measured by a pulse amplitude modulated (PAM) fluorometry. Results showed that the photosynthetic capacity was all inhibited by the four algaecides, to different degrees, by limiting the energy capture in photosynthesis, and blocking the electron transfer chain in primary reaction. For example, at high diuron concentration (7.5 mg L −1 ), φ e , α and rETR max decreased from 0.46 to 0.19 (p −2 s −1 /μmol photons m −2 s −1 , and from 160.7 to 0.1 (p −2 s −1 compared with the control group after 96 h of exposure, respectively. Furthermore, the increase of algaecide dose could lead to the cell lysis, as well as release of intracellular MC-LR that enhanced the accumulation of extracellular MC-LR. The order of MC-LR release potential for the four algaecides was CuSO 4 > H 2 O 2 > diuron > EMA. Highlights: • PAM was used to investigate the effects of algaecides on Microcystis aeruginosa. • We estimate the release of potassium (K + ) from cell membrane for cell lysis. • The risk of microcystin-LR release was evaluated after algaecides exposure. • The order of MC-LR release potential was copper sulfate > hydrogen peroxide > diuron > ethyl 2-methylacetoacetate

Reproduction impairment and endocrine disruption in female zebrafish after long-term exposure to MC-LR: A life cycle assessment

International Nuclear Information System (INIS)

Hou, Jie; Li, Li; Wu, Ning; Su, Yujing; Lin, Wang; Li, Guangyu; Gu, Zemao

2016-01-01

Microcystin-LR (MC-LR) has been found to cause reproductive and developmental impairments as well as to disrupt sex hormone homeostasis of fish during acute and sub-chronic toxic experiments. However, fish in natural environments are continuously exposed to MC-LR throughout their entire life cycle as opposed to short-term exposure. Here, we tested the hypothesis that the mechanism by which MC-LR harms female fish reproduction and development within natural water bodies is through interference of the reproductive endocrine system. In the present study, zebrafish hatchlings (5 d post-fertilization) were exposed to 0, 0.3, 3 and 30 μg/L MC-LR for 90 d until reaching sexual maturity. Female zebrafish were selected, and the changes in growth and developmental indicators, ovarian ultrastructure as well as the levels of gonadal steroid hormones and vitellogenin (VTG) were examined along with the transcription of related genes in the hypothalamic–pituitary–gonadal–liver axis (HPGL-axis). The results showed for the first time, a life cycle exposure to MC-LR caused growth inhibition, decreased ovary weight and ovarian ultra-pathological lesions. Decreased ovarian testosterone levels indicated that MC-LR disrupted sex steroid hormone balance. Significantly up-regulated transcription of brain FSHβ and LHβ along with ovarian ERα, FSHR and LHR suggested positive feedback regulation in the HPGL-axis was induced as a compensatory mechanism for MC-LR damage. It was also noted that ovarian VTG content and hepatic ERα and VTG1 expression were all down-regulated, which might be responsible for reduced vitellus storage noted in our histological observations. Our findings indicate that a life cycle exposure to MC-LR impairs the development and reproduction of female zebrafish by disrupting the transcription of related HPGL-axis genes, suggesting that MC-LR has potential adverse effects on fish reproduction and thus population dynamics in MCs-contaminated aquatic

Ecological risk assessment of microcystin-LR in the upstream section of the Haihe River based on a species sensitivity distribution model.

Science.gov (United States)

Niu, Zhiguang; Du, Lei; Li, Jiafu; Zhang, Ying; Lv, Zhiwei

2018-02-01

The eutrophication of surface water has been the main problem of water quality management in recent decades, and the ecological risk of microcystin-LR (MC-LR), which is the by-product of eutrophication, has drawn more attention worldwide. The aims of our study were to determine the predicted no effect concentration (PNEC) of MC-LR and to assess the ecological risk of MC-LR in the upstream section of the Haihe River. HC 5 (hazardous concentration for 5% of biological species) and PNEC were obtained from a species sensitivity distribution (SSD) model, which was constructed with the acute toxicity data of MC-LR on aquatic organisms. The concentrations of MC-LR in the upstream section of the Haihe River from April to August of 2015 were analysed, and the ecological risk characteristics of MC-LR were evaluated based on the SSD model. The results showed that the HC 5 of MC-LR in freshwater was 17.18 μg/L and PNEC was 5.73 μg/L. The concentrations of MC-LR ranged from 0.68 μg/L to 32.21 μg/L and were obviously higher in summer than in spring. The values of the risk quotient (RQ) ranged from 0.12 to 5.62, suggesting that the risk of MC-LR for aquatic organisms in the river was at a medium or high level during the study period. Compared with other waterbodies in the world, the pollution level of MC-LR in the Haihe River was at a moderate level. This research could promote the study of the ecological risk of MC-LR at the ecosystem level. Copyright © 2017 Elsevier Ltd. All rights reserved.

Pablo Rodríguez Pérez (1976 - 2016)

CERN Multimedia

2016-01-01

It is with great sadness that we announce the sudden loss of Pablo Rodríguez Pérez, a physicist on the LHCb Experiment, who died in Manchester on 1st July 2016.   Pablo Rodríguez Pérez. Pablo obtained his Bachelor of Science in Physics at the Universidade de Santiago de Compostela (USC) in 2003, specialising in electronics before going on to work in industry. He joined the LHCb experiment in 2007, undertaking his Master of Science at USC on the optimisation of readout electronics for the Inner Tracker. He then continued his studies with a PhD, becoming the principal author for the experiment control system of the Silicon Tracker. After the commissioning of the LHCb experiment he moved his attention to the LHCb upgrade, performing the first investigation of prototypes for the upgrade of the vertex locator (VELO). Following his PhD from USC, Cum Laude, he joined the University of Manchester in 2013 to work further on the VELO Upgrade. Pablo took ...

La potestad tributaria en Francisco Suárez

Directory of Open Access Journals (Sweden)

Luis Carlos Amezúa Amezúa

2017-09-01

Full Text Available Francisco Suárez es el teólogo más relevante de la escuela española de derecho natural o Escuela de Salamanca en sentido amplio. Según piensa, el derecho de imponer tributos justos reside en exclusiva en la autoridad suprema, sin necesitar el consentimiento de las Cortes. El Estado tiene ese poder de establecer leyes tributarias para asegurar la paz, el orden y el buen gobierno de la comunidad. Es el poder más importante entre todas las facultades propias de la soberanía, pero debe respetar las exigencias de un impuesto justo: además de la autoridad legítima, una causa justa y distribución proporcional. En este artículo, desarrollaremos la doctrina de Suárez, su interpretación acerca de la duda probable sobre la injusticia del impuesto, y su aceptación de los impuestos sobre el consumo. Todos estos razonamientos iban dirigidos a fortalecer al gobernante, que debe actuar dentro de un marco ético respetuoso con el bien común.

Antioxidant Effect of Curcumin Against Microcystin- LR-Induced ...

African Journals Online (AJOL)

Purpose: To investigate the effect of curcumin on microcystin-LR (MC-LR)- induced renal oxidative damage in Balb/c mice. Methods: 40 male Balb/c mice were assigned randomly to 4 groups each having 10 mice. One group served as normal (saline treated) while another group was used as curcumin control. The third ...

Laboratory studies of dissolved radiolabelled microcystin-LR in lake water

DEFF Research Database (Denmark)

Hyenstrand, Per; Rohrlack, Thomas; Beattie, Kenneth A

2003-01-01

The fate of dissolved microcystin-LR was studied in laboratory experiments using surface water taken from a eutrophic lake. Based on initial range finding, a concentration of 50 microg l(-1) dissolved 14C-microcystin-LR was selected for subsequent time-course experiments. The first was performed ...... fractions. The study demonstrated that biodegradation of dissolved microcystin-LR occurred in water collected at a lake surface with carbon dioxide as a major end-product....

Identificación de Chlamydophila abortus en un aborto ovino en Almoloya de Juárez, México

OpenAIRE

Edgardo Soriano-Vargas; Celene Salgado-Miranda; Juan Manuel Jiménez-Estrada; Marcela López-Hurtado; Fernando M. Guerra-Infante; Marcos R. Escobedo-Guerra

2011-01-01

ResumenSe identificó la presencia de Chlamydophila abortus en un aborto ovino procedente de Almoloya de Juárez, México.SummaryChlamydophila abortus was identified in an ovine aborted fetus from Almoloya de Juárez, México

Natural Law in Francisco Suárez: Passion for Freedom

Directory of Open Access Journals (Sweden)

Manuel López Casquete de Prado

2018-05-01

Full Text Available The Suaretian formulation on the natural law offers one of the most brilliant and accomplished elaborations of the ius-naturalistic tradition. In this article we analyze the keys from which Suárez formulates his proposal, that finds in the concept of freedom its starting point. From the radical and inalienable call to the human being to the exercise of his freedom, Suárez reveals the essence of its elaboration, one of whose consequences would end by decanting —later on— the concept of subjective right. We also pay special attention to the epistemological aspects of its system, which we consider essential to approach a correct understanding of the Suaretian ius-naturalistic proposal. For this purpose, we offer a close comparison between the Suaretian system and the Thomistic epistemology of the natural law.

Comparative Studies on the pH Dependence of DOW of Microcystin-RR and -LR Using LC-MS

Directory of Open Access Journals (Sweden)

Gaodao Liang

2011-01-01

Full Text Available Microcystins (MCs are well known worldwide as hepatotoxins produced by cyanobacteria, but little is known about the physicochemical properties of these compounds. The dependence of the n-octanol/water distribution ratio (DOW of MC-RR and -LR to pH was measured by high-performance liquid chromatography combined with mass spectrometry (LC-MS. There was a remarkable difference in such relationships between MC-RR and -LR. The log DOW of MC-LR decreased from 1.63 at pH 1.0 to -1.26 at pH 6.5, and stabilized between -1.04 and -1.56 at a pH of 6.5~12.0; log DOW of MC-RR varied between -1.24 and -0.67 at a pH of 1.00~4.00, and stabilized between -1.20 and -1.54 at a pH of 4.00~12.00. The difference of hydrophobicity in acidic condition between MC-RR and -LR is important, not only for the analytical method of both toxins, but perhaps also for understanding the difference of toxicity to animals between the two toxins.

Reproduction impairment and endocrine disruption in female zebrafish after long-term exposure to MC-LR: A life cycle assessment.

Science.gov (United States)

Hou, Jie; Li, Li; Wu, Ning; Su, Yujing; Lin, Wang; Li, Guangyu; Gu, Zemao

2016-01-01

Microcystin-LR (MC-LR) has been found to cause reproductive and developmental impairments as well as to disrupt sex hormone homeostasis of fish during acute and sub-chronic toxic experiments. However, fish in natural environments are continuously exposed to MC-LR throughout their entire life cycle as opposed to short-term exposure. Here, we tested the hypothesis that the mechanism by which MC-LR harms female fish reproduction and development within natural water bodies is through interference of the reproductive endocrine system. In the present study, zebrafish hatchlings (5 d post-fertilization) were exposed to 0, 0.3, 3 and 30 μg/L MC-LR for 90 d until reaching sexual maturity. Female zebrafish were selected, and the changes in growth and developmental indicators, ovarian ultrastructure as well as the levels of gonadal steroid hormones and vitellogenin (VTG) were examined along with the transcription of related genes in the hypothalamic-pituitary-gonadal-liver axis (HPGL-axis). The results showed for the first time, a life cycle exposure to MC-LR caused growth inhibition, decreased ovary weight and ovarian ultra-pathological lesions. Decreased ovarian testosterone levels indicated that MC-LR disrupted sex steroid hormone balance. Significantly up-regulated transcription of brain FSHβ and LHβ along with ovarian ERα, FSHR and LHR suggested positive feedback regulation in the HPGL-axis was induced as a compensatory mechanism for MC-LR damage. It was also noted that ovarian VTG content and hepatic ERα and VTG1 expression were all down-regulated, which might be responsible for reduced vitellus storage noted in our histological observations. Our findings indicate that a life cycle exposure to MC-LR impairs the development and reproduction of female zebrafish by disrupting the transcription of related HPGL-axis genes, suggesting that MC-LR has potential adverse effects on fish reproduction and thus population dynamics in MCs-contaminated aquatic environment

Transfrontera Crimes: Representations of the Juárez Femicides in Recent Fictional and Non-Fictional Accounts

Directory of Open Access Journals (Sweden)

Marietta Messmer

2012-05-01

Full Text Available In her article, Marrietta Messmer discusses the representation of the Juárez femicides and their traumatizing effects on the Juárez/El Paso community in four recently published accounts: Teresa Rodriguez's journalistic account The Daughters of Juarez (2007, the documentary Señorita Extraviada (2001 directed by Lourdes Portillo, the feature film Bordertown (2006, directed by Gregory Nava, and Alicia Gaspar de Alba's mystery novel Desert Blood: The Juárez Murders (2005. More specifically, she analyzes the degree to which these sources regard the femicides not merely as a Mexican problem but as a structural and highly significant transborder issue that has its roots in the region's current political and economic developments, as well as its pervasive social and cultural changes.

Assessment of co-seismic landslide susceptibility using LR and ...

Indian Academy of Sciences (India)

Suchita Shrestha

2018-03-28

Mar 28, 2018 ... statistical methods, namely Logistic Regression. (LR) and Analysis ... The LR method has been applied by various researchers ... many bivariate models need that the independent variables be .... through a point (per unit contour length), and tan β is the ..... by multivariate statistical techniques; Nat. Hazards ...

SCREENING OF Lr GENES PROVIDING RESISTANCE TO LEAF RUST IN WHEATH USING MULTIPLEX PCR METHOD

Directory of Open Access Journals (Sweden)

Mehmet AYBEKE

2015-12-01

Full Text Available Leaf rust is a fungal disease in wheat that causes significant decrease in yield around the world. In Turkey, several genes, including leaf rust-resistant (Lr Lr9, Lr19, Lr24 and Lr28, have been found to induce disease resistance. To obtain resistant cultivars during the breeding process, screening of these genes in various specimens is crucial. Thus, we aimed in the present study primarily to improve the multiplex polymerase chain reaction (PCR methodology by which four Lr genes could be simultaneously screened in plant samples carrying these genes. Serial PCR experiments were carried out for determination of optimal PCR conditions for each Lr gene and in all studies nursery lines were used. PCR conditions were determined as follows: 35 cycles of 95°C for denaturation (30 s, 58°C for annealing (30 s and 72°C for elongation (60 s, with an initial 94°C denaturation (3 min and a 72°C extension (30 min. The primers used in the PCR runs were as follows: Lr9F: TCCTTTTATTCCGCACGCCGG, Lr9R: CCACACTACCCCAAAGAGACG; Lr19F: CATCCTTGGGGACCTC, Lr19R: CCAGCTCGCATACATCCA; Lr24F: TCTAGTCTGTACATGGGGGC, Lr24R: TGGCACATGAACTCCATACG; Lr28F: CCCGGCATAAGTCTATGGTT, Lr28R: CAATGAATGAGATACGTGAA. We found that the optimum annealing temperature for all four genes was 61°C and extension temperatures were 62°C or 64°C. Finally, using this new PCR method, we successfully screened these genes in specimens carrying only one single Lr gene. Optimal multiplex PCR conditions were; denaturation at 94°C for 1 min, 35 extension cycles [94°C for 30 s, 57–61ºC (ideal 61°C for 30 s, and 64–68°C for 2 min] and final extension at 72°C for 30 min. In addition, we achieved positive results when running the optimised multiplex PCR tests on Lr19, Lr24 and Lr28. Future studies are planned to expand new wide multiplex PCR method to include all other Lr genes.

Cell density dependence of Microcystis aeruginosa responses to copper algaecide concentrations: Implications for microcystin-LR release.

Science.gov (United States)

Kinley, Ciera M; Iwinski, Kyla J; Hendrikse, Maas; Geer, Tyler D; Rodgers, John H

2017-11-01

Along with mechanistic models, predictions of exposure-response relationships for copper are often derived from laboratory toxicity experiments with standardized experimental exposures and conditions. For predictions of copper toxicity to algae, cell density is a critical factor often overlooked. For pulse exposures of copper-based algaecides in aquatic systems, cell density can significantly influence copper sorbed by the algal population, and consequent responses. A cyanobacterium, Microcystis aeruginosa, was exposed to a copper-based algaecide over a range of cell densities to model the density-dependence of exposures, and effects on microcystin-LR (MC-LR) release. Copper exposure concentrations were arrayed to result in a gradient of MC-LR release, and masses of copper sorbed to algal populations were measured following exposures. While copper exposure concentrations eliciting comparable MC-LR release ranged an order of magnitude (24-h EC50s 0.03-0.3mg Cu/L) among cell densities of 10 6 through 10 7 cells/mL, copper doses (mg Cu/mg algae) were similar (24-h EC50s 0.005-0.006mg Cu/mg algae). Comparisons of MC-LR release as a function of copper exposure concentrations and doses provided a metric of the density dependence of algal responses in the context of copper-based algaecide applications. Combined with estimates of other site-specific factors (e.g. water characteristics) and fate processes (e.g. dilution and dispersion, sorption to organic matter and sediments), measuring exposure-response relationships for specific cell densities can refine predictions for in situ exposures and algal responses. These measurements can in turn decrease the likelihood of amending unnecessary copper concentrations to aquatic systems, and minimize risks for non-target aquatic organisms. Copyright © 2017 Elsevier Inc. All rights reserved.

Microcystin-LR equivalent concentrations in fish tissue during a ...

African Journals Online (AJOL)

The effects of a decomposing cyanobacteria bloom on water quality and the accumulation of microcystin-LR equivalent toxin in fish at Loskop Dam were studied in May 2012. Enzyme-linked immunosorbent assay [ELISA] was used to confirm the presence of microcystin-LR equivalent in the water and to determine the ...

JENDL-4.0 benchmarking for fission reactor applications

International Nuclear Information System (INIS)

Chiba, Go; Okumura, Keisuke; Sugino, Kazuteru; Nagaya, Yasunobu; Yokoyama, Kenji; Kugo, Teruhiko; Ishikawa, Makoto; Okajima, Shigeaki

2011-01-01

Benchmark testing for the newly developed Japanese evaluated nuclear data library JENDL-4.0 is carried out by using a huge amount of integral data. Benchmark calculations are performed with a continuous-energy Monte Carlo code and with the deterministic procedure, which has been developed for fast reactor analyses in Japan. Through the present benchmark testing using a wide range of benchmark data, significant improvement in the performance of JENDL-4.0 for fission reactor applications is clearly demonstrated in comparison with the former library JENDL-3.3. Much more accurate and reliable prediction for neutronic parameters for both thermal and fast reactors becomes possible by using the library JENDL-4.0. (author)

Absolute Transition Rates in {sup 188}lr

Energy Technology Data Exchange (ETDEWEB)

Malmskog, S G; Berg, V

1969-09-15

Half-lives of several excited levels in {sup 188}lr have been measured using an electron-electron delayed coincidence spectrometer. Active {sup 188}Pt sources were prepared from spallation products using the ISOLDE on-line mass separator facility at CERN. The following half-lives were obtained: T{sub 1/2} (54.8 keV level) = (1.93 {+-} 0.10) nsec; T{sub 1/2} (96.7 keV level) = (0.59 {+-} 0.12) nsec; T{sub 1/2} (187.6 keV level) = (0.056 {+-} 0.013) nsec; T{sub 1/2} (195.1 keV level) = (0.051 {+-} 0.010) nsec; T{sub 1/2} (478. 3 keV level) {<=} 0.15 nsec The 54.8 keV transition was found to have an enhanced E2 transition probability indicating a collective character for this transition.

A pM leveled photoelectrochemical sensor for microcystin-LR based on surface molecularly imprinted TiO2@CNTs nanostructure.

Science.gov (United States)

Liu, Meichuan; Ding, Xue; Yang, Qiwei; Wang, Yu; Zhao, Guohua; Yang, Nianjun

2017-06-05

A simple and highly sensitive photoelectrochemical (PEC) sensor towards Microcystin-LR (MC-LR), a kind of typical cyanobacterial toxin in water samples, was developed on a surface molecular imprinted TiO 2 coated multiwalled carbon nanotubes (MI-TiO 2 @CNTs) hybrid nanostructure. It was synthesized using a feasible two-step sol-gel method combining with in situ surface molecular imprinting technique (MIT). With a controllable core-shell tube casing structure, the resultant MI-TiO 2 @CNTs are enhanced greatly in visible-light driven response capacity. In comparison with the traditional TiO 2 (P25) and non-imprinted (NI-)TiO 2 @CNTs, the MI-TiO 2 @CNTs based PEC sensor showed a much higher photoelectric oxidation capacity towards MC-LR. Using this sensor, the determination of MC-LR was doable in a wide linear range from 1.0pM to 3.0nM with a high photocurrent response sensitivity. An outstanding selectivity towards MC-LR was further achieved with this sensor, proven by simultaneously monitoring 100-fold potential co-existing interferences. The superiority of the obtained MC-LR sensor in sensitivity and selectivity is mainly attributed to the high specific surface area and excellent photoelectric activity of TiO 2 @CNTs heterojunction structure, as well as the abundant active recognition sites on its functionalized molecular imprinting surface. A promising PEC analysis platform with high sensitivity and selectivity for MC-LR has thus been provided. Copyright © 2017 Elsevier B.V. All rights reserved.

Electrochemical Aptatoxisensor Responses on Nanocomposites Containing Electro-Deposited Silver Nanoparticles on Poly(Propyleneimine Dendrimer for the Detection of Microcystin-LR in Freshwater

Directory of Open Access Journals (Sweden)

Mawethu P. Bilibana

2016-11-01

Full Text Available A sensitive and reagentless electrochemical aptatoxisensor was developed on cobalt (II salicylaldiimine metallodendrimer (SDD–Co(II doped with electro-synthesized silver nanoparticles (AgNPs for microcystin-LR (L, l-leucine; R, l-arginine, or MC-LR, detection in the nanomolar range. The GCE|SDD–Co(II|AgNPs aptatoxisensor was fabricated with 5’ thiolated aptamer through self-assembly on the modified surface of the glassy carbon electrode (GCE and the electronic response was measured using cyclic voltammetry (CV. Specific binding of MC-LR with the aptamer on GCE|SDD–Co(II|AgNPs aptatoxisensor caused the formation of a complex that resulted in steric hindrance and electrostatic repulsion culminating in variation of the corresponding peak current of the electrochemical probe. The aptatoxisensor showed a linear response for MC-LR between 0.1 and 1.1 µg·L−1 and the calculated limit of detection (LOD was 0.04 µg·L−1. In the detection of MC-LR in water samples, the aptatoxisensor proved to be highly sensitive and stable, performed well in the presence of interfering analog and was comparable to the conventional analytical techniques. The results demonstrate that the constructed MC-LR aptatoxisensor is a suitable device for routine quantification of MC-LR in freshwater and environmental samples.

The interactive effects of microcystin-LR and cylindrospermopsin on the growth rate of the freshwater algae Chlorella vulgaris.

Science.gov (United States)

Pinheiro, Carlos; Azevedo, Joana; Campos, Alexandre; Vasconcelos, Vítor; Loureiro, Susana

2016-05-01

Microcystin-LR (MC-LR) and cylindrospermopsin (CYN) are the most representative cyanobacterial cyanotoxins. They have been simultaneously detected in aquatic systems, but their combined ecotoxicological effects to aquatic organisms, especially microalgae, is unknown. In this study, we examined the effects of these cyanotoxins individually and as a binary mixture on the growth rate of the freshwater algae Chlorella vulgaris. Using the MIXTOX tool, the reference model concentration addition (CA) was selected to evaluate the combined effects of MC-LR and CYN on the growth of the freshwater green algae due to its conservative prediction of mixture effect for putative similar or dissimilar acting chemicals. Deviations from the CA model such as synergism/antagonism, dose-ratio and dose-level dependency were also assessed. In single exposures, our results demonstrated that MC-LR and CYN had different impacts on the growth rates of C. vulgaris at the highest tested concentrations, being CYN the most toxic. In the mixture exposure trial, MC-LR and CYN showed a synergistic deviation from the conceptual model CA as the best descriptive model. MC-LR individually was not toxic even at high concentrations (37 mg L(-1)); however, the presence of MC-LR at much lower concentrations (0.4-16.7 mg L(-1)) increased the CYN toxicity. From these results, the combined exposure of MC-LR and CYN should be considered for risk assessment of mixtures as the toxicity may be underestimated when looking only at the single cyanotoxins and not their combination. This study also represents an important step to understand the interactions among MC-LR and CYN detected previously in aquatic systems.

Roles of piRNAs in microcystin-leucine-arginine (MC-LR) induced reproductive toxicity in testis on male offspring.

Science.gov (United States)

Zhang, Ling; Zhang, Hui; Zhang, Huan; Benson, Mikael; Han, Xiaodong; Li, Dongmei

2017-07-01

In the present study, we evaluated the toxic effects on the testis of the male offspring of MC-LR exposure during fetal and lactational periods. Pregnant females were distributed into two experimental groups: control group and MC-LR group which were exposed to 0 and 10 μg/L of MC-LR, respectively, through drinking water separately during fetal and lactational periods. At the age of 30 days after birth, the male offspring were euthanized. The body weight, testis index, and histomorphology change were observed and the global changes of piwi-interacting RNA (piRNA) expression were evaluated. The results revealed that MC-LR was found in the testis of male offspring, body weight and testis index decreased significantly, and testicular tissue structure was damaged in the MC-LR group. In addition, the exposure to MC-LR resulted in an altered piRNA expression profile and an increase of the cell apoptosis and a decrease of the cell proliferation in the testis of the male offspring. It was reasonable to speculate that the toxic effects on reproductive system of the male offspring in MC-LR group might be mediated by piRNAs through the regulation of the target genes. As far as we are aware, this is the first report showing that MC-LR could play a role in disorder of proliferative and cell apoptosis in the testis of the male offspring by the maternal transmission effect of toxicity. Copyright © 2017 Elsevier Ltd. All rights reserved.

Reactor physical experimental program EROS in the frame of the molten salt applying reactor concepts development

International Nuclear Information System (INIS)

Hron, Miloslav; Kyncl, Jan; Mikisek, Miroslav

2009-01-01

After the relatively broad program of experimental activities, which have been involved in the complex R and D program for the Molten Salt Reactor (MSR) - SPHINX (SPent Hot fuel Incinerator by Neutron fluX) concept development in the Czech Republic, there has been a next stage (namely large-scale experimental verification of design inputs by use of MSR-type inserted zones into the existing light water moderated experimental reactor LR-0 called EROS project) started, which will be focused to the experimental verification of the rector physical or neutronic properties of other types of reactor concepts applying molten salts in the role of liquid fuel and/or coolant. This tendency is based on the recently accepted decision of the MSR SSC of GIF to consider for further period of its activity two baseline concepts- fast neutron molten salt reactor non-moderated (FMSR-NM) as a long-term alternative to solid fuelled fast neutron reactors and simultaneously, advanced high temperature reactor (AHTR) with pebble bed type solid fuel cooled by liquid salts. There will be a brief description of the prepared and performed experimental programs in these directions (as well as the preliminary results obtained so far) introduced in the paper. (author)

Research and development of pyrochemical technologies for ADTT systems in NRI Rez plc

International Nuclear Information System (INIS)

Uhlir, J.

1999-01-01

The activities within the Czech national Partitioning and Transmutation program are oriented mainly toward the following areas: (i) ADS flowsheeting working out a proposal for a suitable technological flowsheet for treating spent fuel into a form fitted for transmutation reactor, including separation procedures before transmutation (Front-end) and separation processes after passage of fuel through the transmutor (Back-end). (ii) Technological research into the uranium component separation from spent fuel by the Fluoride Volatility Method semi-pilot-plant technological research based on the application of experience from spent fuel fluoride reprocessing. (iii) Laboratory research into electro-separation methods for the separation of fission products, plutonium and minor actinides from the fluoride melt. Selection of a suitable matrix composition of fluoride melts based on studies of their physicochemical properties and design of laboratory electro-separation facility. (iv) Development of materials and equipment for molten fluoride salts based ADS technologies, i.e. construction materials development, research into the corrosion resistance and development of equipment for molten fluoride salts technologies. The NRI Rez plc cooperates in this area with the SKODA Nuclear Machinery company

El léxico de parentesco quechua según Juan Pérez Bocanegra (Cuzco, siglo XVII

Directory of Open Access Journals (Sweden)

Raúl Bendezú-Araujo

2015-01-01

Full Text Available ResumenEn el marco de los estudios andinos coloniales, la figura de Juan Pérez Bocanegra, párroco de Andahuaylillas (Cuzco, goza de gran prestigio y su obra es frecuentemente citada como una fuente muy digna de crédito. El aporte más significativo de este clérigo a nuestro conocimiento del pasado andino lo constituye, muy probablemente, su detallada descripción del sistema de parentesco quechua. Ahora bien, sin intentar desmerecer el valor general de la obra de Pérez Bocanegra, la presente nota busca ofrecer una perspectiva lingüístico-filológica de los datos que esta presenta respectodel léxico de parentesco del quechua de inicios del siglo XVII. En ese sentido, intentaremos fundamentar la hipótesis de que, en relación con este aspecto particular, los datos de Pérez Bocanegra no son del todo fiables, pues obedecen a un proyecto evangelizador particular, que deja rastros en la selección y presentación de los lexemas que componen el campo léxico en cuestión.Palabras clave: filología andina, términos de parentesco, Juan Pérez Bocanegra, quechua colonial AbstractWithin the framework of colonial Andean studies, the image of Juan Perez Bocanegra, parish priest of Andahuaylillas (Cuzco, is highly regarded, and his work is often cited as a very reliable source. The most significant contribution of this cleric to our knowledge of the Andean past lies in its detailed description of the Quechua kinship system. However, without trying dismiss the overall value of the work of Pérez Bocanegra, this article seeks to provide a linguistic-philological perspective of the data he provides regarding the Quechua kinship lexicon from the early seventeenth century. In this respect, I will try to support the hypothesis that, on this particular aspect, this author’s data is not entirely reliable, for it obeys a particular evangelizer project that leaves traces in the selection and presentation of the lexemes that compose the lexical field in

El discurso político de Adolfo Suárez durante la Transición. Aplicaciones metodológicas / The political discourse of Adolfo Suárez in the process of Democratic Transition. Methodological applications

Directory of Open Access Journals (Sweden)

Antonio Pantoja Chaves

2009-06-01

Full Text Available Resumen: El presente artículo se centra, como primera toma de contacto , en el análisis del discurso político de Adolfo Suárez y de su componente ideológico durante la Transición, dentro del conjunto de las diferentes fuerzas políticas que más protagonismo tuvieron a lo largo de todo el proceso. La coalición de personalidades políticas que se reunieron en torno a la formación de la Unión de Centro Democrático, con la figura destacada del joven presidente Adolfo Suárez, presenta, no ya sólo para aquella época sino en la actualidad, un interés constante como objeto de estudio a partir de nuestro particular análisis metodológico. Summary: The present article concentrates, as an introduction, in the analysis of the political discourse of Adolfo Suárez and his ideological component during the Transition, within the set of the most outstanding political forces throughout the whole process. The coalition of political personalities that gathered in the formation of the Unión de Centro Democrático, with the prominent figure of young president Adolfo Suárez, is, not only for that one time but at present, a constant interest as object of study from our particular methodological analysis.

Validation of the reactor dynamics code HEXTRAN

International Nuclear Information System (INIS)

Kyrki-Rajamaeki, R.

1994-05-01

HEXTRAN is a new three-dimensional, hexagonal reactor dynamics code developed in the Technical Research Centre of Finland (VTT) for VVER type reactors. This report describes the validation work of HEXTRAN. The work has been made with the financing of the Finnish Centre for Radiation and Nuclear Safety (STUK). HEXTRAN is particularly intended for calculation of such accidents, in which radially asymmetric phenomena are included and both good neutron dynamics and two-phase thermal hydraulics are important. HEXTRAN is based on already validated codes. The models of these codes have been shown to function correctly also within the HEXTRAN code. The main new model of HEXTRAN, the spatial neutron kinetics model has been successfully validated against LR-0 test reactor and Loviisa plant measurements. Connected with SMABRE, HEXTRAN can be reliably used for calculation of transients including effects of the whole cooling system of VVERs. Further validation plans are also introduced in the report. (orig.). (23 refs., 16 figs., 2 tabs.)

System of institutional radioactive waste management in the Nuclear Research Institute Rez plc

International Nuclear Information System (INIS)

Podlaha, J.; Burian, P.

2005-01-01

The Nuclear Research Institute Rez plc (NRI) is a leading institution in the area of nuclear Research and Development in the Czech Republic. The NRI has had a dominant position in the nuclear programme since it was established in 1955 as a state-owned research organization and it has developed to its current status. In December 1992 the NRI has been transformed into a joint-stock company. The NRI's activity encompasses nuclear physics, chemistry, nuclear power, experiments at the research reactor and many other topics. Main issues addressed in the NRI in the past decades were concentrated on research, development and services provided to the nuclear power plants operating WWER reactors, development of chemical technologies for fuel cycle and irradiation services to research and development in the industrial sector, agriculture, food processing and medicine. At present the research activities are mainly targeted to assist the State Office for Nuclear Safety -the nuclear safety regulating body, power plant operator and nuclear facilities contractors. Significant attention is also paid to the use of nuclear technology outside the nuclear power sector, providing a wide range of services to industry , medicine and the preparation of radiopharmaceuticals. NRI operates two research nuclear reactors and another facilities such as a hot cell facility , research laboratories, technology for radioactive waste (RAW) management, 60 Co irradiators, an electron accelerator, etc. In this paper the Centre of RAW management, system of RAW management, facilities for RAW management as well as decontamination and decommissioning activities of the NRI are presented. The NRI provides complex services in the area of RAW management and has gained many experience and full qualification not only in this area but also in the area of decontamination and decommissioning and spent fuel management. The NRI guarantees safe RAW and spent fuel management. (authors)

Kinetic and mechanistic study of microcystin-LR degradation by nitrous acid under ultraviolet irradiation

International Nuclear Information System (INIS)

Ma, Qingwei; Ren, Jing; Huang, Honghui; Wang, Shoubing; Wang, Xiangrong; Fan, Zhengqiu

2012-01-01

Highlights: ► For the first time, degradation of MC-LR by nitrous acid under UV 365 nm was discovered. ► The effects of factors on MC-LR degradation were analyzed based on kinetic study. ► Mass spectrometry was applied for identification of intermediates and products. ► Special intermediates involved in this study were identified. ► Degradation mechanisms were proposed according to the results of LC–MS analysis. - Abstract: Degradation of microcystin-LR (MC-LR) in the presence of nitrous acid (HNO 2 ) under irradiation of 365 nm ultraviolet (UV) was studied for the first time. The influence of initial conditions including pH value, NaNO 2 concentration, MC-LR concentration and UV intensity were studied. MC-LR was degraded in the presence of HNO 2 ; enhanced degradation of MC-LR was observed with 365 nm UV irradiation, caused by the generation of hydroxyl radicals through the photolysis of HNO 2 . The degradation processes of MC-LR could well fit the pseudo-first-order kinetics. Mass spectrometry was applied for identification of the byproducts and the analysis of degradation mechanisms. Major degradation pathways were proposed according to the results of LC–MS analysis. The degradation of MC-LR was initiated via three major pathways: attack of hydroxyl radicals on the conjugated carbon double bonds of Adda, attack of hydroxyl radicals on the benzene ring of Adda, and attack of nitrosonium ion on the benzene ring of Adda.

Kinetic and mechanistic study of microcystin-LR degradation by nitrous acid under ultraviolet irradiation.

Science.gov (United States)

Ma, Qingwei; Ren, Jing; Huang, Honghui; Wang, Shoubing; Wang, Xiangrong; Fan, Zhengqiu

2012-05-15

Degradation of microcystin-LR (MC-LR) in the presence of nitrous acid (HNO(2)) under irradiation of 365nm ultraviolet (UV) was studied for the first time. The influence of initial conditions including pH value, NaNO(2) concentration, MC-LR concentration and UV intensity were studied. MC-LR was degraded in the presence of HNO(2); enhanced degradation of MC-LR was observed with 365nm UV irradiation, caused by the generation of hydroxyl radicals through the photolysis of HNO(2). The degradation processes of MC-LR could well fit the pseudo-first-order kinetics. Mass spectrometry was applied for identification of the byproducts and the analysis of degradation mechanisms. Major degradation pathways were proposed according to the results of LC-MS analysis. The degradation of MC-LR was initiated via three major pathways: attack of hydroxyl radicals on the conjugated carbon double bonds of Adda, attack of hydroxyl radicals on the benzene ring of Adda, and attack of nitrosonium ion on the benzene ring of Adda. Copyright © 2012 Elsevier B.V. All rights reserved.

SR and LR Union Suture for the Treatment of Myopic Strabismus Fixus: Is Scleral Fixation Necessary?

Directory of Open Access Journals (Sweden)

Carol P. S. Lam

2015-01-01

Full Text Available Purpose. To evaluate and compare the effectiveness of scleral fixation SR and LR union suture and nonscleral fixation union suture for the treatment of myopic strabismus fixus. Methods. Retrospective review of 32 eyes of 22 patients with myopic strabismus fixus who had undergone union suture of superior rectus (SR and lateral rectus (LR with or without scleral fixation, and follow-up longer than 6 months at Hong Kong Eye Hospital from 2006 to 2013. Surgical techniques and outcomes in terms of ocular alignment are analyzed. Results. There is significant overall improvement both in postoperative angle of esodeviation (P0.05. Conclusions. Union suture of SR and LR is an effective procedure in correcting myopic strabismus fixus. Fixation of the union suture to the sclera does not improve surgical outcome.

The wheat resistance gene Lr34 results in the constitutive induction of multiple defense pathways in transgenic barley.

Science.gov (United States)

Chauhan, Harsh; Boni, Rainer; Bucher, Rahel; Kuhn, Benjamin; Buchmann, Gabriele; Sucher, Justine; Selter, Liselotte L; Hensel, Goetz; Kumlehn, Jochen; Bigler, Laurent; Glauser, Gaëtan; Wicker, Thomas; Krattinger, Simon G; Keller, Beat

2015-10-01

The wheat gene Lr34 encodes an ABCG-type transporter which provides durable resistance against multiple pathogens. Lr34 is functional as a transgene in barley, but its mode of action has remained largely unknown both in wheat and barley. Here we studied gene expression in uninfected barley lines transgenic for Lr34. Genes from multiple defense pathways contributing to basal and inducible disease resistance were constitutively active in seedlings and mature leaves. In addition, the hormones jasmonic acid and salicylic acid were induced to high levels, and increased levels of lignin as well as hordatines were observed. These results demonstrate a strong, constitutive re-programming of metabolism by Lr34. The resistant Lr34 allele (Lr34res) encodes a protein that differs by two amino acid polymorphisms from the susceptible Lr34sus allele. The deletion of a single phenylalanine residue in Lr34sus was sufficient to induce the characteristic Lr34-based responses. Combination of Lr34res and Lr34sus in the same plant resulted in a reduction of Lr34res expression by 8- to 20-fold when the low-expressing Lr34res line BG8 was used as a parent. Crosses with the high-expressing Lr34res line BG9 resulted in an increase of Lr34sus expression by 13- to 16-fold in progenies that inherited both alleles. These results indicate an interaction of the two Lr34 alleles on the transcriptional level. Reduction of Lr34res expression in BG8 crosses reduced the negative pleiotropic effects of Lr34res on barley growth and vigor without compromising disease resistance, suggesting that transgenic combination of Lr34res and Lr34sus can result in agronomically useful resistance. © 2015 The Authors The Plant Journal © 2015 John Wiley & Sons Ltd.

Paul E. Kahle and Federico Pérez Castro: The Origins of the Madrid School of Biblical Text Criticism

Directory of Open Access Journals (Sweden)

Fernández Tejero, Emilia

2008-06-01

Full Text Available We have frequently been asked about the origins of the Madrid School of Biblical Text Criticism. We have limited the content of this paper to Masoretic studies. Research into the files of the former Instituto Arias Montano of the CSIC disclosed a series of unedited letters between Professors Kahle and Pérez Castro; a paper by F. Pérez Castro and F. Cantera Burgos on “Prof. Paul E. Kahle y los estudios de crítica textual bíblica en España,” and a description by F. Pérez Castro of the first project to edit the Cairo Codex of the Prophets. Through these materials we can trace the main steps of the relationship between these two relevant scholars and the role that such a relationship played in the origin and late development of these studies in Madrid.

A menudo se nos ha preguntado por los orígenes de la escuela de crítica textual bíblica de Madrid. Hemos limitado el contenido de este artículo a los estudios masoréticos. Investigando en los archivos del antiguo Instituto Arias Montano del CSIC hemos encontrado una colección de cartas inéditas entre los Profesores Kahle y Pérez Castro; un artículo escrito por F. Pérez Castro y F. Cantera Burgos titulado «Prof. Paul E. Kahle y los estudios de crítica textual bíblica en España», y la descripción hecha por Pérez Castro del primer proyecto para editar el Códice de Profetas de El Cairo. Gracias a estos testimonios hemos podido documentar las principales fases de la relación entre estos dos eminentes profesores y el papel que tal relación desempeñó en el origen y posterior desarrollo de estos estudios en Madrid.

Introduction of hot cell facility in research center Rez - Poster

International Nuclear Information System (INIS)

Petrickova, A.; Srba, O.; Miklos, M.; Svoboda, P.

2015-01-01

This poster presents the hot cell facility which is being constructed as part of the SUSEN project at the Rez research center (Czech Republic). Within this project a new complex of 10 hot cells and one semi-hot cell will be built. There will be 8 gamma hot cells and 2 alpha hot cells. In each hot cell a hermetic, removable box made of stainless steel will home different type of devices. The hot cells and semi hot cell will be equipped with devices for processing samples (cutting, welding, drilling, machining) as well as equipment for testing (sample preparation area, stress testing machine, fatigue machine, electromechanical creep machine, high frequency resonance pulsator...) and equipment for studying material microstructure (nano-indenter with nano-scratch tester and scanning electron microscope). An autoclave with water loop, installed in a cell will allow mechanical testing in control environment of water, pressure and temperature. A scheme shows the equipment of each cell. This hot laboratory will be able to cover all the process to study radioactive materials: receiving the material, the preparation of the samples, mechanical testing and microstructure observation. Our hot cells will be close to the research nuclear reactor LVR-15 and new irradiation facility (high irradiation by cobalt source) is planned to be built within the SUSEN project

Kinetic and mechanistic study of microcystin-LR degradation by nitrous acid under ultraviolet irradiation

Energy Technology Data Exchange (ETDEWEB)

Ma, Qingwei; Ren, Jing [Department of Environmental Science and Engineering, Fudan University, Shanghai 200433 (China); Huang, Honghui [Key Laboratory of Fisheries Ecology Environment, Ministry of Agriculture, Guangzhou 510300 (China); Wang, Shoubing [Department of Environmental Science and Engineering, Fudan University, Shanghai 200433 (China); Wang, Xiangrong, E-mail: xrxrwang@vip.sina.com [Department of Environmental Science and Engineering, Fudan University, Shanghai 200433 (China); Fan, Zhengqiu, E-mail: zhqfan@fudan.edu.cn [Department of Environmental Science and Engineering, Fudan University, Shanghai 200433 (China)

2012-05-15

Highlights: Black-Right-Pointing-Pointer For the first time, degradation of MC-LR by nitrous acid under UV 365 nm was discovered. Black-Right-Pointing-Pointer The effects of factors on MC-LR degradation were analyzed based on kinetic study. Black-Right-Pointing-Pointer Mass spectrometry was applied for identification of intermediates and products. Black-Right-Pointing-Pointer Special intermediates involved in this study were identified. Black-Right-Pointing-Pointer Degradation mechanisms were proposed according to the results of LC-MS analysis. - Abstract: Degradation of microcystin-LR (MC-LR) in the presence of nitrous acid (HNO{sub 2}) under irradiation of 365 nm ultraviolet (UV) was studied for the first time. The influence of initial conditions including pH value, NaNO{sub 2} concentration, MC-LR concentration and UV intensity were studied. MC-LR was degraded in the presence of HNO{sub 2}; enhanced degradation of MC-LR was observed with 365 nm UV irradiation, caused by the generation of hydroxyl radicals through the photolysis of HNO{sub 2}. The degradation processes of MC-LR could well fit the pseudo-first-order kinetics. Mass spectrometry was applied for identification of the byproducts and the analysis of degradation mechanisms. Major degradation pathways were proposed according to the results of LC-MS analysis. The degradation of MC-LR was initiated via three major pathways: attack of hydroxyl radicals on the conjugated carbon double bonds of Adda, attack of hydroxyl radicals on the benzene ring of Adda, and attack of nitrosonium ion on the benzene ring of Adda.

Fernando Cassinello Pérez, polyhedral architect

Directory of Open Access Journals (Sweden)

M. Centellas Soler

2017-03-01

Full Text Available The work of architect Fernando Cassinello Pérez (Almería, 1928-Madrid, 1975 rests on three pillars: architectural production focused on the design and construction of housing and hotel establishments, academic activity as Professor of Construction at the Escuela de Arquitectura de Madrid, and research concern developed in the IETcc of which he became director, and exercised as an author of books and research papers, as disseminator lecturer, speaker at major conferences or as an active member of international associations linked to construction with concrete. This article will review his prolific activity as polyhedral architect and will find interesting works that designed and built by relying on extensive contemporary and international architectural culture.

Degradation mechanisms of Microcystin-LR during UV-B photolysis and UV/H2O2 processes: Byproducts and pathways.

Science.gov (United States)

Moon, Bo-Ram; Kim, Tae-Kyoung; Kim, Moon-Kyung; Choi, Jaewon; Zoh, Kyung-Duk

2017-10-01

The removal and degradation pathways of microcystin-LR (MC-LR, [M+H] +  = 995.6) in UV-B photolysis and UV-B/H 2 O 2 processes were examined using liquid chromatography-tandem mass spectrometry. The UV/H 2 O 2 process was more efficient than UV-B photolysis for MC-LR removal. Eight by-products were newly identified in the UV-B photolysis ([M+H] +  = 414.3, 417.3, 709.6, 428.9, 608.6, 847.5, 807.4, and 823.6), and eleven by-products were identified in the UV-B/H 2 O 2 process ([M+H] +  = 707.4, 414.7, 429.3, 445.3, 608.6, 1052.0, 313.4, 823.6, 357.3, 245.2, and 805.7). Most of the MC-LR by-products had lower [M+H] + values than the MC-LR itself during both processes, except for the [M+H] + value of 1052.0 during UV-B photolysis. Based on identified by-products and peak area patterns, we proposed potential degradation pathways during the two processes. Bond cleavage and intramolecular electron rearrangement by electron pair in the nitrogen atom were the major reactions during UV-B photolysis and UV-B/H 2 O 2 processes, and hydroxylation by OH radical and the adduct formation reaction between the produced by-products were identified as additional pathways during the UV-B/H 2 O 2 process. Meanwhile, the degradation by-products identified from MC-LR during UV-B/H 2 O 2 process can be further degraded by increasing H 2 O 2 dose. Copyright © 2017 Elsevier Ltd. All rights reserved.

Microcystin-LR Induces Apoptosis via NF-κB /iNOS Pathway in INS-1 Cells

Directory of Open Access Journals (Sweden)

Kai Shen

2011-07-01

Full Text Available Cyanobacterial toxins, especially the microcystins, are found in eutrophied waters throughout the world, and their potential to impact on human and animal health is a cause for concern. Microcystin-LR (MC-LR is one of the common toxic microcystin congeners and occurs frequently in diverse water systems. Recent work suggested that apoptosis plays a major role in the toxic effects induced by MC-LR in hepatocytes. However, the roles of MC-LR in pancreatic beta cells have not been fully established. The aim of the present study was to assess possible in vitro effects of MC-LR on cell apoptosis in the rat insulinoma cell line, INS-1. Our results demonstrated that MC-LR promoted selectively activation of NF-κB (increasing nuclear p50/p65 translocation and increased the mRNA and protein levels of induced nitric oxide synthase (iNOS. The chronic treatment with MC-LR stimulated nitric oxide (NO production derived from iNOS and induced apoptosis in a dose dependent manner in INS-1 cells. Meanwhile, this effect was inhibited by the NF-κB inhibitor PDTC, which reversed the apoptosis induced by MC-LR. Our observations indicate that MC-LR induced cell apoptosis via an iNOS-dependent pathway. A well-known nuclear transcription factor, NF-κB, is activated and mediates intracellular nitric oxide synthesis. We suggest that the apoptosis induced by chronic MC-LR in vivo presents a possible cause of β-cell dysfunction, as a key environmental factor in the development of diabetes mellitus.

Photon spectrum behind biological shielding of the LVR-15 research reactor

Energy Technology Data Exchange (ETDEWEB)

Klupak, V.; Viererbl, L.; Lahodova, Z.; Marek, M.; Vins, M. [Research Centre Rez Ltd., Husinec-Rez 130 (Czech Republic)

2011-07-01

The LVR-15 reactor is a light water research reactor situated at the Research Centre Rez, near Prague. It operates as a multipurpose facility with a maximum thermal power of 10 MW. The reactor core usually contains from 28 to 32 fuel assemblies with a total mass of {sup 235}U of about 5 kg. Emitted radiation from the fuel caused by fission is shielded by moderating water, a steel reactor vessel, and heavy concrete. This paper deals with measurement and analysis of the gamma spectrum near the outer surface of the concrete wall, behind biological shielding, mainly in the 3- to 10-MeV energy range. A portable HPGe detector with a portable multichannel analyzer was used to measure gamma spectra. The origin of energy lines in gamma detector spectra was identified. (authors)

Marine biodiversity at the end of the world: Cape Horn and Diego Ramírez islands

Science.gov (United States)

Ballesteros, Enric; Bell, Tom W.; Giddens, Jonatha; Henning, Brad; Hüne, Mathias; Muñoz, Alex; Salinas-de-León, Pelayo; Sala, Enric

2018-01-01

The vast and complex coast of the Magellan Region of extreme southern Chile possesses a diversity of habitats including fjords, deep channels, and extensive kelp forests, with a unique mix of temperate and sub-Antarctic species. The Cape Horn and Diego Ramírez archipelagos are the most southerly locations in the Americas, with the southernmost kelp forests, and some of the least explored places on earth. The giant kelp Macrocystis pyrifera plays a key role in structuring the ecological communities of the entire region, with the large brown seaweed Lessonia spp. forming dense understories. Kelp densities were highest around Cape Horn, followed by Diego Ramírez, and lowest within the fjord region of Francisco Coloane Marine Park (mean canopy densities of 2.51 kg m-2, 2.29 kg m-2, and 2.14 kg m-2, respectively). There were clear differences in marine communities among these sub-regions, with the lowest diversity in the fjords. We observed 18 species of nearshore fishes, with average species richness nearly 50% higher at Diego Ramírez compared with Cape Horn and Francisco Coloane. The number of individual fishes was nearly 10 times higher at Diego Ramírez and 4 times higher at Cape Horn compared with the fjords. Dropcam surveys of mesophotic depths (53–105 m) identified 30 taxa from 25 families, 15 classes, and 7 phyla. While much of these deeper habitats consisted of soft sediment and cobble, in rocky habitats, echinoderms, mollusks, bryozoans, and sponges were common. The southern hagfish (Myxine australis) was the most frequently encountered of the deep-sea fishes (50% of deployments), and while the Fueguian sprat (Sprattus fuegensis) was the most abundant fish species, its distribution was patchy. The Cape Horn and Diego Ramírez archipelagos represent some of the last intact sub-Antarctic ecosystems remaining and a recently declared large protected area will help ensure the health of this unique region. PMID:29364902

Un texto inédito de Wenceslao Fernández Flórez. "¡S.O.S.! ¡Aquí Europa!"

Directory of Open Access Journals (Sweden)

María Teresa BARBADILLO

2009-11-01

Full Text Available Publicamos aquí un texto inédito de Wenceslao Fernández Flórez contenido en 23 cuartillas escritas de su puño y letra, que me fueron confiadas generosamente por sus sobrinos Wenceslao y Antonio Fernández Flórez. El manuscrito no lleva fecha alguna, y el sobre que lo contenía sólo reproduce el título, con la indicación «Charla radiofónica». Don Antonio Fernández Flórez tiene idea de que data de 1934 ó 35, posiblemente del mes de octubre. No obstante, ni en la prensa de esos años, ni en los archivos del Servicio de Documentación escrita de Radio Nacional de España —en donde nos atendieron con suma amabilidad— queda constancia de esta intervención de Fernández Flórez a través de las ondas.

In-pile cladding tests at NRI Rez and PIE capabilities and experience

International Nuclear Information System (INIS)

Zmitko, M.

2002-01-01

In-pile cladding corrosion test facilities and relevant post-irradiation capabilities at NRI Rez plc are overviewed. Basic information about the research rector LVR-15 and in-pile water loops is given. An experience in the field of Zr-alloy cladding corrosion testing and investigation of cladding corrosion behaviour is demonstrated for two experimental programmes conducted at NRI Rez in the past period. The first example describes results obtained at studying of corrosion behaviour of advanced Zr-alloys under PWR conditions with a special concern to a high lithium content and subcooled surface boiling. The second example informs about completion of the experimental programme supported by the IAEA which is focused on investigation of Zircaloy-4 cladding behaviour under VVER water chemistry, thermal-hydraulic and irradiation conditions with the main to obtain experimental data for an assessment of the Zircaloy-4 cladding compatibility with VVER conditions. (author)

AER Working Group D on VVER safety analysis minutes of the meeting in Rez, Czech Republic 18-20 May 1998

International Nuclear Information System (INIS)

Siltanen, P.

1998-01-01

AER Working Group D on VVER reactor safety analysis held its seventh meeting in Hotel Vltava in Rez near Prague during the period 18-20 May 1998. There were altogether 11 participants from 8 member organisations. The coordinator for the working group, Mr. P. Siltanen (IVO) served as chairman. In addition to the general information exchange on recent activities, the topics of the meeting included: First review of solutions to the 3-dimensional AER Dynamic Benchmark Problem No. 5 on a steam line break accident. This benchmark involves a break of the main steam header. Safety analysis of reactivity events. Recent code development work and fuel behaviour. Coolant mixing calculations and experiments related to diluted slugs. A list of participants and a list of handouts distributed at the meeting are attached to the minutes. (author)

The wheat Lr34 multipathogen resistance gene confers resistance to anthracnose and rust in sorghum.

Science.gov (United States)

Schnippenkoetter, Wendelin; Lo, Clive; Liu, Guoquan; Dibley, Katherine; Chan, Wai Lung; White, Jodie; Milne, Ricky; Zwart, Alexander; Kwong, Eunjung; Keller, Beat; Godwin, Ian; Krattinger, Simon G; Lagudah, Evans

2017-11-01

The ability of the wheat Lr34 multipathogen resistance gene (Lr34res) to function across a wide taxonomic boundary was investigated in transgenic Sorghum bicolor. Increased resistance to sorghum rust and anthracnose disease symptoms following infection with the biotrophic pathogen Puccinia purpurea and the hemibiotroph Colletotrichum sublineolum, respectively, occurred in transgenic plants expressing the Lr34res ABC transporter. Transgenic sorghum lines that highly expressed the wheat Lr34res gene exhibited immunity to sorghum rust compared to the low-expressing single copy Lr34res genotype that conferred partial resistance. Pathogen-induced pigmentation mediated by flavonoid phytoalexins was evident on transgenic sorghum leaves following P. purpurea infection within 24-72 h, which paralleled Lr34res gene expression. Elevated expression of flavone synthase II, flavanone 4-reductase and dihydroflavonol reductase genes which control the biosynthesis of flavonoid phytoalexins characterized the highly expressing Lr34res transgenic lines 24-h post-inoculation with P. purpurea. Metabolite analysis of mesocotyls infected with C. sublineolum showed increased levels of 3-deoxyanthocyanidin metabolites were associated with Lr34res expression, concomitant with reduced symptoms of anthracnose. © 2017 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

Lr-Lp Stability of the Incompressible Flows with Nonzero Far-Field Velocity

Directory of Open Access Journals (Sweden)

Jaiok Roh

2011-01-01

Full Text Available We consider the stability of stationary solutions w for the exterior Navier-Stokes flows with a nonzero constant velocity u∞ at infinity. For u∞=0 with nonzero stationary solution w, Chen (1993, Kozono and Ogawa (1994, and Borchers and Miyakawa (1995 have studied the temporal stability in Lp spaces for 11 and obtain Lr-Lp stability as Kozono and Ogawa and Borchers and Miyakawa obtained for u∞=0.

Tipos de tirano y resistencia en Francisco Suárez

Directory of Open Access Journals (Sweden)

Pablo Font Oporto

2017-09-01

Full Text Available El presente artículo pretende analizar la discusión que Francisco Suárez mantiene con las tesis contrarias a la distinción entre tipos de tirano en la cuestión del tiranicidio (Defensio fidei, Libro VI, capítulo IV, números 10-13. Para esta visión no le es lícito a una persona privada matar a ninguno de los dos tipos de tirano; sólo es posible darles muerte en legítima defensa, porque se entiende que en tal caso se actúa en ejercicio de autoridad pública. Suárez acaba admitiendo esta tesis en el número 13, lo que parece contradecirse con lo sostenido en el número 7, donde se aceptaba la muerte del usurpador por cualquier particular. Sin embargo, en el fondo mantiene la diferencia entre ambos tipos de tirano, por cuanto que en el caso del usurpador sostiene que siempre se dan las condiciones para alegar legítima defensa. Queda sin aclarar qué ocurre en tal caso con las condiciones dispuestas en los números 8 y 9.

y Ciudad Juárez, Chihuahua

Directory of Open Access Journals (Sweden)

Socorro Arzaluz Solano

2006-01-01

Full Text Available El artículo aborda la aplicación del Programa Hábitat, diseñado por el Gobierno de Vicente Fox en 2002, en dos ciudades fronterizas: Nogales, Sonora, y Ciudad Juárez, Chihuahua. Se analiza la implantación del programa atendiendo sus particularidades, entre otros aspectos, se señalan los diferentes agentes que intervinieron en la ejecución de Hábitat, que pese a la claridad de las reglas, fueron diferentes en cada caso. También, las forma s de participación ciudadana promovidas por los gobiernos locales en ambos casos. Se presentan una reflexión final sobre el desarrollo de Hábitat en la frontera norte, y algunas recomendaciones.

Photocatalytic Cellulosic Electrospun Fibers for the Degradation of Potent Cyanobacteria Toxin Microcystin-LR

Science.gov (United States)

2012-01-01

visible light activated or UV light activated), the surface area of the fiber mat, and loading solution pH all have an effect on the distribution of...photocatalysis with nanoparticles (such as titania, TiO2 ) show tremendous promise as a simple and energy efficient tech- nology for water purification and...LR (MC-LR). MC- LR is one of the most commonly found cyanobacteria toxins generated by the more frequently occurring cyanobacteria algae blooms in

A novel photocatalytic material for removing microcystin-LR under visible light irradiation: degradation characteristics and mechanisms.

Directory of Open Access Journals (Sweden)

Xin Sui

Full Text Available Microcystin-LR (MC-LR, a common toxic species in contaminated aquatic systems, persists for long periods because of its cyclic structure. Ag3PO4 is an environment-friendly photocatalyst with relatively good degradation capacity for hazardous organic pollutants. This study aimed to investigate the degradation capacity of Ag3PO4 for MC-LR under visible light.An Ag3PO4 photocatalyst was synthesized by the ion-exchange method and characterized by X-ray diffraction, field-emission scanning electron microscope, and UV-Vis spectrophotometer. MC-LR was quantified in each sample through high-performance liquid chromatograph. The degradation efficiency of MC-LR was affected by initial pH, initial Ag3PO4 concentration, initial MC-LR concentration, and recycle experiments. The degradation intermediates of MC-LR were examined by liquid chromatography-mass spectrometry (LC/MS.The degradation process can be well fitted with the pseudo-first-order kinetic model. The maximum MC-LR degradation rate of 99.98% can be obtained within 5 h under the following optimum conditions: pH of 5.01, Ag3PO4 concentration of 26.67 g/L, and MC-LR concentration of 9.06 mg/L. Nine intermediates were detected and analyzed by LC/MS. Three main degradation pathways were proposed based on the molecular weight of the intermediates and the reaction mechanism: (1 hydroxylation on the aromatic ring of Adda, (2 hydroxylation on the diene bonds of Adda, and (3 internal interactions on the cyclic structure of MC-LR.Ag3PO4 is a highly efficient catalyst for MC-LR degradation in aqueous solutions.

Remediation of old environmental liabilities in the Nuclear Research Institute Rez plc

International Nuclear Information System (INIS)

Svoboda, Karel; Podlaha, Josef

2011-01-01

The Nuclear Research Institute Rez plc (NRI) after 55 years of activities in the nuclear field produced some environmental liabilities that shall be remedied. There are three areas of remediation: (1) decommissioning of old obsolete facilities (e.g. decay tanks, RAW treatment technology, special sewage system), (2) processing of RAW from operation and dismantling of nuclear facilities, and (3) elimination of spent fuel from research nuclear reactors operated by the NRI. The goal is to remedy the environmental liabilities and eliminate the potential negative impact on the environment. Remediation of the environmental liabilities started in 2003 and will be finished in 2014. The character of the environmental liabilities is very specific and requires special remediation procedures. Special technologies are being developed with assistance of external subcontractors. The NRI has gained many experiences in the field of RAW management and decommissioning of nuclear facilities and will use its facilities, experienced staff and all relevant data needed for the successful realization of the remediation. The most significant items of environmental liabilities are described in the paper together with information about the history, the current state, the progress, and the future activities in the field of remediation of environmental liabilities in the NRI. (author)

Pitavastatin attenuates the PDGF-induced LR11/uPA receptor-mediated migration of smooth muscle cells

International Nuclear Information System (INIS)

Jiang, Meizi; Bujo, Hideaki; Zhu, Yanjuan; Yamazaki, Hiroyuki; Hirayama, Satoshi; Kanaki, Tatsuro; Shibasaki, Manabu; Takahashi, Kazuo; Schneider, Wolfgang J.; Saito, Yasushi

2006-01-01

Statins, inhibitors of HMG-CoA reductase, elicit various actions on vascular cells including the modulation of proliferation and migration of smooth muscle cells (SMCs). Here, we have elucidated the mechanism by which statins, in particular pitavastatin, attenuate the migration activity of SMCs. The expression of LR11, a member of the LDL receptor family and an enhancer of cell surface localization of urokinase-type plasminogen activator receptor (uPAR), is increased in cultured SMCs by treatment with PDGF-BB. Pitavastatin attenuates the PDGF-BB -induced surface expression of LR11 and uPAR. The increased migration of SMCs observed both upon overexpression of LR11 and via stimulation of secretion of soluble LR11 is not reversed by pitavastatin. In vivo studies showed that the SMCs expressing LR11 in plaques are almost congruent with intimal cells expressing nonmuscle myosin heavy chain (SMemb). Pitavastatin reduced the expression of LR11 and SMemb, and the levels of LR11, uPAR, and SMemb in cultured intimal SMCs were reduced to those seen in medial SMCs. We propose that this statin reduces PDGF-induced migration through the attenuation of the LR11/uPAR system in SMCs. Modulation of the LR11/uPAR system with statins suggests a novel treatment strategy for atherogenesis based on suppression of intimal SMC migration

Fundamentos teológicos de la censura en Francisco Suárez

Directory of Open Access Journals (Sweden)

Manuel Lázaro Pulido

2017-09-01

Full Text Available La censura es un acto recogido dentro del Código de Derecho Canónico. La teología subyacente se inscribe dentro de la historia de la salvación propia del concilio Vaticano II. Varios siglos antes, el maestro jesuita Francisco Suárez reflexionó sobre la censura en un voluminoso tratado (Disputationum de censuris…, en el que anticipa los elementos pertenecientes a la censura que aparecen en el actual CDC. Suárez realiza una lectura teológica en el que destaca el carácter medicinal de la censura, a partir de la lectura sacramental de la pena y desde un antropología de la voluntad, que supone una apuesta por la prevención del hombre y su salvación, antes que por su carácter penal, o si se quiere por dotar a la ley penal de un carácter salvífico.

Effects of sintering process, pH and temperature on chemical durability of Ce{sub 0.5}Pr{sub 0.5}PO{sub 4} ceramics

Energy Technology Data Exchange (ETDEWEB)

Ma, Jiyan; Teng, Yuancheng, E-mail: tyc239@163.com; Huang, Yi; Wu, Lang; Zhang, Kuibao; Zhao, Xiaofeng

2015-10-15

The Ce{sub 0.5}Pr{sub 0.5}PO{sub 4} ceramics with high relative density of 99% and small average grain size of 0.15 μm were prepared by hot-pressing at 1150 °C for 2 h. The effects of sintering process, pH values and temperature on the chemical durability of the ceramics were investigated. The results show that normalized elemental leaching rates of Pr (LR{sub Pr}) and Ce (LR{sub Ce}) of the hot-pressed ceramics are slightly lower than that of the ceramics sintered at 1500 °C for 4 h by normal pressure. The LR{sub Pr} and LR{sub Ce} reach the highest values (∼10{sup −3} g m{sup −2} d{sup −1}) when pH = 3, while the LR{sub Pr} and LR{sub Ce} have the lowest values (∼10{sup −7} g m{sup −2} d{sup −1}) when pH = 7. The surface of the ceramic in pH = 3 leachate appears serious corrosion with plenty of pores. The precipitation of low-soluble was formed on sample surface during leaching tests at pH = 9 and 11. - Highlights: • The Ce{sub 0.5}Pr{sub 0.5}PO{sub 4} ceramics with high relative density of 99% and small average grain size of 0.15 µm were prepared by hot-pressing at 1150 ºC for 2 h. • The normalized elemental leaching rates of Pr (LR{sub Pr}) and Ce (LR{sub Ce}) of the hot-pressed ceramics are slightly lower than that of the ceramics sintered at 1500 ºC for 4 h by normal pressure. • The LR{sub Pr} and LR{sub Ce} reach the highest values (∼10{sup −3} g m{sup −2} d{sup −1}) when pH = 3, while the LR{sub Pr} and LR{sub Ce} have the lowest values (∼10{sup −7} g m{sup −2} d{sup −1}) when pH = 7.

Remediation of the old environmental liabilities in the Nuclear Research Institute Rez. Situation at the end of 2008

Energy Technology Data Exchange (ETDEWEB)

Kovarik, Petr; Svoboda, Karel; Podlaha, Josef [Nuclear Research Institute Rez (Czech Republic)

2010-10-15

The Nuclear Research Institute Rez (NRI) has been a leading institution in the area of R and D (Research and Development) in the Czech Republic. The NRI has had a dominant position in the nuclear programme of the former Czechoslovakia since it was established in 1955. In December 1992 the NRI has been transformed into a joint-stock company. The Institute's activity encompasses nuclear physics, radiochemistry, experiments at the research reactor and many other topics. Main issues addressed in the NRI in the past decades were concentrated on research, development and services provided to the VVER reactors, development of chemical technologies for fuel cycle and irradiation services. Currently, the research activities are mainly targeted to assist the State Office for Nuclear Safety. Significant attention is also paid to the use of nuclear technology outside the nuclear power sector, providing a wide range of services to industry, medicine and the preparation of radiopharmaceuticals. NRI operates 2 research nuclear reactors, hot cell facility, research laboratories, and technology for radioactive waste management, radionuclide irradiators, an electron accelerator and others. After 50 years of activities in the nuclear field, there have been many environmental liabilities that are being remedied in the NRI. There are 3 areas of these remediation activities: - decommissioning of old obsolete facilities, - processing of RAW resulting from operation and dismantling of nuclear facilities, and - elimination of spent fuel from research nuclear reactors. The goal is to remedy the environmental liabilities and eliminate the potential negative impact on the environment. Remediation of the environmental liabilities started in 2003 and should be finished in 2014. (orig.)

LR-90 prevents methylglyoxal-induced oxidative stress and apoptosis in human endothelial cells

Science.gov (United States)

Figarola, James L.; Singhal, Jyotsana; Rahbar, Samuel; Awasthi, Sanjay

2014-01-01

Methylglyoxal (MGO) is a highly reactive dicarbonyl compound known to induce cellular injury and cytoxicity, including apoptosis in vascular cells. Vascular endothelial cell apoptosis has been implicated in the pathophysiology and progression of atherosclerosis. We investigated whether the advanced glycation end-product inhibitor LR-90 could prevent MGO-induced apoptosis in human umbilical vascular endothelial cells (HUVECs). HUVECs were pre-treated with LR-90 and then stimulated with MGO. Cell morphology, cytotoxicity and apoptosis were evaluated by light microscopy, MTT assay, and Annexin V-FITC and propidium iodide double staining, respectively. Levels of Bax, Bcl-2, cytochrome c, mitogen-activated protein kinases (MAPKs) and caspase activities were assessed by Western blotting. Reactive oxygen species (ROS) generation and mitochondrial membrane potential (MMP) were measured with fluorescent probes. LR-90 dose-dependently prevented MGO-associated HUVEC cytotoxicity and apoptotic biochemical changes such as loss of MMP, increased Bax/Bcl-2 protein ratio, mitochondrial cytochrome c release and activation of caspase-3 and 9. Additionally, LR-90 blocked intracellular ROS formation and MAPK (p44/p42, p38, JNK) activation, though the latter seem to be not directly involved in MGO-induced HUVEC apoptosis. LR-90 prevents MGO-induced HUVEC apoptosis by inhibiting ROS and associated mitochondrial-dependent apoptotic signaling cascades, suggesting that LR-90 possess cytoprotective ability which could be beneficial in prevention of diabetic related-atherosclerosis. PMID:24615331

Las culpas del Rey y de su Favorito. El proceso a Alonso Ramírez de Prado (1607-1608

Directory of Open Access Journals (Sweden)

Giuseppe MROZEK ELISZEZYNSKI

2013-01-01

Full Text Available El enorme poder alcanzado por el letrado Alonso Ramírez de Prado en los primeros ocho años (1598-1606 del reinado de Felipe III fue resultado directodel dominio que su patrón, el duque de Lerma, ejerció sobre la corte y el joven rey. El 26 diciembre de 1606, su repentina detención puso fin a una rutilante carrera política y empezó un proceso, descuidado por mucho tiempo por los historiadores, junto al conde de Villalonga, don Pedro Franqueza. A través del análisis de la documentación oficial relativa a la causa de Ramírez de Prado, el presente trabajo pretende ilustrar las diferentes razones de la acusación y,sobre todo, los argumentos de la defensa, encargada al hijo del acusado, don Lorenzo Ramírez de Prado. El veredicto de culpabilidad emitido al final del proceso parecía anular cualquier argumento de la defensa. Sin embargo, el debate sobre la responsabilidad del soberano con respecto al poder de susfavoritos continuó a lo largo de las décadas siguientes.The huge power achieved by the jurist Alonso Ramírez de Prado in the firsteight years (1598-1606 of the reign of Philip III was a direct result of the supremacy of his patron, the Duke of Lerma, over the whole court and theyoung king. On December 26, 1606, his sudden arrest brought his brilliantcareer in politics to an end and started a trial, overlooked for a long time by historians in favor of the concurrent one against the Earl of Villalonga, PedroFranqueza. Through the analysis of the official documentation about the case of Ramírez de Prado, the article aims to illustrate the many reasons of the prosecution and, above all, the arguments of the defence, entrusted to his son, Lorenzo Ramírez de Prado. The verdict of guilty returned at the end of the process seemed to erase any argument of the defence. However, the debateabout the responsibilities of the sovereign in relation to the power of his favourites was destined to continue in the following decades

Crystallization and preliminary crystallographic analysis of human LR11 Vps10p domain

International Nuclear Information System (INIS)

Nakata, Zenzaburo; Nagae, Masamichi; Yasui, Norihisa; Bujo, Hideaki; Nogi, Terukazu; Takagi, Junichi

2010-01-01

LR11/sorLA contains in its extracellular region a large (∼700-residue) Vps10p domain that is implicated in its intracellular protein-trafficking function. Here, the expression, purification, crystallization and preliminary crystallographic characterization of this domain are described. Low-density lipoprotein receptor (LDLR) relative with 11 binding repeats (LR11; also known as sorLA) is genetically associated with late-onset Alzheimer’s disease and is thought to be involved in neurodegenerative processes. LR11 contains a vacuolar protein-sorting 10 protein (Vps10p) domain. As this domain has been implicated in protein–protein interaction in other receptors, its structure and function are of great biological interest. Human LR11 Vps10p domain was expressed in mammalian cells and the purified protein was crystallized using the hanging-drop vapour-diffusion method. Enzymatic deglycosylation of the sample was critical to obtaining diffraction-quality crystals. Deglycosylated LR11 Vps10p-domain crystals belonged to the hexagonal space group P6 1 22. A diffraction data set was collected to 2.4 Å resolution and a clear molecular-replacement solution was obtained

Main: 1LR5 [RPSD[Archive

Lifescience Database Archive (English)

Full Text Available Aux311; Zea Mays Molecule: Auxin Binding Protein 1; Chain: A, B, C, D; Engineered: Yes; Mutation: Yes Protei...-.|EMBL; L08425; AAA33430.1; -.|PIR; S16262; S16262.|PDB; 1LR5; X-ray; A/B/C/D=39-201.|PDB; 1LRH; X-ray; A/B/C/D=39-201.|Mai

Some investigations and use of LR-115 track detectors for radon measurements

CERN Document Server

Amrani, D

2001-01-01

Closed passive integrating radon dosimeters based on the use of cellulose nitrate (LR-115 type II) have been developed for assessment of long term radon exposure. This paper presents and comments the results of investigations, of registration efficiency, calibration factors, linearity tests and lower limit of detection for LR-115 detectors from different batches.

Time changes of vertical profile of neutron fluence rate in LVR-15 reactor

International Nuclear Information System (INIS)

Viererbl, L.; Stehno, J.; Erben, O.; Lahodova, Z.; Marek, M.

2003-01-01

The LVR-15 reactor is a light water research type reactor, which is situated, in Nuclear Research Institute, Rez near Prague. The reactor is used as a multipurpose facility. For some experiments and material productions, e.g. for homogeneity of silicon resistance in production of radiation doped silicon, the time changes of vertical profile of neutron fluence rate are particularly important. The assembly used for silicon irradiation has two self-powered neutron detectors installed in a vertical irradiation channel in LVR-15 reactor. Vertical profile of thermal neutron fluence rate was automatically scanned during reactor operation. The results of measurements made in 2002 and 2003 with these detectors are presented. A set of vertical profile measurements was made during two 21-days reactor cycles. During the cycle the vertical profile slightly changes both in the position of its maximum and in the shape. The time dependences of the position of profile maximum and the profile width at half maximum during the cycle are given. (author)

Detection of trace microcystin-LR on a 20 MHz QCM sensor coated with in situ self-assembled MIPs.

Science.gov (United States)

He, Hao; Zhou, Lianqun; Wang, Yi; Li, Chuanyu; Yao, Jia; Zhang, Wei; Zhang, Qingwen; Li, Mingyu; Li, Haiwen; Dong, Wen-fei

2015-01-01

A 20 MHz quartz crystal microbalance (QCM) sensor coated with in situ self-assembled molecularly imprinted polymers (MIPs) was presented for the detection of trace microcystin-LR (MC-LR) in drinking water. The sensor performance obtained using the in situ self-assembled MIPs was compared with traditionally synthesized MIPs on 20 MHz and normal 10 MHz QCM chip. The results show that the response increases by more than 60% when using the in situ self-assembly method compared using the traditionally method while the 20 MHz QCM chip provides four-fold higher response than the 10 MHz one. Therefore, the in situ self-assembled MIPs coated on a high frequency QCM chip was used in the sensor performance test to detect MC-LR in tap water. It showed a limit of detection (LOD) of 0.04 nM which is lower than the safety guideline level (1 nM MC-LR) of drinking water in China. The low sensor response to other analogs indicated the high specificity of the sensor to MC-LR. The sensor showed high stability and low signal variation less than 2.58% after regeneration. The lake water sample analysis shows the sensor is possible for practical use. The combination of the higher frequency QCM with the in situ self-assembled MIPs provides a good candidate for the detection of other small molecules. Copyright © 2014 Elsevier B.V. All rights reserved.

Nostalgia of the Encomienda. Rereading Juan Suárez de Peralta's Tratado del descubrimiento (1589

Directory of Open Access Journals (Sweden)

Enrique González González

2009-10-01

Full Text Available The work Tratado del descubrimiento de las Yndias y su conquista, written  by the New Spain Creole Juan Suárez de Peralta around 1589, has traditionally been read as just another Conquest chronicle, scarcely interesting in its first chapters, but fully vivid in its “second” part, where the author  tells of the so-called conspiracy of Martín Cortés,  Second Marquis of the Valley of Oaxaca. This paper, however, suggests that the Tratado, in keeping with its title, must be read as a treatise in which Suárez de Peralta pleads for the legitimacy of the encomienda and offers an account of the fateful —as he sees them— consequences  brought about by the Crown's rulings to suppress it. Therefore, the Tratado must be considered within the great debates of the time on how conquered peoples, conquerors and their descendants  should be treated. Although not a professional lawyer, Suárez de Peralta turns out to be a resourceful and convincing writer. Far from offering a linear account  of a series of events, he takes advantage of ambiguity in order  to argue, from different  viewpoints,  on several issues. Sensing that he defends a lost cause, his allegation oozes irony, disillusion, and nostalgia.

Microcystin-LR induces anoikis resistance to the hepatocyte uptake transporter OATP1B3-expressing cell lines

International Nuclear Information System (INIS)

Takano, Hiroyuki; Takumi, Shota; Ikema, Satoshi; Mizoue, Nozomi; Hotta, Yuki; Shiozaki, Kazuhiro; Sugiyama, Yasumasa; Furukawa, Tatsuhiko; Komatsu, Masaharu

2014-01-01

Microcystin-LR is a cyclic peptide released by several bloom-forming cyanobacteria. Understanding the mechanism of microcystin-LR toxicity is important, because of the both potencies of its acute cytotoxicity and tumor-promoting activity in hepatocytes of animals and humans. Recently, we have reported that the expression of human hepatocyte uptake transporter OATP1B3 was critical for the selective uptake of microcystin-LR into hepatocytes and for induction of its fatal cytotoxicity. In this study, we demonstrated a novel function of microcystin-LR which induced bipotential changes including anoikis resistance and cytoskeleton reorganization to OATP1B3-transfected HEK293 cells (HEK293-OATP1B3). After exposure to microcystin-LR, HEK293-OATP1B3 cells were divided to the floating cells and remaining adherent cells. After collection and reseeding the floating cells into a fresh flask, cells were confluently proliferated (HEK293-OATP1B3-FL) under the microcystin-LR-free condition. Both the proliferated HEK293-OATP1B3-FL and remaining adherent HEK293-OATP1B3-AD cells changed the character with down- and up-regulation of E-cadherin, respectively. Additionally, these cells acquired resistance to microcystin-LR. These results suggest that microcystin-LR could be associated with not only tumor promotion, but also epithelial–mesenchymal transition-mediated cancer metastasis. Furthermore, microcystin-LR might induce the cytoskeleton reorganization be accompanied epithelial–mesenchymal transition

Analysis of WRKY transcription factors and characterization of two Botrytis cinerea-responsive LrWRKY genes from Lilium regale.

Science.gov (United States)

Cui, Qi; Yan, Xiao; Gao, Xue; Zhang, Dong-Mei; He, Heng-Bin; Jia, Gui-Xia

2018-06-01

A major constraint in producing lilies is gray mold caused by Botrytis elliptica and B. cinerea. WRKY transcription factors play important roles in plant immune responses. However, limited information is available about the WRKY gene family in lily plants. In this study, 23 LrWRKY genes with complete WRKY domains were identified from the Botrytis-resistant species Lilium regale. The putative WRKY genes were divided into seven subgroups (Group I, IIa-e, and III) according to their structural features. Sequence alignment revealed that LrWRKY proteins have a highly conserved WRKYGQK domain and a variant, the WRKYGKK domain, and these proteins generally contained similar motif compositions throughout the same subgroup. Functional annotation predicted they might be involved in biological processes related to abiotic and biotic stresses. A qRT-PCR analysis confirmed that expression of six LrWRKY genes in L. regale or the susceptible Asian hybrid 'Yale' was induced by B. cinerea infection. Among these genes, LrWRKY4, LrWRKY8 and LrWRKY10 were expressed at a higher level in L. regale than 'Yale', while the expression of LrWRKY6 and LrWRKY12 was lower in L. regale. Furthermore, LrWRKY4 and LrWRKY12 genes, which also respond to salicylic acid (SA) and methyl jasmonate (MeJA) treatments, were isolated from L. regale. Subcellular localization analysis determined that they were targeted to the nucleus. Constitutive expression of LrWRKY4 and LrWRKY12 in Arabidopsis resulted in plants that were more resistant to B. cinerea than wild-type plants. This resistance was coupled with the transcriptional changes of SA and JA-responsive genes. Overall, our study provides valuable information about the structural and functional characterization of LrWRKY genes that will not only deepen our understanding of the molecular mechanisms underlying the defense of lily against B. cinerea but also offer potential targets for cultivar improvement via biotechnology. Copyright © 2018 Elsevier Masson

Conversando sobre sexualidades Entrevista a Gloria Careaga Pérez

OpenAIRE

Fernández Carvajal, Doris

2015-01-01

Gloria Careaga Pérez: cuenta con una Maestría en Psicología Social, en la Universidad Nacional Autónoma de México (UNAM) y Licenciatura en Psicología, en el Instituto Tecnológico de Estudios Superiores de Occidente. Se desempeña como profesora de la Facultad de Psicología de Universidad Nacional Autónoma de México (UNAM). Es activista feminista, con una amplia participación en foros y conferencias internacionales en defensa de los derechos humanos de las personas sexualmente diversas. Integra...

Chronic exposure to microcystin-LR affected mitochondrial DNA maintenance and caused pathological changes of lung tissue in mice

International Nuclear Information System (INIS)

Li, Xinxiu; Xu, Lizhi; Zhou, Wei; Zhao, Qingya; Wang, Yaping

2016-01-01

Microcystin-LR (MC-LR), an important variant of cyanotoxin family, was frequently encountered in the contaminated aquatic environment and taken as a potent hepatotoxin. However, a little was known on the association between the long-term MC-LR exposure and lung damage. In this study, we investigated the changes of the pulmonary histopathology, mitochondrial DNA (mtDNA) integrity and the expression of mtDNA encoded genes in the mice with chronic exposed to MC-LR at different concentrations (1, 5, 10, 20 and 40 μg/L) for 12 months. Our results showed that the long-term and persistent exposure to MC-LR disturbed the balance of redox system, influenced mtDNA stability, changed the expression of mitochondrial genes in the lung cells. Notably, MC-LR exposure influenced the level of inflammatory cytokines and resulted in thickening of the alveolar septa. In conclusion, chronic exposure to MC-LR affected mtDNA maintenance, and caused lung impairment in mice. - Highlights: • A simulated natural exposure to MC-LR caused the lung pathological changes. • The chronic exposure disturbed the redox system balance of lung tissue cells. • The chronic exposure impaired the mtDNA stability and mitochondria function. • The lung was one of the vulnerable organs to MC-LR exposure in mice. - Long-term exposure to MC-LR in drinking water disturbed the balance of redox system, affected mitochondrial DNA maintenance and caused lung impairment in mice.

An Overlooked Contributor to a Unique Colombian Periodical. Enrique Pérez and the revista Hispania (1912-1916

Directory of Open Access Journals (Sweden)

Jane M. Rausch

2018-04-01

Full Text Available Hispania, a cultural periodical published in London between 1912 and 1916, was an important Colombian endeavor that reflected widely-shared Latin American concerns before and during the outbreak of the First World War. After a brief review of the role of literary periodicals in Colombian humanities, this essay analyzes the numerous contributions published by Enrique Pérez Lleras in Hispania. It concludes that Pérez believed Hispanic America could have avoided the threat of United States and/or European imperialism by spurning despotic rule, educating a governing elite, developing a trained civil service, and establishing strict controls over foreign investment and immigration.

Application of DNA RFLP procedures in interspecific gene transfer: The Lr19 translocation of wheat

International Nuclear Information System (INIS)

Prins, R.; Marais, G.F.; Marais, A.S.; Pretorius, Z.A.; Janse, B.J.H.

1998-01-01

Twenty-nine lines with deletions in the Lr19 ('Indis') translocated chromosome segment were used to physically map Thinopyrum Restriction Fragment Length Polymorphism (RFLP) loci as well as the Sr25 and Sdl loci. The relative distances between marker loci on the translocation were then calculated. The information was then used as an aid to characterize several recombined forms of the translocation. The data confirmed the reported homoeology between the Lr19 segment and chromosome arm 7DL of wheat. Also, it seems that the Lr19 translocation in 'Indis' is very similar to the Lr19 segment in the T4 source and that the former may not derive from Thinopyrum distichum. Near-isogenic lines of the recombined segments were derived and used to study their expression of leaf rust resistance. It became evident that only one potentially useful recombinant was obtained in an earlier attempt to induce allosyndetic pairing between the Lr19 translocation and 7DL of wheat. (author)

Quality assurance for environmental radon measurements by LR115 nuclear track detectors

Energy Technology Data Exchange (ETDEWEB)

Gomaa, M A [National Network of Radiation Physics, Atomic Energy Authority, Cairo (Egypt); Hafez, A F [Physics Department, Faculty of Science, Alexandria Univercity, Alexandria (Egypt); Hussein, A S [Radiation Protection Department, Nuclear Power Plants Authority, Cairo (Egypt)

2007-06-15

Passive radon dosimeters based on LR115 nuclear track detectors are very attractive for assessment of radon exposure. For developing countries wishing to undertake national radon survey the most appropriate techniques are those making use of LR115 detectors. These detectors are small, cheap, simple, and non-hazardous and provide an entirely adequate tool for large scale use in assessing levels of radon over several months because of the short - term fluctuations in radon concentrations. In this paper, the principles and philosophy in order to improve the quality and reliability of radon exposure under a quality assurance (QA) program are presented . Also examples of how a QA program of radon measurements by LR115 detectors using the can-techniques are well defined and applied.

Quality assurance for environmental radon measurements by LR115 nuclear track detectors

International Nuclear Information System (INIS)

Gomaa, M.A.; Hafez, A.F.; Hussein, A.S.

2007-01-01

Passive radon dosimeters based on LR115 nuclear track detectors are very attractive for assessment of radon exposure. For developing countries wishing to undertake national radon survey the most appropriate techniques are those making use of LR115 detectors. These detectors are small, cheap, simple, and non-hazardous and provide an entirely adequate tool for large scale use in assessing levels of radon over several months because of the short - term fluctuations in radon concentrations. In this paper, the principles and philosophy in order to improve the quality and reliability of radon exposure under a quality assurance (QA) program are presented . Also examples of how a QA program of radon measurements by LR115 detectors using the can-techniques are well defined and applied

Nuclear research reactor 0.5 to 3 MW

Energy Technology Data Exchange (ETDEWEB)

NONE

1992-05-15

This nuclear reactor has been designed for radioisotope production, basic and applied research in reactor physics and nuclear engineering, neutron-beam experimentation, irradiation of various materials and training of scientific and technical personnel. It is located in the 'Production Area' of the Nuclear Technology Center. It is equipped with the necessary facilities for large-scale production of radioisotopes to be used in medicine as well as for other scientific and industrial purposes. In addition, it has a Neutronography Facility and the required equipment to perform Neutron-Activation Analysis. It is an open pool-type reactor, moderated and cooled with light water, fuelled with 20% enriched uranium. Its reflector are graphite and water. It has plate-type fuel elements clad in aluminium. The reactor core is located near the bottom of the demineralized water pool. It includes fuel elements, reflector and sample-holding devices for materials to be irradiated. This kind of configuration, which is widely used in research reactors, provides a high degree of safety since it prevents the core from becoming exposed under any circumstance and does not require any cooling system during reactor shutdown. Power output is between 0.5 to 3 MW{sub TH}, with a minimum thermal neutron flux of approx, 10{sup 13} n/cm{sup 2}{center_dot}sec, at irradiation zone almost with no modifications. Heat extraction is achieved by means of a cooling circuit which comprises two circulation pumps and a plate-type heat exchanger. Final heat dissipation to the atmosphere is performed through another cooling circuit which includes two circulation pumps and a cooling tower. Reactor control is accomplished with five neutron-absorbing rods positioned by means of especially designed elements and governed by the reactor's instrumentation and control system. Should an abnormal situation arise, gravity causes the rods to fall automatically, thus extinguishing the nuclear reaction. The reactor

Nuclear research reactor 0.5 to 3 MW

International Nuclear Information System (INIS)

1992-05-01

This nuclear reactor has been designed for radioisotope production, basic and applied research in reactor physics and nuclear engineering, neutron-beam experimentation, irradiation of various materials and training of scientific and technical personnel. It is located in the 'Production Area' of the Nuclear Technology Center. It is equipped with the necessary facilities for large-scale production of radioisotopes to be used in medicine as well as for other scientific and industrial purposes. In addition, it has a Neutronography Facility and the required equipment to perform Neutron-Activation Analysis. It is an open pool-type reactor, moderated and cooled with light water, fuelled with 20% enriched uranium. Its reflector are graphite and water. It has plate-type fuel elements clad in aluminium. The reactor core is located near the bottom of the demineralized water pool. It includes fuel elements, reflector and sample-holding devices for materials to be irradiated. This kind of configuration, which is widely used in research reactors, provides a high degree of safety since it prevents the core from becoming exposed under any circumstance and does not require any cooling system during reactor shutdown. Power output is between 0.5 to 3 MW TH , with a minimum thermal neutron flux of approx, 10 13 n/cm 2 ·sec, at irradiation zone almost with no modifications. Heat extraction is achieved by means of a cooling circuit which comprises two circulation pumps and a plate-type heat exchanger. Final heat dissipation to the atmosphere is performed through another cooling circuit which includes two circulation pumps and a cooling tower. Reactor control is accomplished with five neutron-absorbing rods positioned by means of especially designed elements and governed by the reactor's instrumentation and control system. Should an abnormal situation arise, gravity causes the rods to fall automatically, thus extinguishing the nuclear reaction. The reactor building has a ventilation

MONUMENTO A PEDRO PÉREZ RODRÍGUEZ [Material gráfico

OpenAIRE

Anonymous

1980-01-01

ANEXO SELLO DE LA COMISIÓN DEL PATRIMONIO HISTÓRICO ARTÍSTICO DE GÁLDAR. MONUMENTO LEVANTADO POR LA PARROQUIA DE SAN JOSÉ DE LOS CAIDEROS A SU PRIMER PÁRROCO, EL SACERDOTE MAJORERO, DON PEDRO PÉREZ RODRÍGUEZ. SE ENCUENTRA EL BUSTO EN LA GLORIETA LATERAL DEL CENTRO. Copia digital. Madrid : Ministerio de Educación, Cultura y Deporte. Subdirección General de Coordinación Bibliotecaria, 2015

Theoretical spectroscopic study of the conjugate microcystin-LR-europium cryptate

Energy Technology Data Exchange (ETDEWEB)

Santos, Julio G.; Dutra, Jose Diogo L.; Costa Junior, Nivan B. da; Freire, Ricardo O., E-mail: rfreire@ufs.br [Universidade Federal de Sergipe (UFS), Sao Cristovao, SE (Brazil). Departamento de Quimica; Alves Junior, Severino; Sa, Gilberto F. de [Universidade Federal de Pernambuco (UFPE), Recife, PE (Brazil). Departamento de Quimica Fundamental

2013-02-15

In this work, theoretical tools were used to study spectroscopic properties of the conjugate microcystin-LR-europium cryptate. The Sparkle/AM1 model was applied to predict the geometry of the system and the INDO/S-CIS model was used to calculate the excited state energies. Based on the Judd-Ofelt theory, the intensity parameters were predicted and a theoretical model based on the theory of the 4f-4f transitions was applied to calculate energy transfer and backtransfer rates, radiative and non-radiative decay rates, quantum efficiency and quantum yield. A detailed study of the luminescent properties of the conjugate Microcystin-LR-europium cryptate was carried out. The results show that the theoretical quantum yield of luminescence of 23% is in good agreement with the experimental value published. This fact suggests that this theoretical protocol can be used to design new systems in order to improve their luminescence properties. The results suggest that this luminescent system may be a good conjugate for using in assay ELISA for detection by luminescence of the Microcystin-LR in water. (author)

[Epilepsy in the Spanish Renaissance. The work of Pérez Cascales of Alcalá].

Science.gov (United States)

García-Albea, E

During the Renaissance, the University of Alcalá de Henares represented the most best of Spanish medical humanism. A return to the classics after mediaeval religious obscurantism meant a 'modern' spirit of reconsideration of the major neurological disorders. In 1611 Francisco Pérez Cascales, trained at this university, wrote the first great Spanish treatise on paediatrics, Liber de affectionibus puerorum, which included a long chapter on epilepsy (alferecía). The author, considered to be a 'Hippocratic galenist' critically reviewed, with data from empirical observations, the Greek theory of humours. Following the Galenic tradition, he distinguished three types of epilepsy: primary or originating in the brain, and by 'consensus' (originating in another region but with secondary cerebral involvement) either of the stomach or other parts of the body. The work of Pérez Cascales is one of the most complete contributions to the under understanding of epilepsy at his time.

Suárez, el derecho natural y la crítica contemporánea

Directory of Open Access Journals (Sweden)

Sebastián Contreras

2017-07-01

Full Text Available Los actuales defensores de la teoría de la ley natural, en su mayoría, sindican a Suárez como el responsable de introducir una interpretación fisicalista de santo Tomás. Por fisicalismo entienden la doctrina moral según la cual las acciones son buenas o malas por comparación a la naturaleza. Se trata, entonces, de la identificación de la ley natural con la naturaleza racional. Suárez, sin embargo, rechaza esta posición, argumentando que la naturaleza no es una regla moral sino el fundamento de los principios naturales. El trabajo, pues, consiste en una revisión de la filosofía suarista sobre la ley natural, con un énfasis especial en la crítica que hacen de ella los autores de la filosofía contemporánea.

Carbon monoxide exposure in households in Ciudad Juárez, México.

Science.gov (United States)

Montoya, Teresa; Gurian, Patrick L; Velázquez-Angulo, Gilberto; Corella-Barud, Verónica; Rojo, Analila; Graham, Jay P

2008-03-01

This study assessed exposure to carbon monoxide from gas and wood heater emissions in a sample of 64 households in peri-urban residential areas in Ciudad Juárez, Chihuahua, México. Indoor and outdoor carbon monoxide concentrations and temperatures were monitored for a continuous period of 1 week at 1 and 6-min intervals, respectively. The moving average carbon monoxide concentrations were compared to the World Health Organization (WHO) standards for carbon monoxide. Sixty-seven percent of households with gas heaters and 60% of households with wood heaters exceeded a health-based standard at some point during the monitoring. The difference between indoor and outdoor temperatures was modestly correlated with average carbon monoxide exposure (r=0.35, p-value h standard of 9ppm (odds ratio=5.1, p-value=0.031). These results highlight the need for further efforts to identify and mitigate potentially hazardous carbon monoxide exposures, particularly in moderate-income countries with cooler climates.

Infermeria Medicoquirúrgica II. Temari corresponent al Professor Francisco Pérez Dolz. Curs 2017-2018

OpenAIRE

Pérez Dolz, Francisco

2017-01-01

El document forma part dels materials docents programats mitjançant l'ajut del Servei de Política Lingüística de la Universitat de València. Temari corresponent al professor Francisco Pérez Dolz

Removal of microcystin-LR from drinking water using a bamboo-based charcoal adsorbent modified with chitosan.

Science.gov (United States)

Zhang, Hangjun; Zhu, Guoying; Jia, Xiuying; Ding, Ying; Zhang, Mi; Gao, Qing; Hu, Ciming; Xu, Shuying

2011-01-01

A new kind of low-cost syntactic adsorbent from bamboo charcoal and chitosan was developed for the removal of microcystin-LR from drinking water. Removal efficiency was higher for the syntactic adsorbent when the amount of bamboo charcoal was increased. The optimum dose ratio of bamboo charcoal to chitosan was 6:4, and the optimum amount was 15 mg/L; equilibrium time was 6 hr. The adsorption isotherm was non-linear and could be simulated by the Freundlich model (R2 = 0.9337). Adsorption efficiency was strongly affected by pH and natural organic matter (NOM). Removal efficiency was 16% higher at pH 3 than at pH 9. Efficiency rate was reduced by 15% with 25 mg/L NOM (UV254 = 0.089 cm(-1)) in drinking water. This study demonstrated that the bamboo charcoal modified with chitosan can effectively remove microcystin-LR from drinking water.

Académico Fernando Serpa Flórez

Directory of Open Access Journals (Sweden)

José Felix Patiño Restrepo

2001-12-01

Full Text Available

Brillante, generoso, noble, escritor prolífico, un completo caballero, Fernando Serpa Flórez fue el prototipo del médico intelectual, humanista y humanitario. Su vocación por la salud pública lo llevó a ocupar altos cargos en el ramo: Secretario General del Ministerio de Salud, Secretario de Salud de Bogotá, Director del Instituto Nacional de Salud, Director del Ministerio de Salud y Ministro Encargado de Salud. Como Asesor de la Organización Mundial de la Salud, trabajó en Afganistán en el programa de erradicación de la viruela.
Fue médico, jefe de Ecopetrol. Desde su elevada posición como Magistrado del Tribunal Nacional de Etica Médica, y con el ejemplo de su vida personal, como uno de los miembros más distinguidos de la Academia Nacional de Medicina, Fernando Serpa Flórez ocupa un lugar de particular distinción en la historia
contemporánea de la medicina colombiana.

Tuve el privilegio de su amistad por más de medio siglo, como condiscípulo en la Facultad de Medicina de la Universidad Nacional y luego a través de los años compartiendo afectos e intereses. Me acompaño con talento, lealtad y dedicación como Director del Ministerio cuando ocupé el cargo de Ministro en el Gobierno del eximio Presidente Guillermo León Valencia. Para quienes lo conocimos de cerca, este vástago de
una brillante familia de médicos, sobrevivirá en nuestra memoria y en sus obras...

los caminos globales de Ciudad Juárez, Chihuahua-El Paso,Texas

Directory of Open Access Journals (Sweden)

Kathleen Staudt

2006-01-01

Full Text Available En este artículo se abordan temas selectos de políticas públicas, que dividen y unen a las mujeres en la frontera México-Estados Unidos, concentrados en el área metropolitana de Ciudad Juárez-El Paso, que conforma una "economía interdependiente", con una población superior a dos millones de personas, cuya mayoría comparte una herencia mexicana. De esta forma, se analiza una perspectiva compleja: la economía global en la que las maquiladoras de Ciudad Juárez están a la vanguardia; los cambios ideológicos de derecha en los gobiernos de México y Estados Unidos; con gobiernos divididos en filiación partidista así como en materia del federalismo, éste practicado en forma diferente por ambos, y en los cuales las voces de las mujeres tienen poca notoriedad. Sin embargo, ellas se organizan en grupos que representan sus intereses, aunque sus voces han sido marginadas en la sociedad y en la acción legislativa. Existen pocas organizaciones binacionales de mujeres, con algunas excepciones en los aspectos de salud y violencia.

Avatares y desafíos del Instituto Juárez de Tabasco

Directory of Open Access Journals (Sweden)

Judith Pérez Castro

2015-01-01

Full Text Available El propósito de este trabajo es hacer un análisis de las circunstancias que rodearon la fundación y el desarrollo del Instituto Juárez de Tabasco. El artículo intenta mostrar la compleja situación que enfrentó este establecimiento educativo desde su creación en 1879 hasta las primeras décadas del siglo XX y el impacto que esto tuvo tanto en su oferta educativa como en su planta académica. Las principales variables que contextualizaron el desarrollo institucional fueron la difícil situación financiera, el cierre y apertura de sus carreras, la insuficiencia de matrícula, la débil organización de su cuerpo de profesores y la inestabilidad política estatal. A pesar de esto, el Instituto Juárez logra mantenerse y consolidarse como la principal opción educativa a nivel preparatoria y profesional en la entidad, hecho que aunado a un nuevo proceso de reforma hacen posible su ascenso como universidad hacia finales de los años cincuenta.

Investigations into the biodegradation of microcystin-LR in wastewaters

International Nuclear Information System (INIS)

Ho, Lionel; Hoefel, Daniel; Palazot, Sebastien; Sawade, Emma; Newcombe, Gayle; Saint, Christopher P.; Brookes, Justin D.

2010-01-01

Microcystins are potent hepatotoxins that can be produced by cyanobacteria. These organisms can proliferate in wastewaters due to a number of factors including high concentrations of nutrients for growth. As treated wastewaters are now being considered as supplementary drinking water sources, in addition to their frequent use for irrigated agriculture, it is imperative that these wastewaters are free of toxins such as microcystins. This study investigated the potential for biodegradation of microcystin-LR (MCLR) in wastewaters through a biological sand filtration experiment and in static batch reactor experiments. MCLR was effectively removed at a range of concentrations and at various temperatures, with degradation attributed to the action of microorganisms indigenous to the wastewaters. No hepatotoxic by-products were detected following the degradation of MCLR as determined by a protein phosphatase inhibition assay. Using TaqMan polymerase chain reaction, the first gene involved in bacterial degradation of MCLR (mlrA) was detected and the responsible bacteria shown to increase with the amount of MCLR being degraded. This finding suggested that the degradation of MCLR was dependent upon the abundance of MCLR-degrading organisms present within the wastewater, and that MCLR may provide bacteria with a significant carbon source for proliferation; in turn increasing MCLR removal.

Neutron flux characterization using Lr-115 NTD and binary glass metal as converter

International Nuclear Information System (INIS)

Alvarado, R.; Palacios, D.; Sajo B, L.; Greaves, E.; Barros, H.; Nemeth, P.; Goncalves, I. F.

2010-01-01

The installed neutron irradiation cell at the Simon Bolivar University Laboratory is employed frequently for applications where the neutron field should be monitored. The ratio of epithermal and thermal neutron flux were determined by the cadmium difference method in three different irradiation locations of a graphite thermalized 252 Cf source. Monte Carlo simulation provided the expected thermal neutron field inside the irradiation cell and the nuclear trace detectors sensitivity. The passive device is a Kodak-Pathe Lr-115 externally coated with a thin (0,1 mm) binary glass metal strip Fe 75 B 25 where the 10 B(n,α) 7 Li reaction converts free neutrons into alpha particles that are registered as etched tracks. The results allow to determine the neutron flux in an easy, reproducible and effective way, with the advantage of a low self-absorption effect due to the converter material. Improved etching process of the Lr-115 nuclear track detectors and the software parameters for track analysis are included. (Author)

The Rise and Development of Physics in Cuba: An Interview with Hugo Pérez Rojas in May 2009

Science.gov (United States)

Baracca, Angelo

Hugo Celso Pérez Rojas was born in 1938, and works as a senior researcher at the Institute of Cybernetics, Mathematics and Physics, at the Ministry of Science and Technology, Cuba. Pérez Rojas is emeritus member of the Academy of Sciences of Cuba, member of the Latin American Academy of Sciences and Fellow TWAS since 1994. He was one of the founders of the School of Physics in the University of Havana in 1962, and moved in 1971 to the Cuban Academy of Sciences. His national awards include the Rafael Maria Mendive and Carlos J. Finlay Medals. He was awarded in 2011 the National Prize in Physics from the Cuban Physical Society. His interests include quantum field theory and its applications to finite temperature problems in high-energy physics and condensed matter. Among these, Pérez Rojas has devoted special attention to quantum electrodynamics in matter and in vacuum in the presence of external fields, phase transitions in electroweak theory, relativistic quantum Hall effect, Bose-Einstein condensation in magnetic fields, and applications of physics to social sciences. He is interviewed here by Angelo Baracca in May 2009.

Turismo industrial: oportunidades y retos dentro del sector de manu- factura en Ciudad Juárez

Directory of Open Access Journals (Sweden)

Francisco Arturo Bribiescas Silva

2015-01-01

Full Text Available Turismo Industrial, tema relevante dentro de la región fronteriza Ciudad Juá-rez-El Paso, donde la Industria de manufactura tiene gran dinamismo eco-nómico, y se visualizan expectativas y propuestas innovadoras a este sector. Este trabajo es una exploración de las oportunidades y retos de la industria manufacturera instalada en Ciudad Juárez para desarrollar actividades de turismo industrial en sus instalaciones. La información se obtuvo a través de entrevistas a profundidad con 15 gerentes de las empresas más importantes de esta región. Dentro de los resultados se puede observar que las actividades del turismo industrial son percibidas por los gerentes entrevistados como benéficas y consideradas como una actividad alterna a la manufactura.

Inhibition of Microcystis aeruginosa and microcystin- LR with one ...

African Journals Online (AJOL)

Yomi

2State Key Laboratory of Urban Water Resource and Environment, Harbin Institute of Technology, Harbin 150001,. China. ... industrial wastewater and domestic sewage. One of the .... LR detected by high performance liquid chromatography.

Application of the k0-NAA method at the HANARO research reactor

International Nuclear Information System (INIS)

Jong-Hwa Moon; Sun-Ha Kim; Yong-Sam Chung; Young-Jin Kim

2007-01-01

The k 0 -standardization method (k 0 -NAA) is known as one of the most remarkable progresses of the NAA with its many advantages. For the application of k 0 -NAA method at the NAA 1 irradiation position where the neutrons are well thermalized in the HANARO research reactor, KAERI, Korea, the determination of the reactor neutron spectrum parameters such as α and f have been carried out. The measured values of a and f using the 'Cd-ratio' triple monitor method were 0.127±0.022 and 1010±70, respectively. To evaluate the applicability of k 0 -NAA in our analytical system, the analysis of three kinds of SRMs was executed. The analytical results showed that the relative error of most of the elements was less than 10% and the U-scores were within 2. It is turned out that the procedure of the k 0 -NAA in the HANARO research reactor is available for a practical application in the environmental fields. (author)

76 FR 60937 - Draft License Renewal Interim Staff Guidance LR-ISG-2011-02; Aging Management Program for Steam...

Science.gov (United States)

2011-09-30

...-2011-02; Aging Management Program for Steam Generators AGENCY: Nuclear Regulatory Commission. ACTION... License Renewal Interim Staff Guidance (LR-ISG), LR-ISG-2011-02, ``Aging Management Program for Steam... using Revision 3 of NEI 97-06 to manage steam generator aging. The Draft LR-ISG revises the NRC staff's...

Process optimization for microcystin-LR degradation by Response Surface Methodology and mechanism analysis in gas-liquid hybrid discharge system.

Science.gov (United States)

Zhang, Yi; Wei, Hanyu; Xin, Qing; Wang, Mingang; Wang, Qi; Wang, Qiang; Cong, Yanqing

2016-12-01

A gas-liquid hybrid discharge system was applied to microcystin-LR (MC-LR) degradation. MC-LR degradation was completed after 1 min under a pulsed high voltage of 16 kV, gas-liquid interface gap of 10 mm and oxygen flow rate of 160 L/h. The Box-Behnken Design was proposed in Response Surface Methodology to evaluate the influence of pulsed high voltage, electrode distance and oxygen flow rate on MC-LR removal efficiency. Multiple regression analysis, focused on multivariable factors, was employed and a reduced cubic model was developed. The ANOVA analysis shows that the model is significant and the model prediction on MC-LR removal was also validated with experimental data. The optimum conditions for the process are obtained at pulsed voltage of 16 kV, gas-liquid interface gap of 10 mm and oxygen flow rate of 120 L/h with ta removal efficiency of MC-LR of 96.6%. The addition of catalysts (TiO 2 or Fe 2+ ) in the gas-liquid hybrid discharge system was found to enhance the removal of MC-LR. The intermediates of MC-LR degradation were analyzed by liquid chromatography/mass spectrometry. The degradation pathway proposed envisaged the oxidation of hydroxyl radicals and ozone, and attack of high-energy electrons on the unsaturated double bonds of Adda and Mdha, with MC-LR finally decomposing into small molecular products. Copyright © 2016 Elsevier Ltd. All rights reserved.

Main: 1LR4 [RPSD[Archive

Lifescience Database Archive (English)

Full Text Available 1LR4 トウモロコシ Corn Zea mays L. Casein Kinase Ii, Alpha Chain Name=Ack2; Zea Mays Mole...cule: Protein Kinase Ck2; Chain: A; Synonym: Casein Kinase Ii, Alpha Chain; Engineered: Yes Transferase 2.7....ray; A=2-326.|PDB; 1M2Q; X-ray; A=2-328.|PDB; 1M2R; X-ray; A=2-328.|PDB; 1OM1; X-ray; A=1-332.|Mai

A further study of the (CR-LR) difference technique for retrospective radon exposure assessment

International Nuclear Information System (INIS)

Nikezic, D.; Yip, C.W.Y.; Leung, S.Y.Y.; Leung, J.K.C.; Yu, K.N.

2006-01-01

The (CR-LR) difference technique, based on the CR-39 and LR 115 detectors, for the determination of implanted 210 Po in glass after deposition of short-lived radon progeny, was analyzed in details in this paper. The sensitivities of both detectors were calculated using the Monte Carlo method with V functions particularly derived in our previous works for the detectors used in the present experiments. The dependency of the sensitivity ratio on the removed layer of both detectors was determined and verified experimentally. The simulated sensitivity ratios correlate well with the experimental ones. A major finding of the present work is that the sensitivity ratio between the CR-39 and LR 115 detectors depends only weakly on the ratio between the 238 U and 232 Th concentrations in the glass samples. This is crucial for the application of the (CR-LR) difference technique for retrospective radon exposure assessments, since measurements of the 238 U and 232 Th concentrations in the relatively small real-life glass samples will make the retrospective radon exposure assessments impractical

Intraperitoneal exposure of whitefish to microcystin-LR induces rapid liver injury followed by regeneration and resilience to subsequent exposures

International Nuclear Information System (INIS)

Woźny, Maciej; Lewczuk, Bogdan; Ziółkowska, Natalia; Gomułka, Piotr; Dobosz, Stefan; Łakomiak, Alicja; Florczyk, Maciej; Brzuzan, Paweł

2016-01-01

To date, there has been no systematic approach comprehensively describing the sequence of pathological changes in fish during prolonged exposure to microcystin-LR (MC-LR). Towards this aim, juvenile whitefish individuals received an intraperitoneal injection with pure MC-LR, and the injection was repeated every week to maintain continuous exposure for 28 days. During the exposure period, growth and condition of the fish were assessed based on biometric measurements. Additionally, selected biochemical markers were analysed in the fishes' blood, and their livers were carefully examined for morphological, ultrastructural, and molecular changes. The higher dose of MC-LR (100 μg·kg −1 ) caused severe liver injury at the beginning of the exposure period, whereas the lower dose (10 μg·kg −1 ) caused less, probably reversible injury, and its effects began to be observed later in the exposure period. These marked changes were accompanied by substantial MC-LR uptake by the liver. However, starting on the 7th day of exposure, cell debris began to be removed by phagocytes, then by 14th day, proliferation of liver cells had markedly increased, which led to reconstruction of the liver parenchyma at the end of the treatment. Surprisingly, despite weekly-repeated intraperitoneal injections, MC-LR did not accumulate over time of exposure which suggests its limited uptake in the later phase of exposure. In support, mRNA expression of the membrane transport protein oatp1d was decreased at the same time as the regenerative processes were observed. Our study shows that closing of active membrane transport may serve as one defence mechanism against further MC-LR intoxication. - Highlights: • The study presents pathological changes in whitefish during prolonged MC-LR exposure. • After early, severe injury, the damaged liver parenchyma of the fish regenerated. • Endoplasmic reticulum, cytoskeleton, and chromatin were the main targets for MC-LR. • MC-LR did not

Accumulation of free and covalently bound microcystins in tissues of Lymnaea stagnalis (Gastropoda) following toxic cyanobacteria or dissolved microcystin-LR exposure

International Nuclear Information System (INIS)

Lance, Emilie; Neffling, Milla-Riina; Gerard, Claudia; Meriluoto, Jussi; Bormans, Myriam

2010-01-01

Accumulation of free microcystins (MCs) in freshwater gastropods has been demonstrated but accumulation of MCs covalently bound to tissues has never been considered so far. Here, we follow the accumulation of total (free and bound) MCs in Lymnaea stagnalis exposed to i) dissolved MC-LR (33 and 100 μg L -1 ) and ii) Planktothrix agardhii suspensions producing 5 and 33 μg MC-LR equivalents L -1 over a 5-week period, and after a 3-week depuration period. Snails exposed to dissolved MC-LR accumulated up to 0.26 μg total MCs g -1 dry weight (DW), with no detection of bound MCs. Snails exposed to MCs producing P. agardhii accumulated up to 69.9 μg total MCs g -1 DW, of which from 17.7 to 66.7% were bound. After depuration, up to 15.3 μg g -1 DW of bound MCs were detected in snails previously exposed to toxic cyanobacteria, representing a potential source of MCs transfer through the food web. - The study concerns accumulation and elimination of both free and bound microcystins (MCs) in tissues of a gastropod exposed to MCs producing cyanobacteria or dissolved MC-LR.

Accumulation of free and covalently bound microcystins in tissues of Lymnaea stagnalis (Gastropoda) following toxic cyanobacteria or dissolved microcystin-LR exposure

Energy Technology Data Exchange (ETDEWEB)

Lance, Emilie, E-mail: emilie.lance@live.f [UMR CNRS Ecobio 6553, University of Rennes 1, Campus de Beaulieu, 265 Avenue du General Leclerc, 35042 Rennes Cedex (France); Neffling, Milla-Riina [Department of Biochemistry and Pharmacy, Abo Akademi University, Tykistoekatu 6, FI-20520 Turku (Finland); Gerard, Claudia [UMR CNRS Ecobio 6553, University of Rennes 1, Campus de Beaulieu, 265 Avenue du General Leclerc, 35042 Rennes Cedex (France); Meriluoto, Jussi [Department of Biochemistry and Pharmacy, Abo Akademi University, Tykistoekatu 6, FI-20520 Turku (Finland); Bormans, Myriam [UMR CNRS Ecobio 6553, University of Rennes 1, Campus de Beaulieu, 265 Avenue du General Leclerc, 35042 Rennes Cedex (France)

2010-03-15

Accumulation of free microcystins (MCs) in freshwater gastropods has been demonstrated but accumulation of MCs covalently bound to tissues has never been considered so far. Here, we follow the accumulation of total (free and bound) MCs in Lymnaea stagnalis exposed to i) dissolved MC-LR (33 and 100 mug L{sup -1}) and ii) Planktothrix agardhii suspensions producing 5 and 33 mug MC-LR equivalents L{sup -1} over a 5-week period, and after a 3-week depuration period. Snails exposed to dissolved MC-LR accumulated up to 0.26 mug total MCs g{sup -1} dry weight (DW), with no detection of bound MCs. Snails exposed to MCs producing P. agardhii accumulated up to 69.9 mug total MCs g{sup -1} DW, of which from 17.7 to 66.7% were bound. After depuration, up to 15.3 mug g{sup -1} DW of bound MCs were detected in snails previously exposed to toxic cyanobacteria, representing a potential source of MCs transfer through the food web. - The study concerns accumulation and elimination of both free and bound microcystins (MCs) in tissues of a gastropod exposed to MCs producing cyanobacteria or dissolved MC-LR.

Mirzam C. Pérez, The Comedia of Virginity: Mary and the Politics of Seventeenth-Century Spanish Theater

Directory of Open Access Journals (Sweden)

Natalia Fernández

2016-01-01

Full Text Available Reseña de Mirzam C. Pérez, The Comedia of Virginity: Mary and the Politics of Seventeenth-Century Spanish Theater, Waco (Texas, Baylor University Press, 2012, 173 pp. ISBN: 9781602586451.

La vegetación como sistema de control para las Islas de Calor Urbano en Ciudad Juárez, Chihuahua

Directory of Open Access Journals (Sweden)

Maria Goretti Salas Esparza

2017-06-01

Full Text Available A nivel mundial, el territorio ha experimentado un proceso de urbanización, el cual ha modificado las condiciones físicas y climatológicas como consecuencia de la densificación y construcción de las zonas urbanas, sobre todo a partir de la utilización de materiales que retienen el calor y que propician el fenómeno de isla de calor urbano (ICU, término establecido por Gordon Manley en 1958 (Fernández, 1996. Este trabajo evalúa el impacto que tienen las áreas verdes para actuar como sistema de control de isla de calor sobre Ciudad Juárez, Chihuahua, durante el verano del 2016. La metodología consistió en analizar cuatro áreas verdes para determinar la diferencia de temperatura que existe entre las zonas arboladas y las no arboladas, registrando temperaturas con sensores Hobo®, cada 15 minutos. Los resultados obtenidos demostraron que existe una diferencia de temperatura de 3,82 °C entre los lugares arbolados y no arbolados en el área verde con mayor nivel de vegetación, mientras que el área verde con menor nivel de vegetación se encontró una diferencia de 0,53 °C. Sin embargo, el impacto que tendrán sobre la zona urbana dependerá de la configuración y características de la misma área verde.   Documeto fianciado bajo el marco Tesis de Maestría en Planificación y Desarrollo Urbano " Áreas verdes como sistema de control para las Islas de Calor Urbano en Ciudad Juárez, Chihuahua".Universidad Autónoma de Ciudad Juárez

LAS MUERTAS DE JUÁREZ: BIOÉTICA, GÉNERO, PODER E INJUSTICIA AS MORTAS DE JUÁREZ: BIOÉTICA, GÊNERO, PODER E INJUSTIÇA DEAD WOMEN OF JUAREZ: BIOETHICS, GENDER, POWER, AND INJUSTICE

Directory of Open Access Journals (Sweden)

Jorge Alberto Álvarez Díaz

2003-01-01

Full Text Available Más de 300 mujeres muertas... la historia está llena de injusticias. En ocasiones, las víctimas, sus descendientes u organizaciones han reclamado por la injusticia realizada. Este trabajo intenta ser un reclamo por la injusticia vivida por más de 300 mujeres, muchas de ellas víctimas de violación y homicidio, en Ciudad Juárez, Chihuahua, México. En la década pasada (1993-2003 más de 300 mujeres han desaparecido; muchas se han encontrado posteriormente violadas, mutiladas y asesinadas. Recordando el principialismo, el énfasis se hace en una reflexión posmodernista de la bioética, el género, el poder y la injusticia. Se hace un análisis de la violencia como un problema de salud pública, con un énfasis especial en la salud sexual y la violencia en contra del género femenino. Se comenta la relación entre violación y homicidio contra mujeres. Finalmente, un comentario sobre el escalofriante caso de "las muertas de Juárez". Analizando los datos epidemiológicos sobre violación y homicidio en México, es particularmente importante recalcar que los casos de Juárez no son "típicos", son realmente diferentesMais de 300 mulheres mortas... a história está cheia de injustiças. Por vezes, as vítimas, seus descendentes ou organizações protestaram pela injustiça ocorrida. Este trabalho procura ser um clamor pela injustiça vivida por mais de 300 mulheres, muitas delas vítimas de estupro e homicídio, na Cidade Juárez, Chihuahua, México. Na década passada (1993-2003, mais de 300 mulheres desapareceram; muitas foram encontradas posteriormente como vítimas de estupro, mutiladas e assassinadas. Lembrando o principialismo, a ênfase é feita numa reflexão pós-moderna da bioética, o gênero, o poder e a injustiça. Analisa-se a violência como um problema de saúde pública, com uma ênfase especial na saúde sexual e na violência contra o gênero feminino. Comenta-se a relação entre estupro e homicídio contra as mulheres

El oficio de docente en las novelas de Pérez Galdós / The teacher labour in the novels of Pérez Galdós

Directory of Open Access Journals (Sweden)

Ana-María Montero_Pedrera

2017-01-01

Full Text Available Resumen Este artículo analiza el oficio de docente en las novelas contemporáneas de Pérez Galdós. En ellas describe innumerables temas y personajes, entre ellos los maestros y maestras, con los que ejemplifica diversos tipos humanos con características bien definidas. Se ha usado el método histórico-educativo para el estudio y en los modelos hallados hay docentes bondadosos, con reminiscencias krausistas, como Máximo Manso en El amigo Manso; ramplones y faltos de vocación como José Ido en Tormento. Sublimes maestras como Atenaida, en La razón de la sinrazón; o doña Lupe, avara e impostora, en Fortunata y Jacinta. Pero, hemos hallado valores en el Magisterio; noble profesión, maltratada tradicionalmente por la sociedad y por los poderes públicos. Abstract This article discusses the teaching profession in Pérez Galdós’ contemporary novels. It describes many topics and characters, including teachers, with who exemplifies various human types with defined characteristics. The historicaleducational method is been used for the analysis. In the models found there are caring teachers, with Krausists reminiscences as Máximo Manso in El amigo Manso; Simples and with a lack of vocation as José Ido in Torment. Sublime teachers as Atenaida, in La razón de la sinrazón; or Dona Lupe, greedy and impostor, in Fortunata y Jacinta. But we have in the Magisterium values; noble profession, traditionally mistreated by society and by the government.

Microcystin-LR induced reactive oxygen species mediate cytoskeletal disruption and apoptosis of hepatocytes in Cyprinus carpio L.

Directory of Open Access Journals (Sweden)

Jinlin Jiang

Full Text Available Microcystins (MCs are a group of cyclic hepatotoxic peptides produced by cyanobacteria. Microcystin-LR (MC-LR contains Leucine (L and Arginine (R in the variable positions, and is one of the most common and potently toxic peptides. MC-LR can inhibit protein phosphatase type 1 and type 2A (PP1 and PP2A activities and induce excessive production of reactive oxygen species (ROS. The underlying mechanism of the inhibition of PP1 and PP2A has been extensively studied. The over-production of ROS is considered to be another main mechanism behind MC-LR toxicity; however, the detailed toxicological mechanism involved in over-production of ROS in carp (Cyprinus carpio L. remains largely unclear. In our present study, the hydroxyl radical (•OH was significantly induced in the liver of carp after a relatively short-term exposure to MC-LR. The elevated reactive oxygen species (ROS production may play an important role in the disruption of microtubule structure. Pre-injection of the antioxidant N-acetyl-cysteine (NAC provided significant protection to the cytoskeleton, however buthionine sulfoximine (BSO exacerbated cytoskeletal destruction. In addition, the elevated ROS formation induced the expression of apoptosis-related genes, including p38, JNKa, and bcl-2. A significant increase in apoptotic cells was observed at 12-48 hours. Our study further supports evidence that ROS are involved in MC-LR induced damage to liver cells in carp, and indicates the need for further study of the molecular mechanisms behind MC-LR toxicity.

Microcystin-LR Induced Reactive Oxygen Species Mediate Cytoskeletal Disruption and Apoptosis of Hepatocytes in Cyprinus carpio L.

Science.gov (United States)

Jiang, Jinlin; Shan, Zhengjun; Xu, Weili; Wang, Xiaorong; Zhou, Junying; Kong, Deyang; Xu, Jing

2013-01-01

Microcystins (MCs) are a group of cyclic hepatotoxic peptides produced by cyanobacteria. Microcystin-LR (MC-LR) contains Leucine (L) and Arginine (R) in the variable positions, and is one of the most common and potently toxic peptides. MC-LR can inhibit protein phosphatase type 1 and type 2A (PP1 and PP2A) activities and induce excessive production of reactive oxygen species (ROS). The underlying mechanism of the inhibition of PP1 and PP2A has been extensively studied. The over-production of ROS is considered to be another main mechanism behind MC-LR toxicity; however, the detailed toxicological mechanism involved in over-production of ROS in carp (Cyprinus carpio L.) remains largely unclear. In our present study, the hydroxyl radical (•OH) was significantly induced in the liver of carp after a relatively short-term exposure to MC-LR. The elevated reactive oxygen species (ROS) production may play an important role in the disruption of microtubule structure. Pre-injection of the antioxidant N-acetyl-cysteine (NAC) provided significant protection to the cytoskeleton, however buthionine sulfoximine (BSO) exacerbated cytoskeletal destruction. In addition, the elevated ROS formation induced the expression of apoptosis-related genes, including p38, JNKa, and bcl-2. A significant increase in apoptotic cells was observed at 12 - 48 hours. Our study further supports evidence that ROS are involved in MC-LR induced damage to liver cells in carp, and indicates the need for further study of the molecular mechanisms behind MC-LR toxicity. PMID:24376844

Low-priced, time-saving, reliable and stable LR-115 counting system

International Nuclear Information System (INIS)

Tchorz-Trzeciakiewicz, D.E.

2015-01-01

Nuclear alpha particles leave etches (tracks) when they hit the surface of a LR-115 detector. The density of these tracks is used to measure radon concentration. Counting these tracks by human sense is tedious and time-consuming procedure and may introduce counting error, whereas most available automatic and semiautomatic counting systems are expensive or complex. An uncomplicated, robust, reliable and stable counting system using freely available on the Internet software as Digimizer™ and PhotoScape was developed and proposed. The effectiveness of the proposed procedure was evaluated by comparing the amount of tracks counted by software with the amount of tracks counted manually for 223 detectors. The percentage error for each analysed detector was obtained as a difference between automatic and manual counts divided by manual count. For more than 97% of detectors, the percentage errors oscillated between −3% and 3%. - Highlights: • Semiautomatic, uncomplicated procedure was proposed to count the amount of alpha tracks. • Freely available software on the Internet used as alpha tracks counting system for LR-115. • LR-115 detectors used to measure radon concentration and radon exhalation rate

Operations of the LR56 radioactive liquid cask transport system at U.S. Department of Energy sites

International Nuclear Information System (INIS)

Davidson, J.S.; Hornstra, D.J.; Sazawal, V.K.; Clement, G.

1996-01-01

The LR56 cask system is licensed for use in France under Certificate of Compliance F/309/B(U)F for transport of 4,000-liter volumes of radioactive liquids. Three LR56 cask systems (with modifications for use at Department of Energy (DOE) sites) have been purchased for delivery at the Hanford Site, Oak Ridge National Laboratory (ORNL), and Savannah River Site (SRS). The LR56 cask systems will be used for on-site transfers of Type B quantities of radioactive liquid waste. The ORNL unit will also be used as a Type A packaging for transfers of radioactive liquids between DOE sites. This paper discusses LR56 operating features and the use of the cask system at the three DOE sites

Intraperitoneal exposure of whitefish to microcystin-LR induces rapid liver injury followed by regeneration and resilience to subsequent exposures

Energy Technology Data Exchange (ETDEWEB)

Woźny, Maciej, E-mail: maciej.wozny@uwm.edu.pl [Department of Environmental Biotechnology, Faculty of Environmental Sciences, University of Warmia and Mazury in Olsztyn, ul. Słoneczna 45G, 10-709 Olsztyn (Poland); Lewczuk, Bogdan; Ziółkowska, Natalia [Department of Histology and Embryology, Faculty of Veterinary Medicine, University of Warmia and Mazury in Olsztyn, ul. M. Oczapowskiego 13, 10-713 Olsztyn (Poland); Gomułka, Piotr [Department of Ichthyology, Faculty of Environmental Sciences, University of Warmia and Mazury in Olsztyn, ul. M. Oczapowskiego 5, 10-719 Olsztyn (Poland); Dobosz, Stefan [Department of the Salmonid Research in Rutki, Inland Fisheries Institute in Olsztyn, Rutki, 83-330 Żukowo (Poland); Łakomiak, Alicja; Florczyk, Maciej; Brzuzan, Paweł [Department of Environmental Biotechnology, Faculty of Environmental Sciences, University of Warmia and Mazury in Olsztyn, ul. Słoneczna 45G, 10-709 Olsztyn (Poland)

2016-12-15

To date, there has been no systematic approach comprehensively describing the sequence of pathological changes in fish during prolonged exposure to microcystin-LR (MC-LR). Towards this aim, juvenile whitefish individuals received an intraperitoneal injection with pure MC-LR, and the injection was repeated every week to maintain continuous exposure for 28 days. During the exposure period, growth and condition of the fish were assessed based on biometric measurements. Additionally, selected biochemical markers were analysed in the fishes' blood, and their livers were carefully examined for morphological, ultrastructural, and molecular changes. The higher dose of MC-LR (100 μg·kg{sup −1}) caused severe liver injury at the beginning of the exposure period, whereas the lower dose (10 μg·kg{sup −1}) caused less, probably reversible injury, and its effects began to be observed later in the exposure period. These marked changes were accompanied by substantial MC-LR uptake by the liver. However, starting on the 7th day of exposure, cell debris began to be removed by phagocytes, then by 14th day, proliferation of liver cells had markedly increased, which led to reconstruction of the liver parenchyma at the end of the treatment. Surprisingly, despite weekly-repeated intraperitoneal injections, MC-LR did not accumulate over time of exposure which suggests its limited uptake in the later phase of exposure. In support, mRNA expression of the membrane transport protein oatp1d was decreased at the same time as the regenerative processes were observed. Our study shows that closing of active membrane transport may serve as one defence mechanism against further MC-LR intoxication. - Highlights: • The study presents pathological changes in whitefish during prolonged MC-LR exposure. • After early, severe injury, the damaged liver parenchyma of the fish regenerated. • Endoplasmic reticulum, cytoskeleton, and chromatin were the main targets for MC-LR. • MC-LR did not

The first critical experiment with a new type of fuel assemblies IRT-3M on the training reactor VR-I

International Nuclear Information System (INIS)

Matejka, Karel; Sklenka, Lubomir

1997-01-01

The paper 'The first critical experiment with a new type of fuel assemblies IRT-3M on training reactor VR-1 presents basic information about the replacement of fuel on the reactor VR-1 run on FJFI CVUT in Prague. In spring 1997 the IRT-2M fuel type used till then was replaced by the IRT-3M type. When the fuel was replaced, no change in its enrichment was made, i.e. its level remained as 36% 235 U. The replacement itself was carried out in tight co-operation with the Nuclear Research Institute Rez plc., as related to the operation of the research reactor LVR-15. The fuel replacement on the VR-I reactor is a part of the international program RERTR (Reduced Enrichment for Research and Test Reactors) in which the Czech Republic participates. (author)

Up-dating of the RA-0 reactor shielding. Gamma and neutron isodoses

International Nuclear Information System (INIS)

Murua, Carlos A.; Chautemps, Norma A.; Ackerley, Alejandro F.; Alexeiew, Vladimiro

1999-01-01

A comparative analysis of the historical shielding configurations of the RA-0 reactor is performed and the comparison methodology is described. The gamma and neutron dose mapping of the last two stages of the reactor shielding has been carried out and the results are analysed

Theoretical Work for the Fast Zero-Power Reactor FR-0

Energy Technology Data Exchange (ETDEWEB)

Haeggblom, H

1965-08-15

The theoretical part of the fast reactor physics work in Sweden, has mainly been connected with the FR-0 reactor. The report describes the principal features of this reactor, evaluation of cross sections, calculations of critical masses, reactivity of the air gap and of control rods and calculations of neutron generation time and effective beta values. Carlson codes in spherical and in cylindrical geometry are used to evaluate critical masses and fluxes. In cases when reactivity changes are calculated, complementary methods are perturbation theory and variational calculus. The agreement with experiments is in some cases good, especially the determination of critical mass, but in other cases discrepancies are observed, e.g. the activation of U-238 in the reflector is much larger than the theoretical spectrum predicts.

Nuclear Research Institute Rez: Its past and present and future challenges

International Nuclear Information System (INIS)

Pazdera, F.

2001-01-01

The paper gives an overview of the history of the Nuclear Research Institute Rez development over forty years of its existence. Its present activities are discussed in some detail. These historical and present activities represent the basis for discussing: challenges faced by the NRI; interactions of NRI with their environment; collaboration and co-operation. Nuclear research centres would continue to be the main source of expertise for power plant operation, radiation and isotope applications, regulatory practices and waste management. Future developments should ensure viability of these centres. (author)

Naturaleza metodológica y actualidad de las «Disputaciones metafísicas» de Francisco Suárez

Directory of Open Access Journals (Sweden)

Martin GRABMANN

2009-09-01

Full Text Available RESUMEN: Las primera de las conmemoraciones en torno al pensamiento del teólogo y filósofo español Francisco Suárez (1548-1617, que después serán repetidas de forma regular, se produjo en el ámbito académico occidental entorno a la celebración del tercer centenario de su muerte. La universidad de Munich rindió tributo con la publicación del volumen colectivo titulado P. Franz Suarez, S. I. De entre aquellas páginas hemos querido recuperar y adaptar a la lengua castellana el estudio del prestigioso medievalista Martin Grabmann. La referencia a éste entre los especialistas en el pensamiento suareciano es un lugar común a la hora de precisar el carácter sintético y ecléctico de la obra metafísica de Suárez, así como para ilustrar la tesis de la penetración de sus ideas en el ámbito protestante. Es nuestra pretensión que la traducción que aquí presentamos auxilie tanto al historiador, a modo de recordatorio de un valor que generalmente no encuentra asiento en nuestros escritos ni en nuestras aulas, como al especialista, en la justa ponderación de sus rasgos y en especial, de su influencia.ABSTRACT: The first of the conmemorations about the thinking of the spanish theologian and philosopher Francisco Suárez (1548-1617, who later will be repeated of regular, was sucessed in the academic western area into around the celebration of the third centenary of his disappearance. The University of Munich, had shown tribute, printing the collective book called P. Franz Suárez, S. I. The reference to this study between the learners of Suárez is a common place at the moment of specifying the synthetic and eclectic character, of the Suárez’ metaphysical work, as well as reinforcement to the thesis of his fret in the Protestant area of the ideas. It is our pretension that the translation that we present helps so much the historian, as followup of a value that generally finds seat neither in our writings or in our lectures rooms, and

El concepto de ser en Suárez. ?Unívoco o análogo?

Czech Academy of Sciences Publication Activity Database

Heider, Daniel

2017-01-01

Roč. 20, č. 40 (2017), s. 99-120 ISSN 0329-8930 Institutional support: RVO:67985955 Keywords : Suárez * concept of being * analogy * univocity Subject RIV: AA - Philosophy ; Religion OBOR OECD: Philosophy, History and Philosophy of science and technology http://studium.unsta.edu.ar/ojs/index.php/Studium/article/view/141/120

Diversas obras de Maricarmen Sánchez de Ramírez, en Venezuela

Directory of Open Access Journals (Sweden)

Editorial, Equipo Editorial

1981-02-01

Full Text Available This paper deals with three important works of the Madrid born Venezuelan architect, Mari Carmen Sánchez de Ramírez. The first, and the only one completed at present, are seven onefamily dwellings grouped together in one volumetric and structural unit. The second is a tall office building, triangular in shape and composed of a thirty-two story tower, a ground floor public area and a ten floor mechanically operated parking garage. Third and last is the Multi-purpose Complex, located on the coast. It is made up of commercial areas, residential areas, offices, parking facilities and public areas.

En este trabajo se recogen tres interesantes obras de la arquitecto venezolana, nacida en Madrid, Maricarmen Sánchez de Ramírez. La primera, única realizada hasta la fecha, trata de la agrupación de siete viviendas unifamiliares en una misma unidad volumétrica y estructural. La segunda corresponde a un alto edificio de oficinas, de sección triangular, y compuesto por una torre de 32 niveles, un cuerpo bajo de espacios públicos y un estacionamiento mecánico de 10 plantas de altura. La tercera y última comprende un complejo multiuso, situado en la costa, formado por zonas comerciales, áreas de vivienda, oficinas, estacionamiento y espacios públicos.

Ciudad, espacio y ceguera en ciudad Juárez México / City, Space, and Blindness Juárez, México

Directory of Open Access Journals (Sweden)

Maria Esther Vega-Ocampo

2015-05-01

Full Text Available Normal 0 false false false EN-US JA X-NONE /* Style Definitions */ table.MsoNormalTable {mso-style-name:"Table Normal"; mso-tstyle-rowband-size:0; mso-tstyle-colband-size:0; mso-style-noshow:yes; mso-style-priority:99; mso-style-parent:""; mso-padding-alt:0in 5.4pt 0in 5.4pt; mso-para-margin:0in; mso-para-margin-bottom:.0001pt; mso-pagination:widow-orphan; font-size:10.0pt; font-family:Cambria;} Resumen. La comunidad ciega en ciudad Juárez Mexico en frontera con Estados Unidos, mantiene en nuestros días una ausencia participativa en lo cotidiano, la estructura urbana de poca inclusión, los lleva crear alternativas para su movilidad. El objetivo  de este estudio es comprender y analizar cómo es la interacción social y espacial del ciego en una ciudad deshabilitada para su movilidad. Se utilizo un enfoque cualitativo que permitiese una observación cercana al grupo mediante entrevistas semi estructurada y observación participante, se escogió a un grupo de jóvenes ciegos que asisten a la Escuela para Ciegos Luis Braille. Se encontró que la ciudad  muestra un reflejo marginal que genera restricciones en su traslado, movilidad y aprendizaje espacial manteniendo una difícil autonomía.   Abstract: The community of visually impaired persons in Ciudad Juarez, Mexico, sitting astride the United States border, is practically absent from the city's day-to-day life. Providing negligible accommodations, Ciudad Juarez is not an inclusive environment and thus the visually impaired must auto-construct their own means of mobility to get out into the broader community they inhabit. The objective of this study is to analyze and understand the social and spacial interaction of the visually impaired in a northern Mexican border city entirely unequipped for them. The study focuses on a group of students at the Luis Braille School for the Blind in Ciudad Juarez, who were interviewed and observed during a prolonged period of time, and concludes that

Activity and Transcriptional Responses of Hepatopancreatic Biotransformation and Antioxidant Enzymes in the Oriental River Prawn Macrobrachium nipponense Exposed to Microcystin-LR

Directory of Open Access Journals (Sweden)

Julin Yuan

2015-10-01

Full Text Available Microcystins (MCs are a major group of cyanotoxins with side effects in many organisms; thus, compounds in this group are recognized as potent stressors and health hazards in aquatic ecosystems. In order to assess the toxicity of MCs and detoxification mechanism of freshwater shrimp Macrobrachium nipponense, the full-length cDNAs of the glutathione S-transferase (gst and catalase (cat genes were isolated from the hepatopancreas. The transcription level and activity changes in the biotransformation enzyme (glutathione S-transferase (GST and antioxidant enzymes (superoxide dismutase (SOD, catalase (CAT, glutathione peroxidase (GPx in the hepatopancreas of M. nipponense exposed to MC-LR (0.2, 1, 5, and 25 μg/L for 12, 24, 72 and 96 h were analyzed. The results showed that the isolated full-length cDNAs of cat and gst genes from M. nipponense displayed a high similarity to other crustaceans, and their mRNAs were mainly expressed in the hepatopancreas. MC-LR caused significant increase of GST activity following 48–96 h (p < 0.05 and an increase in SOD activity especially in 24- and 48-h exposures. CAT activity was activated when exposed to MC-LR in 12-, 24- and 48-h exposures and then it was inhibited at 96-h exposure. There was no significant effect on GPx activity after the 12- and 24-h exposures, whereas it was significantly stimulated after the 72- and 96-h exposures (p < 0.05. The transcription was altered similarly to enzyme activity, but the transcriptional response was generally more immediate and had greater amplitude than enzymatic response, particularly for GST. All of the results suggested that MC-LR can induce antioxidative modulation variations in M. nipponense hepatopancreas in order to eliminate oxidative damage.

Neutron absorption profile in a reactor moderated by different mixtures of light and heavy waters

International Nuclear Information System (INIS)

Nagy, Mohamed E.; Aly, Mohamed N.; Gaber, Fatma A.; Dorrah, Mahmoud E.

2014-01-01

Highlights: • We studied neutron absorption spectra in a mixed water moderated reactor. • Changing D 2 O% in moderator induced neutron energy spectral shift. • Most of the neutrons absorbed in control rods were epithermal. • Control rods worth changes were not proportional to changes of D 2 O% in moderator. • Control rod arrangement influenced the neutronic behavior of the reactor. - Abstract: A Monte-Carlo parametric study was carried out to investigate the neutron absorption profile in a model of LR-0 reactor when it is moderated by different mixtures of heavy/light waters at molecular ratios ranging from 0% up to 100% D 2 O at increments of 10% in D 2 O. The tallies included; neutron absorption profiles in control rods and moderator, and neutron capture profile in 238 U. The work focused on neutron absorption in control rods entailing; total mass of control rods needed to attain criticality, neutron absorption density and total neutron absorption in control rods at each of the studied mixed water moderators. The aim was to explore whether thermal neutron poisons are the most suitable poisons to be used in control rods of nuclear reactors moderated by mixed heavy/light water moderators

Thermal hydraulic analyses of LVR-15 research reactor with IRT-M fuel

International Nuclear Information System (INIS)

Macek, J.

1997-01-01

The LVR-15 pool-type research reactor has been in operation at the Nuclear Research Institute at Rez since 1955. Following a number of reconstructions and redesigning, the current reactor power is 15 MW. Thermal hydraulic analyses to demonstrate that the core heat will be safely removed during operation as well as in accident situations were performed based on methodology which had been specifically developed for the LVR-15 research reactor. This methodology was applied to stationary thermal hydraulic computations, as well as to transients, particularly with reactivity failure and loss of circulation pumps emergencies. The applied methodology and the core configuration as used in the Safety Report are described. The initial and boundary conditions are then considered and the summary of the calculated failures with regard to the defined safety limits is presented. The results of the core configuration analyses are also discussed with respect to meeting the safety limits and to the applicability of the methodology to this purpose

Lr67/Yr46 confers adult plant resistance to stem rust and powdery mildew in wheat.

Science.gov (United States)

Herrera-Foessel, Sybil A; Singh, Ravi P; Lillemo, Morten; Huerta-Espino, Julio; Bhavani, Sridhar; Singh, Sukhwinder; Lan, Caixia; Calvo-Salazar, Violeta; Lagudah, Evans S

2014-04-01

We demonstrate that Lr67/Yr46 has pleiotropic effect on stem rust and powdery mildew resistance and is associated with leaf tip necrosis. Genes are designated as Sr55, Pm46 and Ltn3 , respectively. Wheat (Triticum aestivum) accession RL6077, known to carry the pleiotropic slow rusting leaf and yellow rust resistance genes Lr67/Yr46 in Thatcher background, displayed significantly lower stem rust (P. graminis tritici; Pgt) and powdery mildew (Blumeria graminis tritici; Bgt) severities in Kenya and in Norway, respectively, compared to its recurrent parent Thatcher. We investigated the resistance of RL6077 to stem rust and powdery mildew using Avocet × RL6077 F6 recombinant inbred lines (RILs) derived from two photoperiod-insensitive F3 families segregating for Lr67/Yr46. Greenhouse seedling tests were conducted with Mexican Pgt race RTR. Field evaluations were conducted under artificially initiated stem rust epidemics with Pgt races RTR and TTKST (Ug99 + Sr24) at Ciudad Obregon (Mexico) and Njoro (Kenya) during 2010-2011; and under natural powdery mildew epiphytotic in Norway at Ås and Hamar during 2011 and 2012. In Mexico, a mean reduction of 41 % on stem rust severity was obtained for RILs carrying Lr67/Yr46, compared to RILs that lacked the gene, whereas in Kenya the difference was smaller (16 %) but significant. In Norway, leaf tip necrosis was associated with Lr67/Yr46 and RILs carrying Lr67/Yr46 showed a 20 % reduction in mean powdery mildew severity at both sites across the 2 years of evaluation. Our study demonstrates that Lr67/Yr46 confers partial resistance to stem rust and powdery mildew and is associated with leaf tip necrosis. The corresponding pleiotropic, or tightly linked, genes, designated as Sr55, Pm46, and Ltn3, can be utilized to provide broad-spectrum durable disease resistance in wheat.

Data acquisition for the LVR-15 research reactor. Final report

International Nuclear Information System (INIS)

Dusek, J.; Holy, J.; Rysavy, J.

1993-11-01

The activities are reviewed carried out under contract No. 5686 between the IAEA and the Nuclear Research Institute at Rez. A list of components, their description and block diagrams of the LVR-15 reactor are presented. Totally, 40 failures during testing and 48 failures during operation were recorded for the period 1991 to 1993. The failure causes and development are briefly described. Information on the failures was classified and included into the system. The contribution to data classification and processing is presented. A number of additional variants are pointed out, of the exact use of non-parametric and parametric statistical methods when developing the comprehensive probabilistic model. A list is given of initiating events as starting points of accident sequences collected from the operating experience. The report consists of three supplements: (i) Data collection on the LVR-15 research reactor; (ii) Some statistical methods for the data processing; (iii) Initiating events data of research reactor for the use of probabilistic safety assessment. (J.B.) 54 tabs., 17 figs., 14 refs

A Multi-Walled Carbon Nanotube-based Biosensor for Monitoring Microcystin-LR in Sources of Drinking Water Supplies

Science.gov (United States)

A multi-walled carbon nanotube-based electrochemical biosensor is developed for monitoring microcystin-LR (MC-LR), a toxic cyanobacterial toxin, in sources of drinking water supplies. The biosensor electrodes are fabricated using dense, mm-long multi-walled CNT (MWCNT) arrays gro...

Influence of management of variables, sampling zones and land units on LR analysis for landslide spatial prevision

Directory of Open Access Journals (Sweden)

R. Greco

2013-09-01

Full Text Available Several authors, according to different methodological approaches, have employed logistic Regression (LR, a multivariate statistical analysis adopted to assess the spatial probability of landslide, even though its fundamental principles have remained unaltered. This study aims at assessing the influence of some of these methodological approaches on the performance of LR, through a series of sensitivity analyses developed over a test area of about 300 km2 in Calabria (southern Italy. In particular, four types of sampling (1 – the whole study area; 2 – transects running parallel to the general slope direction of the study area with a total surface of about 1/3 of the whole study area; 3 – buffers surrounding the phenomena with a 1/1 ratio between the stable and the unstable area; 4 – buffers surrounding the phenomena with a 1/2 ratio between the stable and the unstable area, two variable coding modes (1 – grouped variables; 2 – binary variables, and two types of elementary land (1 – cells units; 2 – slope units units have been tested. The obtained results must be considered as statistically relevant in all cases (Aroc values > 70%, thus confirming the soundness of the LR analysis which maintains high predictive capacities notwithstanding the features of input data. As for the area under investigation, the best performing methodological choices are the following: (i transects produced the best results (0 P(y ≤ 93.4%; Aroc = 79.5%; (ii as for sampling modalities, binary variables (0 P(y ≤ 98.3%; Aroc = 80.7% provide better performance than ordinated variables; (iii as for the choice of elementary land units, slope units (0 P(y ≤ 100%; Aroc = 84.2% have obtained better results than cells matrix.

Factores asociados con el uso inconsistente de condón en hombres que tienen sexo con hombres de ciudad juárez

OpenAIRE

Mendoza-Pérez, Juan C.; Ortiz-Hernández, Luis

2012-01-01

Objetivo Analizar los factores asociados con el uso inconsistente de condón en hombres que tienen sexo con hombres (HSH) de Ciudad Juárez, Chihuahua. Material y métodos Se realizó un estudio observacional, transversal y analítico con una muestra por conveniencia (n=186) de HSH de Ciudad Juárez. Las variables independientes fueron: nivel socioeconómico, actitudes hacia del uso del condón, uso de drogas, consumo de alcohol, identidad por orientación sexual y la discrimina­ción por orientación s...

Institutional radioactive waste management in the Nuclear Research Institute Rez plc

International Nuclear Information System (INIS)

Kovarik, P.; Svoboda, K.; Podlaha, J.

2008-01-01

Nuclear research institute Rez, plc. (mentioned below as NRI) has had a dominant position in the area of the nuclear research and development in the Czech Republic, the Central and the Eastern Europe. Naturally, the radioactive waste management is an integral part of the nuclear industry, research and development. For that reason, there is Centre of the radioactive waste management (mentioned below as Centre) in the NRI. This Centre is engaged in the radioactive waste treatment, decontamination, characterisation, decommissioning and other relevant activities. This paper describes the system of technology and other information about institutional radioactive waste management in the NRI. (authors)

El espacio y el tiempo en W. F. Flórez

OpenAIRE

Mandianes Castro, Manuel

1990-01-01

En las novelas de W. F. Flórez, como en la vida real de las aldeas gallegas, el espacio tiene muchos niveles: "lareira", aldea, parroquia, ciudad, Castilla, América, "fraga" y el subterráneo maravilloso, y el tiempo tiene cualidades: olor, sabor. Una lectura atenta de estas dos novelas demuestra que la oralidad forma parte importante de la narración; que el autor es, por lo mismo, en buena medida, un auténtico trasmisor de la tradición y que, por lo tanto, los etnólogos y antropólogos han de ...

Synthesis of an A'B' Precursor to Angelmicin B: Product Diversification in the Suárez Lactol Fragmentation.

Science.gov (United States)

Li, Jialiang; Todaro, Louis; Mootoo, David R

2011-11-01

We describe a synthetic strategy for the angelimicin family of anthraquinoid natural products that involves converting a central highly oxygenated decalin intermediate to the AB and A'B' subunits. Herein, we report the synthesis of the bicyclic A'B' subunit that complements our earlier route to the tricyclic AB framework. The differentiating tact in the two syntheses focused on controlling the Suárez radical fragmentation of lactol precursors by modulating the substrate's structural rigidity. A more flexible lactol gave the tricyclic AB framework, whereas a more rigid substrate led to the bicyclic A'B' precursor, presumably through divergent pathways from the radical produced in the initial fragmentation step. These results establish a versatile advanced synthetic precursor for the angelimicins, and on a more general note, illustrate strategies for applying the Suárez fragmentation to diverse and complex molecular frameworks.

Allelopathic effects of microcystin-LR on the germination, growth and metabolism of five charophyte species and a submerged angiosperm.

Science.gov (United States)

Rojo, Carmen; Segura, Matilde; Cortés, Francisco; Rodrigo, María A

2013-11-15

Microcystins (MCs) are produced by cyanobacteria in aquatic environments and adversely affect macrophytes at very high concentrations. However, the effects of MC on macrophytes at concentrations of environmental relevance are largely unknown. The main objective of this study was to analyze the allelopathic effects of MC-LR at natural concentrations (1, 8 and 16 μg MC-LR/L) on five charophyte species (Chara aspera, C. baltica, C. hispida, C. vulgaris and Nitella hyalina) and the angiosperm Myriophyllum spicatum. Macrophyte specimens were obtained from a restored area located in Albufera de València Natural Park, a protected coastal Mediterranean wetland. Two different experiments were conducted involving (i) the addition of MC-LR to natural sediment to evaluate its effects on seed germination and (ii) the addition of MC-LR to water cultures of macrophytes to evaluate its effects on growth and metabolic functions. In water, the MC-LR concentration decreased by 84% in two weeks; the loss was not significant in sediment. The first seedlings (all C. hispida) emerged from the wetland sediment following a delay of a few days in the presence of MC-LR. The germination rates in 8 and 16 μg MC-LR/L treatments were 44% and 11% of that occurring in the absence of MC, but these differences disappeared over time. The final density was 6-7 germlings/dm(3). Final germling length was unaffected by MC-LR. Rotifers (Lecane spp.) emerging from the natural sediment during the experiment were favored by MC-LR; the opposite pattern was observed in the cladoceran Daphnia magna. The growth rates of C. vulgaris, C. baltica and N. hyalina were unaffected by MC exposure, whereas those of C. hispida and C. aspera were reduced in the MC treatments relative to the control treatment. The concentration of chlorophyll-a and the in vivo net photosynthetic rate were lower in the presence of MC-LR, even at the lowest concentration, for all of the characeans tested. M. spicatum was sensitive to the

Infermeria Médico-Quirúrgica II. Temari corresponent al Professor Francisco Pérez Dolz. Curs 2017-2018

OpenAIRE

Pérez Dolz, Francisco

2017-01-01

El document forma part dels materials docents programats mitjançant l'ajut del Servei de Política Lingüística de la Universitat de València Infermeria Médico-Quirúrgica II. Temari corresponent al Professor Francisco Pérez Dolz. Curs 2017-2018.

Capacitación de líderes comunitarios como gestores sociales en Ciudad Juárez, Chihuahua

Directory of Open Access Journals (Sweden)

Carmen Álvarez

2015-01-01

Full Text Available El trabajo consiste en describir el desarrollo de un esquema de capacitación de líderes co - munitarios. El enfoque de la formación está dirigido a la gestión de proyectos de incidencia en las comunidades, basándose en diagnósticos participativos. El taller de formación de líderes comunitarios fue desarrollado por la Comisión Nacional para Prevenir y Erradicar la Violencia contra las Mujeres (Conavim en conjunto con la Universidad Autónoma de Ciudad Juárez y la Fundación del Empresariado Chihuahuense (Fechac y se diseñó tomando en consideración el ambiente de crisis social y de seguridad por la que atravesó Ciudad Juárez, así como en las necesidades de capacitación de promotores sociales expresadas en el programa “Todos somos Juárez”.

O direito da guerra em Francisco Suárez: o projeto civilizador da Escolástica Espanhola

Directory of Open Access Journals (Sweden)

Paulo Emílio Borges de Macedo

2013-03-01

Full Text Available O presente texto analisa o direito da guerra em Francisco Suárez. Menos uma explanação sobre um ramo do direito internacional, neste trabalho, busca investigar-se a origem deste direito, sob uma ótica bastante particular. Trata-se de reconstruir o intento de um dos maiores expositores da Escolástica Espanhola para salvar uma tradição cristã muito antiga da sua destruição. A doutrina da guerra justa, embora de origem cristã, corresponde a um dos maiores esforços da humanidade como um todo para limitar a violência da guerra, mesmo antes da existência de um direito internacional. Para manter a validade das proposições da teoria da guerra justa – e minimizar os efeitos da guerra –, Suárez precisou alterar-lhe o fundamento: de doutrina religiosa, ela se tornou jurídica.

Oxidation of microcystin-LR by the Fenton process : Kinetics, degradation intermediates, water quality and toxicity assessment

NARCIS (Netherlands)

Park, Jeong-Ann; Yang, Boram; Park, Chanhyuk; Choi, Jae-Woo; van Genuchten, Case M.|info:eu-repo/dai/nl/413489647; Lee, Sang-Hyup

2017-01-01

The Fenton process was assessed as a cost-effective technology for the removal of Microcystin-LR (MC-LR) among UV, UV/H2O2, and Fenton process according to efficiency and electrical energy per order (EE/O). The determined practical concentrations of the Fenton reagents were 5 mg/L Fe(II) and 5 mg/L

JORGE RAMÍREZ ESPINO, PRODUCTOR DE FLORES ARTIFICIALES [Material gráfico

OpenAIRE

Suárez García, Carlos Félix

1980-01-01

JORGE RAMÍREZ ESPINO, ARTESANO TRADICIONAL DE LAS PALMAS DE GRAN CANARIA DEDICADO A LA PRODUCCIÓN DE FLORES ARTIFICIALES CON TIRAS DE PLATANERA, HOJAS DE DRAGO, CAMISA DE MILLO Y LA PIÑA DE LA FLOR DE LA PLATANERA NACIÓ EN LAS PALMAS DE GRAN CANARIA EN EL AÑO 1942. COMIENZA SU ANDADURA DE MANERA AUTODIDACTA, CONFECCIONANDO FLORES, EN EL AÑO 1992, AL TIEMPO QUE REALIZA COLLARES PARA CABRAS CON ANTONIO PERERA HASTA EL AÑO 1995, EN QUE COMIENZA A VENDER SUS PRIMEROS PRODUCTOS DEL CARA AL PÚBL...

The calibration of the solid state nuclear track detector LR 115 for radon measurements

CERN Document Server

Gericke, C; Jönsson, G; Freyer, K; Treutler, H C; Enge, W

1999-01-01

An experimental calibration of indoor room and outdoor soil detector devices which are based on LR 115 as sensitive element has taken place at the Swedish Radiation Protection Institute in Stockholm (Sweden) in 1994 and 1996, at the Physikalisch-Technischen Bundesanstalt in Braunschweig (Germany) in 1997 and at the Umweltforschungszentrum Leipzig-Halle (Germany) in 1997. Special properties of the used solid state nuclear track detector (SSNTD) material LR 115 have been measured to define the application of the experimental calibration.

The location of locoregional recurrence in pathologic T3N0, non-irradiated lower rectal cancer

International Nuclear Information System (INIS)

Kim, Mi Sun; Keum, Ki Chang; Rhee, Woo Joong; Kim, Hyun Ju; Kim, Min Ji; Choi, Seo Hee; Nam, Ki Chang; Koom, Woong Sub

2013-01-01

To investigate the patterns of locoregional recurrence of pathologic T3N0 (pT3N0) lower rectal cancer omitting postoperative radiotherapy (RT) and explore the potential of modification of a RT field. From Jan 2003 to Nov 2011, 35 patients omitting preoperative or postoperative RT for pT3N0 lower rectal cancer were included. We defined the lower rectal cancer as the tumor with the inferior margin located below the virtual line-a convergent level between rectal wall and levator ani muscle. All patients had radiologic examinations for recurrence evaluation during the follow-up duration. The median follow-up duration was 66.4 months (range, 1.4 to 126.1 months). Eight (22.9%) of the 35 patients had recurrence. Three (8.6%) was local recurrence (LR) only, 3 (8.6%) was distant metastasis (DM) only, and 2 (5.7%) was LR with DM. All LR were located at primary tumor sites. The overall survival rate, LR-free survival rate, and DM-free survival rate at 5 years was 79.8%, 83%, and 87%, respectively. All LR developed from tumors over 5 cm. However, there was no statistical significance (p = 0.065). There was no other risk factor for LR. Even though the patients included in this study had pathologically favorable pT3N0 rectal cancer, LR developed in 14.3% of patients. Most of the LR was located at primary tumor sites prior to surgery. Based on these findings, it might seem reasonable to consider postoperative RT with a smaller radiation field to the primary tumor site rather than the conventional whole pelvic irradiation.

Accumulation of free and covalently bound microcystins in tissues of Lymnaea stagnalis (Gastropoda) following toxic cyanobacteria or dissolved microcystin-LR exposure.

Science.gov (United States)

Lance, Emilie; Neffling, Milla-Riina; Gérard, Claudia; Meriluoto, Jussi; Bormans, Myriam

2010-03-01

Accumulation of free microcystins (MCs) in freshwater gastropods has been demonstrated but accumulation of MCs covalently bound to tissues has never been considered so far. Here, we follow the accumulation of total (free and bound) MCs in Lymnaea stagnalis exposed to i) dissolved MC-LR (33 and 100 microg L(-1)) and ii) Planktothrix agardhii suspensions producing 5 and 33 microg MC-LR equivalents L(-1) over a 5-week period, and after a 3-week depuration period. Snails exposed to dissolved MC-LR accumulated up to 0.26 microg total MCs g(-1) dry weight (DW), with no detection of bound MCs. Snails exposed to MCs producing P. agardhii accumulated up to 69.9 microg total MCs g(-1) DW, of which from 17.7 to 66.7% were bound. After depuration, up to 15.3 microg g(-1) DW of bound MCs were detected in snails previously exposed to toxic cyanobacteria, representing a potential source of MCs transfer through the food web. Copyright (c) 2009 Elsevier Ltd. All rights reserved.

LA GESTIÓN INTEGRAL DE LOS RESIDUOS SÓLIDOS URBANOS EN JUÁREZ: LECCIONES INNOVADORAS PARA OTROS MUNICIPIOS

Directory of Open Access Journals (Sweden)

Ismael Couto Benítez

2012-06-01

Full Text Available El arribo de la iniciativa privada a la gestión integral de residuos sólidos urbanos en el municipio de Ciudad Juárez promovió un nuevo mecanismo institucional para operar un servicio público que ha cumplido las expectativas de mejora y eficiencia establecidos por los indicadores de gerenciamiento para el servicio de limpieza pública, además de solventar el problema de la falta de presupuesto para el mantenimiento y renovación del equipo de recolección de basura. Este documento aborda, a partir de una revisión histórica de datos y entrevistas con los directivos de la empresa PASA y los funcionarios del gobierno municipal de Juárez, el modelo en que se gestó y la forma en que opera el servicio de limpia en uno de los cinco municipios más poblados de México. A partir de esta experiencia, se asumen nuevos retos para la administración de los servicios públicos municipales a partir de prácticas de negociación, calidad en el servicio, rendición de cuentas y control gubernamental.   ABSTRACT The integration of the private sector into comprehensive management of urban solid waste in the municipality of Ciudad Juárez shows a new institutional mechanism to operate a public service that has fulfilled the improvement and efficiency expectations established by managerial indicators for public sanitation services, in addition to overcoming the lack of budget provision for maintenance and renewal of waste collection equipment. By means of a historical revision of data as well as interviews with both executive directors of a garbage-collecting firm called PASA and officials of the municipal government of Ciudad Juárez, this document approaches the waste collection model that was created as well as the way in which the garbage collection service operates in one of the five most populated municipalities in Mexico. Based on this experience, the management of municipal public services assumed new challenges by using negotiation practices

Development of gas cooled reactors and experimental setup of high temperature helium loop for in-pile operation

Energy Technology Data Exchange (ETDEWEB)

Miletić, Marija, E-mail: marija_miletic@live.com [Czech Technical University in Prague, Prague (Czech Republic); Fukač, Rostislav, E-mail: fuk@cvrez.cz [Research Centre Rez Ltd., Rez (Czech Republic); Pioro, Igor, E-mail: Igor.Pioro@uoit.ca [University of Ontario Institute of Technology, Oshawa (Canada); Dragunov, Alexey, E-mail: Alexey.Dragunov@uoit.ca [University of Ontario Institute of Technology, Oshawa (Canada)

2014-09-15

Highlights: • Gas as a coolant in Gen-IV reactors, history and development. • Main physical parameters comparison of gas coolants: carbon dioxide, helium, hydrogen with water. • Forced convection in turbulent pipe flow. • Gas cooled fast reactor concept comparisons to very high temperature reactor concept. • High temperature helium loop: concept, development, mechanism, design and constraints. - Abstract: Rapidly increasing energy and electricity demands, global concerns over the climate changes and strong dependence on foreign fossil fuel supplies are powerfully influencing greater use of nuclear power. In order to establish the viability of next-generation reactor concepts to meet tomorrow's needs for clean and reliable energy production the fundamental research and development issues need to be addressed for the Generation-IV nuclear-energy systems. Generation-IV reactor concepts are being developed to use more advanced materials, coolants and higher burn-ups fuels, while keeping a nuclear reactor safe and reliable. One of the six Generation-IV concepts is a very high temperature reactor (VHTR). The VHTR concept uses a graphite-moderated core with a once-through uranium fuel cycle, using high temperature helium as the coolant. Because helium is naturally inert and single-phase, the helium-cooled reactor can operate at much higher temperatures, leading to higher efficiency. Current VHTR concepts will use fuels such as uranium dioxide, uranium carbide, or uranium oxycarbide. Since some of these fuels are new in nuclear industry and due to their unknown properties and behavior within VHTR conditions it is very important to address these issues by investigate their characteristics within conditions close to those in VHTRs. This research can be performed in a research reactor with in-pile helium loop designed and constructed in Research Center Rez Ltd. One of the topics analyzed in this article are also physical characteristic and benefits of gas

Diagnostics on LALR(k) conflicts based on a method for LR(k) testing

DEFF Research Database (Denmark)

Kristensen, Bent Bruun; Madsen, Ole Lehrmann

1981-01-01

A user of an LALR(k) parser generator system may have difficulties in understanding how a given LALR(k) conflict is generated. This is especially difficult if the conflict does not correspond to an LR(k) conflict. A practical method for giving informative diagnostics on LALR(k) conflicts is prese......A user of an LALR(k) parser generator system may have difficulties in understanding how a given LALR(k) conflict is generated. This is especially difficult if the conflict does not correspond to an LR(k) conflict. A practical method for giving informative diagnostics on LALR(k) conflicts...

Solar photo-Fenton treatment of microcystin-LR in aqueous environment: Transformation products and toxicity in different water matrices

Science.gov (United States)

Transformation products and toxicity patterns of microcystin-LR (MC-LR), a common cyanotoxin in freshwaters, during degradation by solar photo-Fenton process were studied in the absence and presence of two major water components, namely fulvic acid and alkalinity. The transformat...

First successful ionization of Lr (Z = 103) by a surface-ionization technique

Energy Technology Data Exchange (ETDEWEB)

Sato, Tetsuya K., E-mail: sato.tetsuya@jaea.go.jp; Sato, Nozomi; Asai, Masato; Tsukada, Kazuaki; Toyoshima, Atsushi; Ooe, Kazuhiro; Miyashita, Sunao; Schädel, Matthias [Advanced Science Research Center, Japan Atomic Energy Agency (JAEA), 2-4 Shirakata-shirane, Tokai-mura, Ibaraki 319-1195 (Japan); Kaneya, Yusuke; Nagame, Yuichiro [Advanced Science Research Center, Japan Atomic Energy Agency (JAEA), 2-4 Shirakata-shirane, Tokai-mura, Ibaraki 319-1195 (Japan); Graduate School of Science and Engineering, Ibaraki University, 2-1-1, Bunkyo, Mito, Ibaraki 310-8512 (Japan); Osa, Akihiko [Department of Research Reactor and Tandem Accelerator, Japan Atomic Energy Agency (JAEA), 2-4 Shirakata shirane, Tokai-mura, Ibaraki 319-1195 (Japan); Ichikawa, Shin-ichi [Advanced Science Research Center, Japan Atomic Energy Agency (JAEA), 2-4 Shirakata-shirane, Tokai-mura, Ibaraki 319-1195 (Japan); Nishina Center for Accelerator-Based Science, RIKEN, 2-1 Hirosawa, Wako, Saitama 351-0198 (Japan); Stora, Thierry [ISOLDE, CERN, CH-1211 Geneva 23 (Switzerland); Kratz, Jens Volker [Institut für Kernchemie, Universität Mainz, D-55099 Mainz (Germany)

2013-02-15

We have developed a surface ionization ion-source as part of the JAEA-ISOL (Isotope Separator On-Line) setup, which is coupled to a He/CdI{sub 2} gas-jet transport system to determine the first ionization potential of the heaviest actinide lawrencium (Lr, Z = 103). The new ion-source is an improved version of the previous source that provided good ionization efficiencies for lanthanides. An additional filament was newly installed to give better control over its operation. We report, here, on the development of the new gas-jet coupled surface ion-source and on the first successful ionization and mass separation of 27-s {sup 256}Lr produced in the {sup 249}Cf + {sup 11}B reaction.

Reactor physical program in the frame of the MSR-SPHINX transmuter concept development

International Nuclear Information System (INIS)

Hron, M.; Mikisek, M.

2008-01-01

In the frame of the R and D program for the Molten Salt Reactor (MSR) - SPHINX (Spent Hot fuel Incinerator by Neutron flux) concept, which has been under development in the Czech Republic as an actinide burner in resonance neutron spectrum and a radionuclide transmuter in a well-thermalized neutron spectrum, and namely its reactor physical part, the relatively broad experimental activities have been involved in the program, recently, which will serve for a validation of computer codes and verification of design inputs for designing of a demonstration unit of the MSR-type. The experimental program, which has been focused, in its first stage, on a short-term irradiation of small size samples of molten-salt systems as well as structural materials proposed for the MSR blanket in the field of high neutron flux of research reactors, will be in the proposed next stage of the program focused on a large-scale experimental verification of design inputs by use of MSR-type inserted zones into the existing light water moderated experimental reactor LR-0, which may allow to modify it to experimental zero power salt reactor SR-0. There has been a preparatory stage of the project called EROS started in the year 2006 and new experiments with MSR-type zones irradiated by cyclotron based neutron source are planned at the end of 2007 and should go on in the year 2008. There will be a brief description of the so far prepared and performed experimental programs introduced in the paper. (authors)

Studies on the liquid fluoride thorium reactor: Comparative neutronics analysis of MCNP6 code with SRAC95 reactor analysis code based on FUJI-U3-(0)

Energy Technology Data Exchange (ETDEWEB)

Jaradat, S.Q., E-mail: sqjxv3@mst.edu; Alajo, A.B., E-mail: alajoa@mst.edu

2017-04-01

Highlights: • The verification for FUJI-U3-(0)—a molten salt reactor—was performed. • The MCNP6 was used to study the reactor physics characteristics for FUJI-U3 type. • The results from the MCNP6 were comparable with the ones obtained from literature. - Abstract: The verification for FUJI-U3-(0)—a molten salt reactor—was performed. The reactor used LiF-BeF2-ThF4-UF4 as the mixed liquid fuel salt, and the core was graphite moderated. The MCNP6 code was used to study the reactor physics characteristics for the FUJI-U3-(0) reactor. Results for reactor physics characteristic of the FUJI-U3-(0) exist in literature, which were used as reference. The reference results were obtained using SRAC95 (a reactor analysis code) coupled with ORIGEN2 (a depletion code). Some modifications were made in the reconstruction of the FUJI-U3-(0) reactor in MCNP due to unavailability of more detailed description of the reactor core. The assumptions resulted in two representative models of the reactor. The results from the MCNP6 models were compared with the reference results obtained from literature. The results were comparable with each other, but with some notable differences. The differences are because of the approximations that were done on the SRAC95 model of the FUJI-U3 to simplify the simulation. Based on the results, it is concluded that MCNP6 code predicts well the overall simulation of neutronics analysis to the previous simulation works using SRAC95 code.

Radioactive waste management at WWER type reactors

International Nuclear Information System (INIS)

1993-05-01

This report was prepared within the framework of the Technical Assistance Regional Project on Advice on Waste Management at WWER Type Reactors, which was initiated by the IAEA in 1991. The Regional Project is an integral part of the IAEA's activities directed towards improvement of the safety and reliability of nuclear power plants with WWER type reactors (Soviet designed PWRs). Forty-five WWER type units are currently in operation and twenty-five are under construction in Bulgaria, Czechoslovakia, Finland, Hungary and the former USSR. The idea of regional collaboration between eastern European countries under the auspices of the IAEA was discussed for the first time during the last meeting of the Council for Mutual Economic Assistance (CMEA) on spent fuel and radioactive waste management, held in Rez, Czechoslovakia, in October 1990. Since then, the CMEA and some of its former Member States have ceased to exist. However, there are many reasons for eastern European countries to continue their regional collaboration at a higher level. The USSR, the designer and supplier of WWER type reactors in eastern European countries, participated in the first phase of the project. The majority of WWER type reactors are situated in States of the former USSR (Russia and Ukraine). The main results of the first phase of the Regional Project are: (i) Re-establishment of communication channels among eastern European countries operating WWER type reactors by incorporating the IAEA's technical assistance; (ii) Identification of common waste management problems (administrative and technical) requiring resolution; (iii) Familiarization with radioactive waste management systems at nuclear power plants with WWER type reactors - Paks (Hungary), Loviisa (Finland), Jaslovske Bohunice (Czechoslovakia) and Novovoronezh (Russian Federation). Tabs

Similar uptake profiles of microcystin-LR and -RR in an in vitro human intestinal model

International Nuclear Information System (INIS)

Zeller, P.; Clement, M.; Fessard, V.

2011-01-01

Highlights: → First description of in vitro cellular uptake of MCs into intestinal cells. → OATP 3A1 and OATP 4A1 are expressed in Caco-2 cell membranes. → MC-LR and MC-RR show similar uptake in Caco-2 cells. → MCs are probably excreted from Caco-2 cells by an active mechanism. -- Abstract: Microcystins (MCs) are cyclic hepatotoxins produced by various species of cyanobacteria. Their structure includes two variable amino acids (AA) leading to more than 80 MC variants. In this study, we focused on the most common variant, microcystin-LR (MC-LR), and microcystin-RR (MC-RR), a variant differing by only one AA. Despite their structural similarity, MC-LR elicits higher liver toxicity than MC-RR partly due to a discrepancy in their uptake by hepatic organic anion transporters (OATP 1B1 and 1B3). However, even though ingestion is the major pathway of human exposure to MCs, intestinal absorption of MCs has been poorly addressed. Consequently, we investigated the cellular uptake of the two MC variants in the human intestinal cell line Caco-2 by immunolocalization using an anti-MC antibody. Caco-2 cells were treated for 30 min to 24 h with several concentrations (1-50 μM) of both variants. We first confirmed the localization of OATP 3A1 and 4A1 at the cell membrane of Caco-2 cells. Our study also revealed a rapid uptake of both variants in less than 1 h. The uptake profiles of the two variants did not differ in our immunostaining study neither with respect to concentration nor the time of exposure. Furthermore, we have demonstrated for the first time the nuclear localization of MC-RR and confirmed that of MC-LR. Finally, our results suggest a facilitated uptake and an active excretion of MC-LR and MC-RR in Caco-2 cells. Further investigation on the role of OATP 3A1 and 4A1 in MC uptake should be useful to clarify the mechanism of intestinal absorption of MCs and contribute in risk assessment of cyanotoxin exposure.

75 FR 4879 - Juan E. Pérez Monté, M.D.; Confirmatory Order Modifying License (Effective Immediately)

Science.gov (United States)

2010-01-29

... the Health Physics Society, and the Journal of Nuclear Medicine; and, 2. Dr. P[eacute]rez will also... national meetings of the Health Physics Society and the Society of Nuclear Medicine. If the request to make... following: Galenus (Puerto Rico), the Journal of the Health Physics Society, and the Journal of Nuclear...

Comercio transfronterizo y su impacto en la región de El Paso-Ciudad Juárez: Una propuesta de financiamiento de la planeación binacional

Directory of Open Access Journals (Sweden)

Sergio Peña

2003-01-01

Full Text Available El presente artículo analiza el impacto del comercio transfronterizo en la región de El Paso-Ciudad Juárez, entendido como tal el valor de las compras que los consumidores mexicanos realizan en El Paso. Los resultados muestran que el monto de las ventas al menudeo en esta ciudad en el año 2000 excedieron en 33% los valores ajustados del modelo. Este último debe interpretarse como el efecto del comercio transfronterizo. Los impuestos generados por el comercio transfronterizo suman aproximadamente 125 millones de dólares y equivalen aproximadamente a los egresos brutos totales del municipio de Ciudad Juárez en el año 2000. El artículo pone de relieve la potencialidad que tendrían esos recursos para el financiamiento del desarrollo urbano binacional de El Paso y Ciudad Juárez

Dynamics of microcystins-LR and -RR in the phytoplanktivorous silver carp in a sub-chronic toxicity experiment

International Nuclear Information System (INIS)

Xie Liqiang; Xie Ping; Ozawa, Kazuhiko; Honma, Takamitsu; Yokoyama, Atsushi; Park, Ho-Dong

2004-01-01

A sub-chronic toxicity experiment was conducted to examine tissue distribution and depuration of two microcystins (microcystin-LR and microcystin -RR) in the phytoplanktivorous filter-feeding silver carp during a course of 80 days. Two large tanks (A, B) were used, and in Tank A, the fish were fed naturally with fresh Microcystis viridis cells (collected from a eutrophic pond) throughout the experiment, while in Tank B, the food of the fish were M. viridis cells for the first 40 days and then changed to artificial carp feed. High Performance Liquid Chromatography (HPLC) was used to measure MC-LR and MC-RR in the M. viridis cells, the seston, and the intestine, blood, liver and muscle tissue of silver carp at an interval of 20 days. MC-RR and MC-LR in the collected Microcystis cells varied between 268-580 and 110-292 μg g -1 DW, respectively. In Tank A, MC-RR and MC-LR varied between 41.5-99.5 and 6.9-15.8 μg g -1 DW in the seston, respectively. The maximum MC-RR in the blood, liver and muscle of the fish was 49.7, 17.8 and 1.77 μg g -1 DW, respectively. No MC-LR was detectable in the muscle and blood samples of the silver carp in spite of the abundant presence of this toxin in the intestines (for the liver, there was only one case when a relatively minor quantity was detected). These findings contrast with previous experimental results on rainbow trout. Perhaps silver carp has a mechanism to degrade MC-LR actively and to inhibit MC-LR transportation across the intestines. The depuration of MC-RR concentrations occurred slowly than uptakes in blood, liver and muscle, and the depuration rate was in the order of blood>liver>muscle. The grazing ability of silver carp on toxic cyanobacteria suggests an applicability of using phytoplanktivorous fish to counteract cyanotoxin contamination in eutrophic waters. - Silver carp are tolerant of cyanobacterial toxins, and might be used to control toxic algal blooms in highly eutrophic lakes

太冲穴古代文献应用分析%Application Analysis of Taichong(LR3) in the Ancient Literatures

Institute of Scientific and Technical Information of China (English)

王文琴; 张永臣; 贾红玲

2013-01-01

目的：通过对太冲古代文献的整理，总结太冲的应用规律。方法：以《中华医典》（第四版）收录的中医古籍1000部为检索范围，对太冲的主治病症、腧穴配伍、配伍主治病症、刺灸法、刺激量等文献进行系统整理，并建立数据库。结果：太冲应用符合纳入标准的有752条，治疗病症共有689条，涉及87部古籍。太冲配伍的使用频次共有1433次，与太冲穴配伍的经穴为167个。结论：太冲单穴适应于临床各科，尤善于治疗中医内科病症，前7位的内科病症为咳嗽、黄疸、痫病、呕吐、痹症、厥症、淋证；配伍后主治前10位的病症为痹症、胸痹、腹痛、血证、虚劳、黄疸、痉证、水肿、腰痛、中风；太冲的腧穴配伍以合谷、足三里、三阴交、行间、昆仑、照海、悬钟、中封、大敦、百会等经穴频数为较多，常用的配伍“穴对”为太冲与行间、太冲与合谷、太冲与三阴交；常用的刺灸法为灸法，针刺深度为针三分，针刺时间为十呼，灸法刺激量为三壮。%Objective:To sum up the application regularity of Taichong ( LR3) through studying the ancient lit-eratures about Taichong (LR3).Methods:We searched 1000 TCM Ancient Books in the “Encyclopedia of Tra-ditional Chinese”( the Fourth Edition ) and organized the information systematically including the primary disea-ses and symptoms of Taichong (LR3),the compatibility of acupionts, the primary diseases and symptoms of Tai-chong ( LR3 ) with compatible effects , the methods of needling and moxibustion , the stimulating quantity of nee-dling and moxibustion , with which we built a data base .Results:A total of 752 relevant articles of Taichong ( LR3) on the application and 689 primary diseases and symptoms were collected in accordance with the inclu-sive criteria in 87 TCM ancient books .The results also showed that the occurrence frequency of Taichong ( LR3

Containment Loads Analysis for CANDU6 Reactor using CONTAIN 2.0

International Nuclear Information System (INIS)

Kim, Tae H.; Yang, Chae Y.

2013-01-01

The containment plays an important role to limit the release of radioactive materials to the environment during design basis accidents (DBAs). Therefore, the containment has to maintain its integrity under DBA conditions. Generally, a containment functional DBA evaluation includes calculations of the key containment loads, i. e., pressure and temperature effects associated with a postulated large rupture of the primary or secondary coolant system piping. In this paper, the behavior of containment pressure and temperature was evaluated for loss of coolant accidents (LOCAs) of the Wolsong unit 1 in order to assess the applicability of CONTAIN 2.0 code for the containment loads analysis of the CANDU6 reactor. The containment pressure and temperature of the Wolsong unit 1 were evaluated using the CONTAIN 2.0 code and the results were compared with the CONTEMPT4 code. The peak pressure and temperature calculated by CONTAIN 2.0 agreed well with those of CONTEMPT4 calculation. The overall result of this analysis shows that the CONTAIN 2.0 code can apply to the containment loads analysis for the CANDU6 reactor

Review of Arciaga, Juárez y Mendoza (Coords. (2013. Introducción a la Psicología Social

Directory of Open Access Journals (Sweden)

Ali Lara

2014-11-01

Full Text Available Reseña del libro: Salvador Arciaga Bernal, Juana Juárez Romero y Jorge Mendoza Garcia  (coord. (2013. Introducción a la Psicología Social. México: UAM-MAPorrúa. ISBN 978-607-28-0109-7

Omega-3 fatty acid docosahexaenoic acid increases SorLA/LR11, a sorting protein with reduced expression in sporadic Alzheimer's disease (AD): relevance to AD prevention.

Science.gov (United States)

Ma, Qiu-Lan; Teter, Bruce; Ubeda, Oliver J; Morihara, Takashi; Dhoot, Dilsher; Nyby, Michael D; Tuck, Michael L; Frautschy, Sally A; Cole, Greg M

2007-12-26

Environmental and genetic factors, notably ApoE4, contribute to the etiology of late-onset Alzheimer's disease (LOAD). Reduced mRNA and protein for an apolipoprotein E (ApoE) receptor family member, SorLA (LR11) has been found in LOAD but not early-onset AD, suggesting that LR11 loss is not secondary to pathology. LR11 is a neuronal sorting protein that reduces amyloid precursor protein (APP) trafficking to secretases that generate beta-amyloid (Abeta). Genetic polymorphisms that reduce LR11 expression are associated with increased AD risk. However these polymorphisms account for only a fraction of cases with LR11 deficits, suggesting involvement of environmental factors. Because lipoprotein receptors are typically lipid-regulated, we postulated that LR11 is regulated by docosahexaenoic acid (DHA), an essential omega-3 fatty acid related to reduced AD risk and reduced Abeta accumulation. In this study, we report that DHA significantly increases LR11 in multiple systems, including primary rat neurons, aged non-Tg mice and an aged DHA-depleted APPsw AD mouse model. DHA also increased LR11 in a human neuronal line. In vivo elevation of LR11 was also observed with dietary fish oil in young rats with insulin resistance, a model for type II diabetes, another AD risk factor. These data argue that DHA induction of LR11 does not require DHA-depleting diets and is not age dependent. Because reduced LR11 is known to increase Abeta production and may be a significant genetic cause of LOAD, our results indicate that DHA increases in SorLA/LR11 levels may play an important role in preventing LOAD.

Characterization of the TRIGA Mark III reactor for k0-neutron activation analysis

International Nuclear Information System (INIS)

Diaz R, O.; Herrera P, E.; Lopez R, M.C.

1997-01-01

The non-ideality of the epithermal neutron flux distribution in a a reactor site parameter (α), the thermal-to-epithermal neutron ratio (f), the irradiation channel neutron temperature (T n ) and the k 0 -factors for more than 20 isotopes were determined in the 3 typical irradiation positions of the TRIGA Mark III reactor of the National Nuclear Research Institute, Salazar, Mexico, using different experimental methods with conventional and non-conventional monitors. This characterization is used in the k 0 -method of NAA, recently introduced at the Institute. (author). 21 refs., 3 figs., 5 tabs

Photocatalytic degradation and mineralization of microcystin-LR under UV-A, solar and visible light using nanostructured nitrogen doped TiO2

International Nuclear Information System (INIS)

Triantis, T.M.; Fotiou, T.; Kaloudis, T.; Kontos, A.G.; Falaras, P.; Dionysiou, D.D.; Pelaez, M.; Hiskia, A.

2012-01-01

Highlights: ► N-TiO 2 exhibited effective degradation of MC-LR under UV-A, solar and visible light. ► Complete photocatalytic mineralization of MC-LR was achieved under UV-A and solar light. ► The organic nitrogen is mainly released as ammonium and nitrate ions. - Abstract: In an attempt to face serious environmental hazards, the degradation of microcystin-LR (MC-LR), one of the most common and more toxic water soluble cyanotoxin compounds released by cyanobacteria blooms, was investigated using nitrogen doped TiO 2 (N-TiO 2 ) photocatalyst, under UV-A, solar and visible light. Commercial Degussa P25 TiO 2 , Kronos and reference TiO 2 nanopowders were used for comparison. It was found that under UV-A irradiation, all photocatalysts were effective in toxin elimination. The higher MC-LR degradation (99%) was observed with Degussa P25 TiO 2 followed by N-TiO 2 with 96% toxin destruction after 20 min of illumination. Under solar light illumination, N-TiO 2 nanocatalyst exhibits similar photocatalytic activity with that of commercially available materials such as Degussa P25 and Kronos TiO 2 for the destruction of MC-LR. Upon irradiation with visible light Degussa P25 practically did not show any response, while the N-TiO 2 displayed remarkable photocatalytic efficiency. In addition, it has been shown that photodegradation products did not present any significant protein phosphatase inhibition activity, proving that toxicity is proportional only to the remaining MC-LR in solution. Finally, total organic carbon (TOC) and inorganic ions (NO 2 − , NO 3 − and NH 4 + ) determinations confirmed that complete photocatalytic mineralization of MC-LR was achieved under both UV-A and solar light.

Inactivation Kinetics of the Cyanobacterial Toxin Microcystin-LR by Free Chlorine

Science.gov (United States)

Worldwide, the increasing occurrence of toxins produced by cyanobacteria in water bodies used as source waters for drinking water has become an important public health issue. Microcystin-LR is one of the most commonly found cyanotoxins. A detailed evaluation of the free chlorine ...

Study and application of k0-IAEA program on the Dalat Research Reactor

International Nuclear Information System (INIS)

Cao Dong Vu; Tran Quang Thien; Nguyen Thi Sy; Ho Manh Dung; Nguyen Nhi Dien

2011-01-01

The pneumatic 7-1 and rotary rack (lazy susan) facilities are two main irradiation channels for neutron activation analysis at Dalat research reactor. The experiments for characterizing these two irradiation facilities at June, July and August, 2010 by k 0 -IAEA using Al-0.1% Au, Al-0.1% Lu, 99.98% Ni and 99.8% Zr monitors were done. The neutron spectrum parameters include: (1) Thermal neutron flux (Φ th ); (2) The ratio between thermal neutron flux and epi-thermal neutron flux (f); (3) The α factor describing the neutron flux distribution 1/E 1+α , and (4) The neutron temperature (T n ). This study provides the first database for further studying and applying k 0 -IAEA at Dalat Research Reactor in the future. (author)

Effect of Acupuncture at LR3 on Cerebral Glucose Metabolism in a Rat Model of Hypertension: A 18F-FDG-PET Study

Directory of Open Access Journals (Sweden)

Jing Li

2018-01-01

Full Text Available Our objective was to investigate the effect of acupuncture at LR3 on cerebral glucose metabolism in spontaneously hypertensive rats (SHRs. We used 18F-2-fluoro-deoxy-D-glucose positron emission tomography (18F-FDG-PET to examine the effects of acupuncture at LR3 on cerebral glucose metabolism in SHRs. SHRs were randomly allocated to receive no treatment (SHR group, needling at LR3 (SHR + LR3 group, or sham needling (SHR + sham group. Rats received 10 min acupuncture once per day for 7 days and were compared to normotensive Wistar Kyoto (WKY rats. Blood pressure (BP measurement and PET were performed after the first needling and the 7-day treatment period. BP was lower in the SHR + LR3 group compared to the other SHR groups between 30 and 60 min after the first needling and at 24 and 48 h after the 7-day treatment period. Glucose metabolism in the motor, sensory, and visual cortices was decreased in SHR group compared to WKY group. Needling at LR3 was associated with decreased glucose metabolism in the dorsal thalamus, thalamus, and hypothalamus and with increased metabolism in the cerebellar anterior and posterior lobes, medulla oblongata, and sensory cortex compared to the SHR group. These findings suggest that LR3 acupuncture improves hypertension through a mechanism involving altered brain activation in SHRs.

LR1: a candidate RNA virus of Leishmania.

OpenAIRE

Tarr, P I; Aline, R F; Smiley, B L; Scholler, J; Keithly, J; Stuart, K

1988-01-01

Although viruses are important biological agents and useful molecular tools, little is known about the viruses of parasites. We report here the discovery of a candidate for an RNA virus in a kinetoplastid parasite. This potential virus, which we term LR1, is present in the promastigote form of the human pathogen Leishmania braziliensis guyanensis CUMC1-1A but not in 11 other stocks of Leishmania that were examined nor in Trypanosoma brucei. The candidate viral RNA has a size of approximately ...

Data-processing program from the operating modes of the nuclear reactor (P0DER)

International Nuclear Information System (INIS)

Totev, T.L.; Boyadzhiev, A.I.

1981-01-01

A program PODER for processing data from the operating modes of the reactors taking into account the effects of corrosion, hydration, and deformation of the nuclear reactor fuel element sheathing, the formation of the corrosion product deposits, the change in the geometric dimensions of the nuclear reactor fuel element due to the temperature deformation, as well as the various gas fillers, are elaborated. The ''hot channel'' method determining the reliability of the system is realized. The basic equations describing the thermohydraulic processes in nuclear reactors are solved by the finite difference method. Approximations are carried out with the approach of least squares. The temperature distribution versus the zirconium sheathing height is computed for the case of WWER-440 type reactors. The advantages of the proposed program P0DER are discussed

Bulk etch rate of LR-115 cellulose nitrate film

International Nuclear Information System (INIS)

Harris, M.J.; Schlenker, R.A.

1977-01-01

Bulk etch rate (V/sub b/) of Kodak LR-115 cellulose nitrate film has been studied, and values for the parameter are presented. An interesting variability of V/sub b/ has been found which has implications for microdosimetry using this type of integrating nuclear track detector. Short-term and longer-term thickness changes have been observed which may increase the uncertainty in estimations of dose using this type of detector

The Lr34 adult plant rust resistance gene provides seedling resistance in durum wheat without senescence.

Science.gov (United States)

Rinaldo, Amy; Gilbert, Brian; Boni, Rainer; Krattinger, Simon G; Singh, Davinder; Park, Robert F; Lagudah, Evans; Ayliffe, Michael

2017-07-01

The hexaploid wheat (Triticum aestivum) adult plant resistance gene, Lr34/Yr18/Sr57/Pm38/Ltn1, provides broad-spectrum resistance to wheat leaf rust (Lr34), stripe rust (Yr18), stem rust (Sr57) and powdery mildew (Pm38) pathogens, and has remained effective in wheat crops for many decades. The partial resistance provided by this gene is only apparent in adult plants and not effective in field-grown seedlings. Lr34 also causes leaf tip necrosis (Ltn1) in mature adult plant leaves when grown under field conditions. This D genome-encoded bread wheat gene was transferred to tetraploid durum wheat (T. turgidum) cultivar Stewart by transformation. Transgenic durum lines were produced with elevated gene expression levels when compared with the endogenous hexaploid gene. Unlike nontransgenic hexaploid and durum control lines, these transgenic plants showed robust seedling resistance to pathogens causing wheat leaf rust, stripe rust and powdery mildew disease. The effectiveness of seedling resistance against each pathogen correlated with the level of transgene expression. No evidence of accelerated leaf necrosis or up-regulation of senescence gene markers was apparent in these seedlings, suggesting senescence is not required for Lr34 resistance, although leaf tip necrosis occurred in mature plant flag leaves. Several abiotic stress-response genes were up-regulated in these seedlings in the absence of rust infection as previously observed in adult plant flag leaves of hexaploid wheat. Increasing day length significantly increased Lr34 seedling resistance. These data demonstrate that expression of a highly durable, broad-spectrum adult plant resistance gene can be modified to provide seedling resistance in durum wheat. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

Experimental study on the aging process of the LR 115 cellulose nitrate radon detector

International Nuclear Information System (INIS)

Siems, M.; Freyer, K.; Treutler, H.-C.; Joensson, G.; Enge, W.

2001-01-01

An experimental determination of the aging process of cellulose nitrate detector material was based on the examination of special properties of the LR 115 solid state nuclear track detectors (SSNTDs) of various ages up to 18 years. The examined relevant parameters are the bulk etching rate v b and the track etching rate v t . These parameters are responsible for the appearance, the size and the registration efficiency of tracks of α-particles from radon gas in the detector. To find a correlation between these material parameters and the detector sensitivity an experimental calibration of indoor room and outdoor soil detector devices based on LR 115 took place at the Umweltforschungszentrum Leipzig-Halle (Germany). To avoid routine calibration work in external radon exposure facilities a correction of the age dependent calibration factors with the material parameters measured in one's own laboratory was targeted. In this study a general age dependence, however, was not found. The following statements for practical applications can be made. (i) the bulk etching rate v b for detectors of the same batch has a depth dependence and this dependence is constant over 2 years (LR 115 September 1994). (ii) detectors of different batches older than 5 years and stored at room temperature show an odd v b behaviour when v b is used for describing track shapes. (iii) the calibration factor of detectors of different batches that were stored at about +4 deg. C is constant over 5 years (LR 115 September 1994 and February 1999, Table 2). The conclusion is that LR 115 detectors not older than 5 years and stored in a refrigerator at about +4 deg. C should be preferred for radon measurements. Furthermore these detectors should be recalibrated every year and the microscope work of this calibrations should be performed by the same person who performs the measurements. In addition, a phenomenon related to fundamental track formation mechanisms was found, that the time straggling of the

Magneto-resistance of Si0,97Ge0,03 whiskers irradiated by reactor fast neutrons

International Nuclear Information System (INIS)

Pavlovska, N.T.; Litovchenko, P.G.; Karpenko, A.Ya.; Uhryn, Yu.O.; Pavlovskyj, Yu.V.; Ostrovskii, I.P.; Khoverko, Yu.M.

2012-01-01

The influence of reactor fast-neutrons irradiation by the fluence of 8,6·10 17 n/cm 2 and strong magnetic field (up to 14 T) on resistance of Si 1-x Ge x (x = 0.03) whiskers in the temperature range of 4,2 - 300 K is studied. The activation energy of the of impurity levels is calculated. The interpretation of changes in the magneto-resistance is proposed

Photocatalytic degradation and mineralization of microcystin-LR under UV-A, solar and visible light using nanostructured nitrogen doped TiO{sub 2}

Energy Technology Data Exchange (ETDEWEB)

Triantis, T.M.; Fotiou, T. [Laboratory of Catalytic - Photocatalytic Processes (Solar Energy - Environment), Institute of Physical Chemistry, National Center for Scientific Research ' Demokritos' , Neapoleos 25, 15310 Agia Paraskevi, Attiki (Greece); Kaloudis, T. [Organic Micropollutants Laboratory, Athens Water Supply and Sewerage Company (EYDAP SA), WTP Aharnon, Menidi (Greece); Kontos, A.G.; Falaras, P. [Laboratory of Photo-redox Conversion and Storage of Solar Energy, Institute of Physical Chemistry, National Center for Scientific Research ' Demokritos' , Neapoleos 25, 15310 Agia Paraskevi, Attiki (Greece); Dionysiou, D.D.; Pelaez, M. [Environmental Engineering and Science Program, School of Energy, Environmental, Biological and Medical Engineering, University of Cincinnati, OH 45221-0012 (United States); Hiskia, A., E-mail: hiskia@chem.demokritos.gr [Laboratory of Catalytic - Photocatalytic Processes (Solar Energy - Environment), Institute of Physical Chemistry, National Center for Scientific Research ' Demokritos' , Neapoleos 25, 15310 Agia Paraskevi, Attiki (Greece)

2012-04-15

Highlights: Black-Right-Pointing-Pointer N-TiO{sub 2} exhibited effective degradation of MC-LR under UV-A, solar and visible light. Black-Right-Pointing-Pointer Complete photocatalytic mineralization of MC-LR was achieved under UV-A and solar light. Black-Right-Pointing-Pointer The organic nitrogen is mainly released as ammonium and nitrate ions. - Abstract: In an attempt to face serious environmental hazards, the degradation of microcystin-LR (MC-LR), one of the most common and more toxic water soluble cyanotoxin compounds released by cyanobacteria blooms, was investigated using nitrogen doped TiO{sub 2} (N-TiO{sub 2}) photocatalyst, under UV-A, solar and visible light. Commercial Degussa P25 TiO{sub 2}, Kronos and reference TiO{sub 2} nanopowders were used for comparison. It was found that under UV-A irradiation, all photocatalysts were effective in toxin elimination. The higher MC-LR degradation (99%) was observed with Degussa P25 TiO{sub 2} followed by N-TiO{sub 2} with 96% toxin destruction after 20 min of illumination. Under solar light illumination, N-TiO{sub 2} nanocatalyst exhibits similar photocatalytic activity with that of commercially available materials such as Degussa P25 and Kronos TiO{sub 2} for the destruction of MC-LR. Upon irradiation with visible light Degussa P25 practically did not show any response, while the N-TiO{sub 2} displayed remarkable photocatalytic efficiency. In addition, it has been shown that photodegradation products did not present any significant protein phosphatase inhibition activity, proving that toxicity is proportional only to the remaining MC-LR in solution. Finally, total organic carbon (TOC) and inorganic ions (NO{sub 2}{sup -}, NO{sub 3}{sup -} and NH{sub 4}{sup +}) determinations confirmed that complete photocatalytic mineralization of MC-LR was achieved under both UV-A and solar light.

Reflexions al voltant de la proposta lingüística de Josep Nebot i Pérez

Directory of Open Access Journals (Sweden)

Joan Rafael Ramos

2015-10-01

Full Text Available This article tries to outline the general background of grammatical studies in Catalan by the end of the 19th century and beginnings of the 20th century, while phocusing on the work of the Valencian grammarian Josep Nebot i Pérez, his linguistic ideology and his interesting proposal of producing two different set of grammars: a popular one, and another addressed to the more cultivated reader.

El cine de Pérez Arroyo y los proyectores de juguete de posguerra / The Cinema of Pérez Arroyo and the Postwar Toy Projectors

Directory of Open Access Journals (Sweden)

Raúl González-Monaj

2016-08-01

Full Text Available La historia de la animación de posguerra en nuestro país, conocida como «la edad dorada», siempre ha resultado fascinante por el contexto en que se desarrolló y por ello se ha convertido en objeto de estudio, pero todavía quedan algunos episodios menores por ultimar. El presente trabajo pretende completar una de esas lagunas, la referente a la obra de Joaquín Pérez Arroyo y su posterior relación con el cine doméstico de juguete y su entorno. A través de esta investigación profundizaremos en las películas de este animador, apenas conocido, y en su decisiva participación en dos de los ejemplos más populares del cine de juguete nacional: Payá y Jefe. Casos que estuvieron conectados gracias a él y que se mueven entre el cine de papel y los 35 mm, entre el salón comedor y la sala de cine, entre Mikito y Quinito.Palabras clave: cortometraje de animación, CIFESA, proyector de juguete, Payá, Saludes, Jefe, Quinito. AbstractThe story of the postwar animation in Spain, known as the « Golden Age», has always been fascinating due to the context where it happened and so, it became object of study. Nevertheless, there are still some episodes to be finished. This study aims to complete one of these gaps as the one related to Joaquín Pérez Arroyo's work and his later connection to home cinema as a toy and its context. All through this research, we'll analyze films of this barely known author and his decisive participation in two of the most popular toy cinema examples in Spain: Payá and Jefe. Thanks to him, these two cases became connected, two worlds that coexist within the paper film and the 35 mm, between the living room and the movie theatre, between Mikito and Quinito.Keywords: animation short film, CIFESA, toy projector, Payá, Saludes, Jefe, Quinito.

Development of COS-SNP and HRM markers for high-throughput and reliable haplotype-based detection of Lr14a in durum wheat (Triticum durum Desf.).

Science.gov (United States)

Terracciano, Irma; Maccaferri, Marco; Bassi, Filippo; Mantovani, Paola; Sanguineti, Maria C; Salvi, Silvio; Simková, Hana; Doležel, Jaroslav; Massi, Andrea; Ammar, Karim; Kolmer, James; Tuberosa, Roberto

2013-04-01

Leaf rust (Puccinia triticina Eriks. & Henn.) is a major disease affecting durum wheat production. The Lr14a-resistant gene present in the durum wheat cv. Creso and its derivative cv. Colosseo is one of the best characterized leaf-rust resistance sources deployed in durum wheat breeding. Lr14a has been mapped close to the simple sequence repeat markers gwm146, gwm344 and wmc10 in the distal portion of the chromosome arm 7BL, a gene-dense region. The objectives of this study were: (1) to enrich the Lr14a region with single nucleotide polymorphisms (SNPs) and high-resolution melting (HRM)-based markers developed from conserved ortholog set (COS) genes and from sequenced Diversity Array Technology (DArT(®)) markers; (2) to further investigate the gene content and colinearity of this region with the Brachypodium and rice genomes. Ten new COS-SNP and five HRM markers were mapped within an 8.0 cM interval spanning Lr14a. Two HRM markers pinpointed the locus in an interval of HRM designed for agarose gel electrophoresis/KASPar(®) assays and high-resolution melting analysis, respectively, as well as the double-marker combinations ubw14/ubw18, ubw14/ubw35 and wPt-4038-HRM-ubw35 will be useful for germplasm haplotyping and for molecular-assisted breeding.

Influence of the datasets size on the stability of the LR in the lower region of the within source distribution

NARCIS (Netherlands)

Haraksim, Rudolf; Meuwly, Didier

2013-01-01

This article focuses on the statistical evaluation of the fingermark evidence using the likelihood ratio (LR) approach. It studies the influence of the quantity of data used to model the within (WS) and between (BS) source variability. The LR system built for the experiment uses an Automated

Identification of leaf rust resistant gene Lr10 in Pakistani wheat ...

African Journals Online (AJOL)

Leaf (brown) rust is the major disease of wheat in Pakistan and other countries. The disease is more effectively controlled when several rust resistance genes are pyramided into a single line. Molecular survey was conducted to screen 25 Pakistan wheat germplasm for the presence of leaf rust resistance gene Lr10 using ...

Implications for new physics from B-bar 0->π0π0 and B-bar 0->K-bar 0K0

International Nuclear Information System (INIS)

Cheng Jianfeng; Gao Yuanning; Huang Chaoshang; Wu Xiaohong

2006-01-01

We have analyzed the B-bar 0 ->π 0 π 0 puzzle in three kinds of models beyond the standard model (SM). It is shown that the minimal flavor violation (MFV) models, the minimal supersymmetric standard model (MSSM), and the two Higgs doublet models (2HDM) I and II cannot give an explanation of the B-bar 0 ->π 0 π 0 puzzle within 1σ experimental bounds and the model III 2HDM can explain the puzzle without a conflict with other experimental measurements. If the constraint on C 8g from b->sg is not imposed, for all kinds of insertions considered there are regions of parameter space, where the scalar quark mass is larger (much larger) than the gluino mass in the case of LR or RL (LL or RR), in which the puzzle can be resolved within 1σ experimental bounds

residenciales de madres sin cónyuge en Ciudad Juárez

Directory of Open Access Journals (Sweden)

Claudia Zamorano Villarreal

2006-01-01

Full Text Available Se abordarán los itinerarios y las prácticas residenciales de madres sin cónyuge en Ciudad Juárez, ese punto de convergencia de inmigrantes nacionales y capitales internacionales y ahora, una de las más importantes ciudades maquiladoras del país. A partir de 51 historias de vida con trabajadoras de esta industria, se comparan los itinerarios residenciales de familias monoparentales con los de familias biparentales. Esta comparación permite ver las desventajas de las primeras para ingresar al mercado de la vivienda, que no se explican únicamente por factores de orden económico, sino también moral y práctico.

Reading and writing direction effects on the aesthetic appreciation of photographs.

Science.gov (United States)

Chahboun, Sobh; Flumini, Andrea; Pérez González, Carmen; McManus, I Chris; Santiago, Julio

2017-05-01

Does reading and writing direction (RWD) influence the aesthetic appreciation of photography? Pérez González showed that nineteenth-century Iranian and Spanish professional photographers manifest lateral biases linked to RWD in their compositions. The present study aimed to test whether a population sample showed similar biases. Photographs with left-to-right (L-R) and right-to-left (R-L) directionality were selected from Pérez González's collections and presented in both original and mirror-reversed forms to Spanish (L-R readers) and Moroccan (R-L readers) participants. In Experiment 1, participants rated each picture for its aesthetic pleasingness. The results showed neither effects of lateral organization nor interactions with RWD. In Experiment 2, each picture and its mirror version were presented together and participants chose the one they liked better. Spaniards preferred rightward versions and Moroccans preferred leftward versions. RWD therefore affects aesthetic impressions of photography in our participants when people pay attention to the lateral spatial dimension of pictures. The observed directional aesthetic preferences were not sensitive to the sex of the model in the photographs, failing to support expectations from the hypotheses of emotionality and agency. Preferences were attributable to the interaction between general scanning strategies and scanning habits linked to RWD.

The human dimension of AIDS in Cuba: Jorge Pérez MD MS, Director, Pedro Kourí Tropical Medicine Institute. Interviewed by Gail Reed.

Science.gov (United States)

Pérez, Jorge

2011-04-01

Except for the people living with the disease, no others have so immersed themselves in Cuba's world of HIV/AIDS as Dr Jorge Pérez. It is a world of Cuban returnees from Angola's war against apartheid South Africa, gay and bisexual men, housewives, transactional sex workers, rebellious teenagers, and infected surgeons and scientists-a cultural kaleidoscope reflecting all the faces of AIDS. To more than one international author, he is simply "Cuba's AIDS doctor." Speaking to his patients at the Pedro Kourí Tropical Medicine Institute in Havana, it is easy to see why, but also to appreciate the courage, compassion, and persistent search for new knowledge that characterize the Institute's staff as a whole. Dr Pérez's story-now told in two books based on his diaries-is not his alone. MEDICC Review held two interview sessions with Jorge Pérez just days apart at the beginning of April: one before and one after his designation as the new Director of the Tropical Medicine Institute, where he previously served as Deputy Director and Chief of Hospital Services. More than strictly medical matters, the conversation turned to the human dimension of HIV/AIDS, the depth to which it has touched many directly and affected Cuban society as a whole, and the challenges ahead for Cuba's flagship institution for research and treatment of infectious diseases.

Algunas novelas de Darío Fernández-Flórez: de Zarabanda (1944 a Alta Costura (1954. Temas escabrosos en tiempos de restricciones moralistas

Directory of Open Access Journals (Sweden)

Montejo Gurruchaga, Lucía

2008-06-01

Full Text Available Dario Fernández-Flórez begins in 1944 with Zarabanda a narrative style of intellectual eroticism and inmoral atmosphere which attracted no attention. Six years later he published Lola, espejo oscuro the recollections of a high prostitute. The novel was an scandal and an immediate success. Although the topic and its treatment were odd at the time because the strict moral values which mantained Franco´s regime were ignored, the novel was published with no cuts at all. Censorship was deaf to all the voices that warned of its dangers. This had an explanation: Darío Fernández-Flórez held an important post in the Propaganda National Service. After his dismissal censors were less lenient.Darío Fernández-Flórez inicia en 1944 con Zarabanda una narrativa de erotismo intelectualizado y ambiente amoral que no tuvo ningún eco. Seis años después publicará Lola, espejo oscuro, las memorias de una prostituta de alto copete. La novela suscitó un gran escándalo y su éxito fue inmediato. Aunque el tema y su tratamiento eran inusitados en aquellos momentos porque la obra daba al traste con los estrictos valores morales que sustentaban el régimen franquista, la novela fue publicada sin recortes; la censura hizo oídos sordos a todas las voces que alertaban de su peligro. Este hecho tiene una explicación: Darío Fernández-Flórez ocupaba un cargo importante en el Servicio Nacional de Propaganda. Tras su cese, los censores serán menos benevolentes.

alpha-particle radioactivity from LR 115 by two methods of analysis

CERN Document Server

Azkour, K; Adloff, J C; Pape, A

1999-01-01

LR115 track detectors were exposed to samples of Moroccan phosphate and phosphogypsum to measure their alpha-particle radioactivity. Then two formalisms were used for the dosimetry: simulation by a Monte Carlo method and determination of concentrations from a numerically integrated track registration equation. The results were compared with those deduced gamma-ray spectrometry.

Lettuce (Lactuca sativa L.) leaf-proteome profiles after exposure to cylindrospermopsin and a microcystin-LR/cylindrospermopsin mixture: a concentration-dependent response.

Science.gov (United States)

Freitas, Marisa; Campos, Alexandre; Azevedo, Joana; Barreiro, Aldo; Planchon, Sébastien; Renaut, Jenny; Vasconcelos, Vitor

2015-02-01

The intensification of agricultural productivity is an important challenge worldwide. However, environmental stressors can provide challenges to this intensification. The progressive occurrence of the cyanotoxins cylindrospermopsin (CYN) and microcystin-LR (MC-LR) as a potential consequence of eutrophication and climate change is of increasing concern in the agricultural sector because it has been reported that these cyanotoxins exert harmful effects in crop plants. A proteomic-based approach has been shown to be a suitable tool for the detection and identification of the primary responses of organisms exposed to cyanotoxins. The aim of this study was to compare the leaf-proteome profiles of lettuce plants exposed to environmentally relevant concentrations of CYN and a MC-LR/CYN mixture. Lettuce plants were exposed to 1, 10, and 100 μg/l CYN and a MC-LR/CYN mixture for five days. The proteins of lettuce leaves were separated by two-dimensional electrophoresis (2-DE), and those that were differentially abundant were then identified by matrix-assisted laser desorption/ionization time of flight-mass spectrometry (MALDI-TOF/TOF MS). The biological functions of the proteins that were most represented in both experiments were photosynthesis and carbon metabolism and stress/defense response. Proteins involved in protein synthesis and signal transduction were also highly observed in the MC-LR/CYN experiment. Although distinct protein abundance patterns were observed in both experiments, the effects appear to be concentration-dependent, and the effects of the mixture were clearly stronger than those of CYN alone. The obtained results highlight the putative tolerance of lettuce to CYN at concentrations up to 100 μg/l. Furthermore, the combination of CYN with MC-LR at low concentrations (1 μg/l) stimulated a significant increase in the fresh weight (fr. wt) of lettuce leaves and at the proteomic level resulted in the increase in abundance of a high number of proteins. In

TNF-α-induced NF-κB activation promotes myofibroblast differentiation of LR-MSCs and exacerbates bleomycin-induced pulmonary fibrosis.

Science.gov (United States)

Hou, Jiwei; Ma, Tan; Cao, Honghui; Chen, Yabing; Wang, Cong; Chen, Xiang; Xiang, Zou; Han, Xiaodong

2018-03-01

Idiopathic pulmonary fibrosis (IPF) is a chronic, progressive, and irreversible lung disease of unknown cause. It has been reported that both lung resident mesenchymal stem cells (LR-MSCs) and tumor necrosis factor-α (TNF-α) play important roles in the development of pulmonary fibrosis. However, the underlying connections between LR-MSCs and TNF-α in the pathogenesis of pulmonary fibrosis are still elusive. In this study, we found that the pro-inflammatory cytokine TNF-α and the transcription factor nuclear factor kappa B (NF-κB) p65 subunit were both upregulated in bleomycin-induced fibrotic lung tissue. In addition, we discovered that TNF-α promotes myofibroblast differentiation of LR-MSCs through activating NF-κB signaling. Interestingly, we also found that TNF-α promotes the expression of β-catenin. Moreover, we demonstrated that suppression of the NF-κB signaling could attenuate myofibroblast differentiation of LR-MSCs and bleomycin-induced pulmonary fibrosis which were accompanied with decreased expression of β-catenin. Our data implicates that inhibition of the NF-κB signaling pathway may provide a therapeutic strategy for pulmonary fibrosis, a disease that warrants more effective treatment approaches. © 2017 Wiley Periodicals, Inc.

Pulmonary effects of active smoking and secondhand smoke exposure among adolescent students in Juárez, Mexico

Directory of Open Access Journals (Sweden)

Bird Y

2016-06-01

Full Text Available Yelena Bird,1 Hugo Staines-Orozco2 1School of Public Health, University of Saskatchewan, Saskatoon, SK, Canada; 2Institute of Biomedical Sciences, Universidad Autónoma de Ciudad Juárez, Anillo Envolvente del PRONAF y Calle Estocolmo, Ciudad Juárez, Chihuahua, Mexico Background: Youth smoking trends among Latin American countries, including Mexico, are on the rise. Notably, although the high prevalence of smoking in teens has been well documented in the literature, few studies have evaluated the impact of smoking and secondhand smoke (SHS exposure on their respiratory system.  Objective: To investigate the effects of smoking and SHS exposure on the respiratory health and lung function among eighth-grade students in Juárez, Mexico. Methods: A cross-sectional study was undertaken on a sample of convenience. The study outcomes centered on evaluating 300 students’ lung function by spirometry (forced expiratory volume in 1 second [FEV1], forced expiratory volume in 1 second/forced vital capacity ratio [FEV1/FVC], and forced mid-expiratory flow rate [FEF25%–75%] and their respiratory health (smoking behavior and SHS exposure by their self-reported responses to a standardized respiratory questionnaire. The study outcomes were compared among three distinct groups: 1 nonsmokers/nonexposed to SHS; 2 nonsmokers/exposed to SHS; and 3 smokers. Results: The majority of the study participants were 14 years old (85%, females (54%, who attended eighth grade in a public school setting (56%. Approximately, half reported being of low socioeconomic status (49% and nonsmokers/exposed to SHS (49%. The lung function parameters of smokers were found to be lower (FEV1 =62.88±10.25; FEV1/FVC =83.50±14.15; and FEF25%–75% =66.35±12.55 than those recorded for the nonsmokers/exposed to SHS (FEV1 =69.41±11.35; FEV1/FVC =88.75±15.75; and FEF25%–75% =78.90±14.65 and significantly reduced when compared to the nonsmokers/nonexposed to SHS (FEV1 =79.14±13

Study text and sets of questions for the training and examination of selected personnel of nuclear research facilities. Issue 2. Experimental teaching methods

International Nuclear Information System (INIS)

Fleischhans, J.; Hejzlar, R.; Hermansky, B.

2004-01-01

The VR-1 teaching reactor is described, 14 experimental exercises are given (e.g. Starting up and running the VR-1 reactor; Neutron detection and detectors; Measuring delayed neutrons ; Reactivity measurement; Control rod calibration; ...) and practical training at the existing Czech research reactors (LVR-15; LR-0; VR-1) is briefly highlighted. (P.A.)

Double Exposure and the Climate Gap: Changing demographics and extreme heat in Ciudad Juárez, Mexico

Science.gov (United States)

Collins, Timothy W.; McDonald, Yolanda J.; Aldouri, Raed; Aboargob, Faraj; Eldeb, Abdelatif; Aguilar, María de Lourdes Romo; Velázquez-Angulo, Juárez Gilberto

2013-01-01

Scholars have recognized a climate gap, wherein poor communities face disproportionate impacts of climate change. Others have noted that climate change and economic globalization may mutually affect a region or social group, leading to double exposure. This paper investigates how current and changing patterns of neighborhood demographics are associated with extreme heat in the border city of Juárez, Mexico. Many Juárez neighborhoods are at-risk to triple exposures, in which residents suffer due to the conjoined effects of the global recession, drug war violence, and extreme heat. Due to impacts of the recession on maquiladora employment and the explosion of drug violence (since 2008), over 75% of neighborhoods experienced decreasing population density between 2000 and 2010 and the average neighborhood saw a 40% increase in the proportion of older adults. Neighborhoods with greater drops in population density and increases in the proportion of older residents over the decade are at significantly higher risk to extreme heat, as are neighborhoods with lower population density and lower levels of education. In this context, triple exposures are associated with a climate gap that most endangers lower socioeconomic status and increasingly older aged populations remaining in neighborhoods from which high proportions of residents have departed. PMID:25642135

Mentira y Verdad en tres Novelas de Sergio Ramírez: Algunos Procedimientos de Verosimilitud

OpenAIRE

Rodríguez Sancho, Javier

2013-01-01

Con base en la narrativa del nicaragüense Sergio Ramírez, se efectúa un análisis sobre algunos procedimientos de verosimilitud utilizados por el escritor en tres de sus novelas: Tiempo de fulgor (1970); ¿Te dio miedo la sangre? (1977) y Un baile de máscaras (1995). La evaluación de los textos busca comprender los niveles en que el escritor hace uso de ciertos procedimientos de verosimilitud para contarnos algunas mentiras verdaderas como él mismo lo ha llamado, en su ensayo: Mentiras verdader...

Levels of surface contamination with radioactive materials at workplaces of nuclear research centre at Rez

International Nuclear Information System (INIS)

Hoelgye, Z.; Nemcova, I.; Kasikova, M.; Popper, J.; Chysky, J.

1983-01-01

A hygiene supervision unit at workplaces of the nuclear Research Institute in Rez monitored on a long-term basis surface contamination with radioactive substances. Surface contamination was found at workplaces with open sources. Of the 4343 monitored places action levels were only exceeded in 13 cases. The obtained data were used for typifying workplaces with the highest level of surface contamination, to determine in certain instances the mechanism of the escape of radioactive substances from insulating facilities and to determine the rate of the spread of the radioactive substance into adjacent non-active workplaces. (author)

MASTER-2.0: Multi-purpose analyzer for static and transient effects of reactors

Energy Technology Data Exchange (ETDEWEB)

Cho, Byung Oh; Song, Jae Seung; Joo, Han Gyu [Korea Atomic Energy Research Institute, Taejon (Korea)

1999-01-01

MASTER-2.0 (Multi-purpose Analyzer for Static and Transient Effects of Reactors) is a nuclear design code based on the two group diffusion theory to calculate the steady-state and transient pressurized water reactor core in a 3-dimensional Cartesian or hexagonal geometry. Its neutronics model solves the space-time dependent neutron diffusion equations with NIM(Nodal Integration Method), NEM (Nodal Expansion Method), AFEN (Analytic Function Expansion Nodal Method)/NEM Hybrid Method, NNEM (Non-linear Nodal Expansion Method) or NANM (Non-linear Analytic Nodal Method) for a Cartesian geometry and with AFEN/NEM Hybrid Method or NLFM (Non-linear Local Fine-Mesh Method) for a hexagonal one. Coarse mesh rebalancing, Krylov Subspace method and asymptotic extrapolation method are implemented to accelerate the convergence of iteration process. Master-2.0 performs microscopic depletion calculations using microscopic cross sections provided by CASMO-3 or HELIOS and also has the reconstruction capability of pin information by use of MSS-IAS (Method of Successive Smoothing with Improved Analytic Solution). For the thermal-hydraulic calculation, fuel temperature table or COBRA3-C/P model can be used selectively. In addition, MASTER-2.0 is designed to cover various PWRs including SMART as well as WH-and CE-type reactors, providing all data required in their design procedures. (author). 39 refs., 12 figs., 4 tabs.

Effects of microcystin-LR and cylindrospermopsin on plant-soil systems: A review of their relevance for agricultural plant quality and public health

Energy Technology Data Exchange (ETDEWEB)

Machado, J.; Campos, A. [Interdisciplinary Centre of Marine and Environmental Research (CIIMAR/CIMAR), University of Porto, Rua dos Bragas 289, P 4050-123 Porto (Portugal); Vasconcelos, V. [Interdisciplinary Centre of Marine and Environmental Research (CIIMAR/CIMAR), University of Porto, Rua dos Bragas 289, P 4050-123 Porto (Portugal); Department of Biology, Faculty of Sciences, University of Porto, Rua do Campo Alegre, P 4069-007 Porto (Portugal); Freitas, M., E-mail: maf@ess.ipp.pt [Interdisciplinary Centre of Marine and Environmental Research (CIIMAR/CIMAR), University of Porto, Rua dos Bragas 289, P 4050-123 Porto (Portugal); Polytechnic Institute of Porto, Department of Environmental Health, School of Allied Health Technologies, CISA/Research Center in Environment and Health, Rua de Valente Perfeito, 322, P 440-330 Gaia (Portugal)

2017-02-15

Toxic cyanobacterial blooms are recognized as an emerging environmental threat worldwide. Although microcystin-LR is the most frequently documented cyanotoxin, studies on cylindrospermopsin have been increasing due to the invasive nature of cylindrospermopsin-producing cyanobacteria. The number of studies regarding the effects of cyanotoxins on agricultural plants has increased in recent years, and it has been suggested that the presence of microcystin-LR and cylindrospermopsin in irrigation water may cause toxic effects in edible plants. The uptake of these cyanotoxins by agricultural plants has been shown to induce morphological and physiological changes that lead to a potential loss of productivity. There is also evidence that edible terrestrial plants can bioaccumulate cyanotoxins in their tissues in a concentration dependent-manner. Moreover, the number of consecutive cycles of watering and planting in addition to the potential persistence of microcystin-LR and cylindrospermopsin in the environment are likely to result in groundwater contamination. The use of cyanotoxin-contaminated water for agricultural purposes may therefore represent a threat to both food security and food safety. However, the deleterious effects of cyanotoxins on agricultural plants and public health seem to be dependent on the concentrations studied, which in most cases are non-environmentally relevant. Interestingly, at ecologically relevant concentrations, the productivity and nutritional quality of some agricultural plants seem not to be impaired and may even be enhanced. However, studies assessing if the potential tolerance of agricultural plants to these concentrations can result in cyanotoxin and allergen accumulation in the edible tissues are lacking. This review combines the most current information available regarding this topic with a realistic assessment of the impact of cyanobacterial toxins on agricultural plants, groundwater quality and public health. - Highlights: �

Effects of microcystin-LR and cylindrospermopsin on plant-soil systems: A review of their relevance for agricultural plant quality and public health

International Nuclear Information System (INIS)

Machado, J.; Campos, A.; Vasconcelos, V.; Freitas, M.

2017-01-01

Toxic cyanobacterial blooms are recognized as an emerging environmental threat worldwide. Although microcystin-LR is the most frequently documented cyanotoxin, studies on cylindrospermopsin have been increasing due to the invasive nature of cylindrospermopsin-producing cyanobacteria. The number of studies regarding the effects of cyanotoxins on agricultural plants has increased in recent years, and it has been suggested that the presence of microcystin-LR and cylindrospermopsin in irrigation water may cause toxic effects in edible plants. The uptake of these cyanotoxins by agricultural plants has been shown to induce morphological and physiological changes that lead to a potential loss of productivity. There is also evidence that edible terrestrial plants can bioaccumulate cyanotoxins in their tissues in a concentration dependent-manner. Moreover, the number of consecutive cycles of watering and planting in addition to the potential persistence of microcystin-LR and cylindrospermopsin in the environment are likely to result in groundwater contamination. The use of cyanotoxin-contaminated water for agricultural purposes may therefore represent a threat to both food security and food safety. However, the deleterious effects of cyanotoxins on agricultural plants and public health seem to be dependent on the concentrations studied, which in most cases are non-environmentally relevant. Interestingly, at ecologically relevant concentrations, the productivity and nutritional quality of some agricultural plants seem not to be impaired and may even be enhanced. However, studies assessing if the potential tolerance of agricultural plants to these concentrations can result in cyanotoxin and allergen accumulation in the edible tissues are lacking. This review combines the most current information available regarding this topic with a realistic assessment of the impact of cyanobacterial toxins on agricultural plants, groundwater quality and public health. - Highlights: �

Electromagnetic effects involving a tokamak reactor first wall and blanket

International Nuclear Information System (INIS)

Turner, L.R.; Evans, K. Jr.; Gelbard, E.; Prater, R.

1980-01-01

Four electromagnetic effects experienced by the first wall and blanket of a tokamak reactor are considered. First, the first wall provides reduction of the growth rate of vertical axisymmetric instability and stabilization of low mode number interval kink modes. Second, if a rapid plasma disruption occurs, a current will be induced on the first wall, tending to maintain the field formerly produced by the plasma. Third, correction of plasma movement can begin on a time scale much faster than the L/R time of the first wall and blanket. Fourth, field changes, especially those from plasma disruption or from rapid discharge of a toroidal field coil, can cause substantial eddy current forces on elements of the first wall and blanket. These effects are considered specifically for the first wall and blanket of the STARFIRE commercial reactor design study

Misery, Hope and Humanity in Benito Pérez Galdós's Misericordia (1897

Directory of Open Access Journals (Sweden)

María Isabel Rovira Martínez de Contrasta

2014-10-01

Full Text Available Amidst the great turmoil, appalling conditions and ineffable hardships of impoverished nineteenth-century Spain, the realist writer Benito Pérez Galdós brilliantly weaves a tale of humanity and friendship in Misericordia, a story about the compassion, unfaltering loyalty and devotion of the main character, Benina, towards her neighbors. The plot revolves strategically around the lowest and most economically deprived social group, the beggars, thus separating Galdós's Misericordia from the work of his contemporaries. In this fictional work, the lower class is given great social visibility via Benina, who constitutes the embodiment of all the values, ideology and principles the writer seeks to praise and emphasize in the story.

Identification of rust resistance genes Lr10 and Sr9a in Pakistani ...

African Journals Online (AJOL)

Identification of rust resistance genes Lr10 and Sr9a in Pakistani wheat germplasm using PCR based molecular markers. M Babar, AF Mashhadi, A Mehvish, AN Zahra, R Waheed, A Hasnain, S ur-Rahman, N Hussain, M Ali, I Khaliq, A Aziz ...

Safe dismantling of the SVAFO research reactors R2 and R2-0 in Sweden

International Nuclear Information System (INIS)

ARNOLD, Hans-Uwe; BROY, Yvonne; Dirk Schneider

2017-01-01

The R2 and R2-0 reactors were part of the Swedish government's research program on nuclear power from the early 1960's. Both reactors were shut down in 2005 following a decision by former operator Studsvik Nuclear AB. The decommissioning of the R2 and R2-0 reactors is divided into three phases. The first phase - awarded to AREVA - involved dismantling of the reactors and associated systems in the reactor pool, treatment of the disassembled components as well as draining, cleaning and emptying the pool. In the second phase, the pool structure itself will be dismantled, while removal of remaining reactor systems, treatment and disposal of materials and clean-up will be carried out in the third stage. The entire work is planned to be completed before the end of this decade. The paper describes the several steps of phase 1 - starting with the team building, followed by the dismantling operations and covers challenges encountered and lessons learned as well. The reactors consist of 5.400 kg aluminum, 6.000 kg stainless steel restraint structures as well as, connection elements of the mostly flanged components (1.000 kg). The most demanding - from a radiological point of view - was the R2-0 reactor that was limited to ∼ 1 m"3 construction volumes but with an extremely heterogeneous activation profile. Based on the calculated radiological entrance data and later sampling, nuclide vectors for both reactors depending on the real placement of the single component and on the material (aluminum and stainless steel) were created. Finally, for the highest activated component from R2 reactor, 85 Sv/h were measured. The dismantling principles - adopted on a safety point of view - were the following: The always protected base area of the ponds served as a flexible buffer area for waste components and packaging. Specific protections were also installed on the walls to protect them from mechanical stress which may occur during dismantling work. A specific work platform was

Tissue distributions and seasonal dynamics of the hepatotoxic microcystins-LR and -RR in a freshwater snail (Bellamya aeruginosa) from a large shallow, eutrophic lake of the subtropical China

International Nuclear Information System (INIS)

Chen Jun; Xie Ping; Guo Longgen; Zheng Li; Ni Leyi

2005-01-01

Tissue distributions and seasonal dynamics of the hepatotoxic microcystins-LR and -RR in a freshwater snail (Bellamya aeruginosa) were studied monthly in a large shallow, eutrophic lake of the subtropical China during June-November, 2003. Microcystins (MCs) were quantitatively determined by High-Performance Liquid Chromatography (HPLC) with a qualitative analysis by a Finnigan LC-MS system. On the average of the study period, hepatopancreas was the highest in MC contents (mean 4.14 and range 1.06-7.42 μg g -1 DW), followed by digestive tracts (mean 1.69 and range 0.8-4.54 μg g -1 DW) and gonad (mean 0.715 and range 0-2.62 μg g -1 DW), whereas foot was the least (mean 0.01 and range 0-0.06 μg g -1 DW). There was a positive correlation in MC contents between digestive tracts and hepatopancreas. A constantly higher MC content in hepatopancreas than in digestive tracts indicates a substantial bioaccumulation of MCs in the hepatopancreas of the snail. The average ratio of MC-LR/MC-RR showed a steady increase from digestive tracts (0.44) to hepatopancreas (0.63) and to gonad (0.96), suggesting that MC-LR was more resistant to degradation in the snail. Since most MCs were present in the hepatopancreas, digestive tracts and gonad with only a very small amount in the edible foot, the risk to human health may not be significant if these toxic parts are removed prior to snail consumption. However, the possible transference of toxins along food chains should not be a negligible concern. - Snails bioaccumulate microcystins in their hepatopancreas, gut and gonad, posing a risk to human consumers

El Multiculturalismo Canadiense ante el Arte y los Testimonios de Constanza Camelo Suárez

Directory of Open Access Journals (Sweden)

Alexandre Beaudoin Duquette

2017-04-01

Full Text Available Resumen Constanza Camelo Suárez es una artista visual de origen colombiano que vive en la provincia de Quebec, en Canadá.  En el año 2008, realizó un performance en una importante estación del metro de la ciudad de Montreal, que llevaba por título Dilatar o contraer el universo.  En el marco de esta intervención, un grupo de inmigrantes guiados por perros lazarillo caminaban con los ojos vendados por los pasaportes de sus países de origen y llevaban puesto en su cintura unos aparatos de los cuales emanaban de manera aleatoria las notas de los himnos nacionales de sus países respectivos, así como las del himno canadiense.  Su acción nos brinda varios elementos que nos permiten cuestionar, romper o relativizar los estereotipos del discurso propagandístico de las instituciones migratorias canadienses.  En el presente trabajo, se trata precisamente de entablar una relación disonante entre el performance y fragmentos de testimonios de Constanza Camelo Suárez y una “historia de éxito” que fue publicada en el sitio Internet del Ministerio de Ciudadanía e Inmigración canadiense en el año 2011 y que lleva por título María Aragón: una joven canadiense de 10 años que causa sensación en YouTube.  Lo anterior se lleva a cabo analizando las siguientes fuentes de disonancia, entendida como la relación entre elementos de información incompatibles: multiculturalismo/transculturalidad, consenso/accidentes situacionales, ocupación del espacio público/espacio masivo ocupado, demostración de fuerza/demostración de vulnerabilidad. Palabras-claves: Arte latinoamericano, diáspora latinoamericana, diáspora colombiana, migración a Canadá, multiculturalismo canadiense, propaganda migratoria.   Canadian Multiculturalism face the Art and Testimonies of Constanza Camelo Suárez Abstract  Constanza Camelo Suárez is a visual artist of Colombian origin living in the province of Quebec, Canada. In 2008, she performed at an important

Modified CC-LR algorithm with three diverse feature sets for motor imagery tasks classification in EEG based brain-computer interface.

Science.gov (United States)

Siuly; Li, Yan; Paul Wen, Peng

2014-03-01

Motor imagery (MI) tasks classification provides an important basis for designing brain-computer interface (BCI) systems. If the MI tasks are reliably distinguished through identifying typical patterns in electroencephalography (EEG) data, a motor disabled people could communicate with a device by composing sequences of these mental states. In our earlier study, we developed a cross-correlation based logistic regression (CC-LR) algorithm for the classification of MI tasks for BCI applications, but its performance was not satisfactory. This study develops a modified version of the CC-LR algorithm exploring a suitable feature set that can improve the performance. The modified CC-LR algorithm uses the C3 electrode channel (in the international 10-20 system) as a reference channel for the cross-correlation (CC) technique and applies three diverse feature sets separately, as the input to the logistic regression (LR) classifier. The present algorithm investigates which feature set is the best to characterize the distribution of MI tasks based EEG data. This study also provides an insight into how to select a reference channel for the CC technique with EEG signals considering the anatomical structure of the human brain. The proposed algorithm is compared with eight of the most recently reported well-known methods including the BCI III Winner algorithm. The findings of this study indicate that the modified CC-LR algorithm has potential to improve the identification performance of MI tasks in BCI systems. The results demonstrate that the proposed technique provides a classification improvement over the existing methods tested. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

Master-3.0: multi-purpose analyzer for static and transient effects of reactors

International Nuclear Information System (INIS)

Cho, Byung Oh; Joo, Han Gyu; Cho, Jin Young; Song, Jae Seung; Zee, Sung Quun

2002-03-01

MASTER-3.0 (Multi-purpose Analyzer for Static and Transient Effects of Reactors) is a nuclear design code based on the multi-group diffusion theory to calculate the steady-state and transient pressurized water reactor core in a 3-dimensional Cartesian or hexagonal geometry. Its neutronics model solves the space-time dependent neutron diffusion equations with NIM (Nodal Integration Method), NEM (Nodal Expansion Method), AFEN (Analytic Function Expansion Nodal Method)/NEM Hybrid Method, NNEM (Non-linear Nodal Expansion Method) or NANM (Non-linear Analytic Nodal Method) for a Cartesian geometry and with NTPEN (Non-linear Triangle-based Polynomial Expansion Nodal Method), AFEN (Analytic Function Expansion Nodal)/NEM Hybrid Method or NLFM (Non-linear Local Fine-Mesh Method) for a hexagonal one. Coarse mesh rebalancing, Krylov Subspace method, energy group restriction/prolongation method and asymptotic extrapolation method are implemented to accelerate the convergence of iteration process. MASTER-3.0 performs microscopic depletion calculations using microscopic cross sections provided by CASMO-3 or HELIOS and also has the reconstruction capability of pin information by use of MSS-IAS (Method of Successive Smoothing with Improved Analytic Solution). For the thermal-hydraulic calculation, fuel temperature table or COBRA3-C/P or MATRA model can be used selectively. In addition, MASTER-3.0 is designed to cover various PWRs including SMART as well as WH- and CE-type reactors, providing all data required in their design procedures

Exploring the efficacy of an environmental health intervention in Ciudad Juárez, Mexico.

Science.gov (United States)

Hernández, Alma A; Grineski, Sara E

2010-01-01

This study explores the efficacy of an environmental health intervention in several poor colonias in Ciudad Juárez (Mexico). Parents of children with respiratory problems were given environment-friendly products intended to replace hazardous products used in the home, as well as information about environmental health. Parents were surveyed before and after to measure the effectiveness of the intervention and to gauge perceptions. There was a significant reduction in hazardous chemical use (eg, cleaning products and pesticides) and breathing problems. While the intervention focused on changing in-home behaviors, open-ended responses revealed that parents were most concerned about outdoor environmental conditions over which they had less control.

The robustness of k0-NAA in large multi-purpose research reactors

International Nuclear Information System (INIS)

Attila Stopic; Bennett, J.W.

2014-01-01

The challenges and opportunities associated with performing k 0 -NAA in high-powered, multi-purpose research reactors are examined and recommendations are made concerning the conditions that need to be met in such facilities in order to allow the potential for this method of elemental analysis to be fully realised. (author)

El primer volumen de Notas de un reporter de Alejandro Pérez Lugín

Directory of Open Access Journals (Sweden)

Julia María Labrador Ben

2006-12-01

Full Text Available Alejandro María de las Mercedes Pedro Pérez García Lugín nació el 22 de febrero de 1870 en Madrid. Era hijo de Antonio Pérez Serrano, natural de Cabra (Córdoba, y de María  Josefa  del  Carmen  García  Lugín  y  Castro,  natural  de  Santa  María  del  Camino (Santiago de Compostela2. En 1883 se trasladó con su familia a Santiago de Compostela, donde sus padres instalarían una céntrica y lujosa camisería llamada «El Buen Gusto», nombre que se convertiría en el apodo por el que Alejandro era conocido entre sus compañeros de estudios y amigos3. Ingresó en la Universidad de Santiago de Compostela para estudiar la carrera de Derecho y alcanzó la Licenciatura en 1891. Cuando tenía tan solo dieciocho años falleció su madre4. Esa etapa fue decisiva para su posterior actividad tanto  periodística  como  literaria. Todas  sus  vivencias  estudiantiles  constituirán  mucho más tarde la base de su primera novela, La Casa de la Troya (1915, a la que le corres- ponde el mérito de ser la novela española con mayor número de ediciones después de El Quijote y que aún hoy se sigue reeditando.

Microcystis aeruginos strain [D-Leu1] Mcyst-LR producer, from Buenos Aires province, Argentina

Directory of Open Access Journals (Sweden)

Lorena Rosso

2014-04-01

Full Text Available Objective: To show the toxicological and phylogenetic characterization of a native Microcystis aeruginosa (M. aeruginosa strain (named CAAT 2005-3 isolated from a water body of Buenos Aires province, Argentine. Methods: A M. aeruginosa strain was isolated from the drainage canal of the sewage treatment in the town of Pila, Buenos Aires province, Argentina and acclimated to laboratory conditions. The amplification of cpcBA-IGS Phcocyanin (PC, intergenic spacer and flanking regions was carried out in order to build a phylogenetic tree. An exactive/orbitrap mass spectrometer equipped with an electrospray ionization source (Thermo Fisher Scientific, Bremen, Germany was used for the LC/ESI-HRMS microcystins analysis. The number of cell/mL and [D-Leu1] Mcyst-LR production obtained as a function of time was modelled using the Gompertz equation. Results: The phylogenetic analysis showed that the sequence clustered with others M. aeruginosa sequences obtained from NCBI. The first Argentinian strain of M. aeruginosa (CAAT 2005-3 growing under culture conditions maintains the typical colonial architecture of M. aeruginosa with profuse mucilage. M. aeruginosa CAAT 2005-3 expresses a toxin variant, that was identified by LC-HRMS/Orbitrapas as [D-Leu1] microcystin-LR ([M+H]+=1 037.8 m/z. Conclusions: [D-Leu1] microcystin-LR has been also detected in M. aeruginosa samples from Canada, Brazil and Argentina. This work provides the basis for technological development and production of analytical standards of toxins present in our region.

Activismo transnacional y calidad de la democracia en México: Reflexiones en torno al caso de Ciudad Juárez

Directory of Open Access Journals (Sweden)

Alberto Martín

2008-04-01

Full Text Available Abstract: Transnational activism and quality of democracy  in Mexico: reflections centring on the case of Ciudad JuárezThis article analyses the impact of transnational  activism in the call to solve the deaths of hundreds of women in Cuidad Juárez. The efforts of  organizations of relatives of disappeared women  to secure the solidarity of national and international organizations and networks have been crucial  in influencing the federal Mexican government to  investigate these crimes. In addition, by placing  the problem inside wider frames of interpretation  – those of gender violence and human rights–, the  organizations of Juarez have helped to open the  debate concerning the question of violence in  general against women in Mexico. Nevertheless,  the results of the movement at the local level are  still far from satisfactory due to questions related  both to internal problems and weaknesses of local  organizations as well as to structural problems of  democracy in Mexico, which include the weakness of rule of law and the ineffectiveness of the  political system in implementing effective accountability.Resumen:El artículo analiza el impacto de la internacionalización de la movilización en pro del esclarecimiento de los crímenes cometidos contra mujeres  en Ciudad Juárez, México. La capacidad de las  organizaciones de familiares de desaparecidas de  concitar la solidaridad de organizaciones y redes  nacionales e internacionales, ha sido determinante  para desencadenar la intervención del gobierno  federal mexicano en la investigación de los crí- menes. Asimismo, a través de la inserción del  problema en marcos de interpretación más amplios – los de la violencia de género y los derechos humanos -, las organizaciones de Juárez han  contribuido a abrir el debate en torno a la violencia contra la mujer en México. Sin embargo, a  nivel local los resultados del movimiento se encuentran aún lejos

Bond scission cross sections for alpha-particles in cellulose nitrate (LR115)

CERN Document Server

Barillon, R; Chambaudet, A; Katz, R; Stoquert, J P; Pape, A

1999-01-01

Chemical damage created by alpha-particles in cellulose nitrate (LR115) have been studied by infrared spectroscopy. This technique enables identifying the sensitive bonds and giving an order of magnitude of their scission cross sections for given alpha-particle energies. The high cross sections observed suggest a new description of the track etch velocity in this material.

Bioleaching of Primary Nickel Ore Using Acidithiobacillus ferrooxidans LR Cells Immobilized in Glass Beads

Directory of Open Access Journals (Sweden)

Ellen Cristine Giese

2015-06-01

Full Text Available Sulphide minerals are one of the most important sources of value metals. For several years, a large number of hydrometallurgical and biotechnological processes have been developed to leach low-grade sulphide ores and the conditions are well established. However, the management of microorganisms in the bioleaching process is not easy to handle. In this paper, the use of immobilized cells of Acidithiobacillus ferrooxidans LR in glass beads in bioleaching of primary nickel ore was evaluated. The column experiments inoculated with immobilized cells of A. ferrooxidans LR showed the same efficiency than the conventional method using free cells and is promising for application on a larger scale as it ensuring integrity and activity of biomining microorganisms and reduce process costs. DOI: http://dx.doi.org/10.17807/orbital.v7i2.698 

Evolution of the LR56 radioactive liquid waste transportation system for use at Hanford, Oak Ridge, and Savannah River Sites

International Nuclear Information System (INIS)

Clement, G.; Delvecchio, D.J.; Sazawal, V.

1997-01-01

The LR56 system is a radioactive liquid transportation cask licensed for use in France for on-site road transfer of Type B bulk quantities of radioactive liquids. Three LR56 systems (with adaptations for use at the Department of Energy (DOE) sites in the US) have been recently purchased for use at the Hanford site, the Oak Ridge National laboratory site and the Savannah River Site. The paper discussed the main features of the LR56 system and presents the evolution of the design. Particular attention is given to the last version developed for the Savannah River Site to be used for the transfer of highly concentrated alpha bearing liquids. For this application a special enhancement of the secondary vessel has been implemented which provides the system with a double leak tight confinement

Jumping spark evaluation of α-radiograms taken on strippable LR-115 film

International Nuclear Information System (INIS)

Somogyi, G.; Hunyadi, I.; Varga, Zs.

1978-01-01

Jumping spark counting was used for the automatic measurement of α-ray tracks on Kodak Pathe LR-115 type special cellulose nitrate films. The effect of temperature and interruptions on the etching rate was observed during the etching of the α track detectors. The recommended parameters for the etching are the following: 10% NaOH solution, 60 +- 0.1 deg C, 1.5 h etching time, 20 rotations/min. The final thickness is 6-7 μm. The counting efficiency of the jumping spark evaluation in the function of the track density and the α energy was carefully studied. The angular distribution of the α particles from the Al(p, α) 24 Mg reaction was determined. This method can be effectively used for the measurement of environmental α activity as for 222 Rn release from 226 Ra. (V.N.)

Measurement of the Left-Right Asymmetry in Z0 Events at SLAC

Energy Technology Data Exchange (ETDEWEB)

Szumilo, A

2004-01-05

Recent results from the 1992 and 1993 left-right asymmetry cross section measurements at the Stanford Linear Accelerator Center are presented. Measurements made with SLAC running with a center-of-mass energy at the Z{sup 0}-pole (91.2 GeV) by the SLD detector and an average electron beam polarization of 22.4 {+-} 0.7% for 1992 and 62.6 {+-} 1.2% for 1993. The asymmetry measured was A{sub LR} = 0.100 {+-} 0.044 and A{sub LR} = 0.1656 {+-} 0.0073 for the 1992 and 1993 runs, respectively. This in turn allows them to calculate the weak mixing angle value of sin{sup 2} {theta}{sub W} = 0.2378 {+-} 0.0056 and sin{sup 2} {theta}{sub W} = 0.2288 {+-} 0.0009 for the two data sets.

The city that makes the Maquila: The case of Ciudad Juárez (México)

OpenAIRE

Rodríguez Álvarez, Olga Lucía

2007-01-01

La configuración del espacio urbano de las ciudades depende en alto grado de los diversos momentos de las actividades productivas y es a partir de ellos que se dan las transformaciones en el espacio urbano. En el caso de Ciudad Juárez, México la inserción de la industria maquiladora de exportación como la "mano invisible" que llevara el desarrollo y progreso a través de la transición de una economía primaria a una secundaria, le imprimió una nueva dinámica y configuración espacial. A casi tre...

La risa en Francisco Suárez. El paso de la Edad Media al Barroco

Directory of Open Access Journals (Sweden)

Manuel Lázaro Pulido

2012-07-01

Full Text Available El estudio muestra la relación entre la tradición medieval presente en la segunda escolástica y las consecuencias en el Barroco del humanismo renancentista, a partir de la referencia que hace Suárez a la risa en el Comentario al De anima. Aparece un desarrollo de la temática clásica y medieval sobre la risa, donde se tiene en cuenta la esfera intelectual del Humanismo científico y se señalan algunas temáticas que se tendrán presente en el Barroco moderno.

Graphite moderator annealing of the experimental reactor for irradiation (0.5 MW)

International Nuclear Information System (INIS)

Oliveira Avila, Carlos Alberto de; Pires, Luis Fernando Goncalves

1995-01-01

This work describes an operational procedure for the annealing of the graphite moderator in the 0,5 MW Experimental Reactor for Irradiation. A theoretical methodology has been developed for calculating the temperature field during the annealing process. The equations for mass, momentum, and energy conservation for the coolant as well as for the energy conservation in the moderator are solved numerically. The energy stored in the graphite and released in the annealing is accounted for by the use of a modified source term in the energy conservation equation for the moderator. A good agreement has been found for comparisons of the calculations with annealing data from the BEPO reactor. The major parameters affecting annealing have also been determined. (author). 8 refs, 11 figs

IMAGING OF BRAIN FUNCTION BASED ON THE ANALYSIS OF FUNCTIONAL CONNECTIVITY - IMAGING ANALYSIS OF BRAIN FUNCTION BY FMRI AFTER ACUPUNCTURE AT LR3 IN HEALTHY INDIVIDUALS.

Science.gov (United States)

Zheng, Yu; Wang, Yuying; Lan, Yujun; Qu, Xiaodong; Lin, Kelin; Zhang, Jiping; Qu, Shanshan; Wang, Yanjie; Tang, Chunzhi; Huang, Yong

2016-01-01

This Study observed the relevant brain areas activated by acupuncture at the Taichong acupoint (LR3) and analyzed the functional connectivity among brain areas using resting state functional magnetic resonance imaging (fMRI) to explore the acupoint specificity of the Taichong acupoint. A total of 45 healthy subjects were randomly divided into the Taichong (LR3) group, sham acupuncture group and sham acupoint group. Subjects received resting state fMRI before acupuncture, after true (sham) acupuncture in each group. Analysis of changes in connectivity among the brain areas was performed using the brain functional connectivity method. The right cerebrum temporal lobe was selected as the seed point to analyze the functional connectivity. It had a functional connectivity with right cerebrum superior frontal gyrus, limbic lobe cingulate gyrus and left cerebrum inferior temporal gyrus (BA 37), inferior parietal lobule compared by before vs. after acupuncture at LR3, and right cerebrum sub-lobar insula and left cerebrum middle frontal gyrus, medial frontal gyrus compared by true vs. sham acupuncture at LR3, and right cerebrum occipital lobe cuneus, occipital lobe sub-gyral, parietal lobe precuneus and left cerebellum anterior lobe culmen by acupuncture at LR3 vs. sham acupoint. Acupuncture at LR3 mainly specifically activated the brain functional network that participates in visual function, associative function, and emotion cognition, which are similar to the features on LR3 in tradition Chinese medicine. These brain areas constituted a neural network structure with specific functions that had specific reference values for the interpretation of the acupoint specificity of the Taichong acupoint.

Los cambios en la estructura intraurbana de Ciudad Juárez, Chihuahua, de monocéntrica a multicéntrica

Directory of Open Access Journals (Sweden)

César M. Flores Fuentes

2001-01-01

Full Text Available El artículo tiene como objetivo analizar los cambios en la estructura intraurbana de Ciudad Juárez, Chihuahua, durante el periodo 1989-1993. Para ello se usaron los censos económicos de comercio y servicios de 1989 y 1994, el censo de población de 1990 y el conteo de población de1995, ambos a nivel de AGEB. Lo anterior fue posible mediante la construcción del índice de centralidad. En 1989 la estructura intraurbana de Ciudad Juárez mostró la presencia de dos centros principales. Dichos centros, aunque con la misma jerarquía urbana, tienen distintas funciones, como resultado de contar con ramas económicas que tienen diferentes áreas de mercado, desigual densidad poblacional y distinta capacidad de compra de sus principales consumidores. Para 1994 la ciudad siguió teniendo esos dos centros principales, aunque se crearon tres nuevos subcentros que se localizan fuera de las tradicionales áreas centrales, en zonas de fácil acceso y buena infraestructura. En este contexto, la estructura intraurbana se encuentra en proceso de convertirse de monocéntrica en multicéntrica

Disponibilidad de esporomas de hongos comestibles en los bosques de pino-encino de Ixtlán de Juárez, Oaxaca Edible mushroom sporocarp availability in pine-oak forests in Ixtlán de Juárez, Oaxaca

Directory of Open Access Journals (Sweden)

Roberto Garibay-Orijel

2009-08-01

Full Text Available Los hongos comestibles son recursos forestales cuyo aprovechamiento sustentable depende del conocimiento de la distribución y productividad de sus esporomas. En el presente trabajo se evaluó la disponibilidad de 81 hongos comestibles por medio de la abundancia, distribución temporal y espacial de sus esporomas. Estas variables se integraron en un índice de importancia ecológica (VI que brinda una medida para estimar la disponibilidad de sus esporomas en los bosques. El estudio se realizó durante 2001 y 2002 en los bosques de Pinus-Quercus de Ixtlán de Juárez, Oaxaca. Las especies más abundantes fueron Laccaria laccata var. pallidifolia, Gymnopus confluens y Laccaria vinaceobrunnea. La especie con mayor producción de biomasa húmeda de esporomas (2.21 Kg/sitio de muestreo fue Laccaria laccata var. Pallidifolia. Sólo G. confluens y G. dryophilus produjeron esporomas desde principios de junio hasta finales de octubre. Las especies con mayor disponibilidad fueron L. laccata var. pallidifolia, G. confluens, L. vinaceobrunnea y H. purpurascens. La riqueza de hongos comestibles silvestres en Ixtlán es alta (96 especies, pero su disponibilidad es muy heterogénea (de L. laccata var. pallidifolia VI = 0.7905, a Helvella infula VI = 0.0055. Dentro del mismo bosque, en sitios relativamente cercanos la composición de especies es diferente y su producción de esporomas y biomasa son contrastantes.Wild edible mushrooms are non timber forest products whose sustainable use must have an ecological basis. In this work, we measured the availability of 81 edible mushrooms by means of their abundance, frequency, biomass production, temporal and spatial distribution of their fruiting bodies. These variables were integrated into an ecological importance index (IV which describes sporome availability in the forest. The research was carried out during 2001 and 2002 in the Pinus-Quercus forests of Ixtlán de Juárez, Oaxaca. The most abundant species were

Experimental demonstration of CMOS-compatible long-range dielectric-loaded surface plasmon-polariton waveguides (LR-DLSPPWs)

DEFF Research Database (Denmark)

Zektzer, Roy; Desiatov, Boris; Mazurski, Noa

2015-01-01

We demonstrate the design, fabrication and experimental characterization of long-range dielectric-loaded surface plasmon-polariton waveguides (LR-DLSPPWs) that are compatible with complementary metal-oxide semiconductor (CMOS) technology. The demonstrated waveguides feature good mode confinement...

Studies of the Reactivity Effect of Polythene in the Fast Reactor FR0

Energy Technology Data Exchange (ETDEWEB)

Tiren, I; Haakansson, R

1967-12-15

Measurements of the reactivity effect of polythene (CH{sub 2}){sub n} have been made in two FR0 assemblies having neutron spectra broadly similar to those of current steam cooled fast reactor concepts. The experiments include studies of the axial and radial distributions of the reactivity coefficient. The reactivity contributions from small polythene samples were found to be approximately additive. No large effects of heterogeneity or interaction between samples were observed. Comparisons with calculations using a homogeneous model are therefore relevant. The experimental results are largely in reasonable agreement with calculated values. The latter are very sensitive to moderate changes in the cross sections at low neutron energies. The agreement with experiment is improved if transport rather than diffusion theory is used. Although the geometrical size of FR0 is probably adequate for studies of steam coefficients in fast power reactors, Pu isotopes and fission products should be included in the core composition in order to obtain information of direct use in such studies.

Política social, protección social y programa empleo temporal: el caso Juárez, México

Directory of Open Access Journals (Sweden)

Claudia Marcela Roqueme Ramírez

2013-01-01

Full Text Available Este trabajo es un análisis del Programa Empleo Temporal (PET en Ciudad Juárez en el marco del concepto protección social. Para ello se indaga acerca de la política social en México como un intento de comprender hasta qué punto ha contribuido dicho programa a esta alternativa de desarrollo. En este sentido, la revisión bibliográfica se empleó como una herramienta documental y metodológica que permitió conocer otras experiencias en América Latina para situar que la problemática del desempleo y la protección constituyen aún un desafío. Ciudad Juárez no es la excepción. La indagación del PET conduce a proponer que, aunque sus efectos sean positivos temporalmente, los resultados obtenidos son limitados ya que las políticas de acción están encaminadas a solventar en su mayoría contingencias y no una sustentabilidad a mediano y largo plazo. Finalmente, se propone la creación de un índice para monitorear y evaluar el impacto del PET en términos de cobertura, del perfil de los beneficiarios y de los ingresos generados entre los beneficiados.

Assessment of hemolytic activity, enzyme production and bacteriocin characterization of Bacillus subtilis LR1 isolated from the gastrointestinal tract of fish.

Science.gov (United States)

Banerjee, Goutam; Nandi, Ankita; Ray, Arun Kumar

2017-01-01

In the present investigation, probiotic potential (antagonistic activity, enzyme production, hemolytic activity, biosafety, antibiotic sensitivity and bile tolerance level) of Bacillus subtilis LR1 was evaluated. Bacteriocin produced by the bacterial strain B. subtilis LR1 isolated from the gastrointestinal tract of Labeo rohita was purified and characterized. The molecular weight of the purified bacteriocin was ~50 kDa in 12 % Native PAGE and showed inhibitory activity against four fish pathogens such as Bacillus mycoides, Aeromonas salmonicida, Pseudomonas fluorescens and Aeromonas hydrophila. The purified bacteriocin was maximally active at temperature 40 °C and pH 7.0, while none of the tested surfactants affect the bacteriocin activity. Extracellular enzyme activity of the selected bacterial strain was also evaluated. Amylase activity was estimated to be highest (38.23 ± 1.15 µg of maltose liberated mg -1  protein ml -1 of culture filtrate) followed by cellulase and protease activity. The selected bacterium was sensitive to most of the antibiotics used in this experiment, can tolerate 0.25 % bile salt and non-hemolytic in nature. Finally, the efficiency of the proposed probiotic candidate was evaluated in in vivo condition. It was detected that the bacterial strain can effectively reduce bacterial pathogenicity in Indian major carps.

Book Review / Reseña:GUBERN, R., MONTERDE, J. E., PÉREZ PERUCHA, J., RIAMBAU, E. y TORREIRO, C., Historia del cine español

Directory of Open Access Journals (Sweden)

Jesús F. Pascual Molina

2009-07-01

Full Text Available Reseña del libro: GUBERN, R., MONTERDE, J. E., PÉREZ PERUCHA, J., RIAMBAU, E. y TORREIRO, C., Historia del cine español, Madrid, Ediciones Cátedra, 2009. 652 pp. ISBN: 978-84-376-2561-4.

Direct determination of bulk etching rate for LR-115-II solid state ...

Indian Academy of Sciences (India)

The thickness of the removed layer of the LR-115-II solid state nuclear track detector during etching is measured directly with a rather precise instrument. Dependence of bulk etching rate on temperature of the etching solution is investigated. It has been found that the bulk etching rate is 3.2 m/h at 60°C in 2.5 N NaOH of ...

Quaternary alluvial fans of Ciudad Juárez, Chihuahua, northern México: OSL ages and implications for climatic history of the region

Science.gov (United States)

Zúñiga de León, David; Kershaw, Stephen; Mahan, Shannon

2016-01-01

Alluvial fans formed from sediments derived from erosion of the Juárez Mountains in northernmost México have a significant flood impact on the Ciudad Juárez, which is built on the fan system. The northern part of Ciudad Juárez is the most active; further south, older parts of the fan, upon which the rest of the city is built, were largely eroded by natural processes prior to human habitation and subsequently modified only recently by human construction. Three aeolian sand samples, collected from the uppermost (youngest) parts of the fan system in the city area, in places where human intervention has not disturbed the sediment, and constrain the latest dates of fan building. Depositional ages of the Quaternary alluvial fans were measured using Optically Stimulated Luminescence (OSL) on aeolian sands that have inter-fingered with alluvial fan material. These dates are: a) sample P1, 31 ka; b) sample P2, 41 ka; c) sample P3, 74 ka, between Oxygen Isotope Stages (OIS) 3 to 5. They demonstrate that fan development, in the area now occupied by the city, terminated in the Late Pleistocene, immediately after what we interpret to have been an extended period of erosion without further deposition, lasting from the Late Pleistocene to Holocene. The three dates broadly correspond to global glacial periods, implying that the cool, dry periods may reflect periods of aeolian transport in northern México in between phases that were wetter to form the alluvial fans. Alluvial fan margins inter-finger with fluvial terrace sediments derived from the Río Bravo, indicating an additional component of fan dissection by Río Bravo lateral erosion, presumed to be active during earlier times than our OSL ages, but these are not yet dated. Further dating is required to ascertain the controls on the fan and fluvial system.

The first measurement of the left-right cross section asymmetry in Z0 boson production

International Nuclear Information System (INIS)

Ben-David, R.J.

1994-05-01

The first measurement of the left-right cross section asymmetry (A LR ) in Z degrees boson production has been made with the SLAC Large Detector (SLD) at the SLAC Linear Collider (SLC). The measurement was performed at a center-of-mass energy (E cm ) of 91.55 GeV with a longitudinally polarized electron beam. The average beam polarization was (22.4 ± 0.6)%. Using a sample of 10,224 Z degrees decays, A LR is measured to be 0.102 ± 0.044(stat) ± 0.003(syst), which determines the effective electroweak mixing angle to be sin 2 θ W eff = 0.2375 ± 0.0056(stat) ± 0.0004(syst)

RAZORBACK - A Research Reactor Transient Analysis Code Version 1.0 - Volume 3: Verification and Validation Report.

Energy Technology Data Exchange (ETDEWEB)

Talley, Darren G.

2017-04-01

This report describes the work and results of the verification and validation (V&V) of the version 1.0 release of the Razorback code. Razorback is a computer code designed to simulate the operation of a research reactor (such as the Annular Core Research Reactor (ACRR)) by a coupled numerical solution of the point reactor kinetics equations, the energy conservation equation for fuel element heat transfer, the equation of motion for fuel element thermal expansion, and the mass, momentum, and energy conservation equations for the water cooling of the fuel elements. This V&V effort was intended to confirm that the code shows good agreement between simulation and actual ACRR operations.

El Club Dumas de Arturo Pérez-Reverte como paradigma de la narrativa posmoderna española

OpenAIRE

Isaac Gómez Laguna

2015-01-01

El presente artículo ofrece un análisis de los diferentes rasgos posmodernistas que aparecen de manera explícita en El Club Dumas, novela insignia de la narrativa posmoderna en España, en torno a tres ejes centrales: a) género de la obra e intertextualidad, b) indeterminación e irrealidad, y c) individuo y sociedad. Mediante esta reflexión pretendemos evidenciar que su autor, Arturo Pérez-Reverte, no solo crea una novela puramente posmoderna, sino que su obra le sirve para teorizar acerca del...

Neutron flux parameters for k{sub 0}-NAA method at the Malaysian nuclear agency research reactor after core reconfiguration

Energy Technology Data Exchange (ETDEWEB)

Yavar, A.R. [School of Applied Physics, Faculty of Science and Technology, University Kebangsaan Malaysia (UKM), Bangi, Selangor 43600 (Malaysia); Sarmani, S. [School of Chemical Sciences and Food Technology, Faculty of Science and Technology, University Kebangsaan Malaysia (UKM), Bangi, Selangor 43600 (Malaysia); Wood, A.K. [Analytical Chemistry Application Group, Industrial Technology Division, Malaysian Nuclear Agency (MNA), Bangi, Kajang, Selangor 43000 (Malaysia); Fadzil, S.M. [School of Applied Physics, Faculty of Science and Technology, University Kebangsaan Malaysia (UKM), Bangi, Selangor 43600 (Malaysia); Masood, Z. [Analytical Chemistry Application Group, Industrial Technology Division, Malaysian Nuclear Agency (MNA), Bangi, Kajang, Selangor 43000 (Malaysia); Khoo, K.S., E-mail: khoo@ukm.m [School of Applied Physics, Faculty of Science and Technology, University Kebangsaan Malaysia (UKM), Bangi, Selangor 43600 (Malaysia)

2011-02-15

The Malaysian Nuclear Agency (MNA) research reactor, commissioned in 1982, is a TRIGA Mark II swimming pool type reactor. When the core configuration changed in June 2009, it became essential to re-determine such neutron flux parameters as thermal to epithermal neutron flux ratio (f), epithermal neutron flux shape factor ({alpha}), thermal neutron flux ({phi}{sub th}) and epithermal neutron flux ({phi}{sub epi}) in the irradiation positions of MNA research reactor in order to guarantee accuracy in the application of k{sub 0}-neutron activation analysis (k{sub 0}-NAA).The f and {alpha} were determined using the bare bi-isotopic monitor and bare triple monitor methods, respectively; Au and Zr monitors were utilized in present study. The results for four irradiation positions are presented and discussed in the present work. The calculated values of f and {alpha} ranged from 33.49 to 47.33 and -0.07 to -0.14, respectively. The {phi}{sub th} and the {phi}{sub epi} were measured as 2.03 x 10{sup 12} (cm{sup -2} s{sup -1}) and 6.05 x 10{sup 10} (cm{sup -2} s{sup -1}) respectively. These results were compared to those of previous studies at this reactor as well as to those of reactors in other countries. The results indicate a good conformity with other findings.

¿La práctica de la siembra directa en cultivos de soja favorece las poblaciones de acridios (Orthoptera: Acrididae en el partido de Benito Juárez? Does the direct tillage practice in soybean crops favour grasshopper populations (Orthoptera: Acrididae, in Benito Juárez county?

Directory of Open Access Journals (Sweden)

Daniel Scuffi

2012-12-01

Full Text Available Considerando el desarrollo del cultivo de soja en siembra directa en el partido de Benito Juárez, y que algunos autores sostienen que esta práctica favorece los acridios, se evaluó la riqueza de especies y la abundancia en soja con siembra directa y convencional. Se registraron siete especies (Aleuas lineatus Stål, Covasacris pallidinota (Bruner, Baeacris pseudopunctulatus (Ronderos, Dichroplus elongatus Giglio-Tos, Dichroplus maculipennis (Blanchard, Dichroplus pratensis Bruner y Scotussa lemniscata (Stål. La riqueza de especies acumulada en los diferentes cultivos fue similar (p> 0,05. En soja de primera con siembra directa, se registraron 2,3 ± 0,19 especies, en soja de primera con siembra convencional 1,45 ± 0,15 especies y en soja de segunda con siembra directa 2,25 ± 0,28 especies. Dichroplus elongatus fue la especie más abundante en todos los cultivos y en todos los momentos. Las restantes presentaron baja abundancia y se registraron en algunos momentos. No existió diferencia (p> 0,05 en la abundancia de tucuras entre los cultivos y en las diferentes fechas de muestreo. La baja riqueza de especies registrada estaría relacionada con la baja diversidad vegetal de los cultivos. Este estudio no mostró diferencias en la abundancia y riqueza de especies de acuerdo a la labranza utilizada.Considering the development of the soybean crops using direct tillage in Benito Juárez county, and taking into account that for some authors this practice favours the grasshopper populations, the abundance and species richness in soybean with direct and conventional tillage were evaluated. Seven species were registered (Aleuas lineatus Stål, Covasacris pallidinota (Bruner, Baeacris pseudopunctulatus (Ronderos, Dichroplus elongatus Giglio-Tos, Dichroplus maculipennis (Blanchard, Dichroplus pratensis Bruner and Scotussa lemniscata (Stål. The accumulated richness was similar (p> 0.05, along the different crops; 2.3 ± 0.19 species were registered in

Testing the applicability of the k 0-NAA method at the MINT's TRIGA MARK II reactor

International Nuclear Information System (INIS)

Siong, Wee Boon; Dung, Ho Manh; Wood, Ab. Khalik; Salim, Nazaratul Ashifa Abd.; Elias, Md. Suhaimi

2006-01-01

The Analytical Chemistry Laboratory at MINT is using the NAA technique since 1980s and is the only laboratory in Malaysia equipped with a research reactor, namely the TRIGA MARK II. Throughout the years the development of NAA technique has been very encouraging and was made applicable to a wide range of samples. At present, the k 0 method has become the preferred standardization method of NAA (k 0 -NAA) due to its multi-elemental analysis capability without using standards. Additionally, the k 0 method describes NAA in physically and mathematically understandable definitions and is very suitable for computer evaluation. Eventually, the k 0 -NAA method has been adopted by MINT in 2003, in collaboration with the Nuclear Research Institute (NRI), Vietnam. The reactor neutron parameters (α and f) for the pneumatic transfer system and for the rotary rack at various locations, as well as the detector efficiencies were determined. After calibration of the reactor and the detectors, the implemented k 0 method was validated by analyzing some certified reference materials (including IAEA Soil 7, NIST 1633a, NIST 1632c, NIST 1646a and IAEA 140/TM). The analysis results of the CRMs showed an average u score well below the threshold value of 2 with a precision of better than ±10% for most of the elemental concentrations obtained, validating herewith the introduction of the k 0 -NAA method at the MINT

Testing the applicability of the k0-NAA method at the MINT's TRIGA MARK II reactor

Science.gov (United States)

Siong, Wee Boon; Dung, Ho Manh; Wood, Ab. Khalik; Salim, Nazaratul Ashifa Abd.; Elias, Md. Suhaimi

2006-08-01

The Analytical Chemistry Laboratory at MINT is using the NAA technique since 1980s and is the only laboratory in Malaysia equipped with a research reactor, namely the TRIGA MARK II. Throughout the years the development of NAA technique has been very encouraging and was made applicable to a wide range of samples. At present, the k0 method has become the preferred standardization method of NAA ( k0-NAA) due to its multi-elemental analysis capability without using standards. Additionally, the k0 method describes NAA in physically and mathematically understandable definitions and is very suitable for computer evaluation. Eventually, the k0-NAA method has been adopted by MINT in 2003, in collaboration with the Nuclear Research Institute (NRI), Vietnam. The reactor neutron parameters ( α and f) for the pneumatic transfer system and for the rotary rack at various locations, as well as the detector efficiencies were determined. After calibration of the reactor and the detectors, the implemented k0 method was validated by analyzing some certified reference materials (including IAEA Soil 7, NIST 1633a, NIST 1632c, NIST 1646a and IAEA 140/TM). The analysis results of the CRMs showed an average u score well below the threshold value of 2 with a precision of better than ±10% for most of the elemental concentrations obtained, validating herewith the introduction of the k0-NAA method at the MINT.

Homicidio masculino en Ciudad Juárez. Costos de las masculinidades subordinadas

Directory of Open Access Journals (Sweden)

Salvador Cruz

2011-01-01

Full Text Available El homicidio masculino agudizado en Ciudad Juárez en los años 2008 y 2009, con casi cuatro mil asesinatos, constituye la expresión más evidente de la violencia urbana. Dicha violencia ha tomado rostro en hombres, en su mayoría jóvenes y marginados. Los datos muestran un comportamiento del homicidio doloso asimilado a significados relacionados con la masculinidad más tradicional, cuyo costo recae en la vida misma. Se observa a través de los escenarios, los horarios en que ocurren los eventos y las formas de ejecución, que esta práctica delictiva puede ser comprendida como una actividad masculina que explota una subjetividad proclive a la violencia y que reproduce las asimetrías de género y significados asociados a la dicotomía masculino-femenino.

El doctor Moreno Pérez y el anopheles crucians

Directory of Open Access Journals (Sweden)

Facultad de Medicina Revista

1943-03-01

Full Text Available En el año de 1933, con ocasión del conflicto del Amazonas, el doctor Ignacio Moreno·Pérez trabajó como médico de sanidad en la hoya del río Caquetá. Prosiguiendo sus estudios sobre paludismo y mosquitos transmisores a que dedicó gran parte de su meritoria vida, practicó una inspección entomológica de las cercanías de Florencia, capital de la comisaria del Caquetá, y encontró una raza en aguas salobres de Anopheles crucians. El hallazgo comunicado por él en el informe de 1934 de la comisión de paludismo del valle del Magdalena, (Estudios de Paludismo en el Valle del Magdalena, Departamento Nacional de Higiene, Sección de Sanidad Rural, Bogotá editorial de "Cromos", 1934, despertó mucho interés y fué objeto de controversias, porque conforme a los estudios de Howard, Dyar y Knab (1917, la localización del Anopheles crucians era casi hiperbórea, por encima del paralelo 25 en la América del Norte y solamente se había logrado ver además en Cuba y Jamaica.

Estudo populacional do camarão-rosa Penaeus Paulensis pérez farfante (natantia, penaeidae na Lagoa da Conceiçáo, Santa Catarina, Brasil Populational study of the pink-shrimp Penaeus Paulensis pérez farfante (natantia, penaeidae in the Conceição Lake, Florianópolis, Santa Catarina, Brazil

Directory of Open Access Journals (Sweden)

Joaquim Olinto Branco

1998-01-01

Full Text Available In the time period between May/92 to April/93, 2693 (1243 males and 1450 females specimens of Penaeus paulensis Pérez Farfante, 1967 were collected. The shrimps were captured by night using a hand net in äreas between 30 to 150 cm deep. The abundance of P. paulensis is regulated mainly by the temperature, the summer being the season of greater profusion. The major recruiting period takes place in the Spring with shrimps measuring between 1,0 to 3,0 cm and approximately 2,0 months old. The population reaches the pre-adult in the Fall-Winter period with average length between 8,8 cm (females and 9,3 cm (males. The migration to the ocean occurs during the Winter. The artisanal fishing in the Conceição Lake is predatory, acting upon the young and pre-adult shrimps, which may jeopardize the marine reproducer stock.

Rapid Isolation of a Single-Chain Antibody against the Cyanobacterial Toxin Microcystin-LR by Phage Display and Its Use in the Immunoaffinity Concentration of Microcystins from Water

Science.gov (United States)

McElhiney, Jacqui; Drever, Mathew; Lawton, Linda A.; Porter, Andy J.

2002-01-01

A naïve (unimmunized) human semisynthetic phage display library was employed to isolate recombinant antibody fragments against the cyanobacterial hepatotoxin microcystin-LR. Selected antibody scFv genes were cloned into a soluble expression vector and expressed in Escherichia coli for characterization against purified microcystin-LR by competition enzyme-linked immunosorbent assay (ELISA). The most sensitive single-chain antibody (scAb) isolated was capable of detecting microcystin-LR at levels below the World Health Organization limit in drinking water (1 μg liter−1) and cross-reacted with three other purified microcystin variants (microcystin-RR, -LW, and -LF) and the related cyanotoxin nodularin. Extracts of the cyanobacterium Microcystis aeruginosa were assayed by ELISA, and quantifications of microcystins in toxic samples showed good correlation with analysis by high-performance liquid chromatography. Immobilized scAb was also used to prepare immunoaffinity columns, which were assessed for the ability to concentrate microcystin-LR from water for subsequent analysis by high-performance liquid chromatography. Anti-microcystin-LR scAb was immobilized on columns via a hexahistidine tag, ensuring maximum exposure of antigen binding sites, and the performance of the columns was evaluated by directly applying 150 ml of distilled water spiked with 4 μg of purified microcystin-LR. The procedure was simple, and a recovery rate of 94% was achieved following elution in 1 ml of 100% methanol. Large-scale, low-cost production of anti-microcystin-LR scAb in E. coli is an exciting prospect for the development of biosensors and on-line monitoring systems for microcystins and will also facilitate a range of immunoaffinity applications for the cleanup and concentration of these toxins from environmental samples. PMID:12406716

“In the city of god” The advocacy of Mary by Miguel Suárez and the wall paintings at the Founder’s Manor in Tunja. New documents and interpretations.

Directory of Open Access Journals (Sweden)

Abel Fernando Martínez Martín

2015-07-01

Full Text Available This text exposes some documental sources gathered from the Regional Archive of Boyacá (RAB, which identify the relevance of Miguel Suárez de Figueroa, eldest son and heir to Gonzalo Suárez Rendón, founder of the city of Tunja, in charge of inishing and decorating of the roofs of the Founder’s Manor,as well as main sponsor and founder of Rosario Chapel, located in Santo Domingo church. Furthermore, an iconographic interpretation of the roof of the main hall in the Founder’s Manor is proposed, different from the one exposed by the historians Santiago Sebastián and José Miguel Morales Folguera.

Pesquisaje de cáncer de mama en la comunidad de Santos Suárez

Directory of Open Access Journals (Sweden)

Marianela Prendes Labrada

1998-04-01

Full Text Available Se realiza un estudio descriptivo en 3 consultorios del área del Policlínico "Santos Suárez" en el año 1996 con el objetivo de determinar la incidencia de cáncer de mama y la utilización de métodos de detección precoz. Se informa que la muestra estuvo constituida por 600 mujeres mayores de 20 años seleccionadas al azar a las cuales se les hizo el pesquisaje y se les aplicó una encuesta. Se encuentra que la incidencia de cáncer mamario fue del 3 %. El 22,5 % de las mujeres se clasificaron como de alto riesgo de padecer el cáncer y el 83,3 % de los cánceres mamarios se detectaron en mujeres con alto riesgo y más de 50 años. Se señala que el 58,2 % de la muestra no conoce el autoexamen de mama y el 64 % no lo practica. Al 45,1 % de las mujeres nunca se le había realizado el examen clínico de las mamasA descriptive study of 3 physicians'offices from Santos Suárez polyclinic was carried out in 1996 aimed at determining the incidence of breast cancer and the use of early diagnosis methods. It is stressed that 600 randomly chosen women over 20 were included in the sample, who were screened and applied a survey. The breast cancer incidence rate was 3 %. 22.5 % of sampled women was clasified as high breast cancer risk subjects whereas 83.3 % of detected breast cancer was found in high risk women over 50. 58.2 % of them has no idea about the breast self-examination and 64 % does not put it into practice. 45.1 % of women has never been breast-screened before

Convergencia tecnológica y nacimiento de las maquiladoras de tercera generación: el caso Delphi-Juárez

Directory of Open Access Journals (Sweden)

Arturo Lara Rivero

2001-01-01

Full Text Available El objetivo de este trabajo es el de explicar el nacimiento de un moderno, inédito centro de investigación y desarrollo de auto partes electrónicas: Delphi - Juárez . La pregunta básica que guía este trabajo es la siguiente: ¿cuáles son las implicaciones de la convergencia tecnológica electrónica / automotriz sobre el número, distribución espacial y jerárquica de los proveedores? Esta convergencia tecnológica viene a revalorizar las antiguas funciones eléctricas (y tanto a los viejos proveedores de partes eléctricas maduras como a los proveedores de arneses y a insertarlas en una nueva jerarquía tecnológica con interacciones más intensas entre proveedores de arneses, léase maquiladoras del sector auto partes electrónicos / eléctricos y las empresas propiamente automotrices. Resulta imprescindible leer la formación del centro de investigación y desarrollo Delphi Juárez desde la perspectiva de los procesos de convergencia, resolución de desequilibrios tecnológicos y coevolución tecnológica del campo electrónico y automotriz.

Correlation consistent basis sets for actinides. II. The atoms Ac and Np-Lr.

Science.gov (United States)

Feng, Rulin; Peterson, Kirk A

2017-08-28

New correlation consistent basis sets optimized using the all-electron third-order Douglas-Kroll-Hess (DKH3) scalar relativistic Hamiltonian are reported for the actinide elements Ac and Np through Lr. These complete the series of sets reported previously for Th-U [K. A. Peterson, J. Chem. Phys. 142, 074105 (2015); M. Vasiliu et al., J. Phys. Chem. A 119, 11422 (2015)]. The new sets range in size from double- to quadruple-zeta and encompass both those optimized for valence (6s6p5f7s6d) and outer-core electron correlations (valence + 5s5p5d). The final sets have been contracted for both the DKH3 and eXact 2-component (X2C) Hamiltonians, yielding cc-pVnZ-DK3/cc-pVnZ-X2C sets for valence correlation and cc-pwCVnZ-DK3/cc-pwCVnZ-X2C sets for outer-core correlation (n = D, T, Q in each case). In order to test the effectiveness of the new basis sets, both atomic and molecular benchmark calculations have been carried out. In the first case, the first three atomic ionization potentials (IPs) of all the actinide elements Ac-Lr have been calculated using the Feller-Peterson-Dixon (FPD) composite approach, primarily with the multireference configuration interaction (MRCI) method. Excellent convergence towards the respective complete basis set (CBS) limits is achieved with the new sets, leading to good agreement with experiment, where these exist, after accurately accounting for spin-orbit effects using the 4-component Dirac-Hartree-Fock method. For a molecular test, the IP and atomization energy (AE) of PuO 2 have been calculated also using the FPD method but using a coupled cluster approach with spin-orbit coupling accounted for using the 4-component MRCI. The present calculations yield an IP 0 for PuO 2 of 159.8 kcal/mol, which is in excellent agreement with the experimental electron transfer bracketing value of 162 ± 3 kcal/mol. Likewise, the calculated 0 K AE of 305.6 kcal/mol is in very good agreement with the currently accepted experimental value of 303.1 ± 5 kcal

Revisiting the Ceara Rise, equatorial Atlantic Ocean: isotope stratigraphy of ODP Leg 154 from 0 to 5 Ma

Science.gov (United States)

Wilkens, Roy H.; Westerhold, Thomas; Drury, Anna J.; Lyle, Mitchell; Gorgas, Thomas; Tian, Jun

2017-07-01

Isotope stratigraphy has become the method of choice for investigating both past ocean temperatures and global ice volume. Lisiecki and Raymo (2005) published a stacked record of 57 globally distributed benthic δ18O records versus age (LR04 stack). In this study LR04 is compared to high-resolution records collected at all of the sites drilled during ODP Leg 154 on the Ceara Rise, in the western equatorial Atlantic Ocean. Newly developed software is used to check data splices of the Ceara Rise sites and better align out-of-splice data with in-splice data. Core images recovered from core table photos are depth and age scaled and greatly assist in the data analysis. The entire splices of ODP sites 925, 926, 927, 928 and 929 were reviewed. Most changes were minor although several were large enough to affect age models based on orbital tuning. A Ceara Rise composite record of benthic δ18O is out of sync with LR04 between 1.80 and 1.90 Ma, where LR04 exhibits two maxima but Ceara Rise data contain only one. The interval between 4.0 and 4.5 Ma in the Ceara Rise compilation is decidedly different from LR04, reflecting both the low amplitude of the signal over this interval and the limited amount of data available for the LR04 stack. A regional difference in benthic δ18O of 0.2 ‰ relative to LR04 was found. Independent tuning of Site 926 images and physical property data to the Laskar et al. (2004) orbital solution and integration of available benthic stable isotope data from the Ceara Rise provides a new regional reference section for the equatorial Atlantic covering the last 5 million years.

IRT-LR-DIF with Estimation of the Focal-Group Density as an Empirical Histogram

Science.gov (United States)

Woods, Carol M.

2008-01-01

Item response theory-likelihood ratio-differential item functioning (IRT-LR-DIF) is used to evaluate the degree to which items on a test or questionnaire have different measurement properties for one group of people versus another, irrespective of group-mean differences on the construct. Usually, the latent distribution is presumed normal for both…

Social acceptability urban form and sustainability in urban neighborhoods in Ciudad Juárez, Chihuahua

Directory of Open Access Journals (Sweden)

Claudia Gabriela Vargas Fernández

2016-11-01

Full Text Available In the field of urban planning, questioning around sustainability and the possibility of sustainable urban planning has led to a new set of approaches and discussions that impact studies on urban form and sustainable livelihoods. This approach characterized the work presented by Mike Jenks and Colin Jones (2010, Dimensions of the Sustainable City, where a set of variables are presented about urban sustainability from the neighbourhood level of analysis. In that sense, this article proposes the analysis of three social housing neighborhoods in Ciudad Juárez, Chihuahua, México, integrating aspects of urban form and social acceptability, in order to understand the relationship between the physical and sociocultural dimensions of the concept of urban sustainability.

Implementation of the k{sub 0} technique using multi-detectors on diverse irradiation facilities of TRIGA Reactor; Implementacion de la tecnica k{sub 0} usando multidetectores en diferentes instalaciones de irradiacion del Reactor TRIGA

Energy Technology Data Exchange (ETDEWEB)

Caldera C, M. de G.

2013-07-01

The k{sub 0} method with the technique of neutron activation analysis allows obtaining important characteristics parameters that describe a nuclear reactor. Among these parameters are the form factor of epithermal neutron flux, α and the ratio of thermal neutron flux with respect to the epithermal neutron flux, f. These parameters were obtained by irradiation of two different monitors, one of Au-Zr and the other of Au-Mo-Cr, where the last one was made and implemented for the first time. Both monitors were irradiated in different positions in the TRIGA Mark III Reactor at the National Institute of Nuclear Research. (Author)

Code manual for CONTAIN 2.0: A computer code for nuclear reactor containment analysis

International Nuclear Information System (INIS)

Murata, K.K.; Williams, D.C.; Griffith, R.O.; Gido, R.G.; Tadios, E.L.; Davis, F.J.; Martinez, G.M.; Washington, K.E.; Tills, J.

1997-12-01

The CONTAIN 2.0 computer code is an integrated analysis tool used for predicting the physical conditions, chemical compositions, and distributions of radiological materials inside a containment building following the release of material from the primary system in a light-water reactor accident. It can also predict the source term to the environment. CONTAIN 2.0 is intended to replace the earlier CONTAIN 1.12, which was released in 1991. The purpose of this Code Manual is to provide full documentation of the features and models in CONTAIN 2.0. Besides complete descriptions of the models, this Code Manual provides a complete description of the input and output from the code. CONTAIN 2.0 is a highly flexible and modular code that can run problems that are either quite simple or highly complex. An important aspect of CONTAIN is that the interactions among thermal-hydraulic phenomena, aerosol behavior, and fission product behavior are taken into account. The code includes atmospheric models for steam/air thermodynamics, intercell flows, condensation/evaporation on structures and aerosols, aerosol behavior, and gas combustion. It also includes models for reactor cavity phenomena such as core-concrete interactions and coolant pool boiling. Heat conduction in structures, fission product decay and transport, radioactive decay heating, and the thermal-hydraulic and fission product decontamination effects of engineered safety features are also modeled. To the extent possible, the best available models for severe accident phenomena have been incorporated into CONTAIN, but it is intrinsic to the nature of accident analysis that significant uncertainty exists regarding numerous phenomena. In those cases, sensitivity studies can be performed with CONTAIN by means of user-specified input parameters. Thus, the code can be viewed as a tool designed to assist the knowledge reactor safety analyst in evaluating the consequences of specific modeling assumptions

Code manual for CONTAIN 2.0: A computer code for nuclear reactor containment analysis

Energy Technology Data Exchange (ETDEWEB)

Murata, K.K.; Williams, D.C.; Griffith, R.O.; Gido, R.G.; Tadios, E.L.; Davis, F.J.; Martinez, G.M.; Washington, K.E. [Sandia National Labs., Albuquerque, NM (United States); Tills, J. [J. Tills and Associates, Inc., Sandia Park, NM (United States)

1997-12-01

The CONTAIN 2.0 computer code is an integrated analysis tool used for predicting the physical conditions, chemical compositions, and distributions of radiological materials inside a containment building following the release of material from the primary system in a light-water reactor accident. It can also predict the source term to the environment. CONTAIN 2.0 is intended to replace the earlier CONTAIN 1.12, which was released in 1991. The purpose of this Code Manual is to provide full documentation of the features and models in CONTAIN 2.0. Besides complete descriptions of the models, this Code Manual provides a complete description of the input and output from the code. CONTAIN 2.0 is a highly flexible and modular code that can run problems that are either quite simple or highly complex. An important aspect of CONTAIN is that the interactions among thermal-hydraulic phenomena, aerosol behavior, and fission product behavior are taken into account. The code includes atmospheric models for steam/air thermodynamics, intercell flows, condensation/evaporation on structures and aerosols, aerosol behavior, and gas combustion. It also includes models for reactor cavity phenomena such as core-concrete interactions and coolant pool boiling. Heat conduction in structures, fission product decay and transport, radioactive decay heating, and the thermal-hydraulic and fission product decontamination effects of engineered safety features are also modeled. To the extent possible, the best available models for severe accident phenomena have been incorporated into CONTAIN, but it is intrinsic to the nature of accident analysis that significant uncertainty exists regarding numerous phenomena. In those cases, sensitivity studies can be performed with CONTAIN by means of user-specified input parameters. Thus, the code can be viewed as a tool designed to assist the knowledge reactor safety analyst in evaluating the consequences of specific modeling assumptions.

Sex-dependent effects of microcystin-LR on hypothalamic-pituitary-gonad axis and gametogenesis of adult zebrafish

Science.gov (United States)

Liu, Wanjing; Chen, Chuanyue; Chen, Liang; Wang, Li; Li, Jian; Chen, Yuanyuan; Jin, Jienan; Kawan, Atufa; Zhang, Xuezhen

2016-03-01

While microcystins (MCs) have been reported to exert reproductive toxicity on fish with a sex-dependent effect, the underlying mechanism has been rarely investigated. In the present study, zebrafish were exposed to 1, 5 and 20 μg/L MC-LR for 30 d. The gonad-somatic index declined in all treated males. 17β-estradiol (E2), testosterone (T), 11-keto testosterone (11-KT) and follicle-stimulating hormone (FSH) levels increased in serum from all treated females, while T, FSH and luteinizing hormone (LH) levels changed in all treated males. Histomorphological observation showed that MC-LR exposure evidently retarded oogenesis and spermatogenesis. Transcriptional changes of 22 genes of the hypothalamic-pituitary-gonad (HPG) axis exhibited sex-specific responses, and the relationship between gene transcriptions and gametogenesis was evaluated by principle component analysis (PCA). Major contributors to PC1 (gnrh2, gnrhr3, ar, lhr, hmgra, hmgrb and cyp19a) were positively correlated with the number of post-vitellogenic oocytes, while PC1 (gnrh2, lhβ, erβ, fshr, cyp11a and 17βhsd) were positively correlated with the number of spermatozoa. The protein levels of 17βHSD and CYP19a were affected in both females and males. In conclusion, this study first investigated the sex-dependent effects of microcystins on fish reproduction and revealed some important molecular biomarkers related to gametogenesis in zebrafish suffered from MC-LR.

Preparation of mandatory documentation before the start up of the RA-0 `zero power` nuclear reactor at Cordoba National University; Preparacion de la documentacion mandatoria para la puesta en marcha del reactor nuclear RA-0 en la Universidad Nacional de Cordoba

Energy Technology Data Exchange (ETDEWEB)

Martin, H R; Keil, W M; Pezzi, N

1992-12-31

Before the start up of the RA-0 `zero power` nuclear reactor installed at Cordoba National University, it was necessary to send to the Regulatory Authority the mandatory documentation which is required in the licensing process. With the previous papers existing for the operation in the first years of the `70, a work program for the future operational training personnel was elaborated. Based on the Authority`s applicable rules and the recommendations and with particular criteria originated in the working university conditions, the SAFETY report of RA-0 nuclear reactor was prepared. This paper describes the principal contents, items and documents involved in the safety report. (Author). [Espanol] Con motivo de la nueva puesta en servicio del REACTOR NUCLEAR RA-0 fue necesario elaborar la documentacion mandatoria requerida por la Autoridad Regulatoria Nacional. Siguiendo los lineamientos de las normas y recomendaciones vigentes e incluyendo criterios propios en lo que debia ser el contenido final de dicha documentacion, fue preparado lo que se ha denominado el INFORME DE SEGURIDAD DEL REACTOR NUCLEAR RA-0. Este documento que se describe en este trabajo, si bien contiene las habituales descripciones de todos los Informes de Seguridad, incluye otros aspectos que no siendo requeridos expresamente en el mismo, han dado una mayor coherencia a la conformacion de todos los aspectos que interrelacionan las areas de seguridad fisica, radiologica, nuclear y de control de materiales nucleares bajo salvaguardias. (Autor).

Nuevas otras de Jenaro Pérez Villaamil y Carlos de Haes

Directory of Open Access Journals (Sweden)

Arias Anglés, Enrique

2004-06-01

Full Text Available La intención del presente trabajo es dar a conocer y catalogar algunas obras, aparecidas últimamente, de estos dos grandes maestros del paisajismo español del siglo XIX. Unas tienen el interés de aportamos, o ampliamos, la visión de una etapa determinada del artista de la que tenemos escaso conocimiento; otras meramente contribuyen a aumentar el catálogo conocido de las obras de estos pintores y, aunque nada nuevo aporten al juicio que de su pintura poseemos en general, ya eso mismo siempre resulta de por sí un valor añadido a su producción, y más si se trata de algún buen cuadro; y, por último, también tenemos el caso de la obra que ha podido ser identificada gracias a sernos conocido previamente su dibujo preparatorio. Comenzaremos por las que nos amplían la visión de una etapa pictórica poco conocida del paisajista romántico español Jenaro Pérez Villaamil…

High performance sulfur, nitrogen and carbon doped mesoporous anatase–brookite TiO2 photocatalyst for the removal of microcystin-LR under visible light irradiation

International Nuclear Information System (INIS)

El-Sheikh, Said M.; Zhang, Geshan; El-Hosainy, Hamza M.; Ismail, Adel A.; O'Shea, Kevin E.; Falaras, Polycarpos; Kontos, Athanassios G.; Dionysiou, Dionysios D.

2014-01-01

Graphical abstract: - Highlights: • Synthesis of tailor-designed C, N and S doped titania anatase–brookite nano-heterojunction photocatalyst. • Microcystin-LR was completely removed in the presence of doped sample under visible light. • The MC-LR degradation rate achieved by the doped sample was much better than that of un-doped sample under visible light. - Abstract: Carbon, nitrogen and sulfur (C, N and S) doped mesoporous anatase–brookite nano-heterojunction titania photocatalysts have been synthesized through a simple sol–gel method in the presence of triblock copolymer Pluronic P123. XRD and Raman spectra revealed the formation of anatase and brookite mixed phases. XPS spectra indicated the presence of C, N and S dopants. The TEM images demonstrated the formation of almost monodisperse titania nanoparticles with particle sizes of approximately 10 nm. N 2 isotherm measurements confirmed that both doped and undoped titania anatase–brookite materials have mesoporous structure. The photocatalytic degradation of the cyanotoxin microcystin-LR (MC-LR) has been investigated using these novel nanomaterials under visible light illumination. The photocatalytic efficiency of the mesoporous titania anatase–brookite photocatalyst dramatically increased with the addition of the C, N and S non-metal, achieving complete degradation (∼100%) of MC-LR. The results demonstrate the advantages of the synthetic approach and the great potential of the visible light activated C, N, and S doped titania photocatalysts for the treatment of organic micropollutants in contaminated waters under visible light

Redescription of Chabaudacuaria multispinosa (Pérez Vigueras, 1938) n. g., n. comb. (Nematoda: Spirurida: Acuariidae) based on specimens from Ardea herodias L. and Nyctanassa violacea (L.) (Ardeidae) in Florida.

Science.gov (United States)

Mutafchiev, Yasen; Kinsella, John M

2012-10-01

Chabaudacuaria n. g. is erected, as monotypic, for C. multispinosa (Pérez Vigueras, 1938) n. comb. (Spirurida: Acuariidae) [syns Cheilospirura multispinosa Pérez Vigueras, 1938; Acuaria multispinosa (Pérez Vigueras, 1938) Yamaguti, 1961]. This species, a parasite of various ardeid birds, is redescribed by means of light and scanning electron microscopy based on material from great blue herons Ardea herodias L. and yellow-crowned night herons Nyctanassa violacea (L.) in Florida, USA. Chabaudacuaria n. g. resembles Acuaria Bremser, 1811, Cheilospirura Diesing, 1861, Skrjabinocerca Schikhobalova, 1930 and Xenocordon Mawson, 1982 in its straight cordons which do not anastomose. However, it can be distinguished from them by the didelphic-prodelphic uterus and the absence of caudal alae in the males. In the pattern of its cordons (consisting of a row of plates and a longitudinal ridge) and the absence of an area rugosa, the new genus is similar to Chevreuxia Seurat, 1918, Syncuaria Gil'bert, 1927, Aviculariella Wehr, 1931, Skrjabinocara Kurashvili, 1940, Decorataria Sobolev, 1949 and Desportesius Chabaud & Campana, 1949, which are characterised by anastomosing cordons. The didelphic-prodelphic female reproductive system of Chabaudacuaria is intermediate between the didelphic-amphidelphic uterus of Chevreuxia and the monodelphic-prodelphic uterus of Syncuaria, Aviculariella, Skrjabinocara, Desportesius and Decorataria. Therefore, the straight and non-anastomosing cordons are considered to be autapomorphic for Chabaudacuaria.

El Club Dumas de Arturo Pérez-Reverte como paradigma de la narrativa posmoderna española

Directory of Open Access Journals (Sweden)

Isaac Gómez Laguna

2015-06-01

Full Text Available El presente artículo ofrece un análisis de los diferentes rasgos posmodernistas que aparecen de manera explícita en El Club Dumas, novela insignia de la narrativa posmoderna en España, en torno a tres ejes centrales: a género de la obra e intertextualidad, b indeterminación e irrealidad, y c individuo y sociedad. Mediante esta reflexión pretendemos evidenciar que su autor, Arturo Pérez-Reverte, no solo crea una novela puramente posmoderna, sino que su obra le sirve para teorizar acerca del posmodernismo.

MACVIA-LR (Fighting Chronic Diseases for Active and Healthy Ageing in Languedoc-Roussillon): A Success Story of the European Innovation Partnership on Active and Healthy Ageing.

Science.gov (United States)

Bousquet, J; Bourret, R; Camuzat, T; Augé, P; Bringer, J; Noguès, M; Jonquet, O; de la Coussaye, J E; Ankri, J; Cesari, M; Guérin, O; Vellas, B; Blain, H; Arnavielhe, S; Avignon, A; Combe, B; Canovas, G; Daien, C; Dray, G; Dupeyron, A; Jeandel, C; Laffont, I; Laune, D; Marion, C; Pastor, E; Pélissier, J Y; Galan, B; Reynes, J; Reuzeau, J C; Bedbrook, A; Granier, S; Adnet, P A; Amouyal, M; Alomène, B; Bernard, P L; Berr, C; Caimmi, D; Claret, P G; Costa, D J; Cristol, J P; Fesler, P; Hève, D; Millot-Keurinck, J; Morquin, D; Ninot, G; Picot, M C; Raffort, N; Roubille, F; Sultan, A; Touchon, J; Attalin, V; Azevedo, C; Badin, M; Bakhti, K; Bardy, B; Battesti, M P; Bobia, X; Boegner, C; Boichot, S; Bonnin, H Y; Bouly, S; Boubakri, C; Bourrain, J L; Bourrel, G; Bouix, V; Bruguière, V; Cade, S; Camu, W; Carre, V; Cavalli, G; Cayla, G; Chiron, R; Coignard, P; Coroian, F; Costa, P; Cottalorda, J; Coulet, B; Coupet, A L; Courrouy-Michel, M C; Courtet, P; Cros, V; Cuisinier, F; Danko, M; Dauenhauer, P; Dauzat, M; David, M; Davy, J M; Delignières, D; Demoly, P; Desplan, J; Dujols, P; Dupeyron, G; Engberink, O; Enjalbert, M; Fattal, C; Fernandes, J; Fouletier, M; Fraisse, P; Gabrion, P; Gellerat-Rogier, M; Gelis, A; Genis, C; Giraudeau, N; Goucham, A Y; Gouzi, F; Gressard, F; Gris, J C; Guillot, B; Guiraud, D; Handweiler, V; Hayot, M; Hérisson, C; Heroum, C; Hoa, D; Jacquemin, S; Jaber, S; Jakovenko, D; Jorgensen, C; Kouyoudjian, P; Lamoureux, R; Landreau, L; Lapierre, M; Larrey, D; Laurent, C; Léglise, M S; Lemaitre, J M; Le Quellec, A; Leclercq, F; Lehmann, S; Lognos, B; Lussert, Cj M; Makinson, A; Mandrick, K; Mares, P; Martin-Gousset, P; Matheron, A; Mathieu, G; Meissonnier, M; Mercier, G; Messner, P; Meunier, C; Mondain, M; Morales, R; Morel, J; Mottet, D; Nérin, P; Nicolas, P; Nouvel, F; Paccard, D; Pandraud, G; Pasdelou, M P; Pasquié, J L; Patte, K; Perrey, S; Pers, Y M; Portejoie, F; Pujol, J L E; Quantin, X; Quéré, I; Ramdani, S; Ribstein, J; Rédini-Martinez, I; Richard, S; Ritchie, K; Riso, J P; Rivier, F; Robine, J M; Rolland, C; Royère, E; Sablot, D; Savy, J L; Schifano, L; Senesse, P; Sicard, R; Stephan, Y; Strubel, D; Tallon, G; Tanfin, M; Tassery, H; Tavares, I; Torre, K; Tribout, V; Uziel, A; Van de Perre, P; Venail, F; Vergne-Richard, C; Vergotte, G; Vian, L; Vialla, F; Viart, F; Villain, M; Viollet, E; Ychou, M; Mercier, J

2016-01-01

The Région Languedoc Roussillon is the umbrella organisation for an interconnected and integrated project on active and healthy ageing (AHA). It covers the 3 pillars of the European Innovation Partnership on Active and Healthy Ageing (EIP on AHA): (A) Prevention and health promotion, (B) Care and cure, (C) and (D) Active and independent living of elderly people. All sub-activities (poly-pharmacy, falls prevention initiative, prevention of frailty, chronic respiratory diseases, chronic diseases with multimorbidities, chronic infectious diseases, active and independent living and disability) have been included in MACVIA-LR which has a strong political commitment and involves all stakeholders (public, private, patients, policy makers) including CARSAT-LR and the Eurobiomed cluster. It is a Reference Site of the EIP on AHA. The framework of MACVIA-LR has the vision that the prevention and management of chronic diseases is essential for the promotion of AHA and for the reduction of handicap. The main objectives of MACVIA-LR are: (i) to develop innovative solutions for a network of Living labs in order to reduce avoidable hospitalisations and loss of autonomy while improving quality of life, (ii) to disseminate the innovation. The three years of MACVIA-LR activities are reported in this paper.

Instruction texts and problems for the training and examination of selected personnel at research nuclear facilities

International Nuclear Information System (INIS)

Matejka, K.; Fleischhans, J.; Hejzlar, R.

1994-01-01

The publication comprises 6 separate brochures: (1) Selected chapters in reactor theory; (2) Experimental education methods; (3) Research and experimental reactors; (4.1) Technical description of the LVR-15 reactor; (4.2) Technical description of the LR-0 reactor; (4.3) Technical description of the VR-1 reactor; (5) Research reactor safety and operation; and (6) Database of problems for qualification examinations. Brochure No. 4 consists of 3 separate parts. The publication is intended for the training and examination of the following research reactor staff: reactor operator, shift engineer, control physicist, and start-up group head. (J.B.)

Revisiting the Ceara Rise, equatorial Atlantic Ocean: isotope stratigraphy of ODP Leg 154 from 0 to 5 Ma

Directory of Open Access Journals (Sweden)

R. H. Wilkens

2017-07-01

Full Text Available Isotope stratigraphy has become the method of choice for investigating both past ocean temperatures and global ice volume. Lisiecki and Raymo (2005 published a stacked record of 57 globally distributed benthic δ18O records versus age (LR04 stack. In this study LR04 is compared to high-resolution records collected at all of the sites drilled during ODP Leg 154 on the Ceara Rise, in the western equatorial Atlantic Ocean. Newly developed software is used to check data splices of the Ceara Rise sites and better align out-of-splice data with in-splice data. Core images recovered from core table photos are depth and age scaled and greatly assist in the data analysis. The entire splices of ODP sites 925, 926, 927, 928 and 929 were reviewed. Most changes were minor although several were large enough to affect age models based on orbital tuning. A Ceara Rise composite record of benthic δ18O is out of sync with LR04 between 1.80 and 1.90 Ma, where LR04 exhibits two maxima but Ceara Rise data contain only one. The interval between 4.0 and 4.5 Ma in the Ceara Rise compilation is decidedly different from LR04, reflecting both the low amplitude of the signal over this interval and the limited amount of data available for the LR04 stack. A regional difference in benthic δ18O of 0.2 ‰ relative to LR04 was found. Independent tuning of Site 926 images and physical property data to the Laskar et al. (2004 orbital solution and integration of available benthic stable isotope data from the Ceara Rise provides a new regional reference section for the equatorial Atlantic covering the last 5 million years.

Ciudad Juárez en los sesenta: la estructura urbana en transición

Directory of Open Access Journals (Sweden)

Luis Enrique Gutiérrez Casas

2009-01-01

Full Text Available El presente trabajo está estructurado de tal forma que puedan cubrirse, de manera general, los distintos aspectos que consideramos explican el problema de la vivienda en Ciudad Juárez. En la primera parte planteamos el problema de la vivienda desde varios aspectos, déficit, bajos salarios y pérdida del poder adquisitivo de los trabajadores, fluctuación del mercado inmobiliario, crecimiento poblacional, cambios en la composición del mercado laboral, flujos migratorios, políticas económicas y de vivienda. En la segunda parte centramos nuestro análisis en los AHI. Sus rasgos principales son las formas irregulares de apropiación del suelo urbano, la autoconstrucción y la introducción ilegal de servicios públicos, entre otros.

En femenino: Apuntes sobre la obra de Esperanza Barroso y Raquel Ramírez

Directory of Open Access Journals (Sweden)

Andrés Leonardo Caballero Piza

2016-03-01

Full Text Available El siguiente artículo proporciona algunas coordenadas de interpretación para la obra de las artistas santandereanas Esperanza Barroso y Raquel Ramírez, desde los conceptos de currículo oculto y micropolítica, y desde diversas fuentes documentales de carácter historiográfico (catálogos, folletos, recortes de prensa y entrevistas. Mediante el concepto de currículo oculto se reconstruye de forma general el ámbito en que fueron educadas ambas artistas, mientras que con el de micropolítica se inscriben sus obras en las preocupaciones del arte colombiano de los setentas, que giraron en torno de los modos de representación del cuerpo desde el deseo individual, la emancipación subjetiva y las restricciones jurídicas del Estado.

Validation of the VTT's reactor physics code system

International Nuclear Information System (INIS)

Tanskanen, A.

1998-01-01

At VTT Energy several international reactor physics codes and nuclear data libraries are used in a variety of applications. The codes and libraries are under constant development and every now and then new updated versions are released, which are taken in use as soon as they have been validated at VTT Energy. The primary aim of the validation is to ensure that the code works properly, and that it can be used correctly. Moreover, the applicability of the codes and libraries are studied in order to establish their advantages and weak points. The capability of generating program-specific nuclear data for different reactor physics codes starting from the same evaluated data is sometimes of great benefit. VTT Energy has acquired a nuclear data processing system based on the NJOY-94.105 and TRANSX-2.15 processing codes. The validity of the processing system has been demonstrated by generating pointwise (MCNP) and groupwise (ANISN) temperature-dependent cross section sets for the benchmark calculations of the Doppler coefficient of reactivity. At VTT Energy the KENO-VI three-dimensional Monte Carlo code is used in criticality safety analyses. The KENO-VI code and the 44GROUPNDF5 data library have been validated at VTT Energy against the ZR-6 and LR-0 critical experiments. Burnup Credit refers to the reduction in reactivity of burned nuclear fuel due to the change in composition during irradiation. VTT Energy has participated in the calculational VVER-440 burnup credit benchmark in order to validate criticality safety calculation tools. (orig.)

Validation of thermal hydraulic computer codes for advanced light water reactor

International Nuclear Information System (INIS)

Macek, J.

2001-01-01

The Czech Republic operates 4 WWER-440 units, two WWER-1000 units are being finalised (one of them is undergoing commissioning). Thermal-hydraulics Department of the Nuclear Research Institute Rez performs accident analyses for these plants using a number of computer codes. To model the primary and secondary circuits behaviour the system codes ATHLET, CATHARE, RELAP, TRAC are applied. Containment and pressure-suppressure system are modelled with RALOC and MELCOR codes, the reactor power calculations (point and space-neutron kinetics) are made with DYN3D, NESTLE and CDF codes (FLUENT, TRIO) are used for some specific problems. An integral part of the current Czech project 'New Energy Sources' is selection of a new nuclear source. Within this and the preceding projects financed by the Czech Ministry of Industry and Trade and the EU PHARE, the Department carries and has carried out the systematic validation of thermal-hydraulic and reactor physics computer codes applying data obtained on several experimental facilities as well as the real operational data. The paper provides a concise information on these activities of the NRI and its Thermal-hydraulics Department. A detailed example of the system code validation and the consequent utilisation of the results for a real NPP purposes is included. (author)

Dose rates modeling of pressurized water reactor primary loop components with SCALE6.0

International Nuclear Information System (INIS)

Matijević, Mario; Pevec, Dubravko; Trontl, Krešimir

2015-01-01

Highlights: • Shielding analysis of the typical PWR primary loop components was performed. • FW-CADIS methodology was thoroughly investigated using SCALE6.0 code package. • Versatile ability of SCALE6.0/FW-CADIS for deep penetration models was proved. • The adjoint source with focus on specific material can improve MC modeling. - Abstract: The SCALE6.0 simulation model of a typical PWR primary loop components for effective dose rates calculation based on hybrid deterministic–stochastic methodology was created. The criticality sequence CSAS6/KENO-VI of the SCALE6.0 code package, which includes KENO-VI Monte Carlo code, was used for criticality calculations, while neutron and gamma dose rates distributions were determined by MAVRIC/Monaco shielding sequence. A detailed model of a combinatorial geometry, materials and characteristics of a generic two loop PWR facility is based on best available input data. The sources of ionizing radiation in PWR primary loop components included neutrons and photons originating from critical core and photons from activated coolant in two primary loops. Detailed calculations of the reactor pressure vessel and the upper reactor head have been performed. The efficiency of particle transport for obtaining global Monte Carlo dose rates was further examined and quantified with a flexible adjoint source positioning in phase-space. It was demonstrated that generation of an accurate importance map (VR parameters) is a paramount step which enabled obtaining Monaco dose rates with fairly uniform uncertainties. Computer memory consumption by the S N part of hybrid methodology represents main obstacle when using meshes with large number of cells together with high S N /P N parameters. Detailed voxelization (homogenization) process in Denovo together with high S N /P N parameters is essential for precise VR parameters generation which will result in optimized MC distributions. Shielding calculations were also performed for the reduced PWR

CaMn0.875Ti0.125O3 as oxygen carrier for chemical-looping combustion with oxygen uncoupling (CLOU)—Experiments in a continuously operating fluidized-bed reactor system

KAUST Repository

Rydén, Magnus

2011-03-01

Particles of the perovskite material CaMn0.875Ti0.125O3 has been examined as oxygen carrier for chemical-looping with oxygen uncoupling, and for chemical-looping combustion of natural gas, by 70h of experiments in a circulating fluidized-bed reactor system. For the oxygen uncoupling experiments, it was found that the particles released O2 in gas phase at temperatures above 720°C when the fuel reactor was fluidized with CO2. The effect increased with increased temperature, and with the O2 partial pressure in the air reactor. At 950°C, the O2 concentration in the outlet from the fuel reactor was in the order of 4.0vol%, if the particles were oxidized in air. For the chemical-looping combustion experiments the combustion efficiency with standard process parameters was in the order of 95% at 950°C, using 1000kg oxygen carrier per MW natural gas, of which about 30% was located in the fuel reactor. Reducing the fuel flow so that 1900kg oxygen carrier per MW natural gas was used improved the combustion efficiency to roughly 99.8%. The particles retained their physical properties, reactivity with CH4 and ability to release gas-phase O2 reasonably well throughout the testing period and there were no problems with the fluidization or formation of solid carbon in the reactor. X-ray diffraction showed that the particles underwent changes in their phase composition though. © 2010 Elsevier Ltd.

Impactos de la maquila en el medio ambiente de Ciudad Juárez

Directory of Open Access Journals (Sweden)

Centro de Estudios Regionales y Comunicación Alternativa (CERCA

2009-01-01

Full Text Available En el presente trabajo analizamos, de manera general, los cambios que ha generado el proyecto maquilador en Ciudad Juárez. Primero observamos su efecto sobre el crecimiento de la mancha urbana, la dotación de servicios, etcétera, su repercusión en el medio ambiente y las condiciones de vida de la población juarense. Nos planteamos, además, ubicar los principales problemas causados por el desarrollo de la industria maquiladora, particularmente en lo relativo a los desechos tóxicos y nucleares, así como apuntar la tendencia del proyecto económico-urbano que ésta ha impuesto en nuestra ciudad, para concluir con una breve presentación de las reacciones populares y algunas propuestas ante el problema. Asimismo, exponemos los problemas de contaminación que resultan de otras actividades no vinculadas a la industria maquiladora.

Street Art at the Border: Representations of Violence and Death in Ciudad Juárez

Directory of Open Access Journals (Sweden)

Diana Alejandra SILVA LONDOÑO

2016-01-01

Full Text Available El objetivo de este artículo es realizar una lectura interpretativa de las tramas de sentido de la violencia y la muerte violenta en Ciudad Juárez, a partir de su representación en el arte urbano. Por medio de entrevistas en profundidad, observación participante, recorridos urbanos y regis - tro fotográf ico de la producción artística de los colectivos de arte urbano fronterizo se explora cómo las/os jóvenes se conciben a sí mismas/os, perciben su experiencia biográf ica y cuáles son sus márgenes de agencia desde las prácticas artísticas en contextos de violencia.

Design and Analysis of the Power Control System of the Fast Zero Energy Reactor FR-0

Energy Technology Data Exchange (ETDEWEB)

Schuh, N J.H.

1966-12-15

This report describes the power control by means of the fine-control rod and the design of the control system of the fast zero energy reactor FR-0 located in Studsvik, Sweden. System requirements and some operational conditions were used as design criteria. Manual and automatic control is possible. Variable electronic end-stops for the control rod have been designed, because of the special construction of the reactor and control rod. Noise in the control system caused by the reactor, detector and electronics caused disturbances of the control system at the lower power levels. The noise power-spectrum was measured. Statistical design methods, using the measured noise power spectrum, were used to design filters, which will reduce the influence of the noise at the lower power levels. Root Loci sketches and Bode diagrams were used for stability analyses. The system was simulated on an analogue computer, taking into account even nonlinearities of the control system and noise. Typical cases of reactor operation were simulated and stability analysis performed.

Design and Analysis of the Power Control System of the Fast Zero Energy Reactor FR-0

International Nuclear Information System (INIS)

Schuh, N.J.H.

1966-12-01

This report describes the power control by means of the fine-control rod and the design of the control system of the fast zero energy reactor FR-0 located in Studsvik, Sweden. System requirements and some operational conditions were used as design criteria. Manual and automatic control is possible. Variable electronic end-stops for the control rod have been designed, because of the special construction of the reactor and control rod. Noise in the control system caused by the reactor, detector and electronics caused disturbances of the control system at the lower power levels. The noise power-spectrum was measured. Statistical design methods, using the measured noise power spectrum, were used to design filters, which will reduce the influence of the noise at the lower power levels. Root Loci sketches and Bode diagrams were used for stability analyses. The system was simulated on an analogue computer, taking into account even nonlinearities of the control system and noise. Typical cases of reactor operation were simulated and stability analysis performed

Historias de dictadura. Primeros cuentos de Sergio Ramírez

Directory of Open Access Journals (Sweden)

María del Pilar Ríos

2017-07-01

Full Text Available Los primeros textos del escritor nicaragüense Sergio Ramírez presentan algunos elementos que conforman, a manera de mosaico, los principales rasgos de la vida individual y social durante la larga dictadura somocista (1936 – 1979. Poder, violencia, dependencia política, social y económica son algunas de las problemáticas que asoman y su tratamiento se acentúa o modifica entre una publicación y otra más allá del orden de aparición. Asimismo, en el marco de las luchas por la liberación encabezadas por el Frente Sandinista de Liberación Nacional (FSLN, se cuestiona la función del arte y del intelectual. Propongo una serie de cuentos incluidos en Cuentos (1963, Nuevos Cuentos (1969 y Charles Atlas también muere (1976 en la que reviso, en primera instancia, la postura en torno al arte y al intelectual que exponen mediante la autofiguración del autor. Luego, exploro algunos elementos que conforman esos mundos narrativos y que funcionan como denuncia político-social al mismo tiempo que imaginan y reivindican una nueva nación en sintonía con los postulados presentes en las luchas revolucionarias.

In vitro translocation experiments with RxLR-reporter fusion proteins of Avr1b from Phytophthora sojae and AVR3a from Phytophthora infestans fail to demonstrate specific autonomous uptake in plant and animal cells.

Science.gov (United States)

Wawra, Stephan; Djamei, Armin; Albert, Isabell; Nürnberger, Thorsten; Kahmann, Regine; van West, Pieter

2013-05-01

Plant-pathogenic oomycetes have a large set of secreted effectors that can be translocated into their host cells during infection. One group of these effectors are the RxLR effectors for which it has been shown, in a few cases, that the RxLR motif is important for their translocation. It has been suggested that the RxLR-leader sequences alone are enough to translocate the respective effectors into eukaryotic cells through binding to surface-exposed phosphoinositol-3-phosphate. These conclusions were primary based on translocation experiments conducted with recombinant fusion proteins whereby the RxLR leader of RxLR effectors (i.e., Avr1b from Phytophthora sojae) were fused to the green fluorescent protein reporter-protein. However, we failed to observe specific cellular uptake for a comparable fusion protein where the RxLR leader of the P. infestans AVR3a was fused to monomeric red fluorescent protein. Therefore, we reexamined the ability of the reported P. sojae AVR1b RxLR leader to enter eukaryotic cells. Different relevant experiments were performed in three independent laboratories, using fluorescent reporter fusion constructs of AVR3a and Avr1b proteins in a side-by-side comparative study on plant tissue and human and animal cells. We report that we were unable to obtain conclusive evidence for specific RxLR-mediated translocation.

Calculation methodology validation. Pt. 2/01-R. Calculation of the multiplication factor for eight experiments with a critical set of nineteen VVER-440 fuel assemblies

International Nuclear Information System (INIS)

Kyncl, J.

2001-04-01

Comparison calculations were performed for 8 experiments accomplished in 2000 on the LR-0 reactor. The MCNP4a code was applied using effective cross section data in the continuous representation as per the ENDF/B-VI library. (P.A.)

siRNA - Mediated LRP/LR knock-down reduces cellular viability of malignant melanoma cells through the activation of apoptotic caspases.

Science.gov (United States)

Rebelo, Thalia M; Vania, Leila; Ferreira, Eloise; Weiss, Stefan F T

2018-07-01

The 37 kDa/67 kDa laminin receptor (LRP/LR) is over-expressed in tumor cells and has been implicated in several tumourigenic processes such as metastasis and telomerase activation, however, more importantly the focus of the present study is on the maintenance of cellular viability and the evasion of apoptosis. The aim of the study was to investigate the role of LRP/LR on the cellular viability of early (A375) and late stage (A375SM) malignant melanoma cells. Flow cytometry and western blot analysis revealed that A375SM cells contain more cell-surface and total LRP/LR levels in comparison to the A375 cells, respectively. In order to determine the effect of LRP/LR on cell viability and apoptosis, LRP was down-regulated via siRNA technology. MTT assays revealed that LRP knock-down led to significant reductions in the viability of A375 and A375SM cells. Confocal microscopy indicated nuclear morphological changes suggestive of apoptotic induction in both cell lines and Annexin-V FITC/PI assays confirmed this observation. Additionally, caspase-3 activity assays revealed that apoptosis was induced in both cell lines after siRNA-mediated down-regulation of LRP. Caspase-8 and -9 activity assays suggested that post LRP knock-down; A375 cells undergo apoptosis solely via the extrinsic pathway, while A375SM cells undergo apoptosis via the intrinsic pathway. siRNAs mediated LRP knock-down might represent a powerful alternative therapeutic strategy for the treatment of malignant melanoma through the induction of apoptosis. Copyright © 2018. Published by Elsevier Inc.

The NACA Exceptional Service Medal presented at the NACA High Speed Flight Station. L-R: Hugh Dryden

Science.gov (United States)

1956-01-01

The NASA exceptional Service Medal presented at the NACA High Speed Flight Station. L-R: Hugh Dryden, Joe Walker (X-1A research pilot), Stan Butchart (pilot of the B-29 mothership), Richard Payne (X-1A crew chief).

LOFT reactor vessel 290/sup 0/ downcomer stalk instrument penetration flange stress analysis

Energy Technology Data Exchange (ETDEWEB)

Finicle, D.P.

1978-06-06

The LOFT Reactor Vessel 290/sup 0/ Downcomer Stalk Instrument Penetration Flange Stress Analysis has been completed using normal operational and blowdown loading. A linear elastic analysis was completed using simplified hand analysis techniques. The analysis was in accordance with the 1977 ASME Boiler and Pressure Vessel Code, Section III, for a Class 1 component. Loading included internal pressure, bolt preload, and thermal gradients due to normal operating and blowdown.

Measuring heat transfer through TR-0 reactor fuel element

International Nuclear Information System (INIS)

Nemec, V.; Turzik, Z.; Vitek, M.

1977-05-01

The time course of temperatures of the peripheral and the central fuel pins of the TR-O reactor was studied during moderator temperature changes using a model. The formula T=Tsub(e)+(Tsub(o)-Tsub(e)).exp(-t/tsub(e)) applies, where T is the pin temperature, Tsub(o) the initial pin temperature, Tsub(e) is the steady-state bath temperature, tsub(e) the time constant of temperature equilibration and t the time required for a temperature change from value Tsub(o) to T. For the bath level height H=1 m the tsub(e) value for the central pin was determined to be 1.05 hours, for the peripheral pin 0.96 hour; for level height H=2 m the values were 2.1 and 2.12 hours, respectively. The dependence found will allow correcting the experimental results in measurements with heated moderator for fuel temperature changes. (Ha)

La cultura del feminicidio en Ciudad Juárez, 1993-1999

Directory of Open Access Journals (Sweden)

Julia Estela Fragoso Monárrez

2000-01-01

Full Text Available El proposito de esta investigación es analizar los asesinatos cometidos contra niñas y mujeres de Ciudad Juárez en los años de 1993 a 1999, a través de la categoría analítica del feminicidio. Diferenciar las distintas clases de feminicidios y delinear los perfiles sociodemográficos de vulnerabilidad de las niñas y las mujeres asesinadas. Finalmente clasificar la relación de parentesco entre la víctima y el victimario. Los datos se recolectaron de fuentes secundarias y oficiales para 162 víctimas. Los resultados arrojan un perfil preliminar sociodemográfico de las víctimas y confirman la existencia de varios tipos de feminicidios en algunos casos en relación a la ocupación de las víctimas. En cuanto a la noción de un asesino serial o una epidemia de machismo que repite patrones de exterminio, ambas categorías se encuentran presentes. Los resultados también confirman una relación de parentesco o desconocimiento entre las víctimas y el victimario

El impuesto predial en Ciudad Juárez desde una perspectiva de equidad

Directory of Open Access Journals (Sweden)

Sergio Peña-Medina

2016-01-01

Full Text Available El aspecto de equidad en el impuesto predial es un tema relevante que se aborda en este artículo. Ésta se diferencia entre vertical y horizontal; la primera se refiere a un enfoque progresivo en donde aquellas propiedades que valen más pagan una tasa superior a las de menor valor; la equidad horizontal apunta a un tema de valuación y, en ella, las propiedades comparables pagan la misma tasa. El artículo tiene como objetivo poner a prueba la hipótesis de regresividad del impuesto predial; se argumenta que ésta es inequitativa dado que en términos proporcionales las propiedades de menor valor pagan una tasa superior a las de mayor valor. Los resultados en esta investigación soportan la hipótesis de que existe un efecto de regresividad en el impuesto predial en Ciudad Juárez; consecuentemente es importante reflexionar sobre la estructura actual del sistema catastral.

Parameters of calibration of the measurement system of {sup 222} Rn based in LR-115; Parametros de calibracion del sistema de medicion de {sup 222} Rn basado en LR-115

Energy Technology Data Exchange (ETDEWEB)

Garcia, M.L.; Mireles, F.; Quirino, L.; Davila, I.; Lugo, F.; Pinedo, J.L. [CREN-UAZ, 98068 Zacatecas (Mexico); Chavez, A. [ININ, 52045 Ocoyoacac, Estado de Mexico (Mexico)]. e-mail: mluisagb@hotmail.com

2003-07-01

Since the SSNTD technique (Solid State Nuclear Track Detection) it was discovered it has been used as passive method for the detection of subnuclear particles in great variety of fields of the science. The use of the technique in measurements of {sup 222} Rn in air have already been established implying better methodologies in the exhibition to the environment until their engraving and reading processes. The SSNTD technique is since a method by comparison since the material it can be used a single time, therefore it requires of calibration in one controlled radon atmosphere, using gauged standards. The objective of this work is to show the calibration of the devices used as radon monitors based on SSNTD. The material used as SSNTD is LR-115 Il. The standardization of the parameters used in the exhibition to radon in air, engraving and reading process, its are based on the response of the LR-115 Il, the one arrangement of the device, engraving speed and mainly the calibration factor. They are considered two types of monitors: Open camera and Closed camera, the difference among the calibration factors of both cameras is the percentage of the descendants of radon in the open camera. The standardized parameters are operation voltage of the counting system; temperature, time and concentration of the engraving solution; and thickness. (Author)

Implementation of the k0 technique using multi-detectors on diverse irradiation facilities of TRIGA Reactor

International Nuclear Information System (INIS)

Caldera C, M. de G.

2013-01-01

The k 0 method with the technique of neutron activation analysis allows obtaining important characteristics parameters that describe a nuclear reactor. Among these parameters are the form factor of epithermal neutron flux, α and the ratio of thermal neutron flux with respect to the epithermal neutron flux, f. These parameters were obtained by irradiation of two different monitors, one of Au-Zr and the other of Au-Mo-Cr, where the last one was made and implemented for the first time. Both monitors were irradiated in different positions in the TRIGA Mark III Reactor at the National Institute of Nuclear Research. (Author)

Castigo divino, de Sergio Ramírez, novela policial, folletinesca, satírica y autorreflexiva

Directory of Open Access Journals (Sweden)

Gisela Kozak Rovero

2014-06-01

Full Text Available La historia de Castigo divino, del nicaragüense Sergio Ramírez (1942, podría figurar perfectamente en las páginas de cualquier periódico amarillista. Sexo, dinero, poder, muerte y equívoco son los ingredientes perfectos de un suceso estremecedor capaz de despertar el morbo colectivo: un triple asesinato con estricnina, perpetrado por un joven abogado de veinticinco años en las personas de su propia esposa, una posible amante y el padre de ésta. La novela se construye a modo de expediente del caso, combinando registros diversos y divergentes, propios de la industria cultural y de discursos “no literarios”, como se evidencia sin problemas con un simple repaso de los títulos de las partes y capítulos del texto.

New nuclear data group constant sets for fusion reactor nuclear analyses based on JENDL-4.0 and FENDL-3.0

International Nuclear Information System (INIS)

Konno, Chikara; Ohta, Masayuki; Kwon, Saerom; Ochiai, Kentaro; Sato, Satoshi

2015-01-01

We have produced new nuclear data group constant sets from JENDL-4.0 and FENDL-3.0 for fusion reactor nuclear analyses; FUSION-J40-175, FUSION-F30-175 (40 materials, neutron 175 groups, gamma 42 groups), FUSION-J40-42 and FUSION-F30-42 (40 materials, neutron 42 groups, gamma 21 groups). MATXS files of JENDL-4.0 and FENDL-3.0 were newly produced with the NJOY2012 code. FUSION-J40-175, FUSION-J40-42, FUSION-F30-175 and FUSION-F30-42 were produced with the TRANSX code. KERMA factors, DPA and gas production cross-section data were also prepared from the MATXS files with TRANSX. Test calculations were carried out in order to validate these nuclear group constant sets. They suggested that these group constant sets had no problem. (author)

Microcystin-LR equivalent concentrations in fish tissue during a postbloom Microcystis exposure in Loskop Dam, South Africa

CSIR Research Space (South Africa)

Nchabeleng, T

2014-12-01

Full Text Available The effects of a decomposing cyanobacteria bloom on water quality and the accumulation of microcystin-LR equivalent toxin in fish at Loskop Dam were studied in May 2012. Enzyme-linked immunosorbent assay [ELISA] was used to confirm the presence...

Evaluation of LR-115 cellulose nitrate film for use in bone autoradiography

International Nuclear Information System (INIS)

Harris, M.J.; Schlenker, R.A.

1977-01-01

An evaluation of Kodak LR-115 cellulose nitrate (CN) film for alpha autoradiography of radium-burdened bone was undertaken. Comparison of the registration efficiency between a plaster of Paris radiator and bone samples on NTA nuclear track emulsion and on the CN film is presented. CN film was observed to record as etched-through holes 11 percent and as tracks only 32 percent of the events detected by NTA emulsion. Potential advantages and disadvantages of using CN film in microdosimetry and for adapting it to automated analysis are discussed

Application of the LR-56 at DOE Facilities in the United States

International Nuclear Information System (INIS)

Smith, A.C.

1998-05-01

The ability to ship Type B liquid packages will be necessary for the nuclear industry to meet the energy production requirements of the next century. There are no packages licensed in the United States for transportation of large quantities of such liquids at present. Packages designed for transporting liquids must address technical challenges and incorporate features which are not common to packages designed for solid contents. These issues and the methods of addressing them are illustrated by the safety analysis performed for utilization of the LR-56 Liquid Package at US DOE facilities

Experimental Studies on Assemblies 1 and 2 of the Fast Reactor FR-0. Part 1

Energy Technology Data Exchange (ETDEWEB)

Andersson, T L; Hellstrand, E; Londen, S O; Tiren, L I

1965-08-15

FR0 is a fast zero power reactor built for experiments in reactor physics. It is a split table machine containing vertical fuel elements. 120 kg of U{sup 235} are available as fuel, which is fabricated into metallic plates of 20 % enrichment. The control system comprises 5 spring-loaded safety elements and 3 + 1 elements for startup operations and power control. The reactor went critical in February 1964. The first assemblies studied were made up of undiluted fuel into a cylindrical and a spherical core, respectively, surrounded by a reflector made of copper. The present report describes some experiments made on these systems. Primarily, critical mass determinations, flux distribution measurements and studies of the conversion ratio are dealt with. The measured quantities have been compared with theoretical predictions using various transport theory programmes (DSN, TDC) and cross section sets. The experimental results show that the neutron spectrum in the copper reflector is softer than predicted, but apart from this discrepancy agreement with theory has generally been obtained.

Criticality analysis of IPEN/MB-01 reactor using scale 6.0 and ENDF/B VII

International Nuclear Information System (INIS)

Cardoso, Fabiano S.; Salome, Jean; Pereira, Claubia; Fortini, Angela

2015-01-01

Since 1988, the IPEN/MB-01 reactor has been utilized for basic reactor physics research and as an instructional laboratory system. A series of experiments was conducted, and many of the components were evaluated in LEU-COMP-THERM-077 and LEU-COMP-THERM-089 benchmarks. In this work, we will compare the benchmark value references, with the newest ENDF/BVII libraries for neutron transport calculations through KENO-VI of the SCALE 6.0 codes. The 3D reactor model was simulated using 238 groups of energy and continuous energy libraries. The idea was to obtain, on this work, preliminary values of effective neutron multiplication factor to guide future work to get nuclear data as neutron flux, depleted fuel isotopic composition and generate homogenized and collapsed cross-sections libraries by few neutron energy groups to be used by other neutronic codes. It is expected that this study will produce a research source to be used as a support for future works employing such codes for nuclear safety criticality analysis and to verify compliance with the requirements of safety standards for nuclear fuel materials. (author)

Microcystin-LR exposure induces developmental neurotoxicity in zebrafish embryo

International Nuclear Information System (INIS)

Wu, Qin; Yan, Wei; Liu, Chunsheng; Li, Li; Yu, Liqin; Zhao, Sujuan; Li, Guangyu

2016-01-01

Microcystin-LR (MCLR) is a commonly acting potent hepatotoxin and has been pointed out of potentially causing developmental neurotoxicity, but the exact mechanism is little known. In this study, zebrafish embryos were exposed to 0, 0.8, 1.6 or 3.2 mg/L MCLR for 120 h. MCLR exposure through submersion caused serious hatching delay and body length decrease. The content of MCLR in zebrafish larvae was analyzed and the results demonstrated that MCLR can accumulate in zebrafish larvae. The locomotor speed of zebrafish larvae was decreased. Furthermore, the dopamine and acetylcholine (ACh) content were detected to be significantly decreased in MCLR exposure groups. And the acetylcholinesterase (AChE) activity was significantly increased after exposure to 1.6 and 3.2 mg/L MCLR. The transcription pattern of manf, chrnα7 and ache gene was consistent with the change of the dopamine content, ACh content and AChE activity. Gene expression involved in the development of neurons was also measured. α1-tubulin and shha gene expression were down-regulated, whereas mbp and gap43 gene expression were observed to be significantly up-regulated upon exposure to MCLR. The above results indicated that MCLR-induced developmental toxicity might attribute to the disorder of cholinergic system, dopaminergic signaling, and the development of neurons. - Highlights: • MCLR accumulation induces developmental neurotoxicity in zebrafish embryo. • The decrease of dopamine levels might be associated with the MCLR-induced developmental neurotoxicity in zebrafish larvae. • The alternation of cholinergic system might contribute to the change of neurobehavior in zebrafish larvae exposure with MCLR. - MCLR accumulation induces developmental neurotoxicity by affecting cholinergic system, dopaminergic signaling, and the development of neurons in zebrafish embryo.

Nuevos hallazgos documentales y biográficos sobre Alonso Xuárez maestro de Sebastián Durón

Directory of Open Access Journals (Sweden)

de la Fuente Charfolé, José Luis

2012-12-01

Full Text Available Alonso Xuárez was no minor composer in the musical field of his time. The quality and effectiveness of his compositions makes them deserving of a leading place in Spanish and European music of the 17^th century. In spite of this almost nothing is known about this composer prior to his being appointed to teach in the chapel of Cuenca cathedral. Virtually all the currently available data is of a secondary and collateral nature and arises from research into his disciple the organist Sebastián Durón, the renowned opera composer and teacher at the Capilla Real of Charles II.

Alonso Xuárez no fue un compositor menor dentro del panorama musical de su tiempo. La calidad y eficacia de su música merece estar en primera línea de la música española y europea del siglo XVII. Sin embargo, el desconocimiento de este músico es casi completo con anterioridad a su nombramiento en el magisterio de capilla de la catedral de Cuenca. Prácticamente todos los datos expuestos hasta el momento han sido restos secundarios y colaterales desprendidos de otras investigaciones realizadas sobre la figura de su discípulo, el reputado compositor de teatro lírico y maestro de la Capilla Real de Carlos II, el organista Sebastián Durón.

The Good News of the prophet-woman: identity and political culture in the writings of Fourierists Mª Josefa Zapata and Margarita Pérez de Celis | La Buena Nueva de la mujer profeta: identidad y cultura política en las fourieristas Mª Josefa Zapata y Margarita Pérez de Celis

Directory of Open Access Journals (Sweden)

Gloria Espigado Tocino

2008-12-01

Full Text Available This article describes how the Fourierists Josefa Zapata and Margarita Pérez de Celis constructed a liberating identity for women through their writings in their own newspapers. Followers of the theories of the French utopian socialist Charles Fourier, they used a prophetic form of discourse to announce the advent of a new era for mankind, in which women would be redeemed. Advocates of a humanitarian Christianity which sought to correct fundamental social inequalities, they were, however, subject to censorship which was always on the alert for the threat of subversion that their discourse entailed. | Este artículo describe cómo las fourieristas Josefa Zapata y Margarita Pérez de Celis construyeron una identidad emancipadora para la mujer, a través de sus escritos en sus propios periódicos. Seguidoras de las teorías del socialista utópico francés Charles Fourier, adoptaron la expresión profética para anunciar el advenimiento de una nueva era para la humanidad, donde la mujer sería igualmente redimida. Seguidoras de un cristianismo humanitarista que resolviera los desequilibrios sociales fundamentales fueron, sin embargo, objeto de la censura que estuvo atenta a la amenaza de subversión que su discurso encerraba.

Valoración del aporte nutricional y su relación con el estado nutricional de los niños de primer y segundo grado de primaria de la I.E. Pérez Araníbar

OpenAIRE

Paredes Aramburú, Jacqueline

2014-01-01

Informe final de actividades de Internado en Comunidad, sede Puericultorio Pérez Araníbar. Carrera de Nutrición y Dietética, Facultad de Ciencias de la Salud. Universidad Peruana de Ciencias Aplicadas (UPC). Lima, Perú. 30 de setiembre de 2014. El Puericultorio Pérez Araníbar es el albergue de niños, niñas y adolescentes más grande del Perú y de América Latina. Es una institución que se encarga de albergar en promedio a 230 niños que se encuentran en estado de abandono o cuyos padres se en...

[Epidemiology of gunshot wounds at Ciudad Juárez, Chihuahua General Hospital].

Science.gov (United States)

Moye-Elizalde, G A; Ruiz-Martínez, F; Suarez-Santamaría, J J; Ruiz-Ramírez, M; Reyes-Gallardo, A; Díaz-Apodaca, B A

2013-01-01

Since 2007, Ciudad Juárez, Chihuahua has been considered as one of the most violent cities in the world. The General Hospital in this city is the main facility where patients with gunshot wounds are taken. The increased number of admissions of patients with these injuries to many hospitals in the country deserves special attention, as it has an impact on hospital resources and management protocols. To disseminate the epidemiology of fractures caused by gunshot wounds and the hospital care of these patients. A retrospective, observational cohort study was conducted of patients admitted to the Traumatology and Orthopedics Service, Cd. Juárez General Hospital, in Chihuahua, Mexico, from January 2008 to December 2010. All of them sustained fractures resulting from gunshot wounds. A total of 1281 patients with a diagnosis of gunshot wounds were admitted to the hospital; 402 of them were included in this study with 559 fractures; 329 were males and 73 females. Of the 559 fractures, 257 involved the upper limb, 294 the lower limb, and 8 the pelvis. Gunshot wounds-related fractures were classified according to the Gustilo classification. Seventy-nine patients had grade I fractures, 302 grade III, and 21 patients had both grades. Conservative treatment was used in 44.3% of fractures and osteosynthesis in 55%. One patient underwent amputation upon admission. The most widely used osteosynthesis methods were external fixator (37%), straight plates (21%) and intramedullary nail (17%). Five patients (1.3%) underwent amputation: two with femur fracture and 3 with humeral fracture. There were 27 deep infections (6%); one of them resulted in late amputation of the pelvic limb. The most common associated injuries included: chest injuries in 20 patients and abdominal injuries in 17. The range of hospital stay was 1-18 days, with a mean stay of 11 days. The overall mortality rate considering the total number of patients admitted (1,281) was 99 patients (7.72%). From 2006 to 2010 the

Maquiladoras de arneses automotrices: entre la producción de clase mundial y la precariedad laboral en Juárez

Directory of Open Access Journals (Sweden)

Martha Cecilia Miker Palafox

2010-11-01

Full Text Available This article show how the globalization process has impacted in the harness maquiladora industry in Ciudad Juárez and how job insecurity and world-class production can coexist in the production of automotive harness where two of the main local stakeholders (unions and the State are completely blurred and accomplices. The document is based mainly in the analysis of four cases of maquiladora plants producing automotive harnesses owned by world leading corporations, which concentrate over 90% of employment and harness production plants in the in the city.

Señales desde una biblioteca perdida. Infortunios de Alonso Ramírez: identidad criolla y cuestión barroca

OpenAIRE

Becerra, Eduardo

2010-01-01

En los setenta y ochenta del siglo XX surge una corriente en la crítica cultural hispanoamericanista poscolonial, centrada en el discurso identitario y emancipador, enfrentada con los usos tradicionales de la filología. Infortunios de Alonso Ramírez(1690), basada en modelos novelescos áureos de éxito como el relato de aventuras, la novela de cautiverio, y la picaresca, es una de las obras más estudiadas. El artículo estudia los modelos retóricos de esta obra, su relación con la novela colonia...

Research reactor spent nuclear fuel shipment from the Czech Republic to the Russian Federation

International Nuclear Information System (INIS)

Svoboda, K.; Broz, V.; Novosad, P.; Podlaha, J.; Svitak, F.

2009-01-01

In May 2004, the Global Threat Reduction Initiative agreement was signed by the governments of the United States and the Russian Federation. The goal of this initiative is to minimize, in cooperation with the International Atomic Energy Agency (IAEA) in Vienna, the existing threat of misuse of nuclear and radioactive materials for terrorist purposes, particularly highly enriched uranium (HEU), fresh and spent nuclear fuel (SNF), and plutonium, which have been stored in a number of countries. Within the framework of the initiative, HEU materials and SNF from research reactors of Russian origin will be transported back to the Russian Federation for reprocessing/liquidation. The program is designated as the Russian Research Reactor Fuel Return (RRRFR) Program and is similar to the U.S. Foreign Research Reactor Spent Nuclear Fuel Acceptance Program, which is underway for nuclear materials of United States origin. These RRRFR activities are carried out under the responsibilities of the respective ministries (i.e., U.S. Department of Energy (DOE) and Russian Federation Rosatom). The Czech Republic and the Nuclear Research Institute Rez, plc (NRI) joined Global Threat Reduction Initiative in 2004. During NRI's more than 50 years of existence, radioactive and nuclear materials had accumulated and had been safely stored on its grounds. In 1995, the Czech regulatory body , State Office for Nuclear Safety (SONS), instructed NRI that all ecological burdens from its past activities must be addressed and that the SNF from the research reactor LVR -15 had to be transported for reprocessing. At the end of November 2007, all these activities culminated with the unique shipment to the Russian Federation of 527 fuel assemblies of SNF type EK-10 (enrichment 10% U-235) and IRT-M (enrichment 36% and 80% U-235) and 657 irradiated fuel rods of EK-10 fuel, which were used in LVR-15 reactor. (authors)

Effects of serotonin on expression of the LDL receptor family member LR11 and 7-ketocholesterol-induced apoptosis in human vascular smooth muscle cells

Energy Technology Data Exchange (ETDEWEB)

Nagayama, Daiji; Ishihara, Noriko [Center of Diabetes, Endocrinology and Metabolism, Toho University, Sakura Medical Center, 564-1, Shimoshizu, Sakura-City, Chiba 285-8741 (Japan); Bujo, Hideaki [Department of Clinical Laboratory Medicine, Toho University, Sakura Medical Center, 564-1, Shimoshizu, Sakura-City, Chiba 285-8741 (Japan); Shirai, Kohji [Department of Vascular Function, Toho University, Sakura Medical Center, 564-1, Shimoshizu, Sakura-City, Chiba 285-8741 (Japan); Tatsuno, Ichiro, E-mail: ichiro.tatsuno@med.toho-u.ac.jp [Center of Diabetes, Endocrinology and Metabolism, Toho University, Sakura Medical Center, 564-1, Shimoshizu, Sakura-City, Chiba 285-8741 (Japan)

2014-04-18

Highlights: • The dedifferentiation of VSMCs in arterial intima is involved in atherosclerosis. • 5-HT showed proliferative effect on VSMCs which was abolished by sarpogrelate. • 5-HT enhanced expression of LR11 mRNA in VSMCs which was abolished by sarpogrelate. • 5-HT suppressed 7KCHO-induced apoptosis of VSMCs via caspase-3/7-dependent pathway. • The mechanisms explain the 5-HT-induced remodeling of arterial structure. - Abstract: Serotonin (5-HT) is a known mitogen for vascular smooth muscle cells (VSMCs). The dedifferentiation and proliferation/apoptosis of VSMCs in the arterial intima represent one of the atherosclerotic changes. LR11, a member of low-density lipoprotein receptor family, may contribute to the proliferation of VSMCs in neointimal hyperplasia. We conducted an in vitro study to investigate whether 5-HT is involved in LR11 expression in human VSMCs and apoptosis of VSMCs induced by 7-ketocholesterol (7KCHO), an oxysterol that destabilizes plaque. 5-HT enhanced the proliferation of VSMCs, and this effect was abolished by sarpogrelate, a selective 5-HT2A receptor antagonist. Sarpogrelate also inhibited the 5-HT-enhanced LR11 mRNA expression in VSMCs. Furthermore, 5-HT suppressed the 7KCHO-induced apoptosis of VSMCs via caspase-3/7-dependent pathway. These findings provide new insights on the changes in the differentiation stage of VSMCs mediated by 5-HT.

Research activities at nuclear research institute in water chemistry and corrosion

International Nuclear Information System (INIS)

Kysela, Jan

2000-01-01

Research activities at Nuclear Research Institute Rez (NRI) are presented. They are based on former heavy water reactor program and now on pressurized reactors VVER types which are operated on Czech republic. There is LVR-15 research reactor operated in NRI. The reactor and its experimental facilities is utilized for water chemistry and corrosion studies. NRI services for power plants involve water chemistry optimalization, radioactivity build-up, fuel corrosion and structural materials corrosion tests. (author)

Solid0Core Heat-Pipe Nuclear Batterly Type Reactor

Energy Technology Data Exchange (ETDEWEB)

Ehud Greenspan

2008-09-30

This project was devoted to a preliminary assessment of the feasibility of designing an Encapsulated Nuclear Heat Source (ENHS) reactor to have a solid core from which heat is removed by liquid-metal heat pipes (HP).

Development of fuel cycle technology for molten-salt reactor systems

International Nuclear Information System (INIS)

Uhlir, J.

2006-01-01

Full text: Full text: The Molten-Salt Reactor (MSR) represents one of promising advanced reactor type assigned to the GEN IV reactor systems. It can be operated either as thorium breeder within the Th -133U fuel cycle or as actinide transmuter incinerating transuranium fuel. Essentially the main advantage of MSR comes out from the prerequisite, that this reactor type should be directly connected with the 'on-line' reprocessing of circulating liquid (molten-salt) fuel. This principle should allow very effective extraction of freshly constituted fissile material (233U). Besides, the on-line fuel salt clean up is necessary within a long run to keep the reactor in operation. As a matter of principle, it permits to clear away typical reactor poisons like xenon, krypton, lanthanides etc. and possibly also other products of burned plutonium and transmuted minor actinides. The fuel salt clean up technology should be linked with the fresh MSR fuel processing to continuously refill the new fuel (thorium or transuranics) into the reactor system. On the other hand, the technologies of fresh transuranium molten-salt fuel processing from the current LWR spent fuel and of the on-line reprocessing of MSR fuel represent two killing points of the whole MSR technology, which have to be successfully solved before MSR deployment in the future. There are three main pyrochemical partitioning techniques proposed for processing and/or reprocessing of MSR fuel: Fluoride volatilization processes, Molten salt / liquid metal extraction processes and Electrochemical separation processes. Two of them - Fluoride Volatility Method and Electrochemical separation process from fluoride media are under development in the Nuclear Research Institute Rez pic. R and D in the field of Fluoride Volatility Method is concentrated to the development and verification of experimental semi-pilot technology for LWR spent fuel reprocessing, which may result in a product the form and composition of which might be

Flux effect on neutron irradiation embrittlement of reactor pressure vessel steels irradiated to high fluences

International Nuclear Information System (INIS)

Soneda, N.; Dohi, K.; Nishida, K.; Nomoto, A.; Iwasaki, M.; Tsuno, S.; Akiyama, T.; Watanabe, S.; Ohta, T.

2011-01-01

Neutron irradiation embrittlement of reactor pressure vessel (RPV) steels is of great concern for the long term operation of light water reactors. In particular, the embrittlement of the RPV steels of pressurized water reactors (PWRs) at very high fluences beyond 6*10 19 n/cm 2 , E > 1 MeV, needs to be understood in more depth because materials irradiated in material test reactors (MTRs) to such high fluences show larger shifts than predicted by current embrittlement correlation equations available worldwide. The primary difference between the irradiation conditions of MTRs and surveillance capsules is the neutron flux. The neutron flux of MTR is typically more than one order of magnitude higher than that of surveillance capsule, but it is not necessarily clear if this difference in neutron flux causes difference in mechanical properties of RPV. In this paper, we perform direct comparison, in terms of mechanical property and microstructure, between the materials irradiated in surveillance capsules and MTRs to clarify the effect of flux at very high fluences and fluxes. We irradiate the archive materials of some of the commercial reactors in Japan in the MTR, LVR-15, of NRI Rez, Czech Republic. Charpy impact test results of the MTR-irradiated materials are compared with the data from surveillance tests. The comparison of the results of microstructural analyses by means of atom probe tomography is also described to demonstrate the similarity / differences in surveillance and MTR-irradiated materials in terms of solute atom behavior. It appears that high Cu material irradiated in a MTR presents larger shifts than those of surveillance data, while low Cu materials present similar embrittlement. The microstructural changes caused by MTR irradiation and surveillance irradiation are clearly different

La transformación transatlántica de la Monja Alférez .

Directory of Open Access Journals (Sweden)

Chloe Rutter- Jensen

2007-12-01

Full Text Available Catalina de Erauso's story, La historia de la monja alférez escrita por ella misma / Catalina de Erauso recounts her adventures as a man, her later confession of being a woman and virgin, her pension from the king, and even the Pope's legitimization of her dressing as a man. The author examines this text in terms of its contribution and resistance to the construction of gender in Spain and the Spanish American colonies in the early 17th century. The transatlantic voyages open a space in which the figure of Catalina de Erauso transits from one gender category to another. With an emphasis on the prefix 'trans', reading the text through the lens of the 'transsexual' narrative creates new borders and limits, and accentuates the text as a site of struggle over gender identity. The 'transsexual' narrative can help us see the text not only as a site of transition and combination of social categories, but also for interrupting the binary structure of sex and gender that appears so natural today.

Study air ingress into the reactor vessel using ICARE/CATHARE V2.0 in case of severe accident

International Nuclear Information System (INIS)

Gwenaelle Le Dantec; Fichot, F.

2005-01-01

Full text of publication follows: Safety analyses show that core degradation during a severe reactor accident would not be uniform. This was confirmed by TMI2 examinations. In fact, a central region of the core may overheat, melt and flow down to the lower plenum of the reactor while peripheral regions of the core would remain almost intact. Following rupture of the vessel by molten debris, air may be drawn from the containment by natural convection into the reactor coolant system, and react with the intact rods. Studying air ingress into the reactor vessel is of interest because the interaction of air with Zircaloy cladding can strongly affect the evolution of severe accident scenarios. The main effects are heat generation, increasing clad degradation, fission product release and nitriding. In case of air/steam recirculation in the vessel, significant nitriding of cladding can occur. The resulting ZrN phase is characterized by its brittleness and instability under oxidizing conditions, Oxidation of pre-existing ZrN phase layers has been observed to result in violent oxidation and heat release. Therefore, the first consequence for safety is a risk of strong deflagration in the vessel if a large number of rods on which a substantial layer of ZrN has grown are suddenly in contact with oxygen or steam. The second consequence is a late melting of core materials due to the very exothermic oxidation, leading to a late release of materials out of the reactor pressure vessel (RPV). In this paper we present an ICARE/CATHARE V2.0 calculation simulating air ingress into the vessel and in particular to describe the nitriding due to natural convection in the reactor vessel. The basic modeling and the necessary extensions of both ICARE and CATHARE are explained. The natural circulation is calculated to predict the regions of oxygen starvation where nitriding takes place. Key words: air ingress, nitriding, ICARE/CATHARE V2.0. (authors)

Referencias bibliográficas: Julio Cortázar, perspectivas críticas. Ensayos inéditos / Pol Popovic Karic y Fidel Chávez Pérez, coordinadores.

OpenAIRE

Guerrero Almagro, Berta

2014-01-01

Reseña de Julio Cortázar, perspectivas críticas. Ensayos inéditos. Pol Popovic Karic y Fidel Chávez Pérez, coordinadores. Instituto Tecnológico y de Estudios Superiores de Monterrey, Campus de Monterrey y Miguel Ángel Porrúa, librero-editor México, 2012. 384 pp. (ISBN: 978-607-401-581-2)

Addition of phosphotungstic acid to ethanol for dehydration improves both the ultrastructure and antigenicity of pituitary tissue embedded in LR White acrylic resin.

Science.gov (United States)

Sakai, Yuko; Hosaka, Masahiro; Hira, Yoshiki; Watanabe, Tsuyoshi

2005-12-01

Although hydrophilic acrylic resins including LR White have been widely utilized as embedding media for immunocytochemical use, the constituents of tissues are often extracted by the resin monomer during the infiltration process of the embedment, resulting in a discernible impairment of the ultrastructure when the tissue is weakly fixed only with aldehydes. To minimize the extraction by the resin monomer, the embedding procedure with LR White resin was reexamined in the present study. Among the treatments tested, a partial dehydration with 70% ethanol containing 2% phosphotungstic acid (PTA) well preserved the ultrastructure of the pituitary tissue without spoiling the antigenicity of LHbeta and other representative markers for the Golgi apparatus. In addition, treatment with 1% tannic acid (TA) prior to the dehydration described above synergistically improved both the ultrastructure and antigenicity of the tissue so that the orientation of the Golgi apparatus could be determined by double immunogold labeling with commercially available anti-GM130 and anti-TGN38 antibodies. The ultrathin sections from the LR White-embedded tissue treated with TA and dehydrated in 70% ethanol containing 2% PTA also enhanced contrast without conventional heavy-metal staining with uranyl acetate and lead citrate. Our findings further suggest that the precipitation of TA and PTA protected the tissue from being extracted during the embedment, probably because an insoluble complex was transiently formed with the constituents of the tissue. This simple modification of the LR White embedment can extend the application of post-embedding immunocytochemistry as an alternative to pre-embedding immunolabeling with frozen ultrathin sections.

IMAGING OF BRAIN FUNCTION BASED ON THE ANALYSIS OF FUNCTIONAL CONNECTIVITY - IMAGING ANALYSIS OF BRAIN FUNCTION BY FMRI AFTER ACUPUNCTURE AT LR3 IN HEALTHY INDIVIDUALS

OpenAIRE

Zheng, Yu; Wang, Yuying; Lan, Yujun; Qu, Xiaodong; Lin, Kelin; Zhang, Jiping; Qu, Shanshan; Wang, Yanjie; Tang, Chunzhi; Huang, Yong

2016-01-01

Objective: This Study observed the relevant brain areas activated by acupuncture at the Taichong acupoint (LR3) and analyzed the functional connectivity among brain areas using resting state functional magnetic resonance imaging (fMRI) to explore the acupoint specificity of the Taichong acupoint. Methods: A total of 45 healthy subjects were randomly divided into the Taichong (LR3) group, sham acupuncture group and sham acupoint group. Subjects received resting state fMRI before acupuncture, a...

Factores biosocioculturales y uso de métodos anticonceptivos en mujeres que acuden al hospital Elpidio Berovidez Pérez, Otuzco 2014.

OpenAIRE

Campos Jara, Clara Luz

2015-01-01

La investigación tuvo como objetivo general, determinar la relación entre los factores biosocioculturales: edad, estado civil, religión, escolaridad, rol de género con el uso de métodos anticonceptivos en mujeres que acuden al consultorio de obstetricia del Hospital Elpidio Berovidez Pérez, Otuzco 2014, fue de tipo cuantitativo–prospectivo, la muestra estuvo constituida por 115 mujeres de una población de 390, los datos se obtuvieron con la técnica de la entrevista. Obteniéndose los siguiente...

Factores biosocioculturales y uso de métodos anticonceptivos en mujeres que acuden al Hospital Elpidio Berovidez Pérez, Otuzco 2014

OpenAIRE

Campos Jara, Clara Luz

2016-01-01

La investigación tuvo como objetivo general, determinar la relación entre los factores biosocioculturales: edad, estado civil, religión, escolaridad, rol de género con el uso de métodos anticonceptivos en mujeres que acuden al consultorio de obstetricia del Hospital Elpidio Berovidez Pérez, Otuzco 2014, fue de tipo cuantitativo–prospectivo, la muestra estuvo constituida por 115 mujeres de una población de 390, los datos se obtuvieron con la técnica de la entrevista. Obteniéndose los siguiente...

The effect of uncertainty of reactor parameters obtained using k0-NAA on result of analysis

International Nuclear Information System (INIS)

Sasajima, Fumio

2006-01-01

Neutron Activation Analysis using the k 0 method is a useful method allowing convenient and accurate simultaneous analysis of plural elements, eliminating the need for the use of comparative reference samples. As already well known, it is essential for the correct result of an analysis to obtain the α-factor and f-factor for a neutron spectrum in an irradiation field accurately when an attempt is made to use the k 0 method. For this reason, based on data obtained from the experiment conducted in the JRR-3 PN-3 system, how uncertainty of the measured values for α-factor and f-factor affects the result of an analysis was evaluated. The process of evaluation involved intentionally varying the values for reactor parameters followed by making an analysis of environmental reference samples (NIST SRM-1632c) using the k 0 method to examine the effect of these factors on the concentrations of 19 elements. The result of the evaluation revealed that the degree of the effect of uncertainty on the concentrations of 19 elements was at best approx. 1% under the condition of this experiment assuming that the factor α, a reactor parameter, had uncertainty of approx. 200%. (author)

First record and description of male Rhopalione sinensis Markham, 1990, from China, with remarks on genus Rhopalione Pérez, 1920 (Crustacea: Isopoda: Bopyridae)

Science.gov (United States)

An, Jianmei; Niu, Xiaoqian; Markham, John C.; Jiang, Wei

2014-05-01

The bopyrid isopod species Rhopalione sinensis Markham, 1990, is recorded for only the second time, from a new locality in China outside Hong Kong, the type-locality. This is also the first finding of the male R. sinensis, which is herein described. Its host, Arcotheres sinensis (Shen, 1932) is a new record. A review of the four known species of Rhopalione Pérez, 1920, an updated diagnosis of the genus and a key to species are provided.

El discurso amoroso en la novela de la Restauración: las novelas de Benito Pérez Galdós

OpenAIRE

Pérez López, Ana María

2006-01-01

El objetivo de esta Tesis Doctoral ha sido el estudio de las concepciones amorosas que están presentes en la novela española de la Restauración (tomando como punto de referencia la obra de Benito Pérez Galdós), sobre todo, en lo que respecta a una visión idealista, y en una doble vertiente: 1,- La importancia del discurso amoroso para la conformación estructural y temática de estas obras, por tratarse de un componente esencial en la configuración sentimental, moral e intelectual de los person...

Reversal of OFI and CHF in Research Reactors Operating at 1 to 50 Bar. Version 1.0

Energy Technology Data Exchange (ETDEWEB)

Kalimullah, M. [Argonne National Lab. (ANL), Argonne, IL (United States); Olson, A. P. [Argonne National Lab. (ANL), Argonne, IL (United States); Dionne, B. [Argonne National Lab. (ANL), Argonne, IL (United States); Feldman, E. E. [Argonne National Lab. (ANL), Argonne, IL (United States); Matos, J. E. [Argonne National Lab. (ANL), Argonne, IL (United States)

2014-02-28

The conditions at which the critical heat flux (CHF) and the heat flux at the onset of Ledinegg flow instability (OFI) are equal, are determined for a coolant channel with uniform heat flux as a function of five independent parameters: the channel exit pressure (P), heated length (Lh) , heated diameter (Dh), inlet temperature (Tin), and mass flux (G). A diagram is made by plotting the mass flux and heat flux at the OFI-CHF intersection (reversal from CHF > OFI to CHF < OFI as G increases) as a function of P (1 to 50 bar), for 36 combinations of the remaining three parameters (Lh , Dh , Tin): Lh = 0.28, 0.61, 1.18 m; Dh = 3, 4, 6, 8 mm; Tin = 30, 50, 70 °C. The use of the diagram to scope whether a research reactor is OFI-limited (below the curve) or CHF-limited based on the five parameters of its coolant channel is described. Justification for application of the diagram to research reactors with axially non-uniform heat flux is provided. Due to its limitations (uncertainties not included), the diagram cannot replace the detailed thermal-hydraulic analysis required for a reactor safety analysis. In order to make the OFI-CHF intersection diagram, two world-class CHF prediction methods (the Hall-Mudawar correlation and the extended Groeneveld 2006 table) are compared for 216 combinations of the five independent parameters. The two widely used OFI correlations (the Saha- Zuber and the Whittle-Forgan with η = 32.5) are also compared for the same combinations of the five parameters. The extended Groeneveld table and the Whittle-Forgan OFI correlation are selected for use in making the diagram. Using the above five design parameters, a research reactor can be represented by a point on the reversal diagram, and the diagram can be used to scope, without a thermal-hydraulic calculation, whether the OFI will occur before the CHF, or the CHF will occur before the OFI when the reactor power is increased keeping the five parameters fixed.

Parameters of calibration of the measurement system of 222 Rn based in LR-115

International Nuclear Information System (INIS)

Garcia, M.L.; Mireles, F.; Quirino, L.; Davila, I.; Lugo, F.; Pinedo, J.L.; Chavez, A.

2003-01-01

Since the SSNTD technique (Solid State Nuclear Track Detection) it was discovered it has been used as passive method for the detection of subnuclear particles in great variety of fields of the science. The use of the technique in measurements of 222 Rn in air have already been established implying better methodologies in the exhibition to the environment until their engraving and reading processes. The SSNTD technique is since a method by comparison since the material it can be used a single time, therefore it requires of calibration in one controlled radon atmosphere, using gauged standards. The objective of this work is to show the calibration of the devices used as radon monitors based on SSNTD. The material used as SSNTD is LR-115 Il. The standardization of the parameters used in the exhibition to radon in air, engraving and reading process, its are based on the response of the LR-115 Il, the one arrangement of the device, engraving speed and mainly the calibration factor. They are considered two types of monitors: Open camera and Closed camera, the difference among the calibration factors of both cameras is the percentage of the descendants of radon in the open camera. The standardized parameters are operation voltage of the counting system; temperature, time and concentration of the engraving solution; and thickness. (Author)

Tissue distribution, excretion and hepatic biotransformation of microcystin-LR in mice

International Nuclear Information System (INIS)

Robinson, N.A.; Pace, J.G.; Matson, C.F.; Miura, G.A.; Lawrence, W.B.

1991-01-01

The distribution, excretion and hepatic metabolism of [3H]microcystin-LR (sublethal i.v.) were measured in mice. Plasma elimination was biexponential with alpha- and beta-phase half-lives of 0.8 and 6.9 min, respectively. At 60 min, liver contained 67 +/- 4% of dose. Through the 6-day study the amount of hepatic radioactivity did not change whereas 23.7 +/- 1.7% of the dose was excreted; 9.2 +/- 1.0% in urine and 14.5 +/- 1.1% in feces. Approximately 60% of the urine and fecal radiolabel 6 and 12 hr postinjection was the parent toxin. Hepatic cytosol, which contained 70 +/- 2% of the hepatic radiolabel (1 hr through 6 days), was prepared for high-performance liquid chromatography analysis by heat denaturation, pronase digestion and C18 Sep Pak extraction. At 1 hr, 35 +/- 2% of the radiolabel was insoluble or C18 Sep Pak-bound; 43 +/- 3% was associated with a peak of retention time (rt) 6.6 min, and 16 +/- 3% with the parent toxin (rt 9.4 min). After 6 days, 8 +/- 1% was C18 Sep Pak-bound or insoluble; 5 +/- 0% occurred at rt 6.6 min, 17 +/- 1% with parent and 60 +/- 2% was associated with rt 8.1 min. Two other peaks, rt 4.9 and 5.6 min, appeared transiently. Analysis of hepatic cytosol by desalting chromatography under nondenaturing and denaturing conditions revealed that all of the radiolabel was associated with cytosolic components, and 83 +/- 5% was bound covalently through 1 day. By day 6 the amount of covalently bound isotope decreased to 42 +/- 11%. This is the first study to describe the long-term hepatic retention of microcystin toxin and documents putative detoxication products

Analysis of Angolan human hair samples by the k0-NAA technique on the Dalat research reactor

International Nuclear Information System (INIS)

Lemos, P.C.D; Ho Manh Dung; Cao Dong Vu; Nguyen Thi Sy; Nguyen Mong Sinh

2006-01-01

There is personal difference in concentrations of trace elements in the human hair according to human life or history such as occupation, sex, age, food, habit, social condition and so on. It is also found that the individual's deviation of elemental concentrations reflecting the degree of environmental pollutants exposure to the human body, intakes of food and metabolism. The k 0 -standardization method of neutron activation analysis (k 0 -NAA) on research reactor has been recommended by WHO and IAEA as a main analytical technique with the advantages of sensitivity, precision, accuracy, multi-element and routine. This report presents the results of determination of about 20 elements in 23 human hair samples, which have been collected from different places in Angola by using k 0 -NAA technique on Dalat nuclear research reactor. Accuracy of the method was ascertained by analysis of two human hair certified reference materials (CRMs), i.e. NIES-5 and GBW-09101 and assessed by the deviation of experiment to certified values generally within 10% and U-score values mostly lower 2. (author)

Type B liquid package technical issues -- Experience with LR-56 safety analysis

International Nuclear Information System (INIS)

Smith, A.C.; Alstine, M.N. van; Gromada, R.J.; Hensel, S.J.; Gupta, N.K.

1997-01-01

In the course of the development of nuclear industry in France, shipment of Type B quantities (i.e., quantities having significant radiological consequences) of radioactive liquids between different, sites became necessary. Based on the experience acquired at the Commissariat a l'Energie Atomique (CEA) nuclear centers, a series of tanker trailers has been developed to meet this need. Similarly, as part of the ongoing program to process wastes to stable end forms, a need exists to move radioactive liquids at several DOE sites. The LR-56, developed by CEA to transport liquids of medium to high activity, was selected for these US applications, based on its design features and successful operating experience in France. No comparable Type B liquid packages are certified in the US Packages employed in transport of Type B quantities of liquids are either only suitable for small volumes, or are used within site boundaries with extensive administrative controls employed to insure that an adequate level of safety is maintained. The requirement is to provide safety equivalent to the level established by federal regulations in 10 CFR 71. Type B radioactive materials packages (RAM packages) are typically simple, rugged containers which are designed and fabricated in accordance with the ASME Boiler and Pressure Vessel Code to provide containment under the normal conditions of transport (NCT) and hypothetical accident conditions (HAC) established by the regulations. Packages designed for liquid contents must address a number of technical issues which are not common to packages for solid contents. This paper reviews the technical issues associated with Type B liquid packages from the perspective of the experience gained from the evaluation of the LR-56 for use at DOE sites

Development of Blueberry and Carrot Juice Blend Fermented by Lactobacillus reuteri LR92

Directory of Open Access Journals (Sweden)

Carolina Saori Ishii Mauro

2016-12-01

Full Text Available This study aimed to evaluate the blueberry and carrot juice blend as a fermentable substrate for Lactobacillus reuteri LR92, in order to develop a fermented non-dairy functional beverage. Analysis of cell viability, pH, and acidity were performed during the fermentation process. The resistance of the microorganism in the blend, under simulated gastrointestinal conditions and in storage at 4 °C for 28 days, was evaluated at the same time as the antioxidant potential of the fermented juice. After 40 h of fermentation, the L. reuteri population presented a logarithmic growth of three cycles, reaching count records of 10.26 ± 0.23 log CFU/mL and after 28 days of storage at 4 °C, the bacterial population maintained elevated numbers of viable cell (8.96 ± 0.08 log CFU/mL, with increase in the antioxidant capacity of the fermented blend. However, in the test of gastric simulation, the L. reuteri population had a logarithmic reduction of five cycles. In the presence of bile salts, the viability was maintained even after 150 min of incubation. This way, the results suggested that the blueberry and carrot blend juice can be considered as a good medium for the growth of L. reuteri, providing microbiological stability during refrigerated storage with elevated antioxidant capacity, which allows for the development of a non-dairy probiotic beverage.

76 FR 23630 - Office of New Reactors; Proposed Revision 2 to Standard Review Plan, Section 1.0 on Introduction...

Science.gov (United States)

2011-04-27

... Standard Review Plan, Section 1.0 on Introduction and Interfaces AGENCY: Nuclear Regulatory Commission (NRC... Revision 2 to Standard Review Plan (SRP), Section 1.0, ``Introduction and Interfaces'' (Agencywide Documents Access and Management System (ADAMS) Accession No. ML110110573). The Office of New Reactors (NRO...

Response of LR-115 type II and CR-39 plastic track detectors to Am-Be and 14.1-MeV neutrons

International Nuclear Information System (INIS)

Bradley, D.A.; Chong, C.S.; Saat, Ahmat; Sidik, A.G.; Ghose, A.M.

1987-01-01

The fast-neutron response of the plastic LR-115 type II and CR-39 track detectors have been compared, using a 14.1-MeV neutron generator and a radionuclide Am-Be neutron source (effective primary neutron energy 4.5-MeV). The distribution of track diameters for a range of etching times has been evaluated, taking into account track registration efficiency and the relevant fast neutron scattering cross-sections. The efficiency of etched-track formation in LR-115 type II due to neutron irradiation is approximately double that in CR-39. The 14.1-MeV neutrons also tend to produce tracks in both materials with somewhat greater efficiency than do the lower energy neutrons from the radionuclide source, for a given etching time. (author)

Relación entre consultas a urgencias por enfermedad respiratoria y contaminación atmosférica en Ciudad Juárez, Chihuahua

Directory of Open Access Journals (Sweden)

Hernández-Cadena Leticia

2000-01-01

Full Text Available OBJETIVO: Analizar la relación entre las concentraciones ambientales de partículas de diámetro <=10 µm (PM10 y de ozono con el número diario de consultas al servicio de urgencias por enfermedades respiratorias agudas y asma en niños menores de 15 años, residentes de Ciudad Juárez, Chihuahua, México. MATERIAL Y MÉTODOS: Este estudio se realizó durante los años de 1998 y 1999, utilizando un diseño de tipo ecológico. Los datos atmosféricos se obtuvieron de la base de datos de la Agencia de Protección al Ambiente (EPA, provenientes de ocho estaciones de monitoreo ubicadas en Ciudad Juárez y en El Paso, Texas. Los datos de consultas al servicio de urgencias por causas respiratorias se obtuvieron de los registros médicos de dos hospitales del Instituto Mexicano del Seguro Social (IMSS, en Ciudad Juárez, Chihuahua, de julio de 1997 a diciembre de 1998. Los diagnósticos se clasificaron en dos grupos: a asma, y b infecciones respiratorias altas, conforme a la Clasificación Internacional de Enfermedades (CIE-9 o CIE-10. El análisis se realizó con la utilización de la metodología de series de tiempo que emplea regresión Poisson. RESULTADOS: Durante el periodo de estudio la media de 24 horas de PM10 fue de 34.46 µg/m³ (DE=17.99 y la media de los niveles de ozono fue de 51.60 partes por billón (ppb (DE=20.70. El modelo propuesto estima que un incremento de 20 µg/m³ en el promedio de 24 horas, en la exposición a PM10, se relaciona con un incremento de 4.97% (IC 95% 0.97-9.13 en las consultas por asma con un retraso de cinco días y con un incremento de 9% (IC 95% 1.8-16.8 cuando se considera a la exposición acumulada de cinco días anteriores. Respecto a enfermedades respiratorias altas se encontró un aumento de 2.95% en las consultas a urgencias por cada 20 µm/m³ de incremento en el promedio de 24 horas en la exposición a PM10. Se observó que el impacto de PM10 sobre las visitas de urgencia por asma fue más severo en

Experimental investigation of power peak in vicinity of WWER-440 control rod at end of fuel cycle

International Nuclear Information System (INIS)

Mikus, J.

2004-01-01

This paper presents some results of the axial power (fission density) distribution measurements carried out on the light-water, zero-power reactor LR-0 in a WWER-440 type core in vicinity of the WWER-440 control rod model at zero boron concentration in moderator, modelling the conditions at the end of the WWER-440 fuel cycle. Further information concerns the control rod model description, specification of the LR-0 core, fuel assemblies and measurement conditions. The aim of performed experiment is enlargement of the available power peaking database to enable the validation of the calculation codes by means of the measured data that correspond to the end of WWER-440 fuel cycle. (author)

Influencia de aspectos bioéticos en la planificación familiar en Santos Suárez

Directory of Open Access Journals (Sweden)

Marianela de la C Prendes Labrada

1999-01-01

Full Text Available Se realizó un estudio descriptivo de corte transversal en 151 pacientes de la consulta de Planificación Familiar en el Policlínico Santos Suárez entre abril y junio de 1997, con el objetivo de mostrar cómo influyen algunos aspectos bioéticos en la selección, así como en la continuidad del uso de los métodos anticonceptivos y en la satisfacción de las necesidades del individuo. Se aplicó una encuesta y se siguió a los pacientes durante un año. Los datos se procesaron según el cálculo porcentual. Se concluyó que la adecuada capacitación técnica del equipo multidisciplinario, la selección informada, asesoramiento adecuado y respeto de las creencias individuales, socioculturales y de los principios morales, influyeron en los resultados positivos de la selección y continuidad del uso de los métodos anticonceptivos y en la satisfacción de las necesidades del individuo en la consulta de Planificación Familiar.A descriptive cross-sectional study of 151 patients from the Family Planning Department of the "Santos Suárez" Polyclinic was conducted between April and June, 1997, aimed at showing how some bioethical aspects influence on the selection, and continuity of the use of contraceptive methods, and on the satisfaction of the individual’s needs. A survey was done and patients were followed up for a year. Data were processed by percent calculation. It was concluded that the adequate technical training of the multidisciplinary team, the reported selection, the appropiate counseling, and the respect of the individual and sociocultural beliefs, and of the moral principles influenced on the positive results of the selection and continuity of the utilization of the contraceptive methods as well as on the satisfaction of the patients’ needs at the Family Planning Department.

Power peak in vicinity of WWER-440 control rod at end of fuel cycle

International Nuclear Information System (INIS)

Mikus, J.

2003-01-01

This paper presents some results of the axial power distribution measurements carried out in a WWER-440 type core on the light-water, zero-power reactor LR-O in the vicinity of the WWER-440 control rod model at zero boron concentration in moderator. Further presented information concern the description of the control rod model, LR-0 core arrangement, specification of the fuel assemblies and measurement conditions. The aim of performed experiment is enlargement of the available 'power peaking database' to enable the calculation codes validation also by means of data that correspond to the end of WWER-440 fuel cycle (Authors)

Carlos María Ramírez sai em defesa de José Artigas: da crítica à (reconstrução do herói oriental = Carlos María Ramírez defends José Artigas: from criticism to the eastern hero reconstruction

Directory of Open Access Journals (Sweden)

Fuão, Juarez J. Rodrigues

2009-01-01

Full Text Available O artigo analisa a obra Juicio Crítico del Bosquejo Histórico de la República Oriental del Uruguay por el Dr. D. Francisco A. Berra, escrita por Carlos María Ramírez, e o papel do intelectual na construção idealizada de José Artigas. Publicada no ano de 1882, período marcado pelo intenso debate acerca do passado uruguaio, tal obra participou do processo de reabilitação da imagem do líder independentista, caracterizando-o como o grande libertador e o Precursor da Nacionalidade Uruguaia

Using RNA-sequencing and in silico subtraction to identify resistance gene analog markers for Lr16 in wheat

Science.gov (United States)

Leaf rust, caused by Puccinia triticina Eriks., is one of the most widespread diseases of wheat worldwide and breeding for resistance is one of the most effective methods of control. Lr16 is a wheat leaf rust resistance gene that provides resistance at both the seedling and adult stages. Simple s...

Preparation of mandatory documentation before the start up of the RA-0 'zero power' nuclear reactor at Cordoba National University

International Nuclear Information System (INIS)

Martin, H.R.; Keil, W.M.; Pezzi, N.

1991-01-01

Before the start up of the RA-0 'zero power' nuclear reactor installed at Cordoba National University, it was necessary to send to the Regulatory Authority the mandatory documentation which is required in the licensing process. With the previous papers existing for the operation in the first years of the '70, a work program for the future operational training personnel was elaborated. Based on the Authority's applicable rules and the recommendations and with particular criteria originated in the working university conditions, the SAFETY report of RA-0 nuclear reactor was prepared. This paper describes the principal contents, items and documents involved in the safety report. (Author) [es

CaMn0.875Ti0.125O3 as oxygen carrier for chemical-looping combustion with oxygen uncoupling (CLOU)—Experiments in a continuously operating fluidized-bed reactor system

KAUST Repository

Rydé n, Magnus; Lyngfelt, Anders; Mattisson, Tobias

2011-01-01

Particles of the perovskite material CaMn0.875Ti0.125O3 has been examined as oxygen carrier for chemical-looping with oxygen uncoupling, and for chemical-looping combustion of natural gas, by 70h of experiments in a circulating fluidized-bed reactor

Mark I 1/5-scale boiling water reactor pressure suppression experiment. Quick-look report for test numbers 1.0(a) and 1.0(b) performed on March 4 and 8, 1977

International Nuclear Information System (INIS)

McCauley, E.W.; Pitts, J.H.

1977-01-01

The experimental results obtained from pressure suppression experiment numbers 1.0(a) and 1.0(b) that were performed on the Lawrence Livermore Laboratory's 1 / 5 -scale boiling water reactor (BWR) Mark I pressure suppression experimental facility are summarized

On the taxonomic status of Liolaemus filiorum Pincheira-Donoso & Ramírez, 2005 (Iguania: Liolaemidae: A response to Pincheira-Donoso

Directory of Open Access Journals (Sweden)

Jaime Troncoso-Palacios

2015-12-01

Full Text Available I discuss the arguments put forth recently by Pincheira-Donoso, in which the author attempts to revalidate Liolaemus filiorum Pincheira-Donoso & Ramírez, 2005, a species which I had previously considered a junior synonym of L. puritamensis. The author of this revalidation omitted important information including: 1 the description was published without peer review, 2 one of the two types was deposited in a personal collection, 3 the diagnosis is weak and unclear, 4 the holotype was not explicitly described or illustrated. Additionally, the author did not discuss key aspects of my paper, most particularly, the incorrect designation of the holotype of L. filiorum.

Disidir el régimen de horror y muerte: colectivos juveniles femeninos en Ciudad Juárez (México

Directory of Open Access Journals (Sweden)

Salvador Salazar Gutiérrez

2017-01-01

Full Text Available El texto muestra algunos hallazgos en torno al análisis de acciones colectivas en Ciudad Juárez (México, las cuales plantean una serie de estrategias para develar y disentir del régimen de horror y muerte caracterizado por la violencia durante las dos últimas décadas. Por medio de un trabajo etnográico con los colectivos Batallones Femeninos y Nuestras Hijas de Regreso a Casa, presenta cómo prácticas organizativas asociadas con la música o a la intervención urbana de murales son estrategias para promover una ética por la vida en relación con mujeres jóvenes.

Hydrogen Production by Catalytic Partial Oxidation of Coke Oven Gas in BaCo0.7Fe0.3-xZrxO3-δ Ceramic Membrane Reactors

Directory of Open Access Journals (Sweden)

Yao Weilin

2016-01-01

Full Text Available The BaCo0.7Fe0.3-xZrxO3-δ (BCFZ, x = 0.04–0.12 mixed ionic–electronic conducting (MIEC membranes were synthesized with a sol–gel method and evaluated as potential membrane reactor materials for the partial oxidation of coke oven gas (COG. The effect of zirconium content on the phase structure, microstructure and performance of the BCFZ membrane under He or COG atmosphere were systemically investigated. The BaCo0.7Fe0.24Zr0.06O3-δ membrane exhibited the best oxygen permeability and good operation stability, which could be a potential candidate of the membrane materials for hydrogen production through the partial oxidation of COG.

Experimental Studies on Assemblies 1 and 2 of the Fast Reactor FR-0. Part 2

Energy Technology Data Exchange (ETDEWEB)

Hellstrand, E; Andersson, T L; Brunfelter, B; Kockum, J; Londen, S O; Tiren, L I

1965-12-15

In a first part of this report, published as AE-195, an account was given of critical mass determinations and measurements of flux distribution and reaction ratios in the first assemblies of the fast zero power reactor FR0. This second part of the report deals with various investigations involving the measurement of reactivity. Control rod calibrations have been made using the positive period, the inverse multiplication, the rod drop and the pulsed source techniques, and show satisfactory agreement between the various methods. The reactivity worths of samples of different materials and different sizes have been measured at the core centre. Comparisons with perturbation calculations show that the regular and adjoint fluxes are well predicted in the central region of the core. The variation in the prompt neutron life-time with reactivity has been studied by means of the pulsed source and the Rossi-{alpha} techniques. Comparison with one region calculations reveals large discrepancies, indicating that this simple model is inadequate. Some investigations of streaming effects in an empty channel in the reactor and of interaction effects between channels have been made and are compared with theoretical estimates. Measurements of the reactivity worth of an air gap between the reactor halves and of the temperature coefficient are also described in the report. The work has been performed as a joint effort by AB Atomenergi and the Research Institute of National Defence.

INVESTIGACIONES ARQUEOLÓGICAS EN EL FORTÍN PESCADO, PARTIDO DE BENITO JUÁREZ, PROVINCIA DE BUENOS AIRES / Archaelogical research at Fortin Pescado, Benito Juárez county, Buenos Aires province

Directory of Open Access Journals (Sweden)

Vanesa Natalia Bagaloni

2015-12-01

Full Text Available En este trabajo se presentan los primeros resultados del estudio de los materiales recuperados en la localidad arqueológica Fortín Pescado, ubicada sobre la margen izquierda del arroyo Pescado Castigado, en el partido de Benito Juárez (provincia de Buenos Aires. Esta localidad se compone de dos sitios arqueológicos (Fortín Pescado 1 y Fortín Pescado 2 donde se efectuaron excavaciones y recolecciones en superficie y en el perfil de barrancas aledañas. El conjunto arqueológico de ambos sitios incluye restos faunísticos (mayormente animales domésticos, materiales vítreos (botellas cuadradas y cilíndricas, frascos, tarros y damajuanas, fragmentos de gres (botellas de ginebra y/o agua mineral, lozas (tazas y bowls ingleses, metales (clavos, botón, cuchilla y arma, ladrillos y un fragmento de bola de boleadora. Según diversos documentos escritos procedentes del Servicio Histórico del Ejército, del Archivo General de la Nación y del departamento de Geodesia, este fortín se instaló en 1858 y funcionó por lo menos hasta fines de 1863, cuando pasó a ser usado como posta militar hasta el fin de la década. A partir de las intervenciones arqueológicas y el relevamiento de las fuentes escritas se pudieron determinar áreas de actividades específicas (vivienda, descarte pautado y no pautado, corral dentro de esta localidad.  AbstractIn this paper the first results of the materials recovered at the Fortin Pescado archaeological locality are presented. This locality is situated on the left bank of Pescado Castigado stream (Benito Juárez County, Buenos Aires Province. It is composed by two sites (Fortin Pescado 1 and Fortin Pescado 2 where excavations and surface surveys were developed. Surface surveys were also conducted on the profiles of the surrounding canyons. The archaeological assemblages of both sites include faunal remains (mostly of domestic fauna/animals, glassy materials (square and cylindrical bottles, flasks, jars and jugs

Immobilization of biogenic Pd(0) in anaerobic granular sludge for the biotransformation of recalcitrant halogenated pollutants in UASB reactors.

Science.gov (United States)

Pat-Espadas, Aurora M; Razo-Flores, Elías; Rangel-Mendez, J Rene; Ascacio-Valdes, Juan A; Aguilar, Cristobal N; Cervantes, Francisco J

2015-10-19

The capacity of anaerobic granular sludge to reduce Pd(II), using ethanol as electron donor, in an upflow anaerobic sludge blanket (UASB) reactor was demonstrated. Results confirmed complete reduction of Pd(II) and immobilization as Pd(0) in the granular sludge. The Pd-enriched sludge was further evaluated regarding biotransformation of two recalcitrant halogenated pollutants: 3-chloro-nitrobenzene (3-CNB) and iopromide (IOP) in batch and continuous operation in UASB reactors. The superior removal capacity of the Pd-enriched biomass when compared with the control (not exposed to Pd) was demonstrated in both cases. Results revealed 80 % of IOP removal efficiency after 100 h of incubation in batch experiments performed with Pd-enriched biomass whereas only 28 % of removal efficiency was achieved in incubations with biomass lacking Pd. The UASB reactor operated with the Pd-enriched biomass achieved 81 ± 9.5 % removal efficiency of IOP and only 61 ± 8.3 % occurred in the control reactor lacking Pd. Regarding 3-CNB, it was demonstrated that biogenic Pd(0) promoted both nitro-reduction and dehalogenation resulting in the complete conversion of 3-CNB to aniline while in the control experiment only nitro-reduction was documented. The complete biotransformation pathway of both contaminants was proposed by high-performance liquid chromatography-mass spectrometry (HPLC-MS) analysis evidencing a higher degree of nitro-reduction and dehalogenation of both contaminants in the experiments with Pd-enriched anaerobic sludge as compared with the control. A biotechnological process is proposed to recover Pd(II) from industrial streams and to immobilize it in anaerobic granular sludge. The Pd-enriched biomass is also proposed as a biocatalyst to achieve the biotransformation of recalcitrant compounds in UASB reactors.

Power Trip Set-points of Reactor Protection System for New Research Reactor

International Nuclear Information System (INIS)

Lee, Byeonghee; Yang, Soohyung

2013-01-01

This paper deals with the trip set-point related to the reactor power considering the reactivity induced accident (RIA) of new research reactor. The possible scenarios of reactivity induced accidents were simulated and the effects of trip set-point on the critical heat flux ratio (CHFR) were calculated. The proper trip set-points which meet the acceptance criterion and guarantee sufficient margins from normal operation were then determined. The three different trip set-points related to the reactor power are determined based on the RIA of new research reactor during FP condition, over 0.1%FP and under 0.1%FP. Under various reactivity insertion rates, the CHFR are calculated and checked whether they meet the acceptance criterion. For RIA at FP condition, the acceptance criterion can be satisfied even if high power set-point is only used for reactor trip. Since the design of the reactor is still progressing and need a safety margin for possible design changes, 18 MW is recommended as a high power set-point. For RIA at 0.1%FP, high power setpoint of 18 MW and high log rate of 10%pp/s works well and acceptance criterion is satisfied. For under 0.1% FP operations, the application of high log rate is necessary for satisfying the acceptance criterion. Considering possible decrease of CHFR margin due to design changes, the high log rate is suggested to be 8%pp/s. Suggested trip set-points have been identified based on preliminary design data for new research reactor; therefore, these trip set-points will be re-established by considering design progress of the reactor. The reactor protection system (RPS) of new research reactor is designed for safe shutdown of the reactor and preventing the release of radioactive material to environment. The trip set point of RPS is essential for reactor safety, therefore should be determined to mitigate the consequences from accidents. At the same time, the trip set-point should secure margins from normal operational condition to avoid

Intrinsic efficiency of LR-115 in alpha particles detection: simulations and experiments

International Nuclear Information System (INIS)

Aharmim, B.; Sabir, A.; Marah, H.

2002-01-01

A numerical simulation is developed to characterize the response of the cellulose nitrate detector ''LR-115 type II'' to alpha particles of different incidence angles and energies. It permits to know whether an alpha particle at a given energy and direction is able to produce a visible etched track or not. For this purpose, a V t -variable track etch rate model is used. We have considered that the track etch rate is a function of the ionization rate and the defect created by delta rays along the alpha particle trajectory. Validation of the model is presented in the form of comparisons between theoretically computed values of the sensitive energy range and the track diameters and experimentally determined ones

A measurement of the left-right cross section asymmetry in Z0 production with polarized e+e- collisions

International Nuclear Information System (INIS)

Park, H.

1993-12-01

The Stanford Linear Collider at SLAC is an e + e - collider running at √s ∼ M Z and has provided an electron beam with longitudinal polarization at the SLC interaction point. The 1992 polarized run data were taken with the SLD detector. The author presents here the measurement of the left-right cross section asymmetry (A LR ) for the 1992 run. The polarized run began in May and ended in September of 1992 at a mean center-of-mass energy of 91.56 GeV. Tower hit information of the liquid argon calorimeter and endcap warm iron calorimeter pads were used for selecting hadronic Z 0 or tau pair events. The SLD detector collected about 11,000 events during this run. The magnitude of the longitudinal polarization of the electron beam was continuously measured by a polarimeter based on Compton scattering, and was monitored by a polarimeter based on Moller scattering. The luminosity-weighted average longitudinal polarization during the 1992 run was measured as 22.4 ± 0.6 (syst.)%. From these data, the value of A LR has been measured to be 0.102 ± 0.044 (stat.) ± 0.003 (syst.), corresponding to an effective electroweak mixing angle (sin 2 θ w eff ) of 0.2375 ± 0.0056 (stat.) ± 0.0004 (syst.). The error is dominated by the statistical error. This value of sin 2 θ w eff is in good agreement with existing measurements from other experiments. Studies of improvements in A LR event selection for future high-statistics runs are also discussed

Extensive utilization of training reactor VR-1

International Nuclear Information System (INIS)

Matejka, Karel; Sklenka, Lubomir

2003-01-01

institutions; Studying of transmutation technologies ADTT. Public relation activities: Keeping current state in the field number of user schools and number visitors; Developing new demonstration experiments for Secondary/High School students. International co-operation: Continuing close co-operation with Universities in Germany, Austria, Hungary, Slovakia etc.; Participation in Reduce enrichment of research and test reactors RERTR Program with cooperation with Nuclear Research Institute in Rez; Participation in European Nuclear Education Network ENEN and NEPTUNO; Additional courses for potential users. The experiences with the VR-1 operation are excellent for the last 12 years. There was no accident regarding nuclear safety or radiation protection during the whole period of the use. Operation of the reactor is widely included in many study branches and it significantly contributes to the education of our students and also to wide public in terms of conditions and acceptability of the use of nuclear energy. (author)

On tests of local realism by CP-violation parameters of K0 mesons

International Nuclear Information System (INIS)

Genovese, M.

2005-01-01

Recently various papers have proposed to test local realism (LR) by considering electroweak CP-violation parameters values in neutral pseudoscalar meson systems. Considering the large interest for a conclusive test of LR and the experimental accessibility to these tests, in this paper we critically consider these results showing how they, albeit that they are very interesting, require anyway additional assumptions and therefore cannot be considered conclusive tests of LR. (orig.)

AER Working Group D on VVER safety analysis - report of the 2009 meeting

International Nuclear Information System (INIS)

Kliem, S.

2009-01-01

The AER Working Group D on VVER reactor safety analysis held its 18-th meeting in Rez, Czech Republic, during the period 18-19 May, 2009. The meeting was hosted by the Nuclear Research Institute Rez. Altogether 17 participants attended the meeting of the working group D, 16 from AER member organizations and 1 guest from a non-member organization. The co-ordinator of the working group, S. Kliem, served as chairman of the meeting. The meeting started with a general information exchange about the recent activities in the participating organizations. The given presentations and the discussions can be attributed to the following topics: 1) Code validation and benchmarking; 2) Safety analysis and code developments; 3) Reactor pressure vessel thermal hydraulics; 4) Future activities including discussion on the participation in the OECD/NEA Benchmark for the Kalinin-3 NPP

Explicit Determinants of the RFPrLrR Circulant and RLPrFrL Circulant Matrices Involving Some Famous Numbers

Directory of Open Access Journals (Sweden)

Tingting Xu

2014-01-01

Full Text Available Circulant matrices may play a crucial role in solving various differential equations. In this paper, the techniques used herein are based on the inverse factorization of polynomial. We give the explicit determinants of the RFPrLrR circulant matrices and RLPrFrL circulant matrices involving Fibonacci, Lucas, Pell, and Pell-Lucas number, respectively.

Mapping and characterization of the new adult plant leaf rust resistance gene Lr77 derived from Santa Fe winter wheat.

Science.gov (United States)

Kolmer, James A; Su, Zhenqi; Bernardo, Amy; Bai, Guihua; Chao, Shiaoman

2018-04-25

A new gene for adult plant leaf rust resistance in wheat was mapped to chromosome 3BL. This gene was designated as Lr77. 'Santa Fe' is a hard red winter cultivar that has had long-lasting resistance to the leaf rust fungus, Puccinia triticina. The objective of this study was to determine the chromosome location of the adult plant leaf rust resistance in Santa Fe wheat. A partial backcross line of 'Thatcher' (Tc) wheat with adult plant leaf rust resistance derived from Santa Fe was crossed with Thatcher to develop a Thatcher//Tc*2/Santa Fe F 6 recombinant inbred line (RIL) population. The RIL population and parental lines were evaluated for segregation of leaf rust resistance in three field plot tests and in an adult plant greenhouse test. A genetic map of the RIL population was constructed using 90,000 single-nucleotide polymorphism (SNP) markers with the Illumina Infinium iSelect 90K wheat bead array. A significant quantitative trait locus for reduction of leaf rust severity in all four tests was found on chromosome 3BL that segregated as a single adult plant resistance gene. The RILs with the allele from the resistant parent for SNP marker IWB10344 had lower leaf rust severity and a moderately resistant to moderately susceptible response compared to the susceptible RILs and Thatcher. The gene derived from Santa Fe on chromosome 3BL was designated as Lr77. Kompetitive allele-specific polymerase chain reaction assay markers linked to Lr77 on 3BL should be useful for selection of wheat germplasm with this gene.

Annual report 1991

International Nuclear Information System (INIS)

1992-07-01

A review is presented of the economic data and activities of the Nuclear Research Institute (NRI) at Rez. The income, operating expenditures and number of man-years employed (total staff and university graduates) are given for the NRI as a whole and separately for the Division of Nuclear Power and Safety, Division of Reactor Materials, Division of Fuel Cycle Chemistry, Division of Reactor Physics, Division of Radionuclides and Ionizing Radiation, Central Analytical Laboratory, and Research Reactor Laboratory. (J.B.)

Annual report 1992

International Nuclear Information System (INIS)

1993-05-01

A review is presented of the economic data and activities of the Nuclear Research Institute (NRI) at Rez. The income, operating expenditures and number of man-years employed (total staff and university graduates) are given for the NRI as a whole and separately for the Nuclear Power and Safety Division, Reactor Materials Division, Fuel Cycle Chemistry Division, Reactor Physics Division, Radionuclides and Ionizing Radiation Division, Central Analytical Laboratory, Research Reactor Laboratory, and Technical and Production Division. (J.B.)

Compact torsatron reactors

International Nuclear Information System (INIS)

Lyon, J.F.; Carreras, B.A.; Lynch, V.E.; Tolliver, J.S.; Sviatoslavsky, I.N.

1988-05-01

Low-aspect-ratio torsatron configurations could lead to compact stellarator reactors with R 0 = 8--11m, roughly one-half to one-third the size of more conventional stellarator reactor designs. Minimum-size torsatron reactors are found using various assumptions. Their size is relatively insensitive to the choice of the conductor parameters and depends mostly on geometrical constraints. The smallest size is obtained by eliminating the tritium breeding blanket under the helical winding on the inboard side and by reducing the radial depth of the superconducting coil. Engineering design issues and reactor performance are examined for three examples to illustrate the feasibility of this approach for compact reactors and for a medium-size (R 0 ≅ 4 m,/bar a/ /approx lt/ 1 m) copper-coil ignition experiment. 26 refs., 11 figs., 7 tabs

Power distribution gradients in WWER type cores and fuel failure root causes

Energy Technology Data Exchange (ETDEWEB)

Mikuš, Ján M., E-mail: JanMikus.nrc@hotmail.com

2014-02-15

Highlights: • Power (fission rate) distribution gradients can represent fuel failure root causes. • Positions with above gradients were investigated in WWER type cores on reactor LR-0. • Above gradients were evaluated near core heterogeneities and construction materials. • Results can be used for code validation and fuel failure occurrence investigation. - Abstract: Neutron flux non-uniformity and gradients of neutron current resulting in corresponding power (fission rate) distribution changes can represent root causes of the fuel failure. Such situation can be expected in vicinity of some core heterogeneities and construction materials. Since needed data cannot be obtained from nuclear power plant (NPP), results of some benchmark type experiments performed on light water, zero-power research reactor LR-0 were used for investigation of the above phenomenon. Attention was focused on determination of the spatial power distribution changes in fuel assemblies (FAs): Containing fuel rods (FRs) with Gd burnable absorber in WWER-440 and WWER-1000 type cores, Neighboring the core blanket and dummy steel assembly simulators on the periphery of the WWER-440 standard and low leakage type cores, resp., Neighboring baffle in WWER-1000 type cores, and Neighboring control rod (CR) in WWER-440 type cores, namely (a) power peak in axial power distribution in periphery FRs of the adjacent FAs near the area between CR fuel part and butt joint to the CR absorbing part and (b) decrease in radial power distribution in FRs near CR absorbing part. An overview of relevant experimental results from reactor LR-0 and some information concerning leaking FAs on NPP Temelín are presented. Obtained data can be used for code validation and subsequently for the fuel failure occurrence investigation.

Participación ciudadana en las colonias sin agua potable y alcantarillado de Ciudad Juárez, Chihuahua

Directory of Open Access Journals (Sweden)

Gustavo Córdova Bojórquez

2007-01-01

Full Text Available En este artículo se presenta un análisis de la participación ciudadana en la gestión del agua en 14 colonias que carecen del servicio de agua potable y alcantarillado en Ciudad Juárez, Chihuahua. La metodología consistió en analizar y relacionar las influencias externas e internas de los ciudadanos resultando una participación ciudadana muy baja en la gestión del agua determinada en gran medida por el poco conocimiento sobre el tema, la poca confianza en las instituciones públicas, la mínima disposición de participar en proyectos comunitarios y por la gran influencia que tiene el sistema político en la gestión del servicio.

Modos subordinados de acceso a los clásicos en Los príncipes valientes de Javier Pérez Andújar

OpenAIRE

Cáliz Montes, Jessica

2015-01-01

Le présent article aborde la question de la diffusion de la culture savante à travers la culture visuelle en se centrant sur Los príncipes valientes (2007) de Javier Pérez Andújar. Concrètement, il analyse la cohabitation entre la tradition populaire, orale, et une nouvelle culture populaire, pendant la période du « tardo-franquisme ». Cette nouvelle culture est diffusée grâce à différents moyens, qui appartiennent à la « sous-culture » (Amorós) – la télévision, les bandes dessinées, le ciném...

Track counting and thickness measurement of LR115 radon detectors using a commercial image scanner

International Nuclear Information System (INIS)

De Cicco, F.; Pugliese, M.; Roca, V.; Sabbarese, C.

2014-01-01

An original optical method for track counting and film thickness determination of etched LR115 radon detectors was developed. The method offers several advantages compared with standard techniques. In particular, it is non-destructive, very simple and rather inexpensive, since it uses a commercial scanner and a free software. The complete analysis and the calibration procedure carried out for the determination of radon specific activity are reported. A comparison with the results of spark counting defines the accuracy and the precision of the new technique. (authors)

Blind void filling in LR-EPONs: How efficient it can be?

KAUST Repository

Elrasad, Amr; Shihada, Basem

2015-01-01

This work proposes a novel blind void (idle periods) filling in Long-Reach Ethernet Passive Optical Networks (LR-EPONs) namely Size Controlled Batch Void Filling (SCBVF). We emphasize on reducing grant delays and hence reducing the average packet delay. SCBVF delay reduction is achieved by early flushing data during the idle time periods (voids) between allocated grants. The proposed approach can be integrated with almost all of the previously reported dynamic bandwidth allocation schemes. SCBVF is less sensitive to differential distance between ONUs and can work well in case of small differential distances compared to previously reported void filling schemes. We support our work by extensive simulation study considering bursty traffic with long range dependency. Numerical results show a delay reduction up to 35% compared to non-void filling scheme outperforming its main competitors that can achieve up to 7% delay reduction.

Blind void filling in LR-EPONs: How efficient it can be?

KAUST Repository

Elrasad, Amr

2015-07-01

This work proposes a novel blind void (idle periods) filling in Long-Reach Ethernet Passive Optical Networks (LR-EPONs) namely Size Controlled Batch Void Filling (SCBVF). We emphasize on reducing grant delays and hence reducing the average packet delay. SCBVF delay reduction is achieved by early flushing data during the idle time periods (voids) between allocated grants. The proposed approach can be integrated with almost all of the previously reported dynamic bandwidth allocation schemes. SCBVF is less sensitive to differential distance between ONUs and can work well in case of small differential distances compared to previously reported void filling schemes. We support our work by extensive simulation study considering bursty traffic with long range dependency. Numerical results show a delay reduction up to 35% compared to non-void filling scheme outperforming its main competitors that can achieve up to 7% delay reduction.

SFCOMPO 2.0 - A relational database of spent fuel isotopic measurements, reactor operational histories, and design data

Science.gov (United States)

Michel-Sendis, Franco; Martinez-González, Jesus; Gauld, Ian

2017-09-01

SFCOMPO-2.0 is a database of experimental isotopic concentrations measured in destructive radiochemical analysis of spent nuclear fuel (SNF) samples. The database includes corresponding design description of the fuel rods and assemblies, relevant operating conditions and characteristics of the host reactors necessary for modelling and simulation. Aimed at establishing a thorough, reliable, and publicly available resource for code and data validation of safety-related applications, SFCOMPO-2.0 is developed and maintained by the OECD Nuclear Energy Agency (NEA). The SFCOMPO-2.0 database is a Java application which is downloadable from the NEA website.

Francisco Suárez en la vida de su tiempo y en la del nuestro. Editorial

Directory of Open Access Journals (Sweden)

Juana María Gil Ruiz

2017-09-01

Full Text Available Con la aparición de este número dedicado —como no puede ser de otro modo— a Francisco Suárez, en la vida de su tiempo y en la del nuestro, con motivo del cuarto centenario de su fallecimiento, ACFS inaugura una nueva etapa —la tercera— que pretende, además de aprovechar este homenaje, afrontar los nuevos retos planteados por la sociedad-economía del conocimiento y sus variados indicadores —formales— de medición de calidad. Es cierto que lo que marca la calidad, al menos la científica, debería sobrepasar cualquier requisito formal, pero más allá de lo que siempre debió y debe ser lo importante, el fondo, las revistas jurídicas han tenido que reinventarse para cumplir con los requerimientos de indexación exigidos por las reconocidas Bases de Datos.

José Gestoso y Pérez. Teoría y Praxis de la Conservación

Directory of Open Access Journals (Sweden)

Mª Dolores Ruiz de Lacanal Ruiz-Mateos

2013-12-01

Full Text Available El objetivo de este artículo es hacer una reflexión sobre las aportaciones que José Gestoso y Pérez (1852-1917 realiza a la teoría y la praxis de la conservación. Persona de gran prestigio y mérito, desarrolló su labor profesional en Sevilla a mediados del siglo XIX y principios del siglo XX y ha sido objeto de numerosas investigaciones. Tras la lectura de los estudios, que le resaltan como un referente claro de la cultura sevillana en sus múltiples manifestaciones, (Historia y crítica del Arte, Arqueología, Archivística, etc., este artículo concentra la atención en sus propios textos, para descubrir que constituyen un conjunto coherente y estructurado de conocimientos teóricos y prácticos, aportan unos objetivos definidos y una metodología con recursos y estrategias, que son claros antecedentes de nuestros actuales “planes” de conservación.

New code for VVER-440 loading pattern design

International Nuclear Information System (INIS)

Bajgl, J.; Lehmann, M.

1999-01-01

This paper describes the main attributes of a new computer program OPTIMAL used for loading pattern design in Dukovany NPP (4 reactors VVER-440). We have been developed this program in Nuclear Research Institute Rez since 1994 on the base of special contract between Dukovany NPP and Nuclear Research Institute Rez. General information about the optimisation methodology is given in the first part. The organisation of the optimisation process is described in part 2. Construction of the optimisation functional is shown in part 3. Procedures used during one-cycle optimisation are described in part 4. (Authors)

Uncertainty analysis of the 35% reactor inlet header break in a CANDU 6 reactor using RELAP/SCDAPSIM/MOD4.0 with integrated uncertainty analysis option

International Nuclear Information System (INIS)

Dupleac, D.; Perez, M.; Reventos, F.; Allison, C.

2011-01-01

The RELAP/SCDAPSIM/MOD4.0 code, designed to predict the behavior of reactor systems during normal and accident conditions, is being developed as part of an international nuclear technology Software Development and Training Program (SDTP). RELAP/SCDAPSIM/MOD4.0, which is the first version of RELAP5 completely rewritten to FORTRAN 90/95/2000 standards, uses the publicly available RELAP5 and SCDAP models in combination with (a) advanced programming and numerical techniques, (b) advanced SDTP-member-developed models for LWR, HWR, and research reactor analysis, and (c) a variety of other member-developed computational packages. One such computational package is an integrated uncertainty analysis (IUA) package being developed jointly by the Technical University of Catalonia (UPC) and Innovative Systems Software (ISS). RELAP/SCDAPSIM/MOD4.0(IUA) follows the input-propagation approach using probability distribution functions to define the uncertainty of the input parameters. The main steps for this type of methodologies, often referred as to statistical approaches or Wilks’ methods, are the ones that follow: 1. Selection of the plant; 2. Selection of the scenario; 3. Selection of the safety criteria; 4. Identification and ranking of the relevant phenomena based on the safety criteria; 5. Selection of the appropriate code parameters to represent those phenomena; 6. Association of uncertainty by means of Probability Distribution Functions (PDFs) for each selected parameter; 7. Random sampling of the selected parameters according to its PDF and performing multiple computer runs to obtain uncertainty bands with a certain percentile and confidence level; 8. Processing the results of the multiple computer runs to estimate the uncertainty bands for the computed quantities associated with the selected safety criteria. RELAP/SCDAPSIM/MOD4.0(IUA) calculates the number of required code runs given the desired percentile and confidence level, performs the sampling process for the

Uncertainty analysis of the 35% reactor inlet header break in a CANDU 6 reactor using RELAP/SCDAPSIM/MOD4.0 with integrated uncertainty analysis option

Energy Technology Data Exchange (ETDEWEB)

Dupleac, D., E-mail: danieldu@cne.pub.ro [Politehnica Univ. of Bucharest (Romania); Perez, M.; Reventos, F., E-mail: marina.perez@upc.edu, E-mail: francesc.reventos@upc.edu [Technical Univ. of Catalonia (Spain); Allison, C., E-mail: iss@cableone.net [Innovative Systems Software (United States)

2011-07-01

The RELAP/SCDAPSIM/MOD4.0 code, designed to predict the behavior of reactor systems during normal and accident conditions, is being developed as part of an international nuclear technology Software Development and Training Program (SDTP). RELAP/SCDAPSIM/MOD4.0, which is the first version of RELAP5 completely rewritten to FORTRAN 90/95/2000 standards, uses the publicly available RELAP5 and SCDAP models in combination with (a) advanced programming and numerical techniques, (b) advanced SDTP-member-developed models for LWR, HWR, and research reactor analysis, and (c) a variety of other member-developed computational packages. One such computational package is an integrated uncertainty analysis (IUA) package being developed jointly by the Technical University of Catalonia (UPC) and Innovative Systems Software (ISS). RELAP/SCDAPSIM/MOD4.0(IUA) follows the input-propagation approach using probability distribution functions to define the uncertainty of the input parameters. The main steps for this type of methodologies, often referred as to statistical approaches or Wilks’ methods, are the ones that follow: 1. Selection of the plant; 2. Selection of the scenario; 3. Selection of the safety criteria; 4. Identification and ranking of the relevant phenomena based on the safety criteria; 5. Selection of the appropriate code parameters to represent those phenomena; 6. Association of uncertainty by means of Probability Distribution Functions (PDFs) for each selected parameter; 7. Random sampling of the selected parameters according to its PDF and performing multiple computer runs to obtain uncertainty bands with a certain percentile and confidence level; 8. Processing the results of the multiple computer runs to estimate the uncertainty bands for the computed quantities associated with the selected safety criteria. RELAP/SCDAPSIM/MOD4.0(IUA) calculates the number of required code runs given the desired percentile and confidence level, performs the sampling process for the

Determination of the working voltage of the RP-0 and RP-10 nuclear reactors starting chains

International Nuclear Information System (INIS)

Zuniga, Agustin; Veramendi, Emilio; Salazar, Alberto

2014-01-01

This report presents the determination of the voltage curve of the RP-0 and RP-10 nuclear reactor starting chains, as an approach for determining the working voltages. The method consisted in changing the voltage and recording the corresponding counts. Then, the area of the best response was determined according to the detector characteristics, and also was found that for the RP-0, the response was in the proportional region, meanwhile for the RP-10, the response was in the region of ionization chambers. The values obtained were: BF3-A3 (RP-0) and 1150 V for RP-10, CF-A1 = 400 V, CF-A2 = 400 V, CF-A3 = 400 V. (authors).

Evaluación del desempeño del docente de la unidad educativa Prof. Fernando Ramírez

Directory of Open Access Journals (Sweden)

Jorge F. Ojeda Rodríguez

2012-04-01

Full Text Available En la aplicación práctica de sistema de evaluación del desempeño de los maestros cada día recobra más importancia en pro de mejorar las cualidades profesionales del docente. Por lo que el propósito de este estudio es analizar el Evaluación Del Desempeño Del Docente De La Unidad Educativa Prof. Fernando Ramírez Municipio Independencia Estado Yaracuy, en sus dimensiones pedagógicas, emocional y de responsabilidad se fundamenta en una investigación descriptiva apoyado en un diseño de campo. La población estuvo representada por treinta y dos (32 docentes que laboran en el plantel objeto de este estudio, la muestra fue la totalidad de la población, para recolectar la información se elaboró como instrumento un cuestionario de 30 ítems con escala tipo Likert con cuatro alternativas de respuestas el cual se sometió a la validez de contenido a través del juicio de expertos, asimismo se aplicó el Coeficiente de Confiabilidad Alfa-Cronbach, obteniéndose como resultado 0,90. Para analizar la información se procedió a la tabulación, codificación y graficación de datos. Sobre la base de los resultados se presentaron las conclusiones del estudio.

A preliminary neutronic evaluation of the high temperature gas-cooled test reactor HTR-10 using the scale 6.0 code

International Nuclear Information System (INIS)

Sousa, Romulo V.; Fortini, Angela; Pereira, Claubia; Carvalho, Fernando R. de; Oliveira, Arno H.

2013-01-01

The High Temperature Gas-cooled Test Reactor HTR-10 is a 10 MW modular pebble bed type reactor, which core is filled with 27,000 spherical fuel elements, e.g. TRISO coated particles. This reactor was built by the Institute of Nuclear Energy Technology (INET), Tsinghua University, China, and its first criticality was attained on December 1, 2000. The main objectives of the HTR-10 are to verify and demonstrate the technical and safety features of the modular HTGR (High Temperature Gas-cooled Reactor) and to establish an experimental base for developing nuclear process heat applications. In this work, using the Standardized Computer Analysis for Licensing Evaluation (SCALE) 6.0, a nuclear code developed by Oak Ridge National Laboratory (ORNL), the HTR-10 first critical core is modeled by the DEN/UFMG. The K eff was obtained and compared with the reference value obtained by the Idaho National Laboratory. The result presents good agreement with experimental value. The goal is to validate the DEN/UFMG model to be applied in transmutation studies changing the fuel. (author)

User Manual for XnWlup2.0, A Software to Visualize Nuclear Data for Thermal Reactors in WIMS-D Libraries

International Nuclear Information System (INIS)

Thiyagarajan, T.K.; Ganesan, S.; Jagannathan, V.; Karthikeyan, R.

2002-10-01

A project to prepare an exhaustive handbook of WIMS-D cross sections for thermal reactor applications comparing different WIMS-D compatible nuclear data libraries originating from various countries has been successfully implemented. A computer software, called XnWlup2.0, with graphical user interface for MS Windows has been developed at BARC. This report summarizes the salient features of this new software for the users of WIMS-D libraries. Several sample outputs produced by the software are presented to illustrate the powerful use of this software for routine use in reactor physics analyses. (author)

Full-length U-xPu-10Zr (x = 0, 8, 19 wt.%) fast reactor fuel test in FFTF

Energy Technology Data Exchange (ETDEWEB)

Porter, D.L., E-mail: Douglas.Porter@inl.gov [Idaho National Laboratory, P.O. Box 1625, Idaho Falls, ID 83415-6188 (United States); Tsai Hanchung [Argonne National Laboratory, 9700 South Cass Avenue, Argonne, IL 60439-4803 (United States)

2012-08-15

The Integral Fast Reactor-1 (IFR-1) experiment performed in the Fast Flux Test Facility (FFTF) was the only U-Pu-10Zr (Pu-0, 8 and 19 wt.%) metallic fast reactor test with commercial-length (91.4-cm active fuel-column length) conducted to date. With few remaining test reactors, there is little opportunity for performing another test with a long active fuel column. The assembly was irradiated to the goal burnup of 10 at.%. The beginning-of-life (BOL) peak cladding temperature of the hottest pin was 608 Degree-Sign C, cooling to 522 Degree-Sign C at end-of-life (EOL). Selected fuel pins were examined non-destructively using neutron radiography, precision axial gamma scanning, and both laser and spiral contact cladding profilometry. Destructive exams included plenum gas pressure, volume, and gas composition determinations on a number of pins followed by optical metallography, electron probe microanalysis (EPMA), and alpha and beta-gamma autoradiography on a single U-19Pu-10Zr pin. The post-irradiation examinations (PIEs) showed very few differences compared to the short-pin (34.3-cm fuel column) testing performed on fuels of similar composition in Experimental Breeder Reactor-II (EBR-II). The fuel column grew axially slightly less than observed in the short pins, but with the same pattern of decreasing growth with increasing Pu content. There was a difference in the fuel-cladding chemical interaction (FCCI) in that the maximum cladding penetration by interdiffusion with fuel/fission products did not occur at the top of the fuel column where the cladding temperature is highest, as observed in EBR-II tests. Instead, the more exaggerated fission-rate profile of the FFTF pins resulted in a peak FCCI at {approx}0.7 X/L axial location along the fuel column. This resulted from a higher production of rare-earth fission products at this location and a higher {Delta}T between fuel center and cladding than at core center, together providing more rare earths at the cladding and

Microcystin-LR removal from aqueous solutions using a magnetically separable N-doped TiO2 nanocomposite under visible light irradiation

Science.gov (United States)

The performance of magnetically separable N-doped TiO2 was found to be significantly improved when compared with a non-magnetic N-doped TiO2 for the aqueous removal of cyanotoxin Microcystin-LR. The observed enhanced photocatalytic activity may be related to the presence of ferri...

Bolívar, Juárez y Guevara: apuntes sobre socialización e identidad

Directory of Open Access Journals (Sweden)

Pedro António Da Silva-Abrantes

2011-01-01

Full Text Available A través de un análisis de las biografías de Bolívar, Juárez y Guevara, se discute la compleja relación entre socialización, identidad y cambio social, en los tiempos modernos. Tras un debate inicial sobre los usos y limitaciones del método biográfico, se busca comprender la vida de los tres personajes históricos, utilizando y buscando explorar algunas teorías sociológicas recientes. Se concluye que, en los tres casos, la integración desde temprana edad a distintos entornos sociales y, en particular, a procesos educativos múltiples resultantes de distintos movimientos político-pedagógicos, ocurrencias biográficas imprevistas e incluso a partir de cierta edad, de un trabajo consciente de los actores sobre sí mismos, permitió la formación de un habitus de fusión. Se argumenta que esta identidad peculiar personificó (y promovió la unificación de fuerzas sociales en conflicto.

Renzo Ramírez Bacca. Historia Laboral de una hacienda cafetera: La Aurora, 1882-1982

Directory of Open Access Journals (Sweden)

Jesús Fernando Barrios Ordóñez

2011-01-01

Full Text Available El libro de Renzo Ramírez Bacca, historiador y profesor asociado adscrito al Departamento de Historia de la Universidad Nacional de Colombia, sede Medellín, es el resultado de una investigación profunda y documentada que tiene como propósito analizar los sistemas de organización laboral y las formas de ordenamiento administrativo y productivo en la hacienda cafetera La Aurora, ubicada en el actual municipio de El Líbano, en el departamento del Tolima. Esta hacienda fue una de las mayores del norte del Tolima, en la cual se adoptaron sistemas modernos de producción, relacionados, en un principio, con el sistema de aparcería, categoría de trabajadores permanentes con base en la fuerza de trabajo familiar, bajo la figura de arrendatarios, tabloneros, contratistas, partijeros y agregados. Posteriormente, la tecnificación cafetera se sustituye por la administración directa, que utiliza fuerza de trabajo asalariada temporal, modificando las relaciones laborales de tipo familiar que prevalecían en la hacienda.

Forward-backward multiplicity correlations in pp collisions at = 0.9, 2.76 and 7 TeV

Science.gov (United States)

Adam, J.; Adamová, D.; Aggarwal, M. M.; Aglieri Rinella, G.; Agnello, M.; Agrawal, N.; Ahammed, Z.; Ahmed, I.; Ahn, S. U.; Aimo, I.; Aiola, S.; Ajaz, M.; Akindinov, A.; Alam, S. N.; Aleksandrov, D.; Alessandro, B.; Alexandre, D.; Alfaro Molina, R.; Alici, A.; Alkin, A.; Alme, J.; Alt, T.; Altinpinar, S.; Altsybeev, I.; Alves Garcia Prado, C.; Andrei, C.; Andronic, A.; Anguelov, V.; Anielski, J.; Antičić, T.; Antinori, F.; Antonioli, P.; Aphecetche, L.; Appelshäuser, H.; Arcelli, S.; Armesto, N.; Arnaldi, R.; Aronsson, T.; Arsene, I. C.; Arslandok, M.; Augustinus, A.; Averbeck, R.; Azmi, M. D.; Bach, M.; Badalà, A.; Baek, Y. W.; Bagnasco, S.; Bailhache, R.; Bala, R.; Baldisseri, A.; Ball, M.; Baltasar Dos Santos Pedrosa, F.; Baral, R. C.; Barbano, A. M.; Barbera, R.; Barile, F.; Barnaföldi, G. G.; Barnby, L. S.; Barret, V.; Bartalini, P.; Bartke, J.; Bartsch, E.; Basile, M.; Bastid, N.; Basu, S.; Bathen, B.; Batigne, G.; Batista Camejo, A.; Batyunya, B.; Batzing, P. C.; Bearden, I. G.; Beck, H.; Bedda, C.; Behera, N. K.; Belikov, I.; Bellini, F.; Bello Martinez, H.; Bellwied, R.; Belmont, R.; Belmont-Moreno, E.; Belyaev, V.; Bencedi, G.; Beole, S.; Berceanu, I.; Bercuci, A.; Berdnikov, Y.; Berenyi, D.; Bertens, R. A.; Berzano, D.; Betev, L.; Bhasin, A.; Bhat, I. R.; Bhati, A. K.; Bhattacharjee, B.; Bhom, J.; Bianchi, L.; Bianchi, N.; Bianchin, C.; Bielčík, J.; Bielčíková, J.; Bilandzic, A.; Biswas, S.; Bjelogrlic, S.; Blanco, F.; Blau, D.; Blume, C.; Bock, F.; Bogdanov, A.; Bøggild, H.; Boldizsár, L.; Bombara, M.; Book, J.; Borel, H.; Borissov, A.; Borri, M.; Bossú, F.; Botje, M.; Botta, E.; Böttger, S.; Braun-Munzinger, P.; Bregant, M.; Breitner, T.; Broker, T. A.; Browning, T. A.; Broz, M.; Brucken, E. J.; Bruna, E.; Bruno, G. E.; Budnikov, D.; Buesching, H.; Bufalino, S.; Buncic, P.; Busch, O.; Buthelezi, Z.; Buxton, J. T.; Caffarri, D.; Cai, X.; Caines, H.; Calero Diaz, L.; Caliva, A.; Calvo Villar, E.; Camerini, P.; Carena, F.; Carena, W.; Castillo Castellanos, J.; Castro, A. J.; Casula, E. A. R.; Cavicchioli, C.; Ceballos Sanchez, C.; Cepila, J.; Cerello, P.; Chang, B.; Chapeland, S.; Chartier, M.; Charvet, J. L.; Chattopadhyay, S.; Chattopadhyay, S.; Chelnokov, V.; Cherney, M.; Cheshkov, C.; Cheynis, B.; Chibante Barroso, V.; Chinellato, D. D.; Chochula, P.; Choi, K.; Chojnacki, M.; Choudhury, S.; Christakoglou, P.; Christensen, C. H.; Christiansen, P.; Chujo, T.; Chung, S. U.; Cicalo, C.; Cifarelli, L.; Cindolo, F.; Cleymans, J.; Colamaria, F.; Colella, D.; Collu, A.; Colocci, M.; Conesa Balbastre, G.; Conesa del Valle, Z.; Connors, M. E.; Contreras, J. G.; Cormier, T. M.; Corrales Morales, Y.; Cortés Maldonado, I.; Cortese, P.; Cosentino, M. R.; Costa, F.; Crochet, P.; Cruz Albino, R.; Cuautle, E.; Cunqueiro, L.; Dahms, T.; Dainese, A.; Danu, A.; Das, D.; Das, I.; Das, S.; Dash, A.; Dash, S.; De, S.; De Caro, A.; de Cataldo, G.; de Cuveland, J.; De Falco, A.; De Gruttola, D.; De Marco, N.; De Pasquale, S.; Deloff, A.; Dénes, E.; D'Erasmo, G.; Di Bari, D.; Di Mauro, A.; Di Nezza, P.; Diaz Corchero, M. A.; Dietel, T.; Dillenseger, P.; Divià, R.; Djuvsland, Ø.; Dobrin, A.; Dobrowolski, T.; Domenicis Gimenez, D.; Dönigus, B.; Dordic, O.; Dubey, A. K.; Dubla, A.; Ducroux, L.; Dupieux, P.; Ehlers, R. J.; Elia, D.; Engel, H.; Erazmus, B.; Erdal, H. A.; Eschweiler, D.; Espagnon, B.; Esposito, M.; Estienne, M.; Esumi, S.; Evans, D.; Evdokimov, S.; Eyyubova, G.; Fabbietti, L.; Fabris, D.; Faivre, J.; Fantoni, A.; Fasel, M.; Feldkamp, L.; Felea, D.; Feliciello, A.; Feofilov, G.; Ferencei, J.; Fernández Téllez, A.; Ferreiro, E. G.; Ferretti, A.; Festanti, A.; Figiel, J.; Figueredo, M. A. S.; Filchagin, S.; Finogeev, D.; Fionda, F. M.; Fiore, E. M.; Fleck, M. G.; Floris, M.; Foertsch, S.; Foka, P.; Fokin, S.; Fragiacomo, E.; Francescon, A.; Frankenfeld, U.; Fuchs, U.; Furget, C.; Furs, A.; Fusco Girard, M.; Gaardhøje, J. J.; Gagliardi, M.; Gago, A. M.; Gallio, M.; Gangadharan, D. R.; Ganoti, P.; Gao, C.; Garabatos, C.; Garcia-Solis, E.; Gargiulo, C.; Gasik, P.; Germain, M.; Gheata, A.; Gheata, M.; Ghidini, B.; Ghosh, P.; Ghosh, S. K.; Gianotti, P.; Giubellino, P.; Giubilato, P.; Gladysz-Dziadus, E.; Glässel, P.; Gomez Ramirez, A.; González-Zamora, P.; Gorbunov, S.; Görlich, L.; Gotovac, S.; Grabski, V.; Graczykowski, L. K.; Grelli, A.; Grigoras, A.; Grigoras, C.; Grigoriev, V.; Grigoryan, A.; Grigoryan, S.; Grinyov, B.; Grion, N.; Grosse-Oetringhaus, J. F.; Grossiord, J.-Y.; Grosso, R.; Guber, F.; Guernane, R.; Guerzoni, B.; Gulbrandsen, K.; Gulkanyan, H.; Gunji, T.; Gupta, A.; Gupta, R.; Haake, R.; Haaland, Ø.; Hadjidakis, C.; Haiduc, M.; Hamagaki, H.; Hamar, G.; Hanratty, L. D.; Hansen, A.; Harris, J. W.; Hartmann, H.; Harton, A.; Hatzifotiadou, D.; Hayashi, S.; Heckel, S. T.; Heide, M.; Helstrup, H.; Herghelegiu, A.; Herrera Corral, G.; Hess, B. A.; Hetland, K. F.; Hilden, T. E.; Hillemanns, H.; Hippolyte, B.; Hristov, P.; Huang, M.; Humanic, T. J.; Hussain, N.; Hussain, T.; Hutter, D.; Hwang, D. S.; Ilkaev, R.; Ilkiv, I.; Inaba, M.; Ionita, C.; Ippolitov, M.; Irfan, M.; Ivanov, M.; Ivanov, V.; Jacholkowski, A.; Jacobs, P. M.; Jahnke, C.; Jang, H. J.; Janik, M. A.; Jayarathna, P. H. S. Y.; Jena, C.; Jena, S.; Jimenez Bustamante, R. T.; Jones, P. G.; Jung, H.; Jusko, A.; Kalinak, P.; Kalweit, A.; Kamin, J.; Kang, J. H.; Kaplin, V.; Kar, S.; Karasu Uysal, A.; Karavichev, O.; Karavicheva, T.; Karpechev, E.; Kebschull, U.; Keidel, R.; Keijdener, D. L. D.; Keil, M.; Khan, K. H.; Khan, M. M.; Khan, P.; Khan, S. A.; Khanzadeev, A.; Kharlov, Y.; Kileng, B.; Kim, B.; Kim, D. W.; Kim, D. J.; Kim, H.; Kim, J. S.; Kim, M.; Kim, M.; Kim, S.; Kim, T.; Kirsch, S.; Kisel, I.; Kiselev, S.; Kisiel, A.; Kiss, G.; Klay, J. L.; Klein, C.; Klein, J.; Klein-Bösing, C.; Kluge, A.; Knichel, M. L.; Knospe, A. G.; Kobayashi, T.; Kobdaj, C.; Kofarago, M.; Köhler, M. K.; Kollegger, T.; Kolojvari, A.; Kondratiev, V.; Kondratyeva, N.; Kondratyuk, E.; Konevskikh, A.; Kovalenko, V.; Kowalski, M.; Kox, S.; Koyithatta Meethaleveedu, G.; Kral, J.; Králik, I.; Kravčáková, A.; Krelina, M.; Kretz, M.; Krivda, M.; Krizek, F.; Kryshen, E.; Krzewicki, M.; Kubera, A. M.; Kučera, V.; Kucheriaev, Y.; Kugathasan, T.; Kuhn, C.; Kuijer, P. G.; Kulakov, I.; Kumar, J.; Kumar, L.; Kurashvili, P.; Kurepin, A.; Kurepin, A. B.; Kuryakin, A.; Kushpil, S.; Kweon, M. J.; Kwon, Y.; La Pointe, S. L.; La Rocca, P.; Lagana Fernandes, C.; Lakomov, I.; Langoy, R.; Lara, C.; Lardeux, A.; Lattuca, A.; Laudi, E.; Lea, R.; Leardini, L.; Lee, G. R.; Legrand, I.; Lehnert, J.; Lemmon, R. C.; Lenti, V.; Leogrande, E.; León Monzón, I.; Leoncino, M.; Lévai, P.; Li, S.; Li, X.; Lien, J.; Lietava, R.; Lindal, S.; Lindenstruth, V.; Lippmann, C.; Lisa, M. A.; Ljunggren, H. M.; Lodato, D. F.; Loenne, P. I.; Loggins, V. R.; Loginov, V.; Loizides, C.; Lopez, X.; López Torres, E.; Lowe, A.; Lu, X.-G.; Luettig, P.; Lunardon, M.; Luparello, G.; Maevskaya, A.; Mager, M.; Mahajan, S.; Mahmood, S. M.; Maire, A.; Majka, R. D.; Malaev, M.; Maldonado Cervantes, I.; Malinina, L.; Mal'Kevich, D.; Malzacher, P.; Mamonov, A.; Manceau, L.; Manko, V.; Manso, F.; Manzari, V.; Marchisone, M.; Mareš, J.; Margagliotti, G. V.; Margotti, A.; Margutti, J.; Marín, A.; Markert, C.; Marquard, M.; Martashvili, I.; Martin, N. A.; Martin Blanco, J.; Martinengo, P.; Martínez, M. I.; Martínez García, G.; Martynov, Y.; Mas, A.; Masciocchi, S.; Masera, M.; Masoni, A.; Massacrier, L.; Mastroserio, A.; Matyja, A.; Mayer, C.; Mazer, J.; Mazzoni, M. A.; Mcdonald, D.; Meddi, F.; Menchaca-Rocha, A.; Meninno, E.; Mercado Pérez, J.; Meres, M.; Miake, Y.; Mieskolainen, M. M.; Mikhaylov, K.; Milano, L.; Milosevic, J.; Minervini, L. M.; Mischke, A.; Mishra, A. N.; Miskowiec, D.; Mitra, J.; Mitu, C. M.; Mohammadi, N.; Mohanty, B.; Molnar, L.; Montaño Zetina, L.; Montes, E.; Morando, M.; Moreira De Godoy, D. A.; Moretto, S.; Morreale, A.; Morsch, A.; Muccifora, V.; Mudnic, E.; Mühlheim, D.; Muhuri, S.; Mukherjee, M.; Müller, H.; Mulligan, J. D.; Munhoz, M. G.; Murray, S.; Musa, L.; Musinsky, J.; Nandi, B. K.; Nania, R.; Nappi, E.; Naru, M. U.; Nattrass, C.; Nayak, K.; Nayak, T. K.; Nazarenko, S.; Nedosekin, A.; Nellen, L.; Ng, F.; Nicassio, M.; Niculescu, M.; Niedziela, J.; Nielsen, B. S.; Nikolaev, S.; Nikulin, S.; Nikulin, V.; Nilsen, B. S.; Noferini, F.; Nomokonov, P.; Nooren, G.; Norman, J.; Nyanin, A.; Nystrand, J.; Oeschler, H.; Oh, S.; Oh, S. K.; Ohlson, A.; Okatan, A.; Okubo, T.; Olah, L.; Oleniacz, J.; Oliveira Da Silva, A. C.; Onderwaater, J.; Oppedisano, C.; Ortiz Velasquez, A.; Oskarsson, A.; Otwinowski, J.; Oyama, K.; Ozdemir, M.; Pachmayer, Y.; Pagano, P.; Paić, G.; Pajares, C.; Pal, S. K.; Pan, J.; Pandey, A. K.; Pant, D.; Papikyan, V.; Pappalardo, G. S.; Pareek, P.; Park, W. J.; Parmar, S.; Passfeld, A.; Patalakha, D. I.; Paticchio, V.; Paul, B.; Pawlak, T.; Peitzmann, T.; Pereira Da Costa, H.; Pereira De Oliveira Filho, E.; Peresunko, D.; Pérez Lara, C. E.; Peskov, V.; Pestov, Y.; Petráček, V.; Petrov, V.; Petrovici, M.; Petta, C.; Piano, S.; Pikna, M.; Pillot, P.; Pinazza, O.; Pinsky, L.; Piyarathna, D. B.; Ploskon, M.; Planinic, M.; Pluta, J.; Pochybova, S.; Podesta-Lerma, P. L. M.; Poghosyan, M. G.; Polichtchouk, B.; Poljak, N.; Poonsawat, W.; Pop, A.; Porteboeuf-Houssais, S.; Porter, J.; Pospisil, J.; Prasad, S. K.; Preghenella, R.; Prino, F.; Pruneau, C. A.; Pshenichnov, I.; Puccio, M.; Puddu, G.; Pujahari, P.; Punin, V.; Putschke, J.; Qvigstad, H.; Rachevski, A.; Raha, S.; Rajput, S.; Rak, J.; Rakotozafindrabe, A.; Ramello, L.; Raniwala, R.; Raniwala, S.; Räsänen, S. S.; Rascanu, B. T.; Rathee, D.; Rauf, A. W.; Razazi, V.; Read, K. F.; Real, J. S.; Redlich, K.; Reed, R. J.; Rehman, A.; Reichelt, P.; Reicher, M.; Reidt, F.; Renfordt, R.; Reolon, A. R.; Reshetin, A.; Rettig, F.; Revol, J.-P.; Reygers, K.; Riabov, V.; Ricci, R. A.; Richert, T.; Richter, M.; Riedler, P.; Riegler, W.; Riggi, F.; Ristea, C.; Rivetti, A.; Rocco, E.; Rodríguez Cahuantzi, M.; Rodriguez Manso, A.; Røed, K.; Rogochaya, E.; Rohr, D.; Röhrich, D.; Romita, R.; Ronchetti, F.; Ronflette, L.; Rosnet, P.; Rossi, A.; Roukoutakis, F.; Roy, A.; Roy, C.; Roy, P.; Rubio Montero, A. J.; Rui, R.; Russo, R.; Ryabinkin, E.; Ryabov, Y.; Rybicki, A.; Sadovsky, S.; Šafařík, K.; Sahlmuller, B.; Sahoo, P.; Sahoo, R.; Sahoo, S.; Sahu, P. K.; Saini, J.; Sakai, S.; Saleh, M. A.; Salgado, C. A.; Salzwedel, J.; Sambyal, S.; Samsonov, V.; Sanchez Castro, X.; Šándor, L.; Sandoval, A.; Sano, M.; Santagati, G.; Sarkar, D.; Scapparone, E.; Scarlassara, F.; Scharenberg, R. P.; Schiaua, C.; Schicker, R.; Schmidt, C.; Schmidt, H. R.; Schuchmann, S.; Schukraft, J.; Schulc, M.; Schuster, T.; Schutz, Y.; Schwarz, K.; Schweda, K.; Scioli, G.; Scomparin, E.; Scott, R.; Seeder, K. S.; Segato, G.; Seger, J. E.; Sekiguchi, Y.; Selyuzhenkov, I.; Senosi, K.; Seo, J.; Serradilla, E.; Sevcenco, A.; Shabanov, A.; Shabetai, A.; Shadura, O.; Shahoyan, R.; Shangaraev, A.; Sharma, A.; Sharma, N.; Shigaki, K.; Shtejer, K.; Sibiriak, Y.; Siddhanta, S.; Sielewicz, K. M.; Siemiarczuk, T.; Silvermyr, D.; Silvestre, C.; Simatovic, G.; Singaraju, R.; Singh, R.; Singha, S.; Singhal, V.; Sinha, B. C.; Sinha, T.; Sitar, B.; Sitta, M.; Skaali, T. B.; Skjerdal, K.; Slupecki, M.; Smirnov, N.; Snellings, R. J. M.; Snellman, T. W.; Søgaard, C.; Soltz, R.; Song, J.; Song, M.; Song, Z.; Soramel, F.; Sorensen, S.; Spacek, M.; Spiriti, E.; Sputowska, I.; Spyropoulou-Stassinaki, M.; Srivastava, B. K.; Stachel, J.; Stan, I.; Stefanek, G.; Steinpreis, M.; Stenlund, E.; Steyn, G.; Stiller, J. H.; Stocco, D.; Strmen, P.; Suaide, A. A. P.; Sugitate, T.; Suire, C.; Suleymanov, M.; Sultanov, R.; Šumbera, M.; Symons, T. J. M.; Szabo, A.; Szanto de Toledo, A.; Szarka, I.; Szczepankiewicz, A.; Szymanski, M.; Takahashi, J.; Tanaka, N.; Tangaro, M. A.; Tapia Takaki, J. D.; Tarantola Peloni, A.; Tariq, M.; Tarzila, M. G.; Tauro, A.; Tejeda Muñoz, G.; Telesca, A.; Terasaki, K.; Terrevoli, C.; Teyssier, B.; Thäder, J.; Thomas, D.; Tieulent, R.; Timmins, A. R.; Toia, A.; Trogolo, S.; Trubnikov, V.; Trzaska, W. H.; Tsuji, T.; Tumkin, A.; Turrisi, R.; Tveter, T. S.; Ullaland, K.; Uras, A.; Usai, G. L.; Utrobicic, A.; Vajzer, M.; Vala, M.; Valencia Palomo, L.; Vallero, S.; Van Der Maarel, J.; Van Hoorne, J. W.; van Leeuwen, M.; Vanat, T.; Vande Vyvre, P.; Varga, D.; Vargas, A.; Vargyas, M.; Varma, R.; Vasileiou, M.; Vasiliev, A.; Vauthier, A.; Vechernin, V.; Veen, A. M.; Veldhoen, M.; Velure, A.; Venaruzzo, M.; Vercellin, E.; Vergara Limón, S.; Vernet, R.; Verweij, M.; Vickovic, L.; Viesti, G.; Viinikainen, J.; Vilakazi, Z.; Villalobos Baillie, O.; Vinogradov, A.; Vinogradov, L.; Vinogradov, Y.; Virgili, T.; Vislavicius, V.; Viyogi, Y. P.; Vodopyanov, A.; Völkl, M. A.; Voloshin, K.; Voloshin, S. A.; Volpe, G.; von Haller, B.; Vorobyev, I.; Vranic, D.; Vrláková, J.; Vulpescu, B.; Vyushin, A.; Wagner, B.; Wagner, J.; Wang, H.; Wang, M.; Wang, Y.; Watanabe, D.; Weber, M.; Weber, S. G.; Wessels, J. P.; Westerhoff, U.; Wiechula, J.; Wikne, J.; Wilde, M.; Wilk, G.; Wilkinson, J.; Williams, M. C. S.; Windelband, B.; Winn, M.; Yaldo, C. G.; Yamaguchi, Y.; Yang, H.; Yang, P.; Yano, S.; Yasnopolskiy, S.; Yin, Z.; Yokoyama, H.; Yoo, I.-K.; Yurchenko, V.; Yushmanov, I.; Zaborowska, A.; Zaccolo, V.; Zaman, A.; Zampolli, C.; Zanoli, H. J. C.; Zaporozhets, S.; Zarochentsev, A.; Závada, P.; Zaviyalov, N.; Zbroszczyk, H.; Zgura, I. S.; Zhalov, M.; Zhang, H.; Zhang, X.; Zhang, Y.; Zhao, C.; Zhigareva, N.; Zhou, D.; Zhou, Y.; Zhou, Z.; Zhu, H.; Zhu, J.; Zhu, X.; Zichichi, A.; Zimmermann, A.; Zimmermann, M. B.; Zinovjev, G.; Zyzak, M.

2015-05-01

The strength of forward-backward (FB) multiplicity correlations is measured by the ALICE detector in proton-proton (pp) collisions at = 0 .9, 2 .76 and 7 TeV. The measurement is performed in the central pseudorapidity region (| η| 0 .3 GeV /c. Two separate pseudorapidity windows of width ( δη) ranging from 0.2 to 0.8 are chosen symmetrically around η = 0. The multiplicity correlation strength ( b corr) is studied as a function of the pseudorapidity gap ( η gap) between the two windows as well as the width of these windows. The correlation strength is found to decrease with increasing η gap and shows a non-linear increase with δη. A sizable increase of the correlation strength with the collision energy, which cannot be explained exclusively by the increase of the mean multiplicity inside the windows, is observed. The correlation coefficient is also measured for multiplicities in different configurations of two azimuthal sectors selected within the symmetric FB η-windows. Two different contributions, the short-range (SR) and the long-range (LR), are observed. The energy dependence of b corr is found to be weak for the SR component while it is strong for the LR component. Moreover, the correlation coefficient is studied for particles belonging to various transverse momentum intervals chosen to have the same mean multiplicity. Both SR and LR contributions to b corr are found to increase with p T in this case. Results are compared to PYTHIA and PHOJET event generators and to a string-based phenomenological model. The observed dependencies of b corr add new constraints on phenomenological models. [Figure not available: see fulltext.

Removal of FePO4 and Fe3(PO4)2 crystals on the surface of passive fillers in Fe0/GAC reactor using the acclimated bacteria

International Nuclear Information System (INIS)

Lai, Bo; Zhou, Yuexi; Yang, Ping; Wang, Juling; Yang, Jinghui; Li, Huiqiang

2012-01-01

Highlights: ► Fe 3 (PO 4 ) 2 and FePO 4 crystals would weaken treatment efficiency of Fe 0 /GAC reactor. ► Fe 3 (PO 4 ) 2 and FePO 4 crystals could be removed by the acclimated bacteria. ► FeS and sulfur in the passive film would be removed by the sulfur-oxidizing bacteria. ► Develop a cost-effective bio-regeneration technology for the passive fillers. - Abstract: As past studies presented, there is obvious defect that the fillers in the Fe 0 /GAC reactor begin to be passive after about 60 d continuous running, although the complicated, toxic and refractory ABS resin wastewater can be pretreated efficiently by the Fe 0 /GAC reactor. During the process, the Fe 3 (PO 4 ) 2 and FePO 4 crystals with high density in the passive film are formed by the reaction between PO 4 3− and Fe 2+ /Fe 3+ . Meanwhile, they obstruct the formation of macroscopic galvanic cells between Fe 0 and GAC, which will lower the wastewater treatment efficiency of Fe 0 /GAC reactor. In this study, in order to remove the Fe 3 (PO 4 ) 2 and FePO 4 crystals on the surface of the passive fillers, the bacteria were acclimated in the passive Fe 0 /GAC reactor. According to the results, it can be concluded that the Fe 3 (PO 4 ) 2 and FePO 4 crystals with high density in the passive film could be decomposed or removed by the joint action between the typical propionic acid type fermentation bacteria and sulfate reducing bacteria (SRB), whereas the PO 4 3− ions from the decomposition of the Fe 3 (PO 4 ) 2 and FePO 4 crystals were released into aqueous solution which would be discharged from the passive Fe 0 /GAC reactor. Furthermore, the remained FeS and sulfur (S) in the passive film also can be decomposed or removed easily by the oxidation of the sulfur-oxidizing bacteria. This study provides some theoretical references for the further study of a cost-effective bio-regeneration technology to solve the passive problems of the fillers in the zero-valent iron (ZVI) or Fe 0 /GAC reactor.

TREATMENT OF METHANOLIC WASTEWATER BY ANAEROBIC DOWN-FLOW HANGING SPONGE (ANDHS) REACTOR AND UASB REACTOR

Science.gov (United States)

Sumino, Haruhiko; Wada, Keiji; Syutsubo, Kazuaki; Yamaguchi, Takashi; Harada, Hideki; Ohashi, Akiyoshi

Anaerobic down-flow hanging sponge (AnDHS) reactor and UASB reactor were operated at 30℃ for over 400 days in order to investigate the process performance and the sludge characteristics of treating methanolic wastewater (2 gCOD/L). The settings OLR of AnDHS reactor and of UASB reactor were 5.0 -10.0 kgCOD/m3/d and 5.0 kgCOD/m3/d. The average of the COD removal demonstrated by both reactors were over 90% throughout the experiment. From the results of methane producing activities and the PCR-DGGE method, most methanol was directly converted to methane in both reactors. The conversion was carried out by different methanogens: one closely related to Methanomethylovorans hollandica in the AnDHS retainted sludge and the other closely related to Methanosarcinaceae and Metanosarciales in the UASB retainted sludge.

Effects of Acute Bleeding Followed by Hydroxyethyl Starch 130/0.4 or a Crystalloid on Propofol Concentrations, Cerebral Oxygenation, and Electroencephalographic and Haemodynamic Variables in Pigs

Directory of Open Access Journals (Sweden)

Aura Silva

2014-01-01

Full Text Available Bleeding changes the haemodynamics, compromising organ perfusion. In this study, the effects of bleeding followed by replacement with hydroxyethyl starch 130/0.4 (HES or lactated Ringer’s (LR on cerebral oxygenation and electroencephalogram-derived parameters were investigated. Twelve young pigs under propofol-remifentanil anaesthesia were bled 30 mL/kg and, after a 20-minute waiting period, volume replacement was performed with HES (GHES; N=6 or LR (GRL; N=6. Bleeding caused a decrease of more than 50% in mean arterial pressure (P<0.01 and a decrease in cerebral oximetry (P=0.039, bispectral index, and electroencephalogram total power (P=0.04 and P<0.01, resp., while propofol plasma concentrations increased (P<0.01. Both solutions restored the haemodynamics and cerebral oxygenation similarly and were accompanied by an increase in electroencephalogram total power. No differences between groups were found. However, one hour after the end of the volume replacement, the cardiac output (P=0.03 and the cerebral oxygenation (P=0.008 decreased in the GLR and were significantly lower than in GHES (P=0.02. Volume replacement with HES 130/0.4 was capable of maintaining the cardiac output and cerebral oxygenation during a longer period than LR and caused a decrease in the propofol plasma concentrations.

The Dopants and Doping Level Dependence of the Structure and Magnetic Properties of the Eu (BA_1-xLR_x)₂Cu₃O_7+δ

Energy Technology Data Exchange (ETDEWEB)

Lin, Yu [Iowa State Univ., Ames, IA (United States)

2002-12-31

Eu(Ba_1-xLR_x)₂Cu₃O_7+δ were systematically studied in order to understand how the valence of the rear earth elements, ionic sizes and magnetic moment affect the crystal structure and magnetic and electrical properties. Differential thermal analyses were carried out to check the phase purity, X-ray data were least-squares fitted to determine the lattice parameters, and DC-SQUID magnetometry was used to characterize the superconducting properties. These results showed that the crystallography is consistent with other EuLR123ss series, LR = La, Pr, Eu. The lattice parameters vary with the ionic radii of the rare earth ions. Unlike the uniform change in lattice parameter, the superconducting transition did not vary systematically with the ionic size of the dopants. Although the general trend was for T_c to decrease with decreasing ionic size of the dopant, for the same doping level, Pr was anomalous, depressing T_c faster. Although the exact mechanism is not clear, this result is consistent with the depression of T_c for Pr substitution for the rare earth in R123. The critical current J_c was determined using the Bean model from magnetization versus field measurements as a function of temperature and field. The effect of the dopants on J_c with the increasing of temperature or applied field was determined. For T < 77 K and small values of x, the value of J_c was increased over that of the x = 0 sample. In addition, the smaller the substituting atom, the higher the J_c becomes. For instance, at x = 0.025, Eu123 < EuLa.025 < EuPr.025 < EuNd.025 < EuEu.025. The enhancement of J_c disappears for x > 0.05 and T > 0.5T_c.

Chlorhexidine and proanthocyanidin enhance the long-term bond strength of resin-based endodontic sealer

Directory of Open Access Journals (Sweden)

Thaís Fantinato Trindade

2018-05-01

Full Text Available Abstract The aim of this study was to evaluate the effects of proanthocyanidin (PA and chlorhexidine (CHX on the bond strength (BS, failure pattern, and resin-dentin interface morphology of the endodontic sealers EndoREZ and AH Plus after 24 h and 6 months of water storage. A total of 120 prepared bovine roots were divided into six groups: AH Plus, CHX+AH Plus, PA+AH Plus, EndoREZ, CHX+EndoREZ, and PA+EndoREZ. Dentin was treated for 1 or 5 min with 2% CHX or 15% PA, respectively. Roots were filled and stored in water for 24 h or 6 months (n = 10. Root slices were subjected to push-out test and scanning electron microscopy (SEM. Data were compared using two-way ANOVA and student's t-test (α = 5%. BS decreased over time for AH Plus and untreated EndoREZ (p 0.05. At 6 months, EndoREZ had higher BS values for CHX and PA than control (p 0.05. Cohesive and mixed failures were observed in all groups. SEM revealed sealer tags in the root dentin. In conclusion, BS decreased with time and AH Plus had higher BS than EndoREZ in untreated dentin; however, CHX or PA enhanced long-term BS of EndoREZ. Overall, dentin treatment affected failure pattern and resin-dentin interface morphology, particularly for EndoREZ.

Measurement of the neutron activation constants Q0 and k0 for the 27Al(n, γ)28Al reaction at the JSI TRIGA Mark II reactor

International Nuclear Information System (INIS)

Vladimir Radulovic; Andrej Trkov; Radojko Jacimovic; Robert Jeraj

2013-01-01

Measurements of the neutron activation constants Q 0 and k 0 for the 27 Al(n, γ) 28 Al reaction have been performed in two irradiation channels with different spectral characteristics at the JSI TRIGA Mark II reactor. In the determination of Q 0 the fission spectrum contribution to the reaction rates has been corrected for. The final experimental value of the Q 0 factor was found to differ significantly from the adopted value in the k 0 -database. The experimental value of the k 0 factor is in agreement with the recommended value in the k 0 -database. The thermal cross-section and resonance integral for the reaction were found to be in good agreement with the values calculated from the cross-sections from the ENDF/B-VII.1 library. (author)

Simulation development for TRIGA reactor

International Nuclear Information System (INIS)

Handoyo, D.

1997-01-01

A simulator of the dynamic of TRIGA reactor has been made. this simulator is meant to study the reactor kinetic behavior and for operator training to more assure the safety and the reliability of the real operation of TRIGA reactor. the simulator consists of PC (Personal Computer) for processing the calculation of reactivity, neutron flux, period, ect and control panel for regulating the input data such as the change of power range, control rod position as well as cooling flow rate. the result will be displayed on screen monitor of personal computer as given in the real control room of TRIGA reactor. the output of simulator will be verified by comparing with measurement result in the real TRIGA MARK II reactor of Musashi institute of technology. for the change of reactivity of 0.3, 0.5 and 0.7 the reactor power and fuel temperature between the simulator and measurements are comparable

Prediction of the transition energies of atomic No and Lr by the intermediate Hamiltonian coupled cluster method

International Nuclear Information System (INIS)

Borschevsky, A.; Eliav, E.; Kaldor, U.; Vilkas, M.J.; Ishikawa, Y.

2007-01-01

Complete text of publication follows: Measurements of the spectroscopic properties of the superheavy elements present a serious challenge to the experimentalist. Their short lifetimes and the low quantities of their production necessitate reliable prediction of transition energies to avoid the need for broad wavelength scans and to assist in identifying the lines. Thus, reliable high-accuracy calculations are necessary prior and parallel to experimental research. Nobelium and Lawrencium are at present the two most likely candidates for spectroscopic measurements, with the first experiments planned at GSI, Darmstadt. The intermediate Hamiltonian (IH) coupled cluster method is applied to the ionization potentials, electron affinities, and excitation energies of atomic nobelium and lawrencium. Large basis sets are used (37s31p26d21f16g11h6i). All levels of a particular atom are obtained simultaneously by diagonalizing the IH matrix. The matrix elements correspond to all excitations from correlated occupied orbitals to virtual orbitals in a large P space, and are 'dressed' by folding in excitations to higher virtual orbitals (Q space) at the coupled cluster singles-and-doubles level. Lamb-shift corrections are included. The same approach was applied to the lighter homologues of Lr and No, lutetium and ytterbium, for which many transition energies are experimentally known, in order to assess the accuracy of the calculation. The average absolute error of 20 excitation energies of Lu is 423 cm -1 , and the error limits for Lr are therefore put at 700 cm -1 . Predicted Lr excitations with large transition moments in the prime range for the planned experiment, 20,000-30,000 cm -1 , are 7p → 8s at 20,100 cm -1 and 7p →p 7d at 28,100 cm -1 . In case of Yb, the calculated ionization potential was within 20 cm -1 of the experiment, and the average error of the 20 lowest calculated excitations was about 300 cm -1 . Hence, the error limits of nobelium are set to 800 cm -1

Optimal reactor strategy for commercializing fast breeder reactors

International Nuclear Information System (INIS)

Yamaji, Kenji; Nagano, Koji

1988-01-01

In this paper, a fuel cycle optimization model developed for analyzing the condition of selecting fast breeder reactors in the optimal reactor strategy is described. By dividing the period of planning, 1966-2055, into nine ten-year periods, the model was formulated as a compact linear programming model. With the model, the best mix of reactor types as well as the optimal timing of reprocessing spent fuel from LWRs to minimize the total cost were found. The results of the analysis are summarized as follows. Fast breeder reactors could be introduced in the optimal strategy when they can economically compete with LWRs with 30 year storage of spent fuel. In order that fast breeder reactors monopolize the new reactor market after the achievement of their technical availability, their capital cost should be less than 0.9 times as much as that of LWRs. When a certain amount of reprocessing commitment is assumed, the condition of employing fast breeder reactors in the optimal strategy is mitigated. In the optimal strategy, reprocessing is done just to meet plutonium demand, and the storage of spent fuel is selected to adjust the mismatch of plutonium production and utilization. The price hike of uranium ore facilitates the commercial adoption of fast breeder reactors. (Kako, I.)

SFCOMPO 2.0 – A relational database of spent fuel isotopic measurements, reactor operational histories, and design data

Directory of Open Access Journals (Sweden)

Michel-Sendis Franco

2017-01-01

Full Text Available SFCOMPO-2.0 is a database of experimental isotopic concentrations measured in destructive radiochemical analysis of spent nuclear fuel (SNF samples. The database includes corresponding design description of the fuel rods and assemblies, relevant operating conditions and characteristics of the host reactors necessary for modelling and simulation. Aimed at establishing a thorough, reliable, and publicly available resource for code and data validation of safety-related applications, SFCOMPO-2.0 is developed and maintained by the OECD Nuclear Energy Agency (NEA. The SFCOMPO-2.0 database is a Java application which is downloadable from the NEA website.

MLR reactor

International Nuclear Information System (INIS)

Ryazantsev, E.P.; Egorenkov, P.M.; Nasonov, V.A.; Smimov, A.M.; Taliev, A.V.; Gromov, B.F.; Kousin, V.V.; Lantsov, M.N.; Radchenko, V.P.; Sharapov, V.N.

1998-01-01

The Material Testing Loop Reactor (MLR) development was commenced in 1991 with the aim of updating and widening Russia's experimental base to validate the selected directions of further progress of the nuclear power industry in Russia and to enhance its reliability and safety. The MLR reactor is the pool-type one. As coolant it applies light water and as side reflector beryllium. The direction of water circulation in the core is upward. The core comprises 30 FA arranged as hexagonal lattice with the 90-95 mm pitch. The central materials channel and six loop channels are sited in the core. The reflector includes up to 11 loop channels. The reactor power is 100 MW. The average power density of the core is 0.4 MW/I (maximal value 1.0 MW/l). The maximum neutron flux density is 7.10 14 n/cm 2 s in the core (E>0.1 MeV), and 5.10 14 n/cm 2 s in the reflector (E<0.625 eV). In 1995 due to the lack of funding the MLR designing was suspended. (author)

Optimum Design of LLC Resonant Converter using Inductance Ratio (Lm/Lr)

Science.gov (United States)

Palle, Kowstubha; Krishnaveni, K.; Ramesh Reddy, Kolli

2017-06-01

The main benefits of LLC resonant dc/dc converter over conventional series and parallel resonant converters are its light load regulation, less circulating currents, larger bandwidth for zero voltage switching, and less tuning of switching frequency for controlled output. An unique analytical tool, called fundamental harmonic approximation with peak gain adjustment is used for designing the converter. In this paper, an optimum design of the converter is proposed by considering three different design criterions with different values of inductance ratio (Lm/Lr) to achieve good efficiency at high input voltage. The optimum design includes the analysis in operating range, switching frequency range, primary side losses of a switch and stability. The analysis is carried out with simulation using the software tools like MATLAB and PSIM. The performance of the optimized design is demonstrated for a design specification of 12 V, 5 A output operating with an input voltage range of 300-400 V using FSFR 2100 IC of Texas instruments.

Feasibility studies of colorless LR 115 SSNTD for alpha-particle radiobiological experiments

International Nuclear Information System (INIS)

Chan, K.F.; Tse, A.K.W.; Fong, W.F.; Yu, K.N.

2006-01-01

The feasibility of using the active layer of the colorless LR 115 SSNTD for alpha-particle radiobiological experiments was studied. The track revelation time on the bottom side (the side attached to the polyester base) was much longer than that on the top side (the side not attached to the polyester base) of the active layer so track formation on the top side was more desirable. In relation to this, culture of HeLa cells on the bottom side of the active layer was found feasible although the cultured cell number was relatively smaller. The feasibility of using this SSNTD for alpha-particle radiobiological experiments was demonstrated by culturing cells on the bottom side while performing alpha-particle irradiation and chemical etching on the top side, and by taking photographs of the cells and alpha-particle tracks together under the optical microscope

Coverage of violence in risk areas: case of the Ciudad Juárez´Journalist Association

Directory of Open Access Journals (Sweden)

José Luis González-Esteban

2016-11-01

Full Text Available This research analyzes the situation of journalism in a high risk area, Ciudad Juarez, Mexico. The analysis is based on the knowledge and analysis of the training activity, violence and corruption denounced by Juarez Journalists Association, founded and run by women journalists. A meeting with journalists of the association and in-depth interviews are the main methodological tools to understand the meaning and value of this group of juarenses journalists. In the same way this article analyzes, through a quantitative methodology, the strategy of activism and the international projection of the association through their social networks. In addition, research is completed with a content analysis about the prevalence and significance of the ‘red note’ in El Diario de Juárez, the main newspaper in this border area, which even has a delegation in the US city of El Paso. Coverage of violence in high risk areas gives a special value to journalism in newspapers like the aforementioned and corporate work of this group of juarenses journalists.

Measurements for kinetic parameters estimation in the RA-0 research reactor

International Nuclear Information System (INIS)

Gomez, A; Bellino, P A

2012-01-01

In the present work, measurements based on the neutron noise technique and the inverse kinetic method were performed to estimate the different kinetic parameters of the reactor in its critical state. By means of the neutron noise technique, we obtained the current calibration factor of the ionization chamber M6 belonging to the power range channels of the reactor instrumentation. The maximum current allowed compatible with the maximum power authorized by the operation license was also obtained. Using the neutron noise technique, the reduced mean reproduction time (Λ*) was estimated. This parameter plays a fundamental role in the deterministic analysis of criticality accidents. Comparison with previous values justified performing new measurements to study systematic trends in the value of Λ*. Using the inverse kinetics method, the reactivity worth of the control rods was estimated, confirming the existence of spatial effects and trends previously observed (author)

Reactor noise analysis of experimental fast reactor 'JOYO'

International Nuclear Information System (INIS)

Ohtani, Hideji; Yamamoto, Hisashi

1980-01-01

As a part of dynamics tests in experimental fast reactor ''JOYO'', reactor noise tests were carried out. The reactor noise analysis techniques are effective for study of plant characteristics by determining fluctuations of process signals (neutron signal, reactor inlet temperature signals, etc.), which are able to be measured without disturbances for reactor operations. The aims of reactor noise tests were to confirm that no unstable phenomenon exists in ''JOYO'' and to gain initial data of the plant for reference of the future data. Data for the reactor noise tests treated in this paper were obtained at 50 MW power level. Fluctuations of process signals were amplified and recorded on analogue tapes. The analysis was performed using noise code (NOISA) of digital computer, with which statistical values of ASPD (auto power spectral density), CPSD (cross power spectral density), and CF (coherence function) were calculated. The primary points of the results are as follows. 1. RMS value of neutron signal at 50 MW power level is about 0.03 MW. This neutron fluctuation is not disturbing reactor operations. 2. The fluctuations of A loop reactor inlet temperatures (T sub(AI)) are larger than the fluctuations of B loop reactor inlet temperature (T sub(BI)). For this reason, the major driving force of neutron fluctuations seems to be the fluctuations of T sub(AI). 3. Core and blanket subassemblies can be divided into two halves (A and B region), with respect to the spacial motion of temperature in the reactor core. A or B region means the region in which sodium temperature fluctuations in subassembly are significantly affected by T sub(AI) or T sub(BI), respectively. This phenomenon seems to be due to the lack of mixing of A and B loop sodium in lower plenum of reactor vessel. (author)